techniques in applied microbiology
Vol. 14 (1978) edited by M. J. Bull (lst reprint 1983) Vol. 15 (1979) edited by M...
91 downloads
1767 Views
20MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
techniques in applied microbiology
Vol. 14 (1978) edited by M. J. Bull (lst reprint 1983) Vol. 15 (1979) edited by M. J. Bull Vol. 16 (1982) edited by M. J. Bull Vol. 17 (1983) edited by M. E. Bushell Vol. 18 (1983) Microbial Polysaccharides, edited by M. E. Bushell Vol. 19 (1984) Modern Applications of Traditional Biotechnologies, edited by M. E. Bushell Vol. 20 (1984) Innovations in Biotechnology, edited by E. H. Houwink and R. R. van der Meer Vol. 21 (1989) Statistical Aspects of Microbiological Analysis of Foods, by B. Jarvis Vol. 22 (1986) Moulds and Filamentous Fungi in Technical Microbiology, by O. Fassatiovh Vol. 23 (1986) Microorganisms in the Production of Food, by M. R. Adams Vol. 24 (1986) Biotechnology of Amino Acid Microbiology, edited by K. Aida, I. Chibata, K. Nakayama and Y. Yamada Vol. 25 (1988) Computers in Fermentation Technology, edited by M. E. Bushell Vol. 26 (1989) Rapid Methods in Food Microbiology, edited by M. R. Adams Vol. 27 (1989) Bioactive Metabolites from Microorganisms, edited by M. E. Bushell and U. Gr~ife Vol. 28 (1993) Micromycetes in Foodstuffs and Feedstuffs, by Z. Jesenskh Vol. 30 (1994) Bioactive Secondary Metabolites of Microorganisms, by V. Betina Vol. 31 (1995) Techniques in Applied Microbiology, by B. Sikyta
techniques in applied microbiology
BOHUMIL SIKYTA Faculty of Pharmacy, Charles University, Hradec Krdtlovd, Czech Republic
progress in industrial microbiology
ELSEVIER Amsterdam--Oxford--New York--Tokyo 1995
Published in co-edition with INFORMATORIUM, Prague Distribution of this book is being handled by the following team of publishers for the East European Countries INFORMATORIUM Na Topolce 10, 140 00 Prague 4, Czech Republic for all remaining areas Elsevier Science B. V. Sara Burgerhartstraat 25 P. O. Box 211, 1000 AE Amsterdam, The Netherlands
ISBN 0-444-98666-9 (~) Informatorium, 1995 Translation (~) Karel Sigler, 1995 All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, recording or otherwise, without prior written permission of the copyright owner. Printed in the Czech Republic
PREFACE
Since time immemorial, microorganisms have played an important role in human society, especially in the preparation of foods, beverages, and also in the treatment of infectious diseases. For millenia, people made use of microorganisms without suspecting that all these useful functions were performed by these invisible organisms. The modern, or science-based, foundation of industrial microbiology was laid by Louis Pasteur in the nineteenth century. His first work in microbiology concerned the isolation of microorganisms causing the deterioration of the quality of wine. His motto, supremely important for applied microbiology, was: "There are no applied sciences only the application of science -a very different matter." The modern development of industrial microbiology began in this century with the industrial-scale production of citric acid and solvents. After World War II, the industrial production of antibiotics, which required the strict maintenance of sterile conditions, assumed increasing importance. The seventies witnessed the elaboration of methods of genetic engineering, which made possible the economically practicable microbial production of peptide hormones, cytokines, vaccines and other products of animal origin. At present, applied microbiology plays an important role in many branches of a national economy, including industry, agriculture, the food industry, pharmaceuticals, medicine, and environmental protection. One of the reasons for writing this book was to summarize the present state of knowledge concerning the industrial application of microorganisms. The book is based on my long experience in research and development at the Research Institute of Antibiotics and Biotransformations in Roztoky near Prague, where I participated in the development of production technologies for a number of antibiotics, amino acids, enzymes and other biosynthetic products, and the scale-up to the production level. Subsequently I worked at the Institute of Microbiology in the Academy of Sciences of the Czech Republic, where I was in close contact with current developments and practice in basic or general microbiology. In conclusion, I should like to mention with gratitude my tutors, who introduced me into the realm of general and applied microbiology" Professor Ji-
~i St/lrka, formerly the Head of the Department of Microbiology at the Faculty of Science, Charles University, Prague, now a Professor at the University of Marseille, the late Professor Milo~ Herold, Director of the Research Institute of Antibiotics and Biotransformations at Roztoky, and Professor Ivan M~tlek, the former Director of the Institute of Microbiology, Academy of Sciences of the Czech Republic. My thanks are due also to my colleagues for their encouragement and help during the writing of this book. BOHUMIL SIKYTA
CONTENTS
PREFACE 1
2
3
INTRODUCTION
13
1.1 Definition and scope of industrial microbiology 1.2 Basic branches of industrial microbiology 1.2.1 Microbiology, biochemistry and microbial physiology 1.2.2 Genetics of microorganisms 1.2.3 Microbial engineering 1.3 Research 1.3.1 Laboratory research 1.3.2 Pilot plant 1.3.3 Termination of research 1.4 Risks in applied microbiology References
14 15 15 18 19 22 23 24 25 30 31
KINETICS OF MICROBIAL GROWTH AND PRODUCT FORMATION
33
2.1 Microbial growth and reproduction 2.1.1 Growth curve 2.1.2 Changes in the course of growth and proliferation 2.1.3 Mathematical description of microbial growth and reproduction 2.1.4 Special features of growth of filamentous microorganisms 2.1.5 Kinetics of growth of microbial colonies 2.2 Product formation 2.2.1 Relationship between growth rate and product formation rate 2.2.2 Product formation in a batch culture 2.3 Substrate consumption 2.3.1 Effect of substrate concentration on growth rate 2.3.2 Consumption of substrate for maintenance energy 2.4 Kinetic characteristics of microbial processes 2.4.1 Relationship between product formation and substrate consumption 2.4.2 Classification of processes according to reaction type References
33 33 37 40 44 47 49 50 51 52 53 55 56 58 60 60
C O N T I N U O U S CULTURE SYSTEMS
62
3.1 Classification of continuous culture systems 3.2 Open continuous culture systems 3.2.1 Single-stage systems
62 63 63
4
5
3.2.2 Single-stage systems with feedback 3.2.3 Multistage continuous flow systems 3.2.4 Multistage continuous systems with bidirectional flow 3.3 Heterogeneous continuous open flow systems 3.3.1 Tubular systems 3.3.2 Tower systems 3.4 Closed continuous culture systems 3.4.1 Total feedback of cells 3.4.2 Systems with cells mechanically separated from nutrient flow 3.4.3 Systems with immobilized cells 3.4.3.1 Packed bed bioreactors 3.4.3.2 Fluidized bed bioreactors 3.4.3.3 Film bioreactors 3.4.3.4 Hollow-fibre bioreactors References
68 68 71 74 74 75 78 78 79 80 81 82 83 84 85
GENETICS AND SELECTION OF INDUSTRIAL MICROORGANISMS
86
4.1 An ideal industrial microorganism 4.2 Strategies of acquisition of an ideal production microorganism 4.3 Enrichment methods and selection of desirable strains 4.3.1 Enrichment in a batch culture 4.3.2 Enrichment in a continuous culture 4.3.3 Direct visualization and isolation of production strains 4.4 Mutation-selection strain improvement 4.5 Mutation biosynthesis (mutasynthesis) 4.6 Use of deregulation of metabolic pathways 4.6.1 Overproduction of amino acids 4.6.2 Overproduction of nucleotides 4.6.3 Overproduction of other metabolites 4.7 Cell and protoplast fusion 4.7.1 Cell fusion 4.7.2 Protoplast fusion 4.7.3 Application in industrial microorganisms 4.8 DNA recombination in vitro 4.8.1 Preparation and cloning of DNA fragments 4.8.2 Cloning vectors 4.8.3 Problems in the application of molecular genetic methods in industrial microorganisms, and their solution 4.8.4 Possibilities of application in microbial processes 4.9 Total gene synthesis and site-directed mutagenesis 4.9.1 Total gene synthesis 4.9.2 Site-directed mutagenesis References
86 87 90 91 94 96 98 101 103 104 106 107 109 109 110 112 113 114 115
RAW MATERIALS
131
5.1 Water and associated problems 5.2 Plant raw materials
134 135
120 122 124 124 127 128
6
7
5.2.1 Monosaccharides and oligosaccharides 5.2.2 Polysaccharides -- starch and inulin 5.2.3 Cellulose 5.2.4 Plant oils 5.2.5 Nitrogen sources of plant origin 5.3 Animal raw materials 5.3.1 Lactose and whey 5.3.2 Animal fats 5.4 Chemical and petrochemical raw materials 5.4.1 Gaseous substrates 5.4.2 Alcohols and organic acids 5.4.3 n-Alkanes 5.4.4 Inorganic and organic synthetic nitrogen sources 5.4.5 Trace elements, growth factors and precursors 5.5 Chemical and biological control of raw materials, storage and homogenization 5.5.1 Chemical and biological control of raw materials 5.5.2 Raw materials storage and transport 5.5.3 Homogenization of raw materials References
136 138 140 150 151 153 154 155 155 155 157 159 160 161 164 165 166 167 167
C U L T I V A T I O N DEVICES
170
6.1 Devices for culture on solid substrates 6.1.1 Stationary cultivation on solid substrates 6.1.2 Devices with mixing of solid substrates 6.2 Surface culture on liquid substrates 6.2.1 Stationary surface culture on liquid substrates 6.2.2 Bioreactors with thin liquid layers 6.3 Systems for laboratory-scale submerged cultivation 6.3.1 Culture flasks and shakers 6.3.2 Devices for large-volume cultivation on rockers 6.4 Bioreactors with mechanical mixing 6.4.1 Laboratory bioreactors 6.4.2 Pilot-plant bioreactors 6.4.3 Industrial bioreactors 6.5 Bioreactors with pneumatic and hydraulic mixing 6.6 Devices for anaerobic culture 6.6.1 Laboratory devices 6.6.2 Bioreactors for anaerobic culture References
173 173 176 177 177 179 182 182 185 186 187 196 197 201 204 204 205 207
STERILIZATION
209
7.1 Sterilization of media 7.1.1 Steam sterilization of media 7.1.2 Sterilization and medium quality 7.1.3 Sterilization of media in flasks and laboratory bioreactors 7.1.4 Continuous steam sterilization of media 7.1.5 Scale-up of steam sterilization of media
210 210 217 219 221 224
10
8
9
7.1.6 Filtration sterilization 7.1.7 Sterilization by chemicals 7.1.8 Sterilization by radiation 7.2 Air sterilization 7.2.1 Methods of air sterilization other than filtration 7.2.2 Air sterilization by filtration 7.2.3 Mechanisms of particle trapping 7.2.4 Theory of air filtration by fibrous materials 7.2.5 Evaluation of filter bed efficiency 7.2.6 Filter construction References
226 227 228 229 230 230 231 232 235 237 239
AERATION AND M I X I N G
241
8.1 Theory of oxygen transfer 8.2 Methods of aeration capacity (kLa) determination 8.2.1 Methods applicable to model systems 8.2.2 Methods applicable to cultivation systems 8.3 Factors affecting aeration capacity (kLa) 8.3.1 Critical oxygen concentration and oxygen consumption 8.3.2 Aeration and mixing intensity 8.3.3 Physical factors 8.3.4 Chemical factors 8.4 Rheology of fluids 8.4.1 Viscosity and Newtonian fluids 8.4.2 Non-Newtonian fluids 8.5 Mixing 8.5.1 Mechanical mixing -- impellers 8.5.2 Oxygen supply underneath the impeller 8.5.3 Dimensionless criteria and geometrical similarity 8.5.4 Bubble holdup in an aerated vessel 8.5.5 Flow pattern in a stirred vessel during aeration 8.5.6 Homogenization time 8.5.7 Scale-up References
242 244 244 246 249 250 251 254 256 258 259 261 264 265 268 269 273 274 276 277 280
MONITORING, CONTROL AND REGULATION OF MICROBIAL PROCESSES
282
9.1 Methods and devices 9.1.1 Automatic analyzers 9.1.2 Ion-selective electrodes (ISEs) 9.1.3 Enzyme electrodes 9.1.4 Mass spectrometry 9.2 Physical environmental factors 9.2.1 Temperature and pressure measurement and regulation 9.2.2 Gas and fluid flow 9.2.3 Measurement of fluid volume, weight and density 9.2.4 Regulation of foam level 9.2.5 Measurement of impeller speed, power input and torque 9.2.6 Viscosity measurement
283 284 285 285 286 288 288 289 290 290 291 292
9.3 Chemical environmental factors 9.3.1 Measurement and regulation of pH and rH 9.3.2 Measurement and regulation of dissolved oxygen 9.3.3 Measurement and regulation of dissolved carbon dioxide and other gases 9.3.4 Determination of gases in the gas phase 9.3.5 Measurement of substrate and product concentrations 9.4 Biological environmental factors 9.4.1 Concentration of microorganisms 9.4.2 Determination of microbial population homogeneity 9.4.3 Determination of intracellular components of microbial cells 9.5 Attachment of the bioreactor to a computer 9.5.1 Computer function in the bioreactor-computer setup 9.5.2 Construction of a bioreactor-computer setup References l0 ELABORATION OF MICROBIAL PROCESSES 10. l Acquisition of production strains 10.1.1 Collections of microorganisms 10.1.2 Isolation of microorganisms from natural materials 10.2 Preservation and storage of microbial cultures 10.2.1 Preservation of cultures by drying 10.2.2 Preservation of cultures with limited metabolic activity 10.2.3 Preservation of cultures by freeze-drying 10.2.4 Control and evaluation of preserved microorganisms 10.3 Component parts of a microbial process 10.3.1 Inoculum preparation 10.3.2 Nutrient media 10.3.3 Regulation of secondary metabolite biosynthesis 10.3.3.1 Effect of primary metabolites and intermediates on secondary metabolism 10.3.3.2 Regulation of secondary metabolism by carbon, nitrogen and phosphorus sources 10.3.3.3 Regulation of biosynthesis of secondary metabolites by stimulatory, autoregulatory and autotoxic compounds 10.3.4 Laboratory and pilot-plant processes 10.4 Elaboration of procedures for recombinant microorganisms 10.4.1 Regulation of expression of recombinant genes 10.4.2 Plasmid stability 10.4.3 Modelling of recombinant cultures 10.4.4 Cultivation strategies for recombinant microorganisms 10.5 Contamination of microbial processes 10.5.1 Sterility of microbial processes 10.5.2 Susceptibility of microbiological processes to contamination and protection against contamination 10.6 Waste processing 10.6.1 Waste control 10.6.2 Methods of waste treatment 10.7 Economy of microbial processes
294 295 296 297 298 300 307 309 310 312 313 313 317 319 322 323 323 323 326 326 327 328 329 330 331 335 337 339 340 343 345 351 352 352 354 355 358 359 361 362 363 364 365
12 10.7.1 10.7.2 10.7.3 10.7.4 References
Culture devices Raw materials Air filtration, heating and cooling Product isolation and purification
11 IMMOBILIZED BIOCATALYSTS 11.1 Immobilized enzymes 11.2 Immobilized cells 11.2.1 Immobilized nonliving cells 11.2.2 Immobilized live nongrowing cells 11.2.3 Immobilized growing cells 11.3 Co-immobilized biocatalysts 11.4 Basic prerequisites for preparation of immobilized biocatalysts 11.5 Techniques of enzyme immobilization 11.5.1 Adsorption of an enzyme to a carrier surface 11.5.2 Covalent bonding to a carrier surface 11.5.3 Cross-linking of enzyme molecules (copolymerization) 11.5.4 Entrapment of enzymes in a matrix 11.5.5 Encapsulation or anchoring of an enzyme in a membrane structure 11.6 Techniques of cell immobilization 11.6.1 Cell immobilization without a carrier 11.6.2 Immobilization of cells to a carrier 11.6.3 Immobilization of cells by trapping into polymers 11.7 Immobilized biocatalysts of the second generation 11.7.1 Immobilized biocatalysts used for biosyntheses 11.7.2 Co-immobilized biocatalysts and biocatalyst mixtures 11.7.3 Immobilized biocatalysts for nonaqueous media and for water-insoluble substrates 11.8 Characteristics and evaluation of immobilized biocatalysts 11.9 Bioreactors for immobilized biocatalysts References 12 MICROBIAL PROCESSES ASSOCIATED WITH PRODUCT ISOLATION in situ 12.1 Evaporation 12.1.1 Vacuum fermentation 12.1.2 Vacuum fermentation with immediate product evaporation 12.2 Extractive fermentation 12.2.1 Fluid-fluid extraction 12.2.2 Aqueous two-phase systems 12.2.3 Extractive fermentation with pertraction 12.3 Adsorption 12.4 Ion exchangers 12.5 Dialysis fermentation 12.6 Filtration 12.7 Crystallization References
365 366 368 369 369 373 375 376 377 378 378 379 379 381 382 383 385 385 386 387 387 391 393 398 399 401 406 409 410 412 415 415 415 416 417 417 419 421 421 423 424 425 427 428
INDEX OF MICROORGANISMS
429
SUBJECT INDEX
432
1
INTRODUCTION
The invisible world of microorganisms has always been a highly important factor in the ecosystem inhabited by the human race. Infectious diseases have limited the growth of the human population while fermented foods and beverages have always been important parts of the diet. Fermented bread was baked in ancient Egypt as long ago as 6000 years, as documented by the findings of bread loaves in Egyptian pyramids (Jacob, 1954). Fermentation of fruits is so old that ancient Greeks attributed its discovery to one of their gods, Dionysos. Beer brewing can be documented to have been widely known 3000 years B.C. in Babylonia, where brewery-located, not domestic production included twenty beer brands, some of them being exported to Egypt (Kramer, 1965). Soya sauce has been produced in China and Japan by soybean fermentation for 1500 years, and so were fermented milk beverages and foods in the Balkans and in Central Asia. Fermented products did not include only bread, cheese and fermented drinks. More than 3000 years ago the Chinese used fermented soybean curd for treating skin infections, while Indians in Central America used fungi for curing infected wounds. Archaeological examinations have revealed tetracycline in the bones of Nubian farmers living 1400 years ago on the Nile banks in Sudan. These people were found to have grown or cultivated a tetracyclineproducing streptomycete on cereals which were then used for production of bread or alcoholic beverages. This food represented up to 80 % of their nutrition and the occurrence of infectious diseases among them was therefore much smaller than in other contemporary populations. The first scholar who devoted his attention to fermentation was Libavius, who made a distinction between fermentation and putrefaction. In 1595 he proposed the concept of ferments which affect and change matter. In 1669, Becher pointed out differences between fermentation and putrefaction or decay and stated that only materials containing saccharides can give rise to the so-called wine spirit. In 1818, Erxleben suggested that the organisms seen in the microscope by Antonie van Leeuwenhoek cause fermentation, which is their life process. The first to formulate the chemistry of alcoholic fermentation was Gay-Lussac in 1815. The scientific or professional bases of industrial microbiology were laid
14
in 1857, when Louis Pasteur proved that alcoholic fermentation is brought about by yeast and that yeasts are living organisms. Robert Koch introduced the isolation of pure microbial cultures and laid the basis for sterilization. Modern development of industrial microbiology began in the 20th century. During World War I microbiological methods were used to produce glycerol, acetone, butanol, propanol, citric acid and other basic chemicals. The next epoch began in the course of World War II and is associated with the discovery of antibiotics. Production of antibiotics required the maintenance of absolutely sterile conditions in the production, elaboration of methods for submerged cultivation on laboratory and pilot-plant scale, development of methods for improvement and screening of microorganisms and new methods for separation and isolation of labile products whose concentrations in the culture fluid are very low. Advances in both biological and engineering aspects positively affected and accelerated the introduction of further microbial products into bulk productions. During the seventies, methods were elaborated for directed changes and transfers of genetic material (genetic manipulations) which opened the way to a bulk production of peptide hormones, interferons, new vaccines and other products of animal origin via economically advantageous microbial synthesis. Also highly important was the elaboration of techniques of enzyme and cell immobilization, which greatly simplified and reduced the costs of biotransformations of important products.
1.1
DEFINITION AND SCOPE OF INDUSTRIAL MICROBIOLOGY
Industrial microbiology or, in other terms, microbial technology or fermentation processes can be defined as the application of scientific and engineering principles in the treatment of raw materials by microbiological means for providing goods and services. Scientific and engineering principles make use of information and data from microbiology, biochemistry, physiology, genetics, as well as biochemical, chemical, mechanical and cost engineering. The term microbiological means includes microorganisms or their components. The definition also includes the term materials which denotes organic and inorganic substances used for microbial conversions. These conversions encompass not only the transformation of the materials in microbiological processes but also procedures for the preparation and processing of materials for these processes. The definition further refers to providing goods and services. The term goods describes the products of pharmaceutical and food industries and products destined for agriculture, while services include water treatment, processing of industrial and agricultural wastes and environmental protection in general (Moser, 1992).
15
1.2
BASIC BRANCHES OF INDUSTRIAL MICROBIOLOGY
All branches of industrial microbiology have a common theoretical basis which considerably affects their further development. The main fields determining largely the direction of industrial microbiology are general microbiology and microbial genetics, physiology and biochemistry which together form the basis for application of theoretical knowledge; and microbial engineering which constitutes the basis for application of engineering know-how in industrial microbial processes. The mutual linkage and intertwining of individual science and engineering disciplines is illustrated in Fig. 1.1. Taxonomy Ecology
Biocafalysfs Improvement Growthand Regulatory (enzymesand cells) and selection proliferation mechanisms ~ ~ Product formation
l,.c,o,,o,_oo,,,l I HICROBIAL ENfilNEERINfi
1
1
BIOSYNTHESISAND BIOTRANSFORmATiO. ,I HECHANICAL ENGINEERING
f
Modelling
Cu[fure
Hathemafico[ processing
Isolation devices
devices
CHEHICAL ENGINEERING
PRICE ENGINEERING
f
Moss and oxygen Economy transfer (raw materials and energy)
Fig. 1.1 Connection of scientific and engineering disciplines in industrial biosynthesis and biotransformation of microbial products
1.2.1
Microbiology, biochemistry and microbial physiology
When discussing microbiological and biochemical approaches one should be aware of their unique character which stems from using biocatalysts as means for transformation of molecules. The most important sources of these biocatalysts are microorganisms. For a practical application it is necessary to select a suitable biocatalyst and ensure its optimum structure and properties, along with optimum ambient conditions for its use. When viewed in proportion to the total number of known microbial species the number of species in industrial use is still marginal. The reasons for this are"
16 a) the use of traditional microorganisms, b) concentration of research in genetics and biochemistry on traditional models, c) neglect of some types of microorganisms -- anaerobic, autotrophic, slowly growing and nutritionally exacting. This situation has slowly begun to change with growing demand for microorganisms with special biocatalytic properties. Intensified efforts directed at isolating new types of microorganisms and their products reflect the necessity of innovating antimicrobial and pharmacologically active substances. One important innovation was the screening of enzyme inhibitors produced by microorganisms and of biologically active compounds that can be used for treating hypertension, thromboses, overweight, tumour diseases and gastric ulcers. Search for inhibitors which inactivate enzymes degrading antibiotics is highly promising, as these agents can substantially promote the development of efficient chemotherapies. Research into microbial physiology is currently directed towards the elucidation of relationships between the metabolic abilities of microorganisms and the environment. Phenotypical variability of microorganisms based on modification of cellular structures can be used on the one hand for practical purposes but, on the other hand, it can cause problems. Adjustment of environmental conditions with the culture device (process optimization) is necessary for successful scale-up of the process from the laboratory to the production scale. If the environmental conditions are not precisely defined, the reproducibility of the process is low because of phenotypical variability of the microorganisms. Overproduction of metabolites is physiologically abnormal for the microorganisms and the whole procedure has to be carefully regulated with the use of feedback mechanisms. Overproduction of extracellular metabolites makes imperative also a change in the permeability of the cell wall and membrane facilitating export of the metabolites from the cells, and preventing their feedback effect on production. Of considerable importance are studies of the physiological state of microorganisms. M~lek (1976) defined the physiological state as follows: "The term physiological state of a microbial population is an auxiliary term which embodies properties and states, along with the ability to respond to the properties of the medium and reflect these properties in specific changes in metabolism or morphology. This is often associated with accumulation of specific metabolites." Physiological state can also be defined as a "genetically determined sum of metabolic potencies of the culture which is reflected, in dependence on environmental conditions, in a certain level of reproduction and in the ability to respond to changes in these conditions by specific changes in metabolism with a resulting establishment of a new quality. This
17
new quality can have the form of differentiation of morphological features, or physiological and biochemical processes with the formation of specific metabolites and a clear dependence on culture history” (RiCica and Votruba, 1982). The increasing knowledge of the mechanism of primary and especially secondary metabolism gives rise to a more effective use of biochemical reactions. This has an impact not only on the production of important metabolites, but also, for example, on the degradation of a variety of materials in waste processing. A better knowledge of the catabolism of xenobiotic chemicals can substantially improve the efficiency of waste water treatment. Biochemistry plays an important role also by revealing the fundamental structure of enzymes and their function, thereby contributing to a more efficient use of biocatalysts. As compared with catalysts used in organic syntheses, enzymes are unique in several respects: they can catalyze a broad spectrum of reactions, are usually highly selective and the reaction rates can be very high. A more profound knowledge of structural properties of enzymes, especially those whose function is linked with the cell wall, could lead to increased stability of the enzymes. The price of most enzymes is so high that their use is economically feasible only on repeated application. This has led to the development of immobilization techniques in which water soluble enzymes are transformed into solid catalysts. Immobilization can also be used for whole live or non-living microbial, plant or animal cells or their parts such as cell walls. It should be stressed that processes based on immobilized biocatalysts include so far mostly relatively simple conversions. Their potential is vast, however, considering the versatility of microorganisms which can accomplish multiple-step reactions in the syntheses of highly complex products. Some engineering problems encountered in the use of immobilized biocatalysts have not yet been adequately resolved. Nearly all existing processes make use of packed columns where the biocatalyst wear is minimal. However, biochemical reactions are accompanied by liberation of hydrogen ions or hydroxyl ions which makes continuous pH adjustment necessary. In columnshaped reactors this is complicated, and so is also, for example, gas supply (oxygen supply in aerobic processes). For this reason stirred bioreactors are sometimes preferred but in these cases the biocatalyst wear is considerable. Some compounds such as steroids or lipids are water insoluble and can be dissolved only in nonaqueous solvents. This causes problems with biocatalyst stability and with the elucidation of the mechanisms of substrate and product transfer in multiphase systems. The current research and development in this field includes immobilized biocatalysts of the 2nd and 3rd generations which contain in the same prepar-
18
ation several types of immobilized enzymes and cells for complex biotransformations (Hartmeier, 1985). Another promising line is the development of biocatalysts for non-aqueous media (Klibanov et al., 1977). Detailed knowledge of the mechanisms governing enzyme activity will facilitate directed changes and manipulations of the catalytic properties of the enzymes. In addition to chemical modifications, enzymes with altered properties can be obtained by using mutants capable of growing on compounds structurally related to the substrates for wild parent strains. Future objectives include a detailed knowledge of the relationship between amino acid composition and structure, enzyme activity and substrate specificity. It will then be possible to use directed mutagenesis to acquire enzymes with properties such as heat stability, insensitivity to extreme pH values, inhibitors, etc..
1.2.2
Genetics of microorganisms
The recent advances in microbial industry are closely connected with the development of general and molecular genetics. Genetic methods can provide not only strains producing a given compound in substantially higher concentrations as compared to parent strains, but also strains producing different or modified compounds. At present there is virtually no industrial microbial process which does not to a significant extent rely on genetic and improvement methods, be it older or more traditional, or more modern productions of biomass, primary or secondary metabolites. According to expert estimates, the impact of genetics on increasing production of microbial processes makes up 30 to 50 % depending on the type of the product. Increasing production of metabolites by industrial microorganisms used to be based predominantly on random mutations and selection, rather than on deliberate methods using fundamental knowledge of genetics and biochemistry of production microorganisms. This state of affairs stemmed from: a) lack of sufficient knowledge of genetics and biochemistry of the microorganisms, b) lack of convincing proofs and documentation of the attained results, c) the fact that yield increase was achieved in a relatively short time. The situation in the genetics of industrial microorganisms in the seventies was assessed by Pontecorvo in his introductory lecture at the 2nd International Symposium on the Genetics of Industrial Microorganisms in 1975 as follows" " . . . the reason for the disappointing state of the application of genetics in the improvement of industrial microorganisms is the fragmentation of effort. Every industrial concern has its own mini-team working in secrecy and trying to produce more desirable strains." and further, "What should we do
19
about this? In analogy to plant breeding, this improvement can be carried out efficiently in a few highly specialized breeding centres.” Since then the situation has changed considerably. New, specialized companies such as Panlabs, Biogen, Cetus, Genentech, Genex and others are concerned with the application of modern methods of molecular genetics and genetic manipulations. In cooperation with other firms they have introduced into production entirely new products, and used directed selection to produce new high-producing strains. These directed selection procedures make use of a prescreening methodology based on a profound knowledge of genetic and biochemical mechanisms. They have been successfully applied in industrial microorganisms and have replaced empirical mutation and selection procedures. Cell or protoplast fusion and DNA recombination, which make it possible to cross the borders between species, substantially extended the application possibilities of genetics. These methods were used in the production of animal proteins by microorganisms, in enhancement of production of primary and secondary metabolites and in construction of microorganisms utilizing substrates in a more economical way. Protoplast fusion is important for combining large parts of a genome, which is desirable in cases when the synthesis of a certain product is regulated in a complex manner by a large number of genes. On the other hand, the method of DNA recombination is useful in cases when the synthesis of a certain product is mediated by a lower number of genes.
1.2.3 Microbial engineering Another theoretical basis of industrial microbiology is microbial engineering. This term has been coined in order to distinguish from the common terms bioengineering or biochemical engineering that part which deals with engineering aspects of microbiological processes (Sikyta, Prokop and Novak, 1973, 1974). The subject matter of this discipline is the elaboration of technological procedures and acquisition of fundamental information about the physical, kinetic and other characteristics of the processes. Studies of mass transfer, media and air sterilization, aeration and mixing have found their application in modern microbial processes. The study of rheological properties of cultures, especially of filamentous microorganisms, scale-up and scale-down systems (Ettler, 1991 ; Votruba and Sobotka, 1992), process kinetics and modelling (Volesky and Votruba, 1992) is at the centre of attention and is expected to yield results applicable in practice. An important question is the elaboration of strategies for process control and regulation and their automation.
20
No process is complete until the product is isolated in its final form. Isolation of products involves the solution of a number of problems which did not exist earlier. Older microbial processes revolved usually around relatively simple and stable substances in considerable concentrations whereas in modern processes the concentrations of some products can be very low. Special isolation techniques have therefore been elaborated which ensure satisfactory isolation of even minute amounts of products. The personnel engaged in elaborating the technology of microbial processes need to have a fundamental knowledge of product isolation techniques. For instance, it would be counterproductive to automate a culture process and try to achieve the highest possible yields at any costs if this optimization would impair the possibilities of product isolation. Isolation procedures are complicated by the simultaneous production of other metabolites and cell autolysis. These factors increase the isolation costs which usually make up 50 to 80 % of total costs. Any cultivation and isolation process must therefore be considered and evaluated as a whole. It is also recommended that product yields should be checked not only analytically but also by directly isolating the product from culture fluid. This is to avoid the situation where the analytical method will determine the concentration of not only the desired product but also a structurally similar but worthless byproducts. Biological discoveries, especially in genetic engineering, open new horizons for applications and are therefore at the centre of attention. However, overstressing of biological aspects has led to underestimating the problems of scale-up from the laboratory to the production level. The difference between introducing a new process in microbial and chemical industries is mainly in that the projects for construction of microbial industrial establishments are drawn up before the operational conditions are thoroughly known. For this reason, the industrial production process often has to be long and labouriously adjusted and modified during plant operation, including an exact specification of the product. The smaller interest in the engineering aspects of microbiological processes has been due to several factors: a) In contrast to the rapid advances in genetic engineering and other fields of biology the advances in microbial engineering are much slower. b) Costs of engineering research into microbial technologies are high also because the processes are often bulk productions. Furthermore, microbial engineering studies were rare in the past and the industry relied mostly on empirical approaches. e) In principle there are no engineering operations that would be strictly impossible to perform, even though under non-optimal conditions.
21
In microbiological industry, operations requiring aseptic work have been satisfactorily elaborated and contamination of processes occurs only rarely. In addition, in batch processes the whole device is sterilized between individual runs so that the contaminating microorganisms can proliferate for only a limited period. The increased use of continuous processes which run for long time periods poses new demands on aseptic operation. Cultivation of pathogenic microorganisms and recombinant microorganisms has led to the development of laboratory and production-scale reactors with corresponding modifications of valves, joints and seals. The price of these devices is high. Most industrial microbial processes have so far been carried out in stirred and aerated reactors. A number of new types of bioreactors have been designed but only a small portion have been actually introduced into the production because new pneumatic and hydrodynamic systems have been proven to be superior to the existing traditional mechanical systems. A crucial factor is the energy input for mixing which decides to a large extent the product price. Another factor is bioreactor size, because in large-volume units every mechanical fault or failure or contamination is accompanied by a considerable financial loss. When designing stirring systems it should be kept in mind what microorganism is being cultivated because shear forces can damage cells, especially of filamentous microorganisms. A special discipline is price engineering which operates with a value function expressed as the financial effect of the activity under study. The relevant methodology includes mathematical modelling of the process, analysis of dynamics of raw material, product and energy prices caused by seasonal variations and market fluctuations. A part of an optimum design of a technology is the identification of prognostic models of price development. The priceoriented model makes it possible to tune the requirements of technology to economic parameters and provides a basis for decision and management activities. All the above methods and operations necessary for the elaboration of a microbial process and its scale-up can be summarized in a schematic diagram (Fig. 1.2). Individual operations are given in a clockwise direction on the circumference of two semicircles. The right-hand semicircle includes procedures related to the macroscopic regulation, i.e. factors of environment, while the left-hand semicircle comprises factors associated with intracellular, i.e. microscopic regulation. These seemingly incompatible parts are joined at the points denoting new strains. This scheme implies that the development and optimization of a microbial process is to be viewed as a cyclically repeating sequence of serially arrayed operations.
22 z
~'S"S'IOr~-
.~,
Oo: o:o .
z
Fig. 1.2 Survey of procedures used in elaboration of industrial microbial processes (after Aiba, 1983)
1.3
RESEARCH
The recent advances in industrial microbiology and in the introduction of new products into bulk production have been based on a number of factors. The first of these was a rapidly receding role of empirical approaches in the research work. Applied research involved steadily growing numbers of highly qualified personnel with a very good theoretical background. In advanced industrial countries, the education and training of specialists in industrial microbiology is therefore a centre of interest (Umbreit, 1974; Brunner, 1975; Lafferty, 1975). Another contributory factor was a close collaboration of experts from various fields, microbiologists, geneticists, biochemists, physiologists, chemists, engineers and mathematicians, dictated by the biological and technological complexity of the tasks and the need for their rapid solution. The third prerequisite for the current progress has been the use of modern, fully automated analytical methods and instrumentation, and highly so-
23
phisticated laboratory and pilot-plant equipment connected with on-line computers. 1.3.1
Laboratory research
Addressing a certain problem or task naturally requires accumulation of all available literature data on the problem, including patent materials, followed by a proposal for problem solution which embodies also an economic analysis. The completed survey should provide a basis for designing an exact working plan, usually in several alternatives. If the problem is of a complex nature, which requires the cooperation with other organizations, such as clinical groups and establishments, the proposal should include also the list of all institutions that are to participate in the work, with a definition of their tasks. Economic analysis is in principle an evaluation of presumed profit brought about by the successful solution of the problem. It is based on the proposal of the research problem supported by literature and patent survey, and compares the estimated costs of problem solution with the final economic outcome to be expected from the completed task. Conclusions drawn from this comparison are one of the most important guidelines for evaluation and approval of the proposal. The required extent and equipment of research laboratories and their working programme depend on the extent and aims of the research tasks to be solved. The research work can in principle be organized in two ways: a) Research groups are established which address in a complex way the whole task (e.g. elaboration of amino acid, enzyme or antibiotic biosynthesis). Such a group will then include microbiologists, geneticists, biochemists, analytical and organic chemists and engineers who will have at their disposal all necessary equipment including pilot-plant facilities. In other words, the team develops the whole process from laboratory procedures up to the pilot-plant scale. b) Research teams are organized according to the speciality of their members. Each team then contributes to the overall solution of a problem by using a certain proportion of its research capacity. For instance, microbiological laboratories address the problems of acquisition of several production microorganisms, a genetic group works on increasing the yield of several metabolites and a chemical group studies the isolation of several products at the same time. After completion of laboratory research a laboratory prescription is set up and forwarded to the pilot plant for further development. An analytical team then performs analyses for all other teams including the pilot-plant group. In some cases the organization of research work involves a combination
24
of the two approaches. Thus research teams may solve the problem in a complex way on the laboratory scale only, or an analytical group solves problems connected with elaboration of analytical methods for several teams. This combined approach is useful because pilot-plant instrumentation and analytical equipment are increasingly more complex and expensive and it would be uneconomical to equip all research teams with expensive equipment and highly qualified operators.
1.3.2
Pilot plant
The main task of each pilot plant is the verification of laboratory procedures, and their modification to permit the scale-up of the pilot-plant process to the industrial scale (Hockenhull, 1975). The principal objectives of a microbial pilot plant are: a) Verification of laboratory results and development of a pilot-plant prescription for the cultivation of a production strain and product isolation. b) Modification of the technology, aiming at increasing the production of the given compound, shortening cultivation time and economizing the culture and isolation procedure through selection of economically advantageous raw materials. c) Basic technological research of a general nature which facilitates the scale-up of research results to industrial level. An integral part of pilot-plant research is the construction and development of new cultivation and isolation devices and their constituent units, with the objective of testing construction materials and their resistance to temperature, pressure and corrosion. Other important factors to be studied are the optimum installation of apparatus units and their interconnection, ensuring optimal operation, assembly and disassembly, and operational safety. Intensively studied aspects of culture devices are especially new and more convenient types of aeration and mixing of microbial cultures, medium heating and cooling, and the development of systems for inoculation, precursor supply, dosage of antifoam agents and nutrients in the course of the cultivation, regulation of pH, dissolved oxygen, carbon dioxide and other gases. Attention is also paid to the automated analysis of substrates, intermediates and final products, and to the connection of bioreactors with computers (hardware, software) which enables the processes to be optimized. The above steps increase the risk of contamination of the process and this necessitates the development of new, more secure systems for their installation. The risk of contamination can be further reduced by introducing improved techniques of air and media sterilization, better sealing of the impeller shaft and blocking of sampling and connecting conduits.
25
The isolation pilot-plant unit is the place of further processing and treatment of separated cell matter or culture fluid. The fluid is pumped via a conduit into storage vessels equipped with impellers and cooling to prevent degradation of heat-labile products. The cell matter that has been transferred into a tank is further filtered and dried, extracted or disintegrated on appropriate cell breakers (a disintegrator using pressure or glass beads, or a blender). The unit houses machinery for extraction, evaporation, filtration, precipitation, lyophilization and drying, ion exchange columns and ultrafiltration devices. The pilot plant has a common room for the servicing personnel, a laboratory for testing and verification work, and refrigerators for storing heat-labile products. The isolation unit should also have spare space for the installation of new types of apparatus. 1.3.3
Termination of research
Successful termination of a piece of research is followed by writing up the results for publication in a professional journal or monograph, a patent or a research report.
Paper(s) The most common way of completing scientific and research work is the publication of results in a scientific or professional journal or a symposium proceedings. When writing a paper, close attention should be paid to the Instruction to Authors issued by the appropriate journal. The paper can have the form of short communication, full paper or a review. The most important journals in the field of industrial microbiology are: Acta Biotechnologica Applied and Environmental Microbiology Bio/Technology Biotechnology and Bioengineering Biotechnology Letters Biotechnology Techniques Developments in Industrial Microbiology Enzyme and Microbial Technology Journal of Applied Bacteriology Journal of Applied Chemistry and Biotechnology Journal of Biotechnology Journal of Chemical Technology and Biotechnology Journal of Fermentation Technology Journal of Industrial Microbiology Letters in Applied Microbiology Prikladnaya Mikrobiologiya
26
Journals and periodical book series publishing reviews include: Advances in Applied Microbiology Advances in Biochemical Engineering Advances in Microbial Physiology Annual Reports on Fermentation Processes Applied Biochemistry and Bioengineering Bacteriological Review Biotech-Forum Biotechnology Advances Biotechnology and Genetic Engineering Reviews International Industrial Biotechnology Microbial Technology Practical Biotechnology Process Biochemistry Progress in Industrial Microbiology Swiss Biotech Topics in Enzyme and Fermentation Biotechnology Trends in Biotechnology
Professional commercial and information periodicals include: Abstracts in Bio Commerce Applied Genetics News Biofutur Biomass Bulletin Biomass Digest* Bioprocessing Technology Biotechnology Abstracts (Dorvent Biotechnology Abstracts) Biotechnology Bulletin* Biotechnology Bulletin Reports* Biotechnology in Japan News-Service Biotech News Biotechnology News Biotechnology Press Digest* Biotech Quarterly Biotech Update European Biotechnology Newsletter Genetic Engineering and Biotechnology Monitor Genetic Engineering Letter Genetic Engineering News Genetic Technology News Industrial Biotechnology McGraw-Hill's Biotechnology Newswatch Manufacturing Chemist Practical Biotechnology Scrip Telegen Reporter
27
These journals are mostly very expensive and their information value varies widely; some of them publish "shop talk" or "gossip" instead of hardcore information items (Davies, 1982). Journals denoted by an asterisk are not recommended while journals printed in italics have an excellent standard but are very expensive (with the exception of Scrip). The results of scientific and research work can also be presented at local, national or international meetings in the form of invited lectures or discussion contributions at workshops or in round-table discussions, or as displays or posters. The most prominent among the various international institutions organizing meetings in industrial microbiology are: European Federation of Biotechnology (EFB) Federation of European Biochemical Societies (FEBS) Federation of European Microbiological Societies (FEMS) International Organization of Biotechnology and Bioengineering (IOBB) International Union of Microbiological Societies (IUMS) -- International Committee of Economic and Applied Microbiology (ICEAM) International Union of Pure and Applied Chemistry (IUPAC) Commission on Biotechnology
Communications can be published as reviews; invited lectures usually appear in extenso in meeting proceedings. Patents
If the results of a piece of research are economically important and can be applied in industry they should be patented. Subject matters of patents can include: a) products obtained through the activity of microorganisms, b) methods of manufacture of products obtained through the activity of microorganisms, e) procedures utilizing activities of microorganisms for other purposes, d) methods of improvement and breeding of industrial production microorganisms, e) new strains of industrial production microorganisms. Until recently, most countries did not allow patenting of microbial species, strains and mutants or procedures for their acquisition. This attitude was based on the concept that natural phenomena and objects found in nature cannot be patented. It led to the situation where the microorganisms were kept in secrecy and were not available to the public. However, almost all industrial microorganisms differ substantially from the parent strains originally
28 isolated from nature, having been obtained in the laboratory either by mutation improvement or by genetic engineering methods, i.e. through deliberate human activities. For this reason it is now possible to patent in most countries microbial strains and methods of their acquisition, provided the patent contains the description of morphological and biochemical characteristics of the patented microorganism and the method of its acquisition. In addition, the microorganism has to be deposited with some of the known collections of microorganisms and has to be available for all who want to examine the novelty of the patent. Problems associated with patents on microorganisms have been extensively discussed by many authors (Marcus, 1975; Pridham and Hesseltine, 1975; Vossius, 1979; Wegner, 1979). In some cases, the question of whether to apply for a patent or not is of prime importance. If the author cannot be sure that the competitors will not be able without permission to use a modification of the patented procedure or production strain, he would be better advised to keep the results secret and refrain from applying for a patent. This does not concern products which can be relatively easily recognized in the market. It is convenient if the process makes it possible to detect in the product trace amounts of some specific compounds characteristic of the patented technological procedure. The possibility also exists to label the microorganism with some genetic marker. Every country restricts the categories of objects for which patents can be granted. In some countries the possibilities of patenting cover a very broad range while in others they are subject to severe constraints as a reaction to foreign trade control and protection. There are also certain differences among countries as to the factual and time requirements during the application for, and granting of, a patent. The granting of a patent requires that the author or his legal representative submit the patent application in an appropriate form to the Patent Office. This preliminary application is, on submission, marked by the date and hour of the day in order to determine priority. Within 12 months of the date the author may supply some detailed data (examples) but he cannot change the claim(s). The Patent Office then forwards the patent to examiner(s) for evaluation of its novelty. If approved, the patent is publicly presented. This presentation and a publication in appropriate documents of the Patent Office provides the public with the opportunity to evaluate the novel features of the patent. If there are no objections the patent is usually granted within 3 months of its publication. The duration of patent validity differs somewhat in individual countries but it is sixteen years on average. If the patent is claimed also in other countries, the claim has to be submitted within one year of the original patent application. A patent includes two important parts, the description and the claims.
29 The description informs experts on the novelty of the patent and presents examples of its application. The claims defined at the end of the patent indicate what is prohibited concerning manufacture, use and selling prior to expiration of the patent.
Research report As a rule, the final research report has three main parts" introduction, main statement and conclusion. The introduction explains the purpose of the research work, its objectives and importance. Further sections present all materials serving as a basis for the project and a literature survey, in the form of a discussion. The survey should clearly illustrate the relationship of individual literature sources to the task solution. The main part summarizes all experimental activities according to laboratory notebooks. The most convenient form is tables and graphs which are highly comprehensible. The experimental material presented in this concise and well organized way should be accompanied by an equally well documented and justified ultimate method of problem solution. The description of preparation of individual products should include data about the raw materials used and the minimum requirements for their purity. All experimental parameters based on trials, which became a part of the operational prescription, should always be given not only in terms of their numerical values but also their maximum permissible deviations; for instance, data on temperature should include not only optimum temperature but also limits within which the temperature may fluctuate without endangering the outcome of the process, and the consequences of exceeding these limits. The conclusion contains a recapitulation of the whole task formulation, operational flow-sheet and the results achieved. The recapitulation is followed by an economic evaluation of results as a basis for a proposal of practical utilization, which is also presented. Part of the economic analysis is a calculation of costs per unit amount of product. Appendices to the report contain all details that would make the actual report too extensive and would detract from its comprehensibility, but are indispensable for a more detailed study. Other appendices are tables, diagrams, photographs, blueprints, etc.. An important part of a research report is the pilot plant prescription. This should be set up in such a way that it would serve as a good basis not only for an industrial production but also for project formulation. The pilot plant prescription should contain: a) justification of the chosen proportions of reactants and comparison of new data with the laboratory prescription,
30 b) calculation of raw materials, intermediates and waste products per unit amount of the end product, c) corrosion tables for those reaction steps in which the selection of a suitable material for the apparatus cannot be decided in advance, d) physical constants of raw materials, intermediates and all waste products, such as specific weight, density, specific heat, viscosity, loose weight, reaction heat, or pH, e) analyses of waste products and gases arising during the reaction, and suggestions for their utilization or disposal, f) tables of inflammation points for all inflammable compounds used, classification of other raw materials according to their explosivity, etc., g) simple tests for rapid preliminary evaluation or assessment of raw materials and products, h) data on toxicity and physiological effects of raw materials, products and waste products, i) an outline of a production scale operation prescription, and j) a schematic design of reaction apparatus with a detailed documented proposal for construction material(s).
1.4
RISKS IN APPLIED MICROBIOLOGY
In common with some other branches of an economy, the microbiological industry also accumulates waste materials which have to be disposed of in order to avoid negative environmental effects. An additional task is to prevent any possible spreading of microorganisms and products that may be deleterious for human health, both in the production installation and in its vicinity (Ginjaar, 1980). This risk can be caused not only by microorganisms which are pathogenic or potentially pathogenic, but also by nonpathogenic microorganisms if they are produced in large amounts, by products such as toxins, antibiotics, hormones, psychopharmaceuticals, and also by compounds used for product isolation. Microbiological productions involve some steps which may represent health risks for the operators, for example the following operations: a) cultivation of pathogenic microorganisms and their separation (aerosols), b) production of pharmaceuticals such as antibiotics (resistant strains), hormones (metabolic disturbances), enzymes (allergies) and psychopharmaceuticals (addictions), c) product isolation operations using chemicals with toxic effects (organic solvents).
31
The introduction of genetic manipulation methods has led to apprehension that these methods could give rise to microorganisms with entirely unknown pathogenic properties against which there would be no protection, or microorganisms with highly negative environmental effects, such as organisms rapidly degrading lignocellulosic materials. Very strict rules have therefore been introduced for work with these microorganisms (Anonymous, 1992). Although such situations cannot be completely excluded, current experience has shown that these apprehensions are largely unfounded and that, apart from some minor exceptions, the microbiological techniques and rules applicable to work with newly constructed strains are identical to those used for conventional work with pathogenic microorganisms (Anonymous, 1984; Ktienzi et al., 1985). In terms of environmental protection it should be realized that these productions may cause spreading or escape, whether by air or via water, of biologically active substances and microorganisms. The escape of antibiotics may cause selection of resistant bacterial strains containing plasmids, and transfer of these plasmids into other microorganisms may bring about spreading of resistance to the antibiotic. Water treatment in microbiological productions is very similar to that used for other biological productions characterized by large water consumption.
REFERENCES Aiba, S. (1983) Microbial Utilization of Renewable Resources 3, Osaka. Anonymous (1984) Swiss Biotechnol. 2 (5), 7. Anonymous (1992) Release of organisms into the environment -- voluntary code of conduct. Biotechnol. Forum Europe 9, 218. Brunner, R. (1975) Biotechnologie in Osterreich. 1. Arbeitstagung, Graz. Davies, J. (1982) Nature 299, 493. Ettler, P. (1991) Folia Microbiol. 36, 493. Ginjaar, L. (1980) Biotechnol. Lett. 2, 153. Hartmeier, W. (1985) Trends Biotechnol. 3, 149. Hockenhull, D. J. D. (1975) Adv. Appl. Microbiol. 19, 187. Jacob, H. E. (1954) 6 000 Jahre Brot. Hamburg. Klibanov, A. M., Samokhin, G. P., Martinek, K., Berezin, I. V. (1977) Biotechnol. Bioeng. 19, 1351. Kramer, S. N. (1965) History Begins in Sumeria (In Czech), Prague. Ktienzi, M., Assi, F., Chmiel, A., Collins, C. H., Donikian, M., Dominguez, J. B., Financzek, L., Fogarty, E. M., Frommer, W., Hasko, F., Howland, J., Houwink, E. W., Mahler, J. L., Sandkvist, A., Sargeant, K., Sloover, C., Tu~'nenburg Mu~s, G. (1985) Appl. Microbiol. Biotechnol. 21, 1. Lafferty, R. M. (1975) Biotechnologie in Osterreich. 1. Arbeitstagung, Graz. M/tlek, I. (1976) Physiological State of Continuously Grown Microbial Cultures. In: Continuous Culture 6: Applications and New Fields, Chichester. Marcus, I. (1975) Adv. Appl. Microbiol. 19, 77.
32 Moser, A. (1992) Acta Biotechnol. 12, 69-78. Pontecorvo, G. (1976) Presidential Address. In: 2nd Internatl. Symp. Genet. Industrial Microrganisms, London. Pridham, T. G., Hesseltine, C. W. (1975) Adv. Appl. Microbiol. 19, 1. Ri6ica, J., Votruba, J. (1982) Overproduction of Microbial Products. FEMS Symp. No. 13, London. Sikyta, B., Prokop, A., Novfik, M. (1973) Advances in Microbial Engineering, Part 1. Biotechnol. Bioeng. Symp. 4, New York. Sikyta, B., Prokop, A., Novfik, M. (1974) Advances in Microbial Engineering, Part 2, Biotechnol. Bioeng. Symp. 4, New York. Umbreit, W. W. (1974) Adv. Appl. Microbiol. 17, 1. Volesky, B., Votruba, J. (1992) Modelling and Optimization of Fermentation Processes. Amsterdam. Vossius, V. (1979) Biotechnol. Lett. 1, 187. Votruba, J., Sobotka, M. (1992) Folia Microbiol. 37, 331. Wegner, H. C. (1979) Biotechnol. Lett. 1, 145.
33
KINETICS OF MICROBIAL GROWTH AND PRODUCT FORMATION
The understanding of any microbiological process requires kinetics studies examining the rates of production of cells and their metabolites and the effects of various factors on these rates. With advancing knowledge of the function of enzyme systems, growth regulation and product formation, the kinetics of microbiological processes has become progressively more exact; this in turn facilitates the generalization and control of the course of industrial-scale productions and the enhancement of product yields. This chapter deals with the kinetics of batch cultures of microorganisms and the factors affecting the process.
2.1
MICROBIAL GROWTH AND REPRODUCTION
The basic type of cultivation of microorganisms is the so-called batch culture. In the following text we shall consider only submerged cultivation in a liquid medium, which is the most common and most important type of batch culture. In this process, a sterile medium of a given initial composition is inoculated by a certain amount of microorganisms of a given species and the microorganisms are cultured, usually under constant conditions (temperature, aeration, etc.). The cultivation proceeds in most cases until both proliferation and growth cease due to exhaustion of nutrients or accumulation of toxic metabolites. Development of microbial populations was found to involve substantial changes in the rates of growth and reproduction. 2.1.1
Growth curve
When experimentally determined cell number or cell mass concentration, or (more often) their logarithms are plotted against time, a characteristic curve is obtained. When the parameter under study is cell number, the curve is called a multiplication curve whereas the plot of cell mass concentration against time yields a growth curve. As seen in Fig. 2.1a, b the two curves are not identical. The following phases may be distinguished on the multiplication curve:
34
1. lag-phase" a period of adaptation of inoculated cells to the new environment; the number of live cells usually decreases, 2. acceleration phase: cell begin to multiply at an increasing rate, 3. exponential phase" the number of cells rises exponentially with time, 4. deceleration phase: multiplication rate decreases, 5. stationary phase" multiplication rate is in equilibrium with death rate, 6. death phase which may be subdivided into accelerated death phase, exponential death phase and death declination phase. Jog N
A
2
No
Log X
Xo
5
B
/ I I l
I
I
I I
l
4
j
5
-------4
b
Fig. 2.1 Multiplication (A) and growth (B) curve Nnumber of cells, X biomass concentration; individual phases: I -- lag phase, 2 - acceleration phase, 3 exponential phase, 3' balanced growth, 4declination phase, 5 stationary phase, 6 - death phase
Fig. 2. l b shows a growth curve for the same culture. The lag phase is seen to be shorter than on the multiplication curve since the growth rate begins to increase earlier than the multiplication rate. The acceleration phase is also shorter while the exponential phase is usually substantially longer. In curve section 3' both the growth and the multiplication rates are maximal and a linear relationship exists between the number of cells and their weight. The rates of formation of all cell components (RNA, DNA, enzymes, etc.) are also identical. This, usually very short, period is called balanced growth. The declination phase sets in earlier on the growth curve and the stationary phase is much longer than on the multiplication curve. The later onset of biomass concentration decrease is caused by cell lysis.
35 The difference between the two curves reflects mostly changes in cell size and composition brought about by accumulation or degradation of cellular material during culture. This is also the reason for the differences between multiplication and growth rates, with the exception of the balanced growth period. However, this general pattern can change in individual cases; one or several phases may be missing or, on the other hand, the growth pattern can be still more complex. Lag phase and acceleration phase. Following a transfer of the microorganisms into a new medium, their concentration often remains constant for a certain period. This period may be very short or it may take several hours; sometimes the concentration of the microorganisms can even drop. The terminology used in the literature is sometimes confusing: some authors use the term lag to denote the second phase, others combine the first and the second phase into one. Together, the two phases represent the period of preparation to proliferation. The most important factors affecting the length of the two phases are the following: composition of original medium (in which the microorganisms grew before the transfer into the new medium), composition of the new medium (into which the microorganisms have been transferred), strain type and its age, amount of microorganisms and their genetic equipment, physical factors (temperature, pH, redox potential) and sometimes also substances synthesized by the microorganisms in this phase. The length of the two phases can be defined as the time interval between the time of inoculation and the time point at which exponential pattern of microbial growth has just set in. A semilogarithmic plot of cell concentration shows the point when the curve assumes a linear character (cf. Fig. 2.1). For this reason, Monod (1949) suggested that the lag phase should be defined as the time distance between the experimental line and a parallel ideal line depicting a situation when the lag phase would not exist. The acceleration phase proper can be characterized as the period when all important enzyme reactions gradually attain maximum constant rates and assume a steady state. After termination of the steady state, the exponential phase sets in. When all these facts are summed up the first two phases can be characterized as follows: a) Growth rate exceeds multiplication rate. Enzyme activity expressed as oxygen consumption, heat evolution or CO2 production, and referred to biomass unit or unit amount of nitrogen in the biomass, is the same as in the exponential phase. b) Microorganisms with a long generation time in the exponential phase exhibit also a longer acceleration phase. The poorer the medium, the longer
36 also is this phase. The phase length is also extended following the transfer of microorganisms into a medium of composition different from that of the inoculation medium. When microorganisms are inoculated from the exponential phase they grow mostly without lag phase whereas microorganisms inoculated from the stationary phase exhibit long lag and acceleration phases. e) Other growth phases are usually unaffected by the lag phase and the acceleration phase. d) The larger the inoculum the shorter the lag phase and the acceleration phase. e) Cells in the acceleration phase differ from cells in other phases as to their physiological state; they are considered to be physiologically young. They differ from cells in later phases in their higher sensitivity to environmental changes (temperature, pH, chemicals) but are more resistant to agglutination during electrophoresis. Exponential phase. The lag phase and acceleration phase are followed by the exponential phase. It can be characterized as a period during which the microorganisms have a constant maximal specific growth rate. Cells in this phase do not change with time as to their chemical composition and the replication of all their parts must therefore proceed at the same rate. The maximum multiplication rate is a result of a number of interrelated factors, biochemical and biophysical processes, and it persists as long as the microorganisms have at their disposal sufficient amount of nutrients and the culture growth is not inhibited by its own metabolic products. Declination phase. With a gradual exhaustion of nutrients and accumulation of toxic metabolic products the microorganisms gradually lose their ability to maintain the high specific growth rate attained in the exponential phase, and the growth rate declines steadily. The shape of the growth curve in the declination phase may vary widely. Sometimes the growth ceases as soon as the energy source has been depleted, in other cases the exponential phase is relatively short and the declination phase long. The type of microorganism is another factor which determines the length of the declination phase. The determination of the phase duration depends closely on the assay method: if the cell concentration is measured via the number of live cells in a unit volume the phase duration is comparable with the preceding growth phases. On the other hand, if total cell mass in a unit volume is determined the phase may seem disproportionately long. Stationary phase represents a segment of the growth curve in which the microbial population attains a maximum, and for a certain period constant, size. As with the declination phase, the determination of its duration depends on the method of measurement of microbial concentration. The maximum concentration of microorganisms that can be achieved is determined by
37
a number of simultaneously acting factors: initial concentration of the energy source, nitrogen and trace element sources, concentration of oxygen and sometimes also the method of pH regulation (inorganic or organic acid). When the concentration of an essential nutrient is low the total growth is nearly proportional to this concentration. During this phase the cells often accumulate storage substances or prepare for sporulation, or sporulate. Death phase. Although the death of microorganisms induced by different chemical and physical factors has been thoroughly studied, surprisingly little attention has been paid to natural death of microorganisms in the appropriate part of the growth curve. This is due to the fact that, when examining the growth curve, the growth and death rates are not studied separately. When, however, the number of live cells, dead cells and the total number of cells are determined separately at intervals and all three parameters are used to calculate the specific growth rate, different values are obtained. No rule exists for the course of cell death. The death can be slow or fast, and can be associated with or divorced from cell autolysis. Microbial death is not of a purely academic interest but has a considerable practical impact on microbiology and biotechnology.
2.1.2
Changes in the course of growth and proliferation
Changes in cell concentration during a batch culture are accompanied by changes in the physiological state of the cells, i.e. in a set of their biochemical and physiological properties (Mfi.lek, 1976). Studies of bacterial composition at different stages of a batch culture revealed several important changes.
Fig. 2.2 Changes in cell number, chemical composition, concentration and weight during a batch culture of bacteria (Herbert,1961) N - number of cells, X - biomass concentration, G -- individual cell weight, R -- specific content of RNA, D -- specific content of D N A (relative units with initial values equal to unity). For details see the text
38
These observations, summarized by Herbert (1961), are illustrated in a somewhat idealized form in Fig. 2.2. When a fresh medium is inoculated with microorganisms the cell mass begins to increase exponentially and this rise is paralleled by a rise in the specific RNA content (i.e. RNA mass referred to cell weight or number). Both values rise to a certain limit (denoted a in the figure). The interval between inoculation and the point a represents the interval needed by every individual cell to divide, i.e. the lag phase. The RNA content per unit cell weight and the mass of individual cells remain relatively constant during the exponential phase of growth. When some nutrient in the medium becomes exhausted the individual cell mass begins to decrease (in the figure this happens at point b at which also the specific RNA content begins to decline). Exponential division proceeds until point c is reached whereas the rate of RNA synthesis already decreases. At point c the rate of cell division begins to drop until the beginning of the stationary phase (point d). When the content of D NA per unit cell mass is determined at these different phases of the culture the shape of the resulting curve is opposite to that depicting changes in RNA in the cells, although the changes in DNA are less conspicuous. These results show that data on cell composition and properties have little significance if they are not accompanied by data on the growth phase. This is also clear from Table 2.1 Table 2.1 Cell mass and R N A content in some bacteria (Herbert, 1961)
Microorganism
Aerobacter aerogenes Bacillus anthracis Bacillus cereus Chromobacterium prodigiosum Chromobacterium violaceum Clostridium welchii Corynebacterium hofmanii Salmonella typhi Escherichia coli Pasteurella pestis Proteus vulgaris Staphylococcus aureus A -B -bSE --
a
Cell mass b
R N A content b
(Pg)
(%)
Medium a
Medium with casein and yeast extract Medium with trypsin-treated meat extract Stationary cells Exponential cells
S
E
S
E
0.11
0.40
1.97 0.12 0.17 0.91
3.77 0.35 0.56 2.19
0.19 0.12 0.13 0.18 0.19
0.34 0.41 0.15 0.36 0.24
4.4 1.5 3.9 7.8 7.2 32.2 25.4 10.5 15.5 5.9 12.6 5.2
26.6 24.0 31.5 32.1 30.3 42.2 51.0 35.9 37.0 20.1 35.0 10.0
Table 2.2 Characteristics of developmental phases of Streptomyces rimosus in submerged culture (Dosko~il et aL, 1958) F Growth phase
II Exponential growth of primary mycelium
I Lag phase
III Decomposition of primary mycelium .
Duration (h)
about 1.5 (in smallinoculum cultures)
10 25 depending on inoculum size
Mycelial growth (mg ml -I dry wt)
up to 4
Nucleic acids
5
i RNA maximum, ! fast DNA synthesis
.
.
IV Growth of secondary mycelium
.
V Stationary phase
, ,
10
about 25 i
ceases
up to 8
RNA drops, DNA rises slightly
RNA drops, DNA rises slightly
18
the rest of culture period ceases
02 respiration (ml 1-l h -l)
not measurable
rises exponentially to 500 700
decreases slightly
constant or slightly rising
decreases slightly to 300 400
Mycelial morphology
long and thick filaments
long and thick filaments
decay of strong g+ filaments
long thin gfilaments
decay of long thin filaments
not measurable
maximum, 137 on average
decreases slightly
drops sharply to 20 50
decreases slightly
slowed-down consumption of saccharides and NH3-N
fast and complete exhaustion of saccharides and NH3-N
02
(ml g - l h -i)
II complete
Nutrient consumption
I consumption of amino-N and Pi, fast consumption of saccharides and j ammonia-nitrogen
! Pyruvic acid (l-tg ml-I )
24
30
! fast rise to 800
Antibiotic production (mg ml-l ) ,,,
g+ -- Gram-positive g- -- Gram-negative
fast drop to 20
50
1300 onset of production
,
sometimes slight rise (max. 200) 600
40 on average
1000
I 1500 [
.
1800
40
which shows cell mass and RNA content in some bacteria collected in the exponential and stationary growth phases. Changes in the sensitivity of microorganisms to different ambient effects, during growth in a batch culture, have long been known. For instance, Escherichia coli cultures display varying sensitivity against UV-light: the sensitivity increases in the lag phase to a maximum value which persists till the end of the exponential phase and then decreases. These changes are related to changes in the metabolic activity, reflected in altered 02 consumption, CO2 production, deamination activity, etc.. Some microbial species undergo marked changes in cell morphology during batch culture, giving rise to so-called growth cycles. For instance, the development of Azotobacter chroococcus includes several forms that are conspicuously different from each other, so that the culture appears to consist of several microbial species. At the beginning of cultivation, Azotobacter cells are thick motile rods with rounded ends, either single or doubled. Subsequently the rods become shortened and are transformed into coccus-shaped or diplococcus-like grainy structures which often aggregate. In addition, the species forms persistent cells or cysts. A similar complex developmental pattern was observed in Streptomyces rimosus, a producer of oxytetracycline (Table 2.2), or in other actinomycetes and fungi.
2.1.3
Mathematical description of microbial growth and reproduction
Microbial growth and proliferation are complex processes, the mathematical description of which cannot fully include biological aspects such as population inhomogeneities caused by genetic variability and physiological state of the microorganisms. It should be noted that all formulas and relationships given below hold only under the assumption of a complete homogeneity of culture conditions, i.e. genetic and physiological stability of both microorganisms and their environment.
Specific growth rate If all conditions for microbial growth are fulfilled we can assume that increase in biomass concentration dX within an infinitely short time interval dt will be directly proportional to the quantity of biomass X and the time unit dX = uXdt
from which it follows
[2.11
41
dX - /xX dt
[2.2]
The differential d X / d t represents the growth rate of the population. Parameter ~t, which denotes the growth rate of a biomass unit, =
1 dX X
[2.3]
dt
is called specific growth rate and is expressed in reciprocal time units.
I
tog•
2
~---
t
Fig. 2.3 Time course of specific growth rate /~ and biomass concentration X in a batch culture. Growth curve phases are the same as in Fig. 2.1b
During a batch cultivation the specific growth rate changes continuously from zero to a maximum value, J2max (Fig. 2.3). The value of maximum specific growth rate depends on the type of the microorganism and on physical and chemical cultivation conditions (temperature, pH, medium composition). Under given culture conditions it is constant and represents an important characteristic of the process. Its typical values in microorganisms under conventional culture conditions are given in Table 2.3.
Table 2.3 Maximal specific growth rate (#max) of different microorganisms Microorganism Bacteria Yeasts Actinomycetes Fungi * Aerobic cultivation
Cultivation temperature
(oc)
JJ'rnax (h-i)
37 30* 28 28
0.6--1.2 0.3 0.5 0.1 --0.3 0.1 --0.3
42
If ~t is constant, the integration of equation [2.3] yields l n X = lnX0 + ~tt
[2.4]
where X0 is biomass concentration at time t = 0.
_
o
c
0.6 h
-1
- 2 :3 0 0
i
1
2
3
11
I
I
4
5
6
7
--------- time(h)
Fig. 2.4 Determination growth rate
of a specific
The dependence of In X on time provides a straight line with slope/z (Fig. 2.4). On transforming equation [2.4] into the form of decadic logarithms we obtain /.tt
log. X - 2.30 + log X0
[2.5]
Equation [2.4] implies that X In --~ =/zt
[2.6]
ao
Then X = X0eu'
[2.7]
The growth obeying this law is called exponential or logarithmic. The principal parameter characterizing the growth rate is the specific growth rate. Other growth parameters given below can be expressed via the specific growth rate.
43
Biomass doubling time The relationship between the specific growth rate ~t and the biomass doubling time t~ can be obtained by inserting into equation [2.6] X = 2X0
and
t=
td
then td -
In 2 0.693 /z #
[2.81
Multiplication degree The degree of multiplication is determined from the ratio X/Xo which is equal to e~' (equation [2.7]). On the other hand, if biomass increases via n doublings or generations, we can write X
Xo
= 2"
[2.91
Then X n = 3.32 log X0
[2.101
When the amount of inoculum used for seeding is 10 % (v/v) of the final quantity of biomass, then n = 3.32.
Reciprocal doubling time If the n u m b e r of doublings of biomass in a time t equals t/6, then t
X = X02 ,L-
[2.11]
On transforming the equation into a logarithmic form with base 2 we obtain log2 X = log2 X0 +
t t~
[2.12]
The slope 1/t~ of the time dependence of log Xis the reciprocal doubling time.
44
Death of microorganisms Death of microorganisms proceeds throughout the whole growth (proliferation) curve but its rate changes. This phenomenon has been little studied despite its practical significance. The most marked is the effect of cell death at the end of the growth (proliferation) curve. The kinetics of death can be described by the following equation dX = -reX dt
[2.13]
dN - -m N dt
[2.14]
X = )(maxe - ~ t
[2.15]
N = Nmaxe-re'
[2.16]
or, more exactly,
Integration yields
The process has been described in detail in a monograph written by Pirt (1975). 2.1.4
Special features of growth of filamentous microorganisms
The study of growth kinetics of filamentous microorganisms is more complex than in unicellular microorganisms. Filamentous microorganisms include bacteria (e.g. Leptothrix), actinomycetes and fungi. Depending on strain
/--------4
10 ,,u.m
Fig. 2.5 Development of filament length in Streptomyces hygroscopicus measured in a microculture (Schuhmann and Bergter, 1976)
45
and cultivation conditions, filamentous microorganism can exhibit two basic types of growth: homogeneous and pellet. Homogeneous growth of filaments and hyphae. Figure 2.5 shows the analysis of filamentous growth of an actinomycete in a culture at a constant specific growth rate, d X / d t - IzX. Actinomycetes form long polynuclear filaments without septa. Such an ideal pattern, however, considerably differs from the reality in stirred and aerated cultures in which the filaments are subject to the 10-
o
10
8
L z
z S
o
6-
6 z z
Ne Q
N
_
r
4
4
2
O l - ~ 1 7 6 1 I7 6 0 4
I 1 8 12 time (h)
l 16
I, 0
I 1
I 1 2 3 time (h)
4
Fig. 2.6 Mycelial growth in filamentous microorganisms L -- total length of all hyphae, N - - number of terminal hyphae: (a) Streptomyces hygroscopicus (Schuhmann and Bergter, 1976), (b) Thermoaetinornyces vulgaris (Kretschmer, 1978)
action of cavitation and shear forces and are thereby broken into smaller parts. Measurement of the length of all filaments (hyphae) and counting of all filament ends or apical cells in microcultures point to a constant growth rate (Fig. 2.6). In contrast to actinomycetes, fungi form long hyphae composed of cells with markedly differentiated apical cells. Kinetically, however, the two cases can be described analogously. Assuming that the filaments or hyphae grow exponentially, it has to hold that the branching is linear. When the mean filament (hyphal) length is L and the number of filament ends, or apical cells, is /~, then we obtain (Bergter, 1978) dL = a~ dt
[2.17]
46 and dLa dt
-
[2.18]
flL
where a(~mean h-l) is the mean specific rate of apical growth, fl(fl~ean h-l) ~ mean specific rate of branching of terminal filaments or hyphae. In other words, the increment of filament or hyphal length L is proportional to the number of filament ends or apical cells La and vice versa. The L / L a ratio is a hyphal growth unit (Caldwell and Trinci, 1973) which has to correspond to equations [2.17] and [2.18]. Differentiation of the L/La ratio can be performed using the rule of differentiation for complex functions
L)
d "~a
dL
dLa
_ " ~ La
at
L
[2.19]
m
dt
La2
Inserting CtLa for dL/dt and flL for dLo/dt we obtain
d( a) dt
=a-fl
E220,
Pellet growth. It is not yet entirely clear what induces pellet growth but an important role is attributed to mechanical forces during mixing, which break the homogeneous mycelium into smaller parts which then give rise to pellets. Another important factor is the medium composition or nature (clear solutions or suspensions in which solid particles adhere to the filament surface) and the number of spores used to inoculate the medium. A pellet cross-section is given in Fig. 2.7. The surface layers of the pellet are well supplied with nutrients including oxygen, and the growth is not inhibited by toxic metabolites. Towards the pellet centre the rate of nutrient and oxygen diffusion decreases, which causes a decrease in the hyphal or filament growth rate. The
•
Fig. 2.7 Cross-section of a pellet r - pellet radius, w -- thickness of a pellet surface layer, Xp -- biomass of the outer pellet layer
47
pellet as a whole cannot therefore grow exponentially and the description of growth kinetics is very difficult. For simplification, however, let us assume an exponential growth. Then dX - /~Xp dt
[2.21]
where Xp is the biomass in the external pellet layer. The pellet radius (r) is proportional to the thickness w of this layer. Then dr
- /.tW
[2.221
/,zwt + ro
[2.231
dt and, after integration, r=
If the pellet density at all points is d, then 4 r3 rtd X : -~-
[2.24]
On solving equation [2.24] for r and inserting into equation [2.23] we obtain for pellet growth 1
1
X-y_ 4rtd 3
~-
l,t W t + X o
[2.25]
If all pellets in the culture do not have the same diameter, then such growth can be described by equation [2.25], as shown by Pirt (1966, 1975) and Righelato (1975). However, the assumption that the surface pellet layer grows exponentially while the interior does not grow at all, is a gross simplification considering the complexity of growth of a mere hypha or a filament. 2.1.5
K i n e t i c s o f growth o f m i c r o b i a l c o l o n i e s
When a vegetative cell or spore is inoculated on a solid medium, it reproduces after germination until the depletion of nutrients or until further growth is inhibited by formation of toxic metabolites. The cell mass M referred to a colony at time t can be described by the following equation dM - /tM dt
[2.26]
which is analogous to equation [2.2]. Its integration gives lnM = lnM0 + /zt where M0 is the mass of the original cell.
[2.27]
48
If the colony grows in a circular way to a constant height h and with radius r, then
M= nr2hp where p is the cell mass per unit volume. On inserting this value into equation [2.27] we obtain the relationship lnr-
-~ t + lnr0
[2.28]
where r0 is the radius of the colony (original cell) at time to.
--
I I
i I I I I
v
I I 1 I I I 1
~Q ~111I!1
!
\ .
.
.
.
.
.
.
. . . . . . . . .
.~
!1111111111
Fig. 2.8 Development of a colony with a relatively large radius (Hattori, 1985) 1 -- initial nutrient concentration level, h -- colony height, r width of the growing zone, A r - - increment of the growing zone width, Aa cross-section through the growing zone
1
Under these assumptions the colony radius will increase exponentially and the slope of the plot of lnr versus t will be linearly related to the specific growth rate. Study of a visible colony of Escherichia coli revealed that at a radius larger than 2 mm the colony grows no longer exponentially but linearly. The linear growth model for this case was proposed by Pirt (1967). The model assumes that the cells will have sufficient nutrients and will grow exponentially provided the number of colonies on the dish is not too large. With increasing size of the colonies the rate of diffusion of nutrients to cells will decrease until the growth eventually stops (Fig. 2.8). Futhermore, the breadth r of the growing zone is assumed to be constant until a steady state is reached and the colony height is also taken to be constant except for the peripheral growth zone. The total colony mass is given by
49
dM - /.tMg dt
[2.291
where Mg is the mass of cells in the growing zone. Mg can be approximated to 2rtpAa, where Aa is the cross-section of the growing zone. Inserting these values into equation [2.29] we obtain
dr dt
Aa h ~t
[2.30]
Then Ao r = - - ~ ~tt + r0
[2.31]
If a, h and p are taken to be constant, equation [2.31] implies a linear relationship between the colony growth rate and time.
2.2
PRODUCT FORMATION
The statement that microbial growth and proliferation are complex processes and their kinetic description requires considerable simplification holds even more for the formation of microbial products. Products and their formation can be viewed from several aspects: a) as a process involving regulatory mechanisms or a process free of regulatory mechanisms (Bergter, 1983), b) as primary or secondary metabolites formed in the trophophase or idiophase (Bu'Lock, 1965; Bu'Lock et al., 1975), c) as intracellular or extracellular products, d) according to the relationship between the growth rate and the rate of product formation (Maxon, 1955), e) according to the stoichiometry of their formation, f) according to the rate of product formation and substrate consumption (Gaden, 1959), g) according to the complexity of reactions leading to product formation (Deindoerfer, 1960). The kinetics of product formation will be discussed irrespective of the regulatory mechanisms taking part in it.
50
2.2.1
Relationship between growth rate and product formation rate
The rate of product formation can in principle be determined in three ways" a) The rate of product formation is limited by the same factor as the growth rate dP dX dt kp dt and, since d X / d t
= ~tX,
[2.32]
it holds that dP 1 = kp ~t dt X
[2.33]
The ratio of specific growth rate to specific rate of product formation is therefore constant and the two rates are proportional. This case is termed growth-associated product formation. b) The rate of product formation depends only on the concentration of microorganisms and their physiological state, and is therefore independent of the concentration of other medium components in a certain range of conditions. The rate of product formation is proportional to the concentration of microorganisms, specific rate of formation is constant dP - /zX dt
[2.34]
c) The rate of product formation is determined in other ways or by other factors than the specific growth rate. This case has not been kinetically described. The cases (b) and (c) are denoted as product formation unassociated with growth. In reality, various processes of these types are likely to proceed simultaneously but one may predominate so that the other can be neglected. The above relationships hold only in a certain range of conditions and a change in operation parameters therefore produces a change in individual constants. Luedeking and Piret (1959) showed that the rate of lactic acid formation is given by the formula dP dt -
dX a --d?
[2.351
Both mechanisms, growth-associated and growth-unassociated, therefore play a role in the process. Constants a and fl are functions of pH.
51
2.2.2
Product formation in a batch culture
During the growth of microorganisms in a batch culture, a certain quantity of product P is synthesized in a time interval dt d P = kpXd t
[2.36]
If kp is constant, the concentration of product after a time t will be P
t~
.r d P = ~ f X d t P0
[2.37]
0
Then [i
[2.38]
P : Po + k~ f Xdt 0
X
- X mQx
kp
kpo
.
.
.
.
.--"
P
Q.
a_" x"
t
/
/
Xo
Po 0
! I
/
1/
t'P
', \
[ [ F'----
dt
tl ~--
dt
t2
time
Fig. 2.9 Time course of product accumulation in a batch culture (Pirt, 1975) Xbiomass concentration, P product concentration, kp - - specific rate of product formation
The value of the integral in equation [2.38] can be determined graphically from the area delimited by the curve X = X / t in the range from t = 0 to t2 (Fig. 2.9). During exponential growth equation [2.38] is transformed into
e : Po kpXo ( e " - 1)
[2.391
After termination of growth, the rate of product synthesis decreases. The. value of kp is assumed to be constant; as long as the growth does not cease in
52
time, tp decreases. The decrease in product concentration is given by the equation P2
t2
f d P = Xma x ~ kpdt
P~
t~
[2.40]
where P~ and P2 is product concentration at time t, and t2 (Fig. 2.9).
2.3
SUBSTRATE CONSUMPTION
The quantity of produced biomass X is directly proportional to the amount of the consumed substrate S [2.41]
X = YS
where Y is a proportionality constant also called the growth yield Y-
X S
[2.42]
This direct proportionality between X and S holds not only for the initial concentration of substrate and the ensuing biomass but at any point of the whole growth curve; equation [2.41] can therefore be rewritten as follows dX dt
-dS - Y ~
[2.43]
dX -dS
[2.44]
dt
or
Y-
Equation [2.43] can be used to express the rate of substrate consumption in terms of the growth rate dS dt Since the growth rate is d X / d t
1 dX Y dt
[2.45]
= l.tX we may write
dS dt -
1 ~t Y ~tX = -~ X
[2.46]
The equation implies that the rate of substrate consumption is directly proportional to biomass concentration. The proportionality constant is the ratio of two constants,/1 and Y, and can therefore be expressed as a composite constant
53 U
q=
7
[2.47]
The proportionality between the rate of substrate consumption and biomass concentration can be expressed as [2.48] The proportionality constant q is the specific rate of substrate consumption, i.e. rate of substrate consumption referred to a biomass unit 9
-
-dS 1 7 5
[2.49]
Parameter q can be used to characterize not only the rate of consumption of any substrate but also the rate of production of any product, and is therefore generally called the specific metabolic rate or metabolic quotient.
2.3.1
Effect of substrate concentration on growth rate
Over a wide range, growth rate is independent of substrate concentration; this is supported by the existence of the exponential growth phase in a batch culture. The metabolic quotient q can be expressed by the following equation [2.50] where K,
is a saturation constant,
qrn.lx- maximum value of q at S
> K,. On introducing into equation 12.501 terms q and qrnClx (Pirt, 1975), the equations q = ,u/ Y and qm,,,= ,urn,,/Y yield [2.51] This formula, called the Monod equation, is clearly analogous to the Michaelis-Menten equation describing enzyme reactions. Specific growth rate equals the maximum specific growth rate multiplied by a fraction whose numerator is substrate concentration and denominator is the sum of this concentration and the saturation constant. Since the value of the saturation constant is always larger than zero, the whole fraction is smaller than unity; in other words, the exact value of .urn,, can be determined only theoretically. Equation [2.51] describes a hyperbolic curve, the value p being its asymptote (Fig. 2.10).
54
The saturation constant Ks is obviously substrate concentration at which the specific rate corresponds to half the maximum specific growth rate. The value of the saturation constant is very low" for saccharides it is of the order of mg 1-~ medium, for amino acids in auxotrophic mutants gg 1-~. There are however microorganisms such as Mycobacterium tuberculosis in which the value of Ks for glucose is several grammes per litre medium. The concentration of car-
zt.
Fig. 2.10 Dependence of specific growth rate on substrate concentration
bon sources in microbial processes is usually in the range of grammes per litre, the value of Ks is 10 to 100 l-tg 1-1. This value can reduce the maximum specific growth rate only negligibly and therefore does not affect the process of biomass synthesis. The situation in product formation, however, is difficult. A more exact determination of values of Ks and/Zm~ can be done by the method of Lineweaver and Burk (1934). Equation [2.51] can be modified to
1
K~+S
~Lt
,Umax S
-- =
1 ( Ks
-
S
~max
- 1 ) ' + ---
[2.52]
J-tmax
When 1 / S is plotted on the abscissa and 1/p on the ordinate, the resulting line gives the value of - 1 / K ~ as the intercept with the abscissa and 1//Amax as the intercept with the ordinate (Fig. 2.11). In addition to equation [2.51], the specific growth rate as a function of substrate concentration can also be described by other equations: ,/2--- ]-s
/t=
- K--?
1-e ~max
1 +aX-~
(Teissier, 1942) (Moser, 1958)
[2.53] [2.54]
where a and 7/are constants. Another plot is S -- ~Umax Ks (X + S)
(Contois, 1959)
[2.55]
55
1 Ks
! 6~
]
~x too•
w
1
1
S
Fig. 2.11 Determination of the saturation constant K~ and the maximum specific growth rate ,Um,,,x according to Lineweaver and Burk
These simple models naturally cannot encompass any wide substrate concentration range and cannot describe linear or diffuse growth. Yet even the simple Monod's model can in some cases be further simplified if the concentration of substrate in the exponential phase of the growth (proliferation) curve is substantially higher than the value of the saturation constant, /.t = = /-tmax. On the other hand, the value of Ks can considerably exceed the concentration S. Then S / . t - /.Zm~x K~ [2.56]
2.3.2
Consumption of substrate for maintenance energy
Maintenance energy is a special case of maintenance metabolism. It denotes that part of the energy generated by the catabolism which is utilized for functions other than biomass synthesis. One of the methods for determining substrate losses due to maintenance energy assumes that these losses are independent of the specific growth rate. The rate of substrate consumption for maintenance energy is then equal to the total rate of substrate consumption minus the rate of substrate consumption for growth
-N-
m=
dt
X
-d
r dt
X
where m is substrate consumption for maintenance energy, c - - t o t a l substrate consumption, r - - c o n s u m p t i o n of substrate for growth.
56
Equation [2.57] can be written in the form ~t
O'ms
=-
Yx/s
~t ymax a X/S
[2.581
where tTm~ is the specific rate of substrate consumption for the maintenance of cell's life processes, i.e. maintenance energy, y ~ / a ~ maximum biomass yield at a zero substrate consumption for maintenance.
1
$
Yxm
1 ~mS"ym~ X~ __z'
/
/
mox
Yx/s
Fig. 2.12 Graphical determination of the maximum biomass yield coefficient (y~/ax) and the specific rate of substrate consumption for maintenance energy (O'ms)
/
Equation [2.58] can also be expressed as follows 1 Y~/~
1 O'ms t Y~x/~x ~z
[2.59]
Its graphic form, given in Fig. 2.12, serves for determining Y~/~, E~x/axand O'ms ~
2.4
KINETIC CHARACTERISTICS OF MICROBIAL PROCESSES
The rate of a microbial process is defined as the momentary rate of the concentration change of a certain system component. This change is most often referred to the concentration of biomass (dX/dt), substrate (dS/dt) or product (dP/dt), sometimes to other rates such as respiration rate. All these rates are important and should be included in the characteristics of microbial
57
systems. Other important characteristics are the productivity, yield constant and economic coefficient. Rate can be expressed in two ways, as volume or specific rate. At any point during a batch culture, volume rate can be determined from the slope of a tangent to the curve of time dependence of concentration of the given component. Typical volume rate units are g 1-~h--~ of synthesized biomass, products, or consumed substrate. Specific rates are defined as the rate of change in the concentration of a certain component per unit cell mass. Specific rate is determined by dividing the volume rate by the concentration of the microorganisms, expressed as cell number, cell density or cell dry weight. The volume terms disappear and the rate has the following units: g product per g cells per hour, g substrate per g cells per hour or g cells per g cells per hour. The last expression represents the specific growth rate. Specific rates of growth, product formation or substrate consumption at
L ~___P~ x
// b , /~ -d___~S~
I
t C
Fig. 2.13 Specific rates of growth (a), product formation (b) and substrate consumption (c)
58 time t = t~ are defined in Fig. 2.13. The abscissa gives concentration of biomass X, product P and substrate S, ordinate shows cultivation time. The specific growth rate in a batch culture is seen to be a function of time t and its maximum value corresponds to the growth rate in the exponential phase. Specific rate is preferred to volume rate in kinetic studies since it illustrates cellular activity; volume rates are preferred in designing of culture devices. Productivity usually refers to a certain technological process or culture device; it gives the quantity of biomass or another product in a certain volume per unit time. This parameter is used for comparing and assessing different technological processes and devices. For instance, a certain technological process of penicillin production provides yields of 15 000 i. u. of penicillin per 1 ml in 120 h (short cultivation) whereas another technology yields 30 000 i. u. per 1 ml in 200 h (prolonged cultivation). The corresponding volume rates of production are 125 and 150 i. u. per 1 ml per 1 h, respectively. In another example, a 200 m 3 volume bioreactor provides 4000 tonnes of a microorganism in a year, another yields 12 000 tonnes; the latter microorganism is thus three times as productive as the former. The yield constant refers the amount of produced biomass or product to consumed substrate, economical effect refers the yield to the total amount of substrate used.
2.4.1
Relationship between product formation and substrate consumption
Product formation associated, unassociated or partially associated with growth was described in Section 2.2.1. The decisive factor in this respect is obviously the way, and the time interval, in which the carbon source is utilized for product formation. These data were used by Gaden (1959) to divide microbial processes into three groups" a) Product formation proceeds stoichiometrically to the consumption of the carbon source which provides energy for microbial growth. Changes in the rate of product formation occur in parallel with changes in the rate of carbon source consumption (Fig. 2.14a). b) Product formation is only indirectly connected with the consumption of the carbon source which provides energy for growth (Fig. 2.14b). c) Product formation is apparently unassociated with carbon source consumption (Fig. 2.14c). The first type of processes includes ethanol and lactic acid production. The growth is completely dependent on the ability of the microorganisms to acquire energy via glycolysis. Growth and product formation proceed in parallel only under anaerobic conditions. Under aerobic conditions the substrate is metabolized via other pathways which provide other products. In processes
59
of the second group the microbial growth is separated in time from product formation although the carbon source provides both the energy for growth and the carbon for product formation. Typical examples are citric acid, itaconic acid and amino acid productions. The third group of processes displays no close relationship between the rate of consumption of an energy substrate and the rate of product formation. These processes include the biosynthesis of antibiotics and other secondary metabolites. These compounds are often exported from the cells only after growth cessation. If the carbon source is supplied in excess, the product does not change (in contrast to processes of the second group). Product yields are usually increased by supplying precursors at a certain time point.
1/
2
/,
-i..c._
...... ,i,........
\-
/
~ -..
time
O9
I_.~ L..-" /.-....~....--\\ :...."-),
t
f
L_/__U
'~t
time
3 O9 ~J r
A c
---~
time
Fig. 2.14 Relationship between growth and product formation (Gaden, 1959) Product formation associated with growth (a), product formation partially associated with growth (b), product formation unassociated with growth (c); 1 -- specific growth rate, 2 -- specific rate of product formation, 3 specific rate of substrate consumption
60
2.4.2 Classification of processes according to reaction type
Deindoerfer (1960) proposed the following classification of microbial processes according to the types of participating reactions: a) Simple reactions. Substrates are converted into products in a stable stoichiometric ratio without any accumulation of intermediates. Examples are growth of bacteria or yeasts, or an enzyme conversion of substrates by precultivated microorganisms. b) Parallel reactions. Substrates are converted into several products in variable stoichiometric ratios. The relative rates of formation of these products change according to substrate concentrations. An example is the accumulation of polysaccharides or lipids in dependence on the carbon source concentration in the medium. e) Sequential reactions. The formation of the end product sets in only after an accumulation of one or more intermediates. This process is represented, for instance, by the production of gluconic acid from glucose in microorganisms which do not synthesize gluconolactonase, or by the biosynthesis of antibiotics. d) Successive reactions. These processes include two simple reactions which can be regulated by enzyme induction. Examples are the diauxic growth of microorganisms. During growth on a mixture of hexoses and pentoses, the former saccharides are first utilized from the medium. During oxidation of glucose to 5-oxoglutaric acid, bacteria first convert glucose to gluconic acid and this is then transformed into 5-oxoglutaric acid. It should be noted, however, that the above schemes do not hold generally and they result from a certain arrangement of the technological process (type of substrates, manner of their addition to the culture, production microorganism). This can be illustrated by the biosynthesis of penicillin" when lactose is used as carbon source, penicillin begins to be synthesized only towards the end of the growth phase and the main antibiotic synthesis takes place only in the stationary phase. On using a continuous feed of glucose or sucrose instead of lactose, the antibiotic synthesis occurs in parallel with growth. Recombinant microorganisms, which have been deprived of their genetically based sensitivity to glucose repression, can simultaneously assimilate hexoses and pentoses.
REFERENCES Bergter, F. (1978) Z. Allgem. Mikrobiol. 18, 143. Bergter, F. (1983) Wachstum von Mikroorganismen. Experimente und Modelle. 2. Auflage, Jena.
61 Bu'Lock, J. D. (1965) The Biosynthesis of Natural Products. An Introduction to Secondary Metabolism. London. Bu'Lock, J. D., Hamilton, D., Hulme, M. A., Powell, A. J., Smalley, H. M., Shepherd, D., Smith, G. N. (1975) Can. J. Microbiol. 11,765. Caldwell, J. Y., Trinci, A. P. (1973) Arch. Microbiol. 88, 1. Contois, D. E. (1959) J. Gen. Microbiol. 21, 40. Deindoerfer, F. H. (1960) Adv. Appl. Microbiol. 1, 321. Dosko~il, J., Sikyta, B., Kagparovfi, J., Dosko~ilov~, D., Zaji~ek, J. (1958) J. Gen. Microbiol. 18, 302. Gaden, E. L. (1959) J. Biochem. Microbiol. Technol. Eng. 1,413. Hattori, T., (1985) Rep. Inst. Agr. Res. Tohoku Univ. 34, 1. Herbert, D. (1961) The chemical composition of micro-organisms as a function of their environment. In: Symp. Soc. Gen. Microbiol. l l, Cambridge. Kretschmer, S. (1978) Z. Allgem. Mikrobiol. 18, 701. Lineweaver, H., Burk, D. (1934) J. Am. Chem. Soc. 56, 658. Luedeking, R., Piret, E. L. (1959) J. Biochem. Microbiol. Technol. Eng. 1, 431. Mfilek, I. (1976) Physiological state of continuously grown microbial cultures. In: Continuous Culture 6: Applications and New Fields, Chichester. Maxon, W. D. (1955) Appl. Microbiol. 3, 110. Monod, J. (1949) Ann. Rev. Microbiol. 3, 371. Moser, H. (1958) The Dynamics of Bacterial Populations Maintained in the Chemostat, Washington, D. C. Pirt, S. J. (1966) Proc. Royal Soc. B, 166, 369. Pitt, S. J. (1967) J. Gen. Microbiol. 47, 181. Pirt, S. J. (1975) Principles of Microbe and Cell Cultivation, Oxford. Righelato, R. C. (1975) Growth kinetics of mycelial fungi. In: Filamentous Fungi 1, London. Schuhmann, E., Bergter, F. (1976) Z. Allgem. Mikrobiol. 16, 201. Teissier, G. (1942) Reo. Sci. 80, 209.
62
3
CONTINUOUS CULTURE SYSTEMS
The continuous culture of microbial and other cells is a method whereby they can be cultured for any chosen time period under steady state conditions. This prolonged maintenance of steady state represents the basic methodological advantage over batch culture methods. The time factor, so crucial in batch culture, is completely eliminated. Because of this the cells remain in a defined physiological state and the product can be more uniform. Furthermore, any population density can be chosen or changed to another one. This meets the conditions required for studies of reaction kinetics which demand constant concentration to be maintained. The pivotal feature of the continuous culture is thus the steady state; other features, which can be used for the solution of both theoretical and practical problems, depend on this basic tenet.
3.1
CLASSIFICATION OF CONTINUOUS CULTURE SYSTEMS
Continuous culture systems can be classified by their operation principles (Fig. 3.1). In open systems the cells are continuously washed out of the reactor along with the effluent fluid at a constant rate corresponding to the rate of appearance of new cells in the vessel. Under such conditions it is therefore possible to attain a steady state cell concentration. In closed systems, on the other hand, the cells are retained in the vessel and their concentration therefore usually steadily increases. The main difference between the open and the closed systems is that the former can operate in a dynamic steady state whereas in the latter this dynamic steady state can never be achieved. Obviously, although the meaning of the term "open" and "closed" employed here is not entirely identical with analogous expressions of classical thermodynamics, it is nevertheless fairly similar as regards the technical arrangements or conditions, as well as the operational character.
63 3.2
OPEN CONTINUOUS CULTURE SYSTEMS
These systems are characterized by a constant composition of the culture in the culture space (cf. Fig. 3.1). Homogeneous continuous culture systems can be divided into singlestage and multistage systems with two or more vessels arranged in a chain. The multistage system may form a simple chain with medium inflow into the first stage, or a complex chain with multiple medium inflow feeds. Both the medium composition in individual vessels and the vessel volumes can be either identical or different. The most sophisticated multistage system is a complex chain with mutual culture exchange. All homogeneous open systems can be modified by partial feedback of cells.
3.2.1
Single-stage systems
Single-stage continuous culture systems can be divided into two types depending on the method used to attain the steady state:the chemostat (Novick and Szilard, 1950) or bactogene (Monod, 1950), and the turbidostat (Bryson and Szybalski, 1952). The chemostat is an apparatus where the constant concentration of a particular compound, i.e. the limiting substrate, maintains a constant cell concentration in the medium. Regulation is performed by controlling the selected flow rate F which, together with the constant volume V, defines the dilution rate D - F/V. Under steady-state conditions D is equal to the population growth rate ~. Usually, the dilution rate is set at a value slightly below the maximum growth rate ~tma~of the population. The other type, the turbidostat, is based on maintaining a constant cell population in the medium through continuous monitoring of optical density or turbidity of the culture and its adjustment via the flow rate. As the population grows the optical density or turbidity increases, and when a critical value is reached fresh medium is allowed to flow in (Fig. 3.2a). The resulting decrease in the optical density or turbidity gives an impulse for stopping the medium entry. It is thus possible to run the culture at D values very close to ~ . Turbidostats of this type suffer from two major drawbacks. The first drawback arises from a physical limitation imposed upon it, viz. an absolute requirement that X should be higher than Xd. The other problem with the turbidostat is that the steady state gains dX/dD, are usually low (Agrawal, 1987), thereby making the controlled variable X relatively insensitive to the manipulated variable D. These drawbacks can be circumvented in a turbidostat with two feed streams, shown in Fig. 3.2b. The feed stream C contains all but the limiting nutrient in excess; the limiting nutrient is supplied at a con-
64
A. Open continuous systems a) homogeneous -- spatially constant composition of the culture
single-stage . . . . . .
i
---~
:-"i I i
simple (chemostat, turbidostat)
simple with partial feed-back of the culture
I UL~ ~
dialyzed culture (D-dialyzer)
multistage ---I
-
simple chain with inflow into the first stage
I
simple chain with partial feed-back of the culture
t
.... ,
,:i
---I
;
.... I1~
l!!-~---l!
complex chain with inflow into more stages
I
complex chain with inflow into more stages with mutual culture exchange
Fig. 3.1 Classification of continuous culture systems
65
b) heterogeneous -- spatially variable composition of the culture
simple tubular (fluid or solid substrates)
tubular with partial feed-back of the culture
....
----i,
L
1 i
tubular continuously inoculated from the chemostat
counter-current system (inoculum from the chemostat or with the partial feed-back of the culture)
B. Closed continuous systems
!
.....
vessel with permeable walls
I
J
~-
microorganisms grow on permeable walls medium flows above the medium flows inside the surface of the culture tube . . . . .
1!!
;
l
[
T
!
9
!
v
total feed-back of cells or culture filtrate (S-separator)
cells growing on the interface gas-fluid (culture growing fluid-solid (immobilized on the surface) cells, percolators)
66 stant flow rate F0. The other stream W is simply sterile water and its inflow rate Fw is manipulated to control X in the vessel. Overall, the cell density in the modified device is controlled by manipulating the dilution rate D = = (Fc + Fw)/Vat varying feed concentration Sf = DcSJFc + Fw whereas in the conventional device it is controlled by manipulating D at a constant Sf. Consequently, the steady state gains in the modified device are higher than in the conventional one. This, however, occurs at the expense of a lower saturation limit of the manipulated variable D.O. (dissolved oxygen). At a particular value of the specific growth rate # the lower saturation limit for a conventional turbidostat is D = # while for the modified device it is Dw < #. Therefore, for a proper controller design Fc is chosen such that the product of increase in the
Medium
~I
Fm'Sm = 0
_...,,
/ ~ l Dm=Fm/V X Confrotter
C
D=Fm/V
FcTSc
V
Concentrated S~bstrofe stream C
X Meesurement or estimQtion
Woter ~fream
Fw~ Sw= 0
W
Dw:Fw/V
De=Fc/V~._.~~ X
Controtter
1 Measurement D = ( F c + Fw ) / V
Fig.
3.2 (a) Conventional
or esfimQtion
turbidostat, (b) modified turbidostat (Agrawal,
1987)
67 steady state gain and the saturation limit on the manipulated variable is maximized for a given ~. This criterion yields Dc = F~/V = ~t/2 in a steady state. The single-stage system is entirely suitable for simple cases where cells are cultured on a simple strictly defined medium to obtain a maximum of their biomass or of some product directly connected with their growth. This can be done for theoretical purposes of biochemical, physiological or genetic research, for the production of cell mass, or to obtain a simple product which is formed basically in one step of metabolic transformation. The single-stage continuous culture is also a powerful tool for optimization or improvement of the medium, enabling the changing of one culture parameter at a time when all others are maintained constant. Medium composition can be developed systematically by observing changes in steady state values of the system when corresponding parameters are modified one at a time. An attractive strategy is to adopt continuous-flow enrichment techniques for microorganism selection. Chemostat enrichment enables selection to be made under constant conditions on the basis of different specific growth rates and substrate concentrations, i.e. enrichment of microorganisms lacking pronounced metabolic specificity (Harder et al., 1977; Sikyta, 1991). Figure 3.3 summarizes the selection advantages of chemostat and turbidostat enrichment cultures. Although continuous-flow enrichment techniques have proved highly valuable for microorganism selection in the context of SCP and enzyme production and biodegradation, they have not yet been widely adopted (Harrison, 1978; Bull et al., 1979). Yet for commercial processes of a continuousflow type there are clear benefits in using continuous-flow enrichments for selecting the appropriate microorganisms (Bull, 1981). Finally, continuousflow enrichment almost invariably selects communities of interacting species, a feature which may hold considerable economic interest. CHEMOSTAT
r = q
....
S Y(~ K~+ S
m~
selects for: low K m (saturation constant) high q high Yc low m (maintenance energy requirement) ....
TURBIDOSTAT selects for: high ~tm,,x high qmax high Yc low m
~t = ]z..... - m Yc :
YG(qmax- m)
Fig. 3.3 Microorganism selection in chemostat and turbidostat (Harrison, 1978)
68
3.2.2
Single-stage systems with feedback
The productivity of a continuous culture is limited by the low concentration of microbial cells in the bioreactor. The dilution rate D must be less than the maximum specific growth rate ~tm~. This limitation can be overcome by separating a fraction of the cells from the culture fluid and returning them to the bioreactor. Recycling of cells in a continuous culture is used to retain cells and thereby increase the biomass concentration in the bioreactor, allowing increased throughput and decreased retention time. Several methods can be used for this purpose. Cell recycle by settling requires a flocculent strain, but it should be kept in mind that the dilution rate is limited by the settling velocity of the flocculent strain. The centrifugation method is not workable in high-density systems, aseptic conditions are difficult to achieve, and the process is normally too expensive and complicated to be economical. The recently developed membrane filter systems are quite promising in increasing cell mass. As long as cell broth flows tangentially across the membrane filter surface, cell deposition on the membrane surface is minimized, and thus, high throughput rate is maintained. The membrane filter may be installed in the spin rotor or the cartridges may be attached to fixtures in the bioreactor. The membrane system attached to the bioreactor makes continuous high-density culture possible by removing metabolic products selectively through the membrane and recirculating cells back to the bioreactor.
3.2.3
Multistage continuous flow systems
Individual vessels may be connected together, generating a small family of linked systems which incorporate heterogeneity in the chain as a whole, but in which each vessel is itself homogeneous. The multistage system may form a simple chain. The vessels are connected in parallel, in series or as cascades, each feeding the next but in one direction only. If the conditions of the corresponding stage require different flow rates or residence times 1/D, a set of vessels of different volumes is designed. The multistage character has been attained in some cases by vertical or horizontal division of a single vessel of different shape into several chambers or floors. In complex chains with multiple substrate addition, the fresh medium is fed into the first stage as well as into the second and later stages, according to the character of the process. The inflowing media may have the same or a different composition. For different reasons cultures of other microorganisms, which are cultivated continuously and separately prepared in the desirable physiological state, can be fed into the system as well. The material added to
69 the system need not necessarily be a fluid. In certain cases substances can be employed in powder form, especially when an increase in dilution must be prevented. The previously described systems may be supplemented by the feedback of a certain portion of the total amount of cells. A portion of the suspension is fed back into the same or another preceding stage. The residual substrate together with the remaining cells flows off for further processing. The conditions in the system are given by the ratio between the cell concentration in th~ vessel, into which the suspension is fed back, and the cell concentration in the returned suspension (the ratio must be greater than 1) as well as by the volumetric feedback ratio, i.e. the ratio of feedback flow to medium flow. The cell concentration in the corresponding stage is then greater than the concentration in the final outflowing medium. This concentration is given by the degree of feedback as compared to the continuous system without feedback. This method facilitates operation at a greater flow rate with a simultaneous increase of the resulting cell production, i.e. the culture volume may be diminished at identical productivity. A steady-state two-stage continuous culture gives some of the advantages of both batch and single-stage culture. In each stage the culture is homogeneous, and its mean properties are constant. In the total system the final products are a function of the cell's history. Examples confirming this statement have been given for the microbial production of extracellular protease in a two-stage continuous culture system (Jensen, 1972). These studies demonstrate that if the set of optimal conditions for cell growth is quite different from that for the synthesis of secondary metabolites, then a two-stage continuous culture system offers a distinct advantage in that the first stage can be optimized for cell growth, and the second for product formation. The feasibility of operating a multistage continuous culture of plant cells was demonstrated for Nicotiana tabacum (Sahai and Shuler, 1984). Cells in the second stage produced much higher levels of phenolics per unit weight of cells than cells in either the first stage or in a single-stage unit. When a glucose side stream was fed to the second stage, an increase in apparent cell division was observed with a simultaneous decrease in phenolics productivity. When the toxic precursor phenylalanine was pulsed into the bioreactor, the quantity of biomass decreased temporarily while phenolics productivity increased. These experiments demonstrate that multistage continuous culture may be useful in increasing secondary metabolite formation in cells and in exploring mechanisms controlling secondary metabolite formation. A system with multiple substrate addition, especially a two-stage system, offers considerable possibilities for experimental as well as practical use.
70 Such a two-stage process has been used commercially in Sweden for microbial biomass production from potato processing wastes (Jarl, 1969). In the first stage, Saccharomyces fibuligera is cultivated in pure culture to produce amylase. The effluent from this stage flows into the second stage along with a supplemental flow of fresh medium. The second stage contains a mixed culture of S. fibuligera and Candida utilis. For continuous production of microbial fat by Rhodotorula glutinis a twostage system was developed. The first stage was used for biomass growth with high growth rate. The exhausted medium was then passed in equal proportions to the two second stage bioreactors each of which was supplemented with nitrogen-free medium with excess of sugar and the dilution rate was decreased to 1/2 (Almazan et al., 1981). The multistage continuous-flow system is very important for the disposal of different waste materials, which may be decomposed, utilized or transformed by microorganisms (Van den Eynde et al., 1984). Methane production by anaerobic digestion of organic waste is of increasing economic importance. Traditional commercial anaerobic digesters contain mixed microbial populations where the primary acidogenic fermentation provides the severely anaerobic conditions and products which act as substrate for the secondary methanogenic fermentation. The two phases differ widely in their physiological and nutritional requirements; it has been proposed that if the two phases are physically separated by using two bioreactors in series, they may both operate under more suitable conditions leading to improved efficiency of anaerobic waste treatment processes (Ghosh and Klass, 1978; Cho, 1983). There are problems, however, with the settlement of the biomass, particularly that from the methanogenic bioreactor; for this reason, certain bioreactor types would not be suitable for this purpose. Such problems may be overcome by using a bioreactor design such as fluidized bed that is able to retain a high concentration of biomass immobilized on a solid support. An aerobic two-stage system was used for the production of a-amylase by Bacillus amyloliquefaciens (Rutten and Daugulis, 1987). The a-amylase activity and volumetric productivity were compared in batch, single-stage and two-stage systems. The single-stage chemostat attained a relatively constant enzyme concentration and maximum enzyme productivity. The two-stage continuous system achieved a relatively low enzyme concentration, and a modest productivity. Continuous culture systems were less effective than the batch system. An interesting two-stage continuous culture system for microbial degradation of crude oil in sea water has been described (Bertrand et al., 1983) and is shown in Fig. 3.4. After growth of a mixed bacterial population in the bioreactor 1 the used medium was kept in a storage vessel 2. The cells were eliminat-
71
~F
8 air
v
Jill.
~
II
111-~7 6
air
Fig. 3.4 Two-stage continuous culture for degradation of crude oil (Bertrand et al., 1983)
ed by centrifugation 3. After filtration 4 through a membrane filter an aliquot of the used medium was added to the growth medium 5 composed of sea water enriched with nitrogen and phosphate. This mixture was introduced into the bioreactor called "emulsification bioreactor" 6 together with crude oil which was kept in a flask 7 under pressure. The pump outlet 8 was adjusted according to the required dilution rate, pump 9 was adjusted according to the desired substrate concentration. The degradation percentage reached 83 % with a 0.05 h -1 dilution rate and a 6 g 1-l crude oil concentration.
3.2.4
Multistage continuous systems with bidirectional flow
Multistage continuous flow systems can be linked in two directions at the same time and this allows the development of opposing gradients of solutes present in reservoirs located at each end of the chain. The resulting device was called a gradostat (Fig. 3.5). In these systems cells and solutes are transferred by pumping through tubing lines in one direction or by gravity over weirs in the other. The vessel volumes are all the same and flow rates in each direction are equal; at steady state solute gradients are linear from sources to sinks (Wimpenny, 1985). The characteristics of the bidirectional flow mean that residence times may vary according to the position in the chain. Vessels at the centre of the
72 A
B
S
S
A _
1
B 1---.-I.
S
~.
L
~
!
! i
-]
S
A
S
S
Fig. 3.5 The gradostat, a bidirectional compound continuous culture system (Wimpenny, 1985) (a) The principle of gradostat operation. (b) The estuarine model ecosystem; vessels are connected by open tubing providing a diffusion path. (c) Gradostat with a cascade connection; vessels are connected by weirs Wand by tubing pumps P. In all diagrams .4 and B are sources of particular solute while S represents sinks or outlets from each system
chain have the longest residence time while those at the ends have the shortest. Microorganisms growing near the centre of the chain can grow at their ~m~x value, although the average dilution rate in the system is greater than the ~ax for the microorganism; microorganisms can then grow under nonlimiting conditions. The gradostat can be modified in order to simplify its construction and
73 operation. Two modifications are illustrated in Fig. 3.6. The first one (3.6a) is a glass tube where individual sections are separated by a stainless steel plate in which two holes of a specified diameter are drilled. The system is stirred by blades located on a common shaft which runs horizontally from one end to the other; the shaft is rotated by a motor. Culture can diffuse through the holes between neighbouring vessels and the rate of transfer is dependent on the diameter of the holes and on the rate of agitation. Fresh medium is pumped into the system at each end. Culture is pumped out of the system at one end while any excess flows out from the other end over a weir.
I Inlet Weir
-
QVFTubing section
I~/ Standard o.per1ure I
Stirrer I blade
'
Outlet I
Weir
I
I shaft Outlet
I I I
I
D
~]
Precision bore tubing /
Inter 1
I / Rotating disc
I
Inlet
I
I
i
I
- -
Stirrer ff
Inlet 2 1
0utter 2
Fig. 3.6 Modified version of the gradostat (Wimpenny, 1985). Detailed description is given in the text
The second modification (3.6b) is again a glass tube with a shaft which has a number of discs, whose rotation generates a mixing action. The space between individual discs constitutes "a vessel" while the gap between the discs and the tube is equivalent to the holes in the previous construction and allows exchange between neighbouring sections. The characteristics of the system depend on the number of discs, the rate of their rotation, the rate of medium inflow and the rate of exchange between the neighbouring spaces. Both arrangements described above resemble the tubular and tower system. The gradostat can be further modified using membrane filter spacers be-
74
tween individual vessels. In this arrangement it permits bidirectional solute exchange, but not exchange of cells. Each vessel can be regarded as a separate chemostat. This system allows investigation of interactions between different microorganisms.
3.3
HETEROGENEOUS CONTINUOUS OPEN FLOW SYSTEMS
The main difference between this type and the homogeneous continuous open systems is that no mixing of fluid elements occurs longitudinally along the flow path. Therefore it can be defined as an imperfectly mixed system. The composition of the inflowing medium changes along the axis according to a certain concentration gradient dependent on the flow rate. The system is comparable to a multistage process with an infinite number of vessels between which a continuous transition arises (Slezhk and Sikyta, 1961). The ideal case is represented by the medium frontally flowing through a narrow cylindrical vessel without being mixed. 3.3.1
Tubular systems
The tubular vessel can have different forms and be horizontally or vertically oriented. The horizontal tubular bioreactors are depicted in Fig. 3.7. Simple coils (3.7a) or coils with degasifiers (3.7b) are meant for anaerobic processes only. A horizontal tube with rotating discs (3.7c) consists of several closely spaced discs anchored to a shaft. This system was developed for treatment of waste water, where the biological slime grows on the surface of the discs and is alternately submerged to absorb nutrients and then raised out of the medium to oxidize the absorbed compounds. A similar design is represented by the multiple-blade horizontal bioreactor (3.7d). It consists of cylindrical compartments where each part is sealed off from its neighbouring compartment by a plate with an overflow hole in the upper half. This system is very advantageous for cultivation of molds. Another design (3.7e) is the horizontal rotary bioreactor. The thin-layer tubular bioreactor (3.7f) is applicable for low-foaming microbial cultures. It can be modified in several manners" the thin-layer bioreactor using microbial flocs; the thin-layer film bioreactor with biofilms growing on the surface of a rotating drum; the agitated tubular bioreactor as a sort of gas/liquid fluidized bed with a foam-like consistency. A pneumatically aerated tubular bioreactor (3.7g) is mostly used for waste water treatment. In this system air is introduced over the entire length of the bioreactor. Mechanically or pneumatically scraped tubular bioreactors
75
(3.7h) are equipped with rotary internal coils, a moving belt of internal discs or helical ribbons and orifices directly in the tube. These scrapers segregate the culture into moving compartments. The systems must be supplied with a constant inoculum if they are to operate in a steady state. For this purpose either the inoculum is prepared in the chemostat and introduced into the system, or an aliquot of the culture is fed back into the system.
b
lllllllllllllllli]~ IIIIIIIIIIIIIIIIII'
C
[llllll,,,,~lllll]
~: e
' "F Q ~G,,L
i
IL
g
G---] X . L /
h
3.3.2
MBHR
~G
k.]../ I (PsTR)
~L
HRR
Fig. 3.7 Horizontal tubular bioreactors for bioprocessing (Moser, 1985) (a) ordinary pipe; (b) with gasifiers; (c) biodiscs; (d) multiple blade MBHR; (e) horizontal rotary reactor, HRR; (f) thin-layer tubular reactor, ThLTR, and mechanically agitated and aerated tubular reactor, MATR; (g) pneumatically aerated and agitated tubular reactor, PATR; (h) mechanically or pneumatically scraped tubular reactor, MSTR (PSTR); G-gas, L-liquid
Tower systems
The concept of continuous tower fermentation was developed for the brewing industry in Britain in the mid-1960's. However, it has only found limited application, as have other continuous fermentation systems in that industry, because of factors unrelated to their efficiency for ethanol production. Advantage has been taken, in tower fermentation, of the fact that some yeas[s naturally aggregate into flocs, which allow them to settle against an upflow of
76
fluid. By incorporating a settling zone within the bioreactor, free of turbulence caused by the evolving carbon dioxide, it is possible to accumulate the yeasts simply and easily, thus achieving very high densities and hence a corresponding increase in conversion capabilities per unit volume. This is achieved without resorting to external sedimentation or centrifugation and cell recycle. Such peripheral equipment adds substantially to fermentation capital costs and the additional mechanical complexity adds to operating problems and can be a potential source of microbial contamination. In the tower systems, the space of the bioreactor is usually divided into floors, which can be variously adapted (Fig. 3.8). The medium with cells flows or soaks vertically through the bioreactor. A lighter gaseous or liquid phase, immiscible with the heavier aqueous phase, flows in the opposite direction. As in the horizontal system it is also more effective in this case to introduce continuously new, separately and continuously prepared inoculum into the bioreactor. Sometimes part of the culture which has passed through the bioreactor can be fed back.
RDF
,'-I
Co-current i---_ -
RAF
RDPF
Cc:::~erf
-
SFF
LPF
~+ t-f H-
-.
L---~ I }
_k
H"
f-F t-+
L
-F-F ~E
L
G
PP L
t
~
L
=
WWF
~ ~ V~(G)
J
SPTF
I
_
_
SMCF
41
SJIF
I
9-
I
O0 4F~
Il
0 41-
i i
(IM)
L
G GI~
c--4AS
-
P
G
Fig. 3.8 Possible arrangements of tower fermentation systems (Moser, 1985) R D F - - rotating disc fermentor, R D P F - - rotating pulsed disc fermentor, RAF-- rotating arm fermentor, L P F - liquid pulsed fermentor, S F F - spiral flow fermentor, W W F - wetted wall fermentor, S P T F - - staged pulse tray fermentor, S M C F - - sectioned mixed compartment fermentor, S J I F - - sectioned jet injection fermentor, I M - - injection mixer of suspension and air (L and G), ASair separator, P P - liquid pulsator, R M - reciprocating motion
77
The use of a horizontal or a vertical bioreactor is dependent on the particular microbiological process. The rate of continuous ethanol fermentation by yeast cells was found to be higher in a horizontal flow channel bioreactor than in a vertical column bioreactor under the same operational conditions (Toda et al., 1986). This higher fermentation rate in the horizontal bioreactor ,was attributed to accumulation of yeast cells in the bioreactor by free sedimentation and incomplete mixing in the direction of liquid flow. Fodderbeefs
: ii i i i ii ~ii ii iii iiiii iiii.!!i!ii!!iJiii[
I::::.::.".: 9 .
.
.." .o'...'....
-
I:'Pasteu;izaiion:J 12h retention /} chamber ![ 70-~ ~ ,:~,~L- L,-_Z..L-, ...i,,l~::,~,',',',~.,l~,',:[,'~nn~
?4h retention 25-30 ~
Inoculation port
(15.5 ff)
,'III
lllllllllllIFl
Fermen~red ~qi iiiiiiii!!!ii~ beet ~utp ~i,iiiii!!iiiiiH ~IIII!IIiI!IIHI~
Fig. 3.9 Continuous solid phase bioreactor (Gibbons, Westby and Dobbs, 1984)
The system described above can be used also for continuous solid substrate fermentation, such as cellulosic material. The bioreactor can be arranged in a vertical or a horizontal position. The vertical configuration consists of chambers positioned each above the other, forming a tower-like system. With the horizontal type a tubular-like bioreactor is formed. The first stage of both systems into which the substrate and solutes are separately fed, is thoroughly mixed. There, the period of maximum vegetative growth of microorganisms is taking place. The rate of addition of the solid substrate and of solutes depends on the rate of cellulose decomposition. The partly fermented mass is then transported to successive stages. In a tower system the fermented
78 material inside the chambers is aerated by the upward air flow, mechanically agitated and forced to fall from one chamber through the bottom down into the next one. In a horizontal tubular bioreactor, the fermented mass is transported along the tube with the aid of a spiral or a running belt, being mechanically loosened and aerated along the way. The retention time in both systems is determined by the required degree of cellulose decomposition. One of the continuous solid phase cultivation devices used for fuel ethanol and protein feed production from fodder beets is shown in Fig. 3.9 (Gibbons et al., 1984). The important components are: a hammermill to pulp the fodder beets, a nonported, steam pasteurization chamber to destroy microbial contaminants, a yeast inoculation port, and an auger that simultaneously conveys and mixes the fermenting pulp.
3.4
CLOSED CONTINUOUS CULTURE SYSTEMS
The closed continuous culture systems differ from the open ones in that all microorganisms remain in the system. A gradual increase of dead cells occurs as a rule and consequently more than one limiting factor appears. The culture never attains the dynamic steady state. The process proceeds practically as a prolonged batch process, whose biophase changes with time and whose time of persistence is limited. For this reason as well, the closed cultivation systems cannot be considered to be true continuous-flow processes capable of operating for an arbitrary period. 3.4.1
Total feedback of cells
Open homogeneous or heterogeneous systems change into closed systems by the replacement of partial feedback of cells by total feedback of cells. Two modifications of this circulation system exist. In the first case fresh medium is introduced into the vessel, into which the cell suspension is returned after being concentrated in part of the utilized medium. In the second case the same medium with the cell suspension circulates in a specially adapted vessel. In another type of apparatus the same medium circulates continuously. The cells are quantitatively separated from the withdrawn culture fluid and the clear medium is returned until the nutrients are completely utilized. Such a cultivation system was described for culturing Streptococcus lactis. Cultures with complete cell recycle were performed by connecting a hollow fibre unit to the bioreactor. The aim was to obtain high cell densities for the production of superoxide dismutase, while avoiding the growth-inhibiting effects of the lactic acid produced (Hoist et al., 1985). A cell mass of 19 g 1-~ was
79 obtained after 22 h of cultivation and four times higher superoxide dismutase productivity than for batch cultivations. The system with 100 % recycle has been successfully used also for the production of ethanol from cheese whey lactose (Janssens et al., 1984).
3.4.2
Systems with cells mechanically separated from nutrient flow
Product inhibition is a major factor limiting several conventional microbial processes. In order to increase productivity, it is necessary to remove a particular product as it is formed by the cells. To accomplish this, various product-removal methods have been investigated for coupling with the cultivation, including vacuum evaporation and solvent extraction. Nonselective dialysis driven by a solute concentration gradient across a microporous membrane is attractive for relieving product inhibition, despite the limitation of diffusion rates, especially if managed in a continuous cultivation system. Dialysis continuous cultivation systems have been studied (Stieber and Gerhardt, 1981a) using the ammonium-lactate fermentation as a model. Substrate is fed into a continuous bioreactor circuit that is dialyzed against a continuous dialysate circuit into which only water is fed. Relative to conventional nondialysis continuous processes, this process results in a higher conversion rate of a more concentrated substrate, produces cells at higher rates and concentrations, and yields a dialysate effluent containing a cell-free product. An alternative way to operate a dialysis continuous fermentation is to feed the substrate into a continuous dialysate circuit and thence into the bioreactor circuit via dialysis. If the bioreactor circuit is operated without an effluent, the cells are contained and thus essentially "immobilized" within the bioreactor circuit whereas the product is continuously removed via dialysis into the continuous dialysate circuit and into the effluent. Such a system has been modelled with the ammonium-lactate fermentation (Stieber and Gerhardt, 1981b). The further advantage of the process is that substrate is converted into product without appreciable expenditure of substrate for cell growth, and the substrate is sterilized by membrane passage. Figure 3.10 shows the schematics of two ways to operate a dialysate-feed continuous culture system. An effluent can be located in both the dialysate and bioreactor circuit (3.10a), or in only the dialysate circuit (3.10b). According to the simulation and predictions system a could be useful for the continuous production of a high concentration of cells at a high rate, and system b could be used for the purpose of producing a metabolite at a high rate. A nondialysis bioreactor that achieves essentially the same objectives as dialysis cultivation was developed (Sortland and Wilke, 1969). The bioreactor
80 contained a built-in rotating cylindrical microfilter that permitted the continuous removal of cell-free effluent. The continuous removal of inhibitory metabolites by the filter bioreactor enabled Streptococcusfaecalis to be grown anaerobically to a population density 45 times greater than that obtained by simple batch cultivation. A similar filtration-based cultivation device, called a roto-
o
11
BC
DC
b
II
BC
DC
Fig. 3.10 Schematics of dialysate-feed continuous cultivation system (Stieber and Gerhardt, 1981a): (a) system with both dialysate and bioreactor effluents; (b) system with only a dialysate effluent. I -- influent, E - effluent, B C - bioreactor circuit, D C - dialyzer circuit
fermentor, was used to produce ethanol from glucose (Margaritis and Wilke, 1978). This bioreactor, incorporating a rotating membrane module, overcomes the fouling and concentration polarization problems. Although it appears to be too complex to be practical, the potential was established for using synthetic membranes to greatly enhance bioreactor productivity.
3.4.3
S y s t e m s with i m m o b i l i z e d cells
Immobilized cell bioreactors are a class of bioreactors in which the cells are physically retained in the bioreactor. Physical retention can be achieved by a variety of immobilization techniques of which natural attachment, chemical coupling and gel encapsulation are the most commonly employed. The immobilized cell bioreactors are of interest because they offer the potential for long term continuous operation, high volumetric productivity, reduced capital, operating, waste treatment, and product recovery costs, and reduced endproduct and substrate inhibition. Besides all this, several additional benefits may be realized in many secondary products fermentations. Immobilization of cells prevents their loss from the bioreactor, either by "active" or "passive" immobilization. Active immobilization requires the production of cells, which, after mixing with some chemical agent, are immobilized by chemical or physical means. Passive immobilization occurs when films or flocs of cells form naturally around or within support material provided for that purpose. The inert particles are simply placed in the bioreactor and the medium is inoculated in the normal way. Cells become immobilized
within the particles as a natural consequence of growth during an initial batch period. Continuous processes using immobilized biocatalysts can be performed in various types of bioreactors which are set out in Fig. 3.11. They belong basically to two principal types, (a) bioreactors with piston flow and (b) mixed bioreactors, which can be used in modifications suitable for continuous proPB -
-
FB
V---
"
tll t
III I
I.
]
IJlt
III I
I1 II 11
ST
1 1
M
LR
D~ ~176
1 l
Fig. 3.11 Bioreactors for immobilized cell: P B - packed bed, F B - fluidized bed, T - tubular, S T - - stirred, M - multistage, L R - loop recycle
cesses. The choice of a suitable bioreactor depends on a number of factors: type of biocatalysts, type of the microbiological process, requirements for solution adjustment during the process, supply of oxygen or gases, concentration of substrates, products or inhibitory products. 3.4.3.1
Packed bed bioreactors
The basic bioreactor with piston flow is a column in which no backflow mixing of the contents takes place and the whole contents are thermally homogeneous. The substrate flows through the column from bottom to top or from top to bottom. If the biocatalyst in the column tends to be compressed, the layer of the biocatalyst is usually divided by baffles into plates with a pressure equalization after each plate reducing the pressure gradient in the column. Sometimes it is useful to array the columns in a battery, with one column serving as a main reactor and the others as safety vessels. After exhaustion of the main column the safety column is used as a new main column and a new safety column is switched on. Upward flow prevents compression of immobilized biocatalysts since an increased flow aids in increasing the distance between biocatalyst particles.
82 Two interesting developments based on the principle of packed bed have been made for the treatment of waste gases and waste waters. In order to eliminate organic pollutants in waste gases, a biological filter bed technique has been developed, with a self-regenerating capacity and a low pressure drop (Ottengraf and Van den Oever, 1983). The bed consists of an appropriate filling material, in order to let microorganisms grow on the solid surface and to supply them with inorganic nutrients. Most organic compounds are oxidized to carbon dioxide and water. The composition of the solid phase and the viable microorganisms present are such that aging is prevented, as a result of which a relatively high activity can be maintained during a long period of time. The apparatus consists of glass columns divided into five separate stages. At the bottom of each stage a perforated sieve plate is fitted to support the package. The package is inoculated with an active sludge suspension from a municipal waste-water treatment plant. To keep the humidity of the filter bed at the desired level, tap water is periodically sprayed by a nozzle, mounted at the top of each stage. A process train consisting of the following sequence of unit processes, a bell-saddle-packed anaerobic filter, and an activated sludge nitrification system was evaluated for the treatment of synthetically prepared coal gasification wastewater (Suidan et al., 1983). The first-stage anaerobic filter resulted in very little removal of organic matter and no methane production. Excellent reduction of organic matter occurred in the granular activated carbon anaerobic filter. It is felt that the success of the activated carbon anaerobic filter was due to the ability of the activated carbon to sequester some components of the wastewater that were toxic to the mixed culture of anaerobic microorganisms. The activated sludge nitrification system resulted in complete ammonia oxidation and was very efficient in final effluent polishing.
3.4.3.2
Fluidized bed bioreactors
Fluidized bed bioreactors are obviously of a conical shape tapering to the bottom. Their main advantage is that in the upper broadened part the linear ascending velocity of the particles decreases and so does the pressure gradient; in the lower narrow part the particles sediment. These types of bioreactors can be successfully used both for active and passive immobilized cells. In the latter case the solid substrate plus cells are denser than normal aqueous media and can be retained in a column through which nutrient solutions are pumped in the ascending direction. The particles become fluidized and move around rapidly. This rapid motion has two effects: solute exchange between the medium and cells attached to the solid
83 substrate is enhanced, and cells formed at the surface of the film on the solid substrate are removed by attrition. Biological fluidized bed bioreactors are generally regarded as highly effective devices for treating organic loaded wastewaters. Compared with conventional techniques they present a highly specific surface available for biological colonization giving higher biomass concentration and substrate consumption rate (Toldr5. et al., 1986). This technique is especially advantageous because it works efficiently at low ambient temperatures and short retention times on low to medium strength wastewaters. The performance of a fluidized bed bioreactor is more efficient than that of a fixed bed bioreactor for continuous ethanol production. This could be due to the increased transport rate of carbon dioxide gas in the bulk solution of a fluidized bed bioreactor. It has been estimated that the dead volume occupied by carbon dioxide gas in the fixed bed bioreactor is about 65 % of the total effective bioreactor volume at 100 % conversion.
3.4.3.3
Film bioreactors
Biofilm systems can be used to retain slow growing microorganisms within a continuous flow bioreactor. In this way, the retention time of the liquid phase may be chosen independently of the specific growth rates. Although a high concentration of microorganisms can be achieved, because of diffusional limitations, the substrate conversion rates tend to be proportional to the surface area of the film and not to the total biomass of microorganisms. Anaerobic downflow stationary fixed film bioreactors which retain microbial biomass in the bioreactor on stationary supports have been shown capable of digesting wastes within suspended solids at high organic loading rates and short hydraulic retention times with concomitant high methane production rates (Kennedy and Van den Berg, 1982). Feed was pumped at the required rate into the top of the bioreactor and the effluent was withdrawn from the bottom for disposal or recirculation with the feed. An interesting configuration of film bioreactors is the rectangular film bioreactor (Joshi and Yamazaki, 1984). Cloths or porous stainless steel fibre filter sheets were used for physical entrapment of microorganisms and were placed vertically in parallel in a horizontal bioreactor. A single-stage or multistage system can be used for the production of different metabolites.
84
3.4.3.4
Hollow-fibre bioreactors
One particularly attractive immobilization geometry is the cylindrical configuration of asymmetric hollow-fibre ultrafiltration membranes. Asymmetric hollow fibre membranes are anisotropic structures consisting of an ultramicroporous inner layer approximately 0.1 to 0.5 llm thick surrounded by an open-celled macroporous polymer matrix. The dense inner wall of the fibre acts as a semipermeable membrane with pore diameters of the order of nanometers. The macroporous matrix, which serves as a mechanical support for the ultra-thin membrane, consists of 60--90 % void space and possesses a large hydraulic permeability. gaseous producfs
gaseous nufrienfs
liquid products
gaseous producfs
wall matrix confainingcells
gaseous nufrienfs
Fig. 3.12 Asymmetric hollow-fibre membrane reactor design (Inloes et al., 1983)
The general design for a hollow-fibre membrane bioreactor is shown in Fig. 3.12 (Inloes et al., 1983). A single fibre is epoxied at both ends inside a glass shell, and an inoculum is introduced into the shell space of the bioreactor through access ports in the outer shell. Liquid-phase nutrients convectively flowing through the fibre lumen diffuse across the ultramicroporous membrane into the membrane region containing cells. Cellular metabolic products, excreted into the extracellular space within the fibre wall, diffuse in the reverse direction across the ultramicroporous membrane and into the fibre lumen where they are subsequently swept from the fibre, resulting in a continuous process for converting substrates to products. If required, continuous flushing of the shell space with a gas stream may be used to supply gaseous nutrients such as oxygen, while simultaneously removing gaseous metabolic products such as carbon dioxide from the system. Recently dual hollow fibre bioreactor systems have been developed for the purpose of immobilizing microbial cells. The immobilized cells grown aerobically in these systems were
85
present in extremely high densities, reaching 300-666 g dry weight per litre of the empty space (Hwang and Chang, 1987). REFERENCES Agrawal, P. (1987) Biotechnol. Techn. 1, 19. Almazan, O., Klibansky, M., Otero, M. A. (1981) Biotechnol. Lett. 3, 663. Bertrand, J. C., Rambeloarisoa, E., Rontani, J. F., Giusti, G., Mattei, G. (1983) Biotechnol. Lett. 5, 567. Bryson, V., Szybalski, W. (1952) Science 116, 45. Bull, A. T. (1981) Strategies in microbial process optimization. In: Global Impacts of Applied Microbiology VI, New York. Bull, A. T., Ellwood, D. C., Ratledge, C. (1979) The changing scene in microbial technology. In: Microbial Technology: Current State, Future Prospects, Cambridge. Cho, Y. K. (1983) Biotechnol. Lett. 5, 555. Ghosh, S., Klass, D. L. (1978) Process Biochem. 13, 15. Gibbons, W. R., Westby, C. A., Dobbs, T. L. (1984) Biotechnol. Bioeng. 26, 1098. Harder, W., Kuenen, J. G., Matin, A. (1977) J. Appl. Bact. 43, 1. Harrison, D.E.F. (1978) Adv. Appl. Microbiol. 24, 129. Holst, O., Hansson, L., Berg, A. C., Mattiason, B. (1985) Appl. Microbiol. Biotechnol. 23, 10. Hwang, J. S., Chang, H. N. (1987) Biotechnol. Lett. 9, 237. Inloes, D. S., Smith, W. J., Taylor, D. P., Cohen, N. S., Michaels, A. S., Robertson, C. R. (1983) Biotechnol. Bioeng. 25, 2653. Janssens, J. H., Bernard, A., Bailey, R. B. (1984) Biotechnol. Bioeng. 26, 1. Jarl, K. (1969) Food Technol. 23, 1009. Jensen, D. E. (1972) Biotechnol. Bioeng. 14, 647. Joshi, S., Yamazaki, H. (1984) Biotechnol. Lett. 6, 797. Kennedy, K. J., Van den Berg, L. (1982) Biotechnol. Lett. 4, 137. Margaritis, A., Wilke, C. R. (1978) Biotechnol. Bioeng. 20, 727. Monod, J. (1950) Ann. Inst. Pasteur 79, 390. Moser, (1985) Imperfectly Mixed Bioreactor Systems. In: Comprehensive Biotechnology 2, New York. Novick, A., Szilard, L. (1950) Science 112, 715. Ottengraf, S. P. P., Van den Oever, A. H. C. (1983) Biotechnol. Bioeng. 25, 3089. Rutten, R., Daugulis, A. J. (1987) Biotechnol. Lett. 9, 505. Sahai, O. P., Shuler, M. L. (|984) Biotechnol. Bioeng. 26, 27. Sikyta, B. (1991) Directed Selection of Microorganisms in Continuous Culture, Prague. Slezfik, J., Sikyta, B. (196|) J. Biochem. Microbiol. Technol. Eng. 1,357. Sortland, L. D., Wilke, C. R. (1969) Biotechnol. Bioeng. 11, 805. Stieber, R. W., Gerhardt, P. (198 l a) Biotechnol. Bioeng. 23, 523. Stieber, R. W., Gerhardt, P. (1981b) Biotechnol. Bioeng. 23, 535. Suidan, M. T., Siekerka, G. L., Kao S. W., Pfeffer, J. T. (1983) Biotechnol. Bioeng. 25, 1581. Toda, K., Ohtake, H., Asakura, T. (1986) Appl. Microbiol. Biotechnol. 24, 97. Toldrfi, F., Flors, A., Lequerica, J. L., Valles, S. (1986) Appl. Microbiol. Biotechnol. 23, 336. Van den Eynde, E., Vriens, L., De Cuiooper, P., Verachtert, H. (1984) Appl. Microbiol. Biotechnol. 19, 288. Wimpenny, J. W. T. (1985) Microbiol. Sci. 2, 53.
86 GENETICS AND SELECTION OF INDUSTRIAL MICROORGANISMS
Economic analyses of industrial microbiological processes show that genetics participates in increased productivity of the technological operation to the same extent as does microbial physiology and microbial engineering. In some cases genetic methods have enabled new products to be introduced into large scale production, such as amino acids, nucleotides and nucleosides by auxotrophic and regulatory mutants of bacteria, and especially animal proteins that are produced with the aid of genetically manipulated microorganisms (Sikyta, Pavlasovfi and Stejskalovfi, 1986; Carter et al., 1986). The participation of genetics in introducing new products and ensuring productivity increase of existing productions will continuously increase with the development of genetic methods, especially genetic manipulations. The goal of genetic research in industrial microbiology is to acquire or, in terms of genetic engineering, to construct ideal industrial microorganisms.
4.1
AN IDEAL INDUSTRIAL MICROORGANISM
It is not difficult to characterize the ideal industrial microorganism. It should synthesize a certain substance as a single product, in a maximal concentration, and should excrete it at a maximal rate from the cells or accumulate it within the cells. The synthesis should proceed at a maximal specific rate, i.e. at the lowest possible biomass concentration, or, if the product is the biomass, growth should proceed at a maximal specific growth rate. Substrate consumption should also be minimal, i.e. it is desirable to achieve a high yield coefficient. The microorganisms must be able to utilize a number of raw materials of varying composition and varying purity and the raw materials should require minimal processing prior to cultivation, i.e. the processing costs should be marginal. In aerobic processes, the biosynthesis should take place with a minimal consumption of oxygen which is one of the most expensive substrates. The microorganism has to be resistant against phages. From the technologist's viewpoint the microorganism should have the lowest possible sensitivity to process variables, i.e. temperature, pH, and other factors, it should not be foam forming or produce substances lowering the transfer rate
87 of oxygen and other gases. Construction of a production strain usually starts by first improving the most important property, i.e. production ability, and then gradually other features or traits according to their importance.
4.2
STRATEGIES OF ACQUISITION OF AN IDEAL PRODUCTION MICROORGANISM
When formulating a strategy, one should base the considerations on the analysis of available genetic methods including individual approach levels, the actual methods and their complexity, prerequisites for their application and, eventually, the microorganisms and their products to which these methods can be applied. One should make a distinction between: a) methods for the production (acquisition) of new strains such as mutagenesis or recombinant techniques, b) methods of detection of new strains obtained by mutagenesis or recombination, including screening and selection methods. Screening consists in testing all individuals in a population whereas selection is the isolation of the desirable variant type under conditions that prevent repeated isolation of other individuals in the population. The construction of an ideal industrial production microorganism should be based on the most comprehensive knowledge of (a) the metabolic pathways, (b) regulatory mechanisms governing these pathways, (e) their genetic basis, i.e. genetic analysis of the microorganism. The methodological approach to increasing the overproduction of certain metabo|ites consists in deregulation of appropriate metabolic pathways leading to the product and blockage or suppression of those that carry out synthesis of other products. The deregulation includes an empirical or directed disruption of regulatory mechanisms that preclude the overproduction of less important primary or secondary metabolites. The most important regulatory mechanisms are: a) feedback inhibition of activity of key enzymes of the biosynthetic pathway, b) regulation of enzyme synthesis, c) metabolic factors decisive for availability of intermediates, d) regulation of permeability (in the case of products excreted from the cells). It is therefore desirable to isolate mutants that suffer from disruption of some of the regulatory mechanisms, or multiple mutants in which the disruption encompasses several of these mechanisms. Various empirical and rational methods can be used to acquire strains
88 Table 4.1 Empirical and science-based methods of acquisition of new strains Approach
Highly empirical
Empirical
Science-based Highlyscientific
|
cell and protogene manipulaplast fusion, mut- tions, gene synasynthesis, appli- thesis cation of selection pressures
Methods
random selec- asporogenicmuttion ants, morphological mutants, auxotroph/prototroph reversion, resistance to analogues,! antimetabolites and organometal ions
Strain properties
overproduction
overproduction
Methodological prerequisites
knowledgeof mutagenfunction, statistics
isolation of auxot- techniques for furophic and resis- sion,knowledge tant mutants of metabolic pathways, population genetics
overproduction of overproduction, new compounds synthesisof substances not synthesized by the cell (animal proteins) chromosome mapping, sequencing techniques, vectors, restrictases and ligases, expression in host cell, gene synthesis techniques
with various desirable properties (Table 4.1). Examples of such strains are given in Table 4.2 along with their practical .uses. The genetic basis of increased overproduction of a certain metabolite, or the biosynthesis of a product that was not synthesized by the original microorganism, can be conspicuously affected by genetic manipulation. One of the most important and at the same time most difficult tasks is the identification of a strain with the required properties in the population, and its subsequent isolation. Although techniques have been established for identification of certain types of mutants (auxotrophic and regulatory; see the following chapters), no methods have as yet been described for a simple identification and isolation of strains differing in the magnitude of overproduction. Some tentative tests can be carried out on plates by measuring the growth or transparent zones around colonies, or by colony staining in the case of producers of enzymes or antibiotics, but the final assessment of overproduction has to be carried out by laborious tests on large numbers of isolates in flasks and
89 Table 4.2 Mutant types and their properties useful for industrial application Mutant type
Industrial use
1 Resistance to bacteriostatic or bactericidal compounds
use of raw materials contaminated by different compounds
2 Ability to utilize smaller number of substrates than parent strain
better utilization of substrate and a higher economical coefficient
3 Changes in nutrient transport
assimilation of compound(s) unassimilable by parent strain
4 Defects in anabolic pathways (auxotrophy)
accumulation of important compounds (amino acids, nucleotides)
5 Temperature resistance
process performance at higher temperature, saving of cooling water
6 Defective regulation mechanisms At the level of synthesis a) Defective induction and repression system (constitutive mutants) b) Resistance to catabolite repression c) Resistance to oxygen effect
production of required compound (enzyme) without inducer addition use of cheap and rapidly metabolizable substrates insensitivity to fluctuations in oxygen supply
At the level of activity Resistance to feedback inhibition and repression
increased production of important compounds
7 Changed or extended substrate specificity
use of nontraditional or more numerous substrates
also in bioreactors, because a direct relationship does not always obtain between production on plates and under submerged conditions. Methods of acquisition of new strains can be divided into empirical and rational. For a long time the only empirical method for enhancing the production of industrially important metabolites (antibiotics, alkaloids, steroids, etc.) was the mutation-selection strain improvement. Screening of large numbers (thousands) of isolates in cultivation tests is necessary in order to increase the production of a given metabolite even by a mere several per cent. Among the rational methods are enrichment techniques, direct visualization of the most producing strains, gene manipulations such as cell or protoplast fusion, and in vitro DNA recombination. The enrichment techniques make use of accumulation of desirable phenotypes in closed (batch cultivation) or open (continuous cultivation) systems, the original population being either mutagenized or nonmutagenized. The direct visualization methods allow the study of morphology of the colonies, their size and growth rate, intensity of selective staining and/
90 or the size of the growth or transparent zone around the colony. Modern methods of cell or protoplast fusion make it possible to obtain a high percentage of hybrids with desirable properties. These methods are used when a large number of genes participate in the synthesis of the product. The methods of DNA recombination in vitro, in contrast, are used when a small number of genes is responsible for the product synthesis.
4.3
ENRICHMENT METHODS AND SELECTION OF DESIRABLE STRAINS
The underlying factor in enrichment methods is the selection pressure, i.e. ambient conditions under which only those microorganisms grow that possess enzyme equipment corresponding to these conditions. The probability of enrichment of these cells in the population can be strongly increased by setting up a growth medium whose chemical composition and physical properties ensure the preponderant growth of desirable individuals, or suppress the growth of undesirable parts of the population. In principle, any composition of the medium, its physical properties, sterilization method and cultivation procedure represent a set of certain selection pressures that favour the growth of the best adjusted individuals. In order, however, to implement a pronounced selection pressure the conditions have to be as strict as possible (growth/no growth), or the cultivation has to be long enough to permit the enrichment of the desired part of the population (in a continuous culture). Selection factors can include sources of carbon, nitrogen, phosphorus, sulphur or oxygen, trace elements, inhibitory substances such as heavy metals, antibiotics or ethanol, competitive or noncompetitive inhibitors, catabolite repressors, corepressors, inducers, physical and physico-chemical factors such as temperature or pH. The selection pressure can be intensified by using combinations of several factors, for instance" a) substrate and temperature; when an enzyme is produced at 28 ~ but not at 37 ~ the elevated temperature can be used to increase the selection pressure; b) two substrates (carbon and nitrogen sources), one of which at the same time partially represses the synthesis of the enzyme; c) two substrates, one of which acts at the same time as, for example, an inducer and competitive inhibitor of the enzyme synthesis. Such combinations of selection pressures can create conditions promoting selective enrichment of overproducing strains (constitutive and at the same time insensitive to catabolite repression) or strains with altered substrate
91
specificity, especially in enzyme producing organisms. Among several substrates containing the same bond to be cleaved, the most suitable one for the selection of an overproducing strain is that which is assimilated at the lowest rate. The use of these methods is not limited to the selection of suitable strains overproducing industrially important enzymes; they can also be used, albeit indirectly, for selection of strains producing secondary metabolites. The biosynthesis of some antibiotics is known to be the highest in strains utilizing intensively fatty acids: it is then advisable to enrich and isolate strains with lipase overproduction. On establishing a relationship between the biosynthesis of a substance and a certain enzyme the methods can be applied to enrich the appropriate microorganisms. Enrichment methods are also very important when recombinant strains are to be accumulated and isolated, because direct detection of these strains is rarely feasible. The enrichment of desirable microorganisms can be carried out by two basic methods, i.e. in a batch culture and in a continuous culture. 4.3.1
Enrichment in a batch culture
The procedure consists in a cyclic reinoculation of a microbial (mutagenized or nonmutagenized) population from one flask into another in a medium with appropriate selection pressure. The gradual reinoculation brings about an enrichment in the culture of increasing concentrations of desirable strains and the population becomes more and more homogeneous. The reason for 1.0 3
2
c o
~0.8 r-i d .._.. i._
~' 0.6
4--
Cl
0 r-
.o 0.4 0 r
e-OJ tO
t
0.2
,:/ 0
20
40 ----- time (h }
60
80
Fig. 4.1 Growth of Escherichia coli ATCC 9637 in subcultures on a medium with 0.2 % (w/w) phenylacetamide, 1 % (w/w) lactate and 0.05% (w/w) phenylacetic acid. 1, 2, 3 - subcultures. Specific activity of enzyme (rag 6APA/ mg cell dry matter) in 1 = 150, 2 = 580, 3 = 935
92
this is the gradual predominance of organisms with the highest growth rate, which reflects either the fastest utilization of appropriate substrate(s) or resistance to adverse growth conditions. The examples given below illustrate these possibilities. Enrichment of strains with overproduction of penicillin amidase was achieved by repeated transfers of Escherichia coli ATCC 9637 in a selective nutrient medium. As seen in Fig. 4.1, the growth rate of the population increased on each transfer, concomitantly with increasing specific activity of the enzyme which rose by a factor of nearly l0 as compared with the original culture already on the third transfer. For selection of strains resistant to glucose 0.6
,._,. Cl
$ o.4
~o
2
I
0.2 8
to
0
100
200 time (h)
300
400
Fig. 4.2 Growth of Escherichia coli ATCC 9637 in subcultures on a medium with 0.15 % (w/w) phenylacetamide, 1.0 % (w/w) glucose and 0.05 % (w/w) phenylacetic acid. 1, 2 - subcultures
catabolite repression, an E. coli strain with a high enzyme activity was inoculated into a medium containing glucose as the only carbon source. Figure 4.2 illustrates the finding that, between cultivation hours 300 and 400, the predominant part of the population consisted of bacteria resistant to glucose catabolite repression, the high specific activity of the enzyme being preserved. It was therefore possible to use for industrial purposes a high-production strain cultured on a simple synthetic medium. Enrichment of constitutive strains was performed using the growth lag as an indicator and detection marker. A strain synthesizing a given enzyme constitutively grows without a lag whereas the strain with inducible synthesis of the enzyme requires a lag to achieve full induction. Alternating transfers in media containing an inducing and a repressing substrate, such as lactose-glucose, will therefore bring about gradual enrichment of constitutive strains (Cohen-Bazire and Jolet, 1953). Englesberg et al. (1965) made use of the method of anti-induction in the
93 selection of strains with constitutive metabolism of L-arabinose. The medium contained L-arabinose as the only carbon source and D-fucose as a nonmetabolizable inhibitor of the induction of enzymes of the ara-operon. McFall (1964) obtained strains constitutive for D-serine deaminase by using D-serine as the only carbon source and fl-alanine as competitive inhibitor. In this case the constitutive strains had a double selection advantage over the inducible population whose growth was inhibited by the rate of synthesis of D-serine deaminase, and which was subject to competitive inhibition by fl-alanine. With selection of strains producing secondary metabolites, the above possibilities are rather limited. On the other hand, conditions can be selected that do not automatically guarantee the acquisition of strains with higher production but can significantly affect the economy of the industrial operation. For instance, it is possible to choose the composition of the nutrient medium, method of sterilization, concentration of dissolved oxygen, cultivation temperature and duration, and so determine with considerable likelihood the desired properties of the new strain. One of the raw materials used as medium component in the biosynthesis of tetracycline antibiotics is the corn-steep liquor. The phosphorus content in individual batches usually fluctuates and this is naturally reflected in fluctuating phosphorus content in the medium in the range of some 20-100 l-tg ml -~. Strains of Streptomyces aureofaciens produce the highest levels of the antibiotic at phosphorus levels in the medium of 30-40 lxg ml -l, higher phosphorus concentrations suppressing the production considerably. As it would be impractical to ensure a constant phosphorus content in the corn-steep liquor, high concentrations of phosphorus were used to select strains that do not suffer from antibiotic production drop at higher phosphorus levels. The production of the tetracycline antibiotics by strains of Streptomyces aureofaciens declines appreciably when aeration is transiently discontinued, especially between cultivation hours 4 and 12 (Matelovfi et al., 1955). Selection of strains whose antibiotic production is unaffected by aeration breaks was performed by introducing multiple aeration breaks at regular intervals between cultivation hours 4 and 12. The following example shows the effect of the method of sterilization as a selection condition. Improvement of strains for streptomycin biosynthesis yielded strains with 20-30 % production increase on the laboratory scale in shaken flasks, but in large-scale bioreactors the production remained the same as in the original strain. Altered sterilization conditions close to those used under laboratory conditions brought about a renewed 20-30 % production rise in the selected strains even in large-scale bioreactors, whereas no production increase was detected in the parent strain.
94 4.3.2
Enrichment in a continuous culture
Continuous culture is an exceedingly suitable method for enrichment of overproducing strains and their regulatory mutants. The enrichment can in principle be carried out in a chemostat or in a turbidostat. In a chemostat, the growth is limited by a single substrate added in a suboptimal concentration at a constant dilution rate, in a turbidostat the concentrations of microorganisms are maintained at a constant level through dilution rate. The composition of the population changes during the cultivation in dependence on the genetic heterogeneity of the microbial population at the beginning of the cultivation, and owing to mutations arising during the continuous growth. The simplest example is the enrichment of microorganisms with a higher growth rate in processes where the product is the biomass. When a chemostat is used, then inoculation of the population into batch cultures at certain time intervals serves to determine the maximum specific growth rate. In a turbidostat the increasing growth rate (regulated automatically by monitoring cell concentration via a photocell) indicates directly the enrichment by a more rapidly growing population. It should be noted however that selection in a chemostat takes place under a limiting substrate concentration whereas in a turbidostat it takes place under substrate excess, and the enriched strains will thus differ in the values of the saturation constant Ks. The turbidostat can also be used for enrichment of strains growing at extreme temperature, pH or at extreme inhibitor concentrations which prevent the growth of the original population. As in the preceding example the growth of the desirable strain is demonstrated by an increased dilution rate (i.e. increased inflow of the nutrient medium into the culture vessel). Thus Brown and Oliver (1982), when selecting in a turbidostat a strain of Saccharomyces uvarum that could withstand 12 % (w/w) ethanol, monitored the growth rate via carbon dioxide production and regulated it through ethanol feed. A technique highly suitable for accumulating enzyme overproducing strains is based on the use of the chemostat. Novick and Horiuchi (1961) and Horiuchi, Tomizawa and Novick (1962) were the first to use the technique for the enrichment of E. coli strains overproducing/3-galactosidase. Limitation of growth by lactose served to select strains whose enzyme activity was higher by a factor of ten than that of the parent strains. Since then the chemostat has been used for enrichment and isolation of a large number of hyperproductive strains, as illustrated in Table 4.3. Francis and Hansche (1972) used fl-glycerophosphate to limit the growth of Saccharomyces cerevisiae in a chemostat; after 300 generations at pH 6.0 they selected strains with a higher content of acid phosphatase (pH optimum 4.2). In tests in a pH range of 3.0-6.0 these
95 Table 4.3 Enrichment of Escheriehia coli strains with endoenzyme hyperproduction in a chemostat (Sikyta, 1991) Enzyme
Selection pressure
fl-Galactosidase o-Serine deaminase Tryptophanase Ribitol dehydrogenase Penicillin amidase
lactose limitation D-serine limitation tryptophan limitation limitation by xylitol or ribitol limitation by temperature and compounds with C O - - N H bond glycerol limitation
Glycerol dehydrogenase
Increase in specific enzyme activity 30 x 25 x 6x 12x 30 x 10x
strains had a consistently higher activity of the enzyme than the parent strains (Fig. 4.3). An interesting example of selection of strains with lowered demands for trace elements was reported by Downie and Garland (1973). On limiting the growth of Candida utilis in a chemostat by copper at D = 0.2 h-~ the authors found that, following a certain period of continuous growth, the dry weight of the cells increased severalfold owing to changes in metabolic pathways. The conventional pathway via cytochrome oxidase was replaced in the new strains by an alternative oxidase pathway on the level of cytochrome b. On return to the normal copper content in the medium the cells reverted again to cytochrome oxidase but the alternative enzyme was not lost. This finding opens up new possibilities of use of the selection in chemostat.
"io
60
QI
50 leE
Y 30E
~20
~10
3.6
4.0
4.4 --~
4.8 pH
5.2
5.6
8.0
Fig. 4.3 pH dependence of specific activity of acid phosphatase in a parent strain of Saccharomyces cerevisiae ( 0 ) and in a mutant selected in chemostat (O)
96 The enrichment in a chemostat can also be used to accumulate auxotrophic strains (Zamenhof and Eichhorn, 1967). When his- mutant grew along with the his + revertant in the presence of histidine it had a strong selective advantage over the revertant and the concentration of the latter decreased during 48 generations by 4 . 1 0 3 cells. A similarly derepressed mutant resistant to 5-methyltryptophan had a selective disadvantage during growth with the parent population and its concentration decreased during 26 generations lOS-fold.
4.3.3
Direct visualization and isolation of production strains
Identification of the most productive strains is in general difficult and time consuming; methods have been developed that make it possible to identify desirable individuals on selective solid media by the morphology of colonies, colony size and rate of growth, colony colour or the growth zone of a test organism surrounding the colony, clear zones around it, and the colour of these zones. The strains can then be easily isolated. These so-called prescreening methods permit the isolation of the following strain types: a) overproducing, b) auxotrophic, c) resistant to metal ions or organo-metal ions, antimetabolites and inhibitors, analogues, temperature, pH and other stress factors (high medium osmolarity, high concentration of nonmetal ions, etc.), catabolite repression, or feedback inhibition, d) constitutive, e) with extended assimilation of substrates, f) strains with combined properties (overproducing plus resistant, etc.). Overproducing strains
A prescreening method was developed by Ichikawa et al. (1971) for evaluation of antibacterial activity of antibiotics producing strains. The method consisted in point inoculation of agar cylinders 5 mm in diameter with mutagenized colonies and subsequent cultivation in a thermostat with high humidity. Following the cultivation the antibiotic production efficiency was determined on agar plates with test organisms. Colonies which formed inhibition zones larger than the control ones were taken for further screening in shaken flasks. The efficiency of the method is illustrated by the data published by Chang and Elander (1979):
97
Overproducing isolates Selection
Number of isolates tested number
Random Prescreening
2000 192
0.2 1.6
Although the size of the inhibition zone does not always reflect the ability of the isolate to produce the antibiotic under submerged conditions, the method is convenient for discarding low-producing or nonproducing colonies (70 to 80 % of the total) before further screening. Various possibilities exist in the prescreening of enzyme producers in dependence on whether endo- or exoenzymes are being produced. In endoenzyme producers the technique usually involves staining of colonies with specific dyes, mostly after a preceding treatment of colonies (permeabilization), and determination of colony stain intensity. Colonies of strains producing fl-galactosidase can be stained with o-nitrophenyl-fl-D-galactoside or fluorescent compounds such as fluorescein-di-fl-D-galactopyranoside (Rotman, 1961) or naphthol-As-Bi-fl-D-galactopyranoside (Srienc, Campbell and Bailey, 1983). In a similar way o-nitrophenylphosphate is used for phosphatase activity assay, etc.. With exoenzyme producers the zone is usually detected using a colour indicator or the formation of a clear zone around the colony is the indicator. For amylase detection the nutrient medium is supplied with a colourless substrate, the so-called starch azure, which lends a blue tint to the zone appearing due to the action of the enzyme. With fl-glucosidases a zone of a black precipitate, which arises by reaction of esculetin with iron salts, is measured (Cuskey et al., 1982); with pectinases or inulases a clear zone appears due to pectin hydrolysis or inulin dissolution (Tsang and Groot Wassink, 1985). Polygalacturonic acid transeliminase hydrolyzes polygalacturonic acid and the efficiency of this hydrolysis is determined by spraying the plates with hydrochloric acid, which results in clear zones being formed around the colonies (Hsu and Vaughn, 1969). Production of vitamins and growth factors can be detected from the size of the growth zone of a test microorganism which surrounds the colony and is dependent on the produced substance.
Auxotrophic strains Auxotrophic strains are important especially for production of amino acids, nucleotides and nucleosides, for basic recombination steps in genetics and for microbiological assays of various compounds. They are mostly detect-
98 ed by the well-known penicillin overlay method (Davis, 1948) and isolated by the equally familiar replica method. Resistant strains
Strains resistant to physical or chemical factors can be detected and isolated from solid media. These solid media contain appropriate toxic or inhibitory substances in various concentrations, allowing the growth of only those strains resistant to them. Depending on the synthesized products the methods of their identification are those described in the preceding paragraph concerning overproducing strains. An extensive literature has been devoted to the methods of acquisition of resistant and constitutive strains (Calam, 1964; Hopwood, 1970; Demain, 1971a,b; Sikyta, 1983).
4.4
MUTATION-SELECTION STRAIN IMPROVEMENT
Most industrial microorganisms have been acquired by a mutation-selection improvement procedure which became the basic method especially for the selection of high-producing strains yielding secondary metabolites (Van6k, Ho~t'~lek and Cudlin, 1973 ; McDonald, 1976; ~ebek and Laskin, 1979; Krumphanzl, Sikyta and Van6k, 1982). The mutation-selection improvement is based on a genetically differentiated population which arises due to the action of a mutagen on the production strain. It is followed by selection during which the strains with the best production properties are gradually selected from the mutagenized population. These strains are subjected to another mutagenetic intervention and the whole procedure is repeated. A sequence of successive mutation-selection steps ensures a continuing increase in the production ability of industrial microorganisms. Figure 4.4 illustrates the sequence of steps in the basic mutation-selection cycle. One cycle, which starts with a certain strain and ends with the acquisition of another strain with a higher production ability, can be divided into separate steps A-K-F. The most productive strains are placed in long-term storage as stock strains A-K. The cycle commences with inoculation of the stock strains onto agar slopes B. The culture is then washed off the agar slope to obtain a cell or spore suspension Cwhich is subjected to the action of some of the chemical or physical mutagens. The population which survives the treatment is plated in Petri dishes at a dilution that permits the growth of isolated colonies D. These colonies are transferred on agar slopes F. The number of isolates per one set is usually in the range of 30 to 300, and tends to decrease on repeated testing of production on the laboratory scale Fto include
99
only the most productive strains. The final result is the identification of the most productive strain (boxed strain in Fig. 4.4) which is then deposited as stock strain and used as the initial strain in another improvement cycle A-K". The production of this parent strain is taken as 100 %. On completion of the first cycle the production was increased by a factor denoted Z', after the second cycle by Z", etc.. 100 + Z'+ Z"+Z"
[ ~ A:I' A~'
mutogen
~- B
100 +Z' + Z"
~A,5_ K)
o r 4t-o
QJ I/) r r . _o 4-
(B o,, )
(C"')
(D"')
(E"')
(F "'1
(B")
(C")
(D")
(E")
(F")
E')
IF')
~00+ Z'
A_Z___ I ~.-K)
o r o.
mutagen
/
100 /~ porenf (~ sfroin
(A'-K)
(B')
(C')
(D')
Fig. 4.4 S c h e m e o f a m u t a t i o n s e l e c t i o n p r o g r a m m e . For e x p l a n a t i o n s see the text
This schematic illustration of the improvement process also provides information on the possibilities of its optimization. With advancing level of the improvement programme the production increments achieved in the resulting strains tend to decrease. The overall production rise is based on an ever-increasing number of strains whose acquisition requires the screening of an ever-increasing number of isolates from populations after mutagenic interventions. Optimization is in principle achieved by shortening the time needed for individual cycles, for example by perfecting and honing up the routine operations, and by automation of some steps or the whole programme. Mutagenesis and selection are based mostly on empirical rules, the theoretical genetical knowledge playing a relatively minor role in these operations. The molecular mechanism of action of individual mutagens is on the whole
100
relatively well known but their application is mostly a matter of routine because the action mode of the mutagens has no clear-cut relationship to the mode of application and the required results. Some mutagens belonging to alkylating agents have been successfully used (nitrogen mustard gas, ethyleneimine, N-methyl-N'-nitro-N-nitrosoguanidine) while others have not achieved a wide recognition (ethyl methyl sulphonate). The choice of a suitable mutagen for a mutagenesis improvement programme depends also on the strain in question and its history. Tradition also plays a role in that individual establishments tend to prefer certain groups of mutagens that have been successfully applied in the past (UV-irradiation plus nitrogen mustard, UV-light plus ethyleneimine). Although the repeated use of the same mutagen may bring useful results, a change of the mutagens after a certain time is recommended. Although such a change cannot be directly shown to bring about a useful mutation, it usually brings no adverse results and reduces the probability of inducing a resistance to the given mutagen. In addition to the selection of suitable mutagens, another important factor is the choice of suitable strains and their number. The mutation-selection process should preferably start with a single strain with the highest attainable production, or, better still, with two or three strains on which the primary intervention would be performed because the sensitivity of individual strains to the mutagen may vary. At later stages of the programme the number of treated strains should be increased. The following requirements should be met in order to ensure the success of a mutation-selection process: a) a suitable system for obtaining mutants of a given type, b) reliable screening system, c) suitable method for evaluation of results, d) reliable analytical methods, e) appropriate culture storage and preservation. Strain instability, variability of cultivation yields and assay errors can bring about variability of results (Fig. 4.5) and a large number of tests is then required to obtain a new production strain. The screening system is very important because it provides the basis for the least laborious selection of high production isolates. Optimization of the screening procedure should include the determination of: a) the number of screening steps, b) the number of isolates tested in the first screening, c) the number of strains taken for screening at the beginning of each cycle. Statistical evaluation of efficiency of screening procedures has shown a two-stage screening to be satisfactory for optimal assessment of isolates. The best results were achieved in a process in which the number of selected iso-
101
lates in the first and the second stage was reduced by the same factor. The number of strains taken for processing at the beginning of each cycle depends on the frequency of strains with higher production, a larger number of strains being necessary when the frequency of the high production strains in the experimental set is low. Since strains with a 10 % increase in production appear only rarely in later stages of the improvement programme the threshold should be set at a 5 % production increment, and higher productivity should be attained by multiple repetition of the treatment.
I
I
cuttivation
variQbitity
/
/
60 % __ a.ss.ay .
i
I
Fig. 4.5 Effect of different factors on variability of results
Selected strains have to be tested in the laboratory under conditions approaching as closely as possible the production setup. Improvement is essentially a selection of strains suitable for given cultivation conditions and production increase is then achieved by optimizing the culture conditions via selecting a more suitable medium for the strain in question. Strains with the highest production under laboratory conditions may fail on cultivation on the production scale. A scale-down process is then usually employed to find the basis of the failure. Such a process is described in Section 10.3.4.
4.5
MUTATION BIOSYNTHESIS (MUTASYNTHESIS)
Mutation biosynthesis (mutasynthesis) is a procedure in which a microorganism producing an antibiotic is mutagenized in order to acquire production-defective mutants blocked at a certain point of the biosynthetic pathway
102
responsible for the synthesis of a certain moiety of the antibiotic molecule. These blocked mutants are then supplemented with various natural or unnatural precursors and they synthesize new antibiotic derivatives. An essential prerequisite is that the cells should be able to assimilate the precursor; if not, then in vitro systems have to be used. These antibiotic-negative or-defective mutants have been termed idiotrophic (Nagaoka and Demain, 1975). The mutational biosynthesis can be illustrated by the following scheme:
a ~BN~ ,
~D
~/...I ~
DB
C,
E~
DE
Intermediate D arises in a biosynthetic pathway from C while another pathway produces intermediate B from A under the catalytic action of enzyme a. The two intermediates yield the end product DB. When the A --~ B pathway is blocked, the DB product is no longer synthesized and a new end product DE is formed on addition of compound E. Mutational biosynthesis was first used by Shier, Rinehart and Gottlieb (1969) in a strain of Streptomyces fradiae producing neomycins A, B and C to incorporate a biologically synthesized diaminocyclitol subunit of deoxystreptamine. Mutagenesis yielded a mutant incapable of deoxystreptamine biosynthesis; the biosynthesis was restored only on addition of deoxystreptamine to the medium. On cultivation in the presence of streptamine instead of deoxystreptamine the mutant produced two new antibiotic substances called hybrimycin A~ and A2. Epistreptamine, a C-2 epimer of streptamine, yielded another two antibiotics, hybrimycin B~ and B2. New biosynthetic analogues of the aminoglycosidic antibiotic butirosin were produced by mutasynthesis using mutant strains of Bacillus circulans (EIander and Chang, 1979). Further antibiotics obtained by mutasynthesis are listed in Table 4.4. A detailed survey of application of this method in the biosynthesis of new antibiotics, which are frequently more effective and otherwise more convenient than their prototypes, was published by Daum and Lemke (1979). Apart from purely production purposes the mutants blocked at certain points of the biosynthetic pathway are very important for studying antibiotic synthesis. The principle of mutational biosynthesis could also be used for the biosynthesis of new secondary metabolites other than antibiotics, but these lines of application have not yet been published.
103 Table 4.4 Some antibiotics obtained by mutation biosynthesis Original antibiotic Pyrrolnitrine Daunomycin Rifamycin B Sisomycin Streptomycin Penicillin N Gentamycin
4.6
Production microorganism
New antibiotic 4-fluoropyrrolnitrine adriamycin rifamycin W mutamycins streptomutin 6-(D)-(2-amino-2-carboxy)-ethylthioacetamido-penicillanic acid hydroxy- and deoxy-gentamycins
Pseudomonas aureofaciens Streptomyces peuceticus Nocardia mediterranei Micromonospora inyoensis Streptomyces griseus Acremonium chrysogenum Micromonospora purpurea
USE OF DEREGULATION OF METABOLIC PATHWAYS
The cellular regulatory mechanisms, which are described in some detail in Section 10.3.4, prevent the overproduction of both primary and secondary metabolites. In order to achieve metabolite overproduction, these regulatory mechanisms have to be artificially perturbed or disorganized. The deregulation of metabolic pathways has been successfully achieved using auxotrophic and regulatory mutants in which some metabolic pathways or their parts are
Table 4.5 Accumulation of amino acids by auxotrophic mutants Genetic trait (auxotrophy for)
Amino acid Lysine
threonine methionine + threonine homosefine
Diaminopimelic acid Homoserine
lysine
Valine Ornithine Tyrosine Phenylalanine Proline Citrulline
threonine isoleucine arginine + citrulline phenylalanine tyrosine isoleucine + histidine + ornithine isoleucine arginine
Production microorganism
Corynebacterium glutamicum Corynebacterium glutamicum Corynebacterium glutamicum, Brevibacterium flavum Brevibacterium flavum, Corynebacterium glutamicum Corynebacterium glutamicum, Brevibacterium flavum Corynebacterium glutamicum Corynebacterium gluta~icum Corynebacterium glutamicum Corynebacterium glutamicum Corynebacterium glutamicum Brevibacterium flavunl Corynebacterium glutamicum
104
either blocked or, in contrast, released from control. These mutants constituted the basis of biosynthetic production of amino acids (Kinoshita, Nakayama and Udaka, 1957), nucleotides and nucleosides (Hirose, Enei and Shibai, 1979), and played an important role in enhancement of production of enzymes, antibiotics, steroids and other compounds. 4.6.1
Overproduction of amino acids
A classical example of deregulation of metabolic pathways is the overproduction of amino acids by auxotrophic mutants which are defective in feedback inhibition or repression mechanisms. The relationship between accumulation of a certain amino acid and dependence on this amino acid is shown in Table 4.5. Figure 4.6a shows the accumulation of lysine by an auxotrophic mutant. Since L-lysine and L-threonine inhibit aspartokinase by a feedback mechanism, L-lysine is expected to be accumulated by mutants dependent on L-homoserine or L-threonine and methionine. Figure 4.6b shows schematically the
Asp----
asportate/3- semiotdehyde Asp-P -,,- Asp- CHO =//---~ Hse ~
Met
/3 - o sport y[ p ho s phctf.e,
t
Lys inhibition
Thre
J i
b -ketobutyrote i
gtucose/L-Thr
\
~
KB Pyr
repression
~/////Z inhibition
./ l~-aceto-~:-hydroxybutyrete I AHB //~--~-- L- lie "~- a~e'etotoctat6 ~ --- AL ) ~
// /
-- ] ~ L-Vat
J~,~-isopropytrnateate IAX-~ ~:- IPM ---~L-Leu
/////////~
Fig. 4.6 Lysine accumulation by a homoserine-dependent auxotrophic mutant (a) and accumulation of valine and leucine by an isoleucine-dependent auxotrophic mutant (b)
105 Table 4.6 Accumulation of amino acids by regulatory mutants Amino acid
Amino acid analogue
Lysine Threonine
S-(2-aminoethyl)-L-cysteine 2-amino-3-hydroxyvaleric acid
Arginine Histidine
2-thiazolylalanine 2-thiazolylalanine
Tryptophan Methionine
5-methyltryptophan ethionine
Production microorganism Brevibacterium flavum Brevibacterium flavum, Escherichia coil Brevibacterium flavum Corynebacterium glutamicum
1,2,4-triazolylalanine Escherichia coli Escherichia coli
accumulation of L-valine and L-leucine by feedback derepression in an auxotrophic mutant. In this case L-valine is accumulated by auxotrophic mutants dependent on L-isoleucine. Amino acid overproduction can also be achieved in regulatory mutants (Table 4.6). The overproduction principle in this case is the elimination of feedback regulatory mechanisms, or elimination of sensitivity of these mutants to the feedback regulation, i.e. to end-product inhibition or repression. Asp --~
Asp-P
inhibition
41
--~ A s p - C H O
--~ Hse - - ~ Met
Lys
Thr
t
1
1
~ / / / / / / J,// / / / / / / / /
///// ////
,
represslon
g///////////~ _
Fig. 4.7 Accumulation of lysine by a mutant resistant to lysine analogue (a) and accumulation of valine by a mutant resistant to valine analogue (b)
i06
The relationship between accumulation of an amino acid and the resistance to its analogue is given in Figure 4.7. The scheme in Fig. 4.7a concerns lysine biosynthesis by mutants resistant to the lysine analogue S-(2-aminoethyl)-Lcysteine, which are also insensitive to the feedback inhibition by L-lysine and L-threonine. Fig. 4.7 b illustrates the accumulation of L-valine by mutants resistant to its analogue, and hence insensitive to feedback repression.
Table 4.7 Accumulation of amino acids by auxotrophic regulation mutants (Nakayama, 1982) Amino acid
Genetic markers of the mutant
.
Tryptophan Tyrosine Phenylalanine Threonine Isoleucine Lysine Methionine
Phenal-, Tyr-, Trp analogue ~, Phenal analogue r, Tyr analogue r Phenal L, Trp analogue r, Phenal analogue ~, Tyr analogue r Tyr-, Phenal analogue r, Tyr analogue r Met-, Thr analogue r, Lys analogue r Met-, Thr analogue ~, Lys analogue ~, Isoleu analogue r Homoser ~, Leu-, Lys analogue ~ Thr-, Met analogue ~
Phenal -- phenylalanine, Tyr -- tyrosine, Trp -- tryptophan, Met -- methionine, Lys -- lysine, Isoleu -- isoieucine L - leaky, r - resistant
A combination of both approaches, i.e. application of auxotrophic regulatory mutants, can be used to further enhance the production of amino acids. These mutants are also more stable and are not subject to reverse mutations (Table 4.7). 4.6.2
Overproduction of nucleotides
Like in the overproduction of amino acids, overproduction of nucleotides can be attained by deregulating their biosynthetic pathways via isolation of auxotrophic and regulatory mutants. Strains overproducing inosine have to be blocked in adenyl synthetase to prevent the strict regulation of adenine nucleotides by phosphoribosylpyrophosphate amidotransferase, and also in nucieosidase to prevent decomposition of inosine to hypoxanthine. Also useful is deficiency in inosine monophosphate dehydrogenase and an active 5'-nucleotidase. Table 4.8 surveys the strains overproducing inosine and their genetic characteristics. Analysis of regulatory mechanisms and synthesis of purine nucleotides shows the following conditions to be important for acquisition of a strain overproducing guanine" deficiency in adenylosuccinate synthetase and guan-
107 Table 4.8 Inosine overproducing strains (modified after Hirose, Enei and Shibai, 1979) Inosine concentration (g 1-~)
Microorganism Bacillus subtilis (ade-, tyr-, his-)
16
Bacillus subtilis (ade-, his-, 5-nucleotidasestr~
IMP-dehydrogenaseweak) Bacillus pumilus (ade-)
20 16
ade -- adenine, tyr -- tyrosine, his -- histidine
Table 4.9 Selected strains overproducing guanine (modified after Hirose, Enei and Shibai, 1979) Guanine concentration (g 1-~)
Microorganism Bacillus Bacillus Bacillus Bacillus
subtilis subtilis subtilis subtilis
(ade-, (ade-, (ade-, (ade-,
red-, 8 AGr) trp-, red-, 6 AX r) his-, red-, MSOr) red-, 8 AGr, leu-, his-)
4.3 5.0 16.0 10.0
ade -- adenine, red -- guanosine monophosphate reductase, 8 AG -- 8-azaguanine, trp -- tryptophan, 6 AX -- 6-azaxanthine, his -- histidine, MSO -- methionine sulphoxide (glutamine analogue), r -- resistant osine m o n o p h o s p h a t e reductase, lowering of the rate of hydrolysis of purine nucleosides and deregulation of enzymes of the guanosine m o n o p h o s p h a t e pathway, in particular p h o s p h o r i b o s y l p y r o p h o s p h a t e amidotransferase, inosine m o n o p h o s p h a t e d e h y d r o g e n a s e and guanosine m o n o p h o s p h a t e synthetase. Some overproducing strains with these properties are listed in Table 4.9.
4.6.3
Overproduction of other metabolites
An illustrative example of application of knowledge of metabolic pathways is the isolation of strains of Bacillus licheniformis producing the antibiotic bacitracin. The limiting factor in the biosynthesis of peptide antibiotics is nonprotein amino acid, in this case ornithine. A genetic block at the point of ornithine degradation by ornithine-fl-transaminase causes an increase in bacitracin production and a drop in the concentration of glutamate and proline in the cells. These amino acids are formed from ornithine via arginine catabolic pathways (Fig. 4.8). Auxotrophic mutants, or mutants resistant or sensitive to metabolite ana-
108
logues or antimetabolites have also been used for overproduction of other metabolites, although the mechanisms leading to overproduction have not always been completely elucidated. By reverting auxotrophic strains of Streptomyces viridifaciens to prototrophic ones, in particular met- to met +, Dulaney and Dulaney (1967) obtained isolates producing 6 times more chlortetracycline than the parent strains. Similarly, Ichikawa et al. (1971) obtained strains of Streptomyces kasugaensis overproducing kasugamycin. Protine.
",~
fi Iufamaf-~e
Ornithine- 6- transQminQse ><
Arginine thine BacifrQcin
Fig. 4.8 Genetic block in bacitracin biosynthesis
Methionine participates in the biosynthesis of chlortetracycline and the reversion of mutants auxotrophic to this primary metabolite, which is a precursor of the secondary product, can be used as a suitable tool for acquiring strains overproducing the secondary metabolite. The production of the antifungal antibiotic pyrrolnitrine was increased more than 3 times in mutants resistant to fluorotryptophan or methyltryptophan. The pyrrolnitrine precursor D-tryptophan cannot be used in industrial production for economic reasons (Elander et al., 1971). In a similar way, based on the finding that a-aminoadipic acid, cysteine and valine are direct precursors in the biosynthesis of penicillins and cephalosporins, the production of these antibiotics was increased by isolating mutants resistant to the analogues of these and other amino acids (Chang and Elander, 1979). Isolation of strains sensitive to certain antimetabolites or growth inhibitors such as acriflavine or p-fluorophenylalanine provides strains overproducing primary or secondary metabolites, such as cephalosporin C. Analogously, the synthesis of cephalosporin C via increased consumption of methionine was achieved by isolating a strain of Cephalosporium acremonium sensitive to selenomethionine (Niiesch et al., 1976). Monofluoroacetate is known to inhibit aconitate hydratase which converts citrate into isocitrate in Candida lipolytica. Mutants sensitive to monofluoroacetate produce less aconitate hydratase and the ratio of synthesized citric acid to isocitric acid is 9 7 : 3 , while in unsensitive strains it is 60 "40 (Akiyama et al., 1972). Heavy metal ions such as Hg 2§ or Cu E§ form complexes which can play a role in production of fl-lactam antibiotics. Mutants resistant to metal ions overproduce fl-lactam antibiotics as a result of detoxification of these metals. Godfrey (1973) used this property to isolate Streptomyces lipmanii strains re-
109
sistant to copper phenylacetate and overproducing cephamycin while Elander (1982) acquired by a similar method strains resistant to mercury(II) chloride and overproducing cephalosporin C.
4.7
CELL AND PROTOPLAST FUSION
Although microorganisms possess natural recombination mechanisms the percentage of the resulting recombinants (hybrids) in the populations is very low. One of the main reasons is the fact that the cell wall forms a barrier preventing the fusion of cells of not only different species and genera, but also cells of the same species. The number of recombinants can be increased by breaking down the cell wall, thereby facilitating the fusion of cell contents. The method represents basically an induced cell fusion, or, in cases where cell fusion is not feasible, fusion of protoplasts and their subsequent regeneration to cells (Fig. 4.9). In addition, the cells or protoplasts can be transformed by transformation DNA added in the form of plasmid or phage vectors or fragments. These techniques permit intraspecies, but also interspecies or intergeneric crossing.
a
b
c
Fig. 4.9 Protoplast fusion. Protoplast preparation (a): cell wall (outer ring) is removed by enzymes. Induced fusion (b) in a medium with polyethylene glycol and Ca 2+. Reversion (c): cell wall is restored in an agar medium
4.7.1
Cell fusion
Several methods can be used for induced fusion of cells or, better, their contents or for the transfer of foreign DNA into the cell. The transfer of genetic information necessary for the genetic transformation of the recipient cells can be greatly facilitated by treating the cells with lithium acetate or acetates of other alkali metals, which act on the cell surface. Another method is microinjection (Celis, Graesmann and Loyter, 1980). With the aid of a micromanipulator, a borosilicate glass micropipette is used
llO
to inject recipient cells with the contents of another cell or a protoplast, DNA, chromosomes, mRNA, tRNA, etc.. Electrofusion or electroporation is another widely used system. Electric current is used to create pores in cell walls that allow the mixing of cell contents. The electroporation device consists of a regulator and a reactor. The regulator is an electronic setup allowing the production and regulation of an electric field that promotes the cell-cell interaction. The field parameters such as pulse amplitude, frequency, duration and number can be precisely adjusted. The cell-cell interaction takes place in the reactor, a vessel with positively charged electrodes whose distance to the cells can also be adjusted. Change in the distance allows a contact or a contact-free action of the electrode. The reactor vessel has a volume of 1 ml and the treatment usually takes less than three minutes.
4.7.2 Protoplast fusion
Protoplast preparation and regeneration The method of preparation and regeneration of protoplasts depends on whether the microorganisms used are prokaryotic or eukaryotic, and in the former case also on whether they are gram + or gram- organisms. A decisive factor dictating the use of various techniques of protoplast acquisition is the composition of the cell wall, a secondary factor being the physiological state of the cells (age). In gram + prokaryotes of the genera Micrococcus, Bacillus, Streptomyces and others, protoplasts are usually prepared by lysozyme treatment of the cells. The concentration needed for obtaining protoplasts of Micrococcus luteus is 1 ktg ml -~ whereas 50 l.tg ml -~ is necessary to obtain protoplasts from Bacillus megaterium. In most microorganisms the formation of protoplasts is stimulated by growth in nutrient media containing subinhibitory concentrations of glycine. Lysis of gram- cells takes place only after addition of complexing agents, such as EDTA. Cell walls are completely dissolved in isotonic or strongly hypertonic sucrose solutions (0.1 to 0.2 M) in which also the resulting protoplasts are stable. Fungal protoplasts are obtained with the aid of enzymes that cleave the glucan-mannan or chitin complex. Yeast protoplasts are prepared by treating the cells with the snail (Helix pomatia) gut lytic enzyme (helicase, sulphatase, glusulase) or zymolyase from Arthrobacter luteus (Peberdy, 1979). A more complex situation is usually encountered in filamentous fungi, and enzyme mixtures (glusulase, chitinase, cellulases, or lytic complexes isolated from streptomycetes) have to be used. Protoplasts can also be obtained from spores
111
but the treatment with lytic agents has to be considerably prolonged. Stabilization of fungal protoplasts is usually achieved with saccharides (yeasts) or inorganic salts (e.g. 0.6 M magnesium sulphate used with filamentous fungi). Protoplasts are regenerated in osmotically stabilized agar media either by washing off onto a softer agar using a hypertonic medium or by a direct plating on a regeneration medium. Protoplasts from filamentous fungi can be also regenerated in liquid media. The reversion frequency is never 100 % and it varies within one species as well as among different species by several to several tens per cent.
Protoplast fusion and its detection Optimum conditions for protoplast fusion are assured by the presence of polyethylene glycol (PEG) which was first used by Kao et al. (1974) for plant cell fusion. Since then this fusogen has been used in all types of microbial, plant and animal cells (Hopwood, 1981). The concentrations used in bacteria are 30-50 % (w/v) but the exact optimum concentration has to be experimentally determined for each species, and also the molecular weight of the PEG employed. The fusion is further stimulated by the presence of Ca 2§ and dimethyl sulphoxide (DMSO). The exposure to PEG can be relatively short, only slightly over 1 min. The PEG concentration used for fusion of fungal protoplasts is lower than that used for bacteria or animal cells, the optimum being between 25 and 30 % (w/v), and better results were achieved with higher-molecular-weight PEG. The pH optimum for fusion is 9.0 and the presence of Ca 2+ increases fusion efficiency. The so-called dead donor technique has been used for increasing the number of recombinants in prokaryotic microorganisms (Levi, Sanches Rivas and Schaeffer, 1977; Fodor, Demiri and Alf61di, 1978). Protoplasts of one of the two strains to be fused are first exposed to a lethal heat dose or to streptomycin, or, as in the case of streptomycetes, to light (Hopwood and Wright, 1981). Alternatively, both partners can be inactivated; Hopwood and Wright (1979) inactivated both strains of Streptomyces coelicolorthat were to be fused, and thereby achieved an appreciable increase in the number of recombinants, apparently by eliminating via this treatment damaged protoplasts incapable of fusion. Successful genetical work based on protoplast fusion also requires, naturally, an efficient method of detection of recombinant strains. As before, the traits used for the purpose include auxotrophy and resistance (antibiotics, acriflavine) or their combinations. For instance, Peberdy and Brandshaw (1982)
112
used auxotrophy and acriflavine resistance in Aspergillus nidulans and A. rugulosus as identification markers as opposed to prototrophy and acriflavine sensitivity.
4.7.3
Application in industrial microorganisms
Although most prokaryotic microorganisms possess natural recombination mechanisms is not quite clear to what extent transformations of protoplasts with plasmids can be used as compared with transformation and transduction into competent cells. However, it appears certain that both methods can yield strains overproducing enzymes (Young, 1980). When the direct transfer of genetic information into the competent cells is impossible for some reason, then protoplast fusion is an indispensable method for recombination. The examples given below illustrate these possibilities. FUsion of cells of two strains of Brevibacterium glutamicum, one of which produced large amounts of lysine but grew slowly while the other was a lowproduction strain with a high growth rate, yielded recombinant strains that overproduced lysine while simultaneously the cultivation period was shortened by two-thirds (Leuchtenberger and Kircher, 1986). A low-producing highly sporulating strain of Cephalosporium acremonium was recombined by protoplast fusion with a nonsporulating strain requiring inorganic sulphate instead of methionine. The resulting recombinant strain grew at a high rate, sporulated well, synthesized cephalosporin from sulphate, and the antibiotic production was increased by 40 % as compared with the parent strain (Hamlyn and Ball, 1979). Protoplast fusion is also used in combination with conventional mutagenesis programmes, usually (a) when the programme affords so-called unhealthy high-production microorganisms which are accumulated after a number of mutated generations and can then be recombined with healthy, even though low-producing, strains, or (b) when the mutation improvement yields a number of high-producing strains which are not used in further production; recombination of these high-producing strains can yield recombinants suitable for further mutagenic interventions. Diploid crosses obtained by fusion of Saccharomyces cerevisiae with Schizosaccharomyces pombe, and Candida tropicalis with Saccharomyces fibuligera, possessed the enzyme equipment of both parent strains. The fusion frequency was relatively low (10 -5) and the isolates differed in their stability (Provost et al., 1978). Another possible application of genetic recombination is the acquisition of a producer of a new antibiotics through the fusion of two producers synthesizing different or even the same antibiotic. Thus fusion of Streptomyces ri-
113
mosus v. kanamyceticus producing kanamycin, with S. kanamyceticus producing also kanamycin, afforded a recombinant producing neomycin.
4.8
DNA RECOMBINATION in vitro
In contrast to fusion of cells and protoplasts, which is used for recombining large parts of the genome in cases where the synthesis of the product is regulated in a complex way by a large number of genes, the technique of in vitro vector pBR325 EcoRI
foreign DNA
Apr
Tc r
?9
0RI
Eco RI digestion ...r_4AATTC...
1
9- -CTTA#IG- - -
~C~ " " A A T T"c.
]AA.-6'~
A
P
~
~
tc
ORI \
/
hybrid formation; covatent bond ( DNA tigase ) V
Ap r
TC r
ORI insertion inactivation of Cmr
i
iron sformation (Ap r, Tcr,Ams hybrid ptasmid)
Fig. 4.10 Cloning of foreign DNA into a plasmid vector from Escherichia coli by insertion inactivation. Following cleavage of vector pBR325 and foreign D NA by Eco RI restriction endonuclease the two DNA's are ligated. Insertion of DNA into the vector inactivates the gene responsible for chloramphenicol resistance (Cm'). The desirable clones can be detected after transformation as colonies resistant to ampicillin (Ap r) or tetracycline (Tc r) but sensitive to chloramphenicol (Cm ~)
114
D NA recombination is especially suited for cases when a small number of genes participates in product synthesis. A relatively simple laboratory technique based on the use of restriction enzymes can be employed to obtain D NA fragments which are then joined by ligases and the construct is transferred into a cell or a protoplast using a suitable vector. The procedure is schematically illustrated in Fig. 4.10 and its essential steps are" a) Selection of the enzyme whose gene is to be cloned. b) Selection of DNA containing the appropriate gene. c) Selection of a suitable vector (plasmid or phage). d) Recombination of the vector DNA with the donor DNA. e) Transformation in suitable cells. f) Identification of cells containing appropriate recombinant DNA. g) Acquisition of amplified DNA and its characterization. h) Gene modification. i) Insertion of modified genes into a compatible expression vector. j) Transformation of suitable cells. k) Growth of the cells, plasmid isolation and characterization. 1) Growth of cells containing the desirable product.
4.8.1
Preparation and cloning of DNA fragments
The donor DNA can be any DNA isolated from microorganisms, plant, animal and human cells. Although long DNA strands arise already during isolation due to spontaneous DNA fragmentation, shorter fragments are usually obtained by incubation with restriction enzymes (endonucleases). Some of the most frequently used restriction enzymes have hexanucleotide recognition sites and give rise to DNA fragments with four-base single-strand cohesion termini (Table 4.10). These are preferred over enzymes with pentanucleotide
Table 4.10 Restriction sites of some restriction endonucleases used for cloning (Churchward and Chandler, 1985) 5'-cohesive ends
BamHI --GIGATCC--
KpnI
--GGTAC] C---C[CATGG--
BglII
--A[GATCT---TCTAGIA--
PstI
--CTGCAIG--
EcoRI
--GIAATTC---CTTAAIG--
--CCTAGIG--
blunt ends
3'-cohesive ends
--GIACGTC--
PvuI
CTG---GTC I GAC--
SmaI --CCC IGGG---GGG CCC--
115
or tetranucleotide recognition sequences because the average length of the fragment may contain an average-length gene. The frequency of each hexanucleotide sequence in a polynucleotide containing the four standard bases in equal proportions is 1 in 4 6 (1 in 4096, i.e. genetic information sufficient for encoding a protein of 136 500 Da molecular weight). The resulting DNA fragments are incorporated into a suitable vector DNA molecule which serves as one component of the host/vector system. The other component is the host cell, very often a bacterial cell such as Escherichia coli, or a suitable eukaryotic cell. An ideal vector is a relatively small DNA molecule capable of autonomous replication in the host cell. Depending on the enzyme used for fragmentation of donor DNA and for linearization of the vector DNA, the resulting DNA molecules can have short protruding single-strand ends with complementary nucleotide sequences. This facilitates the spontaneous formation of recombinant DNA molecules. Addition of DNA ligase then brings about covalent closure of the DNA strand ends. Suitable host cells can take up the vector DNA molecules with the incorporated donor DNA by transformation. When the transformed cells reproduce, the in vitro recombinant DNA will replicate autonomously according to the specific properties of the vector used, giving rise to a recombinant D NA clone. Methods of in vitro DNA recombination with detailed protocols are described in a number of handbooks or manuals (Perbal, 1984; POhler and Timmis, 1984).
4.8.2
Cloning vectors
Cloning vectors should be small, physically and genetically well defined and easy to purify. Insertion of a foreign DNA fragment must not cause inactivation of any important gene of the vector DNA molecule. The vector DNA should contain multiple target sites for restriction enzymes and the foreign DNA fragments should be easily detectable. It should have strong promotors near the insertion site which ensure the transcription of the foreign DNA fragment. Detection is usually based on resistance to some antibiotics. The vectors include plasmid, phage, cosmid and shuttle vectors. Plasmid vectors
Plasmids are covalently closed circular extrachromosomal DNA particles carrying different numbers of genes (2 to 250). They exist autonomously in the cell cytoplasm or integrated in the chromosome in various numbers of copies
116
(1 to 100), the number of copies being inversely proportional to the size of the plasmid. Plasmid vectors have been prepared from plasmids from a number of microorganisms, especially of the genera Escherichia, Streptomyces and Saccharomyces. The number of newly constructed vectors increases rapidly and so does the number of microbial genera used for vector acquisition (Hopwood et al., 1983; Hardman and Cowland, 1985a,b; Jones and Woods, 1986; promoter ePrOduct-
~
nC;doinng
setection morker x~
j~Jterminotor reptication origin
Fig. 4.11 Idealized plasmid vector. The figure shows a circular double-stranded plasmid DNA with properties important for subsequent application. Replication origin is the DNA region required for replication of the plasmid in the host cell. The selection marker usually encoding resistance to an antibiotic ensures the possibility to select cells that have retained the plasmid. The DNA region encoding the product is bounded by promoter and terminator elements which affect the rate of product synthesis
~ 35.8 kb ~3000oMB1
~}!~Avat
~
-Boil
BR 322
Pvu II
\
/ ~ ' - ~ Bgtll
~
~
+]~x~ ~ Pst l
\ ~- Pst l \ ~ x_ Bgt II I~~ +nd111 Pst l BamHI s cp2*
I\
Fig. 4.12 Restriction maps of plasmids pBR322 and scp2". Data outside the circles denote target sites for restriction endonucleases. Numbers inside the pBR322 circle denote the number of base pairs, arrows denote construction of the plasmid from two plasmids and one transposon
117 Hi nd III
Hindlll Hindll EcoRI
XbalHind II ,EcoRI .~~~~-..
(
Hind III , #~r-
Pvul
~
2o0o 4ooo / \\ ~..~"" 00o / 1
mv ,, Hind III 7 EcoRI Pst ~ " Rvu Hpal Aval (Hindll) form
H
Ava I
Yhnl
FcoRJ
"-e32_/1
Hfnd I I l . . ~ ' X b a Rvu I1"Pvul '------~ Hind " III
Xbu,
form
23 XY R
Pvul Pvull ~ . . . . . .Hindlll EcoRI r,/
Hpal Aval (Hincll)
.Hpal . J l [ ] IFAva I [Hind II)-~\ \_2000 . . . . / ]/ Pvvl ~.\ \ __4 u u u / // Pst l "\\ \ --,,-,,-,n v ~'
Aval
Pvul Pvu II r , / . > ~
Hind lll.i
I
14 XY L
Hindlll Xbol " 4'000
Avol
/ sooo\
_]' 1000. Pst l '~000 - / Xl~alHindll k'xO~60010/
EcoRI 4,
Pvul Hpol -'-r--~. ^ _I Ava (Hincll)
HindlllEcoRI
Fig. 4.13 Restriction map of the yeast circular 2//plasmid (Broach, 1981). Different restriction sites are shown in the two illustrations of the plasmid. Upper panel -- inverted repeat sequences are denoted by a full line, lower panel -- repeat sequences denoted by parallel lines. Numbers inside circles denote base pair numbering
Kielland-Brandt et al., 1986). An idealized plasmid vector is shown in Fig. 4.11 and some of the most important plasmid vectors are given in Figs. 4.12 and 4.13.
Phage vectors Phage vectors are derived from the Escherichia coli bacteriophage and the q~C31 actinophage from Streptomyces lividans. They contain segments carrying genes that have no connection with the replication of the phage D N A . Deletion of these segments was used to construct phage molecules with lower molecular weight and a suitable n u m b e r of target sequences for restriction enzymes. The newly inserted D N A fragment should have a molecular weight identical with the deleted D N A segment. Phage vectors have the advantage of permitting the cloning of relatively large foreign D N A fragments, their integration into the chromosome, and, after phage induction, the acquisition of a large a m o u n t of cloned D N A fragments.
118
Cosmid vectors Cosmid vectors are used for cloning of large segments of prokaryotic and eukaryotic genomes in E. coli. These vectors consist of plasmid DNA which contains the usual markers ensuring cloning (genes ensuring selection and replication) and cos (cohesive terminal sites) of phage/1, sequences. The cos sequences of the plasmid molecule are recognized by specific/1, proteins and by protein precursors of the/1, phage head. The size of the cloned fragments in cosmids exceeds 4 kb. The phage receptor sites on the cell surface serve for the penetration of cosmid molecules with inserted foreign DNA fragments into the cell. These hybrid vectors of the/1, phage and a plasmid permit the cloning of very long DNA fragments and acquisition of so-called genome libraries from which individual genes can be obtained by specific methods.
Shuttle vectors These vectors have been constructed for intergeneric gene transfer and for the study of gene expression in heterologous hosts. They are in principle constructed by fusion of two vectors from the appropriate hosts, for example genera Escherichia-Bacillus, Escherichia-Streptomyces, Escherichia-Saccharomyces. Shuttle vectors have been constructed for Escherichia and Streptomyces from pACY177 and 184 (E. coli) and SLP 1.2 (S. coelicolor) and the DNA was transformed into S. lividans; other plasmids to be used were pBR322 and plJ101 (Taylor, Eckhardt and Fare, 1983). Highly efficient vectors for cloning in thesegenera are pJL197 and 198, which were obtained by fusion of scp 2* 50a I Sstl
~
6 Xho I
\
\ "10 Xbal 11 Hind III 13 12 BamHI Spill
Fig. 4.14 Bifunctional cosmid vector pJP3
119
from Streptomyces coelicolor and pBR322 from E. coli (Hersberger, Larson and Fishman, 1983), and the bifunctional cosmid vector pJP3 (Portmore, Burnett and Chiang, 1987) illustrated in Fig. 4.14. Vectors such as pAM 1, which consist mostly of E. coli DNA (ori, 2 marker genes suitable for cloning sites) and carry the leu § (prototrophic for leucine) gene as an eukaryotic marker, have been found to replicate autonomously in the yeast Saccharomyces cerevisiae when supplemented with replication origin from the yeast DNA (homologous cloning). This system was also extended to
eukaryotic DNA (CephaLospo-I rium)
teu 2
Fig. 4.15 Hybrid plasmid pCP2
heterologous cloning; so-called shotgun experiments (cf. Fig. 4.15) were used to select eukaryotic DNA ori segments from other cells or organelle DNA (Esser and Oeser, 1985). The pCP2 vector contains the eukaryotic segment of the mitochondrial DNA from the fungus Cephalosporium. For practical purposes it would be advantageous to perform the molecular cloning in eukaryotes with hybrid vectors containing a small eubacterial segment; this would allow a fast replication in the eukaryote and acquisition of sufficient amounts of material to be used in eukaryotes. The structure of such a vector is shown in Fig. 4.16. A vector of this kind would be universal for prokaryotes as well as eukaryotes provided the host DNA would ensure replication onset.
vr.-(S ' tet,oo2 Fig. 4.16 Scheme of a vector for eukaryotic cloning
120
4.8.3
Problems in the applicltion of molecular genetic methods in industrial microorganisms, and their solution
Despite examples of the successful use of molecular genetic methods in industrial processes (cf. Section 4.8.4), a number of problems still have to be tackled to enable their large-scale employment. The major problems are caused by the instability of extrachromosomal elements, incomplete knowledge of the genetical basis in a number of industrial microorganisms, and the toxicity of the products if these are synthesized in large concentrations.
Genetic instability of extrachromosomal elements The genetic instability of many extrachromosomal elements poses a number of problems. Recombined plasmids, or genes inserted into these plasmids, can be lost due to a number of mechanisms such as segregation, recombination with a chromosome, deletion, etc. (Meyer, 1986). Although the revertants, which arise by these mechanisms, are found in the population in low frequencies, they have a considerable selection advantage relative to the plasmid-containing cells. ' The genetic fia~tabifity can be alleviated using several methods: 1. Introduction of a particular gene into the plasmid, such as a) a gene resistant to an antibiotic introduced into a sensitive host cell, b) a gene encoding a phage repressor introduced into a lysogenic host which is lysogenized by the phage with a defective repressor, c) a functional gene for DNA synthesis introduced into a host cell mutant for this gene. 2. Regulation of expression of cloned genes (the cell is stressed only at the end of the growth phase). 3. The use of vector replicons which are naturally more stable than others. 4. Elimination of the homology between extrachromosomal elements and the host chromosome by using recombinant defective host cells. 5. Avoidance of the use of extrachromosomal elements which transfer transposons. The strategy of incorporation of antibiotic-resistant genes into plasmids, and introduction of these plasmids into a cell which is sensitive to the antibiotic, represents a thoroughly verified method for maintenance of plasmids in cells. This approach is economically unfeasible for the majority of bulk microbial productions, but it is suitable for the production of expensive substances such as interferon, hormones and some enzymes. The concept of using a plasmid with a gene for a phage repressor in a lysogenic host cell has ap-
121 peared independently in a number of research laboratories. If the lysogenic phage carries the repressor mutation, the loss of the plasmid will result in the induction of the phage and the death of the cell. Other cells in the populations will continue to be phage-resistant as long as they retain the plasmid carrying the repressor genes. A different strategy for the maintenance of a recombinant plasmid, whose expression results in a considerable metabolic stress being applied on the cell, is represented by the expression of cloned genes in plasmids. The metabolic stress then appears only at the end of the growth phase. This method minimizes the further growth of cells that have lost the recombinant plasmid. If an appropriate regulation circuit is introduced into the plasmid or into the cell, such a regulation of expression can be achieved by adding an inducer or performing temperature shifts. The use of stable vector replicons need not be explained in detail. Suffice it to say here, that their stability changes considerably depending on the bacterial species and strain used. Points 4 and 5 are closely related. One of the mechanisms of gene loss can be a recombination leading to deletions or shifts. In order to avoid the nucleotide sequence homology between the extrachromosomal element DNA and the host chromosome, recombinant defective host cells are often used. Gene loss or shift is also associated with the presence of transposons. For this reason, the construction of a recombinant plasmid has to be carried out in a way which ensures the removal of transposons.
Insufficient genetic characterization of industrial microorgan&ms In a number of industrial microorganisms, such as Corynebacteria, obligately anaerobic or extremely thermophilic bacteria, the genetic systems for gene cloning and introduction into the cells are still unknown. However, the development of new vectors and gene-transfer systems is so rapid that even these problems can be expected to be resolved in the near future. Rational approaches in this direction include: 1. The use of molecular genetic techniques for the isolation of genes and other genetic elements from industrial microorganisms, and their study in microorganisms whose genetic systems are well known (Escherichia coli, Bacil-
lus subtilis). 2. Development of systems for gene transfer into industrially important bacteria and fungi (promiscuous plasmids, cell and protoplast transformation and fusion). 3. Development of genetic systems in industrially important microorganisms and the use of their own genetic elements as vectors.
122
Product toxicity
This problem is relatively difficult to solve, as very little is known about the molecular basis of product toxicity. This holds for strains overproducing ethanol, butanol and acetone, organic acids, aromatic substances or antibiotics. The possible ways to address the problem include" 1. transfer of genes into microorganisms insensitive to the product, 2. transfer of genes tolerant to the product into production microorganisms, 3. determination of the molecular basis of toxicity and tolerance to the product. One or more genes can successfully be transferred into microorganisms exhibiting a high degree of tolerance to the product, whereas the transfer of genes regulating the whole metabolic pathway is very difficult. On the other hand, the transfer of genes tolerant to the product into high-producing microorganisms can be genetically rather complicated. The problem of product toxicity can also be alleviated technologically by using an in situ product isolation (see Chapter 12). 4.8.4
Possibilities of application in microbial processes
Techniques of in vitro DNA recombination can be used for constructing production microorganisms which would be difficult or impossible to construct by other genetical methods. The objectives of this approach are: a) production of gene products normally not synthesized by microorganisms, such as animal or plant proteins, b) construction of new metabolic pathways, c) enhancement of product yield per unit of substrate, d) increase of the gene dose and thereby also of product concentration, e) change of the regulatory mechanisms (increase in the rate of product formation), f) construction of microorganisms with particular properties (such as heat stability). DNA recombination in vitro has been used to construct microorganisms carrying genes encoding the synthesis of animal proteins such as insulin, growth hormones, interferons, enzymes and other products. The spectrum of the products obtained in this way steadily widens. The production microorganisms include mostly recombinant strains of Escherichia coli, Bacillus subtilis and Saccharomyces cerevisiae. The considerable advantage of the microbial production of these substances is the possibility of their highly effective bulk production based on the high specific growth rate of the microorganisms,
123
while a disadvantage is the secretion of other proteins with antigenic properties. The construction of a microorganism with a novel metabolic pathway is given in Fig 4.17. In the presence of ammonium ions, the E. coli aspartase relatively efficiently transforms fumaric acid into aspartic acid. The cis-isomer of fumaric acid, maleic acid, which is 30 % cheaper than fumaric acid, can be obtained via spontaneous hydration of maleic anhydride. E. coli does not grow on maleate whereas other microorganisms, such as the genus Pseudomonas, do so. The introduction of the maleate isomerase gene into E. coli allows the production of aspartate from a cheaper precursor. Meteic Qnhydrid e
Mateic ~ctc id
mQteefeisomerQse Pseudomonas
z
gene ma~otion AspQr'fic QCid
esparfase E. cob', Brevibac#erium flavum
FumQric ctcid
Fig. 4.17 Construction of a new metabolic pathway in Escherichia coil using genes from two different microorganisms (Jackson, 1981)
Another possibility is the construction of a new metabolic pathway for the biosynthesis of new antibiotics, for instance the introduction into the cell of a gene encoding two or more different metabolic pathways leading to the biosynthesis of a particular antibiotic. It can be expected that the action of enzymes from a particular pathway on the intermediates and end products of the other pathway will bring about the synthesis of a new antibiotic. An example of achieving an enhanced product yield from substrate is the cloning of the E. coli gene for the ATP-independent glutamate dehydrogenase, and its transfer into the obligately methylotrophic bacterium Methylophilus methylotrophus using a plasmid vector (Windass et al., 1980; Senior and Windass, 1980). This bacterium grows on a mixture of methanol, ammonium ions and salts. It does not assimilate ammonium ions via the glutamate dehydrogenase pathway but via the glutamine synthetase-glutamate synthetase reaction which consumes 1 mole ATP per mole ammonia. A recombinant plasmid containing the glutamate dehydrogenase gene was transferred into Methylophilus cells, in which it is expressed and is stable. The resulting strains utilized the substrate carbon 4 to 7 % more effectively than parent strains, because less ATP was needed for ammonia assimilation owing to the presence of the ATP-independent E. coli glutamate dehydrogenase.
124
Increased gene dose can be achieved by amplification of phages or plasmids, which brings about an increase in their copy numbers. Incorporation of the trp operon, which is normally present in the E. coli chromosome, into the transduction phage 2, and its amplification leads to massive tryptophanase production, which may bring the content of the enzyme to some 50 weight per cent of the total soluble cell proteins (Moir and Brammar, 1979). Recombination was used to construct a strain of Bacillus subtilis which produced a-amylase at a rate 250 times higher than the parent strain (Yoneda, 1980). Successive recombination steps yielded mutants R3, amy S, pep S, tmr and pap M 118, each of which exhibited a 2- to 7-fold higher production of the enzyme than the preceding strain. Another example of gene amplification, based on the use of a yeast plasmid, was published by Gerbaud et al. (1979). The ura 3 gene was ligated to the 2 ~tm yeast plasmid and the construct was transferred into a bacterial plasmid. Transformation of yeast protoplasts with this hybrid plasmid yielded a 30-fold increase in the specific activity of orotidine-5-monophosphate carboxylase. It would also be beneficial to transfer the operons responsible for antibiotic production from the slowly growing streptomycetes into fast-growing eubacteria such as E. coli or B. subtilis. The faster growth would probably be reflected in a better reproducibility of antibiotic production; other advantages would include a better substrate utilization caused by the more convenient cell surface/volume ratio and better oxygen transfer. The above examples illustrate the possibilities of using recombination methods for constructing new types of production microorganisms with increased production of important metabolites. The spectrum of methods and their applications is certain to increase vastly in the years to come.
4.9
TOTAL GENE SYNTHESIS AND DIRECTED MUTAGENESIS
These two methods make it possible to change any predetermined sites in genes, and to study the effects of these changes on the function and activity of the encoded proteins. This approach, often termed protein engineering, is highly promising both in terms of theoretical studies and of practical applications.
4.9.1
Total gene synthesis
It is currently possible to synthesize DNA chemically according to a predetermined plan, using gene synthesizers. This strategy is based on the classical work of Khorana et al. (1976) concerning gene synthesis. It consists
125
in the synthesis of overlapping oligonucleotides, which are synthesized separately and then are linked to form required sequences (Fig. 4.18). The question which has not yet been fully clarified is the selection of the codon (Winnacker, 1984). How critical this selection can be is shown in Fig. 4.19, which compares the use of codons for strongly and weakly expressed genes from E. coli. Especially striking are the codons AUA for isoleucine, CGC and CGA for arginine and GGA for glycine. A limited use of these codons in strongly expressed genes correlates well with the low concentration of the corresponding tRNA. 151
126
b A AGGGGGTGGTGGTAGTGAAAGTTTTCAGGCTTTCTTAA 5' G. \rT TCCCCCACCACCATCACTTTCAAAAGTCCGAAAG
3'
TTGGAAGCT TCAGCTACTGCCGTC TAAATCTC A G I I I I I
11
I
I
I
I
!
!
I
I
I 1 I
I
i
I
I
I
I
!
I
I !
I
I
!
i
!
/
A ACCT TCGAAGTCGATGACGGC AGATTTAGAGTC T
~AGC ATTACCCGTGGTGGGGTTCCCGAGCGGCC AA A I A-q 'CCGGACGAGGGAATAGCCCTTCGCCCCGCGTAG TA I
11
i
I
I
I
I
I
!
i
I
!
!
I
1 I
I I
!
!
1 I
I
1
!
!
I!
1
! I
I
I l"
G GCCTGC TCCCT TATCGGGAAGCGGGGCGCATC AT~
PROMOTER----~
o A,A A?AQTT??A, TT?TG, A A,A TG, T ? ? ? c G c g c A ? \
5' A A T T C T T T C T C A A C G T A A C A C T T T A C A G C G G C G C G T C '
-56 Fig. 4.18 Structure of the tyrosine t R N A suppressor gene (Khorana et al., 1976). Small triangles denote sizes of individual oligonucleotides which are reassociated with the gene
It should be noted that the synthesis of a particular functional DNA segment without the knowledge of the nucleotide sequence is very difficult, as seen from the following simple calculation. The genetic alphabet is composed of only four nucleotides, the total information carried by the nucleic acids being determined by the linear arrangement of these four building blocks. This implies that the number of nucleotide combinations N containing n building blocks, is given by N = 4". The number of possible combinations in even
126 U
C
strong weak
A
strong weak
strong weak..
93
36
87
49
6
37
ochre
64
12
62
amber
73
21
29
39
151
113
102
12
71
16 26
33
69
-~3
22
345
G
Set
Pro
Cys
..
19
His
g0
294
L162
101
169
166
67
156
103
/,8
13
101
262
118
137
110
159
98
--~2
27
15
32
S 259
1 63
140
130
28
76
192
108
173
87
41
66
119
48
83
123
Fig. 4.19 Selection
I 119 L129
10 1479
{
25
66
204
106
333
210
106
98
22 3
9s
lC)1
133
-.~-3
27
--~ 1
42
10
56
-.,,
Arg ~.
Set
\ 106 44 Asp< 116 183 i Gtu
39
05
38
q
t -23
Trp
45
Lys
34
opa 1
I 26
Thr
[ " 13
Arg
r
t 40 t--
61
r ---~ 3
28
I!226 Ll 1
17
124
174
140
--=- 4
42
.--~14
66
of a codon for strongly and weakly expressed genes (Grosjean and Fiers,
1982)
small nucleotides is large, for instance 106 for small chains of 10 nucleotides and 10 ~2 for 20-nucleotide chains. Let us illustrate further the significance of these numbers by assuming that a part of a gene representing 20 nucleotides should be systematically altered and then functionally tested. If this work was being carried out by the whole population of our planet, i.e. 4.5 billion people, each of whom would construct and test one combination per day, the total number of combinations tested in a year would be 1.5 • 10 ~2. In other words, it would take almost a year before a suitable combination with an optimum function would be found (Arber, 1985). However, since most genes contain more than 20 nucleotides, this random procedure is clearly utterly unsuitable for synthesizing new genes. An average gene can contain some 1000 nucleotides. The number of combinations N with 1000 building blocks is 4 ~~176176 or 106~ This shows how important
127
is the basic knowledge of specific biological functions of such systems. Only with the aid of this knowledge is it possible to perform manipulations or use synthetic oligonucleotides for improving current functions, or for creating new ones.
4.9.2
Site-directed mutagenesis
The detailed analysis of the structure and function of microbial genes requires the acquisition of data about the complete nucleotide sequences. These include the information about the signal sequences participating in the gene expression (promoters, operators, attenuators, terminators, ribosomal binding sites), which determine the amino acid sequences in the proteins. When the functional role of individual nucleotides or amino acids has been assessed, it is possible to change base pairs in a predetermined way at precisely defined points (site-specific), or to accomplish random changes of base pairs in defined DNA regions (region-specific). Using this method, the genes encoding enzymes can be mutagenized in order to obtain enzymes with altered (improved) catalytic activity (protein engineering, protein construction). A number of methods are used for site-directed mutagenesis. Some of them are based on treating isolated DNA regions with chemicals (methoxamine, sodium disulphite; Shortle and Nathans, 1978; Shortle, Dimaio and Nathans, 1981). Another strategy makes use of the faulty incorporation of a nucleotide, when suitable DNA polymerases are used for the in vitro synthesis of a double-strand DNA on a single-strand wild-type DNA template (Shortle et al., 1982). Still another method, the oligonucleotide directed mutagenesis (Zoller and Smith, 1982; Dalbadie-McFarland et al., 1982), makes use of the fact that the M 13 phage has a single-strand genome, and cloning in this phage can be used to convert any DNA to a single-strand form. The resuiting DNA strand can be hybridized with a synthetic oligodeoxyribonucleotide carrying the required change, for instance in a single nucleotide. Elongation of this primer by DNA polymerase can yield a population of phages carrying the mutagenized incorporated DNA. Winter et al. (1982) cloned the gene for tyrosyl-tRNA-synthetase from Bacillus stearothermophilus into a vector derived from the bacteriophage M 13, in order to facilitate the mutagenesis with incorrectly linked oligodeoxyribonucleotide primers. The recombinant M13 clone yielded enzyme levels corresponding to more than 50 weight per cent of the soluble protein expressed in the host cell of E. coli. The replacement of Cys-35 at the active site of the enzyme with serine led to a decrease in the activity of the enzyme, which was ascribed to lowered Km for ATP. Alkaline proteases or subtilisins are readily inactivated; this inactivation
128
was found to be based on the oxidation of the sulphur atom in Met-222, in the vicinity of the active site of the enzyme. Substitution of Met-222 with amino acids less sensitive to oxidation, such as alanine, serine or leucine leads in all cases to an increased resistance to 1 M hydrogen peroxide; the specific activity of the enzyme rises from 0.3 % (Lys-222) to 50 % (Ala-222) relative to the wild-type strain (Wells, Vasser and Powers, 1985). These activities can hardly be predicted by modelling. The increased resistance to oxidation in subtilisinproducing mutants will make it possible to introduce a new series of products including enzyme detergents for bleaching. The key to increasing the temperature and pH stability of an enzyme is the introduction of disulphide bonds into the enzyme molecule. This can be accomplished by replacing cysteines with serine pairs bonded by hydrogen bonds, or with methionines whose methyl group is in contact with the a-carbon of glycine. Insertion of disulphide bonds into the T4 lysozyme extends its life-time at 67 ~ and pH 8 from 11 min to more than 6 hours (Perry and Wetzel, 1986). The replacement of the cysteine Cys-17 with serine also enhances the antiviral activity of fl-interferon. The resistance of triosephosphate isomerase to heat denaturation can be increased by replacing tWO asparagines (which become deaminated at elevated temperatures) with threonines. The modified enzyme retains its activity at 100 ~ for a period which is twice that found in the native enzyme (Bialy, 1986).
REFERENCES Akiyama, S., Suzuki, T., Sumino, Y., Nakao, Y., Fukusa, H. (1972) Agric. BioL Chem. 36, 339. Arber, W. (1985) Swiss Biotechnol. 3(1), 7. Bialy, H. (1986) Biotechnology 4, 683. Broach, J. R. (1981) The yeast plasmid 2 p circle. In: The Molecular Biology of the Yeast Saccharomyces. The Life Cycle and Inheritance, Cold Spring Harbor. Brown, S. W., Oliver, S. G. (1982) Eur. J. Appl. Microbiol. Biotechnol. 16, 119. Calam, C. T. (1964) Progress Ind. Microbiol. 5, 1. Carter, B. L. A., Doel, S., Goodey, A. R., Piggott, J. R., Watson, M. E. W. (1986) Microbiol. Sci. 3, 23. Celis, J. E., Graesmann, A., Loyter, A. (1980) Transfer of Cell Constituents into Eukaryotic Cells. New York. Chang, L. T., Elander, R. P. (1979) Dev. Ind. Microbiol. 20, 367. Churchward, G., Chandler, M. (1985) In vitro recombinant DNA technology. In: Comprehensive Biotechnology 1, New York. Cohen-Bazire, G., Jolet, M. (1953) Ann. Inst. Pasteur84, 937. Cuskey, S. M., Frein, E. M., Montenecourt, B. S., Eveleigh, D. E. (1982) Overproduction of cellulase -- screening and selection. In: Overproduction of Microbial Products, London.
129 Dalbadie-McFarland, G., Cohen, L. W., Riggs, A. D., Morin, C., Itakuba, K., Richards, J. H. (1982) Proc. Nat. Acad. Sci. USA 79, 6409. Daum, S. J., Lemke, J. R. (1979) Ann. Rev. Microbiol. 33, 241. Davis, B. D. (1948) J. Am. chem. Soc. 70, 4267. Demain, A. L. (1971 a) Methods Enzymol. 22, 86. Demain, A. L. (1971b) Adv. Biochem. Eng. 1, 113. Downie, J. A., Garland, P. B. (1973) Biochem. J. 134, 1051. Dulaney, E. L., Dulaney, D. D. (1967) Trans. N.Y. Acad. Sci. 29, 782. Elander, R. P. (1982) Traditional versus current approaches to the genetic improvement of microbial strains. In: Overproduction of Microbial Products, London. Elander, R. P., Chang, L. T. (1979) Microbial culture selection. In: Microbial Technology 2, New York. Elander, R. P., Mabe, J. A., Hamill, R. L., Gorman, M. (1971) Folia Mierobiol. 16, 157. Englesberg, E., Irr, J., Power, J., Lee, N. (1965) J. Bacteriol. 90, 443. Esser, K., Oeser, B. (1985) Process Biochem. 20(3), 86. Fodor, K., Demiri, E., Alf61di, L. (1978) J. Baeteriol. 135, 68. Francis, C. J., Hansche, P. E. (1972) Genetics 70, 59. Gerbaud, C., Fournier, P., Blanc, H., Aigle, M., Heslot, H., Guerineau, M. (1979) Gene 5, 233. Godfrey, O. W. (1973) Antimicrob. Agents Chemother. 4, 73. Grosjean, H., Fiers, W. (1982) Gene 18, 199. Hamlyn, P. F., Ball, C. (1979) Recombination studies with Cephalosporium acreminium. In: Genetics of Industrial Microorganisms, Washington, D.C. Hardman, D. J., Cowland, P. C. (1985a) Microbiol. Sci. 2, 90. Hardman, D. J., Cowland, P. C. (1985b) Microbiol. Sci. 2, 184. Herschberger, C. L., Larson, J. L., Fishman, S. E. (1983) Ann. N. Y., Acad. Sci. 413, 31. Hirose Y., Enei, H., Shibai, H. (1979) Ann. Rep. Ferm. Proc. 3, 253. Hopwood, D. A. (1970) The isolation of mutants. In: Methods Microbiol. 3A, London. Hopwood, D. A. (1981) Ann. Rev. Microbiol. 35, 237. Hopwood, D. A., Wright, H. M. (1979) J. Gen. Microbioi. 111, 137. Hopwood, D. A., Wright, H. M. (1981) J. Gen. Mierobiol. 126, 21. Hopwood, D. A., Bibb, M. J., Bruton, C. J., Chater, K. F., Feitelson, J. S., Gil, J. A. (1983) Trends Biotechnol. 1(2), 40. Horuichi, T., Tomizawa, J. I., Novick, A. (1962) Biochim. Biophys. Acta 55, 152. Hsu, E. J., Vaughn, R. H. (1969) J. Bacteriol. 98, 172. Ichikawa, T., Date, M., Ishikura, T., Ozaki, A. (1971) Folia Microbiol. 16, 218. Jackson, D. A. (1981) Molecular genetics and microbial fermentations. In: Trends in the Biology of Fermentations for Fuels and Chemicals, New York. Jones, D. T., Woods, D. R. (1986) Microbiol. Sci. 3, 19. Kao, K. N., Constabel, F., Michayluk, M. R., Gamborg, O. L. (1974) Planta 120, 215. Khorana, H. G., Agarwall, K. L., Besmer, P., Btichi, H., Gruthers, M. H., Cashion, P. J., Fridkin, M., Jay, E., Kleppe, K., Kleppe, R., Kuma, A., Loewen, P. C., Miller, R. C., Minamoto, K., Panet, A., Ray Bhandary, U. L., Ramamoorty, B., Sekiya, T., Takeya, T., van de Sande, J. J. (1976) J. Biol. Chem. 251,565. Kielland-Brandt, M. C., Casey, G. P., Gjermansen, C., Holmberg, S., Nilsson-Tillgren, T., Petersen, J. G. L., Polaina, J. (1986) Swiss Biotechnol. 4(1), 18. Kinoshita, S., Nakayama, K., Udaka, S. (1957) J. Gen. Appl. Microbiol. 3, 276. Krumphanzl, V., Sikyta, B., Van6k, Z. (1982) Overproduction of Microbial Products, London. Leuchtenberger, W., Kircher, M. (1986) Swiss Biotechnol. 4(1), 18. Levi, C., Sanches Rivas, C., Schaeffer, P. (1977) FEMS Letters 2, 323.
130 Matelovh, V., Musilkov~i, M., Ne~/lsek, J., ~mejkal, F. (1955) Preslia 27, 27. McDonald, K. D. (1976) Genetics of Industrial Microorganisms, London. McFall, E. (1964) J. Mol. Biol. 9, 746. Meyer, H.-P. (1986) Swiss Biotechnol. 4(1), 7. Moir, A., Brammar, W. J. (1979) Molec. Gen. Genetics 149, 87. Nagaoka, K., Demain, A. L. (1975) J. Antibiotics 28, 627. Nakayama, K. (1982) Breeding of amino acid producing microorganismns. In: Overproduction of Microbial Products, London. Novick, A., Horiuchi, T. (1961) Cold Spring Harbor Symp. Quant. Biol. 26, 239. Ntiesch, J., Hinnen, A., Liersch, M., Treichler, J. H. (1976) Final steps in the biosynthesis of cephalosporin C and some aspects of methionine and lysine metabolism of a Cephalosporium sp. In: Genetics of Industrial Microorganisms, London. Peberdy, J. F. (1979) Ann. Rev. Microbiol. 33, 21. Peberdy, J. F., Brandshaw, R. E. (1982) Inter-species hybridization in fungi -- implications for metabolite production. In: Overproduction of Microbial Products, London. Perbal, B. (1984) A Practical Guide to Molecular Cloning, New York. Perry, L. J., Wetzel, R. (1986) Biochemistry 25, 733. Portmore, J. J., Burnett, W. V., Chiang, S. J. (1987) Biotechnol. Lett. 9, 7. Provost, A., Bourguignon, C., Fournier, P., Ribet, A. M., Heslot, H. (1978) FEMS Lett. 3, 309. Ptihler, A., Timmis, K. N. (1984) Advanced Molecular Genetics, Berlin. Rotman, B. (1961) Proc. Nat. Acad. Sci. USA 47, 1981. Sebek, O. K., Laskin, A. I. (1979) Genetics of Industrial Microorganisms, Washington, D. C. Senior, P. J., Windass, J. (1980) Biotechnol. Lett. 2, 205. Shier, W. T., Rinehart, K. L., Gottlieb, D. (1969) Proc. Nat. Acad. Sci. USA 63, 198. Shortle, D., Nathans, D. (1978) Proc. Nat. Acad. Sci. USA 75, 2170. Shortle, D., Dimaio, D., Nathans, D. (1981) Ann. Rev. Biochem. 15, 265. Shortle, D., Grisafi, P., Bencovic, J. J., Botstein, D. (1982) Proc. Nat. Acad. Sci. USA 79, 1588. Sikyta, B. (1983) Methods in Industrial Microbiology, Chichester. Sikyta, B. (1991) Directed Selection of Microorganisms in Continous Culture, Prague. Sikyta, B., Pavlasov~, E., Stejskalov~, E. (1986) Acta Biotechnol. 6, 109. Srienc, F., Campbell, J. L., Bailey, J. E. (1983) Biotechnol. Lett. 5, 43. Taylor, D. P., Eckhardt, T., Fare, L. R. (1983) Ann. N. Y. Acad. Sci. 413, 47. Tsang, E. W. T., Groot Wassink, J. W. D. (1985) Biotechnol. Lett. 7, 179. Van6k, Z., Hogt'hlek, Z., Cudlin, J. (1973) Genetics of Industrial Microorganisms, Amsterdam. Wells, J. A., Vasser, M., Powers, D. B. (1985) Gene 260, 6518. Windass, J. D., Worsey, M. J., Pioli, E. M., Pioli, D., Barth, P. T., Atherton, K. T., Dart, E. C., Byrom, D., Powell, K., Senior, P. J. (1980) Nature 287, 396. Winnacker, E. L. (1984) Swiss Biotechnol. 2(4a), 33. Winter, G., Fersht, A. R., Wilkinson, A. J., Zoller, M., Smith, M. (1982) Nature 299, 756. Yoneda, Y. (1980) Appl. Environm. Microbiol. 39, 274. Young, F. E. (1980) J. Gen. Microbiol. 119, 1. Zamenhof, S., Eichhorn, H. H. (1967) Nature 216, 456. Zoller, J. J., Smith, M. (1982) Nucleic Acids Res. 10, 6487.
131
5
RAW MATERIALS
Whereas in most branches of industry the conversion of raw materials to final products amounts to 50 to 90 % by weight, in microbial processes raw materials represent a 50- to 100-fold multiple of the final product weight. Compared with other industries, the demands for amount and quality of raw materials used for production of microbial products are substantially higher. The quality control of raw materials is given special attention because most of the final products are used predominantly in medicine and food industries, and production microorganisms are very sensitive to the content of trace substances in raw materials. Raw materials are used for setting up nutrient media, for isolation of products and their processing into the final form. The function of nutrient media in microbiology is similar to that of the chemical reaction medium; in addition, they have to meet basic demands for permitting biochemical processes to take place: they have to sustain microbial growth and product formation. Such a suitable medium is usually achieved by transforming individual raw materials (substrates) into a liquid form, although under certain circumstances solid or gaseous substrates are also used. Biochemically speaking, substrates can be divided into basic, which contain low amounts of chemical energy (e.g. water, carbon dioxide, oxygen, nitrogen), high-energy or macroergic, and intermediate substrates arising during the conversion of basic substrates into the high-energy ones. For each industrial production the costs of raw materials are of decisive importance and have to be made up for either by a large-scale production of cheap products, or a small-scale production of expensive products. The suitability of raw materials is governed not only by their price but by a number of other factors such as the necessity of material processing before use, availability and stable quality, energy and water requirements, quality of the final product and possibilities of competitive use of the raw material for another production. These factors add up in investment and operational costs and thereby affect the price of the final product. Industrial microbial processes are under constant pressure towards employing cheaper and better substrates. Yet what is a cheaper substrate? A cheaper substrate may have a lower stability on storage, cause problems in
132
sterilization, or have variable quality. And what is a better substrate? Productivity increase need not necessarily be decisive since the substrate may contain traces of admixtures that are extremely difficult to remove after cultivation, or may not always be suitable, for example, for human use and therefore fail to be approved by appropriate authorities (Ratledge, 1977). An advantage of microbial processes over other industrial operations lies in the possibility of using several types of raw materials for the same purpose. When the price of one of them rises, a cheaper one can be used instead. If the prices of all raw materials rise the only solution is to raise the prices of products. Variable prices of raw materials also bring about shifts in products range. For instance, increased prices of raw materials necessary for a b i o p r o duct production may elevate the price of the product to a critical level. If anil alternative chemical synthesis is available for a given product, chemical pro, cess is introduced at the expense of the microbial process. Processes the least
Plant raw materials
Primary
/
saccharides and oligosaccharides
L___ polysaccharides
starch inulin cellulose
Secondary
molasses: beet, cane hydrol date syrup corn steep liquor yeast extract soya peptone lignocelluloses
sulphite liquor seed husks
Waste
plant debris
straw bagasse nut skin
after vegetable processing
corn or tuber steep sour cabbage onion peelings wastes after legume boiling
after fruit processing
citrus fruit apples, pears bananas (pith) pineapples mango
133 Animal raw materials
Primary
]
lactose animal fats
Secondary
whey chitin
Waste
from meat, poultry, fisheries pigsty or cowshed wastes municipal waste
Chemical and petrochemical raw materials
gases: CH4, CO2, CO oil products: n-alkanes C-sources alcohols acids ammonium" NH~-, (NH4)2SO4, NHaC1 N-sources
inorganic nitrates, nitrites organic synthetic: urea
Trace elements" atomic numbers 23--30, 42, 48 Precursors Fig. 5.1 Raw materials resources
affected by increased raw material prices are those for which the alternative chemical production is complicated or unfeasible, as in the case with antibiotics and secondary metabolites in general. A substantial change in raw materials may promote a substantial change in technology. This happened on introducing hydrocarbons in the Sixties when, for instance, production of citric acid shifted from the traditional use of Aspergillus niger to processes based on yeasts utilizing n-alkanes (Shennan and Levi, 1974). When setting up formulae for nutrient media the price of carbon sources plays an important role since these substances are used in the largest weight amounts. They may differ considerably in the carbon content. On comparing seemingly widely different substrates from the broad spectrum currently available, their price referred to the carbon content tends to be about the same; thus the same amount of biomass can be produced from 100 tonnes of saccharides and from 200 tonnes of n-alkanes. Importantly, raw materials used in microbial processes should be available all the year round. A number of natural raw materials are produced seasonally; since these raw materials tend to become contaminated on storage, the problem arises of how to maintain their quality for the following 6 to 9
134
months. An important economic factor is the transportation costs. Waste or auxiliary raw materials with an excessively high water content have a limited applicability when the distance of the production plant from the collection or loading point is too great; it is therefore recommended to build the plants in the vicinity of the resource point location. Very few data exist on the actual use of certain types and quantities of raw materials. These data are as a rule kept secret because of competition. Types of raw materials of different origin used in microbial processes are outlined in Fig. 5.1.
5.1
WATER AND ASSOCIATED PROBLEMS
One of the main drawbacks of enzyme catalysis is that it usually takes place in an aqueous medium. As compared with chemical processes, microbial processes employ substantially lower concentrations of the reactants, for several reasons: a) Concentrations of microbial catalysts are usually low because the microbial growth is limited by various substrates, especially oxygen. b) Reaction products act frequently as production inhibitors, often in relatively low concentrations. e) High concentrations of substrates may inhibit product formation; for instance a high concentration of glucose or sucrose prevents, through catabolite repression, the production of an antibiotic. For economic reasons, enzyme reactions take place at relatively low concentrations of both substrates and enzymes. Although biocatalysts require mostly aqueous medium and are used in dilute solutions or suspensions, some of them react also on a liquid-liquid interface or in the presence of a high concentration of substrate dissolved in a phase immiscible with water. Despite all advances in increasing the productivity of microbial processes the concentrations of products remain fairly low. In the case of organic acids and amino acids they amount to some 10-12 weight per cent, with antibiotics about 3 % and with vitamins 1%. Large amounts of water are consumed in cooling, washing and other auxiliary operations. It is therefore desirable to introduce water recirculation, especially in large-scale production plants. Preparation of nutrient media and washing of microbial biomass in microbial processes are performed with drinking water. Technical quality water is used for media cooling after sterilization, regulating culture temperature and washing cultivation and isolation devices. When drinking water is in short
135
supply, processed water of a lower quality can be used instead. The necessary treatment of the lower-quality water can include the following steps: a) chemical treatment consisting of iron removal, stripping of free chlorine, elimination of aggressive carbonic acid and adjustment of water hardness; b) removal of suspended substances by sedimentation and filtration; c) removal of microorganisms by filtration, sterilization or disinfection; d) separation of colloids by reverse osmosis. The quality of water can vary and has to be regularly checked by chemical and biological tests. Water containing even traces of ammonia, nitrous or nitric acid salts and more than 100 germs per 1 ml is unacceptable. Higher content of heavy metals in the water inhibits microbial growth and causes corrosion of cultivation devices; calcium and magnesium complicate the utilization of some nutrients by microorganisms.
5.2
PLANT RAW MATERIALS
These include natural materials produced in agriculture or forestry -- cereals, root or tuber crops, wood pulp, etc.. The materials can be divided into several groups. Primary (major) materials, such as saccharides, polysaccharides and plant oils are relatively well defined; lignocellulosic materials are less well defined. Secondary (auxiliary) materials arise in the production of other products and include for example molasses, corn-steep liquor, etc.. Waste materials have a highly variable composition, with water content either very high (sulphite liquors, potato tuber wash, waste waters from fruit and vegetables processing) or very low (solid plant waste, seed husks). The distinction between auxiliary and waste raw materials is not very sharp because the latter, after suitable processing, may be used successfully in microbial processes. The processing used for auxiliary and especially waste raw materials before use includes physical, chemical or biological methods (evaporation and drying, chemical or enzymic hydrolysis, fermentation). Plant raw materials have the advantage of being renewable but the cultivation of some plants includes considerable energy costs. The disadvantage of these materials is their variable composition in dependence on plant cultivar, geographical conditions, or weather.
136
5.2.1
Monosaccharides and oligosaccharides
Traditional carbon sources for microbial processes are sucrose and D-glucose, and also auxiliary materials containing these sugars such as beet and cane molasses, hydrol, date syrup, wood pulp prehydrolysates and hydrolysates. Among related waste materials are sulphite liquors and waste after processing of plant products in the food industry. o-Glucose is found in fruits of bushes and trees and its highest amounts are present in grapes (10-30 weight per cent). It is produced industrially by acid or enzymic hydrolysis of starch. In the future, D-glucose is likely to be produced by hydrolysis of cellulose from lignocellulosic materials; because of its importance this process will be dealt with separately in Section 5.2.3. Since the cost of glucose is somewhat higher than that of sucrose, it is employed for the production of more expensive pharmaceutical products. Special attention should be paid to glucose sterilization because of brown products that are formed at higher temperatures in the presence of proteins, amino acids or ammonium ions and phosphates, and are not assimilated by microorganisms. Instead of glucose hydrol is sometimes used; this is a byproduct in the production of pure glucose from starch. It is obtained as a solid substance and contains more than 50 weight per cent glucose. Sucrose is produced in sugar factories from sugar beet or cane, with various degrees of purity -- refined sugar, raw sugar or molasses. The grade of purity of sucrose determines its use in productions (antibiotics, biomass, alcohols and solvents). The price of sucrose on world markets varies considerably. Production surpluses are most often encountered in Central America and in the Caribbean, production deficits occur mostly in the USA. Molasses is a widely used substrate which is marketed in various quality grades. The highest-quality molasses is used for the production of baker's yeast and antibiotics; lower grade molasses is suitable for production of citric acid and ethanol. Molasses is a thick syrupy dark-coloured fluid. According to its source we have cane and beet molasses, whose compositions are given in Table 5.1. During the long transport from tropical regions cane molasses becomes massively contaminated and consequently highly inverted. Acid molasses is not suitable for microbial processes because of its higher content of sulphur dioxide, nitrites, volatile acids and invert sugar. Unsuitable also are molasses containing more than 106 microbial cells per 1 g. With small exceptions, when it is used in low concentrations, native molasses cannot be used directly for microbial processes but has to be first clarified. Date syrup is a brown viscous fluid obtained by heating dates in water, followed by filtration and concentration. It contains more total saccharides,
137 Table 5.1 Composition of beet and cane molasses (White, 1948) Molasses.
% (w/w)
Component
Dry matter Total saccharides P205 CaO MgO K20 SiO2 A1203 Fe203 C Ash substances
Beet
Cane
78.00 85.00 48.00 58.00 0.20 2.80 0.01 I 0.02 0.15 0.70 0.01 0.10 2.20 -- 4.50 0.10 0.50 0.005 0.06 0.001 -- 0.02 28.00 34.00 4.00 8.00
85.00 78.00 58.00 50.00 0.50 0.08 0.0090.07 0.15 -- 0.80 0.25 - - 0.80 0.80 2.20 0.05 -- 0.30 0.01 -- 0.04 0.0010.01 28.00 -- 33.00 3.50 -- 7.50
I
-
-
-
-
phosphates and sulphates than molasses and has a lower nitrogen content. When used for citric acid production from Aspergillus niger it gives yields comparable to those achieved with molasses (A1-Obaidi and Berry, 1979). Processing of fruits and vegetables in canneries results in large amounts of wastes which are now attracting considerable attention. Apple pomace, whose composition is given in Table 5.2, was used for producing biomass, ethanol and acetone-butanol. The yields were 1.9-2.2 weight per cent referred to pure pomace (Voget et al., 1985). A similar waste material is the mush obtained after pressing of lemons, limes, grapefruits, tangerines and oranges (Buzzini et al., 1993) and paw-paw fruit pulp extract (Enweta et al., 1992); it
Table 5.2 Composition of apple pomace (Voget, Mignone and Ertola, 1985) Component Water Total saccharides out of this fructose glucose sucrose Pectin Fibre Proteins (N • 6.25) Ether extract Ash substances
Dry matter (%) 79.30 10.80 67.00 23.00 10.00 3.00 4.50 0.62 0.72 0.40
138
contains about 16 % (w/w) of the original fruit. Also similar are mushes from apricots, peaches, forest fruits and berries, mangoes, bananas (Chung and Myers, 1979) and other fruits. Among vegetable wastes tested as substrates are sauerkraut juice, liquors remaining after boiling of beans and other legumes, and onion remnants (Abou-Zeid, E1-Fattah and Farrid, 1979). The drawback of these materials is their low content of carbon sources in the liquid.
5.2.2
P o l y s a c c h a r i d e s - - starch and inulin
Polysaccharides are suitable carbon sources for microbial processes both because of their availability and because they are easily utilized by microorganisms. The mos.t widely used are starch, inulin and cellulose. All of them are polymeric substances which form colloid solutions and are water insoluble save for inulin. Before being used as components of nutrient media they have therefore to be transformed into a soluble form. Starch
Starch is found in plants in the form of granules deposited in seeds, roots, tubers and leaves. Its different varieties are named according to the origin, i.e. the parent plant from which they are produced" potatoes, wheat, barley, oat, maize, buckwheat, sorghum, manioc, palm (sago), banana, etc.. Starch grains are hygroscopic; in the cold they remain unchanged, while with increasing temperature and in the presence of moisture they swell markedly and are transformed into so-called starch paste. This transformation takes place in a sufficient amount of water ( 1 : 4 ) at 100 ~ At temperatures between 120 and 130 ~ the starch paste becomes liquefied and in this form it can be relatively easily chemically or enzymatically hydrolyzed. Starch is usually composed of some 20 % (w/w) water-soluble amylose which is stained blue with iodine in the cold, and 80 % (w/w) amylopectin which becomes merely paste-like in warm water and is stained violet with iodine. Amyloses are composed of a-glucopyranose units bound by carbons 1 and 4 into long unbranched chains. One molecule contains 25 to 1000 glucose residues and, as a consequence, the molecular weight of amylose varies over a broad range, from 4 • 103 to 1.5 • 105. Amylopectin is constituted by some 3000 glucose residues and its molecular weight is about 5 • 105. The molecule is branched and features therefore, besides the bonds between carbons 1 and 4, also bonds on carbon 6. Starch is obtained mostly from three kinds of plants: tuber crops (potatoes), cereals (maize) and tropical plants (manioc and palms). The content of
139
starch in some plants and the yield of starch referred to 1 hectare per year are given in Table 5.3. The starch content is seen to vary from 19 % by weight in potatoes to 75 % in rice. An outstanding source of starch is manioc (cassava, tapioca) from Manihot esculenta Glantz that grows in a belt from USA (Arizona) to Argentina. This plant is considered as possessing the most intensive photosynthesis known. Its roots contain 20 to 35 % (w/w) starch and little Table 5.3 Starch content and hectare yields of some starch-containing plants Plant Potatoes (tubers) Batatas Manioc (roots) Sago Maize (seeds) Wheat (seeds) Barley (seeds) Rye (seeds) Oat (seeds) Rice (seeds)
Starch content
Starch yield
(% of dry matter)
(t ha -~ y e a r - l )
19
7.5 9
22 32 20 60 56 54 50 38 75
21.0 9 4.8 4.5 3.3 2.0
1.7 5.3
proteins, only 1 to 2 weight per cent. The crop yields per 1 hectare, especially in Brazil, are high -- 13 tonnes per year in untreated stands and 40 to 60 tonnes per year in cultured plots (De Menezes, 1978). The yearly starch production from 1 hectare may thus reach 21 tonnes, about three times the yield given by potatoes (7.5 t per year). Manioc contains hydrogen cyanide, which can be removed by drying or washing. In modern high-yield cultivars the hydrogen cyanide content is very low (0.007 weight per cent). The greater part of starch is consumed in ethanol production for alcoholic drinks and as an energy source. The yearly production of ethanol from manioc in Brazil, 43 million hectolitres, is mostly used in a mixture with petrol (20 weight per cent ethanol) as motorcar fuel, the so-called gasohol. Starch is the main substrate for the production of ethanol or amylases, and in the biosynthesis of antibiotics produced by actinomycetes because it is more slowly assimilated than saccharides and does not cause catabolite repression. Low-quality starch is suitable for biomass and ethanol production. To be utilized by most microorganisms it has to be first degraded to glucose or maltose by chemical or enzymic hydrolysis. The procedures have been thoroughly described in older textbooks (Underkofler and Hickey, 1954; Prescott and Dunn, 1959). Current efforts are directed at using starch directly
140
without previous hydrolysis, especially in ethanol production. This can be achieved by using recombinant microorganisms containing genes for amylase synthesis. Inulin
Inulin is a colourless microcrystalline substance readily soluble in warm water (Leclerq, 1985). It is a reserve polysaccharide of tuber, corn or stolon plants such as Jerusalem artichokes, chicory and of plants of the genera Inula and Taraxacum. It is a nonreducing poly-fl-D-fructan with fructose units (usually not more than 30) bound between carbons 1 and 2. The enzyme inulase splits inulin to D-fructose. An important source of inulin is artichokes, i.e. tubers of Heliantus tuberosus, which are used as fodder and for foodstuff production but can also be used as the carbon source in microbial processes. Both tubers and the top parts of the plants contain 13 to 20 weight per cent saccharides including 11% inulin. The hectare yields of tubers are up to 30 tonnes per year, the aboveground parts amount to 100 tonnes per year and the plants can be grown even in lower-quality soils. A particular disadvantage of the tubers is their rapid spoilage. On the other hand, inulin can be prepared from the tubers simply by grinding and water extraction at 70 ~ The extraction is repeated twice with 30-50 volume per cent water, and 100 litres of extract yield 10 kg inulin. Microorganisms synthesizing inulase can utilize inulin directly, others after acid hydrolysis by, for instance, phosphoric acid at pH 2 for 1-3 h at 80 ~ (Toran Diaz et al., 1985). Inulin has been used for cultivation of yeasts and production of ethanol. The hectare yields of chicory (Cichorium) are considerable (15 to 30 tonnes per year of bulbs and 8 to 15 tonnes of leaves) but chicory, as opposed to artichokes, can hardly serve as inulin source for microbial productions.
5.2.3
Cellulose
Considerations of cellulose as utilizable resource usually begin with the statement that "cellulose is the most copious renewable organic material in nature" or "the energy of sunlight is fixed in photosynthesis in the form of cellulose". Both these statements are certainly true. The net result of photosynthesis, i.e. the excess of photosynthesis over respiration, on Earth is yearly 15 to 20 • l01~ t of organic matter (lignocellulose), out of which one half is cellulose. Even this amazing production is only about 0.1% when referred to the total solar energy coming to the Earth.
141
Cellulose sources and properties
The main source of cellulose is woody or nonwoody plants or products derived therefrom, waste products from forestry, wood industry, agriculture and food industry. The world reserves of these resources are given in Table 5.4. The most readily available are waste products from forestry and wild plants, although the applicability of the latter is questionable in view of collection and transport costs. An important resource among materials arriving
Table 5.4 Cellulose resources Resource Agricultural debris Bagasse Cereal straw Field stubble Plant leaves and stems Peelings, seed coats and piths
World supply in 1,000 tonnes
55 000 88 500
Forestry wastes Tree trash and twigs Shavings and sawdust Bark Wild plants Bamboo Papyrus Feather-grass Reeds
30 000 5 000 500 30 000
Food industry wastes Squashes and mashes Coffee grounds Fruit mashes and pulps Vegetable peelings and chippings Textile industry wastes Sisal, abaca, etc. Yuta, hemp, flax Cotton Municipal waste House waste Waste paper Agriculture wastes Dung Liquid manure Poultry bedding
904 6 100 13 500
142
from nonwoody plants is bagasse (waste material in cane sugar production) in view of the high hectare yearly yields (80 t as compared with 1 t for wheat straw, 2 t for grass and 20 t for trees). Wood processing wastes constitute some 40 weight per cent of the wood mass and some of them have a higher cellulose content that the wood itself. With small exceptions such as cotton, in which cellulose makes up 90 % of dry weight, cellulose is not found in nature in
1
i Fig. 5.2 Plant fibre structure (Tsao et aL, 1978) 1 -- lumen, 2 - internal secondary wall, 3 - main secondary wall, 4 - transient lamella, 5 - primary wall
a pure form but forms complexes with hemicelluloses and lignin. Most plant materials contain cellulose, hemicellulose and lignin in a weight ratio of 4 " 3 " 3 but the ratio may vary depending on the kind of the lignocellulosic biomass. Cellulose is a linear homopolymer made up from anhydroglucose units linked mutually by 1-4 bonds. Individual linear polymeric molecules are interconnected and form filaments. Cellulose filaments are surrounded by lignin and hemicellulose (Fig. 5.2). Lignin is in principle composed of highly oxidized benzene rings (polyphenols), hemicellulose consists of hexoses, pentoses and saccharide acids. Hemicelluloses are readily hydrolyzed whereas cellulose is difficult to hydrolyze, and the problems of lignin hydrolysis are even greater. Cellulose is difficult to hydrolyze because (a) it has a highly ordered structure which is 80 % crystalline, with easily hydrolyzable amorphous component reaching only some 15 weight per cent, and (b) its filaments are surrounded by lignin which serves as physical protection. The resistance of lignin to hydrolysis is due to its randomly synthesized chemical structure.
143
Techniques for releasing cellulosefrom lignocellulose complexes These procedures are often called pretreatment or prehydrolysis and they aim at releasing cellulose from lignocellulose complexes and transforming the crystalline form of cellulose for the most part into the amorphous form. The procedures can be divided into several groups: a) mechanical (grinding, cutting), b) physical (exposure to heat, pressure, radiation), c) chemical (exposure to hydroxides, acids, extraction agents), d) combined mechanical and physico-chemical procedures, e) biological, i.e. enzymic (ligninases, hemicellulases). Combinations of different techniques are often used in order to achieve a maximum complex effect, i.e. degradation of hemicellulose and lignin and transformation of crystalline cellulose to the amorphous form. a) Mechanical procedures. Grinding in a hammer mill reduces particle size and enhances the susceptibility of the material to hydrolysis but it does not change the proportion of the crystalline component. Wet or colloid milling causes particle diminution and some increase in susceptibility to hydrolysis but the milling costs are high. Krupnova and Sharkov (1964) recommended grinding of material heated to 200-240 ~ which brings about a reduction in the fraction of crystalline form. The heating itself is ineffective. Ground rye straw subjected to further decomposition by chafing exhibited a twice greater extractability of saccharides as compared with straw ground in a hammer mill (Han, 1978). As seen from Fig. 5.3 the success of the milling also depends on the type of the material processed. 100
-~ 8o L N
~
==
60
-,- . "
40
ar__~, ~9 P
~,-- 20 0 0
I 2O
I
40
I
I
I
60 80 100 time of milling {min)
1
120
J
140
Fig. 5.3 Effect of milling of different kinds of wood on their sensitivity to hydrolysis (Millet, Backer and Satter, 1975) 1 -- sweetgum, 2 - aspen, 3 - red oak, 4 - hickory, 5 - red alder
144
b) Physical procedures. The most important method is expansion o f the lignocellulosic material by wet heat (extrusion) or dry heat (cleavage). This involves rupturing of the filaments and release of smaller chunks of cellulose. The overall effect depends on the degree of expansion. During extrusion, saturated steam under pressure is left to penetrate into the material for 2 to 20 min and then the pressure is reduced back to atmospheric. The water inside the materials evaporates away, expands rapidly and disintegrates the material to smaller particles with increased porosity (Grous, Converse and Grethlein, 1986). This pretreatment is comparable to acid hydrolysis but is more economical. Lignocellulose complexes are effectively depolymerized by ?'-radiation but only in relatively high doses (above 10 Mrad). At doses below 1 Mrad the radiation has no effect and above 50 Mrad cellulose becomes water-soluble. The degree of depolymerization is thus dependent on the radiation dose (cf. 5 000 I
o
:,,= 1 000 o N
"-" 500 E
~ ~
o
""
100
II/
~_
50-
I
10 ! 5
I
1
I
6
7
8
tog O (tad)
Fig. 5.4 Degree of polymerization of cellulose as ' a function of radiation dose (Aoki, Norimoto and Yamada, 1977)
Fig. 5.4). Another result of the radiation is the formation of free radicals and solubilization of a substantial part of lignocellulose. Whether the changes involve also a decrease in the proportion of crystalline cellulose remains still to be seen. This is likely to happen at doses above 80 Mrad (Goto, Harada and Saiki, 1974). By and large, the costs of the procedure are very high. The effect of ?'-irradiation pretreatment on the biodegradation of forest lignocelluloses by Aspergillus niger was studied by Bhatt et al. (1992). c) Chemical procedures. The most important pretreatments of lignocellulosic materials are chemical. Their advantage is their rapid effect, good reproducibility and, in some cases, also a prospect of effective practical use.
Pretreatment of lignocellulosic materials by acid and alkaline hydrolysis. The first commercial use of acid hydrolysis dates back to 1913 in the USA.
145
The material was hydrolyzed in a rotary digester with 2 volume YO(v/v) H2S04 at 175 "C. The hydrolysate was used for ethanol production until 1923. The Scholler process used in Germany employed 1 Yo (v/v) HCl for prehydrolysis, followed by subsequent main hydrolysis with 0.5 YO(v/v) H2S04. During World War I1 a process used in USA included a continuous percolation with 0.4-0.6 YO(v/v) H,SO, at 150-180 "C which yielded saccharide syrup in an amount of 45-55 % (w/w) referred to the debarked wood (Reese, Mandels and Weiss, 1978). None of these procedures were economically suitable in the long run. Alkaline pretreatment of lignocellulosic materials also has a long history and started with the processing of straw in order to increase its digestibility by ruminants (Beckmann, 1922). NaOH is the agent of choice. The pretreatment is effective, even though it is not cheap. NaOH above 8 YO(w/w) causes an intramicellar swelling of cellulose filaments and their depolymerization. A short treatment with 0.1 to 0.5 % (v/v) sodium hydroxide esterifies uronic acids and saponifies acetates, causing swelling and loosening of structure. Additions of ZnO to the alkaline solution increase cellulose swelling (Garves and Dietrichs, 1975). In general, the alkaline pretreatment is more effective with hard wood than with soft wood, which is probably connected with the content of lignin. The shortcoming of the alkaline treatment is the consumption of large volumes of alkaline solutions and wash water and a loss of dry weight up to 25 Yo of the treated materials. The efficiency of the alkaline treatment may in some materials be further enhanced by subsequent grinding in ball mills. Other methods. Other chemical methods include extraction of cellulose from lignocellulose complexes and its dissolution after a preceding removal of hemicelluloses (Blaiej and KoSik, 1985), and oxidation of lignin. Once the cellulose is dissolved it can be further hydrolyzed to glucose. An efficient cellulose dissolving agent is cadoxene (Jayne and Neuschaffer, 1957). Cadoxene is an alkaline aqueous solution of ethylenediamine (25 to 30 weight per cent) and cadmium oxide or hydroxide (4.5 to 5.2 weight per cent) which was originally used for cellulose determination. It solubilizes cellulose and on water addition the cellulose reprecipitates in the form of fine tufts. The effect of cadoxene on processing of bagasse and maize wastes is seen in Fig. 5.5. It can solubilize about 1 0 % (w/w) cellulose at normal pressure and without pH adjustment. It causes little damage to the cellulose, is almost infinitely stable, and is relatively easy to prepare and regenerate. It is not toxic for cellulases, but cadmium can have negative environmental effects. Another agent used for cellulose solubilization is called CSMS. It is an aqueous solution of 17 % (w/w) sodium tartrate, 6.6 YOferric chloride, 7.5 YO
146
caustic soda and 6.2 % sodium sulphite. It is less toxic than cadoxene and can be prepared in a solid form which is advantageous for transport, handling and storage. Like cadoxene it can be reprecipitated by methanol after cellulose solubilization. Besides, addition of methanol into the acid solution of lignocellulose also reprecipitates the Solubilized cellulose. Among other agents used for disrupting the structure of lignocellulosic materials are SO2, NaC10, H202 and ozone. Exposure to SO2 increases the proportion of lignocelluloses sensitive to enzymic hydrolysis from 1-49 % (w/w) to 63 % and decreases the concentration of lignin from 23 % to 6 % (Millet,
100i 0 E
2
-
f_
-
-= 6 0 .~_
/
o 40-
1 20 2 0
0
5
1 I 10 15 reaction time(h)
J
I
2O
Fig. 5.5 Effect of cadoxene on the processing of bagasse (1) and corn bran (2) (Tsao et aL, 1978). Processing without cadoxene O, m; with cadoxene O, []
Backer and Satter, 1975). NaC10 was used to oxidize and liberate lignin, especially in straw and sawdust. It was effective at concentrations as low as 0.5 M and a 30-min treatment at pH 7 to 9 at room temperature caused a 80 % delignification (David et al., 1985). When using H:O2, 4 % (w/w) of lignocellulose is supplied with 1% (v/v) H20:, pH is adjusted with NaOH to 11.5 and the mixture is left for several hours at room temperature. The treatment results in the liberation of about 50 % of lignin and hemicellulose from the complex; the solution is then filtered and unsolubilized cellulose is dried (Gould, 1985). Ozone treatment of lignocellulose yields saccharides, acids and fibrous material rich in cellulose. Ozone treatment degrades preferentially lignin before cellulose. When used with bagasse it provided up to 12 % (w/w) of reducing saccharides in the solution (Puri, 1983). d) Combined physico-chemical procedures. The best practical results are to be expected from methods combining the advantages of mechanical, physical
147
and chemical processes of pretreatment of lignocellulosic materials, i.e. grinding, heating to elevated or high temperatures (including steam feed) at high pressures, and action of chemical agents both gaseous and liquid. Several promising treatments have been described but comparison of their efficiency for various kinds of lignocellulose is still lacking. Attempts have also been made to use the materials after this type of treatment directly as substrates for microbial processes using mixed microbial cultures. A highly efficacious procedure appears to be treatment with NH4 + in an intermediate state between a liquid and gaseous phase at 132.4 ~ and a pressure of 11.28 MPa (Weimer and Chou, 1986). Delignification of cellulose by butanol makes use of a butanol-water mixture ( 1 : 1 ) with the addition of 0.3 % (v/v) HC1. The treatment is performed at 170 ~ for 1 h. The resulting products can be easily separated because lignin is accumulated in butanol, hemicellulose in the aqueous phase, and cellulose remains in the solid phase. Prehydrolysis with SO2 was carried out on a large scale, the capacity being 1.5 t coniferous cutoffs per 1 h. The time of prehydrolysis was 2 min, steam pressure 1.7 MPa and SO2 concentration 2-2.6 % referred to wood dry weight. Enzymic hydrolysis of wood processed in this way achieved more than 90 % of theoretical saccharide yield, whereas the steam hydrolysis alone gave only 53 % of the theoretical yield (Wayman et al., 1986). e) Biological (enzymic) processes. Also economically promising is the biological (enzymic) process for cellulose production from lignocellulosic materials, mainly because it does not require high pressures or temperatures, nor large amounts of chemicals. Enzymic degradation of lignin has been the centre of efforts of researchers for more than 80 years. A considerable advance was made when the fungi Phanerochaete chrysosporium and Phlebia radiata were found to produce the enzyme ligninase which degrades lignin at a very high rate (Rogalski et al., 1993). A corollary result of examination of its mode of action was the explanation of why previous efforts have been unsuccessful. The problem was in the individual chemical structure of lignins, which are synthesized randomly and arbitrarily, in contrast to all other biopolymers which are very precisely synthesized (Milgrom, 1985). Since enzymes act specifically, as dictated by their tertiary structure determining strictly the geometry of the enzyme active site, the intrinsic disorderliness of lignin structure precludes a tight stoichiometric relationship between the enzyme and the substrate. Ligninase, in contrast to conventional oxidases, can degrade lignin without atmospheric oxygen and it behaves at the same time as peroxidase, abstracting an electron from an aryl ring. Ligninase has a stronger ability to abstract electrons from a substrate than other peroxidases and is very stable, which makes it an ideal means for recovering cellulose and glucose (Kirk, Croan and Tien, 1986).
148
Preparation of glucose from cellulose The main objective of degradation of lignocellulosic materials is an economically suitable production of glucose as a raw material for microbial processes. The possibilities of release of cellulose from lignocellulose complexes were discussed in preceding paragraphs. The liberated cellulose can be further hydrolyzed either chemically by acid hydrolysis, or biologically using enzymes, to yield glucose. Glucose is also formed in certain amounts during 9 i processing of hgnocellulose by physical and chemical methods. Besides the traditional chemical methods of hydrolysis of cellulose to glucose employing H2SO4 or HC1, new more efficient procedures have recently been devised, such as the solvolysis of wood with HF, which affords nearly theoretical yields of fluorinated saccharides. These can be freed of hydrogen fluoride and then treated with a weak acid which transforms sugar oligomers into monomers (Hardt and Lamport, 1982). Another process includes cellulose swelling with a saturated aqueous solution of CaC12 and subsequent hydrolysis with traces of gaseous HC1 at a low temperature; the product is a 45 % (w/w) glucose solution from which CaCI2 is removed by electroosmosis. Enzymic hydrolysis of cellulose has so far been most successful using species of the genus Trichoderma which possess cellulases that have been most thoroughly studied. The species of choice are Trichoderma reesei, T. viride and T. konigii which contain the whole cellulase system of three enzymes, namely:
insoluble cellulose soluble cellulose
.[
1
~
endocel[ulase
~----1
exoceUutose 1
\exocettutase
I
........
I I I I
I
e n d o c e l t u [ ~ cetIobiose mostly cel[obiose
glucose
I I
0000000
Fig. 5.6 Scheme of enzyme hydrolysis of cellulose (Saddler, 1986)
I 1 I I I I
I J
end product inhibition
149
a) endo-fl-l,4-glucanase or fl-l,4-glucanoglucanohydrolase (EC 3.2.1.4) known also as carboxymethylcellulase or Cx cellulase, b) exo-fl- 1,4-glucanase or fl- 1,4-glucanocellobiohydrolase (EC 3.2.1.91) known also as cellobiohydrolase, avicellase or C~ cellulase, e) fl- 1,4-glucosidase (EC 3.2.1.21) or cellobiase. In the cellulase system from Trichoderma the largest proportion is represented by C~ cellulase, about 80 weight per cent of the total cellulase proteins. Cellulose hydrolysis commences with random cleavage of internal fl-l,4-bonds by endoglucanase. Thereafter exoglucanase gradually removes cellobiose from the nonreducing ends of the chain. A combined action of endoglucanase and exoglucanase gives rise to cellobiose and oligosaccharides. Glucosidase then hydrolyzes cellobiose and other oligomers to produce glucose (Cuskey et al., 1982). The schematics of cellulose hydrolysis by the complex of enzymes are shown in Fig. 5.6. The synthesis of the enzymes is controlled by regulatory mechanisms, viz. induction and catabolite repression, and it is therefore advisable to isolate strains that do not possess these mechanisms.
Table 5.5 Comparison of acid and enzymic hydrolysis of cellulose Parameter Preprocessing Rate of hydrolysis Temperature Pressure Yield Inhibitors Implementation Economy
Acid hydrolysis may be necessary high (min) high (200 ~ increased fluctuates yes yes (Russia) unclear
Enzymic hydrolysis
necessary low (h) low (up to 45 ~ atmospheric fluctuates no pilot plant unclear
Merits and shortcomings of chemical and enzymic hydrolysis are summarized in Table. 5.5. The greatest advantage of chemical cellulose hydrolysis is its rapidity; the time period necessary for the process to occur is about 20 min whereas enzymic hydrolysis requires several hours. Capital costs of chemical hydrolysis are higher and the process is fraught with technical problems (corrosion); enzymic hydrolysis uses larger production volumes but equipment costs are lower. Chemical hydrolysis yields products toxic for microorganisms, which are virtually nonexistent in enzymic hydrolysis in view of the specific action of the enzymes. However, pure glucose is not produced even in enzymic hydrolysis due to the complexity of the starting material.
150
Production of glucose from lignocellulosic materials will be economically hopeful only when the price of the glucose so produced is not higher than that of starch-derived glucose. 5.2.4
Plant oils
According to their ability to congeal on air, plant oils can be divided into noncongealable or slightly congealable, semicongealable and congealable. Semicongealable oils are most common. They contain less unsaturated fatty acids than noncongealable oils, the major ones being oleic and linoleic acids with a little linolenic acid, which can be altogether absent. They are obtained mostly from rape-seed, sunflower and soya seeds. Noncongealable oils contain up to 20 % (v/v) saturated fatty acids, among the saturated ones oleic acid makes up to 50 % (v/v) and linoleic acid about 30 % (v/v). Linolenic acid is usually absent or present in very small amounts. These oils are found in peanuts. Congealable oils have a low (less than 10 % by weight) content of saturated fatty acids, linolenic and linoleic acids are the major unsaturated acids. The content of oleic acid is lower than that of linolenic acid. Their best source is hemp and poppy-seed.
Table 5.6 Hectare yields of some oleaginous plants and hectare yields of oils Plant (seeds) Soya Sunflower Rape Mustard Poppy Linseed Hemp
Yield (t h a - l year-~) 3 2 3.5 1 1 1.3 1
Oil in plant (weight %)
Oil yield (max.) (t ha-1 y e a r - l )
18 ----50 33
0.3 1.3 1.6 0.4 0.7 0.6 0.3
40 35 30 40
60 45 40 65
Plant oils contain minute amounts of other substances such as proteins, chlorophyll, mucous substances, etc.. The hectare yields of oleaginous plants and oil yields per 1 hectare are given in Table 5.6. Plant oils are used in microbial processes mostly as carbon sources in antibiotics production. The concentrations used are typically around 10 % (v/v) but they could be considerably higher, 30 % or more. The oils serve also as cosubstrates in the production of penicillins, tetracyclines, streptomycins, cephalosporin and riboflavin, fl-carotene and citric acid (Ratledge, 1977). The
151
presence of oils in nutrient media protects actinomycete filaments and fungal hyphae against mechanical damage by shear forces. Oils dissolve some metabolites with growth inhibiting effects, for example antibiotics. The most common among plant oils are soya and palm oils. Semicongealable oils present problems when transported and delivered through piping and have to be therefore preheated. Plant oils are also used as defoamers; as they are consumed by the microorganisms they have to be replenished during the cultivation. When setting up formulas for nutrient media it should be kept in mind that the energy content of oils per unit weight is 2.5 times higher than that of saccharides.
5.2.5
Nitrogen sources of plant origin
Following carbon sources, nitrogen sources represent the second most important component of nutrient media in terms of weight. These sources of plant origin are complex substrates that contain, in addition to basic components such as proteins, polypeptides, peptides and amino acids, also accompanying substances such as lipids, vitamins and trace elements which have a positive effect on microbial growth and product formation. Their natural origin is reflected in a large variability of both quantitative and qualitative proportion of individual constituents, not only between various raw materials but also between individual lots or batches of the same material. The main sources of nitrogen compounds are cereals, oleaginous crops and tuber crops, and their proteinaceous components in the form of flours or meals and various byproducts arising during the processing of the basic raw materials after separation of starch and extraction of oils. Before use in media, some raw materials are treated microbially (corn-steep liquor). Special natural nitrogenous substances are soybean peptone and yeast extract. Flours and meals
Cereal flours contain on average 10 % proteins, concentrated mostly in the aleurone layer and in the germ, i.e. grain parts with the lowest content of polysaccharides and the highest content of lipids, minerals and vitamins. The highest content of proteins, some 44 to 47 %, has been found in soybean flour which is the most common source of organic nitrogen (after oil extraction from the beans). In addition, soybean flour contains 0.5-1.2% lipids, 5.5-6.0 % cellulose and ash substances, 31-32 % nitrogen free substances, calcium, phosphorus and phosphatides. It serves also as carbon source owing to its content of starch. A similar material is peanut meal which is obtained after oil extraction from ground peanuts. Although the composition of the two ma-
152
terials is similar they cannot be mutually freely substituted in some microbial processes. Soybean flour is the component of almost all media for antibiotics production, whether performed by the genus Bacillus, Streptomyces or with fungi. Peanut meal is used for chlortetracycline biosynthesis but not for tetracycline production. Flours and meals from other cereals (wheat, rye) are seldom used for these purposes.
Corn-steep liquor This material is obtained as a byproduct in the production of maize starch. It contains biologically active substances in various qualitative and quantitative proportions depending on the quality of the maize used and the technology of its processing. These substances are transferred into the cornsteep by extraction from the cereal and also owing to lactic fermentation that occurs during the steeping process in starch production. Because of this, the corn-steep liquor has no fixed composition. Since the beginning of its use in penicillin fermentations it has been a staple component of nutrient media for production of antibiotics and other primary and secondary metabolites. Table 5.7 Composition of corn-steep liquor (Sikyta, 1983) Component
(weight %)
Component
Water
30
60
Ash substances
Total nitrogen
2.7
4.5
Amino nitrogen
1.0
2.0
Reducing substances
0.1
0.11
Lactic acid
5.0
11.4
0.1
0.5
0.01
0.02
Ca Cu Fe Mg Mn S Zn K
Volatile acids SO2
(weight %) 8.0 0.25
10.0 0.75 up to 0.001 0.01 0.03 0.25 0.50 0.02 0.06 0.15 0.20 0.0003 0.003 0.50 1.0
Corn-steep liquor contains large amounts of nitrogen compounds, reducing substances and ash substances with trace elements. Table 5.7 gives its composition. Amino acids represent over 80 % of the total nitrogen content and this proportion is further increased on hydrolysis. An important quality parameter is the ratio of amino nitrogen to total nitrogen, which should be about 0.4, i.e. some 2 % (w/w) of amino nitrogen in the liquor dry weight. This proportion is related to the intensity of lactic fermentation during corn steeping.
I53
On heating corn-steep liquor above 100 "C and cooling it down, a greywhite precipitate is formed which is undesirable in nutrient media. It can be removed by the following procedure: I kg corn-steep liquor (60 dry weight) i s mixed with 2.5 1 tap water and the pH is adjusted to 7.0 with saturated NaOH solution. The solution is boiled for 5-10 min, cooled down and filtered through kieselguhr. The precipitate on the filter is washed with water to a filtrate volume of 5 l. Under these conditions 5 l filtrate corresponds to l kg corn-steep liquor. The precipitate contains mostly calcium and magnesium phosphates and after this treatment it is highly suitable for microbial cultivations since the separated biomass is pure and suitable for biotransformations, and also for product isolation. Furthermore, this treatment of the corn-steep liquor was found to increase antibiotics production by one third, probably by removing excess phosphates which repress antibiotic synthesis. Yeust e-xtract
Yeast extract is a peptone type substance obtained after autolysis or plasmolysis of baker's or brewer's yeast. Before further processing the latter yeast has to be freed of bitter hop substances by washing with water at pH 6.5-7.0. Autolysis takes place in tanks under constant stirring; the temperature is gradually increased to 48 to 50 "C and kept at this level for several hours. Thereafter it is raised to 75 "C in order to inactivate the yeast enzymes. Plasrnolysis takes place in the presence of sodium chloride but then the extract contains 30 to 40 weight per cent NaCI. Cell walls are separated from the solution by filtration or centrifugation. The liquid has to be concentrated quickly at 37 "C to a thick syrup to prevent contamination and degradation of heat-labile substances. Yeast extract in a powder form is obtained by spontaneous drying in Y U C U O or i n a spray drier. Yeast extract contains 7.5 to 10.5 (Yo total nitrogen, out of which 3.4 to 4.8 (Yo is amino nitrogen in the form o f amino acids and peptides, about 8 'Yo saccha.rides, some 3.8 %I phosphorus in the form of P@, and relatively large amounts of sodium and potassium. Because of its high price it i s used mostly in laboratory nutrient media and only rarely on industrial scale, usually for small-magnitude productions of expensive products.
5.3 ANIMAL R A W MATERIALS
These materials are considerably less abundant than plant raw materials and are represented mostly by secondary products from agriculture and food industry. The chief saccharide is lactose and its byproduct whey. another
154
group includes animal fats and, as nitrogen sources, meat extract and peptone. Waste products of animal origin arise during the processing of meat, poultry and fish foods. Because of their unpleasant environmental properties, stable or animal house wastes are usually simply disposed of as a matter of environmental protection. Their anaerobic processing yields methane which can be used as energy source. The solid waste remaining after the cultivation is usually used as manure but, after sterilization, it is eminently suitable as a substrate for surface cultivation of higher fungi. The liquid manure fraction was even tested as replacement for nutrient source in ethanol production (Lamptey, Moo-Young and Robinson, 1986).
5.3.1
Lactose and whey
Lactose is a disaccharide found in mammalian milk in a concentration of 3 to 8 %. It is produced by several classical and modern methods from sweet whey. Curds are collected on filters prior to the processing, the whey is heated to 40-45 ~ and centrifuged in order to remove fat. It is concentrated in vacuum evaporators to achieve supersaturation necessary for lactose crystallization. Hot concentrated whey is transferred into crystallizers where it is agitated and cooled down to obtain lactose crystals. These are separated, dried and ground. The lactose yield is about 70 % referred to the original amount present in the whey. The purity of the lactose so produced may reach 90-95 %. A modern approach consists in protein removal from the whey by reverse osmosis, the subsequent steps being the same. Lactose is assimilated only by some prokaryotic microorganisms (lactic fermentation bacteria, Enterobacteriaceae and a few others), among yeasts by Kluyveromyces fragilis. It is used as one of the main carbon sources in the biosynthesis of penicillin. Whey is a byproduct in cheesemaking, curd and casein production. Whey composition varies depending on the method of cheesemaking. Sweet whey is converted into sour whey when lactose is converted into lactic acid by microorganisms. The composition of both sweet and sour whey is given in Table 5.8. Before use in nutrient media, whey is dried because it normally contains 93-96 % (w/w) water which raises transport costs and promotes contamination. It is used for cultivation of yeast used for human nutrition, and also for production of antibiotics (in the form of nisin), lactic and propionic acid. It is also used for ensilage and directly as fodder but the main part, especially from small-scale dairies, is disposed of as waste. Lately the interest in using whey in the microbiological industry has been increasing, especially in the production of ethanol and butanol. Cultivation of Clostridium acetobutylicum on whey gave a 1.5 % butanol yield with a suitable butanol : acetone : ethanol ratio of 10:1 : 1 (Maddox, 1980).
155
Table 5.8 Composition of sweet and sour whey Component Dry matter Fat Proteins ( N x 6.25) Lactose Lactic acid Citric acid Ash substances
Sweet whey (weight Oh) 7.0 1.0 1.0 4.5 - 5.0 traces 0. I 0.5 0.7 6.0 0.8 0.8
~
~
~
~
Sour whey (weight YO) 5.0
-
7.0
traces 0.8 - 1.0 3.8 - 4.2 0.6 - 0.8 0.1
0.7
-
0.8
5.3.2 Animal fats Animal fats are used in microbial processes in a similar way as plant oils, albeit on a smaller scale because they are less accessible and are mostly in a solid state. Only liquid fats are suitable as components of nutrient media, for instance lard oil, lower-quality fish oil or fish processing oils. They are used in antibiotics productions and as defoamers. As with plant oils their energy content is 2.5 times higher than that of saccharides.
5.4
CHEMICAL AND PETROCHEMICAL RAW MATERIALS
Industrial-scale production of proteins from single-celled microorganisms has brought to the centre of interest raw materials of chemical and petrochemical origin which are available in large amounts and stable quality. These materials can be divided into gases, alcohols and acids, inorganic and organic synthetic sources of nitrogen and phosphorus, trace elements and precursors.
5.4.1 Gaseous substrates These include mainly methane, carbon monoxide, carbon dioxide, hydrogen and hydrogen sulphide.
Methane Methane is available in regions rich in oil fields. It is often called natural gas. Its reserves as fossil fuel are limited and only marginally renewable. Methane is preferentially used as an energy source. At today’s consumption rate its reserves will be depleted within 40 years (Dimmling, 1978). It can be also
156
obtained by partial oxidation of coal, bituminous oils and crude oil at low temperatures but even in this case it is usually consumed as an energy source. Methane is formed also as a product of anaerobic digestion of organic wastes; the ensuing amounts are also limited and depend on the yearly tonnage of renewable plant resources. It is produced on a large scale in devices processing agricultural waste (gi~lle, slurry) and municipal wastes, and on a small scale on farms. The major part of the produced methane, even in large-scale units, is returned for powering their operation and only a small part is free to use for other purposes. The processing of 900 t organic wastes per day has been calculated to provide 3900 m 3 methane h -~ (Pfeffer and Liebman, 1976). Even as a natural gas, methane cannot be considered an important substrate, its price notwithstanding. It is utilized only by a small number of bacteria with special metabolism, which do not grow on conventional substrates such as glucose or acetate (Whittenbury et al., 1975). The scale of products obtained from it is therefore narrow. Another disadvantage is its tendency to explode in a mixture with some gases. However, methane can be relatively easily chemically oxidized to methanol which is then utilized by a larger number of microorganisms.
Carbon dioxide Carbon dioxide can be used as carbon source by phototrophic bacteria belonging to two groups: purple bacteria (Rhodospirillineae) and green bacteria (Chlorobiineae). These organisms carry out anoxygenous photosynthesis and are dependent on an external hydrogen donor. They can utilize molecular hydrogen, elemental sulphur, thiosulphate, organic acids, alcohols and saccharides (Schlegel, 1992). These bacteria could be used for production of sulphur, hydrogen and some pigments.
Carbon monoxide This gas is used as a single carbon source by aerobic bacteria of the genera Bacillus and Pseudomonas. Experiments were performed with Pseudomonas earboxidovorans and Bacillus sp. aiming at production of single-cell proteins. Microbial utilization of carbon monoxide would also undoubtedly contribute to environmental protection.
Hydrogen sulphide Hydrogen sulphide is utilized as energy source by bacteria of the genus Chlorobium. The anaerobic organism Chlorobium thiosulphatophilum assimi-
157
lates H2S and C O 2 under autotrophic conditions and in the light, excretes sulphur and accumulates polyglucose. In the dark it dissimilates polyglucose to three organic acids with acetic acid as the main component. Hydrogen sulphide is an unpleasant and toxic gaseous waste from chemical industry and in this way it could conceivably be used for production of sulphur and organic acids.
Hydrogen As a substrate, hydrogen could be available in large amounts for microbial processes provided it were possible to introduce its economically feasible large-scale production as a novel motorcar fuel. During growth under aerobic conditions on a gaseous mixture (70 % v/v H2 + 20 % O2 + 10 % CO2), Alcaligenes eutrophus yields more than 20 g 1-~ of cell dry weight. In addition, the cells deposit intracellularly up to 80 % (w/w) of poly-fl-hydroxybutyric acid which can be easily polymerized, giving rise to a polymer similar to polyethylene.
5.4.2
Alcohols and organic acids
Methanol Methanol is produced basically by chemical oxidation of methane. An amount of 1 t methane can produce both theoretically and practically 2 t methanol at a low price. In 1977 the price of methanol on world markets was one third of that of ethanol. The price becomes even more advantageous if referred to the carbon content. Besides the natural gas and methane produced by anaerobic processing of wastes, methanol can also be produced chemically from oil gas, oil, heavy oil, and also from coal and wood. When considering the production capacities for methanol it is imperative to realize that to a certain extent the devices for methanol production can be used for ammonia production, and vice versa. The current yearly world production is estimated at some 16 million tonnes. Methanol is utilized by only a few microorganisms. At present it is envisaged mainly for production of single-cell proteins. The economics of this process is significantly affected by the type of the microorganism used. Table 5.9 compares the processes using Candida boidinii with those based on the genetically manipulated bacterium Methylophilus methylotrophus. It shows that important parameters decisive for the economy of the process are more favourable in the case of the bacterium, which exhibits better substrate utilization, faster growth, higher biomass concentration in the bioreactor, and
158 Table 5.9 Comparison of protein production from methanol by yeasts and bacteria
Parameter
Yield per substrate (weight %) Maximum specific growth rate (h -~) Dilution rate in a continuous process (h -~) Cell dry matter in bioreactor (g 1-~) Crude protein in cell dry matter (weight %)
Yeasts
Bacteria
( Candida boidinii)
( Methylophilus methylotrophus)
42 0.3 0.25 20 50
60 0.65 0.5 30 75
a higher content of proteins in the product. On applying the data from Table 5.9 to a 1000 m 3 bioreactor commissioned 300 days per year, the yield is 18 000 t crude protein with the yeast and 81 000 t with the bacterium. On the other hand, the process based on the yeast has the following advantages: easier separation of biomass after cultivation, lower pH value during cultivation and thus lower tendency to contamination (this however does not hold absolutely), and a better acceptability of the product. However, bacterial biomass has a higher content of essential amino acids, especially methionine which is lacking in yeast biomass. As previously with n-alkanes, the possibilities of using methanol in diverse branches of the microbiological industry are at present being intensively explored. These processes include the production of lysine, glutamic acid, threonine, serine and other amino acids, organic acids (citric, fumaric, a-ketoglutaric), vitamins (especially B12), polysaccharides and other products. A broader application is hampered by its toxicity. For this reason it has to be added to the culture gradually, in doses or continuously, i.e. using fed-batch or continuous processes which are sometimes difficult to use in the production of secondary metabolites, as these are mostly synthesized only under substrate excess in the culture. This problem however is not unsurmountable, as shown by the processes used for penicillin biosynthesis in which continuous glucose feed is used. Methanol volatility can cause evaporation losses in excess of 10 % (v/v) and this problem has to be addressed accordingly.
Ethanol In contrast to methanol, an apparently paradoxical situation is found with ethanol. On the one hand it is envisaged as a promising substrate for the microbiological industry, which is produced in large quantities by chemical synthesis, while on the other it is produced microbiologically from starch-containing raw materials which are used as substrates in microbiological produc-
159
tions. This paradox can be explained as being due to the fact that the chemical production from ethylene is economically advantageous only in large production units which give rise to surplus ethanol, and, on the other hand, chemical synthesis is subject to successful competition by microbiological productions utilizing cheap raw material resources. The situation may change even more in favour of microbiological productions after the expected introduction of production of ethanol from lignocellulosic substrates. On the negative side, the price of microbiologically produced ethanol has to include the cost of its distillation. The technology of bioprocess ethanol production can further be improved by new isolation and strain selection procedures, and by introduction of novel high producing strains that can withstand high ethanol concentrations (in excess of 80 g 1-~). This would result in a substantial increase in ethanol yields even in batch processes (Lee et al., 1981). Both synthetically and microbiologically produced ethanol is an easily accessible raw material with standard quality. Its physico-chemical properties class it among surface active compounds; accordingly, it promotes foam formation in nutrient media. The foam is thin and actually improves the distribution of air in the liquid phase. Among technologically useful factors are easy dosage and good solubility in water, which contribute to the easy preparation of the media. A particular drawback, as with methanol, is its volatility. Also, synthetically prepared ethanol contains growth-inhibiting substances such as crotonaldehyde. Ethanol is used in production of yeast for human nutrition, production of amino acids (glutamate), tricarboxylic cycle acids, vitamins, polysaccharides, and also as a substrate in the production of orotic acid, orotidine, ergosterol and cephalosporin. Acetic acid
Microbial applications of acetic acid are much more numerous than of ethanol. It is easily produced from ethanol by chemical oxidation, and can also be obtained by processing cellulosic waste substrates under anaerobic conditions with the homoacetogenic thermophilic bacterium Clostridium thermoaceticum (Zeikus, 1980). It is used as cosubstrate in the production of glutamic acid (Miescher, 1975) and citric acid (Uchio, 1976). 5.4.3
n-Alkanes
The low price of n-alkanes and their ready utilizability by microorganisms induced appreciable changes in the spectrum of raw materials used in the microbiological industry in the 1960's. Procedures for biomass production
160
were elaborated in a relatively short period and semipilot and pilot plant production units were built. The yeast Candida lipolytica was employed for n-alkane based production of citric acid, other acids, vitamins, amino acids, nucleotides, specific lipids and antibiotics. The trend was halted in 1973 by the fourfold rise in oil prices on world markets and a number of productions were discontinued (e.g. fodder proteins) while others returned to traditional substrates. The economic feasibility of each n-alkane based production began to be thoroughly studied. Among traditional processes n-alkanes could conceivably be used only in glutamic acid production because, in contrast to natural materials, n-alkanes do not contain biotin whose lack in the medium is essential for secretion of glutamic acid from the cells. In other microbial processes the yields would have to exceed considerably those achieved with traditional substrates. The most suitable are n-alkanes with medium chain length, i.e. C~0 to Ca0. They may differ widely in assimilability, these differences being more pronounced in n-alkanes with even-numbered chains than in those with odd numbers of carbon atoms. Microorganisms grow better on mixtures than on individual n-alkanes, n-Alkanes with C2 to C8 are less suitable both in terms of availability and yields. The same holds for alkanes with C20 or higher which are not liquid under usual cultivation temperatures.
5.4.4
Inorganic and organic synthetic nitrogen sources
Both inorganic and organic substances which contain nitrogen in diverse forms can serve as nitrogen sources. Nitrogen source assimilating pathways are very much more common than processes assimilating carbon sources; they include those processing molecular nitrogen, nitrites, nitrates, ammonium ions and gaseous ammonia. The most important organic materials are those containing amino nitrogen. For economic reasons the quality of nitrogen sources cannot be on a par with the quality grade of pure laboratory chemicals, and the quality is also variable depending on the product. In general, microorganisms can be said to grow faster on organic than on inorganic nitrogen sources. Ammonium sulphate contains 21% nitrogen and is readily soluble in water. Technical-quality ammonium sulphate contains some 20.7 % nitrogen, a maximum of 0.15 % free sulphuric acid and 2 % water. Diammonium hydrogen phosphate is used mostly in yeast production as nitrogen and phosphorus source. Its theoretical nitrogen content is 21.2 % and the content of phosphoric acid is 74 %, i.e. 53.7 % referred to P205. Technical grade products are contaminated by ammonium sulphate. When dissolved
161
they give rise to voluminous sludge which precipitates poorly and contains calcium and iron phosphates. Ammonia is used either as an aqueous solution containing 25 % (v/v) ammonia, or gaseous. Technical grade ammonia water should have the following properties: density 0.91, NH4 + 20-25 %, evaporation residue 0.4 g 1-~. Care should be taken during ammonia storage to take account of the ready liberation of gaseous ammonia from solutions. Urea is used infrequently as a nitrogen source because of its higher price and instability at higher temperatures, on account of which it has to be sterilized by filtration. Except for urea, the above substances are components of almost all nutrient media used in the microbiological industry.
5.4.5
Trace elements, growth factors and precursors Trace elements
Nutrient media components of particular importance are phosphorus and magnesium because of their participation in energy transfers and transductions via ATP-mediated reactions. The majority of microbial cells contain calcium, potassium, sulphur and sodium and these elements have therefore to be added to nutrient media in appropriate amounts. Other trace elements such as cobalt, iron, copper, zinc and manganese, though essential, are usually present as contaminants in other media components and in water. However, when using synthetic media in which the pure chemicals or raw materials prove to be deficient in some trace elements when dissolved in distilled water, the appropriate trace elements have to be supplemented. In general, concentrations of trace elements optimal for growth can be said to be higher than those needed for products biosynthesis; in the case of secondary metabolites the concentration range is relatively narrow. In biomass production all necessary trace elements have to be in the medium in sufficient amounts to preclude precocious limitations of growth. In terms of weight phosphorus is the most abundant trace element; this reflects its importance in the synthesis of nucleic acids, enzymes of primary metabolism and energy-rich phosphate bonds. When supplementing media with trace elements, the elemental composition of biomass is taken as the basis. Synthesis of secondary metabolites and structures necessary for cell differentiation requires a very exact concentration of phosphate in the medium, often below 10 mM, although both prokaryotic and eukaryotic cells are capable of growing at up to 500 mM phosphorus. Among other elements whose
162
amounts in various organisms are thought to be critical are zinc in fungi and actinomycetes, manganese in the genus Bacillus and iron in bacteria and actinomycetes (Weinberg, 1982). Critical concentrations of trace elements depend on strain and medium composition. The optimum concentrations of trace elements have to be determined empirically in each particular case because their effect on the formation of secondary metabolites is difficult to forecast. Figure 5.7 illustrates the relationship between the concentration of Fe 3+, cell growth and production of pyoverdin, a yellow-green fluorescing pigment in Pseudomonas fluorescens (Meyer and Abdallah, 1978). Whereas cell concentration rises with increasing Fe 3+ concentration in the medium, the concentration of pyoverdin exhibits a sharp maximum at intermediate iron concentrations. 100
2,5
.~_
75
L
I_ tl/ > O
s
1,5 o 50 .~_
b
E
t
E x
~ 25
E
0,5
t 0
I
2
ALMF e 3§
5
0 10
Fig. 5.7 Effect of concentration of Fe 3+ on the growth and pyoverdin synthesis in Pseudomonas fluorescens (Meyer and Abdallah, 1978) cell concentration (O), pyoverdin production (O)
In some cases the synthesis of bacterial secondary metabolites requires substantially higher concentrations of trace elements than does cell growth. For instance, maximum production of pyocyanine in Pseudomonas aeruginosa occurs at iron concentrations 30 times higher than those suitable for growth (Kurachi, 1959), and a similar situation obtains with the synthesis of HCN in Chromobacterium violaceum (Rotgers and Knowles, 1978). Synthesis of antibiotics and toxins by the genus Bacillus requires 100-fold magnesium concentrations compared to that required for vegetative growth. Molecules of some products contain metals which directly determine the product's yield and therefore have to be integral parts of the medium. Thus
163 Table 5.10 Stimulation of product biosynthesis by trace elements Element
Product
Cobalt
acetone, butanol macrolide antibiotics chlortetracycline chloramphenicol vitamin B 12
Molybdenum Nickel Zinc Iron
nitrogenase ribitol diphosphate carboxylase kanamycin A iron-containing dextran
Phosphorus Magnesium Chlorine
Production microorganism
Clostridium acetobutylicum different streptomycetes
Streptomyces aureofaciens Streptomyces venezuelae Propionibacterium shermanii, Streptomyces olivaceus Rhizobium, Klebsiella Alcaligenes eutrophus Streptomyces kanamyceticus Leuconostoc mesenteroides
cobalt is part of the vitamin B~2 molecule, biosynthesis of ferridextran is dependent on a sufficient concentration of ferric ions and biosynthesis of chlortetracycline depends on the concentration of chlorides. Further examples are given in Table 5.10. On the other hand, the presence of certain trace elements in the medium may prevent the formation of the desired metabolite. The appropriate ions or salts should be absent in the medium but their elimination is often difficult, especially with natural raw materials. A notorious example is the inhibition of citric acid production by Mo 2+, Cu 2+ and Zn 2+ ions present in molasses; these ions have to be removed either by additions of potassium ferrocyanide or EDTA. Tetracycline biosynthesis cannot proceed in the presence of even minute concentrations of chlorides in the medium, and the culture is supplied by inhibitors of chlorination such as 2-mercaptobenzimidazole. S-isopropyl derivatives of homocysteine inhibiting methylation are used in the biosynthesis of 7-chlor-6-dimethyltetracycline.
Growth factors and vitamins The major source of growth factors and vitamins is natural carbon and nitrogen sources. Should these materials serve as mere sources of vitamins, it would be more suitable in some microbiological processes to supply vitamins in pure form (amino acid biosynthesis). Growth factors and vitamins are required for growth by yeasts (Saceharomyees eerevisiae), lactic bacteria, as well as by Clostridium acetobutylicum producing acetone and butanol. Biotin is important in amino acid biosynthesis because it affects the secretion of some amino acids from cells into the medium. Biosynthesis of lysine and secretion of glutamic acid from mutants of the genus Corynebacterium or Brevibacterium
164
proceeds at medium biotin concentrations not higher than 5 ~tg 1-~, biosynthesis of homoserine at 17.5 lag 1-~ (Yamada et al., 1972). Precursors
Precursors are substances that are directly incorporated into the molecules of products and are important especially in production of secondary metabolites. They were discovered in the course of research into the biosynthesis of secondary metabolites. The first to be explored was phenylacetic acid Table 5.11 Some important precursors Precursor
Product
Phenylacetic acid
penicillin G
Phenoxyacetic acid
penicillin V
Propionic acid n-Propanol p-Hydroxybenzoic acid
erythromycin candicidin novobiocin coenzyme Q fl-carotene licopen
2,2,6-Trimethylhexanone Imidazole
Production microorganism Penicillium chrysogenum, Penicillium notatum Penicillium chrysogenum, Penicillium notatum Streptomyces erythreus Streptomyces griseus Streptomyces niveus Candida tropicalis Blakeslea trispora Blakeslea trispora
(phenylacetamide) whose addition into nutrient media not only substantially enhanced the production of penicillin G, but penicillin G was synthesized as the sole product among all possible penicillins. Likewise, addition of phenoxyacetic acid (phenoxyacetamide) increased the production of penicillin V. Such specific precursor treatment can specifically increase production of various types of penicillins. Further elaboration of this method, the socalled mutasynthesis (see Section 4.5) has enabled new industrially important antibiotics to be produced. Examples of use of precursors for industrial purposes are given in Table 5.11.
5.5
CHEMICAL AND BIOLOGICAL CONTROL OF RAW MATERIALS, STORAGE AND HOMOGENIZATION
Fluctuations in biomass and microbial products yields often pose problems in the development of a given process. These fluctuations may stem from a variety of factors, one of the most significant being the composition and
165
quality of raw materials. Yield fluctuations can be minimized by using homogeneous, standard quality raw materials both in laboratory trials and in pilot plant and industrial productions. Substitution of assured-quality materials by unknown ones may cause severe problems in developing the process, and can lead to considerable losses in production economy. 5.5.1
Chemical and biological control of raw materials
Production microorganisms are sensitive to even minute concentrations of stimulating or toxic substances. Chemical control of raw materials may therefore sometimes fail to give a true picture of their applicability for microbial processes. This holds especially for natural materials containing complex mixtures of different substances. Complete chemical control of all accompanying substances would be too expensive and complicated. However, chemical control is necessary for determining the basic constituents of raw materials such as nitrogen, ash substances, reducing substances, heavy metals and acids. Determination of the quality of a raw material includes as an important part determinations of dry weight, density, colour, clarity and aroma, which supplement the purely chemical analyses. The wrong smell of molasses or corn-steep liquor often attests to faulty storage and contamination by undesirable microorganisms, colour different from a standard points to an incorrect technology of raw material production (e.g. caramelization). A high content of reducing substances and amino nitrogen in corn-steep liquor indicates insufficient extent of lactic fermentation. The quality of individual batches of raw materials and their suitability for a microbial process is reliably determined by a biological test. Each lot of the material is therefore subjected to a cultivation test in which yields obtained with the new batch are compared with those achieved with a standard raw material with known track record. Standard raw materials should be stocked in amounts large enough to support large series of experiments or cultivations. A medium is prepared from standard raw materials and these raw materials are replaced by the tested sample one at a time. The medium comprising only standard components then serves as control. The suitability of a raw material for a particular process is usually determined from results of three independent cultivation trials, each of which involves culturing in three flasks containing an all-standard medium, and another three with the raw material batch to be tested. The new material has to provide yields nearly identical (at least 90 Yo) with those obtained with standard materials. However, it should be borne in mind that flask and bioreactor cultivations proceed under different conditions and some material apparently suitable for flask cultivation may fail in a bioreactor.
166
For instance, a certain lot of calcium carbonate suitable for flask cultivation in tetracycline biosynthesis was not suitable for bioreactor cultivation because of different grain size. Batches with fine granulation are more suited for flask cultures, coarse-grained batches are better suited for the bioreactor. Evaluation of this property of calcium carbonate is performed by a simple test: 1 g sample is shaken in a test tube with 10 ml water, left to stand for 1 h and the ratio of sediment height to liquid height is measured. The higher the ratio the higher the sedimentation rate and the larger grain size (Sikyta, 1983). For these reasons new batches of raw materials are best tested in laboratory or pilot plant bioreactors. Different batches of the same raw material added into the medium can stimulate in a different manner the production of a desired metabolite. In oxytetracycline biosynthesis, a certain batch of corn-steep liquor at a concentration of 0.2 % supported antibiotic yields about one-fifth higher than at 0.4 % whereas another gave 10 % higher yields at the higher concentration. A batch of soybean flour eminently suitable for microbial processes according to the results of chemical analyses was found unsuitable for chlortetracycline biosynthesis because it accelerated the metabolism of the producer strain and thereby lowered the antibiotic production. The same soybean flour batch accelerated metabolism in the same strain and at the same time enhanced the production of tetracycline. On replacing 30 % of the soybean flour by peanut flour the metabolic rate was lowered and chlortetracycline production increased markedly.
5.5.2
Raw materials storage and transport
The production of some raw materials is seasonal and the materials have therefore to be stored for prolonged periods of time up to one year (cornsteep liquor, molasses, meals and flours, etc.). Other materials are available the year round and their storage can be shorter. Storage has to ensure a stable quality of the materials. Natural materials are affected by light, temperature and the action of microorganisms. For this reason, temperature has to be kept constant at room temperature or below according to the type of the material stored. Raw materials that could react must not be stored together. According to the physical state, raw materials can be divided into powders, liquids and gases. Some of them are hygroscopic (starch, sucrose, sodium and potassium hydroxide, sodium nitrate) and are therefore stored in polyethylene bags on pallets, in the dark and at 10 to 15 ~ Liquid raw materials are stored in underground silos and tanks, reservoirs, casks or barrels. Molasses is supplied from sugar plants in cisterns from which it is pumped in-
167
to closed tanks. Fresh molasses is unsuitable for direct use and has to be stored for 2-3 months in the tanks. Another liquid or semiliquid raw material, corn-steep liquor, has to be stored in the dark and cold. It is useful to store it in large tanks which facilitates its subsequent homogenization; this in turn assures a constant quality even when different batches are supplied. Oils are transported to smaller plants in barrels, large plants are supplied by cisterns from which the oils are pumped into storage tanks. Cisterns are also used for transporting aqueous ammonia solutions which are then stored in a way similar to that used for alkalies and acids. Sodium or potassium hydroxide are supplied in flakes or grains in casks and are strongly hygroscopic. Alcohols such as ethanol or methanol require special care both during transport and during storage because they are toxic and inflammable. Correct logistics of transport and distribution of raw materials from storage sites to production sites and inside the production units is an important factor. A useful procedure involves preparation of nutrient media directly in storage units and their subsequent transfer by piping into production departments; this obviates an interplant trucking of large amounts of raw materials.
5.5.3 Homogenization of raw materials Raw materials from one batch should be used in production as long as possible, which can be assured only in small plants. Large plants with high daily consumption of raw materials have to homogenize these materials in order to maintain a reasonably uniform quality. It is useful when the homogenization is performed by the supplier. Liquid materials in tanks are easy to homogenize by mixing. Powdery or bulk materials are also homogenized relatively easily by mixing in tanks. The choice of type and size of homogenization devices for bulk materials depends on the required capacity of the device, degree of homogenization, material to be homogenized, requirements for aseptic operation, etc.. Homogenization of loose materials is efficiently done using continuous homogenizers with a nonrandom, controlled mixing regime (so-called static mixers).
REFERENCES Abou-Zeid, A . 3 . A., El-Fattah, A. F. A., Farrid, M. A. (1979), Agric. B i d . Chem. 43, 1977. Al-Obaidi, Z., Berry, D. R. (1979) Biotechnol. Leu. 1, 153. Aoki, T., Norimoto, A., Yamada, T. (1977) Wood Rex 62, 19. Beckmann, E. ( I 922) Brit. Patent I5 1 229.
168 Bhatt, A. K., Bhalla, T. C., Agrawal, H. O., Sharma, N. (1992) Biotechnol. Techn. 6, 111. Bla~ej, A., Ko~ik, M. (1985) Degradation reactions of cellulose and lignocellulose. In: Cellulose and its Derivatives, Chichester. Buzzini, P., Gobbetti, M., Rossi, J., Ribaldi, M. (1993) Biotechnol. Lett. 15, 151. Chung, S. L., Myers, S. P. (1979) Dev. Ind. Microbiol. 20, 723. Cuskey, S. M., Frein, E. M., Montenecourt, B. S., Eveleigh, D. E. (1982) Overproduction of cellulase -- screening and selection. In: Overproduction of Microbial Products, London. David, C., Fornasier, R., Greindl-Fallon, C., Vanlautem, N. (1985) Biotechnol. Bioeng. 27, 1591. De Menezes, T. J. B. (1978) Process Biochem. 9, 24. Dimmling, W. (1978) Starch/Stiirke 30, 401. Enweta, C., Ayanru, D. K. G., Obokwe, C. O. (1992) Acta Biotechnol. 12, 127. Garves, K., Dietrichs, H. H. (1975) Holzforschung 29, 39. Goto, T., Harada, H., Saiki, H. (1974) Bull. Kyoto Univ. Forrest. 46, 153. Gould, M. J. (1985) Biotechnol. Bioeng. 27, 225. Grous, W. R., Converse, A. O., Grethlein, H. E. (1986) Enzyme Microb. Technol. 8, 274. Han, Y. W. (1978) Adv. Appl. Microbiol. 23, 119. Hardt, H., Lamport, D. T. A. (1982) Biotechnol. Bioeng. 24, 903. Jayne, G., Neuschaffer, K. (1957) Die Makromol. Chemie 28, 71. Kirk, T. K., Croan, S., Tien, M. (1986) Enzyme Microb. Technol. 8, 27. Krupnova, A. V., Sharkov, V. I. (1964) Gidroliz. i lesokhim, prom. S S S R 17, 3. Kurachi, M. (1959) Bull. Inst. Chem. Res. Kyoto Univ. 36, 163. Lamptey, J., Moo-Young, M., Robinson, C. W. (1986) Biotechnol. Lett. 8, 525. Leclerq, E. (1985) Process Biochem. 20 (3), 75. Lee, K. J., Skotnicki, M. L., Tribe, D. E., Rogers, D. L. (1981) Biotechnol. Lett. 3, 207. Maddox, I. S. (1980) Biotechnol. Lett. 2, 443. Meyer, J. M., Abdallah, M. A. (1978) J. Gen. Microbiol. 107, 319. Miescher, G. M. (1975) U. S. Patent 3 929 575. Milgrom, L. (1985) New Scientist 1, 16. Millet, M. A., Backer, A. J., Satter, L. D. (1975) Bioteehnol. Bioeng. Symp. 5, 193. Pfeffer, J. T., Liebman, J. C. (1976) Resources Recov. Conserv. 1, 295. Prescott, S., Dunn, C. (1959) Industrial Microbiology, New York. Puri, V. P. (1983) Biotechnol. Lett. 5, 773. Ratledge, C. (1977) Ann. Rep. Ferm. Proc. 1, 49. Reese, E. T., Mandels, M., Weiss, A. H. (1978) Adv. Biochem. Eng. 8, 181. Rogalski, J., Hattaka, A., Wojtas-Wasilevska, M., Leonovicz, A. (1993) Acta Biotechnol. 13, 41. Rotgers, P. B., Knowles, J. C. (1978) J. Gen. Microbiol. 108, 261. Saddler, J. N. (1986) Microbiol. Sci. 3, 84. Schlegel, H. G. (1992) Allgemeine Mikrobiologie, Stuttgart. Shennan, L., Levi, J. D. (1974) Progr. Ind. Microbiol. 13, 3. Sikyta, B. (1983) Methods in Industrial Microbiology, Chichester. Toran Diaz, I., Jain, V. K., Allavis, J.-J., Baratti, J. (1985) Biotechnol. Lett. 7, 527. Tsao, G. T., Ladisch, M., Ladisch, K., Hsu, T. A., Dale, B., Chou, T. (1978) Ann. Rev. Ferm. Proc. 2,1. Uchio, R. (1976) Japanese Patent 7 638 488. Underkofler, L. A., Hickey, R. J. (1954) Industrial Fermentation 2, New York. Voget, C. E., Mignone, C. F., Ertola, R. J. (1985) Biotechnol. Lett. 7, 43. Wayman, M., Parekh, S., Chornat, E., Overend, R.P. (1986) Biotechnol. Lett. 8, 749. Weimer, P. J., Chou, Y. (1986) Appl. Environ. Microbiol. 52, 733.
169 Weinberg, E. D. (1982) Biosynthesis of microbial metabolites regulation by mineral elements and temperature. In: Overproduction of Microbial Products, London. White, J. (1948) Amer. Brewer 20, 21. Whittenbury, R., Dalton, H., Eccleston, M., Reed, H. L. (1975) Microbial Growth on C~ Compounds, Kyoto. Yamada, K., Kinoshita, S., Tsunoda, T., Aiba, S. (1972) The Microbial Production of Amino Acids, Tokyo. Zeikus, J. G. (1980) Ann. Rev. Microbiol. 34, 423.
170
6
CULTIVATION DEVICES
Culture devices are used to accomplish complex biological processes which result in accumulation of biomass of microbial, but also plant or animal cells or their products. When selecting a suitable culture device or system it is necessary to take into account a number of biological, chemical, physical and technological factors. These are schematically summarized in Fig. 6.1. Cultivation device
Type of cultured cells
Substrates
bacteria microorganisms plant cells animal cells solid semiliquid
t
yeasts actinomycetes fungi
liquid gaseous surface
Oxygen supply
Demands for asepsis
Scale
Technological configuration
aerobic
I
anaerobic ~ fully aseptic production-aseptic partially aseptic fully nonsterile .... laboratory pilot plant production batch fed-batch semicontinuous ~ continuous
Fig. 6.1 Factors governing the selection of a cultivation device
submerged
171
The choice of a culture device has to take into account the size and morphology of microbial cells, i.e. whether they are unicellular (bacteria, yeasts), filamentous (actinomycetes), or multicellular filamentous (higher fungi), whether they form mycelium and whether they are susceptible to mechanical damage during culture. An important criterion is the type of the end product - biomass of a certain specific composition, or a metabolite accumulated inside the cells or secreted into the medium. Devices can be classified also according to the type and form of the biocatalyst used, i.e. bioreactors for culturing free cells or bioreactors with immobilized enzymes or cells. Another criterion is the type of substrate (gaseous, liquid, solid). The supply of solid, liquid or semiliquid nutrients usually presents no problems. These arise when gaseous substrates such as air, oxygen, carbon dioxide or methane are to be supplied. Some microorganisms produce cell matter or products only when cultured on solid substrates (formation of fruit bodies of higher fungi, synthesis of some biologically active substances) and fail to perform when cultured under submerged conditions. Devices for surface culture on solid and liquid substrates are substantially more simple and therefore also cheaper than devices for submerged culture but the growth and product formation are appreciably slower. An important feature is the relationship of the cells to oxygen, whose appropriate supply has to be ensured when the organism is aerobic. Since oxygen is one of the most expensive substrates the appropriate culture device has to be chosen with considerable care. Devices with surface aeration are used in isolated cases. Some microorganisms, especially microaerophilic ones, do not require oxygen but can grow and produce metabolites equally well in its presence. Anaerobic microorganisms do not grow in the presence of oxygen, which thus has to be removed by flushing the culture device with some inert gas. The necessary complexity of the culture device is significantly affected by the necessity of maintaining aseptic conditions. In some microbial processes, such as the cultivation of pathogenic or some genetically manipulated microorganisms, it is imperative that not a single germ penetrates from the device into the environment. The construction of these devices is correspondingly complicated (pressure sterilization of media, air overpressure in the device, steam or another blockage of all joints and valves communicating with outside, foam removal, etc.). Simpler devices can be used in operations that are conducted under partially aseptic conditions. The sterilization of media is also necessary but this can be done by boiling, air is usually also sterilized but the air overpressure in the bioreactor during culture is not necessary. These processes include for instance the production of biomass for fodder purposes,
172
or operations where ambient conditions (high or low pH, extreme temperatures or limited assimilability of substrates) prevent the proliferation of undesirable microflora. Completely unsterile processes such as waste water treatment are conveniently performed with the aid of natural ambient microflora and aseptic conditions are thus actually undesirable. However, even in these aerobic processes special attention is to be paid to oxygen supply into the system, in particular its economy, because the energy costs can be very high. Anaerobic processes of waste water treatment require the maintenance of a reasonable homogeneity of a growing mixed population, distribution of nutrients and satisfactory gas accumulation and removal. The elaboration of microbiological processes and their scale-up are usually carried out in culture devices with gradually increasing volumes, usually by a factor of 10. This procedure is logical because the initial stages of a process involve manipulation with, and evaluation of, large series of samples, whether the desired goal is the selection of suitable production strains, composition of nutrient media or chemical or physical culture conditions. Optimal procedures elaborated in flasks are tested in larger laboratory devices -- laboratory bioreactors -- which make it possible also to assess some technological problems because they resemble production devices. Before introducing a process into the production scale it is necessary to evaluate further material and technological parameters in pilot plant devices which allow to a large extent the assessment of the economics of the production process. Laboratory bioreactors usually have volumes of 500 ml to 50 1, pilot plant devices are in the scale of 50 1 to 5 m 3 and production bioreactors have volumes of the order of 5 m 3 to 3000 m 3. In some operations such as the production of vaccines the production bioreactors are considerably smaller, about 100 1, whereas production of microbial proteins, when carried out in 20 m 3 vessel, is still considered pilot-plant. With regard to the configuration of the technological process, culture devices can be divided into single-stage (batch) devices, operations suitable for semicontinuous and fed-batch culture, and devices for continuous culture. When the requirement for aseptic conditions complicates the design of batch culture devices, the level of complexity naturally increases all the more in devices for semicontinuous or even prolonged continuous culture. This is one of the main factors hampering the introduction of continuous processes into practice, because the construction costs of appropriate culture devices are extremely high. The complexity of the microbial process dictates also the use of a single-stage continuous device (production of biomass or growth-associated products) or multistage configurations (product formation is not associated with growth).
173
6.1
DEVICES FOR CULTURE ON SOLID SUBSTRATES
Cultivation of microorganisms on substrates solidified by agar, gelatine or silica gel is routinely used for classification and determination of microorganisms, their maintenance, and in preparation of inocula. These substrates are also exceptionally used for culturing pathogenic microorganisms for vaccine production. Bulk materials such as bran, straw and other cellulosic wastes have been used for a long time for cultivation of fungi (Prescott and Dunn, 1949; Underkofler and Hickey, 1954) with the aim of cultivation of edible fungi, production of enzymes and increasing the palatability of fodder straw. Solid substrates are also used for composting, microbial ore leaching, coal desulphuration and processing of solid agricultural wastes.
6.1.1
Stationary cultivation on solid substrates
Laboratory research into the cultivation of microorganisms on solid substrates is accomplished in a variety of flasks, cylinders, trays and other receptacles under aseptic, partially aseptic or nonsterile conditions. Cultivation under aseptic conditions requires the sterilization of the device, the solid substrate and air, and maintenance of aseptic conditions during sampling. Under partially aseptic conditions the sterilization is usually performed only with the solid substrate, other operations being carried out under nonaseptic conditions. Devices for stationary culture on solid substrates are relatively simple. Cultivation is performed on metal plates with an area of several dm2 or m2 placed one above another in a thermostated chamber. The optimal thick-
a
b
Fig. 6.2 Tray ( n ) and chamber ( b )system for surface cultivation of microorganisms on solid substrates (Rehm, 1980)
174
ness of the wet substrate layer is 4-8 cm. Temperature and moisture are kept on required levels by pumping sterile thermostated moist air into the device. The solid substrate is autoclaved along with the plates and inoculated with the production culture. When aseptic conditions do not need to be maintained during the cultivation, the metal plates can be replaced by wooden trays (Fig. 6.2) onto which either sterilized or unsterilized moistured substrate is layered, inoculated with appropriate culture and cultured for the required time interval. These procedures are used for cultivation of edible fungi, especially champignons (Rehm, 1980). ~7
2
I
t
,
p~ckin9
I!111i11111lIIIillllllll'l |
!
IL
J
IM ~ 5
3
Fig. 6.3 Laboratory unit for cultivation of microorganisms in thick layers of solid substrate (Deschamps et al., 1979)
A laboratory device for processing thicker substrate layers is illustrated in Fig. 6.3. It consists of a glass or polyvinylchloride cylinder 1 fitted with a lid 2 and placed in its lower part in a water bath 3 to prevent access of ambient air. The surface of the vessel is covered by a glass wool coating to ensure satisfactory thermal insulation 4. The inner space is divided into compartments by perforated plates 5. Moistened air is fed through openings 6 and leaves through the lid port 7. The same process can be performed in a very simple way in polyethylene bags (Zadra~il and Brunnert, 1981). Spaces formed by a wooden framework or wire nets are gradually filled with layers of moistened substrate such as shredded straw, with a concomitant addition of
175
inoculum, till the whole space is filled up. The cultivation is terminated when the culture has spread homogeneously throughout the whole space. The method is used, for example, for fungal processing of lignocellulosic wastes for fodder production. Under the heading of stationary cultivation on solid substrates is also microbial ore leaching (Manchee, 1979). Dump heaps after ore mining, which contain low concentrations of metals, or ores in situ are inoculated with suitable microorganisms and the leached metal solutions, usually in the form of sulphates, are further processed. The schematics of the basic arrangement of these procedures are given in Fig. 6.4. 2
:':".'~?:
2 .3
.
-
9
9
9
.
~
~
,
9
9
.
~
.
9
,
b
1
]
,' I:.:-.?:!',',,L J,, ;d.':i.!-?i', I " '" :'."
I "\
...." \
/ /
\ 9" : "
.
.
.
.
4-~2
I 4
Fig. 6.4 Systems for microbial ore leaching (Rehm, 1980) (a) Leaching in heaps : I leaching troughs, 2 - protective wall, 3 - dump, 4 - collecting piping, 5 - collecting trough, 6 asphalt base, 7 - pump, 8 - leaching fluid recycling outlet, 9 -- processed solution; (b) leaching in slopes of large dumps: 1 -- dump, 2 -- leaching trough, 3 - overburden with low ore content, 4 leaching solution back feed, 5 - collecting trough, 6 - leaching fluid recycling outlet, 7 - processed fluid; (c) leaching in underground cavities: 1 -- sandy soil, 2 -- leaching solution, 3 -- solution regeneration, 4 -- water impermeable layer; (d) leaching in disused mines: I -- processing tank, 2 - tunnel, 3 - cave, 4 - leaching solution, 5 - solution regeneration
176
6.1.2
Devices with mixing of solid substrates
The simplest device of this type is the vertical mixed bioreactor (Fig. 6.5a). It is in essence a vessel with a perforated bottom and the inner space filled with a moistened solid substrate. Air is brought into the bioreactor through the perforated bottom and the contents are stirred simply using forks driven by a low-speed motor. The low intensity stirring is necessary to avoid excessive damage to the filaments of the growing microorganisms. It serves for breaking up the solid substrate surface, facilitating oxygen access, carbon dioxide removal, and preventing local overheating of the culture.
1 2
3
4
llll"ll '11111lil i l'l'l I I'l"l lllll
1
_
2 a
5
b
c
Fig. 6.5 Solid substrate culture systems with substrate mixing (a) vertical mixed bioreactor, (b) horizontal mixed bioreactor, (c) tubular bioreactor" 1 -- motor, 2 - air inlet, 3 - substrate inlet, 4 - partial culture feedback (inoculation), 5 - product outlet
In a horizontally mixed bioreactor (Means et al., 1962) the contents are mixed by a low-revolution stirrer and baffles (Fig. 6.5b). The air is brought in over the substrate surface at one end of the bioreactor and leaves along with carbon dioxide at the other end. The efficiency of use of the working volume is low and the practical use of this type of device is rare. By contrast, the tubular bioreactor (Fig. 6.5c) makes full use of the whole working space and, in addition, makes possible continuous culture. It consists of a tube fitted with a revolving internal thread or another system that mixes the culture so that the microorganisms grow all over the surface of the solid substrate particles, and at the same time the substrate is moved along the tube. The bioreactor has inlet and outlet openings for letting steam in and the condensate out during sterilization, an opening for substrate supply, and an outlet port for air and the processed substrate.
177
6.2
SURFACE CULTURE ON LIQUID SUBSTRATES
The stationary culture of microorganisms on the surface of a liquid nutrient medium is one of the oldest methods for microbial culture. Although submerged operations have dominated the field for several decades, in some cases surface cultivation procedures on liquid nutrient media have retained an important place. These are mainly operations where the required products are accumulated in the cells or in the culture, and their synthesis depends on differentiation that takes place only during surface growth (aerial mycelium, spores). Another advantage of these processes is the possibility of achieving a high biomass concentration per unit nutrient medium volume; also, the demands for inoculum are lower by a factor of 100 than in submerged cultivations. The initial costs of the device are relatively low and so are the operation costs (low energy input, simple manipulation and regulation of the process, easy mechanization, low labour demands, etc.). A disadvantage is the relatively low velocity of growth and production. This type of cultivation can be carried out in flasks, bottles, pans, bowls or bags, or in bioreactors with a thin liquid layer - film, disc and blade bioreactors which ensure a dynamic method of cultivation with surface movement of the culture liquid.
6.2.1 Stationary surface culture on liquid substrates On a laboratory scale these cultivations are performed in Erlenmeyer flasks or, more frequently, in Fernbach or Roux flasks which offer a larger liquid surface area. Microbial growth and product formation depend to a certain extent on the height of the medium layer, surface area and intensity of gas exchange. When culturing metabolite-producing fungi, the layer of mycelium grown during the cultivation period can be underlaid with fresh medium, and the procedure can be repeated as long as the mycelium remains in the active producing state. Industrial operations can be carried out in large pans made of pure aluminium, zinc-coated iron sheet or stainless steel to prevent corrosion and liberation of undesirable metal ions into the medium. The surface area of the pans is 5 to 10 m?, height 10 to 20 cm, and the culture liquid layer is 4-7 or 8-12 cm. Before use the pans are sterilized by steam or chemically, the medium is sterilized in a central sterilizer and brought via sterile piping to individual pans arranged in plates in culture chambers. The chambers are supplied with sterile air with a relative humidity of 40 to 60 TO(vol), and kept at a con-
178
stant temperature (Fig. 6.6). The air supply is 3 to 15 m 3 m -2 h -1 depending on the particular process. A similar cultivation procedure is also sometimes used in citric acid production. Schroeder and Brandl (1957) designed a culture system for processes susceptible to contamination. The system consists of a series of pans stacked above each other in a sterilized closed metal tank. Sterilized and inoculated nutrient medium is automatically fed into the pans from top to bottom till all
k 7
T
Fig. 6.6 System for surface culture in trays (Schroeder and Brandl, 1957) fermentation chamber, 1 air inlet, 2 - air filter, 3 - air moistener, 4 - air heater, 5 6 - culture collector, 7 - air outlet
pans are filled. The tank is then flushed with sterile air. The system is technically relatively complicated and it found only limited application. A substantially improved technique of stationary surface culture of microorganisms on liquid media under completely aseptic conditions was described by Kybal and V16ek (1976). The culture is carried out in sealed plastic bags and can be used both in laboratory and industrial operations. The production device is illustrated in Fig. 6.7 and consists of the following parts" air supplier 1, air flow meter 2, three-way cock with a regulating valve 3, air filter 4, cultivation bag resting on an inoculation rack 5, bypass valve 6, duplicator for nutrient medium preparation 7, manipulation bench 8, storage transporter 9 and measuring valve 10. The transporter is used for positioning the bags into the incubation space and their transport to the processing unit. Aeration is controlled by a three-way needle valve (one valve per bag) and cooling is ensured by cooling coils built into the bag support racks. The procedure has the
179
following advantages: the possibility of contamination of the process from outside as well as contamination of the environment are substantially decreased, the composition of gases above the growing culture and thus the actual biomechanical processes can be controlled, and it is unnecessary to sterilize the cultivation device because the bags are manufactured sterile. This culture process has been used with considerable success in mass production of fungal spores.
6
! ll+[Iv Fig. 6.7 Industrial-scale unit for stationary cultivation (Kybal and Vl~ek, 1976). For explanation see the text
6.2.2
Bioreactors with thin liquid layers
Among culture devices of this type are the rotating cylinder, disc and blade bioreactors. They are suited for highly viscous nutrient media and for culturing microorganisms susceptible to shear stress. Rotating-cylinder bioreactors were first described by Phillips, Sallans and Spencer (1961) and Gorbach (1969), and were further elaborated in particular by Moser (1982). Basically, they are horizontal tube reactors coated with heat-exchange jackets and fitted with an internal rotating cylinder which dips into the nutrient medium and on whose surface the microorganisms grow (Fig. 6.8a). A modification is represented by a bioreactor with a stationary inner cylinder and a revolving outer tube (Fig. 6.8b). Microorganisms grow on the surface of the cylinders in a thin layer which is constantly renewed due to dipping into the nutrient medium. The cylinder revolves at a relatively high speed, up to 7 Hz, which is usually lower at the beginning of the cultivation to prevent washing of the microorganisms off the cylinder surface. The thickness of the growing layer is usually 1-2 mm; thicker layers would suffer from oxy-
180
l a
Fig. 6.8 Horizontal tubular bioreactors (a) with internal revolving cylinder, (b) with external revolving cylinder
b
gen limitation. Among the advantages of this type of bioreactors is the limited foam formation; the produced carbon dioxide is not dissolved in the liquid, and oxygen supply to the microorganisms is very good. Problems are usually associated with collection of biomass samples from the surface, especially in devices with a rotating outer cylinder. This causes problems in monitoring the microbial growth because the amount of biomass grown has to be referred to a certain area. These types of bioreactors have not yet been used in industrial practice. Disc bioreactors consist of horizontally revolving discs attached to a common shaft (Antonie, 1975). The microorganisms grow on the surface of the slowly revolving discs dipping into the medium. Figure 6.9 illustrates sche-
,,.! 7
I
|
! 3
2 ---113
11 r--
12r'-
Fig. 6.9 Laboratory
.F
9
L
1
disc bioreactor (Blain
et
--n14
al., 1979). For explanation see the text
181
matically a laboratory type of disc bioreactor. It consists of a glass T-tube 1 sealed at both ends by stainless steel plates 2, through the centre of which passes a revolving shaft 3 driven by engine 4 with adjustable revolution velocity. Plastic or stainless steel discs 5 are placed along the shaft. Middle discs are divided into four segments 6 which can be removed for microorganism sampling. During the sampling, one of the segments is removed with the aid of the sampling bag 7, and replaced by another sterile segment. Individual discs on the shaft are separated by rings 8 and the end-plates are fixed by screws 9. The liquid surface is just underneath the shaft, 10. Sterile air is brought in by opening 11, inoculum by opening 12 above the medium surface. The other end of the vessel houses the air outlet 13 and, in its lower part, the culture broth sampling port 14. These bioreactors are used for waste water treatment and are being tested also in metabolite productions.
-
2
--3
1%
Fig. 6. l0 Blade-mixed bioreactor 1 -- substrate, 2 -- air inlet, 3 - substrate outlet
Blade bioreactors operate on a similar principle as disc bioreactors (Fig. 6.10). The microorganisms grow on the surface of blades of a slowly revolving impeller half immersed in culture medium, the other half protruding out of the medium. As in disc bioreactors, the oxygen transfer is very good because of the thin layer of microorganisms growing on the blades. The application of this type of bioreactors is similar to that of disc reactors. Culture devices with a thin liquid layer also include systems using tilted flat surfaces along which the culture medium slowly trickles (Fig. 6.11). These systems are used for open-field cultivation of autotrophic microorganisms.
1.~ 2 u______-----~ /
t~
]I 3
Fig. 6.11 Schematic side view of an open field culture unit for autotrophic microorganisms 1 -- tilted cultivation surface, 2 - collection trough, 3 - reservoir, 4 - pump
182
6.3
SYSTEMS FOR LABORATORY-SCALE SUBMERGED CULTIVATION
On an industrial scale, submerged cultivation is the most widely used technique for production of microbial biomass and microbial metabolites. As compared with surface culture, both microbial growth and product formation occur at a higher rate. Air feed or stirring of the culture broth can ensure a satisfactory rate of oxygen transfer and homogenization of the bioreactor contents. Laboratory-scale submerged culture is usually performed in various types of flasks on shakers. 6.3.1 Culture flasks and shakers
Kluyver and Perquin (1933) were the first to use cultivation in flasks on shakers, and the method has been widely used ever since for culturing not only microbial, but also plant and animal cells. Flask cultivations can be performed in large series that make it possible to evaluate and screen production microorganisms, media composition, and to check the quality of both raw materials and inoculum.
Culture flasks Laboratory cultivations on shakers are conducted in test tubes, flasks and bottles of various shapes and sizes. The most common are Erlenmeyer flasks and culture flasks with volumes of 250-500 ml. Some microorganisms, in particular bacteria, are cultured in small to medium volumes in test tubes of different sizes. These cultivation vessels are used mostly for initial strain screening, inoculum growth, multivariable testing and raw materials control. "Flying saucer" shaker flasks and flat bed "Thompson" bottles are also used in isolated cases. The rate of oxygen transfer in the flasks is governed not only by the mechanical characteristics of shaker tables, but also by the flask shape and the ratio of medium to total volume in the flask. The rate of oxygen transfer is substantially higher in flasks with a flat bottom than in round-bottomed ones. It can be increased by placing baffles of various types in the flask. The baffles either pass through the flask neck, or are fixed to the lower part of the flask, or alternately in the upper and lower part (Fig. 6.12). It should be noted, however, that baffles cause foaming of the medium and the foam layer on the liquid surface lowers the rate of gas exchange. Glass flasks are the most widely used. Their advantages are a relatively low price, transparency which permits the observation of microbial growth
183
and medium mixing, easy sterilization and washing. The glass has to be such as to withstand washing in acids and alkalies, heat, and should release no trace elements into the medium. Whole flasks or built-in baffles made of iron, aluminium, stainless steel and other materials are used when testing the effect of construction materials on the course of the microbial process.
Despite its importance, flask closure is an often-neglected factor. The main stress is usually laid on asepsis, less attention being paid to the fact that in aerobic cultivations the flask closure affects the aeration conditions in the culture. The commonly used cotton plugs form an aeration barrier because oxygen has to diffuse through the plug material before reaching the culture. At large oxygen consumption rates in the culture the composition of the gas mixture in the flasks therefore differs from the outside air and the microbial growth may be limited due to oxygen shortage. It goes without saying that the wetting of the plugs by the culture liquid has to be avoided. Other plug materials besides cotton are glass wool, polyurethane foam, gauze or synthetic fibrous materials. Culture in flasks involves loss of water by evaporation. This causes a reduction in the volume of the culture liquid and consequently a change in the medium to total flask volume ratio. This in turn affects the rate of oxygen transfer and thus also the rate of microbial growth and product formation. It has been found that evaporation losses during a 48-h cultivation at 37 "C in 1 1 Erlenmeyer flasks containing 100 ml culture, and performed on a reciprocal shaker at a frequency of 5 Hz, amounted to 20% of the total liquid volume. These losses cannot be avoided, but can be made up for by adding an appropriate volume of water (in this case 20 ml) to the medium at the beginning of culture.
Shakers The main requirements for shakers are quiet, reliable and fault-free operation without vibration even during long-term cultures, the possibility of
184
changing the frequency and cam length in rotary shakers or stroke frequency and amplitude in reciprocal ones, simple and rapid change of culture trays and low operation costs. The simplest shaker type is the so-called rockers. They are usually employed for cultivations in test tubes which are attached to both faces of a plate that performs a pendulum-like motion. The rate of oxygen transfer is low as compared with classical shakers. Shakers can be divided into two groups, reciprocal and rotary. The main advantage of reciprocal shakers is their mechanical simplicity, which is reflected in their lower price. Important parameters in reciprocal shakers are stroke frequency and amplitude. On increasing the stroke frequency and amplitude the oxygen transfer rate rises to a certain threshold value. The stroke frequency is usually 1-2 Hz, the amplitude being 30-80 mm. Reciprocal shakers are suitable for culturing unicellular microorganisms such as bacteria and yeasts. During flask cultivation of fungi the flask walls are sometimes covered with culture growth, which may also form a solid pellicle on the medium surface. Rotary shakers usually achieve higher rates of oxygen transfer than reciprocal ones and are therefore more widely used. Important parameters are revolution frequency and eccentricity. The usual frequencies are 1.5-7 Hz, eccentricities 10-15 mm. Both reciprocal and rotary shakers are sometimes equipped with stroke frequency meters or revolution frequency meters. Some types feature automatic cutoff timers or programmable regulation of stroke or revolution frequency. Culture flasks are placed on trays fitted with various types of brackets according to the flask type and size. Tilting the flasks on trays by 15 to 30 ~ aids in attaining higher oxygen transfer rates than in upright flasks. Trays are arranged in vertical plates. The trays used in reciprocal shakers are usually rectangular, in rotary shakers the trays can be circular or rectangular. The number of plates on shakers is usually 1 to 4. Multi-plate shakers save space, whereas in single-plate shakers individual flasks are easily accessible and the manipulation of flasks and trays is easier. Single-plate shakers also make it possible to attach accessories for supplying nutrient stock solutions, feeding air or other gases, regulating medium pH, etc.. Constant temperature during culture is ensured by placing the shakers in thermostated rooms. Small shakers are sometimes fitted with water baths or constant temperature cabinets. Because both glass and air are poor heat conductors, sufficient air circulation in the shaker rooms is necessary to avoid the formation of temperature gradients between individual parts of the room. The temperature in flasks placed in the middle of large multiplate shakers, which
185
may contain several hundreds of flasks, may be 2-3 "C higher than the mean temperature, especially during the period of maximum culture growth.
6.3.2 Devices for large-volume cultivation on rockers The device described by Kybal and Sikyta (1985) was developed from experience with the stationary culture of microorganisms in plastic bags, and is highly suitable for culturing cells sensitive to mechanical stress (Fig. 6.13). Plastic bags filled with sterile nutrient medium are inoculated and then put on a plate with a regulated swing frequency, placed in a constant temperature culture room. The swinging motion ensures culture mixing and a relatively good oxygen transfer. The possibility of contamination is greatly reduced because of the simple configuration and manipulation.
Fig. 6.13 Rocker culture unit for larger culture fluid volumes (Kybal and Sikyta, 1985) ( a ) front view, ( h ) side view. For explanation see the text
186
The culture device consists of three parts, the control panel A, box B and stand C. The control panel is built into the chamber lid. Its front part contains control elements for heating and swinging regulation 1 while the rear part contains an outlet opening with two flaps for adjustment of aeration intensity. The front of the box is fitted with a transparent door 2 and a support band runs through its middle with built-in three-way taps 3 with a needle valve for regulation of aeration. The central air flow meter 4 is placed on the outside of the box. Vertical rectangular panels on both sides are fitted with heating elements. The plastic bags 6 are placed in the box in transparent frames 7 delimiting the space for inflated bags on flat supports 8. The supports are slid into the box on rails 9 that are attached to vertical strips 10 which run along the entire length of the side walls, and also to the box front. The flat supports are mounted on firm horizontal rails by means of revolving hinges 11. Air is fed through the flow meter 4 via piping 12, it passes through the needle valve 3 and a hose 13 into a circular air filter 14. The filter is attached to a clamp 15. The air is let out of the plastic bags into the main box space via an opening in the upper part of each bag. The stand consists of four rectangular metal legs fitted with adjustable feet which enable the box to be positioned exactly horizontally. Metal crosspieces run between the legs. One of the crosspieces is mounted with apparatus necessary for air preparation 16. Nutrient medium is prepared in a central sterilizer, sterilized and an appropriate amount is pumped into individual plastic bags. Plastic bags of various dimensions, i.e. with width/length/height dimensions of 10/20/3 cm to 120/240/20 cm, are obtained sterile from the manufacturer. Medium in the bags is inoculated and the bags are positioned in the box, thermostated at an appropriate temperature. The air feed over the liquid surface and the motor driving the swinging mechanism are switched on.
6.4
BIOREACTORS WITH MECHANICAL MIXING
These bioreactors are very widely used for both research and production purposes. The contents of the bioreactor are mixed by various numbers of impellers of varying shape, placed on a common shaft. The schematics of a bioreactor with mechanical mixing are shown in Fig. 6.14 including all necessary equipment for successfully conducting a microbial process. The basic components are varied and modified according to the actual aim of the process. The simplest classification of bioreactors with mechanical mixing is by their size, i.e. laboratory, pilot plant and production types. A number of features of
187
these bioreactors are naturally found also in other types of bioreactors of all sizes.
6.4.1
Laboratory bioreactors
Laboratory bioreactors are eminently suitable for research into microbial processes. They serve as one of the intermediate steps in production scale-up and, in contrast to flasks, allow exploration of problems of a technological character because they resemble production bioreactors in shape, aeration and mixing systems. Their merits also include relatively low investment costs,
s 3
61 7
]]
I '!
121
L1
I
I
J
8 9
i j
t
Fig. 6.14 Scheme of a mechanically agitated bioreactor 1 aeration m e a s u r e m e n t and regulation, 2 - - temperature regulation, 3 - - m e a s u r e m e n t of dissolved oxygen, 4 -- m e a s u r e m e n t of impeller power input and speed regulation, 5 measurement of substrate and product concentrations, 6 -- gas analysis, 7 - foam regulation, 8 - - pH m e a s u r e m e n t and regulation, 9 - rheological measurements and regulation
low operation costs and high quality and reproducibility of cultivation results. All these factors contribute to their wide use in research and development of microbial processes. Construction of laboratory bioreactors and auxiliary devices has been reviewed extensively (Solomons, 1967, 1969; Blakebrough, 1969; Steel and.Miller, 1970). The working volume of these bioreactors is usually 1-20 litres. Two basic types are used, stationary and portable reactors. Stationary bioreactors are mounted on stands or supports and are fitted with jackets or coils for in situ sterilization and with systems for constant temperature control. Portable bioreactors arranged in batteries are sterilized in an autoclave either empty or containing medium. They are then placed in a constant temperature bath.
188
The main requirements imposed on laboratory bioreactors are as follows" a) their shape, geometrical proportions and interior equipment should be similar to those of industrial bioreactors; b) they have to be sufficiently flexible so that a variety of factors can be studied in them; c) for economic reasons they have to be relatively small, but still large enough to permit appropriate control of variables; d) they have to be simple to assemble, dismantle and clean; e) their working volumes have to be sufficiently large so that sampling during cultivation does not significantly affect the culture volume, especially with regard to aeration and mixing; f) all control devices such as recording and regulation of temperature and pH, and foam breaking, have to operate reliably so that standard cultivation conditions are ensured; g) they have to be constructed so that the contamination of the culture from the external environment is excluded.
a
b
c
d
Fig. 6.15 Different types of bioreactor vessels (a) glass or metal vessel with an upper lid, (b) glass or metal cylinder with an upper and a lower lid, (c) metal vessel with a glass inspection slit, (d) glass or metal vessel with a tapering lower part
The basic components of a laboratory bioreactor are the vessel, the lid(s), impeller with shaft and a seal chamber, motor, air inlet, baffles, sampling and inoculation ports. In smaller laboratory bioreactors, the vessel is made of high-quality borosilicate glass while in larger ones it is fabricated from stainless steel, or a combination of glass and steel. The vessel bottom is slightly concave and the upper rim is fitted with a flange. Other configurations are cylinders with metal upper and lower parts (lids), or metal cylinders with glass ports (Fig. 6.15). When an air overpressure is maintained in the vessel, it is recommended that the vessel be encased in a protective basket. The lid is usually flat and is fastened to the vessel by screws. High-quality packing (Teflon, Neoprene) is placed between the lid and the vessel. If the
189
vessel is a cylinder, its lower lid is either attached in the same way or the upper and lower lids are connected by retaining rods. The advantage of this configuration is the possibility of mounting twice the number of fittings and additional devices (inlet and outlet tubes, heating coils, probes, sensors). Agitation is achieved in two ways, either by an impeller on a short shaft passing through the centre of the lower lid, or by an impeller on a long shaft passing through the middle of the upper lid. The top impellers are simpler to construct because the packing chamber is not in direct contact with the culture fluid. The impeller shaft is sealed in a packing chamber which can have a number of configurations ~(Fig. 6.16) depending on whether it is the top or the bottom type. Electromagnetic coupling is sometimes used for driving the impeller shaft. This arrangement is advantageous because it excludes the possibility of contamination of the bioreactor contents via leaks around the impeller shaft. Reduction of the laminar flow of fluid in the bioreactor is achieved by one to four baffles, whose width is about one-tenth of the bioreactor diameter. They can be affixed to the inner face of the reactor lid or, in metal vessels, screwed on the reactor walls. They can also be mounted as an easy-to-remove single internal assembly. In glass reactors, baffles can be fabricated as an integral part of the vessel (Fig. 6.17). Air is brought into the bioreactors from the vessel upper or lower lid underneath the impeller by a metal tube either perforated or having a single opening, or ending in a sprinkler rose head. The tube can also be ring-shaped. Other air inlet routes are, for instance, through a hollow impeller shaft or through a baffle. Before entering the bioreactor, the air is filtered by a variety of filters (cotton-wool, sintered-glass or plate filters). It leaves the bioreactor together with other gases through a lid-opening protected against contamination from the environment. Air overpressure in the reactor is maintained by a regulating pressure valve on the air outlet. Systems for the air feed are illustrated in Fig. 6.18. The collection of culture samples from the bioreactor can be accomplished simply by a sampling tube in the lower part of the vessel (bottom lid) or, in vessels with air overpressure, by a sampling tube passing through the upper lid. The first fraction of the collected samples is usually discarded; this entails a considerable consumption of the culture, particularly when the sampling is more frequent. A system eliminating this problem has been constructed (Fig. 6.19). A tube passing through the lid is used for sampling and, at the same time, as an air inlet into the aeration device. To avoid closing the air inlet and outlet during sampling and the subsequent readjustment of aeration intensity after sampling, the air inlet tube has a shunt which makes it possible to feed the air directly into the air space of the bioreactor. Attachment of two
190
! m
'
8 ,9 10 11 '12 11 10 16 5
-------15 16
Fig. 6.16 Construction of a packing chamber (Stanbury and Whitaker, 1986) (a) impeller packing chamber: 1 -- impeller shaft, 2 -- packing, 3 -- upper closure, 4 -- safety ring, 5 lower closure, 6 washer, 7 grease cup, 8 safety ring, 9 securing nut, 10 _ spacer ring, I1 flange connection, 1 2 - screw, 1 3 - washer, 1 4 - nut, 1 5 - impeller, 1 6 - - pad; (b) mechanical packing: 1 -- flexible coupling, 2 -- impeller shaft, 3 -- bearing housing, 4 -- shaft ball journal, 5 -- two grooves for packing lid (only one shown), 6 - O-ring, 7 - sealing body, 8 - stator surface sealed by a rectangular pad, 9 - condensate outlet, 1 0 - rotor surface area, 11 -- bellows, 1 2 - shaft collar, 1 3 - condensate inlet, 1 4 - shaft support casing, 1 5 - gate openings, 1 6 - bearing insert, 1 7 - - lower shaft; (c) simple packing bearing: 1 -- impeller shaft, 2 -- spacer pad, 3 -- tightening screw, 4 -- bearing body, 5 -- grease cup, 6 - stationary packing pad, 7 - bioreactor lid, 8 - packing, 9 - revolving packing, 1 0 - stop block; (d) scheme of a magnetic pad: 1 -- driving magnet, 2 -- driving magnet casing, 3 -- vessel lid, 4 -- bearing, 5 - adjustable ring with a securing screw for bearing positioning, 6 - driving shaft
191
jl -
$:.':.!::::,:!!i:..:.:..i
.
bl I I~
.
2
u
3
I
.
V.,'/2#/'//.n
.
1
I
"///A
F~?~
a•2
!
9----- ~
[~ ~
".
. . . .
1
I
i
I
i
i
13
[~
~,-~
d C
(Fig. 6.16 c, d)
valves to the two air inlet tubes makes it possible to feed air to the culture during operation, or underneath the bioreactor lid during sampling. During sampling, the opening of an appropriate valve forces the medium into the aeration tube and the sample collector; the driving force is an overpressure inside the bioreactor. During operation, air passes through the aeration tube; it is thus unnecessary to discard the first portions of the sample. This arrangement substantially reduces the volume of the collected liquid. The samples can also be collected directly from the bioreactor by punc-
~.~ F-3
:0 a
b
c
Fig. 6.17 Types of mounting of baffles in a bioreactor (a) on vessel walls, (b) on an inner fixture, (c) on air inlet
ct
b
c
d
Fig. 6.18 Air inlet systems (a) nozzle, (b) sintered glass sparger, (c) ring, (d) hollow shaft
192
turing, with a syringe, a special diaphragm (silicon, rubber) which is affixed to the reactor body with a cap nut. The bioreactor lid has a port for medium inoculation, covered by different types of closures. Alternatively, inoculation can be performed by puncturing a sterile diaphragm in the reactor wall with a sterile injection syringe.
1
6 .---4>q!
--Ely
Fig. 6.19 A combined system for aeration and sampling (Sikyta, 1983) 1 air inlet, 2 -- air filter, 3 -- sampling valve, 4 -- air valve, 5air overpressure valve, 6 air outlet valve, 7 impeller, 8 - air sparger III
(1111 ---t
I
M ii1~L-
!
I"#
!
! e
f
Fig. 6.20 Types of temperature regulation in laboratory bioreactors (a) water bath, (b) medium flow through baffles, (c) heating and cooling chamber, (d) heat exchanger in bioreactor bottom, (e) jacket, (f) coil
193
Constant temperature in the bioreactor can be maintained by several methods. Portable laboratory bioreactors are placed in baths at an appropriate temperature, whereas stationary types are thermostated by the flow of a heating medium or a coolant through hollow baffles, a cooling chamber, jacket coil, or through the hollow lid(s) (Fig. 6.20). The temperature can be controlled by a separate flow of cold and warm water, a mixture of cold water and steam, or by using an electrical heating element and water cooling. Mechanical foam breaking in the bioreactors is done by blade-shaped or disc-shaped foam breakers made of wire or other materials and mounted on the impeller shaft, such that they revolve at the same speed as the impeller (Fig. 6.21). The impeller on the shaft is driven by an electric motor. The coupling of the impeller with the motor can be direct, or the driving force is transferred from the motor to the impeller shaft via a belt pulley.
i a
b 1 i
4
Fig. 6.21 Types of simple foam breakers (a) wires on impeller shaft, (b) paddles, (c) turbine 6
I 7 Fig. 6.22 The static foam breaker Turbosep (Dominick Hunter Filters, Ltd., England) 1 foam inlet from the bioreactor, 2 air outlet, 3 - "TURBO" blades, 4 - closing ring, 5 - seal, 6 - foam breaker body, 7 - vortex trap, 8 fluid outlet into the bioreactor
194
Fig. 6.23 Selected commercially manufactured laboratory bioreactors (a) Chemap, Switzerland
N
~.~.
~J
C~
j.
~.,.
.,.~ C~
196
A highly efficient defoaming system, Turbosep, was developed by Dominick Hunter Filters, Ltd (Fig. 6.22). It can be mounted in both laboratory and production bioreactors with a flow rate of up to 4000 l min -~. This static defoaming device makes it possible to increase the reactor working volume by as much as 30 %, and reduces the consumption of defoaming agents by as much as 80%. Some commercially manufactured laboratory bioreact0rs are illustrated in Fig. 6.23.
6.4.2
Pilot-plant bioreactors
Although data on critical technological conditions can be acquired in laboratory bioreactors, it is often necessary, before their production application, to verify the laboratory results in a device closely resembling industrial bioreactors in construction and technology. These devices are pilot-plant bioreactors; they serve to complete, modify and verify the data obtained in laboratory bioreactors. Since, with the same type of agitator having dimensions proportional to bioreactor dimensions, laboratory bioreactors require higher impeller speeds to achieve the same aeration effect as in large bioreactors, and since the aeration effect depends largely on the transfer of mechanical force into the liquid via the impeller, the verification of agitation and aeration conditions is of utmost importance. Different types of agitators, their relative sizes, different types and dimensions of baffles, aeration systems, and the effect of their position inside the bioreactor are also studied on the pilot-plant scale. A basic feature of most microbial syntheses is the stringent requirement for the absence of foreign microorganisms during the cultivation. Large (pilotplant) bioreactors offer a greater possibility of culture contamination, because they are more complicated than laboratory reactors. The reliability of a bioreactor in this respect is determined by the so-called sterility test. The bioreactor is supplied with a relatively rich medium but not inoculated. A conventional process is then carried out including agitation, air feed and sampling, for a duration at least equal to that of the real process. Medium samples are then subjected to a sterility test in a laboratory (see Section 10.5.1). These tests are necessary since the maintenance of sterile conditions is a fundamental requirement for any microbial process. To meet the demand for the absence of foreign microorganisms, the device has to be thoroughly sterilized and the possibility of contamination of the process by undesirable microorganisms must be excluded. This is achieved by a variety of measures. Pilot-plant bioreactors, their pipelines and fittings are sterilized prior to
I97
medium sterilization, sometimes together with air filters. After medium sterilization, the outlet valve at the bottom of the bioreactor is briefly opened to remove air bubbles and the medium is cooled down. When the pressure inside the reactor drops to 0.05 MPa, air is introduced by means of the aeration device. During medium sterilization, all valves and connecting lines are flushed with steam. Flange packings and seals are used as rarely as possible and, whenever possible, are replaced by welding. When using flanges, the packing has to be selected carefully. The packings must not be made of porous materials ; they have to be high-quality and have to be resistant to high sterilization temperatures without losing elasticity or cracking. Valves are mounted in such a way that their packing is located underneath the steam seal, usually in a horizontal position. The mounting of valves on a bioreactor deviates from conventional rules; here the streaming liquid does not flow against the valve cone. The valves are mounted so that the cone shaft packing communicates with the valve steam seal, not with the bioreactor interior. This is because of the risk of microbial contamination by growth through the packing, especially in valves with large construction lengths. The valves have to be placed so that no condensate is formed on the steam-blocked side, since this would prevent a thorough heating by steam. Valves communicating directly with the medium in the bioreactor have to be as close as possible to the reactor wall, with minimum lengths of connecting tubes. It is convenient to arrange a larger number of valves into a system of valve sets which take up less room and are sealed by a common steam inlet. Manometers, safety valves and back pressure regulators are mounted on descending parts of the tubes wherever possible. Pilot-plant bioreactors have been described in detail by a number of authors (Solomons, 1968; Weisman, 1970; Adler and Fiechter, 1983; Einsele 1984). Some commercially manufactured types are shown in Fig. 6.24. 6.4.3 Industrial bioreactors
Agitation of the culture fluid in production-scale bioreactors is effected by different types of stirrers with baffles, the most widely used being an open 6-bladed turbine with a diameter equal to 1/3-112 of the vessel diameter. It brings about a radial flow by forces acting in the direction of turbine blades, and has a dispersing effect. Sometimes two or three turbines on a single shaft are used. In the system developed by Chemap AG the impellers are placed in a special cylinder. Each impeller thus has its separate mixing field: the system makes possible a gradual multistage gas dispersion. If the baffles are removed from the bioreactor, the stirring by turbines promotes the formation of a central vortex which results in the choking up of the impeller by air and leads to energy losses. Other systems using stirrers are those of Vogelbusch and Wald-
198
Fig. 6.24 Some commercially manufactured pilot-plant bioreactors (a) Bioengineering AG, Switzerland
199
(b) L. H. Engineering Co., Ltd., England
200 1
Cl
I !
b
I
Fig. 6.25 Suction of air through a hollow shaft (a) Waldhof bioreactor, (b) Vogelbusch bioreactor; 1 -- air inlet
hof (Fig. 6.25).Vogelbusch bioreactors are equipped with hollow conical impellers, Waldhof vessels feature hollow bent paddles. Both systems produce a suction effect behind the impeller; however, air is usually introduced into the fluid by a compressor via the hollow impeller. The path of the bubbles in both bioreactors is spiral. This extends the hold-up time of air bubbles in both bioreactors and enhances oxygen utilization. A modification of the Waldhof bioreactor is a device equipped with a circulating cylindrical diffuser which draws air from the surface of the culture fluid by suction and, at the same time, acts as a mechanical foam breaker. A similar assembly is built into the Chemap bioreactor called Effigas. An impeller placed in the lower part of the diffuser draws air by suction, thus attaining high values of oxygen transfer. The impeller may be top- or bottom-driven. Chepos bioreactors (Kvasni6ka,
Fig. 6.26 Waldhof bioreactor modified according to Kvasni~ka (1972)
20 1
1972) feature several types of stirrers - axial, radial, tangential - on a common shaft and placed in a diffuser. This arrangement makes it possible to vary independently the energy supply for circulation, dispersion and foam breaking (Fig. 6.26). Similar devices are also equipped with vibration agitators and an air feed at the bottom of the bioreactor. The agitation is accomplished by a reciprocal vertical motion with an amplitude of several millimetres and a frequency of 50 Hz. The advantages of this system include sterility during operation, low energy consumption and low shear effect.
6.5 BIOREACTORS WITH PNEUMATIC AND HYDRAULIC MIXING The simplest type of a bioreactor with pneumatic mixing is the bubble column (Fig. 6 . 2 7 ~ ) Here . the oxygen transfer rates are much lower than in mechanically agitated bioreactors (Prokop and Votruba, 1976). To overcome this shortcoming, further modifications have been designed. The columns are
7 a
I 1
Fig. 6.27 Pneumatically agitated bioreactors ( a ) bubble column, ( b )column with static mixers of the Koch- Schulzer type, (c) column with sieve plates; I - air inlet
equipped with static mixers of the Koch-Schulzer type (Fig. 6.276) or with sieve plates (Fig. 6.27c), which increase the time of bubble hold-up. The airlift principle for circulation and aeration was first used by Scholler and Seidel (1940). This principle (Fig. 6.28) makes use of the difference between the specific mass of the whole dispersion and of the fluid alone. In Lefrancois bioreactors the air lift is built into the device. It may be used in two arrange-
202
Fig. 6.28 Air-lift bioreactor (Scholler and Seidel, 1940) 1 - - air inlet
ments, i.e. with a peripheral or a central air feed (Fig. 6.29). A highly effective type of air-lift bioreactor was developed by Imperial Chemical Industries (Hines, 1978). It is used for the production of intermediates, or, in a recessed or buried configuration, for anaerobic waste water treatment (Fig. 6.30). A bioreactor with a volume of 2000 to 8000 m 3 can fully cover the treatment of waste water from a city with a population of a 1/2 to 1 million. In recent years, bioreactors with hydrodynamic mixing have become very popular. They include two basic types, the "Tauchstrahlbel~ftung" -- deep jet, and the "Strahlbelfiftung" -- loop bioreactor. The former type of bioreactor, developed in Germany (Delicher et al., 1974), uses an external pump for fluid mixing. High values of oxygen transfer are achieved by a narrow jet of fluid which entrains air and introduces it into the bioreactor (Fig. 6.31 a). Fur-
I
oo
o
o
-
~
DO O 0 0 1 ~
Fig. 6.29 Air-lift bioreactor with peripheral aeration with central aeration ( b ) " 1 - - air inlet
(a),
203
ther increase in aeration efficiency may be achieved by the installation of another external pump placed horizontally (next to the first one) or vertically (above the first one). The bioreactor of the Strahlbelfiftung type was developed by Hoechst/Uhde (Jagusch et al., 1972) and uses a submerged fluid jet for aeration (Fig. 6.31 b). 5
J I ....... t 3 ~
--6
Fig. 6.30 Bioreactors designed by Imperial Chemical Industries (Hines, 1978) (a) for cultivation of microorganisms, (b) for waste water treatment; 1 -- air inlet, 2 sparger, 3 baffles, 4 degasifier, 5 gas outlet, 6 - suction pipe, 7 - heat exchanger
.q
1
2
/\ ~j
3
i
~3
3
Fig. 6.31 Bioreactors with hydrodynamic mixing (a) TauchstrahlbelOftung (deep jet), (b) StrahlbelOftung (loop); 1 fluid stream, 2 - gas stream, 3 - pump
204
6.6
DEVICES FOR ANAEROBIC CULTURE
The culture of anaerobic microorganisms had a considerable importance even in the period of introduction of the first microbial products. Recently, it has been gaining new prominence in microbial industry because of the reevaluation of current chemical products (ethanol, solvents, organic acids) due to the increasing shortage of energy and raw material resources.
6.6.1
Laboratory devices
The laboratory devices for culture under anaerobic conditions are relatively simple (Willis, 1969). In principle, the microorganisms have to be excluded from any contact with oxygen. This is achieved by filling the culture I
I - - 1
U ~4
fC
/
L
--6
J
Fig. 6.32 Laboratory device for culturing strict anaerobes (Bhatnagar, Henriquet and Longin, 1983) 1 -- aluminium closure, 2 stopper, 3 aluminium tube with flange, 4 -- aluminium sealing tube, 5 -- aluminium screw-on cap, 6 - rubber stopper, 7 - blood plasma flask
test tubes or flasks with inert gases (CO2, H2, N2 and others). The tubes or flasks are then cultured either stationary or on shakers. Flask closures have to be hermetically sealed; if the gaseous mixture formed above the surface of the medium is to be replaced, the flasks have to be flushed afterwards with an inert gas. Bhatnagar, Henriquet and Longin (1983) developed an improved system for culturing strict anaerobes (Fig. 6.32). It consists of a 0.5-1 1 blood plasma glass flask with a standard rubber stopper and an external screw-on alumini-
205
um closure cap. A standard aluminium T-shaped tube, whose upper end is fitted with a stopper and an aluminium seal closure, is introduced into the flask through an opening in the rubber stopper. For safety reasons, the system is placed in a protective stainless steel basket. The closed side-arm of the T-tube with a glass inspection slit can be used for a direct measurement of optical density. Before cultivation, the flask is supplied with 80 % (volume) hydrogen and 20 % carbon dioxide. 6.6.2
Bioreactors for anaerobic culture
The design of large devices for anaerobic microbial processes has to take into account the purpose of the device, for example the production of liquid or gaseous substances. Bioreactors for the biosynthesis of solvents and organic acids are stainless steel vessels fitted with low-speed agitators which homogeneously disperse the growing microorganisms and also particles suspended in the medium throughout the vessel volume. The vessels are also fitted with outlets, coils or jackets for medium sterilization and constant temperature control, inoculation and sampling assembly, sensors for temperature and pH
co~ ~
/1
;_ 12
s s 6
( } 11
7
10 ~ 3
4
U--3 9 Fig. 6.33 T o w e r bioreactors for a n a e r o b i c culture 1 - - baffles, 2 - s e d i m e n t a t i o n zone, 3 - sampling vents, 4 - substrate inlet, 5 - culture outlet, 6 - s e d i m e n t a t i o n tank, 7 - yeast culture level, 8 gas cyclone, 9 filter, 1 0 - bioreactor, 11 p u m p , 12 gas outlet
206 m e a s u r e m e n t , a n d an o u t l e t for gases w h i c h are s o m e t i m e s p r o d u c e d in cons i d e r a b l e a m o u n t s . In s o m e cases, a g i t a t i o n is a c c o m p l i s h e d by the gas f o r m e d d u r i n g the culture, the gas b e i n g d i s p e r s e d in the c u l t u r e by a n external or i n t e r n a l p u m p . In a d d i t i o n to this b a s i c b i o r e a c t o r type, o t h e r c o n f i g u r a t i o n s o f a t o w e r t y p e h a v e b e e n d e s i g n e d ( P r i n c e a n d B a r f o r d , 1982; C o m b e r b a c h a n d
Fig. 6.34 Device for anaerobic culture with gas production 1 -- circulation impeller, 2 - gas conduit, 3 - weir, 4 - gas reservoir, 5 - waste inlet, 6 - outlet for processed waste
Fig. 6.35 Anaerobic bioreactors with packings 1 -- inlet, 2 - pump, 3 - vessel, 4 - gas collector, 5 - collector tank, 6 - outlet, 7 - packing with carriers for bacteria, 8 - anaerobic filter, 9 -- sludge, 1 0 - carriers with affixed bacterial film
207
Bu'Lock, 1984) for anaerobic processes which entail the formation of balls, lumps or clots in the microbial culture. The medium and recycled gases are fed in at the bottom of the bioreactor (Fig. 6.33). If the bioreactor is used for the production of gas, usually methane from waste substrates, its important part is a gas tank for collecting the resulting gas mixture. The mixing is often ensured by circulation of the gases formed. The basic form of a device of this kind is shown in Fig. 6.34. Anaerobic processing of wastes is conveniently performed in tower bioreactors with different types of internal equipment or packing; the microorganisms then grow on the packing surface in the form of a film (Kennedy and Van den Berg, 1982; Britz, Meyer and Botes, 1983; Guiot and Van den Berg, 1984). Individual devices differ also in the location of the substrate feed inlet in the bioreactor, i.e. top or bottom feed. Figure 6.35 shows the schematics of bioreactors with different packings and with different routes of substrate feed.
REFERENCES Adler, I., Fiechter, A. (1983) Swiss Biotechnol. 2(2), 17. Antonie, R. L. (1975) Fixed Biological Surface -- Waste Water Treatment, Boca Raton. Bhatnagar, L., Henriquet, M., Longin, R. (1983) Biotechnol. Lett. 5, 39. Blain, J. A., Anderson, J. G., Todd, J. R., Divers, M. (1979) Biotechnol. Lett. 1,269. Blakebrough, N. (1969) Design of laboratory fermentors. In: Methods in Microbiology 1, London. Britz, T. J., Meyer, L. C., Botes, P. J. (1983) Biotechnol. Lett. 5, 113. Comberbach, D. M., Bu'Lock, J. D. (1984) Biotechnol. Lett. 6, 129. Delicher, H.-H., Kroetsch, P., Popp, K. H., Stickel, R. (1974) Chem. Ing. Technik 46, 337. Deschamps, A. M., Henno, P., Pernelle, C., Caignault, L., Lebeault, J. M. (1979) Biotechnol. Lett. 1,239. Einsele, A. (1984) Swiss Biotechnol. 2(4), 25. Gorbach, G. (1969), Mschr. f. Brauerei 22, 22. Guiot, S. R., Van den Berg, L. (1984) Biotechnol. Lett. 6, 161. Hines, D. A. (1978) The large scale pressure cycle fermentor configuration. In: Biotechnology, Dechema Monographs 82, 55. Jagusch, L., Pfischel, S., Schieferdecker, K., Schuster, H., Meyer, F. (1972) Czechoslovak Patent 149 588. Kennedy, K. J., Van den Berg, L. (1982) Biotechnol. Lett. 4, 137. Kluyver, A. J., Perquin, L. H. C. (1933) Biochem. Zeit. 266, 68. Kvasni~ka, J. (1972) Czechoslovak Patent 148 540. Kybal, J., Sikyta, B. (1985) Biotechnol. Lett. 7, 467. Kybal, J., Vl~ek, V. (1976) Biotechnol. Bioeng. 18, 1713. Manchee, R. (1979) Trends Biochem. Sci. April. Means, C. W., Savage, G. M., Reusser, F., Koepsell, H. J. (1962) Biotechnol. Bioeng. 4, 5. Moser, A. (1982) Biotechnol. Lett. 4, 281.
208 Phillips, K. L., Sallans, H. R., Spencer, J. F. T. (1961) Ind. Eng. Chem. 53, 749. Prescott, S., Dunn, C. (1949) Industrial Microbiology 2, New York. Prince, I. G., Barford, J. P. (1982) Biotechnol. Lett. 4, 525. Prokop, A., Votruba, J. (1976) Folia MicrobioL 21.58. Rehm, H.-J. (1980) Industrielle Mikrobiologie 2, Berlin. Scholler, H., Seidel, M. (1940) U.S. Patent 219 81 92. Schroeder, E., Brandl, R. from Rehm (1980). Sikyta, B. (1983) Methods in Industrial Microbiology, Chichester. Solomons, G. L. (1967) Process Biochem. 2(3), 7. Solomons, G. L. (1968) Process Biochem. 3(8), 17. Solomons, G. L. (1969) Material and Methods in Fermentation, London. Stanbury, P. F., Whitaker, A. (1986) Principles of Fermentation Technology, Oxford. Steel, R., Miller, T. L. (1970) Adv. Appl. Microbiol. 12, 153. Underkofler, L. A., Hickey, R. J. (1954) Industrial Fermentation 2, New York. Weisman, E. (1970) Process Biochem. 5(2), 10, 18. Willis, A. T. (1969) Techniques for the study of anaerobic spore-forming bacteria. In: Methods in Microbiology 3B, London. Zadra2il, F., Brunnert, H. (1981) Eur. J. Appl. Microbiol. Biotechnol. 11, 182.
209
7
STERILIZATION
In an overwhelming majority of microbial processes, culture devices as well as other apparatuses, fixtures, substrates, air or other gases have to be freed of undesirable microorganisms. Under laboratory conditions sterilization of media and air, as well as the maintenance of sterile conditions during the process usually poses no problems. Increasing complexity of culture devices, especially industrial ones, strongly increases the demands for maintenance of sterile conditions and aseptic manipulation. Sterilization is a general name for procedures in which all living forms of microorganisms are destroyed or removed, in contrast to pasteurization or tyndallization in which the number of surviving microorganisms is merely reduced, though substantially. Disinfection is the removal of microorganisms that could cause infectious disease or some special kind of affliction. Destruction or inactivation of microorganisms can be achieved by wet or dry heat, chemicals or high-energy radiation. Mechanical removal is usually done by filtration. The mechanism of destruction may differ depending on the sterilization process: wet heat denaturates proteins, dry heat acts mostly through oxidative processes, radiation damages DNA, cell membranes and enzymes, chemicals affect both cell surface and intracellular components through oxidation or alkylation. The most resistant bodies against sterilization agents are bacterial spores but the resistance greatly varies depending on the microbial species, strains and forms. In addition to the actual resistance of spores to sterilization, their survival is also aided by environmental conditions affecting the sporulation before sterilization and, in particular, by conditions during the sterilization proper. These include the pH, the osmotic nature of the nutrient medium and the presence of high molecular substances and suspensions which protect the spores against the effect of sterilization treatments. In practice, sterilization efficiency is controlled by determining the death rate of standardized spores of some microorganisms. Heat sterilization efficiency is checked using paper or aluminium foil strips covered with dried up spores of Bacillus stearothermophillus in a concentration of 105 to 106 (Bruch, 1973); radioinactivation is usually controlled by using spores of Bacillus globigii or Clostridium botulinum (Kereluk and Gammon, 1974). Spore cultivation in these tentative tests of
210
sterilization efficiency has to be prolonged because the germinating ability and postgermination development of spores can be restored after several weeks or months. The 24-h or overnight cultivation used sometimes routinely in these tests is in this case quite insufficient.
7.1
7.1.1
STERILIZATION OF MEDIA
Steam sterilization of media
Sterilization of media by wet heat, i.e. steam sterilization, encounters two contradictory problems: the necessity of killing all microorganisms, and especially spores, requires a prolonged use of a high temperature which, on the other hand, is likely to cause degradation of nutrients essential for microbial growth. The main problem in steam sterilization of media is to determine how long the medium has to be exposed to a certain temperature in order to achieve sterile conditions and, at the same time, retain the nutrient value of the medium.
Steam heating Liquid media are often heated by steam to temperatures around 100 ~ This treatment kills off only vegetative cell forms, not spores. Elimination of spores requires fractionated sterilization: The medium is heated to 100 ~ for 30 min and then left to stand for a minimum of 4 h at room temperature to induce germination of surviving spores. A repeated heating then destroys these remaining spores. The heating cycle is usually repeated for the sake of safety. The time intervals between individual sterilization runs must not be too long to prevent formation of further spores from the germinating ones. This sterilization procedure, so called tyndallization, is more than 100 years old. It is not always necessary to kill off all foreign microorganisms and it suffices to eliminate only germinating ones. This is achieved by heating the medium to a temperature below 100 ~ and the process is called pasteurization. There are several ways to perform this treatment: a) prolonged heating to 62 ~ for 30 min; b) short heating to 71.5 ~ for 20 s; c) high heating to 85 to 87 ~ for 3 s. A number of solid substrates used, for instance for cultivation of mushrooms and for production of some technical-quality enzymes, are pasteurized solely by steam. This treatment however kills off not only most vegetative
21 1
forms of bacteria but also a considerable number of yeasts and fungi which usually perish already at temperatures below 80 "C.
Sterilization by steam overpressure The requirement in most media sterilizations is to kill all microbial forms in a single sterilization cycle. This is achieved by employing wet heat under overpressure. The procedure for media sterilization by steam overpressure (Fig. 7.1) includes heating the medium to a preset temperature (interval 4) to t,), maintaining the temperature at this constant level (interval t, to t2) and cooling the medium down to the culture temperature (interval t2 to t3).
-
time
3
Fig. 7. I Operation cycle in sterilization by pressurized steam
The time profile of temperature during heating and cooling depends on the order of the transfer function of the system and on its time constants. The order of the transfer function of the system depends in turn on the type of heat transfer from the heat source or cooling device into the medium and varies according to the construction of the culture device. When the medium is heated electrically the temperature increase is approximately linear, while when steam flowing through heating jacket or coils is used the temperature rise is approximately exponential and with direct steam feed into the medium it is approximately hyperbolic. The time constants of the transfer functions depend on the specific heat, on the medium volume and on the geometrical dimensions of the culture device. In cultivation devices of the same construc-
212
tion but differing in volume the temperature profile curves during heating and cooling have a similar shape but different slopes (Fig. 7.2). Depending on medium composition and its content of sporulating microorganisms, and on the resistance of the spores against wet heat, batch sterilizations are mostly performed by heating the media to 115 ~ for 30 min, or to 121 ~ for 20 min (Table 7.1).
110
}
90
~
70
50
0
~ 20
I I 40 60 time. (min)
0
20
40
I 80
100
80
100
110 o_) [_. L-
7O 50
6O
time. (min)
Fig. 7.2 Temporal profile of temperature during medium heating (a) and cooling (b) in bioreactors of different volumes. 1 - - 190 1, 2--
5701, 3--
57001,
4--
570001
Theory of media sterilization by steam Theoretical analysis of media sterilization was elaborated by Deindoerfer and Humphrey (1959a,b; 1961) and Deindoerfer (1957) who laid the basis for calculation of sterilization time and temperature and thereby for the construction of the sterilization device. As a measure of the sterilization effect they proposed the decrease in the number of viable microbial spores from an initial to a final level. The decisive factor is the heat resistance of the spores, which is different in different microbial species. The overall sterilization ef-
Table 7.1 Resistance of spores of some bacterial species against wet heat
Destruction time (min) at given temperature (~ Bacterium 100
Bacillus anthracis
2
Bacillus subtilis
many hours
Putrefactive anaerobe
110
105
15
5
170
41
15
5
90
5
25
Clostridium welchii
5
45
5
27
10
15
120
32
90
Soil bacteria
500
many hours
Thermophilic bacteria
Clostridium sporogenes
40 420
400 150
135
40
780
300
130
125
10
Clostridiurn tetani
Clostridium botulinum
120
115
45
10
120
100
40 15
300
12
5.6
40
ll0
4
20
6
30
11
35
10
4
8
3.5
214
fect S can be determined from equation [7.1] derived by Deindoerfer and Humphrey (1959a) t
No = 0f k. dt S = In --~-
[7.11
where No is the number of viable spores in the medium before sterilization, N -- number of viable spores in the medium after sterilization, t - - t o t a l sterilization time, k -- specific reaction rate for thermal spore destruction defined by the expression k = - e .~gr
[7.2]
where # is the activation energy for thermal spore destruction in the Arrhenius equation, R --universal gas constant, T --absolute temperature of the medium. If the medium heating and cooling curves are also included in the overall sterilization effect, equation [7.1] is transformed to (Sikyta and Mastner, 1967) ti
12
t3
S = f k(Tl)dt + f k(T2)d/+ f k(T3)dt 0
tI
[7.31
t2
where 0, t~ are time limits of the heating period, t~, t2 -- time limits for the holding period, t2, t3 -- time limits for the cooling period. When individual integrals in equation [7.3] are denoted S~, $2, $3 we obtain S = S, + $2 + $3
[7.3a1
The total sterilization time is given by the equation
2.3
t = ~
No
log N
[7.4]
at temperature T for which the value of k is known. The relationship between the number of surviving spores of Bacillus stearothermophilus, strain 1518, and the heat exposure time is shown in Fig. 7.3. The curves were obtained in buffers and will naturally be different in actual media. The measurements should therefore be always performed in the medium to be used. As seen from Fig. 7.3 at higher temperatures (130 ~ the spore destruction is about 400-fold faster than at 105 ~ The time course of the curves is characteristic of a first-order reaction. The destruction rate is di-
215
rectly proportional to the number of surviving spores. However, the situation is considerably complicated by the fact that the population contains a fraction of spores which are substantially more heat resistant than the majority of spores in this population (Kalinina and Motina, 1986). The probability of achieving absolutely sterile conditions depends on the number of surviving spores. Equation [7.5] gives the probability that a single 105
105
femperofure105 ~
~104
o
t.,. 0
~103
-1
.E
.~_
femper0fure 131.5 ~
104
t'-
L
0 t,., (i,1
102 E i-
e lO r
I
1
0
I
120
I
240
\1
360
t
0
0.2
time (rain)
0.4 time (rain)
0.6
Fig. 7.3 D e p e n d e n c e of the number of surviving spores of Bacillus stearothermophilus 1518 on heat treatment duration (Deindoerfer, 1957)
spore in volume Vsurvives. The total number of spores is N~ V. The probability that 1 out of 100 spores survives is p = 0.01, for a 1-to-1000 survival level p = = 0.001, etc.. The sterilization effect is then given by the equation S = In
N1 V
[7.5]
The smallest number of surviving spores that can cause contamination of any medium volume is 1. If the same probability of absolute sterility is to be achieved in larger volumes the heat treatment has to be correspondingly more thorough. In practice the situation is usually much more complex. The contamination of the medium is usually not due to one but to several microbial species differing in their thermal resistance; one of the species may predominate. Figure 7.4 shows the time dependence of the number of surviving spores for two species present in the medium. Straight line A illustrates the time dependence of the drop of population size for the less thermally resistant microorganism
216
with a low activation energy while line B documents the same dependence for the microorganism with a higher thermal resistance and a higher activation energy. Curve C, obtained by summing the two curves, shows the decrease in the total viable count (Fig. 7.4a). A similar curve obtained in practice indicates therefore a mixed population. In the presence of more than one microbial species more complex curves are obtained, although a straight line does it)
104
co
~ml03 t-
.>_ m
102
o t,_ cxI
E
10
r
l,,
0
I
10
I
20
I
30
I
40
50
lime (rain) a
10 4 E.0 ta
3
~10 " -
. . . .
C
r ~
~ 10 2 o f_. .1o
E 10
r
0 b
10
20
30
lime (rain)
t
40
50
Fig. 7.4 Dependence of the number of surviving spores on heat treatment duration (Richards, 1968) (a) prevalence of less resistant strains, (b) prevalence of more resistant strains; A -- number of spores in a population with a low activation energy, B - number of spores in a population with a high activation energy, C mean number of spores of the two populations
not necessarily imply that the medium contained only one microbial species. In Fig. 7.4a the initial number of the more resistant microorganisms is 100 while that of the less resistant is 1000. Fig. 7.4b illustrates a reverse situation, i.e. an excess of the more resistant microorganisms. In this case curve C is nearly rectilinear despite the presence in the medium of two different microorganisms with different thermal resistance. A particular sterilization procedure has to be developed for every medium. Deindoerfer and Humphrey (1961) proposed a graphical method for the purpose, with a function of the sterilization temperature, 1/T, plotted on the
217
abscissa and a function of time, In t, of the appropriate sterilization temperature plotted on the ordinate. The relationship between the constant k and 1/T for spores of a given microbial species in a given medium may serve as an example. The dependence should be linear, with a slope of - # / 2 . 3 RT (Fig. 7.5). The values necessary for drawing the line are derived from data in Fig. 7.3. The line is based on a minimum of two values of k for different tempera-
..--..
10 -1
,._.. t..4--
,-- 10-2 o
10 3
10 -4
0.001 37 0.00141 0.001 45 reciproca[ femperclfure ( + )
0.00149
Fig. 7.5 Effect of temperature on the rate constant of spore destruction in
Bacillus
stearothermophilus
1518
(Deindoerfer, 1957)
tures. The activation energy for spores of Bacillus stearothermophilus strain 1518 is seen to be equal to 383.5 kJ (Deindoerfer, 1957). 7.1.2
Sterilization and medium quality
Sterilization is often accompanied by undesirable chemical changes in the medium. Carbonyl groups of saccharides are known to react with amino groups of amino acids (Maillard reaction) to yield brown complexes (Kosikowski, 1979) similar to those during caramelization. These complexes contain mostly hydroxymethylfurfurol and levulic acid. Heating of lactose and other reducing saccharides in alkaline medium yields saccharin acids as products (Sowden, 1957). Lactose yields even at neutral pH lactulose which is not toxic but is not metabolized (Thaynithy, Harding and Wase, 1982). Products formed after sterilization (121 ~ 20 min) in media containing lactose and phosphates were found to inhibit the growth of Thermonospora sp. (Vahedra and Bellamy, 1983). Another process to be avoided is the degradation of vitamins and other essential growth factors because the concentration of these
218
substances in the medium significantly affects product yield. At a zero concentration of the factor the yield is minimal whereas at concentrations above a certain critical limit the yield no longer increases (Fig. 7.6). Between zero and the critical concentration of the factor, product yield fluctuates. Generally speaking, a measure of the maintenance of medium quality O is the concentration of an important medium component after sterilization O = In
C1
c:
[7.6]
where C~ is the concentration of the important component before sterilization, Q - - concentration of the important component after sterilization.
I
L I
"ff
/
/
/
8i
t 0
I --,.-concentration of an essentiat nutrient
Fig. 7.6 Relationship between the concentration of a hypothetical essential nutrient and product yield (Banks, 1979)
Equation [7.6] contains no term for volume and the measure of maintaining medium quality is therefore independent of the size of the culture device. On the other hand, overheating, which causes for example colour darkening in synthetic media, may have a positive effect on the growth of some bacteria; this becomes perceptible especially when small-size inocula are used. For instance, propionic fermentation bacteria did not grow in filter sterilized media containing glucose, amino acids and phosphates, or after separate sterilization of glucose in an autoclave. Normal growth occurred even with a small-size inoculum when glucose, phosphates and amino acids were sterilized together. Field and Lichtstein (1958) found that the products arising during the heat treatment of mixtures of these substances function as a substitute
219
for a certain concentration of seeded with a small inoculum. 7.1.3
CO 2
necessary for growth if the medium is
Sterilization of media in flasks and laboratory bioreactors
As stated in the introduction to this chapter, sterilization of a small amount of a medium in an autoclave usually presents no problems, but one should bear in mind several factors that affect autoclave sterilization. Autoclaves either have their own steam source or are attached to an external source. The steam coming from the external source should be saturated but not superheated. Superheated steam evolves in the autoclave during sterilization usually in the presence of air which was not expelled thoroughly from the 135
130 L.3
~-
4--)
125
L. (0 E3-
E ~ 120
115
110
10 -------- time (min)
100
Fig. 7.7 Relationship between sterilization time and temperature in autoclave sterilization of small volumes of media (Perkins, 1956)
device. Sterilization under these conditions closely resembles sterilization by dry heat. Media in test tubes, flasks and laboratory bioreactors are sterilized in an autoclave under static conditions, i.e. without any agitation of the medium. This complicates the sterilization of media containing solid particles. Since during static sterilization, solid particles sediment to the bottom of the vessel and the necessary sterilization period depends on their concentration in the medium, it is difficult to estimate the length of the treatment required. The heat transfer during sterilization of small volumes of media (5 to 50 ml) is almost instantaneous, i.e. it is so rapid that the temperature of the medium in the flasks corresponds exactly to the thermometer reading. Under
220
these conditions the relationship between temperature and sterilization period has the shape shown in Fig. 7.7. When larger media volumes are sterilized one should take into account the lag in heat transfer (Fig. 7.8). The different time profiles of temperature measured at three different points in a vessel during the sterilization of 20 1 medium in an autoclave are shown in Fig. 7.9. Besides the volume of the medium, the course of sterilization is affected also by the material of the vessel. Figure 7.10 shows the difference between the temperature course during sterilization in a flask made of glass and another made of aluminium.
'~~ /-----7--~, ~'~176 / ,,'
1
~'
/
X 60
~
40 20
Fig. 7.8 Time course of medium heating and cooling in a 10 1 vessel in an autoclave 1 -- temperature in the flask, 2 -- temperature in autoclave
o 0
30
oo b I //
I
/,,
i
60 time ( rain )
90
120
t~,,,r.,~,'<,t,.,r~\ '"t:~. I ~...to
,,(.. ....' ..-
//'...."" 60
-....
' ."thermometer
I//,"."
pos~t~or,~
0
30
-
60
-
I
I.
9
90 time (rain)
I .....
\
I ....... 120
150
/
\~
1
180
Fig. 7.9 The time course of temperature of the medium at different points in a 20 1 vessel during sterilization in an autoclave (Wilkinson and Baker, 1964)
221
To prevent complications arising during the sterilization of media containing solid particles and to eliminate temperature differences between different points in the vessel due to thermal resistance during heat transfer, the medium may be continuously agitated during the sterilization process. Media sterilization in large bioreactors is carried out almost exclusively with stirring. When media sterilization under laboratory conditions is carried out in a similar manner the scale-up of the results is considerably facilitated. Chain, Paladino and Zanchi (1959) proposed an autoclave modification in which laboratory bioreactors were stirred during sterilization by agitators,
120
Q.) b EJ
~_
100 / I
80 -
E 60
40
20
/
0
/
/
4
I
8 ----
/
/
/
I
12
/
/
/
/
/
/
/
/
2/ / /
I
I
16
20
24
time (min)
Fig. 7.10 Time course of a 500 ml medium volume heating in an aluminium and a glass flask (Wilkinson and Baker, 1964) 1 - - aluminium, 2 - glass
the shafts of which passed through the autoclave walls. Sikyta, Slechta and Herold (1964) described medium sterilization in a large stirred vessel, the socalled central sterilizer. After sterilization the medium was discharged under sterile conditions into sterile cultivation flasks or laboratory bioreactors. 7.1.4
Continuous steam sterilization of media
Optimum sterilization procedures require the use of high temperatures for short periods of time. This can be achieved only in continuous sterilizers. Batch sterilization in a bioreactor may approach these conditions when the steam is introduced directly into the medium by a steam injector; the heating period of the sterilization cycle is then considerably shorter than when the medium is heated through coils, jackets or electrically. Continuous sterilization of media is important in batch and especially in
222
continuous cultivations. It is necessary when the continuous culture as a whole is to be carried out on a satisfactory technical level. Devices for continuous sterilization include three basic units: (a) a heating unit in which the medium is heated to the required temperature in the shortest possible time interval; (b) a holding vessel in which the heated medium is kept at a constant temperature for a certain time period necessary for complete sterilization, (c) a cooling unit in which the medium is cooled to the culture temperature. The medium in the sterilizer is heated to the required temperature by steam either directly (via an injector) or indirectly. Direct steam injection causes dilution of the medium by condensed water. Indirect heating is accomplished by some kind of a heat exchanger, for example a plate, tube, spiral, or coil, through which steam or oil passes. The holding unit is either a tube or a stirred vessel. The cooling unit may be of various types but usually involves a heat exchanger in the first part of which cold medium is used as coolant, being preheated at the same time and improving the economics of sterilization (Peterson, 1974). The type of sterilizer is determined by the way in which the medium passes through the device and by the manner of heat transfer in each part. During continuous sterilization it is more convenient to control the process by changing the temperature rather than the holding period since the volume of the holding vessel is constant and cannot be as readily changed as temperature. The design of an efficient device should therefore aim at a higher temperature with a shorter holding period. At higher temperatures the holding sfeam sferile medium
holding coil
! I cooling wafer
medium feed
'l
! ,,,
l
Fig. 7.11 Scheme of a continuous sterilization process in a system with heat exchanger and a heat saving step (Banks, 1979)
223
time interval may be substantially shortened and the sterilizer is thus smaller. In addition, the heat degradation of vitamins and growth factors requires a considerably lower activation energy than the destruction of bacterial spores. The design of a continuous sterilizer can be based on the theory of distribution of medium residence times during its passage through the device (Lin, 1979). The most common techniques for continuous sterilization are heat exchangers and steam injectors with flash cooling (Banks, 1979). Heat exchangers. The schematics of a continuous sterilizer of this type are shown in Fig. 7.11. The sterilization process is characterized by very short heating and cooling periods. Heat exchangers of various types are used, the most common being the plate and frame heat exchanger and Rosenblad's double spiral heat exchanger. sfeam
cooling w
medium
Venfuri mixer v
. . . . . . .
I expansion
sferi
[
v~q holding coil
I
lure
Fig. 7.12 Scheme of a continuous steam injector with instantaneous cooling and a heat saving step (Banks, 1979)
Steam injector with flash cooling. In this system the medium is heated very quickly by a continuous and intensive agitation by high-pressure steam in a mixer of the Venturi type. Hot sterile medium from the holding coil is cooled by passing through a throttling valve into an expansion vessel kept at atmospheric pressure or under vacuum. The steam is immediately flashed off and the temperature of the medium rapidly drops. A typical flow diagram of a steam injector with flash cooling designed for a continuous process and including an economical steam utilization is given in Fig. 7.12.
224
7.1.5
Scale-up of steam sterilization of media
Achievement of uniform sterilization efficiency in bioreactors of different sizes and construction types is of great importance in the scale-up of media sterilization. The following factors have to be taken into account: a) With increasing volume of the medium the time necessary for medium heating and cooling to a preselected temperature increases. This causes an increase in the proportion of sterilization occurring during the heating and cooling periods relative to the total sterilization time, provided that the geometrical and construction similarity is retained and the type of steam supply is identical. b) Because the probability of spore survival increases with increasing medium volume, the thermal exposure of the medium must also be increased. c) Differences in construction and geometry and variations in steam temperature considerably complicate the scale-up.
rq
Y reciprocoi femperofure/~"/
Fig. 7.13 A graphic method for medium sterilization scale-up using steam injector (Deindoerfer and Humphrey, 1961) 1 -- region of minimum yield, 2 - increase in the concentration of an essential nutrient and product yield in a transition range, 3 - safe operation region, 4 rise in scale-up and in sterilization effect
During the scale-up of media sterilization, when the product yield is affected by heat treatment, the dependence of sterilization effect on medium quality has to be taken into account. The characteristics of this dependence for a hypothetical steam injector sterilization, i.e. for direct steam injection into the medium which represents the simplest case for evaluation of sterilization effect, can be determined as follows (Fig. 7.13): the reciprocal tempera-
225
ture 1 / T is plotted on the abscissa and the logarithm of sterilization time, In t, is plotted on the ordinate. Two families of lines are then drawn. In one family each line represents the geometrical points at which such sterilization conditions prevail that the sterilization effect is always the same, i.e. the sterilization effect of the heat treatment of the medium is identical. The size (and therefore also sterilization effect) scale-up is denoted by the broken arrow in the left bottom part. The second family of lines represents the geometrical points of sterilization conditions at which different concentrations of an essential nutrient after the sterilization are found. The arrow in the upper top part indicates the direction of yield increase and the broken lines denote two important limits. The upper one corresponds to yield at a negligible amount of the essential nutrient while the lower one corresponds to the critical concentration of the nutrient above which the yield no longer rises. The area between the two lines delineates the space in which the yield is affected by sterilization. The lines corresponding to the minimal and maximal yield divide the figure into three areas: upper, lower and transitional. The upper area is the region of minimal yield; any change in the scale of this area has no effect on the yield since the essential nutrient was completely degraded by sterilization. The lower area is the safe working region; a change in its scale has again no effect on the yield because the critical concentration of the essential nutrient has been exceeded and the maximum yield is attained in all cases. In the transitional area any increase in sterilization time or temperature leads to a decrease in yield. Not all sterilization processes can be analyzed in such a simple way as the steam injector process. In other systems both the heating and cooling stages have to be included in the total sterilization effect. An exact method for the scale-up of sterilization results was developed by Sikyta and Mastner (1967). Using an automatic integrator of the sterilization effect, differences in the effect were measured in six bioreactors with 97 hl working capacity and in three bioreactors with 30 hl working capacity. In both cases a temperature of 120 ~ was maintained for a holding period of 30 or 40 min. Although the bioreactors hardly differed in construction, considerable differences were found in the sterilization effect:
Bioreactor volume
(hi)
Sterilization time at 120 ~ (min)
Sterilization effect (dial units)
30 30 97 97
30 40 30 40
113-127 149-164 141-172 177-209
226
The differences in sterilization effect are due to different sterilization efficiencies during the heating and cooling periods and to slight temperature fluctuations during the holding period. With the aid of the automatic integrator the optimum value of the sterilization effect is determined in one of the stages, usually in a pilot plant bioreactor, irrespective of its construction, and this value can then be reproduced in other scale-up stages. The value by which the sterilization effect must be increased with increasing medium volume can be calculated from the equation
v:
$2 = S~ + In vl
[7.7]
where $2 is the sterilization effect in volume V2, S ~ - sterilization effect in volume V~. As seen from equation [7.7], if the sterilization operation is scaled-up tenfold the sterilization effect must be increased by adding 6.9 dial units whereas with hundredfold scale-up it is necessary to add 13.8 and with a thousandfold scale-up 20.7 dial units. The procedure ensures not only exact sterilization conditions in bioreactors of various sizes, constructions and internal equipment but also an exact and rapid determination of optimum sterilization conditions in industrial bioreactors based on results achieved in pilot plant devices. 7.1.6
Filtration sterilization
Some solutions to be sterilized contain heat labile substances. If the solution is clear, the most suitable sterilization method is filtration. Because of its simplicity it is sometimes preferred over steam sterilization even in solutions containing no heat labile components. The possibility of sterilizing media by filtration is very limited since most media for industrial microbial processes contain colloid or solid particles. Filtration sterilization is mostly used on the laboratory and pilot-plant scale. Sterilization by filtration can be done using Seitz filters, candle filters, sintered-glass filters and membrane filters. Each of these types of filters has its merits and shortcomings (Sykes, 1969). Seitz filters, porcelain candle filters and sintered-glass filters are relatively cheap and easily sterilized but they clog rapidly and are difficult to clean. The most suitable for sterilization of clear solutions are membrane filters. They are made of thin plastic membranes, such as cellulose esters, and have therefore to be handled with care, but they can be sterilized in an autoclave. The filters used for filtration of clear solutions usually have a pore diameter of 0.22 gm, since none of the known bacteria are smaller than 0.22 gm and they can therefore be trapped on
227
the filter. The choice of the filter holder depends on the volume of the solution to be filtered, its viscosity and turbidity. Sterilization in an autoclave at 121 ~ takes 10 to 45 min depending on filter size. The rate of filtration of clear solutions through a filter of 290 mm diameter, pore size 0.45 gm and at 140 kPa pressure is 50 1 min-~ ; the total volume of solution that can be filtered is 100 hl (Mulvany, 1969). 7.1.7
Sterilization by chemicals
Sterilization is performed by highly reactive chemicals in the form of solution, vapours or gas. The most common chemical sterilants are oxirane (ethylene oxide) and other heterocyclic compounds such as methyloxirane (propylene oxide), 2-oxethanone (incorrectly fl-propiolactone), 2-chloromethyloxirane (incorrectly epichlorhydrine), as well as formaldehyde, chlorine, ozone and other agents. The use of chemicals for sterilization depends on the magnitude of their biocidal effect at low concentrations, at normal temperatures and pressures and on short exposures, and easy removal from the sterilized materials and spaces. Because of the high chemical reactivity of these compounds their use in routine sterilizations involves various hazards (explosivity, toxicity, flammability, damage to the sterilized materials, etc.). The most widely used is oxirane which has a characteristically low boiling point (10.8 ~ Because its mixture with air is explosive it is used in a mixture with carbon dioxide, nitrogen or halogenated hydrocarbons. Sterilization can be carried out using an inexplosive commercial oxirane preparation, Cryoxide. At an oxirane concentration of 1% (v/v) and at 4 ~ medium sterilization takes about 1 h (Ernst, 1974). When the temperature is subsequently increased oxirane is removed by volatilization. When testing its sterilization effect on various types of microorganisms dried on the surface of glass beads, the exposure interval had to be extended to several hours (Sykes, 1969). An important role is played by moisture level. When the microbial cells are coated with protective substances the sterilization effect of oxirane substantially decreases because the agent does not reach the cell surface. This factor complicates the evaluation of the actual sterilization effect of almost all chemical sterilizing agents. Oxirane can be used conveniently for sterilization of some thermosensitive materials. Another chemical used for sterilization is 2-oxethanone which is produced in up to 99 % purity. It is highly biocidal but has the disadvantage of being rapidly hydrolyzed. Bacterial spores are killed in only a 0.75 % solution after a 2-h exposure at 37 ~ 2-Oxethanone can also be used for sterilization of media in a continuous system (Toplin, 1962). The advantage of the agent is
228
the lack of any reaction with proteins. Prolonged treatment with 2-oxethanone vapours can be used for sterilization of bioreactor space. 7.1.8
Sterilization by radiation
In practice, sterilization of liquids is mostly performed with electromagnetic X- and y-rays and the particulate electron beams which give rise to both X- and ?'-rays. An important characteristic of sterilization effect of cathode rays is their penetration which is directly proportional to the energy of the electron beam (E) and inversely proportional to material density (/9) Penetration oc
E P
In view of the nature of the reaction mechanisms involved, the optimum sterilization action does not take place on the surface of the treated material; with fl-rays or cathode rays it occurs close beneath the surface while with y-rays it occurs several centimeters deeper. Table 7.2 Lethal doses of different types of radiation Lethal dose (kGy) a Microorganism ?'-raysc
Cathode rays b Vegetative nonpathogenic Vegetative pathogenic Bacterial spores Filamentous fungi Yeasts
1.0 4.5 2.0 2.5 5.0
2.5 5.5 21 11.5 10
1.0 2.0 3.5
2.5 4.0 4.0
2.5
1.5
15 2.0
3.0 3
X-rays d
0.3 5.0 2.5 2.5
5.0 20 10 15
1 kGy = 0.1 Mrad b Radiation source is a van de G r a a f generator (left) or Capacitron (right) c Radiation source 6~ (energy 190 fJ, i.e. 1.2 MeV) d Radiation energy 480 fJ (3 MeV)
a
The radiation resistance of microorganisms varies depending on species and microbial form, as seen from Table 7.2. As with other treatments the highest resistance against radiation is exhibited by bacterial spores. Radiation sterilization is considerably complicated by solid particles in the medium which increase the microbial resistance to radiation. The effect of radiation is also significantly affected by other factors such as the so-called oxygen effect, presence of reducing substances and sensitizing agents, freezing and drying. Lowering of oxygen tension in the medium below l0 mg l-~ reduces the effects
229
of a lethal dose 3 to 4 times. Irradiation of a frozen suspension of Escherichia coil reduces the sensitivity of the bacterium to the treatment due to retardation of diffusion of free radicals through the medium. In contrast, Bacillus subtilis exhibits a higher sensitivity in the frozen state, conceivably due to the rupture of spore walls which makes the bacteria more sensitive to the treatment. Bacillus thermoacidurans and Clostridium sporogenes showed no sensitivity differences between the frozen and non-frozen state. Interesting results were obtained by adding acceptors of free radicals, such as sodium ascorbate, to the media. In a Bacillus subtilis suspension irradiated by cathode rays a 1% (v/v) concentration of this salt lowered the sensitivity of spores to the treatment both in a physiological saline and in a complex medium, whereas in a suspension of Bacillus thermoacidurans this concentration of the salt had a protective effect in the complex medium but not in the saline. According to Kempe (1960) radiation can be used in two ways, radio-pasteurization and radiosterilization. Radio-pasteurization is carried out at lower energies, about 2 kGy for ?'-radiation, and is useful when the liquid contains only Gram-negative and nonsporulating bacteria. This type of sterilization is used for solutions and liquids in which stronger radiation would cause changes in composition. Radiation sterilization of media was used in lactic acid production. In the first step ?'-rays (25 and 45 kGy) were used to sterilize separately corn-steep liquor and malt germs. These were then added under aseptic conditions to the basic medium which was previously sterilized by steam. In parallel, a complete nutrient medium was sterilized by radiation. In this latter case the lactic acid yields were found to be lower and so was the rate of lactic acid formation, whereas separate sterilization gave the same yields and a higher rate of lactic acid formation than a control sterilization by steam. These examples show that extensive further research work is needed before radiation sterilization can be used in an economically convenient way in microbial industry. The basic method of media sterilization therefore remains sterilization by steam (Richards, 1968; Sykes, 1969; Gaughran, 1973 ; Wallh~iusser, 1978; Corbett, 1985; Cooney, 1985).
7.2
AIR STERILIZATION
Problems associated with air sterilization became topical with the rapid development of industrial branches requiring large amounts of sterile air, especially the microbial industry in which a sufficient supply of sterile air is often decisive for a successful production. Various methods of air sterilization have been described and tested; the most convenient for practical purposes
230
was found to be sterilization of air by fibrous or porous materials. Other methods are used rarely and will therefore be mentioned only briefly. 7.2.1
Methods of air sterilization other than filtration
Air can be sterilized by heat. Reduction of an initial number of Bacillus subtilis spores by a factor of 107 was found to require a 24-s heating to 220 ~ When the temperature is increased by 30 ~ exposure time is reduced by half. Air can be heated either in electric ovens or by heat arising during its adiabatic compression, i.e. in a thermally insulated system. This technique of sterilization of large air volumes has so far been hampered by the high costs of rapid heating and cooling of large volumes (when using high temperatures), or difficulties with maintaining large volumes of air for long intervals under constant conditions (when the sterilization proceeds at lower temperatures). Sterilization of air by irradiation by UV-light or other kinds of highenergy radiation has also been economically inconvenient. Air washing by chemicals such as sulphuric acid is inconvenient because small particles contained in the air are not wetted during the passage through the liquid. Also, the washing liquid or its vapours may be entrained in the air stream and adversely affect the course of the microbial process. Another method, an electrostatic precipitation of microorganisms from the air, is not sufficiently effective and can be used only for air pretreatment. 7.2.2
Air sterilization by filtration
The criteria for suitable air filtration system include: efficiency of trapping of microorganisms on air filters, system economy, filter manipulation and handling, and system servicing guaranteed by the supplier. The most important criterion is the efficiency of germ trapping. Air filtration is commonly performed using filters containing fibrous or porous materials (Richards, 1967; Elsworth, 1969; Aiba, Humphrey and Millis, 1973; Conway, 1984, 1985). Air filters can be divided into two groups" a) filters with pores smaller than the particles to be trapped, the so-called absolute filters, and a) filters with openings larger than the filtered particles. Filters with fibrous materials do not form an impenetrable barrier for the microorganisms. They contain a filling or layers of fibrous material such as glass wool or cellulose cotton wool. The fibres are usually 0.5 to 15 lxm in diameter, with larger spaces in between, but they are highly efficient for trapping bacterial spores (1 l.tm) from air. Fibrous filters therefore cannot be absolute
231
and the mechanisms of particle retention differ substantially from those involved in absolute filters. Fibrous filters are relatively cheap, sufficiently robust and have low pressure losses. This last factor is important in industrial processes where costs of pressurized air are considerable. These types of filters are being replaced by microporous membrane filters. Membrane air filters contain pleated hydrophobic material with a fixed submicron uniform pore structure. Their hydrophobicity prevents pressure drop due to filter wetting, and the relatively small but highly efficient filtering surface area permits the construction of filters of relatively small dimensions even for the treatment of large air volumes. 7.2.3
Mechanisms of particle trapping
When selecting a filter it is necessary to know the basic mechanisms of particle retention which form the basis of filtration of aerosols. These include: direct retention, inertial trapping, gravitational sedimentation, Brownian movement and electrostatic forces. Particle filtering based on direct retention is a sieve effect which becomes prominent when the particle size exceeds the pore diameter. It is independent of air flow velocity. Bacteria and bacterial spores have sizes of 0.3-1.0 ~tm or greater. The limiting pore diameter in fibrous air filters fabricated from glass wool or cellulose cotton wool is 2-10 ~m, microporous filters have a pore size equal to or smaller than 0.45 ~m. Membrane filters therefore retain particles by direct trapping. Inertial retention depends on the kinetic energy of the particles and on viscous friction, and the trapping efficiency can therefore be expected to be proportional to particle density and the square of particle diameter, and inversely proportional to air viscosity. Gravitational sedimentation is again directly proportional to particle density and to the square of particle diameter, and inversely proportional to air viscosity and velocity. On increasing the air velocity, the mechanism of inertial retention is therefore preferred over gravitational sedimentation. Small particles suspended in a gas will be retained due to collisions with gas molecules which are subject to the random Brownian movement. The rate of particle retention is inversely proportional to the square of particle diameter, depends in addition on the air velocity and on air stream viscosity, and is optimal at low air velocities and in dry air. Particles impinging on filter fibre are kept in place by van der Waals forces. The air flow rates needed for release of retained particles from the fibres are substantially higher that the commonly used flow rates and the particle release is therefore improbable. Whereas the efficiency of the above mechanisms increases with increas-
232
ing particle diameter, electrostatic forces arising from an initial charge separation are inversely proportional to particle diameter. Their effect depends on the filter layer material, air humidity and flow rate. The effects of these factors increase with decreasing filter fibre diameter. As demonstrated above, the importance of individual factors will change from one device to another depending on the nature of the particles and the filter bed material, on air flow rate, humidity, temperature, etc.. The role of various mechanisms participating in aerosol filtration is illustrated in Fig. 7.14, using the example of per cent penetration of dioctylphthalate particles 5.0
0 :.,s 0.5 ID i_. -4-. (D r (!) 1:3_
o~ l
-
/ /
0.050
//
0
2
1
/
/
\
/ ~ " ~ \ \
~
31 /
i I 4/I //
~
I
\\ \
\\
\\
~x \
/
0.2
\
\\
\\
~ ~
~
J
.-.,.
"~
l
0.4 0.6 0.8 pGrticte diGmeter (#m)
1.0
Fig. 7.14 Mechanisms of aerosol filtration. Per cent penetration of dioctylphthalate particles through resin impregnated glass fibres is plotted as a function of particle diameter for four air flow rates (cm s -l) (Conway, 1985) 1 -- 0.94, 2 - 0.42, 3 - 0.31, 4 0.094
into a filter layer as a function of particle size and air flow rate. The experiments were performed with a resin impregnated glass wool filter bed having a fibre diameter of 0.75 lxm and filter layer thickness of 1.2 cm. As seen from the Figure, the highest penetration was found for particles 0.25-0.35 ktm in diameter. For particles with a smaller or larger diameter the retention was more effective. Detailed treatises have been published on the mechanisms of particle retention by filtration (Webb, 1964; Richards, 1967; Aiba, Humphrey and Millis, 1973; Conway, 1985). 7.2.4
Theory of air filtration by fibrous materials
Equations describing adequately the overall mechanism of particle retention and taking into consideration all relevant factors are difficult to derive. The determination of filtering efficiency has therefore been based on the effi-
233
ciency of a single fibre, i.e. the ratio of the number of retained particles to a unit length of the fibre, divided by the number of particles in the projection area of this unit fibre length. The retention efficiency of a single fibre r/was referred by Ranz and Wong (1952) to the ratio of particle diameter Dp and fibre diameter Dv ,
l+-b- 7
1 +_b_Tv
This expression can, however, be used only in some cases. For instance, let us consider a particle diameter of 1 ~tm and a fibre diameter of 10 ~m. Then equation [7.8] implies that the retention efficiency of a single fibre is 0.2, i.e. 20 %. When both particle and fibre diameters are 1 l.tm, then r/= 1.5, or 150 %. Some researchers have used the principle of single fibre efficiency to calculate the filtration efficiency of the whole filter (Davies, 1952) -
T]filte r
---
1- e
4arlX
~ o , ( , - ~)
[7.9]
where a is the fibre volume (unit volume of filter bed, i.e. ratio of filter density to fibre density), X filter bed height, Dv -- filter diameter. Wong and Johnstone (1955) proposed a similar formula -
T]filte r
--
1- e
4arl~X
~o,
[7.10]
where r/e is the effective retention ability of the fibre, which is a function of r/. Chen (1955) proposed a formula similar to the two preceding equations but taking into account the efficiency of a single fibre in relation to the actual fractional particle penetration
r/ =
-- l n - - ~ - 0
4aX(Dv)mea n
where No is the concentration of particles entering the filter, (Dv)~ - - m e a n fibre surface, (Dv)mean mean fibre diameter. These and similar equations can also be used for evaluating the possibility of increasing the efficiency of filter beds. A simpler approach can be used to facilitate assessment of filtration materials and filter design. When particles, which come into contact with the fibre, are assumed to be firmly retained and uniformly distributed throughout the filter bed, the particle concentration
234
at any point in the filter is equal and each unit filter layer decreases particle concentration by the same proportion. This can be mathematically described by the formula dN = -KN dX
[7.121
where K is a constant, N - - p a r t i c l e concentration in air, X - filter height. Then dN
[7.131
= -KdN
N
and integration between limits 0 and X yields In
N No
-
- KX
[7.14]
Constant K depends on a number of factors such as particle size, fibre size, etc.. Equations [7.9], [7.10] and [7.11] are based on equation [7.14] and their mutual relationships should therefore be examined. Equation [7.14] can be rewritten as follows: N
No
= e- rx
[7.15]
If N~ No is the partial lowering of the number of particles by filter layer X, then the filtration efficiency will be equal to (No - N ) / N = r/f~t~. However, No-
N
No
= I
N
No
[7.161
so that ~filter
"--
1 - e- xx
[7.17]
Equation [7.17] corresponds exactly to the Davies equation [7.9] and the Wong-Johnstone equation [7.10]. When r//k' is inserted into equation [7' 14] instead of K, where 7/is the efficiency of a single fibre and k' is a constant, then the formula 7/= In -~o is identical with the Chen's equation [7.11].
[7.181
235
Equation [7.14] is commonly known as the logarithm-of-penetration plot. It provides a fairly exact basis for filter design and estimation of filter behaviour. Decadic logarithms are used for convenience (k = K/2.303) N log No = - kX
[7.19]
Humphrey and Gaden (1955) developed a procedure for filter design based on the Xg0 concept, defined as the height of a filter bed necessary for reducing the number of entering microorganisms to 1/10, i.e. 90 % filtration efficiency. The log-penetration formula then states that each following filter layer of the same height will reduce the number of microorganisms again to 1/10. For a 90 % reduction it holds N 1 log No = log 10 - -
1 = -kXgo
[7.20]
When Xg0 is experimentally determined, the calculations of filter height are simplified.
7.2.5
Evaluation of filter bed efficiency
Microbiological determination of filter bed efficiency is carried out as follows: An aqueous suspension (aerosol) of microorganisms such as Serratia marcescens, which forms easily recognized red colonies, or of Bacillus subtilis var. niger spores (Robertson and Frieben, 1984) is dispersed in an air stream whose volume flow velocity can be measured. The air thus infected passes through the tested filter until equilibrium is established and samples are then taken before and after the filter. Microbiological assay of the concentration of the microorganisms before and after passage through the filter makes it possible to calculate log N/No for a given filter bed and air flow rate. When the determination is repeated at different filter bed heights, the log-penetration constants can be determined from the plot of N~ No versus X. The value of Xg0 can be read directly as the height corresponding to N/No = - 1 . In the case described by the authors Xg0 = 4.6 cm. The value of k (equations [7.19] and [7.20]) is 1/Xg0, i.e. 0.22. The value of k or Xg0 will change depending on the filter bed type and it is therefore necessary not only to compare different filter beds under identical conditions, but also to examine the change in k with changing air flow rate. Changes in air flow rate bring about changes in the retention mechanism. The dependence of k on the air flow rate will in all cases be similar to the function in Fig. 7.15. In this figure the air flow rate is given
236
as volume s -~ divided by the filter cross-sectional area. The shape and position of the curve will markedly change depending on the filter bed type. With increasing air flow rate an initially fairly low filter efficiency further decreases to a minimum, then increases and decreases again. The existence of the minimum was predicted by Stairmand and Bosanquet (1950) from theoretical considerations of changes in retention mechanism, and experimentally proved by
tinew air
vetocify
Fig. 7.15 Dependence of constant k on air flow rate
Gaden and Humphrey (1956). Figure 7.15 also shows that the retention efficiency again decreases at air flow rates exceeding a certain value, due mainly to:
a) air turbulence in the filter, b) formation of air channels owing to fibre displacement, c) fibre vibration resulting in a release of already retained particles. The main problems in filter testing arise from the fact that the testing is relatively short as compared with the actual process, and also from ignorance of the actual process conditions, i.e. number, size and type of microbial cells and spores passing through the filter. In addition, during a prolonged operation the microorganisms can reproduce in or on the filter, especially when the filter is wet. The proliferation rate depends on the microbial type" for instance, Pseudornonas diminuta proliferates on the filter 5 to 6-fold faster than Escherichia coli. It is also desirable that the change in k in dependence on changes in air flow rate is determined for every filter bed tested; the designed filter can then be made small and cost-effective. Another important factor is pressure drop. Pressure loss on the filter depends on the nature of the filter material, density of filter bed, density of air and the linear velocity of air passing through the filter. Various equations have been derived for the air pressure drop on a filter, for example:
237
Ap =
2 p V2aXC rtDv
[7.21]
where A p is the pressure loss on the filter, V -- linear air velocity, p -- air density, C -- friction coefficient dependent on filter bed characteristics. This equation states that, under otherwise identical conditions, the pressure drop is proportional to the square of air velocity. However, in general, at low air velocities of the order of 0.6 to 0.9 m s -~ the pressure drop decreases linearly with air velocity. The pressure drop can also be determined for different values of air flow in a test filter without a filter bed. A repetition of the same procedure with several filter bed heights yields a family of pressure drop curves showing the dependence on air velocity. If the filter bed has the form of thin plates or shaped materials the filter bed density is usually determined by this preprocessing. An increased filter layer density always brings about increased filter efficiency and a pressure drop. For this reason efficiency enhancement caused by increased filter layer density is the same as that achieved in a thinner layer with a lower density. Excessively compacted layers often result in fibre damage whereas loose layers tend to form channels. The applicable range of filter bed densities is therefore relatively narrow. 7.2.6
Filter construction
Two basic filter types are used for sterilization of air by fibrous materials: a) thick layer filters in which the filtering material is compacted in a cylinder and forms a more or less homogeneous, relatively high layer; b) membrane filters in which a relatively thin filtering layer is affixed on a firm support.
Thick layer filters Filters of this type (Fig. 7.16) consist of a metal cylinder encased in a coat and filled with filter material, usually glass cotton wool. The filter is sterilized by steam and is then thoroughly dried by hot steam passing through the coat. Important features are a uniform packing of filter material throughout the filter space and an optimum density, which prevents the formation of channels and passage of air along the filter walls. A part of the filter layer is usually lost in the first sterilization and has to be replenished.
238
The main shortcomings of filters with fibrous beds are the following" a) they do not provide a consistent and predictable removal of microorganisms; b) they are hydrophilic and can become wet as a consequence of water condensation in the air piping; this hinders air flow; e) they are difficult to handle, especially as regards filter bed replacement.
1~
p-
i1
[
Fig. 7.16 Deep-layer filter for air filtration. 1 -- air outlet, 2 - steam inlet, 3 - condensate outlet, 4 -- air inlet
Membrane filters Membrane filters are fabricated from a hydrophobic material with 0.2 l~m pore size and can therefore trap bacteria, spores and phages. They permit the application of high air flow rates at a low pressure drop on the filter. Their greatest advantage is the fact that water does not pass through the pores provided the intrusion pressure does not exceed 2.2-2.6 atm (0.22-0.26 MPa). They can be sterilized by steam and can be used many times over without filter layer replacements. They are made either of durapore (Millipore), a hydrophobic polyvinylidene difluoride similar to teflon (Leaky and Gabler, 1984) or emflon (polytetrafluoroethylene) (Conway, 1984). An effective filter area of a 25 cm emflon filter is about 2.7 m 2. The filter shown in Fig. 7.17 consists of a filter membrane with support polypropylene layers, and a metal filter casing. Both ends of the casing are fitted with bayonet closures and double seal rings to prevent any leaks. Membrane filters have the following advantages: a) natural hydrophobicity ensures efficient particle retention even from moist air,
239
i11.Lll
i
I ~ ..........
......
non,sterite oir
f
coodte
..
I111ILIL
.
.
.
.
.
i
N
.
~_.~
L_
....
Fig. 7.17 Construction of an absolute air filter
b) the retention of particles larger than the pore size is complete, c) particle retention is independent of the air flow dynamics, d) no fibres are liberated from the filter bed, e) membrane structure prevents formation of channels, f) they are resistant to microbial growth, g) they have a high retention efficiency for small particles (phages); the phages do not replicate because the retained microorganisms also do not grow.
REFERENCES Aiba, S., Humphrey, A. E., Millis, N. (1973) Biochemical Engineering, Tokyo. Banks, G. T. (1979) Scale up of fermentation processes. In: Topics in Enzyme and Fermentation Technology 3, Chichester. Bruch, C. W. (1973) Dev. Ind. Microbiol. 14, 3. Chain, E. B., Paladino, S., Zanchi, F. (1959) Note on the sterilization of media containing solid organic material in laboratory and pilot plant fermenters. In: Selected Scientific Papers from Instituto Superiore di Sanita 2, 88. Chen, C. Y. (1955) Chem. Rev. 55, 595. Conway, R. S. (1984) Biotechnol. Bioeng. 26, 844. Conway, R. S. (1985) Selection criteria for fermentation air filters. In: Comprehensive Biotechnology 2, New York. Cooney, C. L. (1985) Media sterilization. In: Comprehensive Biotechnology 2, New York. Corbett, K. (1985) Design, preparation and sterilization of fermentation media. In: Comprehensive Biotechnology 1, New York. Davies, C. N. (19.$2) Proc. Inst. Mech. Engrs. B 1, 185.
240 Deindoerfer, F. H. (1957) Appl. Microbiol. 5, 221. Deindoerfer, F. H., Humphrey, A. E. (1959a) Appl. Microbiol. 7, 256. Deindoerfer, F. H., Humphrey, A. E. (1959b) Appl. Microbiol. 7, 264. Deindoerfer, F. H., Humphrey, A. E. (1961) Appl. Microbiol. 9, 134. Elsworth, R. (1969) Treatment of process air for deep culture. In: Methods in Microbiology 1, London. Ernst, R. R. (1974) Biotechnol. Bioeng. Symp. 4, 865. Field, M. F., Lichstein, H. C. (1958) J. Bacteriol. 76, 485. Gaden, E. L., Humphrey, A. E. (1956) Ind. Eng. Chem. 48, 2172. Gaughran, E. R. L. (1973) Dev. Ind. Microbiol. 14, 57. Humphrey, A. E., Gaden, E. L. (1955) Ind. Eng. Chem. 47, 924. Kalinina, N. M., Motina, G. L. (1986) Antib. Med. Prom. 31, 17. Kempe, L. L. (1960) Adv. Appl. Microbiol. 2, 313. Kereluk, K., Gammon, R. (1974) Dev. Ind. Microbiol. 15, 411. Kosikowski, F. V. (1979) J. Dairy Sci. 62, 1149. Leaky, T. L., Gabler, R. (1984) Biotechnol. Bioeng. 26, 836. Lin, S. H. (1979) Process Biochem. 14(7), 23, 26. Mulvany, J. G. (1969) Membrane filter techniques in microbiology. In: Methods in Microbiology 1, London. Perkins, J. J. (1956) Principles and Methods of Sterilization, Oxford. Peterson, A. I. (1974) Biotechnol. Bioeng. Symp. 4, 879. Ranz, W. E., Wong, J. B. (1952) Ind. Eng. Chem. 44, 1371. Richards, J. W. (1967) Process Biochem. 2(9), 21. Richards, J. W. (1968) Introduction to Industrial Sterilization, London. Robertson, J. H., Frieben, W. R. (1984) Biotechnol. Bioeng. 26, 828. Sikyta, B., Mastner, J. (1967) Biotechnol. Bioeng. 9, 575. Sikyta, B., ~lechta. J., Herold, M. (1964) Biotechnol. Bioeng. 5, 321. Sowden, J. C. (1957) Adv. Carbohydrate Chem. 12, 35. Stairmand, C. J., Bosanquet, C. H. (1950) Trans. Inst. Chem. Engrs. 28, 130. Sykes, G. (1969) Methods and equipment for sterilization of laboratory apparatus and media. In: Methods in Microbiology 1, London. Thaynithy, K., Harding, G., Wase, D. A. J. (1982) Biotechnol. Lett. 4, 423. Toplin, I. (1962) BiotechnoL Bioeng. 4, 331. Vahedra, D. V., Bellamy, W. D. (1983) Biotechnol. Lett. 5, 63. Wallh~iusser, K. H. (1978) Sterilisation, Desinfektion, Konservierung. Keimidentifizierung -- Betriebshygiene, Stuttgart. Webb, F. C. (1964) Biochemical Engineering, London. Wilkinson, G. R., Baker, L. C. (1964) Progr. Ind. Microbiol. 5, 231. Wong, J. B., Johnstone, H. F. (1955) Collection of aerosols by fiber mats. In: Eng. Expt. Sta., Univ. Illinois, Techn. Rep. 11, AEC Contract AT/30-3/-23.
241
8
AERATION AND MIXING
Aeration and mixing of nutrient media and microorganisms which grow in these media should ensure: a) a sufficient amount of oxygen for aerobic microorganisms, b) concentration and temperature homogeneity of the culture. Oxygen is the final acceptor of electrons and hydrogen in microorganisms which obtain their energy via aerobic respiration; at the same time it serves as a substrate because, through the action of oxygenases, it is incorporated into carbon substrates in the course of their dissimilation. Oxygen acts also as a regulatory factor which either induces aerobic enzymes or inhibits the activity of these enzymes during glycolysis (Pasteur effect) and the synthesis of enzymes during dissimilation of energy sources under anaerobic conditions (oxygen effect). The rate of oxygen consumption in aerobic microorganisms is so high that the oxygen supply after maximum air saturation of the culture can support cell metabolism for a mere 15 s. Consequently, interruption of oxygen supply for an interval even as short as 15 s can seriously impair the respiration of cells of highly aerobic microorganisms such as Acetobaeter. Although such a dramatic effect of a short suspension of oxygen supply is not frequent, an insufficient oxygen level in the culture leads in any case to lowered yields of cells or metabolites. Considerations of oxygen supply in microbial processes include simultaneously aeration and mixing because these two processes exert a common effect on the oxygen level. In some processes using unicellular microorganisms, culture mixing by impeller systems is obviated provided the air dispersers (spargers) are correctly placed in the bioreactor. On the other hand, in cultivations of filamentous microorganisms such as actinomycetes and fungi, mixing is indispensable for a successful process. The main problems in aeration and mixing of submerged microbial cultures are: a) achieving the correct mixing intensity, b) finding reasonable ways of evaluating the effect of aeration and mixing.
242
8.1
THEORY OF OXYGEN TRANSFER
Transfer of oxygen from the gas phase proceeds by molecular diffusion. The double-film theory assumes the formation of a gas-and-liquid film at the gas-liquid interface. All resistance to the transport of oxygen from the gaseous into the liquid phase is assumed to be concentrated in the liquid part, i.e. in the liquid film (Fig. 8.1).
P
gas
tiquid
I I
I I
I I I I I I
dl
d2
~--
C
Fig. 8.1 Scheme of oxygen transfer from gas to liquid d~ -- film thickness, d2 -- thickness of liquid film, C § -- equilibrium oxygen concentration (a function of T, Po2 and physical properties of the liquid), C - momentary concentration of dissolved oxygen, A C - driving force
When the oxygen concentration profile in the film is linear, no reaction takes place in the film and the overall process is a physical oxygen absorption. In the case of chemical absorption the concentration profile is no longer linear. The magnitude of resistance of the liquid film depends on the physicochemical properties of the liquid and its thickness is affected by mixing intensity. The double-film theory presumes an instantaneous equilibration of oxygen concentrations in the gas and the liquid following the contact of the two phases P He
where
-
c
[8.~1
is Henry's constant, C --momentary concentration of dissolved oxygen. The solution of a diffusion process according to the double-film theory is based on the 1st Fick's law He
where N D d C/dx
x d
is diffusion flow, -- diffusivity of oxygen, - - concentration gradient, -- distance, --thickness of the diffusion layer.
243
Solution of the equation has the form D
---d ( C + - C)
[8.3]
N = kL (C + - C)
[8.4]
N= or
where kL is an oxygen transfer coefficient. When the rate of oxygen absorption is referred to the total area of dispersion, A, in a volume VL it can be seen that dC
v , --d7 =
(C + -
dC - kLa(C +dt
C)
[8.5]
[8.6]
C)
where kLa is the volume coefficient of oxygen transfer characterizing the aeration efficiency of the device, a -- specific interface area for mass transfer, C + --equilibrium oxygen concentration. In a system with microorganisms, equation [8.6] has the form dC dt
- kLa(C +-
C)-
rX
[8.7]
where r is the respiration rate of the microorganism, X - - cell concentration. When the rate of oxygen consumption exceeds the rate of absorption the whole system enters, after a certain period, a region of oxygen limitation. Equations [8.6] and [8.7] hold for an ideally mixed system, i.e. for ideally mixed gaseous and liquid phases. In practice this condition is rarely encountered since different oxygen concentrations can be determined in different locations in the liquid phase inside bioreactors; the condition of an ideally mixed system is then not fulfilled. If the oxygen concentration in the liquid is zero equation [8.6] is reduced to the form dC = kLa C + dt
[8.8]
which defines the maximum rate of oxygen transfer under given conditions.
244
8.2
METHODS OF AERATION CAPACITY (kLa) DETERMINATION
The methods for determination of kLa can in practice be divided depending on what system they can be used in, i.e. methods applicable in the system gas-liquid (model systems) and those that can be used in the system gas-liquid-microorganism (culture systems). 8.2.1
Methods applicable to model systems
The sulphite method The oldest method for measuring kLa, elaborated by Cooper, Fernstrom and Miller (1944), is based on chemical monitoring of the decrease in oxygen concentration via oxidation of sulphite to sulphate in the absence or presence of a catalyst (Cu 2+, Co 3+ in a concentration of 10-3-10 -5 kmol m -3) according to the equation 3+ Co
SO~- + 1 / 2 0 2
2-?" S02Cu
Since in this system the concentration of oxygen in the liquid, C-- O, the aeration capacity can be described by the equation
kea =
(dfNa2s~
[8.9]
2C +
The rate of absorption is increased by the chemical reaction and it is therefore necessary to know the acceleration factor of the method. This can be determined as the ratio of chemical and physical absorption values according to the formula
kea f = kOa
[8.101
Since usually f > 1 the measured kLa > ~a and the calculated values are higher than the actual ones. The method is suitable only for comparing the efficiency of individual culture devices. Because of the consumption of the relatively expensive sulphite it cannot be used for testing large-volume bioreactors. It is simple but time taking; one determination may take up to 3 h depending on aeration and mixing intensity. The accuracy of the method drops substantially in the presence of even very low concentrations of surface active compounds such as proteins, amino acids, fatty acids and lipids (Bell and Gallo, 1971).
245
The static and volumetric methods Integration of equation [8.6] gives the formula In
C
+
C+-C
= kLa t
[8.11]
and kLa is evaluated from an aeration experiment by determining suitably the oxygen concentration C during the aeration interval t. Various methods differ in the technique of determining the concentration of dissolved oxygen. In the static method the oxygen concentration is measured by the oxygen electrode; air is brought into the system for an interval t~, the aeration is stopped and steady state oxygen concentration is then measured. The whole system is then freed of oxygen, and air is again brought in for an interval t2(t2 > t~). This technique is used to monitor the whole range of bioreactor liquid saturation throughout the whole time interval t. In the volumetric method the amount of dissolved oxygen is determined via desorption by a carbon dioxide stream and absorption of excess carbon dioxide into a solution of potassium hydroxide in a gas burette.
Gassing-out method The method is based on monitoring, by an oxygen electrode, the exponential change in oxygen concentration in a liquid following a transient displacement of the oxygen by an inert gas, usually nitrogen. The gassing-out phase is followed by removal of the nitrogen gas from the space above the liquid using an air stream. This step is necessary to avoid inadvertent nitrogen intake during the exponential change (Fig. 8.2).
C "~
100 .-. E
8O 60
40 2O 0
I
0
20
I
40
I
60
O, scd.,u.rcttion (%)
I
80
I
100
Fig. 8.2 Time course of dissolved oxygen concentration in the gassing-out method
246
Integration of equation [8.6] gives the formula 1
kLa -
t - to
In
C + - Co
C+- C
[8.12]
When the change in oxygen concentration is plotted against time the aeration capacity value is obtained as the slope of the line (Fig. 8.3). This method is often used to test bioreactors. It is limited, however, by nitrogen consumption and is not applicable in large volumes because the measurement requires
200
100
b b
~
7o
~
50
~3 9
30 20
10
I 2
I 6
I 10 ~--
I 14
I 18
I 22
I 26
30
time (s)
Fig. 8.3 Determination of kLa by the gassing-out method
a sudden change in both aeration and the impeller power input, which is not feasible in large-volume devices. When both the measurement and calculation are carried out in this way the resulting value of kLa has a tentative character and does not provide information about the absolute aeration capacity value. 8.2.2
M e t h o d s applicable to cultivation systems
The balance method
This method is based on monitoring of changes in oxygen concentration in the gas phase. Measurement of changes in the partial oxygen pressure in the liquid makes it possible to calculate also the value of kLa. Taking into account the respiration of carbon dioxide, and referring the air flow to an inert gas such as nitrogen, the rate of absorption Na can be defined by the equation
247
Na -
v[
R VL
where V is the volume of VL -- volume of the R -- gas constant, Y~ molar fraction Y~c -- molar fraction Y2 -- molar fraction Y2c -- molar fraction The rate of absorption ters of oxygen transfer
T~(1- Y l - Y~c) - T2( 1 -
,22
Y 2 - Y2c )
]
[8.131
the inert gas, liquid, of oxygen at the inlet, of carbon dioxide at the inlet, of oxygen at the outlet, of carbon dioxide at the outlet. is a basic parameter for calculating other parameNa kLa = C+ - C
[8.14]
The value of C + has to be corrected for oxygen concentration at the outlet and pressure change at the outlet; another quantity to be known is the change in oxygen solubility in the liquid caused by the disappearance of substrate and the formation of products. The specific rate of oxygen consumption is given by the equation QQ-
Na
X
[8.151
where X is biomass concentration. The requirement for oxygen in the linear growth phase can be defined by the equation Yo/,-
Na Pr
[8.16]
where Pr is productivity. The following equation holds for the exponential growth phase Y0/, -
Qo2 ~t
[8.17]
where ~t is the specific growth rate. The respiration coefficient is given as follows R~=
COz y , _ y:
[8.18]
This method can conveniently be used for scale-up from laboratory to pi-
248
lot plant scale, although it is limited to closed bioreactors. It makes it possible to measure oxygen transfer in the course of a cultivation without interfering with culture aeration and mixing.
Integral balance m e t h o d
The method provides an assessment of utilization of dissolved oxygen by microorganisms and its impact on both the gas and the liquid phase. The oxygen balance is given by the formula dt
-
--H-~eY2 - C
-
Q(C, t)
[8.191
The term Q(C, t) has to be determined from growth experiments. The first term on the right-hand side of the equation represents a change in oxygen concentration during growth, the second term corresponds to oxygen level change during formation of intermediates. Aeration capacity can be determined by computer evaluation of the parameters of a model which embodies data from an experimentally established course of biomass production, concentration of dissolved oxygen, substrate consumption, time course of oxygen concentration at the outlet or other quantities characterizing cumulative oxygen consumption. The advantage of the integral balance method is that it allows one to obtain not only parameters of oxygen transfer but, in addition, other kinetic parameters of growth and it can be used also in the range of oxygen limitation. Another advantage is that it eliminates all effects accompanying the dynamic measurement by oxygen electrode, so that only the quasi-concentration, i.e. steady-state concentration of oxygen has to be measured during the cultivation.
The d y n a m i c m e t h o d
The method is based on monitoring exponential changes in oxygen concentration during cultivation, using an oxygen electrode. The changes are brought about by suspending and restoring aeration and mixing in the bioreactor (Fig. 8.4). Changes in oxygen concentration in the culture are described by equation [8.17] which is reduced in region II, following suspension of aeration and mixing, to the form dC = -rX dt
[8.20]
249
Equations [8.7] and [8.20] hold as long as the oxygen concentration does not drop below a concentration critical for given microorganism, i.e. below the concentration at which the respiration rate begins to depend on the dissolved oxygen concentration. The respiration rate can be determined from the slope of the electrode trace in region II, aeration capacity from the slope of the plot of oxygen concentration against - d C / d t + rX. The limitation of this
L
C§ . . . . t.-,+_ "~
r =d
b_ ............
II
r =x I
y
r }K L(:1
C1
0
time (s)
Fig. 8.4 Time course of oxygen concentration in a culture after interruption (1) and renewal (2) of mixing and aeration
method is the same as in the gassing-out method" it cannot be used in the region of oxygen limitation and for testing large-volume bioreactors because of the sudden energy load on the impeller during restart.
8.3
FACTORS AFFECTING AERATION
CAPACITY(kLa)
The value of k L a in the culture device is affected by a number of factors. Among them are air flow rates, mixing intensity, rheological properties of the culture, presence of defoamers and some organic substances, ionic strength, concentration of carbon dioxide, temperature and pressure. A feature which is important for process scale-up is that the optimum value of kLa determined on the small scale should be applicable also on the large scale. This value can be achieved, although the equipment of culture devices varies widely. Quantitation of relationships between operational variables and kLa should enable a forecast of process conditions that would ensure the attainment of an appropriate k L a value (Stanbury and-Whitaker, 1986).
250
8.3.1
Critical oxygen concentration and oxygen consumption
As seen from equation [8.6] the rate of oxygen transfer is maximal at a zero concentration of dissolved oxygen. However, a decrease of oxygen concentration below a certain threshold, the so-called critical concentration Cc, brings about a decrease in the respiration rate which, under these conditions, becomes a function of oxygen concentration (Fig. 8.5). The critical oxygen 0.04
& "i-" I/1 t::: o
0.03
ri col concentration
0.02
(1; 1=: r o
,.., 0.01 0
t",4
Io
0
I
1 ---.-~. C L
I
i
2 (gO2
3 [-3)
Fig. 8.5 Dependence of specific rate of oxygen consumption (Qo2) on dissolved oxygen concentration (C) in a yeast culture (Finn, 1967)
concentrations for some selected microorganisms are given in Table 8.1. Like other concentration limits, oxygen limitation is manifested by a lowering of the growth rate. In addition, a prolonged residence of microorganisms in a medium with zero oxygen concentration can cause irreversible changes in the respiratory system. Oxygen limitation is therefore undesirable in practice
Table 8.1 Critical oxygen concentrations in some microorganisms (Finn, 1967) Microorganism
Azotobacter vinelandii Escherichia coli Serratia marcescens Pseudomonas denitrificans Yeasts
Penicillium chrysogenum Aspergillus oryzae
Temperature (~ 30.0 37.8 15.0 31.0 30.0 34.8 20.0 24.0 30.0 30.0
Cr (mM l -I) 0.018 - - 0.049 0.0082 0.0031 -- 0.015 -- 0.009 0.0046 0.0037 -- 0.022 --- 0.009 -- 0.020
251
and the concentration of dissolved oxygen has to be maintained at a level higher than the critical concentration. Critical concentrations are relatively low (of the order of units of per cent saturation) but in non-homogeneous systems such as culture broths of filamentous microorganisms can display local oxygen shortages which are reflected in increased values of critical concentrations (the so-called apparent critical concentration Cc). The values of apparent critical concentration for some microorganisms can be relatively high. The following values were given by Phillips and Johnson (196 l) for Aspergillus niger growing in a synthetic medium (compared with analogous values for Escherichia colt):
Microorganism
c
Aspergillus niger Escherichia coli
65
(gmol 1-l) 81
455 65
The apparent critical concentration C c corresponding to 455 t,tmol 1-~ represents, at an oxygen solubility in the medium C + = 5.8 mg 1-~, a value of C = 1.93 mg 1-~, in other words 33.3 % saturation. Commonly encountered critical oxygen concentrations C~ correspond to 5-10 % saturation. Under steady state conditions the rate of oxygen transfer into the culture equals the rate of oxygen consumption by the microorganisms kLa (C § - C) = Qo2x
[8.21]
or
c = c +-
Qo2X kLa
[8.21a]
At a constant temperature, culture composition and a constant partial pressure of oxygen in the gaseous phase, the steady state concentration of dissolved oxygen does not change and it is affected by Qo2X and by kLa.
8.3.2 Aeration and mixing intensity The rate of air flow has a relatively small effect on kLa values in usual mixed systems (Fig. 8.6). The commonly used range of air flow rates is 0.5-1.5 air volume per culture volume per 1 min (volume air flow rate) irrespective of the bioreactor size. The air flow can give rise to foam formation because, while the volume air flow rate increases with the third power, the outflow of inlet air is related to the culture surface area in the culture vessel and rises
252
therefore with the second power. The surface rate of oxygen transfer, i.e. the volume air flow rate referred to the bioreactor cross-section, can sometimes be kept constant during scale-up but this may bring about oxygen limitation. The choice of an optimum volume air flow rate therefore represents a compromise. Mixing has a positive effect on the rate of oxygen transfer because the kLa value is increased for the following reasons: a) finer air dispersion leads to increased interface area a; b) increased turbulence brings about a reduction of the thickness of the liquid film at the interface and an increase in the value of kL; C) the bubble holdup time in the bioreactor increases; d) mixing hampers air bubble coalescence.
0
__1
t
S 0
I
0.5 ----air flow votume rate
1.0
Fig. 8.6 Effect of air flow rate on in a stirred and aerated vessel
kLa
The kLa value in stirred vessels increases with rising air surface velocity (i.e. with the amount of air supplied per bioreactor cross-section) to a certain critical value. This value corresponds to the point of impeller choking, i.e. a situation in which the impeller revolves essentially only on an air cushion. In a certain range the kua value is relatively independent of the bubble size because large bubbles, which have a relatively small surface area, create a larger turbulence in their vicinity, decreasing thereby the interface liquid film thickness and increasing kL. On the other hand, small bubbles have a larger surface area and bring about a lowering of turbulence (Finn, 1964). Only in very small bubbles (diameter below 1 mm) an increase in kLa can be observed. Because the bubble diameter is about 10-fold greater than the diameter of the opening through which air is fed into the bioreactor, these small bubbles can be produced only by using sintered glass spargers or ceramic candles.
253
Cooper, Fernstrom and Miller (1944) measured kca in aerated and stirred bioreactors with a single impeller and derived the following formula kca = k
[8.221
V~
where Pg is power input, V -- liquid volume in the vessel, V~- surface velocity of oxygen, k -- constant. Equation [8.221 implies that kca is nearly directly proportional to the power input per unit volume. However, Bartholomew (1960) showed that this proportionality depends on the vessel size and the exponent in the P g / V t e r m varies with the process scale: Process scale
Value of the
Laboratory Pilot plant Industrial
Pg/Vexponent
0.95 0.67 0.50
It should be noted, however, that the bioreactors used by Bartholomew for his measurements contained multiple impellers whereas those used by Cooper, Fernstrom and Miller were fitted with a single impeller. Top impellers are likely to have consumed more power to achieve the same values of oxygen transfer than bottom impellers, and this may have affected the value of the exponent. Richards (1961) pointed out that any relationship between kLa and the power input per unit volume is affected by a large number of variables which are not included in the above equations (impeller speed, size and shape, surface velocity of air and culture rheology). He proposed a formula which includes one of these variables kca = a
( )04
N
[8.23]
where Nis the impeller speed. Other relationships between kca and power input were verified during microbial cultivations. Taguchi et al. (1968) derived the formula kca = k
( )033
V~
'8 4,
254
while the formula derived by Steel and Maxon (1962) has the form kLa = k p0.46 g
[8.25]
Wang et al. (1979) proposed that in addition to a constant value of kLa which should be maintained during scale-up by changing the impeller diameter relative to bioreactor diameter, the circumferential speed of the impeller should also be kept constant during the scale-up.
8.3.3
Physical factors
Temperature Culture temperature affects oxygen solubility, i.e. steady state concentration of dissolved oxygen, as well as its diffusivity (transfer coefficient) in the culture fluid. Solubility of oxygen in water decreases with temperature while its diffusivity in the liquid phase rises nearly linearly with absolute temperature. The effect of temperature on the rate of oxygen transfer depends on the temperature range. At lower temperatures (10 ~ < T < 40 ~ the rate of oxygen transfer increases with increasing temperature owing to increasing oxygen diffusivity. At higher temperatures (40 ~ < T < 90 ~ the oxygen solubility decreases significantly, which negatively affects kLa.
Pressure Partial tension of oxygen in the culture affects mainly oxygen solubility and thereby also the driving force for oxygen transfer. The dependence of oxygen solubility on oxygen tension is given by the Henry law (Kargi and Moo-Young, 1985) Po2 =PcYo2 = He C~:
[8.26]
where He is the Henry constant, Pc -- total air pressure, Y o 2 - molar fraction of oxygen in the gas phase. Increase in Po2 (at a constant temperature) brings about an increase in + C 02 and a consequent rise in (C § - C) and in kLa.
Medium and culture rheology The rheology of nutrient media and cultures significantly affects the kLa value. A nutrient medium containing polysaccharides, whether as substrates or products, and mycelium exhibits a non-Newtonian behaviour. The rheolog-
255
ical properties of such media change during the cultivation (Tuffile and Pinho, 1970; Le Duy, Marsan and Coupal, 1974; Roels, van den Berg and Voncken, 1974) with changing concentrations of individual components of the culture broth (substrates, products, cell matter). Most bacterial and yeast cultivations take place in relatively low-viscosity Newtonian fluids in which turbulent flow can readily be achieved. The non-Newtonian behaviour of fungal and actinomycetal cultures poses problems with frequent limitation of growth and product formation by oxygen. The difference between oxygen consumption profile in unicellular and mycelial cultures is illustrated in Fig. 8.7. The
o
lb
I----oxygen
I I
'
[imitation
I t---- oxygen II limitation
1
I
\\
\X\,/ i
/
/
'I
", 'l
f
time
~
t... time
_
Fig. 8.7 Effect of oxygen limitation on the rate of oxygen consumption by a bacterial (a) and fungal (b) culture (Banks, 1977) 1 -- concentration of dissolved oxygen, 2 -- rate of oxygen consumption
100
QJ
.~_
.~'50 0
t I
1
I
0.4 0.8 1.2 ---..-concentration of mycetium (%w/v)
1.6
Fig. 8.8 Effect of concentration of Penicillium chrysogenum mycelium on kLa in a stirred bioreactor (Deindoerfer and Gaden, 1955)
256
overall oxygen consumption profile in the two cultures is the same in the exponential growth phase until the point of oxygen limitation is achieved. In the region of oxygen limitation the oxygen consumption in unicellular cultures is constant while in mycelial cultures it declines. The effect of mycelium concentration o n kLa in a Penicillium chrysogenum culture is shown in Fig. 8.8. 8.3.4
Chemical factors
Surface active agents Surface active compounds can both increase and decrease the kLa. Increase in kLa can be caused by a relative increase in bubble surface area, lowering of kLa c a n reflect accumulation of surface active substances at the gasliquid interface which enhances the resistance to oxygen diffusion. It has been experimentally established that the addition of 0.02 % (volume) sodium lauryl sulphate enhanced the rate of oxygen transfer by some 200 % whereas the addition of 0.01% silicon oil or 0.02 % Tween reduced the rate by about 50 %. Table 8.2 gives the effect of different surfactants on the kLa value.
Ionic strength The value of kLa depends considerably on the ionic strength of the culture broth. Robinson and Wilke (1973) derived a formula for the relationship between kLa and the ionic strength in Newtonian liquids
kLa
Pg V m --- " ~ T -s
p~533 /-)2/3 "-" 02 0.0.6 ,/.21/3
[8.27]
where A, is a function of ionic strength, t7 -- surface tension, Do2-- oxygen diffusivity, PL - - density of the fluid, ~uL - - v i s c o s i t y of the fluid. Parameters )~ and m are in an empirical relationship with the ionic strength I of the solution 1
2
I = ~- E Z~ C~ where Z~ is the charge on particle i, C; -- concentration of particle i.
[8.28]
Table 8.2 Effect of surfactants on the value of kL (Aiba, Humphrey and Millis, 1973)
Experimental conditions Surfactant d, (cm)
Q (cm 3 min-l)
kc (cm s-')
HL (cm)
C, (ppm)
kLat C ~ = 0
kLmin
Dioctyl sulphosuccinate
0.028
0.012
Alkylbenzenesulphonate
0.017
0.007
Pentapropylbenzenesulphonate Laurylsulphate
0.55 0.12
Synthetic detergent Laurylsulphate
daQ HE-Q -o- --
0.017 0.14
40
0.16 0.70
bubble diameter air flow volume rate height of liquid concentration of surface-active agent surface tension (l.tN cm -1)
ll0
128 0.85
40
70
0.027
0.014
0.017
0.056
0.013
0.042
0.005
300-
600
0.016
C~ at kLmin
10
20 20
0.016
0.039
0.028
Cs at O'rnin
15 1000
l0 50
100
25
258
8.4.
RHEOLOGY OF FLUIDS
Scale-up of microbial processes and the study of processes of motion, heat and mass transfers in industrial bioreactors requires information about the flow properties of nutrient media and cultures. These properties have a crucial influence on the overall effectivity of the process (Charles, 1978). The flow of fluids is the subject of rheology, which explores the relationship between different deformations of matter (elastic, plastic, flov~ deformation) and their causes. Rheology also explores the macroscopic properties of fluids as related to their microstructure. These relationships then serve for predicting the type and magnitude of deviations from Newtonian behaviour. The current state of rheology of non-Newtonian fluids has so far not permitted the description of their behaviour by a single flow equation. The method of choice is therefore the use of empirical relationships which best describe the experimental data. However, these purely empirical formulas bear no relationship to the actual mechanisms underlying the deviations from Newtonian behaviour. A number of fundamental definitions and terms will be presented, for example the definition of a Newtonian fluid, and the flow behaviour of various types of Newtonian fluids and the possibilities of a mathematical description of the flow of these fluids will be discussed. A fluid is a physical body capable of considerable resistance against external compression forces, and providing a much smaller resistance to small shape changes. Its particles are highly mobile. A fluid is envisaged as a continuum, i.e. a system with continuous distribution of matter and physical quantities characterizing its state. This concept is warranted in real systems whose geometrical dimensions are much greater than the dimensions of individual molecules; the fluid then behaves macroscopically as a continuous body. A fluid particle (element) is defined as a fluid volume which is sufficiently large relative to molecular dimensions and can thus behave externally as a continuum, but is relatively small in regard of the dimensions of the whole system. Fluid flow is the result of forces acting on the fluid. These forces can be divided into two groups: forces whose magnitude is proportional to the mass of a fluid element, such as weight, exert the same effect from the outside on a fluid element and on the whole fluid volume, and they are called volume forces. Forces of the other group act within the body of the fluid. They represent external forces with regard to individual fluid elements but internal forces with regard to the whole fluid volume. They are assumed to act only at a distance corresponding to the distance between neighbouring atoms (molecules) at the two boundaries of an ideal plane delineating a given volume element.
259 They are therefore termed plane forces. They can be divided into forces acting at right angles to the surface (normal forces such as pressure) and forces acting tangentially to the surface (tangential forces).
8.4.1
Viscosity and Newtonian fluids
An important basic concept indispensable for the description of fluid flow is the shear deformation. Let us assume, in agreement with Fig. 8.9, that individual layers of the material studied slide on each other without a volume change. At the same time the body is subject to the sole force P which acts tangentially to the contact area A of the two layers.
A
_~p
__.t dx I,__
T
Fig. 8.9 Model of shear deformation
The tension component acting in the direction of the relative motion of the two layers is called tangential tension, r. Let us introduce the term "relative deformation" y as the mutual displacement of the two material layers referred to their thickness. Hook's law P dx - r = G?' = G ~ A dy
[8.29]
holds for elastic deformation and can be expressed in words as follows" the deformation of a body is proportional to the force acting thereon. G is the socalled modulus of elasticity in shear. Hook's Law does not hold for plastic deformation and the deformation ?' increases as long as the tangential tension r acts. If the force stops acting the rise in deformation ceases and the body keeps its deformed shape. Viscous deformation (or flow) is characterized by increasing deformation under the action of the tension, the rate of deformation being proportional to the acting force. For most fluids the shear rate or
260
the rate of shear deformation D is a linear function of the tangential tension and obeys Newton's law d~'_ r = ~t - - ~ - #D
r
[8.301
where the proportionality coefficient ~t is the dynamic viscosity (viscosity in the following text) of the fluid. Fluids whose flow obeys Newton's law are called Newtonian fluids and their viscosity depends only on their molecular structure and on quantities of state (temperature and pressure). Viscosity is a measure of consistency of the fluid, i.e. its resistance against flow, or a measure of intrinsic friction of molecules. Along with density it represents a fundamental hydrodynamic parameter. Let us envisage a situation as shown in Fig. 8.10. The space between the immobile plane 1 and the mobile plane 2 is filled with a fluid with viscosity #. 2 IIIIIIIII/111~1l
[11111 II IIIII
I III
/1111111111/
IIII/11/I/111111111 1
V
Fig. 8.10 Scheme depicting the shear rate I -- immobile plate, 2 - mobile plate
The fluid adhering to plane 1 is immobile whereas the fluid adhering to plane 2 is carried along at a velocity v. If the width of the gap between the two planes is dy, equations [4.29] and [4.30] can be used for expressing the shear velocity as a function of the translational velocity v (under the provision of independence of derivatives) D = --d-t
=--~y -d--t = dy
[8.31]
The shear velocity D is thus equal to the velocity increment or gradient. In a Newtonian fluid the velocity gradient of individual fluid layers in the direction perpendicular (normal) to the acting tension is directly proportional to this tension while both the tangential tension and the shear velocity are at the same time causes and results of mutual displacement of fluid layers. On constructing flow curves (rheograms) for two Newtonian fluids whose
261
flows are described by equations [8.30] we obtain curves as shown in Fig. 8.11. As implied by the definition equation, viscosity # is the proportionality constant in the linear dependence r =/.tD and in the plot it is determined by the line slope, for example the tangent of the angle a. The viscosity of fluid 1 apparently exceeds that of fluid 2. If the two fluids are flowing, e.g., through a tubing under the action of the same tangential tension r~ = r2, proportional to the pressure gradient in the tubing and thus to the energy driving the flow, the fluid 2 with a lower viscosity will acquire a higher shear velocity 1)2 > D~, in other words it will flow faster and more easily than fluid 1. Rheograms of Newtonian fluids are rectilinear; the viscosity # of these fluids is independent Newfonian fluid
'E
G# I_ ..1-II1
4i---(lJ
m~ - ~2_ -
-
. . . . . . . . . I I
~'2.
2 I I
r.4--
7"..v"" ', \ !n~
//'~
----> shear velocity Is q )
r-
(,4
i!D2 Fig. 8.11 Rheogram of a non-Newtonian fluid
of the value of the shear velocity D and is constant for given physical conditions (temperature and pressure). 8.4.2
Non-Newtonian fluids
The flow of non-Newtonian fluids does not obey Newton's law (equation [8.30]), although the law can be formally written also for these fluids in the form r = #~D, where ~t~ is the so-called apparent viscosity. Index D denotes the dependence of apparent viscosity on the shear velocity D. In contrast to the Newtonian viscosity #, which is solely a function of quantities of state and represents a physical constant describing the properties of given material, the apparent viscosity #~ is a complex structural function which depends under given conditions on actual flow relations and has no significance as a physical constant.
262
The large majority of non-Newtonian fluids exhibit rheograms such as the curve I in Fig. 8.12. Such fluids are called pseudoplastic and their apparent viscosity is the lower, the higher is the tangential tension acting on them. Their consistence in the resting state is several orders of magnitude more viscous than under the action of high tangential tensions. These fluids include solutions and melts of high molecular weight substances (plastics, rubbers), solutions of soaps, detergents, lubricants and diluted suspensions. pseudoptostic fluid Ii/I
lf/i
t.-, Ill
I,...
."
I
A_Z___A_V
',
.,.,,,, ,.I,-. eQ,I eI:1 .4-.
/,I !X.-q .f
t
I I
~-
ii ,
~ ~shear
!
I
I , velocity
DI D
(S-1)
Fig. 8.12 Rheogram of a pseudoplastic fluid
Curve 1 in Fig. 8.12 illustrates a pseudoplastic fluid, curve 2 denotes a Newtonian one. Let us follow the flow behaviour of the two fluids. When they are subject to a low tangential tension q the behaviour of the pseudoplastic fluid .1 will be defined by point A and the corresponding shear velocity Dl whereas the behaviour of the Newtonian fluid 2 is defined by point A' and the corresponding shear velocity D~. The following equation is seen to hold /~ ~ tg a < #o~ ~ tg a~
[8.32]
Under the action of tangential tension r~, the apparent viscosity of the pseudoplastic fluid #o~ is higher than the viscosity of the Newtonian fluid #, i.e. for r~ the Newtonian fluid flows better than the pseudoplastic one. On further increasing the tangential tension an opposite situation may obtain" at a sufficiently high tangential tension r2 the pseudoplastic fluid flows better than the Newtonian one. The apparent viscosity of pseudoplastic fluids decreases with increasing r (tg a2 < tg a~). Another major group of non-Newtonian fluids is represented by plastic or Bighamian fluids in which the shear velocity increases when the initial ten-
263
ptastic fluid ,.;., (,/I
u
o'I
I/I
(:I,I r .4..._, .aG: G: I:I .,i-.
-
!i~gC~ltu de > sheor vetocify D(s -I)
Fig. 8.13 Rheogram of a plastic fluid
sion attains the value r0 > 0 (Fig. 8.13). When the fluid in the vicinity of an immobile wall is subjected to a tangential tension r < r0 it retains its resting condition or flows with a flat velocity profile, i.e. at a zero shear velocity. Among these fluids are concentrated industrial and waste sludges, and paste-like suspensions of chalk and lime. Less common are dilatant fluids which exhibit a behaviour opposite to that of pseudoplastic ones. Their apparent viscosity rises with increasing tangential tension. Figure 8.14 compares the rheograms of a dilatant fluid 1 and a Newtonian fluid 2. The same consideration as with pseudoplastic fluids leads to the conclusion that at lower values of tangential tension r~ the dilatant fluid 1 can flow better than the Newtonian fluid 2 whereas at high values of the tangential tension r2 the opposite may hold true. di[afant fluid 1
..-... 'o'1
I
..._..
gl Or) OJ
t.. ,4I/1 ...., ,4-r--
QJ
r
tr
..I--
--,-- shear vetocity D (s-1)
Fig. 8.14 Rheogram of a dilatant fluid
264
Rheograms of pseudoplastic and dilatant fluids sometimes exhibit a nonzero value of initial tension r0 and can therefore be viewed as plastic fluids with a nonlinear dependence of r on D. The above types of fluids (Newtonian, pseudoplastic, plastic and dilatant) have one property in common, namely the time independence of the tangential tension on the shear velocity D. However, this independence is a limit case because a time dependence of r / D is a frequently encountered phenomenon.
8.5
MIXING
Mixing is the blending of two or more different substances which aims at obtaining a homogeneous mixture. The term also denotes the maintenance of a given medium in an intensive motion which aids in mass or heat transfer or in the formation of a suspension. The method of choice involves achieving a high level of turbulence which ensures efficient transfer of heat and mass in a mixing device. A measure of mixing efficiency is the degree of homogeneity I defined by the formula I = 1 ---1 ~ n
i=1
C~--Ck
[8.33]
CO--Ok
For a given time the degree of homogeneity is determined by simultaneous sampling at n representative points in the mixing vessel, determining the concentrations of the component q under study and inserting the values into equation [8.33], where Cois the initial and Ckthe final concentration of the component. Mixing intensity is a frequently used, but hitherto imprecisely defined, term because different definitions of mixing intensities usually refer to a particular mixing system and a particular process. Three types of mixing are basically used in microbial processes: mechanical, pneumatic and hydraulic mixing. Mechanical mixing is carried out by mechanical mixers or impellers. Impellers impart energy to the fluid either by the action of blades on the fluid or due to tangential friction arising when the fluid comes into contact with the impeller surface. Mechanical impellers can be classified by a number of criteria such as the revolution velocity, direction of flow, and others. In devices using pneumatic mixing air is brought into the vessel from the bottom and it is distributed in the fluid in the form of bubbles. The bubbles rise and therefore bring along parts of the fluid. The contents of the vessel are
265
thus mixed and blended. Depending on the type of gas distribution the fluid flow in the vessel can be either unorganized or directed. Hydraulic mixing is based on a circulation of the fluid by a pump. The inlet and outlet tubings should be as far apart as possible. The outlet tubing ends in a nozzle immersed in the fluid. The conically shaped stream coming out of the nozzle displaces and carries along the ambient fluid (Fig. 8.15a).
0J
E
|
\
O .m
_~ ) .
N N 0 r
.
.
.
,1 '
I
r
Fig. 8.15 O u t f l o w from an i m m e r s e d nozzle with a circular cross-section (a) flow regions: 1 -- flow core, 2 - - mixing zone, 3 -- zone of rest; (b) streamline and longitudinal velocity rate profiles
Vortices are formed at the rim of the stream; the fluid in the vessel is gradually brought into accelerated motion and is thereby mixed (Fig. 8.15b).
8.5.1
M e c h a n i c a l mixing - - impellers
Mechanical impellers can in principle be divided to high-speed and lowspeed ones. The circumferential speed of low-speed impellers varies in the range vc c (0.5 ; 1.5) m-~ s-~, revolution frequency n c (20; 60) min -~. The impeller diameter is near the diameter of the stirred vessel D; this prevents both the formation of incrustations on the walls and local overheating. Low-speed impellers are used for blending highly viscous fluids. Figure 8.16 illustrates the basic types of low-speed impellers. Their dispersion efficiency is very low and their use in the microbial industry is therefore limited, although they have been tested for culturing filamentous microorganisms (Steel and Maxon, 1966). Among low-speed impellers belong also spiral impellers which operate at higher revolution frequencies (n c (30; 250) min-~). They are suitable for
266
blending of highly viscous fluids; fluid circulation is achieved at very low power inputs because these impellers generate a low level of turbulence. Lowspeed impellers include also blade impellers which usually consist of two right-angle or skewed blades with a diameter d ~ (0.5; 0.8) D. Their shortcoming is a low mixing intensity and a large proportion of the tangential component of fluid circulation.
i.
i!, ii a
b
l '.-lJ c
: d
Fig. 8.16 Low-speed impellers (a) horseshoe, (b) comb-shaped, (c) flame impellers, (d) flame impellers with blades
Circulation of the fluid during mixing by high-speed impellers depends on the type of the impeller used and on the presence or absence of baffles. High-speed impellers can be divided into radial, axial and disc types. A typical representative of radial impellers is the turbine impeller or Rushton turbine impeller fitted with a separating disc with six right-angle blades. Its diameter is usually d ~ (0.25; 0.33) D and revolution frequency n is chosen so as to ensure a circumferential speed Vc in the interval vc (3; 9) m s -~. Turbine impellers can be used in a broad range of viscosities of culture fluids (# ~ ( 10-3, 20) kg m-~s-t). In large-volume bioreactors the highest applicable viscosity value is somewhat lower. The turbine impeller has an excellent dispersion efficiency and has found a wide application in microbial industry. The dispersion efficiency and the level of turbulence generated by the impeller increases with decreasing impeller diameter while the circulation efficiency decreases. Turbine impellers with a separating disc can have straight, slanting or curved blades (Fig. 8.17). A representative of axial impellers is the propeller impeller which has the shape of a ship's propeller. Its dispersion efficiency is low but its circulation efficiency is high. For this reason it is sometimes used together with a turbine impeller which serves as disperser. Propeller impellers can be used in a broad range of viscosities (# ~ (10-3; 10) kg m-is -l) and their revolution frequency is chosen so as to ensure a circumferential speed in the interval Vc
267
(6; 15) m -~ s -~. The same function as the propeller impeller is fulfilled by a blade impeller with slanted blades. It is cheaper but has a lower pumping efficiency. The diameter of a blade impeller with slanted blades corresponds to that of a propeller impeller. Disc impellers are shaped like rotating discs and they impart energy to the fluid via viscous friction. They generate considerable shear tensions (high shear velocity gradients). They are therefore sometimes used in microbial industry as dispersers and foam breakers. They operate at high circumferential speeds (Vc c (5; 35) m -~ s -~) and cause only slight circulation of the fluid. Among these impellers are" a) bare disc, b) modified disc in which the disc rim is fabricated as in a circular saw, e) modified blade impeller with blade heights tapering off towards the impeller circumference, d) modified turbine impeller with a toothed ring at the rim. The self-suction impeller is firmly attached to a suction cylinder. Rotation of the impeller, which can be either a closed turbine element or a mere curved tube, creates a negative pressure which drives air, foam and fluid from the space above the fluid surface. The advantage of self-suction impellers is in
a
b
c
Fig. 8.17 Turbine impellers (a) straight blades, (b) slanting blades, (c) curved blades
that they obviate air supply otherwise necessary for air distribution, and foam is removed by back suction into the fluid. However, the rate of air suction is not very high and the fluid level in the vessel has to be kept at a constant height. Schematics of a self-suction impeller consisting of a rotating cylinder fitted in its upper part with openings are shown in Fig. 8.18 (K~ov/tk, Salvet and Sikyta, 1984). The fluid passes gradually through three working spaces that fill up the whole volume of the mixed vessel.This ensures a large contact area
268
and avoids the generation of large shear velocities. The impeller is suitable also for blending highly viscous fluids. In contrast to rotating impellers, vibrating impellers execute an axial motion. The impeller has the shape of discs fitted with openings all over their area. These are positioned on an oscillating shaft. The oscillations are produced by an electromagnet. In the upper part of the disc the openings form cones tapering upwards which give rise to directed fluid flow in the vessel. The oscillation amplitude is 0.5 to 3 mm, the frequency being about 50 Hz.
7
i i
2
6
Fig. 8.18 S c h e m e of a self-suction i m p e l l e r with a r o t a t i n g c y l i n d e r 1 - - rotor, 2 - - r o t o r b o t t o m , 3 - - o p e n i n g in r o t o r b o t t o m , 4 - - r o t o r shaft, 5 - - p a r a b o l o i d o f a rising fluid, 6 - - vessel, 7 drive, 8 r o t o r extension, 9 - o p e n i n g s , 1 0 - s u p p o r t s
The impeller is easy to mount in the vessel because it has a simple seal. It has a low power input and its operation does not produce too much foam. On the other hand, its use is limited to bioreactors with relatively small volumes.
8.5.2
Oxygen supply underneath the impeller
In small mixed vessels, gas is usually brought in via an axially positioned tube underneath the impeller. Impellers of smaller diameter have a high revolution frequency and a very high dispersion efficiency. This efficiency decreases with increasing impeller diameter, i.e. with decreasing revolution frequency. For this reason, gas supply in large volume devices is therefore ensured by a distribution ring with a diameter equal to, or slightly larger than, the impeller diameter d. The number and diameter of distributor openings can be determined from the equation (Leibson et al., 1956)
269
~Ps Ret = N~dt/,z~'
Ret c (500; 2500)
[8.341
where ~ is the gas volume flow, N~ -- number of nozzles, a~ -- nozzle diameter, s - - i n d e x denoting the liquid. The diameter of bubbles in the close vicinity of nozzles is given by the equation (Lehrer, 1971) a~ = 0.8205
(Vg)04 ~
[8.35]
At the same time the condition a~ =< 0.75 X~ has to hold true; Xt is the distance between two neighbouring openings on the distribution ring. When this condition is not fulfilled it is necessary to insert into equation [8.35] an effective number of openings N~,ef 0.75 ( U t - 1) Xt Nt,e f --
8.5.3
dt
+
1
[8.36]
Dimensionless criteria and geometrical similarity
Application of the theory of similarity to the dimensionless forms of differential equations describing fluid flow and subsequent modification of these equations has yielded the following dimensionless criteria characterizing the relations in the mixing vessel"
L Reynolds criterion for mixing ReM ReM- ndZp It
[8.37]
where n is the impeller revolution frequency, d - impeller diameter, p - specific weight of the fluid batch, ~ t - dynamic viscosity. Calculation of the Reynolds criterion for mixing of non-Newtonian fluids involves the computation of the mean shear velocity (DM) value for the given impeller revolution frequency (n) in the stirred vessel according to the equation (Metzner and Taylor, 1960) DM = 11.5 n
[8.38]
270
This correlation holds for d/D < 0.6 and m > 1. The apparent viscosity po corresponding to the calculated value DM is obtained from the rheogram of the stirred fluid and is inserted into equation [8.37].
II. Euler criterion for mixing EUM P
EuM =
n3dSp
[8.39]
where P is impeller power input. The Euler criterion describes the dimensionless impeller power input.
IlL Fround criterion for mixing FrM FrM =
nZd g
[8.40]
represents the ratio of inertial forces to gravitational forces. It is used for describing processes in which gravitational forces play an important role.
I
t
[3' r
u -c L I'
J
Fig. 8.19 Geometrical similarity of turbine impellers (a) and stirred vessels (b)
271
IV. Flow number Kp
V nd 3
Kp-
[8.41]
where V is the volume flow of the stirred fluid. A number of values of Kp have been published for turbine impellers, most of them in the interval Kp ~ (0.5; 0.8). V. Flow number for aeration Kpg
This parameter is defined analogously to Kp"
Vg Kpg-
[8.421
nd 3
where I28 is the gas flow supplied underneath the impeller. It is advantageous to introduce the term geometric similarity of two systems (impellers or stirred vessels) for cases when one of the systems can be transformed into the other by a simple multiplication of all dimensions by a proportionality constant. Figure 8.19a illustrates geometrically similar turI 1 oo0
curve I. .
.
I I
.curve.
.
.
curve 3 .
.
curve
I
I
[
2
-t
t
e4
I~
I
C
~
l
z%
100 50
" 9 #z LLI
___B:O__
N t=EUM - , \
10
5
~'
1>,-!
l
I
1 _ 1 d 4 np= 0
I
X\.~
r-
+
•
-
.
o~
d
5
1 1 d 4 np=4 -
b= 0
''
~--I
'I 1
.
h 1 d 5 b = 1 D 10
' 1
h d b d
. .
~,
I
1 5 1 10
-
''
--;4"-'::::3
.
'
10 2 ~--,,-
I
"
10 3
--
F
I
I
h _ 1 d 8 b I d 12
rip= 4
~
~-~"
I-- ~ ~.,~_.---- + - - - ' ~ " T - -
--~
-'~I 10
i
. . . . . . . . . . . . .
~.
I
1
D
\ .
h
F
._..1 10 4
.....
--t~
I
h 1
1
np=4
B:Oj,:Eu..~ .....2'4_...
e=
L
-=
1Lto(:JR~
40
10 5
Re M = nd 2Q
Fig. 8.20 Power input characteristics of turbine impellers placed in a vessel with dimensions D = 3d, H - D and H 2 = d (Rushton, Costich and Everett, 1950)
272
bine impellers and Fig. 8.19b geometrically similar stirred vessels, including commonly used symbols for individual dimensions.
Power input characteristics Application of dimensionless criteria makes it possible to describe some phenomena occurring during mixing, independent of the size of the stirrer or impeller; the only necessary prerequisite is geometric similarity. Power input characteristics for turbine impellers with and without baffles are given in Fig. 8.20. For ReM < 10 the mixing is in the laminar range whereas for ReM e <10; 5000) it is in the transient region. For ReM > 5000 the mixing is in the turbulent region with a constant value of EuM. This region is also called the automodulation range. When ReM is expressed as shown above, the power input
I
N
\
I
I I
o-
I
z ~% 10 II
E
Ill
2
1
I
I
I
" ~'1, ' t ' -
I I 1
1
~---
"1~
o o o o A^
A~
j
_1
;,,..,. I
'11 ""J
o
illl
10
lOO
Re M =
1000
'1
ndZq
Fig. 8.21 Power input characteristics of a turbine impeller during mixing of non-Newtonian fluids for d~ 6 (0.2" 1.5> and/1o 6 (0.1" 18> kg m-~s -~ (Metzner et aL, 1961). Different symbols denote different experiental runs
characteristic under these conditions holds also for the mixing of non-Newtonian fluids. Figure 8.21 shows that for ReM ~ ( 10; 300) the power input is lowered as compared with Newtonian fluids due to the extension of the laminar region up to ReM = 30. The impeller power input in an aerated system is determined
273
from appropriate graphs or correlations. Figure 8.22 shows a typical decrease in the power input of a turbine impeller during aeration of Newtonian fluidgas systems. These results can also be used for aerated non-Newtonian systems. A frequently recommended correlation has the form
PZnd3 )0.45 ~56
Pg : 0.706
[8.43]
and holds for p c (800; 1650) kg m -3 and # ~ (0.0009; 0.1) kg m-' s -~.
1.0 0.9 0.8
o Z ........
c~
Z
0.7
o'~ o
0.6
E1E FT'~~+ ] N ' S~T ~
0.5
_
0.4
_
0.3
0
t b
~
+II [3 9
+
oA
o
[] Z~
a
oy
I 0.01
I 0.03
1 0.05
I 0.07
0 A
A o
1 0.09
1 0.11
Vg / nd 3
Fig. 8.22 Decrease in turbine impeller power input during aeration of Newtonian fluids (Calderbank and Moo-Young, 1961). Different symbols denote different experimental runs
8.5.4
Bubble holdup in an aerated vessel
Numerous data and correlations have been published on the problem of determining the mean bubble diameter dBM, gas holdup q)and interface area in a stirred vessel (Tsao and Lee, 1977; Blanch, 1979; Lee and Luk, 1983). However, they have for the most part been limited to the given geometry of a small-volume vessel and to physical properties of pure Newtonian liquids such as water or salt solutions. The absolute purity of the fluids is crucial because even a small addition of a surface active agent substantially affects the surface tension and thereby also the bubble size. Utmost care should be exercised when these correlations are extrapolated to actual devices because they
274
were derived from measurements in pure fluid-gas systems; even in these systems deviations of the order of tens of per cent are often found. The gas holdup in a stirred vessel 9 is defined as
(i):Vg V- v
[8.44]
where Vg is culture volume during aeration, V -- liquid phase volume. These values can be estimated from various complex correlations (Calderbank, 1958) which hold for pure and low-viscosity fluids. Determination of a mean bubble diameter dBM is subject to analogous limitations. The correlation given by Calderbank (1958) can be used for fluids approximating water -0.4
dBM = 4.15
ps0.2 o-O.6q~0.5 + 0.0009
[8.45]
where Ps is the density of the stirred fluid. However, the value dBM calculated in this way cannot be used in systems with different physical properties because of the different bubble coalescence in the culture. The range of bubble sizes is broader in aerated non-Newtonian fluids, especially in cultures of filamentous microorganisms, because very small bubbles are trapped among the filaments and larger bubbles are simultaneously formed by increased coalescence (Yoshida, 1982). The following correlation (Calderbank, 1958) is often recommended for calculation of interface area and total bubble surface area a in a stirred vessel referred to the volume of the aerated fluid 0"4.-.0 2
a = 1.44 ( Pg / V) p~ 0-0.6
@~
[8.46]
which is subject to the above limitations.
8.5.5
Flow pattern in a stirred vessel during aeration
Let us consider flow patterns in a stirred vessel with baffles (Fig. 8.23A). Unless air is brought underneath the impeller c via tubing e, two circulation loops d are formed in the vessel. The stream of fluid directed from the impeller towards the vessel wall carries along large vortices generated by the impeller. In this region the turbulence attains the highest value and the conditions for mass transfer are the best. The impact of the fluid against the wall gives
275 rise to pseudoturbulences and the fluid circulates in the vessel with a substantially lower level of turbulence. For this reason a stirred vessel with a turbine impeller is sometimes modelled in a simplified m a n n e r as an ideal mixer in which perfect blending is achieved immediately, with a circulation zone in which there is almost no heat and mass transfer. The highest velocities of the fluid are attained in the stream from the rotating impeller and along the walls.
Fig. 8.23 Flow patterns in stirred vessels during aeration a -- impeller axis. b -- surface of fluid, c - impeller, d - circulation loop, e - gas inlet, f - - baffle, g - gas bubbles; for A to E see the text
At other points in the vessel the flow velocities are lower and attain m i n i m u m values in the centres of circulation loops. It can be readily seen from Fig. 8.23A why the use of n turbine impellers on a c o m m o n shaft does not bring a power input equal to an n-multiple of a single-impeller input. The fluid flowing in a single-impeller vessel towards the centre of the vessel is retarded at the bottom by friction, whereas at the surface, mechanical energy is consumed and e x p e n d e d for n o n u n i f o r m ebbing of the fluid. No such losses occur in the space between two impellers; in fact, the streams due to circulation loops from the two impellers mutually accelerate each other. The energy re-
276
quired for return of the fluid from the wall towards the centre is also lower at the point of contact of the two streams than at any other point in the vessel. The total power input P2 in the case of two impellers is therefore equal to only = 1.414 times the power input of a single impeller Pl. In general we may write P,, = P, (0.586 + 0.414 n)
[8.471
When a small quantity of gas is fed underneath the impeller (Fig. 8.23B) it becomes perfectly dispersed, small bubbles follow fluid particles continuously and are even carried along in the upper circulation loop back towards the impeller. Small bubbles are essentially unaffected by the centrifugal force resulting from fluid rotation in the vessel; at higher gas flow rates this force (Fig. 8.23 C) causes a displacement of bubbles towards the centre of the vessel owing to the pressure of fluid of a higher density. Another circulation loop d with an opposite flow direction is consequently formed at the liquid surface. With increasing gas flow the impeller forms larger bubbles which are rapidly decelerated by the fluid and are then sucked back into the impeller (Fig. 8.23D). The transfer of other bubbles to the centre of the vessel is then more conspicuous and the circulation loop with the opposite flow direction grows. The fluid flow velocity is so low that practically no gas is carried along into the lower circulation loop. Further increase in gas flow causes choking of the impeller (Fig. 8.23 E) and the gas rises to the surface. The only motion imparted to the fluid is by rising bubbles which carry the fluid along. A single circulation loop exists in the vessel; the impeller has no effect on mass transfer and the rate of mass transfer in a vessel with a choked impeller is therefore very low. Efficient aeration aims at attaining the largest possible homogeneity of bubbles in the stirred fluid; the most suitable circumstances complying with this requirement are given in Fig. 8.23B and 8.23 C. For the majority of situations the gas flow (Fig. 8.23 B) will not be sufficient and the flow pattern in an appropriately aerated vessel will approach that shown in Fig. 8.23 C. The situation illustrated in Fig. 8.23 D is no longer appropriate because of the low dispersion efficiency of the impeller and a shortage of dissolved gas in the lower circulation loop.
8.5.6
Homogenization time
The time of homogenization T is defined as the time necessary for a perfect blending of the culture. The simplest method for its determination consists in adding a tracer compound into the mixing device and monitoring the time course of concentration changes. Depending on the type of the tracer
277
compound used, its momentary concentration at a given representative point is determined conductometrically, thermically or optically. The time of homogenization is given by the equation T=
CV V 1)" = C V"n'~"'S-~,bu,
= CTp
[8.48]
where V is the volume of the stirred vessel, I? volume flow of the stirred fluid through the impeller, Tp-- mean time of primary circulation, i.e. mean interval between two passages of a fluid particle through the impeller region. A value of C = 1 is expected for an ideal mixer (a single passage through the impeller region suffices for satisfactory.homogenization) whereas C = 5 is recommended for practical situations. Mixing with turbine impellers in a highly turbulent region (ReM = 50 000) can be defined by the correlation (Norwood and Metzner, 1960) T = 4.1
HD 3
(n4dli
),/,
[8.491
where His the height of fluid in the bioreactor.
8.5.7
Scale-up
The calculation of some parameters of the mixing process (e.g. impeller power input in an aerated and nonaerated system and in part also the time of homogenization) poses no serious problems during scale-up because these parameters can be described (for geometrically similar systems) by numerical values of dimensionless criteria. However, the hydrodynamic similarity achieved during the scale-up does not measure up to the geometric similarity because of the impossibility of maintaining the same values of all dimensionless criteria. The problems of scale-up are the most marked in aerobic microbial processes where the impeller fulfills two functions -- a pump for culture circulation and gas disperser. The working conditions of the impeller are therefore subject to numerous constraints (Einsele, 1978). Certain correlations exist for the immediate vicinity of the impeller (e.g. for power input in an aerated system or for impeller choking) but not for the whole bioreactor volume. These problems have to be addressed with regard to the local values of parameters in the whole volume, obtained by studying suitable mathematical models (Miura, 1976).
278
A number of criteria are recommended for microbial process scale-up" a constant value of the specific power input P/V, constant value of Reynolds criterion ReM, constant value of the circumferential speed of the impeller ltdn, a constant value of the term ndD -~ and others. However, none of the criteria are universal and the use of any of them depends on the particular scaled-up process (Oldshue, 1983). Scale-up often involves a change in the geometry of the system, which further complicates matters. Moreover, most of available data have been acquired by measurements on laboratory devices. Data from production-scale devices are rare and so are studies addressing their relation to data obtained on laboratory units for the same process. The scale-up of a microbial process is therefore still more of an art than an exact procedure.
10
o~
o
P / V " V "~
E >
0
1.0
0
_
0
0,1
0.1
1, 1 -----,--
I 10
~
1 100
"1000
V(m 3)
Fig. 8.24 Relationship between specific power input and bioreactor volume
Einsele (1976) made an attempt to compare data from small-scale and large-scale bioreactors for processes with both unicellular and filamentous microorganisms. His work implies that the specific power input decreases with increasing bioreactor size irrespective of the type of the process (Fig. 8.24). The values of specific power input for a nonaerated system are typically in the interval P / V e (1000; 3000) W m -3 and the following relationship holds P - - ~ V-~ V
[8.50]
Most production units work with relative impeller sizes d/D e (0.3; 0.45) and the height of the fluid in bioreactors is equal to twice the impeller diame-
279 1
1
I
I 10
I 100
10 Re = qnd2.... V 0.35
"2
"T
E "-"
1.0
oi
0,1 0,1
I 1 .,.,,,.
V
1000
[m3~
Fig. 8.25 Relationship between Reynolds criterion and bioreactor volume
ter H = 2D. Two turbine impellers are placed, as a rule, on a single shaft. The value of the Reynolds criterion ReM increases with increasing size of the device according to the formula
ReM ~ 1/0.35
[8.51]
(see Fig. 8.25). The times of homogenization increase approximately with the same exponent T-~ 1/0.3 I
I
[8.52]
I
1 000 T '-'V ~
.--... th I--
100
10
--
0.1
o
I
1
1
10 --4-
V (m 3)
!
100
ooo
Fig. 8.26 Relationship between the period of homogenization and bioreactor volume
280
and in large bioreactors they reach values of up to 100 s -~ (Fig. 8.26). On the other hand, the circumferential speed of the impeller remains constant irrespective of the size of the device and the type of microorganism (i.e. the rheological properties of the fluid; Fig. 8.27) ~tnd ~ (5; 6) m-' s-'
[8.531
The working conditions during scale-up should therefore be chosen according to this equation. Einsele (1976) found no production process with an oxygen consumption higher than No: = 8.3 mol-lm -3.
I
I
I
100
~T
E
"13 e-
10 o o _.__.____.--~-
ll >
o
0.1
I
1
o
I
10 V (m 3 )
!
100
1 000
Fig. 8.27 Relationship between the circumferential speed of impeller and bioreactor volume
REFERENCES Aiba, S., Humphrey, A. E., Millis, N. F. (1973) Biochemical Engineering, Tokyo. Banks, G. T. (1977) Aeration of molds and streptomycete culture fluids. In: Topics in Enzyme and Fermentation Biotechnology 1, Chichester. Bartholomew, W. H. (1960) Adv. Appl. Microbiol. 2, 289. Bell, G. H., Gallo, M. (1971) Process Biochem. 6(4), 443. Blanch, H. W. (1979) Ann. Rep. Ferm. Proc. 3, 47. Calderbank, P. H. (1958) Trans. Inst. Chem. Engrs. 37, 443. Calderbank, P. H., Moo-Young, M. B. (1961) Trans. Inst. Chem. Engrs. 39, 337. Charles, M. (1978) Adv. Biochem. Eng. 8, 1. Cooper, C. M., Fernstrom, G. A., Miller, S. A. (1944) Ind. Eng. Chem. 36, 504. Deindoerfer, F. H., Gaden, E. L. (1955) Appl. Microbiol. 3, 253. Einsele, A. (1976) Scaling-up of Bioreactors. 5th Int. Ferm. Symp., Berlin.
281 Einsele, A. (1978) Process Biochem. 13(7), 13. Finn, R. K. (1964) Bact. Rev. 18, 254. Finn, R. K. (1967) Biochem. Biol. Eng. Sci. 1, 69. Kargi, F., Moo-Young, M. (1985) Transport phenomena in bioprocesses. In: Comprehensive Biotechnology 2, New York. K~ov~.k, P., Salvet, M., Sikyta, B. (1984) Biotechnol. Lett. 6, 307. Le Duy, A., Marsan, A., Coupal, B. (1974) Biotechnol. Bioeng. 16, 61. Lee, Y. H., Luk, S. (1983) Ann. Rep. Ferm. Proc. 6, 101. Lehrer, I. H. (1971) I.E.C. Proc. Des. Develop. 10, 37. Leibson, I., Holcomb, E. G., Cacoso, A. G., Jacmic, J. J. (1956) AIChE Journal 2, 296. Metzner, A. B., Taylor, J. S. (1960) AIChE Journal 6, 109. Metzner, A. B., Feehs, R. H., Rmos, H. L., Otto, R. E., Tuthill, J. D. (1961) AIChE Journal7, 3. Miura, Y. (1976) Adv. Biochem. Eng. 4, 3. Norwood, K. W., Metzner, A. B. (1960) AIChE Journal 6, 432. Oldshue, J. Y. (1983) Ann. Rep. Ferm. Proc. 6, 75. Phillips, H. D., Johnson, M. J. (1961) J. Biochem. Microbiol. Technol. Eng. 3, 277. Richards, J. W. (1961) Progr. Ind. Microbiol. 3, 143. Robinson, C. W., Wilke, C. R. (1973) Biotechnol. Bioeng. 15, 755. Roels, J. A., Van Den Berg, J., Voncken, R. (1974) Biotechnol. Bioeng. 16, 181. Rushton, J. H., Costich, E. W., Everett, H. J. (1950) Chem. Eng. Progr. 49, 467. Stanbury, P. F., Whitaker, A. (1986) Principles of Fermentation Technology, Oxford. Steel, R., Maxon, W. (1962) Biotechnol. Bioeng. 4, 231. Steel, R., Maxon, W. (1966) Biotechnol. Bioeng. 8, 109. Taguchi, H., Imanaka, T., Teramoto, S., Takatsu, M., Sato, M. (1968) J. Ferm. Technol. 44, 823. Tsao, G. T., Lee, Y. H. (1977) Ann. Rep. Ferm. Proc. 1, 115. Tuffile, C. M., Pinho, F. (1970) Biotechnol. Bioeng. 12, 849. Wang, D. I. C., Cooney, C. L., Demain, A. L., Dunnill, P., Humphrey, A. E., Lilly, M. D. (1979) Fermentation and Enzyme Technology, New York. Yoshida, F. (1982) Ann. Rep. Ferm. Proc. 5, 1.
282
MONITORING, CONTROL AND REGULATION OF MICROBIAL PROCESSES
Product yields and scale-up from laboratory to production scale are considerably affected by the appropriate measurement, control and regulation of microbial processes. Whereas laboratory trials include measurement, control and regulation of a number of physical, chemical and biological factors, production-scale processes involve the regulation of only those processes which are immediately related to the efficient functioning of a given technological process. The costs of these operations are high despite the advances that have been achieved in measurement and regulation techniques. To ensure an efficient regulation of microbial processes it is necessary" a) to carry out cultivations in fully instrumentalized systems, b) to correlate the results with known data on cell metabolism and metabolic regulations, c) to make use of the resulting knowledge to elaborate optimal regulation conditions including continuous monitoring, analysis and feedback regulation of the culture medium. Devices for satisfactorily functioning instrumentalized cultivations may include a number of systems ranging from relatively simple units performing simple measurements via a few mechanized sensors, to systems with automated measurement connected on-line to a computer. The choice of a suitable measuring method and regulation system depends on a number of factors which are summarized in Fig. 9.1. The type of microorganism and composition of nutrient medium affect the selection of methods for measurement of cell matter concentration, growth and proliferation rate, type of substrate, manner of substrate addition during culture and measurement of its concentration, type of product, and complexity of analytical assays as dependent on the product concentration in the culture. Devices for measurement and regulation of processes taking place under non-aseptic conditions are substantially simpler than devices for processes that require the maintenance of strictly aseptic conditions. Measuring processes and regulation of physical, chemical and biological factors in small cultivation units differ from those in large-scale devices. With the exception of continuous cultivations, common automatic analyzers cannot be used in
283 unicellular multicellular
Type of microorganism
filamentous clear medium Medium composition suspension medium solid liquid
Substrate
gaseous biomass primary metabolite
Product
secondary metabolite sterile Process type
I nonsterile laboratory
Production device scale
pilot plant production scale
Fig. 9.1 Factors affecting the choice of measuring method and regulating system
small devices because of the considerable culture volume taken during sampiing. This leads to the introduction of suitable measuring electrodes placed in situ in the culture. Large bioreactors are usually equipped with several identical sensors located at different points in the bioreactor. Sensors can be classified according to: a) the location of the sensor -- in the bioreactor, on the bioreactor or outside the bioreactor (on a bypass), b) the type of data acquisition -- discontinuous, continuous, c) ambient factors to be measured -- physical, chemical, biological, molecular biological, d) the type of data acquired -- primary (direct), or secondary (derived).
9.1
METHODS AND DEVICES
The measurement and regulation of physical environmental factors are readily carried out using sensors which are employed also in other industrial branches. Their installation should be performed so as to eliminate the possibility of contamination of the culture from the environment. Chemical factors are determined by analytical methods making use of automatic analyzers, ion-selective electrodes, enzyme electrodes, enzyme thermistors, semiconduc-
284
tor gas sensors, catalytic sensors, calorimetric, spectrophotometric and spectrometric methods, gas chromatography and nuclear magnetic resonance. Methods specific for microbial processes include biological and molecular biological techniques for determining concentration and composition of cell matter, rate of growth and proliferation, homogeneity of populations and cell components. Some of the methods make possible the continuous measurement of the quantity in question (on-line), others permit measurement only in collected samples.
9.1.1
Automatic analyzers
Automatic analyzers can be single-purpose or multi-purpose. Single-purpose automatic analyzers are used, for example, for determining the elemental composition of cell matter, individual substrates, intermediates and products. Multi-purpose automatic analyzers are usually modular and their basic building units (modules) are combined to provide sets suitable for certain types of assays. Among the most widely used are Autoanalyser-type automatic analyzers manufactured by Technicon. The main parts of these analyzers are" a) a sample collector for off-line analysis which is not used for on-line analysis because the culture is continuously withdrawn from the culture device; b) a peristaltic pump fitted with a set of tubings of suitable diameters (flow rates from 0.015 to 3.9 ml min -~) that serve for pumping necessary stock solutions from their reservoirs and for pumping the sample. The sample is conducted along the length of the sampling tube as a distinct fluid column into which tiny air (or nitrogen) bubbles are introduced which separate the column into short regular segments. These bubbles prevent the dilution of the solution by the water which is drawn into the tube by suction at intervals to separate individual sample columns. Sometimes microorganisms or other solid particles are to be filtered off before the sample enters the system; this is usually done by a continuous filter consisting of a paper strip unwinding continuously from a stock roll. Each point of junction of two solutions in the tubing is followed by a glass stirring spiral. When the sample solution contains impurities that could disturb the determination it is first dialyzed. If, for instance, a colour reaction is to be developed by heating, the experimental setup contains a thermostated bath with adjustable constant temperature. The solution then passes into the measuring device (colorimeter, spectrophotometer, fluorimeter, flame photometer, etc.) via a flow-through cuvette after being degassed. The measured data are either continuously recorded on a line recorder (when the culture is collected direct from the bioreactor) or are stored after analogue/digital transduction. As during their pas-
285 sage through the system standard samples are subjected to exactly the same interventions as experimental samples, it is not necessary to carry out colour reactions or dialysis to the complete end.
9.1.2
Ion-selective electrodes (ISEs)
Ion selective electrodes (ISEs) are systems consisting of an electrochemical membrane with different permeability for different ions, which separates two electrolytes. The membrane is basically a layer of a solid electrolyte or an electrolyte solution in a solvent immiscible with water. The membrane is in contact with an electrolyte solution on one or both sides. ISEs often contain an internal reference electrode which is sometimes replaced by just a metal contact or by an insulator and semiconductor layer. ISEs permit highly sensitive, rapid, exact and nondestructive measurement of ion activities or concentrations in different media (Kell, 1980). Apart from direct measurements of ion activities or concentrations they can serve, with the use of a calibration curve, for continuous monitoring of concentration changes, as elements for control of dosage of agents or as very accurate indicator electrodes in potentiometric titrations. ISEs have numerous advantages for practical use: they do not affect the tested solution, are mobile, suitable for direct determinations as well as titration sensors, and cost effective. Their major advantage in application in microbial processes is the measurement in situ without sample collection. This makes them suitable also for measurements in small volumes of culture broths. Certain problems are posed by their sterilization, application in media containing suspended particles, and surface growth, especially during cultivation of filamentous microorganisms.
9.1.3
Enzyme electrodes
Problems may arise in the determination of cell components, substrates and metabolites in culture broths by, for instance, spectrophotometric methods when the tested fluids are not transparent. In these cases electrochemical determination is the method of choice. A number of biological sensors make use of reactions catalyzed by enzymes which are highly specific (Guilbault, 1976; Satoh, Karube and Suzuki, 1977; Barker and Somers, 1978). Microbial enzymes and cells are used most often as biocatalysts although animal and plant enzymes, cells and tissues are also used for the purpose (Rechnitz, Arnold and Meyerhoff, 1979; Schubert, Wollenberger and Scheller, 1983). Enzyme electrodes are the most common sensors of this type. Earlier constructions of enzyme electrodes consisted of an electrochemical sensor, a semipermeable membrane and an intermediate layer containing the enzyme.
286
The function of the system depended on the diffusion of the substrate through the membrane and on the reaction of the substrate with the enzyme. The reaction consumed or yielded a certain compound whose concentration was measured by the electrochemical sensor. The main shortcoming of these electrodes was a slow response. This led to the construction of semipermeable membranes with enzymes immobilized directly either on the surface or inside the membrane. The response of these systems is much faster. Recent developments in this field have led to the construction of biosensors containing immobilized cells, in particular microbial, instead of immobilized enzymes. These sensors can be divided into three groups (Karube and Suzuki, 1983)" a) microbial sensors consisting of immobilized cells and an oxygen electrode, i.e. sensors based on an amperometric respiration assay, b) microbial sensors consisting of immobilized cells and a fuel-cell type electrode, i.e. sensors based on amperometric assay of electroactive metabolites, c) microbial sensors consisting of immobilized cells and membrane electrodes (pH, CO2), i.e. sensors based on potentiometric determination of electroactive metabolites. As in the case of ISEs, the main advantage of biosensors is measurement without sample collection and a high specificity, while the main shortcoming is their difficult sterilization.
9.1.4
Mass spectrometry
This method is increasingly used for measuring the concentrations of some substrates and especially products in microbial processes. It has a number of advantages over other measuring methods: a) it permits the continuous measurement of samples under aseptic conditions, b) it allows a simultaneous determination of several components, c) it has a considerable selectivity and a short response time (of the order of seconds), d) the measuring device is cost effective in view of the scope of measurements, e) the device can be attached to a computer. A quadrupole mass spectrometer is especially suitable for measurements of this type. The schematics of the measuring device connected to a bioreactor are given in Fig. 9.2. Special care should be given to the selection of the membrane, which is crucial for the response time and also for the overall construction of the sampling system. The membrane should have satisfactory permea-
287 b i l i t y a n d r i g i d i t y a n d s h o u l d b e r e a d i l y s t e r i l i z e d (Fig. 9.3). I n q u a n t i t a t i v e analysis distinction should be made between the mass transfer into the evacuated space and the problems associated with the actual spectrometric meas u r e m e n t . W h e n t h e m o l a r f r a c t i o n s o f all m e a s u r e d c o m p o n e n t s in t h e bior e a c t o r a n d in t h e v a c u u m s y s t e m are i d e n t i c a l t h e p r o b l e m is r e d u c e d 5
2
[
9
6
11 ]
7
I
I
3
I!11
1
4 Fig. 9.2 Attachment of a mass spectrometer with a bioreactor (Doerner et al., 1982) 1 -- bioreactor, 2 -- safety valve, 3 -- pump, 4 -- diaphragm, 5 - mass spectrometer, 6 um pump, 7 - processor, 8 - chart recorder
vacu-
VQCUUm
2
/
1
/
/
/
4 5
6
Fig. 9.3 Sample collection by a diaphragm system under vacuum (Pung6r et al., 1980) 1 -- disc with 1/16" openings, 2 - O-ring, 3 - nuclepor, 4 - diaphragm, 5 - air inlet, 6 - sample outlet
288
to satisfactorily quantitative measurement. However, when the membrane is used for sampling, the molar fractions of the components on the two sides of the membrane will differ. Another problem which requires special attention is calibration.
9.2
PHYSICAL ENVIRONMENTAL FACTORS
Measurement and regulation of physical factors such as temperature, pressure, gas and fluid flows, volumes, etc. performed in microbial processes have much in common with analogous procedures used in other industrial branches, especially in chemical industries. On the other hand, they have their particular characteristics" ranges of measured temperatures and pressures are substantially narrower and the measured values are substantially lower than those measured in other industrial branches, due to the biological material used in these processes. Another principal difference derives from the fact that the majority of microbial processes take place under completely aseptic conditions which considerably complicates the construction of some devices (pumps, gas flow meters, etc.) and their mounting in the bioreactor or on it (shaft seals, measurement of pressure, torque or temperature). Special care must be given to construction materials, because even mere traces of heavy metals liberated during sterilization or during cultivation can negatively affect microbial growth and product formation.
9.2.1
Temperature and pressure measurement and regulation
The usual temperature range for culture of microorganisms is 20-40 ~ exceptionally 60-70 ~ in thermophilic microorganisms and 10-20 ~ in psychrophilic ones. With the exception of limit or threshold temperatures, temperature fluctuations of + 1 ~ do not affect the course of microbial processes. Temperature measurements are carried out using mercury thermometers, thermocouples, thermistors and resistance thermometers. Glass mercury thermometers are placed in a vessel with a contact fluid; this arrangement causes delay between the actual temperature in the culture and the temperature reading on the thermometer. Direct placement of the thermometer in the culture broth is not recommended because of the possible damage to the thermometer. Direct-reading thermometers are more robust and can be placed directly on the bioreactor or in a contact fluid vessel depending on the type of bioreactor sterilization used. Thermocouples are used less often because of their low
289
output voltage. Thermistors have to be frequently calibrated because their resistance increases with increasing temperature in a nonlinear way. The most common devices are resistance thermometers (Ni, Pt) which have linear characteristics and are stable. Temperature is regulated by a variety of heating elements and by the flow of a heating fluid or a coolant, usually water, through the culture device. Pressure can be measured by a Bourdon manometer placed after the bioreactor air outlet filter. The filter should not be wet as the manometer reading would then deviate from the actual pressure inside the bioreactor. Satisfactory results have also been obtained with diaphragm manometers attached to the dead end of the Bourdon tube. The diaphragm is fabricated from stainless steel and is mounted between two flanges, one of which can be placed directly on the bioreactor lid. The diaphragm is therefore easy to sterilize. The pressure readings are shown either on pointer instruments with a scale or are mediated by fluid movements in a calibrated column. 9.2.2
Gas and fluid flow
Gas flow is measured by flow meters (rotameters) or by calibrated throttle diaphragms. The accuracy of measurement by commercially available flow meters is usually _+ 2 % and the ratio of maximum to minimum flow rate is 10: 1. The instruments can be steam sterilized but they are usually mounted before the air filters owing to water condensation, which makes their sterilization unnecessary. The accuracy of the measurement depends on the pressure in the piping, which should therefore be recorded. Measurements of higher flow rates (above 10 1 min-') can be carried out using the more expensive turbine flow meters which have a higher accuracy. Calibrated throttle diaphragms are used for this purpose in industrial bioreactors. They are characterized by high measuring accuracy, independence of pressure fluctuations, possibility of remote visualization, regulation and recording of flow rate and relatively low investment and maintenance costs. Even though the diaphragm is usually mounted at the end of air waste outlet piping there is no risk of contamination of the bioreactor contents. Liquid flow is measured by different types of flow meters, by measuring the weight of the liquid and via mechanical signals of measuring or dosage devices (pumps). The devices used most often in practice are based on fluid volume measurements because they are simpler and cheaper than devices for fluid mass measuring. Fluid mass measurement is more accurate because it is independent of temperature, pressure, viscosity and other physical factors. Fluid volume measurement is usually performed by tube, diaphragm or piston pumps. Tube pumps, either rotary or linear, are the most common both in the
290
laboratory and on an industrial scale. They make it possible to change the flow rate over a very broad range either by changing the rate of tube compression or by changing the tube diameter; aseptic conditions are easy to maintain. The reproducibility of dosage depends on the quality of the tube material because it is continuously compressed to varying degree. Diaphragm pumps are suitable for lower flow rates. The fluid to be pumped is separated from the environment by a flexible diaphragm. The motion is transferred to the membrane either directly or via an auxiliary fluid with a piston. Piston pumps for sterile operation have to be encased in an auxiliary flexible cover to protect parts in direct contact with the environment from possible contamination. The basic requirement is that all dosage and measuring devices should be sterilizable, usually by steam. Dosage devices are used for addition of medium components, inoculum, solutions for pH regulation and defoaming, and in continuous cultivations.
9.2.3
Measurement of fluid volume, weight and density
Medium or culture volume in a bioreactor can be determined either by measuring the fluid height via an observation slit or, under nonaseptic conditions, by a calibrated ladder gauge. Another measuring device is a probe based on capacitance (cf. Section 9.2.4). The weight of contents of small-volume bioreactors is measured on a suitable type of commercially available scales, in large-volume bioreactors by tensometric balance with semiconductor tensometers. Weighing of bioreactors is also used in continuous cultivations for an exact maintenance of a constant culture volume in the bioreactor, especially at high flow rates and considerable culture foaming. The density of culture broth is determined simply by dividing the broth weight by its volume.
9.2.4
Regulation of foam level
Foam formation is a relatively common phenomenon during microbial processes, especially in complex media containing natural raw materials. Uncontrolled foaming can cause contamination of the culture fluid; moreover, foam spillover reduces the culture volume in the culture device. Foam removal is mostly done by mechanical foam breakers (cf. Section 6.4.1) or by addition of natural or synthetic defoamers reducing surface tension. Depending on medium composition and the type of production microorganism the cultivation gives rise to light foam with large air bubbles, or to heavy foams with
291
small air bubbles. Some authors distinguish between antifoam agents and defoamers; the former are added to nutrient media at the beginning of cultivation while the latter are supplied in the course of cultivation. Foam detection is performed by two main types of sensors based on conductance and capacitance. The conductance sensors consist of an insulated stainless steel probe functioning as an electrode while the bioreactor lid functions as earthing. When foam reaches up to the uninsulated end of the electrode, an electrically controlled unit activates a defoamer dosage setup. Some systems use two probes, one of them being placed higher, the other lower in the bioreactor. The upper probe activates defoamer dosage, the lower one cuts it off. The capacitance-based probe is a metal rod covered all over its surface by a teflon layer. These probes are more expensive but more reliable because they are less susceptible to disturbances than conductance sensors. Defoamers have to be supplied in the smallest possible amounts because they lower the rate of oxygen transfer and complicate product isolation. A lag always exists between defoamer addition and the foam subsidence so that the next defoamer dose is added with a certain time lag.
9.2.5
Measurement of impeller speed, power input and torque
The impeller speed during mixing of media depends on bioreactor size: it is in the range of 100 to 2000 min -~ and decreases with increasing bioreactor volume. The impeller drives are usually electronically controlled DC motors with thyristor speed regulation. The required impeller speed can be adjusted by a potentiometer or by an external signal, and it is measured by a contactless induction system. The induction sensor is mounted on the engine shaft and provides a direct information about engine revolutions. Measurement of impeller power input and impeller torque are important for scale-up and for determining the power consumption by the impeller. Large-volume bioreactors are equipped with wattmeters which, however, are not suitable for small-volume units because of energy losses in the seal gasket, which cause inaccuracies in the measurement. Small-scale bioreactors are therefore fitted with torsion dynamometers or extensometers. The torsion dynamometer (torque meter) gauges the torque between the engine shaft and the impeller. The shaft is placed in a freely revolving bearing fitted with a spring or a coil. The torque causes deviation of the spring or the coil, which can be read on a scale. The construction of extensometer is based on changes in the conductivity of a resistance wire caused by its longitudinal or transversal mechanical load. In contrast to torsion dynamometers, extensometers are mounted on the shaft inside the bioreactor. Four tensometers are mounted on the axle at an angle of 45* relative to the axle; at this angle the shear deformation
292
attains a maximum. Lead wires to the bridge are attached inside the hollow shaft by a system of collector rings.
9.2.6
Viscosity measurement
Viscosity measurement can be used for assessing cell growth and morphology in the culture and for indicating the physical characteristics of the culture, especially in filamentous microorganisms. Cultures of unicellular microorganisms have the properties of Newtonian fluids, whereas cultures of multicellular microorganisms are non-Newtonian fluids which change their viscosity at different shear velocities. Viscosity determination is complicated by the fact that measurements performed in bioreactors of the same volume, but with different internal equipment, yield different values; dissimilar viscosity values are also obtained at different flow rates and filament shapes (Fig. 9.4). A number of viscometer constructions operate at known shear velocities; these are mostly unsuitable
,.-..
T_._, ....... r o
S' E r-
U'} (U c. ,._ t:I Q.l tu'}
9 /
x.. 3
~sheor vetocih/(s-1)or impetter speed(s-I
Fig. 9.4 Effect of flow rate and fibre shape on viscosity values I -- late cultivation phase, 2 early cultivation phase, 3 - slope directly proportional to viscosity
for use in microbial processes because they have tubes with a small internal diameter. Another important feature is the requirement that a viscometer should permit the measurement of certain shear velocities; this is not the case with simpler viscometers which do not make it possible to distinguish between plastic and pseudoplastic fluids. The most common is the Couett viscometer which is equipped with a rotating coaxial cylinder whose shear velocity can be defined. A complicating factor which has to be taken into account is the fluctuating shear in the space between the cylinders. Kemblowski, Kristiansen and Ajayi (1985) developed a system for con-
293
tinuous measurement of culture broth viscosity in an on-line configuration, which is schematically illustrated in Fig. 9.5. The culture fluid is pumped from the bioreactor by a peristaltic pump I via a silicon rubber tube into the degasitier 2. The gas bubbles separated here are automatically or manually vented by a valve 3. The medium rises from the conical degasifier bottom into the viscometer which consists of a stainless steel cylinder 4a and a coaxial six-blade impeller 4b. The level of the fluid in the viscometer can be inspected by a glass slit 4c. The impeller shaft is fitted with a rotating labyrinth seal 4d. The air inlet tube is fitted with a valve 4e and a filter 4f The fluid level in the vis-
9
I
air in{el 4e
4d 4f
---
8
air ouflef
4c 4o
.4b 5
air o
fo bioreocfor
from bioreocfor
~
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
J
Fig. 9.5 Scheme of a continuous on-line measurement of culture fluid viscosity (Kemblowski, Kristiansen and Ajayi, 1985). For explanation see the text
cometer is kept at a constant height by another peristaltic pump 5 with a higher flow rate than the operation rate of pump 1. The measured fluid returns back into the bioreactor through a silicon rubber tube. The impeller shaft is connected to a measuring head 7 which makes it possible, together with the regulating unit 8, to use the required shaft revolution speed and measure the torque. The measured values are recorded on a line recorder 9. The measuring head and the regulation unit used in this case were Rheomat 115 (Contraves). The whole measuring system with the exception of the measuring head and the regulation unit was placed in a thermostated chamber 6.
294
The mean shear rate 7', and the mean shear tension r, can be determined in the following way 7s = K N
[9.1]
r~ = Z a
[9.2]
is the impeller revolution speed, regulation unit reading, constants dependent on the measuring system geometry. K,Z Constant K is given by the formula
where N a
-
-
-
-
1
K =
2rtA "- l
[9.3]
Ckd 3
where C, A are proportionality constants in empirical equations based on calibration, k, n -- coefficients or exponents representing rheological parameters of the calibration solution, d -- impeller diameter. Constant Z is given by the equation Z-
2rtKa Cd 3
[9.4]
where a is a constant characteristic for the measuring head.
9.3
CHEMICAL ENVIRONMENTAL FACTORS
The chemical environmental factors that are important to measure and regulate are pH, rH, concentration and partial pressure of dissolved oxygen in aerobic processes, concentration and partial pressure of dissolved carbon dioxide and other gases which are either produced or consumed (methane, hydrogen, carbon monoxide). In addition, concentration of oxygen and carbon dioxide are also often measured in the outlet gas mixture. Also crucially important is the measurement of concentrations of substrates, intermediates and products. These measurements are currently conducted using ion-selective electrodes as well as electrodes employing immobilized biocatalysts, which permit a continuous on-line measurement, and mass spectrometric methods.
295
9.3.1
Measurement and regulation of pH and rH
Values of pH are either measured and recorded, or measured and regulated (usually this amounts to maintaining the pH at a constant value) in a range of pH 2 to 12. Such a system consists of sterilizable electrodes and instruments for measurement, recording and regulation, reservoirs for acid and alkaline solutions (gases), and pumps (Fig. 9.6). The solutions have to be fed in slowly and the feed has to be placed away from the vicinity of the electrodes
!
--1
2 -
\
U3----U~
I I I I I I I I
t
5
6
Fig. 9.6 System for pH m e a s u r e m e n t and regulation 1 acid or alkali stock solution, 2 - - solenoid valve, 3 - - air, 4 - chart recorder and p H controller, 5 lead-in box, 6 - reference electrode, 7 - glass electrode (saturated calomel electrode)
to make the regulation as precise as possible. The dosage of titrants has to be adjusted according to the frequency of feed pulses, their length and the range of pH regulation. A number of electrodes that can be steam sterilized together with the culture device, as well as overpressure electrodes are currently available on the market. The redox potential is measured in a device similar to pH-meters but differing from them in that metal (most often platinum) electrodes are used instead of glass electrodes and the potential is measured in millivolts in the
296
range 0-800 or - 5 0 0 - 0 - + 500. The values of the redox potential can be regulated by feeding into the device nitrogen gas or oxygen, cysteine, ascorbic acid or sodium thioglycolate. In aerobic processes the redox potential is not very often measured because the measurement is complicated by the presence of dissolved oxygen and the resulting data are difficult to interpret.
9.3.2 Measurement and regulation of dissolved oxygen Monitoring of dissolved oxygen concentration is the most important at low oxygen levels which can inhibit aerobic growth. If oxygen is not the growth limiting factor its measurement is not so important. A sudden change in the level of dissolved oxygen can point to a change in cell metabolism some time before the change is actually demonstrated in the culture. The actual concentration and partial pressure of oxygen dissolved in a culture fluid are measured by the oxygen electrode. The anode in this electrode is a platinum wire, the cathode is a ring composed of silver and silver oxide. The electrolyte is a cellulose gel containing potassium chloride, the membrane is fabricated from a fine stainless steel mesh and teflon and can be readily replaced (usually after 5-10 sterilization cycles). The electrode response time is usually short (less than 10 s) and the accuracy of measurement is _+ 1%. The measurements can be performed over a temperature range of + 5 to +50 ~ The electrodes are manufactured from glass or stainless steel and can be steam sterilized (130 ~ 30 min). The electrode signal passes into an amplifier, a monitor, and is recorded on a line recorder. These electrodes measure the partial pressure of oxygen which is to be distinguished from the actual oxygen concentration. Oxygen concentration in a solution is directly proportional to its partial pressure. Oxygen solubility decreases with increasing concentration of dissolved substances but its partial pressure does not change. The accuracy of measurement with oxygen electrodes is still plagued by a number of problems such as the inhomogeneity of the electrode environment (Linek and Vacek, 1985). The effect of inhomogeneity of electrode environment on the measurement of dissolved oxygen concentration can be avoided in a system consisting of a teflon tube placed in the bioreactor, through which a stream of nitrogen is passed. The oxygen dissolved in the culture broth diffuses through the tube wall into the stream of nitrogen and its concentration is measured in an oxygen analyzer (Phillips and Johnson, 1961). Dissolved oxygen can also be suitably measured by mass spectrometry (Pungor et al., 1980; Doerner et al., 1982). In this case a tube ending in a silicon membrane is placed in the culture and the gas mixture diffusing into the tube is vacuum-transferred into the analyzer.
291
The concentration of dissolved oxygen can be regulated either by changing the volume coefficient of mass transfer or by changing the inlet oxygen concentration. The volume coefficient of oxygen transfer can be changed by changing the impeller speed (Herbert, Phipps and Tempest, 1965). In the system devised by these authors the electrode signal activates a servo-amplifier which regulates the revolutions of the impeller driving engine. When the level of dissolved oxygen drops below a preset level the impeller speed is increased until the desired oxygen level is attained. In a simpler arrangement air is brought at a constant rate into the bioreactor through a tube whose outlet can be adjusted at different heights according to the electrode signal. The lower the tube outlet in the culture fluid the longer the residence time of air bubbles in the fluid and the higher the rate of oxygen transfer. Regulation of the concentration of dissolved oxygen via modification of oxygen concentration in the inlet can be achieved in two ways: by changing the nitrogen/oxygen ratio in the inlet gas at a constant gas volume (Siege11 and Gaden, 1962) or by changing the amount of air fed into a constant nitrogen flow. The methods using changes in impeller speed o r changes in air amount fed into a constant nitrogen flow have the drawback of changing at the same time the mixing characteristics. The method based o n changing the nitrogen/ oxygen ratio in the inlet gas, which retains constant impeller speed and a constant gas feed amount, is therefore the method of choice. A widely used method for regulating the dissolved oxygen level, which respects also the capacity limits of the culture device for oxygen transfer, was designed by Hospodka (1966). In this approach the oxygen level is regulated by the rate of addition of energy (carbon) source into the bioreactor.
9.3.3 Measurement and regulation of dissolved carbon dioxide and other gases The concentration of dissolved carbon dioxide is measured by a potentiometric sensor in which the actual internal probe is a glass electrode in a dilute solution of sodium bicarbonate (Fig. 9.7). An equilibrium pressure of COz corresponding to its concentration in the outside solution is attained in the membrane pores and the same C 0 2concentration is established in the internal solution surrounding the glass electrode. Modern microporous membranes have enabled the construction of a number of gas probes which are commercially produced (Ross, Riseman and Krueger, 1972). In the ammonia electrode the ammonia diffusing through the membrane also affects the pH in a solution around a glass electrode, which is then recorded. Other electrodes constructed on a similar principle are used for determination of SOz, HCN
298 and H2S. The response time of gas sensors or electrodes depends primarily on the rate of diffusion of the gas through the microporous membrane. Gases dissolved in the culture fluid, such as carbon dioxide, hydrogen, methane, nitrogen and hydrogen sulphide, can be determined with high accuracy and precision by a quadrupole mass spectrometer after their separation from the fluid by a teflon or polyethylene membrane (Cox et al., 1984). r
Fig. 9.7 Potentiometric gas probe (Orion Research) 1 -- internal electrode, 2 - internal electrolyte, 3 electrode, 4 - hydrophobic porous membrane
9.3.4
reference
Determination of gases in the gas phase
In microbial processes, gases such as oxygen, carbon dioxide, methane, hydrogen, hydrogen sulfide or carbon monoxide are either released as products or consumed as substrates (cf. Section 5.4.1). In both cases it is desirable to know their concentration in bioreactor inlet or outlet. Oxygen is measured by a paramagnetic oxygen analyzer in the range of 16 to 21 volume per cent. This range is linearized and amplified to a current range of 0 to 20 m A. Measurement error due to the presence of CO2 is automatically compensated by an infrared gas analyzer. Oxygen concentration can also be determined more cheaply, by bubbling the gas slowly through a water column in which the dissolved oxygen concentration is measured at constant temperature by an oxygen electrode. The content of carbon dioxide in the gases is most often determined by an infrared gas analyzer in the range of 0 to 10 volume per cent. The analyzer signal is linear in the range of 0 to 20 mA, the current is directly proportional to the CO2 content and is recorded on a chart recorder. Carbon dioxide can be assayed similarly to oxygen by passing the fermentation gases through a water column and measuring the dissolved CO2 concentration in the water by an ap-
299
propriate electrode. Another method involves the use of a paramagnetic gas analyzer; the gas mixture is passed into the analyzer in an alternating manner, directly and then after CO2 adsorption, and the CO2 concentration is determined from the difference (Phillips, 1963). Methane can be measured by a biosensor with immobilized cells of Methylomonas flagellata (Karube and Suzuki, 1983). The bacteria consume me-
,~
-
o! L
9
'/
7
T i
4
5
tsl 7 o o
_
-
--
6
Fig. 9.8 Scheme of a methane biosensor (Karube and Suzuki, 1983) 1 - - pump, 2 gas sample collector, 3 - gas, 4 - cotton wool filter, 5 - reference reactor, 6 - reactor with methane oxidizing bacteria, 7 - oxygen electrode, 8 - amplifier, 9 - chart recorder
thane along with oxygen, whose decrease is measured. The system is schematically illustrated in Fig. 9.8. It includes a reactor with immobilized cells, a reference reactor and two oxygen electrodes. Methane is brought into both reactors. In each branch the partial pressure of oxygen is measured by an oxygen electrode and the difference between the readings from the two electrodes has been found to be linear below 6.6 mM methane. The minimum measurable concentration is 13.1 gM, operation life-time 20 days or 500 analyses.
300
9.3.5
Measurement of substrate and product concentrations
A chemical can be at the same time a substrate and a product; this holds, for example, for alcohols, organic acids and amino acids. We shall therefore describe the determination of individual compounds according to their chemical nature, i.e. saccharides, alcohols, organic acids, amino acids, inorganic nitrogen compounds, antibiotics, etc., irrespective of whether they are substrates or products. Determination of gaseous substrates and products was dealt with in preceding chapters. In this section we shall not discuss conventional analytical methods such as colorimetry or spectrophotometry but shall focus on modern methods which allow a continuous computer-supported measurement of concentrations. Among these are techniques using biological sensors (enzyme electrodes), catalytic sensors and mass spectrometric methods. The last technique can safely be expected to dominate the field of these measurements.
Saccharides The most common saccharides in microbial processes are glucose, sucrose and lactose. When choosing the method for their determination the crucial factor is the desired sensitivity of assay (Table 9.1). The most sensitive method is seen to be the technique based on enzyme electrodes. The first en-
Table 9.1 Methods used for glucose determination (Keyes, Semersky and Gray, 1979) Instrument Glucose Analyzer 2 Industrial Analyzer Model 27 Technizyme Glucose Module Oxidase Electrode
Manufacturer Beckman Instruments Yellow Springs Instrument Co. Technicon Instrument Corp. Yellow Springs Instrument Co.
Sensitivity I O0 ppm I O0 ppm I ppm 0.5-- I ppm
zyme electrode to be developed was the glucose oxidase electrode for glucose assay (Updike and Hicks, 1967). The electrode was later improved by the use of immobilized glucose oxidase (Barker, Emery and Novias, 1971; Nanjo and Guilbault, 1974), and especially by the application of immobilized cells of Pseudomonasfluorescens in a collagen membrane as a sensor; these cells utilize specifically glucose (Karube, Mitsuda and Suzuki, 1979). The scheme of the sensor is given in Fig. 9.9. It includes the collagen membrane with bacteria and another teflon membrane permeable for oxygen, alkaline electrolyte, platinum cathode and a lead anode. The double membrane is in direct contact
301
with the platinum electrode and is protected by a rubber ring. The current is measured by a milliamperometer and the signal is recorded on a chart recorder. The oxygen consumed by the bacteria lowers the concentration of the dissolved oxygen in the membrane (after oxygen saturation); this decreases the current on the membrane until an equilibrium is established (10 min, 30 ~ The equilibrium value depends on glucose concentration. The current/glucose concentration dependence is linear below 20 mg 1-', the reproducibility is +6 %, minimum stability 30 days. The electrode is more sensitive, stable and cheaper than electrodes using glucose oxidase.
j
Qir
L
-55 ._-.~- . " . . .
~
Fig. 9.9 Glucose determination by a biosensor with immobilized cells (Karube, Mitsuda and Suzuki, 1979) 1 -- collagen membrane with bacteria, 2 - teflon membrane, 3 - platinum cathode, 4 - lead anode, 5 - electrolyte (KOH), 6 - amperometer, 7 - - chart recorder
Sensitive enzyme electrodes have also been described for the assay of other monosaccharides, disaccharides and polysaccharides such as sucrose (Satoh, Karube and Suzuki, 1976), lactose and maltose (Cordonier, Lawny and Chapot, 1975) or starch (Barker and Somers, 1978). Sucrose can also be determined by an enzyme thermistor consisting of a Wheatstone bridge and invertase or Saccharornyces cerevisiae cells immobilized on porous glass (Mandenius, Danielsson and Mattiasson, 1981). Before measurement, the sample is degassed in a degasifier and diluted by a buffer containing K C N which kills the cells. The sensor works reliably for up to six months.
Alcohols The alcohols most often determined are ethanol (both as a product and as a substrate), methanol and butanol.
302
Ethanol can be assayed by a biosensor, ISE electrode, enzyme electrode, semiconductor sensor or quadrupole mass spectrometer. Figure 9.10 shows the biosensor which consists of Trichosporon brassicae cells immobilized in a porous acetylcellulose membrane, a teflon gas impermeable membrane and an oxygen electrode (Hikuma et al., 1979). The relationship between signal current and ethanol concentration is linear below 22.5 mg 1-~, minimum con-
I i
--3
/
10
4
~'~9
Fig. 9.10 Biosensor for ethanol and acetic acid assay (Hikuma et al., 1979) 1 -- aluminium electrode, 2 electrolyte, 3 - insulation, 4 -- platinum cathode, 5 rubber ring, 6 - nylon mesh, 7 - teflon membrane, 8 - microorganisms, 9 - acetylcellulose membrane, 1 0 - porous teflon diaphragm
centration assayed by the sensor is 2 mg 1-1, reproducibility is ! 6 % and the stability is retained over 2100 assays. The shortcoming of this sensor is a relatively long response time. Enzyme electrodes based on immobilized alcohol oxidase (Nanjo and Guilbault, 1975) or alcohol dehydrogenase (Malinauskas and Kulys, 1978) measure only low ethanol concentrations of 1 or 2.5 g 1-' respectively. Dairaku and Yaman6 (1979) used a system in which ethanol diffused from the culture fluid through a porous teflon tube into the stream of an inert gas and its concentration was monitored by a flame ionization detector. A similar system using a semiconductor detector was used by Puhar et al. (1980). These systems measure ethanol concentrations of up to 120 g 1-~ but the assay sensitivity decreases with increasing ethanol concentration. A very good ethanol assay system was devised by Lee et al. (1981). It is an on-line semiconductor gas sensor in which a semipermeable membrane separates the gas flow from the culture fluid (Fig. 9.11). The system is cheap, can be steri-
303
lized in situ by steam and has a relatively short response time (1 min). Another satisfactory system is the quadrupole mass spectrometer (Pungor et al., 1980; Doerner et al., 1982) which has a very fast response (17 s) and can be connected on-line to a computer. Methanol can be determined by a bioelectrochemical cell (Plotkin, Higgins and Hill, 1981) embodying an anode and a cathode chamber separated vent opening
13ll 1 11i 12 FL~
!
lO
1
9
i_
(21"
" j-i,, ! I i
I
iI
34 I
1
)2
Fig. 9.11 Schematics of a system with semiconductor gas sensor for ethanol assay (Lee et aL, 1981) 1 air filter, 2 - pressure regulator, 3 - needle valve, 4 - rotameter, 5 - semipermeable membrane, 6 - gas sensor, 7 - temperature regulated chamber, 8 - constant current feed for sensor heating, 9 resistor voltage converter, 1 0 - A / D converter, 11 microcomputer, 1 2 - image monitor, 13 teleprinter
by a membrane. The anode chamber contains methanol dehydrogenase from P s e u d o m o n a s in a buffer of pH 9.5. Nitrogen is pumped over the solution which is magnetically stirred. The current arising in the cell is determined by measuring the potential difference by a 10 fl resistor connecting the electrodes. This bioelectrochemical cell could be improved by incorporating into it an immobilized enzyme or cells. Methanol concentration can also be determined on a mass spectrometer (Reuss, Piehl and Wagner, 1975). Butanol determination is used in acetone-butanol fermentation. The main problem here is the specificity of the method in view of the concomitant formation of other compounds such as acetone, ethanol, acetic and butyric acids, and gases. Suitable methods include mass spectrometry (Doerner et al., 1982) and headspace gas chromatography used by Comerbach, Scharer and Moo-Young (1985). Organic acids
Acetic acid can be determined on a quadrupole mass spectrometer (Doerner et al., 1982) or by using a biosensor identical with that used for ethanol assay (cf. Fig. 9.10). The minimum concentration of acetic acid detectable by the
304
biosensor is 5 mg 1-', assay reproducibility is +6 %, stability three weeks, and reliable operation can be expected for 1500 assays. Formic acid has been assayed by a fuel-cell-tape electrode (Karube and Suzuki, 1983) composed of a teflon membrane, platinum anode, AgO2 cathode and an electrolyte. Membrane with immobilized Clostridium butyricum is placed on the surface of a teflon membrane and covered with another, porous teflon membrane. The measuring unit consists of the microbial sensor, indicator, mV-amperometer and a chart recorder. The hydrogen produced from the formic acid penetrates through the teflon membrane and is oxidized on the platinum anode. The relationship between the signal current and formic acid concentration is linear below 1 g 1-~, minimum detectable concentration is 19 mg 1-~, assay error does not exceed + 5 % and sensor stability period is 20 days. Lactic acid can be assayed by an enzyme electrode containing yeast lactate dehydrogenase and cytochrome b2, butyric acid on a quadrupole mass spectrometer (Doerner et al., 1982).
Amino acids The concentration of amino acids can be measured either by high performance liquid chromatography (Radjai and Hatch, 1980)or by automatic analyzers. The latter method consumes a considerable amount of expensive enzymes and it is therefore more useful to use biosensors. These are usually constructed as follows: lyophilized microbial cells are supplied with a drop of water, covered from both sides with nylon mesh and placed on the surface of
Table 9.2 Characteristics of enzyme electrodes for amino acid assays
Substrate o-Amino acids D-Amino acids L-Phenylalanine L-Asparagine L-Tyrosine L-Lysine L-Glutamic acid
L-Arginine
Immobilized enzyme D-amino acid oxidases L-amino acid oxidases ditto + peroxidase asparaginase decarboxylase decarboxylase glutamate and lactate dehydrogenase decarboxylase decarboxylase + diamino oxidase
Sensor
Concentration range ( m o l l -l )
Stability
NH + NH~INH4 C02 C02
5 x 10 -5 - 10 -2 10-4 10-2 5 X 10 -5 - 10 -3 5 • 10 -5 10 -2 10-4 10-1 2 X 10 -4 1.5 X 10 -3
1 month > 1 month > 3 weeks 1 month 3 weeks 2 weeks
NH4 CO2 02
10-4_
10-3
10-4_
10-2
15 days > 1 month
2
> 6 months
2 x 10 -5
X 10 - 4
305
a silicon rubber electrode membrane. The whole setup is covered with a cellophane foil (Hikuma et al., 1980b). Liberated CO2 is measured by a CO2 electrode, oxygen by an 02 electrode and NH4 by an ISE electrode. When ISEs are used for ammonia assay the pH of the samples is adjusted to 10; this brings about a partial hydrolysis of the amino acids and the resulting values are therefore somewhat higher than actual concentrations. Characteristics of enzyme electrodes for amino acid assay are given in Table 9.2. Nitrogen sources
The concentrations of NH4 and NO2 can be measured by ion-selective electrodes. The most common electrodes of this type are Orion ISEs which are used with a digital pH/ion-meter (Le Duy and Samson, 1982). NH4 electrodes use potentiometric detection and are constructed from a combined glass electrode and a gas-permeable membrane. The assay takes place at a strongly alkaline pH and the main interfering species is amines. 2
3
.....
NO2
NO2
I
I I I
,- .-- ., ,..- -. t,
' - , ,.,",
"2".'. . ' - . 1 ~ ',,-. },
4
I
I I
5
,"' 02,-" " ": ' "','i ' ' " f" " - , ; . , "," ~,~" - , IL ; 9: . - - . ' , . , 9" ' ~
Fig. 9.12 Principle of a biosensor for nitrite assay (Karube et al., 1982) 1 buffer of pH 2.5, 2 buffer of pH 7.5, 3 - immobilized cells, 4 oxygen electrode, 6 - gas permeable membrane
teflon membrane,
Nitrification bacteria such as Nitrosomonas utilize ammonium ions as the only energy source, whose assimilation is coupled to oxygen consumption. These bacteria can be used in an immobilized form for amperometric determination of ammonium ions. The system consists of the immobilized bacteria plus an oxygen electrode (Hikuma et al., 1980a). Gaseous ammonia diffuses through a permeable membrane and is assimilated by the bacteria. This results in the consumption of the oxygen dissolved at the membrane. The ensu-
306
ing current decrease proceeds to an equilibrium value which is dependent on the concentration of ammonium ions. The dependence of the current on the concentration of the ions is linear below 42 mg NH 4 per 1 1, minimum measurable concentration is 0.1 mg 1-', reproducibility + 5 % and stability is retained during 1500 analyses. A biosensor for nitrite assay is based on immobilized cells of Nitrobacter sp. and an oxygen electrode (Karube et al., 1982). The measuring system is illustrated in Figure 9.12. Immobilized cells separated into rings are placed on the surface of an oxygen electrode teflon membrane and covered with another teflon membrane permeable for gases, which is affixed by an O-ring. The drop of current from an initial to an equilibrium value is linearly dependent on NaNO2 concentration in the range below 0.59 mM (current drop 0.63 l.tA). The minimum measurable concentration is 0.01 mM, reproducibility +5%, stability period 21 days and the number of analyses feasible with one sensor is 400. Antibiotics
Antibiotics are most conveniently determined by automatic analyzers. In this procedure test microorganisms sensitive to a certain antibiotic are contin-
T sS: 6
5
3
4
Fig. 9.13 Flow-through sensor with immobilized cells for cephalosporin assay (Matsumoto et al., 1975) 1 -- soda lime, 2 - vessel with a buffer, 3 - peristaltic pump, 4 -- sample collector, 5 - reactor for immobilized cells, 6 - combined glass electrode, 7 - measuring chamber, 8 - amplifier, 9 - chart recorder
307
uously cultured in a chemostat and the culture is supplied by a sample of the antibiotic to be tested. Its concentration is determined from the degree of inhibition of CO2 production. The assay of penicillins and cephalosporins can also be performed by biosensors. The biosensor for cephalosporin determination shown in Fig. 9.13 is based on cells of Citrobacterfreundii containing cephalosporinase, which releases hydrogen from cephalosporins. The cells are immobilized in a collagen membrane (Matsumoto et al., 1975). The error of measurement does not ex-
[
--1
2~
~3
1 Fig. 9.14 Sensor for penicillin assay (Cullen et al., 1974) 1 -- pH electrode, 2 -- sintered glass filter with absorbed penicillinase, 3 - tested solution, 4 - reference electrode
ceed + 8 %. A biosensor for penicillin determination is illustrated in Fig. 9.14 (Cullen et al., 1974). It is an enzyme electrode with immobilized penicillinase; the enzyme hydrolyzes penicillins to penicillanic acid. The pH drop caused by the formation of the acid is then measured. The assay is accurate in the concentration range 10 -5 to 3 x 10 3 M, corresponding to 3.5-1100 ttg penicillin per ml.
9.4
BIOLOGICAL ENVIRONMENTAL FACTORS
An important quantity for control of microbial processes is the concentration of cell mass. Its measurement has been conducted using a number of direct and indirect methods, none of which is generally applicable. The concentration of microorganisms in media containing solid particles, or microorganisms growing on solid substrates can be determined only by indirect methods. Of equal importance for the direct monitoring of some key metabo-
308
lites as the biomass determination is the assessment of the live or metabolically active part of the population, cell size and their reproduction ability, distribution of cells ages in the population and the intracellular components (DNA, RNA, ATP, NADH, proteins, etc.). Figure 9.15 presents the main differences between the principles and methods used for biomass measurement (Clarke et al., 1986). Most measuring methods view the culture as a system composed of two parts, the biomass and the culture fluid. The measured parameters, whether macroscopic (amount of biomass) or microscopic (intracellular metabolite), are then average or overall values. Distribution population analysis is also very often necessary to take Principle Optical
Suitable for the analysis of
scattering fluorescence infra-red po [arisafion
biomass cells population + + + + +/ + + +/ -
dielectric
+
+
+
acoustic
+
+/-
+
wave propagation scattering
etecfrochemica[
+/-
NMR
+/-
ATP DNA vital staining
+/+ +
biochemica[
~ i ~
! i
TI
Princip[--~e
acoustic dietecfric
+/+ +
Sa__.m.mptecollector
unimmersed noninvasive immersed noninvasive
etecfrochemica[
immersed invasive
biochemical
remote flow
Fig. 9.15 Principles and methods of biomass determination (Clarke et al., 1986)
309
into account the biochemical, physiological and morphological variability existing within microbial populations. 9.4.1
Concentration of microorganisms
The concentration of microorganisms can be determined by measuring the cell count or by measuring biomass. The simplest methods for determining cell count are microscopic cell counting in a counting chamber or plating of the microorganisms on agar media in a Petri dish (this determines only the viable count). Modern methods for the measurement of cell count use particle analyzers, Coulter counting, flow cytometers or laser flow microfluorometers (Matyus et al., 1984). In a laser fluorometer microbial cells collected from a culture sample are aligned in a narrow tube one after another and then pass individually through a light beam (Hatch, Wilder and Cadman, 1979). Continuous argon laser is used for UV-light while helium-neon laser is used for the infrared region (630 nm). Particle analyzers are not suited for determining cell count in suspension media because they do not distinguish cells from any other suspended particles. In flow cytometers, on the other hand, microorganisms can electrically be distinguished from inert particles owing to different dielectric properties (Schanne and Ceretti, 1978). Biomass concentration can be measured by direct and indirect methods. In direct methods the microorganisms are first separated from the culture fluid by centrifugation or filtration and their volume or weight is measured either in native cells or as dry weight (after drying to a constant weight). In one procedure standardized samples of the filtered microbial cake are weighed and then returned back into the culture vessel by washing-off (Thomas et al., 1985). Much more common than direct assay methods are indirect procedures which are simpler and faster. Among the indirect methods, densitometry has found the widest application. If the culture fluid contains no solid particles the optical density can be measured spectrophotometrically. Its values are directly proportional to the number of particles per unit volume. As long as the distribution of particle size is constant (Pirt, 1975) and the optical density is lower than 0.5 (Lee and Lim, 1980) the cell density can be determined directly by using an appropriate proportionality constant. If the density is too high the culture has to be diluted or the sensitivity of measurement has to be reduced. However, if the cell size distribution changes, the proportionality constant in the Beer law is altered and the accuracy of the determination drops. This problem can be addressed by measuring the size of individual cells on a parti-
310
cle analyzer or a flow cytometer. The cell size distribution can be integrated in a computer and the exact cell density can thus be determined. A number of suppliers are currently marketing flow cytometers for continuous measurement of microbial density which can be placed inside or outside the bioreactor. The operating range of methods based on light scattering can be significantly improved by the use of lasers, both at low (-~ 103 cells ml -~) and at relatively high (---108 cells ml -~) densities of microbial cultures. Biomass has also been determined by electrochemical sensors constructed on the principle of a fuel biocell (Ackland, Manvell and Bean, 1984) which combine the production or consumption of electroactive substances by microorganisms with an electrochemical interaction of the microorganisms with electrodes. In addition to the above methods, biomass concentration, especially in suspension media or on solid substrates, can be measured via chemical determination of DNA (Solomon, Erickson and Yang, 1983) or via bioluminescence ATP assay (Ulrich and Wannulund, 1985) in cells. Both assays are based on the fact that the content of DNA and ATP in cells is relatively stable in a certain range of their physiological state.
9.4.2
Determination of microbial population homogeneity
Information about the composition of a microbial population is important for directed biosynthesis of biomass and products since it enables conclusions to be drawn about how the microbial process will proceed. The pertinent data which facilitate the evaluation of the physiological state of the cells and the distribution of intracellular components in individual cells include the ratio of live to dead cells and distribution of cell size and shape. The ratio of live to dead cells in a population can be determined microscopically with the use of special staining techniques. However, these are not always completely reliable and exact information can be obtained only by the time- and labour-consuming direct plating on agar plates which takes hours or days. New, more rapid methods are based on flow cytometry and on biosensors. A scheme of a biosensor for determining concentration of live cells is given in Fig. 9.16 (Matsunaga, Karube and Suzuki, 1980). The construction of the sensor arose from the finding that bacteria are oxidized directly on the anode surface, giving rise to a measurable current. The sensor consists of working and measuring platinum electrodes and a saturated calomel electrode which are connected to a potentiostat. The current is measured by a mV-amperometer and the output signal is recorded on a chart recorder. The current/ cell concentration dependence, for Bacillus subtilis for example, is linear be-
311
low 2 • 109 cells ml -~, the mean error of measurement is + 8 % and the life of the sensor is about 400 h. Distribution analysis of cell size in populations can be performed using laser flow microfluorometry or photon correlation spectroscopy. This method enables culture contamination to be revealed in the range of 250:1 to 1000:1 (organism :contaminant) depending on cell size (cells smaller than 3 to 10 gm). The natural shape polydispersity of microbial cultures (nonspherical cells, cell elongation, formation of cell chains) complicates data obtained in
I,IT,T T I
2
6 7 B
><2
Fig. 9.16 Schematics of a system for electrochemical determination of live microbial cells (Matsunaga, Karube and Suzuki, 1980) 1 -- chart recorder, 2 - potentiostat, 3 - saturated calomel electrode, 4 ceramic joint, 5medium, 6 measuring electrode, 7 working electrode (Pt), 8 - electrolyte (saturated KC1), 9 - - cellulose dialysis membrane
measurements on laser cytometers. Method~ t~ased on a multiple angular measurement, permitting the determination of cell shape (Benson, McDougal and Coffey, 1984), or methods relying on measurements in an ultrasound field (Vienken et al., 1985) also solve these problems. Distribution of mother and daughter yeast cells in a population can be established in a flow cytometer with a helium-neon laser. Using this method, Hjortso, Dennis and Bailey (1985) studied the distribution of mother and daughter cells of Saccharomyces cerevisiae (containing plasmid pRB73 from Escherichia coli) at the beginning, during the course and at the end of the exponential growth phase. According to their data the number of daughter cells
312 0.01
..j"
YT
1.a t-
"
YT
76/1X./.:.../
76+ YT 7611
i.....i"
(._
1. 0
100
200
300
400
500
number of channets
Fig. 9.17 Flow-through cytometric detection of fl-galactosidase in individual cells of Saccharomyces cerevisiae YT 76 (Srienc, Campbell and Bailey, 1983). Histograms were obtained from plasmid-containing populations of strain YT 76, from plasmid-free populations and from a mixture of the two population types
cured of the plasmid doubled at the end of the exponential phase while the fraction of mother cells in the population increased slightly. It is often important for production purposes to determine the concentration of a product in individual cells in the population, because this reflects the total rate of product formation. Methods have so far been elaborated for determination of enzymes, such as alkaline phosphatase (Dolbeare, Vanderlaan and Phares, 1980) and fl-galactosidase (Srienc, Campbell and Bailey, 1983). The methods utilize fluorescent substrates whose hydrolysis by the appropriate cellular enzyme causes fluorescence, which is then measured in a flow cytometer. The cytometric detection of fl-galactosidase in individual cells of Saccharomyces cerevisiae is illustrated in Fig. 9.17. 9.4.3
Determination of intracellular components of microbial cells
Single-purpose automatic analyzers are commercially produced for the determination of the elemental biomass composition. Data of considerably greater importance, however, are obtained by measuring the levels of compo-
313
nents such as DNA, RNA, NADH, ATP, and proteins. DNA, RNA and proteins in individual cells can be determined by inducing their fluorescence with the aid of specific organic dyes and subsequent measurement in a flow cytometer at 488 nm (Melamed, Mullaney and Mendelsohn, 1979; Madjlessi and Bailey, 1980). Natural fluorescence of NADH can be measured in an analogous way (Zabriskie, 1979). The level of ATP can be determined by the bioluminescence technique mentioned above (Ulrich and Wannulund, 1985). When the cell size distribution is known the content of these intracellular constituents can be referred to weight units as a function of cell size (Hatch, 1982).
9.5
ATTACHMENT OF THE BIOREACTOR TO A COMPUTER
Computers represent one of the most powerful tools in the research into microbial processes and in the production of microbial products. They enable the elaboration of methods for enhancement of yields and the rate of synthesis of desired products, and permit the attainment of high production reproducibility and product quality. As compared with other technological processes, microbial processes are much more complex in the sense that external conditions can affect growth of microorganisms or product formation in an unpredictable way. This extremely large sensitivity to environmental changes which can be only poorly controlled or counteracted via classical regulating devices and subsequent interventions into the process, can be successfully coped with using computers. Furthermore, computers make highly qualified personnel free of tedious inspection of measuring devices and evaluation of their data because they can perform all these operations better and much more rapidly.
9.5.1
Computer function in the bioreactor-computer setup
A computer attached to a bioreactor can in principle fulfill four tasks: a) data collection (acquisition, sorting, recording), b) data processing (data reduction and analysis, computation of important quantities), e) process control, d) process optimization.
314
Data collection The first possibility of connection of a computer to a bioreactor is in the field of data collection. This task can be performed at the control centre and every computer can fulfill this function. The computer records process data via appropriate sensors, often with a considerable frequency. These data usually have the form of analogue values, most commonly in mV (temperature, level, flow, concentration, pH, etc.). The recorded data are digitalized and stored in the computer memory, external or internal. They can be provided in the form of a printout. The data in memory can be used for further calculations and processing. For instance, the computer may print the values of all measured quantities at regular intervals, thus providing a log book of the whole process. It also checks if given quantities fall within a preset range or if a given sensor operates smoothly. In the case of malfunction it switches the sensor off and transmits appropriate warnings. Data processing A higher degree of computer control of the process is the use of acquired data for further calculations such as materials balance, quantities of state of the process and derived parameters. The computer may evaluate, for instance, the energy balance of a microbial process, i.e. the sum of energies needed for mixing and aeration, taking impeller and compressor power input as basic quantities. It may also calculate the oxygen transfer coefficient, etc.. Computers are also highly suitable for the application of indirect methods in which the knowledge of the magnitude of a measurable quantity and of its relationship to another, unmeasurable quantity makes it possible to determine, or at least estimate, the latter quantity. Such a method is, for example, the determination of biomass concentration and specific microbial growth rate from the respiration rate values of the culture. The respiration rate can also be used for calculating substrate consumption rate and actual substrate concentration. Because the recording of data involves a certain scatter, regression methods are used to eliminate its effect on the computed quantities. Process control The computer utilizes data inserted into a program or values obtained by data processing as a basis for regulating individual process control variables in such a way that the regulation deviation is minimized in the shortest possible time. Process control is basically carried out by two methods (Fig. 9.18). In
315
the first case (a) the computer adjusts the transfer constants of individual regulators in loops (off-line configuration or set-point control, SPC). In the other case (b) the regulators are replaced by the computer itself and all regulation loops go directly through the computer (on-line configuration or direct digital control, DDC). On-line process control is in principle limited only by process requirements and the quality of the control program. On the other hand, computer failure due to malfunction or a faulty programme leaves the
I
ermeno,onprocess measured vatue
[' end confrot etemenf
!
!
fermeoo,oprocess measured vatue
1
lende confrot [emenf
t
regutafion vQtue compufer o
compufer
[
b
Fig. 9.18 Process regulation types (a) set-point control (DSC) -- off-line attachment, (b) direct digital control (DDC) on-line attachment
process without control. In this situation the off-line process control ensures the operation of regulatory circuits even after computer failure. The off-line connection is much more expensive than an on-line system and is therefore used mainly for critical loops whose failure would cause financial losses exceeding the costs of an off-line system. Computer operation in an off-line control of a certain process includes three mutually interconnected processes: a) regulation maintenance of an individual regulation loop at a preset value; in contrast to the customary regulation the computer also records interactions among individual loops; b) sequencing process control in the direction based on a preceding procedure; c) optimization - - selection of the best overall operation system at any time moment during the process. All three processes are interconnected, optimization being at a higher level than the other two activities.
316
Process optimization The term "process optimization" denotes the approach to a state in which the process exhibits the best characteristics according to a given criterion. The optimum behaviour of the process can be judged from many viewpoints and there exist consequently a multitude of optimal systems" energetically optimal, time-course optimal, etc.. All these viewpoints can be concentrated into a single optimization criterion calculated according to a certain algorithm and the process output quantities in such a way that it reflects objectively all properties to be optimized. The most common optimization criteria are maximum financial profit, minimum production costs, maximum efficiency, and minimum energy consumption. Zi ~
|
'" "
ZJ process v I
Yi
Zi
Zi
xi j"'
I
l~J process I i
I-'
,
[
I I 9 I
]111
wi
-
" " I computer
Wi
_.
~
I
Yi
process
i
Z
I I F ---J
r---
~ ~ wi
model
I I
~ompufer
I model adapfafion
model ~ Fig. 9.19 Strategic approaches to process optimization (a) search, (b) based on process model, (c) adaptive method" x~ -- input variables, Yi -- output variables, zi -- disturbances, w~ -- regulation parameters
The way to resolve optimization problems depends primarily on whether all properties of the process and its relationship to the environment are known. If this is so the computer operates according to a mathematical model and performs the so-called deterministic optimization. It is often necessary, however, to resort to a nondeterministic approach because the information about the process in question is insufficient, i.e. not all input and output quantities, their effect on the process and effects of changes in process parameters are known. In addition to the classification into deterministic and nondeterministic methods, optimization procedures can be divided into static and dynamic groups depending on our knowledge or ignorance of the system structure. The criterion is the temporal behaviour of the system. Dynamic optimization re-
317
quires the best possible course of transient phenomena arising in the system following changes in input parameters. When an optimal behaviour is achieved in a steady state and the objective is its preservation and a suppression of the effect of disturbing quantities, the system is subject to static optimization. Process optimization can be performed by three strategic approaches (Fig. 9.19): a) by the feedback search system, b) according to an exact model of the process, c) using an adaptive method based on an approximate model. No model of the process exists in the feedback search and the process itself is used as a model. The computer acquires information needed for optimization by changing process variables. A gradual change in input variables is directed towards optimizing the course of the process. The advantage of the feedback search is the possibility of control without any knowledge of process structure and without its mathematical description. The procedure is thus applicable in a nondeterministic optimization. Its shortcoming is the time lag between input and output signal, which makes the regulation slow. Optimization according to an exact mathematical model is performed as follows: the optimum process variables serve for computer calculation and evaluation of the optimization criterion. This is then used to determine the control impulses sent to controllers adjusting the regulated process variables. As a result, input variables at the time of their application at the process input already have values that bring about compliance of output variables with the optimization criterion. Only an approximate model of the process is known in the adaptive method. A direct or indirect determination of all important process parameters is followed by a continuous comparison of the model with actual course of the process and its adjustment to changing conditions. This adjustment is carried out according to a given algorithm so that important properties are maintained or even improved.
9.5.2
Construction of a bioreactor-computer setup
The construction of bioreactor-computer systems started at the beginning of the Sixties and has since then yielded a number of systems based on highly instrumentalized bioreactors connected to larger or smaller computers, minicomputers and microcomputers depending on the type of the microbial process and its complexity, size of the device and the purpose of the process, i.e. research or production (Grayson, 1969; Harmes, 1972; Harrison and
318
Harmes, 1972; Nyiry, 1973; Nyiry, Jefferis and Humphrey, 1974; Corrieu, Blach6re and Geranton, 1974; Jefferis, 1975; Humphrey, 1977; Dobry and Jost, 1977; Und6n, Rindone and Hed6n, 1979; Hatch, 1982; Meiners, 1982; Bull, 1983; 1985; Armiger, 1985; Rolf and Lim, 1985; Zabriskie, 1985). The factors to be taken into consideration in the design of such a system include the type of the computer, hardware and the degree of bioreactor instrumentalization (Fig. 9.20).
nutrientfeedrate I
~
I,
~ I
3
~ I
-7}---1 rote of hydroxide
I pHregulation nutrient I 1~ ---
t......
pH
I
I
~~1 !!~t~.-]
L----~ il, temperature , i--~10 ~ IIi air outlet 1 ,~Ik-I ~ I '[_ _I'~] I I-; i I i-I --1~r I I I
I
4
"
7
~-3
_ ~ I
~~.t i =~
I
,,,
i
-I
~6
I,
lls air flowrate ir
Bioreactor-computer setup nutrient supply tank, 2 - - flow meter and air regulator, 3 - - hydroxide reservoir, 4 - - bioreactor, 5 - p H - m e t e r , 6 - drying or filtration, 7 - oxygen analyzer, 8 - carbon dioxide analyzer, 9 - A / D converters, 1 0 multiplexer, I1 -- computer, 12screen, 13teleprinter, 14 - - external memory, 1 5 drawing unit, 1 6 - magnetic tape Fig. 9.20 1 --
Computer peripheries have to ensure satisfactory communication between the operator and the computer, as well as high-quality process monitoring, data output and processing. Standard equipment of modern systems includes a graphic display, hardcopy accessory, printer and external data storage (disks, CD-ROM). Process periphery ensures a bidirectional transfer of data between the process and the computer. Analogue signals from sensors (current or voltage)
319
are transformed by an A / D converter to digital signals'; digital signals from sensors are often transferred to converters via a multiplexer. For process regulation, output digital signals are transformed into regulation signals. These are either impulse signals for stage monitors which control the regulators of analogue control loops, or the terminal regulation elements which are adjusted directly via impulse signals.
REFERENCES Ackland, M. R., Manvell, P. M., Bean, P. G. (1984) Biotechnol. Lett. 6, 137. Armiger, W. B. (1985) Instrumentation for monitoring and controlling bioreactors. In: Comprehensive Biotechnology 2, New York. Barker, A. S., Somers, P. J. (1978) Enzyme electrodes and enzyme based sensors. In: Topics in Enzyme and Fermentation Biotechnology 2, Chichester. Barker, A. S., Emery, A. N., Novias, J. M. (1971) Process Biochem. 6, 11. Benson, C. M., McDougal, D. C., Coffey, D. S. (1984) Cytometry 5, 512. Bull, D. N. (1983) Ann. Rep. Ferm. Proc. 6, 359. Bull, D. N. (1985) Instrumentation for fermentation process control. In: Comprehensive Biotechnology 2, New York. Clarke, D. J., Blake-Coleman, B. C., Carr, R. J. G., Clader, M. R., Atkinson, T. (1986) Trends Biotechnol. 4, 173. Comberbach, D. M., Scharer, J. M., Moo-Young, M. (1985) Enzyme Microb. Technol. 7, 543. Cordonier, M., Lawny, F., Chapot, D. (1975) FEBS Lett. 59, 263. Corrieu, G., Blach6re, H., Geranton, A. (1974) Biotechnol. Bioeng. Syrup. 4, 607. Cox, R. P., Jensen, B. B., Joergensen, L., Degn, H. (1984) Microbiol. Sci. 1,200. Cullen, L. F., Rusling, J. F., Schleifer, A., Papariello, G. J. (1974) Anal. Chem. 46, 1955. Dairaku, K., Yaman6, T. (1979) Biotechnol. Bioeng. 21, 1671. Dobry, D. D., Jost, J. L. (1977) Ann. Rep. Ferm. Proc. 1, 95. Doerner, P., Lehmann, J., Piehl, H., Megnet, R. (1982) Biotechnol. Lett. 4, 557. Dolbeare, F. A., Vanderlaan, M., Phares, W. (1980) J. Histochem. Cytochem. 28, 419. Grayson, P. (1969) Process Biochem. 4(3), 43. Guilbault, G. G. (1976) Handbook of Enzymatic Methods of Analysis, New York. Harmes, C. S. (1972) Dev. Ind. Microbiol. 13, 146. Harrison, D. E. F., Harmes, C. S. (1972) Process Biochem. 7(4), 1. Hatch, R. (1982) Ann. Rep. Ferm. Proc. 5, 291. Hatch, R., Wilder, C., Cadman, T. W. (1979) Biotechnol. Bioeng. Symp. 9, 25. Herbert, D., Phipps, P. J., Tempest, D. W. (1965) Labor. Pract. 14, 1150. Hikuma, M., Kubo, T., Yasuda, T., Karube, I., Suzuki, S, (1979) Biotechnol. Bioeng. 21, 1845. Hikuma, M., Kubo, T., Yasuda, T., Karube, I., Suzuki, S. (1980a) Anal Chem. 52, 1020. Hikuma, M., Obana, H., Yasuda, T., Karube, I., Sizuki, S. (1980b) Anal. Chim. Acta 116, 61. Hjortso, M. A., Dennis, K. E., Bailey, J. E. (1985) Biotechnol. Lett. 7, 21. Hospodka, J. (1966) Biotechnol. Bioeng. 8, 117. Humphrey, A. E. (1977) Process Biochem. 12, 19. Jefferis, R. P. (1975) Process Biochem. 10(4), 15. Karube, I., Suzuki, S. (1983) Ann. Rep. Ferm. Proc. 6, 203.
320 Karube, I., Mitsuda, S., Suzuki, S. (1979) Eur. J. AppL Microbiol. Biotechnol. 7, 343. Karube, I., Okada, T., Suzuki, H., Hikuma, M., Yasuda, T. (1982) Eur. J. Appl. Microbiol. Biotechnol. 15, 127. Kell, D. B. (1980) Process Biochem. 15(1), 18. Kemblowski, Z., Kristiansen, B., Ajayi, O. (1985) Biotechnol. Lett. 7, 803. Keyes, M. H., Semersky, F. E., Gray, D. N. (1979) Enzyme Microb. Technol. 1, 91. Le Duy, A., Samson, R. (1982) Biotechnol. Lett. 4, 303. Lee, C., Lim, H. (1980) Biotechnol. Bioeng. 22, 639. Lee, J. H., Woodard, J. C., Pagan, R. J., Rogers, P. L. (1981) Biotechnol. Lett. 3, 251. Linek, V., Vacek, V. (1985) Dissolved oxygen probes. In: Comprehensive Biotechnology 4, New York. Madjlessi, J. F., Bailey, J. E. (1980) Biotechnol. Bioeng. 22, 1657. Malinauskas, A., Kulys, J. (1978) Anal. Chim. Acta 98, 31. Mandenius, C. F., Danielsson, B., Mattiasson, B. (1981) Biotechnol. Lett. 3, 629. Matsumoto, K., Seijo, H., Watanabe, T., Karube, I., Satoh, I., Suzuki, S. (1975) Anal Chim. Acta 105, 429. Matsunaga, T., Karube, I., Suzuki, S. (1980) Eur. J. Appl. Microbiol. Biotechnol. 10, 125. Matyus, L., Szablo, G., Pesli, I., Gaspar, R., Damjanovich, S. (1984) Biochim. Biophys. Acta 19, 209. Meiners, M. (1982) Computer application in fermentation. In: Overproduction of Microbial Products, London. Melamed, M. R., Mullaney, P. F., Mendelsohn, M. L. (1979) Flow Cytometry and Sorting, New York. Nanjo, M., Guilbault, G. G. (1974) Anal. Chim. Acta 73, 367. Nanjo, M., Guilbault, G. G. (1975) Anal Chim. Acta 75, 169. Nyiry, L. (1973) Adv. Biochem. Eng. 2, 49. Nyiry, L., Jefferis, R. P., Humphrey, A. E. (1974) Biotechnol. Bioeng. Symp. 4, 613. Phillips, K. L. (1963) Biotechnol. Bioeng. 5, 9. Phillips, D. H., Johnson, M. J. (1961) J. Biochem. Microbiol. Technol. Eng. 3, 261. Pirt, S. J. (1975) Principles of Microbe and Cell Cultivation, New York. Plotkin, E. V., Higgins, I. J., Hill, H. A. O. (1981) Biotechnol. Lett. 3, 187. Puhar, E., Guerra, L. H., Lorencez, I., Fiechter, A. (1980) Eur. J. Appl. Microbiol. Biotechnol. 9, 227. Pungor, E., Perley, C. R., Cooney, C. L., Weaver, J. C. (1980) Biotechnol. Lett. 2, 409. Radjai, M. K., Hatch, R. T. (1980) J. Chromatogr. 196, 319. Rechnitz, G. A., Arnold, M. A., Meyerhoff, M. E. (1979) Nature 278, 466. Reuss, M., Piehl, H., Wagner, F. (1975) Eur. J. Appl. MicrobioL 1,323. Rolf, M. J., Lim, H. C. (1985) Systems for fermentation process control. In: Comprehensive Biotechnology 2, New York. Ross, J. W., Riseman, S. H., Krueger, J. A. (1972) Pure Appl. Chem. 36, 473. Satoh, I., Karube, I., Suzuki, S. (1976) BiotechnoL Bioeng. 18, 269. Satoh, I., Karube, I., Suzuki, S. (1977) Biotechnol. Bioeng. 19, 1095. Schanne. O. F., Ceretti, E. P. R. (1978) Impedance Measurements in Biological Cells, New York. Schubert, F., Wollenberger, U., Scheller, F. (1983) Biotechnol. Lett. 5, 239. Siegell, S. D., Gaden, E. L. (1962) BiotechnoL Bioeng. 4, 345. Solomon, B. O., Erickson, L. E., Yang, S. S. (1983) Biotechnol. Bioeng. 25, 2569. Srienc, F., Campbell, J. L., Bailey, J. E. (1983) Biotechnol. Lett. 5, 43. Thomas, D. C., Chittur, V. K., Cagney, J. W., Lim, H. C. (1985) Biotechnol. Bioeng. 27, 729. Ulrich, P. G., Wannulund, J. C., (1985) Int. Clin. Prod. Rev., March/April, 36.
321 Und6n, A., Rindone, W. P., Hed6n, C.-G (1979) Process Biochem. 14(3), 8. Updike, S. J., Hicks, G. P. (1967) Nature 214, 986. Vienken, J., Zimmermann, U., Zenner, H. P., Coakley, W. T., Gould, R. K. (1985) Biochim. Biophys. Acta 820, 259. Zabriskie, D. W. (1979) Biotechnol. Bioeng. Symp. 9, 117. Zabriskie, D. W. (1985) Data analysis. In: Comprehensive Biotechnology 2, New York.
322
10
ELABORATION OF MICROBIAL PROCESSES
The elaboration of microbial processes includes a wide range of operations with the production microorganism, beginning with its isolation and establishing or determining its basic growth and nutritional requirements and characteristics. The next step is the development of a method for optimum preservation and maintenance of the strain, assessing its stability during transfers, reinoculations and subculturing, and the establishment of a laboratory flask cultivation protocol, which includes the definition of optimum physical, chemical and biological culture conditions. Special stress is laid on media composition, which has to ensure growth and/or product formation on the one hand, but has to be economically feasible on the other. The elaboration of the laboratory procedure is followed by a scale-up in laboratory and pilotplant bioreactors. The work can be significantly accelerated and intensified by optimization methods based on modelling of the process under study. Strain improvement provides new, high producing strains whose productivity has to be evaluated by the above procedures. The whole activity thus represents a cyclic sequence of operations involving not only laboratory but also pilot-plant scale procedures. It is important that the isolation of the product from the culture broth should be tested and verified, at least tentatively, at some point during these research operations. If the isolation is found to be difficult or economically unfeasible the culture protocol has to be adjusted accordingly. The elaboration of the procedure ends with the writing up of a pilot-plant protocol and its verification on a production scale. Microbial products can in principle be obtained in two ways, by biosynthesis and biotransformation. During biosynthesis the product is synthesized by the microorganism in the course of the cultivation, and is isolated after its termination from culture fluid or from cells. In biotransformations, cultured cells are separated and used for transforming a substrate into the product.
323
10.1 ACQUISITION OF PRODUCTION STRAINS
Production strains can be obtained either from a particular microbial collection, or by isolation from natural materials. Cultures obtained from collections are pure, and their basic morphological, physiological and biochemical characteristics are known, whereas isolates from nature have to be first purified, i.e. freed of undesirable accompanying microorganisms, the pure culture has to be isolated and characterized. 10.1.1
Collections of microorganisms
Bacteria, actinomycetes, yeasts and filamentous fungi are kept in microbial collections. General collections contain all types of microorganisms while specialized collections preserve only some microbial types. Other types of collections are specialized, for example, to industrial microorganisms (usually corporate collections), pathogenic, autotrophic, or microorganisms isolated from insects. Public collections are organized in scientific or educational institutions and, in contrast to private collections, provide culture samples to customers for an appropriate charge. Collections of microorganisms also function as information, science and research centres, often specialized in the practical use of the collection stock. Their personnel take part in expert services, court trials and legal strain protection. The Worm Federation of Culture Collections has its headquarters in Brisbane in Australia and publishes a Worm Catalogue of Cultures (Martin and Skerman, 1972) in which microbial genera and species are arranged alphabetically. Individual items contain the name of the microorganism, the abbreviation of the collection in which it is deposited and its deposit number, as well as information about who collected it, number under which it is deposited in other collections, and literature reference. The most important world culture collections and their locations are given in Table 10.1. 10.1.2
Isolation of microorganisms from natural materials
Natural environments such as soil (fields, meadows, woods) and waterways (rivers, lakes, oceans) are copiously colonized by microorganisms. In a well-tilled soil, 1 m 3 was found to contain 30 to 120 kg microbial fresh weight. The more heterogeneous the natural habitat, the more variegated is also the microflora. Ecological studies permit us to forecast which source would be the most suited for isolation of a given microorganism (Schlegel, 1992). Most antibiotic-producing actinomycetes have been isolated from field and
324 Table 10.1 Major world collections of microorganisms Name
Abbreviation
Location
AJ ATTC
Anijomoto Co. American Type Culture Collection
Kawasaki, Japan Rockville, MD, USA
BKM
Vsesoyuznaya kollektsiya mikroorganismov
Moscow, Russia
CBS
Centraalbureau voor Schimmelcultures
Baarn, The Netherlands
CCM
Czech Collection of Microorgamisms
Brno, Czech Republic
CDA
Canadian Department of Agriculture
CIP
Collection de Institut Pasteur
Ottawa, Canada Paris, France
CN
Borroughs Welcome Research Laboratories
Beckenham, UK
CMI CNCM
Commonwealth Mycological Institute Collection Nationale de Cultures de Microorganisms
Kew, UK Paris, France
DSM
Deutsche Sammlung von Mikroorganismen
Braunschweig, Germany
ETH
Eidgen6sische Technische Hochschule
Zurich, Switzerland
FDA
Food and Drug Administration
Washington, DC, USA
FGSC
Fungal Genetic Stock Center, Humboldt State College
Arcata, CA, USA
FRR IAM
Division of Food Research, CSIRO Institute of Applied Microbiology, University of Tokyo
Sydney, Australia Tokyo, Japan
IFO IMB
Institute for Fermentation Institut for Mikrobiologie der Humboldt-Universitat
Osaka, Japan Berlin, Germany
IMET
Jena, Germany
INMI
Hans-Kn611-Institut for N a t u r s t o f f Forschung e. V. Institute of Microbiology, Rutgers, The State University Institut mikrobiologii Akademii Nauk
ITCC
Indian Type Culture Collection
IMRU
NCIB
i National Collection of Industrial Bacteria
New Brunswick, NJ, USA Moscow, Russia New Delhi, India Aberdeen, UK
NCTC NRRL
National Collection of Type Cultures Northern Utilization Research and Development Division, US Department of Agriculture
London, UK Peioria, IL, USA
PCM
Polish Collection of Microorganisms
Wroclaw, Poland
PRL
Prairie Regional Laboratory
Saskatoon, Canada
VPI
Anaerobe Culture Collection, Virginia Polytechnic Institute and State University
Blackburg, VI, USA
I
325
meadow soil, most cellulolytic microorganisms from wood soils (rotting wood), most sporulating bacteria from hay infusions, most autotrophic and phototrophic microorganisms from waterways, most thermoresistant microorganisms from the vicinity of hot springs, etc.. It should be kept in mind, however, that the composition of the microflora continuously changes due to agriculture and industrial activities and interventions; specific types of microorganisms can then be isolated from the modified environment. For instance, microorganisms utilizing hydrocarbons were isolated from oil fields or from the vicinity of petrol stations, microorganisms degrading toxic substances from industrial wastes of factories producing these substances as intermediates or wastes, lactic fermentation bacteria from milk products or pastures, etc.. The enrichment of a certain microorganism from the environment is achieved by a variety of methods" batch or continuous culture on solid or liquid media (Veldkamp, 1970; Veldkamp and Jannasch, 1972; Bull and Slater, 1982). The enrichment procedures have to ensure that, under given conditions (medium composition, aerobic or anaerobic conditions, pH, temperature) the desirable microbial types should grow faster than other component microorganisms of the collected mixed culture (cf. also Section 4.3.2). In contrast to isolation of microorganisms for academic research, isolation and selection for industrial purposes has to respect a number of criteria imposed by the production destination (Bull, Ellwood and Ratledge, 1979): a) nutrient requirements, such as for vitamins, may make bacteria preferable to yeasts; materials prices and energy costs may dictate the use of microorganisms utilizing ammonium salts, not nitrates; b) environmental characteristics -- cultivations performed at and above 40 ~ save energy and cooling water, frequently no special substrate pretreatment or processing is necessary for cultures carried out at extreme pH values; these factors reduce the risk of contamination; c) process type -- the usefulness of microorganisms depends on whether they are to be used in a batch or a continuous process, under aseptic or nonaseptic conditions; d) interaction of the microorganisms with the culture d e v i c e - sensitivity to shear stress damage, tendency to adhere to surfaces, formation of pellet mycelium or tendency to foam; e) stability of the microorganism as to morphology and genotype, which ensures stable production of a given product, resistance to phages and environmental changes; f) suitability for genetic manipulations; g) high product yieM per unit of consumed substrate; h) high productivity, i.e. product yield per unit time, which is dependent
326 on product yield, specific growth rate and insensitivity to high concentrations of both the substrate and the product; i) s u i t a b l e p r o d u c t isolation - - filamentous or readily flocculating microorganisms are easy to separate, and secreted products are easier to isolate than intracellular components. The majority of current microbial processes, with the exception of some food industry productions and waste water treatment, use pure cultures. However, serious considerations are being paid to the use of mixed cultures even in processes that have so far been performed with pure cultures (Trevidi and Tsuchiya, 1975; Harrison et al., 1976; Takao, Kondo and Tanida, 1978; Charley and Bull, 1979).
10.2 PRESERVATION AND STORAGE OF MICROBIAL CULTURES Three basic methods are used in the microbial industry to preserve and store microorganisms" a) drying of microorganisms in medium on other solid substances; b) preservation under conditions of limited respiration and metabolism" on agar slants, in deep freeze, or preservation of spores and cells in water; c) removal of water from microbial cells or spores by lyophilization, and preservation of the dried cells.
10.2.1
Preservation of cultures by drying
As metabolic activity requires water, dehydration is a desirable tool for preventing changes in microbial cultures. The method is highly efficient and has been in use for more than 70 years (Heckley, 1978). A natural habitat for numerous microorganisms is soil, from which they can be isolated even after a prolonged storage. Sterile soil has been used for induction of sporulation and storage of spores of anaerobic, as well as aerobic sporulating clostridia and bacilli. It is suitable also for actinomycetes and fungi which can survive in a dried condition not only as spores, but also as dried vegetative cells because of their low metabolic activity and a considerable quantities of energy they retain. As found by Pridham, Lyons and Phrompatina (1973), one half of 1800 strains of actinomycetes dried in soil survived for 20 years. Preservation of microorganisms by drying has also been done using silica gel (Perkins, 1962). The procedure is simple and does not require a special apparatus. An appropriate amount of silica gel is placed in test tubes with cot-
327 ton-wool stoppers, dried and sterilized for !.5 to 2 h at 175 ~ Trollope (1975) tested 33 bacterial species and 22 fungal species preserved in this way for 4 years. The survival of cultures preserved in a powder form at room temperature was 64 % in bacteria and 77 % in fungi. The survival was still higher when the cultures were preserved at 4 ~ Iijima and Sakane (1973) described a method of drying of bacterial cultures and bacteriophages at 2 to 5 ~ in a vacuum. The cells were mildly dehydrated and then dried on cotton-wool stoppers. This procedure was milder than lyophilization. A simple method was used with yeasts" sterile powdery CaCO3 was supplied with yeast suspension. The mixture was dried and the cells retained their fermentation ability (alcohol production) for a long time (Murphy and De Gonzhles, 1973). 10.2.2
Preservation of cultures with limited metabolic activity
Storage on agar slants Culture storage and maintenance via (not too frequent) transfers on agar slants and preservation of these agars in refrigerators or under oil has been widely used for years. Some cultures, such as E. coli, which lose the ability of enzyme overproduction after preservation by lyophilization, can be successfully preserved on starvation agar for more than four years (Pavlasov~, Stejskalov~, and Sikyta, 1986). Maintenance of fungal cultures (Mucor, Cunninghamelia, Penicillium or Aspergillus) on agars under oil caused no changes in saccharide assimilation after l0 months (Shmotina, 1975). A 4-year storage of 52 Oomyces strains under oil at 22 ~ likewise had no effect on their viability (K~i~kov~ and Balan, 1975). A 4-year storage of producers of fungal amylases on agars under oil yielded cells with a better enzyme production than lyophilized strains (Tatarenko, Igolkina and Manko, 1976).
Storage in water Most microorganisms rapidly perish after being transferred into distilled water. However, cultures of Pseudomonas solonacearum survive in distilled water for more than a decade whereas they die rapidly during storage in a refrigerator. Spores of different fungal species were observed to survive long periods in water in a refrigerator (Marx and Daniel, 1976). The survival seems to be better in strongly sporulating strains as compared with weakly sporulating ones. Strains of Saccharornyces cerevisiae and Sarcina lutea were successfully maintained in a dilute buffer in a refrigerator (Tanguay and Bogert, 1974).
328
Preservation of frozen cultures This method of preservation, introduced into microbiological practice by Sokolski, Stapert and Ferrer (1964), has been highly successful and is widely used for preservation of industrial microorganisms (Dietz and Churchill, 1985). Its advantage is that it permits equally well the preservation of spores and vegetative cells. A culture in suspension is transferred under sterile conditions into a vial with a cryoprotective agent, e.g. 10 volume per cent glycerol. The vial is sealed by fusing and placed in a vessel containing liquid nitrogen. Yamasato, Okuno and Ohtomo (1973) studied the viability of 259 strains of 32 genera (135 species) of bacteria suspended in 10 % (v/v) glycerol or honey and stored at -53 ~ for 16 months. About 10 % gram-positive and 3 % gramnegative bacteria rapidly lost their viability; honey was found to be better for storage than glycerol. Daily and Higgens (1973) found that addition of 5 % (w/w) lactose, maltose or raffinose to 10 % (v/v) glycerol enhanced the viability of spores, vegetative cells and their fragments. Modified techniques suitable for inoculation have also been described. Cox (1968) obtained satisfactory results with freezing droplets of cultures while Nagel and Kunz (1972) used small glass beads suspended in a bacterial culture with equine serum. A preservation method developed for fungi consists in cutting off culture disks grown on agar surface and freezing them in the gas phase above liquid nitrogen (Dietz, 1975). A highly suitable method for preservation appears to be supercooling, at which water does not form ice crystals at 0 ~ (Anonymous, 1985). The water is dispersed in an inert oil in small droplets while the specimen to be frozen is dispersed in the oil phase. The mixture is then frozen to - 4 0 ~ The procedure thus uses the well-known principle of low-temperature preservation but eliminates the lethal effect of freezing. It is not necessary to add cryoprotective compounds to the culture.
10.2.3
Preservation of cultures by freeze-drying
Lyophilization or freeze-drying is a widely used method of preservation of microbial cultures (Heckley, 1978). Microorganisms are suspended in a medium such as serum or skimmed milk and transferred into sterile glass ampoules. They are then quickly frozen to a low temperature with concomitant drying under a deep vacuum. The ampoules are then sealed by fusion and placed in a refrigerator. With a correct procedure the viability of most lyophilized cultures is more than 10 years. The development of the technique involved primarily the selection of suitable protective media, various gases to fill the ampoules after lyophilization and the use of the technique on special
329
microbial species. Equine serum was supplemented by various saccharides and similar compounds; m-inositol was found to be the most suitable (Redway and Lapage, 1974). The~ gas of choice was nitrogen (or simply vacuum) while other gases such as carbon dioxide or argon were less suited, although even these were better than air. As mentioned above, lyophilization was not suitable for Escherichia co6 but it was very well suited for preservation of phages. The failure of lyophilization of E. coli cultures was explained by Ashwood-Smith and Grant (1976) as being due to an activation of nucleases which cause breaks in single-strand D NA. Lyophilization is a common preservation method for antibiotics-producing actinomycetes but it is being replaced by freezing. The protective agents used for actinomycete preservation include equine serum, sucrose with gelatine, or skimmed milk. Another combination is equine serum with sodium glutamate. The preserves are stored at 4-10 ~ Lyophilization was also found to be useful for preparing starter cultures of lactic bacteria; before lyophilization, the cultures are supplemented with 10 % sucrose, 5 % sodium citrate, 5 % gelatine or 2 % sodium glutamate (Speckman, Sandine and Elliker, 1974).
10.2.4
Control and evaluation of preserved microorganisms
Culture preserves or stock cultures can be obtained by two principal methods: a) A parent stock culture is subcultured at regular (e.g. 1-year) intervals on a suitable medium and the resulting subcultures are again preserved and serve as starting material for everyday use. The stock culture is thus used to produce several parallel "operation" stock cultures. This method is used when a long-term stability of the parent stock cultures can be assured. b) Each preparation of a new stock culture is preceded by selection. The starting stock culture is used for a single-colony or single-spore plating (in this case after propagation) and the resulting isolates are reinoculated on agars, their production ability is verified by a laboratory shaker cultivation, and only isolates with the highest production are preserved. This procedure, although much more laborious, is the only one to be used in cases when a rapid decrease in production ability of the culture occurs, for example after spore transfer or spore subculturing. Spore transfer as part of strain propagation before the production of preserved cultures cannot naturally be avoided in sporulating microorganisms. The above selection procedure can eliminate the negative effect of spore transfer. In fact, repeated selection often leads to gradual productivity rise. A systematic and regular selection is usually indispensable in actinomycetes and fungi, because these microorganisms often show a sharp decrease in productivity after a few spore transfers. Another adverse
330
effect of spore transfers in these microorganisms is a rapid increase in heterogeneity, which in turn again leads to a decrease in overall strain productivity. Each batch of preserved stock cultures has to be checked, by plating, for the absence of contamination, and by flask cultivations on shakers for production ability. If the production of the strains after preservation and storage is significantly lower than 95 % of the control (i.e. strain before the preservation), the preservation procedure cannot be considered satisfactory. 10.3 COMPONENT PARTS OF A MICROBIAL PROCESS
Irrespective of the type of the microbial process, its development can be divided into the following parts" a) selection of production microorganism, its maintenance and preservation; b) selection of the most suitable form of inoculation (inoculum age and amount); c) selection of optimal composition of inoculation and production medium and the type of their sterilization; fl) optimization of the culture procedure for product formation; e) selection of a suitable culture system and device including air sterilization and automatic process regulation; production stage (bioreacfor)
culture reservoir
flask
inoculation bioreactor biomass separation product i!olafion product purification
strain selection
medium sterilization ~ /
medium set-up
i
aeration and mixing regulation
waste processing
raw materials Fig. 10.1 Linking of partial steps in the elaboration of an industrial microbial process
331
f) selection of a suitable technique for product isolation and purification; g) waste utilization and disposal. Mutual relationships among these partial steps or process parts are given in Fig. 10.1. The research and development of any industrial microbial process includes as an important part the assessment of mutual relationships between individual operations and their alteration depending on which of the parts limit the process economy. For instance, increase in production of a certain compound via selection of more efficient strains can give rise to undesirable byproducts complicating product isolation. The use of rich media complicates waste disposal and treatment. More intensive aeration and mixing bring about an increase in product formation but, on the other hand, can cause losses by culture fluid spillover due to excessive foaming, inconvenient increase in energy consumption, etc.. Process elaboration therefore consists of the gradual optimization of individual component process parts which, however, must take into account their effect on the process as a whole.
10.3.1
Inoculum preparation
The basis of a successful industrial microbial process is the inoculum, which has to fulfill the following criteria: a) It has to consist of healthy active cells so that the length of the subsequent lag phase is minimal. b) It has to be available in a sufficiently large amount, so that the inoculation can be performed in a sufficiently large volume. c) It has to have a suitable morphological form. d) It has to be free of contamination by other microorganisms or phages. e) It has to retain its ability of product formation. An important factor affecting the above properties is medium composition. It should be borne in mind that the suitability of an inoculation medium is verified only during the cultivation in the production step. Product formation in an inoculated culture is not decisive and the composition of the inoculation medium may therefore differ from that in the production stage. According to Lincoln (1960), however, growth of the inoculum in the productionstage medium minimizes the lag phase. This would reflect the fact that, when the composition of the inoculation medium is similar to that of the production medium, the period of culture adaptation to the latter is shortened, thereby reducing the total culture time. The commonly used inoculum size is 3 to 10 % referred to the medium volume; the volume of the inoculum therefore increases with increasing volume of the culture device. The scale-up usually includes 2 to 3 culture steps in flasks on shakers and 1 to 3 cultivation steps in bioreactors depending on
332
the size of the ultimate bioreactor. An increasing number of steps brings about an increased risk of contamination.and degeneration of the strain, and requires stricter control of the inoculum. A compromise is therefore sought between the size of the inoculum used and the number of inoculation steps, and the risk of strains contamination and degeneration. The basic procedure is as follows" A stock culture is plated on solid medium and about 10 morphologically typical and uniform colonies are selected and inoculated on sugar slants. This step yields subcultures, each of which serves as a basis for a new production cycle. It is useful to investigate the quality of these subcultures in cultivations in flasks on shakers before transferring the inoculum into the production bioreactor. Subcultures are used to inoculate flasks, usually 250-500 ml in volume; these in turn serve for the inoculation of large flasks or laboratory bioreactors, which are used to inoculate pilot-plant bioreactors. In each stage the culture has to be checked for potential contamination; the purity control method should be as fast as possible. Although the results of these tests are often not known before the propagated inoculum enters the production stage, they provide information on the stage at which the contamination had appeared. In sporulating microorganisms, the procedure of inoculum preparation can be modified by using spore suspension. Lincoln (1960) proposed a somewhat more laborious procedure for preparation of inoculum for bacterial cultivations, which can be with some modification applied to any type of microorganism. It consists in dividing a fully grown subculture into several small aliquots and storing these aliquots frozen for up to several months, ready for inoculation. The production and growth characteristics of the inoculum are tested at intervals before as well as after the freezing. This procedure provides uniform and well-tested inoculum over a long period.
Inocula for bacterial cultivations The main objective of inoculum preparation is to obtain inoculum with a short lag phase. Long lag phase is undesirable not only due to the retardation of the whole process but also because of the larger consumption of medium components it entails. The length of the lag phase is affected by the inoculum size, its physiological state and other factors. It is recommended that bacteria from the exponential phase of growth should be used in all cases, provided the cells are metabolically active. The age of the inoculum is important, especially with sporulating bacteria whose cells sporulate at the end of the exponential phase; a high percentage of spores in the inoculum extends the subsequent cultivation period. A uniform quality of inoculum is
333
sometimes achieved by defining the number of generations after inoculation. For production of bacterial enzymes, Underkofler (1976) recommended the use of an inoculation medium with a composition identical with that of the production medium, plus a large volume of inoculum. A method which proved useful in some industrial bacterial processes is the so-called crossing: a relatively large volume of culture from a production (20 to 60 %) is used to inoculate another production bioreactor. The procedure, which saves considerable time, is not restricted to bacterial cultivations but can also be used in the biosynthesis of antibiotics by streptomycetes or fungi. A special technique of inoculum preparation is used in acetone-butanol fermentations. Before the inoculations, spores are subjected to a short heating to 100 ~ This stimulates their germination and eliminates less viable spores (Beech, 1952). Production bioreactors have sometimes been successfully seeded with a very small volume of inoculum (as little as 10 1 per 100 000 1 medium), which resulted in a considerable shortening of the otherwise long lag phase.
Inocula for fungal cultivations Inocula used for culturing of fungi can consist of either vegetative cells or, more frequently, spores. Most industrially important fungi are capable of asexual sporulation and spores are therefore the starter material for inoculation even on the production scale. Four basic techniques have been developed for preparation of high concentrations of spores" sporulation on solid media, on solid substrates, surface sporulation on liquid media and sporulation in submerged cultures. Sporulation on media with agar is a commonly used technique. A modified method for preparation of spores in rotating flasks was described by Parker (1950). Agar medium is sterilized in cylindrical flasks, cooled down to 45 ~ and uniformly distributed over the interval surface of the flask on a rotating device. It is then seeded and incubated for 6-7 days at 24 ~ The course of spore formation can be easily monitored and the large internal surface of the flasks ensures a sufficient amount of spores for future use. A number of fungi sporulate well on the surface of different cereal seeds such as millet, barley or maize. Sporulation depends on the amount of water added to the seeds before sterilization, and on air moisture, which should be as high as possible (Vezina and Singh, 1975). Production of spores on a laboratory scale is usually accomplished in Roux or Fernbach flasks; the spore yield when cereals are used is 5-50 times that attained in the same flasks with an agar medium, in view of the large surface of the seeds. The production is carried out in devices as described in Chapter 6.
334
Large amounts of spores can be prepared by surface cultivation on liquid media. Massive sporulation in these media takes place on the surface of the so-called mycelial mat. The procedure for production of spores from different fungal species under aseptic conditions was described by Kybal and Sikyta (1986). The method of cultivation in sterile plastic bowls is very simple, and is much more economical than other techniques including submerged culture, because of the large amounts of spores it yields. A decisive role in submerged sporulation is played by medium composition. Good sporulation requires a low level of nitrogen, usually 0.05-0.1% (w/w), and intensive aeration. The lower the aeration intensity, the lower also the necessary nitrogen content. Some fungi, such as Giberella fujikuroi used for gibberellin production, form no asexual spores and vegetative inoculum has to be used instead of spores. The procedure can be improved by mycelium fragmentation in a homogenizer, which affords a considerable number of mycelial fragments as growth centres. The type of the inoculum used and its amount has a substantial effect on mycelial growth and morphology. The mycelium can grow diffusely and in Table 10.2 Effect of spore concentration and medium composition on the morphology of Penicillium chrysogenum in a submerged culture (Camici, Sermonti and Chain, 1952) Medium Cornsteep liquor + dextrin Czapek-Dox Glucose + lactose + ammonium lactate
Spore concentration in medium
0-') above below above below above below
10 10 3 3 2 2
• x x • x •
105 105 105 105 105 105
Morphology filaments pellets filaments pellets filaments pellets
Table 10.3 Effect of mycelium morphology on some industrial microbial processes in fungi (Stanbury and Whitaker, 1986) Process Penicillin Citric acid Biomass Biomass
Microorganism
Penicillium chrysogenum Aspergillus niger Agaricus campestris Fusarium
Optimum morphological form filaments pellets pellets filaments
335
a homogeneous suspension, or in the form of pellets. For a massive spore in oculation the mycelium growth is diffuse whereas at low spore concentrations the mycelium grows in pellets. The effect of spore concentration and the composition of the production medium on the morphology of a Penicillium chrysogenum culture is shown in Table 10.2. The morphological form of the mycelium considerably affects product formation (Table 10.3) and the type of the inoculum used should therefore ensure the development of a suitable morphological form.
Inocula for cultivation of actinomycetes The large majority of industrially important actinomycetes form asexual spores. For this reason spores are used as starting material for inoculation. These spores are usually propagated on a sporulation agar medium. It should be noted, however, that agar can inhibit growth or sporulation, even though the inhibitory effect can be lowered by washing it (Stark and Smith, 1961). The inoculum form (spore concentration) also affects the morphology of the following growth but not, in contrast to fungi, product formation. When vegetative inoculum is used it should be first homogenized in order to obtain a large number of growth centres. Germination of spo~es can be substantially accelerated when the outer fibrous spore coat is disrupted in a disintegrator (Mikulik et al., 1984). The spores are otherwise prepared analogously as in fungi. 10.3.2.
Nutrient media
Medium composition has to correspond to fundamental demands of microorganisms for biomass formation, and has to ensure sufficient energy for product biosyntheses. Considerations of medium compositions are based on an equation which embodies the stoichiometry of growth and product formation" carbon sources + nitrogen sources + other sources biomass + products + carbon dioxide + water + heat
This equation should have a quantitative form; this is important for an economically feasible design of medium composition which keeps the losses of individual components at a minimal level. This approach makes it possible to calculate the minimal amounts of substrates needed for the production of a certain amount of biomass. If the amount of biomass needed for the production of a defined quantity of product is known, we can calculate also the concentrations of substrates for the desired product. However, the biosynthesis
336
requires other medium components and their quantitation is therefore difficult. Quantitation of the above equation hinges on the knowledge of elemental composition of microorganisms (Table 10.4). In addition to principal components, microbial growth requires small amounts of further elements such as Fe, Zn, Cu, Mn, Co, Mo, or B. Analyses of nutrient media often show an excess of P or K and shortage of Zn, Cu, and other trace elements. The concentration of phosphorus in media is usually high in order to ensure sufficient buffering capacity. Table 10.4 Elemental composition of bacteria, yeasts and fungi (% dry mass) Element
Bacteria
Yeasts
Fungi
Carbon Hydrogen Nitrogen Phosphorus Sulphur Potassium Sodium Calcium Magnesium Chlorine Iron
50--53 7 12--15 2.0--3.0 0.2-- 1.0
45
40--63
1.0--4.5
0.5 1.0 0.01 1.0 0.1 --0.5 0.5 0.02--0.2
50 7 7.5--11 0.8--2.6 0.01--0.24 1--4 0.01--0.1 0.1--0.3 0.1 0.5
7 10 0.4--4.5 0.I--0.5 0.2--2.5 0.02--0.5 0.1 1.4 0.1--0.5
0.01 --0.5
0.1 --0.2
Especially vital for product formation is the amount of the carbon source. However, its optimum concentration is difficult to determine because the complete metabolic pathway(s) of the substrate is often not known in detail. Cooney (1979) calculated the theoretical yields for penicillin G biosynthesis from the materials and energy balance of the biosynthetic pathway, based on reaction stoichiometry. The total synthesis stoichiometry is a2 C6H!206 + b2 NH3 + c2 02 + d2 H2SO4 + e2 PAA-~ n2 Pen G + P2 CO2 + q2 H 2 0 where a2, b2, c2, d2, e2, n2,/02, q2 are stoichiometric coefficients and PAA is phenylacetic acid. Solution of the equation yields 10/6 C6Hi206 + 2 NH3 + 1/2 0 2 CO2 + 9 H20
2 -+-
H2SO4 + C8H802
C16HI804N28 +
The theoretical yield from 1 g glucose is 1.1 g penicillin G. If the production process is conducted as a fed-batch culture, then 28 % (w/w) glucose is consumed for biomass formation, 61% (w/w) for maintenance metabolism
337
and 11% (w/w) for penicillin synthesis. Actual penicillin yield is 0.053 g per 1 g glucose, i.e. about 20 times lower than the theoretical yield. The choice of a suitable carbon source should take into consideration the rate at which it is metabolized, because this rate affects biomass formation as well as the synthesis of primary and secondary metabolites. Rapid growth at high concentrations of rapidly assimilated saccharides is often associated with a low production of a secondary metabolite (cf. Section 10.3.3). Regulation mechanisms also have to be respected when selecting a suitable nitrogen source. For instance, the enzyme nitrate reductase, which converts nitrates into ammonium ions, is repressed in their presence. Ammonium ions are therefore preferentially used as nitrogen sources. In fungi, ammonium ions in addition repress in general amino acid uptake, while certain amino acids repress permeases. For all these reasons, the setting up of nutrient media in which a mixture of different nitrogen sources is used has to take into consideration the complex regulation of assimilation of nitrogen sources, and their resulting sequential consumption. The following procedure has been recommended by Nisbet (1982) for selection of a suitable medium" a) set up a series of media with different substrates in growth-limiting concentrations (C, N, P, O); b) replace each substrate which is depleted with another substrate which will not be depleted; c) use polymeric or complex forms of the growth-limiting substrate; d) do not use rapidly assimilable carbon source (glucose) or nitrogen (NH4) which can cause catabolite repression; e) supply a sufficient concentration of important cofactors (metal ions); f) buffer your medium so that p H changes are minimized. It should be borne in mind that the composition of the medium affects also the selection of the bioreactor type. Media for laboratory processes need not be optimal for cultivations in large production bioreactors. Highly viscous media require, for optimum oxygen transfer, higher power input for mixing. Medium composition also affects the value of pH, redox potential, foam formation, necessity to add precursors or metabolic inhibitors, as well as morphology, especially in filamentous microorganisms.
10.3.3
Regulation of secondary metabolite biosynthesis
The term secondary metabolite was introduced by plant physiologists and was applied to microorganisms by Bu'Lock (1961, 1967) who drew a distinction between primary, i.e. essential metabolites and secondary, dispensable ones. The two types of metabolites were also distinguished using other
338 terms such as general and special metabolites (Martin, 1978). Secondary metabolites were also termed idiolites (Walker, 1974) because they are formed in the course of the idiophase (production phase) of a batch culture. Primary metabolism denotes an interconnected series of catabolic, amphibolic and anabolic reactions catalyzed by enzymes converting substrates and intermediates into basic cellular building blocks such as DNA, RNA, proteins, lipids and polysaccharides. Secondary metabolites are produced only by some microbial species and genera in relatively low concentrations. Their structures vary widely. Cells usually produce mixtures of secondary metabolites depending on their genetic equipment and environmental factors. This occurs because, unlike primary metabolic enzymes, their counterparts active in secondary metabolism are not too specific. A characteristic feature of the biosynthesis of secondary metabolites is that they are formed usually at low specific growth rates of the microorganisms. Individual biosynthetic pathways are subject to general regulatory mechanisms such as induction, catabolite regulation and feedback allosteric interaction with the end product. In batch cultures, metabolites are formed usually after the culture growth has terminated. The growth phase is also called trophophase while the production phase is idiophase (Bu'Lock et al., 1975). This division, however, is rather crude because in a number of processes the two phases are not separated and the culture continues its growth, albeit at a lower rate, even during the idiophase. Moreover, one and the same process can exhibit a typical biphasic behaviour or a combination of the two phases depending on medium composition and cultivation technique. For instance, if the medium for penicillin production contains two carbon sources assimilated at different rates, the production of the antibiotic sets in after mycelial growth, whereas with a continuous feed of a single carbon source the mycelial growth and penicillin production proceed in parallel (Sikyta, 1983). A single-phase or two-phase course of the process is thus dependent on process arrangement and culture mode. In view of the above facts the term "excessive metabolites", coined by Van6k et al. (1973), appears to be justified. Modern biosynthetic processes are longterm cultivations and should be arranged so as to permit a concomitant growth and production of a secondary metabolite; therefore, both growth rate and product synthesis should be regulated. Regulation of secondary metabolism can in principle be divided into three levels: a) Regulation by primary or secondary metabolites which function as precursors, inducers, effectors and regulatory signals. b) Regulation by environmental factors, i.e. medium composition -sources of carbon, nitrogen, phosphorus, metal ions and oxygen.
339
c) Regulation on the level of secondary metabolic pathways such as feedback regulation and formation of autoregulatory and autotoxic substances. 10.3.3.1
E f f e c t of p r i m a r y m e t a b o l i t e s a n d i n t e r m e d i a t e s on secondary metabolism
Although the mechanisms of induction of enzymes of secondary metabolism are not exactly known we can present some criteria which point to such regulations. Induction of secondary metabolism should be demonstrated only when the effector molecules are added prior to the synthesis of the secondary metabolite, i.e. in the course of the growth phase. Primary metabolite should stimulate product biosynthesis in a way different from the stimulation caused by a precursor. In addition, non-metabolizable structural analogues of an efo fector should be able to substitute for the effector molecule in the stimulation of secondary metabolism. As all regulatory phenomena are concentration-dependent, a rise in the level of pool of effector metabolites or their derivatives can be expected to occur shortly before the appearance of secondary metabolic enzymes. The stimulatory effect of tryptophan on the biosynthesis of ergoline alkaloids by Claviceps used to be attributed to its effect as precursor. Later it was proved that tryptophan is an inducer of at least one (dimethylallyltryptophan synthetase) and probably more enzymes necessary for the synthesis of the alkaloids. Tryptophan analogues, which fail to be incorporated into the alkaloid molecules, also stimulate alkaloid production. Stimulation of biosynthesis by tryptophan requires that the amino acid be added into the culture during the growth phase, although the synthesis takes place later (Drew and Demain, 1977). A similar situation is with the stimulation of cephalosporin C biosynthesis by methionine. Here also, the stimulation occurs only when methionine is added to the culture before the actual antibiotic synthesis. Methionine also affects the morphology of the production strain by inducing the formation of more numerous arthrospores. A similar effect, i.e. fragmentation of mycelium to arthrospores, was observed with norleucine, although this amino acid contains no sulphur in its molecule. In streptomycin biosynthesis, mannans affect the conversion of mannosidostreptomycin to streptomycin by inducing a-D-mannosidase. End-products of primary metabolic pathways, which are feedback regulated, are often used as precursors in the biosynthesis of secondary metabolites. The direct precursor of the dihydrothiazine ring in penicillin synthesis by Penicillium chrysogenum is valine. It can therefore be expected to regulate the synthesis by controlling the first enzyme of the synthetic pathway, viz. valine synthetase of the acetohydroxy acid. In high producing strains, this en-
340
zyme was found to be less sensitive to the feedback inhibition by valine than in low producing ones. A similar pattern was found in the production of pyrrolnitrine by low-production strains of Pseudomonas aureofaciens, where tryptophan is necessary as a precursor and the endogenous synthesis of tryptophan is seen to be finely regulated. Mutants resistant to 5-fluoro- or 6-fluorotryptophan do not require tryptophan because they are insensitive to the feedback inhibition by this amino acid. The overproduced tryptophan is then incorporated into the antibiotic molecule. A variety of secondary metabolic pathways participate in the production of primary metabolic pathway intermediates. In these cases we may expect that the feedback regulation of the first enzyme by a primary end-product will lower the production of the secondary metabolite. Although lysine does not participate in penicillin synthesis as a precursor, a-aminoadipic acid, which is an intermediate in its biosynthesis, is the first step in peptide production in penicillin biosynthesis. Lysine is commonly known to lower the biosynthesis of penicillin; a-aminoadipic acid not only eliminates this inhibitory effect, but actually stimulates penicillin production even in the absence of lysine. Inhibition of penicillin production by lysine is the result of a feedback inhibition of the first enzyme of lysine biosynthesis, homocitrate synthetase (Masurekar and Demain, 1972). The activity of the enzyme is obviously very important in the production phase, dropping markedly towards its end. A similar regulation scheme holds for the production of candicidin in Streptomyces griseus. The end-products of the metabolic pathway are amino acids important for the synthesis of p-aminobenzoic acid, a candicidin precursor. In this case the feedback regulation apparently affects the conversion of erythrose-4-phosphate and phosphoenolpyruvate to 7-phosphate-fl-deoxy-Darabinoheptulosonoic acid. 10.3.3.2
R e g u l a t i o n of s e c o n d a r y m e t a b o l i s m by c a r b o n , n i t r o g e n and p h o s p h o r u s s o u r c e s
Regulation of secondary metabolism by carbon catabolism The ubiquitous repression or inhibition of catabolic enzymes by rapidly utilized carbon sources occurs also in secondary metabolism (Demain, 1982). Glucose, which is an excellent source of carbon and energy for microbial growth, is only rarely used as the main carbon and energy source in the biosynthesis of secondary metabolites because, like other rapidly metabolized carbon sources, it represses their biosynthesis (Table 10.5). Catabolite repression. The medium used for actinomycin biosynthesis by Streptomyces antibioticus contains 0.1% (w/w) glucose and 1% (w/w) galac-
341 Table 10.5 Secondary metabolites whose production is repressed by glucose Secondary metabolite
Nonrepressing carbon source
Microorganism
Actinomycin Bacitracin Cephalosporin Chloramphenicol Enniatin Indolemycin Kanamycin Neomycin Penicillin Prodigiosine Puromycin Siomycin Streptomycin Violacein
galactose citrate sucrose glycerol lactose fructose galactose maltose lactose galactose glycerol maltose mannan maltose
Streptomyces antibioticus Bacillus licheniformis Cephalosporium acremoniurn Streptomyces sp. Fusarium sambucinum Streptomyces griseus Streptomyces kanamyceticus Streptomyces fradiae Penicillium chrysogenum Serratia marcescens Streptomyces alboniger Streptomyces sioyaensis Streptomyces griseus Chromobacterium violaceum
tose; the antibiotic synthesis does not take place until glucose has been exhausted. As shown by Gallo and Katz (1972) the formation of phenoxazine synthetase, which participates in the antibiotic synthesis, is repressed by glucose but not by galactose. The synthesis of the enzyme is repressed also by other rapidly assimilated carbon sources. A similar phenomenon was observed also in puromycin biosynthesis in which o-demethylpuromycin transferase, apparently the terminal enzyme of puromycin biosynthesis, is subject to catabolite repression (Pogell et al., 1976). In the novobiocin producer Streptomyces niveus, catabolite repression is caused by citrate but not by glucose. When the medium contains a mixture of glucose and citrate, the first to be depleted is citrate, and antibiotic production commences only after its exhaustion (Kominek, 1972). In kanamycin biosynthesis in Streptomyces kanamyceticus, several carbon sources cause catabolite repression by repressing the terminal biosynthetic enzyme, N-acetylkanamycin aminohydrolase. A similar repression was found with mannoside streptomycinase in the biosynthesis of streptomycin and with C-acylhydrolase in cephalosporin C synthesis. Readily utilizable carbon sources permit a rapid growth of microorganisms but, generally speaking, repress the synthesis of secondary metabolites. Catabolite inhibition. In some cases, glucose or other carbon sources cause inhibition, rather than repression, of enzymes of secondary metabolism. It is sometimes difficult to distinguish between the two processes because the enzyme can be degraded and resynthesized. It has been known for many years that, in the biosynthesis of fl-lactam antibiotics, glucose is rapidly depleted in
342
the course of the growth phase whereas sucrose is consumed slowly in the production phase, and the concentration of antibiotic produced on sucrose is therefore higher. Low glucose concentrations ensure higher antibiotic yields than high glucose levels in the medium, apparently owing to inhibition of presynthesized enzymes.
Regulation of secondary metabolism by nitrogen catabolism Catabolite regulation of primary metabolism by nitrogen includes repression of enzymes by readily assimilated nitrogen sources (urease, histidinase, proteases, nitrate reductase, etc.). As with carbon sources, slowly assimilated nitrogen sources are more suitable for biosynthesis than fast assimilated ones (Aharonowitz, 1980). One of the reasons for the ever increasing use of soybean and peanut flour in antibiotic synthesis has probably been the fact that their hydrolysis to amino acids or ammonium nitrogen is very slow. Differences also exist between the rates of consumption of individual amino acids; those whose assimilation is slow are again suitable as substrates for biosyntheses. The synthesis of trihydroxytoluene by Aspergillusfumigatus is also regulated by nitrogen catabolism, since the product appears in the culture only after nitrogen depletion, and addition of ammonium ions completely inhibits the production (Ward and Packter, 1974).
Regulation of secondary metabolism by phosphate The synthesis of a number of secondary metabolites is inhibited by inorganic phosphate in concentrations which are optimal, or at least not inhibitory, for growth (Martin, 1977). This inhibition is conspicuous in the biosynthesis o f a number of antibiotics and ergot alkaloids. For instance, chlortetracycline biosynthesis in a batch culture sets in only after phosphate exhaustion. The mechanism of inhibition is assumed to involve regulation by ATP or the energy charge. At a high phosphate concentration the intracellular ATP synthesis may increase, leading to a high energy charge in the cell. Janglovh, Such3~ and Van6k (1969) found that both a low-production and a high-production strain of Streptomyces aureofaciens exhibit a fast increase in ATP level during growth and its drop to a low level in the production phase. The lowproduction strain was found to maintain a 2- to 4-fold higher ATP level as compared with the high-production one. In the case of candicidin biosynthesis, addition of phosphate causes an instantaneous increase in ATP level; phosphate is assumed to inhibit the activity of candicidin synthetase. Higher concentrations of inorganic phosphate completely inhibit alkaloid biosynthesis in Claviceps and were found to re-
343
press the first enzyme of the biosynthetic pathway, chanoclavine cyclase (Krupinski, Robbers and Floss, 1976). Derepression of phosphate inhibition is brought about by tryptophan or its analogues. Inhibition by phosphate was observed also in streptomycin biosynthesis but its mechanism is different. Phosphate inhibits phosphatases which take part in the antibiotic biosynthesis. The biosynthesis involves the hydrolysis of at least three phosphate bonds and the ultimate enzymic step is the cleavage of phosphate from streptomycin phosphate (Walker and Walker, 1971).
10.3.3.3
R e g u l a t i o n of b i o s y n t h e s i s of s e c o n d a r y m e t a b o l i t e s by s t i m u l a t o r y , a u t o r e g u l a t o r y and a u t o t o x i c c o m p o u n d s
Antibiotic biosynthesis is stimulated by low concentrations of externally added substances of widely varying structure and with unknown modes of action. Thus barbiturates have a stimulatory effect on the biosynthesis of rifamycin and anthracyclines (Lancini and White, 1973; Kr~lovcov~, Blumauerov~ and Van6k, 1977) without being precursors. They are effective only when added to a batch culture in the early stages of cultivation. Their regulatory effect on rifamycin biosynthesis derives from the activation of the enzyme system transforming rifamycin SV to rifamycin B. Analogous effects of barbiturates on the biosynthesis of anthracycline antibiotics (galirubine in Streptomyces galileus) were observed, probably due to the activation of enzymes hydroxylating aclavinone. The biosynthesis of tetracycline antibiotics is stimulated by several compounds such as benzylthiocyanate, the effect being stronger in low-production strains than in high-production ones. The production is stimulated if the agent is added to the culture before cultivation hour 12. Among autoregulatory agents, the best known is factor A, i.e. 2-S-isocapryloyl-3-R-hydroxymethyl-?'-butyrolactone, which stimulates the biosynthesis of streptomycin (Khokhlov and Tovarova, 1972) by the mechanism shown in Figure 10.2. This factor is synthesized by all strains of Streptomyces griseus, i.e. both industrial and nonproduction strains. Mutants incapable of synthesizing streptomycin do not synthesize factor A. If factor A is added in a very low concentration during medium inoculation, it induces antibiotic production in mutants blocked in the production; addition at a later stage, i.e. after 48 h, has no effect. An autoregulatory compound is also produced by Streptomyces virginiae during virginiamycin biosynthesis (Yanagimoto and Terui, 1971). The substance is formed shortly before the onset of antibiotic synthesis and is excreted from the cells. Addition of virginiamycin inhibits the synthesis of the stimulatory agent.
344
Among autotoxic substances are antibiotics which control the synthesis of the same antibiotic in the producer strain by inhibitory mechanisms. This phenomenon was described for a number of antibiotics (Martin and Demain, 1980). The process appears to involve mostly inhibition of appropriate synthetases which play a role in the production phase. Inhibitory concentrations of externally added antibiotics depend on the levels of antibiotics produced by factor A O~(CH2)uCH~ gtucose gtucose-6-!hosphofe frucfose-6-phosphate
0
Ii 0
CH3 CH3
=---6-phosphogiuconafe
gtucose-l-phosphQfe inosifob-l-phosphafe
pe ose
g ucosamine-6-posphae fhimidinediphosphafe N-methyl-L!gtucosomine
stgrl~p']'f~
\
I
0~
/
NH
C=NH~
1__5 I
H3
OH I
OH
HO(cH2OH~ '
OH Fig. 10.2 Effect of factor A on streptomycin biosynthesis (Khoklov and Tovarova, 1972)
the strains. For instance, the inhibitory concentration of penicillin for a highproduction strain of Penicillium chrysogenum E-15 is 15 mg ml-', in strain Q 176 which produces 420 ~tg penicillin per 1 ml it is 2 mg ml-', and in strain NRRL 1951 producing 125 ~tg penicillin per 1 ml it is 200 gg ml-' (Gordee and Day, 1972). One of the selection methods for overproducing strains is therefore cultivation at a high concentration of the antibiotic in a selection medium. This procedure selects mutants whose synthetases are obviously insensitive to inhibition by the antibiotic.
345
10.3.4
Laboratory and pilot-plant process
Development of an industrial microbial process proceeds in three stages: elaboration on the laboratory scale, scale-up to pilot plant, and a final adjustment and introduction into the production scale.
Laboratory process Laboratory research and development activities involve the following tasks: a) Elaborating the cultivation of the production strain and its propagation on solid media, and ensuring its stability during vegetative and spore transfers. b) Setting up and verifying a suitable composition of inoculation and production media, taking into account the prices of individual raw materials and product yield. e) Elaborating a suitable technique of laboratory cultivation of the production strain including physical, chemical and biological environmental factors and their optimization. The culture conditions for a particular strain, i.e. medium composition, culture temperature and time form an integral system which cannot be mechanically transferred to another strain, and can no longer be considered optimal when culture conditions change. A suitable method of production strain preservation can be verified only by studying the stability of the strain in long-term experiments. Each type of preserved stock cultures should be available in sufficient amounts even when the strain with optimal production has not yet been selected and preserved. This procedure should ensure the availability of standard inoculum for a sufficiently long period and, at the same time, long-term evaluation of strain stability and the suitability of its storage and preservation methods. Medium composition should be determined in early stages of the research, and should primarily guarantee reproducible results. Reproducible results are based on uniform suitable quality and quantity of raw materials and on a suitable technique of medium preparation (sterilization, etc.). The following research phase includes detailed studies of medium composition which aims at determining quantitative proportions of individual medium components and maintaining their correct proportions in the course of the process. Apart from productivity, the suitability of composition of an industrial medium is given by several factors: availability and prices of raw materials, sterilizability, demands for cost-effective isolation and product purification.
346
The production of some metabolites can be adversely affected by the presence of certain metals and the selection of suitable construction materials for bioreactors should therefore be given considerable care. To acquire preliminary information about the suitable materials, laboratory cultivations are either performed in flasks fabricated from the materials to be used, or metal plates are inserted into the flasks in such a way that their surface area corresponds to the proposed surface area/medium volume in the bioreactor. However, the presence of the plates alters medium aeration and mixing relations and thus also the course of the cultivation. As a control, glass plates of the same size are therefore placed in parallel into identical culture flasks. Table 10.6 shows the effect of different materials on streptomycin biosynthesis. When plates metallized by aluminium or coated with a polyamide resin are used, the production equals that observed with glass plates, whereas other materials may cause considerable yield drop (60 % with tin-plated plates) or a complete inhibition of the antibiotic production (zinc-plated plates).
Table 10.6 Effect of different materials on streptomycin biosynthesis (Sikyta, 1983) Surface layer Glass (control) Aluminium metallizing Stainless steel metallizing Brass metallizing Zinc metallizing Copper metallizing Tin plating Phosphatidized Rubber coating Polyamide resin coating
Streptomycin production (% control) 100 100 28 18 0 15 60 47 45 109
The above scheme forms the basis for the elaboration of a tentative laboratory process. Following its successful termination a detailed analysis is performed of all factors crucial for product yields. This cyclic arrangement of research work is universally employed for the elaboration of the production technology of each product. The immediate task of the laboratory process is to obtain a sufficient basis for process scale-up to the production scale. Trials performed in flasks on shakers provide basic information about the production strain, medium composition, suitable type of inoculum, etc., but they yield meagre information concerning the technological factors such
347
as the bioreactor design, aeration, mixing, process measurement and regulation. All these factors are crucial for the production-scale process but the relevant data can be obtained only in laboratory and pilot-plant bioreactors.
Pilot-plant process As stated above, the primary task of laboratory cultivations is to achieve reproducible results, and the same holds true for laboratory and pilot-plant bioreactors. At the beginning of the work the absolute production magnitude is not of primary importance, the main stress being laid on the reproduction of a standard course of the microbial process with expected changes in growth rate, pH, nutrient consumption, metabolite production and the physiological state of the microorganisms. Only when reproducible results have been achieved can individual optimum conditions be sought. The first concern is with aeration and mixing, followed by the effect of changes in the content of individual medium components, especially carbon and nitrogen sources, and their ratio. In parallel, tests are performed with different types of defoamers and their various concentrations, which can affect air dispersion in the culture and thus microbial respiration. Some defoamers, such as plant oils and animal fats, can be utilized by the microorganisms. This alters culture metabolism, p H, and the course of the whole process. Other factors to be studied are also important for pilot plant and production processes. Among these factors are the increase in the inoculation culture volume, amount of spores or vegetative inoculum, and their propagation in several stages. A sufficient amount of inoculum is usually attained in a twostage or three-stage cultivation in which the volume of the medium in each following stage is appropriately increased. The inoculum from the last stage should have a high quality to ensure a satisfactory product yield in a short period. These trials again include examination of medium composition. The sufficient amount of inoculum acquired in the inoculation bioreactor can then be used to inoculate sterile medium in a production bioreactor. The inoculum transfer is performed under sterile conditions using some of the systems illustrated in Fig. 10.3. During inoculation and subsequent cultivation the contents of the bioreactor are aerated and mixed; the volume of air passing through the culture is usually in the range of 0.1 to 1 air volume per minute per culture volume. Aeration intensity depends on a number of factors such as the impeller size and shape, its speed, number and size of baffles and medium composition (viscosity). These factors are tested one by one. When suitable conditions prevail after inoculation, the microorganisms begin to reproduce and the pH changes spontaneously from values optimal for rapid growth to values optimal for product biosynthesis. Any irregularity
348
in the process leads to a disturbance of the balance between aeration, mixing and medium composition. In a batch culture, the lag phase takes up 15 to 30 % of the time necessary for maximum product formation. If the product formation is not associated with growth the maximum yield is attained 15-20 h earlier. For instance, penicillin production during its biosynthesis sets in 15 to 20 h after inoculation and the maximum penicillin level is reached after 70 to 75 h. Extended culture time is often economically unsuitable. The design of an optimum cultivation procedure has to include a careful consideration of economics both as concerns the process yield and the necessary cultivation time.
4
5
ILl ~y
1
6
Fig. 10.3 Systems for the transfer of inoculum into the bioreactor (a) inoculation of a production-scale bioreactor by spore suspension, (b) inoculation of production-scale bioreactor from a seeder bioreactor unit; 1 - - steam inlet, 2 - - sterile air feed, 3 - - spore containing vessel, 4 - - seeder bioreactor, 5 - - production bioreactor, 6 - separator
As a rule, the optimum ct~lti\:~tion temperature, which depends on the type of the microorganism, should be kept constant but cases have been described when different temperatures were used for different phases of growth and product formation. The optimum temperature for cultivation of fungi is 24 to 28 ~ for most actinomycetes 25 to 30 ~ and for bacteria 28 to 37 ~ Thermophilic microorganisms, which are beginning to be used for production purposes, have optimum growth temperatures 40 to 70 ~ The advantage of
349
cultivation of thermophilic microorganisms is a considerable saving of cooling water and a reduced sensitivity to contamination by foreign microorganisms. Medium composition has to be monitored during the cultivation and the concentrations of individual components have to be adjusted to optimal levels. Appropriate adjustment of medium components also ensures the required course of culture pH, otherwise the pH has to be adjusted by adding acids or bases to the culture. Measurements and tests used to check the course of the cultivation are of two types (Sikyta, 1983): a) measurement and monitoring of culture parameters (temperature, aeration, mixing, defoaming); b) monitoring of culture development by microscopic methods (microscopic staining, flow cytometry, etc.). The course of the cultivation is judged by the changes in culture composition (nutrient consumption, metabolite production) and by the rate of synthesis of a given product.
Scale-down
The scale-up from the laboratory to the pilot-plant level brings a number of problems reflecting not only the difference in volumes but also different technologies used for different process scales. Processes elaborated in the laboratory need not be fully reproducible and product yields may well be lower in the pilot plant that in the laboratory. The main differences between laboratory and pilot-plant technology are in the methods of culture aeration and mixing, medium sterilization, inoculation, foam formation and breaking and the construction materials used. Literally hundreds of cultivation trials can readily be performed in the laboratory while repetition of experiments in bioreactors is rather limited. To be able to reproduce laboratory results in bioreactors in the shortest possible time, the reasons for differences in yields have to be established. This is often done in scale-down experiments beginning with bioreactors and ending up in culture flasks, with simultaneous control of factors in which the two types of cultivation differ. The necessary prerequisite for successful scaledown experiments is a good reproducibility of results in both systems;this is usually achieved by using the same raw materials, chemicals and water. In addition, the experiments have to be carried out in the same culture device at all times. Differences between the laboratory cultivation procedure and the bio-
350 Table 10.7 Differences between culture conditions in flasks and in bioreactors (Sikyta, 1983) Process step
Difference in
Bioreactor
Flask
Apparatus
construction material
glass
stainless steel
Medium preparation
procedure
manual mixing
impeller
Medium sterilization
procedure
autoclave (without agitation)
agitation
Inoculum
time of growth under different culture conditions
Cultivation
aeration and mixing, defoaming
reactor process are listed in Table 10.7. These differences form the basis for setting up the protocol of a scale-down experiment" 1. Standard laboratory procedure. 2. Control of medium preparation" the medium is prepared in the bioreactor, sterilized in the laboratory (in an autoclave) and seeded by an inoculum prepared in culture flasks on shakers. 3. Control of medium sterilization: the medium is prepared and sterilized in bioreactors and inoculated by inoculum prepared in culture flasks on shakers. 4. Control of inoculum prepared in a bioreactor: the medium is prepared and sterilized in the laboratory (in an autoclave) in flasks, and is seeded by inoculum prepared in a bioreactor. 5. Control of the cultivation process" medium is prepared and sterilized in bioreactors and seeded by an inoculum prepared in a bioreactor. The culture is collected from the bioreactor at regular intervals and is further cultured in flasks on shakers. These experiments may yield, for example, the following results: Stage Production (%)
1
2
100
100
3 60
4
100
5 60
The results indicate that the lower product yields achieved in bioreactors are due to differences in medium sterilization; sterilization of medium in the bioreactors is thus the step which has to be tested and improved. The usual procedure is to measure the time necessary for medium sterilization and sterilization temperature. If the sterilization proceeds batchwise in a central medi-
351
um sterilizer, samples from the sterilizer are taken in the course of the sterilization, inoculated and cultivated in flasks on shakers. A similar procedure is adopted when the drop in product yields is caused by other factors, such as differences in inoculum preparation. Samples are collected from inoculum growing in an inoculation bioreactor and are then used for seeding medium in culture flasks on shakers. Lower product yields in bioreactors may be due to an interplay of several factors, or the yields in all experimental variants may be lower than in a standard laboratory procedure. In these cases it is necessary to check other factors such as foam formation and breaking. The scale-down method can also be used to determine consequences of failures that may occur in production bioreactors: aeration and mixing failure, fluctuations in culture temperature, sudden changes of pH, etc.. These problems can be simulated in laboratory or pilot-plant bioreactors and their effect on product yield can be analyzed.
10.4
ELABORATION OF PROCEDURES FOR RECOMBINANT MICROORGANISMS
Methods of genetic manipulation have yielded industrially important microorganisms producing animal proteins. These microorganisms differ from all conventional microorganisms in genetic stability and nutritional requirements. In addition, products obtained from recombinant eukaryotic or prokaryotic microorganisms differ considerably in their character (glycosylated -- nonglycosylated), product secretion and production of pyrogens. All these factors markedly affect the method of product isolation and thus also process costs. Efforts have been focused on acquisition of recombinant microorganisms secreting products into the medium. This would facilitate product isolation because it is possible to avoid cell breakage, which, moreover, liberates a number of proteins complicating product isolation. The production ability of most recombinant microorganisms, both prokaryotic and eukaryotic, is associated with the presence of plasmids in the cells. Plasmid stability, i.e. the continued presence of the plasmids in the cell, is crucial for the presence or absence of synthesis of a given product. This concerns not only products of the type of peptide hormones and interferons, but also enzymes, antibiotics and other industrially important substances. Plasmid stability in the cells depends on medium composition (growth limiting factors), temperature, growth rate, plasmid size and copy number, and on the mechanism of their replication.
352
The most common recombinant microorganisms are Escherichia coli and Saccharomyces cerevisiae; this is because they are genetically and physiologically the best-studied organisms. Other frequently used recombinant microorganisms belong to the genera Bacillus and Streptomyces which have been used for decades for the production of a multitude of products. The problem with recombinant microorganisms from these genera is that the recombinant proteins produced are often degraded by proteases produced by the host strain.
10.4.1
Regulation of expression of recombinant genes
Expression of plasmid genes can be either constitutive or else is regulated in dependence on the promotor used. Each expression system has its strong and weak points. Constitutive systems are simple with respect to the culture process. The synthesis of the product need not be induced by the addition of an inducer, or triggered by temperature shift-up or shift-down. On the other hand, constitutive production of a recombinant protein can interfere with cell growth, reducing thereby the specific growth rate or even causing cell death. Plasmid expression can bring about an increased segregation instability due to which recombinant strains are gradually replaced by plasmid-free variants. Despite these problems, constitutive systems have been used for the production of a number of recombinant proteins (Bernard and Helsinki, 1980; McCalleer et al., 1984). Problems associated with constitutive plasmid expression can be alleviated by using a regulated expression system. The culture strategy for this system consists in letting the cells grow to high concentrations under conditions when the plasmid replication proceeds without recombinant gene expression. In such systems the plasmids are more stable and the differences between the growth rates of plasmid-harbouring cells and plasmid-free ones are minimal (Caulcott et al., 1985). When the high cell concentration has been achieved, then the expression of a given product takes place, depending on the nature of the promoter, after the addition of an inducer, depletion of an inhibitor or corepressor, or following a temperature shift.
10.4.2
Plasmid stability
An important factor in the scale-up of processes utilizing recombinant microorganisms is the stability of the plasmid used. Plasmid instability can be divided into two categories" segregation and structural instability. Segregation instability is defined as a complete loss of plasmid due to defects in the course of cell division. Structural instability is a change in plasmid structure resulting
353
from insertion, deletion or nonsense mutation of plasmid DNA and leading to a loss of the function of the cloned gene. The study of plasmid stability was initiated by chemostat experiments performed under growth limitation by different factors and involving plasmids coding for the resistance to several antibiotics. The resistance to individual antibiotics was found to be lowered or lost depending on the type of the limiting nutrient. The rate of resistance loss was also found to differ with different conditions; this points to a clear effect of environment on plasmid stability. Furthermore, different plasmids exhibit different stability in the same host cell, indicating that the instability can be a function of plasmid structure. Caulcott et al. (1985) studied the stability of several plasmids coding for the synthesis of Met-prochymosin in E. coli. Problems with stability appeared when intermediate numbers of plasmid copies (40 to 60 copies per host chromosome) were used. The instability was caused by unregulated production of Met-prochymosin. Pinches, Louw and Watson (1985) investigated the stability of the plasmid coding for the production of a-amylase in Bacillus subtilis in complex media supplemented with glucose or starch in the presence and absence of antibiotic selection. The plasmid loss in the exponential growth phase was negligible in the absence of the antibiotic selection, both with glucose and with starch. In the stationary phase, however, the plasmid elimination increased sharply, reaching 70 %. The rate of plasmid elimination depended on the type of the carbon source, being faster with glucose than with starch. Plasmid loss under these conditions was perceptible even in the presence of antibiotic selection. The catabolite plasmid TOL coding for toluene and xylene utilization was studied in a continuous culture of Pseudomonas putida. The cells grew on m-toluate, then on succinate or benzoate. Whereas no plasmid elimination was observed after transfer to succinate even after 600 h of continuous growth, transfer to benzoate caused a 98 % plasmid loss after only 100 h (Keshavarz, Lilly and Clarke, 1985). Plasmid stability was studied also in the yeast Saceharomyces cerevisiae (Futcher and Cox, 1984). Plasmids derived from the 2~-circle plasmid exhibited different stability; systems with higher copy numbers were more stable than systems with lower copy numbers but their use led to lower values of ~tm,~. Interestingly, cells with plasmids had a selective advantage over plasmid-free cells and the stability increased with increasing growth rate. There are very few data on plasmid stability during cultivations in large bioreactors. A recombinant strain of E. coli was found to secrete large quantities of fl-lactamase and, at the same time, to degrade rapidly ampicillin present as a selection factor in the medium. Following a complete degradation of ampicillin the plasmids disappeared from the population and plasmid-bear-
354
ing cells were quickly replaced by plasmid-free ones which had a higher growth rate. The problem was resolved by inoculating the medium in the bioreactor by a very small inoculum (0.3 gl per 300 1). These data can be summarized by saying that plasmid stability is a genetic function of the plasmid and is significantly affected by the genetics and physiology of the host cell. Different plasmids in the same host can exhibit different stability while the same plasmid can display different stability in different hosts. The stability of the plasmid is also affected by growth conditions and the nature of the growth limiting factor, the largest lowering of stability being found when the growth is limited by phosphorus. Plasmid stability depends also on the cell growth rate. The stability of plasmids can to a certain extent be retained by using selection pressures; however, their implementation under large scale production conditions is not simple. 10.4.3
M o d e l l i n g of recombinant cultures
A model for the growth of cells containing an unstable recombinant plasmid was described by Imanaka and Aiba (1981) and generalized by Ollis and Chang (1982). Let Pbe the probability that a single cell loses plasmid after one generation. The growth of cells with (X § and without (X-) plasmid can be described by the Monod equation modified by the probability factor dX + S + + dt - /~maxX K+ S (1dXdt
S K+ S
-- ,/./max x -
+ + -I- ,t/maxX
P)
S K+ S
[10.1]
P
[10.2]
where K is the half-saturation constant and S is substrate concentration. Product formation associated and unassociated with growth is defined by the equation derived by Luedeking and Piret dP dt
-
AX
+ +
B
dX + ~ dt
[10.3]
The substrate balance is then given by the equation dS dt
1 dX Y dt
+
[10.4] dt
Simulations obtained by solving these equations are illustrated in Fig. 10.4, where X0 is the X - / X ~ ratio during inoculation. These results are in keeping with the experimental data showing that inoculum with a high concentra-
355
tion of cells of a given phenotype ensures the highest productivity in the absence of selection pressure. Kim and Ryu (1984) derived an equation for the ratio of plasmid-free and plasmid-harbouring cells
x-
x +-
2~o -
t ( ll x0- +
~
o-
2-0-
t ~_ti ~
[lo.5]
where cr is the number of plasmid-free cells ( - ) derived from plasmid-containing cells (+) per 1 generation, i.e. the so-called segregation coefficient. 0 2O r
.s 4,-
0.25
L.4.-
=15 Q,I
tO
/0.50
.4-t,,.a
1.0
-~10 0 c,_
Xo
0
10.4.4
l
4
8 --~- time (h)
12
1
16
Fig. 10.4 Effect of cell concentration Xo in inoculum on product formation (Ollis and Cheng, 1982). Curves are drawn in a dimensionless form on the assumption that production is, and is not, associated with growth according to the Luedeking-Piret model
Cultivation strategies for recombinant microorganisms
The criteria used in elaboration of procedures for cultivation of recombinant microorganisms are essentially identical with the criteria for other cultivations; high volumetric productivity, high product and/or cell concentration, high yield referred to substrate, high selectivity, low material costs and high growth rate. The results of earlier studies concerning the achievement of the highest possible concentrations of cells, e.g. Escherichia coli, are still valid (Bauer and Shiloach, 1974). These authors cultured E. coli in a semisynthetic medium; the medium pH was adjusted by NH3 and pure oxygen was used to maintain oxy-
356
gen concentration above the growth-limiting level. Glucose was supplied batchwise following a sudden increase in dissolved oxygen indicating glucose exhaustion. Maximum cell concentration was 38 g 1-~ referred to the initial culture volume in the bioreactor; this corresponded to a final cell concentration of 26 g 1-~ referred to the volume increase owing to NH3 and glucose additions. 3 000
3 -
{ --2000
llJ c_
.s
.._.. o
._c
QJ
.s
E 2
._c
r - -
1 200 ~ tZl
E
u
r
1
0
t I r-
I 4O I
- 100
o c_
\\
r
~r a0 E
~=
-50
x o
\ \ \
Q/
120 0
o
--
1
5
I
time (h)
10
15
0
.-~
t
Fig. 10.5 Cultivation of Escherichia coli for high cell concentration (Bauer and White, 1976). G l u c o s e supply rate (arrows) was changed in a constant relation to the addition of pH-regulating alkalies, up to the m a x i m u m rate of oxygen transfer. Subsequently both the growth rate and the o x y g e n consumption rate were regulated by temperature decrease
An automated system with sucrose dosage regulating the concentration of dissolved oxygen gave yields of 42 g 1-~ at a 15 % saturation (Gleiser and Bauer, 1981). Still higher concentrations of cells, 55 g 1-~ referred to the initial and 35 g 1-~ referred to the final culture volume in the bioreactor, were achieved when the glucose dosage was kept constant relative to ammonia (15 g glucose/g NH3) and the pH was kept at 6.8. A similar procedure was used in cultivations of Pseudomonas ~uorescens, Aerobacter aerogenes and four strains of E. coli. Extension of the growth phase can be achieved by
357
maintaining the dissolved oxygen concentration above the limiting level via decreasing the cultivation temperature (Fig. 10.5). This system yielded concentration of bacteria 47 g 1-i within 12 h. Luli, Gordon and Allen (1985) reported on a fed batch culture system using E. coli AC 80pAS 621 in which a cell concentration of 100 g l -~ was attained after 14 h. The system used a continuous feeding of glucose and magnesium sulphate and a periodic dosage of a nitrogen source. All these high yields of E. coli cells were obtained at growth rate values below #max. A batch-fed culture of Candida brassicae on ethanol yielded 128 g 1-~ (Su-
1 o
7O
7
-- 700
60-
6
600
50 -
5
500 !
4
400 E
- 3
- 3 0 0 a.J~'
'7 r
2 '~ E "30 ..,.-,. %....
F
~20
l
I 10 0
4.t-
----
._~ 200 ~
-2
r
100
-1
0
10
20
30 time(h)
I 40
9OOl o ~ 50
,0 60
_
t
0
Fig. 10.6 Production of a-interferon by Escherichia coli (Fieschko and Ritch, 1985). Glucose supply rate was used to limit the specific growth rate in the range 0.10 to 0.14 h-~. Formation of the recombinant product was induced by increasing temperature above 30 ~
zuki et al., 1985). To shorten the lag phase and increase yields, ethanol as carbon source was supplied in such a way that its concentration was maintained at 4 g 1-~, pH was kept at 5.5 by feeding NH4OH into the system and the concentration of dissolved oxygen was kept at 2.5 ppm. A concentrated solution of salts was added in proportion to the rate of ethanol or NH4OH dosage. A similar technique was used in the production of a recombinant protein by E. coli. Muth (1984) obtained high concentrations of bacteria in the production of human insulin from E. coli trp- with the regulation of the trpE
358
promoter. The techniques of temperature regulation and glucose dosage were found to be equally effective to support cell growth and a high yield of the insulin A chain, and to prevent growth limitation by oxygen. It was also proved to be more convenient to culture uninduced bacteria in the presence of tryptophan than induced cultures in the absence of this amino acid. The induction following culture growth, and caused by tryptophan depletion, led to higher biomass concentration and insulin yield as compared with cells induced during growth. Fieschko and Ritch (1985) used a batch-fed system for production of human interferon (Fig. 10.6). The rate of glucose supply was periodically adjusted so that the specific growth rate was in the range 0.10 to 0.14 h-~; this prevented acetate formation up to the maximum rate of glucose addition. The cell concentration at 30 ~ was 30 g 1-~ within 38.5 h. At this stage the culture was induced by increasing temperature to 42 ~ and the yield rose to 65 g 1-~ biomass and 5.5 g 1-~ interferon without measurable acetate concentrations. It can be stated that the concentrations of microorganisms that can be attained in batch-fed cultivations using different dosage methods are >40 g I -~. Aeration by oxygen-enriched air is necessary only when a productivity > 4 g 1-~ h -~ is to be achieved. An unlimited growth leads to the production and accumulation of glycolytic intermediates (ethanol, acetate).
10.5 CONTAMINATION OF MICROBIAL PROCESSES
The contamination of industrial microbial processes and the principles and techniques of eliminating contamination can be judged from several angles: a) type of the metabolite produced, b) specific properties of the culture, e) construction of the device used in the process, d) medium and its components, e) process technology. The overall adverse effect of contamination is affected by the combination of different factors. For instance, the effect of contamination on penicillin biosynthesis is much more severe than with other biosynthetic processes because the product is rapidly inactivated by penicillinase. Streptomycin biosynthesis is negatively influenced by contamination by actinophages, provided the production strain is sensitive to these phages. Deviations from appropriate technology in the construction of the culture device may cause serious problems because the determination of the site and source of contamination is difficult even with the aid of modern detection methods (Perkowski,
359
Daransky and Williams, 1984). Media containing insoluble and poorly sterilizable components with a high content of spores are frequent contamination sources. Moreover, the sensitivity of a certain process to contamination, and its adverse effect are determined by a number of factors such as pH, aeration intensity and the duration of the process. Contaminating microorganisms negatively affect industrial microbial processes by: a) destroying cells of the production strain, b) inactivating synthesized metabolites, c) producing substances affecting the metabolism of the producer, d) depriving the medium of substances necessary for growth and product synthesis. However, the presence of contaminating microorganisms need not always cause a drop in metabolite production. In the biosynthesis of broadspectrum antibiotics the product inhibits the growth of contaminating microorganisms and thereby protects the culture. The term protected cultivation is used for processes in which undesirable contamination is suppressed by the presence of an antimicrobial agent (Herold and Ne~sek, 1959). The agent is either added to the medium in a suitable form, or else is produced by the culture. 10.5.1
Sterility of microbial processes
An indispensable part of microbial technologies is the elaboration of methods for determining culture purity, i.e. the presence of foreign microorganisms. The terms process contamination and sterile cultivation are not entirely correct because, strictly speaking, the process is always contaminated by the production microorganism and the culture is not completely sterile because the growth of the desirable microorganism has to be assured. Testing for the presence of foreign microorganism is imperative in all decisive phases of the process, i.e. during cultivation, isolation and final processing of the product. Microbial contamination is identified by microscopic and cultivation methods. Microscopic examination is valuable because of its rapidity, and is also very effective with massive contaminations. In mild contamination, an efficient detection can be achieved only when the foreign microorganisms differ substantially in shape or motility from the production culture. In most cases it is difficult to distinguish living and dead cells, which are found in most natural raw materials and are killed by sterilization. Some help comes from vitality tests which, however, are not entirely reliable. Identification of foreign microorganisms is best performed by a cultivation test.
360
Laboratory examination for contamination makes use of the following procedure (Sikyta, 1983): Culture samples are aseptically collected into flasks; a 1 ml volume is used to inoculate two test tubes containing 5 ml broth and a loopful of the culture serves for inoculating blood agar. Incubation is carried out for 24 to 48 h at 37 ~ The samples are then microscopically and macroscopically examined for the presence of foreign microorganisms. When the results are not identical, the cultures are inoculated into 1 ml test tubes while the colonies from the blood agar are inoculated into another four test tubes (2 + 2) which are evaluated after a 24-h cultivation at 37 ~ The macroscopic search for foreign microorganisms includes comparison of the macroscopic pattern of the samples with the growth pattern of the original culture. For instance, original culture is seen to grow in the broth on the test tube bottom whereas the contaminated culture grows throughout the broth volume. Alternatively, the original culture may, for instance, form a pellicle on the broth surface whereas the contaminated culture grows homogeneously or at the bottom. Colonies of foreign microorganisms on blood agar may differ from original colonies in their shape, size and colour, or in their hemolytic activity. The main shortcoming of cultivation tests is their slowness, stemming from the fact that reliable results are obtained only after 24 h. However, the results of tests for contamination should be known much sooner, for instance in the cases of inoculum for bioreactors. Cultivation tests may also in some cases fail to reveal all foreign microorganisms, for the following reasons: a) Foreign microorganisms are not necessarily intercepted in sample collection if their concentration per unit volume is low. b) The culture to be tested is further diluted during inoculation of media for testing. c) In the given cultivation time and with the media used the foreign microorganisms need not always be sufficiently propagated to ensure microscopic or macroscopic detection. d) The growth of foreign microorganisms in the test medium may be inhibited by a metabolite from the tested culture. The sterility of an industrial microbial process is therefore defined as the failure to prove the presence of foreign microorganisms under given test procedure conditions. Detection of foreign microorganisms can also be performed by, for example, laser flow fluorometry or photon correlation spectrometry (cf. Section 9.4.2) but the costs of the appropriate instrumentation are very high.
361
10.5.2
Susceptibility of microbial processes to contamination and protection against contamination
Industrial microbial processes can be divided into several groups according to their sensitivity to contamination and their requirements for aseptic conditions (Table 10.8). In principle, these processes can be divided into those that do not require aseptic conditions, and cultivations performed under aseptic conditions. Cultivations under non-aseptic conditions can be further classified according to whether the whole process takes place without asepsis, i.e. whether natural contamination is desirable (process type 1) or whether a certain part of the process takes place under aseptic conditions, while another occurs under non-aseptic conditions (process type 2). In processes of type 2 the medium is usually sterilized and inoculated by a special inoculum, the cultivation proceeding without asepsis. This type of cultivation is realized in proTable 10.8 Classification of industrial microbial processes as to the necessity to maintain aseptic conditions
Process 1. Nonsterile cultivation, natural microflora
2. Nonsterile cultivation, specific inocula
3. Aseptic cultivation, specific inocula
4. Aseptic cultivation with special stress on asepsis
Note
Application waste-water treatment
the largest volumes used; continuous aerobic process, activated sludge, bioreactors up to 30 000 m 3
biogas
anaerobic process
beer
sterile medium, fast course of process prevents sizable contamination, bioreactors up to 320 m 3
lactic fermentation
milk pasteurization, bioreactors up to 20 m 3
ethanol
large-volume anaerobic fermentation
antibiotics
complex media, bioreactors up to 200 m 3
single cell proteins
continuous culture, bioreactors up to 500 m 3
plant pathogens
large-capacity production of asparaginase and xanthan
animal pathogens
production of toxins and vaccines
recombinant cells
strict asepsis in view of possible undesirable effects
362
cesses which take place in a strongly acid medium (organic acids), at elevated temperatures (thermophilic microorganisms), in a medium unsuitable for foreign microorganisms (alcohols, solvents), under anaerobic conditions, at low temperature (breweries), or when the maximum growth rate of the microorganisms is so high that the proliferation of foreign microorganisms does not exceed the lag phase (fodder yeast). Another factor deciding whether or not a process is to be performed under aseptic conditions is its purpose (agriculture, industry). These cultivations have recently been less and less employed because even mildly contaminated products (fodder yeast, lactic acid) cause health problems in farm animals. Processes of types 3 and 4 (Table 10.8), which provide products important for pharmaceutical or food industries, have to proceed under completely aseptic conditions. Processes of type 3, whose products are used outside these branches of industry (e.g. some enzymes), require aseptic conditions because the medium composition and the neutral pH are highly suitable for proliferation of contaminating microorganisms. Especially strict aseptic conditions need to be maintained in processes of type 4 which include cultivations of pathogenic (plant, animal) and some recombinant microorganisms obtained by genetic manipulations. Highly aseptic conditions have to be maintained not only during cultivation (prevention of the escape of microorganisms from the culture device) but also during the steps following the cultivation, for example during culture disposal. Antimicrobial agents for the protection of some microbial processes have been used for a long time. For instance, ammonium hydrofluoride and pentachlorophenol have been used as antiseptic agents in ethanol production, sulphur dioxide and later sorbic acid in wine production, formaldehyde, hydrofluoric, formic, salicylic or picric acids in fodder yeast production (Underkofler and Hickey, 1954). Agents used for protecting fungal cultivations against bacterial contaminations included chlorine dioxide, 2,4-dichlorophenoxyacetic and boric acids, ammonium hydrogen fluoride and sodium pentachlorophenolate. The formerly recommended and sometimes employed antibiotics are no longer used for this purpose because of the danger of plasmid transfer of resistance.
10.6 WASTE PROCESSING
An integral part of any industrial microbial process is waste disposal and processing. Each microbial production makes use of raw materials which are transformed into products and give rise to waste materials. The amount and type of the unavoidable waste arising in any process depend on the nature of
363
the process. The currently widely used and fashionable term wastefree technology is therefore incorrect and misleading; the problem is rather to utilise even these waste materials, and to deal with non-utilisable ones in a manner that does not pollute the environment. Wastes from microbial industries include non-utilised inorganic and organic compounds, media, microorganisms, solid particles such as filtration materials, waste water from bioreactor washing and cleaning, and residues of materials from isolation steps, for example organic solvents. With exceptions such as cultivations of pathogenic microorganisms, wastes from microbial industry contain in general no toxic materials. A typical feature of microbial productions is the fact that product synthesis consumes a small part of the total raw materials (5 to 10 %). 10.6.1
Waste control
Individual technological steps in a process have to be constantly checked for possible escape of materials and for excessive water consumption. Water management and control gains importance in proportion to the ever increasing volume of microbial productions; water recycling is being introduced wherever possible.
Table 10.9 BOD values of microbiological industry wastes (modified according to Stanbury and Whitaker, 1986) Waste
Household wastes (for comparison) Sulphite liquors Ethanol (molasses) Baker's yeast Antibiotics P e n i c i l l i n - wet mycelium filtrate Streptomycin Aureomycin Solvents
BOD (mg 1-z) 350 20 000--45 000 10 000--25 000 3000--14 000 5000--30 000 40 000--70 000 2150--10 000 2450-- 5900 4000-- 7000 up to 2 000000
High concentrations of organics in waste materials cause problems in their purification, because their presence leads to high BOD (biological oxygen demand) values which are indicators of the extent of pollution. As seen in Table 10.9, the BOD value in wastes from different microbial productions varies widely but exceeds by several orders of magnitude the values in house-
364 hold waste. The highest BOD values are exhibited by microbial cells; their spillage into waste waters should therefore be prevented. The method of BOD measurement assesses the amount of oxygen needed for oxidizing organic substances in water by microorganisms over a certain period and at given temperature (usually 5 days at 20 ~ The decrease in oxygen content can be determined and expressed in mg oxygen per 1 1 sample. Because the test takes 5 days the relevant information is often obtained by using the COD test (chemical oxygen demand) which, in contrast, takes several hours. This test yields higher values because it involves also the oxidation of substances which cannot be oxidized by microorganisms; the BOD :COD ratio is 0.2" 1 to 0.5" 1. An ideal procedure would be to discharge the waste into rivers, lakes and other waterways at BOD values of 20 to 30 mg 1-~. Assessment of the situation with production waste may provide an answer to the following questions" a) which water resources can be combined for repeated use; b) which concentrated wastes containing valuable substances can be used for agriculture (fodder, fertilizers) or as fuels; c) which toxic substances require special handling and processing; d) what can be the maximum waste load under conditions of maximal production; e) which wastes can be discharged directly and which have to be pretreated in waste treatment units connected with the production establishment. 10.6.2
Methods of waste treatment
Microbial industry wastes can be treated or processed using (a) physical, (b) chemical and (c) biological methods. Removal of suspended solid particles before biological treatment substantially reduces the BOD. Almost all industrial microbial processes include separation of cells during product isolation. Waste cells or mycelia can in many cases be used as fodder; if they are contaminated by filter materials (particles from filter support layers) they are composted or mechanically dehydrated and the resulting waste material is either burnt (Grieve, 1978) or dumped. Fine suspended and colloid particles are removed by coagulation or flocculation (Cooper, 1975). Coagulation is usually instantaneous whereas flocculation takes time and requires mixing to facilitate the formation of aggregates. Ferrous, ferric or aluminium sulphate, or calcium hydroxide are used as coagulants. The resulting flocs are sedimented in settling pits or tanks to form a sludge which is then mechanically dehydrated. Most organic wastes can be biologically degraded either aerobically or
365
anaerobically using a number of methods. Widely used techniques are sprayed biological filters and their tower modifications, i.e. rotating discs or drums, as well as treatment with activated sludge and its modifications. Anaerobic procedures employed for the purpose include the use of anaerobic digesters. Detailed descriptions of water treatment methods and techniques can be found in specialized publications (Rudolfs, 1953; Koziorowski and Kucharski, 1972; Callely, Foster and Stafford, 1977).
10.7 ECONOMY OF MICROBIAL PROCESSES The basic characteristic of a competitive industrial microbial process is that the microorganism has to produce the given product in economically feasible concentrations. The success of such a process, however, depends additionally on a number of factors (Stanbury and Whitaker, 1986): 1. Capital investments into culture devices and auxiliary equipment have to be as low as possible but the equipment has to be manufactured so as to permit the performance of a variety of microbial processes, i.e. it has to be highly adaptable. 2. Raw materials have to be as cheap as possible and must be utilised with the highest possible efficiency. Testing of other raw materials has to proceed even after setting up the production process. 3. The productivity of the microorganisms needs to be as high as possible. 4. Whenever possible, menial labour should be replaced by automation. 5. The cultivation period must be as short as possible to enable the production unit to be effectively utilized. 6. Isolation and purification steps have to be simple and fast. 7. The amount of production wastes has to be as low as possible. 8. Energy needed for heating and driving the devices needs to be utilized with the highest attainable efficiency. 9. Production spaces must be effectively used but the possibility of installation of further machinery has to be taken into consideration. In practice, however, the observation of these rules can only be achieved by way of a compromise, because the simultaneous fulfillment of all these requirements is impossible. 10.7.1
Culture devices
Requirements for the most efficient economy of a process lead logically to efforts to construct the largest possible culture units, as the economical effi-
366
ciency usually rises with increasing production scale. An empirical relationship exists between the price and the size of a device: price~ = (size~)" price2 size2 where n is the exponent or size factor. The exponent has a value of 0.6 in the brewing industry (Pratten, 1971) and 0.7 to 0.8 in single-cell protein production (Humphrey, 1975, MacLennan, 1976). Other factors playing a role in planning the size of the production device are construction, cooling, aeration and mixing. When designing the cooling system it should be borne in mind that the bioreactor volume is directly proportional to the third power of bioreactor radius, r 3, whereas its area is proportional to r 2. For this reason bioreactor scale-up involves a decrease of the surface-to-volume ratio and therefore also of the efficiency of cooling. It is thus impossible in very large bioreactors to draw off heat via the outer surface of the vessel and additional cooling systems (external heat exchangers, internally installed cooling spirals) have to be used. These additional modifications are not cheap and, moreover, they affect the mixing relations in the bioreactor. The upper limit to the bioreactor size is governed by the feasibility of its transport from the place of manufacture to the installation locality. The operating life of a culture device varies widely in dependence on the nature of the process. The lowest operating life for systems producing singlecell protein was determined as l0 years, with an average life-time of 15 years (MacLennan, 1976; Hamer, 1979). The life-time of devices for acetone-butanol fermentation is 25 years (Spivey, 1978) while brewery units may serve for 50 to 100 years. Operation of a culture device includes the supply of energy for the production of steam, pressurized air, for impeller drive and for water supply and circulation. As published by Hastings and Jackson (1965), a medium sized antibiotics production process has the following hourly demands" 45 tonnes of steam, 5000 kW electricity, 57 000 m 3 pressurized air and 200 m 3 water. The production of 1 tonne acetic acid requires 480 m 3 cooling water, l0 m 3 process water, 12 tonnes steam and 570 kW electric power (Pape, 1977). 10.7.2 Raw materials
Prices of individual raw materials used as media components represent 38 to 73 % of total production costs. The most expensive are carbon sources whose prices on world markets fluctuate considerably. The prices that can be paid for raw materials are directly proportional to prices of products; the
367 Table 10.10 Effect of substrate price on biomass price (modified after Abbott and Clamen, 1973)
Substrate Maleate (wastes)
Glucose n-Paraffins Methanol Methane Ethanol Acetate
Substrate price (arbitrary units)
Biomass price (arbitrary units)
0 2.0 4.0 2.0 1.0 6.0 6.0
0 3.9 4.0 5.0 1.6 8.8 17.0
more expensive the product, the higher can be raw materials costs and vice versa. The effect of variable prices of raw materials on the production of a unit amount of cells is shown in Table 10.10. Insofar as costs of raw materials are concerned, the products of microbial industry can be classed into three groups (Fig. 10.7): Production votume
c_
"ID
~ t_
smait medium targe ~Monoctonatantibodiesi Inferferons I Vaccines I r Enzyme inhibifors r Hormones Vitamins Antibiotics Enzymes Amino acids Organic acidsl "XD PoLymers I Yeasfsl Fodder yeast Ethanol I Sotvenfs I Biomass I Methane I Wastes medium low high Technotogicat lever
oJ r-y-ca. O rid c_
~c
~_~ ._ ~.c_ ~9 -~=~ c~ ~ c_ o
.o_ 4--
e-~ .4---
~g ~ E
tv ,c ....
o7. ,-- ,-t~Qj
Fig. 10.7 Classification of microbial processes according to technological level, production volume, product price and application areas
a) low price products: single-cell proteins, organic acids, solvents, polysaccharides, alcohols; b) medium price products: antibiotics, alkaloids, vitamins; c) high price products: specific proteins (insulin, growth hormone, interferons), products of microbial transformations (steroids). Decisions about the use of higher-priced, more exactly defined raw mate-
368
rials or cheaper, less defined ones include the following quandary (Stowell and Bateson, 1984)" higher prices
~
chemically defined raw materials -~
1
process reproducibility
1
lowering of costs by process improvement
cheap raw materials
:
lower prices
1
fluctuating quality
1
process instability l problems with process improvement
10.7.3
Air filtration, heating and cooling
As shown in Section 7.2, air sterilization by heat is practically feasible but expensive. Richards (1968) calculated that sterilization of 283 m 3 air requires 132 kJ min -~, with a corresponding load on the cooling system. Stark and Pohler (1950) studied the possibility of sterilizing air by means of the heat of compression. The most economic working range in piston compressors at 7.03 kg cm -2 without filters is 56.6 to 141.5 m 3 air min -~, in single-stage compressors 141.5 to 566 m 3 min -~ and in turbocompressors 707 to 849 m 3 min -~. When using filters with fibrous packing, the investment costs depend on filter size, especially on its cross-sectional area, while operation costs depend on the pressure drop across the filter (for a given filter size). Some types of air filters require a large installation space, some are more compact. For instance, a filter with fibrous packing and with a capacity of 8.5 m 3 air min -~ takes up 32.5 m 3 whereas an absolute filter occupies a mere 3.83 m 3. An important factor is filter service life, with attendant costs of filter or filter packing replacement. To extend the filter service life it is advisable to insert prefilter(s) for reducing air impurities (e.g. oil droplets from the compressor) into the system before the filter proper. The best approach to heating and cooling would be to avoid both operations in all phases of the industrial microbial process. Since this is not possible, the energy for heating and cooling has to be minimized by limiting both operations to a necessary minimum; for example, in" a) medium pressure sterilization or boiling above or at 100 ~ and its cooling,
369
b) sterilization and cooling of culture device and its accessories, c) temperature regulation in the course of the cultivation process, d) drying of the final product. The costs of culture fluid cooling, especially during a rapid microbial growth, are not negligible because, for instance, in the case of single-cell protein production, they can amount to 10-15 % of the product price. A yearly production of 100 000 tonnes of single cell proteins requires the removal of heat corresponding to 46 x 107 kJ h -~ (Lichtfield, 1977). Cooling costs can be reduced in reactors of new construction, such as the airlift, and by the introduction of thermophilic and thermotolerant microorganisms into the productions.
10.7.4
Product isolation and purification
Data on product isolation and purification costs are not very frequent in the literature. Stowell and Bateson (1984) enumerated the factors contributing to isolation and purification costs: a) product losses, however small, at every stage of the isolation procedure, b) high energy costs and maintenance costs associated with filtration and centrifugation, c) high price of solvents and other chemicals. According to Atkinson and Mavituna (1983) the losses during isolation of citric acid are 8 weight per cent, in penicillin G before conversion to the potassium salt 4 weight per cent. These values seem in fact too optimistic and reflect an ideal state which can hardly be achieved in actual operation. The losses can be reduced by reducing the number of isolation and purification steps. When choosing the separation device, filtration is preferred to centrifugation whenever possible, as energy outlays for filtration are substantially lower than with centrifugation.
REFERENCES Abbott, B. J., Clamen, A. (1973) Biotechnol. Bioeng. 15, 117. Aharonowitz, Y. (1980) Ann. Rev. Microbiol. 34, 209. Anonymous (1985) Process Biochem. 6, X. Ashwood-Smith, M. J., Grant, E. (1976) Cryobiology 13, 206. Atkinson, B., Mavituna, F. (1983) Biochemical Engineering and Biotechnology Handbook, London. Bauer, S., Shiloach, J. (1974) Biotechnol. Bioeng. 16, 933.
370 Bauer, S., White, M. D. (1976) Biotechnol. Bioeng. 18, 839. Beech, S. C. (1952) Ind. Eng. Chem. 44, 1677. Bernard, H. U., Helsinki, D. R. (1980) Genet. Eng. 2, 133. Bull, A. T., Slater, J. H. (1982) Microbial interactions and community structure. In: Microbial Interactions and Community Structure, London. Bull, A. T., Ellwood, D. C., Ratledge, C. (1979) The changing scene in microbial technology. In: Microbial Technology: Current State, Future Prospects, Cambridge. Bu'Lock, J. D. (1961) Adv. Appl. Microbiol. 3, 293. Bu'Lock, J. D. (1967) Essays in Biosynthesis and Microbial Development, New York. Bu'Lock, J. D., Hamilton, D., Hulme, M. A., Powell, A. J., Smalley, H. M., Shepherd, D., Smith, G. N. (1975) Can. J. Microbiol. 11, 765. Callely, A. G., Foster, C. F., Stafford, D. A. (1977) Treatment of Industrial Effluents, London. Camici, L., Sermonti, G., Chain, E. B. (1952) Bull. Worm Health Organisation 6, 265. Caulcott, C. A., Lilley, G., Wright, E. M., Robinson, M. K., Yarranton, G. (1985) J. Gen. Microbiol. 131, 3355. Charley, R. C., Bull, A. T. (1979) Arch. Microbiol. 123, 239. Cooney, C. L. (1979) Process Biochem. 14(5), 31. Cooper, P. (1975) Water Pollution Control 74, 303. Cox, C. S. (1968) Nature 220, 1193. Daily, W. A., Higgens, C. E. (1973) Cryobiology 10, 364. Demain, A. L. (1952) Catabolite regulation in industrial microbiology. In: Overproduction of Microbial Products, London. Dietz, A. (1975) Conference on Cryogenic Preservation of Cell Cultures, Natl. Acad. Sci., Washington, DC. Dietz, A., Churchill, B. W. (1985) Culture preservation and stability. In: Comprehensive Biotechnology, Vol. 2, New York. Drew, S. W., Demain, A. L. (1977) Ann. Rev. Microbiol. 31, 343. Engberg, B., NordstrSm, K. (1975) J. Bacteriol. 123, 179. Fieschko, J., Ritch, T. (1985) Ann. Meeting Soc. Ind. Microbiol., Boston. Futcher, A. B., Cox, B. S. (1984) J. Bacteriol. 157, 283. Gallo, M., Katz, E. (1972) J. Bacteriol. 190, 659. Gleiser, I. E., Bauer, S. (198 l) Biotechnol. Bioeng. 23, 1015. Gordee, E. Z., Day, L. E. (1972) Antimicrob. Agents Chemother. 1,315. Grieve, A. (1978) Water Pollution Control 77, 314. Hamer, G. (1979) Econ. Microbiol. 4, 315. Harrison, D. E. F., Wilkinson, R. G., Wren, S. J., Harwood, J. H. (1976) Mixed bacterial cultures as a basis for continuous production of SCP from C~ compounds. In: Continuous Culture 6: Applications and New Fields, Chichester. Hastings, J. J. H., Jackson, T. (1965) Chem. Eng. 8, 406. Heckley, R. J. (1978) Adv. Appl. Microbiol. 24, 1. Herold, M., Ne~/lsek, J. (1959) Adv. Appl. Microbiol. 1, 1. Humphrey, A. A. (1975) Product outlook and technical feasibility of SCP. In: Single Cell Protein 2, Massachusetts. Iijima, T., Sakane, T. (1973) Cryobiology 10, 379. Imanaka, I. T., Aiba, S. (1981) Ann. N.Y. Acad. Sci. 1, 369. Janglov~, Z., Such3~, J., Van6k, Z. (1969) Folia Microbiol. 14, 208. Keshavarz, T., Lilly, M., Clarke, P. H. (1985) J. Gen. Microbiol. 131, 1193. Khoklov, A. S., Tovarova, I. I. (1972) Postepy Hig. Med. Dosh. 26, 469. Kim, S. H., Ryu, D. D. (1984) Biotechnol. Bioeng. 26, 497.
371 Kominek, L. A. (1972) Antimicrob. Agents Chemother. 1, 123. Koziorowski, B., Kucharski, J. (1972) Industrial Waste Disposal. Oxford. Krhlovcovh, E., Blumauerovh, M., Van6k, Z. (1977) Folia Microbiol. 22, 182. K~i~kov~., L., Balan, J. (1975) Folia Microbiol. 20, 351. Krupinski, V. M., Robbers, J. E., Floss, H. G. (1976) J. Bacteriol. 125, 158. Kybal, J., Sikyta, B. (1986) Acta Biotechnol. 6, 245. Lancini, G. C., White, R. C. (1973) Process Biochem. 8, 14. Lichtfield, J. H. (1977) Adv. Appl. Microbiol. 22, 267. Lincoln, R. E. (1960) J. Biochem. Microbiol. Tech. Eng. 2, 481. Luli, G. W., Gordon, L. B., Allen, B.R. (1985) 190th Natl. ACS Meeting, Chicago. MacLennan, D. G. (1976) Single cell protein from starch. In: Continuous Culture 6: Applications and New Fields, Chichester. Martin, A. M., Skerman, B. J. (1972) World Directory of Collections of Cultures of Microorganisms, Toronto. Martin, J. F. (1978) Manipulation of gene expression in the development of antibiotic production. In: Antibiotics and Other Secondary Metabolites. Biosynthesis and Production. New York. Martin, J. F. (1977) Adv. Biochem. Eng. 6, 105. Martin, J. F., Demain, A. L. (1980) Microbiol. Rev. 44, 230. Marx, D. H., Daniel, W. J. (1976) Can. J. Microbiol. 22, 338. Masurekar, P. S., Demain, A. L. (1972) Can. J. Microbiol. 18, 1045. McCalleer, W. J., Buniack, E., Maighetter, R. Z., Wampler, E., Miller, W. J., Hilleman, M. R. (1984) Nature 307, 178. Mikulik, K., Janda, I., Weiser, J., ~fastn~i, J., Jir~.fiov~, A. (1984) Eur. J. Biochem. 145, 381. Murphy, N. F., De Gonzhles, I. M. (1973) J. Agric. Univ. P.R. 57, 203. Muth, W. L. (1984) ACS Meeting, Philadelphia. Nagel, J. G., Kunz, L. J. (1972) Appl. Microbiol. 23, 837. Nisbet, L. J. (1982) J. Chem. Tech. Biotech. 32, 251. Ollis, D. F., Chang, H. (1982) Biotechnol. Bioeng. 24, 2583. Pape, M. (1977) The competition between microbial and chemical processes for the manufacture of basic chemicals and intermediates. In: Microbial Energy Conversion. Oxford. Parker, A. (1950) Aseptic technique in industrial scale fermentations. In: Recent Advances in the Fermentation Industries, London. Pavlasovh, E., Stejskalov~t, E., Sikyta, B. (1986) Biotechnol. Lett. 8, 415. Perkins, D. D. (1962) Can. J. Microbiol. 8, 591. Perkowski, C. A., Daransky, G. R., Williams, J. (1984) Biotechnol. Bioeng. 26, 857. Pinches, A., Louw, M. E., Watson, T. G. (1985) Biotechnol. Lett. 7, 621. Pogell, B. M., Sankaran, L., Redshaw, P. A., McCann, P. A. (1976) Microbiology. Washington, DC. Pratten, C. F. (1971) Economies of Scale in Manufacturing Industry, Cambridge. Pridham, T. G., Lyons, A. J., Phrompatina, B. (1973) Appl. Microbiol. 26, 441. Redway, K. F., Lapage, S. P. (1974) Cryobiology 11, 73. Richards, J. W. (1968) Introduction to Industrial Sterilisation, London. Rudolfs, W. (1953) Industrial Wastes. Their Disposal and Treatment, New York. Schlegel, H. G. (1992) Allgemeine Mikrobiologie, Stuttgart. Shmotina, G. E. (1975) Mikol. Fitopatol. 9, 349. Sikyta, B. (1983) Methods in Industrial Microbiology, Chichester. Sokolski, W. T., Stapert, E. M., Ferrer, E. B. (1964) Appl. Microbiol. 12, 327. Speckman, C. A., Sandine, W. E., Elliker, P. R. (1974) Dairy Sci. 57, 165. Spivey, M. J. (1978) Process Biochem. 13(11), 2, 25.
372 Stanbury, P. F., Whitaker, A. (1986) Principles of Fermentation Technology, Oxford. Stark, W. H., Pohler, G. M. (1950) Ind. Eng. Chem. 42, 1789. Stark, W. M., Smith, R. L. (1961) Progr. Ind. Microbiol. 3, 211. StoweU, J. D., Bateson, J. B. (1984) Economic aspects of industrial fermentations. In: Bioactive Microbial Products 2, London. Suzuki, T., Mori, H., Yamane, T., Shimizu, S. (1985) Biotechnol. Bioeng. 27, 192. Takao, S., Kondo, Y., Tanida, M. (1978) Agr. Biol. Chem. 42, 1973. Tanguay, A. E., Bogert, A. B. (1974) Appl. Microbiol. 27, 1175. Tatarenko, E. S., Igolkina, E. V., Manko, V.G. (1976) MikrobioL Zhurna138, 176. Trevidi, N. C., Tsuchiya, H. M. (1975) Int. J. Min. Proc. 2,1. Trollope, D. R. (1975) J. Appl. Bacteriol. 38, 115. Underkofler, L. A. (1976) Microbial enzymes. In: Industrial Microbiology, New York. Underkofler, L. A., Hickey, R. J. (1954) Industrial Fermentations. Vol. 2, New York. Van~k, Z., Ho~t'~ilek, Z., Blumanerov~i, M., Mikulik, K., Podojil, M., B~hal, V., Jechovh, V. (1973) Pure Appl. Chem. 34, 463. Veldkamp, H. (1970) Enrichment cultures of prokaryotic organisms. In: Methods in Microbiology Vol. 3A, London. Veldkamp, H., Jannasch, H. W. (1972) J. Appl. Chem. Biotechnol. 22, 105. Vezina, C., Singh, K. (1975) Transformation of organic compounds by fungal spores. In: The Filamentous Fungi, London. Walker, J. B. (1974) J. Biol. Chem. 249, 2397. Walker, M. S., Walker, J. B. (1971) J. Biol. Chem. 246, 7034. Ward, A. C., Packter, N. M. (1974) Eur. J. Biochem. 46, 323. Yamasato, K., Okuno, D., Ohtomo, T. (1973) Cryobiology 10, 453. Yanagimoto, M., Terui, G. (1971) J. Ferment. TechnoL 49, 611.
373
11
IMMOBILIZED BIOCATALYSTS
The elaboration of methods for biocatalyst immobilization is conceivably one of the most important innovations in applied microbiology. One of the first countries in which the method of biocatalyst immobilization was introduced, and the first country in which cells were immobilized in gels, was the Czech Republic. In 1962 researchers from the Antibiotics Research Institute at Roztoky near Prague submitted a patent no.113 908 “A method of preparation of substances by biosynthesis and biotransformation using biochangers” (Culik et al., 1964) according to which enzyme producers such as microbial, animal or plant cells or tissues, or enzymes in the form of preparations from animal organs or plant tissues, were spread and fixed in gel-like hydrophilic carriers (Fig.] 1.1). These were to be placed in a medium containing the substances destined for biocatalytic conversion and the transport of the substances from the liquid medium to the enzyme, as well as the transport of the products back into the medium, occurred through the permeable enzyme carrier. At the time of the patent application the term immobilization had not yet been introduced, and the immobilized biocatalysts were termed biochangers. The patent described various types of carriers (agar, gelatine, silica gel, natural and synthetic resins), their forms (granules, cylinders, beads, film, fibres), basic technological arrangements suitable for biotransformations, preparation of various substances via biotransformations conducted with nongrowing cells (hydrolysis of penicillin G by penicillin amidase from Escherichia coli, dehydrogenation of cortisone to prednisone by a strain of Mycobacterium flavum, and decarboxylation of diaminopimelic acid to lysine using a strain of E. coli). The biosynthesis of various products by growing immobilized cells was also briefly described. The patent described also the first procedure for co-immobilization, which was performed with cells of E. coli and calcium carbonate needed for pH regulation inside the gel granules. As seen from the number of reviews (Vandamme, 1976; Abbott, 1977, 1978; Jack and Zajic, 1977; Messing, 1975, 1980; Chibata, Tosa and Fujimura, 1983; VojtiSek and Jirkb, 1983; Klein and Vorlop, 1985; Charles and Phillips, 1985), all the above problems were later intensively addressed by a number of other authors.
CESKOSLOVENSKA SOCIALISTICKA R E PU B LI KA
PAT E N T O V Y S P IS 113908 Prduo k V~lU~_itZ vrlndlezu 19~fslugf stdtu podle w 3 odst. 6 zdk. ~. 34/1957 Sb. PT
30 h, 6
MPT
{2 07 r
DT
615.779 66.098
Pfihl~igen,o 17. XlI. 1962 (PV 7102-62}
Vylo2en, o 15. IX. 1964 OIIAD PRO PATENTY A VYNALEZY
Vyd~in,o 15. III. 1985
Dr. KAREL CULIK, BOFIUMIL SIKYTA, prom. biol., IOSEF SLEZAK, prom. chem., in2. IOSEF PALKOSKA a in2. JAROMiR SLECHTA, vgichni PRAHA, ANTONiN BI~ECKA, prom. biol., ROZTOKY u P r a h y , d,oc. in2. MILOS HEROLD a ZDENEK HOSTALEK, ppom. biol., ,oba PRAHA
Zpfisob p~ipravy l~itek b i o s y n t h e s o u a b i o t r a n s f o r m a e i p o m o c i biom~nir:fi Fig. 1I. I Record of Czechoslovak Patent 113 908 concerning immobilized biocatalysts
315
In 1966, Mosbach and Mosbach described the immobilization of plant cells with esterase and decarboxylase activity in polyacrylamide gel and the conversion of cortexolone to cortisone. In the same year Leuscher described immobilization of cells in cellulose nitrate, polyurethane and polyvinylalcohol, and in 1969 Chibata reported on the first industrial application of immobilized aminoacylases in the preparation of D-amino acids from a mixture of D- and L-amino acids (Chibata and Tosa, 1977). The main carriers patented previously by the Czech team were used by a number of authors and are still being used. Immobilization includes a number of techniques suitable for bonding enzymes, cell organelles and microbial, plant or animal cells. Immobilization biotechnology can therefore be defined as binding or immobilization of biologically active molecules (enzymes, antigens, antibodies, antibiotics, etc.) or cells in a separate phase permitting exchange with the main phase which contains dispersed or dissolved substrate(s) and product(s) (White, 1985).
11.1
IMMOBILIZED ENZYMES
Enzymes are natural catalysts; about 2000 enzymes that have been determined and characterized catalyze reactions that form the vital core of life of animals, plants and microorganisms. In contrast to chemical catalysis, enzyme catalysis usually proceeds under very mild conditions in neutral solutions, at normal temperature and pressure. It is also marked by a high specificity. The use of enzyme catalysis therefore involves no damage to the reactants or products even when these are unstable at higher temperatures or extreme pH values. Also, the formation of byproducts, a common problem in chemical catalysis, is mostly excluded. The main obstacle to a wide use of enzymes in industrial processes was their shortage, high price and instability. Recent advances in genetics and biochemistry have considerably enhanced the availability of enzymes and this has brought about a decrease in their prices. Further cost reduction can be achieved by enzyme recycling after the reaction, provided the enzyme retains its'biological activity. Enzymes in solution, which are usually.used in very low concentrations, often below I pg 1- I, are difficult and costly to recover by conventional isolation techniques. On binding the enzyme to an insoluble material it can be retrieved by simple filtration. Many enzymes in living organisms exist and function, in fact, in an immobilized form, but these naturally immobilized enzymes differ from artificially immobilized ones by being immobilized reversibly; by contrast, artifi-
376
cially immobilized enzymes are required to function without being released into the ambient solution. As opposed to cell immobilization, enzyme immobilization is useful if: a) the enzymes are extracellular, i.e. they are exported from cells; b) the substrate molecule has a high molecular weight and passes only with difficulties through the barrier of the carrier and the cell wall; c) the enzyme is not of microbial origin and has to be extracted from a plant or animal tissue before immobilization; d) the reaction product must not contain even minute amounts of accompanying substances released from immobilized cells; e) the immobilization of the enzyme is preferable for economic, analytical, therapeutic or other reasons.
11.2 IMMOBILIZED CELLS The immobilization of microorganisms is a natural phenomenon. The stones in a river are slippery because their surface is covered by a film of photosynthetic microorganisms. Stones at greater depths, to which the sunlight does not reach, are covered by films of nonphotosynthesizing microorganisms. Immobilized microbial cells have been empirically used since 1820 when the Schutzenbach method of vinegar production was introduced. This fast process used conversion of ethanol to acetic acid by acetic fermentation bacteria fixed in the form of a film on wood shavings. Natural water cleansing processes also involve microbial populations growing on immersed supports such as stones or wood. What is then actually new about the current state of application of immobilized cells? The new factor is the not merely empirical 1
2
immobitized enzyme 1
2
3
I
3
immobitized cetts I 20
1 I 40 60 retofive costs (%)
I 80
J 100
Fig. 11.2 Comparison of costs of industrial production of aspartic acid with immobilized enzymes and with immobilized cells (Fukui, 1983) 1 -- raw materials, 2 - biocatalyst preparation, 3 - labour and energy costs
377
but now rationally based application of immobilized cells in three physiological states: nonliving cells, live nongrowing cells and growing cells, depending on the process to be carried out. We can therefore talk about extension of studies with immobilized enzymes to include cells with preserved biological activity. Most processes are carried out with immobilized microbial cells but immobilized plant and animal cells have recently been gaining importance (Rosevear and Lambe, 1983). The use of immobilized cells offers the following advantages as compared with the use of immobilized enzymes: a) costly and time consuming extraction and purification processes become unnecessary, b) stability of the enzyme can be enhanced, e) complex enzyme conversions can be accomplished, d) the possibility arises of biosynthesis of various substances, e) the economics of the process is improved (Fig. 11.2).
11.2.1
Immobilized nonliving cells
If the required product is synthesized or degraded enzymatically and this process does not depend on whether the cells metabolize or grow, it can be accomplished with cells that are no longer living, and the immobilization methods used can at the same time kill the cells but must not affect their enzyme activities. The cells should contain the appropriate enzyme(s) in high concentrations and it is therefore advisable that they come from hyperproducing strains. The substrate is added to the system in such a form that it can be appropriately modified by the enzyme(s) while optimum pH and temperature are being maintained. This procedure is analogous to enzyme immobilization, but has the advantage that the enzyme need not be isolated from the cells and is therefore usually more stable in its natural cellular environment. A disadvantage of immobilized cells is the fact that the diffusion velocity of substrates and products within the cells is lowered and the concentration of the enzyme referred to a unit surface area or volume is lower. This results in the need for increased reactor size. Immobilized cells may also contain other undesirable enzymes which can convert the substrate to another product, or catalyze reactions yielding undesirable substances (toxins). Some processes therefore include stabilization of the appropriate enzyme followed by inactivation of other heat labile enzymes by heating to 60-80 ~ for several minutes or by adding metal ions. The permeability of the cells can be increased before the immobilization by toluene, cetyltrimethylammonium bromide, lauryl sulphate, or by autolysis. In some cases the immobilization process itself involves a facilitation of the penetration of the substrate to the enzyme.
378
11.2.2
Immobilized live nongrowing cells
When a product is synthesized by living nongrowing cells or cells from the stationary or the death phase, the cells are immobilized in such a way that they no longer grow but still retain their metabolic activity. Then they do not proliferate and the added substrates are converted solely to the desired products. Should the cells be still growing, they would consume some of the substrates for growth which would be wasteful. Cells immobilized in this way are used for synthesizing products the formation of which is not connected with growth. Appropriate nutrient media differ substantially from those used in systems with free cells (Messing, 1980). A problem is to maintain the immobilized cells free of infection both during their preparation and during the subsequent use in bioreactors. 11.2.3
Immobilized growing cells
These are used when the synthesis of the product(s) is associated with microbial growth. The system is therefore supplied with nutrients necessary for growth and proliferation and possible growth inhibiting products have to be removed from the vicinity of the cells. These requirements necessitate the use of special immobilization techniques ensuring that the cells can multiply (this precludes e.g. the use of encapsulation) but are not excessively washed out into the medium. The immobilization techniques depend also on the type of microorganism (unicellular, multicellular, filamentous), on the ability of cells to aggregate and on ambient medium (viscosity). In sporulating microorganisms the immobilization is often preferably performed with spores, which are less sensitive to sterilization with chemical or physical agents than vegetative cells. Especially suitable is the application of immobilized cells in continuous processes because the increased retention time ( I / D ) of these cells in the system obviates cell recirculation and permits the use of substantially higher dilution rates than with free cells. Immobilized cells were found to multiply in a synchronous way and the liberated daughter cells retain the same generation time as the parent immobilized cells for up to 12 generations (Durand and Navarro, 1978). Aerobic processes are burdened with problems with the supply of oxygen to aggregates of immobilized cells and with the removal of products, such as carbon dioxide, which may inhibit growth and product formation. The kinetics of nutrient and oxygen supply and penetrations of the nutrients through cell clusters resemble the pellet-like growth of filamentous microorganisms. Immobilized growing cells offer the following advantages (Chibata, Tosa and Fujimura, 1983): a) the number of cells to be immobilized is very low,
379
b) concentration of cells in the carrier is higher than in a liquid nutrient medium, e) the productivity is higher because a dense cell layer is formed on the surface of the carrier during growth, d) production stability is higher because the cells multiply during the operation, and e) dilution rate can be changed independently of the growth rate.
11.3 CO-IMMOBILIZED BIOCATALYSTS
When the intended biosynthesis or biotransformation is complex or multistage, or when the reaction course of simple biosynthesis or biotransformation is to be improved, co-immobilized biocatalysts are the system of choice. Depending on the nature of the process the co-immobilization is carried out with various enzymes or cells, cells plus enzymes or coenzymes, or cells or enzymes together with insoluble substrates, high-density particles which facilitate biocatalyst sedimentation, or with substances serving for pH adjustment. The possibilities of preparation of these biocatalysts include the following kinds of co-immobilization: a) two or more enzymes, b) enzymes with coenzymes, e) two or more types of live cells, d) two or more types of nonliving cells (or living cells that perish during immobilization), e) a mixture of living and nonliving cells, f) nonliving cells with enzymes, g) enzymes or cells with a solid substrate, h) enzymes or cells with high density particles, i) enzymes or cells with substances affecting the pH. Co-immobilized biocatalysts are also called second generation immobilized biocatalysts and their applications will be discussed in the following Sections.
11.4
BASIC PREREQUISITES FOR PREPARATION OF IMMOBILIZED BIOCATALYSTS
The preparation of an immobilized biocatalyst should begin with considerations concerning the selection of: a) a suitable biocatalyst,
380
b) a suitable carrier or gel, c) a suitable immobilization technique. As stated above, the immobilization may include free enzymes or cellconfined enzymes, i.e. whole cells that perish before or during immobilization but retain their appropriate enzyme activities. Immobilization can also be done with living cells that either grow, or no longer grow, after the immobilization. The selection of the biocatalyst should take into account its optimum pH, temperature and half-saturation constant, its heat stability and its resistance to the effects of other environmental factors, such as denaturation. Whatever the immobilization procedure used, it should guarantee that the immobilized biocatalyst retains the appropriate enzyme activity and that its parts are not, or only in minute amounts, released into the solution (with the exception of immobilized growing cells). The immobilization should yield biocatalyst particles that are easy to separate from the solution, are mechanically firm and resistant to abrasion. The biocatalyst particles should have optimum size or surface area that enables the enzyme reaction to proceed at a maximum rate and therefore allows the use of the highest possible substrate concentration. An important factor, especially in immobilized cells, is the maximum velocity of diffusion of the substrates to the biocatalysts and of the resulting products back to the solution. Aseptic conditions should be maintained both during the preparation of the immobilized biocatalyst and during the process in the bioreactor. Biocatalysts often have to be sterilized to prevent their contamination, and strict aseptic conditions analogous to those used in processes with free cells should be adhered to during the bioconversion or biotransformation. The agents most frequently used for sterilization of immobilized biocatalysts are formaldehyde, ethanol, sorbic acid, antibiotics or radiation. Careful consideration should be also given to storage of immobilized biocatalysts, whether in dry or in wet state (temperature, preservatives, etc.). The following properties and features should be assessed when selecting carrier or support materials for immobilization: a) chemical composition and chemical functionality of the chemical or electrostatically active group, b) chemical stability of the matrix and of the reactive groups as dependent on pH, temperature and other environmental factors, c) heat stability and resistance to microbial attack, d) pore volume and internal surface area (matrix volume accessible to biocatalyst molecules), e) carrier hydrophilicity and the amount of water retained, 0 binding capacity for the biocatalyst, its mechanical characteristics, possibility of regeneration or recycling and price.
381
The spectrum of materials for immobilization is broad and keeps expanding rapidly. The materials can in principle be divided into two main groups: A. Materials or carriers to which the biocatalyst is bound physically, physico-chemically or chemically. B. Materials in which the biocatalyst is entrapped or entrained. Materials to which biocatalysts are bound include a number of natural carriers such as plant residues (sawdust), cellulose, dextran and other polysaccharides, proteins such as gelatine or albumin, inorganic carriers such as glass, ceramics, sand, porous steel, aluminium and especially zirconium and titanium oxides, synthetic polymers such as polyacrylamide, polyvinyl chloride, light-crosslinkable resins, polyurethane, natural polymers such as calcium alginate, z-carrageenan, agar-agar or collagen. Encapsulation of biocatalysts is usually performed with materials that permit the formation of a semipermeable polymer membrane. The techniques of biocatalyst immobilization are currently being elaborated down to minute details. The following Sections present and classify the most important procedures according to whether they are used for immobilizing enzymes or cells (living, nonliving) and according to the purpose they are to serve.
11.5 TECHNIQUES OF ENZYME IMMOBILIZATION
The first attempts at converting soluble enzymes into insoluble forms included adsorption of the enzymes onto clays and similar materials. Nelson and Griffin (1916) adsorbed invertase onto charcoal and aluminium oxide. In the years to follow, similar studies were rather rare until 1954, when a systematic research into immobilization of enzymes began. Grubhofer and Schleith (1954) adsorbed amylase, pepsin, ribonuclease and carboxypeptidase onto diazotized polyamidostyrene; the enzymes were shown not only to be bound but also to retain some enzymatic activity. Bar-Eli and Katchalski (1960) bound trypsin to the copolymer of p-aminophenylalanine and leucine and found an increase in enzyme stability on its transfer into the insoluble form. In 1966 Manecke and Gunzel described the immobilization of nonhydrolytic enzymes such as alcohol dehydrogenase onto synthetic polymers. An overview of the state of the art in the field until 1968 was published by Kay (1968), more recent developments being surveyed in reviews by Messing (1975, 1985), Wingard, Katchalski-Katzir and Goldstein (1976), Chibata (1978), Kennedy and Cabral (1983)). The current techniques for enzyme immobilization include:
382
a) adsorption of the enzyme to carrier surface, b) covalent bond formation between the enzyme and the carrier surface, c) cross-linking of enzyme molecules (copolymerization), d) entrapping of the enzyme in the matrix, e) encapsulation or anchoring of the enzyme in a membrane structure. Promising results have been obtained with combinations of various methods. For instance, adsorption of an enzyme to the carrier combined with cross-linking of the enzyme with bifunctional agents was found to enhance the immobilization yield and to improve other properties important for production applications.
11.5.1
Adsorption of an enzyme to a carrier surface
Physical adsorption is a reversible interaction between the carrier and the enzyme molecules. Because of these weak interactions the bond is highly labile and the enzyme can be readily desorbed by changes in pH, ionic strength, temperature or reactant concentrations. For these reasons a stable biocatalyst is difficult to obtain with reproducible yields. Although the method is simple and requires a mere contact of the carrier with enzyme molecules under mild conditions, this inherent instability of the biocatalyst makes it the least suitable for enzyme immobilization. A better method is immobilization of enzymes by ionic bonds which are stronger than physical adsorption. The resulting biocatalyst is therefore also more stable provided suitable pH and ionic strength are maintained. On altering the reaction conditions (pH, ionic strength) the enzyme can be released from the carrier and reused. Chelation or metal bonds are used to bind the enzyme to a carrier surface activated by various agents, most often titanium(IV) oxide. This very simple method makes use of mild binding conditions because the activation and neutralization of the carrier is carried out prior to the contact with the enzyme. The weak interactions between the activated carrier and the biologically active material were formerly ascribed to physical adsorption. The underlying mechanism is assumed to be ligand replacement or exchange because change in pH, temperature or ion concentration brings about a more or less complete desorption. Amination or carboxylation of the carrier was used to obtain a more uniform product and to reduce the inhibitory effects of titanium. Immobilization of enzymes by adsorption was reviewed by Goldstein and Manecke (1976), Chibata (1978) or Messing (1985).
383
11.5.2
Covalent bonding to a carrier surface
Immobilization of enzymes by covalent bonding to the carrier surface is the most c o m m o n method because it precludes the desorption of the enzyme from the carrier and can be used over a wide range of pH and ionic strength Table 11.1 Some reactive groups for enzyme immobilization Agent
Type
Reactive groups
Glutaraldehyde
--CH=O
dialdehyde
Sodium periodate
--CH=O
dialdehyde 0
II
N
C arboimide- N-hydro xys u ccinimide
C
II
activated ester
--C--
1
I
--C
C--
I
Titanium tetrachloride
0
I
\ /
/ Ti
CI
I
--N--C--CH2--CH2--C
II
O
Thiophosgene N-Hydroxysuccinimidobromoacetate
Hydrazinenitrous acid
--N=C=S
//
\
acyl chloride C1 isothiocyanate
0
II
--N--C--CH2--Br
I
I --
E-
l
I
O
bromoacetamide
acylazide
_ tCl_hr --C
Ethyl chloroformate
metal chelate
\
C1
Thionylchloride succinanhydride
0
\
/
0
cyclic carbonate
C
II
0 Acetyl-H +
--CH=O
aldehyde
384
values. Its disadvantage is that the preparation of the biocatalyst includes several steps. The chemical bond can be accomplished using a number of functional groups belonging to the protein moiety of the enzyme" a- and e-amino groups, a-, fl- and y-carboxy groups, sulphydryl groups, imidazole groups and hydroxyl groups (Table 11.1). Suitable carriers include carbohydrates, proteins and substances containing amino groups, as well as inorganic materials. The binding of the enzyme to a carbohydrate carrier is accomplished either by binding the cyano group of cyanogen bromide to two hydroxyls on the carrier surface (a in formula 11.1) or by binding the carboxy group of cellulose to carbodiimide (b in formula 11.1) O
I
O--C--NH--E + B r C N --~ OH O
NR'
I
II
I--C--OH+C
I
\ C = NH O /
OH
O NHR' O I [ NH2--E I +2H + --~I--C--O--CH 9 --C--NH--E+O=C
NR"
I
NHR' I
I
NHR"
NHR"
Formula 11.I
A number of polyfunctional agents are used to covalently bind an enzyme to a protein or a carrier containing amino groups. For instance, diazobenzidine selectively binds tyrosyl groups, glutaraldehyde forms Schiff bases with amino acids, aliphatic and aromatic isocyanates with urea, isothiocyanates with thiourea, etc.. The most common are inorganic carriers, especially those with silan bonds. This technique involves the linkage of silan, especially y-aminopropyltriethoxysilan, to the inorganic surface via an inorganic functional group. This is then bound by a covalent bond to the amino group of the enzyme. O
O
- - O - - S i - - O --Si(CH2)3 NH2
--O--Si--OH-O --O--Si--OH--
0
Formula 11.2
O
+(EtO)3Si(CH2)3 NH2 ~
O
O
- - O ~ S i - - O - - Si(CH2)3 NH2
0
0
+ EtOH
385
The terminal amine can be bound to the enzyme by a bifunctional agent or polymerized isocyanate. 11.5.3
Cross-linking of enzyme molecules (copolymerization)
The method is based on the creation of intermolecular bonds between enzyme molecules by bifunctional or polyfunctional agents (Fig. 11.3). Enzyme molecules can bind not only mutually but also to other molecules. The enzyme activity of the immobilized preparations depends on the degree of crosslinking. The use of high concentrations of cross-linking agents results in the
/
Fig. 11.3 Cross-linking of enzyme molecules
formation of more numerous bonds, but the enzyme activity is usually low because the extensive cross-linking may hamper the diffusion of the substrate to the active site(s), which can itself be subject to cross-linking. The ensuing immobilized biocatalysts have a rubbery or gel-like texture and are difficult to use for practical purposes except when they can be prepared in the form of membranes that can be used in a spiral configuration in bioreactors. 11.5.4
Entrapment of enzymes in a matrix
Enzyme trapping can be taken as a physical immobilization of the enzyme in the matrix network. In contrast to enzyme cross-linking and copolymerization, the enzyme is not a chemical component of the matrix. The matrix is usually polyacrylamide or similar substances, but also starch, collagen, agar, alginate, etc. are used. The disadvantage of this kind of process is the
386
tendency of the entrapped enzyme to escape into the environment, which is brought about by the fact that the gel has large pores (gels with uniform pore size are very difficult to prepare). Another problem is the idiffusion through the pores, especially with large substrate molecules. Also, free radicals arising in the polymerization of synthetic gels may inactivate the enzyme. The washing out of the enzyme can be prevented by cross-linking the entrapped enzyme by a bifunctional agent. These techniques however are used mainly for cell immobilization. 11.5.5
Encapsulation or anchoring of an enzyme in a membrane structure
Encapsulation or microencapsulation of an enzyme entails its incorporation into a semipermeable polymeric membrane which protects the enzyme from inactivation. The preparation includes interface polymerization, evapor-
/ enzyme \\ / +
!\Xhydrophi[ic ) monomer i \ ~ w j
J
/
organic solvent emulsification
f
/ ,_1 ~i
\
)
~
solvent
organic
infer-surface polymerization
~-'-
\
enzyme
organic
~
C
~"'--"
1/ enzyme \~. ~>lJPolymer I~ \'~'---sol,ution / ]
!I
,:,
2. emulsion
E \
enzyme \
/
I .~
3.drying
(heating, vacuum) to>
~/-,~ 9 enzyme \ \ , > ~ I concenfrafed I I ~ 2: \\
/
o
emulsification
organic sotvent
organic sol.vent
sol.vent 1.emutsion
C
removalof nonreacted monomer
/
organic
/
sol,vent
phase separation
or-
solvent exchange
Fig. 11.4 Methods of enzyme encapsulation by (a)inter-surface polymerization, (b)solvent evaporation, (c) phase separation (Chibata, 1978)
387
ation of the solvent and phase separation (Chibata, 1978) as seen in Fig. 11.4. Encapsulated enzymes are suitable only for degradation of low molecular substrates; on the other hand the amount of immobilized enzyme referred to the volume of the immobilized preparation is the highest among all the methods used. The materials used for constructing membranes on or into which enzymes are immobilized include cellulose nitrates, acetates or ethylcellulose, collagen, etc.. These semipermeable membranes can be shaped as flat plates, dialysis tube or hollow fibres. The method is simple and the activity of the immobilized enzyme does not change during the process because the enzyme remains in fact in solution in its natural form. Increasing the diffusion velocity of substrate or product molecules by altering the flow rate can however cause enzyme losses, especially in membranes with higher porosity.
11.6 TECHNIQUES OF CELL IMMOBILIZATION
These techniques can be divided into three groups (see Fig. 11.5): a) immobilization of cells without the use of a carrier, b) immobilization of cells to a carrier, e) immobilization of cells by encapsulation and by trapping into polymers. 11.6.1
Cell immobilization without a carrier
This immobilization technique requires no natural or synthetic carriers and represents, in principle, the immobilization or stabilization of enzymes in cells or aggregated cell particles. The easiest way to stabilize enzymes in cells is to heat the cells to 60 to 80 ~ for several minutes, provided of course that the appropriate enzyme survives this heat treatment without activity loss. Other, undesirable enzymes such as proteinases, may suitably be denaturated by the treatment. Another promising treatment is exposure to a citrate solution that reacts with the chitosan present in cell walls, with subsequent heating to dryness (Tsumura and Kasumi, 1976). Pellets of filamentous microorganisms such as fungi or actinomycetes, can also be considered a form of immobilized cells. Cell immobilization can also be achieved through flocculation with various agents such as cationic or anionic polyelectrolytes, for example polyamine- and carboxy-substituted polyacrylamide (Lee and Long, 1974), mineral hydrocolloids or oxides, hydroxides, sulphates and phosphates of Mg 2+, Ca :+, Fe 2+, Fe 3+, and Mn 2+. Flocculated cells are then dried and further pro-
388
Pellet Mutual intertwinning and adhesion of the filaments
Cross-linking of cell contents A: without permeabilization, or B: with permeabilization (using glutaraldehyde or 2,4-toluene di-isocyanate)
f
Aggregation by flocculation Cells aggregate under the influence of flocculation agents (polyelectrolytes, mineral hydrocolloids)
\
Cross-linking of permeabilized cells In the presence of water-insoluble compounds, crosslinked, permeabilized cells covalently bind with glutaraldehyde
Microencapsulation Use of derivatives of cellulose, polyacrylates, etc.
Entrapment Entrapment into a water-insoluble polymer or a thermoreversible gel (cellulose, acrylamide, agar, alginate, etc.)
Physical bonding Use of carrier particles (ceramic material, porous glass) to which cells can bond physically
Polar bonding Use of carrier particles (ion-exchange resins) with which cells can form polar bonds
Covalent bonding Use of carriers (glycidylmethacrylate, methylaldehyde, etc.); cells form covalent bonds with the surface of the carrier
Fig. 11.5 Techniques of cell immobilization (Sikyta, 1986)
389
Aggregation by electrical or magnetic means
Aggregation cross-linking
by
covalent
Use of a water-soluble coreacting compound (polyethyleneimine or hexamethylenediamine)
Entrapment
Entrapment
Entrapment of cross-linked cells into polymer
Entrapment of cross-linked cells followed by cross-linking of cells with particles
Covalent bonding
Coordinate bonding
Cells form covalent bonds with the surface of crosslinked waste cells or filaments
Cells bond onto (or in) a polymer matrix of inorganic gel (polymer hydroxides/Zr, Ti, Fe, etc.)
KEY
Q cetts or fi[ctmenfs supporfing mQferia[ @ covatenf bonds
390
cessed to yield particles of the desired size. Cells immobilized in this way have a relatively low mechanical resistance. A very important method is the cross-linking of the intracellular contents or cell agglomerates (flocs, pellets) which appreciably stabilizes cells against autolysis. The cross-linked particles exhibit strongly increased sedimentation and mechanical firmness and the activity of the enzymes is usually increased. The mechanical strength and elasticity of cell aggregates is further enhanced by using a flocculation agent, such as a cationic agent, which reacts with the cross-linking agents. The cross-linking is usually conducted with polyfunctional agents that penetrate into the cell to react with appropriate parts of the cytoplasm, cytoplasmic membrane and cell wall. These polyfunctional agents include dialdehydes of dicarbonic acids, 2,4-toluenediisocyanate, chlorinated triazines, diazo-derivatives of acridine, acriflavine, pyridine and pyrimidine, and especially glutaraldehyde. The treatment of cells or cell aggregates with these agents may result in a substantial lowering or loss of enzyme activity. The reasons for this activity loss may be inactivation of the appropriate enzyme(s) by the polyfunctional cross-linking agents, or alternatively a substantial change of the permeability of the plasma membrane or the cell wall by these agents, which prevents the diffusion of the substrate to the enzyme (Munton and Russel, 1973). To restore the diffusion ability the cross-linked cells are permeabilized by toluene, cetyltrimethylammonium bromide or lauryl sulphate. The permeability of the biocatalyst can also be increased when the cells used for its preparation have previously been partially disintegrated or autolyzed. This treatment releases the cell contents and the cells after such treatment are cross-linked with glutaraldehyde or 2,4-toluenediisocyanate. In some cases the partially disintegrated cells are supplied, before their crosslinking, with water-soluble proteins such as albumin, or with water-soluble polyamines (polyethyleneimine, hexamethylenediamine) which increase the stability of enzymes susceptible to inactivation by cross-linking agents (Petre, Noel and Thomas, 1978). A similar method includes the use of a mixture of native and partially disintegrated microbial cells with co-reactants such as polyethyleneimine. A highly useful process consists in cross-linking the contents of individual cells by glutaraldehyde, permeabilization of the cross-linked cells and their subsequent mutual covalent bonding in the presence of compounds with two primary or secondary amino groups and glutaraldehyde. The resulting biocatalysts are stable and have suitable sedimentation and mechanical properties thanks to the double cross-linking of both the cell components and individual cells, performed in the first and the last reaction step (Vojtigek et al., 1980). If the cross-linking with glutaraldehyde or other polyfunctional agents
39 I
yields a preparation in which the diffusion of the substrate is satisfactory but the enzyme is inactive due to the cross-linking of its active site, a successful preparation can be obtained by immobilization procedures with water-soluble chemically reactive polymers with a high molecular weight. The immobilization process consists in preparing a solution of the reactive water-soluble polymers with glutaraldehyde (the polymers are obtained by polymerizing substances with two primary or secondary amino groups). This solution is then supplied with intact or disintegrated cells (VojtiSek et al., 1984). The procedure can be further modified by additional cross-linking with glutaraldehyde, or addition of water-soluble proteins as co-reacting substances. 11.6.2 Immobilization of cells to a carrier
Methods of cell immobilization of this type are similar to the methods used for immobilizing enzymes and are based on physical adsorption, physicochemical (polar) linkages, ionic bonds, chemical and coordination covalent bonds. They may also include a covalent bond via a spacer after carrier actiTable 11.2 Physical adsorption of cells to a carrier Carrier
Cells
Reaction ~~
Gelatine PVC Porous glass Anthracite Cotton fibres DOWEX resin Wood sawdust Cellulose
lactic bacteria Sacclia romyces ca rlshergensis Snccharomjws car1.yhergeti.si.c. Pseudomonas vp. Zi3momonu.s mohilis Escherichiu coli Nocardiu eqi~tl~ropolis S u c c h a r o m j x s cerecisiae A.c.pergil1u.s i q ' z a e Penicilliutn roqirefbrti
lactose/lactic acid beer glucose/ethanol phenol degradation glucose/ethanol succinic acid steroid conversion glucose/ethanol sucrose hydrolysis fatty acid oxidation
vation, or physical adsorption with covalent cross-linking. Among the carriers used for this treatment of cells are inorganic (glass, sand, clays, granules or chips, ceramics, bentonite, etc.) or organic materials (cellulose, ion exchanger resins). The first immobilization of this type was described by Hattori and Furusaka (1960, 1961). For physical adsorption the cells are simply mixed with the carrier, which can be any material reacting with the cell (Table 11.2). The resulting binding of cells to the carrier is usually not very tight, the cells tend to become re-
392
leased from the carrier surface and to undergo autolysis. The enzyme activity is also rather low. As seen from Table 11.3, which shows the weight of Saccharomyces carlsbergensis cells adsorbed on various carriers, the efficiency of adsorption of given microorganism depends strongly on the type of carrier used. Immobilization of cells by chemical linkage is brought about by mixing the cells with a carrier that has previously been chemically activated or modified in such a way that it contains chemically active groups capable of reacting with appropriate chemical groups on the cells. Carriers suitable for this technique are chemically reactive organic polymers or monomers (glycylmethacrylate, methacrylate with epoxide or aldehyde groups). Another commonly used group of carriers includes polymeric hydroxides of Fe 3+, Zr 4+, Ti 3§ or Ti 4+, in which the cells are immobilized both on the surface and within the polymer. These biocatalysts have satisfactory sedimentation and hydrodynamic charactecist~cs and ~etain a high enzyme activity..A factor limiting_their use is a high cost. Table 11.3 Immobilization of 1976)
Saccharomyces carlsbergensis cells on different carriers (Navarro,
Carrier Wood shavings PVC shavings Dowex 1 x 8 (acetate) Duolite A 162 (acetate) Duolite A 101 D (acetate) Duolase 6 P 3 Sphaerosil XOB 015 Sphaerosil treated with glutaraldehyde
Cell dry matter (mg g-i carrier) 248 80 21 9 17 2.5 17 2
Among carriers to be used are also microorganisms that are produced as wastes in various microbiological productions, and their price is correspondingly low. Cells and cell walls contain natural polymers (polysaccharides, chitosan, chitin, mannan, teichoic acid substituted with a-D-glucopyranosyl residues), amino groups and other reactive groups capable of binding to other cells or enzymes. The stability of cells or cell aggregates immobilized physically or chemically can be increased by cross-linking the cells with carriers by polyfunctional agents; diffusion can be enhanced by permeabilization and subsequent cross-linking.
393
11.6.3 Immobilization of cells by trapping into polymers Entrapping into polymers is used mainly with living cells. The immobilized cells are then not liberated into the solution, diffusion of substrates to and into the cells is sufficient and the cells can even grow. The technique can be used to immobilize not only microbial but also plant and animal cells. Immobilization materials include synthetic polymers (polyacrylamide, polyvinyl chloride, photo-cross-linked resins and polyurethane) as well as natural polymers such as calcium alginate, r-carrageenan, agar, gelatine, cellulose and collagen. A great advantage of polymer-trapping methods, especially those using natural polymers, is that the immobilization proceeds under mild conditions and the cells retain a high activity for long periods of time. As found by Cheetham, Imber and Isherwood (1982), bacterial cells immobilized in alginate gel are 350-fold more stable than free cells.
Synthetic polymers Among the synthetic polymers, polyacrylamide gel has been the most widely used since 1966 (Mosbach and Mosbach, 1966). The immobilization procedure consists of adding the cells into the solution of the monomer, i.e. acrylamide, and the co-monomer N,N-methylenebisacrylamide, in the presence of polymerization initiators and promoters such as ammonium peroxybisulphate and N,N,N',N'-tetramethylenediamine (Klein and Vorlop, 1985). The efficiency of the biocatalyst is affected by the content of acrylamide, weight ratio of the cells to acrylamide, and the size of the gel particles. The first two factors are responsible for gel hardness and pore size while the particle size determines the enzyme activity and stability. The efficiency of the biocatalyst is the highest when the gel polymerization is carried out at 0 ~ and it decreases on increasing the temperature. The period of polymerization plays an important role" its shortening under 5 h causes lowered efficiency of the biocatalyst while its extension brings about inactivation of enzymes. Table 11.4 surveys some of the operations making use of cells immobilized in this way. Further advances in the development of biocatalysts based on synthetic polymers were marked by the introduction of techniques using gels formed from prepolymers of photo-cross-linked resins and polyurethane (Omata et al., 1979; Fukui, 1983). These techniques offer a number of advantages: the formation of the polymer matrix can be achieved in a simple way under very mild conditions. The prepolymers of a photo-cross-linked resin are polymerized by UV light for several minutes, urethane prepolymers by a mere mixing with aqueous cell suspensions. The reactions thus proceed without heating or
394
extreme pH changes, and without using chemicals which could modify the structure of the biocatalyst. In addition, prepolymers containing a number of photosensitive functional groups or isocyanate groups (in the case of urethane) with a certain spacing can be prepared in advance in the absence of the biocatalyst. This feature makes it possible to select the dimensions of the gel matrix network. The length of the main prepolymer chain is closely connected Table 11.4 Cell immobilization in polyacrylamide gel Cells
Curvularia lunata Brevibacterium ammoniagenes Escherichia coli
Substrate
Enzyme
Reaction or product
compound Reichstein S fumaric acid
steroid- 1 l-A-hydrolyase fumarase
cortisol
fumaric acid
L-aspartate ammonia lyase penicillin amidase
L-aspartic acid
Escherichia coli
penicillin G
Achromobacter liquidum
L-histidine
Clostridium butyricum Arthrobacter Escherichia coli Arthrobacter aceris Yeasts Streptomyces fradiae
glucose steroids lactose NAD + + ATP sucrose
L-histidine ammonia lyase oligoenzyme system fl-galactosidase NAD § kinase invertase oligoenzyme system
L-malic acid
6-aminopenicillanic acid urocanic acid hydrogen A-3-ketosteroids glucose + galactose NADP glucose + fructose proteases
with the network structure of gels formed from the prepolymers. Microbial cells trapped in prepolymers have been successfully used in a number of processes (Table 11.5). An important advantage of polyurethane biocatalysts is the possibility of their application for biotransformations of both water-soluble and insoluble, and even strongly hydrophobic substances.
Natural polymers Natural polymers are ideal materials for cell immobilization because, in contrast to synthetic polymers, they are inert, do not damage the cells and are substantially cheaper. Immobilization of cells in natural polymers ensures conditions very similar to natural ones (Kennedy, 1982). The procedure used for immobilization of cells into heat reversible gels such as agar or gelatine consists of a simple addition of the cells and their mixing with a warm polymer (at about 50 ~ The gel is then left to set and is
395 Table 11.5 Use of cells immobilized in prepolymers Use
Microorganism (condition) Baker's yeast (dried) Hansenula jadinii (dreid) Rhodotorula minuta (lyophilized) Yeast (growing) Nocardia rhodocrous (lyophilized) Arthrobacter simplex (acetone powder) Corynebacterium sp. (live) Streptomyces roseochromogenes (untreated) Enterobacter aerogenes (lyophilized) Escherichia coli (untreated) Citrobacter freundii (acetone powder) Alcaligenes eutrophus (untreated) Escherichia coli (untreated) Escherichia coli (acetone powder) Propionibacterium sp. (growing) Methanogenic bacteria (growing) Curvularia lunata (live) Rhizopus stolonifer (live)
ATP production production of CDP-choline DE-menthol cleavage ethanol production steroid dehydrogenation steroid dehydrogenation steroid hydroxylation steroid hydroxylation adenine arabinoside production 6-aminopenicillanic acid production cephalosporin assay NADH production L-aspartic acid production L-threonine assay vitamin B 12 production methane production steroid hydroxylation steroid hydroxylation
mechanically processed to obtain particles of the required size. In another procedure a warm agar solution containing cells (usually 2.5 to 3.5 % aqueous agar solution) is left to trickle in drops through a small orifice into toluene or tetrachloroethylene. The resulting gel beads differ in size according to the rate of dripping (Toda and Shoda, 1975). Some operations employing these biocatalysts are listed in Table 11.6. Table 11.6 Immobilization of cells in agar gel Microorganism
Substrate
Enzyme
Escherichia coli
penicillin G
penicillin amidase
Fusarium fulvorum
penicillin V
penicillin amidase
Mycobacterium flavum
cortisone
Saccharomyces pastorianum Escherichia coli Clostridium butyricum Rhodospirillum rubrum Yeasts Pichia stipitis I
sucrose
3-ketosteroid A-dehydrogenase invertase
lactose different malate lactose xylose
fl-galactosidase oligoenzyme system oligoenzyme system fl-galactosidase oligoenzyme system
Product 6-aminopenicillanic acid 6-aminopenicillanic acid prednisolone glucose + fructose glucose + galactose H2 H2 + CO2 glucose + galactose ethanol
396 Table I 1.7 Immobilization of cells in alginate Cells
Methanosarcina barkeri Candida tropicalis Saccharomyces cerevisiae Saccharomyces carlsbergensis Lactic bacteria Kluyveromyces marxianus Aspergillus niger Claviceps purpurea Gluconobacter oxydans Streptomyces tendae
Substrate wastes phenol glucose milk (lactose) inulin molasses complex complex complex
Product methane C O 2 + H:O ethanol beer milk curdling, yoghurts ethanol citric acid clavine alkaloids glycerol nikkomycin
Biocatalysts based on alginates (heteropolymers of carboxylic acids linked by (1-4)-glycosidic bonds of fl-D-mamuronic and a-L-guluronic acid) are produced by mixing cells into a 2.5-4 % (w/w) polymer solution and letting the mixture drop into cold water containing a minimum of 0.05 % (w/w) calcium chloride. This yields small particles of the immobilized biocatalyst (Hackel et al., 1975; Kierstan and Bucke, 1977). It should be noted that calcium alginate particles tend to dissolve in solutions containing phosphate ions. However, treatment with trivalent cations, for instance 0.1 M aluminium nitrate, doubles the firmness of the gels and makes them stable even in phosphate-containing media without impairing the cell activities (Rochefort, Regh and Chau, 1986). Some typical applications of the alginate immobilization technique are given in Table 11.7. u-Carrageenan, which is composed of fl-o-galactose sulphate and 3,6-anhydro-a-o-galactose, acquires a gel structure on cooling, similar to agar (Takata, Tosa and Chibata, 1977). Particles suitable for applications are produced by dripping of a warm carrageenan solution containing cells into cold water containing ions such as Cu 2+, Mg 2+, Fe 3+, K § NH4 +, Ca 2+ or amines, or else solvents immiscible with water. The immobilized biocatalyst is readily dissolved in physiological saline; this treatment separates cells from the gel so that their physiological state after the catalytic process can be studied (cell count, autolysis, etc.). Cell immobilization is also accomplished with the aid of structural insoluble proteins such as collagen (Vieth, Wang and Saini, 1973; Vieth and Venkatasubramanian, 1976) or zein. The cells are immobilized in the material by dispersion, i.e. by intensive stirring of a cell suspension which is then poured out to form a thin film. It is then dried in the air, can be treated with glutaraldehyde and is fabricated most often in the form of plates.
397
Cell immobilization by precipitation with water insoluble polymers is usually done by mixing the cells with the polymer (most often cellulose and its derivatives) dissolved in an organic solvent and precipitating the mixture in water or another solvent. This technique yields the biocatalyst in the form of membranes, interwoven fibres, hollow fibres, and can also be used for microencapsulation of cells similar to the encapsulation of enzymes (Chang, 1977).
Preparation of beads of gel-immobilized biocatalysts This preparation entails the dripping of cell suspension in a polymer from a capillary tube into a solution of a cross-linking agent. The bead size can be regulated by changing the nozzle flow of the mixture. Vorlop and Klein (1981) described a 42-nozzle device based on this principle, capable of producing 3 to 5 kg h -1 biocatalyst beads 3 mm in diameter. With decreasing bead size the production capacity of the device decreased considerably. The 2
3
M
rm-3
Fig. 11.6 Schematics of a device for preparation of immobilized biocatalysts (Matulovic, Rasch and Wagner, 1986) 1 -- temperature control, 2 - pressurized air inlet, 3 -- polymer and cell inlet, 4 -- reservoir for polymer and cells, 5 - motor with adjustable revolutions, 6 - driving belts, 7 - - shaft, 8 - inlet for solution of cross-linking agent, 9 pellet collector, 1 0 rotating ring with nozzles, 11 -- rotating vessel, 1 2 - solution with crosslinking agent
mechanical vibration system used by Hulst et al. (1985) had a production capacity of 24 1 h-~ of biocatalyst beads 1.1 mm in diameter. The system is suitable for cell suspensions in low-viscosity polymers but the beads have a low mechanical strength. Another method for preparation of biocatalysts in alginate beads smaller than 1 mm makes use of two liquid nozzles (Regh, Dorger and Chau, 1986). Like the preceding method, it can be used only with low-viscosity polymers because at concentrations above 1% (w/w) the nozzles become clogged. This
398
problem is overcome in the device illustrated in Fig. 11.6, a ring fitted with nozzles and rotating at a high velocity. The number of nozzles is 70-120, nozzle diameter 0.5-1 mm and rotation speed 1400-1800 rpm. The device produces biocatalyst beads of 0.5-1 mm in diameter, at a rate of up to 24 kg h -~ and with different types of polymers (alginate, ~-carrageenan, agar, chitosan). These immobilized biocatalysts are mechanically resilient because they are fabricated from concentrated polymer solutions injected into solutions of cross-linking agents.
11.7 IMMOBILIZED BIOCATALYSTS OF THE SECOND GENERATION
All the biocatalysts described above can be taken as belonging to the first generation because they are used mostly for simple single-stage reactions. Their merits as compared with the use of free cells or enzymes have been demonstrated in a number of industrial applications, such as the production of fructose syrups, 6-aminopenicillanic acid, aspartic acid, L-amino acids from mixtures of o- and L-amino acids, hydrolysis of lactose, and others. Interestingly, immobilized biocatalysts have not yet been introduced in some traditional large-scale processes such as starch hydrolysis. At present, attention is concentrated on the research and development of immobilized biocatalysts of the second generation which" a) accomplish whole sequences of reactions leading to desired products (oligoenzyme systems -- co-immobilized biocatalysts, mixtures of immobilized biocatalysts), b) improve the functions of currently produced biocatalysts (co-immobilization of biocatalysts with substances regulating pH, with substrates, especially insoluble ones, or with magnetic substances facilitating biocatalyst separation), c) permit regeneration of cofactors, d) accomplish biosynthesis of catabolite and biosynthetic products (primary and secondary metabolites) similar to those performed by free cells, e) are used to perform reactions in nonaqueous media or with water-insoluble substrates. The development of these second-generation biocatalysts is paralleled by the development of new types of reactors suitable for these biotransformations and biosyntheses.
399
11.7.1
Immobilized biocatalysts used for biosyntheses
The biosynthesis of catabolite or biosynthetic products is currently performed with living immobilized cells. Catabolic products are usually produced with the aid of nongrowing immobilized cells, biosynthetic products by nongrowing or growing cells. The main advantage of immobilized biocatalysts is that the processes can be carried out for long periods of time vastly exceeding the possibilities of free cells (hundreds of days in semicontinuous or continuous operations). The immobilized state was also found to increase the genetic stability of the cells. Immobilized cells do not undergo mutations as frequently as do free cells, as attested by their long-term stability in metabolite productions. Cell ageing, however, affects both morphological and physiological characteristics of the immobilized cells. In some productions these changes have no substantial effect on products synthesis, whereas in others the rate of the synthesis is affected due to changes in the permeability of the cell wall and plasma membrane, reorganization of cell organelles, etc.. A question which still awaits clarification is what morphological or physiological state of microorganisms is optimal for immobilization. Some authors recommend the use of spores for immobilization of sporulating microorganisms because they are heat resistant and consequently more easily sterilized by heat. The genus and species of the microorganism whose spores are immobilized is also important. K~en et al. (1987) found on immobilizing Claviceps fusiformis in alginate gel that the biosynthesis of clavine alkaloids is best performed with vegetative cells from the early production phase, while immobilized conidiospores gave lower yields. On the other hand, Kopp and Rehm (1984) found no difference between immobilized spores and vegetative cells of Claviceps purpurea. As with free cells, the choice of a correct type and age of the inoculum to be immobilized is another important factor and so is the composition of the inoculum culture medium. The composition of the production medium differs from the culture medium for free cells, especially in the biosynthesis of secondary metabolites. It contains lower concentrations of substrates necessary for growth (phosphorus, nitrogen) because a very high concentration of cells can be used at the very onset of the process and it is then unnecessary that their number should further increase. This medium composition is advantageous especially for the production of secondary metabolites where an excessive concentration of phosphorus often causes inhibition of biosynthesis. In principle, the rate of biosynthetic reactions is directly proportional to cell concentration in the immobilized biocatalyst but the actual optimal ratio of biocatalyst components differs from process to process. An additional important factor in aerobic processes is the supply of oxy-
400 Table 11.8 Catabolic products produced by immobilized cells Product Butanol
Ethanol
Microorganism Clostridium acetobutylicum Clostridium beyerinckii CIostridium butyricum Endomycopsis fibuligera Kluyveromyces fragilis Pachysolen lennophilus Saccharomyces carlsbergensis Saccharomyces diastaticus Saccharomyces cerevisiae
Glycerol
Zymomonas mobilis Saccharomyces cerevisiae
2,3-Butanediol Isopropanol
Enterobacter aerogenes CIostridium butyricum
Immobilization alginate alginate alginate polyurethane foam alginate alginate kieselguhr polyurethane foam u-karrageenan, agar, ion exchangers, alginate, bagasse, wood shavings polystyrene, alginate, u-karrageenan sintered glass, alginate, u-karrageenan, polyacrylamide u-karrageenan alginate
Table 11.9 Biosynthetic products produced by immobilized cells Product Acetic acid Citric acid Lactic acid L-Glutamic acid L-Isoleucine 12-Ketochenodeoxycholic acid Amylase Cellulase Protease fl-Galactosidase Vitamin B 12 Candicidin Bacitracin Cephalosporin Penicillin G
Microorganism
Immobilization
Acetobacter aceti Acetobacter sp. Aspergillus niger Saccharomyces lipolytica Lactobacillus lactis Lactobacillus delbrueckii Brevibacterium flavum Corynebacterium glutamicum Serratia marcescens Brevibacterium fuscum
porous ceramics hydrated titanium oxide alginate wood shavings alginate alginate collagen polyacrylamide x-karrageenan u-karrageenan
Bacillus subtilis Bacillus amyloliquefaciens Trichoderma reesei Streptomyces fradiae Lactobacillus bulgaricus Propionibacterium sp. Streptomyces griseus Bacillus sp. Streptomyces clavuligerus Penicillium chrysogenum
polyacrylamide u-karrageenan rt-karrageenan polyacrylamide agar, acetyl cellulose polyurethane collagen polyacrylamide polyacrylamide polyacrylamide
40 1
gen to the immobilized cells. Its effect can kinetically be described similarly as the coil (pellet) growth. Oxygen deficit leads to inhibition of cell respiration and experiments were therefore done with oxygen donors that could increase its availability for the cells. Though technically feasible, this procedure is economically unfavourable, in particular in long-term operations. The limited rate of metabolic reactions and proliferation in immobilized cells can be expected to affect the spectrum of the metabolites produced both positively and negatively, i.e. either the production of undesirable metabolites is lowered or these undesirable products are excreted at the expense of the production of the needed metabolite. These effects are associated with the rate and course of metabolic reactions and with regulation of enzyme synthesis and activity in immobilized cells, and the pertinent problems have yet to be solved. Some selected catabolic products obtained with the aid of immobilized microbial cells are surveyed in Table 11.8 together with the immobilization techniques used, biosynthetic products are given in Table 11.9. It should be noted, however, that the products in question have been produced on the laboratory scale and no report on their being introduced into industrial productions exists. 11.7.2
Co-immobilized biocatalysts and biocatalyst mixtures
Co-immobilized biocatalysts are systems that contain in a single particle several different enzymes or cells, mixtures of enzymes and cells, coenzymes (cofactors) with enzymes or cells, or biocatalysts containing other solid substances. As to the types of carriers and gels used and the binding techniques, co-immobilization can essentially be performed using the technologies described above. The selection of the method depends on the purpose for which the co-immobilizate is to be used. The basic possibilities of preparation of coimmobilized biocatalysts are illustrated in Fig. 11.7. Some series of reactions cannot be accomplished with co-immobilized biocatalysts owing to various diffusion barriers in the carrier used, or to considerable differences between pH and temperature optima of individual biocatalysts. For these purposes it is advisable to use mixtures of individually immobilized biocatalysts, individual reactions being carried out in a single bioreactor or in separate bioreactors.
Co-immobilization of different biocatalysts An example of a natural co-immobilization is mixed populations growing on solid substrates in water, streams or lakes. Selection-acquired populations of different microorganisms and protozoa are used as immobilized living cells
402
@| @|
|174 |174
O0 O0
O0 O0
,,
adsorption
gel
ftoccutofion
co-immobilization of live cells
[-
~ - ~
p
lr
adsorption
gel
ftoccu[Qfion
co-immobilization of live and nonliving cells
o~ 9 9 o e o o
o
9 o 9 e
i
9 o
9 ~9 o~ o O O9 ooo ~ ooO o 9
-...j
\./
.
co-immobilization of live cells and enzymes
o
co-immobilization of nonliving cells and enzymes
Fig. 11.7 Basic types of preparation of co-immobilized biocatalysts
for aerobic and anaerobic water treatment and for removal of both toxic and nontoxic wastes. Co-immobilized biocatalysts are conveniently used with mixtures of substrates that cannot be fully utilized by a single microorganism because of its lack of appropriate enzyme spectrum. Another application is in multistage enzyme syntheses of complex substances. An example of such an application of co-immobilized enzymes is given in Fig. 11.8. The synthesis of penicillins and cephalosporins from 6-(L-a-aminoadipyl)-L-cysteinyl-D-valine by Streptomyces clavuligerus (Jens6n, Westlake and Wolfe, 1984) requires four enzyme types: cyclase, epimerase, ring-extending enzyme and an oxidizing enzyme. When these enzymes are co-immobilized on ion exchangers, the reaction takes place within 60 min of substrate addition. Co-immobilization of enzymes and cells is also advantageous when the synthesis of the desired products has to be preceded by a step involving degradation of a primary substrate to reaction products that serve as the actual substrate in the synthesis, or are used in further reactions. Examples of such procedures with co-immobilized enzymes and cells are given in Table 11.10, and a detailed description of one of them is in Fig. 11.9. Immobilized cells of
403 L
H "" COOH
0
H
SH
CH 3
----N ----'C - H D ~COOH
0~
~;- (L'- o~ a m i n o a d i p y l ) - L - c y s l e i n 7 [ - D - va[[ne
I
ring forming enzyme H
, L
H'" c o o H
o
S CH 3 ,~C /
j -
o~
=q-.
COOH
isopenicillin N
I
epimerQse
1
H , L
~'i
li
coo~
[
o
0
S_
I\~L"
|
CH,$
[
..---N~qU ~
COOH
penici[tin N
I
ring extending enzyme
1
H
lid H
I
I
COOH
S ~ /
0
/
._--"~ N ~ 0q \ f
COOH deacetoxycephalosporin C I oxidizing enzyme
CH 3
1 H 2
H
N
~
/
N
'r-S
S
COOH deacetytcephalosporin C
Fig. 11.8 Enzymes participating in the biosynthetic pathway of penicillins and cephalosporins in Streptomyces clavuligerus (Jens6n, Westlake and Wolfe, 1984)
404 Table 11.10 Co-immobilized systems cell-enzyme (Hartmeier, 1985) Component 1
Component 2
Saccharomyces cerevisiae Saccharomyces cerevisiae Saccharomyces cerevisiae Saccharomyces cerevisiae Zymomonas mobilis Zymomonas mobilis Saccharomyces cerevisiae Aspergillus niger Aspergillus niger
fl-glucosidase glucoamylase fl-galactosidase pepsin fl-galactosidase fl-glucosidase glucose oxidase catalase glucoamylase
Application cellobiose fermentation low-dextrin beer lactose fermentation low-protein wine lactose fermentation cellobiose fermentation gluconic acid + fructose gluconic acid + fructose oxygen removal from beer
H~,O H202
.v .-'.-'.-'.-'.-'.-'."."i"
""..'.-'..].].'..{.'.'"
glucose gtuconic acid
Fig. 11.9 Co-immobilization of catalase with Aspergillus niger mycelium containing glucose oxidase (D6ppner and Hartmeier, 1984)
Aspergillus niger use their glucose oxidase to oxidize glucose to gluconic acid. This reaction is strongly inhibited under oxygen deficit. To ensure sufficient oxygen supply a co-immobilizate is fabricated which contains immobilized glucose oxidase in cells to whose surface catalase had been bound. On addition of hydrogen peroxide, which serves as a donor of oxygen, the reaction rate increases 10-fold as compared with the conventional procedure in which oxygen is supplied by aeration. A modification of this procedure was published by Hartmeier and Heinrichs (1986) who co-immobilized live cells of
/
\\o]o.
\
o)I 4
Fig. 11.10 Co-immobilization of catalase with cells of Gluconobacter oxidans containing glucose oxidase (Hartmeier and Heinrichs, 1986) 1 -- alginate, 2 - catalase molecules, 3 - cells of Gluconobacter, 4 - membrane
405
Gluconobacter oxidans with catalase in alginate gel and coated the resulting beads (diameter 1 mm) with a semipermeable membrane of Eudragit, an acrylate-methacrylate copolymer (Fig. 11.10). As in the preceding case, the main advantage of this technique was the substantial acceleration of the reaction, and an appreciable extension of the half-life of biocatalyst activity. Very promising is the possibility of co-immobilization of enzymes with cofactors. Although the method of cofactor immobilization or binding has been known since 1979 (Wang and King, 1979) its industrial use was described only recently. Wandrey (1984) co-immobilized an oligoenzyme system containing the appropriate enzymes along with cofactors necessary for the production of L-methionine, L-valine and L-phenylalanine from keto acids. NAD § a-keto acid dehydrogenase and formate dehydrogenase were bound to polyethylene glycol (Fig. 11.11) and placed in a membrane bioreactor. The production capacity was 10-15 tonnes amino acids per month. A similar system was described by Kato et al. (1987). N6-[N-(6-aminoethyl)carbamoylme thyl]-NAD was covalently bound to formate dehydrogenase (FDH). The F D H - N A D complex served for the regeneration of NAD(H) necessary for further reaction, according to the scheme pyruvate FDH-
lactate d e h y d r o g e na s e -~ lactate N A D H --~ F D H -
CO 2 (
NAD + COOH
If the co-immobilized biocatalyst cannot be used for some reasons, a mixture of individually immobilized biocatalysts is used instead. Thus the initial substrate for production of L-alanine in a two-stage reaction is fumaric acid which is converted to L-aspartic acid by aspartase contained in immobilized cells of Escherichia coli. This is further decarboxylated to L-alanine by immobilized cells of Pseudomonas dacunhae containing L-aspartate-fl-decarboxylase. The co-immobilization of these cells is feasible but is not practi-
ot-keto acid
COOH
I
C--O
carbon dioxide COz
I
R
NH40H
- NADH2 ~
2 HzO -=
NAD
COOH I H--C~NHz L- amino acid
I
R
1 ~ E
1
2
H~COOH
formic acid
Fig. 11.11 Production of L-amino acids and a - k e t o acids E~ - - d e h y d r o g e n a s e of ketoacids, E2 - formate d e h y d r o g e n a s e
406
cable because the pH optima for the different reactions differ widely. The cells of the microorganisms were therefore immobilized separately and were used in separate bioreactors kept at different pH values (Chibata, Tosa and Takamatsu, 1984).
Co-immobilization of biocatalysts with organic and inorganic substances This method is used for improving the properties of immobilized or coimmobilized biocatalysts. Such immobilization was first described by t~ulik et al. (1964) and concerned the co-immobilization of Escherichia coli cells with calcium carbonate in agar gel. Calcium carbonate was used for regulating the pH in the co-immobilizate particles because otherwise the hydrolysis of penicillin G by penicillin acylase contained in the catalyst was accompanied by a marked drop in pH inside the particles that eventually stopped the reaction. Wang and Hettwer (1982) co-immobilized yeast cells in a ~-carrageenan gel together with 10 % (w/w) secondary calcium phosphate. The co-immobilization was found to enhance the gel density and the particle sedimentation rate, to maintain pH at the required value, to extend cell life and increase ethanol production. To improve the separation of immobilized biocatalyst particles, Burns, Kvesitadze and Graves (1985) developed a method for magnetic separation of the particles from solutions. The biocatalysts were immobilized in sodium alginate together with a solution of iron(Ill) oxide. The resulting beads were resistant to temperatures up to 120 ~ pressure, pH and solvents. Co-immobilization has also been used with success with insoluble substrates. Kaul, Adlerkreutz and Mattiasson (1986) co-immobilized water-insoluble steroid substances destined for biotransformation with appropriate microbial cells. In this system each particle of the biocatalyst represented a kind of a minireactor. Co-immobilization can be used also with other substances such as enzyme inducers or inducer analogues enhancing desirable synthesis rates, inhibitors blocking the function of undesirable enzymes, or activators increasing enzyme activity. 11.7.3
Immobilized biocatalysts for nonaqueous media and for water-insoluble substrates
Among the second-generation immobilized biocatalysts are also those that serve to catalyze enzyme reactions in nonaqueous media. The elaboration of appropriate methods and introduction of such biocatalysts into practice has an immense importance because a multitude of important reactions take
407 place in nonaqueous media, the alternative chemical synthesis being mostly complicated and environmentally unacceptable. One of the promising techniques in this direction is biocatalyst modification (Inada et al., 1986). The modification may consist, for example, in covalent attachment of an amphipathic molecule to the surface of the enzyme. The hydrophobic nature of polyethylene glycol (PEG) makes it possible to modify enzymes in an aqueous solution in such a way as to make them capable of functioning in a nonaqueous environment. C1 N~/ CH3--(OCH2CH2),,--OH + CI
\
monomethoxypolyethylene glycol
/ N--
N
-~
\ CI
cyanuric chloride
N~
/
~- C1
O--(CH2CH20)n--CH3 N
\
9
/ N--
\ O--(CH2CH20),--CH3
2,4-bis (O-methoxypolyethylene glycol)-6-chloro-s-triazine (activated with PEG2) O~(CH2CH20)n--CH3 N protein - - N H
\
/
/
N
N - - - \ O~(CH2CH20),,~CH3
Formula 11.3 Table 11.11 shows the relationship between the degree of modification of catalase and its solubility in benzene. Lipase from Pseudomonas fluorescens modified by PEG retains 80 % of activity relative to the unmodified enzyme but, interestingly, its activity in the synthesis of methyl laurate or ethyl laurate is the highest at - 3 ~ whereas at 37 ~ the activity is a mere one fifth of the original. Although technologically undesirable, this finding points to other possibilities for the use of modified
408 Table I l.l I Solubility of modified catalase in benzene (Inada et al., 1986) Degree of enzyme modification
(%)
Solubility in benzene (mg ml-i)
0 21 34 46 55
0 0.14 0.25 0.64 2.00
enzymes. Synthesis of esters based on these enzymes showed that the optimum reaction temperature increases with increasing length of the carbon chain of the alcohol substrate, provided the fatty acid substrate is lauric acid (C 12). On the other hand, a decreasing length of the fatty acid carbon chain is accompanied by rise in optimal reaction temperature if the alcoholic substrate is methanol. These unexpected findings could have a considerable impact on the stereospecific synthesis of heat-labile organic compounds. Modified enzymes are highly stable; modified lipase stored in benzene retains, even after 3 months, about 50 % and after 5 months fully 40 % of the original activity. Modified enzymes are also temperature resistant (optimum 70 ~ as compared with their unmodified counterparts (45 ~ this considerably extends their range of application. The study of other enzymes, especially those requiring cofactors, ATP or metal ions, will show if they can be modified so that they can be used in organic solvents. A new direction in preparative organic synthesis was opened up by Klibanov et al. (1977). An enzyme reaction proceeds in a two-phase system water/organic solvent immiscible with water. The enzyme is in the aqueous phase, which makes unnecessary its stabilization against inactivation by the nonaqueous solvent. Substrates, on being dissolved in the organic phase, may diffuse freely into the aqueous phase in which they are transformed by the enzyme. The resulting products then diffuse back into the organic phase. In contrast to the routinely used combination water/water miscible solvent the content of water in the nonaqueous solvent is assumed to be negligible; in reactions where water is formed as a product (synthesis of esters, amides, polymerization of amino acids, saccharides, dehydration reactions, etc.) this arrangement makes it possible to shift the reaction equilibrium considerably in the direction of product formation. The fact that the system consists of two phases promotes the shift in reaction equilibrium in the same direction via free energy. These assumptions were verified on the synthesis of the ethyl ester of N-acetyl-L-tryptophan from the component acid and alcohol. Porous glass was impregnated with an aqueous solution of chymotrypsin in buffer
409
and suspended in chloroform containing N-acetyl-L-tryptophan and ethanol. The yield of ester in water was about 0.01%, in this two-phase system it was 100 %.
11.8
CHARACTERISTICS AND EVALUATION OF IMMOBILIZED BIOCATALYSTS
Immobilization substantially affects the properties of the biocatalysts as compared with soluble enzymes or free cells. The features most affected are: a) biocatalyst activity, b) diffusion of substrates and products given by diffusion barriers, e) inhibition of activity by physical and chemical factors, d) changes in the microenvironment demonstrated in differences of concentrations of components in the close vicinity of the biocatalyst, e) changes in optimum pH values. These changes are reflected in the reaction kinetics of the biocatalysts; a distinction is therefore made between the inherent (true) reaction rate in free biocatalysts and the actual (measured) rate in immobilized ones. According to the recommendations of the Working Group for Immobilized Biocatalysts at the European Federation of Biotechnology, each immobilized biocatalyst should be characterized by the following criteria (Konecny, 1984): 0. General description 0.1 Reaction scheme 0.2 Enzyme and microorganism (cells) 0.3 Type of carrier 0.4 Immobilization method 1. Preparation of immobilized biocatalyst 1.1 Immobilization method, reaction conditions 1.2 Dry weight yield, residual activity in the supernatant 2. Physical and chemical characteristics 2.1 Biocatalyst form, mean diameter of a wet particle 2.2a. Behaviour when compressed in column systems, or b. Abrasion in a mixed vessel, or c. Minimum rate of fluidization and abrasion in a fluid bed 3. Kinetics of immobilized biocatalysts 3.1 Initial rate versus substrate concentration for free and immobilized biocatalyst 3.2 Diffusion limitation in the immobilized biocatalyst system (effect of particle size or packing on enzyme activity) 3.3 Conversion degree versus time (points on a curve) 3.4 Stability on storage (initial rate after storage of various length) 3.5 Operational stability (initial rate or transformation ability of the reactor system after various periods of operation)
410
The efficiency of bonding or entrapment of the biocatalyst to or into the carrier is usually expressed as the amount of the bound proteins in mg per g dry or wet preparation. Other descriptions include the specific activity P in nkat per mg protein or dry weight or the relative activity, i.e. the ratio of activities of the same amount of immobilized and free biocatalyst. Further important characteristics are stability on storage and operational stability. These two parameters are usually given as half-times, i.e. intervals during which the activity drops to half the original level. Kinetic parameters such as the Michaelis-Menten constant, maximum reaction rate, etc., are denoted as apparent and determined as in free biocatalysts.
11.9 BIOREACTORS FOR IMMOBILIZED BIOCATALYSTS
Processes utilizing immobilized biocatalysts are conveniently conducted in various types of reactors whose schematics are given in Fig. 11.12. They fall basically into two principal types, piston flow reactors and mixed reactors that can operate in configurations for single, semicontinuous and continuous processes. The choice of a suitable bioreactor should take into account biocatalyst type (particle size, shape, mechanical or hydrodynamic resistance, sedimentation properties, specific activity of the bound biocatalyst), microbial process to be performed (biosynthesis, biotransformation), necessity of medium adjustment during reaction (pH, temperature), supply of oxygen or other gases, and the concentration of substrate, product or inhibitory products. The basic bioreactor with piston flow is a column (solid bed bioreactor) 2b. No backmixing of its contents takes place and the whole contents are thermally homogeneous. Substrate may pass through the column upwards or downwards. If the biocatalyst tends to be compressed in the column its layer can be divided by partitions or septa into plates, with pressure equalization after each plate. This lowers the pressure gradient in the column. The columns can be connected into batteries, one column being the main reactor vessel and the others being safety vessels. On exhaustion of the main vessel one of the safety vessels is switched on as the main one, another being used as the safety vessel. Upward flow prevents biocatalyst compression and increases the column flow rate by keeping greater distances between biocatalyst particles. This gives rise to a conically shaped downward tapering fluidized bed bioreactor 2c. The advantage of this bioreactor is that the linear upward velocity of particles, and thereby also the pressure gradient, drops in the upper extended part whereas in the lower tapering part, the particles sediment. A modification of the piston flow bioreactor is the tubular reactor in which the solution of the substances that are to be transformed flows through a nar-
411
row tube whose inner surface is coated with immobilized biocatalyst. A coiled or looped tube is technologically advantageous. The simplest type of the mixed bioreactor is the bubbled column la in which the biocatalyst is freely suspended. Mixed bioreactors are used to increase the mass transfer l b, 2a. The mechanical systems can be modified by introducing biocatalyst separation steps involving either sedimentation, centrifugation lc or recirculation 2d. Mixed bioreactors are used in processes which require adjustment of reaction conditions or oxygen supply. In addition to these basic types some constructions contain biocatalysts immobilized directly on the inner surface of the device (walls, stirrers). This configuration is sometimes used in rotary disc bioreactors or systems with a thin fluid layer (cf. Figs. 6.9, 6.10, 6.11). These systems obviate the separation of the biocatalyst from the solution. Bioreactors can also be packed di-
~P
la
lb
lc
j
i
I 2a
2b
2c
[
2d
1
l
T
Bioreactors for immobilized biocatalysts batch process, 2 - continuous process; l a - bubble column, l b - stirred bioreactor, b i o r e a c t o r with complete recycling, 2 a - - stirred bioreactor, 2 b - - fixed-bed bioreactor, f l u i d i z e d - b e d bioreactor, 2 d recycling bioreactor
4
Fig. 11.12 1 --
lc2c-
412
rectly with a gel containing the cells in such a way that the vertical flow is ensured by a system of channels formed in the gel. Such a configuration, which was devised by Johansen and Flink (1986), is shown in Fig. 11.13. A mixture of alginate and cells is supplemented with calcium citrate and D-glucono-1,5-1actone, the mixture is stirred and transferred into a reactor fitted with metal rods that are pulled out after gelation. This system has no problems with carbon dioxide evolution or with air distribution as in solid bed bioreactors, but its working volume is reduced. .
.
//
Fig. 11.13 Schematics of an internally gelatine-packed bioreactor with immobilized cells (Johansen and Flink, 1986)
REFERENCES Abbott, B. J. (1977) Ann. Rep. Ferm. Proc. 1, 181. Abbott, B. J. (1978) Ann. Rep. Ferm. Proc. 2, 91. Bar-Eli, A., Katchalski, E. (1960) Nature 188, 856. Burns, M. A., Kvesitadze, G. I., Graves, D. J. (1985) Biotechnol. Bioeng. 27, 137. Chang, T. M. S. (1977) Encapsulation of enzymes, cell contents, cells, vaccines, antigens, antiserum, cofactors, hormones and proteins. In: Biomedical Applications of Immobilized Enzymes and Proteins, New York.
413 Charles, M., Phillips, J. (1985) Combined immobilized enzyme/cell systems. In: Comprehensive Biotechnology 2, New York. Cheetham, P. S. J., Imber, C. A., lsherwood, J. (1982) Nature 299, 628. Chibata, I. (1978) Immobilized Enzymes, Research and Development, Tokyo. Chibata, I., Tosa, T. (1977) Adv. Appl. Microbiol. 22, 1. Chibata, I., Tosa, T., Fujimura, M, (1983) Ann. Rep. Ferm. Proc. 6, 1. Chibata, I., Tosa, T., Takamatsu, S. (1984) Mierobiol. Sci. 1, 58. (~ulik, K., Sikyta, B., Slezfik, J., Palkoska, J., glechta, J., B~e(~ka, A. Herold, M., Ho~f~lek, Z. (1964) Czechoslovak Patent 113 908. D6ppner, T., Hartmeier, W. (1984) Starch 36, 283. Durand, G., Navarro, J. M. (1978) Process Biochem. 13(9), 14. Fukui, S. (1983) Immobilized biocatalysts. In: Microbial Utilization of Renewable Resources 3, Osaka. Goldstein, L., Manecke, G. (1976) Appl. Biochem. Bioeng. 1, 23. Grubhofer, N., Schleith, L. (1954) Z. Physiol. Chem. -- Hoppe Seiler's 297, 108. Hackel, U., Klein, J., Megnet, R., Wagner, F. (1975) Eur. J. AppL Microbiol. 1, 291. Hartmeier, W. (1985) Trends in Biotechnol. 3, 149. Hartmeier, W., Heinrichs, A. (1986) Biotechnol. Lett. 8, 567. Hattori, T., Furusaka, C. (1960) J. Biochem. (Tokyo)48, 831. Hattori, T., Furusaka, C. (1961) J. Biochem. (Tokyo)50, 312. Hulst, A. C., Tramper, J., Van't Riet, K., Westerbeek, J. M. M. (1985) Biotechnol. Bioeng. 27, 870. Inada, Y., Takahashi, K., Yoshimoto, T., Ajima, A., Matsushima, A., Saito, Y. (1986) Trends in Biotechnol. 4, 190. Jack, T. R., Zajic, J. E. (1977) Adv. Biochem. Eng. 5, 125. Jens6n, S., Westlake, D. W. S., Wolfe, S. (1984) Appl. Microbiol. Biotechnol. 20, 155. Johansen, A., Flink, J. M. (1986) Biotechnol. Lett. 8, 121. Kato, N., Yamagami, T., Shimao, M., Sahazawa, Ch. (1987) AppL MicrobioL Biotechnol. 25, 415. Kaul, R., Adlerkreutz, P., Mattiasson, B. (1986) Biotechnol. Bioeng. 28, 1432. Kay, G. (1968) Process Biochem. 3(8), 36. Kennedy, J. F. (1982) Nature 299, 777. Kennedy, J. F., Cabral, J. M. S. (1983) Solid Phase Biochemistry: Analytical Aspects, New York. Kierstan, M., Bucke, C. (1977) Biotechnol. Bioeng. 19, 387. Klein, J., Vorlop, K. D. (1985) Immobilization techniques -- cells. In: Comprehensive Biotechnology 2, New York. Klibanov, A. M., Samokhin, G. P., Martinek, K., Berezin, I. V. (1977) Biotechnol. Bioeng. 19, 1351. Konecny, J. (1984) Swiss Biotechnol. 2(3), 15. Kopp, B., Rehm, H. J. (1984) Appl. Microbiol. Biotechnol. 19, 141. K~en, V., Ludvik, J., Kofrofiov~, O., Kozov~i, J., 0,ehfi~ek, Z. (1987) Appl. Microbiol. Biotechnol. 26, 219. Lee, C. K., Long, M. E. (1974) US Patent 3 821 086. Leuscher, F. (1966) German Patent 1 227 855. Manecke, G., Gunzel, G. (1966) Macromol. Chem. 91, 136. Matulovic, U., Rasch, D., Wagner, F. (1986) Biotechnol. Lett. 8, 485. Messing, R. A. (1975) Immobilized Enzymes for Industrial Reactors, New York. Messing, R. A. (1980) Ann. Rep. Ferm. Proc. 4, 105. Messing, R. A. (1985) Immobilization techniques -- enzymes. In: Comprehensive Biotechnology 2, New York. Mosbach, K., Mosbach, R. (1966) Acta Chem. Scand. 20, 2807. Munton, T. J., Russel, A. D. (1973) Appl. Microbiol. 26, 508.
414 Navarro, J. M. (1975) Thesis Doct. Ing., Toulouse. Nelson, J. M., Griffin, E.G. (1916) J. Am. Chem. Soc. 38, 1109. Omata, T., Tanaka, A., Yamane, T., Fukui, S. (1979) Eur. J. Appl. Microbiol. Biotechnol. 6, 207. Petre, D., Noel, C., Thomas, D. (1978) Biotechnol. Bioeng. 20, 127. Regh, T., Dorger, C., Chau, P. C. (1986) Biotechnol. Lett. 8, 111. Rochefort, W. E., Regh, T., Chau, P. C. (1986) Biotechnol. Lett. 8, 115. Rosevear, A., Lambe, C. A. (1983) Topics in Enzyme and Fermentation Biotechnology 7, Chichester. Sikyta, B. (1986) Microbiol. Sci. 3, 16. Takata, I., Tosa, T., Chibata, I. (1977) J. Solid Phase Biochem. 2, 225. Toda, K., Shoda, B. (1975) Biotechnol. Bioeng. 17, 481. Tsumura, N., Kasumi, T. (1976) 5th Int. Ferment. Symp., Berlin. Vandamme, E. J. (1976) Chem. Ind. 24, 1070. Vieth, W. R., Venkatasubramanian, K. (1976) Methods Enzymol. 44, 243. Vieth, W. R., Wang, S. S., Saini, R. (1973) Biotechnol. Bioeng. 15, 565. Vojti~ek, V., Jirkfi, V. (1983) Folia Microbiol. 28, 309. Vojti~ek, V., Jirkfi, J., Krumphanzl, V., (~ulik, K. (1984) Czechoslovak Patent 231 458. Vojti~ek, V., Zeman, R., Bfirta, M., (~ulik, K. (1980) Czechoslovak Patent 203 607. Vorlop, K. D., Klein, J. (1981) New developments in the field of cell immobilization -- formation of biocatalysts by ionotropic gelation. In: Enzyme Technology, Heidelberg. Wandrey, C. (1984) Biotech. Europe 84, 391. Wang, H. Y., Hettwer, D. J. (1982) Biotechnol. Bioeng. 24, 1827. Wang, S. S., King, C. K. (1979) Adv. Biochem. Eng. 12, 119. White, C. A. (1985) The use of cellulose as a matrix for immobilization biotechnology. In: Cellulose and its Derivatives, Chichester. Wingard, L. B., Katchalski-Katzir, E., Goldstein, L. (1976) Immobilized Enzyme Principles, New York.
415
12
MICROBIAL PROCESSES ASSOCIATED WITH PRODUCT ISOLATION IN SITU
Microbial products are in most cases isolated from the culture after the cultivation has been terminated. On attaining a certain concentration in the culture, a number of microbial products however inhibit not only the growth of the production organism but also product synthesis. The arrest may take place under conditions when the concentration of the product is still fairly low, i.e. below 10 % (v/v or w/w). Among such metabolites are alcohols (ethanol, butanol), solvents (acetone), organic acids (lactic, salicylic) (Cohen et al., 1984; Ishii et al., 1985), and antibiotics. Although the production arrest can be avoided by using strains resistant to the metabolite in question, the tolerance increase is never very high and attempts at isolating such strains have often failed. It is therefore desirable to develop methods for isolating such products already during the cultivation, thereby lowering their concentration in the culture below the inhibitory level. Product isolation in situ also substantially reduces the amount of waste water because nutrients can be used at high concentrations. The overall process costs could then decrease because some energy-requiring operations such as separation would be obviated. Depending on the type of metabolite produced, the production microorganism and nutrient medium composition, the following methods can be used for in situ product isolation: evaporation, extraction, adsorption, ion exchangers, dialysis, filtration and crystallization.
12.1 EVAPORATION 12.1.1
Vacuum fermentation
Volatile products can be separated from the culture liquid by maintaining a vacuum in the bioreactor. The products are then evaporated even at a normal cultivation temperature. Product concentration is kept at a low level, which prevents inhibition by the product. Three systems applicable to vacuum fermentation were described by Cysewski and Wilke (1977). These systems (Fig. 12.1) were designed for ethanol production from concentrated substrates. When the process was conducted at a constant feed of glucose into the
416
bioreactor (Fig. 12.1a) the production of ethanol initially increased considerably but dropped rapidly after 48 h. The accumulation of toxic nonvolatile products was markedly lowered by removing a portion of the culture from the bioreactor (Fig. 12.1 b). As a consequence the specific ethanol production rose by 38 %. When an additional yeast recycling device was used (Fig. 12.1c) the specific ethanol production exceeded 83 g 1-~ h-~ as compared with 14 g 1-~ hin conventional continuous productions.
5
T~
b
7
c
t4
3
Fig. 12.1 Systems for vacuum fermentation (a) simple vacuum fermentation, (b) vacuum fermentation with efflux, (c) vacuum fermentation with cell recycling, (d) vacuum fermentation with immediate product evaporation; I -- bioreactor, 2 - sugar feed, 3 vacuum compressor, 4 - inlet of sterile oxygen (a, b, c) or air (d), 5 -- outlet, 6 pump, 7 - valve, 8 low pressure vessel, 9 cell separator, I0carbon dioxide outlet
Although even highly concentrated sugar solutions can readily be processed during vacuum fermentation, problems arise with accumulation of considerable amounts of byproducts and with their removal. For instance, carbon dioxide has to be compressed from the low pressure to atmospheric pressure in costly compressors. Small amounts of oxygen necessary for limited growth of yeast have to be supplied as pure oxygen, because at the lowered pressure in the bioreactor its solubility is low. To circumvent these problems a system was developed for vacuum fermentation with immediate product evaporation (Fig. 12.1d).
12.1.2
Vacuum fermentation with immediate product evaporation
In this system the bioreactor operates at atmospheric pressure while the culture liquid circulates in a vacuum chamber in which ethanol is constantly volatilized and its inhibitory effect is thus kept low. Because of the separation of the vacuum chamber and the bioreactor, the carbon dioxide formed in the
417
bioreactor does not have to be compressed. The compression costs are reduced and air can be used for aeration instead of pure oxygen. The system was used for ethanol production by Zymomonas mobilis and Candida acidothermophilum (Ghose, Roychoudhury and Ghose, 1984). When ethanol concentration in the bioreactor reached an inhibitory level the culture fluid was left to circulate between the vacuum chamber and the bioreactor until the ethanol level dropped. Only then was the glucose feed resumed; the total bioreactor volume was restored after ten cycles because of the formation of nonvolatile metabolites. Evaluation of the economics of vacuum fermentations with immediate evaporation showed no difference between the traditional continuous cultivation with cell recycling, and the vacuum fermentation method, because increased productivity of the latter process was compensated by increased investment and operation costs. A basic shortcoming of vacuum fermentation is its limited applicability. The product has to be more volatile than water, and this restricts the application essentially to ethanol a n d / o r acetaldehyde production. Continuous removal of the culture from the bioreactor can be used to suppress the negative effects of nonvolatile byproducts but it results in a concomitant removal of dilute ethanol. It is these ethanol losses that limit the productivity of both vacuum fermentation and vacuum fermentation with immediate'product evaporation (Maiorella, Blanch and Wilke, 1983).
12.2 EXTRACTIVE FERMENTATION 12.2.1
Fluid-fluid extraction
During fermentation the metabolites can be extracted from the culture fluid with a suitable water-insoluble organic solvent. Products dissolved in the solvent can then be separated by distillation or re-extraction into a buffer. The culture fluid and the solvents can be brought into contact either in the bioreactor or in an external extraction vessel. Extractive fermentation should be carried out with solvents that have a high extractive capacity, are selective for the products to be separated, and nontoxic or only slightly toxic for the microorganisms. The first study of extractive fermentation was published by Finn (1966). The purpose of the process was to lower the inhibition of prodigiosin production in Serratia by its extraction into kerosene, but it was not successful in increasing the production. A better success was recorded in a process where ethanol was extracted into dodecanol flowing through the bioreactor with im-
418
mobilized cells of Saccharomyces cerevisiae (Minier and Goma, 1982). A 40 % glucose solution was fermented with a volume productivity 5 times higher than in the conventional process without extraction, but the flow of dodecanol through the bioreactor had to be 17 times greater than the flow of glucose because of the relatively low capacity of dodecanol for ethanol. A highly promising solvent for extractive fermentation is oleyl alcohol (cis-9-octadecene-1-ol) which has a considerable capacity for ethanol, acetone and butanol and is not toxic for the microorganisms. Extraction of ethanol in situ was carried out by introducing into the system a unit for immediate ethanol evaporation from the solvent leaving the bioreactor, and the regenerated solvent was returned into the system (Daugulis et al., 1987). The fraction of ethanol isolated from the effluent was about 90 %. The content of ethanol in the effluent was 65-85 % (v/v), the rest being water. The system is stable and no accumulation of toxic products takes place.
I
!1t,
:.'..:.
Fig. 12.2 Schematics of a system for extraction fermentation (Taya, Ishii and Kobayashi, 1985) 1 - - bioreactor, 2 - pH-meter, 3 - N a O H solution, 4 - glucose solution, 5 - oleyl alcohol, 6 - - pulse counter, 7 - - pumps. Dotted area - - solvent phase
Oleyl alcohol was also used for extractive fermentation of acetone and butanol in a batch-fed system (Taya, Ishii and Kobayashi, 1985), illustrated in Fig. 12.2. The production was 13 g butanol 1-~ and 7.5 g acetone 1-~ under optimum conditions, with a glucose consumption of 73 g 1-~. The same fermentation process was performed with dibutyl phthalate as solvent (Wayman and Parekh, 1987). The concentration of acetone and butanol in the process without extraction was 24 g 1-~, with the solvent it was 32 g 1-~ at the same sugar concentration. Another advantage of dibutyl phthalate is its stimulatory effect on microbial growth. Apart from alcohols and solvents, extraction was used in anaerobic methane fermentation for isolating butyric, valeric and caproic acids (Levy, Sanderson and Wise, 1981). The extraction was performed with kerosene which
419
was regenerated by re-extraction into the basic solution. The concentration of acids in the extraction solvent was l0 times higher than in the culture fluid. It should be noted, however, that in a continuous process the accumulated acetic and propionic acids, which are nearly insoluble in kerosene, would probably limit fermentation productivity. The effect of several solvents on the anaerobic acidophilic bacteria used in the production of organic acids was studied by Datta (1981). No toxicity was found with saturation concentrations of crude oil, toluene and amy| acetate applied concomitantly with TOPO (trioctylphosphine oxide) or Alamine 336 (a tertiary amine). Playne and Smith (1983) tested a total of 30 organic solvents as to their effect on facultatively anaerobic bacteria producing organic acids. Out of this number, 12 solvents were nontoxic, two inhibited growth partially and 15 were toxic. The toxic effect of the solvents on the lactic acid producer Lactobacillus delbrueckii increased in the sequence alkane < cumene < ketone < tertiary amine < secondary amine < quarternary amine. The solvents with the highest capacity for lactic acid were the most toxic; it is therefore obvious that the toxicity of a particular solvent depends on the species of the microorganism used, and suitable solvents should always be selected by screening.
12.2.2 Aqueous two-phase systems In order to avoid problems with the use of organic solvents in extractive fermentations, the in situ isolation of products from culture fluid has been carried out with aqueous two-phase systems. Instead of organic solvents, the culture fluid is supplied with polymers until the formation of two separate phases which contain 85-95 % water and are biocompatible. The microorganisms usually remain in one phase whereas low-molecular substances are uniformly distributed in both phases. The volumes of the phases can be adjusted so that the phase containing microorganisms is much smaller than the other. The majority of the product is in the microorganism-free phase. One of the oldest studies of application of two aqueous phases has been the toxin production in Clostridium tetani (Puziss and Hed6n, 1965). The solution used included 2 % dextran and 12 % polyethylene glycol (PEG) and the volume ratio of the two phases (top :bottom) was 15 : 1. The cells remained in the smaller phase with dextran whereas the toxin was uniformly distributed in both phases. The PEG phase contained 15 times more toxin because of the advantageous phase volume ratio. A batch extractive cultivation afforded a 100-fold enhancement of production as compared with the conventional process without extraction, owing to the removal of toxic products from the culture fluid.
420
Aqueous two-phase extractive fermentation was also used for ethanol production (Kuhn, 1980). The volume ratio of the top (dextran) to the bottom (PEG) phase was 9:1. The contents of the bioreactor were stirred and the dextran-rich phase containing yeast cells in droplets was dispersed in the PEGrich phase. After complete consumption of added glucose the PEG phase, containing 90 % ethanol, was separated and ethanol was isolated by distillation. The ethanol-free PEG phase was returned to the bioreactor and glucose was added anew. Ten fermentation cycles brought about an increase in the metabolic byproduct glycerol and accumulation of toxic nonvolatile substances, and a consequent lowering of fermentation rate. This was restored by periodic addition of yeast cells and separation of nonvolatile metabolites by dialysis. Aqueous two-phase extractive fermentation was tested on a laboratory scale also with other products. In the production of acetone and butanol by Clostridium acetobutylicum, introduction of the extraction step lowered the inhibition by these products but the productivity of the extraction system was identical with that of the conventional fermentation without extraction (Mattiasson et al., 1982). The system consisted of 6 % dextran (by weight) and 25 % polyethylene glycol. The same system was used also for extractive fermentation of acetic acid using E. coli; the production of acetic acid increased by 50 % as compared with the process without extraction (Mattiasson and HahnH/igerdal, 1983). In addition to fermentations, the aqueous two-phase extraction was also tested for biotransformations of chemicals by nongrowing cells. This method is called extractive bioconversion (Kaul and Mattiasson, 1986). The bottom phase used in this process also contains dextran or cheaper starch-based polymers, the top phase contains polyethylene glycol, methoxypropylene glycol or polypropylene glycol. In some cases buffer is simply used as the bottom phase (Lee and Chang, 1989). The microorganisms performing the bioconversion are mostly dispersed in the bottom phase while the products are accumulated in the top phase, from which they are also isolated. The system makes use of the differences in the hydrophobicity of the polymers used for phase formation and the reactions take place at higher substrate concentrations. Extractive fermentation and bioconversion with two aqueous phases have not yet been elaborated to a degree that would allow an assessment of their economic potential. The crucial factors are the price of the polymers, frequency of their replacement, isolation of products from the polymer mixture and accumulation of byproducts during a prolonged operation. An advantage is the biocompatibility of the polymers that allows reduction in waste water volumes, broad applicability of a number of products and accumulation of byproducts and their possible isolation.
421
12.2.3
Extractive fermentation with pertraction
In extractive fermentation the microorganisms are accumulated at the liq u i d - l i q u i d interface, thereby reducing the extraction rate (Crabbe, Tse and Munro, 1986). To prevent this undesirable phenomenon a modified extraction method, so-called pertraetion, has been developed which makes use of a liquid support membrane for extraction (Schlosser and Kossazcky, 1986). Such a system used for acidogenic fermentation is shown in Fig. 12.3. The pertrac-
7 t3
Fig. 12.3 Extraction f e r m e n t a t i o n with pertraction 1 - - bioreactor, 2 - - gas outlet, 3 heating membrane, 4 - culture fluid p u m p , 5 - pertraction unit, 6 alkaline solution, 7 alkaline solution pump
tion unit contains a support liquid membrane placed between two spaces and supported by a plastic grid plate which causes turbulence. The culture circu lates through one part of the vessel whereas NaOH solution removing the extracted acids circulates through the other part of the vessel. The key parameter for successful pertraction extractive fermentation is the pH value of the culture fluid. The productivity of the pertraction system was found to be 5-fold higher than in a conventional process.
12.3 ADSORPTION In situ adsorption or desorption on charcoal was used for isolating products of acetone-butanol fermentation from culture fluid (Weizmann et al.,
1948). The process is routinely carried out using porous adsorbents with an extremely large surface area, from charcoal to polymeric resins. The adsorbents can be added directly into the bioreactor or can be placed in a vessel outside the bioreactor through which the culture fluid circulates (Fig. 12.4). The procedure was used in ethanol production. The charcoal was added into the bioreactor; the production was not enhanced despite the lowering of
422
concentration of free ethanol, because adsorption adversely affects the viability of yeast cells (Wang, Robinson and Lee, 1981). Better results were achieved with nongrowing stationary yeast cells which were separated from the culture fluid and therefore excluded from contact with the charcoal (Lee and Wang, 1982). After separation of ethanol, the yeast cells and the culture medium were returned to the bioreactor and the fermentation was continued after glucose addition. The volume productivity of ethanol reached 25 g 1-~ h -~.
6 a
b
6 r
Fig. 12.4 Systems for fermentation and product isolation in situ by adsorption or ion exchangers (a) with addition of adsorption agent (ion exchanger) into culture fluid, (b) system with a separate isolation unit, (c) system with a separate isolation unit and cell separation; 1 -- bioreactor, 2 -- nutrient feed, 3 -- addition of adsorption agent (ion exchanger), 4 -- ion exchanger column, 5 - cell separator, 6 - outlet
Lencki, Robinson and Moo-Young (1983) used industrially available polymers such as polystyrene or acrylester resins for ethanol adsorption but the polymers were found to considerably reduce or completely inhibit yeast growth. The in situ recovery of ethanol from fermentation by different hydrophobic adsorbents has been studied by Einicke, G1/~ser and Sch611ner (1991). Liquid phase experiments have demonstrated that pentasil zeolites have a high selectivity for ethanol in the low concentration range. The contact of the fermentation broth with the zeolite NaZSM-5 avoids the product inhibition. On the other hand, the ethanol production rate dramatically changes in dependence on the glucose-to-adsorbent ratio. The in situ isolation of butanol and isopropanol from a culture of Clostridium beyerinckii was also done with the addition of charcoal and polymeric resins to the culture (Groot and Luyben, 1986). After termination of the cultivation the adsorbents were separated on a metal filter, the products desorbed at 150 ~ and the adsorbents were used for repeated adsorption. Satisfactory results were obtained in the isolation of the antibiotic cycloheximide from culture fluid by in situ adsorption (Wang, Kominek and Jost, 1980, Wang, 1983). The biosynthesis of this antibiotic by Streptomyces griseus is feedback-regulated by the product; the culture fluid was therefore supplied
423
in the course of the fermentation by a neutral polymeric resin which caused a decrease in cycloheximide concentration in the culture, but a doubling of the overall production from 800 t-tg ml-~ to 1600 l-tg ml -~. If the resin was coated in an ultrafiltration membrane before addition, the concentration of the antibiotic increased to 1800 t-tg ml-~; this indicates that the resin inhibited the production. The toxicity of resins for microorganisms is one of the serious problems hampering the application of adsorption for in situ product isolation. Other complicating factors are the low capacity of adsorbents used for isolating products from whole culture, unspecific adsorption of cells, medium components and intermediates, and resin abrasion. Some of these factors, in particular resin toxicity, can be alleviated by immobilizing the cells in the bioreactor or separating them from the culture before the point of contact of the culture fluid with the adsorbent. All these modifications increase the complexity of the process and thereby also its costs.
12.4 ION EXCHANGERS
Like adsorbents, ion exchangers are either added directly into the culture liquid in the bioreactor or packed into a separate column through which the culture fluid is circulated. In the production of salicylic acid from naphthalene by Pseudomonas aeruginosa, a concentration of 10 g 1-~ of salicylic acid was found to have a toxic effect on the cells, to inhibit the production and to induce degradation of salicylic acid. Addition of an anion exchanger resin directly into the culture fluid increased the salicylic acid concentration to 30 g 1-~ (Kitai et al., 1968). When the resin was encapsulated in a cellophane membrane and then added into the bioreactor, thereby eliminating the direct contact of the resin with, and its inhibitory effect on, the cells, the production increased to 55 g 1-~. A system of production of salicylic acid by Corynebacterium renale, in which the culture fluid circulated between the bioreactor and an ion exchanger column, yielded a salicylic acid concentration of 14.6 g 1-~, i.e. double that achieved in a conventional process without the anion exchanger (Tangu and Ghose, 1981). Ion exchanger resins were also used for isolation of the antibiotics novobiocin and neomycin from culture fluid (Denkewalter and Gillin, 1959). The ions released from the ion exchanger on product adsorption can inhibit microbial growth while ionic compounds from the culture fluid, which can adsorb on the resin surface, reduce its capacity for product adsorption. At the same time nonionic metabolites can accumulate in the culture broth. In addition, ion exchanger resins are expensive and the mass transfer is slow, the
424
devices are relatively large and capital costs are high. All these factors may offset the increased productivity, so that the method may become economically unattractive.
12.5 DIALYSIS FERMENTATION In dialysis fermentation a selectively semipermeable membrane separates the culture space from the medium reservoir. Nutrients from the reservoir diffuse into the culture whereas metabolites diffuse from the culture into the reservoir. A low product concentration is maintained in the culture space, thus preventing possible inhibitory effects. This type of fermentation was the most intensively studied for the case of lactic acid production. Friedman and Gaden (1970) found that lactic acid fermentation productivity increased from 5 g 1-~ in conventional process to 8 g 1-~ in the dialysis process. Stieber and Gerhardt (1981a) developed two methods for dialysis fermentation of lactic acid. In one system substrate was added into the continuous bioreactor circuit and dialyzed against a continuous dialyzer circuit supplied with pure water. As compared with the conventional process without dialysis, this system afforded a higher conversion of more concentrated substrates and faster cell growth, resulting in higher cell concentration. Also, the dialyzer effluent contained product without cells. An alternative method of continuous culture with dialysis is represented by a system with substrate feed into a continuous dialyzer circuit and thence into the bioreactor circuit via dialysis. When the bioreactor circuit operates without an outlet (in a batch configuration) it contains cells which are thus to all intents and purposes immobilized in the circuit, whereas the product is continuously removed through dialysis into the continuous dialyzer circuit and thence isolated (Stieber and Gerhardt, 198 lb). An additional advantage is that the substrate is converted to product without the necessity of supplying further substrate for cell growth, and is sterilized on passage through the membrane. Figure 12.5 illustrates two kinds of a continuous dialysis cultivation system. The outlet can be placed in both the dialyzer and the bioreactor circuit (Fig. 12.5a) or in the dialyzer circuit only (Fig. 12.5b). System a is suitable for continuous production of high cell concentrations, system b for metabolite production. In the semicontinuous dialysis system used for the production of salicylic acid by Pseudomonas fluorescens, the solid-phase naphthalene used as substrate remained in the culture volume whereas salicylic acid could diffuse into the medium reservoir (Abbott and Gerhardt, 1970). When the concentration of salicylic acid reached an inhibitory level, fresh medium was fed in from the
425
reservoir. Although the salicylic acid production rate was 2.6-fold higher than in a conventional process, its concentration in the solution was lower. Extraction of cycloheximide from a culture of Streptomyces griseus, described by Kominek (1975), made use of a cellophane dialysis tube through which pure water passed, placed in the bioreactor. Cycloheximide was isolated from the water by methylchloride extraction and the water was returned to the dialysis circuit. This technique led to a doubling of antibiotic concentration.
3 4
5
b Fig. 12.5 Schematics of continuous fermentation systems with dialysis (Stieber, Gerhardt, 1981a) (a) with outflow from dialyzer and bioreactor, (b) with outflow from dialyzer; 1 -- feed, 2 - dialyzer, 3 - outflow, 4 - bioreactor circuit, 5 dialyzer circuit
The main advantage of dialysis fermentation is the elimination of production inhibition by the end product and the high cell holdup, and consequently high cell concentration, attained in the system. Drawbacks are the high product isolation costs caused by low product concentration in the dialysis effluent, clogging of the relatively expensive membranes and accumulation of nondiffusible metabolites inhibiting cell metabolism and growth.
12.6 FILTRATION
Filtration is one of the most promising methods for removal of inhibitory metabolites. Various types of hollow-fibre bioreactors have been constructed for this purpose in recent years. An example is shown in Fig. 12.6. It is in principle a cylinder divided into two spaces by an asymmetric membrane, with hollow fibres. The anisotropic structure of the membranes is composed of ultramicroporous inner layers enclosed in a macroporous polymer matrix. The dense inner layer functions as a semipermeable membrane whereas the macroporous matrix with its 60-90 % void space endows the membrane with
426
a high hydraulic permeability. The medium passes through the inner bioreactor space and diffuses through the ultramicroporous membrane into the space containing the cells. The excreted metabolic products diffuse in an opposite direction and are removed. Fermentation with hollow fibre filtration was tested in a variety of processes, for instance the synthesis of fl-lactamase by E. coli (Inloes et al., 1983), continuous production of ethanol (Nishizawa et al., 1983, 1984), lactic acid 3
3
4
5
4
Fig. 12.6 Schematics of a bioreactor with hollow fibre filtration (Inloes et al., 1983) 1 -- nutrient feed, 2 - product outlet, 3 - outlet for gaseous products, 4 - inlet for gaseous nutrients, 5 - porous wall with cells
(Ohleyer et al., 1985) and superoxide dismutase (Hoist et al., 1985). This process exhibited a production of 19 g 1-~ cell mass in 22 h cultivation, and a 4-fold higher concentration of superoxide dismutase than a conventional process. Although very elegant, the hollow-fibre macrofiltration module cannot be sterilized and the flow rate of filtrate through the hollow fibres is not very high. For practical purposes the separation of inhibitory metabolites from cultures is more conveniently performed with ceramic materials which are mechanically stable, resistant to chemicals and high temperatures. These properties are highly desirable in fermentations which necessitate steam sterilization and washing for repeated use. Despite these problems, hollow-fibre modules have been used for fermentations, particularly of lactic acid. Mehaia and Cheryan (1986) used this system in a lactic acid fermentation from whey by Lactobacillus bulgaricus, for separating lactic acid from the culture fluid. At a cell concentration of 10 g l -~, the optimum lactic acid production rate was 35 g 1-~ h -~, and at 30 g 1-1 cells it exceeded 80 g 1-~ h -~ at a complete substrate consumption. This is the highest lactic acid production rate ever achieved. The efficiency of the system was also verified in other lactic acid producers, such as Streptococcus cremoris and Lactobacillus casei (Tanigushi et al., 1987). The respe-
427
ctive cell concentrations of these microorganisms were 81 and 49 g 1-~ cell dry weight; this corresponds to 11- and 9-fold productivity relative to that of a conventional batch fermentation without filtration.
12.7 CRYSTALLIZATION Product isolation by crystallization has so far been used only in the biotransformation of L-aspartate to L-alanine by immobilized cells of P s e u d o m o nas d a e u n h a e (Takamatsu and Ryu, 1988). The system included a bioreactor with immobilized bacteria, the effluent from which was brought into a unit consisting of a crystallizer and a separator (Fig. 12.7). After product separa-
6
s
l/
/ 6
6
Fig. 12.7 Crystallization biotransformation (simplified, after Takamatsu and Ryu, 1988) 1 -- bioreactor, 2 - medium reservoir, 3 - crystallization unit, 4 - medium feed, 5 - outlet to product isolation (centrifugation, drying), 6 pumps
tion, the filtrate containing residual substrate concentration passed from the unit into a substrate-feed reservoir, where it was supplied with fresh substrate, and then returned to the bioreactor for another bioconversion cycle. The process brought about a considerable improvement in product quality, and production costs were 25 % lower than in a conventional batch process. The system seems to be highly suited for a number of production operations and is likely to find a broad range of application.
428 REFERENCES Abbott, B. J., Gerhardt, P. (1970) Bioteehnol. Bioeng. 12, 577. Cohen, A., van Gemert, J., Yoetemeyer, R. J., Breure, A. M. (1984) Process Biochem. 19, 228. Crabbe, P. G., Tse, C. W., Munro, P. A. (1986) Biotechnol. Bioeng. 28, 939. Cysewski, C. R., Wilke, C. R. (1977) Biotechnol. Bioeng. 19, 1125. Datta, R. (1981) Biotechnol. Bioeng. 23, 61. Daugulis, A. J., Swaine, D. E., Kollerup, F., Groom, C. A. (1987) Biotechnol. Lett. 9, 425. Denkewalter, R. G., Gillin, J. (1959) German Patent 1 062 891. Einicke, W. D., Glaser, B., Sch611ner, R. (1991) Acta Biotechnol. 11, 353. Finn, R. K. (1966) J. Ferment. Technol. 44, 305. Friedman, M. R., Gaden, E. L., Jr. (1970) Biotechnol. Bioeng. 12, 961. Ghose, T. K., Roychoudhury, P. K., Ghose, P. (1984) Biotechnol. Bioeng. 26, 377. Groot, W. J., Luyben, K. C. A. M. (1986) Appl. Mierobiol. Biotechnol. 25, 29. Holst, O., Hanssson, L., Berg, A. C., Mattiasson, B. (1985) Appl. Microbiol. Bioteehnol. 23, 10. Inloes, D. S., Smith, W. J., Taylor, D. P., Cohen, N. S. (1983) Biotechnol. Bioeng. 25, 2653. Ishii, S., Taya, M., Kobayashi, T. (1985) J. Chem. Eng. Japan 18, 125. Kaul, R., Mattiasson, B. (1986) Appl. Microbiol. Biotechnol. 24, 259. Kitai, A., Tone, H., Ishikura, T., Oyaki, A. (1968) J. Ferment. Technol. 46, 442. Kominek, L. A., (1975) Antimicrob. Agents Chemother. 7, 856. Kuhn, I. (1980) Biotechnol. Bioeng. 25, 2393. Lee, Y. H., Chang, H. N. (1989) Biotechnol. Lett. 11, 23. Lee, S. S., Wang, H. Y. (1982) Biotechnol. Bioeng. Symp. 12, 221. Lencki, R. W., Robison, C. W., Moo-Young, M. (1983) Biotechnol. Bioeng. Syrup. 13, 617. Levy, P. F., Sanderson, J. E., Wise, D. L. (1981) Biotechnol. Bioeng. Symp. 11, 239. Maiorella, B., Blanch, H. W., Wilke, C. R. (1983) Biotechnol. Bioeng. 25, 103. Mattiasson, B., Siominen, M., Andersson, E., Haggstrom, L., Albertson, P.-A., Hahn-Hagerdal, B. (1982) In: Enzyme Engineering. Mattiasson, B., Hahn-H~.gerdal, B. (1983) In: Immobilized Cells and Organelles 1, 121. Mehaia, M. A, Cheryan, M. (1986) Enzyme Microbiol. Technol. 8, 289. Minier, M., Goma, G. (1982) Biotechnol. Bioeng. 24, 1565. Nishizawa, Y., Mitani, Y., Tamaki, M., Nagai, S. (1983) J. Ferment. Technol. 61, 599. Nishizawa, Y., Mitani, Y., Fukunishi, K., Nagai, S. (1984) J. Ferment. Technol. 52, 41. Ohleyer, E., Blanch, H. W., Wilke, C. R. (1985) Appl. Biochem. Biotechnol. 11, 317. Playne, M. J., Smith, B. R. (1983) Biotechnol. Bioeng. 7, 1251. Puziss, M., Hed6n, C.-G. (1965) Biotechnol. Bioeng. 7, 355. Schlosser, S., Kossazcky, E. (1986) J. Rad. Nucl. Chem. 101, 115. Stieber, R. W., Gerhardt, P. (1981a) Biotechnol. Bioeng. 23, 523. Stieber, R. W., Gerhardt, P. (1981b) Biotechnol. Bioeng. 23, 535. Takamatsu, S., Ryu, D. D. Y. (1988) Enzyme Microb. Technol. 10, 593. Tangu, K. S., Ghose, T. K. (1981) Process Biochem. 16(2), 24. Tanigushi, M., Kotani, M., Kobayashi, T. (1987) J. Ferment. Technol. 65, 179. Taya, M., Ishii, S. Kobayashi, T. (1985) J. Ferment. Technol. 63, 181. Wang, H. Y., Kominek, I. A., Jost, J. L. (1980) In: Advances in Biotechnology 1,601. Wang, H. Y., Robinson, F. M., Lee, S. S. (1981) Bioteehnol. Bioeng. Symp. 11, 555. Wang, H. Y. (1983) Ann. N. Y. Acad. Sci. 413, 313. Wayman, M., Parekh, R., (1987) J. Ferment. Technol. 65, 295. Weizmann, C., Bergman, E., Sulzbacher, M., Pariser, E.R. (1948) J. Soc. Chem. Ind. 67, 225.
429
INDEX OF MICROORGANISMS
Acetobacter 241 aceti 400 s p . 400 Achromobacter 5 7 liquidum 394 Acremonium chrysogenum 103 Aerobacter aerogenes 38, 356 Agaricus campestris 334 Alcaligenes eutrophus 157, 163, 395 Arthrobacter 394 -- aceris 394 luteus 110 -- simplex 395 Aspergillus 32 7 -- fumigatu s 342 nidulans 342 -- niger 133, 137, 251, 334, 396, 400, 404 -- oryzae 250, 391 rugulosus 112 Azotobacter chroococcus 40 -- vinelandii 250
- -
-
- -
-
- -
- -
- -
Bacillus 110, 118, 152, 156, 162, 352 70, 400 anthracis 38, 213 -- cereus 38 circulans 102 -- globigii 209 -- licheniformis 107, 341 megaterium 110 pumilus 107 - - s p . 400 -- stearothermophilus 12 7, 209, 214, 215, 217 -- subtilis 107, 121, 122, 213, 229, 235, 353, 31 O, 400 -- thermoacidurans 229 Blakeslea trispora 164 Brevibacterium 163 -
- -
- -
- -
-
a
m
y
l
o
l
i
q
u
e
f
a
c
i
e
n
s
ammoniagenes 394 flavum 103, 105, 123, 400 glutamicum 112
- -
- -
Candida acidothermophilum 417 boidinii 15 7, 158 -- brassicae 357 -- tropicalis 112, 164, 396 utilis 70, 95 Cephalosporium 119 acremonium 108, 112, 341 Chlorobiniineae 156 Chlorobium thiosulphatophilum 156 Chromobacterium prodigiosum 38 N violaceum 38, 162, 341 Citrobacter freundii 307, 395 Claviceps 339, 342 fusiformis 399 -- purpurea 396, 399 Clostridium acetobutylicum 154, 163, 400, 420 beyerinckii 400, 422 botulinum 209, 213 -- butyricum 304, 394, 395, 400 -- sporogenes 213 tetani 213, 419 thermoaceticum 159 -- welchii 38, 213 Corynebacterium 163 103, 105, 400 hofmanii 38 -- renale 423 - - s p . 395 Culvularia lunata 394, 395 Cunninghamella 32 7 - -
- -
- -
- -
- -
- -
-
-
g
l
u
t
a
m
i
c
u
m
Endomycopsis fibuligera 400 Enterobacter aerogenes 395, 400 Enterobacteriaceae 154
430
Escherichia 106, 118 38, 40, 48, 91, 92, 95, 105, 117, 118, 119, 121, 122, 123, 229, 236, 250, 251, 311, 327, 353, 355, 356, 357, 373, 391, 405, 406, 420, 426 -
-
c
o
l
i
113, 124, 329, 394,
115, 127, 352, 395,
Fusarium 334 -- fulvorum 395 sambucinum 341 -
-
Giberella fujikuori 334 Gluconobacter oxidans 396, 404, 405 Hansenula janidii 395 Klebsiella 163 Kluyveromyces fragilis 154, 400 marxianus 296 -
-
Leptothrix 44 Leuconostoc mesenteroides 163 Methanosarcina barkeri 396 Methylomonas flagellata 299 Methylophilus 123 methylotrophus 123, 15 7, 158 Micrococcus 110 luteus 110 Micromonospora inyoensis 103 purpurea 103 Mucor 32 7 Mycobacterium flavum 373, 395 tuberculosis 54 -
-
-
-
-
-
-
-
Nitrobacter sp. 306 Nitrosomonas 305 Nocardia erythropolis 391 mediterranei 103 -- rhodocrous 395 -
-
Pachysolen lennophilus 400 Pasteurella pestis 38 Penicillium 32 7 -- chrysogenum 164, 250, 255, 256, 334, 335, 339, 341, 344, 400 notatum 164 -- roqueforti 391 :"',, 9,'~,~:,,..Tete chrysosporium 14 7
Phlebia radiata 14 7 Pichia stipitis 395 Proplonibacterium shermanii 163 sp. 395, 400 Proteus vulgaris 38 Pseudomonas 123, 156, 303 --aeruginosa 162, 423 -- aureofaciens 103, 340 -- carboxidovorans 156 -- dacunhae 405, 427 denitrificans 250 -- diminuta 236 fluorescens 162, 300, 356, 407, 424 -- putida 353 solonacearum 327 -sp. 391 -
-
Rhizobium 163 Rhizopus stolonifer 395 Rhodospirillineae 156 Rhodospirillum rubrum 395 Rhodotorula glutinis 70 -- minuta 395 Saccharomyces 116, 118 -- carlsbergensis 391, 392, 396, 400 cerevisiae 94, 95, 112, 119, 122, 163, 301, 311, 312, 327, 352, 353, 391, 396, 400, 404, 418 diastaticus 400 fibuligera 70, 112 -- lipolytica 400 pastorianum 395 uvarum 94 Salmonella typhi 38 Sarcina lutea 327 Schizosaccharomyces pombe 112 Serratia 417 -- marcescens 235, 250, 341, 400 Staphylococcus aureus 38 Streptococcus -- cremoris 426 -- faecalis 80 lactis 78 Streptomyces 110, 116, 118, 152, 352 alboniger 341 antibioticus 340, 341 -- aureofaciens 93, 163, 342 -- clavuligerus 400, 402, 403 -
-
-
-
-
-
-
-
-
-
431 - - coelicolor 111, 118, 119 erythreus 164 -- f r a d i a e 102, 341, 394, 400 gallileus 343 griseus 103, 164, 340, 341, 343, 400, 422, 425 hygroscopicus 44, 45 kanamyceticus 113, 163, 341 kasugaensis 108 lipmanii 108 -- lividans 117, 118 -niveus 164, 341 -- olivaceus 163 -- peuceticus 103 - - rimosus 39, 40, 112 roseochromogenes 395
- - sioyaensis 341 --
sp.
341
tendae 396 venezuelae 163 - - virginiae 343 - - viridifaciens 108 Thermoactinomyces vulgaris 45 Thermomonospora sp. 217 Trichoderma 148, 149 - - konigii 14 7 - - reesei 14 7, 400 - - viride 14 7 Trichosporon brassicae 302 Z y m o m o n a s mobilis 391, 400, 404, 417
432
SUBJECT INDEX
absorption coefficient 243 acceleration phase of growth 35 acetic acid, determination 303 -- - - , substrate for microorganisms 159 aeration capacity, determination 244 - - , theory 242 alcohols, determination 301 air filters 237 amino acids, determination 304 anaerobic bioreactors 205 - - digestion 206 analyzers, automatic 284 antimicrobial agents 262 apple pomace 137 Arrhenius equation, death rate of microorganisms 214 auxotrophic strains, amino acids production 103 - - , isolation 97 - - , nucleotides production 106 -
-
-
-
bactogen 63 baffles, in bioreactors 191 flasks 183 bioreactors, air-lift 202 - - , disc 180 - - , film 83 - - , fluidized bed 82 - - , hollow fibre 84 - - , hydrodynamically mixed 203 - - , industrial 197 - - , mixed 186 - - , laboratory 187 - - , packed bed 81 - - , pilot-plant 196 - - , pneumatically agitated 201 - - , tower 75 - - , tubular 74 biosynthesis of aminoacids 103
nucleotides 106 biotransformation 322 bubble holdup 273 butanol determination 303 carbon dioxide, determination 297 -- --, substrate for microorganisms 156 carbon monooxide, substrate for microorganisms 156 catabolite inhibition 341 -- repression 340 cell mass, measurement 309 cellulose, biological degradation 147 - - , chemical degradation 144 - - , glucose preparation from 148 - - , physical degradation 144 - - , properties 141 - - , release from lignocellulose complexes 143 - - , sources 141 chemostat 63 co-immobilization of different biocatalysts 401 with different organic and inorganic substances 406 collections of microorganisms 323 computers 316 contamination, determination 359 - - , of processes 361 continuous culture, amylase production 70 --, bactogen 63 --, chemostat 63 -- --, crude oil degradation 70 --, fat production 70 --, gradostat 72 --, immobilized cells 80 --, multistage 68 --, single-stage 63 -
-
-
-
-
-
-
-
-
-
-
-
-
-
433 -- --, systems 62, 64, 65 --, tower 75 --, tubular 74 --, turbidostat 63 corn-steep liquor 152 critical oxygen concentration 250 culture flasks, baffles 183 -- --, closure 183 -- --, for anaerobes 204 --, material 182 - - --, size and shape 182 -
-
-
-
-
-
-
-
-
-
-
-
data collection 314 -- control 314 - - processing 314 date syrup 136 D D C control 315 death of microorganisms 44 phase 37 declination phase 36 deformation, shear 259 deregulation of metabolic pathways 103 dialysis fermentation 424 diauxy 60 dilution rate 63 dissolved oxygen, measurement 296 D N A recombination in vitro, application in practice 122 , cloning 113 , restriction endonucleases 114 doubling time 43 reciprocal 43 DSC control 315 d y n a m o m e t e r 291 electrodes, cephalosporine assay 306 --, dissolved oxygen measurement 296 --, enzyme 285 --, glucose assay 301 --, ion selective 285 --, live microbial cells determination 311 --, penicillin assay 307 --, pH measurement 295 --, redox potential measurement 295 enrichment cultures, batch 91 --, continuous 94 Euler's criterion 270 -
ethanol, measurement 302 --, substrate for microorganisms 158 exponential growth phase 36 extensometer 291 extrachromosomal elements, instability of 120 extractive bioconversion 420 fermentation 417 pertraction 421
-
fats, animal 155 feedback of cells, in continuous system 78 Fick's law 242 filamentous microorganisms, growth 44 Filters, air sterilization, membrane 238 , , thick layer 237 --, liquids filtration 226 flours 151 flow number 271 pattern 274 fluids, dilatant 263 - - , flow measurement 289 --, Newtonian 260 --, n o n - N e w t o n i a n 261 --, plastic 262 --, pseudoplastic 262 foam breakers, mechanical 193 level regulation 290 formic acid, determination 304 Fround's criterion 270 -
-
gas flow measurement 289 gene synthesis, total 124 genetic engineering 86 glass electrode 295 glucose, determination 301 --, substrate for microorganisms 136 gradostat 72 growth, apical 46 --, balanced 34 --, curve 33 --, factors 163 --, filamentous microorganisms 44 --, measurement of 309 --, microbial colonies 47 --, rate, specific 40 --, --, maximal specific 41
434 hemicellulose 142 Henry's constant 242 homogeneity of microbial population, measurement 310 homogenization, raw materials 167 - - , time 276 hydrogen, substrate for microorganisms 157 hydrogen sulphide, substrate for microorganisms 156 hyphae 45 impellers, flow pattern 275 - - , geometrical similarity 270 - - , low speed 266 --, oxygen supply 268 --, power imput 271 - - , speed measurement 291 --, turbine 267 immobilized biocatalysts, bioreactors 410 - - , evaluation 409 - - --, for biosynthesis 399 --, for n o n a q u a e o u s media 406 - - --, preparatory methods 379 - - --, second generation 398 immobilized cells, growing 378 - - --, in gels 397 - - --, living 377 - - - - , nongrowing 378 - - , techniques for immobilization 388 immobilized enzymes, absorption 382 - - - - , copolymerization 385 - - - - , covalent bonding 383 - - , encapsulation 386 - - --, entrapment 385 --, techniques of immobilization 381 industrial microbiology, definition 14 --, disciplines 15 - - - - , history 13 - - , international institutions 27 --, risks in 30 industrial microorganisms, ideal 86 - - , strategies of acquisition 87 inoculation step, actinomycetes 335 - - --, bacteria 332 - - --, fungi 333 inoculum, preparation 331 - - , transfer into the bioreactor 348 -
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
-
intracellular components, determination 312 inulin 140 isolation, auxotrophic microorganisms 97 - - , microorganisms from natural materials 323 journals, commercial 26 --, scientific 25 kL a determination, culture systems, balance method 246 , , dynamic method 248 , integral balance method 248 -- --, model systems, gassing-out method 245 , sulphite method 244 kL a effect of aeration 251 -ionic strength 256 -medium 254 mixing 251 oxygen concentration 250 rheology of the culture 254 surface active agents 256 -temperature 254 laboratory process 345 - - research 23 lactose 154 lag phase 35 lard oil 155 lignin 142 limiting substrate concentration 63 lyophilization of strains 328 lysine accumulation 104 maintenance energy 55 manometer Bourdon 289 mass spectrometry 286 methane determination 299 -- substrate for microorganisms 155 methanol, determination 303 --, substrate for microorganisms 157 microbial colony, growth kinetics 47 engineering 19 microbiology industrial, health risk 30 --, international societies 27 -
-
-
-
435 -- - - , journals 25 mixing efficiency 264 -- impeller 265 -- scale-up 277 -- theory 264 molasses, beet 137 - - , cane 137 M o n o d equation 53 multiplication curve 34 degree 43 mutagenesis 18 site directed 127 mutagens, chemical lO0 - - , physical lO0 mutants, auxotrophic 104 - - , constitutive 93 - - , industrial application 89 - - , overproduction of endoenzymes 95 - - , regulatory 105 mutasynthesis lO1 -
-
N e wtonia n fluids 261 elastic deformation 259 flow curves 260 nitrite determination 305 nitrogen, inorganic sources 133, 160 - - , natural sources 151, 153 - - , organic sources 133, 161 n o n - N e w t o n i a n fluids 261 a ppa r e n t viscosity 261 Bighamian fluids 262 dilatant fluids 263 plastic fluids 262 pseudoplastic fluids 262 nutrient media 131 stoichiometry of growth and product formation 335 oils, plant 150 optomization, deterministic 316 - - , dyna m i c 317 - - , nondeterministic 316 - - , processes of 316 - - , static 317 2-oxetanone 227 oxirane 227 oxygen c ons u m p t i o n 2 4 3 , 2 5 0 -- critical concentration 250 -- determination 296
-
paramagnetic analyzer 298 transfer teory 242
-
paramagnetic gas analyzer 298 patents 27 pellet growth kinetics 46 pH electrode 295 phosphorus, sources 161 physiological state 16 pilot-plant, cultivation part 24 - - , isolation part 25 - - , objectives 24 - - , process 347 polysaccharides 138 power imput 272 m e a s u r e m e n t 291 precursors 164 prescreening 96 preservation of strains 326 evaluation 329 price engineering 21 air filtration 368 raw materials 366 product isolation 369 product formation, batch culture 51 isolation 20 productivity 58 protoplast fussion 110 regeneration 111 publication 25 -
-
-
-
raw materials, animal origin 153 - - , chemical and petrochemical origin 155 -- - - , control biological 165 , chemical 165 - - , homogenization 167 - - , plant origin 135 - - , storage 166 reaction, parallel 60 sequential 60 -- simple 60 -- successive 60 recombinant microorganisms, cultivation 355 - - - - , growth modelling 354 - - - - , plasmid stability 352 redox potential, m e a s u r e m e n t 295 reference electrode 295 -
-
-
-
-
-
-
-
-
-
436 research, laboratory 23 --, organization 23 --, pilot-plant 24 --, report 29 - - , termination 25 resistant strains, isolation 98 Reynold's criterion 269 rheology of fluids 258 rockers for cultivation 185 saccharides, determination 300 --, raw materials 136 saturation constant 55 scale-down 349 scale-up, mixing 277 --, schematic diagram 22 --, sterilization 224 screening 87 secondary metabolism, effect of primary metabolism on 339 - - --, regulation by carbon sources 340 --, regulation by nitrogen sources 342 - - --, regulation by phosphate 342 selection 87 - - programme 99 shakers, reciprocal 184 --, rotary 184 specific rate, growth 40, 59 - - --, product formation 59 --, substrate consumption 59 spores, thermal resistance 209, 213 starch 138 stationary phase 36 sterilization of air, filter bed efficiency 235 - - -- --, filtration 230 - - - - , particle trapping 231 - - - - - - , theory 232 sterilization of nutrient media, automation 225 , chemical 227 , continuous 221 , cycle 211 , filtration 226 , radiation 228 -
-
-
-
-
-
, scale-up 224 , steam 210 , theory 212 substrates, consumption, kinetics 52 - - , gaseous 155 --, solid, cultivation equipment 173 sucrose 136 temperature measurement 288 thermometer 288 trace elements 161 tower systems 75 tubular systems 74 turbidostat 63 - - modified 63, 66 unicellular microorganism 283 cell size distribution 312 urea 161 vacuum fermentation 415 systems for 416 vectors, cosmid 118 --, phage 117 --, plasmid 115 --, shuttle 118 viscometer 293 viscosity, apparent 261 - - , measurement 292 vitamins 163 waste control 363 treatment 364 water cleaning 135 -- for microbial processes 135 whey 154 wood milling 433 -
-
Yeast, cytometric detection of fl-galactosidase 312 --, extract 153 yield coefficient 56 zeolites 422