Taenia Solium Cysticercosis: From Basic to Clinical Science (Cabi Publishing)

Taenia solium Cysticercosis

From Basic to Clinical Science

Taenia solium Cysticercosis From Basic to Clinical Science

Edited by

Gagandeep Singh Dayanand Medical College & Hospital Ludhiana Punjab, India and

Sudesh Prabhakar Department of Neurology Postgraduate Institute of Medical Education and Research Chandigarh, India

CABI Publishing

CABI Publishing is a division of CAB International CABI Publishing CAB International Wallingford Oxon OX10 8DE UK Tel: +44 (0)1491 832111 Fax: +44 (0)1491 833508 E-mail: [email protected] Web site: www.cabi-publishing.org

CABI Publishing 10 E 40th Street Suite 3203 New York, NY 10016 USA Tel: +1 212 481 7018 Fax: +1 212 686 7993 E-mail: [email protected]

© CAB International 2002. All rights reserved. No part of this publication may be reproduced in any form or by any means, electronically, mechanically, by photocopying, recording or otherwise, without the prior permission of the copyright owners. A catalogue record for this book is available from the British Library, London, UK. Library of Congress Cataloging-in-Publication Data Singh, G. (Gagandeep) Taenia solium cysticercosis : from basic to clinical science / edited by G. Singh and S. Prabhakar. p. cm. Includes bibliographical references and index. ISBN 0-85199-628-0 1. Cysticercosis. 2. Taenia. I. Prabhakar, S. (Sudesh) II. Title. RC136.7 .S545 2002 616.9’64--dc21 2002001332 ISBN 0 85199 628 0

Typeset in Palatino by Columns Design Ltd, Reading, UK Printed and bound in the UK by Biddles Ltd, Guildford and Kings Lynn.

Contents

Contributors

ix

Preface

xiii

Abbreviations

xiv

SECTION I

TAENIA SOLIUM CYSTICERCOSIS: BASIC SCIENCE

1. Taenia solium: Basic Biology and Transmission Zbigniew S. Pawlowski

1

2. Taenia solium Cysticercosis: New and Revisited Immunological Aspects Ana Flisser, Dolores Correa and Carlton A.W. Evans

15

3. Molecular Determinants of Host–Parasite Interactions: Focus on Parasite José L. Molinari and Patricia Tato

25

4. Animal Models of Taenia solium Cysticercosis: Role in Understanding Host–Parasite Interactions Astrid E. Cardona and Judy M. Teale 5. Mitochondrial DNA of Taenia solium: From Basic to Applied Science Akira Ito, Minoru Nakao, Munehiro Okamoto, Yasuhito Sako and Hiroshi Yamasaki 6. Hereditary Factors in Neurocysticercosis with Emphasis on Single, Small, Enhancing CT Lesions Vasantha Padma, Satish Jain, Achal Srivastava, Manjari Tripathi and Mahesh C. Maheshwari SECTION II

35 47

57

EPIDEMIOLOGY

7. Taenia solium Cysticercosis: an Overview of Global Distribution and Transmission Peter M. Schantz 8. What Have We Learnt From Epidemiological Studies of Taenia solium Cysticercosis in Peru? Hector H. García, Robert H. Gilman, Armando E. Gonzalez, Manuela Verastegui, Victor C.W. Tsang and The Cysticercosis Working Group in Peru

63

75

v

vi

Contents

9. Epidemiology of Taenia solium Taeniasis and Cysticercosis in Mexico Elsa Sarti 10. Taenia solium Taeniasis and Cysticercosis in Central America José Garcia-Noval, Ana L. Sanchez and James C. Allan

83 91

11. Neurocysticercosis in Brazil: Epidemiological Aspects Svetlana Agapejev

101

12. Taenia solium Taeniasis and Cysticercosis in Asia Gagandeep Singh, Sudesh Prabhakar, Akira Ito, Seung Yull Cho and Dong-Chuan Qiu

111

13. Taenia solium Cysticercosis in Africa Michel Druet-Cabanac, Bienvenue Ramanankandrasana, Sylvie Bisser, Louis Dongmo, Gilbert Avodé, Léopold Nzisabira, Michel Dumas and Pierre-Marie Preux

129

14. Taenia solium Cysticercosis: the Special Case of the United States Wayne X. Shandera, Peter M. Schantz and A. Clinton White Jr

139

15. Porcine Cysticercosis Armando E. Gonzalez, Patricia P. Wilkins and Teresa Lopez

145

16. Taenia solium: A Historical Note Noshir H. Wadia and Gagandeep Singh

157

SECTION III

TAENIA SOLIUM CYSTICERCOSIS: CLINICAL ASPECTS

17. Neurocysticercosis: an Overview of Clinical Presentations Sudesh Prabhakar and Gagandeep Singh

169

18. Meningeal Cysticercosis Oscar H. Del Brutto

177

19. Heavy Multilesional Cysticercotic Syndromes Oscar H. Del Brutto, Hector H. García and Sudesh Prabhakar

189

20. Intraventricular Neurocysticercosis Albert C. Cuetter and Russell J. Andrews

199

21. Neurocysticercosis and Epilepsy Arturo Carpio and W. Allen Hauser

211

22. Cerebrovascular Manifestations of Neurocysticercosis Fernando Barinagarrementeria and Carlos Cantú

221

23. Taenia solium Cysticercosis: Uncommon Manifestations Gagandeep Singh and Indermohan S. Sawhney

229

24. The Story Behind Solitary Cysticercus Granuloma Vedantam Rajshekhar

241

25. Seizures Due to Solitary Cysticercus Granuloma J.M.K. Murthy

251

26. Paediatric Neurocysticercosis Sudesh Prabhakar and Gagandeep Singh

257

27. Psychiatric Manifestations of Neurocysticercosis Orestes V. Forlenza

263

28. Taenia solium Cysticercosis: Ophthalmic Aspects Atul Kumar and Namrata Sharma

269

Contents

29. Neurocysticercosis: Diagnosis and Treatment in Special Situations Ravindra K. Garg and Alok M. Kar SECTION IV

281

CYSTICERCOSIS: PATHOLOGY

30. The Pathology of Neurocysticercosis Alfonso Escobar and Karen M. Weidenheim 31. Single Small Enhancing Computed Tomography Lesions – Pathological Correlates Geeta Chacko SECTION V

vii

289

307

NEUROCYSTICERCOSIS: INVESTIGATIONAL ASPECTS

32. Imaging and Spectroscopy of Neurocysticercosis Deepshikha Sharda, Sanjeev Chawla and Rakesh K. Gupta 33. Taenia solium Cysticercosis: Immunodiagnosis of Neurocysticercosis and Taeniasis Patricia P. Wilkins, Marianna Wilson, James C. Allan and Victor C.W. Tsang

311

329

34. Antigen-based Immunoassays in the Diagnosis of Taenia solium Cysticercosis Dolores Correa, Raquel Tapia-Romero, Antonio Meza-Lucas and Olga Mata-Ruiz

343

35. Polymerase Chain Reaction in the Diagnosis of Taenia solium Cysticercosis Taru Meri and Seppo Meri

351

36. Immunodiagnosis in Solitary Cysticercus Granulomas Anna Oomen

359

SECTION VI

TAENIASIS–CYSTICERCOSIS: THERAPY AND PREVENTION

37. Pharmacology of Anticysticercal Therapy Helgi Jung and Dinora F. González-Esquivel

363

38. Controversies in the Drug Treatment of Neurocysticercosis Bhim S. Singhal and Rodrigo A. Salinas

375

39. Neurocysticercosis: Neurosurgical Perspective Bhawani S. Sharma and P. Sarat Chandra

387

40. Endoscopic Management of Intraventricular Cysticercosis Marvin Bergsneider and Jaime H. Nieto

399

41. Control of Taenia solium with Emphasis on Treatment of Taeniasis James C. Allan, Philip S. Craig and Zbigniew S. Pawlowski

411

42. Taenia solium Vaccination: Present Status and Future Prospects Carlton A.W. Evans

421

43. Control of Taenia solium with Porcine Chemotherapy Armando E. Gonzalez

431

44. Use of a Simulation Model to Evaluate Control Programmes against Taenia solium Cysticercosis Armando E. Gonzalez, Robert H. Gilman, Hector H. García and Teresa Lopez

437

Index

449

Contributors

Svetlana Agapejev, Department of Neurology and Psychiatry, PO Box 540, School of Medicine, UNESP, 18618-000 Botucatu, São Paulo, Brazil. James C. Allan, Pfizer Global Research and Development – Veterinary Medicine Clinical Development, Pfizer Ltd, Sandwich, CT13 9NJ, UK. Russell J. Andrews, Department of Neurology, Texas Tech University Health Sciences Center, El Paso, Texas 79905, USA. Gilbert Avodé, School of Medicine, Cotonou, Benin. Fernando Barinagarrementeria, Department of Neurology, Instituto Nacional de Ciencias Medicas y Nutricion, ‘Salvador Zubiran’, México City, México. Marvin Bergsneider, Division of Neurosurgery, University of California, Los Angeles, Harbor–UCLA Medical Center, Los Angeles, California, USA. Sylvie Bisser, Institut d’Epidémiologie Neurologique et de Neurologie Tropicale, EA 3174 (Neuroparasitologie et Neuroépidémiologie Tropicale) Faculté de Médecine, 2 rue du Dr Marcland, 87025 Limoges, France. Carlos Cantú, Department of Neurology, Instituto Nacional de Neurologia y Neurocirgia ‘Manuel Velasco Suarez’, México City, México. Astrid E. Cardona, Department of Microbiology, The University of Texas Health Science Center at San Antonio, San Antonio, Texas 78229, USA. Arturo Carpio, Comprehensive Epilepsy Center, School of Medicine, University of Cuenca, Ecuador, PO Box 0101-719, Cuenca, Ecuador. Geeta Chacko, Division of Neuropathology, Department of Neurological Sciences, Christian Medical College and Hospital, Vellore 632 004, Tamil Nadu, India. P. Sarat Chandra, Department of Neurosurgery, CN Center, Room 720, All India Institute of Medical Sciences, Ansari Nagar, New Delhi 110 029, India. Sanjeev Chawla, Department of Radiodiagnosis, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Rae Bareli Road, Lucknow 226 014, Uttar Pradesh, India. Seung Yull Cho, Section of Molecular Parasitology, Department of Molecular Medicine, Sungkyunkwan University College of Medicine, Sungkyunkwan, Korea. Dolores Correa, Departmento de Biotecnologia, Instituto de Diagnostico y Referencia Epidemiologicos (INDRE), Secretaria de Salud, México DF, México. Philip S. Craig, Department of Biological Sciences, School of Environment and Life Sciences, University of Salford, Salford, M5 5W7, UK. Albert C. Cuetter, Department of Neurology, Texas Tech University Health Sciences Center, El Paso, Texas 79905, USA. © CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

ix

x

Contributors

Oscar H. Del Brutto, Department of Neurology, Luis Vernaza Hospital, Guayaquil, Ecuador. Louis Dongmo, School of Medicine, Yaoude, Cameroon. Michel Druet-Cabanac, Institut d’Epidémiologie Neurologique et de Neurologie Tropicale, EA 3174 (Neuroparasitologie et Neuroépidémiologie Tropicale) Faculté de Médecine, 2 rue du Dr Marcland, 87025 Limoges, France. Michel Dumas, Institut d’Epidémiologie Neurologique et de Neurologie Tropicale, EA 3174 (Neuroparasitologie et Neuroépidémiologie Tropicale) Faculté de Médecine, 2 rue du Dr Marcland, 87025 Limoges, France. Alfonso Escobar, Instituto de Investigaciones, Biomedicas, National Autonomous University of México, Ciudad Universitaria 04510, México DF, México. Carlton A.W. Evans, Imperial College, Department of Infectious Diseases, Hammersmith Hospital, Du Cane Road, London W12 0NN, UK. Ana Flisser, Departmento de Microbiologia y Parasitologia, Facultad de Medicina, National Autonomous University of México, Ciudad Universitaria, San Angel, México 04510 DF, México. Orestes V. Forlenza, Laboratory of Neuroscience (LIM-27), Department and Institute of Psychiatry, Faculty of Medicine, University of São Paulo, São Paulo, Brazil. Hector H. García, Departments of Transmissible Diseases, Microbiology, and Pathology, Universidad Peruana Cayetano Heredia, Lima, Peru. José Garcia-Noval, Centro de Investigaciones de las Ciencias de la Salud, Facultad de Ciencias Medicas, Universidad de San Carlos, Zona 12, Guatemala City, Guatemala. Ravindra K. Garg, Department of Neurology, King George’s Medical College, Lucknow, 226 003, Uttar Pradesh, India. Robert H. Gilman, Department of International Health, Johns Hopkins School of Public Health, Johns Hopkins University, 615 N Wolfe St, Room W 3501, Baltimore, Maryland 21205, USA. Armando E. Gonzalez, Facultad de Medicina Veterinaria, Universidad Nacional Mayor de San Marcos, Lima, Peru. Dinora F. González-Esquivel, Laboratorio de Neuropsicofarmacologia, Instituto Nacional de Neurologia y Neurocirugia, México City, México. Rakesh K. Gupta, Department of Radiodiagnosis, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Rae Bareli Road, Lucknow 226 014, Uttar Pradesh, India. W. Allen Hauser, Department of Neurology and Public Health, College of Physicians and Surgeons, Columbia University, GH Sergievsky Center, 630 West 168th Street, New York 10032, USA. Akira Ito, Department of Parasitology, Asahikawa Medical College, Midorigaoka-Higashi 2-1-1-1, Asahikawa 078-8510, Hokkaido, Japan. Satish Jain, Department of Neurology, Neurosciences Center, All India Institute of Medical Sciences, New Delhi, 110 029, India. Helgi Jung, Laboratorio de Neuropsicofarmacologia, Instituto Nacional de Neurologia y Neurocirugia, México City, México. Alok M. Kar, Department of Neurology, King George’s Medical College, Lucknow, 226 003, Uttar Pradesh, India. Atul Kumar, Dr Rajendra Prasad Center for Ophthalmic Sciences, All India Institute of Medical Sciences, Ansari Nagar, New Delhi 110 029, India. Teresa Lopez, Laboratorio de Micribiologia y Parasitologia, Facultad de Medicina Veterinaria, Universidad Nacional Mayor de San Macos, Cdra. 29 Av. Circunvalacion s/n San Borja, Lima, Peru. Mahesh C. Maheshwari, Department of Neurology, Neurosciences Center, All India Institute of Medical Sciences, New Delhi, 110 029, India. Olga Mata-Ruiz, Departmento de Biotecnologia, Instituto de Diagnostico y Referencia Epidemiologicos, Secretaria de Salud, México DF, México.

Contributors

xi

Seppo Meri, Department of Bacteriology and Immunology, Haartman Insitute, PO Box 21 (Haartmaninkatu 3) 00014, University of Helsinki, Finland. Taru Meri, Department of Bacteriology and Immunology, Haartman Insitute, PO Box 21 (Haartmaninkatu 3) 00014, University of Helsinki, Finland. Antonio Meza-Lucas, Departmento de Biotecnologia, Instituto de Diagnostico y Referencia Epidemiologicos, Secretaria de Salud, México DF, México. José L. Molinari, Department of Molecular Genetics, Institute of Cellular Physiology, National Autonomous University of México, México DF 04510, Apartado Postal 70–242, México. J.M.K. Murthy, Department of Neurology, The Institute of Neurological Sciences, CARE Hospital, Nampally, Hyderabad, 500 001, India. Minoru Nakao, Department of Parasitology, Asahikawa Medical College, MidorigaokaHigashi 2-1-1-1, Asahikawa 078-8510, Hokkaido, Japan. Jaime H. Nieto, Division of Neurosurgery, University of California, Los Angeles, Harbor–UCLA Medical Center, Los Angeles, California, USA. Léopold Nzisabira, School of Medicine, Bujumbura, Burundi. Munehiro Okamoto, Department of Laboratory Animal Sciences, School of Veterinary Medicine, Faculty of Agriculture, Tottori University, Koyamacho-Minami 4-101, Tottori 680-8553, Tottori, Japan. Anna Oomen, Neurochemistry Laboratory, Department of Neurological Sciences, CMC Hospital, Vellore 632 004, India. Vasantha Padma, Department of Neurology, Neurosciences Center, All India Institute of Medical Sciences, New Delhi, 110 029, India. Zbigniew S. Pawlowski, Clinic of Parasitic and Tropical Diseases, ul., Przybyszewskiego 49, 60-355 Poznan, Poland. Sudesh Prabhakar, Department of Neurology, Postgraduate Institute of Medical Education and Research, Chandigarh, 161 001, India. Pierre-Marie Preux, Institut d’Epidémiologie Neurologique et de Neurologie Tropicale, EA 3174 (Neuroparasitologie et Neuroépidémiologie Tropicale) Faculté de Médecine, 2 rue du Dr Marcland, 87025 Limoges, France. Dong-Chuan Qiu, Sichuan Institute of Parasitic Diseases, 10 University Road, Chengdu 610041, Sichuan Province, People’s Republic of China. Vedantam Rajshekhar, Department of Neurological Sciences, Christian Medical College and Hospital, Vellore, 632 004, India. Bienvenue Ramanankandrasana, Institut d’Epidémiologie Neurologique et de Neurologie Tropicale, EA 3174 (Neuroparasitologie et Neuroépidémiologie Tropicale) Faculté de Médecine, 2 rue du Dr Marcland, 87025 Limoges, France. Yasuhito Sako, Department of Parasitology, Asahikawa Medical College, MidorigaokaHigashi 2-1-1-1, Asahikawa 078-8510, Hokkaido, Japan. Rodrigo A. Salinas, Healthcare Programmes Division, Ministry of Health, Chile. Ana L. Sanchez, Department of Microbiology, National Autonomous University of Honduras, Tegucigalpa, Honduras. Elsa Sarti, INDRE, Carpio no. 470, 3rd floor, Col. Sto. Tomás, CP 04230, Mexico City, Mexico. Indermohan S. Sawhney, Department of Neurology, Morriston Hospital, Morriston, Swansea SA6 6NL, UK. Peter M. Schantz, Division of Parasitic Diseases, National Center for Infectious Diseases Centers for Disease Control and Prevention, Atlanta, Georgia 30341, USA. Wayne X. Shandera, Department of Medicine, Sections of General Internal Medicine and Infectious Diseases, Baylor College of Medicine and Ben Taub General Hospital, Houston, Texas 77030, USA. Deepshikka Sharda, Department of Radiodiagnosis, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Rae Bareli Road, Lucknow, 226 014, Uttar Pradesh, India.

xii

Contributors

Bhawani S. Sharma, Department of Neurosurgery, CN Center, Room 720, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, 110 029, India. Namrata Sharma, Dr Rajendra Prasad Center of Ophthalmic Sciences, All India Institute of Medical Sciences, Ansari Nagar, New Delhi, 110 029, India. Gagandeep Singh, Department of Neurology, Dayanand Medical College and Hospital, Ludhiana, 141 001, Punjab, India. Bhim S. Singhal, Department of Neurology, Bombay Hospital Institute of Medical Sciences, 12 Marine Lines, Mumbai, 400 0020, India. Achal Srivastava, Department of Neurology, Neurosciences Center, All India Institute of Medical Sciences, New Delhi, 110 029, India. Raquel Tapia-Romero, Departmento de Biotecnologia, Instituto de Diagnostico y Referencia Epidemiologicos, Secretaria de Salud, México DF, México. Patricia Tato, Department of Microbiology and Parasitology, Faculty of Medicine, National Autonomous University of México, México DF 04510, México. Judy M. Teale, Department of Microbiology, The University of Texas Health Science Center at San Antonio, San Antonio, Texas 78229, USA. Manjari Tripathi, Department of Neurology, Neurosciences Center, All India Institute of Medical Sciences, New Delhi, 110 029, India. Victor C.W. Tsang, Division of Parasitic Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia 30341, USA. Manuela Verastegui, Laboratorio de Parasitologia, Facultad de Ciencias, Universidad Peruana Cayetano Heredia, Av. Honorio Delgado s/n Urbanizacion Ingeniera, San Martin de Porres, Lima, Peru. Noshir H. Wadia, Director of Neurology, Jaslok Hospital and Research Center, Mumbai, India. Karen M. Weidenheim, Division of Neuropathology, Montefiore Medical Center, AECOM, YU111, East 210th Street, Bronx, New York 10467, USA. A. Clinton White Jr, Infectious Disease Section, Department of Medicine, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030, USA. Patricia P. Wilkins, Division of Parasitic Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia 30341, USA. Marianna Wilson, Division of Parasitic Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia 30341, USA. Hiroshi Yamasaki, Department of Parasitology, Asahikawa Medical College, MidorigaokaHigashi 2-1-1-1, Asahikawa, 078-8510, Hokkaido, Japan.

Preface

Neurocysticercosis and the macroparasite Taenia solium, which causes it, have been known about for time immemorial. Through history, one can follow the development of concepts regarding the aetiology, pathology, clinical science and treatment of the disorder. Recent times have however been complicated by accumulating knowledge regarding molecular biology, immunology and genetics of the disorder. The relationship between the molecular laboratory and bedside clinical practice is becoming increasingly powerful. In these times of molecular advances, a review of neurocysticercosis and T. solium that focuses on past accomplishments, current understanding and future hopes seems appropriate. A number of scientific antecedents mean that the goals of effective treatment and, more importantly, eradication are foreseeable. This alone prompted the genesis of this textbook, which symbolizes the spirit of unity between basic researchers, clinicians and field workers. Since the book involved a large number of subspeciality areas including parasitology, immunology, biology, genetics, epidemiology and public health, clinical neurology, radiology and veterinary medicine, it was impossible for two authors alone to write such a volume. Therefore, we solicited the contribution of a number of experts, each with great depth of knowledge and experience in their respective areas. The contributors to this book are its principal strength and we are indebted to them for their time and effort spent not only in writing their respective chapters but also for the years of painstaking work that led to the realization of knowledge through basic, clinical or field research. It is because of their involvement, that the book turns out what it was meant to be, a ‘one-stop shop for T. solium cysticercosis’. We express our appreciation of several associates among the contributors, who gave invaluable suggestions while planning the book project and were also involved in stimulating discussions: James Allan, Peter Schantz, Ana Flisser, Patricia Wilkins, Hector García, Akira Ito, Phillip Craig, Arturo Carpio, Carlton Evans and Svetlana Agapejev. Davinder Singh and Arun Gupta provided excellent editorial assistance with the text and illustrations, respectively. Finally, this book is a tribute to those millions afflicted by the disorder. They have contributed in their own way to the understanding of the disorder. It is our fervent hope that the recent accomplishments in scientific understanding brought out in this volume will ultimately lead to the goal of complete global eradication of the parasite, T. solium.

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

xiii

Abbreviations

AED AFB AIDS ALBSO ATT AUC C1 CDC cDNA CECT CI Cmax CNS COI COII COIII Con A CSF CT CWG DTH EDTA EEG EITB ELISA ES FLAIR FMO Gd GIS GPL GST HIV HLA HPLC-ELISA hsps

antiepileptic drug acid-fast bacilli acquired immune-deficiency syndrome albendazole sulphoxide antitubercular treatment area under the plasma concentration–time curve first cervical vertebra Centers for Disease Control complementary deoxyribonucleic acid contrast enhanced CT confidence interval maximal concentration central nervous system cytochrome c oxidase subunit I cytochrome c oxidase subunit II cytochrome c oxidase subunit III concanavalin A cerebrospinal fluid computed tomography Cysticercosis Working Group delayed type hypersensitivity ethylenediamine tetra-acetic acid electroencephalography enzyme-linked immunoelectrotransfer blot enzyme-linked immunosorbent assay excretory–secretory fluid attenuation inversion recovery flavin-containing monoxygenase gadolinium global information system glycoproteins glutathione-S-transferase human immunodeficiency virus human leucocyte antigen high pressure liquid chromatography-ELISA heat shock proteins

© CAB International 2002. Taenia solium Cysticercosis xiv

Abbreviations

HU ICH ICP IDEMSC IEF IFN IgG IgM IHA IL ILAE IMOA IMSC IP IV IVNC LLGP LrRNA MAb MF MoAb MRI mtDNA NADH NADPH NC Nd:YAG NOD-SCID Pc PCR PD PoAb PRA Rnase RR rRNA SCG SDS-PAGE SrRNA SSECTL sTS TCD Th TNF tRNA VPS

Hounsfield units intracranial hypertension intracranial pressure intradural extramedullary spinal cysticercosis immunoelectrophoresis interferon immunoglobulin G immunoglobulin M indirect haemagglutination assay interleukin International League Against Epilepsy intramuscular oncosphere assay intramedullary spinal cysticercosis intraperitoneal intravascular intraventricular neurocysticercosis lentil lectin-bound glycoproteins large subunit rRNA monoclonal antibody metacestode factor monoclonal antibody magnetic resonance imaging mitochondrial deoxyribonucleic acid reduced nicotinamide-adenine dinucleotide nicotinamide-adenine dinucleotide phosphate (reduced form) neurocysticercosis neodymium:yttrium alminium-garnet non-obese diabetic-severe combined immunodeficiency corrected P value polymerase chain reaction proton density polyclonal antibody participatory rural appraisal ribonuclease relative risk ribosomal ribonucleic acid solitary cysticercus granuloma sodium dodecyl sulphate-polyacrylamide gel electrophoresis small subunit rRNA single small enhancing CT lesion synthetic Taenia solium transcranial doppler T helper cell tumour necrosis factor transfer ribonucleic acid ventriculoperitoneal shunt

xv

1

Taenia solium: Basic Biology and Transmission Zbigniew S. Pawlowski

No animal has been responsible for more hypotheses, discussions and errors than the tapeworm Casimir Joseph Davaine, 18601

Introduction Even today, the above statement by the author of a French textbook of parasitology deserves attention. While some of the earlier controversies regarding the taxonomic status, life cycle and pathogenicity of Taenia solium have been solved, several issues in relation to basic biology, modalities of transmission and control remain unsettled. A major reason for these persisting uncertainties has been that the study of Taeniidae is neither a research nor a control priority. Fifty years ago in UK, and in many countries today, taeniasis in humans was considered a trifle, and regarded as more suitable for an examination question than for consideration as a potential threat of cysticercosis2. Basic, experimental as well as field studies upon T. solium infection are still few. The control of human cysticercosis for a long time was left to veterinary services alone. The eradication of human cysticercosis in Europe made it clear that certain economic and social standards and community discipline and cooperation were necessary for successful control of infection. Since socioeconomic improvement is a gradual and slow process, long-term control programmes

would take time in several developing countries where cysticercosis is endemic. Recently, schemes for short-term control have been developed with an aim to bring about immediate control of T. solium infection in developing countries (reviewed in Chapters 41–44). These methods require multidisciplinary collaboration between clinical, veterinary and public health services, and immunology and parasitology disciplines as well as support at the community and national levels3. In order to understand the basis of the control strategies, it is necessary to have sound knowledge of the life cycle and mechanisms of transmission of infection. This chapter reviews basic biology of T. solium with emphasis on aspects related to its transmission.

Taxonomic Status of T. solium The origin of tapeworms still remains a controversial issue4,5. According to actual systematics, there are two major subclasses of tapeworms: Cestodaria and Eucestoda. Taenia solium belongs to the subclass, Eucestoda, order, Cyclophyllidea and family, Taeniidae5. The family, Taeniidae

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

1

2

Z.S. Pawlowski

comprises 11 genera of small to large sized tapeworms. They have a holdfast organ – the scolex – and an elongated-segmented tape-like body. Each segment has intricately developed sexual organs but does not have an alimentary canal. The genus Taenia has about 20 species; important among these are T. solium (pork tapeworm), T. saginata (beef tapeworm), T. crassiceps (rodent tapeworm), T. hydatigena (canine tapeworm), T. ovis (canine tapeworm) and T. pisiformis (canine tapeworm). Only a few species among Taeniidae present potential health hazards to humans: Taenia solium, T. saginata, Echinococcus granulosus and E. multilocularis. In addition, there are anecdotal reports of human infection with T. crassiceps, T. hydatigena and T. multiceps. Few other zoonotic species, e.g. T. taeniaeformis, T. ovis and T. hydatigena are good models for laboratory and field studies; the latter can hardly be performed with T. solium on account of its high pathogenic risk potential. Therefore, studies of related species constitute a useful source of information on biology and transmission of T. solium. Although the ‘Standardized Nomenclature of Animal Parasitic Diseases’ recommended the use of the term ‘taeniosis’ (T. solium taeniosis, T. saginata taeniosis), the term, ‘taeniasis’ continues to be widely used6. The term, ‘cysticercosis’ denotes infection with the metacestode stage (cysticercus) of Taenia. It was as late as 1853 that cysticerci were demonstrated to be a developmental stage of T. solium and not a separate parasite species as was previously held7. The terms, ‘cysticercus cellulosae’ and ‘cysticercus bovis’ were introduced in the 18th century; these are of historic value only and should never be used in a generic fashion. In medical literature, the expression ‘cysticercosis’ synonymously denotes T. solium metacestode infection unless otherwise specified, e.g. bovine cysticercosis.

Differences between T. solium, T. saginata and T. saginata asiatica Several morphological abnormalities of strobila or individual proglottides of T. sagi-

nata, and less frequently T. solium adult tapeworms have been noted, often giving rise to taxonomic confusion in the past. The taxonomic revision of genus Taenia, published by Verster, recognizes only two species of Taeniidae, namely, T. solium and T. saginata as capable of parasitizing the human gut8,9. The so called Asian Taenia, first described in 1980s in Taiwan, was initially proposed to be a new species but is now accepted to be a subspecies of T. saginata namely, T. saginata asiatica (see Chapter 5)10,11. The adult stage of T. solium needs to be differentiated from other Taeniidae, particularly the closely related T. saginata (Table 1.1, Fig. 1.1). Differences between scolices of T. solium and T. saginata were recognized as early as in the 17th century7. T. solium scolices are armed with hooks, while T. saginata scolices are not. This easily visible criterion is now of little routine diagnostic value as intact scolices can rarely be found after treatment with modern anthelminthics (that cause considerable damage to the worm). In general, the adult T. solium is smaller and more delicate than T. saginata. For nearly 150 years, gravid proglottides of T. solium and T. saginata were differentiated by counting the number of lateral uterine branches. In 1967, Verster questioned this criterion and proposed three morphological characteristics for distinguishing T. solium from T. saginata, namely the presence of an armed rostellum, three-lobed ovary and the absence of a vaginal sphincter (Table 1.1, Fig. 1.1)8. These differences are rarely observed in routine diagnostic parasitology practice as scolices and mature proglottides are not commonly available and counting ovarian lobes as well as finding the vaginal sphincter requires fixation and staining of mature proglottides, which is an arduous procedure. Enzyme electrophoresis for the differentiation of Taeniidae was elaborated in the early 1970s; it has been replaced by DNA fingerprinting in the 1990s12,13. Specific DNA probes for T. solium and T. saginata are now available13. Intraspecific DNA differences were demonstrated between T. solium tapeworms originating from various continents (reviewed in Chapter 5)14. These molecular studies also

Muscle, viscera 7–10  4–6 No rostellum Rugae

1.5–2.0 4 0.7–0.8 Absent Absent 4–12 12–14 c. 2000 800–1200 Two lobes Present No 18–32 (15) Dichotomous Single, spontaneously

0.6–1.0 4 0.4–0.5 Present 22–32 1.5–8 7–10 700–1000 375–575 Three lobes Absent Yes 7–12 (16) Dendritic Mainly in groups, passively

Cattle, reindeer

T. saginata

Brain, skin, muscle 5.6–8.5  3.1–6.5 Rostellum and hooks Wart-like formations

Pig, wild boar

Intermediate host

Metacestodes Site Size (mm) Scolex Bladder surface Adult tapeworm Scolex Diameter (m) Number of suckers Diameter of suckers (mm) Rostellum Number of hooks Proglottides Length (mm) Maximal breadth (mm) Number of proglottides Mature proglottides Number of testes Ovary Vaginal sphincter Cirrus pouch extending to excretory vessels Gravid proglottides Number of uterine branches Branching pattern Expulsion from host

T. solium

Characteristic

16–21 (32) Dichotomous Single, spontaneously

868–904 Two lobes Present No

c. 3.5 c. 9.5 260–1016

0.8 4 0.24–0.29 Present Absent

Liver (exclusively) 22 Rostellum, rudimentary hooklets (1–37) Wart-like formations

Pig, cattle, goat, some wild mammals

T. saginata asiatica

Table 1.1. Morphological differences between T. solium, T. saginata and T. saginata asiatica (compiled from references 10, 18, 37 and 46).

Basic Biology and Transmission 3

Z.S. Pawlowski

0.5 mm

4

(a)

(b)

(c)

2 mm (d)

(e)

(f)

(g)

5 mm

ut

(h)

(i)

(j)

Fig. 1.1. Diagrammatic representation of the comparative morphological features of adult T. solium (a, d, f, h), T. saginata (b, g, i) and T. saginata asiatica (c, e, j) (adapted from references 8, 10, 47). Note that tri-lobed ovary in the mature proglottid of T. solium (d), in comparison to two lobes in the mature proglottid of T. saginata and T. saginata asiatica (e), the presence of the vaginal sphincter in the atrium genitale of T. saginata (g). Note also the differences in the branching pattern of the uterus of T. solium (h), T. saginata (i) and T. saginata asiatica (j) proglottides.

Basic Biology and Transmission

support speciation of T. saginata asiatica as a subspecies of T. saginata15. Recently, a serologic assay, using T. solium excretory–secretory antigens that is 95% sensitive and 100% specific, has been developed to identify T. solium tapeworms carriers (reviewed in Chapter 33)16. A rapid, highly sensitive and specific dot blot assay has also been developed for detection of T. solium eggs, which otherwise cannot be differentiated from T. saginata and some other taeniid eggs by morphological criteria alone17. The differentiation of T. solium and T. saginata taeniasis is important for clinical reasons and epidemiological purposes. However, in regions, where both are endemic in animals, and when species-specific diagnosis in humans is not possible, any case of taeniasis should be considered and treated without delay as suspected T. solium infection.

5

Stages in Development of T. solium The life cycle of T. solium is divided into six characteristic developmental stages (Fig. 1.2): 1. Preadult tapeworm: a stage between the cysticercus, after it has successfully invaded the definite host, and the mature tapeworm. 2. Adult tapeworm: a reproductive stage capable of producing thousands of eggs. 3. Egg: a small embryo covered by an embryophore, a stage responsible for dissemination to the external environment. 4. Oncosphere: a hexacanth larva which migrates from the intestine to internal tissues or organs within the intermediate host. 5. Postoncospheral form: an intermediate stage between an oncosphere in the tissues and a fully developed cysticercus. 6. Cysticercus: a bladder metacestode form that parasitizes tissues of the intermediate host, mainly pigs as well as humans.

Taenia solium Infection: Host Characteristics Preadult and adult tapeworm Humans are the major natural final host of T. solium, implying that man, the only natural definite host, is the most important multiplier, reservoir and disseminator of the infection to pigs. However, experimental infections with adult T. solium after ingestion of cysticerci have been successfully established in lar gibbon (Hylobates lar), chacma baboon (Papio ursinus) and golden hamster (Mesocricetus auratus). T. solium metacestodes are less specific than adult cestodes18. The list of mammals in which cysticerci armed with hooks have been found includes monkeys (Ateles, Cercopithecus, Macacus sp.), wild boars, bush pigs, bush babies, camels, rabbits, hares, rock hyraxes, brown bears, dogs, foxes, cats, polecats, coatis, rats and mice18. In addition, experimental infection with T. solium oncospheres has been successfully established in immunosuppressed mice (see Chapter 4)19. However, many of the reported cysticerci differed in the size of hooks and immunoelectrophoretic pattern of T. solium cysticerci; not all armed cysticerci are those of T. solium18. Humans are unique in that they can harbour both adult and metacestode stages.

The ingestion of pork contaminated with cysticerci by man is a prerequisite for this stage. Upon reaching the human intestine the cysticercus evaginates and loses its bladder wall. The adult tapeworm grows up from behind the scolex of the cysticercus. It takes approximately 2 months to develop into a mature, reproductively competent, adult tapeworm that is capable of producing eggs. The adult tapeworm has a scolex, an elongated neck and a strobila4. The scolex is the holdfast organ armed with four suckers and a rostellum displaying 22–32 characteristic hooks4. The strobila consists of 700–1000 segments proglottids and can be extremely long (Fig. 1.3). It is made up of immature, mature and gravid proglottids, which differ in size, shape and stage of development with respect to their internal reproductive organs and egg content (Fig. 1.1). Proglottids located proximally are small, short and reproductively immature. Mature proglottids are almost rectangular and have fully developed sexual organs. The gravid segments, located towards the very distal end of the strobila, are

6

Z.S. Pawlowski

Stages

Habitat

Number

Time *Human taeniasis

HUMANS

**Human cysticercosis around a carrier **Human cysticercosis: external / internal autoinfection

1. Preadult tapeworm

Gut

One

2 months

2. Adult tapeworm

Gut

One

In years

(Gravid proglottids)

Several in a week

ENVIRONMENT

3. Eggs

Soil, water, dirt

300,000 per day

One year

Transmission of human cysticercosis PIGS 4. Oncosphere

Gut / tissue

One–several

2 days

5. Post-oncosphere

Muscle, brain, other organs

One–several

10–12 weeks

6. Cysticercus

Muscle, brain, other organs

One–several

<1 year

Transmission of human taeniasis: meatborne

Fig. 1.2. Diagrammatic representation of the life cycle of T. solium.

Basic Biology and Transmission

elongated (20  5 mm) and each is packed with a uterus full of eggs. The gravid proglottids detach from the strobila by ‘apolysis’ either individually or in groups of two to five, and are passed in the faeces a few times in a week20. Discharged proglottides remain active and may show some movements. The tapeworm is a protoandrous hermaphrodite4. Its reproductive system is intricately developed. Within each mature proglottid, a centrally located ovary, a vitelline gland and uterus, surrounded by numerous testes can be seen. The male reproductive organs include numerous

7

testes; each connected to the sperm duct (vas deferens) leading to the genital pore. The female reproductive system comprises of a vagina, also located within the genital pore, a receptaculum seminis, an oviduct, a trilobed ovary and a vitelline gland. Both self- and cross-fertilization may occur. Spermatozoa formed in the testes are conveyed through the sperm duct to the genital pore and thereafter to the vagina to finally reach the receptaculum seminis and the oviduct. The ovary discharges eggs in to the oviduct, where the latter are fertilized by spermatozoa. The fertilized eggs acquire

Fig. 1.3. Picture depicting the entire length of the adult T. solium tapeworm. (Source: Ana Flisser, National Autonomous University of México, México DF, México.)

8

Z.S. Pawlowski

yolk cells from a vitelline gland in the oviduct itself and are relocated into the uterus, where they are stored. As the uterus tube is closed without any opening to outside it develops several ramifications packed with eggs, thus occupying most of the gravid proglottid. Besides the reproductive system, the adult tapeworm has four major organ systems: tegument, nervous system, osmoregulatory system and muscular system. It has no digestive canal4. While the tapeworm lives in human small intestine, its scolex is temporarily fixed in the duodenum and the strobila is bent a few times21. However, it frequently moves up and down, in synchrony with the passage of incoming food. It adapts to the rather hostile intestinal environment, being mobile, anaerobic, and is able to withstand the varying pH and digestive enzymes within the intestine. The adult worm is believed to survive for a few years; new proglottides constantly replace those expelled. Studies performed by Yoshino in the 1930s are of interest22–26. He himself swallowed three T. solium cysticerci and noted passage of proglottides starting from 2 months after infection and lasting for 2 years and 3 months26. A tapeworm that dies naturally or after treatment is easily digested and disappears quickly without

(a) (b)

being noticed in the faeces. Usually, a single T. solium tapeworm parasitizes the human gut; however, multiple infections may occur. Superinfection probably exists; it has been documented in experimental T. saginata infection27.

Taenia solium eggs The eggs of T. solium are morphologically indistinguishable from those of other Taenia sp. (Fig. 1.4a). As with eggs of other Taeniidae, the outer shell of T. solium eggs is very delicate and is usually lost while leaving the uterus. What is found in the faeces is an oncosphere covered by an embryophore, characteristic for all Taenia. The embryophore is globular in shape and measures 31–43 m in diameter28. It has a thick striated cover and contains an oncosphere armed with six typical embryonic hooklets (giving it the name, ‘hexacanth embryo’), usually visible through the embryophore cover. The embryophore protects the oncosphere against various unfavourable environmental conditions but is easily broken in the gut of the intermediate host where the substance cementing the keratin-like prismatic elements of its cover is digested.

(b) (a)

Fig. 1.4. Taenia solium eggs (a) and oncospheres (b). The eggs are 40  30 m in size and surrounded by a shell; in the centre of figure (a) is a disintegrating egg, showing the process of hatching of an oncosphere. The oncospheres can be seen surrounding a single egg in (b); their size is smaller (30  20 m) and they contain characteristic embryonic hooklets. (Source: Akivo Ito, Asahikawa Medical College, Asahikawa, Japan.)

Basic Biology and Transmission

The T. solium tapeworm can shed up to 300,000 eggs daily29. Each apolysed proglottid has approximately 40,000 eggs. Most of the eggs are discharged from a pore at the anterior part of the proglottid, but some remain in the uterus. Eggs that are shed into faeces may serve as a source of external autoinfection to people in close contact with the carrier. However, most eggs are disseminated to the environment. The fate of T. solium eggs in the environment has not been adequately studied. In regions that lack sanitation, free-ranging pigs feed upon faecal matter that is indiscriminately deposited by people. This is a natural method to reduce contamination of the environment but it increases incidence of swine cysticercosis. The high reproductive potential of the adult T. solium tapeworm is counterbalanced by an enormous egg loss in the external environment29. Factors influencing egg survival and infectivity have been studied in other members of the genus Taenia and have been comprehensively reviewed elsewhere30–34. Egg survival is adversely affected by extremes of temperature and desiccation. Conversely, humidity and temperatures between 10°C and room temperature favour egg survival29. A number of agents such as wind and water, and some invertebrates and birds are believed to aid in taeniid egg dispersal30–35. However, egg dispersal may be of less importance in the life cycle of T. solium than in that of Echinococcus sp., where sheep presumably get infected while grazing heavily contaminated pasturage31.

Oncosphere The mature oncosphere is a globular larva, 30 m in diameter (Fig. 1.4b). Its body is composed of a few hundred cells differentiated into muscle, excretory and nervous system; it also has six characteristic embryonic hooklets and a pair of penetration glands that are helpful in migration5. Oncospheres, enclosed within embryophores while leaving the human gut, are in various stages of development. A few oncospheres are not fully developed and will mature in the environment (as in the case of

9

E. granulosus oncospheres). Others are mature and readily infective to humans and/or pigs. There are also few senile oncospheres that are incapable of developing further; nevertheless, they serve as immunizing factors while disintegrating in the intermediate host31. It is held that luminal factors such as bile salts are involved in the liberation and activation of mature oncospheres in the gut. Within 2 hours of liberation, oncospheres enter submucosal blood and/or lymphatic vessels and migrate to internal organs such as liver, lungs, muscles and brain. Why oncospheres have a predilection for certain sites such as muscle, brain and subcutaneous tissue is not clear.

Postoncospheral stage or cysticercus The postoncospheral development of the larva (also designated as ‘metacestode’) proceeds within the intermediate host. During this stage, the parasite does not attain sexual maturity. The metacestode of the genus Taenia is known as ‘cysticercus’. The parasite is located in a cavity lined by host epitheloid cells originating from small vessels. The oncosphere quickly change from a solid larva into a bladder form filled with fluid and having a group of cells that will differentiate further into an invaginated scolex. The experiments performed by Yoshino, referred to earlier, helped to clarify the sequence of development of the metacestode23–25. When the freed oncosphere enters the intestinal wall, it is less than 0.03 mm in size23. At about 6 days, the metacestode is still solid and measures 0.4  0.3 mm23. It has an outer membranous wall comprising of pleomorphic cells, while its inner contents are myxomatous. By 12 days, the metacestode is larger and becomes cystic. Between 20 and 30 days, a rudimentary scolex is discernable24. Hooks appear by 40 days and the rostellum and suckers are distinguishable by 40–50 days25. The metacestode reaches its fully grown size of 5.6–8.5 mm  3.1–6.5 mm by 60–70 days. The cysticercus is an ovoid bladder stage. It is filled with an opalescent fluid and contains an invaginated scolex. The bladder consists of outer and inner layers. The outer

10

Z.S. Pawlowski

layer has characteristic hair-like processes. This layer not only plays a protective role but also serves as a trophoblast that absorbs nutrients and excretes metabolites36. Between the outer and inner layers there are few muscle bundles, fine fibres, flame cells, calcareous corpuscles, neural and duct systems and a group of non-differentiated oval cells. Any change in osmotic pressure causes the scolex to become everted. The survival time of a cysticercus is limited to a few years. The naturally degenerating cysticercus becomes necrotic and eventually gets calcified, or forms a granuloma that finally transforms into a fibrotic scar. The cysticercus is typically found in the intermediate host, i.e. the pig. In humans, the cysticercus constitutes a dead-end stage, i.e. its life cycle cannot progress any further. However, its development in pigs, known as porcine cysticercosis, perpetuates the life cycle of the parasite when man ingests contaminated pork with viable cysticerci.

Biological and Economic Cycles of T. solium: Implications for Control Biological cycle The relatively simple natural biological cycle of T. solium zoonosis consists of two hosts and the environment. Man, the final host, harbours the adult tapeworm, which produces several thousands of eggs daily for years. The eggs are disseminated to the environment through faeces. The pig, which is the intermediate host, ingests some of these eggs; the latter develop into cysticerci. When man consumes contaminated pork containing cysticerci, the latter develop into an adult worm inhabiting the human intestine. This completes the life cycle of the parasite (Fig. 1.2). However, man may also be infected by T. solium eggs through internal and external autoinfection. External autoinfection implies faecal–oral infection with T. solium eggs in an individual with intestinal taeniasis. Neglect of hygienic standards such as washing hands after defecation and before consuming meals are principal reasons for external autoinfection. External autoinfection is an established

route of self-infection. Internal autoinfection, suggested by Leukart in 1856 and cited by others, implies infection with eggs through reverse peristalsis37. Internal autoinfection appears theoretically improbable since eggs are required to pass through a brief period of peptic digestion that is necessary for disintegration of the embryophores before being invasive to human tissue37. The possibility of internal autoinfection cannot be totally disregarded however, and merits further study. From 5 to 40% of adult T. solium carriers have been reported to develop cysticercosis38. In the case of infection with T. saginata, it has been demonstrated that the immediate environment of the infected individual is heavily contaminated39. This may not be the case, however, with pork tapeworm infection, because unlike T. saginata, the proglottides of T. solium do not pass out actively through the anus. Nevertheless, the high rates of cysticercosis in individuals with intestinal taeniasis and their family members and household contacts confirm that faecal–oral self- and cross-infection is common38. Similarly, there is the theoretical possibility of outbreak of cysticercosis around T. solium carriers in schools, closed institutions and public eating facilities, though this has never been adequately confirmed.

Economic cycle One can imagine that in addition to the biological cycle of T. solium described above, an economic cycle exists in several developing countries40,41. Several economic factors sustain the life cycle of T. solium in underdeveloped regions. Each rural household, in certain developing countries, rears pigs in small numbers; the latter constitute an important source not only of meat but also of immediate income. The production of freeranging animals needs minimal investment and running costs for the rural poor. In absence of sanitary infrastructure, people use houseyards, open areas and fields for defecation and ablution. This allows free-ranging pigs access to human faeces and perpetuates transmission of parasite from man to pig. Individual rural pork producers and unli-

Basic Biology and Transmission

censed pig dealers are not motivated to pass pork through meat inspection because of threat of condemnation. Furthermore, the lack of fuel as well as the local culinary habits facilitate the consumption of raw or semi-cooked meat. These factors lead to the transmission of the parasite from pig to man in endemic areas42. The socio-ecological and economic factors strongly influence the transmission of T. solium infection and are responsible for its concentration in certain areas, making short-term control with taeniasis therapy possible (discussed in Chapter 41)43,44.

Implications for control In 1993, the Task Force for Disease Eradication (Centers for Disease Control, Atlanta, USA) itemized four diseases that were potentially eradicable in the future; these included lymphatic filariasis, mumps, rubella and T. solium taeniasis/cysticercosis45. Several characteristics of T. solium infection make it suitable for eradication, namely, adult tapeworm infection in humans is the only source of infection for intermediate hosts (pigs); the animal intermediate host population can be managed;

11

there is no significant wildlife reservoir and finally a feasible intervention is available in the form of mass chemotherapy of human taeniasis with safe and effective drugs (reviewed in Chapter 41).

Conclusions Six major stages of development have been recognized in the life cycle of T. solium. Man is a major reservoir, multiplier of the parasite and disseminator of infection to both himself and to the pig. The pig does not play the most important role in spreading human cysticercosis, as was believed until not long ago. The role of the external environment in transmission of T. solium infection is incompletely understood. The control of taeniasis/cysticercosis depends much not only on the biological life cycle but also on the ‘economic’ cycle of T. solium. Several factors including inadequacies in pig husbandry, sanitary facilities, meat inspection, personal hygiene and local feeding habits are involved in the perpetuation of the life cycle of T. solium in the developing world. Control strategies should be able to deal with these deficiencies in order to be effective in eradicating taeniasis/cysticercosis.

References 1. Davaine, C.J. (1860) Traite des Entozoaires et des Maladies Vermineuses de l’Homme et des Animaux Domestiques. JB Bailière et fils, Paris, France. 2. Asher, R. (1953) Troublesome tapeworms. Lancet i, 1019–1021. 3. Schantz, P.M., Cruz, M., Sarti, E., et al. (1993) Potential eradicability of taeniasis and cysticercosis. Bulletin of the Pan American Health Organization 27, 397–403. 4. Wardle, R.A., McLeod, J.A., Radinovsky, S. (1974) Advances in the Zoology of Tapeworms 1950–1970. University of Minnesota Press, Minneapolis, pp. 10–22. 5. Smyth, J.D. (1994) Introduction to Animal Parasitology, 3rd edn. Cambridge University Press, Cambridge, pp. 277–387. 6. Kassai, T., Cordero del Campillo, M., Euzeby, J., et al. (1988) Standardized nomenclature of animal parasitic diseases (SNOAPAD). Veterinary Parasitology 29, 299–326. 7. Grove, D.I. (1990) Taenia solium taeniasis and cysticercosis. In: A History of Human Helminthology. CAB International, Wallingford, UK, pp. 355–383. 8. Verster, A. (1967) Redescription of Taenia solium Linnaeus, 1758 and Taenia saginata Goeze, 1782. Zeitschrift fuer Parasitenkunde 29, 313–328. 9. Verster, A. (1969) A taxonomic revision of the genus Taenia Linnaeus, 1758. Journal of Veterinary Research 36, 3–58. 10. Eom, K.S., Rim, H.J. (1993) Morphological descriptions of Taenia asiatica sp. Korean Journal of Parasitology 31, 1–6.

12

11. 12. 13. 14. 15.

16. 17.

18. 19.

20.

21. 22. 23.

24.

25. 26. 27. 28.

29.

30. 31.

32.

33.

Z.S. Pawlowski

Fan, P.C., Chung, W.C. (1998) Taenia saginata asiatica: Epidemiology, infection, and immunological and molecular studies. Journal of Microbiology, Immunology and Infection 31, 84–89. La Riche, P.D., Sewell, M.M.H. (1978) Differentiation of taeniid cestodes by enzyme electrophoresis. International Journal of Parasitology 8, 479–483. McManus, D.P. (1990) Characterization of taeniid cestodes by DNA analysis. Revue Scientifique et Technique 9, 489–510. Rishi, A.K., McManus, D.P. (1988) Molecular cloning of Taenia solium genomic DNA and characterization of taeniid cestodes by DNA analysis. Parasitology 97, 161–176. Zarlenga, D.S., McManus, D.P., Fan, P.C., et al. (1991) Characterization and detection of a newly described Asian taeniid using cloned ribosomal DNA fragments and sequence amplification by the polymerase chain reaction. Experimental Parasitology 72, 174–183. Wilkins, P.P., Allan, J.C., Verastegui, M., et al. (1999) Development of a serologic assay to detect Taenia solium taeniasis. American Journal of Tropical Medicine and Hygiene 60, 199–204. Chapman, A., Vallejo, V., Mossie, K.G., et al. (1995) Isolation and characterization of species-specific DNA probes from Taenia solium and Taenia saginata and their use in an egg detection assay. Journal of Clinical Microbiology 33, 1283–1288. Pawlowski, Z.S. (1982) Taeniasis and cysticercosis. In: Steele, J.H. (ed.) Handbook Series. Zoonoses. Section C: Parasitic Zoonoses. CRC Press, Boca Raton, Florida Vol. 1, part 2, pp. 313–348. Wang, I.C., Ma, Y.X., Guo, J.X., et al. (1999) Oncospheres of Taenia solium and Taenia saginata asiatica develop into metacestodes in normal and immunosuppressed mice. Journal of Helminthology 73, 183–186. Pawlowski, Z.S. (1994) Taeniasis and cysticercosis. In: Hui, Y.H., Gorham, J.R., Murrel, K.D., et al. (eds) Foodborne Disease Handbook. Diseases Caused by Viruses, Parasites and Fungi. Marcel Dekker, New York, Vol. 2, pp. 199–254. Prevot, R., Hornbostel, H., Dorken, H. (1952) Lokalisations-studien bei Taenia saginata. Klinische Wochenschrift 30, 78–80. Yoshino, K. (1933) Studies on the postembryonal development of Taenia solium. Part I. On the hatching of eggs of Taenia solium. Journal of Medical Association of Formosa 32, 139–141 (English summary). Yoshino, K. (1933) Studies on the postembryonal development of Taenia solium. Part II. On the youngest form of cysticercus cellulosae and on the migratory course of the oncospheres of Taenia solium within the intermediate host. Journal of Medical Association of Formosa 32, 155–158 (English summary). Yoshino, K. (1933) Studies on the postembryonal development of Taenia solium. Part III. On the development of cysticercus cellulosae within the definite intermediate host. Journal of Medical Association of Formosa 32, 166–169 (English summary). Yoshino, K. (1933) Experimental studies on the formation of the scolex of Taenia solium. Journal of Medical Association of Formosa 32, 169–171 (English summary). Yoshino, K. (1934) On the subjective symptoms caused by parasitism of Taenia solium and its development in man. Journal of Medical Association of Formosa 33, 183–194 (English summary). Hornbostel, H. (1959) Bandwurmprobleme in neuer Sicht. Ferdinand Enke Verlag, Stuttgart, Germany, pp. 1–59. Laclette, J.P., Ornelas, Y., Merchant, M.T., et al. (1982) Ultrastructure of the surrounding envelopes of Taenia solium eggs. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 375–387. Lawson, J.R., Gemmell, M.A. (1983) Hydatidosis and cysticercosis: the dynamics of transmission. In: Baker, J.R., Muller, R. (eds) Advances in Parasitology. Academic Press, London, Vol. 22, pp. 262–308. Gemmell, M.A., Johnstone, P.D. (1976) Factors regulating tapeworm populations: dispersion of eggs of Taenia hydatigena on pasture. Annals of Tropical Medicine and Parasitology 70, 431. Gemmell, M, Lawson, J.R., Roberts, M.G. (1987) Population dynamics in echinococcosis and cysticercosis: evaluation of the biological parameters of Taenia hydatigena and T. ovis and comparison with those of Echinococcus granulosus. Parasitology 94, 161–180. Gemmell, M.A., Lawson, J.R. (1989) The ovine cysticercosis as models for research into the epidemiology and control of the human and porcine cysticercosis Taenia solium. I. Epidemiological considerations. Acta Leidensia 57, 165–172. Gemmell, M.A., Johnstone, P.D., Boswell, C.C. (1978) Factors regulating tapeworm population dispersion patterns of Taenia hydatigena eggs on pasture. Research in Veterinary Science 24, 334–338.

Basic Biology and Transmission

13

34. Gemmel, M.A., Lawson, J.R. (1982) Ovine cysticercosis: an epidemiological model for the cysticercosies II. Host immunity and regulation of the parasite population. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 647–660. 35. Lonc, E. (1980) The possible role of the soil fauna in the epizootiology of cysticercosis in cattle. I. Earthworms, II. Dung beetles – the biotic factor in a transmission of Taenia saginata eggs. Angewandte Parasitologie 21, 133–138, and 139–144 36. Bon, E.R., Merchant, M.T., Gonzalez-del Pliego, M., et al. (1982) Ultrastructre of the bladder wall of the metacestode of Taenia solium. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 261–280. 37. Goennert, R., Meister, G., Strufe, R., et al. (1967) Biologische Probleme bei Taenia solium. Journal of Tropical Medicine and Parasitology 18, 76–81. 38. Schantz, P.M., Wilkins, P.P., Tsang, V.C.W. (1998) Immigrants, imaging, and immunoblots: the emergence of neurocysticercosis as a significant public health problem. In: Scheld, W.M., Craig, W.A., Hughes, J.M. (eds) Emerging Infections. ASM Press, Washington, DC, pp. 213–242. 39. Pawlowski, Z., Schultz, M.G. (1972) Taeniasis and cysticercosis (Taenia saginata). Advances in Parasitology 10, 269–343. 40. Pawlowski, Z. (1991) Control of Taenia solium taeniasis and cysticercosis by focus oriented chemotherapy of taeniasis. Southeast Asian Journal of Tropical Medicine and Public Health 22, 284–286. 41. The Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the Sierra of Peru. Bulletin of the World Health Organization 71, 223–228. 42. Pawlowski, Z.S. (1990) Perspectives on the control of Taenia solium. Parasitology Today 6, 371–373. 43. Cruz, M., Davis, A., Dixon, H., et al. (1989) Operational studies on the control of Taenia solium taeniasis/cysticercosis in Ecuador. Bulletin of the World Health Organization 67, 401–407. 44. Craig, P.S., Rogan, M.T., Allan, J.C. (1996) Detection, screening and community epidemiology of taeniid cestode zoonoses: cystic echinococcosis, alveolar echinococcosis and neurocysticercosis. Advances in Parasitology 38, 169–250. 45. Centers for Disease Control and Prevention (1993) Recommendations of the International Task Force for Disease Eradication. Mortality and Morbidity Weekly Report 42, 1–27. 46. Fan, P.C. (1988) Taiwan Taenia and taeniasis. Parasitology Today 4, 86–88. 47. Faust, E.C., Russell, P.F., Jung, R.C. (1974) Clinical Parasitology. Lea and Fibiger, Philadelphia, USA.

2

Taenia solium Cysticercosis: New and Revisited Immunological Aspects Ana Flisser, Dolores Correa and Carlton A.W. Evans

Introduction It has taken almost 25 years to unravel and understand some of the characteristics and mechanisms of the immune response elicited against Taenia solium cysticercus within the human host. Some of these are presently quite clear, for instance, the heterogeneity of the humoral immune response, the existence of immune evasive mechanisms and the fact that the immune response can both protect and harm the host, as demonstrated in several studies performed in animals. Others are still at the stage of requiring precise identification, such as the type and interactions of the components of the cellular immune response, with specific reference to cytokines that may play important roles in different stages of the host–parasite relationship. Four different aspects of the immunology of human T. solium cysticercosis are discussed in this chapter: (i) components and characteristics of the immune response; (ii) evasion of the host immune response by the parasites; (iii) neurocysticercosis (NC) and neoplasia; and (iv) protective immunity induced against T. solium.

Components and Characteristics of the Immune Response to T. solium Cysticercosis The immunology of NC is particularly important because of its paradoxical relationship

with disease pathogenesis. Living cysticerci may cause an asymptomatic infection through active evasion and suppression of immunity. Histological studies have shown that both in humans and pigs, live, viable cysticerci have little or no surrounding inflammation. Cysticerci may persist in the human host for long periods of time, often for years without eliciting surrounding host inflammatory reaction. In contrast, the immune mediated inflammation around one or more degenerating cysts may precipitate symptomatic disease. When the parasite begins to involute, either naturally or after treatment with anticysticercal drugs, a surrounding granulomatous inflammatory response develops both in human and porcine infections. Predominant components of this inflammatory response include plasma cells, lymphocytes, eosinophils and macrophages. The latter engulf parasite remnants, eventually leaving a gliotic scar with calcification. Several correlative clinical, neuroimaging, immunological and histopathological studies have amply demonstrated that symptomatic human cysticercosis corresponds to the presence of tissue inflammation around involuting cysticerci that are transiting between the live, viable stage and the calcified stage1–5. The host immunological response to cysticerci is becoming more and more complicated as more knowledge is accumulating. Broadly it can be divided into humoral and cellular components, outlined below.

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

15

16

A. Flisser et al.

Humoral immune response The humoral immune response is better understood than the cellular one. The fact that humans respond immunologically to antigens of T. solium cysticerci is well evident from the number of immunodiagnostic assays that have been developed using different types of antigens6,7. Several immunoglobulin (Ig) classes are produced as specific antibodies against the parasite. The most frequent is IgG, which can be detected in serum, cerebrospinal fluid (CSF) and saliva and suggests that infection is of long duration8–15. An interesting aspect of the humoral immune response is its compartmentalization; there is evidence for local synthesis of specific IgG antibodies within the brain and the presence of a given antibody class in one compartment (i.e. CSF or serum) and its absence in the other compartments11,16–21. Those cases where both CSF and serum samples were obtained from the same patient and were positive only in one, suggest that the blood–brain barrier is not always damaged by the parasite. On the other hand, seemingly there is a correlation between the presence of antibodies and the intensity of infection1. Enzyme-linked immunoelectrotransfer blot (EITB) detected only 28% of cases with a single cysticercus compared with 94% of those with two or more cysts. Furthermore, antibodies were found in most cases that had live or involuting parasites, but only in few cases with calcified cysts, thereby suggesting that the presence of antibodies is influenced by the evolutionary stage of the parasite. Similarly, in pigs, antibody responses were found to

be proportional to the intensity and duration of infection. In human cysticercosis, differences were also found between benign and malignant cysticercosis, for instance, cysticercotic encephalitis is very immunogenic6,9,16. Thus, the humoral immune response in patients with NC is quite heterogeneous. Its heterogeneity is also evident from the number of antigens recognized: patients’ antibodies may react with one to eight antigens in immunoelectrophoresis and up to 30 antigens in EITB3,22,23.

Cellular immune response Some of the earlier studies that evaluated cellular immune responses in hospitalized patients with NC under corticosteroid treatment reported low proliferation of peripheral blood mononuclear cells after stimulation with mitogens and high proportions of CD8+ cells22,24. These initial studies generated the belief that cellular responses were impaired in NC. On the contrary, a recent study that compared immune responses in individuals with active, untreated NC with paired controls, showed that most patients responded adequately to concanavalin A and to cysticercus antigens; also, CD4+ and CD8+ counts were not significantly different from those of controls25. Precise patterns and pathways of the cellular responses in human NC are still under study and until recently, no clear hypothesis was available before demonstration of the Th1/Th2 duality of the T-helper-cell response (Fig. 2.1)26*. Precise molecular mechanisms underlying Th1 and Th2

*T cells are of the following two types: helper (Th, CD3+/CD4+) and cytotoxic (CTL, CD3+/CD8+). The former produce molecules that regulate the immune response, while the latter lyse histocompatible infected or transformed cells (Fig. 2.1). The type of response elicited by Th cells depends on the subtype they transform themselves to after antigen priming, i.e. Th1 or Th2. The two responses are becoming increasingly difficult to understand as knowledge about them accumulates. Nevertheless, it can generally be said that Th1 cells produce cytokines [including tumour necrosis factor- (TNF-) and interferon-gamma (IFN-)] that promote inflammation, macrophage activation, and intracellular destruction of infectious agents; they also stimulate proliferation of CD8+ cells. Thus, this response is primarily ‘cellular’. On the other hand, Th2 cells stimulate most of the antibody responses, as well as granulocyte proliferation, differentiation and chemotaxis. The major cytokines produced by the Th2 cells are interleukin-4 (IL-4), IL-5, IL-10 and IL-13. This type of response is primarily ‘humoral’. Each response reciprocally down-regulates the other, for instance, IFN- stimulates the Th1 response and inhibits Th2, while IL-4 promotes Th2 response and down-regulates Th1 response.

MHC class II

IL-4

Th0 CD4+

IL-12

MHC class I

Fig. 2.1. Diagrammatic overview of the Th1 and Th2 host immune responses.

Antigenpresenting cell (APC)

Antigens

CTL CD8+

Th2 CD4+

T helper cells

Th1 CD4+

CD8+

Cytotoxic cell

B cell

IL-4 IL-5 IL-6 IL-13

TNF- IFN- IL-15

Plasma cell

IgM IgG

Antibodies

Macrophage activation

IgE

IgA

New and Revisited Immunological Aspects 17

18

A. Flisser et al.

immune responses to natural and experimental cysticercosis are yet to be clarified. Studies so far have addressed molecular components in the CSF, serum and the granuloma itself. Increased levels of interleukin (IL)-1 and IL-6 have been reported in CSF of patients with inflammatory NC27. High levels of IL-6 in CSF of patients with subarachnoid NC have also been reported; this possibly represents an acute phase response. In addition, high levels of tumour necrosis factor-alpha (TNF-alpha) have also been noted in CSF of children with active NC28. TNF-alpha was undetectable in controls and children with inactive NC. In asymptomatic humans, a single low dose of the taeniacidal drug praziquantel, given to treat intestinal parasites may cause sufficient damage to latent asymptomatic cysticerci that inflammation and seizures result29. Similarly, full dose anticysticercal therapy administered in heavy infections has precipitated fatal cerebral inflammation30,31. An immunological study of NC patients treated with praziquantel (without major adverse effects) reported elevated soluble IL-2 in the CSF suggesting a Th1-type immune response to therapy, in contrast with the Th2-type immune response found in animal models of viable cysticerci32. It was therefore hypothesized that living cysticerci facilitate immune evasion by inducing a Th2-type immune response until the death of the larval parasite allows a Th1mediated inflammatory response to develop. This model however, is not consistent with some of the other findings listed above and it seems likely that the regulation of immunity in T. solium cysticercosis is a complex phenomenon. Increased levels of eotaxin and IL-5, both eosinophil-selective mediators, have been found in the sera of patients with NC33. These cytokines are involved in recruiting eosinophils locally as well as systemically. Interestingly, in the mouse model of Angiostrongylus cantonensis infection, ablation of IL-5 activity with anti-IL-5 monoclonal antibody resulted in more severe intracranial disease34. Furthermore, the presence of eosinophils as the first attack cells was reported in porcine cysticercosis after

anticysticercal treatment and after vaccination35,36. This suggests that eosinophils may play an important role in the degenerative phase in this parasitic infection. Another study showed that IL-2 was synthesized by the peripheral blood cells of 58% of individuals with untreated, recently diagnosed NC, while interferon- (IFN-), IL-4 and IL-10, were only found in 11%, 10% and 14%, respectively25. Interestingly, only IFN- was increased in the group of patients as compared to controls. The macroscopic disappearance of killed cysticerci takes about 2 months, but the immunological processes that occur within the involuting granulomas are poorly understood. Very few immunohistochemical studies of the inflammatory response within cysticercus granulomas located in the human central nervous system have been performed, mainly due to limited specimen tissue37,38. Available reports suggest an intermixture of Th1 and Th2 responses in human brain cysticercus granulomas. Observations made in animals are of interest in understanding the complex phenomena that occur in granulomas within the central nervous system. Destruction of parasites in the natural intermediate host, the pig, is mediated by a granulomatous eosinophil-rich inflammation (driven by the Th2 response), followed by macrophage/lymphocyte-driven resolution (involving the Th1 response)35. In apparent discordance, a Th1 response prevails in ‘early’ granulomas, that is, when metacestodes are intact in a rodent model of cysticercosis (T. crassiceps in mice)39. In the same model, ‘late’ granulomas, wherein parasite destruction is complete, exhibit a mixture of Th1 and Th2 cytokines (IL-4). It would seem then that if the first antibody–complement phenomenon does not destroy the oncosphere, the latter develops into a metacestode, giving rise to a host–parasite relationship that, while in equilibrium, has a more ‘silent’ Th1-like pattern (i.e. IL-2), with concomitant presence of antibodies mostly of the IgG class. When this equilibrium is broken, a pro-inflammatory granulomatous Th2-like process provokes parasite destruction. This would be followed by resolution of the inflammatory reaction induced by Th1

New and Revisited Immunological Aspects

cytokines (i.e. macrophages/lymphocytes). The change from ‘equilibrium’ to ‘destruction’ has been demonstrated in cysticercal granulomas in naturally infected pigs35,36.

Evasion of Host Immune Responses by Parasites One of the most interesting phenomena in immunoparasitology is the evasion of host immune responses by the parasite. As alluded to earlier, cysticerci are capable of surviving in the human host for several years before their degeneration sets in. Live, viable cysticerci are associated with little surrounding inflammation. This allows for the maintenance of a host–parasite equilibrium as a result of which the parasite is able to survive in the host for long periods of time. The mechanisms underlying this process are complex and may involve the following40–42.

Survival of parasites lodged in ‘immunologically privileged sites’ After a brief period of migration, T. solium oncospheres lodge in host tissues and transform into cysticerci. The site where they settle and the nature of their relationship to the encapsulating host may contribute to sequestration of the parasites from immune attack. The unequal distribution of cysticerci throughout body tissues does not mirror regional blood flow but may result from selective invasion by the parasite or differential survival of larvae in ‘immunologically privileged sites’43. For example, an experimental model of intraocular T. crassiceps cysticercosis, where the parasite is maintained with ease in the anterior chamber of the eye, has demonstrated that there is little inflammatory response to the parasite in that location44. Similarly, experimental chemotherapy studies in pigs showed that parasites lodged within the brain remained alive longer after anticysticercal treatment than those located in the muscles35. These studies indicate that in naive hosts, cysticerci may develop or persist better in the eye and the brain, as compared to other tissues or organs.

19

Masking of cysticercal antigens by host Igs Cysts obtained from brain, eye and muscle of patients with cysticercosis have demonstrable IgG, IgM, IgA and IgE on their surface, while specific antibodies of these classes, except for IgG, have not been detected in the surrounding fluids45. Morphologically intact cysticerci excised from pigs also present host Ig on their surface46. These results suggest that living parasites mask themselves with host Igs, probably through Fc receptors on the surface of the tegument, which could play a role in the process of Ig endocytosis4750.

Concomitant immunity Concomitant immunity refers to protection conferred by already established parasites against newly invading parasites of the same species in a given host. Concomitant immunity may result from ‘shifts’ in the expressed antigens as parasites develop through their life cycle. Hence, during initial infection, cysticerci may be able to counteract immune effector mechanisms that kill less developed forms. Experimental studies in the porcine model of cysticercosis have shown that reinfection following a challenge with T. solium eggs results in the partial destruction of established cysticerci rather than establishment of additional tissue cysts51. This implies that prior infection protects against new infection. It may be surmised that this protective effect results from ‘shifts’ in the antigens expressed by parasites through different stages of their development in the host. Hence, fully developed cysticerci may express different antigens that are able to withstand host immune responses more effectively than developing cysticerci. It is known that after 1 week of infection, the surface of parasites, previously covered by microvilli, changes to microtriches52 and that surface antigens change during development in Hymenolepis nana53. Concomitant immunity may explain the lack of overwhelming cysticercosis in hyperendemic regions, since animals may only be able to acquire cysticercosis for 1 or 2 weeks after primary exposure54.

20

A. Flisser et al.

Parasites may evade immune recognition by synthesizing host-like antigenic determinants. Immunoglobulin G on the surface of T. solium cysticerci does not show specificity for antigens on the cysticercus55. The possibility that it is synthesized by the parasite was tested in vitro by translation of parasitederived messenger-RNA55. Though not adequately proven, molecular mimicry, i.e. synthesis of host-like antigens by the parasite, may be one the mechanisms involved in immune evasion.

and in healthy controls69,70. Also, 17% of 43 patients with glioma but only 3% of 172 controls had NC65. Whether these chromosomal alterations in lymphocytes or increased cytokine synthesis are responsible for the establishment of neoplasia is not clear. Even though, as mentioned in the earlier sections of this chapter, cysticerci do not seem to induce a generalized immune suppression, since patients produce antibodies, inflammatory reaction, and cytokines, have normal white cell counts and generally good state of health and their immune cells respond in vitro to parasite antigens and mitogens.

Suppression or deviation of the host responses

Protective Mechanisms against T. solium Cysticercosis

The presence of anti-complementary activity described long ago suggested that the classical and the alternative pathways of the complement cascade are inhibited by cysticerci56. Paramyosin (previously known as antigen B) was shown to bind and inhibit C1q, the first component of the complement cascade57. Since this antigen is being released by cysticerci and due to the fact that it is recognized by antibodies of most patients with NC, it could have a dual role in immune evasion: inhibition of C1q and deviation of antibodies to host tissues7,11,57,58. There are several reports of the presence of immunosuppressive factors in extracts prepared from metacestodes of various Taenia species, which inhibit proliferation of lymphocytes against mitogens, or the synthesis of IL259–64, that are reviewed by Molinari and Tato in Chapter 3.

Since there are many Taenia species that infect mammals, there are numerous studies in rodents, ovine and bovines which demonstrate that it is possible to acquire protection against cysticercosis by vaccination. In most studies, crude antigens have been obtained from oncospheres, cysticerci or tapeworms59,71. These studies have been relatively easy to perform since the different stages of the parasite (cysticerci and tapeworms) can develop in animals. Various degrees of protection have been reported, living oncospheres and oncospheral antigens being the most effective immunogens59,71. Recombinant proteins and DNA vaccines have yielded high degrees of immunity72–78. The reader is referred to a detailed discussion of this aspect in Chapter 42.

Molecular mimicry

Conclusions NC and Neoplasia A recent analysis of autopsy files suggested that NC might be a risk factor for human cancer, specifically of the lymphoid tissues65–68. Several data support this hypothesis. Chromosome aberrations in peripheral blood lymphocytes are more common in patients with NC and in cysticercotic pigs as compared to those observed in the same cases after anticysticercal treatment

It is known that antibodies and complement are protective against T. solium oncospheres (Fig. 2.2), but if the pace of the host immune response is slow, then the parasites develop mechanisms to evade the latter. As a result, metacestodes establish and antibodies and complement are no longer effective in destroying them. Thus, a race between development of protective immune mechanisms by the host and evasive mechanisms

New and Revisited Immunological Aspects

21

Phase II. Viable cysticerci and concomitant IR. Immune evasion?

5

4

IR

3

Phase III. Resolution. Immunotherapy?

Phase I: Oncosphere and developing immune response (IR). Vaccination?

2

1

0 0

5

10

15

20

Infection time Fig. 2.2. Phases of cysticercosis in relation to immune response. The initial Phase I is characterized by the development of immune mediated protective mechanisms in the host and the differentiation of the oncosphere into a metacestode. Phase II is a period during which the parasite and the host coexist due to the development of immune evasive mechanisms by the parasite. Finally, in Phase III, the host–parasite equilibrium is broken and the parasite is destroyed by an immune reaction that sometimes even damages the host. This final phase leads to resolution of the infection.

by the parasite occurs during the initial period of infection. Subsequently, an equilibrated host–parasite relationship develops that may last for long periods of time and maintains concomitant immunity. The immune response against T. solium cysticerci appears to have both Th1 and Th2 components, although their precise roles remain controversial. Through not yet understood mechanisms, the parasite is killed primarily by eosinophils, which are

probably chemo-attracted to the site by lymphoid cells. It is surmised that this specific response is mediated by Th2 cytokines. Finally, an intense granulomatous type of inflammatory reaction occurs that leads to complete parasite destruction and resolution with fibrosis. This last mechanism is probably of the Th1-type. Thus, it seems that the Th1 and Th2 cytokines play different roles during various stages of the host–parasite relationship.

References 1. Correa, D., Medina-Escutia, E. (1999) Host–parasite immune relationship in Taenia solium taeniosis and cysticercosis. In: García, H.H., Martínez, S.M. (eds) Taenia solium Taeniasis/Cisticercosis, 2nd edn. Editorial Universo, Lima, Perú, pp. 15–24. 2. de Aluja, A., Vargas, G. (1988) The histopathology of porcine cysticercosis. Veterinary Parasitology 28, 65–77. 3. Flisser, A. (1994) Taeniasis and cysticercosis due to Taenia solium. In: Sun, T. (ed) Progress in Clinical Parasitology. CRC Press, Boca Raton, Florida, pp. 77–116. 4. Sciutto, E., Fragoso, G., Fleury, A., et al. (2000) Taenia solium disease in humans and pigs: an ancient parasitosis disease rooted in developing countries and emerging as a major health problem of global dimensions. Microbes and Infection 2, 1875–1890.

22

A. Flisser et al.

5. Willms, K., Sotelo, J. (2001) Cestodes. In: Gillespie, S., Pearson R.D. (eds) Principles and Practice of Clinical Parasitology. John Wiley & Sons, New York, pp. 613–633. 6. Flisser, A., Larralde, C. (1986) Cysticercosis. In: Walls, K.W., Schantz, P.M. (eds) Immunodiagnosis of Parasitic Diseases. Academic Press, New York, pp. 109–161. 7. Flisser, A., Woodhouse, E., Larralde, C. (1980) Human cysticercosis: antigens, antibodies and nonresponders. Clinical and Experimental Immunology 39, 27–37. 8. Grogl, M., Estrada, J.J., MacDonald, G., et al. (1985) Antigen–antibody analyses in neurocysticercosis. Journal of Parasitology 71, 433–442. 9. Cho, S.Y., Kim, S.I., Kang, S.Y., et al. (1986) Evaluation of enzyme-linked immunosorbent assay in serological diagnosis of human neurocysticercosis using paired samples of serum and cerebrospinal fluid. Korean Journal of Parasitology 24, 25–41. 10. Corona, T., Pascoe, D., Gonzalez-Barranco, D., et al. (1986) Anticysticercus antibodies in serum and cerebrospinal fluid in patients with cerebral cysticercosis. Journal of Neurology, Neurosurgery and Psychiatry 49, 1044–1049. 11. Espinoza, B., Ruiz-Palacios, G., Tovar, A., et al. (1986) Characterization by enzyme linked immunosorbent assay of the humoral immune response in patients with neurocysticercosis and its application in immunodiagnosis. Journal of Clinical Microbiology 24, 536–541. 12. Feldman, M., Plancarte, A., Sandoval, M., et al. (1990) Comparison of two assays (EIA and EITB) and two samples (saliva and serum) for the diagnosis of neurocysticercosis. Transactions of the Royal Society of Tropical Medicine and Hygiene 84, 559–562. 13. Zini, D., Farrell, V.J.R., Wadee, A.A. (1990) The relationship of antibody levels to the clinical spectrum of human neurocysticercosis. Journal of Neurology, Neurosurgery and Psychiatry 53, 656–661. 14. Short, J.A., Heiner, D.C., Hsiao, R.L., et al. (1991) Immunoglobulin E and G4 antibodies in cysticercosis. Journal of Clinical Microbiology 28, 1635–1639. 15. Spina-Franca, A., Livramento, J.A. (1982) Cerebrospinal fluid immunology in neurocysticercosis. European Review of Medicine and Pharmacological Science 4, 385–388. 16. Miller, B.L., Heiner, D., Golderg, M.A. (1983) The immunology of cerebral cysticercosis. Bulletin of Clinical Neurosciences 48, 18–23. 17. Pammenter, M.D., Rossouw, E.J., Epstein, S.R. (1987) Diagnosis of neurocysticercosis by enzymelinked immunosorbent assay. South African Medical Journal 71, 512–514. 18. Cho, S.Y., Kim, S.I., Kang, S.Y., et al. (1988) Intracranial synthesis of specific IgG antibody in cerebrospinal fluid of neurocysticercosis patients. Korean Journal of Parasitology 26, 15–26. 19. Correa, D., Plancarte, A., Sandoval, M.A., et al. (1989) Immunodiagnosis of human and porcine cysticercosis. Detection of antibodies and parasite products. Acta Leidensia 57, 93–100. 20. Estañol, B., Juarez, H., Irigoyen, M.C., et al. (1989) Humoral immune response in patients with cerebral parenchymal cysticercosis treated with praziquantel. Journal of Neurology, Neurosurgery and Psychiatry 52, 254–257. 21. Bueno, E.C., Vaz, A.J., Machado, L.R., et al. (2000) Total IgE detection in paired cerebrospinal fluid and serum samples from patients with neurocysticercosis. Revista do Instituto de Medicina Tropical de São Paulo (Sao Pãulo) 42, 67–70. 22. Flisser, A., Rivera, L., Trueba, J., et al. (1982) Immunology of human neurocysticercosis. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 549–563. 23. Larralde, C., Montoya, R.M., Sciutto, E., et al. (1989) Deciphering western blots of tapeworm in antigens. Taenia solium, Echinococcus granulosus and Taenia crassiceps resolving with sera from neurocysticercosis and hydatid disease patients. American Journal of Tropical Medicine and Hygiene 40, 282–290. 24. Correa, D., Tovar, A., Espinoza, B., et al. (1989) Cisticercosis humana: relación inmunológica huésped-parásito. In: Flisser, A., Malagon, F. (eds) Cisticercosis Humana y Porcina. Su Conocimiento e Investigacion en Mexico. Limusa-Noriega, Mexico DF, Mexico, pp. 31–43. 25. Medina-Escutia, E., Morales-López, Z., Proaño, J.V., et al. (2001) Cellular immune response and Th1/Th2 cytokines in human neurocysticercosis: lack of immune suppression. Parasitology 87, 587–590. 26. Mosmann, T.R., Coffman, R.L. (1989) Th1 and Th2 cells: different patterns of lymphokine secretion lead to different functional properties. Annual Review of Immunology 7, 145–173. 27. Ostrosky-Zeichner, L., García-Mendoza, E., Ríos, C., et al. (1996) Humoral and cellular immune response within the subarachnoid space of patients with neurocysticercosis. Archives of Medical Research 27, 513–517.

New and Revisited Immunological Aspects

23

28. Aguilar-Robolledo, F., Cedillo-Rivera, R., Llaguno-Violante, P., et al. (2001) Interleukin levels in cerebrospinal fluid from children with neurocysticercosis. American Journal of Tropical Medicine and Hygiene 64, 35–40. 29. Flisser, A., Madrazo, I., Plancarte, A., et al. (1993) Neurological symptoms in occult neurocysticercosis after a single taeniacidal dose of praziquantel. Lancet 342, 748. 30. Wadia, N., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis: new observations, including CT scan findings and experience with treatment by praziquantel. Brain 111, 597–614. 31. Takayanagui, O.M., Chimelli, L.L. (1998) Disseminated muscular cysticercosis with myositis induced by praziquantel therapy. American Journal of Tropical Medicine and Hygiene 59, 1002–1003. 32. Cruz-Revilla, C., Rosas, G., Fragoso, G., et al. (2000) Taenia crassiceps cysticercosis: protective effect and immune response elicited by DNA immunization. Journal of Parasitology 86, 67–74. 33. Evans, C.A.W., García, H.H., Hartnell, A., et al. (1998) Elevated concentration of eotaxin and interleukin-5 in human neurocysticercosis. Infections and Immunity 66, 4522–4525. 34. Sasaki, O., Suguya, H., Ishida, K., et al. (1993) Ablation of eosinophils with anti IL-5 antibody enhances the survival of intracranial worms of Angiostrongylus cantonensis in the mouse. Parasite Immunology 15, 349–354. 35. Flisser, A., Gonzalez, D., Skhurovich, M., et al. (1990) Praziquantel treatment of porcine brain and muscle Taenia solium cysticercosis. 1. Radiological, physiological and histopathological studies. Parasitology Research 76, 263–269. 36. Molinari, J.L., Meza, R., Suarez, B., et al. (1983) Taenia solium: immunity in hogs to the cysticercus. Experimental Parasitology 55, 340–357. 37. Restrepo, B., Llaguno, P., Sandoval, M.A., et al. (1998) Analysis of immune lesions in neurocysticercosis patients: central nervous system response to helminth appears Th1-like instead of Th2. Journal of Neuroimmunology 89, 64–72. 38. Restrepo, B.I., Alvarez, J.I., Castano, L.F., et al. (2001) Brain granulomas in neurocysticercosis are associated with a Th1 and Th2 profile. Infections and Immunity 69, 4554–4560. 39. Robinson, P., Altamar, R., Lewis, D., et al. (1997) Granuloma cytokines in murine cysticercosis. Infections and Immunity 65, 2925–2931. 40. Mitchell, G.F. (1982) Genetic variation in resistance of mice to Taenia taeniaeformis: analysis of hostprotective immunity and immune evasion. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 575–584. 41. Flisser, A. (1989) Taenia solium cysticercosis: some mechanisms of parasite survival in immunocompetent hosts. Acta Leidensia 57, 259–263. 42. White, A.C. Jr, Robinson, P., Kuhn, R. (1997) Taenia solium cysticercosis: host–parasite interaction and the immune response. Clinical Immunology 66, 209–230. 43. Barker, C.F., Billingham, R.E. (1977) Immunologically privileged sites. In: Kunkel, H.G., Dixon, F.J. (eds) Advances in Immunology, Vol. 25. Academic Press, New York, pp. 1–54. 44. Cárdenas, F., Plancarte, A., Quiroz, H., et al. (1989) Taenia crassiceps: experimental model of intraocular cysticercosis. Experimental Parasitology 69, 324–329. 45. Correa, D., Dalma, D., Espinoza, B., et al. (1985) Heterogeneity of humoral immune components in human cysticercosis. Journal of Parasitology 71, 535–541. 46. Willms, K., Arcos, L. (1977) Taenia solium: host serum proteins on the cysticercus surface identified by an ultrastructural immuno-enzyme technique. Experimental Parasitology 43, 396–401. 47. Mandujano, A., Vela, M., Alcántara, P., et al. (1990) Presence of a receptor for the Fc fraction of IgG in Taenia solium (Abstract). Bulletin de la Societie de la Socièté Française Parasitologie 8 (Suppl. 1), 578. 48. Kalinna, B., MacManus, D.P. (1993) An IgG (Fc gamma)-binding protein of Taenia crassiceps (Cestoda) exhibits sequence homology and antigenic similarity with schistosome paramyosin. Parasitology 106, 289–296. 49. Hayunga, E.G., Sumner, M.P., Letonja, T. (1989) Evidence of selective incorporation of host immunoglobulin by strobilocerci of Taenia taeniaeformis. Journal of Parasitology 75, 638–642. 50. Ambrosio, J., Landa, A., Merchant, M.T., et al. (1994) Protein uptake by cysticerci of Taenia crassiceps. Archives of Medical Research 25, 325–330. 51. Herbert, I.V., Oberg, C. (1974) Cysticercosis in pigs due to infection with Taenia solium Linnaeus, 1758. In: Soulsby, E.J.L. (ed.) Parasitic Zoonosis. Academic Press, New York, pp. 199–211. 52. Williams, J.F., Engelkirk, P.G., Lindsay, M.C. (1982) Mechanisms of immunity in rodent cysticercosis. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 621–631. 53. Ito, A., Onitake, K. (1987) Changes in surface antigens of Hymenolepis nana during differentiation and maturation in mice. Journal of Helminthology 61, 129–136.

24

A. Flisser et al.

54. Gemmell, M.A. (1972) Hydatidosis and cysticercosis 4. Acquired resistance to Taenia hydatigena under conditions of a strong infection pressure. Australian Veterinary Journal 48, 26–28. 55. Willms, K., Arcos, L. (1997) Taenia solium cysticercosis: host–parasite interactions and the immune response. Clinical Immunology 66, 209–230. 56. Hammemberg, B., Williams, J.F. (1978) Physico-chemical characterization of complement-interacting factors from Taenia taeniaeformis. Journal of Immunology 120, 1039–1045. 57. Laclette, J.P., Shoemaker, C., Richter, D., et al. (1992) Paramyosin inhibits complement C1. Journal of Immunology 148, 124–128. 58. Laclette, J.P., Merchant, M.T., Willms, K. (1987) Histological and ultrastructural localization of antigen B in the metacestode of Taenia solium. Journal of Parasitology 73, 121–125. 59. Flisser, A., Pérez-Montford, R., Larralde, C. (1979) The immunology of human and animal cysticercosis: a review. Bulletin of the World Health Organization 57, 839–856. 60. Burger, C.J., Rikihisa, Y., Lin, Y.C. (1986) Taenia taeniaeformis inhibition of mitogen induced proliferation and interleukin-2 production in rat splenocytes by larval in vitro products. Experimental Parasitology 62, 216–222. 61. Molinari, J.L., Tato, P., Reynoso, O.A., et al. (1990) Depressive effect of a Taenia solium cysticercus factor on cultured human lymphocytes stimulated with phytohemaglutinin. Annals of Tropical Medicine and Parasitology 84, 205–208. 62. Sciutto, E., Fragoso, G., Baca, M., et al. (1995) Depressed T cell proliferation associated with susceptibility to experimental infection with Taenia crassiceps infection. Infections and Immunology 63, 2277–2281. 63. Tato, P., Castro, A.M., Rodríguez, D., et al. (1995) Suppression of murine lymphocyte proliferation induced by a small RNA purified from the Taenia solium metacestode. Parasitology Research 81, 181–187. 64. Arechavaleta, F., Molinari, J.L., Tato, P. (1998) A Taenia solium metacestode factor non-specifically inhibits cytokine production. Parasitology Research 84, 117–122. 65. Del Brutto, O.H., Castillo, P.R., Mena, I.X., et al. (1997) Neurocysticercosis among patients with cerebral glioma. Archives of Neurology 54, 1125–1128. 66. Herrera, L.A., Benita-Bordes, A., Sotelo, J., et al. (1999) Possible relationship between neurocysticercosis and hematological malignancies. Archives of Medical Research 30, 154–158. 67. Herrera, L.A., Ostrosky-Wegman, P. (2001) Do helminths play a role in carcinogenesis? Trends in Parasitology 17, 172–175. 68. Herrera, L.A., Ramírez, T., Rodríguez, U., et al. (2000) Possible association between Taenia solium cysticercosis and cancer: increased frequency of DNA damage in peripheral lymphocytes from neurocysticercosis patients. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 1–5. 69. Montero, R., Flisser, A., Madrazo, I., et al. (1994) Mutation at the HPRT locus in patients with neurocysticercosis treated with praziquantel. Mutation Research 305, 181–188. 70. Flisser, A., González, D., Plancarte, A., et al. (1990) Praziquantel treatment of brain and muscle porcine Taenia solium cysticercosis. 2. Immunological and cytogenetic studies. Parasitology Research 76, 640–642. 71. Lightowlers, M.W. (1994) Vaccination against animal parasites. Veterinary Parasitology 54, 177–204. 72. Johnson, K.S., Harrison, G.B.L., Lightowlers, M.W., et al. (1989) Vaccination against ovine cysticercosis using a defined recombinant antigen. Nature 338, 585–587. 73. Mitchel, G.F. (1990) Vaccines and vaccination strategies against helminths. In: Agabian, N., Cerami, A. (eds) Parasites. Molecular Biology, Drug and Vaccine Design, Wiley-Liss Publications, New York, pp. 349–363. 74. Harrison, G.B.L., Heath, D.D., Dempster, R.P., et al. (1996) Identification and cDNA cloning of two novel low molecular weight host-protective antigens from Taenia ovis oncospheres. International Journal of Parasitology 26, 195–204. 75. Lightowlers, M.W., Rolfe, R., Gaucci, C.G. (1996) Taenia saginata: vaccination against cysticercosis in cattle with recombinant oncosphere antigens. Experimental Parasitology 84, 330–338. 76. Rosas, G., Cruz-Revilla, G., Fragoso, G., et al. (1998) Taenia crassiceps cysticercosis: humoral immune response and protection elicited by DNA immunization. Journal of Parasitology 84, 516–523. 77. Plancarte, A., Flisser, A., Gaucci, C.G., Lightowlers, M.W. (1999) Vaccination against Taenia solium cysticercosis in pigs using native and recombinant oncosphere antigens. International Journal for Parasitology 29, 643–647. 78. Flisser, A., Lightowlers, M.W. (2000) Vaccination against Taenia solium cysticercosis. Memorias do Instituto Oswaldo Cruz 96, 353–356.

3

Molecular Determinants of Host–Parasite Interactions: Focus on Parasite José L. Molinari and Patricia Tato

The relationship between helminths and their hosts is complex and interesting. It is well known that parasites elicit immunological responses in their hosts. What is less well known and appreciated, is that parasites have evolved numerous ways of evading the consequences of host immunological response. The net outcome is that parasites frequently survive for long periods in fully immunocompetent hosts. Host lymphocytes and their cytokines play a crucial role in determining the outcome of parasitic infection (reviewed in Chapter 2). In this chapter, we review certain aspects of the host–parasite interaction in Taenia solium cysticercosis with special emphasis on parasite related factors.

been studied. An idea of the process can be obtained from studies involving other helminths. For instance, Hymenolepis nana oncospheres make use of certain proteases in addition to three pairs of hooks in order to invade host tissues1. Similarly, serine protease activity and excretory–secretory peptidases have been isolated from penetration glands of oncospheres of H. diminuta and T. saginata, respectively2,3. It is held that these enzymes participate in tissue invasion in addition to performing nutritional functions. Finally, T. solium egg infection induces humoral immunological responses in human hosts. This assumption is based on evidence from in vitro studies, where serum from cysticercotic individuals destroys oncospheres in presence of complement4.

Host–oncosphere interactions

Host–metacestode interactions

Ingestion of food or water contaminated with T. solium eggs is the most preliminary step in the development of human cysticercosis. Hatched and activated oncospheres penetrate intestinal tissues, perforate small intestinal blood vessels, and reach the bloodstream. Here, they passively migrate and finally lodge in target tissues and develop into metacestodes. Specific mechanisms underlying T. solium oncosphere penetration have not

Host inflammatory response directed against T. solium metacestodes is a major determinant of clinical symptoms and signs of NC. There is great variability in its onset, duration and severity. The seminal study by Dixon and Lipscomb has established that metacestodes remain in host tissues in a viable, non-degenerate state for variable and prolonged periods of time5. Eventually, usually after 4–5 years, local and systemic immune responses against

Introduction

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

25

26

J.L. Molinari and P. Tato

metacestodes develop. As a result, metacestodes pass through a series of degenerativeevolutionary stages that are described in detail in Chapters 30 and 32. Clinical symptoms and signs owe their appearance and evolution to the host immune responses. Furthermore, histological studies corroborate the relationship between the evolutionary stages of metacestodes and host immune response. In both humans and pigs, live and viable metacestodes are surrounded by only discrete inflammatory reaction6,7. In comparison, studies on pigs pre-immunized with cysticercus antigens have revealed intense granulomatous inflammation surrounding the metacestodes8. These clinical, histological and experimental observations have led several workers including ourselves, to postulate that live T. solium metacestodes are able to down-modulate host immune responses by virtue of producing certain specific molecules. Several such molecules have been previously described9–11. Taenia metacestodes modulate complement function by sulphated polysaccharides that activate and consume complement9. Among other molecules, taeniaestatin inhibits both classic and alternative complement pathways and paramyosin inhibits C1q activation10,11.

Metacestode Factor (MF) Studies evaluating peripheral blood T cells in naturally and experimentally infected cysticercotic pigs, have consistently revealed diminution of CD4+ cell counts in proportion to parasite loads12,13. We postulated that Tcell suppression in cysticercotic pigs might be related to substances secreted by T. solium metacestodes. Similarly, low molecular weight isolates from Schistosoma mansoni and Onchocerca gibsoni have previously been reported to induce depression of (3H) thymidine uptake by lymphocytes stimulated with Concanavalin-A (Con-A)14,15.

Isolation and preliminary characterization A method to isolate substances of molecular weight less than 3500 Dalton from super-

natants of live T. solium metacestodes was designed. The isolate was tested at different doses in human lymphocyte cultures, stimulated with phytohaemagglutinin and was found to suppress (3H) thymidine uptake by lymphocytes. The suppression was forestalled by pre-digestion with ribonuclease (RNase), suggesting that the active molecule may be a RNA fraction16. A suppression of (3H) thymidine uptake has also been demonstrated in T lymphocytes from naturally infected-cysticercotic pigs17. The material that suppresses (3H) thymidine uptake was assigned the name, metacestode factor (MF). We proceeded to study its effects in vivo. Mice were inoculated with MF (four doses of 100 g per mouse) and challenged with one LD50 of Salmonella typhimurium virulent bacilli18. Mice were either treated with S. typhimurium antigen alone or MF alone, or with S. typhimurium antigens and MF in combination. A control group consisted of mice inoculated with saline solution. We observed that mice treated with MF alone, or with both S. typhimurium antigens and MF, died faster and in greater number than control mice. In contrast, all mice survived in the group that was given S. typhimurium antigens alone. When batches of MF were filtered through a Bio-gel P-6 column, two peaks (F1 and F2) were obtained. Further, F1 and F2 were tested in proliferation assays19. While, F1 induced a dose-dependent suppressive effect, F2 induced an increase of the (3H) thymidine uptake elicited by mitogen. Thereafter, an attempt was made to characterize F1 by treating it with several inactivating factors such as RNase, proteases and heat. After treatment, F1 was tested again in proliferation assays. RNase-treated F1 lost its suppressive effect. In contrast, trypsin and papain augmented (3H) thymidine uptake inhibition. Chymotrypsin or heat had no effect. Finally, the effect of F1 was studied in co-cultures of murine macrophages and lymphocytes. It was shown that macrophages pre-incubated with F1 and subsequently cocultured with fresh lymphocytes did not affect (3H) thymidine uptake. In contrast, incorporation of (3H) thymidine by fresh lymphocytes co-cultured with lymphocytes

Molecular Determinants of Host–Parasite Interactions

pre-incubated with F1 was inhibited. This study provided specific evidence for the probable existence of a RNA molecule, F1, whose principal site of action was shown to be the lymphocyte.

Effect on local inflammatory reactions In vivo studies further examined the effects of MF on the inflammatory reaction around implanted metacestodes in mice20. Female BALB/c syngeneic mice were divided into four groups based upon the following experimental protocol. One group of mice was treated with 100 g of MF (one dose every 96 h for 12 days). A second group consisted of mice inoculated with metacestode antigens (100 g as a single dose) alone, while a third group was constituted by mice that were first inoculated with metacestode antigens and then treated with MF. In the fourth (control) group, mice were inoculated with inert normal saline alone. Subsequently, mice in all four groups were implanted with live T. solium metacestodes (six metacestodes/mouse), obtained from cysticercotic pig meat under sterile conditions. Twelve days after the metacestode implantation, the mice were killed. Histopathological studies revealed that: 1. Metacestodes implanted in control mice were completely destroyed and their remnants were surrounded by an intense inflammatory reaction predominantly made up of neutrophils and eosinophils. 2. In metacestodes of mice that were treated with MF alone, there were clearly identifiable and intact suckers, rostellum, tegument and hooks. Few neutrophils, plasma cells, lymphocytes and histiocytes were noted in spiral canals; eosinophils were not observed. 3. Metacestodes implanted in mice immunized with metacestode antigens alone were completely destroyed; their caseous remnants were intensely surrounded and infiltrated by neutrophils and eosinophils. 4. Finally, in mice immunized with metacestode antigens and subsequently treated with MF, there were clearly identifiable (albeit necrotic) rostellum, suckers,

27

parenchymal tissues and tegument; the hooks were dispersed in necrotic tissue. Moderate inflammatory reaction surrounded the metacestodes. Local inflammatory responses were also evaluated using scanning electron microscopy in the experimental protocol outlined above21. Samples from metacestodes removed at 6 and 12 days post-implantation were studied. At 6 days post-implantation, it was found that: 1. In control mice, metacestodes were disintegrated and covered by an intense inflammatory reaction (Fig. 3.1a). 2. Metacestodes removed from mice treated with MF alone were intact and exhibited a scarce inflammation on the bladder tegument (Fig. 3.1b). 3. An evaginated metacestode removed from a mouse inoculated with metacestode antigen alone displayed inflammatory reaction on its scolex. Inflammatory cells were disseminated on the double crown of hooks, suckers and the neck tegument; whereas the bladder wall tegument was covered by a dense net of fibrous material embedding numerous inflammatory cells. 4. Metacestodes removed from mice immunized with metacestode antigens and subsequently treated with MF exhibited few inflammatory cells on their bladder wall teguments. At 12 days post-implantation: 1. Metacestodes removed from control mice were completely enmeshed in an intense inflammatory reaction, with a dense collagen-like matrix embedding numerous inflammatory cells and covering the whole bladder wall tegument. 2. The inflammatory reaction surrounding metacestodes removed from mice treated with MF alone was more intense than that observed on day 6. In one partially evaginated metacestode, the scolex was apparently intact, with minimal amount of inflammatory infiltrate in the folds of its neck. At higher magnification ( 1500), the microtriches were visibly intact with scarce inflammatory cells and eosinophil like-granules.

28

J.L. Molinari and P. Tato

Fig. 3.1a. Scanning electron micrograph of a Taenia solium metacestode removed from a control mouse at day 6. (Reproduced with permission from reference 21.) (ST, subtegument; T, tegument.)

Fig. 3.1b. Scanning electron micrograph of a metacestode removed from a MF-treated mouse at day 6. (Reproduced with permission from reference 21.)

3. Metacestodes from mice immunized with metacestode antigens exhibited much stronger inflammatory reactions on the scolex tegument in comparison to day-6. Copious inflammatory infiltrate was visible surrounding the tegument of an evaginated scolex (Fig. 3.2). Ruptures of different size and depth were evident in the tegument and sub-tegumental suckers. At higher magnification ( 1500), an intense accumulation of

different kinds of white cells, cell debris and fibrinoid material was apparent. 4. In mice immunized with metacestode antigen and treated subsequently with MF, the inflammatory reaction on the bladder wall tegument was less extensive in comparison to immunized (with metacestode antigens) or control groups. Very few inflammatory cells, cell debris and fibrous material were found adherent to intact microtriches.

Molecular Determinants of Host–Parasite Interactions

29

Fig. 3.2. Scanning electron micrograph of an evaginated scolex removed from an immunized mouse at day 12. An intense inflammatory reaction completely covers the scolex tegument. Note the large cell aggregates and several ruptures of the sucker and rostellum teguments. (Reproduced with permission from reference 21.)

Effects on humoral and cellular immune responses Humoral and cellular immune responses to inoculation with metacestode antigens, treatment with MF and metacestode implantation were also studied in the experimental model outlined above. Sera from mice immunized with metacestode antigens and treated with MF showed a significant decrease in antibody titres compared with those of mice treated with metacestode antigens alone. Metacestode implantation further suppressed antibody responses to metacestode antigens. Antibody titres were least in sera of implanted mice treated with MF alone (Fig. 3.3). A suppressive effect of MF was also noted on cellular immune functions. Splenic lymphocytes from mice immunized with metacestode antigens and treated with MF exhibited a significant decrease in (3H) thymidine uptake in comparison with lymphocytes from mice inoculated with metacestode antigens alone (Fig. 3.4)20.

were measured in culture supernatants in order to study the effects of MF on cytokine production22. When cultured with MF, cells showed significantly decreased production of interleukin 2 (IL-2), interferon- (IFN-), and interleukin 4 (IL-4) as compared to mitogen alone. Exogenous recombinant IL-2 and recombinant IL-4 largely restored proliferation responses (85% and 71% of control cells, respectively). MF also inhibited the production of tumour necrosis factor-alpha (TNFalpha) by macrophages stimulated with lipopolysaccharide and IFN-. The results of the above study provide additional evidence of an inhibitory effect of MF upon cytokine production, regardless of the cell type or cytokine (Fig. 3.5). It may be surmised that impairment, specifically of IL-2 and IFN- production may underlie modulatory influences of MF of the nature noted in experiments with metacestodes implanted in mice.

Metacestode Proteases Effects on cytokines Murine spleen cells were stimulated in vitro with Con-A and cytokine concentrations

There is sufficient evidence for the existence of several parasitic secretory proteases. The latter are believed to be involved in invasion, nutrition and immune evasion23–25. White et

30

J.L. Molinari and P. Tato

1.4 1.2 1.0 A (492)

0.8 0.6 0.4 0.2 0 0

100

200

300

400

500

600

700

800

900 1000

Dilutions I IFM

IF C

IM

Fig. 3.3. Antibody titres determined by ELISA in sera from mice inoculated with Taenia solium metacestode antigens (I), inoculated with metacestode antigens plus MF (IF), inoculated with metacestode antigens and implanted with six metacestodes (IM), inoculated with metacestode antigens plus MF and implanted with six metacestodes (IFM), and inoculated with saline (C). Data are expressed as mean values  SE for each treatment (n = 4) (P0.05 for I versus IF, IM or IFM). (Reproduced with permission from reference 20.)

10,000

(3H) Thymidine uptake cpm

9000 8000 7000 6000 5000 4000 3000 2000 1000 0 C

CM

I

IF

F

IM

IMF

MF

Fig. 3.4. Effect of Taenia solium metacestode antigens on the proliferation of murine splenic lymphocytes from the following groups of mice: (C) control; (CM) implanted with six metacestodes; (I) inoculated with metacestode antigens; (IF) inoculated with metacestode antigens plus MF; (F) inoculated with MF; (IM) inoculated with metacestode antigens and implanted with six metacestodes; (IMF) inoculated with metacestode antigens plus MF and implanted with six metacestodes; and (MF) inoculated with MF and implanted with six metacestodes. Bars represent mean values  SE for thymidine uptake by cells stimulated with 1 g of metacestode antigens (P0.05 for I and IM versus IF, IMF, CM or C). (Reproduced with permission from reference 20.)

Molecular Determinants of Host–Parasite Interactions

(a)

(b) 25 IFN- concentration (ng ml–1)

IL-2 concentration (U ml–1)

150

100

50

C–

C+

10

15

5

20

(c)

C–

C+

10

20

C–

C+

10

20

(d) 5 TNF- concentration (ng ml–1)

50 IL-4 concentration (U ml–1)

31

30

10

C–

C+

10

20

MF (g)

3

1

MF (g)

Fig. 3.5. Effect of Taenia solium MF on the production of cytokines. IL-2, IFN- and IL-4 were measured in supernatants of mouse spleen cells treated with 10 and 20 g of MF (measured as ribose) and stimulated with Con-A. TNF-alpha was detected in supernatants of murine macrophage line (IC-21) treated with 10 and 20 g of MF and stimulated with lipopolysaccharide and recombinant IFN-. C are the cytokine concentrations from cells incubated in RPMI medium; C+ are the cytokine values from cells stimulated with Con-A or lipopolysaccharide/recombinant IFN-. (Reproduced with permission from reference 22.)

al., described cysteine, metallo- and serine protease activities in acid extracts from lyophilized T. solium metacestodes. The authors reported IgG digestion by the extracts in vitro26. We postulated that immunoglobulin molecules behaved as target substrates and molecular nutrients for T. solium proteases. Supernatants of live metacestode cultures were evaluated for protease activity on peptide substrates with T cell surface proteins27. Substantial cysteine protease activity in addition to metallo- and serine protease activities was found. Isolated human lymphocytes from volunteers were co-cultured with live

T. solium metacestodes (96% viability) at 37°C for 2 h. Cells were separated, washed and stained with monoclonal antibodies, antiCD4 FITC (fluoresceinated) and anti-CD8 PE (phycoerythrinated). Flow cytometric analysis revealed significant decrease in CD4+ expression (Fig. 3.6). The cause and effect relationship between protease activity and decrease in CD4 expression was demonstrated when human lymphocytes were cultured with metacestode excretory–secretory products in presence of L-cysteine, a reducing substance. Cells were washed and stained and analysed by flow cytometry. Metacestode excretory–

32

J.L. Molinari and P. Tato

102 103 FL1-H

104

103 102

FL2-H

100

100

100 101

c

101

102

FL2-H

103

b

101

102

FL2-H

103

a

101

CD8

100

R1 : 5685 104

R1 : 2210 104

104

R1 : 8467

100

101

102 103 FL1-H

104

100

101

102 103 FL1-H

104

CD4 Fig. 3.6. Flow cytometry analysis of human T cells co-cultured with 100 Taenia solium metacestodes after cells were separated and stained with monoclonal antibody fluoresceinated anti-human CD4 and phycoerythrinated anti-human CD8. (a) Control cells in RPMI 1640 medium without metacestodes. (b) Cells co-cultured for 2 hours with 100 metacestodes. (c) Cells co-cultured for 2 hours with 100 metacestodes and 100 g of rabbit antiserum to metacestode excretory-secretory products. Values are expressed as gated percentages of CD8+and CD4+cells. (Reproduced with permission from reference 27.)

secretory products pre-incubated with E-64 (a specific inhibitor of cysteine protease) served as control material. A significant decrease in CD4 expression, attributable to cysteine protease activity was again demonstrated. Furthermore, treatment with E-64 resulted in the reversion of the inhibitory effect on CD4 expression.

Conclusions T. solium metacestodes exert a modulatory influence on host immunological responses through several molecular agents. MF, a 3500 Da RNA-like molecule is most significant in this regard. It inhibits humoral and cellular immune responses as well as inflammatory reaction around implanted metacestodes in mice. It has also been shown to

inhibit cytokine, particularly IFN- and IL-2, and to a lesser degree IL-4 production in vitro. Live metacestodes also secrete cysteine, metallo- and serine proteases. Cysteine protease activity significantly depletes CD4+ cells in vitro. The elucidation of these molecules and of their actions in experimental conditions have provided insights into the mechanisms by which T. solium metacestodes evade host immunological attack and are able to survive for long periods of time.

Acknowledgements This work was supported by grants from National Council of Science and Technology (Mexico) 23672-M, and National Autonomous University of Mexico. Authors thank Dr. Rodolfo Paredes for photographic material.

References 1. Miyasato, T., Furukawa, T., Inoue, M., et al. (1977) Electron microscopic observations on the penetration of oncospheres of Hymenolepis nana into the intestine of the mouse. Acta Medica Kinki University 2, 1–18. 2. Moczon, T. (1996) A serine proteinase in the penetration glands of the hexacants of Hymenolepis diminuta (Cestoda, Cyclophyllidea). Parasitology Research 82, 67–71. 3. White, A.C. Jr, Baig, S., Robinson, P. (1996) Taenia saginata oncosphere excretory/secretory peptidases. Journal of Parasitology 82, 7–10.

Molecular Determinants of Host–Parasite Interactions

33

4. Molinari, J.L., Tato, P., Lara, A.R., et al. (1993) Effects of serum from neurocysticercosis patients on the structure and viability of Taenia solium oncospheres. Journal of Parasitology 79, 124–127. 5. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis. An analysis and follow-up of 450 cases. Medical Research Council Special Reports Series. Her Majesty’s Stationery Office, London, 299, 1–56. 6. Marquez, H. (1971) Cysticercosis. In: Marcial, R. (ed.) Pathology of Protozoal and Helminth Diseases. Williams and Wilkins, Baltimore, Maryland, pp. 592–617. 7. Hernandez, J.P.A., Marquez, M.H., Sastre, O.S. (1973) Cysticercosis of the central nervous system in hogs. American Journal of Veterinary Research 34, 451–453. 8. Molinari, J.L., Meza, R., Suarez, B., et al. (1983) Taenia solium: immunity in hogs to the cysticercus. Experimental Parasitology 55, 340–357. 9. Hammerberg, B., William, J.F. (1978) Interaction between Taenia taeniaeformis and the complement system. Journal of Immunology 120, 1033–1038. 10. Suquet, C., Green, E.C., Leid, R.W. (1984) Isolation and partial characterization of a Taenia taeniaeformis metacestode proteinase inhibitor. International Journal of Parasitology 14, 165–172. 11. Laclette, J.P., Shoemaker, C.B., Richter, D., et al. (1992) Paramyosin inhibits complement C1. Journal of Immunology 148, 124–128. 12. Tato, P., Valles, Y., Rolon, R., et al. (1987) Effect of the immunization on immunodepressed hogs, infected naturally by Cysticercus cellulosae. Revista LatinoAmericana de Microbiologia (México) 29, 67–71. 13. Molinari, J.L., Tato, P., Valles, Y. (1987) Immunodepression of T lymphocytes in hogs modulated by Cysticercus cellulosae. Revista LatinoAmericana de Microbiologia (México) 29, 293–300. 14. Dessaint, J.P., Camus, D., Fisher, E., et al. (1977) Inhibition of lymphocyte proliferation by factor(s) produced by Schistosoma mansoni. European Journal of Immunology 7, 624–629. 15. Yin, F.D., Nowak, M., Copeman, B., et al. (1983) A low molecular weight immunosuppressive factor produced by Onchocerca gibsoni. Veterinary Immunology and Parasitology 4, 445–451. 16. Molinari, J.L., Tato, P., Reynoso, O.A., et al. (1990) Depressive effect of a Taenia solium cysticercus factor on cultured human lymphocytes stimulated with phytohemagglutinin. Annals of Tropical Medicine and Parasitology 84, 205–208. 17. Molinari, J.L., Soto, R., Tato, P., et al. (1993) Immunization against porcine cysticercosis in an endemic area in Mexico: a field and laboratory study. American Journal of Tropical Medicine and Hygiene 49, 502–512. 18. Molinari, J.L., Tato, P., Reynoso, O.A., et al. (1989) Modulation effects on mice response to a Salmonella typhimurium infection by a Taenia solium cysticerci product of low molecular weight. Revista LatinoAmericana de Microbiologia (México) 31, 327–333. 19. Tato, P., Castro, A.M., Rodriguez, D., et al. (1995) Suppression of murine lymphocyte proliferation induced by a small RNA purified from Taenia solium metacestodes. Parasitology Research 81, 181–187. 20. Tato, P., White, A.C. Jr, Willms, K., et al. (1996) Immunosuppression and inhibition of inflammation in mice induced by a small Taenia solium RNA-peptide to implanted T. solium metacestodes. Parasitology Research 82, 590–597. 21. Molinari, J.L., Tato, P., Rodriguez, D., et al. (1998) Impairment of the inflammatory reaction on implanted Taenia solium metacestodes in mice by a T. solium RNA-peptide: a scanning electron microscopy study. Parasitology Research 84, 173–180. 22. Arechavaleta, F., Molinari, J.L., Tato, P. (1998) A Taenia solium metacestode factor nonspecifically inhibits cytokine production. Parasitology Research 84, 117–122. 23. McKerrow, J.H., Jones, P., Sage, H., et al. (1985) Proteinases from invasive larvae of the trematode parasite Schistosoma mansoni degrade connective tissue and basement membrane macromolecules. Biochemical Journal 231, 47–51. 24. Hotez, P.J., Trang, N.L., McKerrow, J.H., et al. (1985) Isolation and characterization of a proteolytic enzyme from the adult Ancylostoma caninum. Journal of Biological Chemistry 260, 7343–7348. 25. Chappel, C.L., Dresden, M.H. (1986) Schistosoma mansoni: proteinase activity of ‘hemoglobinase’ from the digestive tracts of adult worms. Experimental Parasitology 61, 160–167. 26. White, A.C. Jr, Molinari, J.L., Pillai, A.V., et al. (1992) Detection and preliminary characterization of Taenia solium metacestode proteases. Journal of Parasitology 78, 281–287. 27. Molinari, J.L., Mejia, H., Clinton, A.C. Jr, et al. (2000) Taenia solium: a cysteine protease secreted by metacestodes depletes human CD4 lymphocytes in vitro. Experimental Parasitology 94, 133–142.

4

Animal Models of Taenia solium Cysticercosis: Role in Understanding Host–Parasite Interactions Astrid E. Cardona and Judy M. Teale

Introduction An important outcome of initial clinical studies of neurocysticercosis (NC) was the realization that the brain is not only affected by the presence of metacestodes, but more significantly by the inflammatory response and its sequelae1–3. In the human central nervous system (CNS), host responses to Taenia solium cysticerci range from complete absence, to severe inflammatory reaction4. In most cases, viable parasites have little surrounding inflammation5, which correlates with an asymptomatic stage of NC. In contrast, virtually all cases of symptomatic disease are characterized by prominent immunological responses in host nervous tissue6–9. The reader is referred to Chapter 2 for an overview of host immune responses to cysticercosis. Besides the host immune response, the location, stage, number and the immunomodulatory effects of the metacestodes (reviewed in Chapter 3) also contribute to disease outcome. However, the extent of contribution of these factors and how such factors influence each other is still not clear. It is difficult to segregate and study each of the factors individually in humans. Given the large number of variables involved, the lack of predictability of their interactions in human hosts and complexity of the host immune system at cellular and subcellular

levels, animal models are critical to furthering our knowledge of the host–parasite relationship. Furthermore, animal models are useful in the study of other factors associated with disease acquisition, e.g. genetic factors both in relation to the host (see Chapter 6)10,11and parasite and in the development of novel therapeutic agents and schemes (see Chapter 15). The development of animal models to study T. solium infection has been an arduous task. The earliest experience with animal models was studies exploring immunological mechanisms of resistance to larval cestodes in mice and rats infected with Taenia taeniaeformis12,13. These studies elucidated components of the peripheral response to T. taeniaeformis and found that antibodies and complement were implicated in host defence mechanisms12,13.

Animal Models for Adult T. solium Several mammals have been evaluated as experimental models of adult T. solium. The oral route of infection with T. solium cysticerci obtained from infected pigs has been employed in these models14. In young dogs, tapeworms survived only for 8 days. Mice, albino rats and guinea pigs were not susceptible to T. solium infection. Rhesus monkeys, cats and rabbits did not prove to be useful models14. In contrast, in gerbils and golden

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

35

36

A.E. Cardona and J.M. Teale

hamsters (Mesocricetus auratus), tapeworms developed and exhibited greater sexual development, though mature and infectious oncospheres were not produced14–16. Cysternal infection with scolex and membranes from T. solium cysticerci resulted in an intense granulomatous inflammatory response consisting of lymphocytes in rabbits17. Interestingly, the most successful hosts to date for adult T. solium tapeworms are chinchillas (Chinchillidae family of rodents), in which larvae develop into gravid proglottides, eventually producing infective oncospheres. Infectivity of eggs obtained from the chinchilla model was demonstrated in pigs. Metacestodes were found in pig skeletal muscle, 12 weeks after oral infection with gravid proglottides recovered from chinchillas14. Immunosuppressive treatment with steroids (prednisolone and methyl prednisolone) facilitates the establishment and development of adult T. solium and a related cestode, T. crassiceps in experimental host intestine14,18. The basis of the facilitatory effect of steroid treatment presumably relates to suppression of local mucosal inflammatory responses to worm attachment19. When T cells were depleted in vivo in Mongolian gerbils (Meriones unguiculatus) infected with T. crassiceps ova, only destrobilated adult worms were harvested in the faeces20. This indicated that T cells in some way prevented strobilar attachment to enteral mucosa. A similar effect was observed in prednisolonetreated gerbils, arguably due to an effect of prednisolone upon T cells20. The development of an experimental model that allows the recovery of T. solium eggs is likely to have a significant impact upon future research. Eggs will be available for antigen cloning, analysis and purification. Further application of the chinchilla model will be valuable in the areas of vaccine design and host–adult parasite interactions.

pigs are the natural intermediate host of the helminth. Most researchers employing this model so far have used naturally infected pigs21,22, although experimentally induced infections have also been studied (see also Chapter 15)23. The number of T. solium eggs required for inducing experimental infection varied between 1000 and 380,00023. The porcine model has provided information related to progression of the parasitosis in liver, muscles and lungs. In parallel to human CNS infections, histological studies in this model revealed the presence of immature, mature, degenerate and calcified cysts in pig liver and muscle22,24. As yet, a detailed analysis of the specific immunological elements has not been described in the porcine model. A major area of application of porcine models has been the development of treatment strategies to control porcine cysticercosis with the ultimate goal of preventing human infection. Two of the drugs that are currently used for treatment of human cysticercosis, albendazole and praziquantel, have been used in several different protocols to determine their efficacy for treatment of porcine cysticercosis21, 22, 25, 26. Another drug, oxfendazole has been found effective in controlling swine cysticercosis (reviewed in Chapter 43)27. These studies together with the epidemiological studies are important for the development of interventions to eradicate T. solium infection28,29. However, the scarcity of infected pigs in non-endemic areas, and the difficulty in obtaining T. solium eggs have limited the widespread use of the porcine model. Moreover, there are difficulties in handling pigs, and a high cost of support is involved. Therefore, other animal species have been used to develop experimental models for cysticercosis using related parasites.

Experimental intraocular cysticercosis

Animal Models for Cysticercosis T. solium cysticercosis in pigs Porcine cysticercosis is a successful experimental model for T. solium cysticercosis, as

The eye is an immunologically privileged site. T. crassiceps metacestodes have also been used in experimental models of intraocular/ intravitreous cysticercosis in rabbits30,31. Living T. crassiceps cysticerci in the vitreous cavity produced ocular lesions with an

Animal Models of T. solium Cysticercosis

intense inflammatory response in those rabbits that had been previously infected through the intraperitoneal route or had been inoculated with cysticercus antigen30,31. A granulomatous response comprising eosinophils and polymorphonuclear cells was noted. Naive rabbits and steroid treated rabbits did not exhibit inflammatory ocular lesions30,31. These models are significant in the understanding of immune reactions specifically involved in the intraocular compartment as well as the treatment of ocular cysticercosis.

T. crassiceps experimental cysticercosis Two related cestode parasites, T. crassiceps and Mesocestoides corti have been used extensively as animal models of cysticercosis. Their metacestodes are infectious to mice, and the larval stages of these parasites are easily maintained in the peritoneal cavity of infected mice32,33. Intraperitoneal injection of either organism results in invasion of liver and peritoneum. Intraperitoneal inoculation, however, does not produce CNS lesions, a major drawback of initial investigations with these models. Recently, however, infection with either organism was accomplished in the brain, thereby facilitating the study of infective mechanisms specific to the CNS34. T. crassiceps has a canine definitive host and a rodent intermediate host32,35. In natural infections, the larval form invades several tissues including the peritoneal cavity of the rodent. In BALB/c mice, chronic infection with T. crassiceps induced host immunosuppression. Analysis of the temporal course of the immune response in mice inoculated intraperitoneally with T. crassiceps, revealed a time dependent variation in the intensity of Th1 and Th2 type responses (see Chapter 2 for an overview of the Th1 and Th2 responses)36–38. In the early stages of infection when few or no parasites could be recovered from the peritoneal cavity, mice exhibited a strong Th1 type of immunological response characterized by high interferon- (IFN-) production, IgG2a dominated antibody response and delayed type hypersensitivity (DTH). Late in infection,

37

production of interleukin-2 (IL-2) and IFN- decreased and DTH was depressed, while IL-4, IL-10, IgG2b and IgG1 production was up-regulated. These results suggest that there is a shift from an initial parasite-restrictive, Th1-type based response to a later parasite-permissive, Th2 response. While the early response suppresses infection by metacestodes, the latter allows establishment and growth of T. crassiceps metacestodes in murine hosts36,38. Analyses of the immunological response around peritoneal granulomas formed 3–14 weeks after infection indicate that early granulomas are predominantly associated with a Th1-type response, whereas later granulomas, in which parasite destruction is complete, have a mixture of Th1- and Th2type responses39. These data suggest that dying parasites can no longer modulate host immunological responses. The Th1 granulomatous response is likely to be involved in the pathogenesis of symptomatic human infection in which active inflammation is a major cause of disease. As the parasite is destroyed, the response shifts to involve greater Th2-type cytokine expression, perhaps as a means of down-regulating inflammation39. Interestingly, it was demonstrated that subcutaneous inoculation with larvae induces protection against subsequent intraperitoneal challenge. Parasite destruction was associated with adherence of host cells to the tegument of larvae. The crucial effector population of host cells involved in parasite death is not known40. The T. crassiceps animal model has also been used to investigate mechanisms of immunological regulation that the parasite can exhibit in the host. T. crassiceps larvae release factors that are capable of down-regulating both proliferative responses of and cytokine production by T cells41. These parasite factors were found to down-regulate production of IFN- and IL-4 by mitogen stimulated spleen cells41. This inhibitory effect was caused by excretory–secretory products from the larvae in the early stages of infection. In contrast, excretory–secretory products from larvae harvested late in infection were not suppressive40. Future studies will be critical to elucidate immuno-

38

A.E. Cardona and J.M. Teale

logical mechanisms involved in larval destruction by the host and immunomodulatory mechanisms by which the parasite persists in the host. A major outcome of the development of the mouse–T. crassiceps, host–parasite model has been the recognition of several host factors that influence infection by metacestodes. The sex specific behaviour of the cestode is an outstanding example of one such host factor. In mouse models, T. crassiceps parasitize female mice in preference to male mice in large numbers following intraperitoneal inoculation42. Gonadectomy was found to increase parasite population in male mice but had an opposite effect in female mice42,43. Replacement with 17 -oestradiol favours parasite proliferation in host mice, an effect that is more prominent in male mice44. The sex specific behaviours are not observed in irradiated or neonatally thymectomized mice suggesting that sex hormones interact with the immune system in order to favour or suppress infection43,45. It has been surmised that oestrogens inhibit immune mechanisms and are thereby permissive to T. crassiceps proliferation in mice. The sex-related differences in rate and intensity of establishment described above are evident in the early stages of T. crassiceps infection in mice. In chronically parasitized mice, the parasite establishes itself in large numbers in male mice as well. The effect of chronic T. crassiceps infection on sexual behaviour and related morphological and biochemical parameters is of interest. Chronic infection results in inhibition of sexual responses in male mice, gonadal atrophy in male mice and hypertrophy in female mice and an overwhelming increase of plasma oestradiol levels and corresponding reduction in plasma testosterone levels in male mice46,47. Likewise, an increase in the expression of genes and enzymes associated with oestrogen synthesis has been noted in male mice48,49. Recently, it was demonstrated that the parasite could utilize sex hormone precursors from the host to synthesize sex hormones required for its own development and sustenance50. Another example of host factors involved in T. crassiceps infection is influence of the

human leukocyte antigen system10,11. Expression of the Qa-2, non-classic Class I major histocompatibility complex antigen was associated with resistance to T. crassiceps infection in BALB/cAnN mice10. An understanding of such protective genetic factors is likely to have an impact upon the development of genetically engineered animals, which are inherently resistant to cysticercosis, a novel strategy for its prevention and control.

Mesocestoides corti experimental cysticercosis Similar to T. crassiceps, intraperitoneal injection of the larval stage of the metacestode parasite, M. corti results in chronic infection in mice33,51,52. In nature, M. corti ova are believed to be ingested by terrestrial arthropods. An intermediate host such as the mouse or lizard then consumes the arthropod, where upon the oncosphere develops into the mature larva or metacestode53. Upon ingestion of the intermediate host by a carnivorous mammal such as dog, cat or skunk, a mature intestinal tapeworm develops releasing eggs and perpetuating the life cycle. M. corti infected mice develop splenomegaly and hepatomegaly, with encystment of the organism in the liver33,51,52.

Animal Models for Neurocysticercosis To study the immunological response in the brain during NC, we have developed a mouse model using M. corti and T. crassiceps metacestodes. Due to lack of CNS involvement in intraperitoneally infected mice, intracranial inoculation of the metacestodes was used to analyse immunological responses in CNS. This model has allowed us to follow the kinetics of immunological response in brain. With a view to parallel human disease, metacestodes were injected intracranially, avoiding penetration of brain parenchyma. Mice were sacrificed at different time points after

Animal Models of T. solium Cysticercosis

infection34. The associated pathological and immunological responses in the brain were analysed using haematoxylin and eosin staining (Fig. 4.1) and in situ immunohistochemistry of brain cryosections34.

39

M. corti metacestodes were found to be highly invasive. They infiltrated ventricles, subarachnoid spaces and brain parenchyma within days (Fig. 4.2). Pathological studies revealed presence of lesions with active

Fig. 4.1. Haematoxylin and eosin staining of a brain cryosection, 10 m in thickness. Mesocestoides corti metacestode is present in parenchyma associated with small inflammatory infiltrate shown by the long arrow. The short arrow demarcates a parasite in a lateral ventricle.

100

Percentage of parasites

80 P 60 EP 40

20

0 2 days

1

3

5

10

16

Time p.i (weeks)

Fig. 4.2. Distribution of Mesocestoides corti larvae in the brain of BALB/c mice. Haematoxylin and eosin stained sections from infected mouse brains were analysed for the presence and location of larva. Parasites were counted and classified as P (parenchymal) or EP (extraparenchymal, i.e. located in ventricle, subarachnoid space or meninges). Each data point represents the average of three mice.

40

A.E. Cardona and J.M. Teale

necrosis in brain parenchyma (Fig. 4.3). An accumulation of inflammatory cells in the ventricles and meninges was noted (Fig. 4.4). Massive accumulation of gamma/delta T lymphocytes, macrophages, and to a lesser extent, dendritic cells, NK cells, mast cells and B cells was observed (Fig. 4.5). A Th1 pathway of cytokine expression was observed in the brain after M. corti infection with high levels of IL-2, IL-12, IL-15 and IFN- (Fig. 4.6). Importantly, Th2-related cytokines (IL-10 and IL-13) were either undetectable or found in very low levels (IL-4). Interestingly, gamma/delta T lymphocytes were found in the CNS by 2 days postinfection. These cells co-localized to areas where Th1 cytokines were detected34. The immunological response in the CNS in mice infected with T. crassiceps was similar with the exception that this organism was

larger and fewer organisms were able to penetrate brain parenchyma. In the mouse model, infection of CNS appears to induce initially an innate type of immunological response evidenced by the presence of neutrophils, macrophages and natural killer cells. By 3 days postinfection, an early-induced response develops with the added participation of large numbers of gamma/delta T cells. By 7 days postinfection, an adaptive immunological response is evident with parasite specific T and B cells. The immunological response that develops in mouse brain has been evaluated in both infected BALB/c and C57BL/6 mice. Little difference was found in the type of the cellular and cytokine response in the CNS in these two strains of mice. This is of interest since these two strains often differ dramatically in their response to infectious organisms such as Leishmania54,55.

(a)

(a)

(b)

(b)

Fig. 4.3. Haematoxylin and eosin staining reveal the presence of areas of active necrosis. (a) Hanks balanced salt solution inoculated mice do not reveal pathology showing normal parenchymal tissue. (b) The parasite (P) is associated with active areas of necrosis lacking cellularity (magnification: 150).

Fig. 4.4. Intense inflammatory response associated with parasite (P) in ventricle (a) and subarachnoid space (b) (magnification 150 in (a) and 100 in (b)).

Animal Models of T. solium Cysticercosis

41

4

Number of cells

3

2

1

0 2 days

5 days

1 Time p.i (weeks)

5

13

  CD19 Fig. 4.5. Immunological response in the brain after Mesocestoides corti infection. Two mouse brains obtained after intracranial inoculation with M. corti metacestodes were analysed by immunohistochemistry for the presence of various cell types. Cells in the extraparenchymal regions were counted, and the score given represents: 1–100 cells (1), 100–300 cells (2), 300–500 cells (3). The results represent the average of two mice.

4

Number of cells

3 2 1 0 2 days

5 days

1

5

13

Time p.i (weeks) IL-12 IL-4 Fig. 4.6. Predominance of a Th1 pathway of cytokine response in the brain after Mesocestoides corti infection. Results of immunohistochemical staining for IL-12 and IL-4 are shown. Cells were counted and scores given as described in Fig. 4.5. The results represent the average of two mice.

Data from the mouse model are consistent with previous reports of the cellular immunological responses in human brain.

Macrophages, NK cells and pro-inflammatory cytokines predominate with little or no detection of eosinophils, mast cells and IL-4

42

A.E. Cardona and J.M. Teale

production8. Within the brain, host responses to the parasite appears to be of Th1 inflammatory type in contrast to the Th2 response which is a characteristic response to helminths in peripheral extraneural tissue. However, as disease progresses with granuloma formation, a mixed Th1 and Th2 response is likely. The presence of gamma/delta T cells in large numbers predicts their important role in NC. In lymphoid tissues, gamma/delta T cells represent a minor proportion of T cells and their specific functions are uncertain56,57. We hypothesized that gamma/delta T cells play important immunoregulatory functions by producing cytokines that modulate the development of inflammatory response in CNS. Further studies in the animal model may improve our understanding of the role of this T cell subset in the human disease. The interactions between immunological cells and resident brain cells in the mouse model are of interest with specific reference to T cells. A question that needs to be answered is which antigens may be activating the gamma/delta T cell response? Previous studies have indicated that M. corti secretes a number of molecules when propagated in vitro58,59.

Two of these molecules are temperatureinduced heat shock proteins (hsps) of the hsp70 and hsp60 families58. Since gamma/delta T cells might be able to recognize whole proteins in an antibody-like manner60,61, M. corti hsps have a potential role in the development of an inflammatory response in the CNS. Furthermore, phospholipids have been found to induce specific expansion of human gamma/delta T cells62–64. Future studies with M. corti lipids may help define the mechanism by which the parasite induces an inflammatory response in the brain.

Conclusions Animal models contribute to the areas of parasite biology and immunology and are valuable for the recognition of new mechanisms involved in the host–parasite relationship during cestode infection. These models, and the data obtained from human studies will be critical for the understanding of the progression of the disease in the human host. The animal models hitherto described have been instrumental in the understanding of host–parasite interactions involved in NC.

References 1. Dixon, H., Lipscomb, F.M. (1991) Cysticercosis: an analysis and follow up of 450 cases. Medical Research Council Special Report Series. Her Majesty’s Stationery Office, London, 299, pp. 1–58. 2. Wiederholt, W.C., Grisiola, J.S. (1982) Cysticercosis: an old scourge revisited. Archives of Neurology 39, 533–535. 3. Shandera, W.X., White, A.C. Jr, Chen, J.C., et al. (1994) Neurocysticercosis in Houston, Texas: a report of 112 cases. Medicine 73, 37–52. 4. Ostrosky-Zeichner, P., Garcia-Mendoza, E., Rios, C., et al. (1996) Humoral and cellular immunological response within the subarachnoid space of patients with neurocysticercosis. Archives of Medical Research 27, 513–517. 5. White, A.C. Jr (2000) Neurocysticercosis: updates on epidemiology, pathogenesis, diagnosis, and management. Annual Review of Medicine 51, 187–206. 6. Cecilia, R. (1983) Clinical aspects, pathology and treatment of human cysticercosis. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 179–199. 7. Correa, D., Dalma, D., Espinoca, B. (1985) Heterogeneity of humoral immunological components in human cysticercosis. Journal of Parasitology 71, 535–541. 8. Restrepo, B.I., Llaguno, P., Sandoval, M.A., et al. (1998) Analysis of immunological lesions in neurocysticercosis patients: central nervous system response to helminth appears Th1-like instead of Th2. Journal of Neuroimmunology 89, 64–72. 9. Grewal, J.S., Kaur, S., Bhatti, G., et al. (2000) Cellular immunological responses in human neurocysticercosis. Parasitology Research 86, 500–503.

Animal Models of T. solium Cysticercosis

43

10. Frogoso, G., Lamoyi, E., Mellor, A., et al. (1996) Genetic control of susceptibility to Taenia crassiceps cysticercosis. Parasitology 112, 119–124. 11. Frogoso, G., Lamoyi, E., Mellor, A., et al. (1998) Increased resistance to Taenia crassiceps murine cysticercosis in Qa-2 transgenic mice. Infection and Immunity 66, 760–764. 12. Rickard, M., Williams, J. (1982) Hydatidosis/cysticercosis: immunological mechanisms and immunization against infection. Advances in Parasitology 21, 229–296. 13. Lloyd, S. (1987) Cysticercosis. In: Soulsby, E.J.L. (ed.) Immunological Responses to Parasite Infections, Vol. 2. CRC Press, Boca Raton, Florida, pp. 183–212. 14. Maravilla, P., Avila, G., Cabrera, V., et al. (1998) Comparative development of Taenia solium experimental models. Journal of Parasitology 84, 882–886. 15. Merchant, M.T., Aguilar, L., Avila, G., et al. (1998) Taenia solium: description of intestinal implantation sites in experimental hamster infections. Journal of Parasitology 84, 681–985. 16. Allan, J.C., Garcia-Dominguez, Craig, P.S., et al. (1991) Sexual development of Taenia solium in hamsters. Annals of Tropical Medicine and Parasitology 85, 473–477. 17. Garcia de Llano, C.A., Mateos, J.H., Rivas, A. (1989) Reacción inflamatoria en la neurocisticercosis estudio experimental en conejo. Archivos de Investigacion Medica (Mexico) 20, 61–68. 18. Sato, H., Oku, Y., Rausch, R.L., et al. (1993) Establishment and survival of the strobilar stage of Taenia crassiceps in hamsters, gerbils, and mice, with reference to different helminth isolates. Parasitology Research 79, 619–623. 19. Sato, H., Kamiya, H., Oku, Y., et al. (1994) Infection course of the strobilar stage of Taenia crassiceps in golden hamsters, with reference to host responses. Parasitology Research 80, 99–103. 20. Sato, H., Ihama, Y., Kamiya, H. (2000) Survival of destrobilated adults of Taenia crassiceps in T-celldepleted Mongolian gerbils. Parasitology Research 86, 284–289. 21. Flisser, A., Gonzalez, D., Shkurovich, M., et al. (1990) Praziquantel treatment of porcine brain and muscle Taenia solium cysticercosis. Parasitology Research 76, 263–269. 22. Flisser, A., Gonzalez, D., Plancarte, A., et al. (1990) Praziquantel treatment of brain and muscle porcine Taenia solium cysticercosis 2. Immunological and cytogenetics studies. Parasitology Research 76, 640–642. 23. Fan, P.C., Chung, W.C., Lin, C.Y., et al. (1990) The pig as an intermediate host for Taiwan Taenia infection. Journal of Helminthology 64, 223–231. 24. Kaur, M., Joshi, K., Ganguly, R., et al. (1995) Evaluation of the efficacy of albendazol against the larvae of Taenia solium in experimentally infected pigs, and kinetics of the immunological response. International Journal of Parasitology 25, 1443–1450. 25. Torres, A., Plancarte, A., Villalobos, A.N.M., et al. (1992) Praziquantel treatment of porcine brain and muscle Taenia solium cysticercosis 3. Effect of 1-day treatment. Parasitology Research 78, 161–164. 26. Gonzales, A.E., García, H.H., Gilman, R.H., et al. (1995) Treatment of porcine cysticercosis with albendazol. American Journal of Tropical Medicine and Hygiene 53, 571–574. 27. Gonzalez, A.E., Falcon, N., Gavidia, C., et al. (1998) Time–response curve of oxfendazole in the treatment of swine cysticercosis. American Journal of Tropical Medicine and Hygiene 59, 832–836. 28. Evans, C., Gonzales, A.E., Gilman, R.H., et al. (1997) Immunotherapy for porcine cysticercosis: implications for prevention of human disease. American Journal of Tropical Medicine and Hygiene 56, 33–37. 29. Gilman, R.H., García, H.H., Gonzales, A.E., et al. (1999) Short cuts to development: methods to control the transmission of cysticercosis in developing countries. In: García, H.H., Martinez, S.M. (eds) Taenia solium Taeniosis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 313–326. 30. Cardenas, F., Plancarte, A., Quiroz, H., et al. (1989) Taenia crassiceps: experimental model of intraocular cysticercosis. Experimental Parasitology 69, 324. 31. Santos, A., Paczka, J.A., Jimenez-Sierra, J.M., et al. (1996) Experimental intravitreous cysticercosis. Graefe’s Archives of Clinical and Experimental Ophthalmology 234, 515–520. 32. Freeman, R.S. (1962) Studies on the biology of Taenia crassiceps. Canadian Journal of Zoology 40, 969–971. 33. Mitchell, G.F., Machalonis, J.J., Smith, P.M., et al. (1977) Studies on immunological responses to larval cestodes in mice. Immunoglobulins associated with the larvae of Mesocestoides corti. Australian Journal of Experimental Biology and Medical Science 55, 187–211. 34. Cardona, A.E., Restrepo, B.I., Jaramillo, J.M., et al. (1999) Development of an animal model for neurocysticercosis: immunological response in the central nervous system is characterized by a predominance of gamma/delta T cells. Journal of Immunology 162, 995–1002.

44

A.E. Cardona and J.M. Teale

35. Smyth, J.D. (1994) Introduction to Animal Parasitology. Cambridge University Press, New York, 1189 pp. 36. Terrazas, L.I., Bojalil, R., Govezensky, T., et al. (1998) Shift from an early protective Th1-type immunological response to a late permissive Th2-type response in murine cysticercosis (Taenia crassiceps). Journal of Parasitology 84, 74–81. 37. Villa, O.F., Kuhn, R.E. (1996) Mice infected with the larvae of Taenia crassiceps exhibit a Th2-like immunological response with concomitant anergy and downregulation of Th1-associated phenomena. Parasitology 112, 561–570. 38. Toenjes, S.A., Spolski, R.J., Mooney, K.A., et al. (1999) The systemic immunological response of BALB/c mice infected with larval Taenia crassiceps is a mixed Th1/Th2-type response. Parasitology 118, 623–633. 39. Robinson, P., Atmar, R.L., Lewis, D.E., et al. (1997) Granuloma cytokines in murine cysticercosis. Infection and Immunity 65, 2925–2931. 40. Mooney, K.A., Spolski, R.J., See, E.J., et al. (2000) Immunological destruction of larval Taenia crassiceps in mice. Infection and Immunity 68, 2393–2401. 41. Spolski, R.J., Corson, J., Thomas, P.G., et al. (2000) Parasite secreted products regulate the host response to larval Taenia crassiceps. Parasite Immunity 22, 297–305. 42. Garcia Tamayo, F., Terrazas Valdez, L.I. (1992) Immune response to parasitic infection in mice without seminal vesicles. Archives of Medical Research 23, 149–150. 43. Huerta, L., Terrazas, L.I., Sciutto, E., et al. (1992) Immunological mediation of gonadal effects on experimental murine cysticercosis caused by Taenia crassiceps metacestodes. Journal of Parasitology 78, 471–476. 44. Terrazas, L.I., Bojalil, R., Govezensky, T., et al. (1994) A role for 17-BETA-estradiol in immunoendocrine regulation of murine cysticercosis (Taenia crassiceps). Journal of Parasitology 80, 563–568. 45. Bojalil, R., Terrazas, L.I., Govezensky, T., et al. (1993) Thymus-related cellular immune mechanisms in sex-associated resistance to experimental murine cysticercosis (Taenia crassiceps). Journal of Parasitology 79, 384–489. 46. Larralde, C., Morales, J., Terrazas, L.I., et al. (1995) Sex hormone changes induced by the parasite lead to feminization of the male host in murine Taenia crassiceps cysticercosis. Journal of Steroid Biochemistry and Molecular Biology 52, 575–580. 47. Morales, J., Larralde, C., Arteaga, M., et al. (1996) Inhibition of sexual behaviour in male mice infected with Taenia crassiceps cysticerci. Journal of Parasitology 82, 689–693. 48. Morales-Montor, J., Rodriguez-Dorantes, M., Mendoza-Rodriguez, C.A., et al. (1998) Differential expression of the estrogen-regulated proto-oncogenes c-fos, c-jun, and bc1–2 and of the tumorsuppressor p53 gene in the male mouse chronically infected with Taenia crassiceps cysticerci. Parasitology Research 84, 616–622. 49. Morales-Montor, J., Rodriguez-Dorantes, M., Cerbon, M.A. (1999) Modified expression of steroid 5 alpha-reductase as well as aromatase, but not cholesterol side-chain cleavage enzyme, in the reproductive system of male mice during (Taenia crassiceps) cysticercosis. Parasitology Research 85, 393–398. 50. Gomez, Y., Valdez, R.A., Larralde, C., et al. (2000) Sex steroids and parasitism: Taenia crassiceps cysticercus metabolizes exogenous androstenedione to testosterone in vitro. Journal of Steroid Biochemistry and Molecular Biology 74, 143–147. 51. Johnson, G.W., Nicholas, D., Metcalf, D., et al. (1979) Peritoneal cell population of mice infected with Mesocestoides corti as a source of eosinophils. International Archives of Immunology 59, 315–317. 52. Chapman, C.P., Knopf, P., Hicks, J., et al. (1979) IgG1 hypergammaglobulinemia in chronic parasitic infections in mice: magnitude of the response in mice infected with various parasites. Australian Journal of Experimental Biology and Medical Science 57, 369–372. 53. Novak, M. (1972) Quantitative studies on the growth and multiplication of tetrathyridia of Mesocestoides corti (Hoeppli, 1925) (Cestoda: Cyclophyllidia) in rodents. Canadian Journal of Zoology 50, 1189–1199. 54. Heinzel, F., Sadick, M., Holaday, B., et al. (1989) Reciprocal expression of interferon-gamma or interleukin 4 during the resolution or progression of murine leishmaniasis. Evidence for the expansion of distinct helper T cell subsets. Journal of Experimental Medicine 169, 59–72. 55. Heinzel, F., Sadick, M., Mutha, S., et al. (1991) Production of interferon-gamma, interleukin 2, interleukin 4, and interleukin 10 by CD4+ lymphocytes in vivo during healing and progressive murine leishmaniasis. Proceedings of the National Academy of Sciences USA 88, 7011–7015. 56. Haas, W., Pereira, P., Tonegawa, S. (1993) Gamma/delta cells. Annual Review of Immunology 11, 637–685.

Animal Models of T. solium Cysticercosis

45

57. Modlin, R.L., Pirmez, C., Horman, F.M., et al. (1989) Lymphocytes bearing antigen-specific gamma/delta T cell receptors accumulate in human infectious disease lesions. Nature 339, 8–12. 58. Estes, D.M., Teale, J.M. (1991) Biochemical and functional analysis of extracellular stress proteins of Mesocestoides corti. Journal of Immunology 147, 3926–3934. 59. Teale, J.M., Abraham, K.M. (1987) Regulation of antibody class expression. Immunology Today 138, 1699–1672. 60. Li, H., Lebedeva, M.I., Llera, A.S., et al. (1998) Structure of the Vdelta domain of the human gamma/delta T-cell receptor. Nature 391, 502–506. 61. Groh, V., Steinle, A., Bauer, S., et al. (1998) Recognition of stress-induced MHC molecules by intestinal epithelial gamma/delta T cells. Science 279, 1737–1739. 62. Morita, C., Beckman, E., Bukowski, J., et al. (1995) Direct presentation of nonpeptide prenyl pyrophosphate antigens to human gamma/delta T cells. Immunity 3, 495–507. 63. Tanaka, Y., Morita, C., Nieves, E., et al. (1995) Natural and synthetic non-peptide antigens recognized by human gamma/delta T cells. Nature 375, 155–158. 64. Tanaka, Y., Sano, S., Nieves, E., et al. (1994) Nonpeptide ligands for human gamma/delta T cells. Proceedings of the National Academy of Sciences USA 91, 8175–8179.

5

Mitochondrial DNA of Taenia solium: From Basic to Applied Science

Akira Ito, Minoru Nakao, Munehiro Okamoto, Yasuhito Sako and Hiroshi Yamasaki

Introduction The mitochondrial genome has been sequenced and its variations have been established in humans and several other animal and plant species. Little is, however, known about mitochondrial DNA (mtDNA) of the parasitic flatworms, cestodes and trematodes1–4. While the study of human mitochondrial genome has led to the understanding of genetic basis of a wide range of diseases, a similar study in flatworms has important bearing upon three different areas of knowledge. First, variations in the mitochondrial genome of different species have been utilized for deducing phylogenic relationships and studying evolutionary sequences among different members of a phylum5–8. Secondly, the study of taeniid mtDNA has been useful in speciation as well as in elucidating similarities and differences between individual species. A good example has been the utilization of knowledge of mtDNA structure in establishing the status of a novel taeniid, Taenia saginata asiatica (see below). Finally, it could also provide insights into epidemiological aspects of pathogenicity and zoogeography of individual flatworms. Here, we review intra-species variations in relation to geographical location and molecular evolution of T. solium and their implications for the understanding of its pathogenicity and epidemiology.

Comparative Studies of mtDNA in T. solium, T. saginata and T. saginata asiatica Figure 5.1 depicts the molecular phylogeny of major cestodes. Taenia solium and T. saginata are well known cosmopolitan human tapeworms. In addition, a third taeniid, the Asian Taenia has been recognized lately. There is a high prevalence of this taeniid among aboriginal inhabitants of several East and Southeast Asian countries, including Korea, Taiwan, China, Malaysia, Thailand, Philippines and the Samosir Island of North Sumatra, Indonesia9–13. The Asian Taenia bears similarities to, and is different from both T. solium and T. saginata. It resembles the latter in morphology. However, a major distinguishing feature from T. saginata on one hand and a similarity to T. solium on the other hand is its utilization of swine and not cattle as intermediate hosts. However, it is not clear whether humans can also serve as intermediate hosts to Asian Taenia. Indeed, if human transmission were possible, cases of neurocysticercosis (NC) would abound in countries of East Asia. Fortunately, this is not the case. Two major factors account for the non-pathogenic nature of the Asian Taenia. Firstly, its metacestodes are far smaller in comparison to those of T. solium,

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

47

48

A. Ito et al.

E. multilocularis

1000

E. granulosus LrRNA gene (377–387 bp)

T. hydatigena T. solium 956 1000

T. saginata T. asiatica

T. crassiceps T. pisiformis T. taeniaeformis

0.02

H. diminuta 669 986

H. nana H. microstoma M. corti M. expansa D. caninum 1000

D. latum D. ditremum

F. hepatica Fig. 5.1. A neighbour-joining phylogenic tree of 17 cestodes based on the sequences of partial LrRNA genes. Bootstrap values more than 500 are shown in the tree. The trematode, Fasciola hepatica served as an outgroup. The cestodes examined were Echinococcus multilocularis, E. granulosus, Taenia hydatigena, T. solium, T. saginata, T. asiatica, T. crassiceps, T. pisiformis, T. taeniaeformis, Hymenolepis diminuta, H. nana, H. microstoma, Mesocestoides corti, Moniezia expansa, Dipylidium caninum, Diphyllobothrium latum and D. ditremum.

a factor that may affect its potential to produce neurological symptoms. However, we have shown that larvae of the Asian Taenia can develop to 10 mm or larger in diameter in non-obese diabetic-severe combined immunodeficiency (NOD-SCID) mice14. Secondly, while T. solium is neuro- and myotropic, the Asian Taenia is hepato- and viscero-tropic. In other words, in swine and possibly in humans, metacestodes of the latter are primarily found in the liver and viscera and not in the brain and muscles, as is the case with T. solium. Given the above background, controversy exists with regard to speciation of Asian Taenia

(T. asiatica vs. variant of T. saginata (T. saginata asiatica)),9–11 and also with reference to its potential to cause human cysticercosis12,13. Mitochondrial DNA analysis15–18 and comparative studies of morphology and development of metacestodes of each species in experimental animal models14,19–23 have provided preliminary insights into differences in the biological behaviour of the three human taeniids. Both suggest that the Asian Taenia is highly homologous to T. saginata, and although there are biological differences between the two9,14, T. asiatica should not be classified as a new species but rather a subspecies of T. saginata, i.e., T. saginata asiatica16–18,23.

Mitochondrial DNA of T. solium

Taenia solium mtDNA The structure of the mtDNA in T. solium and a related cestode, Echinococcus multilocularis has been recently established using polymerase chain reaction-amplification and nucleotide sequencing. Between the two species, there are minor variations in the size of the mitochondrial genome (13,709 bp in the case of T. solium and 13,738 bp for E. multilocularis) (M. Nakao et al., Asahikawa, unpublished observations). The heavy chains of the mtDNA of each have 12 genes encoding proteins, two ribosomal RNA (rRNA) genes and 22 transfer RNA (tRNA) genes (Fig. 5.2).

Gene order within mtDNA Gene sequences constituting mitochondrial genomes of various animal phyla are diagrammatically depicted in Fig. 5.3. From the

49

illustration, it is clear that the gene arrangement in the T. solium mitochondrion is highly unique and differs from nematodes as well as other animal phyla. In studies performed on cestodes and trematodes, this unique arrangement has been found to be highly conserved24,35.

Initiating and stop codons The earliest breakthrough in the study of mtDNA of the phylum Platyhelminthes was the determination of the sequence and codon assignments of a 3.5 kb mtDNA segment of the trematode, Fasciola hepatica25–27,35. Bessho et al.27 partially sequenced the cytochrome c oxidase subunit I (COI) gene of mtDNA of the planaria, Dugesia japonica and proposed a unique genetic code for planarian mtDNA. The codon assignments of trematode and planarian are nearly similar except that the

Fig. 5.2. The mitochondrial genome of Taenia solium. Arrows indicate the direction of transcription (COI–III: cytochrome c oxidase subunits I–III; ND1–6 and 4L: NADH dehydrogenase subunits 1–6 and 4L; ATP6: ATPase subunit 6; LrRNA and SrRNA: large and small subunit rRNAs). Genes for tRNAs are indicated as abbreviated capital letters for amino acids. The gene arrangement of T. solium mtDNA is the same as those of Echinococcus multilocularis and T. crassiceps mtDNAs.

50

A. Ito et al.

Vertebrata Mus musculus (16,295 bp) Echinodermata S. purpuratus (15,650 bp) Arthropoda D. yakuba (16,019 bp) Nematoda Caenorhabditis elegans (13,794 bp) Platyhelminthes Taenia solium (13,709 bp) Fig. 5.3. The arrangements of protein and rRNA genes among representative metazoan mitochondrial genomes. The sites of tRNA genes are omitted from this figure. Arrows indicate the direction of transcription.

UAA codon specifies tyrosine in the latter. The codon sequences are unified into the mitochondrial code of the entire phylum Platyhelminthes, and its range is conceived to cover all three classes: Turbellaria, Trematoda and Cestoda. The genetic code is similar to that of echinoderm mitochondria5; however it differs from the universal code27. Our group28 recently found that GUG is an initiating methionine codon and UAA is a terminating codon (Table 5.1).

tRNA and rRNA genes Individual sizes of 22 tRNA genes identified in the cestode mtDNA range from 58 to 73 nucleotides (nt). The variations in length are mostly due to differences in stem and loop sizes of the D and T arms (M. Nakao et al., Asahikawa, unpublished observations). The nucleotide compositions of cestode and nematode mtDNAs are similar. However, the secondary structures of their tRNAs differ from each other. A majority of cestode tRNAs (18 out of 22) can be folded into conventional four-arm cloverleaf structures, whereas the remaining four [tRNASer(AGN), tRNASer(UCN), tRNAArg and tRNACys] have unorthodox structures wherein their D-arms

are unpaired and replaced by loops of 6–9 nt. This unorthodox structure, particularly in tRNAArg and tRNACys, has not been found in any other metazoan mitochondrion so far28. The cestode mtDNA contains genes for large and small subunit rRNAs (LrRNA and SrRNA) of mitochondrial ribosomes. The putative LrRNA and SrRNA genes are 983 and 704 nt long, respectively (M. Nakao et al., Asahikawa, unpublished observations). The length of these genes are similar to those of their nematode counterparts29 but are shorter than those of other metazoan mitochondrial rRNAs, so far reported. It is speculated that the compactness of the cestode rRNAs results from the pressure to minimize the size of the mitochodrial genome. Predicted secondary structures of cestode LrRNA and SrRNA are more similar to those of nematodes30 and trematodes2.

Polymorphism of T. solium: global variations A comparison of sequences of complete COI genes in different isolates of T. solium from Asia (China, India, Indonesia, Thailand), Africa (Mozambique, Tanzania) and Latin

Mitochondrial DNA of T. solium

51

Table 5.1. The flatworm mitochondrial genetic code modified for cestodes. TTT TTC TTA TTG

Phe (F) Phe (F) Leu (L) Leu (L)

TCT TCC TCA TCG

Ser (S) Ser (S) Ser (S) Ser (S)

TAT TAC TAA TAG

Tyr (Y) Tyr (Y) Stop Stop

TGT TGC TGA TGG

Cys ( C ) Cys ( C ) Trp (W) Trp (W)

CCT CTC CTA CTG

Leu (L) Leu (L) Leu (L) Leu (L)

CCT CCC CCA CCG

Pro (P) Pro (P) Pro (P) Pro (P)

CAT CAC CAA CAG

His (H) His (H) Gln (Q) Gln (Q)

CGT CGC CGA CGG

Arg ( R ) Arg ( R ) Arg ( R ) Arg ( R)

ATT ATC ATA ATG*

Ile (I) Ile (I) Ile (I) Met (M)

ACT ACC ACA ACG

Thr (T) Thr (T) Thr (T) Thr (T)

AAT AAC AAA AAG

Asn (N) Asn (N) Asn (N) Lys (K)

AGT AGC AGA AGG

Ser (S) Ser (S) Ser (S) Ser (S)

GTT GTC GTA GTG*

Val (V) Val (V) Val (V) Val (V)

GCT GCC GCA GCG

Ala (A) Ala (A) Ala (A) Ala (A)

GAT GAC GAA GAG

Asp (D) Asp (D) Glu (E) Glu (E)

GGT GGC GGA GGG

Gly (G) Gly (G) Gly (G) Gly (G)

*Initiation codon.

America (Mexico, Ecuador and Peru) was undertaken18,24. Based upon the sequencing data, it was apparent that the Asian isolates differed from the African and American isolates (Fig. 5.4)24. We surmised that the similarities between African and American isolates could be related to a common ancestor or origin. Indeed, pigs were exported from Europe (perhaps, Spain or Portugal) to Africa and America from the 15th century onwards. Therefore, it is conceivable that African and American isolates of T. solium were introduced by European colonization. The hypothesized export phenomenon draws a parallel to the recent export of T. solium from Bali to Irian Jaya after the latter came under Indonesian control in 196911,31,32. The confirmation of the above hypothesis requires an analysis of the mtDNA of T. solium isolated from Europe and the demonstration of its similarity to American and African strains24. The demonstrated differences in the COI gene sequences between Asian and American–African isolates may be surmised to translate into different clinical implications. Indeed, there are differences in the clinical spectrum of NC between Asia and South America. For instance, parenchymal NC and subcutaneous cysticercosis are common while racemose cysticercosis is

rare in Asia. On the other hand, racemose cysticercosis is comparatively more common in Central and South America. Similarly, muscular cysticercosis leading to pseudohypertrophy has almost exclusively been reported from China and India and is uncommon in Central and South America. Furthermore, serological analysis of purified glycoproteins33 and the antigenic components of cyst fluid of T. solium cysticerci34 have revealed differences in the immunoblot profile of isolates from Ecuador and Mozambique on one hand and Irian Jaya, Indonesia and China on the other hand (Fig. 5.5; A. Ito et al., Asahikawa, unpublished data). An increasing amount of travel, immigration and refugeeism in the world is likely to dilute strict geographical predilections of any supposed strains and their different clinical and serological expressions. This is likely to interfere with the determination of a logical inference of phylogenic relationships between substrains as well as the study of epidemiology based on mitochondrial genomics. This however does not prevent us from forming a preliminary opinion that there are indeed at least two different substrains of T. solium based on differences in their mitochondrial genomes, biological and clinical behaviour.

52

A. Ito et al.

Mexico Peru

COI gene (1620 bp)

Tanzania 981

0.01 Da

A

Mozambique

Ecuador

Thailand 1000 Taenia solium

India

China 2

B

China 1 1000 Irian Jaya

1000

Taenia saginata

Taenia asiatica

Echinococcus multilocularis Fig. 5.4. A neighbour-joining phylogenetic tree of various isolates of Taenia solium. The tree was constructed from complete nucleotide sequences of COI genes. Bootstrap values are shown in the tree (group A: the African and Latin American isolates; group B: the Asian isolates).

Suggested Protocol for Collection of Material for mtDNA Studies While setting up a mitochondrial genomics laboratory is an elaborate affair, the collection of biological material is relatively simple. Viable segments or eggs from taeniasic individuals may be frozen or stored in 80–100% ethanol in a capped tube at 4°C for mtDNA studies. Viable T. solium eggs may also be prepared immediately from fresh segments. At our laboratory, oncospheres are hatched in vitro and inoculated into the peritoneal cavity of NOD-SCID mice to obtain well-developed cysticerci within a

few months14. Morphological, microscopic and mtDNA studies are then performed upon the larval stage with the intent of obtaining epidemiological, species and other biological data. Cysticerci resected either from the brain or subcutaneous tissue of humans may also be used as a source for mtDNA32.

Conclusions Most recently, the Asahikawa group in Japan has analysed the complete sequence of mtDNA of T. solium. The mtDNA of T.

Mitochondrial DNA of T. solium

Fig. 5.5. Immunoblot figures of cysticercosis patients from Latin America (Ecuador) reacting with various cyst fluid of Taenia solium from different continents. Lanes 1–4: Cyst fluid of T. solium from pigs in Ecuador (lane 1), in Irian Jaya, Indonesia (lane 2), in China (lane 3) and in Mozambique (lane 4).

solium consists of 13,709 bp and 12 protein genes, two rRNA genes and 22 tRNA genes located exclusively on the heavy chain. It uniquely uses GUG as an initiating methionine codon and UAA as a terminating codon. The unique codon usages are shared by

53

other cestodes including E. multilocularis, E. granulosus and T. crassiceps. These cestodes have a unique gene order that is different from other animals except trematodes. MtDNA studies have established similarities between the Asian Taenia and T. saginata. Furthermore, sequencing of the complete COI gene has revealed differences between isolates of T. solium from Asia and those from Africa and America18,24. The genetic diversity may have important biological, serological and clinical implications and it is likely that the two geographical isolates have different ancestral origins. More such studies, from different geographical locations, particularly Europe, are required. The African and American isolates are believed to have arisen out of European colonization. Mitochondrial DNA studies may be the key to demonstrate a link between European and American–African substrains.

Acknowledgements This study was supported in part by grants from the Nissan Science Foundation and the Uehara Memorial Foundation, by a Grant-inAid for International Scientific Research (Joint Research, 06044089, 07044243, 09044279) and by a Grant-in-Aid for Scientific Research (A) 11694259, (B) 10557029, 12557024 to A. Ito and by a Grant-in-Aid for Scientific Research (C) 70155670 to M. Nakao.

REFERENCES 1. Barker, S., Blair, D. (1996) Molecular phylogeny of Schistosoma species supports traditional groupings within the genus. Journal of Parasitology 82, 292–298. 2. Blair, D., Le, T.H., Després, L., et al. (1999) Mitochondrial genes of Schistosoma mansoni. Parasitology 119, 303–313. 3. McManus, D.P., Hope, M. (1993) Molecular variation in human schistosomes. Acta Tropica 53, 255–276. 4. Kokaze, A., Miyadera, H., Kita, K., et al. (1997) Phylogenetic identification of Sparganum proliferum as a pseudophyllidean cestode. Parasitology International 46, 271–279. 5. Smith, M.J., Arndt, A., Gorski, S., et al. (1993) The phylogeny of echinoderm classes based on mitochondrial gene arrangements. Journal of Molecular Evolution 36, 545–554. 6. Boore, J.L., Collins, M., Stanton, D., et al. (1995) Deducing the patterns of arthropod phylogeny from mitochondrial DNA rearrangements. Nature 376, 163–165. 7. Boore, J.L., Lavrov, D., Brown, W.M. (1998) Gene translocation links insects and crustaceans. Nature 392, 667–668.

54

A. Ito et al.

8. Boore, J.L. (1999) Animal mitochondrial genomes. Nucleic Acids Research 27, 1767–1780. 9. Fan, P.C. (1988) Taiwan Taenia and taeniasis. Parasitology Today 4, 86–88. 10. Eom, K.S., Rim, H.J. (1993) Morphologic descriptions of Taenia asiatica sp. North Korean Journal of Parasitology 31, 1–6. 11. Simanjuntak, G.M., Margono, S.S., Okamoto, M., et al. (1997) Taeniasis/cysticercosis in Indonesia as an emerging disease. Parasitology Today 13, 321–323. 12. Ito, A. (1992) Cysticercosis in Asia-Pacific regions. Parasitology Today 8, 182–183. 13. Galan-Puchardes, M.T., Fuentes, M.V. (1999) Human cysticercosis and larval tropism of Taenia asiatica. Parasitology Today 16, 174. 14. Ito, A., Nakaya, K., Sako, Y., et al. (2001) NOD-SCID mouse as an experimental animal model for cysticercosis. Southeast Asian Journal of Tropical Medicine and Public Health 32 (Suppl.), 85–89. 15. McManus, D.P. (1990) Characterization of taeniid cestodes by DNA analysis. Revue Scientifique et Technique 9, 489–510. 16. Bowles, J., McManus, D.P. (1994) Genetic characterization of the Asian Taenia, a newly described taeniid cestode of humans. American Journal of Tropical Medicine and Hygiene 50, 33–44. 17. Zarlenga, D.S., George, M. (1995) Taenia crassiceps: cloning and mapping of mitochondrial DNA and its application to the phenetic analysis of a new species of Taenia from Southeast Asia. Experimental Parasitology 81, 604–607. 18. Okamoto, M., Nakao, M., Sako, Y., et al. (2001) Molecular variation of Taenia solium in the world. Southeast Asian Journal of Tropical Medicine and Public Health 32 (Suppl.), 90–93. 19. Ito, A., Cheng, W.C., Chen, C.C., et al. (1997) Human Taenia eggs develop into cysticerci in SCID mice. Parasitology 114, 85–88. 20. Ito, A., Ito, M., Eom, K.S., et al. (1997) In vitro hatched oncospheres of Asian Taenia from Korea and Taiwan develop into cysticerci in the peritoneal cavity of female scid (severe combined immunodeficiency) mice. International Journal for Parasitology 27, 631–633. 21. Ito, A., Ma, L., Sato, Y. (1997) Cystic metacestodes of a rat-adapted Taenia taeniaeformis established in the peritoneal cavity of scid and nude mice. International Journal for Parasitology 27, 903–905. 22. Ito, A., Ito, M. (1999) Human Taenia in severe combined immunodeficiency (SCID) mice. Parasitology Today 15, 64–67. 23. Fan, P.C., et al. (1995) Morphological description of Taenia saginata asiatica (Cyclophyllidea: Taeniidae) from man in Asia. Journal of Helminthology 69, 299–303. 24. Nakao, M., Okamoto, M., Sako, Y., et al. (2002) A hypothesis for the distribution of two genotypes of the pork tapeworm Taenia solium worldwide. Parasitology 126 (in press). 25. Garey, J.R., Wolstenholme, D.R. (1989) Platyhelminth mitochondrial DNA: evidence for early evolutionary origin of a tRNASerAGN that contains a dihydrouridine arm replacement loop, and of serine-specifying AGA and AGG codons. Journal of Molecular Evolution 28, 374–387. 26. Ohma, T., Osawa, S., Watanabe, K., et al. (1990) Evolution of the mitochondrial genetic code IV. AAA as an asparagine codon in some animal mitochondria. Journal of Molecular Evolution 30, 329–332. 27. Bessho, Y., Ohama, T., Osawa, S. (1992) Planarian mitochondria II. The unique genetic code as deduced from cytochrome c oxidase subunit I gene sequences. Journal of Molecular Evolution 34, 331–335. 28. Nakao, M., Sako, Y., Yokoyama, N., et al. (2000) Mitochondrial genetic code of cestodes. Molecular Biochemistry and Parasitology 111, 415–424. 29. Okimoto, R., Macfarlane, J.L., Clary, D.O., et al. (1992) The mitochondrial genomes of two nematodes, Caenorhabditis elegans and Ascaris suum. Genetics 130, 471–498. 30. Okimoto, R., Macfarlane, J.L., Wolstenholme, D.R. (1994) The mitochondrial ribosomal RNA genes of the nematodes Caenorhabditis elegans and Ascaris suum: consensus secondary-structure models and conserved nucleotide sets for phylogenetic analysis. Journal of Molecular Evolution 39, 598–613. 31. Schantz, P.M., Wilkins, P.P., Tsang, V.C.W. (1998) Immigrants, imaging and immunoblots: the emergence of neurocysticercosis as a significant public health problem. In: Scheld, W.M., Craig, W.A., Hughes, J.M. (eds) Emerging Infections 2. ASM Press, Washington, DC, pp. 213–242. 32. Wandra, T., Subahar, R., Simanjuntak, G.M., et al. (2000) Resurgence of cases of epileptic seizures and burns associated with cysticercosis in Assologaima, Jayawijaya, Irian Jaya, Indonesia, 1991–95. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 46–50.

Mitochondrial DNA of T. solium

33.

55

Ito, A., Sako, Y., Nakao, M., et al. (1999) ELISA and immunoblot using purified glycoproteins for serodiagnosis of cycsticercosis in pigs naturally injected with Taenia solium. Journal of Helminthology 73, 363–365. 34. Ito, A., Plancarte, A., Ma, L., et al. (1998) Novel antigens for neurocysticercosis: simple method for preparation and evaluation for serodiagnosis. American Journal of Tropical Medicine and Hygiene 59, 291–294. 35. Ito, A., Plancarte, A., Nakao, M., et al. (2002) Neurocysticercosis in Asia: serology/seroepidemiology in humans and pigs. In: Craig, P., Pawlowski, Z. (eds) Cestode Zoonoses: Echinococcosis and Cysticercosis – an Emergent and Global Problem. IOS Press, Amsterdam, pp. 25–31. 36. Le, T.H., Blair, D., Agatsuma, T., et al. (2002) Phylogenies inferred from mitochondrial gene orders – a cautionary tale from parasitic flatworms. Molecular Biology and Evolution 17, 1123–1125.

6

Hereditary Factors in Neurocysticercosis with Emphasis on Single, Small, Enhancing CT Lesions Vasantha Padma, Satish Jain, Achal Srivastava, Manjari Tripathi and Mahesh C. Maheshwari

Introduction Most human disorders are a result of an interaction between environmental and genetic factors. In certain diseases, there is a dominant genetic influence and environmental agencies exert a modulating influence. In others, the primary cause is an environmental agent, most often a microbial, toxic or an immune element, but in addition, there is a small but definite genetic predisposition. A number of infectious and inflammatory disorders fall into the latter category. Significant in this context is the predisposition conferred by the major histocompatibility complex, also known as the ‘human leucocyte antigen (HLA)’ on chromosome 61. Different alleles of the HLA genes either predispose or protect against specific disorders. Multiple sclerosis, systemic lupus erythematosus and diabetes are examples of such disorders2–4. Neurocysticercosis (NC) is a somatic form of taeniasis that is acquired by ingestion of Taenia solium eggs. Environmental factors including poor personal hygiene, improper sanitation and inadequate pig husbandry are primary reasons for its occurrence. The role of genetic factors in NC has not been sufficiently recognized. It might be interesting to postulate the existence of genetic influence, that predisposes certain populations to acquire T. solium cysticercosis, and among

these, subpopulations to exhibit differences in disease manifestations and behaviour. On a different note, the study of genetic factors may also unravel novel control strategies of developing genetically engineered pigs that are resistant to cysticercosis and can effectively check the human–environment–pig– human cycle. The study of genetic influences in human T. solium cysticercosis is at a preliminary stage. In this review, we present some of our data on HLA studies in single, small, enhancing CT lesions (SSECTLs)5,6 and review some of the published human7 and experimental evidence8,9 of the influence of the major histocompatibility complex in disease acquisition.

HLA Studies in SSECTL Aetiology of SSECTL Computed tomography (CT) often demonstrates SSECTLs or the so-called ‘disappearing CT lesions’ in individuals with recent seizures in several developing countries, including India. These lesions are seen to be associated with a benign form of seizure disorder. Rajshekhar has reviewed the events that led to the recognition of the aetiological agent for SSECTL. The reader is referred to

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

57

58

V. Padma et al.

Chapter 24 for a review of aetiological considerations. Current opinion links an overwhelming majority of the SSECTLs to T. solium cysticercosis. This has been based upon histological findings, which have been summarized in this book by Chacko (see Chapter 31). However, other aetiological agents such as tuberculosis, brain abscesses and miscellaneous inflammatory conditions cannot be completely disregarded10.

HLA studies We performed HLA studies in 63 Indian probands with seizures and SSECTL, and also studied the occurrence of seizure types among their family members5. All probands included in the study were clinically evaluated by one of the three authors (SJ, MCM, and VP). Family pedigrees were drawn to include all the first- and second-degree relatives of the probands. Information on affected relatives was collected and, wherever possible, the affected relatives were examined in the outpatient clinic. All probands and affected relatives underwent electroencephalographic evaluations. CT scan was done when possible and indicated. All 63 patients and 340 healthy controls were serologically tested using complement mediated standard micro-lymphotoxicity test for HLA-A, HLA-B and HLA-C antigens. We found a positive family history of seizures among 16 out of 63 (25%) probands with SSECTL. Among affected relatives, 13% had symptomatic generalized epilepsy. A SSECTL was noted in four relatives (17%). The occurrence of different epileptic syndromes among the relatives prompted us to consider either a genetic contribution in the aetiopathogenesis of this syndrome or a hereditary susceptibility to an environmental agent5. Further, preliminary results of HLA class I studies revealed that the frequencies of HLAA11 were decreased, whereas those of HLAB63 and HLA-B58 were increased in probands, when compared with healthy controls (the values were not significant after application of correction factor for P value). Among HLA class II antigens (tested subse-

quently in 41 randomly selected probands), HLA-DR B1*13 occurred in 29.3% of probands in comparison to 9.7% in healthy controls (2 = 10.35; Pc = 0.036; relative risk (RR) = 3.83). In addition, HLA-DR B1*09 was observed with an increased frequency in probands (7.3 vs. 1.3%; 2 = 4.69; RR = 6). No other class II antigens deviated significantly from control5. The HLA Class II genomic typing results in our patients are statistically significant. These associations may be surmised to be an indicator of susceptibility to an infection or infestation in Indian patients with seizures. From a different viewpoint, our report adds to the list of results associating different class I and class II alleles with epileptic syndromes such as juvenile myoclonic epilepsy, Lennox–Gastaut syndrome and severe myoclonic epilepsy in infants11–17. We hypothesized that the condition to which we have been assigning different names is actually an ‘imaging phenotype’. This CT lesion represents a benign epileptic syndrome that occurs predominantly in Asian Indians. The results of our preliminary study prompted us to investigate further, hereditary factors in this syndrome. We reported clinical features in 235 Indian probands with seizures in association with SSECTL along with those in their family members6. HLA class II antigen frequencies were further studied in 41 randomly selected probands. A total of 235 individuals with SSECTL were followed at the outpatient clinic of the Neurology Department, Neurosciences Center, All India Institute of Medical Sciences, New Delhi. These patients represented the ethnic groups of North Indian Hindus. Follow-up CT scan revealed complete or nearly complete (only a residual calcified dot) spontaneous resolution of the lesion in all cases with no specific therapy. Individuals in whom the CT lesion resolved while they were taking antitubercular or anticysticercal drugs, antibiotics and steroids were excluded6. Family history of seizures was considered positive when one or more first- or second-degree relative had seizures. Family pedigrees were similarly drawn for probands having other neurological disease, for instance, muscular dystrophy, to determine the occurrence of seizures in their fam-

Hereditary Factors in Neurocysticercosis

ily members. The affected relatives with seizures in these families also were examined in the same way as the affected relatives of probands. The 41 patients (from a total 235) included for HLA-DR typing were unrelated and randomly selected. HLA-DR typing also was performed on 154 healthy controls (from the same ethnic groups living in the same geographic region)18. A history of seizures was documented among first- and second-degree relatives of 50 (21%) probands. A first-degree relative was affected in 35 and a second-degree relative in 15 probands. Thirty-eight (3%) of 1212 first-degree relatives and 28 (0.8%) of 3379 second-degree relatives were affected. Therefore, the ratio of affected firstdegree : second-degree relatives was 4.3 : 1. Localization-related epilepsies were more common among first-degree relatives (P0.05), whereas generalized epilepsies were more often noted among second-degree relatives (P0.01). Interestingly, seven of 35 first-degree relatives had seizures in association with SSECTL compared with only one of 15 second-degree relatives. Other syndromes were almost equally distributed among the relatives. Among affected firstdegree relatives, seven had localizationrelated epilepsy, while five had SSECTL. Among 1587 first- and 3797 second-degree relatives of 212 controls with neurological diseases other than epilepsy, 20 first- and four second-degree relatives had epilepsy. Affected probands had a significantly higher frequency or a positive family history in comparison to controls6. HLA-DR B1*13 was expressed in 29.3% of probands in comparison to 97% in healthy controls (2 = 10.35; RR = 3.83). On the other hand, HLA-DR B1*09 was observed with an increased frequency in probands (7.3 vs. 1.3%; 2 = 4.69; RR = 6). None of the other class II antigens tested revealed any significant deviation in patients as compared to controls6. Several previously published reports suggest a role of the HLA system in different epileptic syndromes11,13,14,19,20. Juvenile myoclonic epilepsy was shown to be linked to the BF and HLA loci on human chromosome 6 in two population groups from the United States and Germany, and HLA-DRW

59

13 in Arab patients14,19,20. Some ‘genes’ predisposing to the susceptibility to seizures may be located near the HLA locus. From this viewpoint, seizures in association with SSECTL in Asian Indians may represent a genetically determined predisposition to a unique benign epileptic syndrome with particular imaging characteristics.

HLA Studies in Human Neurocysticercosis From a contrasting point of view to that presented above, HLA associations have been reported with other infective diseases such as leprosy, tuberculosis and cysticercosis7,21,22. Del Brutto et al. reported significantly increased frequency of HLA-A28 and decreased frequency of HLA-DQW2 in a Mexican cohort with parenchymal NC7. The authors surmised that HLA-A28 confers susceptibility to NC, while HLA-DQW2 accords resistance. With a similar view, our results of HLA studies in the Indian probands with SSECTLs point to an increased susceptibility to an infective agent such as cysticercosis. It is also possible that affected relatives of individuals with SSECTLs were exposed to the common causative agent (through food and water for cysticercosis). The high prevalence of seizures among first-degree relatives could also be reflection of an exposure to a common environmental agent.

Experimental Evidence for a Genetic Contribution Fragoso et al. investigated the influence of nonclassic Class I MHC Qa-2 antigen expression and acquisition of T. crassiceps cysticercosis in mice8. The authors found that the BALB/cAnN substrain of mice, which did not express Qa-2 antigen was highly susceptible to infection, while another substrain BALB/cJ, which expressed Qa-2 was resistant to T. crassiceps cysticercosis. In further experiments, Qa-2 transgenic mice (C57BL/67/BALBcAnN) were backcrossed to BALB/cAnN mice and then infected with T. crassiceps9. A significantly lower yield of cysticercus larvae was noted in

60

V. Padma et al.

the Qa-2 transgenic mice than in non-transgenic mice. These studies have established a definite relationship between Qa-2 antigen expression and resistance to infection with T. crassiceps cysticercosis in mice. Furthermore, human Class I MHC, HLA-G has been suggested to be functionally similar to murine Qa-2. The experimental data outlined above are significant for the understanding of factors that lead to resistance or susceptibility to cysticercosis.

Conclusions Several HLA molecules have been demonstrated to confer susceptibility or resistance to cysticercosis in humans with SSECTLs, NC and in experimental models of a related cysticercus. The identification of these genetic factors offers the promise of developing strategies for inducing resistance to cysticercosis through genetic manipulation.

References 1. Robinson, J., Waller, M.J., Parham, P., et al. (2001) IMGT/HLA database – a sequence database for the human major histocompatibility complex. Nucleic Acids Research 29, 210–213. 2. Ruiz, N., Giudecelli, V., Ginestoux, C., et al. (2000) IMGT, the international immunogenetics database. Nucleic Acids Research 28, 219–221. 3. Nepom, G.T., Nepom, B.S. (1992) Prediction of susceptibility to rheumatoid arthritis by human leukocyte antigen genotyping. Rheumatic Diseases Clinics of North America 18, 785–794. 4. Subbah, I., Savola, K., Ebeling, T., et al. (2000) Genetic, autoimmune and clinical characteristics of childhood- and adult-onset type 1 diabetes. Diabetes Care 23, 1326–1332. 5. Jain, S., Padma, M.V., Kanga, U., et al. (1997) Human leukocyte antigen studies in Indian probands with seizures associated with single small enhancing computed tomography lesions and seizure types in their family members. Journal of Epilepsy 10, 55–61. 6. Jain, S., Padma, M.V., Kanga, U., et al. (1999) Family studies and human leukocyte antigen class II typing in Indian probands with seizures in association with single small enhancing computed tomography lesions. Epilepsia 40, 232–238. 7. Del Brutto, O.H., Granados, G., Talamas, O., et al. (1991) Genetic pattern of the HLA system: HLA A, B, C, DR, DQ antigens in Mexican patients with parenchymal brain cysticercosis. Human Biology 63, 85–93. 8. Frogoso, G., Lamoyi, E., Mellor, A., et al. (1996) Genetic control of susceptibility to Taenia crassiceps cysticercosis. Parasitology 112, 119–124. 9. Frogoso, G., Lamoyi, E., Mellor, A., et al. (1998) Increased resistance to Taenia crassiceps murine cysticercosis in Qa-2 transgenic mice. Infection and Immunity 66, 760–764. 10. Padma, M.V., Behari, M., Misra, N.K., et al. (1994) Albendazole in single CT ring lesions in epilepsy. Neurology 44, 1344–1346. 11. Durner, M., Janz, D., Zingsem, J., et al. (1992) Possible association of juvenile myoclonic epilepsy with HLA-DRw6. Epilepsia 33, 814–816. 12. Arali, J.A. (1993) Immunological aspects of epilepsy. Brain Development 15, 41–49. 13. van Engelen, B.G., de Waal, L.P., Weemeas, C.M., et al. (1994) Serologic HLA typing in cryptogenic Lennox Gastaut syndrome. Epilepsy Research 17, 43–47. 14. Obeid, T., el Rab, M.O., Daif, A.K., et al. (1994) Is HLA-DRw13 (W6) associated with juvenile myoclonic epilepsy in Arab patients? Epilepsia 35, 319–321. 15. Moen, T., Brodtkorb, E., Michler, R.P., et al. (1995) Juvenile myoclonic epilepsy and human leukocyte antigens. Seizure 4, 119–122. 16. Oguni, H., Uehara, T., Fzumi, T., et al. (1995) Immunogenetic study of patients with severe myoclonic epilepsy in infants and its variant. Epilepsia 36 (Suppl. 3), S9–10. 17. Suastegui, R.A., De la Rosa, G., Fonzalez-Austiazaran, A., et al. (1995) HLA – class II genetic markers are involved in resistance/susceptibility for the expression of massive spasm. Epilepsia 36 (Suppl. 3), S10. 18. Mehra, N.K., Verduijn, W., Taneja, V., et al. (1991) Analysis of HLA-DR2 associated polymorphism by oligonucleotide hybridization in an Asian Indian population. Human Immunology 32, 246–253. 19. Greenberg, D.A., Delgado-Escueta, A.V., Widlitz, H., et al. (1988) Juvenile myoclonic epilepsy may be linked to the BF and HLA loci on human chromosome 6. American Journal of Medical Genetics 31, 185–192.

Hereditary Factors in Neurocysticercosis

61

20. Liu, A.W., Delgado-Escueta, A.V., Serratose, J.M., et al. (1995) Juvenile myoclonic epilepsy locus in chromosome 6p21.2–p11: linkage to convulsions and electroencephalographic trait. American Journal of Human Genetics 57, 368–381. 21. Zerva, L., Ciznam, B., Mehra, N.K., et al. (1996) Arginine at positions 13 or 70–71 in pocket 4 of HLA-DRB1 alleles is associated with susceptibility to tuberculoid leprosy. Journal of Experimental Medicine 183, 829–836. 22. Rajalingam, R., Mehra, N.K., Jain, R.C., et al. (1996) Polymerase chain reaction-based sequence specific oligonucleotide hybridization analysis of HLA class II antigens in pulmonary tuberculosis: relevance to chemotherapy and disease severity. Journal of Infectious Diseases 173, 669–676.

7

Taenia solium Cysticercosis: an Overview of Global Distribution and Transmission Peter M. Schantz

Introduction

History

Taeniasis/cysticercosis caused by Taenia solium, often referred to as the pork tapeworm, is a classical zoonosis, recognized since antiquity, which, as a result of a variety of demographical, technological and political factors, has emerged as an increasingly important disease in regions where it has long been endemic, as well as in regions into which it has been imported or introduced. The two-host life cycle of the tapeworm involves humans as definitive hosts and swine as intermediate hosts. Infected pigs are the source of human taeniasis, an intestinal tapeworm infection acquired by eating undercooked pork contaminated with cysticerci, the larval stage of the cestode. Cysticercosis, however, is acquired by ingesting Taenia eggs shed in the faeces of a human tapeworm carrier and thus may occur in humans who neither eat pork nor share environments with pigs. Although cysticerci may localize throughout the body, most clinical manifestations result from their presence in the central nervous system (neurocysticercosis (NC)), where they can cause seizures, hydrocephalus and other neurological disorders1.

Prominently visible in both its intestinal and tissue stages, the macroparasite T. solium has been known since the earliest times. Spontaneous elimination of individual tapeworm segments was alluded to by writers at the beginnings of recorded history2. The ancient Greeks made reference to ‘measles’ in pork, which were in fact larval cysticerci; however, their significance was not understood. Aristotle compared their appearance to hailstones; he and others regarded them as worm-like animals. In the 16th century, European pathologists associated the condition with disease in humans and described cysticerci in the brains of epileptic persons. By the mid-19th century a number of investigators had demonstrated the link between cystic and strobilar (intestinal) forms of several species of Taenia by showing that cystic forms metamorphosed into adult worms when ingested by suitable hosts. This relationship for T. solium was confirmed in 1855 by Küchenmeister who administered cystinfected pork to a condemned criminal and observed developing adult forms in the man’s intestine after his execution2. About the same time, van Beneden in Belgium

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

63

64

P.M. Schantz

demonstrated that he could produce cysticerci in the muscles of pigs by feeding them T. solium eggs obtained from tapeworm segments passed by infected humans. Further studies confirmed that humans alone were the definitive host of the worm and pigs were the only significant intermediate host; thus, the reasons for the well-recognized paucity of infection in Moslems and Jews, for whom Mosaic laws forbade the ingestion of pork, could then be understood. Scattered reports suggest that the infection was prevalent in pigs and in humans in various parts of the world; however, highest rates of transmission most likely occurred in populations with the poorest recorded medical documentation. During the first half of the 19th century, approximately 2% of postmortem examinations of humans conducted in Berlin, Germany, revealed cysticercosis and details of the clinical and pathologic characteristics of NC were extensively described in German medical literature by the turn of the 20th century3. Although the infection has been virtually eliminated from Germany and

most of the rest of Western Europe, similar or higher prevalence rates have been documented recently in parts of Africa, Asia, and Central and South America4. Improvements in diagnosis (neuroimaging methods and specific antibody detection) have revolutionized the antemortem recognition of this disease, thus improving our understanding of the nature of the disease and its true prevalence while large-scale migration of populations in modern times have continued to expand its distribution.

Geographic Distribution Taenia solium infection is widely endemic in rural areas of developing countries in Central and South America, Asia and Africa (Fig. 7.1). Published reports document the occurrence of clinical NC in most of the countries of the Americas (most notably Mexico, Guatemala, El Salvador, Honduras, Colombia, Ecuador, Peru, Bolivia and Brazil). The infection was reported to be present in

Fig. 7.1. Approximate global geographic distribution of Taenia solium.

Global Distribution and Transmission

18 countries of South and Central America whose combined populations represented 94% of the total 1980 population of the Latin American countries5. Of the American countries, only Canada, the United States, Argentina and Uruguay appear to be free of transmission in the pig–human cycle; however, these latter countries are observing an increase in imported and introduced infections related to immigration of persons from neighbouring countries where T. solium infection is endemic4. No information is available concerning the occurrence, or absence, of infection in Guyana, Suriname and French Guiana. In Asia, most available data are from clinic-based populations and, consequently, are biased in terms of the true geographic origin and epidemiologic factors associated with transmission. Transmission in much of Asia is strongly influenced by prevailing cultural practices and socio-economic conditions. In India, for example, intestinal-stage T. solium infections occur mainly in pork-eating populations, particularly in rural populations and lower socio-economic classes; 78% of children of pig farmers were reported to be passing taeniid eggs6,7. Vegetarian populations are presumably exposed to cysticercosis through direct and indirect contact with Taenia carriers. The vast majority of clinical cases reported in India are of the single-lesion variety with relatively mild symptoms and benign outcome; these are believed to be associated with exposure to eggs in contaminated foodstuffs or other indirect exposure to tapeworm carriers8. Curiously, the greatest number of cases of the rare, massive, disseminated form of the disease have also been reported from India; the explanations for these extremes are unknown9. As might be expected, there are no reports from the strictly Moslem countries of Iran, Pakistan, Afghanistan and Bangladesh. Human NC is reported widely from China and parts of Korea. It is known to occur also, although few published data are available, in the Southeastern Asian countries of Myanmar, Cambodia, Laos, Vietnam and parts of the Philippines. In Indonesia, T. solium infection is endemic in parts of numerous islands including Sumatra, Bali,

65

West Kalimantan, Sulawesi, Flores, East Timor and Irian Jaya10,11. The cestode was apparently introduced into Irian Jaya in recent times when swine from Bali were translocated to (former) West New Guinea12. Improvements in socio-economic conditions were associated with reduction or disappearance of the infection in Japan, Taiwan, Hong Kong, Singapore, and Thailand, where, in recent years, most cases diagnosed were apparently imported. In Africa, T. solium is transmitted throughout most of the continent with the exception of the strictly Muslim areas of North and sub-Saharan Africa. NC is an important cause of neurological disability in regions of Africa in which it has been studied; epilepsy in several countries has been documented to be caused by T. solium infection in 30–51% of cases13. In Africa, as in Asia, subcutaneous localization of cysticerci, concomitant with intracerebral infection, is common (30%); this is in contrast to the infection in American countries where subcutaneous localization in patients with NC is relatively rare4. Because of the limited development of medical and sanitary infrastructure, the impact of the disease may be underestimated to a greater degree than in other regions. The widespread absence of sanitary services, especially adequate disposal of human excrement, and the frequent practice of allowing pigs to roam free, permits transmission of T. solium in most of the regions. Controlled slaughter of swine is rarely practised and consequently cysticerci-infected pork is generally consumed by humans who either ignore or are ignorant of its significance14,15. In South Africa, Zimbabwe and Madagascar where medical services are relatively sophisticated, NC has long been a subject of scientific reports16–19; from other regions, however, there are very limited data because of the lack of diagnostic facilities. NC is reportedly a common clinical entity in many countries of West Africa (Senegal, Benin, Ivory Coast, Togo, Ghana) and Central Africa (Zaire, Cameroon, Burundi and Rwanda)20. Few reports of NC in humans in East Africa have been documented; however, a recent report of T. solium cysticercosis in 13% of pigs slaughtered in

66

P.M. Schantz

three abattoirs in Tanzania suggests that the cestode occurs in at least some regions21. There is increasing recognition that the medical and economic costs of T. solium cysticercosis are greatly underestimated in countries like Tanzania, Zambia, Zimbabwe and South Africa and efforts are underway to document these costs and to organize effective methods of prevention and control (A.L. Willingham, Frederiksberg, Denmark and R.C. Krecek, Onderstepoort, South Africa, personal communication, 2000). Historically, T. solium occurred widely in European countries; indeed, many of the earliest recorded observations about the parasite and its life cycle were reported by European authors2. In the mid-19th century, it was reported that cysticerci were observed in 2% of autopsied human cadavers in Germany and infections were commonly observed in swine at slaughter2. The same was apparently true in many countries of the continent. Today, as a result of improvements in swine husbandry, sanitation and hygiene, the infection has largely disappeared; however, locally acquired infections are still occasionally reported from Spain (Castilla, Extremadura and Andalucia)22,23, northern Portugal24, southern Italy25 and Poland (Z. Pawlowski and A. Ramisz, Poznan, Poland, personal communication, 1997), indicating persisting foci of transmission in some regions.

Prevalence Data Until recently, the only available quantitative data on cysticercosis from any country were clinic-based statistics on the frequency of NC among hospital patients or autopsied cadavers. In Mexico, for example, NC has long been considered to have an important impact on health services expenditures. Through the 1980s, this diagnosis accounted for nearly 9% of admissions in neurology and neurosurgical services and was the final diagnosis in 11–25% of patients operated on for removal of brain tumours1. NC was found in 2.8–3.6% of all autopsies in Mexico City hospitals and was reported as the cause of death in 0.6–1.5% of hospitalized patients. Similar statistics documenting the frequency of clinical

diagnoses of NC have been reported from many other countries; however, such statistics are misleading because differences in availability of medical services and lack of comprehensive and consistent reporting in most countries confound attempts to compare incidence and prevalence between countries and, within a country, between rural and urban areas. For example, extensive documentation in the medical literature on the occurrence of NC in Mexico over many years might have suggested that the disease was more prevalent there than in neighbouring countries; however, recent surveys using modern diagnostic techniques reveal that the prevalences of T. solium infection in some countries of the region exceed rates in Mexico by considerable margins (Table 7.1). In all countries, improved diagnostic technology, new options for treatment, and greater awareness of cysticercosis by the medical and public health communities have resulted in documentation of increased numbers of cases diagnosed in traditional disease-endemic areas as well as new disclosures of active transmission from regions where the disease was previously unrecognized or not reported. Recent surveys and epidemiological studies, using state-of-the-art diagnostic methods26, have begun to document the occurrence of the infection and its impact on affected populations. Table 7.1 compares recent prevalence estimates for T. solium cysticercosis and taeniasis in humans and cysticercosis in pigs in surveys of community-based population samples in Latin America in which comparable diagnostic methods were used27–40. Prevalence varied among communities; however, a consistent relative pattern of prevalence ratios of the different forms of infection has been observed. Prevalences of intestinal stage infection (taeniasis) are relatively low; however, rates of cysticercosis in humans and pigs are usually related quantitatively to the rates of taeniasis. People in affected communities are not usually aware that the parasitic cysts they see in the meat of pigs is the cause of seizures and other neurological disorders; however, use of modern serological and imaging diagnostic technology has identified NC as the most important contributor to the

Global Distribution and Transmission

67

Table 7.1. Prevalence estimates of Taenia solium cysticercosis and taeniasis in humans and pigs in Latin American communities.

Country

Community

Mexico

Angahuan

SeroPrevalence prevalence of Prevalence Sample (EITB1) taeniasis in pigs size (%) (%) (%) Reference 10.8

0.3e

4.0t

Sarti et al., 1992, 199428,27

1005

4.9

0.2e

6.5t

Sarti et al., 199229

1552

Mexico

Xoxocotla

Guatemala

Quesada

862

11.0

1.0c,e

4.0t

Allan et al.,199630, Garcia Noval et al., 200131

Guatemala

El Jocote

955

20.0

2.8c,e

14.0t

Allan et al.,199630, Garcia-Noval et al., 200131

0

n.d.

Military recruits

Ï urban (363) Ì rural Ó (41)

15.0

Honduras

22.0

0.6e

n.d.

Sanchez et al., 199832

Honduras

Agua Caliente

68 536

34.0

1.5e

n.d.

Sanchez et al., 199733

Honduras

Salama County

480

17.0

2.5e

27.1t

Sanchez et al., 199934 , Sakai et al., 199835

Bolivia

‘rural community’

159

22.6

n.d.

38.9i

Tsang and Wilson, 199536

Ecuador

San Pablo del Lago

118

10.4

n.d.

7.5t

Cruz et al., 199837

Peru

Lima (urban)

250

0

n.d.

0

Tsang and Wilson, 199536

Peru

Maceda

371

8.0

0.3e

43.0i

Diaz et al., 199238 García et al., 199639

Peru

Churusapa

134

7.0

n.d.

49.0i

Peru

Haparquilla

108

13.0

n.d.

46.0i

García et al., 199639

Peru

Monterredonda

489

16.0

n.d.

13.0i

García et al., 199639

18.0

n.d.

60–70i

García et al., 199639

24.0

8.6i

36.0i

García et al., 199639, 199940

Peru Peru

Quilcas Saylla

99

Notes: 1. EITB: enzyme-linked immunoelectrotransfer blot. 2. Prevalence of antibodies to cysticercosis measured in humans by EITB assay (Reference 26). 3. Prevalence of taeniasis measured by examination of faecal specimens for eggs e or coproantigensc or both. 4. Prevalence of cysticercosis in pigs measured by visual examination and palpation of tongue t or detection of antibodies by EITB assay i. 5. n.d.: not done.

high rates of epilepsy and migraine headaches in many regions where T. solium infection is endemic. For example, in community-based studies from Mexico, Guatemala, Honduras, Ecuador and Peru, large proportions of persons with histories of seizures had

serological (21–34%) or neurological imaging (54–70%) evidence of NC31,37,41. It is important to note that the seizure episodes in these rural people had not previously been linked to NC and it required this type of active diagnostic intervention to be able to demonstrate

68

P.M. Schantz

the impact of the disease on the health of these communities. Using data on seroprevalence and seizure disorder rates from multiple populationbased community studies in Peru, Bern et al. estimated that there were from 23,512 to 39,186 symptomatic cases of NC in Peru alone42. Extrapolating from limited serological surveys in other countries of Latin America, these authors calculated that 30–50 million persons may have been exposed to T. solium in Latin America alone and that there were an estimated 400,000 infected persons with symptomatic disease. In most countries where T. solium infection is endemic, community-based prevalence data are not yet available and there exist no realistic, databased estimates of the worldwide prevalence of T. solium infection in humans, however, the diagnostic technology now exists to begin to amass such data. There is a need for provision of diagnostic and therapeutic resources at the community level to determine the prevalence of infection and rates of associated morbidity.

Patterns of Transmission Endemic transmission Throughout its worldwide distribution, T. solium is maintained by cyclic transmission in swine and human hosts. More than 40 years ago, T. solium infection was called a ‘testimony to under-development’43; that characterization remains true today. Transmission of T. solium requires that pigs have access to human faeces and that humans ingest inadequately cooked meat of pigs. Such conditions are common in rural areas of many under-developed or unevenly developed countries characterized by poor hygiene, deficient sanitary facilities and primitive swine husbandry practices that allow pigs to run loose all or part of the time; such communities have not yet directly benefited from the achievements in sanitation and hygiene often referred to as the ‘first public health revolution’. In certain situations where pigs are kept in enclosures or are restrained, they may be fed human faeces

purposefully, e.g. ‘pig-sty privies’, thus also leading to transmission of T. solium. Such conditions may appear to be the endpoint of social neglect but usually represent an effective adaptation to poverty and circumstance whereby the pig is nourished adequately at virtually no cost to the owner and, simultaneously, serves as a community scavenger or ‘sanitary police’. Through coprophagy, pigs readily become infected, often at high rates and very intense levels. Recent surveys in disease-endemic communities of Latin America have revealed that infection rates in pigs approach 5–50%27–31,35,36,39,44–46. In T. solium-endemic areas, local populations, including pig owners, are often unaware of the threat to public health that this infection in pigs represents and do not relate the lesions in their animals to disease in humans. Nevertheless, pig owners may routinely check their live pigs for cysticercosis by direct examination of the tongue. This concern is motivated by the knowledge that cysticerci-infected meat may be rejected at slaughter (where visual meat inspection is practised) or will bring a significantly reduced price. Consequently, infected pigs may be slaughtered and sold clandestinely or consumed by the pig-owner’s family. In villages of Central Peru, where infection rates in pigs varied from 14% to 25%, virtually none of the infected pigs were processed at the local slaughterhouse. Rather, pig owners and vendors purposefully bypassed formal slaughterhouses. The investigators estimated that 23% of the total pork consumed in the community was derived from pigs infected with cysticerci46. Studies in Mexico, Guatemala and Peru have shown that the principal factors associated with the likelihood of infection in pigs include increasing age and access to human faeces. Confined pigs tend to be protected from infection but only if confinement is habitual and they are not deliberately fed faeces28,29,47. Improved understanding of the epidemiology of T. solium transmission requires a better understanding of the risk factors for intestinal-stage infection and the modes of dispersal of infective eggs by human tapeworm carriers because taeniid eggs in faeces or contamination of the

Global Distribution and Transmission

hands of infected humans are the direct source of cysticercosis in both pigs and humans. Surveys in disease-endemic communities in Mexico, Guatemala, Peru and Honduras have shown rates of T. solium taeniasis varying from 0.3% to 6%27,29,30,35,38. Factors associated with taeniasis include age (rates of intestinal taeniid infections tend to peak in middle adulthood; however, infections occur in all age groups) and frequency of pork consumption11,29,30,38. In some populations, taeniid infections are observed significantly more frequently in women than in men29,30. The presence of a tapeworm-infected individual within a household is an important risk factor for exposure to T. solium cysticercosis and this risk may be increased if the tapeworm carrier is an individual engaged in food preparation and child care activities. In Peruvian mountain villages, food handlers engaged in preparing and selling a traditional pork dish (‘chicharrones’) were shown to harbour intestinal taeniid infections at a significantly higher rate than other persons in the community39,40. Serological screening of humans from these villages documented levels of apparent exposure to T. solium cysticercosis varying from 5% to 24% (Table 7.1). Significantly higher levels of seropositivity in humans were associated with low levels of sanitary infrastructure and personal hygiene, age more than 20 years and personal histories of taeniasis. Highest seropositivity rates were found in persons with multiple factors39, suggesting that these apparent risk factors and behaviours acted cumulatively. In some communities, there was evidence of ‘clustering’ of seropositive persons in households of persons with histories of or current taeniasis28,29,30,37. In Guatemala, for example, one-third of all seropositive persons were clustered within the same households30. These observations suggest a ‘focal’ pattern of transmission associated with the presence of a tapeworm carrier. There is a need for further studies in other areas where T. solium is currently transmitted to be able to provide baseline epidemiological data and suggest strategies for control.

69

Imported and introduced disease Imported cases of T. solium taeniasis/cysticercosis are those acquired in a foreign country. Onset of illness in NC typically occurs a year or more after initial acquisition of the infection; therefore, among internationally mobile persons exposed to infection, it is not uncommon that development of the disease occurs in a country different from that in which the infection was acquired (‘imported case’). Returning tourists or immigrants can also import intestinal-stage T. solium infections into the country; when the tapeworm carrier travels home or emigrates to a foreign country and inadvertently transmits the infection to another person, or to a pig, the infection has been ‘introduced’ to the host country. More rarely, the infection can be introduced by international transport of infected pigs and subsequent consumption of their infected meat.10,12 Imported disease A unique historical epidemic of imported NC was that which occurred in British troops stationed in India. In at least 450 cases soldiers or their family members developed symptoms 1–30 years (average: 5 years) following their deployment in India48. Approximately a quarter of these patients reported a history of taeniasis; however, little other information was reported on their possible sources of infection. More recently, imported cases of NC are diagnosed every year in countries throughout the world in immigrants or tourists returning from countries where T. solium infection is endemic. This phenomenon is fed by the recent increase in international movement as a result of tourist and business travel and emigration (the World Tourist Organization currently estimates that at least 400 million international border crossings occur each year). In recent years, imported cases of NC have been reported from Australia49–51, Norway52, Spain23, Argentina53, Denmark54 and the USA55. By virtue of the number of immigrants entering the USA every year from countries where T. solium infection is endemic, more cases of imported NC are diagnosed in that country every year

70

P.M. Schantz

than in all other non-endemic countries combined. The recently completed 2000 US Census recorded 35.3 million persons of Hispanic origin living in the USA representing an increase of 12.9 million in the past decade56. Because immigration to the USA from countries where T. solium infection is endemic continues to rise, the numbers of imported cases of NC as well as local transmission from imported tapeworm carriers are likely to increase. Aspects of the impact of this continuing wave of immigration into the USA on the epidemiology of T. solium infection are discussed in greater detail elsewhere in this volume (see Chapter 14) Introduced disease On rare occasions, T. solium has been introduced into a new area and spread epidemically. Such was the case in West Papua (Irian Jaya) where the infection was introduced through swine brought from Bali and given to the local people (Ekari tribals) by the Indonesian government as part of an effort to induce them to accept Indonesian control. Unfortunately, these gift pigs turned out to be a ‘Trojan horse’, because the swine were infected by cysticerci of T. solium and the human population also became infected, with disastrous consequences (see Chapter 12). Local cultural customs and pig husbandry practices facilitated the transmission and rapid spread of the cestode. The first indication of the problem was noted in 1971 when many of the people suffered seizures and burns caused by NC12. As a result of extensive migrations of people with their pigs, the infection has spread throughout the island, possibly including Papua New Guinea, and is now considered a serious emerging health problem10,11. There are no other documented instances of foreign ‘introduction’ and continued transmission of T. solium via infected pigs, however, imported cases of human taeniasis occasionally are linked epidemiologically to clusters of infected pigs in the United States. Such ‘outbreaks’ have been identified by detection of infected swine during routine inspection at slaughter and limited to the exposed cohorts of pigs (Peter M. Schantz, unpublished observations).

Conclusions The only effective solution to the public health problem of T. solium cysticercosis is to prevent transmission of the zoonotic cestode in the thousands of rural communities in Latin America, Africa and Asia where conditions exist to permit the life cycle of T. solium to be completed. Taenia solium infection is widely endemic in rural areas of developing countries where political, socioeconomic and environmental conditions permit the tapeworm’s life cycle in pigs and humans to be completed. Active intervention for control of T. solium infection is still at its infancy and there are many economic and social problems existing in most disease-endemic areas that hinder implementation of these programmes. Even though special studies reveal that morbidity caused by NC can be severe in disease-endemic populations, the nature of the disease and the lack of locally available diagnostic facilities often make NC an essentially silent and unrecognized disease of humans within many affected communities; these realities complicate attempts to motivate and empower the community to initiate measures to control the disease. Pig owners, however, easily recognize the infection in their animals and are aware that cysticercosis reduces the market value of infected pigs and the infection in this valuable meat animal suggests a possible focus for education and prevention measures. In contrast, people rarely understand the relationship between cysticercosis in pigs and taeniasis or cysticercosis in humans and thus lack knowledge and incentive to change behaviour that fosters transmission. In many, if not most, communities where T. solium infection is endemic there is an absence of piped water, sanitary infrastructure, waste disposal, and other basic services; consequently, to be effective in the short-term, intervention measures must be designed to circumvent these deficiencies to the extent possible (see Chapters 41–44). Primary health care facilities are also often lacking or inadequate. Since the disease is generally related to poverty and all its associated manifestations, strategies

Global Distribution and Transmission

to control the disease must consider costs and locally available resources. Nevertheless, the many recent advances in diagnosis and treatment of the disease, and the

71

new knowledge of the impact of the zoonotic disease on local health and the economy, provide incentive and improved means to undertake these tasks57–59.

References 1. Flisser, A. (1994) Taeniasis and cysticercosis due to Taenia solium. Progress in Clinical Parasitology 4, 77–115. 2. Grove, D.I. (1990) Taenia solium taeniasis and cysticercosis. In: A History of Human Helminthology. CAB International, Wallingford, UK, pp. 335–383. 3. Henneberg, R. (1912) The animal parasites of the central nervous system. Handbook of Neurology (German) 3, 642–683. 4. Anonymous (1997) PAHO/WHO Informal Consultation on the Taeniasis/Cysticercosis Complex. Pan American Organization Series HCT/AIEPI-5. Washington, DC, pp. 1–20. 5. Schenone, H.R., Ramirez, A., Rojas, F., et al. (1982) Epidemiology of human cysticercosis in Latin America. In: Flisser, A., Willms, K., Laclette J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 25–38. 6. Banerjee, P.S., Bhatia, B.B., Pandit, B.A. (1994) Sarcocystis suihominis infection in human beings in India. Journal of Veterinary Parasitology 8, 57–58. 7. Singh, S., Singh, N.R., Pandav, C.S., et al. (1994) Toxoplasma gondii infection and its association with iodine deficiency in a residential school in a tribal area of Maharashtra. Indian Journal of Medical Research 99, 27–31. 8. Thakur, L.C., Anand, K.S. (1991) Childhood neurocysticercosis in South India. Indian Journal of Pediatrics 58, 815–819. 9. Wadia, N.H., Desai, S., Bhatt, M.B. (1988) Disseminated cysticercosis. New observations including CT scan findings and experience with treatment by praziquantel. Brain 11, 597–614. 10. Simanjuntak, G.M., Margono, S.S., Okamoto, M., et al. (1997) Taeniasis/Cysticercosis in Indonesia as an emerging disease. Parasitology Today 13, 321–322. 11. Wandra, T., Subahar, R., Simanjuntak, G.M., et al. (2000) Resurgence of epileptic seizures and burns associated with cysticercosis in Assologaima, Jayawijaya, Irian Jaya, Indonesia, 1991–95. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 46–50. 12. Gadjusek, D.C. (1978) Introduction of Taenia solium into West New Guinea with a note on an epidemic of burns from cysticercus epilepsy in the Ekari people of the Wissel Lake area. Papua New Guinea Medical Journal 21, 329–342. 13. Preux, P.M., Avode, G., Bouteille, B.M., et al. (1996) Cysticercosis and neurocysticercosis in Africa: current status. Neurological Infections and Epidemiology 1, 63–68. 14. Graber, M., Chailloux, A. (1970) Existence in Chad of porcine cysticercosis caused by Cysticercus cellulosae (Rudolphi). Revue d’ Elevage et de Medecine Veterinaire de Pays Tropicaux (Paris) 23, 49–55. 15. Permin, A., Yelifari, L., Bloch, P., et al. (1999) Parasites in cross-bred pigs in the upper east region of Ghana. Veterinary Parasitology 87, 63–71. 16. Gelfand, M., Jeffrey, C. (1973) Cerebral cysticercosis in Rhodesia. Journal of Tropical Medicine and Hygiene 76, 87–89. 17. Mafojane, N.A. (1994) The neurocysticercosis project in Atteridgeville-Mamelodi townships. South African Medical Journal 84, 208–211. 18. Powell, S.J., MacLeod, I.N., Proctor, E.M., et al. (1966) Cysticercosis and epilepsy in Africans: a clinical and serological study. Annals of Tropical Medicine and Parasitology 60, 152–158. 19. Sachs, L.V., Berkowitz, I. (1991) Cysticercosis in an urban black South African community: prevalence and risk factors. Tropical Gastroenterology 11, 30–33. 20. Michel, P., Callies, P., Genin, C., et al. (1992) Cysticercosis in Madagascar: diagnostic and therapeutic improvement. Dakar-Médical (Dakar) 37, 191–197. 21. Boa, M.E., Bogh, O.H., Kassuku, A.A., et al. (1995) The prevalence of Taenia solium metacestodes in pigs in northern Tanzania. Journal of Helminthology 69, 113–117. 22. Chinchilla, N., De Andres, D., Gimenez-Roldan, S. (1989) Neurocysticercosis in the urban area of Madrid. Archivos de Neurobiology 52, 287–294.

72

P.M. Schantz

23. Terraza, S., Pujol, T., Gascon, J., et al. (2001) Neurocysticercosis: an imported disease? Medicina Clinica (Barcelona) 116, 261–263. 24. Santos Meneses Monteiro, L.A. (1995) Neurocisticercose no norte de Portugal: Doctoral Disssertation, Institute Ciencias Biomed A. Salazar (ISBN 972–96591–0-9-DL No. 87526/95), 247 pp. 25. Saporiti, A., Brocchieri, A., Grignani, G. (1994) Neurocysticercosis as a cause of epilepsy. A case report. Minerva Medica (Torino) 85, 403–407. 26. Tsang, V.C.W., Boyer, A.E., Brand, J.A. (1989) An enzyme-linked immunotransfer blot assay and glycoprotein antigens for diagnosing human cysticercosis (Taenia solium). Journal of Infectious Diseases 159, 50–59. 27. Sarti, E., Plancarte, A., Schantz, P.M., et al. (1994) Epidemiological investigation of Taenia solium taeniasis and cysticercosis in a rural village of Michoacan state, Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene 88, 49–52. 28. Sarti, E., Aguilera, J., Lopez, A., et al. (1992) Epidemiologic observations on porcine cysticercosis in a rural community of Michoacan State, Mexico. Veterinary Parasitology 41, 195–201. 29. Sarti, E., Flisser, A., Guiterrez, I.O., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis and cysticercosis in humans and pigs in a village in Morelos, Mexico. American Journal of Tropical Medicine and Hygiene 46, 677–685. 30. Allan, J.C., Soto de Alfaro, H., Torres-Alvarez, R., et al. (1996) Epidemiology of intestinal taeniasis in four rural Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157–165. 31. Garcia-Noval, J., Moreno, E., De Mata, F., et al. (2001) An epidemiological study of epilepsy and epileptic seizures in two rural Guatemalan communities. Annals of Tropical Medicine and Parasitology 95, 167–175. 32. Sanchez, A.L., Medina, M.T., Ljungstrom, I. (1998) Prevalence of taeniasis and cysticercosis in a population of urban residence in Honduras. Acta Tropica 69, 141–149. 33. Sanchez, A.L., Gomez, O., Allebeck, P., et al. (1997) Epidemiological study of Taenia solium infections in a rural village in Honduras. Annals of Tropical Medicine and Parasitology 91, 163–171. 34. Sanchez, A.L., Lindback, J., Schantz, P.M., et al. (1999) A population-based case-control study on Taenia solium taeniasis and cysticercosis. Annals of Tropical Medicine and Parasitology 93, 247–258. 35. Sakai, H., Sone, M., Castro, D.M., et al. (1998) Seroprevalence of Taenia solium cysticercosis in pigs in a rural community of Honduras. Veterinary Parasitology 78, 233–238. 36. Tsang, V.C.W., Wilson, M. (1995) Taenia solium: an under recognized but serious public health problem. Parasitology Today 11, 124–126. 37. Cruz, M.E., Schantz, P.M., Cruz, I., et al. (1998) Epilepsy and neurocysticercosis in an Andean community. International Journal of Epidemiology 28, 799–803. 38. Diaz, J.F., Carcamo, C., Castro, M., et al. (1992) Epidemiology of taeniasis and cysticercosis in a Peruvian village. American Journal of Epidemiology 185, 875–882. 39. García, H.H., Gilman, R.H., Gonzales, A.E., et al. (1996) Epidemiologia de la cysticercosis en el Peru. In: García, H.H., Martinez, S.M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo SA, Lima, Peru, pp. 313–326. 40. García, H.H., Araoz, R., Gilman, R.H., et al. (1999) Increased prevalence of cysticercosis and taeniasis among professional fried pork vendors and the general population of a village in the Peruvian highlands. American Journal of Tropical Medicine and Hygiene 59, 902–905. 41. Schantz, P.M., Criales, J.L., Flisser, A., et al. (1994) Community-based epidemiological investigations of cysticercosis due to Taenia solium: comparison of serological screening tests and clinical findings in two populations in Mexico. Clinical Infectious Diseases 18, 879–885. 42. Bern, C., García, H.H., Evans, C., et al. (1999) Magnitude of the disease burden from neurocysticercosis in a developing country. Clinical Infectious Diseases 29, 1203–1209. 43. Canelas, H.M. (1962) Neurocisticercose: incidencia diagnostico y formas. Arquivos de Neuropsiquiatria 20, 1–15. 44. Allan, J.C., Fletes, C., Velasquez-Tohom, M., et al. (1997) Mass chemotherapy for intestinal Taenia solium infection: effect on prevalence in humans and pigs. Transactions of the Royal Society of Tropical Medicine and Hygiene 91, 595–598. 45. Garcia-Noval, J., Allan, J.C., Craig, P.S., et al. (1996) Epidemiology of Taenia solium taeniasis and cysticercosis in two rural Guatemalan communities. American Journal of Tropical Medicine and Hygiene 55, 282–289. 46. Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the Sierra of Peru. Bulletin of the World Health Organization 71, 223–228.

Global Distribution and Transmission

73

47. Diaz, J.F., Gallo, C., García, H.H., et al. (1992) Immunodiagnosis of human cysticercosis: a field comparison of an antibody enzyme-linked immunosorbent assay (ELISA), and an enzyme-linked immunoelectrotransfer blot (EITB) assay in Peru. American Journal of Tropical Medicine and Hygiene 46, 610–615. 48. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an analysis and follow-up of 450 cases. Medical Research Special Report Series. Her Majesty’s Stationery Office, London, 229, 1–58. 49. Oman, K.M., Grayson, M.L., Kempster, P. (1994) Neurocysticercosis and new-onset seizures in short term travelers to Bali. Medical Journal of Australia 161, 399. 50. Yong, J.L.C., Warren, B.A. (1994) Neurocysticercosis: a report of four cases. Pathology 26, 244–249. 51. McDowell, D., Harper, C.G. (1990) Neurocysticercosis – two Australian cases. Medical Journal of Australia.152, 217–218. 52. Dietrichs, E., Aanonsen, N.O., Bakke, S.J., et al. (1994) Tapeworms in the brain – current problem in Norway. The Journal of the Norwegian Medical Association 114, 3089–3092. 53. Villa, A.M., Monteverde, D.A., Rodriguez, W. (1993) Neurocisticercosis en un hospital de la ciudad de Buenos Aires: estudio de once casos. Arquivos de Neuropsiquiatria 51, 333–336. 54. Hansen, N.J.D., Christensen, T., Hagelskjaer, L.H. (1992) Neurocysticercosis: a short review and presentation of a Scandinavian case. Scandinavian Journal of Infectious Diseases 24, 255–262. 55. Schantz, P.M., Wilkins, P.P., Tsang, V.C. (1998) Immigrants, imaging and immunoblots: the emergence of neurocysticercosis as a significant public health problem. Emerging Infections, Vol. 2. ASM Press, Washington, DC, pp. 213–242. 56. Guzman, B. (2001) The Hispanic population. Census 2000 brief. United States, Department of Commerce, C2KBR/01-3, 8 pp. (www.census.gov) 57. Centers for Disease Control and Prevention (1993) Recommendations of the International Task Force for Disease Eradication. Morbidity and Mortality Weekly Report 42 (No. RR-16), 1–27. 58. Gilman, R.H., Dunleavy, M., Evans, C.A.W., et al. (1996) Methods for the control of taeniasis-cysticercosis. In: García, H.H., Martinez, M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo SA, Lima, Peru, pp. 327–340. 59. Schantz, P.M., Cruz, M., Pawlowski, Z., et al. (1993) Potential eradicability of taeniasis and cysticercosis. Bulletin of Pan American Health Organization 27, 397–403.

8

What Have We Learnt From Epidemiological Studies of Taenia solium Cysticercosis in Peru? Hector H. García, Robert H. Gilman, Armando E. Gonzalez, Manuela Verastegui, Victor C.W. Tsang, and The Cysticercosis Working Group in Peru

Introduction Taenia solium taeniasis/cysticercosis has been known since antiquity (it is probable that suspicion as to its origins led some religions to expressly forbid the consumption of pork), but the epidemiology of human and porcine infection and disease has been poorly understood until recently. The lack of an accurate screening tool in the community setting was a barrier to the understanding of the magnitude of infection burden. The design of the enzyme-linked immunoelectrotransfer blot (EITB), the most sensitive and specific serological assay so far available, was a turning point in population studies of cysticercosis. In Peru, South America, the Cysticercosis Working Group (CWG) was formed through the efforts of professionals of different disciplines (biologists, biochemists, clinicians, epidemiologists and others), institutions and countries. The group performed a series of studies oriented to describe the epidemiological characteristics of taeniasis/cysticercosis for T. solium. This information is summarized in the present chapter.

Studies in General Population Overview of seroprevalence studies in Peru Peru, located in South America has 24 million inhabitants. The population is of mixed

ethnicity; most people are Catholic. The country is divided into three clearly defined zones by the Andean mountains: the arid Coast, the Highlands and the tropical Jungle. The geographic divisions served well as a guide to define regional prevalence of T. solium infection within Peru. Cysticercosis was believed to be endemic in the Highlands, and certain zones of the Coast and Jungle. The earliest surveys by the CWG were carried out in communities that were believed to be highly endemic for T. solium cysticercosis1–3. In 1988, two Jungle communities, Maceda (population: 421; altitude: 500 m)1 and Churusapa (population: 275; altitude: 500 m) were sampled. Both were typically representative of the High Jungle communities: each was located close to a river, had an agriculture-based economy and a tropical climate. The survey found that houses were made of adobe, with dirt floors. There was no electricity or water supply; water for consumption was obtained from the river. Further, pigs and other domestic animals were raised free (rarely corralled) and had access to human dwellings. Only a few houses had latrines. Census, mapping, human stool sampling, human and porcine blood sampling, and porcine tongue examination were performed after obtaining population consent. A total of 25 soil samples (five in Maceda and 20 in

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

75

76

H.H. García et al.

Churusapa) and five water samples (each after concentrating 250–500 l of river water) were obtained. The study determined that the EITB-human seroprevalence was 8% and porcine seroprevalence, 45% (Table 8.1). The coproparasitological survey detected Taenia eggs in about 1% of the human population. Most seropositive individuals were neurologically asymptomatic. Taenia ova were not found in any soil or water sample. Subsequently, the CWG focused upon a different geographical environment, the Highlands. A survey was carried out in Haparquilla (population: 371; altitude: 3400 m), a village in the southern Highlands, close to Cusco, in 19903. The Highlands are different from the jungle in that the weather is much colder. Moreover, the survey found that pigs were mostly corralled in the backyards. There were virtually no latrines and villagers defecated in their backyards. Electricity supply existed, however there was no facility of potable water. Human seroprevalence in the Highland community was found to be 13% and was comparatively higher than in the jungle communities. Porcine seroprevalence was similarly high (Table 8.1)2. Two years later, we performed a survey in Saylla, another community in the Highlands, with the help

of the Mother’s Club of the village, and obtained similar findings3. In order to obtain a thorough assessment of the geographical prevalences within Peru, the CWG studied an endemic community (Monteredondo) in the Coastal zone (population: 1200; altitude: 300 m)4. An inspection of this region noted that pigs were kept tied, and human faeces were disposed in the fields, but usually in fixed places. A total of 489 individuals were sampled and human seroprevalence was estimated at 16%. However, interestingly, seroprevalence in pigs (13%) was considerably less than human seroprevalence as well as prevalence figures in porcine populations in other geographic locations (Table 8.1)4. The low prevalence in pigs was somewhat unexpected. When the CWG attempted to analyse the reasons behind the low rates of porcine infection in this community, it found that the Monteredondo community began to grow rice, 3 years before the survey. This led the villagers to tether pigs in order to protect the rice crop. Therefore, at the time of the survey, all pigs were less than 3 years of age and were tethered; accordingly seropositvity rates were low. Serological status in humans remained high since it represented the cumulative effects of exposure over a

Table 8.1. Characteristics of human and porcine populations and EITB based seroprevalence of Taenia solium cysticercosis in Peru. Jungle villages Community Population sampled

Maceda

Highland villages

Coastal village

Churusapa

Haparquilla

Saylla

Monteredondo

371 (88%)*

134 (48%)*

108 (30%)*

99 (20%)*

489

General population

General population

General population

Mothers’ Club and relatives

General population

Human seroprevalence Males Females

8% 7% 9%

7% 6% 7%

13% 10% 15%

24% 41% 18%

16% 13% 20%

Stool disposal

Open field

Open field

Backyard

Backyard

Defined

Type of sample

Porcine seroprevalence

43% (57/133)

49% (43/87)

46% (51/110)

36% (19/53)

13%

Pig raising

Free

Free

Free/corralled

Free/corralled

Tied

*Figures in parentheses represent the percentage of the total population of the village that was sampled.

Lessons from Epidemiological Studies in Peru

much longer period of time. Other community surveys have similarly described high seroprevalence rates in endemic communities within Peru; 15 (13%) out of 112 individuals attending a health centre in Pomabamba, Ancash, and 72 (21%) out of 334 in Vichaycocha, Central Highlands were seropositive. Two large-scale surveys in a population of 3000 in Quilcas (Huancayo, Central Highlands) and 4500 in Andahuaylas (Apurimac, southern Highlands) established seroprevalence rates of 12–15%. In addition, a recent survey in Tumbes in the northern Coast, found 22% of individuals sampled to be seropositive. The above findings are representative of the prevalence in T. solium endemic regions of Peru. In non-endemic areas, the seroprevalence has been consistently found to be less than 1% (1% in unselected urban groups in Lima5 and a specialized sheep-raising cooperative farm in the Highlands6 and no seropositive cases among the low-Jungle communities in Iquitos and La Merced).

Longitudinal studies of seroprevalence The high seroprevalence rates of T. solium antibodies with EITB in disease-endemic populations contrasts with the relatively small number of symptomatic cases of NC among seropositive individuals as well as a large number of putatively inactive brain lesions (mainly calcifications) in seronegative controls. These findings have been borne out in epidemiological studies of T. solium cysticercosis in Peru in common with data from Mexico (see Chapter 9) and Central America (see Chapter 10). The discrepancies have often been a source of confusion. When longitudinal serological data from general population serosurveys in disease-endemic areas were analysed, it was noted that about 40% of initially seropositive individuals became seronegative when resampled after one year7. This phenomenon was first observed between 1993 and 1994 in Monteredondo4,7. Between two consecutive serosurveys, 1 year apart, six (32%, 95%CI: 11–52%) out of 19 initially seropositive individuals in the community reverted to seronegative. In a different

77

location (Quilcas, Central Highlands), 398 villagers were sampled in 1996; 140 were found to seropositive while 258 were seronegative. Three years later, in 1999, 69 out of the 140 that were initially seropositive (50%; 95%CI: 41–58%) were now seronegative. These data demonstrated that many newly infected (or exposed) individuals developed only transient serologic antibody reactions. These individuals may have been exposed to T. solium, but did not eventually develop viable infection, or they may have had cysticercosis that spontaneously resolved. This could also explain the discrepant finding of high background levels of putatively inactive, calcified brain lesions in seronegative controls8–10; it may be surmised that these currently seronegative individuals had transient seropositivity in association with active or transitional cysticercosis that eventually resolved with calcification.

From initial evaluation to intervention The CWG also studied the feasibility of control of T. solium with combined mass human and porcine chemotherapy in the Central Highlands. The prevalence of porcine infection did decrease temporarily; however it soon returned to the pre-intervention levels (CWG, unpublished data). The reader is referred to Chapters 41 and 43 for more comprehensive descriptions of these studies. Geographic position system analysis demonstrated clustering of new infections in pigs around the houses with Taenia carriers (see Chapter 15). Moreover, the pattern of appearance of new cases suggested that immigration from other endemic areas was the major contributor to control failure (CWG, unpublished data).

Studies in Hospital-based Population In order to determine the relationship between EITB-based T. solium seropositive status and neurological disease, 204 of 231 patients consecutively admitted to a neurology ward in Lima were studied5. Twentyone (12%) of 173 patients, who agreed to

78

H.H. García et al.

give blood samples were seropositive. There was however, discordance between clinical and serological diagnoses: over half of the patients clinically diagnosed as having cysticercosis were seronegative. On the other hand, ten seropositive patients had diagnoses other than cysticercosis. One of them had intestinal Taenia infection and another previously had surgery for cerebral cysticercosis (antecedent was not recorded in the current clinical chart). Three seropositive subjects were diagnosed to have NC by computed tomography (CT) scan (showing multiple cysts) upon follow-up, one had a lesion diagnosed on CT as ‘expansive temporal lesion’, and another patient had hydrocephalus5. Another serological survey was performed upon patients visiting a private radiology centre for brain CT scan10. Seroprevalence was 8% in this population. Again, there were discrepancies between radiological diagnoses and seropositive status. Moreover, when the scans were interpreted by a second neuroradiologist (masked to the original interpretation), only one of ten scans was confirmed as having ‘active’ NC, and five of 14 were not recognized as having NC. At the Instituto de Ciencias Neurológicas, Lima, 498 neurological outpatients were examined by EITB11. Of patients with seizures, 12% were seropositive, compared with 3% of those with other neurological symptoms. Seroprevalence increased to 20% if patients had late-onset epilepsy or were born outside Lima, and to 29% if they had both risk factors. The relationship between serological status and seizures was also evaluated in the community setting during a survey in Monteredondo12. Of 52 individuals who were evaluated, 49 had neurological symptoms. Fourteen (34%) of 41 epileptic individuals were found to be seropositive, in comparison to one (12.5%) of eight with headache and/or dizziness. Of the 14 seropositive epileptic individuals, 13 agreed to undergo CT. Seven of these 13 scans revealed evidence of NC: single cyst (2), multiple cysts (1), two calcifications (2), and multiple calcifications (2). In a different community in Huaraz, five (35%)

seropositive cases were found among 16 individuals with history of seizures13. Eight of them (four seropositive and four seronegative) agreed to undergo complete neurological and CT examination at a reference centre. All four seropositive individuals had evidence of NC upon CT: single enhancing lesion (1), multiple live cysts and calcifications (1) and multiple calcifications (2). The four seronegative individuals had normal cerebral CT scans. Age of onset of seizures was 17 or older in seven of the eight patients (excepting one seropositive case). When results of consecutive EITB-based serological studies at a serological laboratory of a large hospital were evaluated, the overall proportion of positive cases was 18% in serum samples and 28% in CSF samples14. Factors potentially associated with seropositivity were analysed using logistic regression techniques. Four factors were significantly associated with a positive test: to be born outside Lima, to have raised pigs, age older than 20, and a history of taeniasis. We have also studied the time to disappearance of antibodies in a series of 50 patients with NC treated with albendazole15,16. Only three of the 14 cured patients became seronegative at one year after successful treatment. In most patients, who had strong baseline serology (displaying all seven reactive bands on EITB), the reactive bands persisted at the end of 1 year of follow-up. Interestingly, an increase in the number of bands was observed around the second week of therapy in patients with viable cysts. A careful coproparasitological evaluation of a prospective series of patients with NC identified intestinal taeniasis in 15%. This prevalence was higher than expected. A direct correlation between the number of cysticerci and the presence of intestinal T. solium was noted, suggesting that heavy infections were commonly the result of autoinfection17. Furthermore, we have confirmed elsewhere that the frequency of adult T. solium infection is high among patients with massive cysticercus infection18. When imaging features in seropositive individuals were analysed it was found that individuals with transitional (enhancing)

Lessons from Epidemiological Studies in Peru

lesions were younger in comparison to those with active (viable) cysts; at older ages both active (viable) cysts and calcified lesions were frequent. This suggested that some infections (probably those with lesser numbers of parasites) were controlled by the host immune response resulting in early death of parasites, whereas others persisted for long periods. Patients with hydrocephalus were older than those with viable cysts, enhancing lesions, or calcifications alone (CWG, unpublished data).

Porcine Cysticercosis Porcine cysticercosis has been reviewed by Gonzalez et al. (Chapter 15). Certain features that are specifically relevant to the understanding of the epidemiology of T. solium cysticercosis in Peru are discussed here. Before 1990, the veterinary team of the CWG evaluated the sensitivity and specificity of tongue palpation vis-à-vis EITB serology, in a controlled design. When evaluated against necropsy, tongue palpation was over 70% sensitive and highly specific, whereas EITB detected all necropsy-positive pigs19. The veterinary team also studied and identified the pig marketing circuits in Peru. They noted that official marketing and slaughtering facilities were completely circumvented by peasants particularly in the Central Highlands. Slaughtering was performed under clandestine conditions; infested carcasses thus obtained were later introduced into the formal market. A significant proportion of commercialized pork was infected in the Highlands. Infected pork was sold at cheaper prices and often mixed and disguised with clean meat in order to facilitate its sale to public eating facilities20. Other major accomplishments of the veterinary team of the CWG include the establishment of the feasibility of using sentinel pigs as an indicator of the burden of infection in a given area21, demonstration of the passive transplacental transfer of immunity and seropositivity22, the use of drugs such as albendazole and oxfendazole for treatment in control measures23–27 and of intramuscular inoculation in an experimental model of porcine cysticerco-

79

sis28. The reader is referred to Chapter 15 for a comprehensive review of these studies.

Conclusions After more than a decade of studies by the CWG, several concepts have emerged while others have been clarified. The most significant of these is that taeniasis/cysticercosis is extremely common in Peru. The magnitude of transmission may be as high as 25% of humans infected at a given time in hyperendemic villages, and may easily be over 10% in many endemic zones. While seroprevalence rates are high, neurologically symptomatic individuals constitute the tip of the iceberg. Also, a proportion of asymptomatic individuals has imaging abnormalities suggestive of NC7–9; these are mainly seronegative individuals with residual, inactive calcified brain lesions. On a converse note, it is also common to encounter asymptomatic seropositive individuals in community studies. As for many other infectious diseases, seropositivity in asymptomatic individuals is generally interpreted as a marker of current subclinical or past infection. A common pitfall in the interpretation of serological data is to compare different kinds of populations. A 10% prevalence in neurological patients at a large urban medical facility (where the overall seroprevalence is likely to be below 10%) cannot be equated to a 10% prevalence in the general population of an endemic community (where surveying epileptic patients may reveal seroprevalence rates of 30–35%). Another pitfall is to assume that, since the majority of seropositive individuals in endemic communities are asymptomatic, seropositivity has no relationship with neurological symptoms. Some authors have questioned the role of NC in the aetiology of seizure disorders. However, studies by the CWG in Peru have demonstrated that seroprevalence rates in neurological patients are consistently much higher than in comparable general populations. This increases further when specific subgroups, for instance, those with late onset seizures are examined. Another important outcome of the work done by the CWG is the realization of the intimate

80

H.H. García et al.

relationship between domestic pig raising, taeniasis and human cysticercosis. Porcine seroprevalence reflects recent infection and porcine serosurveys are the fastest and least expensive method to document levels of ongoing transmission. Pigs are infected early in life29 and are usually slaughtered by the age of 1 year. In a survey in an urban commercial pig slaughterhouse, no animals had cysticercosis. Usually porcine seroprevalence is twice that of human seroprevalence. However, Monterendondo was an exception. Thus human seroprevalence reflects cumulative effect of past exposure, while porcine seroprevalence is an indicator of recent trends in infection burden in a given community.

The CWG is now in the concluding phase of a randomized study designed to evaluate the clinical benefits of anticysticercal therapy for NC, along with radiological (CT/MRI) and immunological (clinical significance of individual antibodies, antigen detection30,31, cytokine pathways32) studies in the natural and post-treatment evolution of human NC.

Acknowledgements Support from grants FD-R-001107 from the Food and Drug Administration, and U19A145431 from NIAID/NIH (USA) is acknowledged.

References 1. Diaz, F., García, H.H., Gilman, R.H., et al. (1992) Epidemiology of taeniasis and cysticercosis in a Peruvian village. American Journal of Epidemiology 135, 875–882. 2. García, H.H., Araoz, R., Gilman, R.H., et al. (1998) Increased risk for cysticercosis and taeniasis among professional fried pork vendors and the general population of a village in the Peruvian highlands. American Journal of Tropical Medicine and Hygiene 59, 902–905. 3. García, H.H., Gilman, R.H., Gonzalez, A.E., et al. (1999) Human and porcine T. solium infection in a village in the Highlands of Cusco, Peru. Acta Tropica 73, 31–36. 4. Gilman, R.H., García, H.H., Gonzalez, A.E., et al. (1999) Shortcuts to development: methods to control the transmission of cysticercosis in developing countries. In: García, H.H., Martínez, S.M. (eds) Taenia solium Taeniasis/Cysticercosis, 2nd edn. Editorial Universo SA, Lima, Peru, pp. 313–326. 5. García, H.H., Martinez, M., Gilman, R.H., et al. (1991) Diagnosis of cysticercosis in endemic regions. Lancet 338, 549–551. 6. Moro, P.L., Guevara, A., Verastegui, M., et al. (1994) Distribution of hydatidosis and cysticercosis in different Peruvian populations as demonstrated by an enzyme-linked immunoelectrotransfer blot (EITB) assay. American Journal of Tropical Medicine and Hygiene 51, 851–855. 7. García, H.H., Gonzalez, A.E., Gilman, R.H., et al. (2001) Transient antibody response in Taenia solium infection in field conditions: a major contributor to high seroprevalence. American Journal of Tropical Medicine and Hygiene (in press). 8. Cruz, M.E., Schantz, P.M., Cruz, I., et al. (1999) Epilepsy and neurocysticercosis in an Andean community. International Journal of Epidemiology 28, 799–803. 9. Sanchez, A.L., Lindback, J., Schantz, P.M., et al. (1999) A population-based, case-control study of Taenia solium taeniasis and cysticercosis. Annals of Tropical Medicine and Parasitology 93, 247–258. 10. García, H.H., Herrera, G., Gilman, R.H., et al. (1994) Discrepancies between cerebral computed tomography and western blot in the diagnosis of neurocysticercosis. American Journal of Tropical Medicine and Hygiene 50, 152–157. 11. García, H.H., Gilman, R., Martinez, M., et al. (1993) Cysticercosis as a major cause of epilepsy in Peru. Lancet 341, 197–200. 12. García, H.H., Gilman, R.H., Tsang, V.C.W., et al. (1997) Clinical significance of neurocysticercosis in endemic villages. Transactions of the Royal Society of Tropical Medicine and Hygiene 91, 176–178. 13. García, H.H., Talley, A., Gilman, R.H., et al. (1999) Epilepsy and neurocysticercosis in a village in Huaraz, Perú. Clinical Neurology and Neurosurgery 101, 225–228. 14. García, H.H., Gilman, R.H., Tovar, M., et al. (1995) Factors associated with T. solium cysticercosis. Analysis on 946 Peruvian neurologic patients. American Journal of Tropical Medicine and Hygiene 52, 147–150.

Lessons from Epidemiological Studies in Peru

81

15. García, H.H., Gilman, R.H., Horton, J., et al. (1997) Albendazole therapy for neurocysticercosis: a prospective double blind trial comparing 7 vs. 14 days of treatment. Neurology 48, 1421–1427. 16. García, H.H., Gilman, R.H., Catacora, M., et al. (1997) Serological evolution of neurocysticercosis patients after antiparasitic therapy. Journal of Infectious Diseases 175, 486–489. 17. Gilman, R.H., Del Brutto, O.H., García, H.H., et al. (2000) Prevalence of taeniasis among neurocysticercosis patients is related to the severity of cerebral infection. Neurology 55, 1062. 18. García, H.H., Del Brutto, O.H. and The Cysticercosis Working Group in Perú (1999) Heavy nonencephalitic cerebral cysticercosis in tapeworm carriers. Neurology 53, 1582–1584. 19. Gonzalez, A.E., Cama, V., Gilman, R.H., et al. (1990) Prevalence and comparison of serologic assays, necropsy, and tongue examination for the diagnosis of porcine cysticercosis in Peru. American Journal of Tropical Medicine and Hygiene 43, 194–199. 20. Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the sierra of Peru. Bulletin of the World Health Organization 71, 223–228. 21. Gonzalez, A.E., Gilman, R.H., García, H.H., et al. (1994) Use of sentinel pigs to monitor environmental Taenia solium contamination. American Journal of Tropical Medicine and Hygiene 51, 847–850. 22. Gonzalez, A.E., Verastegui, M., Noh, J.C., et al. (1999) Persistence of passively transferred antibodies in porcine Taenia solium cysticercosis. Veterinary Parasitology 86, 113–118. 23. Gonzalez, A.E., García, H.H., Gilman, R.H., et al. (1995) Treatment of porcine cysticercosis with albendazole. American Journal of Tropical Medicine and Hygiene 53, 571–574. 24. Gonzalez, A.E., García, H.H., Gilman, R.H., et al. (1996) Effective, single dose treatment of porcine cysticercosis with oxfendazole. American Journal of Tropical Medicine and Hygiene 54, 391–394. 25. Gonzalez, A.E., Falcon, N., Gavidia, C., et al. (1997) Treatment of swine cysticercosis with oxfendazole: a dose-response trial. Veterinary Record 141, 420–422. 26. Gonzalez, A.E., Falcon, N., Gavidia, C., et al. (1998) Time–response curve of oxfendazole in the treatment of swine cysticercosis. American Journal of Tropical Medicine and Hygiene 59, 832–836. 27. Verastegui, M., Gonzalez, A.E., Gilman, R.H., et al. (2000) Experimental infection model for Taenia solium cysticercosis in swine. Veterinary Parasitology 94, 33–44. 28. Gonzalez, A.E., Gavidia, C., Falcon, N., et al. (2001) Cysticercotic pigs treated with oxfendazole are protected from further infection. American Journal of Tropical Medicine and Hygiene 65, 15–18. 29. Diaz, F., Verastegui, M., Gilman, R.H., et al. (1992) Immunodiagnosis of human cysticercosis (Taenia solium): a field comparison of an antibody-enzyme-linked immunosorbent assay (ELISA) an antigen-ELISA and an enzyme-linked immunoelectrotransfer blot (EITB) assay in Peru. American Journal of Tropical Medicine and Hygiene 46, 610–615. 30. García, H.H., Harrison, L.J.S., Parkhouse, R.M.E., et al. (1998) Application of a specific antigen detection ELISA to the diagnosis of human neurocysticercosis. Transactions of the Royal Society of Tropical Medicine and Hygiene 92, 411–414. 31. García, H.H., Parkhouse, R.M.E., Gilman, R.H., et al. (2000) Serum antigen detection in the diagnosis, treatment, and follow-up of neurocysticercotic patients. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 673–676. 32. Evans, C.A.W., García, H.H., Hartnell, A., et al. (1998) Elevated concentrations of eotaxin and interleukin-5 in human neurocysticercosis. Infection and Immunity 66, 4522–4525.

9

Epidemiology of Taenia solium Taeniasis and Cysticercosis in Mexico Elsa Sarti

Introduction Taenia solium taeniasis and cysticercosis are important public health problems in several developing countries of Latin America, Africa and Asia. Mexico has one of the highest frequencies of disease in the Americas1–4. It also has a long history, spanning over three decades, of the development of surveillance, preventive and control strategies with specific reference to T. solium cysticercosis. These and several other aspects of epidemiology of human and porcine cysticercosis and human taeniasis in Mexico are reviewed in this chapter. Mexico is the third largest country in Latin America (after Brazil and Argentina), with an area of 1,972,550 square kilometres. It has a population of almost 100 million, 35% of which live under marginal conditions. Ethnically, most (60%) Mexicans are of Mestizo origin. The official literacy rate was 88% in 1990. Health care personnel and facilities are generally concentrated in urban areas; care in rural areas consists of understaffed clinics operated mostly by medical graduates. Leading causes of death are infections, including parasitic diseases, and respiratory and circulatory failure. Spanish is the official language, spoken by nearly all. However, knowledge of English is increasing rapidly, especially among business people,

the middle class, returned emigrants and the young. The annual population growth rate is 1.96%. The nation underwent a rapid change in the last few decades of the 20th century and Mexicans are viewed as urban, opening to democracy and market-oriented.

Human Intestinal Taeniasis The reported prevalence of intestinal T. solium infection in Mexico is between 0.2% and 3.4%2,3,5–9. This amounts to nearly 1.5 million potential transmitters of Taenia eggs, capable of producing new cases of neurocysticercosis (NC). An average of 13,000 cases of Taenia sp. infection were reported every year during the last 5 years by the National Epidemiological Surveillance System, giving an incidence of 3.8 per 100,000 inhabitants (Fig. 9.1)7,10. Official statistics reveal highest frequency in individuals under 14 years of age with no statistical difference by gender7,10. In comparison, several epidemiological surveys have established peak levels between 16 and 45 years of age (economically productive life) with predominance in women2,5–9,11. These discrepancies reflect differences in ‘taeniasis’ case definitions and methodologies adopted by the two sources of data. While surveillance systems consider only patients

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

83

11.49 –13.1 (1 state)

5.75 – 11.48 (3 states)

2.88 – 5.74 (13 states)

0.19 – 2.87 (15 states)

*Incidence rate by 100,000 inhabitants in Mexico (average 3.0)

Fig. 9.1. State-wise and age-wise incidence of Taenia sp. infection in México, 1994–2000 (Source: National epidemiological surveillance system)10.

Older than 65 years

45–64

Less than 1 year old 1 –4 5 –14 15–24 25–44

0

25

43

*Incidence rates by group of age (100,000 inhabitants)

84 E. Sarti

Epidemiology of Taeniasis and Cysticercosis in Mexico

requesting assistance in local health units, planned epidemiological studies obtain data from house-to-house surveys. The latter, apparently, are more representative of the community burden.

Human Cysticercosis Initially, considerable information on human cysticercosis was derived from cases seen in neurological services of hospitals and necropsy series of general hospitals in Mexico. The frequency of NC from hospital facilities in Mexico appeared to be as high as 8.6 per 100 patients1,3,12. Cysticercosis was detected in 4–13% of large hospital-based autopsy series1,2,13. Neurocysticercosis was listed as the cause of death in 40–80% of autopsy protocols that reported cysticercal infestation. Official sources from Mexican surveillance currently estimate an average of 500 new cases every year, giving a nationwide incidence of 0.6 per 100,000. These projections underestimate the incidence and prevalence of human cysticercosis in Mexico, since a number of cases in rural areas, where facilities for contemporary diagnosis (like computed tomography, magnetic resonance imaging and serology) do not exist, are not registered. Nevertheless, official registers do give us a general idea about the geographical and demographic predilections of human cysticercosis in Mexico (Fig. 9.2). The seroprevalence of cysticercosis using immunoelectrophoresis (IEF) and indirect haemagglutination (IHA) was 1–3% of the population studied. With newer techniques such as the ELISA and EITB (enzyme-linked immunoelectrotransfer blot, better known as ‘blot’), the prevalence has been estimated at around 10%5–9,14,15. Seroprevalence rates are highest between 15 and 45 years of age and in women.

Swine Cysticercosis The reported average prevalence of cysticercosis in swine, from official registered slaughterhouses in Mexico is 0.2%3,16. This

85

figure is at best, an underestimate. It is common to find a large number of informal slaughterhouses without veterinary inspection, in addition to the registered ones in the country. No information on the status of porcine infection in these unauthorized facilities is available. Swine in registered slaughterhouses represent only 40% of the total swine slaughtered3,16. Besides, infected pigs are unlikely to be brought to abattoirs for slaughter. Undernotification may also occur on account of lack of trained personnel in slaughter facilities and of standardized screening practices among meat vendors. In addition to slaughterhousebased data, information has been collected from sampling domestic and free-ranging pigs in Mexico. Tongue inspection and palpation and EITB have been used as methods of evaluation in such studies. The prevalence of porcine cysticercosis was found to vary between 1.4 and 4.0% using tongue inspection or palpation and from 4.1% to 7.0% with EITB6,9,16–17,18. Seroprevalence rates increased with age and peaked at 11 months.

An Overview of Epidemiological Studies from Mexico The study of the taeniasis–cysticercosis complex in Mexico has progressed through logical and sequential steps. It began with investigations into disease frequency at necropsy and later, in clinical series at neurological and neurosurgical services. Studies then progressed towards the search of an adequate, reliable, and convenient diagnostic and screening test, available for use, both in hospital facilities and the community. In the 1970s, epidemiological studies were directed towards the study of prevalence of T. solium. In the 1980s, research looked into risk factors for transmission. Simultaneously, standardization of methods for the diagnosis of taeniasis and cysticercosis, for instance the use of EITB and sound statistical techniques, was undertaken. Finally in the 1990s, intervention studies began examining strategies for control of taeniasis–cysticercosis.

0– 0.19 (4 states) 0.20 – 0.63 (14 states) 0.64 – 2.52 (9 states) 2.53 – 3.94 (5 states)

*Incidence rate by 100,000 inhabitants in Mexico (average 0.5)

Fig. 9.2. State-wise and age-wise incidence of neurocysticercosis in México, 1994–2000 (Source: National epidemiological surveillance system)10.

0 Less than 1 year old 1 –4 5 –14 15 –24 25 –44 45 –64 Older than 65 years

6

12

*Incidence rates by group of age (100,000 inhabitants)

86 E. Sarti

Epidemiology of Taeniasis and Cysticercosis in Mexico

Step 1 (Estimation of disease prevalence) A national survey with urban representation was carried out in 197419. Blood samples of 18,417 individuals were examined for anticysticercus antibodies by IEF; 1% of the population was found to be positive. Earlier, a survey in Oaxaca in 1971 revealed a seropositivity of 3.3% by IHA20. In several communities of Chiapas, seroprevalence by IEF ranged between 0.4% and 7.6%21. Some of the early epidemiological investigations were criticized for not having used rigorous epidemiological methods. Nevertheless, a general idea of disease frequency could be drawn. In 1992, a second nationwide seroepidemiological survey was conducted using a systematic approach. From 66,754 blood samples analysed by IHA, anticysticercus antibodies were detected in 1.2%22. The highest prevalences were noted in West and Southeast Mexico. Our studies using EITB vis-à-vis ELISA for screening established an association of EITB positivity (but not ELISA positivity) with late-onset convulsions6,14,23. Neuroimaging abnormalities compatible with NC were significantly more common in individuals with late-onset convulsions. This led us to infer a risk factor association between cysticercosis and late-onset convulsions and established the superiority of EITB over ELISA as a tool for community screening. It was also found that immunological tests detect exposure to the parasite besides the infection and active disease. Therefore, in the 1990s, EITB was employed for further human sero-surveys. Coproparasitological examinations of faeces with Ritchie, Katz and Faust techniques and faecal antigen assays have been used for screening of intestinal taeniasis24,25. However, both techniques yielded poor results. Incidentally, a simple inquiry about having passed proglottides was found to be a fairly reliable indicator of intestinal taeniasis. This inquiry is simpler and more effective than sophisticated, expensive and timeconsuming faecal tests. Therefore, therapeutic taeniacidal intervention on the basis of this inquiry alone is recommended.

87

The prevalence of intestinal taeniasis using standard coproparasitological evaluations was 0.2–0.4%5,6,8,9,14,17,23,26–29. EITB based seroprevalence of human cysticercosis varied between 4.9% and 10.9%5,6,8,9,14,17,23,26– 29. The prevalence of porcine cysticercosis based on tongue inspection and palpation was 1.4% to 23.8% and using EITB was around 4%6,9,16,18.

Step 2 (Determination of risk factors) In the 1980s, a number of epidemiological and statistical investigations focused on determination of magnitude of disease and risk factors. The first such study was undertaken in ‘El Sótano’, a small community of 150 inhabitants in 19845. An association between ELISA seropositivity and tapeworm carriage, symptoms compatible with cysticercosis (generalized convulsions), swine cysticercosis, and presence of latrines in homes was observed in this study5. Clusters of infection in the ‘El Sótano’ study, suggested that the source of transmission of infection lay within the household (living closely with the tapeworm carrier) rather than the environment. Subsequent studies from Mexico and Central America using EITB and structured questionnaires have confirmed the observations6,9,26,27,30,31. In these studies, cardinal risk factors for human taeniasis included: (i) history of having passed proglottides in stools; and (ii) consumption of uncooked or infected pork. Risk practices that were associated with human cysticercosis included: (i) drinking unboiled water; and (ii) not washing hands before eating food and after defecation. On the other hand, rates of swine cysticercosis were determined by numbers of free-ranging pigs with access to human faeces. The above mentioned human and porcine behaviours facilitate the ‘human–environment–pig–human’ cycle. Modifications of these behaviours were considered as potential strategies for control of the taeniasis–cysticercosis complex. Transmission, other than the human– environment–pig–human cycle has been suggested, for instance, through flies and by ingestion of fruits and vegetables contami-

88

E. Sarti

nated by Taenia eggs32. These modalities of transmission have not been confirmed by studies in Mexico6,17,33.

Step 3 (Developing interventions for control) An evaluation of the efficacy of mass taeniacidal treatment was carried out during 1990, in a community in Sinaloa26. Praziquantel treatment was administered to the population of approximately 2000 inhabitants. Before treatment, 1.3% of the individuals had taeniasis and only one out of the 72 pigs examined had cysticercosis. Treatment lead to complete eradication of intestinal taeniasis but data on porcine cysticercosis was inadequate. By comparison, another study in 1987 provided insights into the role of health education, and demonstrated that health promotion could be a short-term alternative26,27. A promotional campaign emphasizing upon the need to construct latrines in every home and the hazards of open-air defecation was conducted in schools. The study demonstrated that the campaign created awareness about the parasite; unfortunately, mass taeniacidal treatment of members of this community was not successful as the prevalence of porcine cysticercosis had doubled 1 year after intervention. It must be mentioned that this study was not oriented to community intervention, but to the identification of the risk factors. We have evaluated two alternative strategies for control of T. solium in the last decade: (i) mass taeniacidal drug administration; and (ii) health education28,29,34. Both measures were applied to three rural communities of Mexico with similar social, economical and cultural characteristics. Community ‘A’ received mass praziquantel treatment (5 mg kg1), community ‘B’ received health education and community ‘C’ received both mass praziquantel treatment and health education. Demographic, epidemiological, clinical, sanitary and sociological data from 98% of the inhabitants were obtained. Evaluations were performed 6 and 42 months after intervention. Prevalence and incidence rates of taeni-

asis were measured by the frequency of Taenia coproantigens and Taenia eggs in faeces. Swine cysticercosis was measured by palpating tongue and the presence of serum antibodies. Changes in knowledge, attitudes and practices in the communities were evaluated by questionnaires prepared ex professo as well as by direct observation by interviewers. Praziquantel treatment reduced rates of taeniasis by 66%. However, treatment alone, had no impact on swine cysticercosis. A 66–77% decrease in swine cysticercosis was observed in communities where health education was provided (‘B’ and ‘C’). Evaluation of long-term outcome (42 months after the intervention) revealed a reduction of 48% of taeniasis in community ‘B’. This underscored the importance of health education in the effective control of taeniasis–cysticercosis. Health education had a twofold effect. Improved sanitary practices and curtailing free-ranging pigs led to a decrease in the frequency of porcine cysticercosis and ultimately human taeniasis. Secondly, awareness of the utility of taeniacidal treatment and its use prevented human and porcine cysticercosis. Results of our studies suggested that health educational programmes are effective for T. solium control.

Mexican Surveillance to Monitor and Control Taeniasis–Cysticercosis Mexico has a Unique Information System for Epidemiological Surveillance (SUIVE) generating information on community healthrelated risk factors, treatment and control at all operative levels. Information on several diseases subject to epidemiological surveillance, including taeniasis and cysticercosis is collected in a specifically prepared format by some 17,000 primary health care units and is transmitted to State and Federal health authorities for analysis at a national level. Health care personnel manning the primary health care units are imparted continuing education regarding simple and effective screening and treatment of taeniasis and cysticercosis. It is recommended that all individuals presenting to these centres for health

Epidemiology of Taeniasis and Cysticercosis in Mexico

check-ups and treatment for any ailment should be screened for taeniasis–cysticercosis. As mentioned earlier, a simple inquiry about the passage of proglottides suffices as a screening tool. Both cases that are identified as positive by screening and their families should be offered taeniacidal treatment.

Conclusions The prevalence of human taeniasis in Mexico varies between 0.2% and 0.4%, while that of human cysticercosis is 4.9–10.9% and that of

89

swine cysticercosis may be as high as 23.8%. Risk behaviours for taeniasis include freeranging pigs with access to human faeces and poor personal hygiene. Human cysticercosis, on the other hand, is clustered around intestinal adult T. solium carriers. Currently intervention trials focusing on the modification of these risks are underway. The impact of health education and improving sanitary infrastructure is considered important. Finally strategies employing the above interventions both individually as well as in combination, must be evaluated in order to develop a unified national control policy.

REFERENCES 1. Sarti, E., Gutiérrez, I. (1986) La teniasis y cisticercosis en México (Revisión Bibliográfica). Salud Púbica de México 28, 556–563. 2. Sarti, E. (1997) La teniosis y cisticercosis en México. Salud Pública de México 39, 225–231. 3. Organización Panamericana de la Salud (1994) Epidemiología y control de la teniosis y cisticercosis en América Latina. OPS/OMS, Washington, DC. 4. Schantz, P., Cruz, M., Sarti, E., et al. (1993) Potential erradicability of taeniasis and cysticercosis. Bulletin of the Pan American Health Organization 27, 397–403. 5. Sarti, E., Schantz, P., Lara, R., et al. (1988) Taenia solium taeniasis and cysticercosis in a Mexican village. American Journal of Tropical Medicine and Hygiene 39, 194–198. 6. Sarti, E., Schantz, P., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniosis and cysticercosis in humans and pigs in a village in Morelos, Mexico. American Journal of Tropical Medicine and Hygiene 46, 677–684. 7. Correa, M.D., Flisser, A., Sarti, E. (1994) Teniasis y cisticercosis. In: Valdespino-Gomez, J.L. (ed.) Enfermedades Tropicales. Secretaría de Salud, México, DF, Mexico, pp. 335–345. 8. Díaz, S., Candil, R., Uribe, M., et al. (1990) Serology as an indicator of Taenia solium tapeworm infections in a rural community in Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene 84, 563–566. 9. Sarti, E., Schantz, P., Plancarte, A., et al. (1994) Epidemiological investigation of Taenia solium taeniosis and cysticercosis in a rural village of Michoacan State, Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene 68, 49–52. 10. Secretaría de Salud (2000) Boletín Semanal de Epidemiología, 1994–2000. Dirección General de Epidemiología, México DF, Mexico. 11. Schantz, P., Sarti, E. (1989) Diagnostic methods and epidemiologic surveillance of Taenia solium infection. Acta Leidensia 57, 153–163. 12. Medina, M.T., Rosas, E., Rubio-Donnadieu, F., et al. (1990) Neurocysticercosis as the main cause of late onset epilepsy in Mexico. Archives of Internal Medicine 150, 325–327. 13. Rabiela, M.T., Rivas, A., Rodriguez, I.J. (1979) Consideraciones anatomopatológicas de la cisticercosis cerebral como causa de muerte. Patología (México) 17, 119–124. 14. Schantz, P., Sarti, E., Plancarte, A., et al. (1994) Community based epidemiological investigations of cysticercosis due to Taenia solium. Comparison of serological screening tests and clinical findings in two populations in Mexico. Clinical Infectious Diseases 18, 879–885. 15. Flisser, A., Correa, D., Plancarte, A., et al. (1990) New approaches for the diagnosis of Taenia solium taeniasis/cysticercosis. Annals of Human and Comparative Parasitology 65, 95–98. 16. Aluja, A.S. (1982) Frequency of porcine cysticercosis in Mexico. In: Flisser, A., Willms, K., Laclette, J., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 47–50.

90

E. Sarti

17. Sarti, E., Schantz, P., Aguilera, J., et al. (1992) Epidemiologic observations in a rural community of Michoacan State, Mexico. Veterinary Parasitology 41, 195–201. 18. Aluja, A., Villalobos, N., Plancarte, A., et al. (1996) Experimental Taenia solium cysticercosis in pigs. Characteristics of the infection and antibody response. Veterinary Parasitology 61, 49–58. 19. Woodhouse, E., Flisser, A., Larralde, C. (1982) Seroepidemiology of human cysticercosis in Mexico. In: Flisser, A., Willms, K., Laclette, J., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 11–23. 20. Goldsmith, R.S., Kagan, I.G., Reyes-González, M.A., et al. (1971) Estudios serepidemiológicos realizados en Oaxaca, Mexico. I. – Encuesta de anticuerpos parasitarios mediante la prueba de hemaglutinación indirecta. Boletin de la Oficina Sanitaria Panamericana (Washington DC) 71, 500. 21. Flisser, A., Bulnes, I., Díaz, M.L., et al. (1976) Estudio seroepidemiológico de la cisticercosis humana en poblaciones predominantemente indígenas y rurales del estado de Chiapas. Archives of Internal Medicine (México) 7, 107–113. 22. Larralde, C., Padilla, A., Hernández, M., et al. (1992) Seroepidemiology of cysticercosis in Mexico. Salud Pública de México 34, 197–210. 23. Schantz, P., Sarti, E., Plancarte, A., et al. (1991) Clinical, radiological and epidemiological correlation of ELISA and immunoblot assays for Taenia solium cysticercosis in 2 populations. Mexico. American Journal of Tropical Medicine and Hygiene 45, 130–131. 24. Alan, J.C., Avila, G., Garcia-Noval, J., et al. (1990) Immunodiagnosis of taeniasis by coproantigen detection. Parasitology 101, 473–477. 25. Díaz, S., Candil, R., Suate, P., et al. (1991) Epidemiologic study and control of Taenia solium infections with praziquantel in a rural village of Mexico. American Journal of Tropical Medicine and Hygiene 45, 522–531. 26. Keilbach, N., Aluja, S., Sarti, E. (1989) A program to control taeniosis and cysticercosis (Taenia solium). Experiences in a Mexican village. Acta Leidensia 57, 181–189. 27. Rodriguez Canul, R., Fraser, A., Allan, J.C., et al. (2000) Epidemiological study of Taenia solium taeniasis/cysticercosis in a rural village in Yucatan state, Mexico. Annals of Tropical Medicine and Parasitology 93, 57–67. 28. Sarti, E., Flisser, A., Schantz, P.M., et al. (1997) Development and evaluation of health education intervention against Taenia solium in a rural community in Mexico. American Journal of Tropical Medicine and Hygiene 56, 127–132. 29. Sarti, E., Schantz, P., Avila, G., et al. (2000) Mass treatment against human taeniosis for the control of cysticercosis. A population based intervention study. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 85–89. 30. García, H.H., Gilman, R., Tovar, M., et al. (1995) Factors associated with Taenia solium cysticercosis: analysis of nine hundred forty-six Peruvian neurologic patients. American Journal of Tropical Medicine and Hygiene 52, 145–148. 31. Lawson, J.R., Gemmel, M.A. (1983) Hydatidosis and cysticercosis: the dynamics of transmission. Advances in Parasitology 22, 261–308. 32. Spindola Feliz, N., Rojas Wastanino, G., de Haro, Arteaga, L., et al. (1996) Parasite search in strawberries from Irapuato, Guanajuato and Zamora, Michoacán (México). Archives of Medical Research 27, 229–231. 33. Sarti, E., Bronfman, M., Schantz, P., et al. (1993) Estructuración de un proyecto epidemiológico para el control de la Taenia solium. Comparación del uso de quimioterapia masiva contra la teniasis y de la impartición de educación para la salud, como método de intervención de mayor utilidad. Conmemoración Jubileo. Instituto de Investigaciones Biomédicas. UNAM. México DF, México 2, pp. 413–415. 34. Sarti, E. (1989) Epidemiología de la teniasis y cisticercosis. In: Flisser, A., Malagón, F. (eds) Cisticercosis Humana y Porcina, su Conocimiento e Investigación en México. Limus Noriega, México DF, México, pp. 233–242.

10

Taenia solium Taeniasis and Cysticercosis in Central America

José Garcia-Noval, Ana L. Sanchez and James C. Allan

Introduction The Central American region, lying between Mexico and Colombia consists of seven countries: Belize, Guatemala, Honduras, El Salvador, Nicaragua, Costa Rica and Panama (Fig. 10.1). The region occupies approximately 524,000 km2 and had a population of approximately 36 million in 1999. Slightly less than one-third of this population lives in Guatemala. Over half the population is rural and the United Nations classified 46% as living in extreme poverty in 1994. In 1999, rates of access to health services varied from 46% (Honduras) to 96% (Costa Rica)1. The region is ethnically diverse: two-thirds of the population being of mixed race, 49% of the Guatemalan population being classified as indigenous American, up to 9% of the population of Nicaragua being Afro-Caribbean and 87% of the population of Costa Rica being of European origin. The region has an estimated population of 3 million pigs. Taenia solium has been recognized in Central America for over a century2. Neurocysticercosis (NC) was reported in Guatemala and Honduras in 1940 and 1956, respectively, and periodically thereafter over the next quarter-century3–8. The first Panamanian report of NC was made in 1984, though T. solium was known to be endemic in Panama for decades prior to this9–12.

The presence of the parasite within the region also has an impact further afield. Data from both Guatemala and Honduras indicate that a significant number of individuals from rural communities, where T. solium is highly prevalent, travel either to Guatemala City or Tegucigalpa for work13,14. Furthermore, migration also occurs to the United States, such that in one study, 9.7% of a rural population, 100 km from Guatemala City were travelling on a regular basis to Guatemala City or the United States for work13. There have been numerous reports of cysticercosis either in Central American immigrants or in visitors to Central America made in the United States, Europe and Japan15–19. Recently, the employment of domestic help from Latin America and in particular Central America has been implicated in an outbreak of cysticercosis in the United States20,21.

Taeniasis From 1951 to 1960, a mean prevalence of 1.13% of T. solium taeniasis was detected in the 157,085 faecal samples examined in the Institute of Tropical Diseases ‘Rodolfo Robles’, Guatemala City10. Of these cases, 83% were aged between 18 and 45 years old and 42% came from rural areas near Guatemala City. From 1983 to 1989, data

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

91

92

J. Garcia-Noval et al.

N Belmopan

Belize Caribbean Sea

Guatemala

Honduras

Guatemala City

Tegucigalpa San Salvador

El Salvador

Nicaragua Managua

Pacific Ocean

Costa Rica San Jose Panama City

200 km

Panama

Fig. 10.1. Map of Central America showing countries and capital cities.

from health centres in Honduras indicated a mean prevalence of 0.47% of intestinal taeniasis in 365,400 faecal samples22. The Honduran data also brought out significant regional variation in prevalence with rates between 0.06% and 1%. From 1978 to 1987, a survey by the Ministry of Health, Costa Rica recorded a relatively low rate of intestinal taeniasis, with a mean prevalence of 0.05% in 1,176,332 faecal samples examined23. Recent data on rates of taeniasis from rural Central America are available from Honduras and Guatemala13,22,24–26. Rates of up to 6.2%, with an average prevalence of 2% of intestinal taeniasis have been recorded by microscopy in Honduran communities22,25,26. Rates of approximately 1% have been detected by microscopy in Guatemala13,24,27. These data appear to indicate that, in comparison to countries in Latin America, rates in these two countries are high. For instance, average prevalence in Mexico is typically below 0.5%28–33. Interestingly, a study carried out in the United States indicated a prevalence of 4.4% of intestinal taeniasis in Central American migrant workers to North

Carolina but none in migrants from Mexico or Haiti34. Data from field studies in rural areas of Honduras and Guatemala have indicated that T. solium is responsible for 75–100% of all Taenia species worms identified to the species level22,24–26. This contrasts with hospital data from large urban centres where typically no diagnosis to the species level is carried out10,22. There are clear patterns in the distribution of cases of taeniasis within the population of the region. Rates have been demonstrated to vary considerably between, closely situated, communities. For instance, in one study of four similarly sized rural communities, all within 5 km of each other, prevalence rates of taeniasis varied between 1% and 5.7%, with statistically significant differences in prevalence between the communities13. The variations may be linked to socio-economic factors such as sanitation, pig husbandry techniques and rates of pork consumption. Furthermore, within individual communities the inter-household distribution of intestinal taeniasis has been shown to be clustered13,24,25. In the same Guatemalan study,

Taeniasis and Cysticercosis in Central America

rates of taeniasis in household members of indicator cases of the taeniasis were shown to be nearly double that of the general rate of taeniasis in the population (4.7% vs. 2.7%)13. This is consistent with the clustered pattern of intestinal taeniasis reported elsewhere in Latin America28,30,31. Data from both hospitals and rural communities within the region suggest that the highest rates of intestinal taeniasis are in individuals in their late teens to early forties (Fig. 10.2)10,13. Some data suggest that females may be at higher risk than males13,22. Similar sex-biased distributions of intestinal taeniasis have been reported in Ecuador and in Latin American immigrants to the United States35,36. Once again the reasons for this are unknown.

Human Cysticercosis, Neurocysticercosis and Seizures From 1952 to 1961, in a study of hospital records from El Salvador and Guatemala, 118 cases of cysticercosis were detected by autopsy, of which 71 were shown to involve cysts in the brain10. In 1967, a retrospective

93

study of 10,600 Costa Rican autopsy reports showed 24 cases of NC (0.23%)37. All the cases were aged above 7 years and the number of the cysts was overdispersed, with 11 of the 24 autopsies (41.6%) disclosing only one cyst, a median of two cysts per person and a maximum of 17 cysts (Fig. 10.3)37. Retrospective review indicated that 11 cases (45.8%) had apparently been neurologically asymptomatic, intracranial hypertension had been diagnosed in 7 cases (29.1%), convulsive crisis in three cases (12.5%) and motor deficit in two cases (8.3%). One case was not classified37. More recent hospital data from Costa Rica demonstrates the continued presence of low levels of human cysticercosis in that country23. When computed tomography (CT) scanning was introduced to Guatemala in 1980, the number of cases of NC diagnosed increased greatly, resulting in the finding that NC accounted for at least 8% of all admissions to neurological wards in Guatemala City38. Similarly, the introduction of CT and ELISA to Honduras in the middle of the 1980s led to a fivefold increase in the number of diagnoses of NC made in University Hospital, Tegucigalpa22.

5.0 4.5 Percentage prevalence

4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0 0–4

5–9

10–19

20–29

30 – 39

40 – 49

50 – 59

60 – 80

Age cohort (years) Fig. 10.2. Age prevalence of intestinal taeniasis from a study of four rural communities in Guatemala13. A total of 92 cases were diagnosed from a sample size of 3399 individuals (2.7% prevalence). Of the cases 56 were Taenia solium, one case was T. saginata and in 35 cases it was not possible to determine the species present.

94

J. Garcia-Noval et al.

12

Number of individuals

10

8

6

4

2

0 1

2

3

4

5

6

7

8

9

10 11 12 13 14 15 16 17

Number of cysticerci Fig. 10.3. Distribution of intracerebral Taenia solium cysticerci detected in a retrospective study of autopsy results carried out in Costa Rica37.

Seroepidemiology of human cysticercosis in Central America Studies with the glycoprotein antigen based enzyme-linked immunoelectrotransfer blot (EITB) have provided important insights into the burden of cysticercosis in Central America39. For instance, seroprevalence rates were 10% and 17%, respectively, in two rural communities in Guatemala, whilst seroprevalence rates were 17%, 22% and 34%, respectively, in three different rural populations and 15% in an urban population from Tegucigalpa in Honduras14,24–26,40. These rates would suggest that infection rates in Guatemala and Honduras are higher than those routinely reported from the remainder of Latin America such as Mexico, Peru, Colombia or Bolivia, where rates are generally below 10%31,32,41–45. Indeed, a recent assessment of data from Peru suggested a mean seroprevalence of between 6% and 10% there, although seroprevalence rates of up to 35% have been reported43,46. Studies within Central America have indicated, in common with data from other regions, that infection with intestinal taeniasis

or sharing a house with an intestinal taeniasis carrier are significant risk factors for cysticercosis24. In the Honduran study, several socioeconomic factors were associated with seropositivity including lack of potable water, lack of a sanitary toilet, raising pigs and an earthen floor in the home14. In Guatemala females have been shown to be at higher risk of being seropositive (15% seropositive females vs. 11% seropositive males, odds ratio = 1.45, P0.016)24. Whether this reflects greater exposure to infective eggs in the home environment, or is a reflection of the higher rates of intestinal taeniasis seen in females, reported above, is unknown. This sex-specific difference has, however, not been generally reported elsewhere, even within the region, and so may represent a local phenomenon14,26.

Epidemiology of seizure disorders in Central America Prevalence rates of seizure disorders are high among rural communities throughout the region24,26,47,48. The lowest rate reported to date has been in one Guatemalan study that

Taeniasis and Cysticercosis in Central America

neuroimaging studies than apparently neurologically normal controls (47% vs. 24%, P  0.007) (Fig. 10.4)24. In Honduras, one study in a rural community found 41% of 90 epileptics having lesions compatible with NC40. A second Honduran community study found a 17.6% rate of intracranial lesions suggestive of NC in persons with a normal neurological examination26. Finally, an evaluation of family contacts of an indicator case of cerebral cysticercosis at an urban Panamanian hospital resulted in the detection of three of six other family members as EITB positive and two of six (including one of the three seropositives) as having calcified lesions indicative of NC by CT (Fig. 10.4)52. In the clinical setting, a study in Honduran neurological patients indicated that 84% of individuals with seizures and 69% of those with neurological problems other than seizures had lesions suggestive of NC (Fig. 10.4)53. Furthermore, recent data from Honduras indicate that the two major causes of seizures in that country were neonatal hypoxia, as a result of lack of medical attention during delivery, and NC (Ada Zelaya, National University of Honduras, personal communication). Finally, there is evidence from a Honduran study to suggest

indicated a prevalence of 5.8 cases of active epilepsy per 100048. Combined rates of active and inactive epilepsy in rural Honduras have been recorded at 22.7 per 100049. High rates of active epilepsy have been detected in other studies. For instance, prevalence rates of 29 per 1000 in rural Honduras26 and 18 per 1000 in rural Guatemala50 have been detected. Furthermore, the estimated prevalence in a rural population of Guaymi Indians, living on the Caribbean coast near Costa Rica, was up to 57 per 1000, much higher than the rate of active epilepsy in the lower social class population of Panama City (22 per 1000)51.

Neurocysticercosis and seizure disorder: imaging studies Central American studies carried out in urban centres, rural populations and among neurological patients have all established that cysticercosis is a major cause of morbidity due to seizure disorders throughout the region24–26,40,50,51. Data from two rural Guatemalan communities revealed that individuals with history of seizures had a significantly greater chance of exhibiting abnormal intracranial lesions suggestive of NC upon

Neurological status

Village population (Guatemala)

Neurological patients (Honduras)

Trace back to family (Panama)

95

Number of individuals

Punctate calcification

Active/mixed lesions

Any abnormality

Seizures

76

31 (41%)

9 (12%)

36 (47%)

No seizures

51

10 (20%)

3 (6%)

12 (24%)

Seizures

31

20 (65%)

6 (19%)

26 (84%)

No seizures

29

12 (41%)

8 (28%)

20 (69%)

Seizures

1

1 (100%)

No seizures

6

2 (33%)

Fig. 10.4. Correlation between history of seizures and neuroimaging abnormalities detected by CT scan in different populations in Central America: rural village population24; neurological patients52 and trace back to family members of an individual in whom NC was diagnosed51.

96

J. Garcia-Noval et al.

that headache may also be linked to NC53. This link has previously been reported from a rural population in Ecuador and may bear further investigation54. In both field epidemiological studies and studies of neurological patients the most common type of abnormal intracerebral lesions seen by CT scanning have been punctate calcifications (Fig. 10.4)24,26,50,53. Furthermore, studies from the region have indicated that, besides imposing a burden of neurological disease, that, conversely, significant numbers of apparently neurologically normal individuals have abnormal intracranial lesion suggestive of NC14,24–26,50,52. This has led to the suggestion that the majority of cases may, in fact, be asymptomatic as has been suggested in other endemic regions24,26,54,55.

Human cysticercosis and seizure disorder: serological observations Serological testing, particularly using the EITB has been useful in detecting areas of transmission, identifying risk factors associated with infection and producing data that allow comparison both within the region and between Central America and other endemic areas39. In the hospital-based setting, clear associations have been shown between T. solium specific serological status and seizure disorder. This sometimes represents the only recently available data from some countries. For instance, in an ongoing study in Nicaragua, 14.7% of 88 epileptic patients and 2.94% of 102 controls from Leon had antibodies detected by EITB (P0.05, odds ratio = 4.25) (Felix Espinoza, National Autonomous University of Nicaragua, personal communication). Epidemiological studies in the region, and particularly those carried out in endemic communities, have, however, not generally shown an association between either epilepsy or abnormal CT images suggestive of cysticercosis and serological status in this test14,24–26. This contrasts with studies in other areas41,42,46. These interregional variations may be related to the study design. There may, however, be some differences caused by the underlying prevalence and intensity and

location of cystic infections. For instance in Central America there appears to be a relatively high frequency of single active lesions and calcified lesions detected by CT scan in rural populations (see Figs 10.3 and 10.4). It is known that the EITB, though essentially 100% specific for T. solium, is less sensitive in infections involving single cysts and in individuals with calcified lesions56. Furthermore, the high rates of NC in apparently asymptomatic individuals in Central America and the frequency of extraneural infection may further explain the apparent lack of association between serological status and epilepsy in rural Central America. Some studies carried out within the region have, however, demonstrated association between epilepsy and serological status in rural populations. Indeed Panamanian data, collected before the introduction of the glycoprotein-based EITB using an ELISA, demonstrated that significantly more active epileptics were seropositive for cysticercosis than age- and sexmatched controls in a population of Guaymi Indians (44% vs. 6%, relative risk = 14)51.

Porcine Cysticercosis For many years there has been an understanding that porcine cysticercosis imposes a significant economic burden on Central American pork producers10,57,58. In a study carried out across the whole region, except Belize, from 1959 to 1961, it was reported that 68% of all the hogs condemned for any reason in the six main abattoirs serving the capital cities of Guatemala City, San Salvador, Tegucigalpa, Managua, San José and Panama City, were condemned because of cysticercosis10. This represented 2.13% of all the pigs slaughtered over this period in these abattoirs. This situation does not appear to have improved: Honduran figures indicate that, from 1981 to 1986, an average of 4.8% of all pigs slaughtered at the main abattoir serving Tegucigalpa were condemned due to cysticercosis22. Furthermore, in 1994 and 1995 respectively, in the same abattoir, 2.8% and 3% of pigs slaughtered were condemned due to cysticercosis (Alexis Mendoza, PROMDECA, personal communication).

Taeniasis and Cysticercosis in Central America

The failure of the meat inspection process to control this parasite can be seen in data from the mid 1960s, where 6% and 6.5% respectively, of 99 pork sausages and 107 ‘chorizo’ (Spanish type) sausages purchased from a range of randomly selected establishments in Guatemala City were found to harbour cysticerci57. More recent studies from Guatemala revealed that 4% and 14%, respectively, of pigs in two rural communities had cysts present in their tongues ante mortem24. In these respective communities, 22% and 55% of families raised pigs and 77% and 83% of those families that raised pigs allowed them to roam freely in the village. At least 75% of families stated that their main source of pork was pigs killed either at home or in the village with no official meat inspection. In one village 27% of families were aware of having purchased pork containing cysts while in the other community, 6% were aware of this24. Further studies in Guatemala have indicated seroprevalences of antibodies to T. solium antigens using the glycoprotein-based EITB59 of 40% and 64% in pigs from two communities60. Data from Honduras indicate that 27.1% of pigs in one community were seropositive in this test and that pigs may be infected soon after birth, although recent data on the passive transfer of antibodies from infected sows to piglets complicates the interpretation of the serological data61,62.

97

Conclusions: Prospects for Control The prospects for control of T. solium within Central America remain poor. None of the countries has a formal comprehensive control system and abattoir meat inspection is ineffective due to slaughter of significant numbers of pigs outside the formal, regulated, system. Further to this, for much of the region, there is a lack, or indeed complete absence of epidemiological data. Without such data to assess the magnitude of the problem, control programmes cannot be either properly planned or implemented. Within the region, one study, carried out in Guatemala, has indicated that mass chemotherapy with niclosamide significantly reduced prevalence of intestinal taeniasis and seroprevalence of cysticercosis in pigs 10 months later60. Whether such an approach is economically or logistically feasible is, in the current economic climate of much of the region, questionable. If regional governments were to identify T. solium as a problem that needed attention, this might improve the situation. The authors are unaware of any initiatives on this parasite backed by any of the regional governments. Similarly, there appears to have been relatively little work undertaken on this parasite by the local scientific, veterinary or public health communities.

References 1. Pan American Health Organization. (1999) Health Situation in the Americas. Basic Indicators. Special Programme for Health Analysis, PAHO, Washington, DC. 2. Herrera, C.T. (1894) Frequent Endemics and Infections in Guatemala. Thesis, Faculty of Medicine, University of San Carlos, Guatemala. 3. Aguilar, F.J. (1989) Natural history of cysticercosis. In: Aguilar, F.J., Masselli, R., Samayao, A. (eds) Cisticercosis. Asociacion Guatemalteca de Parasitologia y Medicina Tropical, Guatemala, pp. 11–15. 4. Aguilar, F.J., Vizcaino, C. (1954) Cysticercosis in Guatemala. Revista del Collegio Medico (Guatemala) 5, 92–98. 5. Alvarez Rubio, O.A., Nazar, H.N. (1989) Neurocysticercosis in the Hospital Escuela. Revista Medica Hondureña 57, 246–260. 6. Cueva, J.A. (1956) Cysticercosis in Honduras. Revista Medica Hondureña 24, 101–111. 7. Duron, R.A. (1967) Human cysticercosis in Honduras. A statistical review. Revista Medica Hondureña 35, 126–131. 8. Hernandez-Gonzalez, L.A., Arrredondo-Mendoza, F., Prado-Castro, J.A. (1990) Racimedullar neurocysticercosis in Guatemala. Description of the ‘floating cystic lesion’ sign. Revista Mexicana Radiologica 44, 165–169. 9. Acuna, E.R., Velasco Aparicio, G., Guzman Aranda, G. (1988) Neurocysticercosis in Panama. Revista Medica Panama de 13, 9–16.

98

J. Garcia-Noval et al.

10. Acha, P.N., Aguilar, F.J. (1964) Studies on cysticercosis in Central America and Panama. American Journal of Tropical Medicine and Hygiene 13, 48–53. 11. Garrick, D. (1967) Current status of brucellosis, tuberculosis, rabies and cysticercosis in Central America and Panama. Bulletin of the Pan American Health Organization 63, 142–150. 12. Paz, J.R. (1973) Present status of cysticercosis in Panama. Boletin Chileno de Parasitologia 28, 100–102. 13. Allan J.C., Velasquez Tohom, M., Garcia Noval, J., et al. (1996) Epidemiology of intestinal taeniasis in four rural Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157–165. 14. Sanchez, A.L., Medina, M.T., Ljungström, I. (1998) Prevalence of taeniasis and cysticercosis in a population of urban residence in Honduras. Acta Tropica 69, 141–149. 15. Shimizu, Y., Kagawa, S., Onuma, T. (1986) Cerebral cysticercosis – report of an operated case. No Shinkei Geka 14, 209–213. 16. Ciesielski, S., Seed, J.R., Estrada, J., et al. (1993) The seroprevalence of cysticercosis, malaria, and Trypanosoma cruzi among North Carolina migrant farmworkers. Public Health Reports 108, 736–741. 17. Steinmetz, R.L., Masket, S., Sidikaro, Y. (1989) The successful removal of a subretinal cysticercus by pars plana vitrectomy. Retina 9, 276–280. 18. Chatel, G., Gulletta, M., Scolari, C., et al. (1999) Neurocysticercosis in an Italian traveller to Latin America. American Journal of Tropical Medicine and Hygiene 60, 255–256. 19. Prosser, P.R., Wilson, C.B., Forsham, P.H. (1978) Intrasellar cysticercosis presenting as a pituitary tumor: successful transsphenoidal cystectomy with preservation of pituitary function. American Journal of Tropical Medicine and Hygiene 27, 976–978. 20. Schantz, P.M., Moore, A.C., Munoz, J.L., et al. (1992) Neurocysticercosis in an Orthodox Jewish community in New York City. New England Journal of Medicine 327, 692–695. 21. Moore, A.C., Lutwick, L.I., Schantz, P.M., et al. (1995) Seroprevalence of cysticercosis in an Orthodox Jewish community. American Journal of Tropical Medicine and Hygiene 53, 439–442. 22. Kaminsky, R.G. (1991) Taeniasis–cysticercosis in Honduras. Transactions of the Royal Society of Tropical Medicine and Hygiene 85, 531–534. 23. Arroyo, R. (1989) Taeniasis/cysticercosis in Costa Rica. In: Aguilar, F.J., Masselli, R., Samayao, A. (eds) Cisticercosis. Asociacion Guatemalteca de Parasitologia y Medicina Tropical, Guatemala, pp. 75–79. 24. Garcia-Noval, J., Allan, J.C., Fletes, C., et al. (1996) Epidemiology of Taenia solium taeniasis and cysticercosis in two rural Guatemalan communities. American Journal of Tropical Medicine and Hygiene 55, 282–289. 25. Sanchez, A.L., Gomez, O., Allebeck, P., et al. (1997) Epidemiological study of Taenia solium infections in a rural village in Honduras. Annals of Tropical Medicine and Parasitology 91, 163–171. 26. Sanchez, A.L., Lindbäck, J., Schantz, P.M., et al. (1999) A population-based case-control study for T. solium taeniasis and cysticercosis. Annals of Tropical Medicine and Parasitology 93, 247–258. 27. Allan, J.C., Velasquez Tohom, M., Torres Alvarez, R., et al. (1996) Field trial of diagnosis of Taenia solium taeniasis by coproantigen enzyme linked immunosorbent assay. American Journal of Tropical Medicine and Hygiene 54, 352–356. 28. Diaz Camacho, S.P., Candil Ruiz, A., Suate Peraza, V., et al. (1991) Epidemiologic study and control of Taenia solium infections with praziquantel in a rural village of Mexico. American Journal of Tropical Medicine and Hygiene 45, 522–531. 29. Diaz Camacho, S., Candil Ruiz, A., Uribe Beltran, M., et al. (1990) Serology as an indicator of Taenia solium tapeworm infections in a rural community in Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene 84, 563–566. 30. Sarti-Gutierrez, E.J., Schantz, P.M., Lara-Aguilera, R., et al. (1988) Taenia solium taeniasis and cysticercosis in a Mexican village. Tropical Medicine and Parasitology 39, 194–198. 31. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis and cysticercosis in humans and pigs in a village in Morelos, Mexico. American Journal of Tropical Medicine and Hygiene 46, 677–685. 32. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1994) Epidemiological investigation of Taenia solium taeniasis and cysticercosis in a rural village of Michoacan state, Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene 88, 49–52. 33. Rodriguez-Canul, R., Fraser, A., Allan, J.C., et al. (1999) Epidemiological study of Taenia solium taeniasis/cysticercosis in a rural village of Yucatan, Mexico. Annals of Tropical Medicine and Parasitology 93, 57–67. 34. Ciesielski, S., Seed, J.R., Ortiz, J.C., et al. (1991) Intestinal parasites among North Carolina migrant farmworkers. American Journal of Public Health 82, 1258–1262.

Taeniasis and Cysticercosis in Central America

99

35. Cruz, M., Davis, A., Dixon, H., et al. (1989) Operational studies on the control of Taenia solium taeniasis/cysticercosis in Ecuador. Bulletin of the World Health Organization 67, 401–407. 36. Richards, F.O. Jr, Schantz, P.M., Ruiz-Tiben, E., et al. (1985) Cysticercosis in Los Angeles County. Journal of the American Medical Association 254, 3444–3448. 37. Piza, J., Fernandez, A., Soto, M., et al. (1967) Cerebral cysticercosis. a clinico–anatomical study of 24 cases in Costa Rica. Acta Medica Costaricense 10, 5–17. 38. Arredondo, F. (1989) Computerised tomography in the diagnosis of neurocysticercosis. In: Aguilar, F.J., Masselli, R., Samayao, A. (eds) Cisticercosis. Asociacion Guatemalteca de Parasitologia y Medicina Tropical, Guatemala, pp. 51–55. 39. Tsang, V., Brand, A.J., Boyer, A.E. (1989) An enzyme imunoelectrotransfer blot assay and glycoprotein antigens for diagnosing human Taenia solium cysticercosis. Journal of Infectious Diseases 159, 50–59. 40. Sánchez, A.L., Duron, R., Osorio, J.R., et al. (1998) Evaluation of the enzyme-linked immunoelectrotransfer blot (EITB) assay in epileptic patients from a rural community in Honduras. In: Proceedings of the International Congress of Parasitology, ICOPA IX. Italy, pp. 185–189. 41. Diaz, J.F., Verastegui, M., Gilman, R.H., et al. (1992) Immunodiagnosis of human cysticercosis (Taenia solium): a field comparison of an antibody-enzyme-linked immunosorbent assay (ELISA), an antigen-ELISA, and an enzyme-linked immunoelectrotransfer blot (EITB) assay in Peru. The Cysticercosis Working Group in Peru (CWG). American Journal of Tropical Medicine and Hygiene 46, 610–615. 42. Moro, P.L., Guevara, A., Verastegui, M., et al. (1997) Distribution of hydatidosis and cysticercosis in different Peruvian populations as demonstrated by an enzyme-linked immunoelectrotransfer blot (EITB) assay. The Cysticercosis Working Group in Peru (CWG). American Journal of Tropical Medicine and Hygiene 51, 851–855. 43. Bern, C., García, H.H., Evans, C., et al. (1999) Magnitude of the disease burden from neurocysticercosis in a developing country. Clinical Infectious Diseases 29, 1203–1209. 44. Palacio, L.G., Jimenez, I., García, H.H., et al. (1998) Neurocysticercosis in persons with epilepsy in Medellin, Colombia. The Neuroepidemiological Research Group of Antioquia. Epilepsia 39, 1334–1339. 45. Jafri, H.S., Torrico, F., Noh, J.C., et al. (1998) Application of the enzyme-linked immunoelectrotransfer blot to filter paper blood spots to estimate seroprevalence of cysticercosis in Bolivia. American Journal of Tropical Medicine and Hygiene 58, 313–315. 46. García, H.H., Talley, A., Gilman, R.H., et al. (1999) Epilepsy and neurocysticercosis in a village in Huaraz, Peru. Clinical Neurology and Neurosurgery 101, 225–228. 47. Gracia, F.J., Bayard, V., Triana, E., et al. (1988) Prevalence of neurologic diseases in Belisario Porras municipality, District of San Miguelito, Panama, 1986. Revista Medica de Panama 13, 40–45. 48. Mendizabal, J.E., Salguero, L.F. (1996) Prevalence of epilepsy in a rural community of Guatemala. Epilepsia 37, 373–376. 49. Duron, R., Osorio, J.R., Martinez, L., et al. (1997) Epilepsy in Salama, Honduras: first phase of an epidemiological study. Revista Hondureña de Neurociencias 1, 9–18. 50. Garcia-Noval, J., Moreno, E., de Mata, F., et al. (2001) An epidemiological study of epilepsy and epileptic seizures in two rural Guatemalan communities. Annals of Tropical Medicine and Parasitology 95, 167–175. 51. Gracia, F., de Lao, S.L., Castillo, L., et al. (1990) Epidemiology of epilepsy in Guaymi Indians from Bocas del Toro Province, Republic of Panama. Epilepsia 31, 718–723. 52. Gracia, F., Chavarria, R., Archbold, C., et al. (1990) Neurocysticercosis in Panama: preliminary epidemiologic study in the Azuero region. American Journal of Tropical Medicine and Hygiene 42, 67–69. 53. Sanchez, A.L., Ljungström, I., Medina, M.T. (1999) Diagnosis of human neurocysticercosis in an endemic area: a clinical study in Honduras. Parasitology International 48, 81–89. 54. Cruz, I., Cruz, M.E., Teran, W., et al. (1994) Human subcutaneous Taenia solium cysticercosis in an Andean population with neurocysticercosis. American Journal of Tropical Medicine and Hygiene 51, 405–407. 55. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community-based epidemiological investigations of cysticercosis due to Taenia solium: comparison of serological screening tests and clinical findings in two populations in Mexico. Clinical Infectious Diseases 18, 879–885. 56. Wilson, M., Bryan, R.T., Fried, J.A., et al. (1991) Clinical evaluation of the cysticercosis enzyme linked immunotransfer blot (EITB) in patients with neurocysticercosis. Journal of Infectious Diseases 164, 107–109.

100

J. Garcia-Noval et al.

57. Zapatel, J., Ubieto, A., Martinez, M. (1965) Cysticerci in processed meat in Guatemala. American Journal of Tropical Medicine and Hygiene 14, 113–116. 58. Schenone, H. (1973) Some considerations on the occurrence of cysticercosis in swine in Latin America. Boletin Chileno de Parasitologia 28, 106–107. 59. Gonzalez, A.E., Cama, V., Gilman, R.H., et al. (1990) Prevalence and comparison of serologic assays, necropsy, and tongue examination for the diagnosis of porcine cysticercosis in Peru. American Journal of Tropical Medicine and Hygiene 43, 194–199. 60. Allan, J.C., Velasquez-Tohom, M., Fletes, C., et al. (1997) Mass chemotherapy for intestinal Taenia solium taeniasis: effect on prevalence in humans and pigs. Transactions of the Royal Society of Tropical Medicine and Hygiene 91, 595–598. 61. Sakai, H., Sone, M., Castro, D.M., et al. (1998) Seroprevalence of Taenia solium in pigs in a rural community of Honduras. Veterinary Parasitology 78, 233–238. 62. Gonzalez, A.E., Verastegui, M., Noh, J.C., et al. (1999) Persistence of passively transferred antibodies in porcine Taenia solium cysticercosis. Cysticercosis Working Group in Peru. Veterinary Parasitology 86, 113–118.

11

Neurocysticercosis in Brazil: Epidemiological Aspects Svetlana Agapejev

Introduction Human and swine cysticercosis is a disease caused by the metacestode larval form (cysticercus cellulosae) of the parasite, Taenia solium. Factors contributing to the endemic nature of taeniasis–cysticercosis are many. Improper disposal of faeces from infected individuals in the absence of sanitary infrastructure, the existence of latrines and vegetable gardens and/or orchards in the vicinity of pig pens especially when irrigated with contaminated water or fertilized with human faeces, allow the swine access to human faeces. Rearing infected swine, manipulation of contaminated meat through unofficial markets, aberrant inspection at slaughterhouses and butchers’ shops and consumption of raw or poorly cooked pork are risk factors for acquiring human taeniasis. Finally, deficient health education and awareness, precarious personal hygiene such as ingestion of unwashed food and handling of food with dirty and contaminated hands, and possibly the use of water from rivers, streams or lakes, directly for consumption are risk factors for human cysticercosis. Several of these risk factors prevail in Brazil giving it one of the highest prevalences of taeniasis–cysticercosis in the world (Fig. 11.1). A review of Brazilian literature on neurocysticercosis (NC) from 1907 to 2000 reveals

a sizeable collection of papers describing the many aspects of the disorder. A major contribution of Brazilian work has been the generation of autopsy (Table 11.1)1–22 and clinical (Table 11.2)23–52 data. In comparison, seroepidemiologic studies are few but nevertheless available (Table 11.3)53–59. This chapter is based on reports selected from an extensive review of papers from accessible Brazilian literature and from more than 25 years of personal observations60. Together, the autopsy, clinical and epidemiological information reflect the epidemiological characteristics of T. solium cysticercosis in Brazil.

Geographical Prevalences Brazil: geography, people and habits Brazil is the fifth largest country in the world and the largest in South America. It has an area of 8512 million km2 and a population of 172,535 million. Most Brazilians are Catholic Christians. Food habits differ regionally and with economic conditions within Brazil. Meat is an important dietary item, although beef is eaten more frequently than pork. However, sausages made of pork are often consumed raw or undercooked. It is traditional practice in North and Northeast Brazil to eat meat after salting it and then drying it

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

101

102

S. Agapejev

Fig. 11.1. Some endemic factors for the maintenance of taeniasis/cysticercosis complex: (a) Rubbish near a sign (arrow) saying ‘No rubbish disposal ’. (b) Lake water used for drinking and hygiene for humans (arrows) and swine (foreground). (c) Vegetable garden irrigated with contaminated water from the river (arrow). (d) Contaminated pork at a clandestine slaughterhouse.

in the hot sun. In South and Southeast Brazil, pork is roasted or fried. Brazil is a rapidly developing country, making great strides in industrialization. Piped water supply exists in three-quarters and sewer or septic cesspool facilities in one-half of the homes. The Brazilian Association of Pig Producers has 12 million pigs registered in South Brazil, 9 million in Northeast Brazil, 7 million in Southeast Brazil and 6 million in CentralWest Brazil. This, however, is not a true estimate of the porcine population, since a large number of pigs are raised in backyards or are free ranging. Official data from government sources revealed that the prevalence of swine cysticercosis for the period 1952–91 was 0.03–6.9%, through several regions in Brazil. However, epidemiological surveys estimate that the actual prevalence may be as high as 13–28% in certain regions within Brazil.

Geographic prevalence of NC within Brazil While NC is endemic throughout most of Brazil, definite information about the endemic nature of the disease is available from several states (shown in Fig. 11.2). Other states have non-confirmed occurrence of NC. These projections are mostly derived from hospital-based reports and these may not reflect the true prevalence of disease. For instance, Northeast Brazil is an economically underprivileged area and one would expect large number of cases to be reported from this region. However, this might not be the case as a large proportion of cases may be undiagnosed on account of the lack of investigative facilities like computed tomography (CT). Similarly, it appears from the review of literature that more severe cases like intracra-

Neurocysticercosis in Brazil

103

Fig. 11.2. Frequency of human neurocysticercosis in the Brazilian states. (RS: Rio Grande do Sul; SC: Santa Catarina; PR: Paraná; MS: Mato Grosso do Sul; SP: São Paulo; MT: Mato Grosso; MG: Minas Gerais; RJ: Rio de Janeiro; ES: Espírito Santo; TO: Tocantins; FD: Federal District; GO: Goiás; BA: Bahia; SE: Sergipe; AL: Alagoas; PI: Piauí; PE: Pernambuco; PB: Paraíba; AC: Acre; AM: Amazonas; PA: Pará; MA: Maranhão; CE: Ceará; RN: Rio Grande do Norte; RR: Roraima; AP: Amapá.)

nial hypertension and racemose cysticercosis are frequently seen in hospital services in Southern and Southeast Brazil in comparison to North and Northeast Brazil, where most of the hospital-based reports are those of milder varieties of NC. These differences may merely reflect different referral patterns, access to medical care and of expertise in the treatment of more difficult cases in South and Southeast Brazil. Therefore geographical differences in clinical presentations may be more apparent than real (Figs 11.2 and 11.3). From a review of published autopsy and clinical service-based data from 1907 to 2000 and 1915 to 2000, respectively, an average of 600 autopsy diagnoses of NC and 500 clinicoradiological diagnoses of NC were made every year60. Similarly, data available from general

hospitals in Brazil indicate that NC was responsible for about two admissions every month there. These data are at best an underestimate especially since the reporting of taeniasis–cysticercosis is not obligatory in Brazil.

Epidemiological Characteristics Inferred from Autopsy Autopsy is an important tool to confirm clinical diagnosis and estimate disease frequency. Unfortunately, however, resort to autopsy is infrequent in Brazil, primarily owing to factors such as excessive trust in laboratory diagnoses, difficulty in obtaining family authorization, lack of systematic

104

S. Agapejev

(a) North-Northeast Central-West South-Southeast

12.9%

Viable cysts 26%

1.6%

5.2% 4.6%

67%

2.0%

4.0%

1.8%

1.5%

0.4% Autopsy

Clinical series

Seroepidemiology

North-Northeast

(b) 77%

South-Southeast

57% 50% 48%

47%

28%

10% 5% Epilepsy

Intracranial hypertension

Psychiatric disturbance

Headache

Fig. 11.3. Brazilian regional differences in the frequency of neurocysticercosis: (a) and clinical manifestations (b) expressed by the average of the reported incidences.

requirement of obligatory autopsy even in university hospitals, and a high frequency of domiciliary deaths. Since autopsy is difficult to perform in many areas, many cases of disease go unnoticed. There is a lack of uniform protocol for organ examination at autopsy services. Furthermore, slices are usually made at more than 1 cm at autopsy; and as a result, a small pathological lesion may escape detection leading to an underestimation of disease frequency. Survey of necropsy at Legal Medicine institutes and in the popula-

tion may provide a more realistic estimate of the prevalence of NC since ocular globes, skeletal muscles and spinal cord with the nerve roots are analysed in addition to the brain. Nevertheless, NC ranked 19 among pathological diagnoses at autopsy in a general hospital in the city of São Paulo15. The frequency of detection of NC at autopsy in different series in Brazil from 1915 onwards is shown in Table 11.1. A range of frequency from 0.12% to 9.0%, giving an average of 1.5% has been reported1–22,60.

Neurocysticercosis in Brazil

105

Table 11.1. Neurocysticercosis in Brazil – frequency based on autopsy studies. Author (publication year) Almeida§1 (1915) Trétiakoff and Silva§2 (1924) Galvão§3 (1928) Povoa§4 (1934) Salles5 (1934) Pinheiro and Mello§6 (1941) Pupo et al.§7 (1945/1946) Montenegro8 (1946) Hellmeister and Faria9 (1973) Guidugli-Neto and Matosinho-França10 (1977) Queiroz and Martinez11 (1979) Gobbi et al.12 (1980) Almeida and Lima13 (1988) Tavares et al.14 (1988) Almeida et al.15 (1989) Vianna et al.16 (1991) Tavares§17 (1994) Agapejev‡18 (1995) Costa-Cruz et al.19 (1995) Chimelli et al.20 (1998) Lino et al.21 (1999) Montemór-Netto et al.22 (2000)

State*

Frequency (%)

Total number of cases†

SP SP SP SP SP SP SP SP SP SP BA MG CE MG SP FD SP MG MG SP MG PR

0.71 3.6 1.6 1.03 0.12 0.43 1.5 2.5 1.78 0.86 0.30 1.60 0.45 9.0 1.5 1.6 1.85 0.77 1.22 1.5 3.3 3.1

1,822 250 997 1,073 4,000 465 1,000 312 1,013 3,587 4,000 2,306 1,773 1,160 200 1,520 3,681 20,741 2,862 2,522 1,596 901

Note: The data refer to frequency of neurocysticercosis and not to cysticercosis in general. *Federal State of Brazil in which the study was conducted (see Fig. 11.2). †Number of studied cases from which those with neurocysticercosis were selected. ‡Studies in general hospitals. §Studies conducted on psychiatric patients.

Numbers reported depend primarily upon the autopsy protocol adopted, the repute of the medical facility in treatment of disease and possibly on the geographical location within Brazil. For instance, high rates of detection of NC have been noted in autopsy series reported from Southeast Brazil (0.1–9.0%) in comparison with Northeast Brazil (0.30–0.45%). Dichotomy also exists in the relative proportions of viable, asymptomatic and symptomatic cysticercosis. In a large series from the state of Bahia in North Brazil, 67% of examined parasites were viable and there was a high proportion of asymptomatic NC11. The latter refers to those autopsies in which the individuals had no symptoms related to NC during life and autopsy revealed incidental cysts. In comparison, data from our centre in Southeast Brazil revealed viable cysticerci in 26% of the autopsies18.

Autopsy data from Brazil also indicate that NC is the primary cause of death in 16–34% of those cases in which it was detected1–22,60. The final cause of death was found to be intracranial hypertension in 47–69% of these cases18,20. Even in autopsies performed in those who had neurological symptoms during life, NC may be an incidental finding in about 26%18. While parenchymal calcifications and viable cysts are the most common incidental findings, autopsy could occasionally reveal asymptomatic intraventricular or cisternal cysticercosis. NC may also be diagnosed at autopsy in those patients who die as a result of other infectious and parasitic diseases such as pulmonary tuberculosis, paracoccidiomycosis, Chagas’ disease and AIDS18,20. Co-infection probably reflects poor socio-economic and health-related conditions that predispose to both infections.

106

S. Agapejev

Prior to the 1980s, when CT was not available, a diagnosis of NC was often made only after death during necropsy. For instance, a definite ante-mortem diagnosis of NC was made on the basis of cerebrospinal fluid examination in only 3.6% of cases in whom autopsy revealed NC. With the advent of CT, this figure rose to 50–63%, demonstrating the dramatic impact of CT upon the diagnosis of NC15,18,43.

Epidemiological Characteristics Inferred from Hospital-based Studies Several large clinical series of patients with NC have been reported from Brazil (Table 11.2). The frequency of NC, the demographic profile and clinical manifestations depend upon the source of the series. For instance, in four general hospitals in São Paulo state, two

Table 11.2. Neurocysticercosis in Brazil – frequency in clinical series. Author (publication year)

State*

Lange¶|23 (1940) Pupo et al.¶|7 (1945/1946) Brotto24 (1947) Spina-França25 (1956) Canelas26 (1962) Silva et al.27 (1965) Camargo-Lima28 (1966) Mega and Lison ¶|29 (1967) Benício** (1970) Reis31 (1970) Manreza§32 (1982) Takayanagui and Jardim33 (1983) Machado et al.‡34 (1988) Chequer and Vieira35 (1990) Clemente and Werneck36 (1990) Vianna et al.37 (1990) Spina-França et al.¶|39 (1993) Agapejev‡18 (1995)

SP SP SP SP SP PE SP SP PE SP SP SP SP ES RJ FD SP SP

Ferreira et al.§40 (1994) Tavares***17 (1994) Azambuja et al.¶|41 (1995) Camargo¶|42 (1995) Gonçalves-Coêlho and Coêlho¶|43 (1996) Freitas and Palermo44 (1996) Takayanagui et al.45 (1996) Andrade46 (1997) Forlenza et al.***40 (1997) Narata et al.¶|48 (1998)

FD MG RS PR PB PA SP BA SP PR

Agapejev49 (1999) Pfuetzenreiter and Ávila-Pires50 (1999) Gomes et al.¶|51 (2000) Silva et al.¶|52 (2000)

SP SC BA RS

Frequency (%)

Total number of cases†

0.31 0.36 2.98 3.39 0.06 3.08 0.03 1.15 1.76 7.5 0.19

12.9 1.13 0.3 6.1 12.2 13.4 4.8 1.02

9.2 3.3

5.0 1.27

Note: The data refer to frequency of neurocysticercosis and not to cysticercosis in general. *Federal State of Brazil in which the study was conducted (see Fig. 11.2). †Number of studied cases from which those with neurocysticercosis were selected. ‡Studies in general hospitals. §Studies limited to paediatric cases. ***Studies conducted on psychiatric patients. **Cited by Schenone et al.30. ¶| Studies based upon complementary tests (e.g. CT, CSF, etc.).

4,200 10 12,361 2,273 4,900 4,600 355 2,500 9,077

500 126,968 45 100 520 135,000 132,480 3,225 10 188 1,088 51,694 4,011 12 262 157 38 2,554 973 299 57 200 6,300

Neurocysticercosis in Brazil

in the capital city and two outside the capital, NC was responsible for 0.1–0.2% and 0.3–2.5% of hospital admissions, respectively60. In comparison, this disorder was responsible for up to 13% of admissions to neurology and neurosurgery services. Headaches and seizures are the most commonly reported symptoms; headaches are more frequent in women, while seizures are more common in men. Seizures occur more frequently in series collected from outpatient departments in Brazil. In available hospital-based reports of series of patients with NC from Brazil, patients are mostly of rural origin (30–79%). However, urban origin becomes more frequent when more severe clinical presentations of NC in children and adults are considered60–62. Skin colour does not seem to be a selection factor since its frequency was proportional to the studied populations, with no significant statistical difference18,46. In the majority of published studies, the most affected age group is 11–60 years, with a frequency of 22–67% between 21 and 40 years60. In general, there is a predominance of males (51–80%) in most series20,22,46,51,60,61. However, severe manifestations are more commonly reported among females47,48,50,60,63. The period of hospitalization for patients with NC ranges from 1 to 254 days. Most patients require hospitalization for about a week18,34. Nearly one half of the patients require multiple admissions (up to nine, in Brazilian literature)18,34,35. The mortality rate in several of the general hospital based series in Brazil is low (approximately 0.3%). However, among patients with NC, the mortality rate is 4.8–25.9%18,25,26,33,34,37. NC is responsible for 0.6–3.6% of hospital deaths due to neurological disorders in Brazil. When studies from neurosurgical departments are evaluated, the mortality may be as high as 60%64.

107

quency of 2–6% in radiological investigations20,22,45,60. Several studies have addressed the frequency of diagnosis of NC among patients referred to CT scan units38,41,43,48,52,61. While these numbers give us an idea of the frequency of NC in comparison to other neurological disorders, they cannot be extrapolated to establish prevalence of the disease in the community. In addition, the frequency may depend upon whether the CT unit is that of a general hospital or a specialized neurological facility. In most of such published series from Brazil, a diagnosis of NC was made in 1–2% of the CT examinations38,41,43,48,52,61. More meaningful is the fact that the commonest CT abnormality in these reports has been either single or multiple parenchymal calcifications38,41,43,48,52,61.

Compulsory Notification The study of frequency and manifestations of NC seen in a single hospital does not reflect actual disease prevalence and patterns, since they are largely dependent on the pattern of referral to that hospital. Compulsory notification is a more accurate estimate of disease frequency and patterns45. Compulsory notification in Ribeirão Preto, São Paulo, established a prevalence of 54/100,000 inhabitants45. While compulsory notification is useful in estimating the prevalence of clinically overt NC, it would not be able to detect the large number of asymptomatic cases known to exist.

Community-based Serological Studies The seroepidemiology of human cysticercosis has not been systematically studied with the help of contemporary methods of evaluation. Some of the earlier studies have been based upon indirect haemagglutination and ELISA (reviewed in Table 11.3)52–59.

Epidemiological Data Inferred from Imaging Facilities Conclusions While asymptomatic forms of NC (cases with no neurological manifestations during life) are often diagnosed at autopsy, they can also be detected as an incidental finding with a fre-

A plethora of clinical, hospital-based and autopsy reports of human cysticercosis are available from Brazil. These reports suggest

108

S. Agapejev

Table 11.3. Neurocysticercosis in Brazil – seroepidemiological studies. Author (publication year)

State*

Ueda et al.53 (1984) Vianna et al.54 (1986) Arruda et al.55 (1990) Vaz et al.56 (1990) Silva-Vergara57 (1995) Lonardoni et al.58 (1996) Biondi et al.‡ (1998) Pires et al.59 (2000)

SP FD PR SP MG PR AL MA

Total number of cases†

Frequency (%)

824 1122 1168 821 1080 2180 736 756

0.87 5.2 0.68 2.30 1.94 3.2 1.9 6.22

Note: The data refer to incidence of positive reactions for cysticercosis in serum. * Federal State of Brazil in which the study was conducted (see Fig. 11.2). †Number of studied cases from which those with cysticercosis were selected. ‡Biondi, G.F., Nunes, C.M., Cruz, J.M.C., et al., 1998 – unpublished observations.

that human cysticercosis is an important public health problem there; however, they do not provide a true estimate of the disease prevalence. Compulsory notification of the disease is a useful method that has been

evaluated on a preliminary basis in Brazil. It needs to be applied on a wider basis in order to determine areas of high prevalence. Once this is done, control measures may be preferentially applied to these areas.

References 1. Almeida, W. (1915) [Contribution of autopsy to clinical study of cerebral cysticercosis.] Archivos Brasileiros de Psychiatria, Neurologia e Medicina Legal 11, 229–264. 2. Trétiakoff, C., Silva, A.C.P. (1924) [Contribution to the study of cerebral cysticercosis and in details the farther toxic brain lesions in this infection.] Memorias do Hospício de Juquery 1, 37–66. 3. Galvão, S.T. (1928) [Incidence and Prophylaxis of Cysticercosis and Hydatidosis in São Paulo.] Thesis, University of São Paulo, Brazil. 4. Povoa, H. (1932) [Cerebral cysticercosis.] Folha Médica 13, 241–246. 5. Salles, J.M.M. (1934) [Cerebral Cysticercosis.] Thesis, University of São Paulo, Brazil. 6. Pinheiro, J., Mello, A.R. (1941) [Considerations about cerebral cysticercosis.] Archivos Brasileiros de Medicina 31, 192–212. 7. Pupo, P.P., Cardoso, W., Reis, J.B., et al. (1945/1946) [On brain cysticercosis. Its clinic, pathology, radiology and cerebrospinal fluid syndrome.] Arquivos de Assistência aos Psicopatas do Estado de São Paulo 10/11, 3–123. 8. Montenegro, J. (1946) [Blindness caused by brain cysticercosis.] Revista Paulista de Medicina 29, 348–356. 9. Hellmeister, C.R., Faria, J.L. (1973) [Neurocysticercosis. Necropsy details.] Revista da Associação Médica Brasileira 19, 281–282. 10. Guidugli-Neto, J., Matosinho-França, L.C. (1977) [Neurocysticercosis: necroscopic study.] Revista Médica do IAMSPE 8, 65–67. 11. Queiroz, A.C., Martinez, A.M.B. (1979) [The involvement of the central nervous system in cysticercosis.] Arquivos de Neuropsiquiatria 37, 34–41. 12. Gobbi, H., Adad, S.J., Neves, R.R., et al. (1980) [Occurrence of cysticercosis (Cysticercus cellulosae) in necropsied patients in Uberaba – MG, Brazil.] Revista de Patologia Tropical 9, 51–59. 13. Almeida, Y.M., Lima, J.H.C. (1988) [Neurocysticercosis in the state of Ceará: necropsy findings.] Revista da Sociedade Brasileira de Medicina Tropical 11 (Suppl.), 97. 14. Taveras, A.R., Valadares-Neto, D., Pittella, L.E.M. (1988) [Frequency of neurocysticercosis at the Hospital of Clinics of the Federal University of Minas Gerais confirmed by neuropathologic examination.] Arquivos de Neuropsiquiatria 46 (Suppl.), 75.

Neurocysticercosis in Brazil

109

15. Almeida, M.C., Couto, L.A.A.M., Silva, L.H.F., et al. (1989) [Correlation between anatomo-clinical diagnosis and retrospective assessment of clinical diagnosis in post mortem.] Revista de Saúde Pública (São Paulo) 23, 285–291. 16. Vianna, L.G., Macedo, V., Costa, J.M. (1991) Musculocutaneous and visceral cysticercosis: a rare disease? Revista do Instituto de Medicina Tropical de São Paulo 33, 129–136. 17. Taveras, A.R. (1994) [Neuropsychiatric Aspects in Human Neurocysticercosis.] Thesis, Federal University of São Paulo, Brazil. 18. Agapejev, S. (1995) Incidence of Neurocysticercosis at the University Hospital, Faculty of Medicine, State University of São Paulo. (Abstract). Thesis. University of São Paulo, Brazil. Arquivos de Neuropsiquiatria 53, 170–171. 19. Costa-Cruz, J.M., Rocha, A., Silva, A.M., et al. (1995) [Occurrence of cysticercosis in autopsies performed in Uberlândia, Minas Gerais, Brazil.] Arquivos de Neuropsiquiatria 53, 227–232. 20. Chimelli, L., Lovalho, A.F., Takayanagui, O.M. (1998) [Neurocysticercosis: contribution of autopsies to consolidation of the compulsory notification in Ribeirão Preto – SP, Brazil.] Arquivos de Neuropsiquiatria 56, 577–584. 21. Lino, R.S., Reis, M.A., Teixeira, V.P.A. (1999) [Occurrence of encephalic and cardiac cysticercosis (Cysticercus cellulosae) in necropsy.] Revista de Saúde Pública (São Paulo) 33, 495–498. 22. Montemór-Netto, M.R., Gasparetto, E.L., Faoro, L.N., et al. (2000) [Neurocysticercosis: a clinical and pathological study of 27 necropsied cases.] Arquivos de Neuropsiquiatria 58, 883–889. 23. Lange, O. (1940) [Cerebrospinal fluid syndrome in encephalic and meningeal cysticercosis.] Revista de Neurologia e Psiquiatria de São Paulo 6, 35–48. 24. Brotto, W. (1947) [Neurologic aspects of cysticercosis.] Arquivos de Neuropsiquiatria 5, 258–294. 25. Spina-França, A. (1956) [Central nervous system cysticercosis. Considerations about 50 cases.] Revista Paulista de Medicina 48, 59–70. 26. Canelas, H.M. (1962) [Neurocysticercosis: incidence, diagnosis and clinical pictures.] Arquivos de Neuropsiquiatria 20, 1–16. 27. Silva, W.F., Ataide, L., Chiappetta, J. (1965) [Neurocysticercosis: a proposal of 3 cases.] Neurobiologia 28, 51–58. 28. Camargo-Lima, J.G. (1966) [Brain Cysticercosis. Clinical Aspects.] Thesis. Federal University of São Paulo, Brazil. 29. Mega, D., Lison, M.P. (1967) [Hypoglycorachie et cysticercose cérébro-méningée.] Schweizerisch Archiv für Neurologie, Neurochirurgie und Psychiatrie 100, 425–430. 30. Schenone, H., Ramirez, R., Rojas, A. (1973) [Epidemiological aspects of neurocysticercosis in Latin America.] Boletin Chileno de Parasitologia 28, 61–72. 31. Reis, J.B. (1970) [Incidence of Neurocysticercosis at the Department of Neurology and Neurosurgery of the São Paulo School of Medicine During the Period of 1939–1969.] Thesis. Federal University of São Paulo, Brazil. 32. Manreza, M.L.G. (1982) [Neurocysticercosis in childhood: clinical aspects and diagnosis.] Revista do Hospital das Clínicas da Faculdade de Medicina de São Paulo 37, 206–211. 33. Takayanagui, O.M., Jardim, E. (1983) [Clinical aspects of neurocysticercosis: study of 500 cases.] Arquivos de Neuropsiquiatria 41, 50–63. 34. Machado, A.B.B., Pialarissi, C.S.M., Vaz, A.J. (1988) [Human cysticercosis in a general hospital in S. Paulo, Brazil.] Revista de Saúde Pública (São Paulo) 22, 240–244. 35. Chequer, R.S., Vieira, V.L.F. (1990) [Neurocysticercosis in the state of Espírito Santo, Brazil: evaluation of 45 cases.] Arquivos de Neuropsiquiatria 48, 431–440. 36. Clemente, H.A.M., Werneck, A.L.S. (1990) [Neurocysticercosis: incidence in the Rio de Janeiro State.] Arquivos de Neuropsiquiatria 48, 207–209. 37. Vianna, L.G., Macedo, V., Mello, P., et al. (1990) [Clinical and laboratory study of neurocysticercosis in Brasília.] Revista do Brasileira de Neurologia 26, 35–40. 38. Bruck, I., Antoniuk, A.S., Wittig, E., et al. (1991) [Neurocysticercosis in childhood I. Clinical and laboratory diagnosis.] Arquivos de Neuropsiquiatria 49, 43–46. 39. Spina-França, A., Livramento, J.A., Machado, L.R. (1993) Cysticercosis of the central nervous system and cerebrospinal fluid. Immunodiagnosis of 1573 patients in 63 years (1929–1992). Arquivos de Neuropsiquiatria 51, 16–20. 40. Ferreira, M.S., Costa-Cruz, J.M., Nishioka, S.A., et al. (1994) Neurocysticercosis in Brazilian children: report of 10 cases. Tropical Medicine and Parasitology 45, 49–50. 41. Azambuja, N.D., Ambrós, S., Vanzin, J., et al. (1995) [Neurocysticercosis calcifications in computed tomography: a report of the Department of Radiology of HSVP.] Revista do Hospital São Vicente de Paula 7, 14–19.

110

S. Agapejev

42. Camargo, N.J. (1995) Epidemiological situation of taeniasis/cysticercosis in the state of Paraná (Southern part of Brazil) and strategie for its control. PAHO/AMRO WHO Informal Consultation. 43. Gonçalves-Coêlho, T.D., Coêlho, M.D.G. (1996) Neurocysticercosis in Paraíba, Northeast Brazil – an endemic area? Arquivos de Neuropsiquiatria 54, 565–570. 44. Freitas, J., Palermo, E.N. (1996) [Taeniasis–cysticercosis complex in Northern Brazil.] Brazilian Journal of Veterinary Research and Animal Science 33, 270–275. 45. Takayanagui, O.M., Castro e Silva, A.A.M.C., Santiago, R.C., et al. (1996) [Compulsory notification of cysticercosis in Ribeirão Preto – SP.] Arquivos de Neuropsiquiatria 54, 557–564. 46. Andrade, A.S. (1997) [Neurocysticercosis: Clinical, Epidemiological and Diagnostic Aspects – Prospective Study of 157 Patients in Northeastern Region – Bahia, Brazil.] Thesis. Federal University of Rio de Janeiro, Brazil. 47. Forlenza, O.V., Guerra-Vieira, A.H., Nóbrega, J.P.S., et al. (1997) Psychiatric manifestations of neurocysticercosis: a study of 38 patients from a neurology clinic in Brazil. Journal of Neurology, Neurosurgery and Psychiatry 62, 612–616. 48. Narata, A.P., Arruda, W.O., Uemura, E., et al. (1998) [Neurocysticercosis: a CT-scan study in a series of neurological patients.] Arquivos de Neuropsiquiatria 56, 245–249. 49. Agapejev, S. (1999) Standardization of tomographic indexes of the fourth ventricle and its characteristics in patients with neurocysticercosis (Abstract). Thesis. University of the State of São Paulo, Brazil. Arquivos de Neuropsiquiatria 57, 147–148. 50. Pfuetzenreiter, M.R., Ávila-Pires, F.D. (1999) [Clinical manifestations in patients with computerized tomography diagnosis of neurocysticercosis.] Arquivos de Neuropsiquiatria 57, 653–658. 51. Gomes, J., Veiga, M., Correa, D., et al. (2000) Cysticercosis in epileptic patients of Mulungo do Morro – Northeastern Brazil. Arquivos de Neuropsiquiatria 58, 621–624. 52. Silva, J.E., Diefenthaler, A.P., Palma, J.K. (2000) Frequency of suspected cases of neurocysticercosis detected by computed skull tomography in Santa Maria, RS Brazil. Revista do Instituto de Medicina Tropical de São Paulo 42, 57–58. 53. Ueda, M., Nakamura, P.M., Waldman, E.A., et al. (1984) [Frequency of anti-Cysticercus cellulosae antibodies in a population with risk of cysticercosis in a considered normal population segment in regions of the state of São Paulo, Brazil.] Revista do Instituto Adolfo Lutz 44, 25–28. 54. Vianna, L.G., Macedo, V., Costa, J.M., et al. (1996) [Seroepidemiologic study of human cysticercosis in Brasília, Distrito Federal.] Revista da Sociedade Brasileira de Medicina Tropical 19, 149–153. 55. Arruda, W.O., Camargo, N.J., Coelho, R.C. (1990) Neurocysticercosis. An epidemiological survey in two small rural communities. Arquivos de Neuropsiquiatria 48, 419–424. 56. Vaz, A.J., Hanashiro, A.S.G., Chieffi, P.P., et al. (1990) [Frequency of patients with anti-Cysticercus cellulosae antibodies in 5 municipalities of the state of São Paulo.] Revista da Sociedade Brasileira de Medicina Tropical 23, 97–99. 57. Silva-Vergara, M.L., Aluizio, P., Vieira, C.O., et al. (1995) [Epidemiological aspects of cysticercosis due to Taenia solium in the endemic area of Lagamar, MG.] Revista da Sociedade Brasileira de Medicina Tropical 28, 345–349. 58. Lonardoni, M.C.V., Bertolini, D.A., Silveira, T.G.V., et al. (1996) Frequency of anti-Cysticercus cellulosae antibodies in individuals from five counties in the southern region of Brazil. Revista de Saúde pública (São Paulo) 30, 273–279. 59. Pires, M.A.S., Barbosa, S.P.F., Gonçalves-Pires, M.R.F., et al. (2000) Frequency of IgG anti-cysticercus cellulosae antibodies in a human population of the São Luiz Island – MA, between March and June. Annals of the XIII Sao Paulo State Journal of Parasitology, p. 35. 60. Agapejev, S. (1996) Epidemiology of neurocysticercosis in Brazil. Revista do Instituto de Medicina Tropical de São Paulo 38, 207–216. 61. Trevisol-Bittencourt, P.C., Silva, N.C., Figueredo, R. (1998) [Prevalence of neurocysticercosis among epileptic in-patients in the west of Santa Catarina – southern Brazil.] Arquivos de Neuropsiquiatria 56, 53–58. 62. Morales, N.M.O., Agapejev, S., Morales, R.R., et al. (2000) Clinical aspects of neurocysticercosis in children. Pediatric Neurology 22, 287–291. 63. Dantas, F.L.R., Fagundes-Pereira, W.J., Souza, C.T., et al. (1999) [Intramedular cysticercosis: Case report.] Arquivos de Neuropsiquiatria 57, 301–305. 64 Colli, B.O., Martelli, N., Assirati, J.A. Jr, et al. (1994) Cysticercosis of the central nervous system. I. Surgical treatment of cerebral cysticercosis. A 23 years experience in the Hospital das Clínicas of Ribeirão Preto Medical School. Arquivos de Neuropsiquiatria 52, 166–186.

12

Taenia solium Taeniasis and Cysticercosis in Asia

Gagandeep Singh, Sudesh Prabhakar, Akira Ito, Seung Yull Cho and Dong-Chuan Qiu

Introduction

Indonesia

Taenia solium infections remain widely prevalent throughout Asia, Africa and South and Central America. A large number of community-based, epidemiological surveys carried out in several Latin American countries, provide accurate information on the burden of T. solium taeniasis and cysticercosis in these countries (see Chapters 8–10). In this regard, a series of investigations in Peru stands apart in terms of their completeness and accuracy of portrayal of the status of disease there (see Chapter 8). In contrast, precise epidemiological proportions of T. solium infection have not been defined adequately in most Asian countries. All we know is that the disease does exist in several countries like Indonesia, China, India and Nepal. More accurate data are, however, lacking. Information regarding taeniasis–cysticercosis is now available from Indonesia1. In the present review, several researchers review available knowledge about the situation of T. solium cysticercosis in their countries, with particular emphasis upon Indonesia, India, Korea, China and Japan.

Geography, people, customs and food habits Indonesia comprises 17,000 islands, of which 6000 are inhabited2. The islands are situated on the archipelago between the Indian and Pacific Oceans, straddling the equator. Important islands include Java, Sumatra, Borneo, Bali and Irian Jaya (now called West Papua Guinea). The last mentioned comprises the western half of New Guinea, the other eastern half of which is a separate country, namely Papua New Guinea (formerly East Irian Jaya) (Fig. 12.1). Indonesia has a landed area of 1.8 million km2 and a population of 21 million. About 88% of the population is Moslem, the remaining 12% consists of Christians, Hindus and Buddhists2. Certain islands have a majority of non-Moslem communities, for instance of Christians in Irian Jaya and Hindus in Bali. Some 80% of the people live in the countryside. Reliance upon traditional sanitary practices and inadequate cooking of infested pork are principal reasons for the high prevalence of T. solium taeniasis and cys-

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

111

112

G. Singh et al.

Philippines Pacific Ocean Malaysia

Irian Jaya Borneo

Sumatra

Papua New Guinea South Sulawesi Flores

Java Indian Ocean

Bali

Timor Australia Traditionally endemic areas

0

500

km

INDONESIA

Areas rendered highly endemic after introduced disease Areas threatened to become endemic

Fig. 12.1. Geographical representation of Taenia solium endemic regions in Indonesia.

ticercosis in Indonesia. For instance, the tribal inhabitants of Bali use the dwellings of their domestic animals, called ‘teba’, for ablution3. In Irian Jaya, an undeveloped tribal habitat with complete lack of sanitary understructure, people defecate in their house-yards and gardens and allow freeranging pigs to clear the excrement at nighttime. As if to complete the human– pig–human cycle, the Balinese traditional festival dish, ‘lavar’ is made from minced raw pork, mixed with coconut and spices4. In Irian Jaya, male tribals frequently feast upon pork that is inadequately cooked with cassava in earthen ovens during tribal ceremonies5. Women are permitted to consume the dish only after childbirth. Human and porcine cysticercosis are infrequent in the Moslem dominated regions of Indonesia1. However, they constitute major health and economic problems in Irian Jaya, Bali, Timor, Flores, Samosir Island of North Sumatra, Lampung in South Sumatra, West Kalimantan and Sulawesi (Fig. 12.1)1,6,7. In these islands, the estimated prevalence varies between 2% in Bali and 48% in Irian Jaya, the latter being one of the highest reported figures in the world1,6,7.

Intestinal taeniasis Intestinal taeniasis is common in Bali, Sumatra and Samosir Island, but beef Taenia sp. and Asian Taenia sp. are believed to be more common than pork Taenia sp.5,8–11. Recent data is available from a study by Sutisna and co-workers12. They reported three instances of Taenia sp. infection among 415 faecal samples surveyed in Bali; at a species level, one was T. solium, while the other two were T. saginata. The occurrence of T. solium taeniasis in Irian Jaya has been recognized only lately. Indeed several of the surveys of intestinal parasitism, which were undertaken in the 1950s and 1960s, indicated a complete absence of T. solium infection in this region. Thus, in at least two separate communitybased coproparasitic surveys, van der Hoeven and Rijpstra13 (1957), and Kelly and Vines14 (1966), could not find a single case of T. solium infection in Central Irian Jaya and neighbouring Papua New Guinea. The earliest report of human intestinal T. solium infection in the Wissel Lakes area of Irian Jaya was probably made in 197315. Several workers have recently examined the prevalence of intestinal T. solium infection in Irian Jaya. Margono and

Taeniasis and Cysticercosis in Asia

co-workers6,7,16, and other workers17,18, have reviewed these studies and found that the reported prevalence varied from 8% to 51%. The prevalence of intestinal taeniasis in other islands has not been studied in a comprehensive manner, but rates in excess of 5% of the faecal samples examined have been noted in North Sumatra and Timur16,19,20.

Porcine cysticercosis High levels of porcine infection have been noted throughout Indonesia, particularly Bali and Irian Jaya. More accurate data to indicate the prevalence of porcine cysticercosis is recently available from Irian Jaya17. Approximately 24% of pigs examined in Jayawijaya, Irian Jaya were noted to be heavily infected and 74% (50 of 71 examined) demonstrated serological evidence of exposure to T. solium17. The spread of a zoonotic disorder through transport of animals across geographical boundaries is typically exemplified by the story behind the occurrence of T. solium cysticercosis in Irian Jaya. Porcine cysticercosis was not known to occur in Irian Jaya prior to the 1970s. A mass transport of cysticercotic pigs was undertaken from Bali to Irian Jaya in the early 1970s and the taeniasis–cysticercosis epidemic in Irian Jaya followed.

Dog cysticercosis The consumption of canine meat and brain is customary among tribals of Irian Jaya. It might be interesting to speculate that the dog may also be involved in the transmission cycle of T. solium. In this context, parallel may be drawn from evidence of T. saginata taeniasis arising from consumption of undercooked reindeer brain in the former USSR21. Indeed, some recent studies using serological markers suitable for humans and swine have demonstrated serological evidence of exposure (to T. solium) among dogs in Indonesia22,23. Moreover, T. solium cysticerci have also been recovered from seropositive dogs (Ito et al., Jakarta, Indonesia, unpublished data).

113

Human cysticercosis In 1983, Coker-Vann and co-workers, reported an estimated prevalence of 21% of anticysticercus antibodies in sera based upon ELISA among inhabitants of Bali24. In other regions, such as Samosir and Nias, the prevalence of seropositivity was lower, in the range of 3–4%24. More recent data have revealed the continued presence, in low to moderate levels, of anticysticercus seropositive status in Bali. Thus, Theis et al. reported an immunoblot-based seropositivity to be 13%25. Serological prevalence was highest in the age group 21–30 years, with no preference for any gender. In comparison to the high prevalence found by Theis et al.25, Sutisna and co-workers12 determined a seropositive status in only 1.65% of a population surveyed in Bali. All seropositive cases were from one district only, suggesting regional variations with regard to the seroprevalence of cysticercosis on the island of Bali. While human cysticercosis has been known in Bali since at least the 1920s9,26–28, its occurrence in Irian Jaya is a recent phenomenon1. Tumada and Margono were the first to report T. solium cysticercosis in 12 patients in the Wissel Lakes area of Central Irian Jaya in 197315. Several other authors followed with reports of widespread infection among Ekari tribals of this region29–32. In 1978, Subianto et al. reported an unprecedented increase in hospital admissions due to high-degree burns between 1973 and 1976 in Central Irian Jaya31. Burns were believed to be caused by nocturnal seizures in tribals who slept by community fires during winter nights. Seizures were recorded in 63%, subcutaneous nodules were found in 33% and intestinal T. solium infection was demonstrated in 16% of 157 individuals, who were hospitalized with burns31. To build up on the story of the epidemic, while cysticercosis was recognized in Central Irian Jaya in the 1970s it was then unheard of in West Irian Jaya or the neighbouring Papua New Guinea. However, there is recent evidence of the spread of the epidemic to East and South Irian Jaya.

114

G. Singh et al.

Wandra et al. reported 120 burn casualties and new onset seizures in 293 individuals among a community of 15,000 in Jayawijaya district in East Irian Jaya33. Histopathological examination of subcutaneous cysts removed from a number of affected individuals confirmed the diagnosis of cysticercosis. Over the years, cross-border migration between Indonesian Irian Jaya and Papua New Guinea has given rise to concerns about the disease getting established in Papua New Guinea34. In fact, in 1990, Fritzsche et al. detected a serologically confirmed cases of cysticercosis among Irianese refugees in Papua New Guinea35. More recently, however, a survey found 3% of the population of Papua New Guinea to be seropositive and among them, local inhabitants were also positive18.

Philippines The estimated prevalence of T. solium taeniasis in Philippines is about 2%36. In one survey of over 200,000 stool examinations in Manila and elsewhere within the country, the prevalence of T. solium infection was 0.02%37. The estimated prevalence of porcine cysticercosis is 0.16%38. A Medline search indicated several reports of isolated cases and series of NC originating from Philippines39,40.

Hong Kong and Singapore Published reports indicate the occurrence of both indigenous and imported cases in Hong Kong, now part of China41,42. Local or indigenous cases result from consumption of pork imported from the Chinese mainland42. With specific reference to exotic cases, Heap reported that a diagnosis of cysticercosis was quite common in Nepalese Gurkha recruits in the Territorial Army43. The Gurkhas presumably acquired infection while in Nepal. CokerVann et al. surveyed three different ethnic communities using an anticysticercus ELISA and determined an overall prevalence of 8%24. Rates were highest among individuals of Chinese origin (13%) in comparison to those of Indian (5%) or Malay (3%) origin24. While

Singapore is a developed country, it is ‘at-risk’ for T. solium cysticercosis, given the high volume of travel to and from this country.

Vietnam, Cambodia and Laos Studies in the post-Vietnam war period focused on morbidity patterns among war veterans and refugees. Among various illnesses, a high rate of helminthiasis was described in war veterans and refugees by several authors44–47. Several case reports from medical facilities affirmed the occurrence of T. solium cysticercosis in good numbers in Vietnam48–50. In 36 children convalescing from a flu-like illness in Vietnam, 3% of the serum samples were positive for anticysticercus antibodies, when tested in an ELISA in 1972–197324. Contemporary data is now available; Brandt et al. reported reported a seropositivity of 5.7% among inhabitants of North Vietnam51, while reliable estimates of seropositivity are around 8% in Hanoi and 10% in Cambodia and Laos (Carlo Urbani, Hanoi, Vietnam, personal communication).

Thailand According to Vejjajiva, T. solium infestation is uncommon in Thailand52. However, reports of sporadic case and series have been made from several hospitals located throughout Thailand53–57. These indicate that low levels of infection do exist in this country. A recent report from a provincial general hospital in Surin, in Northeast Thailand, alluded to the frequent occurrence of solitary cysticercus granulomas57. There, a solitary cysticercus granuloma was identified in 110 (11%) of 972 patients with a seizure disorder over a 3-year period.

Myanmar One of the earliest Asian reports of cysticercosis was made from Myanmar (Burma) (1912)58. However, a review of literature, including a Medline search did not

Taeniasis and Cysticercosis in Asia

reveal a single recently published report of the disorder originating from Myanmar. Surely, this must be because of lack of awareness rather than the lack of occurrence of T. solium infections. Coker Vann et al. performed a serological study in a local population using an ELISA format and found anticysticercus antibodies in 6% of the samples surveyed24.

Malaysia and Bangladesh Malaysians are mostly Moslems and hence do not consume pork. Accordingly T. solium cysticercosis is recognized only infrequently in this country (Zim Abdul Rashid, Kuala Lumpur, Malaysia, personal communication). Similarly, Islam is the official and most widely endorsed religion in Bangladesh. Hence, indigenous cases of T. solium taeniasis and cysticercosis do not occur (Muzuharal Mannan, Dhaka Neurological Foundation, personal communication).

115

India Geography, people, customs and food habits India is located in subtropical South Asia. With a population of over one billion, it is the second most populated nation in the world. About 80% of the population is Hindu, 14% is Moslem and the remaining 6%, of several religions. The average literacy rate is 52%. About 80% of the people live in villages2. A good majority of the population in India is vegetarian59. Animal proteins account for about 20% of protein intake in India, in comparison with 58% in developed countries60. An unimaginable disparity exists in the geography, ethnicity, religion, food and personal habits, level of education and standards of living within the country. The above listed factors have direct bearing on the frequency of T. solium infection and, consequently, there is significant variation in the frequency of T. solium cysticercosis throughout the country (Fig. 12.2).

Jammu and Kashmir New Delhi Uttar Pradesh Bihar Assam

Calcutta

Kerala

Areas believed to be endemic Areas where transmission possibly exists Areas with no or very few local cases

Fig. 12.2. Geographical representation of regions within India, from where Taenia solium taeniasis and cysticercosis have been reported in considerable numbers.

116

G. Singh et al.

Porcine cysticercosis The estimated pig population in India is 15.4 million59. The density of pigs in the plains of North India (states of Uttar Pradesh, Bihar, Haryana and Punjab) is high and is estimated at 10–18 km2 61. Here, the pig industry largely consists of domestic pig rearers who follow the scavenging system, where pigs are allowed to free range in the morning and are enclosed in unhygienic pens at night61. Data collected from abattoirs from several locations in Uttar Pradesh in the northern plains revealed cysticercal infestation in the muscles of 8–12% of the slaughtered pigs62. Another survey of slaughterhouses in Calcutta in eastern India revealed cysticercus cellulosae infestation in 7% of the slaughtered pigs63.

Human taeniasis Public health and hospital records of British soldiers posted in India in the early part of the 19th century were extremely useful for calculation of the incidence of T. solium taeniasis64. At that time, it was customary to admit individuals with diagnosed taeniasis to hospital on account of the complexity and toxicity of its treatment. Thus, between 1928 and 1932, a total of 774 British soldiers were admitted to hospital because of taeniasis. All of them were assumed to have acquired the infection while in India, because T. solium infection did not exist in Britain at that time. Therefore, all cases were presumed to be new and not existing cases. During this period, approximately 58,000 British troops were stationed in India. This gave a calculated incidence of at least 1.3%. Infection was most commonly reported from the United Provinces (presently, Uttar Pradesh) (Fig. 12.2)64. More recent data has indicated the persistence of T. solium infestation in significant proportions in the areas mentioned above as well a variation in the prevalence throughout the country. A stool survey of 1074 outpatients and inpatients in a hospital in Calcutta revealed Taenia sp. infestation in 12 (1.11%)63. When identified to a species level, T. solium could be identified in only a single instance.

Another hospital-based evaluation of nearly 250,000 faecal samples in Northwest India revealed a prevalence of T. solium of 0.5–2%65. When faecal samples were examined in a community-based survey in Uttar Pradesh, a prevalence of 2% was determined62. A survey of 2559 faecal samples in Sikkim in East India indicated a prevalence of 3.9%66. Prevalence was highest among Lepkhas, Tibetians and Bhotiyas and was comparatively less among Hindus and Nepalese66. Taenia solium taeniasis is less of a problem in South India67,68and in the northern state of Kashmir69. Community based surveys in Tamil Nadu67and the Andaman and Nicobar Islands68 have revealed a high prevalence of geohelminthiasis but no cases of Taenia sp. infection. On the other hand, in Kashmir, where the population is predominantly Moslem, high prevalence of T. saginata infestation was found but no cases of T. solium were encountered in one survey69.

Human cysticercosis There is virtually no population-based data that gives information about the community burden, risk behaviours and geographical predilections of T. solium cysticercosis in India. Medical facility-based data is however available in the form of large series of patients with neurocysticercosis (NC). Health care providers all over the country with the exception of a few states such as Kerala70 in the extreme Southeast and Kashmir (Sushil Razdan, Jammu, India, personal communication) in the extreme north (Fig. 12.2), do see large number of patients with NC. Thus, when pre-computed-tomography (CT) era hospital records of a large referral hospital in Madras, South India were analysed, NC accounted for 0.005% of all neurological admissions71. At a tertiary care neurological referral service in the capital, New Delhi, NC constituted 2.5% of all intracranial spaceoccupying lesions72. In another tertiary hospital in Northwestern India, a survey of over 6000 consecutive autopsy protocols revealed cerebral cysticercosis in 48 (0.75%)65. Intensive evaluations of an unselected series of epileptics at a tertiary-care neurological

Taeniasis and Cysticercosis in Asia

facility in Banglore, South India, in the period when CT and magnetic resonance imaging (MRI) were not accessible, revealed a diagnosis of cerebral cysticercosis in 2%73. With the availability of CT and MRI, the proportion of seizures due to cerebral cysticercosis rose. Thus Murthy and Ravi, from Hyderabad in South India, diagnosed cerebral cysticercosis in 220 (8.7%) of an unselected group of 2537 consecutive patients with seizure disorder74. Similarly, Sawhney et al. noted cerebral cysticercosis in 49 (31%) of 158 patients among a series of 407 patients with seizure disorder in whom a CT scan was done75. In both series, solitary cerebral cysticercus granulomas predominated. Within the country, NC appears to be more prevalent in the northern region including the states of Bihar, Uttar Pradesh through Punjab. Other states also have a fair proportion of disease with the possible exception of Kerala, where low levels of disease reflect efficient sanitation, pig husbandry and a superior socio-economic and educational status and in Kashmir with its predominant Moslem population, where the consumption of pork is forbidden. Experience with contemporary tools of epidemiogical evaluation such as the enzyme-linked immunoelectrotransfer blot (EITB) is limited76. An EITB-based sero-survey of household family contacts of children with solitary cysticercus granulomas found anticysticercus antibodies in 27% of the family contacts. These figures are high because they are from a population that is at risk of exposure, possibly due to consumption of common food items and similar socio-economic and sanitary conditions as with index cases with solitary cysticercus granuloma.

Nepal A systematic evaluation of the dimensions of the problems related to T. solium cysticercosis has not been undertaken in this Himalyan nation with an area of 140,000 km2 and a population of 24 million. The disorder has been recognized as a major health hazard in the country only lately as is evident from few recent reports from major referral hospi-

117

tals77,78. Amatya and Kimula collected 62 cases of cysticercus skin mucosal and breast nodules out of a total of 23,402 biopsies over a 5-year period at the Patan Hospital in the capital city of Kathmandu77. Cases were drawn from all over the country, though the majority were from the capital city itself. Most patients were less than 30 years of age. Data from neurological facilities indicate that NC is the commonest cause of symptomatic seizures in Nepal79. Both solitary and multiple forms of cerebral cysticercosis are seen, though the former predominates.

Sri Lanka According to Senanayake (Peradinya, Sri Lanka, personal communication), NC, including the solitary cysticercus granuloma, which occurs very commonly in several neighbouring countries, does not occur locally in Sri Lanka.

China China has an area of 9.5 million km2 and a population of 1.2 billion. The country is divided by the river Yangtze into two: the warm tropical south and the cold and dry north. About 70% of the population is rural. There is a substantial portion of the population that is Buddhist, Taoist or Moslem, important because these communities do not consume pork. China also has the largest pig population in the world. The Food and Agricultural Organization estimated in 1997 that there were 4.6 billion pigs in China59. Despite this, levels of pork consumption do not approach those noted in the Western Hemisphere. Nevertheless, the conditions do exist in China that may perpetuate the pig–human–environment cycle. Surveys in Yunnan Province indicated that significant numbers of the Pumi and Bai minorities ate raw meat80,81. Surveys in rural portions of the Shandong Province revealed that pigs were rarely corralled, human defecation was indiscriminate and awareness of the means to recognize infected pork was lacking82,83.

118

G. Singh et al.

Neurocysticercosis has been reported from hospitals all over China. Yingkun et al. collected a series of 158 cases between 1956 and 1974 at a large hospital in Beijing84. Most clinic-based data is however not published or is published in Chinese scientific literature, to which the rest of the world’s scientific community has poor access.

Intestinal taeniasis Adult T. solium infection is distributed broadly throughout China. Confirmed cases have been noted in at least 28 provinces. Neimeng, Henan, Shandong, Hebei and Anhui are considered hyperendemic, while other provinces like Guangxi, Guizhou, Yunnan, Sichuan and Tibet have moderate prevalence of intestinal infection85. The National Investigation of Human Parasitic Diseases estimated an average prevalence of 0.112%; however, in certain regions, local prevalence rates were as high as 0.66–6.0%86. The investigation estimated that there were approximately 1.26 million persons with adult T. solium in the entire country. Several regional surveys have indicated varying levels of infection in different provinces within China. For instance, between 1975 and 1987, a coproparasitological evaluation of over 34,000,000 individuals in Henan Province revealed T. solium taeniasis in 0.55%87. Investigations in other regions have yielded similar results: Shandong – 0.8%88; Jinan, Taian and Laiwu City – 0.1%89; Yunnan – 6.93%; Dali City (Louyi village of Eryuan county) – 19.5%; Jilin (Yanji City) – 0.11%; Liaoning (Shengyang and Dalian cities) – 0.005%80; Sichuan (Xide county) – 4.0%90 and Fujian (Xianyou county) – 0.13%91.

Human cysticercosis The earliest report of confirmed human cysticercosis from China was made in 193092. The National Investigation of Human Parasitic Diseases revealed that T. solium cysticercosis was reported from 671 counties in 29 provinces within China93. Five zones of high endemicity have been described: (i) Northeast provinces; (ii) North China (including Hebei,

Neimeng and Shanxi), (iii) Northwest China (including Ganxu, Ningxia and Qinghai); (iv) a fourth zone comprising of Shandong, Henan, Anhui and Hubei; and (v) finally, a fifth zone comprising of Guangdong, Guangxi, Hainan, Yunnan and Sichuan (Fig. 12.3). Sporadic cases have also been reported from the provinces of Jiangshu, Shanghai, Zhejiang, Fujian, Taiwan, Guizhou, Xinjiang and Tibet. Most epidemiological studies have focused on the prevailing situation in Shandong Province82,83,89. Here, 38 clinical cases were detected among 35,512 patients examined in 2000, giving a frequency of 0.2%89. In this province, a seroprevalence (with a specific IgG4 antibody) of 2.2% was noted89. In another study using the indirect fluorescent antibody assay, a seroprevalence of 3.2% was found83. Seropositivity rates increased with age and were highest in persons over 60 years of age. Other factors that were significantly associated with seropositivity were indiscriminate defecation, inability to identify diseased pork and raising pigs. Outside the Shandong Province seropositivity rates are reportedly low94: Haerbin city of Helongjiang Province – 4.3%95; Liaoning Province – 0.02%96; Henan Province – 0.1–1.2%97,98 and Sichuan – 0.8%97. Higher seroprevalence rates have however been noted in the Pumi nation area of Yunnan Province (11.2%)81 and Guangxi (9.5%)99.

Korea Intestinal taeniasis During the past three decades, Taenia infection has decreased steadily in Korea. In a series of national surveys for intestinal helminth infections, undertaken every 5 years, the egg positive rates of Taenia species were 1.9% in 1971, 0.7% in 1976, 1.1% in 1981, 0.3% in 1986, 0.06% in 1992 and 0.002% in 1997, respectively, when one random sample of 1000 people was examined by stool microscopy100. In interpreting these data, low sensitivity of stool microscopy for detecting Taenia infection should be considered. However, the decreasing trend has well been depicted in the consecutive surveys.

Fig. 12.3. Geographical representation of Taenia solium endemic regions in China.

Zone 5

Zone 4

Zone 3

Zone 2

Zone 1

Non-endemic area

300

0

300

600

Miles

Taeniasis and Cysticercosis in Asia 119

120

G. Singh et al.

ally before the 1990s. The egg positive rate has always been the highest in Cheju Province, although the infections were found throughout the country (Fig. 12.4). Except for a few academic surveys, mass chemotherapeutic control has not been undertaken in Korea against intestinal Taenia infections. Instead, taeniafuges such as bithionol (marketed since 1964), niclosamide (since 1976) and praziquantel (since 1981) were allowed to be available to the public, and infected individuals can purchase the drug without prescription.

By examining morphology of Taenia expelled after chemotherapy, the proportion of T. solium was found in the wide range of 4.1–36.7%101 among the Taenia egg passers. As of 1997, the least number of infected people with two species of Taenia was about 9000, which were mostly aged people older than 60 years, living in rural Korea. From them, nationwide number of T. solium infection could be estimated as being in the range of 400–3200 out of 46 million people in Korea. The present intestinal infections are regarded as persisting ones contracted actu-

Pyongyang

Seoul

Not surveyed < 2.5% 2.5–4.9%

Pusan

5.0–7.4% > 7.5%

Cheju Fig. 12.4. Geographic map of Korea depicting major geographical foci of Taenia solium taeniasis and cysticercosis.

Taeniasis and Cysticercosis in Asia

Porcine cysticercosis Porcine infections with T. solium metacestodes had been as high as 7.4% in Cheju Province where pigs had been reared in pigpens in each household102. Swine infection rates also decreased steadily throughout the 1970s to 0.4–0.5%. After 1986, no more swine infections were found when the Governor of Cheju Province banned the use of pigpens. However, the principal reason of disappearance of measly pork in the Korean market was the modernization of the pig breeding industry. In 1980, about half of the pigs came to market from farm households. However, industrialized pig breeding, which started in the 1960s by instigation of an Irish Catholic Mission, has dominated the market since the mid-1980s. It is believed that the transmission cycle from pig to human infection of T. solium ceased in 1985.

Human cysticercosis The earliest report of human cysticercosis in Korea was made in 1937. Thereafter, sporadic case reports continued. Since the 1960s when the industrialization drive began and farmers migrated to industrial areas, the demand for animal proteins increased. During the same period, modernized pig breeding also began, but most pigs originated from farmhouses. Therefore in addition to sporadic cases of cysticercosis from rural areas, urban cases of subcutaneous cysticercosis, orbital and intraocular cysticercosis (which represented recent transmission and active infections) were frequently reported in literature in the 1970s103. One such report described that out of 657 patients with benign and malignant skin tumours, observed in Seoul during 1960–1972, 114 (24.3%) were caused by T. solium cysticercosis104. Out of 174,770 biopsy specimens submitted to the surgical pathology department of a University hospital in Seoul during 1968–1987, 580 cases (0.33%) were diagnosed as parasitic diseases. Of them, 216 (37.2%) were due to cysticercosis105. Cases of NC were also reported during the 1970s.

121

In the 1980s, innovative progress was achieved in diagnosis and patient management of NC including brain imaging by CT/MRI106, chemotherapeutics such as praziquantel107, and antibody test by ELISA108. As a result of the progress, it was found that at least 12.6% of 206 adult-onset epilepsy patients in 1982–1985 were diagnosed as due to cysticercosis109. An epidemiological study for anti-T. solium metacestode antibodies was also undertaken. The antibody positive rate was 3.1% in epilepsy patients while that in normal population was 1.8%110. Since 1984, a multi-antigen screening system has been set up for specific antibodies to three helminth parasites. During 7 years from 1990 to 1997, a total of 10,802 neurological patients with abnormal brain images were examined for the antibody levels. Of them, 1580 (14.6%) were positive for anti-T. solium antibodies in either serum or cerebrospinal fluid or both111. After experiencing epidemic cysticercosis in the early industrialization period, the situation of T. solium cysticercosis in Korea has improved nowadays because of progress in sanitation and pig husbandry. Innovative diagnostics and chemotherapeutics, together with improved patient care, have lessened the social burden caused by the disease. However, even if the transmission cycle of intestinal T. solium infection is stopped, morbidity and mortality due to NC will continue for decades because of the long-term nature of this larval disease.

Japan Masuda et al. reviewed available published and unpublished information on 345 cases of T. solium cysticercosis reported in Japan112. Subsequently, Nishiyama and Araki added more cases to their review, giving a total of 389 cases from 1908 till 1999. Of these 325 were Japanese; 168 were from the Okinawa Island, where an endemic focus existed before the Second World War. Among others, there were 20 Chinese, 22 Koreans, one Indian and 21 of whom no record of nationality was available112,113. In most of the cases reviewed, there was no evidence to suggest adult Taenia infection;

122

G. Singh et al.

presumably these cases acquired infection either during overseas travel or through persons of foreign origin in Japan. Over the last few years, between five and ten cases were detected every year in Japan114–117. At the Asahikawa Medical College, most cases were in workers who visit endemic countries115,117,118. However, two cases reported by Masuda et al. and Ohnishi et al. are of interest since both had no history of overseas travel and apparently acquired the disease locally in Japan112,116. This raises the possibility of an outbreak of cysticercosis such as the one reported in New York in an orthodox Jewish community that never travelled abroad but nevertheless acquired cysticercosis through household food handlers from endemic countries119,120.

West Asia (including Pakistan, Afganistan, Iran, Iraq and the Arabian Peninsula) Most of West Asia is almost exclusively Moslem. Human and porcine cysticercosis does not occur in these locations, though, given the high rate of travel to Arabia, the diagnostic possibility may be considered in foreigners who present with appropriate clinical features121.

Conclusions Asia is a colossal mix of contrasting geographies, cultures, religions and economies. Understandably, therefore, remarkable variations are observed in the prevalence of T. solium-taeniasis and cysticercosis in the continent. There are developed countries with high standards of sanitation such as Japan and Singapore, where T. solium infection is virtually non-existent, apart from an occasional imported case in overseas travellers or immigrants. There are also a number of Moslem countries in West Asia, but also others such as Malaysia, where the consumption of pork is forbidden on religious grounds. Here again, though for a different reason, T. solium infection does not occur. There are also few rapidly developing economies such as Korea, Thailand and Taiwan, where T. solium infection was a major health problem in the past, but its impact is now on the decline. In contrast, there are a number of developing countries such as Indonesia, China, India and Nepal, where a significant burden of disease is believed to exist. Finally, there are a number of countries such as Vietnam, Cambodia, Myanmar and Bhutan for which no current information is available about the status of T. solium infection but levels of infection can be imagined to be high.

References 1. Simanjuntak, G.M., Margono, S.S., Okamoto, M., et al. (1997) Taeniasis/cysticercosis in Indonesia as an emerging disease. Parasitology Today 13, 321–322. 2. www.geographic.org. India, Nepal, Korea, Indonesia and China. 3. Depary, A.A., Kosman, M.L. (1991) Taeniasis in Indonesia with special reference to Samosir Island, North Sumatra. Southeast Asian Journal of Tropical Medicine and Public Health 22, 239–241. 4. Simanjuntak, G.M., Margono, S.S., Sachlan, R., et al. (1977) An investigation on taeniasis and cysticercosis in Bali. Southeast Asian Journal of Tropical Medicine and Public Health 8, 494–497. 5. Sutisna, P. (1977) Human parasitic infections in Bali: a review. Bulletin Penelit Kesehat 17, 276–283. 6. Margono, S.S., Ito, A., Suroso, T. (2000) The problem of taeniasis and cysticercosis in Irian Jaya (Papua), Indonesia. Proceedings of the Sixth Asian-Pacific Congress for Parasitic Zoonoses, pp. 55–64. 7. Margono, S.S., Subahar, R., Hamid, A., et al. (2000) Cysticercosis in Indonesia: epidemiological aspects. Southeast Asian Journal of Tropical Medicine and Public Health 2 (Suppl.), 79-84. 8. Fan, P.C., Chung, W.C., Soh, C.T., et al. (1992) Eating habits of East Asian people and transmission of taeniasis. Acta Tropica 50, 305–315. 9. Cross, J.H., Clarke, M.D., Cole, W.C., et al. (1976) Parasitological survey in northern Sumatra, Indonesia. Journal of Tropical Medicine and Hygiene 79, 123–131. 10. Cross, J.H. (1987) Current status of some parasitic zoonoses in Asia and suggested studies on the application of new technologies. Proceedings of the First Sino-American Symposium on Biotechnology of Parasitic Diseases, pp. 1–5.

Taeniasis and Cysticercosis in Asia

11. 12. 13.

14. 15. 16.

17.

18. 19. 20. 21.

22. 23.

24.

25.

26.

27. 28. 29. 30.

31. 32.

33.

123

Kosin, E., Depary, A., Djohansjah, A. (1972) Taeniasis di pulau Samosir. Majalah Fakultas Kedokteran, Universitas Sumatera Utara, Medan, 3, 5–11. Sutisna, I.P., Fraser, A., Nengah Kapti, L., et al. (1999) Community prevalence study of taeniasis and cysticercosis in Bali, Indonesia. Tropical Medicine and International Health 4, 288–294. van der Hoeven, J.A., Rijpstra, A.C. (1957) Intestinal parasites in the Central Mountains District of Netherlands, New Guinea: an important focus of Balanitidium coli. Tropical and Geographical Medicine 9, 225–228. Kelly, A., Vines, A.P. (1966) Highland region survey of intestinal parasites. Medical Journal of Australia 2, 635–640. Tumada, L.R., Margono, S.S. (1973) Cysticercosis in the area of the Wissel Lakes, West Irian. Southeast Asian Journal of Tropical Medicine and Public Health 4, 371–376. Margono, S.S. (1997) Report for the Eighth Annual Meeting of the Indonesian Organization for Parasitology. In: Simanjuntak, G.M., Margono, S.S., Okamoto, M., et al. (1997) Taeniasis/Cysticercosis in Indonesia as an emerging disease. Parasitology Today 13, 321–322. Subahar, R., Hamid, A., Purba, W., et al. (2001) Taenia solium infection in Irian Jaya (West Papua), Indonesia: a pilot serological survey of human and porcine cysticercosis in Jayawijaya District. Transactions of the Royal Society of Tropical Medicine and Hygiene 95, 388–390. Wandra, T., Subahar, R., Margono, S.S., et al. (2001) Sero-epidemiology of neurocysticercosis in Irian Jaya (West Papua), Indonesia in 1996–1997 and Papua New Guinea in 1997. Acta Tropica (in press). Kusharyono, C., Sukartinah, S. (1991) The current status of food-borne parasitic zoonoses in Indonesia. Southeast Asian Journal of Tropical Medicine and Public Health 22, 8–10. Suweta, G.P. (1991) The situation of cysticercosis and taeniasis in animals/man in Bali. Southeast Asian Journal of Tropical Medicine and Public Health 22, 236–238. Blazek, K., Kirichek, V.S., Schramlova, J. (1986) Cysticercus bovis infection in the reindeer. Proceedings of the Second International Symposium on Taeniasis/Cysticercosis and Echinococcosis/Hydatidosis, pp. 121–127. Ito, A., Plancarte, A., Ma, L., et al. (1998) Novel antigens for neurocysticerosis: simple method for preparation and evaluation for serodiagnosis. American Journal of Tropical Medicine and Hygiene 59, 291–294. Ito, A., Plancarte, A., Nakao, M., et al. (1999) ELISA and immunoblot using purified glycoproteins for serodiagnosis of cysticercosis in pigs naturally infected with Taenia solium. Journal of Helminthology 73, 363–365. Coker-Vann, M.R., Subianto, D.B., Brown, P., et al. (1981) ELISA antibodies to cysticerci of Taenia solium in human populations in New Guinea, Oceania and Southeast Asia. Southeast Asian Journal of Tropical Medicine and Public Health 12, 499–505. Theis, J.H., Goldsmith, R.S., Flisser, A., et al. (1994) Detection by immunoblot assay of antibodies to Taenia solium cysticerci in sera from residents of rural communities and from epileptic patients in Bali, Indonesia. Southeast Asian Journal of Tropical Medicine and Public Health 3, 464–468. Hausman, R., Yoe, T.L., Fossen, A. (1950) Een geval van cysticercose met enkele aantekeningen over taeniasis in Indinesia [A case of cysticercosis with some notes on taeniasis in Indonesia]. Documenta Nederland Indonesia Morbidity Report 2, 59. Hadidjaja, P., Rukmono, B., Sjamsudhajat, et al. (1971) Another case of cysticercosis in Djakarta. Journal of Indonesian Medical Association 21, 461–465. Joe, L.K., Gupito, C., Handojo, K. (1955) A case of cysticercosis in Indonesia. Documenta Nederland Indonesia Morbidity Report 2, 134–136. Muller, R., Lillywhite, J., Bending, J.J., et al. (1987) Human cysticercosis and intestinal parasitism amongst the Ekari people of Irian Jaya. Journal of Tropical Medicine and Hygiene 90, 291–296. Gajdusek, D.C. (1978) Introduction of Taenia solium into West New Guinea with a note on an epidemic of burns from cysticercus epilepsy in the Ekari people of the Wissel Lakes area. Papua New Guinea Medical Journal 21, 329–342. Subianto, D.B., Tumada, L.R., Margono, S.S. (1978) Burns and epileptic fits associated with cysticercosis in mountain people of Irian Jaya. Tropical Geographic Medicine 30, 275–278. Desowitz, R.S., Margono, S.S., Sutjahyo, et al. (1977) Observations on the application of counterimmunoelectrophoresis for the seroepidemiology of human cysticercosis. Southeast Asian Journal of Tropical Medicine and Public Health 8, 303–307. Wandra, T., Subahar, R., Simanjuntak, G.M., et al. (2000) Resurgence of cases of epileptic seizures and burns associated with cysticercosis in Assologaima, Jayawijaya, Irian Jaya, Indonesia, 1991–95. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 46–50.

124

34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54.

55. 56. 57.

58. 59. 60. 61. 62.

G. Singh et al.

McManus, D.P. (1995) Improved diagnosis as an aid to better surveillance of Taenia solium cysticercosis, a potential public health threat to Papua New Guinea. Papua New Guinea Medical Journal 38, 287–294. Fritzsche, M., Gottstein, B., Wigglesworth, M.C., et al. (1990) Serological survey of human cysticercosis in Irianese refugee camps in Papua New Guinea. Acta Tropica 47, 69–77. Cross, J.H. (1988) Biotechnology research on cestodes in the Philippines, Malaysia and Indonesia. Southeast Asian Journal of Tropical Medicine and Public Health 19, 41–45. Hinz, E. (1984) Human Helminthiases in the Philippines. The Epidemiology and Geomedical Situation. Springer-Verlag, Berlin, pp. 166–170, 266–268. Arambulo, P.V., Cabrera, B.D., Tongson, M.S. (1976) Studies on the zoonotic cycle of Taenia saginata taeniasis and cysticercosis in the Philippines. International Journal of Zoonoses 3, 77–104. Quimosing, E.M., Conde, J., Cross, J.H. (1984) Subcutaneous and cerebral cysticercosis treated with praziquantel. Southeast Asian Journal of Tropical Medicine and Public Health 15, 201–205. Jarin, P. Cysticercosis presenting as a tongue mass. UP-PGH ENT Journal. http://www.cm.upm.edu. ph/dept/ent/journal 2.html Ko, R.C. (1991) Current status of food-borne parasitic zoonoses in Hong Kong. Southeast Asian Journal of Tropical Medicine and Public Health 22, 42–47. Woo, E., Yu, Y.L., Huang, C.Y. (1988) Cerebral infarct precipitated by praziquantel in neurocysticercosis – a cautionary note. Tropical Geographic Medicine 40, 143–146. Heap, B.J. (1990) Cerebral cysticercosis as a common cause of epilepsy in Gurkhas in Hong Kong. Journal of Royal Army Medical Corps 136, 146–149. Colwell, E.J., Welsh, J.D., Boone, S.C., et al. (1971) Intestinal parasitism in residents of the Mekong delta of Vietnam. Southeast Asian Journal of Tropical Medicine and Public Health 2, 25–28. Berke, R., Wagshol, L.E., Sullivan, G. (1972) Incidence of intestinal parasites in Vietnam veterans. Eosinophilia – a guide to diagnosis. American Journal of Gastroenterology 57, 63–67. Picher, O., Aspock, H. (1980) Frequency and significance of parasitic infections in refugees from Vietnam. Wiener Medizinische Wochenschrift 130, 190–193. King, P.A., Duthie, S.J., Ma, H.K. (1990) Intestinal helminths in pregnant Vietnamese refugees. Transactions of the Royal Society for Tropical Medicine and Hygiene 84, 723. Pham, H.T., Van Knapen, F. (1989) Preliminary report of praziquantel treatment of cysticercosis patients in Vietnam. Acta Leiden 57, 229–233. Pascoe, M., Saines, N., Lyall, I., et al. (1987) Cerebral cysticercosis: a case report with particular reference to recent advances in diagnosis and treatment. Australian and New Zealand Journal of Medicine 17, 55–57. Perry, H.D., Font, R.L. (1978) Cysticercosis of the eyelid. Archives of Ophthalmology 96, 1255–1257. Brandt, L. (2000) Taenia solium cysticercosis in Northern Vietnam. Third Seminar on Food-borne Parasitic Diseases; Food, Water and Parasitic Zoonoses in the 21st Century, Bangkok, Thailand, 95pp. Vejajiva, A. (1977) Neurology in Thailand. In: Spillane, J.D. (ed.) Tropical Neurology. Oxford University Press, Oxford, UK, pp. 335–352. Vanijanouta, S., Bunnag, D., Riganti, M. (1991) The treatment of neurocysticersosis with praziquantel. Southeast Asian Journal of Tropical Medicine and Public Health 22, 275–278. Morakote, N., Nawacharoen, W., Sukonthasun, K., et al. (1992) Comparison of cysticercus extract, cyst fluid and Taenia saginata extract for use in ELISA for serodiagnosis of neurocysticercosis. Southeast Asian Journal of Tropical Medicine and Public Health 23, 77–81. Chotmongkol, V., Silarugs, S. (1992) Transient paralytic attacks with cerebral cysticercosis. Southeast Asian Journal of Tropical Medicine and Public Health 23, 165–166. Bhoopat, W., Poungarin, N., Issaragrisil, R., et al. (1989) CT diagnosis of cerebral cysticercosis. Journal of Medical Association of Thailand 72, 673–681. Yodnopaklow, P., Mahuntussanapong, A. (2000) Single small enhancing CT lesions in Thai patients with acute symptomatic seizures: a clinico-radiological study. Tropical Medicine and International Health 5, 250–255. Krishnaswami, C.S. (1912) Case of Cysticercus cellulosae. Indian Medical Gazette 47, 43–44. Anonymous. FAO Production Yearbook, 1997–98. Food and Agriculture Organization of the United Nations, Rome, Italy 1998. Griggs, D. (1993) International variations in food consumption. Geography 3, 251–266. Sastry, N.S.R. (1995) Livestock Sector of India: Regional Aspects. International Book Distributing Co., Lucknow, India. Pathak, K.N., Gaur, S.N. (1989) Prevalence and economic implications of Taenia solium taeniasis and cysticercosis in Uttar Pradesh state of India. Acta Leiden 57, 197–200.

Taeniasis and Cysticercosis in Asia

125

63. Ratnam, S., Khanna, P.N., Bandyopadhyay, A.K. (1983) Incidence of taeniasis in man. Indian Journal of Public Health 27, 70–74. 64. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an analysis and follow-up of 450 cases. Medical Research Council Special Report Series 299, 1–58. 65. Mahajan, R.C. (1982) Geographical distribution of human cysticercosis. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 39–46. 66. Mitra, S., Patwari, A. (1998) Intestinal taeniasis in Sikkim. Journal of the Association of Physicians of India 45, 124–126. 67. Kang, G., Mary, S., Mathew, D., et al. (1998) Prevalence of intestinal parasites in rural southern Indians. Tropical Medicine and International Health 3, 70–75. 68. Sugunan, A.P., Murhekar, M.V., Sehgal, S.C. (1996) Intestinal parasitic infection among different population groups of Andaman and Nicobar Islands. Journal of Communicable Diseases 28, 253–259. 69. Patwari, A., Aneja, S., Singh, G., et al. (1980) A study of taeniasis in children. Indian Pediatrics 17, 515–517. 70. Kuruvilla, A., Pandian, J.D., Nair, M.D., et al. (2001) Neurocysticercosis: a clinico-radiological appraisal from Kerala state, South India. Singapore Medical Journal 42, 297–303. 71. Ramamurthi, B., Balasubramaniam, V. (1970) Experience with cerebral cysticercosis. Neurology India 18, 89–91. 72. Wani, M.A., Banerjee, A.K., Tandon, P.N., et al. (1981) Neurocysticercosis – some uncommon presentations. Neurology India 29, 58–63. 73. Mani, A., Ramesh, C.K., Ahuja, G.K., et al. (1974) Cysticercosis presenting as epilepsy. Neurology India 22, 30. 74. Murthy, J.M.K., Ravi, Y. (1995) The syndromic classification of the International League Against Epilepsy: a hospital based study from South India. In: Chopra, J.S., Sawhney, I.M.S. (eds) Progress in Neurology. BI Churchill Livingstone, New Delhi, India, pp. 53–67. 75. Sawhney, I.M.S., Lekhra, O.P., Chopra, J.S. (1995) Evaluation of epilepsy management and future guidelines for a developing country. In: Chopra, J.S., Sawhney, I.M.S. (eds) Progress in Neurology. BI Churchill Livingstone, New Delhi, India, pp. 28–37. 76. Singh, G., Ram, S., Kaushal, V., et al. (2000) Risk of seizures and neurocysticercosis in household family contacts of children with single enhancing lesions. Journal of the Neurological Sciences 176, 131–135. 77. Amatya, B.M., Kimula, Y. (1999) Cysticercosis in Nepal: a histopathologic study of sixty-two cases. American Journal of Surgical Pathology 23, 1276–1279. 78. Shrestha, S.P., Henning, A., Pradhan, D., et al. (1999) Subconjunctival and intraocular cysticercosis in Nepal. Tropical Doctor 29, 251–253. 79. Rajbhandari, K.C. (2000) Clinical profile of epilepsy with neurocysticercosis in Nepal. In: Proceedings of the Third Congress of Asian Oceanian Epilepsy Organization, New Delhi, pp. 18. 80. Fang, W., Lian, Z.Q., Fang, C., et al. (1996) The investigation of infection actuality and epidemic factors of Taenia solium taeniasis/cysticercosis in Bai minority of Dali, Yunnan. Journal of Practical Parasitic Diseases 4, 62. 81. Wang, H.Z., Zhang, H.M., Zhang, L.L., et al. (1997) The seroepidemiological survey of cysticercosis in Pumi minority focusing region of Yunnan Province. The Chinese Journal of Prevention and Care of Parasitic Diseases 10, 306. 82. Cao, W., van der Ploeg, C.P., Xu, J., et al. (1997) Risk factors for human cysticercosis morbidity: a population-based case control study. Epidemiology and Infections 119, 231–235. 83. Cao, W., van der Ploeg, C.P., Gao, C.L., et al. (1996) Seroprevalence and risk factors of human cysticercosis in a community of Shandong, China. Southeast Asian Journal of Tropical Medicine and Public Health 27, 279–285. 84. Yingkun, F., Shan, O., Xiuzhen, Z., et al. (1979) Clinicoelectroencephalographic studies of cerebral cysticercosis, 158 cases. Chinese Medical Journal 92, 770–786. 85. Li, W., Ma, Y. (1995) The epidemiological status of Taenia solium taeniasis in China. Henan Preventive Medicine Journal 6, 44–45. 86. Wang, Z. (1991) The Address to the Meeting of National Antiparasitic Diseases. Guilin, pp.1–4. 87. Ma, Y.X. (1991) The status and countermeasure of prevention and cure of echinococcosis and cysticercosis in China. The Chinese Journal of Prevention and Care of Parasitic Diseases (Suppl.) 4, 50–52.

126

G. Singh et al.

88. Liu, X., Deng, X.L., Zhao, Z.P., et al. (2000) The epidemiological survey of Taenia solium taeniasis/cysticercosis in the center of Shangdong Province. The Chinese Journal of Prevention and Care of Parasitic Diseases 13, 34–36. 89. Zhou, K.X. (1998) The epidemiology and prevention of Taenia solium taeniasis/cysticercosis in China. The Chinese Journal of Prevention and Care of Parasitic Diseases 11, 344–345. 90. Zhou, G.X., Zhang, G.H., Wang, S.Y., et al. (1993) The epidemiological survey of Taenia solium taeniasis/cysticercosis in Xide County of Sichuan. Journal of Practical Parasitic Diseases 1, 25–27. 91. Xu, X.R., Yin, H.Z., Chen, B.J., et al. (1998) The prevention and cure of Taenia solium taeniasis/cysticercosis in Xianyou County. The Haixia Journal of Preventive Medicine 4, 53–54. 92. Zhao, W.X. (1983) The Human Parasitology, 1st edn. People’s Sanitation Publishing Co., Beijing, China, pp. 492–509. 93. Xu, L.Q., Jiang, Z.X., Zhou, C.H., et al. (1999) The investigation of cysticercosis’s distribution in China. The Chinese Journal of Prevention and Care of Parasitic Diseases 12, 30–32. 94. Li, X.C., Sun, D.P., Hu, B.Y., et al. The epidemiological survey of Taenia solium taeniasis/cysticercosis and the study of corresponding countermeasure in Gunzhou City. The Chinese Journal of Prevention and Care of Parasitic Diseases 12, 150. 95. Ji, K.B., Tong, S.F., Liu, Y.L., et al. (1996) The seroepidemiological survey of cysticercosis in Ha Erbin City. The Chinese Journal of Prevention and Care of Parasitic Diseases 9, 313. 96. Li, F.H., Xu, J.T., Sun, T., et al. (1998) The epidemiological investigation of human Taenia solium taeniasis/cysticercosis in Liaoning Province. The Chinese Public Health Journal 14, 227–228. 97. Li, Y., Mo, Q.X., Wang, H., et al. (1997) The investigation of epidemic situation and epidemic factors of Taenia solium taeniasis/cysticercosis in Xiayi county. The Henan Journal of Preventive Medicine 8, 9–10. 98. Wang, Z.Q., Ma, Y.X., Cui, J., et al. (1999) The seroepidemiological survey of human Taenia solium taeniasis/cysticercosis in Weishi County of Henan Province. The Chinese Journal of Prevention and Care of Parasitic Diseases 12, 236–237. 99. Mai, F.Z., Xie, Z.Y., Lu, X.G., et al. (1999) The seroepidemiological survey of Taenia solium taeniasis/cysticercosis in the minority focusing region of Guangxi. The Guangxi Journal of Preventive Medicine 5, 121. 100. Ministry of Health and Welfare, Korea Association of Health (1997) Prevalence of Intestinal Parasitic Infections in Korea: the Sixth Report, pp. 1–287. 101. Rim, H.J., Song, K.W., Joo, K.H., et al. (1980) An epidemiological note on the taeniasis in Korea. Korean Journal of Parasitology 18, 235–240. 102. Han, H.R. (1969) A survey on Cysticercus cellulosae infection in swine of Cheju-Do. Korean Journal of Public Health 6, 23–28. 103. Lee, K.T., Kim, C.H., Park, C.T., et al. (1966) Cysticercosis and taeniasis in Chollapukdo Province. Korean Journal of Parasitology 4, 39–45. 104. Cho, B.K., Houh, W., Shim, S.I., et al. (1973) A study on 657 skin tumors. Korean Journal of Dermatology 11, 3–8. 105. Chi, J.G., Sung, R.H., Cho, S.Y. (1988) Tissue parasitic diseases in Korea. Journal of Korean Medical Science 3, 51–62. 106. Chang, K.H., Kim, W.S., Cho, S.Y., et al. (1988) Comparative evaluation of brain CT and ELISA in the diagnosis of neurocysticercosis. American Journal of Neuroradiology 9, 125–130. 107. Rim, H.J., Lee, J.S., Joo, K.H., et al. (1982) Therapeutic trial of praziquantel (Embay 8440; Biltricide) on the dermal and cerebral human cysticercosis. Korean Journal of Parsitology 20, 169–190. 108. Cho, S.Y., Kim, S.I., Kang, S.Y., et al. (1986) Evaluation of enzyme-linked immunosorbent assay in serological diagnosis of human neurocysticercosis using paired samples of serum and cerebrospinal fluid. Korean Journal of Parasitology 24, 25–41. 109. Han, S.H., Myung, H.J. (1986) A clinical study on epileptic seizures of late onset. Journal of Korean Neurological Association 4, 218–226. 110. Kong, Y., Cho, S.Y., Cho, M.S., et al. (1993) Seroepidemiological observation of Taenia solium cysticercosis in epileptic patients in Korea. Journal of Korean Medical Science 8, 145–152. 111. Cho, S.Y., Kong, Y., Kang, S.Y., et al. (1997) Multi-antigen screening for antibodies to three helminthes parasites in neurologic patients in Korea. Proceedings of the Third Korea-Japan Parasitologists’ Seminar, pp. 39–41. 112. Masuda, H., Niida, M., Nakamura, N., et al. (1980) Cysticercosis in Japan: one case after 30 years of infection with reference of 345 reported cases. Showa Medical College Journal 40, 669–688.

Taeniasis and Cysticercosis in Asia

127

113. Nishiyama, T., Araki, T. (1999) Cysticercosis: clinical and epidemiological aspects. Progress in Medical Parasitology in Japan, 7, 263–274. 114. Miyake, H., Takahashi, K., Tsuji, M., et al. (1993) A surgical case of solitary cerebral cysticercosis. No Shinkei Geka 21, 561–565. 115. Ohsaki, Y., Matsumoto, A., Miyamoto, K., et al. (1999) Neurocysticercosis without detectable specific antibody. Internal Medicine 38, 67–70. 116. Ohnishi, K., Murata, M., Nakane, M., et al. (1993) Cerebral cysticercosis. Internal Medicine 32, 569–573. 117. Ito, A., Nakao, M., Itoh, Y., et al. (1999) Neurocysticercosis case with a single cyst in the brain showing a dramatic drop in specific antibody titers within 1 year after curative resection. Parasitology International 48, 95–99. 118. Ito, A., Nako, M., Sako, Y., et al. (2000) Neurocysticercosis and echinococcosis in Asia: recent advances in the establishment of highly reliable differential serodiagnosis for international collaboration. Southeast Asian Journal of Tropical Medicine and Public Health 31 (Suppl. 1), 16–20. 119. Schantz, P.M., Moore, A.C., Munoz, J.L., et al. (1992) Neurocysticercosis in an orthodox Jewish community in New York City. New England Journal of Medicine 327, 692–695. 120. European Commission (2000) Opinion of the Scientific Committee on Veterinary Measures Relating to Public Health of the Control of Taeniasis/Cysticercosis in Man and Animals. pp. 31. 121. Kak, V.K., Al-Joshi, A.A., Daftary, S.G., et al. (1994) Cerebral cysticercosis presenting as a ring enhancing lesion with partial seizures (A case report with review of literature). Baharin Medical Bulletin 16, 26–28.

13

Taenia solium Cysticercosis in Africa

Michel Druet-Cabanac, Bienvenue Ramanankandrasana, Sylvie Bisser, Louis Dongmo, Gilbert Avodé, Léopold Nzisabira, Michel Dumas and Pierre-Marie Preux

Introduction Taenia solium cysticercosis exists in Africa but published reports are scarce. Its spread is not well understood, owing to the lack of welldeveloped medical infrastructure, and of trained medical staff and diagnostic facilities. Several sub-Saharan African countries have high rates of cysticercosis, because of indiscriminate pork consumption, poor sanitary conditions, free-roaming pigs around residential areas, and lack of veterinary control at slaughter facilities. Even in South Africa, where sanitary and medical facilities are better developed, the disease is well recognized, with a high prevalence having been reported. In West Africa, similar high rates have been reported in countries where epidemiological studies have been carried out. This chapter, based on a previous review1, gives an account of available data concerning T. solium cysticercosis in Africa.

Geography, people and their habits and environment Africa covers more than 30 million km2 of area and, after Asia, it is the second largest continent. It is divided into two parts by the equator. One-third of the continent is desert. The Sahara, the largest desert in the world,

covers almost one-quarter of Africa. Twothirds of the continent has a tropical or subtropical climate. Africa has nearly 600 million inhabitants. Its rate of population growth is the highest in the world, but actually it is sparsely populated, the average population density being around 20 inhabitants per km2. Differences in language, religion, ethnic origin and culture are enormous but comparable to other continents. Regarding religious status, Africa can be divided in two parts: the Moslem dominated northern part and animist and Christian dominated sub-Saharan region. Owing to religious beliefs, pork is not consumed in Moslem dominated regions of Africa, resulting in a low prevalence of cysticercosis in these areas. We have chosen to include Madagascar, an island off the African coast, in this review because of the similarities of the environmental conditions between this country and the African continent. The overall socio-economic standard of the population in Africa is low, the illiteracy rate is high, and cultural backgrounds are difficult to modify. There is a dearth of robust sanitary and medical understructure and trained medical personnel. Access to improved sanitary facilities and training of qualified medical staff is dependent upon socio-economic standards of the society. The latter in turn are negatively influenced by the number of diseases existing in the African continent, resulting in

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

129

130

M. Druet-Cabanac et al.

an important loss of productivity. This forms a vicious cycle that is very difficult to break. In most rural areas, meat inspection is improper or absent. Even in localities where slaughterhouses exist, illegal channels of meat marketing exist. Moreover, slaughterhouses do not exist in villages and people butcher their own animals, offering the meat for sale. Free-ranging pigs with access to human faeces abound. Too many inhabitants in remote areas of the continent ignore the danger of eating meat infected with cysticerci. Different gastronomic customs and beliefs concerning meat consumption also play an important role in transmission of T. solium cysticercosis. In a few ethnic groups, pork infested with cysticercosis is believed to have a better taste than healthy meat. Raw or insufficiently cooked pork meat is consumed to ensure virility in certain other communities. In some tribes of South Africa, tapeworm proglottides are a component of the ‘muti’ administered by native herbalists to expel intestinal worms2. In Africa, maybe more than anywhere else, environment and disease are closely related. As with other communicable diseases, the geographic, demographic and cultural characteristics of the region influence the epidemiology of cysticercosis. For instance, T. solium egg survival in the external environment is influenced by temperature and humidity. The tropical climate of Africa favours egg survival. In addition, ova can be transported over many kilometres by streams and rivers, and mechanically over long distances by birds. Some insects may also transmit the disease. The use of irrigation water contaminated by animal wastes contributes to transmission of cysticercosis. Finally, a high rate of transmission is noted in specific familial environments.

Human Cysticercosis Hospital-based case reports and series In most African countries, neurologists are few and general practitioners are not aware of cysticercosis. Access to modern neuroimaging techniques and serological diagno-

sis is limited. The clinical presentation of neurocysticercosis (NC) is extremely variable and the diagnosis is easy to miss. It is interesting that diagnosis of the first case of NC in a country often follows the completion of training of the first neurologist in that country. The first autopsy report of human cysticercosis in Africa was made from Madagascar in 1910 by Andrianjafy3. Bettencourt in 1911, reported cysticerci in an Angolan individual who died of trypanosomiasis. In 1938, Gallais reported NC in an epileptic individual from Benin4. Review of international literature indicates that T. solium cysticercosis has been reported from many African countries. Cases have been reported from Senegal5–7, Benin8, Ivory Coast9–11, Togo12, Ghana13, Burkina Faso1 and Nigeria14 in West Africa, Democratic Republic of Congo (ex-Zaire)15–17, Cameroon18, Burundi19, Kenya20, Rwanda21–23, Tanzania1 and Uganda1 in Central and East Africa, and Zimbabwe24–26, South Africa27–35 and Madagascar36 in southern Africa. Human cysticercosis was found in 7% of 300 autopsies carried out at Butare, Rwanda23. Gelfand reported cysticercosis in 0.45% of 2148 autopsies conducted in Zimbabwe24. Proctor, identified 71 cases of taeniasis in an autopsy survey of 7597 cases, most of them also had cysticercosis25. In Togo, 38 (1.45%) of 2604 consecutive patients presenting for neurological consultation to the outpatient department of a teaching hospital, were found to have cysticercosis12. Mason et al. observed that 12% of 630 hospitalized patients were seropositive for anticysticercus antibodies with an ELISA26. Sacks and Berkowitz noted a seropositivity rate of 7.4% among hospitalized adult patients in Johannesburg with an ELISA test35. In Madagascar, Michel et al., using ELISA and enzyme-linked immunoelectrotransfer blot (EITB) reported a seroprevalence rate of 36% among 1132 neurologic patients36. Human NC and seizure disorder A review of published studies from Africa reveals that seizures are the most frequent presenting manifestation of NC in common with data available from other continents.

T. solium Cysticercosis in Africa

Powell et al. noted seizures in 58% of 48 patients with proven cysticercosis from Zimbabwe37. In Madagascar, seizures were the presenting symptom in 57% of 241 patients with NC38. A total of 33 (87%) of 38 patients with NC presented with seizures in Togo12. Shasha et al. analysed 141 cases of cysticercosis from South Africa and reported seizures with or without other neurological syndromes in 95 (67.4%) of them39. In a paediatric cohort of 61 cases of cerebral cysticercosis from South Africa, seizures were recorded in 43%30.

131

Several studies from South and Central America indicate that NC is the most common cause of adult-onset seizures40–42. Studies from Africa have produced conflicting viewpoints on the association between NC and seizures (Tables 13.1 and 13.2)2,12,34,37,43–50. Dumas et al. demonstrated evidence of cysticercosis in 26 of 88 individuals with seizure disorder identified during a population-based survey in Togo48. The diagnosis of cysticercosis was based upon presence of one of the following findings: positive serology by ELISA; presence of

Table 13.1. Prevalence of cysticercosis among epileptic patients in sub-Saharan Africa. Number of epileptic patients

Prevalence (%)

45

98 103 93 200

2 37 46 47 34 48 12 49

200 180 70 106 578 88 305 170

40.8 11.7 18.3 12.8 5.5 15.5 34.4 30.0 50.9 28.0 29.5 10.8 13.5

Country

Year

Reference

Burundi

1992 1997 2000 1962

43 44

1965 1966 1987 1987 1991 1989 1995 2000

Cameroon South Africa

Togo

†

Diagnostic method * S, R, N S S S R S, R S, R, N CT CT CT S, R, N S, R, N, CT S

*S: serology; R: calcifications on standard radiographs; N: subcutaneous cysticercus nodules; CT: computerized tomography cerebral scan. †Louis Dongmo, Yaounde, Cameroon unpublished data.

Table 13.2. Seroprevalence of cysticercosis in case–control and transversal studies in sub-Saharan Africa.

Country

Year

Reference

Benin Burundi

2000 1997 2000 2000 1999 2000 2000

* 44

Cameroon Central African Republic Kenya Togo

† ‡

50 * 49

Number of epileptic patients

Prevalence in epileptics (%)

Number of controls

Prevalence in controls (%)

65 103 61 93 187 98 115

1.5 11.7 26.0 18.3 4.0 5.0 13.5

130 72 87 81 374 124 1343

1.5 2.8 24.0 14.8 2.4 2.4 3.8

*Pierre-Marie Preux, Limoges, France, unpublished data. †Nsengiyumva, Burundi, unpublished data. ‡Louis Dongmo, Yaounde, Cameroon, unpublished data.

132

M. Druet-Cabanac et al.

calcifications characteristic of cysticercosis on standard radiographs; proof of cysticerci in subcutaneous nodules by histology. Using the same criteria, evidence of cysticercosis was found in 40 of 98 individuals with seizures in Burundi43. Of these, 25 patients had a positive cerebrospinal fluid (CSF) serology. In a hospital-based study from Madagascar, Michel et al. reported 36% seropositivity for cysticercosis among 1132 consecutive hospitalized patients with neurological complaints38. Laurence and Levi also emphasized the aetiological role of cysticercosis in epilepsy in Zimbabwe, Malawi and Zambia51. However, in several other case-control studies, no difference was found between the seroprevalence rates in individuals with seizures and controls (Table 13.2). More studies with contemporary methods of case finding such as the EITB are needed in order to determine if these differences are real or only due to methodological discrepancies1, 41. Human NC and other neurological presentations Other presentations including intracranial hypertension (ICH), psychiatric symptoms and focal neurological deficits have been reported from Africa. ICH was a presenting symptom in 24% of 61 children with cerebral cysticercosis in South Africa30. In this report, headache and meningoencephalitis were noted in 28% and 13%, respectively. Meningoencephalitis was reported in two patients from Togo12. Some patients having NC present with multiple signs and symptoms. Avodé et al. reported a patient from Benin with diffuse cysticercosis, who presented with seizures, ICH, confusion, myositis and subcutaneous cysticercus nodules8. Spinal cord involvement or ocular cysticercosis has been rarely reported from Africa. Michel et al. reported ocular cysticercosis in 3% of 266 patients with cysticercosis36. Subcutaneous cysticercosis The finding of subcutaneous nodules in individuals with seizures may be taken as presumptive evidence of T. solium cysticercosis.

However, subcutaneous cysticerci need to be differentiated from onchocerciasis nodules in certain parts of Africa, where the latter is endemic. For example, cysticerci were found in 12 cases (22.7%), while onchocerci were found in 36 cases (67.9%) out of 53 biopsies of subcutaneous nodules in Togo48. The study further showed that clinical examination had excellent positive predictive value for onchocerciasis (100%) in comparison with cysticercosis (45.8%). Among the 12 individuals with subcutaneous cysticerci, a diagnosis of NC could not be confirmed in five. Interestingly, the study revealed that there were three epileptics among the 36 cases with histologically proven onchocercal subcutaneous nodules; two of them had intracranial calcifications typical of NC. This raises the possibility of co-infection in areas that are endemic for both disorders.

Community-based data on T. solium cysticercosis While there are several reports of NC in hospitalized patients from Africa, very few community-based studies have been undertaken. When available, studies are often subject to bias because of lack of random sampling or other appropriate epidemiological methods. This may explain the high variability of prevalence rates among different regions within Africa. Nevertheless, preliminary data has emerged to show that most sub-Saharan countries have a high prevalence of T. solium cysticercosis (Table 13.3)2,14,36,48–50,52–57. West Africa A population-based survey evaluated the prevalence of cysticercosis and epilepsy in the Kozah region of northern Togo in 198748,58. The study included 5264 randomly selected subjects above 15 years of age. In this population, the prevalence rate for epilepsy was 16.7 per 1000 (95%CI: 12.3–21.2 per 1000). The overall prevalence of cysticercosis was 2.4%. Serological studies were undertaken in part of this sample (i.e. among epileptic subjects, their relatives and

T. solium Cysticercosis in Africa

133

Table 13.3. Prevalence of human cysticercosis in sub-Saharan Africa and Madagascar. Country

Year

Reference

Benin

1996 1998 1998 2000 1987 2002 2000 1999 1993 1965 1987

52 53 54

1991 1989 2000

57 48 49

Burundi Cameroon

Central African Republic Madagascar South Africa

Togo

‡

55 14 §

50 36 2 56

Population studied *

Prevalence (% )

Sample size

Diagnostic method†

GP GP GP GP GP GP GP GP GP GP SC: Transkei SC: KwaZulu SC GP GP

3.5 3.9 1.5 24.0 2.4 0.8 16.7 2.4 18.0 8.5 0.23 2.49 5.5 2.4 3.8

319 1443 2625 87 764 4128 174 374 1408 2124 736 677 1352 5264 1343

S S S S S S S S S S S S S S, R, N S

*GP: general population; SC: school children. serology; R: calcifications on standard radiographs; N: subcutaneous cysticercus nodules. ‡Nsengiyumva, Burundi, unpublished data. §Louis Dongmo, Yaounde, Cameroon, unpublished data. †S:

neighbours). In this subsample, seroprevalence was 8.4% (95%CI: 6.5–10.7%), and the difference in prevalence between epileptic individuals and others was statistically significant (P0.001). Another survey in the Tone region of Togo, found 170 individuals with seizure disorder among 9155 examined, giving a prevalence of 18.6 per 100049. The seroprevalence of cysticercosis was significantly higher (P106) in subjects with seizure disorder (135 per 1000) than in a control group consisting of 1343 randomly selected individuals (38 per 1000). Using similar methods and case definitions, a survey of 1443 subjects older than 5 years in the Savalou region of Benin, in 1993, indicated a prevalence rate of seizure disorder of 15.2 per 1000 (95%CI: 9.8–23.4 per 1000). Prevalence rates were comparable to those found in Togo52,54. The seroprevalence rate for cysticercosis was 3.9% (95%CI: 3.0–5.1%). No statistically significant difference was found between seropositivity rates among individuals with and without seizures. Two other studies were carried out in Benin by the same team. A serological study for cysticercosis on a representative sample of 319

subjects in Vekky, a lake-side village situated near Cotonou in the Atlantique province of Benin, found 11 (3.5%) positive cases (95%CI: 1.8–6.3%)52. Houinato et al. evaluated 2625 sera using ELISA and immunoblot collected from six regions within Benin by cluster sampling54. The sera, therefore, constituted a representative sample of the national population. A total of 35 (1.3%) subjects were seropositive for cysticercosis (95%CI: 0.9–1.9%). Two regions, Atacora (3.3%) and Atlantique (3.0%) had higher seroprevalence rates than the national average. The Moslem dominated regions of Borgou (0.3%), Ouémé (0.8%) had low seroprevalence rates. The prevalence rate was higher in men (1.9%; 95%CI: 1.2–2.7%) than in women (0.8%; 95%CI: 0.4–1.5%) (P0.05). Benin can then be considered as a country with medium endemicity for cysticercosis with several foci of hyper-endemicity53,59. East Africa In Kazanya, northern Burundi, 25% of individuals with seizure disorder were assigned

134

M. Druet-Cabanac et al.

a diagnosis of NC based on the finding of anticysticercus antibodies in CSF in a community-based survey43. To our knowledge, this is the only population-based study from East Africa. Southern Africa A serological survey using complement fixation and precipitin reactions found an overall prevalence rate of 8.5% of cysticercosis among a rural black population in South Africa2. In an ELISA based serosurvey, 22 of 736 school children from Transkei were found to be serologically positive while only eight of 677 KwaZulu children were positive56. These results, when corrected for the sensitivity and specificity of ELISA, indicate a prevalence rate for cysticercosis of 2.49% in Transkeian school children and 0.23% in the KwaZulu. The differences in prevalence between the two regions are in keeping with the meat-eating habits of the two communities. While KwaZulu is primarily a cattle and meatproducing area, the Transkei region has a large number of free-roaming pigs in addition to cattle. An earlier study in 1966 revealed that the frequency of porcine cysticercosis detected in slaughterhouses in the Transkei area was nearly seven times higher than in those close to the KwaZulu area60. Another ELISA based serosurvey, carried out on school children in Transkei in 1991, determined an overall seroprevalence rate of 5.5%57. The rates were similar for regions with different climatic conditions. An interesting revelation that emerged from this study was the lower seroprevalence rate in undernourished children (3.3%) in comparison with those with good nutritional status (7.3%). The authors attributed this discrepancy to an impaired antibody response associated with proteinenergy malnutrition. In Madagascar, 91 of 34,137 persons with neurological symptoms were found to have NC61. When 1408 sera from healthy individuals from six provinces of Madagascar were evaluated by the anticysticercus ELISA/EITB, a high seroprevalence rate of 18% was obtained36,38.

Porcine Cysticercosis Only few studies have examined the burden of porcine cysticercosis in Africa. In Burundi, the prevalence was found to be around 20%56. In northern Togo, 17% of pigs were reported to be infected58. In South Africa, prevalence of porcine cysticercosis was 4% in 198445. Similar data are also available from other African countries14,62. Veterinary meat inspection is an important method of prevention. Unfortunately, in most parts of Africa, only a very small percentage of pig carcasses undergo veterinary meat inspection. We believe that the situation in Africa is similar to that reported in Peru, where about 65% of the pork consumed is obtained through informal channels, in order to avoid financial losses from the condemnation of infected pigs63. One way to circumvent these problems would be to establish an official market for infected meat. The meat brought there, at a somewhat lower price, could then be processed using methods that would kill all cysts. The production of free-roaming pigs, which feed on domestic wastes and faecal matter, with minimal feeding and maintenance costs is a considerable source of income for small farmers. None of the peasants who raised pigs in Vekky (Benin) practised indoor husbandry52. Similarly, in Savalou (Benin), 92.6% of the pigs are produced using free-range methods53. In western Cameroon, pigs are raised in household pens but humans frequently defecate inside these pens64.

Intestinal Taeniasis Data on intestinal taeniasis in Africa is extremely limited. Furthermore, there are discrepancies between the low prevalence of intestinal taeniasis and the high prevalence of cysticercosis in the same area. For instance, Dumas et al. found T. solium eggs and proglottides in one case out of 1163 stool examinations and eggs alone in eight (0.5%) out of 1157 faecal samples48. Only one of these eight cases was seropositive (ELISA) for cysticercosis. Newell et al.

T. solium Cysticercosis in Africa

established a prevalence of taeniasis (both T. solium and T. saginata) of 0.16% in 1992, 0.25% in 1993 and 0.25% in 1994 among school children in Rumonge, Burundi44. The highest reported prevalence was reported from South Africa, where a survey found 10% prevalence of adult Taenia infection.

Conclusions While human and porcine cysticercosis have been recognized as major health and economic problems in Latin America and also in few developed countries, their impact upon health and economy in Africa has not been adequately appreciated. Preliminary epidemiological data indicate that sub-Saharan Africa may be a major focus of disease.

135

Besides, cysticercosis has also been recognized in West Africa and southern Africa. Studies from Benin and Togo have succeeded in increasing the awareness of local political, administrative and public health authorities concerning cysticercosis and NC. In Benin, information on sanitation has been disseminated through a published handbook. More work of this nature on a collaborative basis involving countries within Africa and beyond are clearly required to assess and contain the situation in Africa.

Acknowledgements We would like to thank the Conseil Régional du Limousin for their financial help and Dr Bernard Bouteille for technical assistance.

References 1. Preux, P.M., Melaku, Z., Druet-Cabanac, M., et al. (1996) Cysticercosis and neurocysticercosis in Africa: current status. Neurological Infections and Epidemiology 1, 63–68. 2. Heinz, H.J., MacNab, G.M. (1965) Cysticercosis in the Bantu of Southern Africa. South African Journal of Medical Sciences 30, 19–31. 3. Andrianjafy, A. (1910) Cysticercose humaine. S S Mad 2, 53–60. 4. Gallais, P. (1938) Deux cas de cysticercose cérébrale avec manifestations épileptiques. Bulletin de la Société de Pathologie Exotique 31, 915–919. 5. Collomb, H., Lariviere, M., Philippe, Y. (1961) Cysticercose cérébrale (premier cas au Sénégal). Bulletin de la Société de Médicine d’African Noire 6, 695–700. 6. Dumas, M., N’Diaye, I.P., Daumens, J.P., et al. (1976) Cysticercose cérébrale (deux nouveaux cas sénégalais). Bulletin de la Société de Médicine d’African Noire 21, 203–211. 7. Collomb, H., Larivière, M., Phillipe, Y., et al. (1964) Foyer de cysticercose de la Basse Casamance (Sénégal). Bulletin et Mémoires de la Faculté Mixte de Médecine et de Pharmacie de Dakar, Sénégal 12, 148–155. 8. Avodé, D.G., Bouteille, B., Avimadjé, M., et al. (1994) Epilepsie, hypertension intracrânienne, syndrome confusionnel et cysticercose cutanée, à propos d’un cas observé en milieu hospitalier au Bénin. Bulletin de la Société de Pathologie Exotique 87, 186–188. 9. Heroin, P., Loubière, R., Doucet, J., et al. (1972) Un cas de cysticercose sous-cutanée en Côte d’Ivoire. Revue Médicale Côte d’Ivoire 8, 26. 10. Giordano, C., Vedrenne, H., Dago-Ekribi, A., et al. (1976) Cysticercose cérébrale à forme confusionnelle avec aspects périodiques à l’EEG, étude anatomo-clinique. Médicine d’Afrique Noire 23, 43 – 51. 11. Bullock, A. (1980) La cysticercose cérébrale. A Propos d’une Observation Clinique, Electrique et Anatomique. Medical thesis, Abidjan, Ivory Coast, 75 pp. 12. Grunitzky, E.K., Balogou, A.K., M’Bella, M., et al. (1995) La cysticercose chez des malades neurologiques en milieu hospitalier à Lomé, Togo. Annales de Médecine Interne 146, 419–422. 13. Odamtten, S.E., Laing, W.N. (1967) Cysticercosis of the brain. Ghana Medical 6, 97–105. 14. Geerts, S., Zoli, A., Wallingham, L., et al. (2002) Taenia solium cysticercosis in Africa: an under-recognised problem. In: Craig, P.S., Pawlowski, Z.S. (eds) Tapeworm Zoonoses: – an Emergent and Global Problem. IOS Press, Amsterdam, pp. 13–23. 15. Fain, A., Duren, P., Fels, P. (1956) Cysticercose généralisée et plasmocytose médullaire (myélome) associés chez une femme de race Muhutu. Annales de la Société de Belge Médecine Tropicale 36, 239–246.

136

M. Druet-Cabanac et al.

16. Denisoff, N., Haenecour, F. (1958) Nouveau cas de cysticercose généralisée dans l’Est Congolais. Annales de la Société de Belge de Médecine Tropicale 38, 529–530. 17. Lelo, T., Malenga, M., Ndoma, K., et al. (1992) La cysticercose cérébrale à Kinshasa, à propos de deux observations. African Journal of Neurological Sciences 11, 36–37. 18. Marty, P., Herzog, U., Marty-Jaussan, et al. (1985) 2 cas de cysticercose observés au Cameroun. Médecine Tropicale 45, 83–86. 19. Aubry, P., Ndayiragije, A., Kamamfu, G., et al. (1990) A propos de 2 cas de cysticercose au Burundi. Bulletin de la Société de Pathologie Exotique 83, 288–289. 20. Ruberti, R.F., Mwingi, S.M.G., Dekker, N., et al. (1985) Epilepsy in the Kenyan Africans. African Journal of Neurological Sciences 4, 1–3. 21. Kestelyn, P., Taelman, H. (1985) Effect of praziquantel in intraocular cysticercosis: a case report. British Journal of Ophthalmology 69, 788–790. 22. Gascon, J., Corachan, M., Ramirez, J. (1989) A propos de 5 cas de cysticercose au Rwanda. Médecine Tropicale 49, 77–80. 23. Vanderick, F.X., Moboryingabo, P. (1972) La cysticercose humaine au Rwanda. Annales de la Société de Belge de Médecine Tropicale 52, 153–155. 24. Gelfand, M. (1948) Cysticercosis of the brain in the Africans of Rhodesia. East African Medical Journal 25, 110–112. 25. Proctor, N.S.T. (1963) Problems associated with tapeworm infestation of the central nervous system. In: van Bogaert, L., Kafer, J.P., Poch, G.F. (eds) Tropical Neurology. Lopez Libreros Editores, Buenos Aires, Argentina, pp. 140. 26. Mason, P., Houston, S., Gwanzura, L. (1992) Neurocysticercosis: experience with diagnosis by ELISA serology and computerized tomography in Zimbabwe. Central African Journal of Medicine 38, 149– 154. 27. Becker, B.J.P., Jacobson, S. (1951) Infestation of the human brain with Coenurus cerebralis. Lancet 29, 1202–1204. 28. De Villiers, P.D. (1953) Cerebral cysticercosis: an aspect of the diagnosis. South African Medical Journal 27, 1097–1098. 29. Gelfand, M., Jeffrey, C. (1973) Cerebral cysticercosis in Rhodesia. Journal of Tropical Medicine and Hygiene 76, 87–89. 30. Thomson, A.J., De Villiers, J.C., Moosa, A., et al. (1984) Cerebral cysticercosis in children in South Africa. Annals of Tropical Paediatrics 4, 67–77. 31. Tuch, P.S., Saffer, D. (1984) Cerebral cysticercosis: a case report and review of literature. South African Medical Journal 65, 211–216. 32. Joubert, J., Joubert, M.J., Lombaard, C.M. (1985) Neurocysticercosis – a comprehensive approach to medical treatment. South African Medical Journal 68, 11–14. 33. Zini, D., Farrell, V.J.R., Wadee, A.A. (1990) The relationship of antibody levels to the clinical spectrum of human neurocysticercosis. Journal of Neurology, Neurosurgery and Psychiatry 53, 656–661. 34. Van As, A.D., Joubert, J. (1991) Neurocysticercosis in 578 black epileptic patients. South African Medical Journal 80, 327–328. 35. Sacks, L.V., Berkowitz, I. (1990) Cysticercosis in urban black South African community: prevalence and risk factors. Tropical Gastroenterology 11, 30–33. 36. Michel, P., Callies, P., Raharison, H., et al. (1993) Epidémiologie de la cysticercose à Madagascar. Bulletin de la Société de Pathologie Exotique 86, 62–67. 37. Powell, S.J., Proctor, E.M., Wilmot, A.J., et al. (1966) Cysticercosis and epilepsy in Africans: a clinical and serological study. Annals of Tropical Medicine and Parasitology 60, 152–158. 38. Michel, P., Callies, P., Raharison, H., et al. (1992) La cysticercose à Madagascar: mise au point diagnostique et thérapeutique. Dakar Médical 37, 191–197. 39. Shasha, W., Van Dellen, J., Cakata, E. (1986) Cysticercosis: an analysis of 141 cases in South Africa. South African Journal of Epidemiology and Infection 1, 94–97. 40. Medina, M.T., Rosas, E., Rubio-Donnadieu, F., et al. (1990) Neurocysticerosis as the main cause of late-onset epilepsy in Mexico. Archives of Internal Medicine 150, 325–327. 41. Carpio, A., Escobar, A., Hauser, W.A. (1998) Cysticercosis and epilepsy: a critical review. Epilepsia 39, 1025–1040. 42. Pal, D.K., Carpio, A., Sander, J.W.A.S. (2000) Neurocysticercosis and epilepsy in developing countries. Journal of Neurology, Neurosurgery and Psychiatry 68, 137–143. 43. Nzisabira, L., Nsengiyumva, G., Bouteille, B., et al. (1992) La cysticercose dans la province de Kayanza (Burundi). Bulletin de la Société de Pathologie Exotique 85, 374–377.

T. solium Cysticercosis in Africa

137

44. Newell, E., Vyungimana, F., Geerts, S., et al. (1997) Prevalence of cysticercosis in epileptics and members of their families in Burundi. Transactions of the Royal Society of Tropical Medicine and Hygiene 91, 389–391. 45. Bird, A.V., Heinz, H.J., Klintworth, G. (1962) Convulsive disorders in Bantu mine workers. Epilepsia 3, 175–187. 46. Naidoo, D.V., Pammenter, M.D., Moosa, A., et al. (1987) Seventy black epileptics: cysticercosis, computed tomography, and electroencephalography. South African Medical Journal 72, 837– 838. 47. Campbell, G.D., Farrell, V.J.R. (1987) Brain scans, epilepsy and cerebral cysticercosis. South African Medical Journal 72, 885–886. 48. Dumas, M., Grunitzky, E.K., Deniau, M., et al. (1989) Epidemiological study of neurocysticercosis in Northern Togo (West Africa). Acta Leidensia 57, 191–196. 49. Balogou, A.K., Grunitzky, E.K., Beketi, K.A., et al. (2000) Cysticercose et épilepsie au nord du Togo dans le Tone. Revue Neurologique (Paris) 156, 270–273. 50. Druet-Cabanac, M., Preux, P.M., Bouteille, B., et al. (1999) Onchocerciasis and epilepsy: a matched case-control study in Central African Republic. American Journal of Epidemiology 149, 565–570. 51. Laurence, F., Levi, S. (1990) Epilepsia in Rhodesia, Zambia and Malawi. African Journal of Medical Science 1, 291–303. 52. Adjidé, C.C., Bouteille, B., Josse, R., et al. (1996) Séroprévalence de la cysticercose dans la commune lacustre de Vekky, département de l’Atlantique (Bénin). Bulletin de la Société de Pathologie Exotique 89, 24–29. 53. Avodé, D.G., Bouteille, B., Houngbe, F., et al. (1998) Epilepsy, cysticercosis and neurocysticercosis in Benin. European Neurology 39, 60–61. 54. Houinato, D., Ramanankandrasana, B., Adjidé, C.C., et al. (1998) Seroprevalence of cysticercosis in Benin. Transactions of the Royal Society of Tropical Medicine and Hygiene 92, 621–624. 55. Zoli, A., Geerts, S., Vervoort, T. (1987) An important focus of porcine and human cysticercosis in West Cameroon. In: Geerts, S., Kumar, V., Brandt, J. (eds) Helminth Zoonoses. Martinus Nijhoff Publishers, Dordrecht, pp. 85–91. 56. Pammenter, M.D., Rossouw, E.J., Dingle, C.E. (1987) Serological detection of cysticercosis in two rural areas of South Africa. Transactions of the Royal Society of Tropical Medicine and Hygiene 81, 242–244. 57. Shasha, W., Pammenter, M.D. (1991) Sero-epidemiological studies of cysticercosis in school children from two rural areas of Transkei, South Africa. Annals of Tropical Medicine and Parasitology 85, 349–355. 58. Dumas, M., Grunitzky, K., Belo, M., et al. (1990) Cysticercose et neurocysticercose: Enquête épidémiologique dans le nord du Togo. Bulletin de la Société de Pathologie Exotique 83, 263–274. 59. Avode, D.G., Capo-Chichi, O.B., Gandaho, P., et al. (1996) Epilepsie provoquée par la cysticercose. A propos d’une enquête sociologique et culturelle réalisée à Savalou au Bénin. Bulletin de la Société de Pathologie Exotique 89, 45–47. 60. Verster, A. (1966) Cysticercosis, hydatidosis and coenurosis in the republic of South Africa. Journal of South African Veterinary Medical Association 37, 37–45. 61. Andriamiandra, A., Cros, J., Dodin, A., et al. (1969) La cysticercose à Madagascar. Bulletin de la Société de Pathologie Exotique 62, 894–900. 62. Geerts, S. (1993) The taeniosis–cysticercosis complex in Africa. Bulletin Séances de l’Académie des Sciences d’Outre-Mer 38, 245–264. 63. Cysticercosis Working Group in Peru. (1993) The marketing of cysticercotic pigs in the Sierra of Peru. Bulletin of the World Health Organization 71, 223–228. 64. Marty, P., Mary, C., Pagliardini, G., et al. (1986) Courte enquête sur la cysticercose et le taeniosis à Taenia solium dans un village de l’ouest Cameroun. Médecine Tropicale 46, 181–183.

14

Taenia solium Cysticercosis: the Special Case of the United States

Wayne X. Shandera, Peter M. Schantz and A. Clinton White Jr.

Introduction Neurocysticercosis (NC) is commonly considered a disease of the developing world. Nonetheless, NC is also diagnosed in the developed world. By virtue of the number of immigrants entering the United States of America (USA) every year from countries where Taenia solium infection is endemic, more cases of imported NC are diagnosed in the USA every year than in all other developed countries combined. While NC cases in the USA occur primarily among immigrants from the developing world, a few cases arise autochthonously. In this chapter we discuss the epidemiology of NC in the developed world by focusing on the USA.

Early American Reports The earliest studies on NC were from Europe. These include descriptions of Taenia morphology, clarification of the animal hosts’ differences between T. solium (originally classified by Linnaeus) and T. saginata (classified by the German scientist, Johann Goeze in the 18th century) and the detailed elucidation of the Taenia life cycle by the 19th-century German scientist Karl Leuckart1. Many of the clinical manifestations were defined by British investigators studying clinical disease

acquired largely in India. Key insights included the observation of the protracted interval between acquisition of disease and onset of symptoms. For example, of over 450 British citizens who acquired infection primarily in India, clinical disease did not present until several years (average: 5 years, range 1–30 years) later in their homeland2. In the USA, T. solium cysticercosis has always been predominantly an imported disease. Even in the early 19th century, when ‘thousands of swine’ roamed streets in New York City and other communities, cysticercosis was rarely described in the USA. Occasional cases were reported in the late 19th century and early 20th century, but most patients were German and Eastern European immigrants who were infected before immigration. A review published in 1899, for example, describes only eight cases including the first case, a German woman reported from New York in 18573. Few cases were reported in the first half of the 20th century4. Two larger case series were published in the 1950s. The first described two new cases from Louisiana as well as a literature review of 40 additional American cases5. Overall, 31% showed ocular disease, and only 49% parenchymal brain disease, suggesting that neurological manifestations were often overlooked. Only three (7%) of the cases had clearly acquired their infection in the USA.

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

139

140

W.X. Shandera et al.

Another American series of cysticercosis cases diagnosed in the USA involved two intraventricular cases and one parenchymal case6. The three patients were from Portugal, Guatemala (the intraventricular cases) and Angola (the parenchymal case). Subsequent articles broadened the clinical spectrum of disease, and showed that surgical intervention improved the outcome of selected cases7–9. Thus, the number of cases described before the 1970s was limited, perhaps due to limitations of diagnostic tests. In addition, the spectrum of disease was skewed towards cases that were obvious (e.g. patients with parasites visible in the eye) or more severe (e.g. intraventricular disease).

T. solium Infections: 1970 Onwards The spurt in T. solium cases in the 1970s In the late 1970s, computed tomography (CT) scanning became widely available in the USA. The result was that parasites in the central nervous system could be identified without invasive testing. At about the same time, the number of immigrants from endemic areas began to increase. Between 1960 and the 1990s, the proportion of the US population born in foreign countries doubled. Furthermore, there was a shift in the country of origin for US immigrants. Prior to the 1970s, most immigrants to the USA were of Canadian or European origin. Changes in immigration policy led to the influx of large numbers of immigrants from Latin America and Asia. The recently completed 2000 US Census recorded 35.3 million persons of Hispanic origin living in the USA, representing an increase of 12.9 million in the past decade10. US immigrants of Mexican origin now number over 20 million. There was also increased travel to endemic areas with an estimated 200 million persons crossing the US–Mexico border every year. Increased immigration plus widespread availability of non-invasive neuroimaging tests resulted in a dramatic increase in recognition of NC. This was initially noted in California. For example, review of hospital records from four large medical centres in Los Angeles for the period 1973–1983

revealed 447 cases diagnosed with NC11. The number of cases, however, only began to increase during the last few years of the 1970s. There was a fourfold increase in the number of cases diagnosed between l977 and l981, which was far greater than the increase in the number of immigrants. The major factor associated with the increased number of cases was the introduction and widespread utilization of CT scans. This technology so enhanced the clinician’s ability to identify and define the nature of intracerebral lesions that its introduction overshadowed any other factors. The vast majority of the patients reported during this period were Hispanic. Most were presumably from Mexico. Even in this early report, however, 12 of the cases (3%) had no history of travel to diseaseendemic areas outside of the USA11. Thus, their infections were presumably acquired locally. As the number of immigrants increased and the geographic range of Hispanic immigration broadened, so did the extent of NC. By the 1990s, we estimated that 1000 NC cases were diagnosed in the USA each year12. With the continued increase in immigration from, and travel to endemic areas, the number of cases is probably higher now. In support of this is the continuing increase in the number of cases in Los Angeles13. While cases were initially noted in southern California, large cases series have subsequently been reported from Colorado, Texas, Chicago and New York12,14–17. Interestingly, these case series are reported from cities with large immigrant populations, especially those from Mexico and Central America. However, up to 42% of the patients were persons born in the USA15,16. Reported sources of possible exposure in these persons included travel to Mexico or Central America (50%) or visitors in the home from Latin America (20%). To document the extent of disease, an ongoing multi-state surveillance project of 11 university-affiliated hospital emergency departments was begun in the late 1990s18. NC was documented as the apparent cause of approximately 2% of cases of seizures. Most cases were seen in the southwestern states. Patients with no travel history and in whom infections may have been locally acquired represented 8% of identified cases.

T. solium Cysticercosis in the USA

Risk factors for T. solium infection in USA To further characterize the epidemiology of NC, we interviewed NC cases diagnosed in Houston19. Of 35 immigrants questioned, 83% were from families that raised pigs, 43% had a history of taeniasis, and 54% had a family history of taeniasis. The median period from immigration to diagnosis was 28 months for the 13 patients who had not left the USA after immigration. Thus, NC cases were concentrated in immigrants from villages in known endemic regions. Travel between the endemic villages and cities in the USA was surprisingly frequent19,20. In the late 1980s, NC was made a reportable disease in southern California. Surveillance was started in 1988 and within 3 years the county health system in Los Angeles was notified of 138 cases21. The number of cases was significantly fewer than would be predicted from hospital surveys, suggesting significant underreporting. As might be expected the case rates were over 2.5 times higher in the Hispanic than in the non-Hispanic communities. In addition, many of the non-Hispanic patients were Asian immigrants. With the increase in numbers of cases, there was also a shift in the spectrum of disease. Most cases diagnosed after the widespread use of neuroimaging studies were due to parenchymal cysticerci. Previously, it was widely assumed that NC carried a grave prognosis and that patients would do poorly unless treated with anticysticercal drugs. Based on uncontrolled studies, praziquantel and subsequently albendazole became widely used. During the early 1980s, neither of these drugs was widely available in the USA. Several investigators in California followed the natural history of patients treated with only symptomatic therapy22,23. US investigators reported that most patients with NC presented with seizures and usually a single enhancing lesion on CT scans. These patients did very well with only symptomatic therapy. By contrast, ocular, ventricular and meningeal disease (which comprised most of the reported cases before the CT era) were only a small minority of cases. Thus, the poor prognosis reported in older series

141

may have been due to ascertainment bias, with only more severe or obvious cases being diagnosed.

Locally acquired infections Locally acquired infections have also occasionally been noted. Pigs sold and consumed in the USA however, are infrequently infected with cysticercosis and among over 80 million swine slaughtered annually, fewer than 10 pigs show evidence of infection1. Thus, local acquisition of T. solium adult tapeworms (taeniasis) is unlikely to be a significant problem. By contrast, local acquisition of NC has been noted. Twelve US-born patients with NC who had not left the USA were identified in the hospital-based survey from Los Angeles21. Similarly, locally acquired cases were also identified in patients from Massachusetts and North Carolina24. A small series of patients with no travel outside of the USA was also reported from Chicago16. Direct or circumstantial evidence commonly links these cases to direct or indirect exposure to immigrants from Latin America, who presumably are (or were previously) carriers of adult-stage T. solium. This was most dramatically shown in a cluster of cases in four unrelated families of an Orthodox Jewish community in New York City25. The clue to the epidemiological puzzle in these cases was the employment of ‘live-in’ housekeepers in all of the exposed households. These female employees had recently emigrated from Latin American countries where T. solium is endemic and were considered the most likely sources of infection for the infected members of these households. Examination of six housekeepers currently or previously employed in the four case households revealed an active Taenia sp. infection in one and a positive serological test result in another. Employment of immigrants as domestic workers was very common in this community; a random telephone survey determined that 94% of the approximately 7000 households in the community employed housekeepers, almost all of whom had recently emigrated from rural areas of Mexico or countries of Central America.

142

W.X. Shandera et al.

Each household employed an average of three such women per year. To further evaluate the extent of this problem, a serosurvey was conducted in the same community which sought to identify exposures and practices associated with acquisition of infection. Anticysticercus antibodies were detected by enyme-linked immunoelectrotransfer blot (EITB) in 23 (1.3%) of 1789 persons from 612 families26. All 23 seropositive persons were asymptomatic, and no intracerebral lesions were found in the 21 seropositive persons who underwent brain imaging. Seropositivity was significantly associated (P 0.05) with female sex, employment of domestic workers for child care duties, and with employment of persons from Central America. This cluster of patients within a community in New York that never ate pork and enjoyed modern hygienic facilities underscored the importance of faecal–oral hygiene in the transmission cycle. The prevalence of these risk factors among the US population in general is unknown. The prevalence of taeniasis among immigrant employees in surveyed households is unknown and may be difficult to determine. Most employees live in the households; many are undocumented aliens; access to the population is limited, and confidentiality of test results is difficult to ensure. A stool examination survey of migrant workers in North Carolina found taeniasis in Central American workers

(4.4%), but none in those from Haiti or Mexico27. Thus, widespread employment of domestic workers from disease-endemic regions and high employee turnover may contribute to exposure risk. It is unclear, however, whether local transmission is in fact rare or merely under-recognized. In Los Angeles, Sorvillo et al. attempted to identify tapeworms among contacts of NC patients21. They identified carriers in 1.1% of the household contacts of their patients. Among the subgroup of NC patients that were not from and had not travelled to endemic areas, 22% had tapeworm carriers among household contacts.

Conclusions Overall, NC is a growing public health problem in the USA. Initial recognition resulted from improved imaging studies and has included more cases of mild disease (e.g. single parenchymal cysticerci) than in most series from developing countries. NC in the USA is primarily a disease of immigrants infected abroad. Thus, as immigration and travel from Latin America and Asia increase, so the number of cases. In addition, small numbers of cases of locally acquired infections are recognized. While the number of such cases is small, the risk factors associated with locally acquired infection need better definition and the magnitude of this problem requires further study.

References 1. Schantz, P.M., Wilkins, P.P., Tsang, V.C.W. (1998) Immigrants, imaging, and immunoblots: the emergence of neurocysticercosis as a major public health problem. In: Scheld, W.M., Craig, W.A., Hughes, J.M. (eds) Emerging Infections 2. ASM Press, Washington, DC, pp. 213–242. 2. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an analysis and follow-up of 450 cases. Medical Research Council Special Report Series. Her Majesty’s Stationery Office, London, pp. 1–58. 3. Diamond, I.B. (1899) Cysticercosis of brain and spinal cord. Journal of the American Medical Association 32, 1365–1369. 4. Dandy, W.E. (1950) Animal parasites invading the central nervous system: cysticercosis cellulosae. In: Lewis’ Practice of Surgery, Vol. 12. W. F. Prior Co, Hagertown, USA, pp. 377–382. 5. Campagna, M., Swartzwelder, C. (1954) Human cysticercosis in the United States. Journal of Parasitology 40 (Suppl.), 46. 6. White, J.S., Sweet, W.H., Richardson, E.P. (1957) Cysticercosis cerebri. New England Journal of Medicine 256, 479–486.

T. solium Cysticercosis in the USA

143

7. Orihel, T.C., Gonzalez, F., Beaver, P.C. (1970) Coenurus from the neck of a Texas woman. American Journal of Tropical Medicine and Hygiene 19, 255–257. 8. Simms, N.M., Maxwell, R.E., Christenson, P.C., et al. (1969) Internal hydrocephalus secondary to cysticercosis cerebri: treatment with a ventriculoatrial shunt. Journal of Neurosurgery 30, 305–309. 9. Carmalt, J.E., Theis, J., Goldstein, E. (1975) Spinal cysticercosis. Western Journal of Medicine 123, 311–314. 10. Guzman, B. (2001) The Hispanic population. Census 2000 Brief. US Department of Commerce, 8 pp. 11. Richards, F.O., Schantz, P.M., Ruiz-Tiben, E., et al. (1985) Cysticercosis in Los Angeles county. Journal of American Medical Association 254, 3444–3448. 12. Shandera, W.X., White, A.C. Jr, Chen, J., et al. (1994) Cysticercosis in Houston, Texas: a report of 112 cases. Medicine 73, 37–52. 13. Zee, C.S., Go, J.L., Kim, P.E., et al. (2000) Imaging of neurocysticercosis. Neuroimaging Clinics of North America 10, 391–407. 14. Earnest, M.P., Reller, L.B., Filley, C.M., et al. (1987) Neurocysticercosis in the United States: 35 cases and a review. Reviews in Infectious Diseases 9, 961–979. 15. Rosenfeld, E.A., Byrd, S.E., Shulman, S.T. (1996) Neurocysticercosis among children in Chicago. Clinical Infectious Diseases 23, 262–268. 16. Stamos, J.K., Rowley, A.H., Hahn, Y.S., et al. (1996) Neurocysticercosis: report of unusual paediatric cases. Pediatrics 98, 974–977. 17. Buitrago, M., Edwards, B., Rosner, F. (1995) Neurocysticercosis: report of fifteen cases. Mount Sinai Journal of Medicine 62, 439–444. 18. Ong, S., Moran, G.J., Talan, D.A., et al. (1998) Radiographically-imaged seizures and neurocysticercosis. Program and abstracts of the International Conference on Emerging Infectious Diseases, Atlanta, Georgia (abstract 28.4). 19. de la Garza, Y., Graviss, E., Shandera, W., et al. (1998) Epidemiology of neurocysticercosis in Houston, Texas. International Conference on Emerging Infectious Diseases, Atlanta, Georgia (abstract). 20. Allan, J.C., Velasquez-Tohom, M., Garcia-Noval, J., et al. (1996) Epidemiology of intestinal taeniasis in four, rural, Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157–165. 21. Sorvillo, F.J., Waterman, S.H., Richards, F.O., et al. (1992) Cysticercosis surveillance: locally acquired and travel-related infection and detection of intestinal tapeworm carriers in Los Angeles. American Journal of Tropical Medicine and Hygiene 47, 365–371. 22. Mitchell, W.G., Crawford, T.O. (1988) Intraparenchymal cerebral cysticercosis in children: diagnosis and treatment. Pediatrics 82, 76–82. 23. Kramer, L.D., Locke, G.E., Byrd, S.E. (1989) Cerebral cysticercosis: documentation of natural history with CT. Radiology 171, 459–462. 24. Centers for Disease Control and Prevention (1992) Locally acquired neurocysticercosis – North Carolina, Massachusetts, and South Carolina, 1989–1991. Morbidity and Mortality Weekly Report 41, 1–4. 25. Schantz, P.M., Moore, A.C., Muñoz, J.L., et al. (1992) Neurocysticercosis in an Orthodox Jewish community in New York City. New England Journal of Medicine 327, 692–695. 26. Moore, A.C., Lutwick, L.I., Schantz, P.M., et al. (1995) Seroprevalence of cysticercosis in an Orthodox Jewish community. American Journal of Tropical Medicine and Hygiene 53, 439–442. 27. Ciesielski, S.D., Seed, J.R., Ortiz, J.C., et al. (1992) Intestinal parasites among North Carolina migrant farmworkers. American Journal of Public Health 82, 1258–1262.

15

Porcine Cysticercosis

Armando E. Gonzalez, Patricia P. Wilkins and Teresa Lopez

Introduction Porcine cysticercosis visibly affects the quality of pork and results in widespread economic losses in areas where Taenia solium is endemic. The rates of porcine infection are variable, but in highly endemic regions, over 20% to 42% of pigs may be infected1. Figures obtained from slaughterhouse inspection generally provide lower levels of infection because obviously infected pigs are not brought to the abattoir for slaughter2.

Diagnostics Infection by T. solium in pigs can be detected by one of three methods: necropsy, palpation or visualization of cysts in the tongue, and immunological assays to demonstrate either antibodies or circulating antigen. The first is not practically useful, as most infected pigs are killed in a clandestine manner2. Tongue examination, although specific, is only moderately sensitive, requires highly trained personnel, is time-consuming and involves the risk of being bitten3,4. Immunological assays appear to be best suited for field surveys. Pigs can be bled rapidly from the anterior vena cava, a task that requires less training, and involves less danger than examination of the tongue3.

Before development of the enzymelinked immunoelectrotransfer blot (EITB), serological diagnosis of porcine cysticercosis was hampered by the lack of a reliable test to establish previous exposure to T. solium eggs. The EITB, which utilizes purified glycoprotein antigens, is highly specific and more sensitive than either ELISA or tongue examination for the detection of T. solium infection in pigs3,5. Other serological methods have also been developed for the surveillance, control and prevention of porcine cysticercosis (reviewed in Chapters 33 and 34). Glycoproteins purified from T. solium cysts by isoelectric focusing6, as also four polypeptides found in the soluble fraction prepared from T. solium cysts7, were shown to react with sera from pigs with confirmed cysticercosis in ELISA and immunoblot formats. Four antigen preparations from T. solium and T. crassiceps were evaluated for the diagnosis of porcine cysticercosis8–10. These studies found that antigens from T. crassiceps cyst fluid were superior to crude extracts prepared from T. solium. Also, an ELISA that used excretory–secretory antigens, prepared from in vitro cultured T. solium cysticerci, was shown to be highly sensitive and specific11. The presence of T. solium specific antibodies does not always correlate with the detection of parasites at necropsy; often, positive

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

145

146

A.E. Gonzalez et al.

serological results are obtained and subsequent necropsy results are negative. D’Souza and Hafeez described that 33.33% of freeranging pigs, in which parasites could not be detected at meat inspection, were positive using ELISA11. This problem affects any antibody-based diagnostic test, including the highly sensitive and specific EITB assay. Sciutto et al. reported that antigen and antibody detection assays showed lower sensitivity and specificity when used in pigs that were reared in rural environments versus those raised on commercial farms12. These data demonstrate that it is not uncommon to detect specific antibody responses in pigs from endemic areas, especially if pigs are free ranging. A positive serological result in the face of a negative necropsy could occur from either prior effective treatment, past infection that has cleared, or exposure to T. solium, among other explanations. In the past, when investigators used the EITB to diagnose porcine cysticercosis, the problem of passively transferred maternal antibodies was recognized as a potential source of bias13. The presence of passive antibodies hampers the use of cohort studies for porcine cysticercosis because in highly endemic villages most piglets must be excluded due to the presence of maternal antibodies, which cannot be differentiated from acquired antibodies. Investigators addressed this issue by sampling only pigs that were older than 3 months. Later, the presence of maternal anticysticercal antibodies was noted in sentinel pigs that were older than 3 months14. Seropositive results that did not correlate with age were also reported by

others, suggesting that maternally transferred antibodies may confound results obtained by using serological methods15,16. Subsequently, it was demonstrated that passive humoral immunity persists in piglets born to seropositive sows up to 35 weeks postpartum4. Infection-specific antibody patterns in the piglets are indistinguishable from maternally transferred antibody reactions. In contrast, new reaction bands produced by the piglet alone most certainly represent a new antigenic stimulus, and therefore are presumed to be the result of new infection14. Although the presence of antibodies in necropsy-negative pigs may, in some ways, limit the use of EITB, the number of bands in the infected animals suggests that diagnostic patterns do not happen at random and that these results may be related to the final infection outcome (A.E. Gonzalez, unpublished data). A study was designed to answer some of these questions to enable a better understanding of the EITB results. A total of 482 pigs were sampled from an endemic area in Huancayo, in the Peruvian Central Highlands. A total of 279 pigs were found to be EITB positive. The prevalence of seropositive pigs in the area was therefore calculated to be 53.59–62.41% (95%CI). A subset of 84 from the 279 EITB-positive pigs were bought and necropsied. The number of EITB bands and necropsy results were registered by age and have been tabulated (Table 15.1). The information (Table 15.1) was used to develop a stochastic model in a spreadsheet (Excel 2000) format using simulation software @risk (Palisade). The probability function of having a necropsy-positive result

Table 15.1. Distribution of necropsy-positive animals by EITB reaction and age. Age Number of EITB bands diagnosed 1–2 3 4+ Total

 8 months

 8 months

Positive

Negative

Positive

Negative

7 5 2 14

13 7 1 21

3 20 3 26

15 7 1 23

EITB: enzyme-linked immunoelectrotransfer blot.

Porcine Cysticercosis

given a band and age combination was simulated using  distributions. The original 279 positive pigs were also organized by age and number of bands (Table 15.2). The confidence limits for the number of expected positive pigs for each group were simulated using binomial distributions that considered the number of positive pigs observed in each group and the  probability previously calculated. The distributions above described were then used to simulate the number of necropsy-positive pigs in each stratum in 500 interactions. The simulation results showed that the mean prevalence of EITB seropositivity was 28% (90%CI: 22–33%) (Fig. 15.1). Antigen detection assays (reviewed in Chapter 34) have also been evaluated in pigs. Monoclonal antibodies (MAbs) produced against T. saginata excretory–secretory products were unable to detect lightly infected animals17. Brandt et al. developed an assay using two MAbs that recognized antigenic components of T. saginata18. Although the sensitivity of the test varied from one animal

Table 15.2. Frequency of positive pigs by age. Bands

 8 months

 8 months

78 39 15

47 75 25

1–2 3 4+

147

to another, the minimum number of living cysticerci that could be detected was 88. Animals harbouring only dead cysticerci gave negative reactions and cross-reactions were observed with sera infected by other taeniids. The test was also able to detect circulating antigen in sheep and pigs, infected with T. ovis and T. solium respectively, and in serum samples of confirmed cases of human cysticercosis18. Another MAb, the HP10, generated against a repetitive epitope present on the surface and in excretory–secretory antigens of T. saginata cysticerci was selected for its ability to detect circulating antigen in a double antibody sandwich ELISA19. The assay was evaluated in a randomized study using control, positive, negative and heterologous infection sera (A.E. Gonzalez, unpublished data). Sensitivity and specificity values were calculated using sera (that served as control) from 40 necropsy-positive pigs with varying infection burdens and 40 necropsy-negative pigs from non-endemic areas. Cross-reactions were evaluated using sera from pigs infected with Cysticercus tenuicollis, hydatid cysts and liver flukes. Sensitivity was 83% (95%CI: 71–94%) with a specificity of 88% (95%CI: 77–98%). After grouping positive sera according to infection burden, it was found that 10 of 15 (67%) sera from mild infections, 10 of 12 from moderate infections (83%) and 13 of 13 from heavy infections gave positive results. Also, 24 of 27

Distribution for prevalence/H27

16 Mean = 0.2790083 14 12 10 8 6 4 2 0 0.18

0.23

0.28

0.33

90%

5% 0.23

0.38 5%

0.33

Fig. 15.1. Simulated prevalence of Taenia solium cysticercosis in swine.

148

A.E. Gonzalez et al.

sera from pigs infected with C. tenuicollis reacted in the antigen detection ELISA. Cross-reactions with hydatid, liver fluke and mixed infections (C. tenuicollis and either hydatid or liver fluke) occurred with 1 of 13 (8%), 0 of 4 (0%) and 25 of 28 (89%) samples, respectively. Although this antigen detection assay may be potentially used to monitor treatment and experimental infections, the use of the test is limited to those areas with a low prevalence of T. hydatigena infections (A.E. Gonzalez, unpublished data).

Epidemiology Field epidemiology The prevalence and risk factors for T. solium infection in pigs were studied in a rural population in Michoacan State, Mexico20–22. Visual inspection of the tongues of 216 pigs revealed cysticerci in 14 (6.5%). The prevalence was slightly but not significantly higher in male (10 of 105) than female pigs (4 of 110). The most important risk factors for infection in pigs were access to human faeces, the presence of an indoor latrine, and indiscriminate disposal of human faeces around the pig owner’s household21,22. Similarly, the seroepidemiology of human and porcine cysticercosis using an EITB assay was studied in a Peruvian jungle community23. Sera and stools were collected from nearly all villagers. Those positive for tapeworm eggs or who were serologically positive were treated. Thirty (8%) of the 371 inhabitants were seropositive. After niclosamide therapy, four Taenia sp. worms were identified in the EITB positive group compared with one in the controls (P=0.06). Pigs were found to be frequently infected; 32% had positive tongue examination and 43% were positive by EITB. Interestingly, the main risk factor for porcine cysticercosis was the presence of a latrine in the house, corroborating the previous report from Mexico. Of the households 71% had at least one EITB positive pig. Two years later, a serological survey of pigs less than 1 year old was able to demonstrate that over 40% of the pigs remained serologically positive23. These results strongly suggest that high lev-

els of environmental contamination by T. solium eggs persisted in the village. Whether this represented eggs that had survived in the soil, or were disseminated by new or previously untreated human infection cannot be determined. As in Latin America, porcine cysticercosis caused by T. solium is a widespread infection in Africa in those areas where free-ranging pigs wander about in the villages, and are raised in the traditional way. The reported prevalences in Zaire ranged from 10% to 30%24. The overall prevalence of porcine cysticercosis found in three slaughterhouses in Tanzania was 13%25. The prevalence of T. solium cysticercosis in slaughter pigs was studied in the Nsukka area of Enugu State, Nigeria26. Infection status was diagnosed by ante-mortem examination of the tongue and detailed post-mortem examination of the carcasses using standard meat-inspection procedures. Over 20% (483 of 2358) of the pigs were found to be positive26.

An appraisal of the environmental contamination by T. solium Direct appraisal A field study performed in Peru showed that it was not possible to demonstrate environmental contamination by Taenia eggs using standard techniques23. Five samples of river water obtained at different points were pumped through a 0.1 m nylon filter. Water quantity varied between 200 and 400 l depending on the amount of sediment present in the water. In addition, five soil samples were taken near the edge of stool pits or latrines and examined for the presence of Taenia sp. eggs using sedimentation techniques. None were positive for Taenia eggs23. Likewise, in a study carried out in a rural community in Mexico, 400 soil samples and 600 flies were examined for the presence of Taenia sp. eggs, all with negative results27. Direct detection of eggs in the environment is extremely difficult because Taenia sp. eggs are scarce and large amounts of soil must be processed and examined microscopically to find a single egg28.

Porcine Cysticercosis

Sentinel pigs Most cysticercosis intervention programmes use human antiparasitic treatment, stool examination and human serodiagnosis to determine disease prevalence, but these methods are generally expensive, slow and difficult to comply with, partly because of cultural problems associated with obtaining human blood and stool samples29,30. Indicators of success of therapy in village treatment schemes have been difficult to measure. Documentation of significant changes in an ideal indicator would best be accomplished by one which requires a small number of subjects, permits sampling at least once a year, is culturally acceptable and feasible to perform in rural communities. The prevalence of neurological symptoms in the human population has been claimed to change in a few years after an intervention programme31. However, there are too many unknown parameters behind this: What proportion of infected humans will have brain cysts?; What proportion of these will ever be symptomatic?; What proportion of old infections will become apparent years after? Similarly, nothing is yet known about clinical significance and the rate of change in the serological status of infected humans in field conditions. Detection of human taeniasis is difficult because of its low prevalence and the poor sensitivity of available assays. Testing pigs for infection by serology fulfils the requirements for consideration as an ideal indicator of the presence of T. solium as a whole, both among different hosts, and in the environment. Since pigs become infected only by ingesting eggs from human faeces, pig infection rates must, therefore, reflect the relative quantity of T. solium eggs in the environment. Obtaining blood samples from pigs is acceptable to villagers, and is easily performed; thus, serodiagnosis in pigs may be a valid and practical way to monitor the potential for cysticercosis infection and can be used to evaluate the efficacy of control programmes. Monitoring T. solium transmission by evaluating the porcine population is more sensitive than sampling human populations, because porcine prevalence is usually double that of human prevalence. Infection occurs over a much smaller period of time (a

149

pig’s life span rarely exceeds 1 year, whilst human life span is 60 years on average). Furthermore, the pig is constantly sampling its environment and thus is a very sensitive indicator of the prevalence of the parasite. Changes in the percentage of infected pigs mirror changes in the intensity of environmental contamination. Pigs are generally sold at less than 1 year of age, therefore, there is a regular supply of new, susceptible animals available for study32. Disease acquisition can easily be determined, since each year there is a new population of pigs. Twelve 2-month-old piglets from Lima, Peru (a non-endemic area for T. solium cysticercosis) were tested by serum EITB for T. solium antibodies and relocated to Maceda, an endemic area13. All native 2-month-old piglets in Maceda (n=157) were also tested by EITB at the same time. The 12 non-native pigs and 28 surviving native pigs were re-tested at 9 months of age. The dams of 115 of the native piglets were also tested, and these piglets were evaluated at 5 and 9 months of age. In piglets from infected (EITB-positive) sows, reactions to bands that were different from those of the mother were presumed to indicate new infection. Of the 12 non-native pigs, four (33%) had acquired antibody to EITB bands after 9 months, but these bands were rather faint. Of 28 native pigs, 18 (64%) acquired new infection by 9 months of age; 56% (nine of 16) of the initially negative pigs showed antibody bands and 75% (nine of 12) of the initially positive native pigs showed new antibody bands. Results indicated a trend for higher infection rates (though not statistically significant) in native pigs. Three years before this experiment, mass niclosamide chemotherapy had been given to 93% of the seropositive humans in the village of Maceda. At that time, 43% (67 of 153) of all pigs were EITB positive13. The results showed that environmental contamination with T. solium eggs was persisting at the time of the second study and that niclosamide, as applied, did not break the cycle of infection and transmission. Furthermore, as pig populations were renewed yearly, EITB positivity rates in piglets less than 1 year old permitted assessment of interventions and intensity of environmental contamination by T. solium with time2.

150

A.E. Gonzalez et al.

The feasibility of using sentinel pigs as a surveillance tool in intervention programmes, as well as an alternative to experimental infection, was further assessed in two trials32. In the first, 51 sentinel pigs were exposed to T. solium eggs from February to April 1996 (Casacancha) and April to June 1996 (Rangra). In the second trial, a total of 38 sentinel pigs were relocated and exposed in Casacancha during April to June 1997. Basically, the sentinel pig model consists of relocating a group of susceptible pigs from a cysticercosis-free area into an endemic region. After 3 months of exposure, pigs are transported to a cysticercosis free area, kept for an additional 3-month period to allow for cysts to achieve full growth, and then killed. The infection status is determined by serological examination and detailed necropsy32. The experiments were successful in Casacancha, where over two-thirds of sentinel pigs were recovered at both opportunities, but not in Rangra, where only one-third of animals were recovered. The low recovery percentage in Rangra prompted the cancellation of this village in the second experiment. The overall attack rate for the first trial was 50% (12/24). Ten out of the 12 EITB-positive pigs had cysts or cyst scars at necropsy. Apparently, the infection rate was higher in Rangra (7 of 10) than in Casacancha (5 of 14) in the first trial, but the numbers involved were small and hence not statistically significant. The overall attack rate in the second trial was 55% (16 of 29). Again, almost all the EITB-positive pigs yielded necropsy-positive results (15 of 16). The application of the sentinel pig model demonstrated a high level of environmental contamination in the study area in both trials. Currently used monitoring tools (slaughterhouse inspection, search for Taenia eggs in the environment, estimation of porcine cysticercosis by tongue examination or serology, estimation of the prevalence of human taeniasis by stool examination, of human neurocysticercosis (NC) by clinical screening, or of human cysticercosis by serology) would not have permitted this demonstration. In Peru, as in other developing countries, pigs do not always go through slaughterhouse inspection. Even if available, villagers would not be

willing either to pay for the service, or expose their animals to the risk of confiscation2. Evaluation of environmental contamination by direct detection of T. solium eggs in the soil has proved inefficient every time it has been tried. Taenia sp. eggs are rarely found in soil or water, or even in sewage-irrigated vegetables13,29,30. Tongue examination of pigs will only detect a subset of heavily infected animals, and miss out on infections outside the tongue3. More importantly, tongue examination is familiar to villagers, and the decision to bring their pigs for inspection may be biased towards bringing only healthy pigs if they have fear of confiscation, or only those pigs more at risk if they feel they can use the service to ‘screen’ their animals2. Serological determination of porcine prevalence is somewhat similar to the sentinel pig model, but has the disadvantage of dealing with a population with a fast turn-over and long-lived passive anticysticercal antibodies4.

Socio-economic aspects Economic losses resulting from food-borne parasitic zoonoses are difficult to assess. Estimation of the global economic impact of these diseases is handicapped by inadequate information on the prevalence and public health importance of parasitic zoonoses for most countries. However, the economic losses due to porcine cysticercosis have been estimated for some countries; in these instances the costs are significant33. In Mexico, for example, porcine cysticercosis is responsible for a loss of more than one-half of the national investment in swine production whereas for all Latin America, porcine cysticercosis accounts for an economic loss of US$164 million34. Besides, T. solium not only causes severe economic losses to the pig industry but also causes a severe zoonotic disease35. Peasants practise pig rearing for shortterm savings. Furthermore, they optimize the profit of rearing pigs by keeping investment to a minimum. This attitude towards pig rearing explains why pigs range freely to obtain a variety of foods, including human

Porcine Cysticercosis

faeces36. The driving force behind peasants’ practices and attitudes to T. solium is the economic benefit in the short- and mid-term periods. People will require an economic incentive for changing their pig-rearing practices. Control strategies that fail to recognize the economic significance of pig keeping are unlikely to be successful in controlling T. solium. An interesting observation in a rural community in coastal Peru illustrates this point36. Factors responsible for the reduction in the prevalence of porcine cysticercosis in this community over a 2-year period were studied. The decrease was found to be linked to the practice of corralling or tethering of pigs, which was enforced to protect the recently introduced rice crop from being ruined by free-ranging pigs (see Chapter 8). Rice cropping was not only more profitable, but also provided by-products to feed the corralled pigs. Therefore, the community agreed to corral their animals. Porcine cysticercosis then decreased because tethering and corralling indirectly prevented the animals from accessing human faeces.

Use of geographic information systems (GIS) to elucidate transmission of porcine cysticercosis The survival and dispersal in T. solium eggs is believed to be similar to those of T. hydatigena and T. ovis37. It has been demonstrated that although most of the eggs of the latter parasites remain within about 180 m of the site of deposition, some disperse rapidly in all directions by means of agents of egg dispersal, such as birds, wind, rainfall, arthropods, earthworms, the feet of other animals and blowflies38,39. However, T. solium eggs may not require dispersion of eggs to infect intermediate hosts. Pigs actively seek and readily ingest human faeces, thus favouring clusters of cases around tapeworm carriers37. A GIS database was used to investigate the presence of clusters in T. solium cysticercosis and examine the relationship between adult tapeworm carriers and intermediate hosts (A.E. Gonzalez, unpublished data). The GIS has been used for spatial analysis of vector habitats and infections

151

and consequent risk assessment in other tropical disorders such as malaria, onchocerciasis and schistosomiasis40–42. Global positioning satellite technology was used to determine the exact position of every household in a village with sub-metre accuracy40. After processing, global positioning satellite files were directly exported to a GIS database for analysis, showing that clusters of incident cases are related to tapeworm carriers (Fig. 15.2). Although T. solium cysticercosis clusters have been previously demonstrated using prevalence data, the clusters were not as clearly defined as when incident cases were studied using the GIS technique. Furthermore, the map made evident that not all tapeworms contaminate the environment. It became clear that careful observation of infection within longitudinal studies provided the most useful information on transmission dynamics.

The marketing of cysticercotic pigs in the Sierra of Peru In Peru, consumption of pork supplied from regulated slaughterhouses is primarily restricted to the large cities on the coast. Approximately 65% of the pork consumed in the country is obtained through informal channels that are not inspected or supervised. The pathways via which pigs are sold were studied in Huancayo (population: 500,000; altitude: 3215 m), a major commercial and agricultural city, 560 km west of Lima, in the Peruvian Sierra (Central Highlands), where cysticercosis is endemic. Official purchase, slaughter and market records were reviewed in addition to direct surveys and participant observation carried out at two informal meat markets in 1988–19892. Based on estimates by the National Statistics Office, 1988, there were 35,000 pigs in Huancayo. Of this number, 25,000 were butchered every year (c. 1220 tonnes of meat per annum). Officially, none of the inspected and condemned meat in Huancayo was reported to be cysticercotic. The two official abattoirs butchered only 18 pigs in 1988 and none in 1989. The meat sold in the official market was graded for its

152

A.E. Gonzalez et al.

N

Incident pigs one two Taenia one two House Road River Main square Other buildings Ruins

Llacta

100 0

100 200 300 400 500 600 700 800 900

Fig. 15.2. GIS map of a village endemic for Taenia solium cysticercosis depicting location of tapeworms and incident pigs.

quality and inspected for cysticercosis. No restrictions were placed on the sale of the meat, based on where or how the carcass was obtained. Infected meat was not sold in the official market. At four visits to the market for the purpose of direct observation, 220 pig carcasses were inspected and only two were found to be infected. These carcasses were then returned to their owner. Observations were then carried out at two local live pig markets in the area surrounding Huancayo. Official pig inspections were never observed in over ten separate visits to each fair. Instead, tongue examinations were routinely performed by local peasants in an attempt to establish the value of the pigs.

Infected pigs were often bought by buyers because of their low price. Buyers mentioned that they also examined the pigs’ tongues for scars; sellers would apparently excise cysts from the tongue in order to increase the market value of the pigs. Based on findings of the tongue examinations performed by buyers, approximately 15% of the pigs sold in the live market were considered to be infected. A total of 52 pigs were inspected at six informal slaughterhouses. Examination of the heads and carcasses of these pigs indicated that seven (14%) had cysticercotic cysts in the muscles or brain. Interviews with the informal butcher revealed that infected meat was

Porcine Cysticercosis

sold either to another city or for use in fried pork (chicharrones). Infected meat was sold only to selected individuals known to the seller. Two processed meat sellers were interviewed, both admitted to selling infected meat; small quantities of infected meat were mixed with non-infected meat, and the mixture was then roasted or fried in fat.

Intramuscular Oncosphere Assay (IMOA): a Novel Experimental Infection Model to Evaluate Chemotherapeutic Agents Previously, experimental models for taeniid tapeworms have employed oral challenge of hosts, other than the natural intermediate hosts (e.g. sheep for T. saginata, SCID mice for Asian Taenia and T. solium, and rodents for T. solium) (reviewed in Chapter 4)43–46. Methods other than oral egg challenge, for instance, intramuscular injection of T. saginata oncospheres and subcutaneous T. solium and Asian Taenia oncosphere injection in SCID mice have also been tried. Currently, the evaluation of porcine cysticercosis model vaccines is limited to pigs infected through the oral route because no other experimental model exists. However, infecting pigs with eggs or proglottides requires very large numbers of infective eggs and results in unpredictable numbers of cysts. No more than 21 cysts were found in any of the pigs when infected with three gravid proglottides in one experiment47. In another Mexican study, oral challenge with 105 eggs eventually produced from four to 212 cysts per pig48. The poor yield may be due to variations in intestinal transit times, which might affect the dissolution of the eggshell. Furthermore, obtaining T. solium with gravid proglottides is not easy since standard therapy with niclosamide or praziquantel often destroys the proglottid. In addition, each experiment requires the use of 25,000–100,000 eggs to obtain reasonable infection. The large number of eggs required for each animal restricts studies to a small number of animals. These limitations of the oral model have prevented its widespread use in vaccine and therapeutic trials.

153

A novel method for infecting pigs with T. solium using an intramuscular inoculum of oncospheres was investigated in a series of five experiments in 18 animals49. The first experiment evaluated three routes of infection: intraperitoneal (IP; n=4), intravenous (IV; n=2) and intraduodenal infection (n=1) with either 6000 or 15,000 oncospheres. Successful infections were obtained following IP and IV inoculation. All cysts in IP inoculated pigs were viable, whilst cysts were either viable or degenerated in IV inoculated pigs. After one IP inoculation, a welldefined cluster of 35 cysts was found in the abdominal muscle. It became apparent that the injection of oncospheres was accidentally made into the muscle rather than into the peritoneal cavity. The results prompted four consecutive experiments devoted to standardize inoculation site, time to necropsy, and inoculation dose via the intramuscular route and to evaluate the feasibility of oncosphere activation in the intramuscular model. Histopathologically, the cysts that developed in the IMOA were no different from those seen with natural infection. The IMOA model is simple to perform, requires a minimal number of oncospheres, permits multiple infections per animal, and decreases the variability in the numbers of cysts recovered, inherent to oral infection models. The direct injection technique is simple and reproducible. It produces relatively constant levels of infection with the same inoculum in different pigs. Also the number of cysts produced is relatively large so that differential effects can be easily observed. In contrast, an intestinal model permits only one inoculum per test pig and produces marked variation in the number of animals infected and in cyst numbers. Thus, the IMOA may be a valuable tool to evaluate therapeutic agents or potential vaccines for porcine cysticercosis. Immunity to T. solium was investigated using the IMOA model in a series of experiments (M. Verastegui, A.E. Gonzalez, R.H. Gilman et al., unpublished observations). Three naturally infected pigs were treated with oxfendazole and then inoculated with oncospheres using the intramuscular route 3 months after treatment. None of the

154

A.E. Gonzalez et al.

treated pigs developed cysts after intramuscular inoculation, while the three uninfected, untreated, control pigs developed intramuscular cysts following inoculation, confirming that successful treatment with oxfendazole provided immunity against further challenge. In a second experiment, two pigs were injected with oncospheres once a week, at different sites. No new cysts developed after the second injection in these pigs. In a third study, two groups of three pigs each were immunized with crude T. solium oncosphere and metacestode antigens, respectively, and subsequently inoculated intramuscularly with oncospheres. Immunization with crude oncosphere antigens induced 100% protection, whilst metacestode antigens provided partial protection to oncosphere challenge since animals immunized with this antigen produced some, albeit degenerated, cysts. These results are similar to other studies where immunization with metacestode extracts did not appear to provide complete protection against cysticercosis (see Chapter 3).

Conclusions The study of the epidemiology of porcine cysticercosis has now provided important insights in to the burden and control of T. solium infection. Three methods are available for the determination of the prevalence of

cysticercosis in pigs: tongue inspection and palpation, meat inspection in abattoirs and serum EITB. The last of these has been found to be most sensitive, specific, safe and economical. The prevalence of porcine cysticercosis in a population at any given time has been shown to be a sensitive indicator of the current levels of T. solium in that population. The sentinel pig model has been found to be particularly useful in this regard. Briefly, it involves translocation of pigs from a cysticercosis-free zone to an endemic zone for 3 months and then back to the former for another 3 months. Porcine infection rates are determined at the end of 6 months; they indicate levels of T. solium infection in the endemic community. Porcine cysticercosis not only poses health hazards to humans but is a major cause for economic loss to pork-producing farmers since the price of infested pork is considerably less than that of healthy pork. Therefore, control of porcine cysticercosis accrues not only health-related but also financial benefits. The viewpoint that only those control measures that provide economic benefits are likely to be successfully implemented is presented. However, for the present, most cysticercotic pigs bypass official meat inspection channels in developing countries; this is a major cause for concern to all involved in initiatives to control T. solium infection through strategies targeting the pig.

References 1. García, H.H., Gilman, R.H., Gonzalez, A.E., et al. (1999) Epidemiology of Taenia solium infection in Peru. In: García, H.H., Martinez, S.M. (eds) Taenia solium Taeniasis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 297–306. 2. Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the Sierra of Peru. Bulletin of World Health Organization 71, 223–228. 3. Gonzalez, A.E., Cama, V., Gilman, R.H., et al. (1990) Prevalence and comparison of serologic assays, necropsy, and tongue examination for the diagnosis of porcine cysticercosis in Peru. American Journal of Tropical Medicine and Hygiene 43, 194–199. 4. Gonzalez, A.E., Verastegui, M., Noh, J.C., et al. (1999) Persistence of passively transferred antibodies in porcine Taenia solium cysticercosis. American Journal of Tropical Medicine and Hygiene 86, 113–118. 5. Tsang, V.C.W., Brand, J., Boyer, E., et al. (1989) Enzyme-linked immunoelectrotransfer blot assay and glycoprotein antigens for diagnosing human cysticercosis (Taenia solium). Journal of Infectious Diseases 159, 50–59. 6. Pathak, K.M., Allan, J.C., Ersfeld, K., et al. (1994) A western blot and ELISA assay for the diagnosis of Taenia solium infection in pigs. Veterinary Parasitology 53, 209–217.

Porcine Cysticercosis

155

7. Ito, A., Plancarte, A., Nakao, M., et al. (1999) ELISA and immunoblot using purified glycoproteins for serodiagnosis of cysticercosis in pigs naturally infected with Taenia solium. Journal of Helminthology 73, 363–365. 8. Nunes, C.M., Biondi, G.F., Heinemann, M.B., et al. (2000) Comparative evaluation of an indirect ELISA test for the diagnosis of swine cysticercosis employing antigen from Taenia solium and Taenia crassiceps metacestode. Veterinary Parasitology 93, 135–140. 9. Pinto, P.S., Vaz, A.J., Germano, P.M., et al. (2000) ELISA test for the diagnosis of cysticercosis antigens of Taenia solium and Taenia crassiceps. Revista do Instituto de Medicina Tropical (São Paulo) 42, 71–79. 10. Pinto, P.S., Vaz, A.J., Germano, P.M., et al. (2000) Performance of an ELISA test for swine cysticercosis antigens of Taenia solium and Taenia crassiceps. Veterinary Parasitology 88, 127–130. 11. D’Souza, P.E., Hafeez, M. (1999) Detection of Taenia solium cysticercosis in pigs by ELISA with an excretory-secretory antigen. Veterinary Research Communications 23, 293–298. 12. Sciutto, E., Aluja, A., Fragoso, G., et al. (1995) Immunization of pigs against Taenia solium cysticercosis: factors related to effective protection. Veterinary Parasitology 60, 53–67. 13. Gonzalez, A.E., Gilman, R.H., García, H.H., et al. (1994) Use of sentinel pigs to monitor environmental Taenia solium contamination. American Journal of Tropical Medicine and Hygiene 51, 847–850. 14. Sakai, H., Sone, M., Castro, D.M., et al. (1998) Seroprevalence of Taenia solium cysticercosis in pigs in a rural community of Honduras. Veterinary Parasitology 14, 233–238. 15. Sciutto, E., Martinez, J.J., Villalobos, N.M., et al. (1998) Limitations of current diagnostic procedures for the diagnosis of Taenia solium cysticercosis in rural pigs. Veterinary Parasitology 79, 299–313. 16. Geerts, S., Kumar, V., Mortelmans, J. (1981) Sheep as an experimental model of Taenia saginata cysticercosis. Tropical Animal and Health Production 13, 37–40. 17. Harrison, L.J.S., Parkhouse, R.M.E. (1985) Antigens in taeniid cestodes in protection, diagnosis and escape. Current Topics in Microbiology and Immunology 120, 159–172. 18. Brandt, J.R., Geerts, S., De Deken, R. (1992) A monoclonal antibody-based ELISA for the detection of circulating excretory-secretory antigens in Taenia saginata cysticercosis. International Journal of Parasitology 22, 471–477. 19. Harrison, L.J.S., Joshua, G.W., Wright, S.H., et al. (1989) Specific detection of circulating/secreted glycoprotein of viable cysticerci in Taenia saginata cysticercosis. Parasite Immunology 120, 159–172. 20. Sarti, E., Schantz, P., Aguilera, J., et al. (1992) Epidemiologic observations on porcine cysticercosis in a rural community of Michoacan State, Mexico. Veterinary Parasitology 41, 195–201. 21. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1994) Epidemiological investigation of Taenia solium taeniasis and cysticercosis in a rural village of Michoacan State, Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene 88, 48–52. 22. Sarti, E., Schantz, P., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis and cysticercosis in humans and pigs in a village in Morelos, Mexico. American Journal of Tropical Medicine and Hygiene 46, 677–685. 23. Diaz, F., García, H.H., Gilman, R.H., et al. (1992) Epidemiology of taeniasis and cysticercosis in a Peruvian village. American Journal of Epidemiology 135, 875–882. 24. Chartier, C., Mutesi, U., Ndakala, N.O. (1990) Helminths of domestic pork in Ituri, Upper Zaire. Annales de la Societe Belge de Medicine Tropicale (Brussels) 70, 213–225. 25. Bao, M.E., Bogh, H.O., Kasuku, A.A., et al. (1995) The prevalence of Taenia solium metacestodes in pigs in northern Tanzania. Journal of Helminthology 69, 270. 26. Onah, D.N., Chiejina, S.N. (1995) Taenia solium cysticercosis and human taeniasis in the Nsukka area of Enugu State, Nigeria. Annals of Tropical Medicine and Parasitology 89, 399–407. 27. Keilbach, N.M., De Aluja, A.S., Sarti, E. (1989) A programme to control taeniasis-cysticercosis (Taenia solium): experiences in a Mexican village. Acta Leiden 57, 181–189. 28. Sarti, E., Schantz, P., Lara, R., et al. (1988) Taenia solium taeniasis and cysticercosis in a Mexican village. American Journal of Tropical Medicine and Hygiene 39, 194–198. 29. Cruz, M., Davis, A., Dixon, H., et al. (1989) Operational studies on the control of Taenia solium taeniasis/cysticercosis in Ecuador. Bulletin of the World Health Organization 67, 401–407. 30. Sarti, E., Schantz, P.M., Avila, G., et al. (2000) Mass treatment against human taeniasis for the control of cysticercosis: a population-based intervention study. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 85–89. 31. Fernandez, M., Gutierrez, A. (1986) Como son las Comunidades de la Zona Intermedia del Valle del Montaro, La Gardenia. Serie Comunidades, Lima, Peru, 50 pp.

156

A.E. Gonzalez et al.

32. Gonzalez, A.E., Gavidia, C., Falcon, N., et al. (2001) Sentinel pigs to monitor Taenia solium transmission in the Peruvian highlands. American Journal of Tropical Medicine and Hygiene 65, 31–32. 33. Murrel, K.D. (1991) Economic losses resulting from food-borne parasitic zoonosis. Southeast Asian Journal of Tropical Medicine and Public Health 22, 377–381. 34. Acevedo-Hernandez, A. (1982) Economic impact of porcine cysticercosis. In: Flisser, A., Willms, K., Laclette, P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 63–68. 35. Gonzalez, A.E. (1977) Evaluation of a Control Programme for Taenia solium Cysticercosis Targeting Human and Porcine Health. PhD thesis. University of Reading, Reading, UK. 36. Gilman, R.H., García, H.H., Gonzalez, A.E., et al. (1999) Short cuts to development: methods to control the transmission of cysticercosis in developing countries. In: García, H.H., Martinez, S.M. (eds) Taenia solium Taeniasis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 313–326. 37. Gemmel, M.A. (1999) Current knowledge of the epidemiology of the family Taeniidae: operational research needs in planning control of Taenia solium. In: García, H.H., Martinez, S.M. (eds) Taenia solium Taeniasis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 219–244. 38. Lawson, J.R., Gemmell, M.A. (1985) The potential role of blowflies in the transmission of taeniid tapeworm eggs. Parasitology 91, 129–143. 39. Lawson, J.R., Gemmell, M.A. (1990) Transmission of taeniid tapeworm eggs via blowflies to intermediate hosts. Parasitology 100, 143–146. 40. Hightower, A.W., Klein, R.E. (1995) Building a geographic information system (GIS) public health infrastructure for research and control of tropical diseases. Emerging Infectious Diseases 4, 156–157. 41. Malone, J.B., Huh, O.K., Fehler, D.P., et al. (1994) Temperature data from satellite imagery and the distribution of schistosomiasis in Egypt. American Journal of Tropical Medicine and Hygiene 50, 714–722. 42. Richards, F.O. (1993) Use of geographic information systems in control programs for onchocerciasis in Guatemala. Bulletin of the Pan American Health Organization 27, 52–55. 43. Gemmell, M., Matyas, Z., Pawlowsky, Z., et al. (1983) Guidelines for Surveillance and Control of Taeniasis/Cysticercosis. VPH/83.49. World Health Organization, Geneva, Switzerland, pp. 1–207. 44. Froyd, G., Round, M.C. (1960) The artificial infection of adult cattle with Cysticercus bovis. Research in Veterinary Science 1, 275–282. 45. Ito, A., Ito, M., Eom, K.S., et al. (1997) In vitro hatched oncospheres of Asian Taenia from Korea and Taiwan develop into cysticerci in the peritoneal cavity of female scid (severe combined immunodeficiency) mice. International Journal of Parasitology 27, 631–633. 46. Ito, A., Chung, W.C., Chen, C.C., et al. (1997) Human Taenia eggs develop into cysticerci in scid mice. Parasitology 114, 85–88. 47. Pathak, K.M., Gaur, S.N. (1990) Immunization of pigs with culture antigens of Taenia solium. Veterinary Parasitology 34, 353–356. 48. Nascimento, E., Costa, J.O., Guimaraes, M.P., et al. (1995) Effective immune protection of pigs against cysticercosis. Veterinary Immunology and Immunopathology 45, 127–137. 49. Verastegui, M., Gonzalez, A., Gilman, R.H., et al. (2000) Experimental infection model for Taenia solium cysticercosis in swine. Veterinary Parasitology 20, 33–44.

16

Taenia solium: a Historical Note Noshir H. Wadia and Gagandeep Singh

The farther backwards you look, the farther forwards you can see. Winston Churchill

Introduction The amazing incongruities and controversies of Taenia solium cysticercosis make sense once we understand the origins of the knowledge regarding the disorder and the parasite. The authors of this chapter have attempted to trace early knowledge about the pathogen, T. solium and its biological behaviour that then led to realization of the malady it caused and its treatment. The essay consists of random notes and is not intended to be a comprehensive and complete review of the history of T. solium cysticercosis.

Early Historical Impressions Among the earliest references to tapeworms are the works of ancient Egyptians that date back to almost 2000 BC. Evidence that the Egyptians were aware of the existence of tapeworms is available from the study of the Eber’s papyrus, a written documentary of the Egyptian perception of maladies of a non-surgical nature and their medical as well as mystical treatment1. Indeed, there are several references to the existence of worms, including perhaps, schistosomes

and tapeworms and their treatment. However, Flisser believes that the tapeworms were of the beef Taenia sp. because the Egyptians never ate pork2. Infestation of pork with bladderworms were known to ancient Greeks as well, as is apparent from mention of measled pork in the History of Animals written by Aristotle (384–322 BC)3. However, the Greeks did not appreciate the helminthic origin of measled pork. A reference to cysticercosis was perhaps made by Aristophanes in his comedy, The Knights, in the 5th century BC. In the play, a slave mentioned examining another person’s tongue in the same way as one would examine a pig’s tongue to see if he was ‘measled’. Further down in history, Pliny (AD 25–79) was perhaps the first to use the term, ‘Taenia’2. Arabian physicians around AD 1000 classified parasitic heminths into longworms, tapeworms, roundworms and smallworms2,4. It is believed that their concept of tapeworm was actually one of a chain of worms, each represented by what we now know to be individual proglottides2. They named these ‘individual worms’ as ‘cucurbitini’, a name derived from their resemblance to cucumber seed but also significant because cucumber seeds

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

157

158

N.H. Wadia and G. Singh

constituted a herbal remedy for intestinal taeniasis. References to intestinal parasitism also appear in the Chinese Yellow Emperor’s Canon of Medicine written in 200 BC5. More specifically, Chao alluded to Taenia in his Etiology and Symptoms of Diseases in AD 6106. The ancient Indian treatise on medicine, the Charaka Samhita also mentions worms and specifically flatworms, which are broad, white and tape-like. At one place, it states that worms (in general) can cause maladies of the head, where they may be observed. However, seizures are not mentioned as a symptom of this malady and there is no reference to pork or meat as a causative agent in the chapter on epilepsy. It is thus conjectural if cysticercosis existed in ancient India.

Beginnings of the Modern Understanding of the Biology of T. solium The classification of tapeworms Records of modern attempts at understanding the biology, life cycle, morphology and nomenclature of tapeworms date to AD 1600.

(a)

(b)

For a detailed account of the developments in classification and nomenclature of tapeworms, the reader is referred to Mönnig (1950)7. The unravelling of the structure of the tapeworms is credited to several workers including Edward Tyson (AD 1650–1708), Karl Asmund Rudolphi (AD 1771–1832) (Fig. 16.1a) and P.J. van Beneden. Carl Linnaeus (AD 1707–1778) (Fig. 16.1b) described the taxonomy of tapeworms, assigning the genus Taenia for all types of tapeworms in his work Systema Naturae8–10. In 1782, Goeze published Versuch einer Naturgeschichte de Eingeweidewurmer hierischer Korper and classified tapeworms on the basis of Linnaeus’s nomenclature11. He also put forward the theory that tapeworms could be inherited. Rudolph Leuckart (AD 1822–1898) (Fig. 16.1c) made notable contributions to the study of science of tapeworms. Significant among them were the recognition of facts that T. saginata occurred only in cattle and T. solium in the pig12. He and Rudolph Virchow were instrumental in the realization of meat inspection laws in Germany in the latter part of the 18th century. He also published a series of ‘Wandtafeln’ (wall charts) depicting the morphology of tapeworms among several other animal species (Fig. 16.2).

(c)

Fig. 16.1. (a) Karl Asmund Rudolphi (1771–1832). (Source: Parasitology 1921, Vol. 13, Cambridge University Press, Cambridge, UK. Reproduced with permission.) (b) Carl Linnaeus (1707–1778). (c) Rudolph Leuckart (1822–1898). (Source: Marine Biological Laboratories. Reproduced with permission.)

T. solium: a Historical Note

159

Fig. 16.2. Wall chart (Wandtafeln) of Rudolph Leuckart, depicting flatworms. (Source: Marine Biological laboratories. Reproduced with permission.)

The link between adult and larval forms of tapeworms The earliest description of cysticercosis was by Paranolus in 1550, who described vesicles in the corpus callosum13. Rumler detected cysts in the dura mater of an epileptic in

158814. None of the early workers recognized the link between adult tapeworms and cysticercosis. In fact, Goeze segregated tapeworms into two different classes, T. visceralis (cystic forms) and T. intestinalis (worm-like forms) based upon whether they were cystic or worm-like in morphology11. Thus, while

160

N.H. Wadia and G. Singh

he appreciated the proximity of relationship between cystic tapeworms and adult tapeworms, he did not sense the fact that they were different stages of the same helminth. Zeder (AD 1800) was probably the first to use the term, ‘Cysticercus’ (cystis: bladder; cercos: tail (Greek)), for the larva of T. hydatigena, the dog tapeworm. Again, he believed that the ‘Cysticercus’ was a distinct genus15. Much of the credit for establishing a link between adult tapeworms and ‘Blasenwürmer’ or bladderworms goes to Freidrich Küchenmeister, a German gynaecologist16,17. Around 1850, he performed a series of experiments first on dogs and then on imprisoned human convicts. In his preliminary experiments, he fed bladderworms from rabbits to dogs and demonstrated the subsequent development of the adult tapeworm, T. pisiformis in dog intestine. Subsequently, he extended his experimental design to humans awaiting execution in a German prison, whom he fed with bladderworms from infested pigs. Upon autopsy after execution of the death sentence, he detected the presence of developing and adult tapeworms in the intestines. Küchenmeister’s work was criticized from several quarters on account of the ethics of the nature of his experiments and the validity of his conclusions. For instance, von Siebold maintained that cysticerci were tapeworms with hydropically degenerate bodies, which developed in an abnormal host4. He however agreed that bladderworms in pigs develop from tapeworm eggs and were not foreign bodies, as was the prevailing view at that time18,19. Grove describes the crossfire on the issue of ethics of Küchenmeister’s work in detail20.

Early clinical impressions In the latter part of the 18th through to the early part of the 19th century, there were sporadic descriptions of T. solium cysticercosis. Virchow described racemose cysticercosis in his paper entitled ‘Traubenhydatiden der weichen Hirnaut’ in 186021 (Figs 16.3a, b). Griesenger, a German psychiatrist, wrote an account in 1862 of neurocysticercosis (NC) with emphasis on the seizure disorder. In

1902, Volovatz published an account of 414 patients with cysticercosis. Vosgein described clinical features in 807 affected individuals comprising mostly French soldiers who had lived overseas in his thesis, ‘Le Cysticercus cellulosae chez l’homme et chez les animmaux’22. According to Brumpt, the distribution of cysticerci in the human body in Vosgein’s series was as follows: ocular – 46%; central nervous system – 40%; skin – 6%; and muscle – 3%23. Later, Henneberg in 1912, described clinical features and evolved a classification based upon strictly compartmentalized clinical features, including generalized (actually referred to as ‘essential’) epilepsy, focal epilepsy, neuropsychiatric presentations, intraventricular cysticercosis, meningeal cysticercosis, spinal cysticercosis and asymptomatic cysticercosis.

Taenia solium: the British Military Connection In the 1930s, interest in the study of human cysticercosis was aroused by several British military doctors at the Queen Alexandria Military Hospital, Millbank, London, including Colonel (later Lieutenant General) William Porter MacArthur (1884–1964) and Colonel (later Brigadier) Henry Byran Frost Dixon (1891–1962)24–31. At that time, Queen Alexandria Hospital was a specialist military facility dealing with infirmity of civilian nature in army personnel and their families. Trauma was therefore not a priority here, and a variety of non-war related ailments including epilepsy were observed here. MacArthur first noticed a high rate of seizures due to cerebral cysticercosis among soldiers returning after military placements in India. He thus wrote24: ‘About 100 soldiers are yearly discharged from the army for epilepsy; during 1933 twenty cases of cysticercosis were identified at Millbank.’ MacArthur published his landmark paper, ‘Cysticercosis as seen in the British army, with special reference to the production of epilepsy’ in 193425. Sir Hamilton Fairley’s remarks on the title of the paper were explicatory27: ‘The title may suggest that this disease is peculiar to Army, but MacArthur’s experience was limited to the Army.’

(b)

Fig. 16.3. (a) Cover of the journal that contains Rudolph Virchow’s landmark article ‘Traubenhydatiden der weichen Hirnaut’, believed to be the first description of racemose cysticercosis. (Source: Clendening Library of the History of Medicine, Kansas University Medical Center, USA. Reproduced with permission.) (b) Diagrammatic description of the pathology of racemose cysticercosis by Virchow. (Source: Clendening Library of the History of Medicine, Kansas University Medical Center, USA. Reproduced with permission.)

(a)

T. solium: a Historical Note 161

162

N.H. Wadia and G. Singh

Indeed, an overwhelming majority of cases of cerebral cysticercosis were drawn from the Army and included personnel who were deputed to India, implying that cysticercosis was acquired from exposure to T. solium through food during their stay in India. Even at that time, T. solium infestation was extremely rare in native Britons. One redeeming aspect of cerebral cysticercosis was that British military provisions enabled soldiers discharged from duty on account of seizures with a diagnosis of cysticercosis to a disability pension. In this regard, the following impressions of MacArthur are noteworthy25: Although the diagnosis benefits the man himself but little, the presence of cysticerci gives him material gain when it has been caused by service abroad, it gives him great mental ease when he can be reassured that there is no chance of epilepsy appearing in his children and when mental deterioration necessitates his certification as insane it carries to his relatives no slur of familial lunacy.

Insights into the transmission of T. solium Mackie’s comments on MacArthur’s presentation on cysticercosis in British troops stationed in India reflect his perceptive views on the transmission of disease from pig to man. He stated: The clinical histories of the cases referred to seemed to show that most of the patients were infected in India and, granted that this appears to be probable, one would like to know more about the methods of transmission from the pig to man. Pig meat in any form is a very unusual article of diet in India… Very low caste Hindus and outcasts and some jungle tribes eat pig flesh but even then it is generally wild pig and not domestic animal. The most likely source of infection for the rank and file is the cheap eating houses in the bazaars run by Eurasian or low caste Hindus, where locally killed pig meat may occasionally be served. The soldiers referred to by Colonel MacArthur must obviously be infected either from the adult T. solium, which they themselves were harbouring or from someone in close contact with them or concerned in the preparation of their food. The presumption is, then, that the

ova were being passed by native servants employed in the barracks; but as I have said before, I do not think that even this class of Indian will eat the flesh of the village pig.

Mackie’s views were confirmed by several subsequent observations by Dixon and his colleagues who noted that the disorder occurred exclusively in corporals and privates, many of whom were cooks and that the officers were mostly spared. He went on to advise that the incidence of T. solium infection should be ascertained in Indians, especially the barracks’s servants, through the records of hospitals and laboratories around military establishments; unfortunately this does not seem to have been done. The remarkable British papers have been quoted somewhat extensively as they reflect indirectly on the status of the infection in India then and have much relevance to the conditions prevailing even today. Though cysticercosis was documented in large numbers among the British military, reports in Indian natives were few in comparison, perhaps reflecting different eating habits of the two. Nevertheless, it is quite evident that cysticercosis must have been prevalent in India in the 19th century. Since there is no earlier record, it remains conjectural as to when it first appeared. Was it brought by the pork-eating European conquerors, when they arrived in the 15th to 17th centuries, when cysticercosis was known to be prevalent in Europe? Or did traders and travellers introduce it across the Chinese borders? After all, predominant vegetarianism and a taboo against eating pork and rearing pigs, especially during Mogul rule, was the prevailing practice in India. Cysticercosis: the clinical disorder It is said that in the early days of MacArthur’s investigations, it was difficult to convince the medical profession that such a condition as cysticercosis ever existed, but subsequently the pendulum swung to overdiagnosis. Scores of reports of cerebral cysticercosis were made around this time (Fig. 16.4)24–31. In one such report, Dixon remarked28: ‘These two cases illus-

T. solium: a Historical Note

163

Unless evidence of cysticercosis is systematically sought for, the diagnosis may be missed, as the subcutaneous nodules which are suggestive of the disease may be absent of examination, only to come out in crops at a later date, remaining for a varying period of time and then disappearing, and radiological evidence may not be convincing for some years as calcification does not usually take place until some four or five years after infestation. Every case suspected of cysticercosis should be re-examined at six-monthly or yearly intervals for the presence of subcutaneous nodules and calcification of the soft parts.

Fig. 16.4. Cover of the landmark publication, Cysticercosis: An analysis and follow-up of 450 cases by H.B.F. Dixon and F.M. Lipscomb published in 196131. (Source: Wellcome Library for the History of Medicine, London. Reproduced with permission.)

trate how necessary it is to view with suspicion all alleged idiopathic epilepsy occurring in soldiers, aged 24 to 26, who suddenly develop fits in the later years of their service overseas.’ The clinical studies carried out at Millbank were significant in that they clarified several important aspects of the clinical behaviour of the disorder. The following observations of Dixon and Smithers exemplify several of such outstanding observations30:

The observations of the British workers had an impact upon the understanding of the pathogenesis of the disease. For instance, MacArthur wondered why ‘new’ subcutaneous cysts appeared over so many years, even when the source of infection was no more present. He showed that the so-called new cysts were all tense and contained dead larva and propounded that living cysts were flaccid and not easily palpable, but with impending death they became turgid and tense. In fact, they were not ‘new’ but ‘old’. He also extrapolated that allied changes must be affecting the cerebral parasites, explaining the long delay in the onset of neurological symptoms after the first subcutaneous nodule could be palpated. It was believed that living cysticerci caused little nervous disturbance unless lodged in large numbers in ‘some responsive centre’. Indeed, MacArthur maintained that the varied clinical presentation could be explained on the basis of the location of the cysticerci. It was realized that cysticercosis could remain asymptomatic for prolonged periods of time. The recognition of the incubation period, i.e. the period of time that elapsed between infection with the larval stage of T. solium and the onset of symptoms of cysticercosis, was also a derivation from these initial studies30–32. The time of initial infection could be confidently estimated from study of records of military placements in India, upon an assumption that T. solium infection was acquired in India alone, especially since the T. solium did not occur in Britain. The incubation period so inferred varied between a few months and 20 years. This was a signifi-

164

N.H. Wadia and G. Singh

cant finding because in several of the subsequent series of cysticercosis that followed these initial studies and were published from endemic areas of Brazil and Mexico, it was not possible to determine the incubation period, because in endemic regions exposure could have occurred at any time33,34. Finally, the fact that symptoms of cerebral cysticercosis were related to degeneration of larvae was also appreciated: These parasites cause little disturbance in the early stages, and the patient may live for years with numerous cysts in both cerebral hemispheres. After their death, however, the parasites may cause symptoms partly by their toxic effects and partly by their increase in size. (Dixon and Smithers, 193430)

Early studies, particularly by MacArthur, pictured a uniformly dismal prognosis of the disorder, with virtually every case ending up in lunacy and leading to death24–26. Dixon and Hargreaves disagreed with MacArthur’s view and remarked31: Our observations have not borne out the view of MacArthur, who believed that the general tendency was one of retrogression, as evidenced by signs of mental deterioration which might be so marked so as to necessitate institutional segregation.

When MacArthur reviewed Dixon and Hargreaves’s paper in the Tropical Diseases Bulletin he countered35: In my experience, relapse has followed symptom free intervals which had lasted for 10, 13, and 20 years. I believe that when a long remission occurs, one can but wait and hope for the best, while cautiously remembering the scriptural injunction, ‘Judge none blessed before his death.’

The reason why early workers inferred a discouraging outcome can now be related to the lack of availability of contemporary methods of diagnosis. The diagnosis of cysticercosis was based upon histology from excised subcutaneous cysts or radiology depicting soft tissue calcification/s. Obviously, only the most severe forms were diagnosed by these archaic tools. On the other hand, benign oligolesional forms like those due to a solitary or few cysts that would be easily picked up on computed tomography (CT) or magnetic

resonance imaging (MRI) in the present day era, would have been missed. We now know that solitary or few cysts36 are far more common than multilesionaldisseminated cysticercosis37; the former carry a good prognosis in comparison to heavy, multiple cysticercosis.

Serodiagnosis of T. solium cysticercosis Weinberg in 1909 was the first to use the complement fixation test on the serum of cysticercotic pigs38. In 1910, Robin and Fiessenger first performed the test upon humans. Other notable contributions so far to the serological diagnosis of cysticercosis have been those of Rothfeld39, Biagi and Tay40, and Neito41. Studies at this stage were not optimistic about the role of serological studies in the clinical context, though Neito reported excellent results of his lengthy and remarkable set-up with the complement fixation tests in the spinal fluid41. Serological confusion compounded clinical confusion with neurosyphilis, an important disorder in the early part of the 19th century. In an account of one such confusion, Castellani described the occurrence of subcutaneous nodules, a positive Wasserman’s reaction in the serum and response to antisyphilitic treatment in three persons under the name, ‘luetic pseudo-cysticercosis’41,42.

Radiology According to Grove, the earliest roentgenological description of dead cysticerci was by Roth in 192620,43. Broughton-Alcock and Weinbren described muscle calcification picked up incidentally on a radiograph of a gunshot wound44. They compared radiological appearances of calcification due to dead cysticerci with those of Trichenella spiralis in a radiograph of a post-mortem specimen of muscle obtained from Sir Arthur Keith. They found that calcifications of Taenia solium were larger than those of Trichenella spiralis. Major contributions on the radiology also came from Morrison45 and Brailsford46,47. It was recognized that cerebral calcification was

T. solium: a Historical Note

less common and appeared later than muscle calcification and if the soft tissue radiographs did not reveal calcifications, skull roentgenograms rarely contributed to the diagnosis. Brailsford was eloquent in his opinion on the role and limitations of roentgenography47: Radiography permits of the diagnosis of cysticercosis when the parasites have degenerated and calcified but affords no help in the earlier years of infestation. … Actually it is rare to obtain radiographic evidence of cysticerci in the brain in patients with symptoms of central nervous system disease. … In the later years, when symptoms have as a rule ceased, radiography for other reasons may reveal the calcified parasites.

In 1945, Arana and Asenjo published a landmark paper on the ventriculographic diagnosis of posterior fossa cysticercosis from Santiago, Chile48. Incidentally, MacArthur expressed surprise over the authors’ observations and commented49: It looks, therefore, as if the commoner types which would bring the above more into their proper proportions may not be coming to light. Perhaps the explanation is that only patients supposed to be suffering from a cerebral tumour were sent to the institute for investigation.

The Search for an Effective Treatment The history of the search for effective treatment for taeniasis and cysticercosis is as old as the recognition of tapeworms and cysticerci. The oldest remedies were the herbal remedies used, for instance, by the ancient Egyptians and Chinese. One can find mention of the use of herbs such as Acacia nilotica and Aloe vera for treatment of worms in the Egyptian papyri1. Similarly, a fungus, ‘Raigan’ (Omphalia lapidescens), that grows on bamboo, has been used by the Chinese as an anthelminthic for nearly 2000 years50. One of the early remedies for the tapeworm was an extract of the male fern, Dryopteris filix-mas, the active medicament of which was filix mas51. Other important remedies included the ground seeds of Cucurbita moschata (pumpkin) and Areca catecho (semen

165

aracae)6,52. Other remedies used in the early part of the last century included ‘betel nut’ boiled in water, tetrachloroethylene, thymol, carbon tetrachloride and hexylresorcinol51–57. Thus Allan in 191255 and Carman in 193156 reported the use of thymol and carbon tetrachloride respectively. In the 1930s through 1950s, filix mas and carbon tetrachloride were most often used for the treatment of tapeworms. With both remedies, prior starvation and subsequent purgation was advocated. For 2 days before the administration of filicis liquidum, the individual was fed upon a liquid diet consisting of orange juice and dextrose. Following the active drug, a saline purgative was administered. Castor oil was specifically contraindicated as it dissolved the filix mas and led to intoxication. The stools obtained following the purge were sieved and examined against a black background to identify the head of the tapeworm. The identification of the head of the tapeworm was taken to be an indicator of successful taeniacidal therapy. If the head was not passed, treatment was repeated and, if still unsuccessful, a duodenal tube was passed and the drugs were infused directly through the tube. However, it was soon recognized that these chemicals were associated with severe toxicity, primarily renal and hepatic. In the 1940s and 1950s, attention focused on the use of atarabine as a taeniacidal agent57–59. Though anecdotally this drug proved to be effective, its major limitations were the side effects of severe vomiting and encephalopathy. Vomiting was prevented by the concomitant administration of largactil or by intraduodenal administration of atarabine. Delirium was treated by the concomitant administration of phenobarbitone (phenobarbital). While in the early part of the 19th century several efforts were made to develop an effective taeniafuge, similar drives for the development of anticysticercal agents were not evident. In fact, in a discussion on MacArthur’s paper25, Sir Hamilton Fairley pointed out that according to Colonel MacArthur’s description, the cysticerci should be kept alive as long as possible; specific drug therapy was contraindicated27. Similarly Dixon and Smithers stated29:

166

N.H. Wadia and G. Singh

There is no known treatment for the established disease, in fact the administration of such substances as Tartar emetic have in some cases produced an exacerbation of symptoms or a fresh crop of palpable nodules, presumably by causing the death of more parasites.

to us that the only surgical operation justified is decompression in order to save sight.’

Thus the fact that specific chemotherapy of larvae could cause exacerbation of symptoms and the mechanisms thereof were recognized very early. Other agents such as neoarsphenamine and bismuth (both antisyphilitic treatments), atarabine, quinine, antimony tartrate, chloroquine, sulfasalazine and streptomycin were tried with no good results. Radiation therapy was also tried but results were not satisfactory5. Henneberg advocated repeated lumbar punctures in selected patients with intracranial hypertension as a palliative measure60. Another palliative measure comprised of the use of bromides and luminal for control of seizures. The earliest attempt at surgical treatment was by Krausse in 190161. MacArthur clearly advocated against resorting to surgery in view of the widespread distribution of larvae24–26. In a series of 99 patients reported by Dixon and Hargreaves, 14 were operated31. Indications for surgery included, the lack of diagnosis, as a relief measure for control of intracranial hypertension and control of seizures. They concluded: ‘It appears

In about 1969, a United States General remarked that it was time to close the book on infectious diseases. His remark was at best a gross underestimate. Taenia solium cysticercosis is a classical example of a reemerging disease that the United States has to cope with, as a result of increasing immigration, travel and general globalization. This is one aspect of the global epidemiology of T. solium. The other, which is perhaps less well appreciated, is the presumed but precisely unknown large number of people affected by the disorder in several developing countries. For these countries, their governments and authorities, history professes that T. solium, which was once widely prevalent in Europe, was eradicated solely by developing sanitary infrastructure and enforcing meat hygiene. Perhaps, the best thing that they can learn from history is that the only way to surely eradicate cysticercosis is by improving sanitation, meat inspection, human behaviours and attitudes and most importantly by socioeconomic development.

Conclusions

References 1. Eber’s Papyrus. http://www.crystalinks.com/egyptmedicine.html 2. Flisser, A. Taeniasis and cysticercosis due to Taenia solium. In: Sun, T. (ed.) Progress in Clinical Parasitology. CRC Press, Boca Raton, Florida, pp. 77–116. 3. Thompson, D.W. History of Animals by Aristotle. http://www.classics.mit.edu/Aristotle/ historyanim.html 4. Wardle, R.A., McLeod, J.A. (1952) The Zoology of Tapeworms. University of Minnesota Press, Minneapolis, pp. 45–91, 155–172. 5. Yingkun, F., Shan, O., Xiuzhen, Z., et al. (1979) Clinicoelectroencephalographic studies of cerebral cysticercosis: 158 cases. Chinese Medical Journal 92, 770–786. 6. Hoeppli, R., Ch’iang, I.H. (1940) Selections from old Chinese medical literature on various subjects of helminthological interest. Chinese Medical Journal 57, 373–380. 7. Mönnig, H.O. (1950) Veterinary Helminthology and Entomology. The Diseases of Domesticated Animals Caused by Helminth and Arthropod Parasites, 3rd edn. Tindall and Cox, London, 11 pp. 8. Linnaeus, C. (1735) Systema Naturae sive segna tria Naturae Systematice Proposita per Classes, Ordines, Genera et Species. Uppsala, Sweden. 9. Linnaeus, C. (1758) Systemae Naturae per regni tria Naturae, Secundum Classes, Ordines, Genera, Species Characteribus, Differentis, Synonymis, Locis. Tomus 1, Edition decima. Reformata, Stockholm, Sweden.

T. solium: a Historical Note

167

10. Linnaeus, C. (1761) Fauna Svecia Sistens Animalia Sveciae Regni: Mamalia, Avesm Amphibia, Pisces, Insecta, Vermes. Distributa per Classes and Ordines, Genera and Species, cum Differenttis Specierum, Synonymis Auctorum, Nomiininibus Incolarum, Locis Natulium, Descrptionibus Insectorum. Edition altera, auctoris, Stockholm, Sweden. 11. Goeze, J.A.E. (1782) Versuch einer Naturgeschichte der Eingeweidewürmer thierischer Körper. PA Pape, Blankenburg, Germany, pp. 471. Cited in Ref. 20. 12. Leuckart, R. (1856) Die Blasenbandwürmer und ihre Entwickelng. Giessen, Germany, pp. 162. Cited in Ref. 20. 13. Panarolus, D. (1652) Iatrologismorum, seu Medicinalium Observationum Pentecostae Quinque. F Moneta, Romae, pp. 445. Cited in Ref. 2. 14. Rumler, J.U. (1558) Secto, a me, in capite, pustulae supra duram meningen apparuerunt, erosa ipsa et cerebro per foramina eminente pluribus in locis. Observationes Medicae. Cited in Ref. 20. 15. Zeder, J.G. (1803) Anleitung zur Naturgeschichte der Eingeweidewürmer. Bamberg, Germany, pp. 432. Cited in Ref. 20. 16. Küchenmeister, F. (1855) Offenes Sendschreiben an die k.k. Gesellschaft der Aertze zu Wein. Experimenteller Nachweis, dass Cysticercus cellulosae innerhalb des menschlinchen Darmkanales sich in Taenia solium umwandelt. Wiener medizinische Wochenschrift 5, 1–4. Translated in: Kean, B.H., Mott, J.E., Russell, A.J. (eds) Tropical Medicine and Parasitology Classic Investigations. Cornell University Press, Ithaca, New York, 1978, pp. 677. 17. Küchenmeister, F. (1855) Die in und an dem Körper des lebenden Menschen vorkommenden Parasiten. In: Ein Lehr- und Handbuch der Diagnose and Behandlung der thierischen und pflanzichen Parasiten des Menschen. BG Teubner, Leipzig, p. 486. Translated in: Lankester, E. (1857) On Animal and Vegetable Parasites of the Human Body, Vol. 1, Animal Parasites Belonging to the Group Entozoa. The Sydenham Society, London, 1857, pp. 452. 18. von Siebold, C.T. (1835) Helminthologische Beiträge. Archiv für Naturgeschichte 1, 45–83. 19. von Siebold, C.T. (1836) Ueber die Spermatozoen der Crustacean, Insecten, Gasteropoden und einiger anderer wirbellosen Thiere. Archiv für Anatomie und Physiologie (Muller) 13–53. 20. Grove, D.I. (1990) A History of Human Helminthology. CAB International, Wallingford, UK, pp. 355–383. 21. Virchow, R. (1860) Helmintologischen Notizen 5. Traubenhydatiden der weichen Hirnhaut. Virchows Archiv für Pathologische Anatomie un Physiologie und für Klinische Medizin 16, 528–535. 22. Vosgien, W. (1911) Le Cysticercus cellulosae Chez l’homme et Ches les Animaux. Thése de la Faculte de Medecine, Paris. 23. Brumpt, E. (1936) Precis de Paristologie, 5th edn. Paris, France. 24. MacArthur, W.P. (1933) Cysticercosis as a cause of epilepsy in man. Transactions of the Royal Society of Tropical Medicine and Hygiene 26, 525–528. 25. MacArthur, W.P. (1934) Cysticercosis as seen in the British army, with special reference to the production of epilepsy. Transactions of the Royal Society of Tropical Medicine and Hygiene 27, 343–357. 26. MacArthur, W.P. (1935) Cysticercosis of the brain. British Medical Journal ii, 1229. 27. Fairley, H. (1934) Tropical Diseases Bulletin 31, 784–785. 28. Dixon, H.B.F. (1933) Two cases of cysticercosis (Taenia solium). Journal of Royal Army Medical Corps 61, 126–128. 29. Dixon, H.B.F., Smithers, D.W. (1935) Cysticercosis (Taenia solium). Journal of Royal Army Medical Corps 64, 227–234, 300–306, 375–380. 30. Dixon, H.B.F., Smithers, D.W. (1934) Epilepsy in cysticercosis (Taenia solium). A study of seventy-one cases. Quarterly Journal of Medicine 3, 603–616. 31. Dixon, H.B.F., Hargreaves, W.H. (1944) Cysticercosis (Taenia solium). A further ten years clinical study covering 284 cases. Quarterly Journal of Medicine 13, 107–121. 32. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an analysis and follow up of 450 cases. Medical Research Council Special Report Series No. 299. Her Majesty’s Stationery Office, London, pp. 1–58. 33. Machado, A.B.B., Pialarissi, C.S.M., Vaz, A.J. (1988) Human cysticercosis in a general hospital in S. Paulo, Brazil. Revista de Saúde Pública (São Paulo) 22, 240–244. 34. Takayanagui, O.M., Jardim, E. (1983) Clinical aspects of neurocysticercosis: Study of 500 cases. Arquivos de Neuropsiquiatria 41, 50–63. 35. MacArthur, W.P. (1945) Tropical Diseases Bulletin 42, 907–908. 36. Mitchell, W.G., Crawford, T.O. (1988) Intraparenchymal cerebral cysticercosis in children: diagnosis and treatment. Paediatrics 82, 76–82.

168

N.H. Wadia and G. Singh

37. Wadia, N., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis: New observations, including CT scan findings and experience with treatment with praziquantel. Brain 111, 597–614. 38. Weinberg, G. (1909) Recherches des anticorps specifiques dans la distomatose et la cysticercose. Comptes Rendus Hebdomadaires des Seances et Memoires de la Societe de Biologie (France) 66, 219–221. 39. Rothfeld, J. (1935) Über die Präcipitationsreaktion bei Hirncysticerkose. Deutsche Zeitschrift Nervenheilk 137, 93–102. 40. Biagi, F.F., Tay, J. (1958) A precipitin reaction for diagnosis of cysticercosis. American Journal of Tropical Medicine and Hygiene 7, 63–65. 41. Nieto, D. (1956) Cysticercosis of the nervous system. Diagnosis by means of the spinal fluid complement test. Neurology 6, 725–738. 42. Castellani, A. (1938) Brief notes on cysticercosis and luetic pseudo-cysticercosis. Journal of Tropical Medicine and Hygiene 41, 213–217. 43. Roth, E.J. (1926) Man as the intermediate host of the Taenia solium. British Medical Journal ii, 470–471. 44. Broughton-Alcock, W., Weinbren, M. (1930) Generalised infection of muscles with Cysticercosis cellulosae; measurement of cysts and comparison with those of Trichinella spiralis. Proceedings of the Royal Society of Medicine 24, 222–224. 45. Morrison, W.K. (1934) Cysticercosis in twin brothers aged 13 years with a radiological study of calcified cysticercus in twelve cases. British Medical Journal i, 13–14. 46. Brailsford, J.F. (1941) Cysticercus cellulosae – its radiographic detection in the musculature and central nervous system. British Journal of Radiology 14, 79–93. 47. Brailsford, J.F. (1942) Unrecognized cysticercosis. Lancet i, 127–128. 48. Arana, R., Asenjo, A. (1945) Ventriculographic diagnosis of cysticercosis of the posterior fossa. Journal of Neurosurgery 2, 181–190. 49. MacArthur, W.P. (1945) Tropical Diseases Bulletin 42, 908–909. 50. Ryo, S. (1937) A new anthelminthic ‘Raigan’ in taeniasis. Journal of Oriental Medicine 26, 799–845. 51. Sandground, J.H. (1938) Newer drugs for the treatment of tapeworm infestations. Some results obtained with carbon tetrachloride, tetrachlorethylene and hexylresorcinol. New England Journal of Medicine 218, 298–304. 52. Liu, H.L. (1936) Betel nut as a useful taeniafuge. Chinese Medical Journal 50, 1273. 53. Ogle, J.W. (1863) Observations of the treatment of Taenia, especially by the use of oil of male fern. British Medical Journal i, 264–266. 54. Pankhurst, R. (1969) The traditional taenicides of Ethiopia. Journal of the History of Medicine 24, 323–334. 55. Allan, W. (1912) Thymol for Taenia saginata. Journal of American Medical Association 59, 197. 56. Carman, J.A. (1931) A note on the clinical aspect of the treatment of taeniasis with carbon tetrachloride. Transactions of the Royal Society of Tropical Medicine and Hygiene 25, 187–190. 57. Schnelewa, A.A. (1931) Anwendüng de Düodenal sonde bei Austreibung von Bandwürmen. Revue Microbiologie Epidemiologie et Parasitologie 10, 297–303. 58. Mazzotti, L., Trevino, A. (1953) Ensayo de tratamiento con ‘Dietilcarbamazina’ (Hetrazan) en tres casos de cistecercosis humana. Revista do Instituto Salubridad y Enfermedades Tropicale México 13, 209–211. 59. Mazzotti, L., Torroella, J. (1955) Resultados negatives de Hetrazan en des casos humans de cesticercosis ocular. Revista do Instituto Salubridad y Enfermedades Tropicale México 15, 217–219. 60. Henneberg, R. (1936) Die tierschen Parasiten des Zentralnervensystem. In: Bumke und Foerster’s Handbuch der Neurlogie. Vierzehuten Band. Springer-Verlag, Berlin, Germany, pp. 286–322. 61. Olive, J.I., Angulo-Rivero, P. (1962) Cysticercosis of the nervous system. Panel discussion. A. Introduction and general aspects. Journal of Neurosurgery 19, 632–634.

17

Neurocysticercosis: an Overview of Clinical Presentations Sudesh Prabhakar and Gagandeep Singh

Introduction

History and Physical Examination

The manifestations of neurocysticercosis (NC) are a puzzling concern to clinicians in endemic and non-endemic countries alike. No symptom or sign is specific for the disorder. Furthermore, a plethora of clinical presentations (reviewed in Chapters 18–29) have been described, giving NC the appropriate title of the modern-day successor of syphilis, the master imitator of all diseases. In non-endemic regions, which are experiencing a reemergence of the disorder, the lack of awareness of NC often leads to delay in diagnosis and resort to unnecessary invasive, potentially harmful and time-consuming tests such a stereotactic biopsy and so forth1. Contrariwise, in endemic areas, clinicians often pronounce a diagnosis of NC only to realize an alternative diagnosis much later2,3. In this view, it is obviously important to classify the disorder, put down diagnostic criteria and familiarize clinicians with salient clinical manifestations. Accordingly, an overview of available and practised systems of staging, classification and diagnosis are discussed in the clinical context in this chapter; more detailed reviews of individual clinical presentations follow in the subsequent chapters.

The symptoms and signs of NC are nonspecific. Parenchymal NC commonly presents with seizures and headaches. Seizures may be single, clustered or recurrent. They are either focal with or without secondary generalization or may be generalized at the onset. Headaches may be transientmigraineous, continuous-tension type or more uncommonly, severe portending intracranial hypertension. Other less common features include focal neurological deficits (usually brief, though rarely persuasive), a variety of psychiatric manifestations and dementia. In patients with extraparenchymal NC, the most common pathological determinant of clinical symptoms and signs is hydrocephalus4,5. These patients present with headaches, which may or may not be associated with nausea and vomiting and visual disturbances resulting from papilloedema and secondary optic atrophy. In addition, they may develop features of meningismus, stroke-like presentations or cranial nerve palsies. General physical examination is usually normal, though subcutaneous nodules may be felt or seen (Fig. 17.1) and ocular examination may disclose ophthalmic cysticercosis (Fig. 17.2) (reviewed in Chapter 28). The sub-

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

169

170

S. Prabhakar and G. Singh

Fig. 17.1. Lingual and subcutaneous cysticerci.

Fig. 17.2. Ocular cysticercosis.

cutaneous nodules represent cysticerci in underlying muscles. The nodules are the size of a pea and are painless. They often go unnoticed by the patient but when recognized they may be a cause of concern to him/her, requiring several assurances from the physician. The skin over the nodules is movable. Nodules are usually detected by palpation alone over the trunk and limbs,

but may be visible over the tongue, face and neck, where the skin is thin (Fig. 17.1). Indeed, the detection of subcutaneous nodules was hitherto considered to be an important aspect of diagnosis of Taenia solium cysticercosis. In a large series of 450 patients reported by Dixon and Lipscomb, 54% had nodules6. Subcutaneous nodules are now becoming rare in view of the rapidity with which a diagnosis of NC is made with the help of computed tomography (CT) and magnetic resonance imaging (MRI). In most cases, neurological examination is normal. Focal neurological deficits if present are subtle and evanescent. In a subset of patients with a large parenchymal burden of disease or extraparenchymal NC7,8, the presenting signs may be those due to intracranial hypertension and/or dementia (reviewed in Chapter 19). These patients commonly have papilloedema, impairment in cognitive protocols and somnolence or varying levels of consciousness. A definite, probable and possible diagnosis of NC can be made on the basis of clinical, radiological and epidemiological criteria, tabulated in Box 17.1. These criteria were proposed by Del Brutto et al., in 19969, and revised in 200110.

An Overview of Clinical Presentations

171

Box 17.1. Diagnostic criteria for neurocysticercosis (NC). (Adapted from references 9 and 10.) Absolute criteria 1. Histological demonstration of cysticerci from either a central or peripheral source. 2. Direct visualization of ophthalmologic cysticerci. 3. Demonstration of a cyst containing a scolex upon neuroimaging study. Major criteria 1. Evidence of lesions suggestive of NC on neuroimaging studies without demonstration of a scolex (MRI or CT showing cystic lesions, ring-enhancing lesions, parenchymal brain calcifications, hydrocephalus, and abnormal enhancement of the leptomeninges. Myelograms showing multiple filling defects in the column of contrast material). 2. Serum anti-cysticercal antibodies demonstrated by immunoblot, or spinal fluid anticysticercal antibodies demonstrated by immunoblot or ELISA. 3. Characteristic cigar-shaped calcifications demonstrated by soft-tissue radiographs of the thigh and calf. Minor criteria 1. Subcutaneous nodules suggestive of cysticerci (without histological confirmation). 2. Punctate intracerebral or soft-tissue calcifications on plain radiographs. 3. Clinical manifestations suggestive of NC (seizures, focal neurological deficits, symptoms of increased intracranial pressure, dementia). 4. Disappearance of intracranial lesions after treatment with anticysticercal drugs. Epidemiologic criteria 1. Residence in a cysticercosis endemic area. 2. Frequent travel to cysticercosis endemic areas. 3. Household contact with an individual infected with Taenia solium. Based on the above diagnostic criteria, the following diagnostic categories were proposed: A. Definite NC (one of the following) One absolute criterion Two major criteria One major, two minor and one epidemiologic criterion B. Probable NC (one of the following) One major and two minor criteria One major, one minor and one epidemiologic criterion Three minor and one epidemiologic criterion C. Possible NC (one of the following) One major criteria Two minor criteria One minor and one epidemiologic criterion

Overview of Disease Staging and Classification The lack of pathognomic clinical features despite the large number of clinical presentations of human T. solium cysticercosis was recognized very early by medical scientists. This led to attempts at systematic classification of disease. Thus, Küchenmeister recognized the presence of cysticercosis in meningeal, cortical and ventricular loca-

tions11. This was one of the earliest versions of more contemporary classifications. A major objective of classification is to guide management approaches and obtain prognostic information. Since in the early part of the 20th century, surgery was the only established method of treatment, initial classification systems were made in order to determine the need and nature of surgical approach. Several orderly classifications were given and perhaps that of Stepien and

172

S. Prabhakar and G. Singh

Table 17.1. Surgically oriented classification of neurocysticercosis. (Source: reference 12.) Group

Clinical characteristics

Surgical implication

I

Space occupying intracranial tumour-like behaviour producing focal neurological manifestations (focal seizures, hemiparesis, visual pathway deficits, cranial neuropathy/ies, cerebellar symptoms and signs) and ultimately raised intracranial pressure (in case of third/ fourth ventricular cysticercosis: posterior fossa mass and obstructive hydrocephalus) Diffuse cerebral syndrome due to numerous cysticerci leading to cerebral oedema, intracranial hypertension (leading to vision loss), organic brain syndrome Basal meningeal or ventricular cysticerci giving rise to hydrocephalus (and intracranial hypertension), rarely focal signs and mental disturbances

Exeresis often indicated

II

III

Chorobski is most well known (Table 17.1)12. The classification worked well in those times, effectively dictating the surgical approach in the absence of modern tools of diagnosis like CT, MRI and enzymelinked immunoelectrotransfer blot (EITB). Understandably, it has been replaced by classification/s that incorporate contemporary diagnostic and therapeutic options13,14. Classifying NC according to the anatomic compartment of involvement is advantageous to clinicians, radiologists and pathologists (Table 17.2). It separates clinical concomitants into those of parenchymal NC (presenting with seizures, space-occupying effects and intracranial hypertension), subarachnoid NC (presenting with meningitis, space-occupying effects and hydrocephalus) and ventricular NC (manifesting as acute hydrocephalus, meningitis or rarely space-occupying lesions). A classification system that is oriented purely anatomically however, does not take into account the evolutionary stage of NC, which also influences clinical presentation. In 1985, Sotelo et al. proposed the classification of NC into active and inactive disease (Table 17.3)15. The classification derives from pathological-radiological staging of NC, which have been described elsewhere in the book (Chapters 30 and 32) in 753 cases. Both viable, live (non-inflamed) parenchymal cysts and degenerating parenchymal cysts represented the active form. Extraparenchymal presentations of active meningitis or arachnoiditis were likewise

Exeresis rarely useful but may be undertaken in life-threatening conditions Cerebrospinal fluid diversion procedure

included in active disease presentations. Parenchymal calcifications and hydrocephalus secondary to meningeal fibrosis were classified into inactive forms. Thus, symptoms of active forms of NC included seizures (most commonly), acute or subacute hydrocephalus (less

Table 17.2. Anatomical classification of neurocysticercosis (NC). 1 2

3

Parenchymal NC Extraparenchymal NC Venticular Subarachnoid Mixed

Table 17.3. Classification of neurocysticercosis into active and inactive forms. (Reproduced with permission from reference 15.) Active forms of NC Arachnoiditis Hydrocephalus secondary to meningeal inflammation Parenchymal cysts Brain infarction secondary to vasculitis Mass effect due to large cyst or cyst clumps Intraventricular cysts Spinal cysts Inactive forms of NC Parenchymal calcifications Hydrocephalus secondary to meningeal fibrosis

An Overview of Clinical Presentations

common) due to meningeal inflammation, arachnoiditis, obstruction by intraventricular cysts, meningitis and stroke (not uncommon) and mass effect due to space-occupying lesions (rare) and myelopathy (rare). Clinical presentations of inactive NC included seizures due to parenchymal calcified NC and chronic hydrocephalus. The purpose of this classification was to differentiate between those cases that required definitive medical (anticysticercal treatment and/or steroids) or surgical management versus those that required only symptomatic medical (antiseizure medications) or surgical (ventriculoperitoneal shunt) management. This classification is perhaps the most widely used in the present day. Carpio et al. classified NC into active, transitional and inactive forms16. This classification is an appropriate staging system based upon clinical and imaging characteristics and has therapeutic implications as well. Active NC forms, which refer to live, viable parenchymal or extraparenchymal cysts, rarely produce symptoms apart from the rare instance of mass effect. Symptomatic NC is incident upon the transitional forms, where degenerating parenchymal cysts produce acute symptomatic seizures. Likewise degenerating subarachnoid cysts produce meningitis, arachnoiditis and hydrocephalus and ventricular cysts lead to acute hydrocephalus. Inactive disease again is exemplified by single or multiple parenchymal calcification/s and/or hydrocephalus secondary to meningeal fibrosis.

Natural course of disease It must be remembered that no compartmentalization is strict, and good proportions of patients simultaneously have several anatomical or evolutionary attributes. Thus, it is not uncommon to find a patient with multiple active, involuting and calcified parenchymal cysts in addition to the presence of cysticercotic hydrocephalus due to chronic arachnoiditis. Likewise, another patient may be having seizures due to transitional forms of NC that ultimately resolve with calcifications. A few years later, this patient may again experience seizures due to a fresh crop of parenchymal cysticerci that have begun

173

involuting. Thus this patient may pass through several stages of NC: active (asymptomatic) initially, transitional, inactive and then again, transitional. The usual course of illness in most patients, particularly those with one or few parenchymal cysts, is benign and self-limiting. These patients have few seizures, often clustered, that remit rapidly. It is not uncommon to find some parenchymal cysts undergoing involution/degeneration at about the same time rather than one after another upon CT. The simultaneous involution is surmised to result from an antigenic stimulation following degeneration of one cyst that induces an immune response against the other cysts as well. This often is the reason for the short, self-limiting course of NC rather than a protracted course. In contrast, clinical syndromes associated with multiple inflamed parenchymal cysticercosis, often synonymously called cysticercotic encephalitis and profuse, non-inflamed cysticercosis, also called ‘disseminated cysticercosis’ (reviewed in Chapter 19), or even few cysts in the intraventricular (discussed in Chapter 20) or subarachnoid (discussed in Chapter 18) locations, often have a foreboding course.

Temporal and Geographical Trends in Clinical Presentation Temporal trends Some of the earliest descriptions of NC in literature portrayed a uniformly dismal prognosis17,18. This was not borne out by several subsequent studies, which suggested that ‘the prognosis was not as bad as previously felt’19,20. More recent experience suggests the existence of benign self-limiting or oligolesional disease in large numbers20–23. This does not indicate a shift in the clinical spectrum of disease from more severe to benign forms but merely reflects early diagnosis and the recognition of benign, oligolesional NC with modern modalities of neuroimaging such as CT and MRI. For instance, the average time period between the first neurological symptom and establishment of a diagnosis of cysticercosis was

174

S. Prabhakar and G. Singh

8.2 years with a range of 1–52 years before 19626. This time period has been reduced to days or months in most developing countries and most certainly to hours or days in developed countries. In another example, the traditional viewpoint prevailed in India that regarded NC as a disorder with multiple parenchymal cysts. With the advent of CT in the early 1980s, a solitary ring-enhancing lesion that resolved spontaneously in 3–6 months was noted upon CT. It took clinical neurologists nearly a decade to understand and accept that these single self-limiting forms were of cysticercal aetiology. In this regard, therefore, CT and later MRI have made the most dramatic impact on our understanding of the disorder.

Geographical trends Several authors have considered geographical differences in clinical presentation before. In fact, as early as 1938, MacArthur was surprised to note the occurrence of subarachnoid cysticercosis diagnosed by ventriculography in South America, although he had not encountered any such form in his vast experience with the disorder in India21,22. His comments continue to fuel speculations that parenchymal NC is more common in India and other South and Southeast Asian countries, while subarachnoid–ventricular forms are more common in Latin America. These differences are perhaps more imaginary than real. Actually, the spectrum of clinical presentations is likely to vary with the volume of patients seen and the referral pattern linked to the repute of the medical facility in terms of treating the disorder either medically or surgically (H.H. García, Lima, personal communication). Thus, a series of patients compiled from a general hospital may have seizures as the dominant manifestation, while a series from a tertiary care neurosurgical facility may have a predominance of subarachnoid and ventricular forms. It appears therefore, that available published clinical series cannot be strictly compared. Nevertheless, the issue of geographical variations in clinical presentation needs to

be resolved by careful prospective collection of data from similar facilities that are matched for therapeutic expertise and reputation, referral pattern and patient volume. Some of the important published series of NC in persons of Latin American origin are summarized in Table 17.4. These have been compared with a series collected in a large tertiary care public hospital facility in India. The presence of NC was established by imaging, surgical pathology and autopsy in this series. Indeed, comparison of these series does not reveal differences in clinical presentation.

Conclusions A spectrum of clinical manifestations from asymptomatic larval infestation to severe presentations with life-threatening intracranial hypertension, irrecoverable cognitive deterioration and altered sensorium impending upon death has been noted in NC. Most patients, however, lie between these two extremes with occasional seizures and/or headaches. Clinical manifestations vary according to the anatomical site of lesion/s and the evolutionary stage of the cysticercus. By the former approach, NC is classified into parenchymal and extraparenchymal. Parenchymal disease results from infection within the brain parenchyma, most commonly at the cortical–subcortical interface. Extraparenchymal NC implies involvement of the cranial and spinal subarachnoid space and the ventricles. Commonly, the clinician encounters patients with combined disease or disease which changes from one compartment to the other. The classification of NC into active (and transitional) and inactive forms is particularly advantageous and has important therapeutic implications. It is conceivable that with the unfolding of novel immune mechanisms that underlie clinical presentations and application of immune therapies against molecular domains, a classification based upon molecular immunology may ultimately replace existing clinical, pathological and radiological classifications.

An Overview of Clinical Presentations

175

Table 17.4. Clinical syndromes (not necessarily the presenting ones) of neurocysticercosis in various published series in the 1980s, about the time when computed tomography was becoming available. Reference

23

15*

24

25

26

Authors

McCormick et al.

Sotelo et al.

Scharff

Collection period Location

1970–1980 Los Angeles, CA, USA 127 11–83 na 68 (53.5%) 59 (46.5%)

1977–1981 Mexico City, Mexico 753 5–76 32 (50.8%) (49.2%)

Grisiola and Wiederholt 1972–1981 San Diego, CA, USA 17 7–58 na 10 (58.8%) 7 (41.2%)

1981–1986 Los Angeles, CA, USA 238 2–82 35 139 (58.4%) 99 (41.6%)

Veerendra Kumar 1974–1980 Bangalore, India 81 1–65 na

70 (55.1%)

(52.4%)

6 (35.3%)

134 (56.3%)

37 (45.7%)

48 (37.8%) 13 (10.2%) 54 (42.5%) 15 (11.8%) na 0 (0%) na na

(43.4%) (15.8%) (29.5%) (2.3%) (7.4%) (1.4%) na na

11 (64.7%) na 14 (82.4%) 3 (17.6%) na 1 (5.9%) na na

51 (21.4%) 5 (2.1%) 13 (5.5%) 10 (4.2%) 8 (3.4%) 1 (0.4%) na na

31 (38.3%) 6 (7.4%) 11 (13.6%) 1 (1.2%) 3 (3.7%) 2 (2.5%) 2 (2.5%) 4 (4.9%)

Number of patients Age (range) in years Age (mean) in years Males Females Clinical syndrome Seizures Intracranial hypertension Dementia Meningio-encephalitis† Stroke Psychiatric presentation‡ Spinal cysticercosis Muscular cysticercosis Ocular cysticercosis

*Only percentages available. criteria for diagnosis of meningitis were variable (including the presence of meningeal signs and cerebrospinal fluid pleocytosis). ‡Does not imply a primary psychiatric presentation. †The

References 1.

Miyake, H., Takahashi, K., Tsuji, M., et al. (1993) A surgical case of solitary cerebral cysticercosis. No Shinkei Geka 21, 561–565. 2. Matson, D.O., Rouah, E., Lee, R.T., et al. (1988) Acanthamoeba meningoencephalitis masquerading as neurocysticercosis. Pediatric Infectious Diseases Journal 7, 121–124. 3. Walus, M.A., Young, E.J. (1990) Concomitant neurocysticercosis and brucellosis. American Journal of Clinical Pathology 94, 790–792. 4. Bandres, J.C., White, A.C., Jr, Samo, T., et al. (1992) Extraparenchymal NC: report of five cases and review of management. Clinical Infectious Diseases 15, 799–811. 5. Lobato, R.D., Lamas, E., Portillo, J.M., et al. (1981) Hydrocephalus in cerebral cysticercosis. Pathogenic and therapeutic considerations. Journal of Neurosurgery 55, 786–793. 6. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an analysis and follow up of 450 cases. Medical Research Council Special Report. Series No. 299. Her Majesty’s Stationery Office, London, pp. 1–58. 7. Wadia, N.H., Desai, S.B., Bhatt, M.B. (1988) Disseminated cysticercosis – new observations including CT scan findings and experience with treatment by praziquantel. Brain 11, 597–614. 8. Garcia, H.H., Del Brutto, O.H. (1999) Heavy nonencephalitic cerebral cysticercosis in tapeworm carriers. Neurology 53, 1582–1584. 9. Del Brutto, O.H., Wadia, N.H., Dumas, M., et al. (1996) Proposal of diagnostic criteria for human cysticercosis and NC. Journal of the Neurological Sciences 142, 1–6. 10. Del Brutto, O.H., Rajshekhar, V., White, A.C., Jr, et al. (2001) Proposed diagnostic criteria for neurocysticerosis. Neurology 57, 177–183.

176

11.

12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26.

S. Prabhakar and G. Singh

Küchenmeister, F. (1855) Die in und an dem Körper des lebenden Menschen vorkommenden Parasiten. Ein Lehr- und Handbuch der Diagnose and Behandlung der thierischen und pflanzichen Parasiten des Menschen. BG Teubner, Leipzig, pp. 486. Translated by E. Lankester (1857). In: On Animal and Vegetable Parasites of the Human Body. Vol. 1. Animal Parasites Belonging to the Group Entozoa. The Sydenham Society, London, pp. 452. Stepieñ, L., Choróbski, J. (1949) Cysticercosis cerebri and its operative treatment. Archives of Neurology and Psychiatry (Chicago) 61, 499–527. Colli, B.O., Martelli, N., Assirati, J.A., et al. (1994) Cysticercosis of the central nervous system. I. Surgical treatment of cerebral cysticercosis. Arquivos de Neuropsiquiatria 52, 166–186. Colli, B.O., Martelli, N., Assirati, J.A., et al. (1995) Surgical treatment of cysticercosis of the central nervous system. Neurosurgery Quarterly 5, 34–54. Sotelo, J., Guerrero, V., Rubio, F. (1985) Neurocysticercosis: a new classification based on active and inactive forms. A study of 753 cases. Archives of Internal Medicine 145, 442–445. Carpio, A., Placencia, M., Santillán, F., et al. (1994) A proposal for classification of neurocysticercosis. Canadian Journal of Neurological Sciences 21, 43–47. MacArthur, W.P. (1933) Cysticercosis as a cause of epilepsy in man. Transactions of the Royal Society of Tropical Medicine and Hygiene 26, 525–528. MacArthur, W.P. (1934) Cysticercosis as seen in the British army, with special reference to the production of epilepsy. Transactions of the Royal Society of Tropical Medicine and Hygiene 27, 343–357. Dixon, H.B.F., Smithers, D.W. (1934) Epilepsy in cysticercosis (Taenia solium). A study of seventy-one cases. Quarterly Journal of Medicine 3, 603–616. Dixon, H.B.F., Hargreaves, W.H. (1944) Cysticercosis (Taenia solium). A further ten years clinical study covering 284 cases. Quarterly Journal of Medicine 13, 107–121. MacArthur, W.P. (1945) Tropical Diseases Bulletin 42, 908–909. Arana, R., Asenjo, A. (1945) Ventriculographic diagnosis of cysticercosis of the posterior fossa. Journal of Neurosurgery 2, 181–190. McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri: review of 127 cases. Archives of Neurology 39, 534–539. Grisiola, J.S., Wiederholt, W.C. (1982) CNS cysticercosis. Archives of Neurology 39, 540–544. Scharff, D. (1988) Neurocysticercosis. Two hundred thirty-eight cases from a California hospital. Archives of Neurology 45, 777–780. Veerendra Kumar, M. (1986) Clinico-pathological Study of Neurocysticercosis. Thesis. University of Bangalore, Bangalore, India.

18

Meningeal Cysticercosis Oscar H. Del Brutto

Introduction The meningeal form of cysticercosis was probably first described in 1860 by Virchow, who found membranous structures at the base of the brain at necropsy of an individual who died of a chronic neurological disorder1. Virchow, however, did not recognize the correct nature of those membranes which he called ‘racemose hydatids’ (Traubenhydatiden). In 1882, Zenker demonstrated cysticercal scolices within such membranes and coined the term ‘cysticercus racemosus’ (quoted by Henneberg)2. According to Zenker’s original description – based on the pathological study of 15 cases – this parasite was a variant of cysticercus cellulosae, which developed into an abnormal shape and size. Only a few authors3–5 described meningeal cysticerci subsequently, until Bickerstaff and co-workers6,7, described their pathological and clinical manifestations in detail, in their classical papers ‘The racemose form of cerebral cysticercosis’ and ‘Cysticercosis of the posterior fossa’. It has been common practice to describe cysticerci located in the brain parenchyma or within cortical sulci between two cerebral convolutions as ‘cysticercus cellulosae’ and those cysticerci located within the basal cisterns as ‘cysticercus racemosus8–11. However, this terminology may be misleading and indicate that these are unre-

lated conditions from different Taenia sp.12. Actually, the term ‘cysticercus cellulosae’ was initially used to describe an unique parasitic infection at a time when it was not known that cysticerci merely represent the larval stage of Taenia solium13. Therefore, neither of the terms, ‘cysticercus cellulosae’ and ‘cysticercus racemosus’ are scientifically acceptable. Flisser proposed the terms ‘cellulose form of T. solium cysticercosis’ and ‘racemose form of T. solium cysticercosis’ in order to differentiate between the two conditions14.

Pathology Taenia solium cysticercus is a vesicle that consists of two main parts: the vesicular wall and an invaginated scolex. The vesicular wall is a membranous structure with festooned appearance made up of an outer eosinophilic layer called the ‘cuticular mantle’, a middle cellular layer with pseudoepithelial structure, and an inner layer formed by circular muscle and reticular fibres15. It may be considered equivalent to the tegument across which the parasite obtains metabolites and nutrition through absorption and diffusion16. Inside the vesicle, there is an invaginated scolex, structurally similar to that of the adult T. solium, including its

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

177

178

O.H. Del Brutto

head armed with suckers and hooks, an elongated neck, and a rudimentary body. A scolex may not be identified in all cysticercus vesicles. These latter forms consist of several membranes attached to each other, usually located within basal cisterns17,18. Histological studies have shown that these structures represent proliferation of parasitic membranes after degeneration of the scolex. Their histochemical composition is unique, because of the presence of acid mucosubstances and hydrophilic lipids in large amounts19. Rabiela et al. described the morphological characteristics of cellulose and racemose forms of the cysticercus, providing evidence that they arise from a single Taenia sp.20,21. The authors also described another form of cysticercus that conserves the scolex but has two or more small bladders sprouting from the main vesicle. This is an ‘intermediate form of cysticercus’, representing an initial stage in the transformation from cellulose to racemose form. Mechanisms responsible for this transformation are incompletely understood. It is believed that vesicles grow and their scolices disappear as the result of hydropic degeneration, caused by the continuous adsorption of cerebrospinal fluid (CSF)18. Macroscopic appearances of meningeal (subarachnoid) cysticerci vary according to

their location. Cysticerci located at the cortical surface of the brain usually have a scolex and are of the cellulose form (Fig. 18.1). This is the most common location of intracranial cysticerci in pathological series15,17. The cysts rarely measure greater than 10 mm because pressure of the brain parenchyma prevents further growth of vesicles. In contrast, cysticerci located within basal cisterns often attain sizes of about 50 mm since their growth is not limited by brain parenchyma. Giant cysts usually lack a scolex. They are commonly located within the Sylvian fissures, cerebellopontine angles, perimesencephalic and prepontine cisterns, and optochiasmatic region. Upon involution, meningeal cysticerci elicit severe inflammatory reaction in the subarachnoid space with formation of dense exudates composed of collagen fibres, lymphocytes, multinucleated giant cells, eosinophils and hyalinized parasitic membranes, leading to thickening of leptomeninges (Fig. 18.2). Meningeal inflammation may be disseminated, inducing neural and vascular damage distant from the sites where parasites lodge. Indeed, leptomeningitis may extend from the optochiasmatic region to the foramen magnum15,18. The optic chiasm is frequently trapped by this dense exudate, leading to visual field defects22. Cranial nerves arising

Fig. 18.1. Small subarachnoid cysticercus located in the depths of cortical sulci. (Reproduced with permission from reference 34.)

Meningeal Cysticercosis

179

Fig. 18.2. Cysticercotic arachnoiditis causing abnormal thickening of leptomeninges around the brainstem.

from the ventral aspect of the brainstem may also be encased, giving rise to cranial nerve palsies23. The foramina of Luschka and Magendie may also be occluded by thickened leptomeninges and parasitic membranes with subsequent development of obstructive hydrocephalus24. The subarachnoid inflammatory reaction elicited by meningeal cysticerci may also involve intracranial vessels. Walls of small penetrating arteries arising from the circle of Willis are invaded by inflammatory cells, leading to endarteritis, adventitial thickening, medial fibrosis and endothelial hyperplasia (Fig. 18.3). The hyperplasia reduces or occludes the lumen of the vessels, leading on to cerebral infarction25. Major intracranial arteries may also be occluded by atheroma-like luminal deposits resulting from disruption of the endothelium; this vascular involvement may cause large cerebral infarcts in the territory of the anterior or middle cerebral arteries26–28. Adherence of the cysticercus to a subarachnoid blood vessel may weaken the vessel wall, resulting in the formation of a mycotic aneurysm29. Finally, meningeal cysticerci may also be located at the spinal subarachnoid space30,31. These are the result of migration of cysts from the intracranial subarachnoid space. It is also possible that cys-

ticerci enter the spinal subarachnoid space by retrograde flow through epidural vertebral veins32. Cysticerci located in the spinal subarachnoid space cause spinal leptomeningitis with resulting inflammatory or demyelinating changes in ventral and dorsal roots or peripheral nerves.

Clinical Manifestations The clinical pleomorphism of meningeal cysticercosis is related to individual variations in number, size and location of parasites, as well as the severity of the subarachnoid inflammatory reaction33,34. While a typical syndrome of meningeal cysticercosis cannot be defined, focal neurological deficits, meningitis and intracranial hypertension in varying combinations are the most common presenting features33–35.

Focal neurological deficits As previously noted, cysticercotic arachnoiditis causes entrapment of cranial nerves arising from brainstem. The oculomotor nerves, which run a long course along the basal meninges from their origin until their entrance into the cavernous

180

O.H. Del Brutto

Fig. 18.3. Microscopic section of an occluded leptomeningeal blood vessel affected by cysticercotic endarteritis. A dense collagen capsule and parasitic membranes surround the vessel. (Reproduced with permission from reference 34.)

sinuses, are particularly susceptible in this regard. Clinical manifestations include diplopia due to extraocular muscle paralysis, and blurred vision due to pupillary abnormalities36. Encasement of the optic nerves and/or optic chiasm by suprasellar exudates leads to decreased visual acuity and visual field defects37,38. Large cyst/s in the cerebellopontine angle cistern present with a syndrome characterized by various combinations of sensorineural hearing loss, vertigo, facial palsy, facial numbness and pain, that may be accompanied by signs of long-tract dysfunction, motor weakness and cerebellar ataxia39. Likewise, clumps of cysts inside the Sylvian fissure may cause contralateral motor weakness and sensory deficits and language disturbances40. Most manifestations described above have a subacute onset and progressive course, often mimicking brain tumours33–40. Strokelike presentations occur in 3% of the patients with subarachnoid cysticercosis41. Ischaemic cerebrovascular complications include lacunar as well as large cerebral infarcts5,42. Lacunar infarcts occur as the result of inflammatory occlusion of small perforating arteries secondary to arach-

noiditis associated with subarachnoid cysts in the suprasellar cisterns. These infarcts are located in the posterior limb of the internal capsule or corona radiata, and produce syndromes such as pure motor hemiparesis and ataxic hemiparesis, that are clinically indistinguishable from those caused by hypertension43,44. Lacunar infarcts may also be located in the midbrain and thalamus, particularly when the paramedian thalamopeduncular branches of the mesencephalic artery are involved by the process of angiitis; in these cases, clinical manifestations include impaired vertical gaze, pupillary abnormalities, somnolence, paraparesis, and urinary incontinence25. Large cerebral infarcts are caused by occlusion of the internal carotid artery, or the anterior or middle cerebral arteries26–28,45–47. Patients present with severe focal neurological deficits secondary to an infarct involving the basal ganglia and/or cerebral cortex. Finally, there are anecdotal reports of patients with subarachnoid haemorrhage due to rupture of mycotic aneurysms of the basilar artery related to large subarachnoid cysticerci attached to the artery29.

Meningeal Cysticercosis

Meningitis Cysticercotic meningitis is most often subacute to chronic.34 It presents with cranial nerve dysfunction or symptoms and signs of increased intracranial pressure. Fever is rarely noted. It is generally believed that meningeal cysticerci do not cause acute meningitis33. However, a recent report described an acute meningeal syndrome attributable to cysticercosis in 27 individuals48. Fever was noted in 74% and neck stiffness in 44% of the patients. The report suggests that cysticercosis should be included in the differential diagnosis acute meningitis, particularly in endemic regions48.

Intracranial hypertension Meningeal cysticercosis may cause intracranial hypertension by two main mechanisms. The most common is development of hydrocephalus due to inflammatory occlusion of the foramina of Luschka and Magendie, with blockage of CSF transit from the fourth ventricle to the subarachnoid space24. This severe or even fatal complication of meningeal cysticercosis presents with a subacute syndrome of intracranial hypertension (headache, vomiting, papilloedema)49. It may be accompanied by symptoms and signs of cranial nerve dysfunction and cerebral infarcts due to the hitherto outlined mechanisms18. Intracranial hypertension may also be incidental to growing clumps of cysts in locations such as Sylvian fissures, anterior interhemispheric fissure, or cerebellopontine angle cisterns39,40. In the latter event, focal neurological deficits precede development of symptoms and signs of intracranial hypertension by several weeks to months.

Seizures While seizures are common manifestations of parenchymal brain cysticercosis, they may also occur in meningeal cysticercosis. Subarachnoid cysticerci located at the cortical surface of the brain, between two cerebral convolutions, induce seizures by irritation of the subjacent cerebral cortex50. There is a lack of literature

181

specifically addressing characteristics of seizure disorder associated with cortical subarachnoid cysticerci, but it may be assumed that the latter give rise to partial seizures with or without secondary generalization as a result of focal irritative mechanisms.

Myelopathy and radiculopathy Subarachnoid cysticerci of the spinal canal usually cause a non-specific clinical picture characterized by a combination of radicular pain and motor deficits of subacute onset and progressive course51,52. Cervical leptomeningeal cysts may cause a compressive myelopathy with signs of upper motor neuron damage in the lower limbs (spastic paraparesis with bilateral Babinski’s signs) associated with atrophy and fasciculations of hand muscles53. In contrast, leptomeningeal cauda equina cysts present with flaccid paraparesis and arreflexia in the lower limbs54. The reader is referred to Chapter 23 for a detailed discussion on spinal cysticercosis.

Diagnostic Evaluation Given the clinical pleomorphism of meningeal cysticercosis, a definitive diagnosis on clinical grounds alone is difficult. Complementary investigations are required to differentiate this condition from other tumours and infections with similar clinical manifestations. Diagnostic work-up includes neuroimaging, lumbar puncture and immunological tests34.

Neuroimaging studies Hydrocephalus, involving lateral, third and fourth ventricles, is the most common neuroimaging finding in meningeal cysticercosis55. Fibrous arachnoiditis can be seen as areas of abnormal enhancement of the leptomeninges at the base of the brain on computed tomography (CT) and magnetic resonance imaging (MRI) (Fig. 18.4). In addition, single or multiple subarachnoid and parenchymal brain cysts or calcifications may

182

O.H. Del Brutto

be noted, a finding that facilitates the diagnosis of neurocysticercosis (NC). Small subarachnoid cysts over the convexity of the cerebral hemispheres were considered rare in initial CT studies of NC56,57. However, the development of new generation CT equipment and MRI led to the recognition of such lesions58,59. It is unusual for large cysts to develop over the convexity of cerebral hemispheres, although isolated cases have been reported40. These cysts are spherical rather than multilobulated and in some cases, a large hyperdense nodule corresponding to the scolex may be seen. Large cysts usually have a multilobulated appearance, displace neighbouring structures, and behave as space-occupying lesions in the Sylvian fissure, cerebellopontine angle and the ambiens and prepontine cisterns (Fig. 18.5)39,60. Ischaemic cerebrovascular complications are well visualized with CT and MRI42. Findings are, however, non-specific since the appearance of NC-related cerebral infarcts is similar to those due to other causes. The accompanying presence of subarachnoid cystic lesions or abnormal enhancement of basal leptomeninges may establish a diagnosis of meningeal cysticercosis in some instances43,44.

However, other conditions with similar presentation, including fungal, tuberculous and carcinomatous meningitis should be considered in the differential diagnosis. Angiographic findings in cysticercotic angiitis include segmental narrowing of the middle cerebral artery, occlusion of the anterior or middle cerebral arteries or even the internal carotid artery, and mycotic aneurysms26–29,44,46. The exact prevalence of angiographic abnormalities in NC is unknown. However, a recent report suggests that angiographically documented arteritis is relatively common in meningeal cysticercosis, including cases without clinical or neuroimaging evidence of cerebral infarction61. CT and MRI are often non-contributory in the diagnosis of spinal meningeal cysticercosis. Myelography may be useful in such situations and may demonstrate multiple filling defects in the column of contrast material corresponding to the cysts. These cysts may be freely mobile within the spinal subarachnoid space and may change their position during myelographic examination according to movements of the patient on the exploration table. This finding is of diagnostic significance30,54,62.

Fig. 18.4. Contrast-enhanced MRI of a patient with severe cysticercotic arachnoiditis showing abnormal enhancement of basal leptomeninges.

Fig. 18.5. MRI showing a giant cysticercus in the Sylvian fissure. Note the multilobulate appearance of the lesion and the displacement of the midline.

Meningeal Cysticercosis

183

Table 18.1. Differences between larval cellulose and racemose forms of Taenia solium. Characteristics

Metacestode form

Racemose form

Shape Scolex Diameter Location

Multilobulated Absent 20–77 mm Basal subarachnoid space

Number Cerebrospinal fluid manifestation Clinical manifestation

Round Present 1–20 mm Parenchymal, convexity subarachnoid space 1–2000 Normal/abnormal Seizures, headaches

Prognosis

Relatively benign

CSF analysis Abnormalities in the cytochemical composition of CSF have been reported in up to 80% of patients with meningeal cysticercosis34,41. The most common finding is moderate mononuclear pleocytosis, with cell counts rarely exceeding 300 mm−3. However, as many as 5000 cells mm−3 (with predominance of neutrophils) may be observed in some instances48. Eosinophils are increased in almost 60% of cases with pleocytosis. However, this finding is not diagnostic and may be seen in other infectious and noninfectious diseases. CSF glucose levels are usually within the normal range despite active meningeal disease. Indeed, normal CSF glucose levels are useful in excluding a diagnosis of tuberculous meningitis, where low CSF glucose levels are usual. However, hypoglycorrhagia (< 40 mg dl−1) has been reported in 12–18% of NC patients9,41. Very low glucose levels (< 10 mg dl−1) have been associated with poor prognosis63. Elevated protein levels in the CSF are common in patients with pleocytosis. Proteins are moderately raised, usually 50–300 mg dl−1, although protein levels as high as 1600 mg dl−1 have been reported63.

Immunological tests An immunological diagnosis of meningeal cysticercosis has the inherent problems of unsatisfactory sensitivity and specificity. False-negative results are related to immune

1–3 Mostly abnormal Intracranial hypertension, cranial nerve palsies Severe

tolerance to the parasite without antibody production, and false-positive results are due to previous contact with the adult T. solium or to cross-reactivity with other helminths34. The complement fixation test is positive in more than 80% of patients with meningeal cysticercosis who have inflammatory changes in the CSF but only in 22% of those who have a normal CSF analysis41. More than 30% of patients with meningeal cysticercosis may have a false-negative result and a similar percentage of individuals may have false-positive results with ELISA in the serum64. In contrast, ELISA measuring anticysticercal antibodies in CSF is more accurate (87% sensitivity and 95% specificity)65. The enzyme-linked immunoelectrotransfer blot (EITB) assay is considered highly reliable for the diagnosis of meningeal cysticercosis (94% to 98% sensitive and 100% specific)66. One of the drawbacks of this assay is that it may be positive in individuals with taeniasis. Therefore, EITB results must be interpreted in context of the clinical manifestations, neuroimaging findings and the habitat of the patient. A positive EITB in serum is of questionable diagnostic value in individuals with neurological disease in endemic areas, while is highly diagnostic in those areas where cysticercosis is rare34. The development of monoclonal antibody-based ELISA to detect presence of cysticercal antigens in CSF may improve diagnostic accuracy for meningeal cysticercosis67. According to a recent report, the sensitivity of the test is 86% and its specificity is 100%68.

184

O.H. Del Brutto

Treatment and Outcome A common therapeutic scheme cannot be put forward for the management of meningeal cysticercosis on account of its variable clinical, pathological and radiological behaviour69,70. Therapy includes combinations of symptomatic drugs, specific anticysticercal drugs, surgical resection of lesions and placement of ventricular shunts35. Medical treatment of small convexity-subarachnoid cysts is similar to that of parenchymal brain cysts, with the difference that albendazole (15 mg kg−1 day−1 for 8 days) is the preferred drug since it penetrates the subarachnoid space better than praziquantel71. There is controversy on the management of giant subarachnoid cysts. Some authors recommend surgical resection of these lesions40. However, medical therapy is equally effective yet less aggressive69. There are several reports of clinical and neuroimaging improvement with albendazole (Fig. 18.6)72–74. The inflammatory reaction that follows albendazoleinduced cyst degeneration may lead to occlusive endarteritis resulting in cerebral infarction due to the proximity of subarach-

noid cysts to intracranial blood vessels47. Dexamethasone administration is useful in the prevention and management of this complication72. It is recommended that dexamethasone administration should precede the institution of anticysticercal therapy by a few days. Furthermore, it may be used for several days after completion of anticysticercal therapy. There is anecdotal evidence of the benefit of neuroprotective drugs, such as nimodipine, in the prevention of cerebral infarction during anticysticercal drug administration to individuals with subarachnoid cysticerci75. The mainstay of management of hydrocephalus due to cysticercotic arachnoiditis is the placement of a ventricular shunt device70. The condition runs a protracted course and carries a poor prognosis owing to a high frequency of shunt dysfunction35. A long-term follow-up study demonstrated 50% mortality rate within the first 2 years of ventricular shunting. The mortality correlated with the number of surgical interventions to revise the shunt76. Shunt dysfunction manifests with headache, vomiting and progressive deterioration of the neurological status. Prompt recognition is

Fig. 18.6. CT before (a) and 3 months after (b) albendazole therapy of a patient with a subarachnoid cysticercus in the interhemispheric fissure. Note resolution of lesion as the result of therapy.

Meningeal Cysticercosis

important to avoid further neurological damage. The continued administration of prednisone in doses of 50 mg three times a week for up to 2 years can reduce the risk of shunt dysfunction from 60% to 13%77. Sotelo recently designed a new shunt device that functions at a constant flow without a valvular mechanism78. This prevents the entry of spinal CSF into the ventricular system towards the inlet of the shunt device. The inversion of CSF transit is one of the most common causes of shunt dysfunction as it allows the entry of subarachnoid inflammatory cells and parasitic debris into the ventricular system79. A recent study reported good shunt function at a mean of 9 months in 96% of patients with hydrocephalus due to cysticercotic arachnoiditis80. Another study compared the effectiveness of this new shunt with that of a conventional Pudenz-type shunt81. One year after follow-up, the Pudenz-type shunt had to be withdrawn or surgically revised in 45% of the patients. This compared with the requirement of shunt revision in 30% of those with the new shunt implant. The main cause of shunt dysfunction in Pudenz-type shunt is shunt occlusion. This complication is rare with the new

185

shunt. A drawback of the new shunt device was insufficient drainage of CSF, a problem that may be resolved by increasing the cross-sectional internal area of the peritoneal end of the catheter.

Conclusions Meningeal cysticercosis involves the basal CSF cisterns or the convexity CSF spaces. The pathological appearance is one of grape-like multilobulated vesicles, without a scolex, occupying much of the volume of the basal cistern or of small cystic structures with a scolex over the cerebral convexity. Focal neurological deficits, meningitis and intracranial hypertension are the most common presenting clinical features. In addition, convexity meningeal cysticerci may present with seizures. Imaging studies reveal a constellation of findings in varying combination: cysts, infarcts and hydrocephalus. Treatment includes surgical and medical options. A judicious choice between the use of the anticysticercal drug, albendazole for small cysts, and surgery for large cysts and hydrocephalus needs to be made.

References 1. Virchow, R. (1860) Helmintologischen Notizen 5. Traubenhydatiden der weichen Hirnhaut. Virchows Archiv für Pathologische Anatomie un Physiologie und für Klinische Medizin 16, 528–535. 2. Henneberg, R. (1912) Die tierischen Parasiten des Zentralnervensystems. I. Des Cysticercus cellulosae. In: Lewandowsky, M. (ed.) Handbuch der Neurologie, Vol. III, Spezielle Neurologie II. Verlag von Julius Springer, Berlin, pp. 643–709. 3. Moniz, E., Loff, R., Pacheco, L. (1932) Sur le diagnostic de la cysticercose cérébrale. A propos de deux cas. L’Encéphale 27, 42–53. 4. Arana, R., Asenjo, A. (1945) Ventriculographic diagnosis of cysticercosis of the posterior fossa. Journal of Neurosurgery 2, 181–190. 5. Escobar, A. (1952) Cisticercosis cerebral. Con el estudio de 20 casos. Archivos Mexicanos Neurologia y Psiquiatria 1, 149–167. 6. Bickerstaff, E.R., Cloake, P.C.P., Hughes, B., et al. (1952) The racemose form of cerebral cysticercosis. Brain 75, 1–18. 7. Bickerstaff, E.R., Small, J.M., Woolf, A.L. (1956) Cysticercosis of the posterior fossa. Brain 79, 622–634. 8. Loo, L., Braude, A. (1982) Cerebral cysticercosis in San Diego. A report of 23 cases and a review of the literature. Medicine 61, 341–359.

186

O.H. Del Brutto

9. McCormick, G.F. (1985) Cysticercosis – Review of 230 patients. Bulletin of Clinical Neurosciences 50, 76–101. 10. Rodacki, M.A., Detoni, X.A., Teixeira, W.R., et al. (1989) CT features of cellulosae and racemosus neurocysticercosis. Journal of Computer Assisted Tomography 13, 1013–1016. 11. Suh, D.C., Chang, K.H., Han, M.H., et al. (1989) Unusual MR manifestations of neurocysticercosis. Neuroradiology 31, 396–402. 12. Biagi, F.F., Briceño, C.E., Martínez, B. (1961) Diferencias entre Cysticercus cellulosae y Cysticercus racemosus. Revista de Biologia Tropical (México) 9, 141–151. 13. Grove, D.I. (1990) A History of Human Helminthology. CAB International, Wallingford, UK, pp. 355–383. 14. Flisser, A. (1994) Taeniasis and cysticercosis due to Taenia solium. In: Sun, T. (ed.) Progress in Clinical Parasitology. CRC Press, Boca Raton, Florida, pp. 77–116. 15. Pittella, J.E.H. (1997) Neurocysticercosis. Brain Pathology 7, 681–693. 16. Lumsden, R.D., Voge, M., Sogandares-Bernal, F. (1982) The metacestode tegument: fine structure, development, topochemistry, and interactions with the host. In: Flisser, A., Willms, K., Laclete, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 307–361. 17. Escobar, A., Nieto, D. (1972) Parasitic diseases. In: Minckler, J. (ed.) Pathology of the Nervous System, Vol. 3. McGraw-Hill, New York, pp. 2503–2521. 18. Escobar, A. (1983) The pathology of neurocysticercosis. In: Palacios, E., Rodriguez-Carbajal, J., Taveras, J.M. (eds.) Cysticercosis of the Central Nervous System. Charles C. Thomas, Springfield, Illinois, pp. 27–54. 19. Valkounova, J., Zdarska, Z., Slais, J. (1992) Histochemistry of the racemose form of Cysticercus cellulosae. Folia Parasitoligica (Praha) 39, 207–226. 20. Rabiela, M.T., Rivas, A., Castillo, S., et al. (1985) Pruebas morfológicas de que C. cellulosae y C. racemosus son larvas de Taenia solium. Archives of Investigative Medicine (México) 16, 83–86. 21. Rabiela, M.T., Rivas, A., Flisser, A. (1989) Morphological types of Taenia solium cysticerci. Parasitology Today 5, 357–359. 22. Del Brutto, O.H., Guevara, J., Sotelo, J. (1988) Intrasellar cysticercosis. Journal of Neurosurgery 69, 58–60. 23. Revuelta, R., Juambelz, P., Balderrama, J., et al. (1995) Contralateral trigeminal neuralgia. A new clinical manifestation of neurocysticercosis: case report. Neurosurgery 37, 138–140. 24. Estañol, B., Kleriga, E., Loyo, M., et al. (1983) Mechanisms of hydrocephalus in cerebral cysticercosis: implications for therapy. Neurosurgery 13, 119–123. 25. Del Brutto, O.H. (1992) Cysticercosis and cerebrovascular disease: a review. Journal of Neurology, Neurosurgery and Psychiatry 55, 252–254. 26. Monteiro, L., Almeida-Pinto, J., Leite, I., et al. (1994) Cerebral cysticercus arteritis: five angiographic cases. Cerebrovascular Disease 4, 125–133. 27. Rodriguez-Carbajal, J., Del Brutto, O.H., Penagos, P., et al. (1989) Occlusion of the middle cerebral artery due to cysticercotic angiitis. Stroke 20, 1095–1099. 28. terPenning, B., Litchmanm, C.D., Heier, L. (1992) Bilateral middle cerebral artery occlusions in neurocysticercosis. Stroke 23, 280–283. 29. Soto-Hernández, J.L., Gomez-Llata, S., Rojas-Echeverri, L.A., et al. (1996) Subarachnoid haemorrhage secondary to a ruptured inflammatory aneurysm: a possible manifestation of neurocysticercosis: case report. Neurosurgery 38, 197–200. 30. Kim, K.S., Weinberg, P.E. (1985) Spinal cysticercosis. Surgical Neurology 24, 80–82. 31. De Souza-Queiroz, L., Filho, A.P., Callegaro, D., et al. (1975) Intramedullary cysticercosis: case report, literature review and comments on pathogenesis. Journal of the Neurological Sciences 26, 61–70. 32. Sperlescu, A., Balbo, R.J., Rossitti, S.L. (1989) Breve comentário sobre a patogenia da cisticercose espinhal. Arquivos de Neuropsiquiatria 47, 105–109. 33. Del Brutto, O.H., Sotelo, J. (1988) Neurocysticercosis: an update. Review of Infectious Diseases 10, 1075–1087. 34. Del Brutto, O.H., Sotelo, J., Román, G.C. (1998) Neurocysticercosis: a Clinical Handbook. Swets & Zeitlingler, Lisse, the Netherlands. 35. Bandres, J.C., White, A.C., Jr, Samo, T., et al. (1992) Extraparenchymal neurocysticercosis: report of five cases and review of management. Clinical Infectious Disease 15, 799–811.

Meningeal Cysticercosis

187

36. Keane, J.R. (1982) Neuro-ophthalmologic signs and symptoms of cysticercosis. Archives of Ophthalmology 100, 1445–1448. 37. Keane, J.R. (1993) Cysticercosis: unusual neuro-ophthalmologic signs. Journal of Clinical Neuro-ophthalmology 13, 194–199. 38. Santoyo, H., Corona, R., Sotelo, J. (1991) Total recovery of visual function after treatment for cerebral cysticercosis. New England Journal of Medicine 324, 1137–1139. 39. Celis, M.A., Mourier, K.L., Polivka, M., et al. (1992) Cysticercose cisternale de l’ángle ponto-cerebellaux. Observatión d’un cas operé et revue de la literature. Neurochirurgie 38, 108–112. 40. Ramina, R., Hunhevicz, S.C. (1986) Cerebral cysticercosis presenting as mass lesions. Surgical Neurology 25, 89–93. 41. Sotelo, J., Guerrero, V., Rubio, F. (1985) Neurocysticercosis: a new classification based on active and inactive forms. Archives of Internal Medicine 145, 442–445. 42. Cantú, C., Barinagarrementeria, F. (1996) Cerebrovascular complications of neurocysticercosis. Clinical and neuroimaging spectrum. Archives of Neurology 53, 233–239. 43. Barinagarrementeria, F., Del Brutto, O.H. (1988) Neurocysticercosis and pure motor hemiparesis. Stroke 19, 1156–1158. 44. Barinagarrementeria, F., Del Brutto, O.H. (1989) Lacunar syndrome due to neurocysticercosis. Archives of Neurology 46, 415–417. 45. McCormick, G.F., Giannotta, S., Zee, C.S., et al. (1983) Carotid occlusion in cysticercosis. Neurology 33, 1078–1080. 46. Levy, A.S., Lillehei, K.O., Rubinstein, D., et al. (1995) Subarachnoid neurocysticercosis with occlusion of the major intracranial arteries: case report. Neurosurgery 36, 183–188. 47. Bang, O.Y., Heo, J.H., Choi, S.A., et al. (1997) Large cerebral infarction during praziquantel therapy in neurocysticercosis. Stroke 28, 211–213. 48. Bonametti, A.M., Baldy, J.L.S., Bortoliero, A.L., et al. (1994) Neurocisticercose com quadro clínico inicial de meningite aguda. Revista do Instituto de Medicina Tropical de São Paulo 36, 27–32. 49. Keane, J.R. (1984) Death from cysticercosis. Seven patients with unrecognized obstructive hydrocephalus. Western Journal of Medicine (San Fransisco) 140, 787–789. 50. Del Brutto, O.H., Santibañez, R., Noboa, C.A., et al. (1992) Epilepsy due to neurocysticercosis: analysis of 203 patients. Neurology 42, 389–392. 51. Carydakis, C., Baulac, M., Laplane, D., et al. (1984) Cysticercose spinale pure. Note sur le liquide céphalorachidien. Revue Neurologique (Paris) 140, 590–593. 52. Malzacher, V.D., Bogumil-Schott, E., Neu, I.S. (1994) Intraspinale manifestation der zystizerkose – Cysticercus racemosus. Nervenarzt 65, 563–567. 53. Kahn, P. (1972) Cysticercosis of the central nervous system with amyotrophic lateral sclerosis: case report and review of the literature. Journal of Neurology, Neurosurgery and Psychiatry 35, 81–87. 54. Hyman, A.D., Gary, C.E., Lanzieri, C., et al. (1986) Tapeworm cysts of the cauda equina. AJNR American Journal of Neuroradiology 7, 977. 55. Rodriguez-Carbajal, J., Arredondo-Estrada, H., Vázquez-Sánchez, H. (1990) La neuroradiología de la neurocisticercosis humana. Revista Mexicana de Radiologia 44, 157–164. 56. Carbajal, J.R., Palacios, E., Azar-Kia, B., et al. (1977) Radiology of cysticercosis of the central nervous system including computed tomography. Radiology 125, 127–131. 57. Bentson, J.R., Wilson, G.H., Helmer, E., et al. (1977) Computed tomography in intracranial cysticercosis. Journal of Computer Assisted Tomography 1, 464–471. 58. Suss, R.A., Maravilla, K.R., Thompson, J. (1986) MR imaging of intracranial cysticercosis: comparison with CT and anatomopathologic features. AJNR American Journal of Neuroradiology 7, 235–242. 59. Martinez, H.R., Rangel-Guerra, R., Elizondo, G., et al. (1989) MR imaging in neurocysticercosis: a study of 56 cases. AJNR American Journal of Neuroradiology 10, 1011–1019. 60. Berman, J.D., Beaver, P.C., Cheever, A.W., et al. (1981) Cysticercus of 60-milliliter volume in human brain. American Journal of Tropical Medicine and Hygiene 30, 616–619. 61. Barinagarrementeria, F., Cantu, C. (1996) Cysticercotic arteritis: frequency in subarachnoid cysticercosis. Neurology 46, A240 (Abstract). 62. Hernández-Gonzalez, L.A., Arredondo-Mendoza, F., Prado-Castro, J.A. (1990) Neurocisticercosis raquimedular en Guatemala. Descripción del signo de ‘lesión quística flotante’. Revista Mexicana de Radiologia 44, 165–169. 63. McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri. review of 127 cases. Archives of Neurology 39, 534–539.

188

O.H. Del Brutto

64. Ramos-Kuri, M., Montoya, R.M., Padilla, A., et al. (1992) Immunodiagnosis of neurocysticercosis. Disappointing performance of serology (enzyme-linked immunosorbent assay) in an unbiased sample of neurological patients. Archives of Neurology 49, 633–636. 65. Rosas, N., Sotelo, J., Nieto, D. (1986) ELISA in the diagnosis of neurocysticercosis. Archives of Neurology 43, 353–356. 66. Richards, F., Jr, Schantz, P.M. (1991) Laboratory diagnosis of cysticercosis. Clinical Laboratory Medicine 11, 1011–1028. 67. Wang, C.Y., Zhang, H.H., Ge, L.Y. (1992) A Mab-based ELISA for detecting circulating antigen in CSF of patients with neurocysticercosis. Hybridoma 11, 825–827. 68. Garcia, H.H., Harrison, L.J.S., Parkhouse, R.M.E., et al. (1998) A specific antigen-detection ELISA for the diagnosis of human neurocysticercosis. Transactions of the Royal Society of Tropical Medicine and Hygiene 92, 411–414. 69. Del Brutto, O.H., Sotelo, J., Román, G.C. (1993) Therapy for neurocysticercosis: a reappraisal. Clinical Infectious Diseases 17, 730–735. 70. White, A.C., Jr (2000) Neurocysticercosis. Current Treatment of Infectious Diseases 2, 78–87. 71. Jung, H., Hurtado, M., Sanchez, M., et al. (1990) Plasma and CSF levels of albendazole and praziquantel in patients with neurocysticercosis. Clinical Neuropharmacology 13, 559–564. 72. Del Brutto, O.H., Sotelo, J., Aguirre, R., et al. (1992) Albendazole therapy for giant subarachnoid cysticerci. Archives of Neurology 49, 535–538. 73. Del Brutto, O.H. (1997) Albendazole therapy for subarachnoid cysticerci: clinical and neuroimaging analysis of 17 patients. Journal of Neurology, Neurosurgery and Psychiatry 62, 659–661. 74. Castellanos, F., Montes, I., Porras, L.F., et al. (2000) Quistes subaracnoideos gigantes por neurocisticercosis: a propósito de dos casos observados en un área rural de Extremadura. Revue Neurologique (Paris) 30, 433–435. 75. Del Brutto, O.H. (1997) Clues to prevent cerebrovascular hazards of cysticidal drug therapy. Stroke 28, 1088. 76. Sotelo, J., Marin, C. (1987) Hydrocephalus secondary to cysticercotic arachnoiditis. A long-term follow-up review of 92 cases. Journal of Neurosurgery 66, 686–689. 77. Roman, R.A.S., Soto-Hernández, J.L., Sotelo, J. (1996) Effects of prednisone on ventriculoperitoneal shunt function in hydrocephalus secondary to cysticercosis: a preliminary study. Journal of Neurosurgery 84, 629–633. 78. Sotelo, J. (1993) A new ventriculoperitoneal shunt for treatment of hydrocephalus. Experimental results. RBM European Journal of Biomedical Technology 15, 257–262. 79. Rubalcava, M.A., Sotelo, J. (1995) Differences between ventricular and lumbar cerebrospinal fluid in hydrocephalus secondary to cysticercosis. Neurosurgery 37, 668–672. 80. Sotelo, J., Rubalcava, M.A., Gomez-Llata, S. (1995) A new shunt for hydrocephalus that relies on CSF production rather than on ventricular pressure: initial clinical experiences. Surgical Neurology 43, 324–332. 81. Sotelo, J. (1996) Update: the new ventriculoperitoneal shunt at the Institute of Neurology of Mexico. Surgical Neurology 46, 19–20.

19

Heavy Multilesional Cysticercotic Syndromes

Oscar H. Del Brutto, Hector H. García and Sudesh Prabhakar

Introduction Most individuals with neurocysticercosis (NC) have one or a few cysts in the brain, constituting what is appreciated as the benign end of the clinical spectrum of the disorder1–3. However, among the wide spectrum of infection and clinical manifestations of human Taenia solium cysticercosis, a small subset of individuals harbour massive infections and develop clinical manifestations related to it1–4. Clinical presentations vary even within this subset. We will review separately the more defined presentations of heavy infections in human cysticercosis, according to Table 19.1.

Cysticercotic Encephalitis Characteristics This syndrome of intracranial hypertension associated with multiple parenchymal cys-

ticerci of homogeneously small size (Fig. 19.1) was first described by Stepien and Chorobsky, in 19495, and was re-visited after the introduction of computed tomography (CT) scanning by Rangel et al. in 19876. Its clinical manifestations are related to severe intracranial hypertension due to the inflammatory reaction around several dying cysticerci. There probably is a booster effect caused by the simultaneous degeneration of many parasites at the same time. Some authors have attributed this syndrome to the phase of brain invasion by the embryos. Although the latter theory cannot be discarded, it does not account for the long duration of symptoms (several months) in most cases reported6. Moreover, the development of cystic parasite vesicles has been shown to take only a few weeks in experimental infection in pigs. The severity of the clinical picture will depend on the number of the parasites and the degree of inflammation and can be severe enough to be fatal.

Table 19.1. Principal neurocysticercosis (NC) syndromes characterized by heavy infestations. Syndrome

Localization

Characteristics

Cysticercotic encephalitis

Brain parenchyma

Heavy non-encephalitic NC

Brain parenchyma

Disseminated cysticercosis

Anywhere in the body

Severe inflammation with intracranial hypertension Massive brain infection with minimal inflammatory response Involvement of several organs

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

189

190

O.H. Del Brutto et al.

between white and grey matter. Upon contrast-enhanced CT, multiple small ring/disc lesions are noted. In the past, several authors have described CT appearances of diffuse brain oedema without any identifiable cystic lesions, giving rise to a consideration of benign intracranial hypertension9,10. This was often seen with older generation CT scans; however, with more contemporary CT infrastructure and magnetic resonance imaging (MRI), the cysticercal aetiology cannot be missed.

Therapy and outcome

Fig. 19.1. Post-gadolinum T1 weighted coronal MRI demonstrating cysticercotic encephalitis.

Clinical manifestations Cysticercotic encephalitis seems to occur more frequently in females and at younger ages, and has also been described in series of paediatric NC7,8. Seven of the eight patients in the series described by Rangel et al. were females, 10–27 years of age6. Symptoms were noted for a maximum of 18 months (mean: 6 months) before diagnosis. Presenting symptoms include headaches that intensify rapidly prior to diagnosis and seizures6. Among the clinical signs, those due to intracranial hypertension including papilloedema often leading on to secondary optic atrophy, false localizing third and sixth cranial nerve palsies, deep tendon hyperreflexia and Babinski’s responses are noteworthy6.

The mainstay of medical treatment is the use of corticosteroids to control the inflammatory reaction11. Dexamethasone has been reported to achieve this successfully, although required doses may be as high as 32 mg day−1. Furosemide, glycerol and osmotic agents are useful adjuncts. On occasion, resort to decompressive craniotomy or craniectomy may be undertaken in order to control intracranial hypertension that threatens vision or life. The use of anticysticercal agents, either albendazole or praziquantel, is contraindicated since they may lead to more degeneration of parasites and worsen the intracranial hypertension. A number of affected individuals for whom follow-up is available required readmission for management of intracranial hypertension6,7. At times, the latter may prove fatal. Other important sequelae of cysticercotic encephalitis include loss of vision and neuropsychiatric impairment.

Heavy Non-encephalitic NC Characteristics

Imaging Computed tomography discloses multiple or confluent hypodense areas representing intense brain oedema6,9. The presence and severity of the oedema can be appreciated from the effacement of sulci, reduced ventricular size and loss of differentiation

Two of the authors (OHD and HHG) have recently described a different syndrome with multiple cerebral parenchymal cysticerci of homogeneously small size (Fig. 19.2). This condition called heavy non-encephalitic NC differs from cysticercotic encephalitis in that no inflammatory reaction can be seen around the cysts, i.e. all parasites are viable and,

Heavy Multilesional Cysticercotic Syndromes

191

our series at the time of diagnosis of NC12. Whether the presence of an intestinal tapeworm, besides being a close source of infection, relates to the mild symptomatic expression of this syndrome has not been determined12,13.

Imaging features Several hundred non-enhancing homogeneously sized, viable cysts are noted throughout the brain parenchyma upon CT and MRI (Fig. 19.2). A scolex is demonstrable in the majority of the cysts.

Therapy

Fig. 19.2. T1 weighted axial MRI showing heavy non-encephalitic neurocysticercosis.

therefore, do not enhance with contrast upon CT/MRI12. It also differs from disseminated cysticercosis, described in the following section, by comparatively fewer parasitic numbers and absence of overwhelming involvement of the muscle and subcutaneous tissue. As a rough rule, there are a few hundred live parasites in heavy nonencephalitic NC, while the number in disseminated cysticercosis is in thousands.

Clinical manifestations There is no clear predominance of this syndrome by sex and the condition seems to occur more frequently during the third or fourth decades of life. Its clinical manifestations are mild. Patients present with seizures, and subtle neuropsychological abnormalities. Features of intracranial hypertension are absent or mild in most patients. Involvement of other parts of the body is frequent but not predominant. Interestingly, intestinal tapeworms were detected in up to 90% of the individuals in

Adequate control of seizures with antiepileptic drugs (AEDs) is mandatory, as in other varieties of NC with seizures. Since it is expected that most cysts will leave residual calcifications and thus predispose to seizure relapse in the future, the use of AED/s will probably be required for the life of the patients. Available options in specific therapy include the use of anticysticercal drugs or inactive observation allowing the parasites to go through natural involution and then control inflammation with long-term corticosteroid therapy. The use of anticysticercal drugs in heavy non-encephalitic cysticercosis has been demonstrated to be effective in destroying the cysts but may lead to severe side effects at the time of death of the cysts. Often, more than one course of anticysticercal therapy is required12,14. Observational clinical and pharmacological data suggest that the action of albendazole is less abrupt than that of praziquantel; therefore we suggest the former at first election. In this case, simultaneous use of corticosteroids (dexamethasone, 0.1 mg kg−1 day−1 and increasing doses according to the clinical condition) is mandatory. If anticysticercal drugs are not used, then serial imaging evaluations should be performed at least once every year, and the use of depot corticosteroids is suggested to avoid sequelae of parasite involution.

192

O.H. Del Brutto et al.

Disseminated Cysticercosis Characteristics The term, ‘disseminated cysticercosis’ was coined by Priest in 1926 to refer to the presence of a plethora of cysticerci in multiple locations in the same patient15. The locations include the subcutaneous tissue, muscles, eye, brain and heart15–17. Sporadic descriptions of this condition have appeared mainly in literature published from India and China14,18–33. The number of reported cases since then have been few by all standards and apart from a few exceptions have emanated from India. We studied clinical and laboratory features in 18 cases that have been reported in the English literature14,19–30,33. Two important phenomena contribute to the unique symptom complex of disseminated cysticercosis. One is the sheer number of live cysticerci. The second is the absence of a host inflammatory response to cysticerci. Factors responsible for the massive cyst load and the absence of an inflammatory response are not known. Unlike the recent description of the association between heavy nonencephalitic parenchymal cysticercosis and intestinal taeniasis, none of the reports of disseminated cysticercosis mention an association with intestinal taeniais based on faecal evaluations or recent or remote history of intestinal taeniasis12. A good number of reported subjects ate pork, but the condition has been reported in vegetarians as well, suggesting that it was not necessary to harbour adult worms in order to develop massive dissemination25,26.

nodules and muscle pains were the first symptoms14,15,20–22,29,33. Muscular pseudohypertrophy followed these initial symptoms by a few weeks to 1 year. The onset of muscular pseudohypertrophy is often marked by a transient febrile illness and skin rash14,22,25,29. Two patients reported by Wadia et al., developed skin rash after the administration of praziquantel14. Muscle pain and tightness are important symptoms but may not be forthcoming in certain patients because of associated cognitive impairment.

Clinical manifestations Disseminated cysticercosis typically presents in young age (mean ±SD of reviewed cases: 22 ±10 years; range: 9–45 years). Among reported cases, males were twice as commonly affected as females. Muscular pseudohypertrophy (Fig. 19.3) was the presenting complaint in eight reported cases19,21,24,27,29. In the remaining reports, seizures, dementia, subcutaneous

Fig. 19.3. Muscular pseudohypertrophy due to disseminated cysticercosis. (Reproduced with permission from reference 27.)

Heavy Multilesional Cysticercotic Syndromes

Muscular pseudohypertrophy is noticeable in the calves, thighs, arms, glutei, trapezius, nuchal muscles and masseters. Usually, there is smooth enlargement of muscles, but a few authors have described nodularity20,22. Pseudohypertrophy often assumes Herculean proportions. MacRobert’s description of a man ‘who went to hospital because of gross alteration in his physical appearance, which had come to resemble that of a professional wrestler to the amusement of his friend and dismay of his household’ is apt in this regard23. Cysticercal muscular pseudohypertrophy is easily distinguished from other more common causes of pseudohypertrophy like Duchenne’s and Becker’s muscular dystrophy by the short history, age of onset and associated central nervous system symptoms. Muscles may rarely be tender on palpation though commonly there is no tenderness20–23. Muscular weakness is mild and never profound. In certain cases, it may not be possible to detect and quantify weakness on account of impaired cognitive status14. Jolly and Pallis stressed the absence of muscular weakness in their patients, all of whom had significant dementia21. Rao et al. described a patient with muscular pseudohypertrophy with no detectable weakness or central nervous system involvement25. Deep tendon reflexes may be absent, normal or even brisk22,25,28. It is worthwhile to stress here that muscular involvement, though common, is rarely symptomatic (except in pseudohypertrophic myopathy) in cysticercosis. In the past, muscular involvement was detected when plain radiographs were performed either for diagnostic purposes or because of unrelated medical conditions34–37. In a wellknown series of 450 British soldiers returning from India, over 70% were diagnosed as having muscle calcifications sometime during their follow-up38. This can not be interpreted as a usual frequency, however, since many of these cases were diagnosed by this finding and thus there was a strong selection bias in the series34–37. The obviously more noticeable clinical manifestations of disseminated cysticercosis arise from cerebral and ocular involvement, and subcutaneous cysticerci that are easily

193

identified at physical examination when present. A helpful tool is to ask the patient about noticing the nodules. It should be noted here that subcutaneous cysticerci are more frequently reported in Asia than in Latin America despite similar endemicity of disease38. Subcutaneous cysticercosis is invariably associated with muscle involvement. Ocular cysts may be noted by careful examination14,15,20,21. Dementia and behavioural disturbances have been reported in approximately 50% of the reviewed cases14,20–22,29. Strangely, despite the massive infestation of the brain, focal neurological deficits and intracranial hypertension are rare22,29.

Laboratory investigations Soft-tissue calcifications are lacking in the majority of cases but a few authors have reported diminutive spotty calcifications in limb radiographs of individuals with disseminated cysticercosis. Most reports have not alluded to the status of muscle enzymes in this condition. Wadia et al. categorically described normal serum creatine kinase levels in two of their patients with pseudohypertrophy14. Electromyographic sampling of muscle was unremarkable in two cases and showed features of an inflammatory myopathy in one case described by the authors. Eosinophilia is an important supporting feature in the laboratory diagnosis of this condition. CT of the brain has been performed in only the most recently reported cases14. A unifying feature is the presence of a plethora of live, not calcified cysts throughout the cerebral parenchyma (Fig. 19.4a). Wadia et al. analysed the CT appearance of muscle infested by cysticerci and described profuse infestation by large numbers giving rise to a honeycomb appearance (Fig. 19.4b)14. Cysts in the muscle were larger than those in the brain and scolices were more difficult to identify. Cysticercal invasion of the muscle has been demonstrated histologically in all reported patients except one. Cysts are alive, 3–30 mm in size, and have scolices without calcification. Jolly and Pallis stressed the

194

O.H. Del Brutto et al.

Therapy and outcome

Fig. 19.4. CT scan of the brain (a) and muscle (b) of a patient with disseminated cysticercosis. (Source: Noshir H. Wadia, Mumbai, India.)

observation of tense cysts, implying early degeneration during involution of cysticerci21. Microscopically, all features of cysticercus cellulosae can be identified, including calcareal corpuscles and the canalicular system. The cysts are surrounded by an inflammatory infiltrate of round cells. Inflammatory as well as necrotic changes in the muscle have been exceptionally noted25,29. More typically, the muscle is histologically normal.

The majority of published reports do not describe follow-up. A limited follow-up of one case described by McGill revealed persisting pseudohypertrophy for at least 19 months22. It would be interesting to speculate that the radiological picture of multiple profuse soft-tissue calcifications is a sequel to cysticercal infestation in muscular pseudohypertrophy. However, no case of cysticercal muscular pseudohypertrophy has been followed up to the point of calcification. A more realistic description of overall outcome is death due the effects of cysticercal infestation at other sites, particularly the brain14. One of the patients reported by Wadia et al. died of status epilepticus within 5 months of presentation. Another died after the institution of praziquantel therapy and a third had a sudden death 2 months after presentation. The cause of death in the third patient is not clear, but it may be interesting to speculate an anaphylactic reaction due to massive release of cysticercal antigens from degenerating cysts as the cause of death. Wadia et al. treated their patients with disseminated cysticercosis with praziquantel and noted an adverse prognosis. Muscle girth initially increased with praziquantel treatment but ultimately resolved in two patients. The third patient died very soon after the institution of anticysticercal therapy. In contrast with the adverse results of praziquantel administration noted by Wadia et al. several Chinese authors have reported improved outcome with treatment31,32. It is imperative that orbital cysticercosis (ocular or extraocular cysts) should be carefully searched for in all cases of disseminated cysticercosis. The reason for this is that cyst/s in these locations may damage visual function if treated inadvertently. Up till now, the treatment of choice for ocular cysticercosis has been surgical excision with vitrectomy, although there are recent reports of using albendazole along with local corticosteroid injections (see Chapter 28). Targeting NC is the next therapeutic priority; these patients should be approached as described above for non-encephalitic NC. The use of symptomatic treatment including AEDs; an

Heavy Multilesional Cysticercotic Syndromes

individualized decision on the use of anticysticercal drugs; adequate supportive measures when using them; maintenance of imaging surveillance; and long-term corticosteroid therapy if anticysticercal agents are not prescribed, are all important aspects of the treatment plan. Subcutaneous and muscular cysticercosis do not require specific therapy unless mass effects due to cyst clumps occur. In these cases, either surgical excision or anticysticercal therapy is effective (again, after first ruling out the possibility of ocular or cerebral cysticercosis).

Comment Evidence from animal studies (Gonzalez et al., unpublished data, 2001) and data on softtissue roentgenograms from older series of cysticercosis suggest that almost all human cases of NC are disseminated to an extent. This dissemination, however, does not cause discernible manifestations because infection is controlled by the host immunity in sites other than the brain39. If this is the case, the heavy infections described hitherto imply that either the host’s immune system is illprepared to counteract tissue infection, or that the infecting parasite load was large enough to overcome the host’s ability to destroy cysts. Although the diagnosis of cysticercosis in these cases will easily fulfil the recommended criteria for NC40, identification of specific syndromes is necessary for sound and appropriate therapy. Since only a few reports of each syndrome are available, some degree of overlap between them does occur. In any case, one or more of these syndromes can be clearly identified when a patient presents with massive infection. All these forms

195

result from either a massive load of T. solium eggs, or a continued source of infection, and the degree of inflammation, closely correlated to the clinical expression, is probably dependent on the previous exposure of the host immune system to T. solium antigens41,42.

Conclusions Three major clinical syndromes with heavy, multilesional cysticercosis have been described. The first, cysticercotic encephalitis, is characterized by a profuse inflammatory response to several degenerating cysticerci in the cerebral parenchyma, giving rise to cerebral oedema and intracranial hypertension. In the second condition, known as ‘heavy nonencephalitic NC’, there are hundreds of live, active and viable cysts throughout the brain parenchyma with no surrounding oedema. The condition, which is not catastrophic like cysticercotic encephalitis, manifests with intracranial hypertension and neuropsychiatric features. The third form, i.e. ‘disseminated cysticercosis’, implies the existence of cysticerci, again live, in still larger numbers, probably thousands, throughout the brain, muscles, skin and eyes. The latter presents with muscular pseudohypertrophy in addition to dementia and other neuropsychiatric disturbances. The clinical behaviour and imaging characteristics of the three syndromes differ; however, a uniting feature is the proclivity of anticysticercal therapy to cause serious, often life-threatening adverse effects due to massive inflammatory oedema and intracranial hypertension that may follow death of the cysticerci. Therefore, extreme caution is to be exercised if resort to anticysticercal therapy is sought.

References 1. Del Brutto, O.H., Sotelo, J., Román, G.C. (1997) Neurocysticercosis. A Clinical Handbook. Swets and Zeiliger, Lisse, the Netherlands, pp. 207. 2. García, H.H., Martinez, S.M. (1999) Taenia solium Taeniasis/Cysticercosis, 2nd edn. Editorial Universo, Lima, Peru, pp. 346. 3. Garcia, H.H., Del Brutto, O.H. (2000) T. solium taeniasis/cysticercosis. Infectious Diseases Clinics of North America 14, 97–120. 4. Bern, C., García, H.H., Evans, C., et al. (1999) Magnitude of the disease burden from neurocysticercosis in a developing country. Clinical Infectious Diseases 29, 1203–1209.

196

O.H. Del Brutto et al.

5. Stepien, L., Chorobsky, J. (1949) Cysticercosis cerebri and its operative treatment. Archives of Neurology and Psychiatry (Chicago) 61, 499–527. 6. Rangel, R., Torres, B., Del Brutto, O., et al. (1987) Cysticercotic encephalitis: a severe form in young females. American Journal of Tropical Medicine and Hygiene 36, 387–392. 7. Del Brutto, O.H., Garcia, E., Talamas, O., et al. (1988) Sex-related severity of inflammation in parenchymal brain cysticercosis. Archives of Internal Medicine 148, 544–547. 8. Lopez-Hernandez, A., Garayzar, C. (1982) Analysis of 89 cases of infantile cerebral cysticercosis. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 127–138. 9. Sharma, K., Gupta, R.K. (1993) Scan negative neurocysticercosis. Pediatric Neurosurgery 19, 206–208. 10. Agapejev, S., Yela, D.A., Gomes, A.E. (1998) Edema cerebral crônico na neurocisticercose. Arquivios de Neuropsiquiatria 56, 569–576. 11. Del Brutto, O.H., Sotelo, J., Roman, G.C. (1993) Therapy for neurocysticerosis: a reappraisal. Clinical Infectious Diseases 17, 730–735. 12. García, H.H., Del Brutto, O.H., and The Cysticercosis Working Group in Perú (1999) Heavy nonencephalitic cerebral cysticercosis in tapeworm carriers. Neurology 53, 1582–1584. 13. Gilman, R.H., Del Brutto, O.H., García, H.H., et al. (2000) Prevalence of taeniosis among neurocysticercosis patients is related to the severity of cerebral infection. Neurology 55, 1062. 14. Wadia, N., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis. New observations, including CT scan findings and experience with treatment with praziquantel. Brain 111, 597–614. 15. Priest, R. (1926) A case of extensive somatic dissemination of Cysticercus cellulosae in man. British Medical Journal ii, 471–472. 16. Cheung, Y.Y., Steinbaum, S., Yuh, W.T., et al. (1987) MR findings in extracranial cysticercosis. Journal of Computed Assisted Tomography 11, 179–181. 17. Mandal, D.K., Banerjee, S., Ghosh, A., et al. (1989) Neurocysticercosis with rare presentations. Journal of the Indian Medical Association 87, 142–144. 18. Krishnaswami, C.S. (1912) Case of Cysticercus cellulosae. Indian Medical Gazette 47, 43–44. 19. Armbrust-Figueiredo, J., Speciali, J.G., Lison, M.P. (1970) Forma myopatica da cysticercose. Arquivos de Neuropsiquitria 28, 385–390. 20. Jacob, J.C., Mathew, N.T. (1968) Pseudohypertrophic myopathy in cysticercosis. Neurology 18, 767–771. 21. Jolly, S.S., Pallis, C. (1971) Muscular pseudohypertrophy due to cysticercosis. Journal of Neurological Sciences 12, 155–162. 22. McGill, R.J. (1948) Cysticercosis resembling myopathy. Lancet ii, 728–730. 23. MacRobert, G.R. (1944) Somatic taeniasis (Solium cysticercosis). Indian Medical Gazette 79, 399–400. 24. Prakash, C., Kumar, A. (1965) Cysticercosis with taeniasis in a vegetarian. Journal of Tropical Medicine and Hygiene 68, 100–103. 25. Rao, C.M., Sattar, S.A., Gopal, P.S., et al. (1972) Cysticercosis resembling myopathy: report of a case. Indian Journal of Medical Sciences 26, 841–843. 26. Salgaokar, S.V., Watcha, M.F. (1974) Muscular hypertrophy in cysticercosis: a case report. Journal of Postgraduate Medicine, Bombay, India 20, 148–152. 27. Sawhney, B.B., Chopra, J.S., Banerji, A.K., et al. (1976) Pseudohypertrophic myopathy in cysticercosis. Neurology 26, 270–272. 28. Singh, A., Jolly, S.S. (1957) Cysticercosis: case report. Indian Journal of Medical Sciences 11, 98–101. 29. Vigg, B., Rai, V. (1975) Muscular involvement in cysticercosis with pseudohypertrophy of muscles. Journal of the Association of Physicians of India 23, 593–595. 30. Vijayan, G.P., Venkatraman, S., Suri, M.L., et al. (1977) Neurological and related manifestation of cysticercosis. Tropical and Geographical Medicine 29, 271–278. 31. Zhu, D., Xu, W. (1983) Effect of biltricide on cysticercosis cellulosae with muscular psuedohypertrophy: a report of three cases. Chi Sheng Chung Hsueh Yu Chi Sheng Chung Ping Tsa Chih 1, 185–186. 32. Xu, Z., Chen, W., Zong, H., et al. (1985) Praziquantel in treatment of cysticercosis cellulosae. Report of 200 cases. Chinese Medical Journal 98, 489–494. 33. Takayanagui, O.M., Chimelli, L. (1998) Disseminated muscular cysticercosis with myositis induced by praziquantel therapy. American Journal of Tropical Medicine and Hygiene 59, 1002–1003. 34. Cruz, I., Cruz, M.E., Teran, W., et al. (1994) Human subcutaneous Taenia solium cysticercosis, in an Andean population with neurocysticercosis. American Journal of Tropical Medicine and Hygiene 51, 405–407.

Heavy Multilesional Cysticercotic Syndromes

197

35. McArthur, W.P. (1934) Cysticercosis as seen in the British army with special reference to the production of epilepsy. Transactions of the Royal Society of Tropical Medicine and Hygiene 27, 343–363. 36. Dixon, H.B.F., Smithers, D.W. (1934) Epilepsy in cysticercosis (Taenia solium). A study of seventy-one cases. Quarterly Journal of Medicine 3, 603–616. 37. Dixon, H.B.F., Hargreaves, W.H. (1944) Cysticercosis (Taenia solium): a further ten years’ clinical study, covering 284 cases. Quarterly Journal of Medicine 13, 107–121. 38. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an analysis and follow up of 450 cases. Medical Research Council Special Report. Series No. 299. Her Majesty’s Stationery Office, London, pp. 1–58. 39. Garcia, H.H., Gonzalez, A.E., Gilman, R.H., et al. (2001) Transient antibody response in Taenia solium infection in field conditions: a major contributor to high seroprevalence. American Journal of Tropical Medicine and Hygiene 65, 31–32. 40. Del Brutto, O.H., Rajshekhar, V., White, A.C., et al. (2001) Proposed diagnostic criteria for neurocysticercosis. Neurology 57, 177–183. 41. Gonzalez, A.E., Gavidia, C., Falcon, N., et al. (2001) Protection of pigs with cysticercosis from further infections after treatment with oxfendazole. American Journal of Tropical Medicine and Hygiene 65, 15–18. 42. Evans, C.A.W., Gonzalez, A.E., Gilman, R.H., et al. (1997) Immunotherapy for porcine cysticercosis: Implications for prevention of human disease. American Journal of Tropical Medicine and Hygiene 56, 33–37.

20

Intraventricular Neurocysticercosis Albert C. Cuetter and Russell J. Andrews

Introduction Intraventricular neurocysticercosis (IVNC) is the presence of tapeworm cysts inside the cerebral ventricular system. IVNC commonly results in intraventricular obstruction, increased intracranial pressure (ICP), meningoencephalitis and ventriculitis. IVNC is a serious condition with an obscure natural history, and in many cases, a poor prognosis. About 30% of patients with NC have intraventricular cysts1,2. In the ventricular system cysts are firmly encapsulated, either float freely throughout the cerebrospinal fluid (CSF) pathways, or are attached to the ependyma, anywhere in the ventricles but with predilection for the occipital horn of the lateral ventricle and the fourth ventricle3. Intraventricular cysts can be single or multiple. Many patients with cysts in the lateral ventricles have multiple parenchymal and subarachnoid cysts2,4. Therefore, most of the patients with intraventricular cysts suffer from seizures before they develop hydrocephalic symptoms4. The larvae prefer to lodge in the well-irrigated parenchyma, and the ventricles are used as a lodging site when the parenchyma is filled. However, a cyst in the fourth ventricle tends to be a solitary mass, without accompanying parenchymal

cysts5,6. Approximately 30% of all patients with NC develop hydrocephalus due to CSF flow obstruction by the cysts either inside the ventricles or in the subarachnoid space7.

Clinical Features The classification of Carpio et al., of neurocysticercosis (NC) into active (vesicular, viable), inflammatory (involutional, transitional, colloidal), and inactive lesions is descriptive and convenient8. Intraventricular cysts have a more aggressive behaviour than parenchymal cysts. The symptoms in parenchymal cysticercosis largely result from the host inflammatory response to the dead or dying larva with irritation and oedema of the brain and the occurrence of epileptic seizures. However, intraventricular cysts may become symptomatic at the time of implantation due to obstruction of the CSF flow, with consequent hydrocephalus and symptoms, signs, and consequences of increased ICP. As the process of involution begins, the inflammatory reaction around a dead or dying cyst produces ependymitis, scarring, obstruction and ventriculitis. The secondary symptomatology of coexisting parenchymal involutional cysts may lead to discovery of asymptomatic intraven-

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

199

200

A.C. Cuetter and R.J. Andrews

tricular cysts with or without hydrocephalus. Thus, there are patients presenting with seizures due to parenchymal involutional cysts who also have asymptomatic intraventricular cysts (Fig. 20.1).

Symptoms mainly due to obstruction of the CSF flow Intraventricular cysts may totally obstruct the CSF flow. This obstruction can be abrupt or gradual. Cysts moving freely within the ventricular system may lodge in one of the vital communication passages of the ventricular system with intermittent or permanent blockade of CSF flow4. Abrupt obstruction Abrupt obstruction of the ventricular system results in acute hydrocephalus with symptoms and signs such as headache, diplopia, dizziness, vomiting, restlessness, drowsiness, respiratory changes, bradycardia, ele-

vation of arterial blood pressure, seizures, and alteration of consciousness. Abrupt intermittent obstruction of the intraventricular CSF flow by the cyst produces abnormalities lasting hours to days. Sudden changes of head position may change the location of the cyst and trigger or alleviate the headaches4,9. Also, sudden change of head position may produce fleeting loss of strength or muscle tone9. These drop attacks may be due to associated sudden bilateral ischaemic changes in brainstem. Abrupt permanent obstruction leads to acute hydrocephalus with stupor, coma, and death from brain herniation4,9–12. Obstruction may occur in the foramen of Monro, third ventricle, aqueduct of Sylvius, or fourth ventricle11. Any obstructing cyst located in the ventricles results in a non-communicating hydrocephalus that requires prompt therapeutic intervention to prevent brain herniation. In the fourth ventricle, direct compression of the brainstem and midcerebellar structures produces, in addition to symptoms of increased ICP, focal deficits due to local mass

Fig. 20.1. Axial T1-weighted post-contrast MRI shows multiple parenchymal cysts and an intraventricular cyst in the occipital horn of the right lateral ventricle. This 32-year-old man presented with seizures. The hydrocephalus had not yet produced symptoms.

Intraventricular Neurocysticercosis

effects, such as gait ataxia, dysmetria and diplopia13,14. In children, this clinical presentation may suggest the presence of a midline cerebellar tumour. A superior aqueductal syndrome is seen in patients with blockade of the aqueduct of Sylvius. These patients have paralysis of vertical gaze as well as other symptoms and signs of increased ICP15. Chronic obstruction Most cases present with insidious, gradual onset of increased ICP4. The obstruction of the CSF circulation may be due to the presence of a large cyst in the ventricular cavities, particularly in the fourth ventricle. Symptoms include headaches, nausea, vomiting, somnolence, memory and behavioral changes, and gait disturbance for several months before presentation4,5,9,12. The neurological examination may reveal decreased alertness, papilloedema, and focal motor neurological deficits, including corticospinal tract signs and frontal lobe motor apraxia. The latter is due to extensive bilateral lesions of long motor tracts originating from the frontal lobes by the enlarging lateral ventricles. Also, ventricular expansion is maximal in the frontal horns with consequent impairment of frontal lobe functions. If not treated, these patients can decompensate and deteriorate abruptly9.

Symptoms due to both obstruction of CSF flow and inflammation Most people who die from chronic complications belong to this category. When the larva in the cyst dies, the involutional process and inflammation turn an asymptomatic intraventricular cyst into a symptomatic one. The involutional cyst liberates antigenic substances that generate an inflammatory reaction throughout the ventricular system, and a severe localized reaction of granular ependymitis that fixes the cyst capsule to the ventricular wall with strong adhesions and fibrosis that may produce irreversible blockade of the CSF circulation. The fourth ventricle is frequently affected. The result is progressive hydrocephalus, increased ICP, and poor response to

201

medical and surgical treatment1,16. Fixed cysts are not susceptible to surgical removal without damage to brain tissue1,7. Patients present with a picture of increased ICP, meningoencephalitis (fever, alteration of consciousness and nuchal rigidity), focal neurological deficit and inflammatory reaction in the CSF7,17. A final clinical stage includes mental deterioration, blindness, quadriparesis, and ataxia, despite appropriate treatment17. There are many complications contributing to clinical deterioration, including cerebral and brainstem infarcts due to angiitis, hypothalamic dysfunction, infections, repeated shunt failure, and progression of the disease with arachnoiditis, ependymitis, ventriculitis and irreversible tissue damage. Inflammatory cysts in the fourth ventricle pose a difficult problem because there is associated widespread granular ependymitis and ventriculitis. This leads to ventricular enlargement that may persist even after a ventriculoperitoneal shunt (VPS) is placed for the relief of the hydrocephalus7. Although there may be single or multiple involutional cysts in the fourth ventricle, in many cases there are no cysts detected by neuroimaging or found during surgery.

Communicating hydrocephalus from basilar arachnoiditis and leptomeningeal scarring This type of basilar meningeal cysticercosis is discussed in Chapter 18.

Radiological and Laboratory Diagnosis The criteria for the diagnosis of IVNC are based on clinical presentation, magnetic resonance imaging (MRI) evidence of cystic lesions containing the scolex, and histological demonstration of the parasite from the brain lesions or from the CSF. Since the clinical presentation of IVNC is by no means specific, it is important to review the clinical history, laboratory findings and imaging studies to arrive at a correct diagnosis.

202

A.C. Cuetter and R.J. Andrews

Computed tomography (CT) Small cysts that do not deform the ventricles are not visualized upon CT because: (i) they have the same density as the CSF; (ii) the wall of the cyst, and the scolex are not visible18,19; and (iii) the cyst does not show contrast enhancement20. In the absence of hydrocephalus, a large intraventricular cyst may be visualized on CT scan if it deforms the ventricle and the cyst mass is outlined by the normal ventricular cavity. A cyst deforming or enlarging the fourth ventricle is well visualized on CT. If the cyst is in the inflammatory stage, there may be oedema of the adjacent tissues. A CT scan may also show calcified inactive parenchymal lesions. The finding of cysts in different stages of evolution, including calcifications, and the presence of hydrocephalus on CT, even if the obstructing cysts are not visualized, helps in the diagnosis.

ment with surrounding oedema similar to inflammatory parenchymal cysts (Fig. 20.2b)19. Differentiation of such a ring-like enhancing lesion from neoplastic processes or other inflammatory processes may be difficult based on imaging findings only19. Obstructing cysts and consequent hydrocephalus are well demonstrated on MRI. Sometimes, there is hydrocephalus and other MRI findings of NC, but no cysts are seen in the ventricles. In some of these cases the enlargement of the ventricles may be a result of ependymitis, scarring, or meningeal involvement. A cyst in the third ventricle or the foramen of Monro gives rise to enlargement of the lateral ventricles, sometimes unilateral only. Cysts in the fourth ventricle produce significant hydrocephalus and usually are not accompanied by parenchymal cysts19.

Immunodiagnosis Magnetic resonance imaging (MRI) MRI readily visualizes intraventricular cysts in about 80% of the cases21. On T1-weighted imaging and fluid attenuation inversion recovery (FLAIR) imaging (Fig. 20.2c), a viable, active intraventricular cyst appears as a spherical lesion of 10–20 mm in diameter, often with the scolex visualized as a mural nodule that has the hyperintensity of fat tissue. Evidence of cystic lesions containing the scolex is one of the absolute criteria for diagnosis22. The cyst wall is a thin hyperintensity outlined between the darkness of the cyst content and the ventricular CSF. On T2weighted imaging, the inside of the cyst is isointense with the surrounding tissues, and the scolex is hyperintense. Ring-like or nodular enhancement has been correlated with the presence of granular ependymitis that accompanies inflammatory, involutional cysts. T1-weighted imaging without gadolinium shows the inflammatory features of an involutional cyst: (i) hyperintense cyst wall; (ii) hyperintense scolex; and (iii) oedema around the cyst (Fig. 20.2a–c). On T1-weighted images with gadolinium, inflammatory cysts have a ring-like enhance-

Over 80% of patients with intraventricular inflammatory lesions have positive enzymelinked immunoelectrotransfer blot (EITB) in serum and CSF. Antibodies are detectable as frequently in serum as in CSF, regardless of the number or apparent condition of the cysts23. Recent data shows that ELISA in serum does not perform well with this disease and has a high rate of both false-positive and false-negative results24. A negative result does not exclude NC; a positive result is not specific for NC, especially in groups with high exposure.

CSF examination Lumbar puncture is contraindicated in patients with increased ICP. In these cases the CSF may be obtained through a ventriculostomy. CSF abnormalities are directly proportional to the degree of local inflammation and ventriculitis. The CSF examination may show no cells, and normal protein and glucose in about half the number of cases9. The other half of patients have a moderate degree of mixed pleocytosis, increased protein and hypoglycorrhagia. There is both

Intraventricular Neurocysticercosis

203

(a)

(b)

(c)

Fig. 20.2. (a) Sagittal T1-weighted MRI shows a large inflammatory (involutional, transitional) cyst in the fourth ventricle. The mural nodule is visible. There is oedema of adjacent brain tissue. (b) Axial T1-weighted post-contrast MRI shows an inflammatory cyst in the fourth ventricle with a ring-like enhancement. There is oedema of adjacent brain tissue. (c) An axial fluid attenuation inversion recovery (FLAIR) MRI shows an inflammatory cyst in the fourth ventricle, oedema in the surrounding brain tissue, and the mural nodule.

polymorphonuclear and lymphomononuclear pleocytosis, but the latter predominates4,9,12,25. Eosinophilia occurs in about 20% of patients with pleocytosis12. Glucose is reduced in about 6%; protein is elevated up to a maximum of 420 mg dl−1 12.

Differential Diagnosis Histological demonstration of the miniature parasite from surgically resected tissue is an important diagnostic criterion22. The tissue may be the surgical specimen from cysts

204

A.C. Cuetter and R.J. Andrews

removed, or the intraventricular content obtained through ventriculostomy. The differential diagnosis of IVNC includes toxoplasmosis, fungal and bacterial meningitis, hydrocephalic sequelae of tubercular meningitis, echinococcosis, intraventricular neoplasms6,13,26 and non-infectious granulomatous chronic meningitis. Toxoplasmosis may present with enlarged ventricles due to ependymitis and aqueductal stenosis18. On neuroimaging, bacterial and coccidioidal ependymitis with ventriculitis produces hydrocephalus and associated enhancement of the ependymal walls of lateral ventricles. However, the clinical picture is different, and there are no cysts, or other signs of NC. Granulomatous tubercular meningitis may present with hydrocephalus, but there is involvement of the meninges at the base of the skull on post-gadolinium MRI27,28. On MRI, the multiloculated parietal cystic structure of echinococcosis may overlap the ventricular silhouette resembling IVNC. A third ventricular cysticercus may mimic a colloid cyst. Fourth ventricle cysts simulate neoplasms such as cystic medulloblastoma, astrocytoma or ependymoma, with obstruction of the ventricular flow, neuroimaging cystic changes of a tumoural mass, and oedema of adjacent brain tissues (Figs 20.2a–c). However, tumours enhance with gadolinium, have much more oedema in the adjacent tissues, and show extension up and down in the ventricle and laterally into prepontine cisterns. Finally, non-infectious conditions such as sarcoidosis and meningeal carcinomatosis may produce chronic hydrocephalus due to leptomeningitis and pachymeningitis18.

Treatment The treatment of IVNC is symptom specific. The choice of treatment from available therapeutic modalities shown below depends on the condition of the patient at the time of presentation, location of cyst, and evolutional stage of the cyst: • emergent temporary ventriculostomy; • VPS procedure; • surgical or endoscopic extirpation of obstructing cysts;

• use of anticysticercal drugs (albendazole, praziquantel); • use of corticosteroids.

Acute hydrocephalus; viable cyst According to current standards, acute hydrocephalus requires ventriculostomy followed by surgical or endoscopic extirpation of viable cyst/s obstructing the CSF flow, particularly those in the fourth ventricle1,6,9,11,19,29,30. After initial placement of a ventriculostomy catheter, a definitive procedure to extirpate the cyst/s is highly advisable. The choice between open surgical removal and endoscopic removal depends upon the operator’s experience. The reader is referred to Chapter 40 for a detailed discussion on the merits and demerits of each procedure, as well as technical details of the endoscopic approach.

Acute hydocephalus; inflamed cyst When there is neuroimaging evidence of ependymitis, VPS without surgical attempts to remove the cyst is preferable because involutional inflammatory cysts are fixed to the ventricular wall with strong adhesions and thickening, and cannot easily be removed without damaging brain tissue1,7,11,31. Even if the cyst is removed, there is a likelihood that VPS may still be necessary6,11. Unfortunately, in most cases, a differentiation between a viable and an inflammatory intraventricular cyst cannot be made. Several clinical points are helpful. A viable cyst does not have clinical symptoms and signs of meningitis, and has no or only discrete inflammatory reaction on CSF that has been obtained by ventriculostomy. Conversely, an involutional inflammatory cyst shows symptoms and signs of meningitis, focal neurological deficit and inflammatory response on CSF examination7. On T1-weighted MRI, an inflammatory cyst has a hyperintense wall, and there is oedema of adjacent brain tissue (Fig. 20.2a). On T1-weighted post-gadolinium imaging, there is a ring-like enhancement in the wall of the inflammatory cyst (Fig. 20.2b).

Intraventricular Neurocysticercosis

It is recommended that patients with acute hydrocephalus due to intraventricular inflammatory cysts be treated with emergent temporary ventriculostomy, followed by a permanent VPS procedure11,32,33. The use of dexamethasone in therapeutic declining dose therapy may afford some benefit to these patients if it relieves the inflammatory stage and brain oedema4,5,25,34.

205

cysts, or by high CSF protein37. In some instances, a lack of improvement after a shunting procedure is explained by mass effect due to an enlarging cyst or inadequate decompression, and in the latter situation, a revision of the shunt is required12,35. Recurrent shunt obstruction by cyst material is another reason for excision of intraventricular cysts5.

Anticysticercal drugs Chronic hydrocephalus; viable cysts Patients with chronic hydrocephalus and increased ICP usually require a permanent VPS35. Open surgical or endoscopic removal of the viable cysts should be done if they are large, if they obstruct the CSF flow, if they complicate shunting, if they cause a mass effect despite shunting, and if the diagnosis is uncertain35. Viable cysts in the fourth ventricle should be extirpated because by their mass effect, these cysts may cause herniation even after VPS9. A transcortical approach is used for removal of cysts from lateral ventricles; a transcallosal approach for cysts in the third ventricle; and a midline suboccipital direct approach for cysts in the fourth ventricle1,11,32. Bergsneider and Nieto (see Chapter 40) discuss the option of direct endoscopic removal of cyst/s without resort to VPS. The surgeon must consider the possibility of cyst migration between the time of diagnosis and craniotomy36. Migration of the targeted cyst must be ruled out by a neuroimaging procedure done immediately before surgery19,33. In cases of multiple cysts and multiple obstructions with loculated hydrocephalus, there may be a need for multiple shunt procedures, each draining a separate compartment31. Patients with intraventricular cysts without hydrocephalus, or with only slight dilatation of the ventricles, require close supervision in case shunting becomes necessary.

Chronic hydrocephalus; inflamed cyst VPS remains the mainstay of therapy of inflamed IVNC. However, shunts are prone to complications in these patients. The most common cause of dysfunction of VPS is obstruction either by gelatinous material from

Some investigators have advocated the use of anticysticercal drugs in conjunction with VPS5,12 to decrease shunt failures and destroy viable cysts. The use of praziquantel, an isoquinoline with broad anthelmintic activity, in IVNC is controversial, since earlier studies have associated such therapy with a poor outcome38. Both failures2,17,38–40, and successes5,41,42, with praziquantel have been observed in the treatment of intraventricular cysts. The recommended dose is 50 mg kg−1 day−1 for 14 days with concomitant use of dexamethasone. There are several reports describing the successful treatment of intraventricular cysts with albendazole (Fig. 20.3a,b)2,43–45. In some series, intraventricular cysts disappeared within 3 months after this approach2,43–45. Albendazole is used at a dose of 15 mg kg−1 day−1 for 15 days. The daily dose is divided into three administrations, and dexamethasone is given concomitantly. Two courses of medication are given 1 month apart. Intermittent long-term steroid therapy may reduce shunt malfunction46. The favourable response to treatment of IVNC with either praziquantel or albendazole is by no means definite and may be a reflection of the natural history of the condition. When the larva in the cyst dies as a result of anticysticercal therapy, there is an inflammatory reaction similar to the one seen with the natural death of the larva47,48. The local reaction with scarring and granulomatous ependymitis may lead to an irreversible blockade of CSF flow due to a permanent tissue damage. In addition, resolution with anticysticercal drugs may take a long period of time, usually in months. During this period, the patient is at risk of developing

206

A.C. Cuetter and R.J. Andrews

(a)

(b)

Fig. 20.3. (a) T1-weighted MRI shows an intraventricular cyst in the frontal horn of the right lateral ventricle. (b) Same patient as in (a), 12 months later. There was a resolution of the cyst.

complications such as ependymitis and acute ventricular obstruction. For this reason, some authors question the effectiveness of anticysticercal therapy in IVNC, even suggesting that the treatment with anticysticercal agents is associated with an increase in frequency of

long-term sequelae49. Therefore, the use of anticysticercal therapy in IVNC continues to be debated50. Collaborative clinical trials are needed to evaluate specific medical treatment of IVNC and to develop a better understanding of the clinical course49.

Intraventricular Neurocysticercosis

Prognosis IVNC is potentially lethal. Early studies showed that the mortality of acute hydrocephalus is 13%33. However, many patients who have surgical removal of the intraventricular cysts and VPS to relieve hydrocephalus, improve with resolution of the hydrocephalus26. The prognosis for patients with IVNC of the fourth ventricle is not good. The mass effect of a cyst in the poste-

207

rior fossa is less well tolerated than at other sites. Significant morbidity is associated with fourth ventricular cysts even after VPS12. Cysts in the fourth ventricle usually present in the inflammatory state with oedema and adhesion to the adjacent tissue (Fig. 20.2c), at which time the resection of the entire lesion is difficult. Hydrocephalus returns in some patients with IVNC, even after cysts have disappeared (Fig. 20.4a–c)2,14,20. Although a reinfection can be the cause of this relapse, in

(a)

(b)

(c)

Fig. 20.4. (a) CT scan of a 46-year-old man shows intraventricular and parenchymal active cysts. (b) CT scan, 11 months later shows resolution of the cyst. (c) One year later the patient presented with increased intracranial pressure. CT scan showed non-communicating hydrocephalus.

208

A.C. Cuetter and R.J. Andrews

some cases, the most likely reason is the obstruction of the CSF pathways by chronic adhesions and thickening left by involutional cysts. This emphasizes the need for aggressive initial treatment in these patients.

Conclusions IVNC is a serious and disabling condition with obscure peculiarities in its natural history, grave complications, and a high rate of poor outcomes. Active, viable intraventricular cysts produce no reaction from the host, but can mechanically interfere with CSF flow, leading to complex clinical syndromes mainly because of obstructive hydrocephalus. These cysts can migrate freely in the ventricular system, giving rise to acute intermittent or permanent symptoms from hydrocephalus and increased ICP. When the larva dies, there occurs a local granulomatous ependymitis and generalized ventriculitis with hydrocephalus,

increased ICP and meningoencephalitis. Neuroimaging is the most important tool for the diagnosis of IVNC. The finding of cysts in different stages of evolution helps in the diagnosis. The treatment of IVNC is symptom specific. Surgical treatment of acute hydrocephalus consists of ventriculostomy followed by permanent VPS. Dexamethasone alleviates the increased ICP, cerebral oedema and inflammation. In chronic hydrocephalus and intraventricular cysts, the selection of treatment modalities such as VPS, surgical removal of the cysts, and anticysticercal therapy is a subject that challenges the common sense, experience, and judgement of the treating physician. There are reports of successes and failures with the use of anticysticercal medication. The use of anticysticercal medications to hasten the involution of intraventricular viable cysts may trigger an inflammatory response similar to the one seen with the natural death of the parasite, with consequent increased frequency of long-term sequelae.

References 1. Madrazo, I., Garcia-Renteria, J.A., Sandoval, M., et al. (1983) Intraventricular cysticercosis. Neurosurgery 12, 148–151. 2. Cuetter, A.C., Garcia-Bobadilla, J., Guerra, L.G., et al. (1997) Neurocysticercosis: focus on intraventricular disease. Clinical Infectious Diseases 24, 157–164. 3. Botero, D. (1989) Cysticercosis. In: Goldsmith, R., Heyneman, D. (eds) Tropical Medicine and Parasitology. Appleton & Lange, Norwalk, Connecticut, pp. 498. 4. Lobato, R.D., Lamas, E., Portillo, J.M., et al. (1981) Hydrocephalus in cerebral cysticercosis: pathogenic and therapeutic considerations. Journal of Neurosurgery 55, 786–793. 5. Bandres, J.C., White, A.C., Jr, Samo, T., et al. (1992) Extraparenchymal neurocysticercosis: report of five cases and review of management. Clinical Infectious Diseases 15, 799–811. 6. Couldwell, W.T., Chandrasoma, P., Apuzzo, M.L.J., et al. (1995) Third ventricular cysticercal cyst mimicking a colloid cyst: case report. Neurosurgery 37, 1200–1203. 7. Salazar, A., Sotelo, J., Martinez, H., et al. (1983) Differential diagnosis between ventriculitis and fourth ventricle cyst in neurocysticercosis. Journal of Neurosurgery 59, 660–663. 8. Carpio, A., Placencia, M., Santillán, F., et al. (1994) A proposal for classification of neurocysticercosis. Canadian Journal of Neurological Sciences 21, 43–47. 9. McCormick, G.F. (1985) Cysticercosis: review of 230 patients. Bulletin of Clinical Neuroscience 50, 76–101. 10. Estañol, B., Kleriga, E., Loyo, M., et al. (1983) Mechanisms of hydrocephalus in cerebral cysticercosis: implications for therapy. Neurosurgery 13, 119–123. 11. Apuzzo, M.L.J., Dobkin, W.R., Zee, C.S., et al. (1984) Surgical considerations in treatment of intraventricular cysticercosis: an analysis of 45 cases. Journal of Neurosurgery 60, 400–407. 12. Shandera, W.X., White, A.C., Jr, Chen. J.C., et al. (1994) Cysticercosis in Houston, Texas: a report of 112 cases. Medicine 73, 37–52. 13. de Morais-Rego, S.F., Latuf, N.L. (1978) Cisticercose do quarto ventrículo simulando neoplasia da fossa posterior à cintillografia cerebral. Relato de um caso. Arquivos de Neuropsiquiatria 36, 371–374.

Intraventricular Neurocysticercosis

209

14. Colli, B.O., Pereira, C.U., Assirati, J.A. (1993) Isolated fourth ventricle in neurocysticercosis: pathophysiology, diagnosis, and treatment. Surgical Neurology 39, 305–310. 15. Stern, W.E. (1981) Neurosurgical considerations in cysticercosis of the central nervous system. Journal of Neurosurgery 55, 382–389. 16. Rabiela, M.Y., Rivas-Hernandez, A., Rodriguez Ibarra, J. (1979) Consideraciones anatomopatológicas sobre cisticercosis cerebral como causa de muerte. Patología 17, 119–136. 17. Joubert, J. (1990) Cysticercal meningitis: a pernicious form of neurocysticercosis which responds poorly to praziquantel. South African Medical Journal 77, 528–530. 18. Kanamalla, U.S., Ibarra, R.A., Jinkins, J.R. (2000) Imaging of cranial meningitis and ventriculitis. Neuroimaging Clinics of North America 325, 309–331. 19. Zee, C.S., Go, J.L., Kim, P.E., et al. (2000) Imaging of neurocysticercosis. Neuroimaging Clinics of North America 325, 391–407. 20. Hanlon, K.A., Vern, B.A., Tan, W.S., et al. (1988) MRI in intraventricular neurocysticercosis: a case report. Infection 16, 242–244. 21. Chang, K.H., Lee, J.H., Han, M.H., et al. (1991) The role of contrast-enhanced MR imaging in the diagnosis of neurocysticercosis. AJNR American Journal of Neuroradiology 12, 509–512. 22. Del Brutto, O.H., Wadia, N.H., Dumas, M., et al. (1996) Proposal of diagnostic criteria for human cysticercosis and neurocysticercosis. Journal of the Neurological Sciences 142, 1–6. 23. Wilson, M., Bryan, R.T., Fried, J.A., et al. (1991) Clinical evaluation of the cysticercosis enzymelinked immunoelectrotransfer blot in patients with neurocysticercosis. Journal of Infectious Diseases 164, 1007–1009. 24. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community-based epidemiological investigation of cysticercosis due to Taenia solium: comparison of serological screening tests and clinical findings in two populations in Mexico. Clinical Infectious Diseases 18, 879–885. 25. Bonametti, A.M., Baldy, J.L., Bortoliero, A.L., et al. (1994) Neurocisticercose com quadro clínico inicial de meningite aguda. Revista do Instituto de Medicina Tropical de São Paulo (São Paulo) 36, 27–32. 26. Zee, C.S., Segal, H.D., Destian, S., et al. (1993) MRI of intraventricular cysticersosis: surgical implications. Journal of Computer Assisted Tomography 17, 932–939. 27. Shah, G.V. (2000) Central nervous system tuberculosis: imaging manifestations. Neuroimaging Clinics of North America 325, 355–374. 28. Bekonakli, E., Cayli, S., Turgut, M., et al. (1998) Primary giant granulomatous basal meningitis: an unusual presentation of tuberculosis. Childs Nervous System 14, 79–81. 29. Bello Martinez, E., de Górgolas Hernández-Mora, M., Albisua Sanchez, J., et al. (1997) Neurocisticercosis en un hospital terciario. Nuevos avances en el diagnóstico y tratamiento. Revista Clinicia Espanola 197, 604–610. 30. Sotelo, J. (1997) Treatment of brain cysticercosis. Surgical Neurology 48, 110–112. 31. Amar, A.P., Ghosh, S., Apuzzo, M.L.J. (2000) Treatment of central nervous system infections. Neuroimaging Clinics of North America 325, 445–459. 32. Couldwell, W.T., Apuzzo, M.L.J. (1989) Management of cysticercosis cerebri. Contemporary Neurosurgery 19, 1–6. 33. Zee, C.S., Segall, H.D., Apuzzo, M.L.J., et al. (1984) Intraventricular cysticercal cysts: further neuroradiologic observations and neurosurgical implications. AJNR American Journal of Neuroradiology 5, 727–730. 34. Rogel-Ortiz, F., Vera-Pedro, M. (1997) Meningitis cisticercosa. Gaceta Medica de Mexico (Mexico) 133, 301–305. 35. Colli, B.O., Martelli, N., Assirati, J.A., Jr, et al. (1986) Results of surgical treatment of neurocysticercosis in 69 cases. Journal of Neurosurgery 65, 309–315. 36. Del Brutto, O.H., Sotelo, J., Roman, G.C. (1993) Therapy for neurocysticercosis: a reappraisal. Clinical Infectious Diseases 17, 730–735. 37. Sandoval, M., Madrazo, I., Garcia-Renteria, J.A., et al. (1990) Obstruction of the ventricular catheter of a CSF shunt system due to the own cyst of Taenia solium. Archives of Investigative Medicine (México) 21, 95–98. 38. Vasconcelos, D., Cruz-Segura, H., Mateos-Gomez, H., et al. (1987) Selective indications for the use of praziquantel in the treatment of brain cysticercosis. Journal of Neurology, Neurosurgery and Psychiatry 50, 383–388. 39. Duplessis, E., Dorwling-Carter, D., Vidaillet, M., et al. (1988) Neurocysticercose intraventriculaire. A propos de trois observations. Neurochirurgie 34, 275–279.

210

A.C. Cuetter and R.J. Andrews

40. Monteiro, L., Almeida-Pinto, J., Stocker, A., et al. (1993) Active neurocysticercosis, parenchymal and extraparenchymal: a study of 38 patients. Journal of Neurology 241, 15–21. 41. Allcut, D.A., Coulthard, A. (1991) Neurocysticercosis: regression of a fourth ventricular cyst with praziquantel. Journal of Neurology, Neurosurgery and Psychiatry 54, 461–462. 42. Proano, J.V., Madrazo, I., Garcia, L., et al. (1997) Albendazole and praziquantel treatment in neurocysticercosis of the fourth ventricle. Journal of Neurosurgery 87, 29–33. 43. Sotelo, J., Penagos, P., Escobedo, F., et al. (1988) Short course of albendazole therapy for neurocysticercosis. Archives of Neurology 45, 1130–1133. 44. Del Brutto, O.H., Sotelo, J. (1990) Albendazole therapy for subarachnoid and ventricular cysticercosis. Journal of Neurosurgery 72, 816–817. 45. Villarreal, H.J., Rangel-Guerra, R., Martinez, H.R., et al. (1990) Cisticercosis parenquimatosa y ventricular tratada con albendazole. Archivos del Instituto Nacional de Neurología y Neurocirugía de México 5, 207–208. 46. Suastegui Roman, R.A., Soto-Hernandez, J.L., Sotelo, J. (1996) Effects of prednisone on ventriculoperitoneal shunt function in hydrocephalus secondary to cysticercosis: a preliminary study. Journal of Neurosurgery 84, 629–633. 47. Spina-Franca, A., Nobrega, J.P.S. (1980) Neurocysticercose e praziquantel. Revista Paulista de Medicina 95, 34–36. 48. Garcia, H.H., Gilman, R.H., Horton, J., et al. (1997) Albendazole therapy for neurocysticercosis: a prospective double-blind trial comparing 7 versus 14 days of treatment. Neurology 48, 1421–1427. 49. Carpio, A., Santillan, F., Leon, P., et al. (1995) Is the course of neurocysticercosis modified by treatment with anthelminthic agents? Archives of Internal Medicine 155, 1982–1988. 50. Salinas, R., Counsell, C., Prasad, K., et al. (1999) Treating neurocysticercosis medically: a systematic review of randomized, controlled trials. Tropical Medicine and International Health 4, 713–718.

21

Neurocysticercosis and Epilepsy Arturo Carpio and W. Allen Hauser

Introduction The natural history of neurocysticercosis (NC) and its clinical course are poorly understood. Presumably, a high percentage of the population harbouring NC remains asymptomatic. Among symptomatic patients, clinical manifestations of NC vary, depending on the number and localization of the cyst(s), as well as the host immune response to the parasite1–5. Acute symptomatic seizures are the most common clinical manifestation of NC in those patients in whom the parasite(s) are located in brain parenchyma6–8. Based on prospective studies, the traditional view that NC is the principal cause of epilepsy in developing countries can be questioned9,10. Similarly, the view that epilepsy attributable to NC generally has an unfavourable course and prognosis, contrasts with recent reports showing an overall favourable prognosis in terms of seizure control and seizure remission2,3,11–13. Although some authors have suggested that anticysticercal treatment is associated with reduced seizure recurrence10,11 there are no hard data to support this from controlled clinical trials. The controversial issues of treatment approach and the relationship between NC and epilepsy are reviewed in this chapter.

Epidemiology of Epilepsy and Cysticercosis The incidence of epilepsy in developing countries is twice that in developed countries14,15. Three-quarters of the 50 million people with epilepsy live in economically disadvantaged countries of the world. Most of those with epilepsy in these countries are untreated16,17. Taeniasis–cysticercosis is endemic in Latin America, India and China, and possibly also in sub-Saharan Africa17. Poor hygiene and living conditions, allowing pigs access to human faeces, put people at risk of developing taeniasis–cysticercosis. A recent epidemiological study has shown that household contacts of patients with NC had a threefold higher risk of positive serology for cysticercosis, in comparison to the general population18. While these findings are still consistent with a common environmental source of infection with Taenia solium eggs, they also suggest a potential role for direct human-to-human contamination. Migrant workers into the USA and other developed countries have also imported T. solium infections5,19. Immunoserological assays, such as enzyme-linked immunoelectrotransfer blot (EITB) or ELISA, detect antibodies against T. solium cysticercosis1,2,20. Epidemiological

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

211

212

A. Carpio and W.A. Hauser

surveys for human cysticercosis, using EITB, report a seroprevalence from 8% to 12% in some regions of Latin America20–24. These assays are useful for identification of individuals who have had systemic contact with the parasite at some time. Seropositivity, however, does not necessarily mean an active systemic infection or central nervous system involvement at any time. Most seropositive individuals in the populations surveyed were asymptomatic. Some studies21,23,24 but not all22 have reported an association between seizures and seropositivity. Although a higher proportion of patients with epilepsy have been shown to be EITB positive when compared with those without epilepsy, the proportion of seropositivity in epileptic patients is similar to that reported in the general population in these same areas. There is also a discrepancy between EITB positivity and computed tomography (CT) findings: more than 50% of those diagnosed as having NC by CT were seronegative22,23. This is especially true in patients with only single or calcified lesions.

Seizures and epilepsy as main clinical manifestations of NC It is widely accepted that seizures are the most common symptom of NC, occurring in 70–90% of patients2,3,5,6,8,12. There is no consistency in the reported distribution of seizure types in patients with NC. Some authors report a higher frequency of partial seizures9,14, others conclude that generalized seizures are more common7,8. It seems that either generalized seizures or partial seizures with secondary generalization are most commonly reported, while complex partial seizures are less frequent. Some authors use the term ‘seizures’ indiscriminately for epilepsy, and vice versa10,11. All people with epilepsy experience seizures, but not all individuals with seizures have epilepsy25. This distinction is not only semantic; it is important from the clinical and epidemiological standpoint. According to the definitions suggested by the International League Against Epilepsy’s

(ILAE’s) Commission on Epidemiology and Prognosis26, ‘provoked’ or ‘acute symptomatic seizures’ are seizures which occur in close temporal association with an acute brain lesion (infection, stroke, cranial trauma, etc.); such seizures are often isolated epileptic events associated with acute conditions, but may recur if the acute condition recurs. Unprovoked seizures (epilepsy, if seizures recur) may occur subsequent to a well-demonstrated antecedent condition, known to substantially increase the risk of epileptic seizures. Symptomatic unprovoked seizures are categorized into two major subgroups: (i) remote symptomatic unprovoked seizures that follow conditions resulting in a static encephalopathy, such as infection, cerebral trauma, or cerebrovascular disease, generally presumed to be the result of this non-progressive (static) lesion; and (ii) progressive symptomatic seizures occurring in association with progressive neurological disorder (brain trauma, degenerative brain disease). Seizures associated with NC may be categorized as either acute symptomatic or as remote symptomatic seizures. Individuals with cysticerci in the transitional form27 or degenerative phase develop acute symptomatic seizures due to the acute inflammatory response of the brain; on the other hand, a patient with seizures who has active, viable cysts and/or inactive, non-inflamed calcified parasites may be categorized as having unprovoked seizures. NC has an unpredictable clinical course, which makes it difficult to categorize all cases into the proposed classification of the ILAE Commission. For instance, a patient with chronic recurrent seizures, whose imaging studies show several non-inflamed parenchymal calcifications, should be categorized as having remote symptomatic unprovoked seizures. The same patient, some years later, can develop hydrocephalus associated with intraventricular cysts or experience a recurrence of parenchymal transitional cysts. This case should be considered to have multiple episodes of NC now resulting in acute symptomatic seizures. The seizure disorder should not be categorized as progressive symptomatic unprovoked seizures (epilepsy)

Neurocysticercosis and Epilepsy

owing to a progressive neurological disorder2. Neurologists from developing countries frequently see patients in whom the first seizure occurred many years before consultation, and when the second seizure occurs at the time of consultation, the imaging study shows one or more calcifications and one cyst in the transitional form with perilesional oedema. We can assume that when the first seizure occurred, the patient had cysts in a transitional form, which eventually became calcified, and currently the patient has new acute seizures27. According to the ILAE Commission we should categorize these patients as having isolated epileptic events associated with a recurrent acute condition (transitional form)26. Ultimately, in patients with NC, what matters most is to differentiate between provoked or acute symptomatic seizures and recurrent unprovoked seizures (epilepsy). This differentiation is very important, because of its implications concerning treatment and prognosis, as will be discussed below. Presumably, the inclusion of people with only acute symptomatic seizures as cases of epilepsy is one of the reasons for the high proportion of epilepsy in some studies.

Is NC the most frequent aetiology of epilepsy in developing countries? It is extremely difficult to compare results of studies of epilepsy due to NC. These studies are few, and are frequently targeted at all seizures, instead of epilepsy alone. Almost all the studies are prevalent case-series, which are not useful for identifying the cause of seizures. There are broad differences in the definition (if any) of NC, as well as failure to define criteria for diagnosis of either seizures or epilepsy. There is no information on the latency between the first acute symptomatic seizure and the first unprovoked seizure, or regarding the age of the patient at the time of onset of seizures in relation to the age of the patient at the time of diagnosis of NC. Studies of highly selected patients with epilepsy (or seizures?) in neurological services of hospital settings from some Latin American countries report

213

NC as the main cause of epilepsy, accounting for 30–50% of patients1,9. The proportion of epilepsy cases associated with cysticercosis using an immunoserological test as a diagnostic tool is considerably lower than the proportion of NC using CT. Only 12% of epileptic patients attending an outpatient clinic in Peru had serological evidence of T. solium as shown by the EITB test21. New information now available from developing countries shows that the proportion of idiopathic (60–70%) to symptomatic epilepsy (30–40%) is similar to that reported in studies from developed countries4,14. Among the symptomatic group, infection and parasitic diseases, particularly NC, perinatal brain damage, and head trauma are the most frequent disorders reported as a cause of epilepsy1,6,21,28,29. In studies from India, in which acute symptomatic seizures were excluded, only 5.3% and 11% of patients with epilepsy had NC30,31. In a recent prospective cohort study, among patients with newly diagnosed epilepsy seen at the five main hospitals in the three major cities of Ecuador, the ratio of idiopathic/cryptogenic (63%) to symptomatic epilepsy (37%) was also similar to the studies from developed countries32. Perinatal brain damage (9%), NC (8.3%), central nervous system infections (4.2%), stroke (4.8%) and head trauma (4.2%) were the most frequent disorders reported as causes of epilepsy (Fig. 21.1). Although NC is one of the most frequent antecedents among the symptomatic group, this disease is not the main cause of epilepsy, as has been previously suggested.

Relationship Between NC and Epilepsy There are clinical inconsistencies in the link between epilepsy and NC. Parasite location may be remote from the apparent epileptogenic region33. There is also no correlation between the NC burden of lesions and the severity of the epilepsy. Patients with severe refractory seizures may have only one calcified lesion; on the other hand, there are patients with multiple cysts or calcifications but no seizures. NC and epilepsy are com-

214

A. Carpio and W.A. Hauser

9.60%

3.50%

Cysticercosis

0.90% 5.70%

Others Tumours Stroke

5.20% 61.70% 3.90%

Infections Head trauma Perinatal insult

9.60%

Idiopathic

Fig. 21.1. Aetiology of epilepsy in Ecuador. (Source: reference 32.)

mon diseases in most developing countries. Because of their high prevalence, a causal as well as fortuitous relationship between the two conditions might exist3,34–36. Seizures may occur at any evolutionary stage of the parasite. Acute seizures are more frequent with the transitional form owing to the inflammatory reaction in the vicinity of cortically or subcortically located cysts. In the active form, seizures have been attributed to mechanical compression by cysticercal cysts2,27. We can theorize that risk of seizure recurrence (i.e. epilepsy) probably occurs in the inactive or calcified form of NC37. This possibility has been attributed to residual perilesional gliosis that results in chronic epileptogenic foci38. This theory, however, requires further confirmatory studies. Some authors have suggested that mild inflammation, visible on contrast-enhanced MRI or CT, may persist in the calcified stage of NC, and may be associated with an increased risk of recurrent seizures39,40. These authors theorize that the perilesional oedema surrounding calcified lesions due to NC is a persistent host-inflammatory response provoked by antigens released from the calcified lesions. However, in patients with multiple calcifications, it is not clear why only some of the calcified lesions would induce inflammation. Electroencephalography (EEG) has been found to be abnormal in 30–50% of patients with seizures due to NC. It is assumed that

EEG findings have poor correlation with symptoms and CT lesions in patients with NC5,41–43. A positive correlation between CT lesions and localizing or lateralizing EEG abnormalities has been reported for only 15–30% of patients. Similarly, the correlation between seizure type and EEG abnormalities ranges from around 7% to 20%43. Discrepancies between clinical localization based on seizure semiology and location of the lesion on neuroimaging is not uncommon in patients with NC. Nevertheless, some authors suggest that this reflects the spread of seizure discharges37,42. In patients with occipital-lobe epilepsy, an occipitotemporal spread was demonstrated in those patients who had automatisms typical of temporal-lobe seizures, and suprasylvian spread was demonstrated in those patients who presented tonic or clonic motor manifestations44. A non-causal relationship between epilepsy and cysticercosis in some cases might explain these apparent discrepancies37. Studies correlating epileptic foci and intracranial calcifications suggest that calcifications themselves were not the origin of the epileptogenic lesion in at least 50% of the cases36. Some authors tried to correlate EEG with the cyst viability41. They found interictal EEG abnormalities in 28% of patients with any form of NC, but no EEG abnormalities in patients with inactive NC. These authors suggested that perilesional gliosis might be insufficient to cause scalp

Neurocysticercosis and Epilepsy

EEG abnormality in the inactive form of NC. Further prospective cohort studies, properly designed to study ictal and interictal EEG abnormalities in patients with seizures, correlated with the different evolutionary stages of the parasite, may clarify the relationship between NC and epilepsy. The coexistence of hippocampal atrophy and extrahippocampal pathological abnormalities, such as cortical dysgenesis and gliosis, referred as ‘dual pathology’, has been reported in 5–30% of patients with medically refractory partial seizures33,45. Dual pathology implies that both lesions somehow interact with each other and contribute to epileptogenesis through mechanisms still poorly understood. Some authors have also attributed hippocampal sclerosis to NC3,35. Patients with calcifications due to NC and mesial temporal lobe epilepsy (hippocampal sclerosis) became seizure-free after anteromesial temporal lobectomy, without resection of the cysticercotic lesion, suggesting the two phenomena are independent34. The possibility of dual pathology related to NC needs further clarification in prospective cohort studies. Considering that epileptogenicity of cysticercotic lesions is probably low for residual calcifications, one should consider the chance association between the two conditions34,35. Unequivocal evidence of causal relationship between NC and epilepsy could be deduced from correlation between clinical, EEG, and imaging data. This evidence should be demonstrated in patients with single or multiple NC lesions shown by imaging studies, in whom video-EEG monitoring displays ictal and interictal abnormalities correlated with type of seizures. The association could be confirmed and the level of risk determined through appropriate epidemiological studies.

Effect of Anticysticercal Treatment on Epilepsy Despite the first reports regarding treatment for NC with anticysticercal drugs such as praziquantel and albendazole being published more than 15 years ago2, to date there

215

are no controlled clinical trials to establish specific indications, definitive doses, and duration of treatment2. A critical review of the literature suggests that the studies upon which these assumptions are based are flawed in terms of patient selection, assignment to treatment, and selection and measurement of outcome variables. Many authors have appropriately criticized publications on this topic and have concluded that no adequate studies of efficacy have been reported (see Chapter 38)5,17,46,47. Other authors have warned that this therapy might be harmful in some patients, particularly when cysts are in the subarachnoidal location, because these drugs might lead to the development of arachnoiditis, arteritis and hydrocephalus48,49. A randomized clinical trial of treatment of patients with newly identified active NC used oral prednisolone alone, praziquantel with prednisolone, or albendazole with prednisolone49. At 6 months and at 1 year after treatment there were no differences in the three treatment groups in terms of the proportion of cases free of cysts, or the relative reduction in number of cysts. At 2 years, there was no difference in the proportion of cases free of seizures over the entire followup period. Based on these results, it appears that treatment with anticysticercal drugs does not modify the prognosis of seizures in patients with NC. This study addressed questions about to what extent and in which patients, treatment with either praziquantel or albendazole is indicated. The improvement attributed to anticysticercal drugs in previous studies may be related to the lack of appropriate controls and is likely to be a reflection of the natural history of the condition. Placebo-controlled trials for NC treatment that are under way should clarify these uncertainties. It has been suggested that seizure control in patients with NC is improved and that the chance of remaining seizure-free after the withdrawal of antiepileptic drug (AED) is greater after a course of anticysticercal drugs when compared with seizure control in those in whom the disease is left untreated10,11. However, these studies do not distinguish between acute symptomatic seizures, chronic recur-

216

A. Carpio and W.A. Hauser

rent seizures that antedate the infection and patients with newly diagnosed recurrent unprovoked seizures. These distinctions are crucial in order to interpret results of such interventions.

Prognosis of First Seizure due to NC There are inconsistent data on the risk of further seizures in patients with first seizure due to NC. In most studies, the sample size has been small, assessment has been carried out retrospectively, and optimal analytical methods have not been used. Some authors report that NC patients with acute symptomatic seizures have a good prognosis in terms of remission of seizures3,7,12,13; others report that most patients have a high risk of seizure recurrence, and suggest that prognosis improves after anticysticercal treatment10,11. In a prospective cohort study, patients with a first seizure and evidence of an active or transitional form of NC were enrolled and followed up for up to 5 years to identify the risk of subsequent seizures49,50. Additional analysis was performed after stratification by treatment of the acute condition: symptomatic treatment alone using AED(s) and prednisolone (33 patients), or symptomatic treat-

ment plus the anticysticercal drug, albendazole, 15 mg kg1 day1, for 8 days (44 patients). Thirty patients (39%) experienced seizure recurrence; however, when using Kaplan–Meier survival analysis, 60% of cases experienced a seizure recurrence in the 5-year period following a first acute symptomatic seizure. Half of these recurrences occurred in the first year. The estimated recurrence was 20% at 6 months, 29% at 12 months, 35% at 24 months, and 60% at 48 months. This high recurrence is in part related to recurrence of acute symptomatic seizures. Among a large array of variables that were assessed as potential risk factors for recurrence, only persistence of abnormalities on follow-up CT scan was predictive of seizure recurrence. Recurrence risk ranged from 22% in patients in whom cysts disappeared, to 78% in patients showing no change in number of cysts. There were no significant differences in the Kaplan–Meier curves of recurrence when treatment groups were compared (Fig. 21.2). It appears that anticysticercal treatment did not modify the risk of seizure recurrence. A similar seizure recurrence risk (37%) has been reported in patients with single enhancing CT lesions42. This relapse rate is similar to that reported in other studies of seizure recurrence in cases with a first acute symptomatic seizure35,51,52.

1.1

Cumulative probability

1.0 0.9 0.8 0.7

Anticysticercal treatment

0.6

Yes Yes-censored

0.5

No

0.4 0

10

20

30

40

50

60

No-censored

Follow-up in months Fig. 21.2. Probability of seizure recurrence after a first seizure in 77 patients with neurocysticercosis as a function of anticysticercal treatment. (Source: reference 32.)

Neurocysticercosis and Epilepsy

There are no guidelines regarding the duration for which AEDs should be continued following an acute NC episode. Some clinicians routinely continue AEDs for 1 year but shorter and longer intervals have been recommended12. The antiseizure medications currently used have no antiepileptogenic effect but do effectively prevent acute symptomatic seizure recurrence53. One assumes that the risk of seizures is substantial as long as there is an active ongoing process as characterized by persistence of oedema around the degenerating lesion. Because of this, we feel CT scan is a useful tool for these treatment decisions. Seizures in the context of oedema and a degenerative lesion should be considered to be acute symptomatic seizures,

217

even if they occur many months after presentation. It is appropriate to monitor cyst activity with CT scanning and to continue AEDs until resolution of the acute lesion. After this time, AEDs may be discontinued. Seizures occurring in individuals after resolution of oedema and resorption or calcification of the degenerating cyst should be considered unprovoked and, in this situation, long-term AEDs are warranted (Fig. 21.3). These are individuals who truly have epilepsy42. Seizure recurrence among those with cyst resolution was about 20%, a figure in accord with studies evaluating unprovoked seizure risk among individuals with structural brain abnormalities and acute symptomatic seizures25,51,52.

Degenerative (transitional) and/or active cysts

Only calcification

Initiate AED Initiate AED CT or MRI after 3–6 months

Cyst(s) resolved and no seizure recurrence

Cyst(s) not resolved with or without seizure recurrence

Maintain AED and CT or MRI at 3–6 months

Cyst(s) resolved but seizure recurrence

Maintain AED for 1–2 years after last seizure

No seizure recurrence for 1 year

Withdraw AED

Seizure recurrence

Maintain AED for 1–2 years after last seizure

Fig. 21.3. Suggested protocol for antiepileptic drugs for patients with first seizure due to neurocysticercosis.

218

A. Carpio and W.A. Hauser

It seems that interpretation of risks of seizures after NC is difficult because of the failure to distinguish acute symptomatic seizures from epilepsy. This distinction must be considered in future studies of the effects of treatment on seizure recurrence in people with cysticercosis. These difficulties are increased in those patients who have mixed forms, including active, transitional and calcified lesions. Further studies should be performed in order to estimate recurrence risk in those patients with probable unprovoked seizures due to calcifications alone, in comparison with patients with acute seizures due to transitional cysts. These studies should include a systematic assessment of treatment strategies. Persons with acute NC should be treated with antiseizure medication until cyst resolution is demonstrated on CT.

Conclusions and Recommendations for Future Research Epilepsy and NC are common diseases in developing countries and cysticercosis is increasingly diagnosed in industrialized nations as a result of migration from endemic regions. Seizures are the most common symptom in patients with a parenchymal location of the parasite. NC is not necessarily the main cause of epilepsy in developing countries, although it is one of the most frequent antecedents among patients with symptomatic seizures. Seizures may occur at any evolutionary stage of the parasite. Acute symptomatic seizures are more frequent in the transitional form owing to the inflammatory response of the brain. The risk of seizure recurrence (epilepsy) occurs in the inactive or calcified form of NC. This has been attributed

to residual perilesional gliosis. There are inconsistencies in the link between NC and epilepsy. Because of the high prevalence of each condition, a causal as well as fortuitous relationship between the two might exist. A correlation between lesions seen on neuroimaging and EEG abnormalities has been reported for only 15–30% of patients. Visible calcifications do not seem to be the source of the epileptogenic lesion in at least 50% of cases. Prospective cohort studies, properly designed to study ictal and interictal EEG abnormalities in patients with seizures, correlated with the different parasite evolutionary stages, may clarify the relationship between NC and epilepsy. NC patients have a good prognosis in terms of remission of seizures. Some authors suggest that prognosis improves after anticysticercal treatment. Recent prospective studies have shown that anticysticercal treatment does not modify the risk of seizure recurrence. This requires confirmation in controlled clinical trials. There are no guidelines regarding the duration for which antiseizure medication should be continued after an acute NC episode. The risk of seizures is substantial as long as there is an active ongoing process as characterized by persistence of oedema around the degenerating lesion. Because of this, CT scans are useful for treatment decisions. Seizures in the context of oedema and a degenerative lesion should be considered to be acute symptomatic seizures even if they occur many months after presentation. After resolution of the acute lesion, antiseizure medication may be discontinued. Seizures occurring after resolution of oedema or calcification of the degenerating cyst should be considered unprovoked and, in this situation, long term AEDs are warranted.

References 1. Bittencourt, P.R.M., Adamolekun, B., Bharucha, N., et al. (1996) Epilepsy in the tropics: II. Clinical presentations, pathophysiology, immunologic diagnosis, economics and therapy. Epilepsia 37, 1121–1127. 2. Carpio, A., Escobar, A., Hauser, W.A. (1998) Cysticercosis and epilepsy: a critical review. Epilepsia 39, 1025–1040. 3. Manreza, M.L. (2000) Epilepsia e neurociticercose. In: Guerreiro, C.A.M., Guerreiro, M.M., Cendes, F., et al. (eds) Epilepsia. Lemos Editorial & Gráficos Ltda, Sao Paulo, Brazil, pp. 255–264.

Neurocysticercosis and Epilepsy

219

4. Martínez, S.M. (1996) Controversias clínicas y terapeúticas en neurocisticercosis. In: García, H.H., Martínez, S.M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo SA, Lima, Peru, pp. 207–216. 5. White, A.C. (2000) Neurocysticercosis. Current Treatment Options in Infectious Diseases 2, 78–87. 6. Adamolekun, A., Carpio, A., Carvalho-Filho, F., et al. (1994) Relationship between epilepsy and tropical diseases. Epilepsia 35, 89–93. 7. Monteiro, L., Nunes, B., Mendonaca, D., et al. (1995) Spectrum of epilepsy in neurocysticercosis: a long-term follow-up of 143 patients. Acta Neurologica Scandinavia 92, 133–140. 8. Nogales-Gaete, J., Arriagada, C., Gonzáles, J. (1997) Sindromes anatomo-clínicos de la neurocisticercosis. In: Arriagada, C., Nogales-Gaete, J., Apt, W. (eds) Neurocisticercosis. Aspectos Epidemiológicos, Patológicos, Immunológicos, Clínicos, Imagenológicos y Terapéuticos. Arrynog Ediciones, Santiago, Chile, pp. 117–138. 9. Medina, M.T., Rosas, E., Rubio-Donnadieu, F., et al. (1990) Neurocysticercosis as the main cause of late-onset epilepsy in Mexico. Archives of Internal Medicine 150, 325–332. 10. Medina, M.T., Genton, P., Montoya, M.C., et al. (1993) Effect of anticysticercal treatment on the prognosis of epilepsy in neurocysticercosis: a pilot trial. Epilepsia 34, 1024–1027. 11. Vázquez, V., Sotelo, J. (1992) The course of seizures after treatment for cerebral cysticercosis. New England Journal of Medicine 327, 696–701. 12. Mitchel, W.G. (1997) How to manage patients with neurocysticercosis? Pediatric neurocysticercosis in North America. European Neurology 37, 126–129. 13. Morales, N.M., Agapejev, S., Morales, R.R., et al. (2000) Clinical aspects of neurocysticercosis in children. Pediatric Neurology 22, 287–291. 14. Carpio, A., Bittencourt, P.R.M. (1998) Epilepsy in the Tropics. In: Chopra, J.S., Sawhney, I.M.S. (eds) Neurology in Tropics. B.I. Churchill-Livingstone, New Delhi, India, pp. 527–532. 15. Sander, J.W., Shorvon, S.D. (1996) Epidemiology of the epilepsies. Journal of Neurology, Neurosurgery and Psychiatry 61, 433–443. 16. Carpio, A. (1995) Epidemiology of tropical neurology in South America. In: Rose, F.C. (ed.) Recent Advances in Tropical Neurology. Elsevier Science, Amsterdam, the Netherlands, pp. 31–42. 17. Pal, D.K., Carpio, A., Sander, J.W.A.S. (2000) Neurocysticercosis and epilepsy. Journal of Neurology, Neurosurgery and Psychiatry 68, 137–143. 18. Goodman, K., Ballagh, S.A., Carpio, A. (1999) Case control study of seropositivity for cysticercosis in Cuenca, Ecuador. American Journal of Tropical Medicine and Hygiene 60, 70–74. 19. Schantz, P.M., Moore, A.C., Munoz, J.L., et al. (1992) Neurocysticercosis in an orthodox Jewish community in New York city. New England Journal of Medicine 327, 692–695. 20. Tsang, V.C., García, H.H. (1996) Immunoblot diagnostic test (EITB) for Taenia solium cysticercosis and its contribution to the definition of this under-recognized but serious public health problem. In: García, H.H., Martínez, S. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo, SA, Lima, Peru, pp. 259–268. 21. García, H.H., Gilman, R., Martinez, M., et al. (1993) Cysticercosis as a major cause of epilepsy in Peru. Lancet 341, 197–200. 22. Garcia-Noval, J., Allan, J.C., Fletes, C., et al. (1996) Epidemiology of Taenia solium taeniasis and cysticercosis in two rural Guatemalan communities. American Journal of Tropical Medicine and Hygiene 55, 282–289. 23. Palacio, L.G., Jimenez, I., García, H.H., et al. (1998) Neurocysticercosis in persons with epilepsy in Medellin, Colombia. Epilepsia 39, 1334–1339. 24. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis and cysticercosis in humans and pigs in a village in Morelos, México. American Journal of Tropical Medicine and Hygiene 46, 677–685. 25. Hauser, W.A., Hesdorffer, D.H. (1990) Epilepsy: Frequency, Causes and Consequences. Demos Press, New York, pp. 197–244. 26. Commission on Epidemiology and Prognosis of the International League Against Epilepsy (1997) The epidemiology of the epilepsies: future directions. Epilepsia 38, 614–618. 27. Carpio, A., Placencia, M., Santillan, F., et al. (1994) Proposal for a new classification of neurocysticercosis. Canadian Journal of Neurological Sciences 21, 43–47. 28. Martinez, H.R., Rangel-Guerra, R., Arredondo-Estrada, J.H., et al. (1995) Medical and surgical treatment in neurocysticercosis. A magnetic resonance study of 161 cases. Journal of the Neurological Sciences 130, 25–34.

220

A. Carpio and W.A. Hauser

29. Singhal, B.S., Ladiwala, U. (1995) Neurocysticercosis in India. In: Rose, F.C. (ed.) Recent Advances in Tropical Neurology. Elsevier Sciences, Amsterdam, the Netherlands, pp. 31–42. 30. Ahuja, G.K., Mohanta, A. (1982) Late onset epilepsy. Acta Neurologica Scandinavia 66, 216–226. 31. Sawhney, I.M., Lekhra, O.P., Shashi, J.S., et al. (1996) Evaluation of epilepsy management in a developing country: a prospective study of 407 patients. Acta Neurologica Scandinavia 94, 19–23. 32. Carpio, A., Hauser, W.A. (1999) Prognosis of first seizure in patients with neurocysticercosis. Epilepsia 40 (Suppl. 2), 271. 33. Rodriguéz-Carbajal, J., Placencia, M., Carpio, A. (1983) Calcificaciones intracraneales anormales: 135 casos estudiados por T.A.C. Neurologia Neurocirurgica y Psiquiatria 24, 49–60. 34. Leite, J.P., Terra-Bustamante, V.C., Fernandes, R.M.F., et al. (2000) Calcified neurocysticercosis lesions and postsurgery seizure control on temporal lobe epilepsy. Neurology 55, 1485–1491. 35. Sakamoto, A.C., Bustamante, V.C.T., Garzón, E., et al. (1992) Cysticercosis and epilepsy. In: Kotagal, P., Luders, H.O. (eds) The Epilepsies: Etiologies and Prevention. Academic Press, San Diego, pp. 275–282. 36. Terra, V., Sakamoto, A.C., Santos, A.C., et al. (1995) Epilepsy and cerebral cysticercosis: correlation between CT, EEG, and clinical findings. Epilepsia 36 (Suppl.3), 226. 37. Singh, G., Sachdev, M.S., Tirath, A., et al. (2000) Focal cortical-subcortical calcifications (FCSCs) and epilepsy in the Indian subcontinent. Epilepsia 41, 718–726. 38. Pradhan, S., Kathuria, M.K., Gupta, R.K. (2000) Perilesional gliosis and seizure outcome: a study based on magnetization transfer magnetic resonance imaging in patients with neurocysticercosis. Annals of Neurology 48, 181–187. 39. Nash, T.E., Petronas, N.J. (1999) Edema associated with calcified lesions in neurocysticercosis. Neurology 53, 777–781. 40. Sheth, T.N., Pilon, L., Keystone, J., et al. (1998) Persistent MR contrast enhancement of calcified neurocysticercosis lesions. American Journal of Neuroradiology 19, 79–82. 41. Chayasirisobhon, S., Menoni, R., Chayasirisobhon, W., et al. (1999) Correlation of electroencephalography and the active and inactive forms of neurocysticercosis. Clinical Electroencephalography 30, 9–11. 42. Murthy, J.M., Reddy, V.S. (1998) Clinical characteristics, seizure spread patterns and prognosis of seizures associated with a single small cerebral calcified CT lesion. Seizure 7, 153–157. 43. Cukiert, A., Puglia, P., Scapola, H.B., et al. (1994) Congruence of the topography of intracranial calcifications and epileptic foci. Arquivos de Neuropsiquiatria 52, 289–294. 44. Williamson, P.D., Thadani, V.M., Darcey, T.M., et al. (1882) Occipital lobe epilepsy: clinical characteristics, seizures spread patterns, and results of surgery. Annals of Neurology 31, 3–13. 45. Cendes, F., Cook, M.J., Watson, C., et al. (1995) Frequency and characteristics of dual pathology in patients with lesional epilepsy. Neurology 45, 2058–2064. 46. Salinas, R., Prasad, K. (1998) Drugs in neurocysticercosis (tapeworm infection of the brain). In: Garner, P., Gelband, H., Olliaro, P., et al. (eds.) Infectious Diseases Module of The Cochrane Database of Systematic Reviews [database on disk, CDROM and online; updated 02 December 1997]. The Cochrane Collaboration; Issue 1. Update Software, Oxford. 47. Kramer, L.D. (1995) Medical treatment of cysticercosis. Ineffective. Archives of Neurology 52, 101–102. 48. Caplan, L.R., Estanol, B., Mitchel, W.G., et al. (1997) How to manage patients with neurocysticercosis. European Neurology 37, 124–131. 49. Carpio, A., Santillan, F., Leon, P., et al. (1995) Is the course of neurocysticercosis modified by treatment with anthelminthic agents? Archives of Internal Medicine 155, 1982–1988. 50. Carpio, A., Hauser, W.A., Lisanti, N., et al. (1999) Prognosis of epilepsy in Ecuador: a preliminary report. Epilepsia 40 (Suppl. 2), 110. 51. Cockerell, O.C., Johnson, A.L., Sander, J.W.A.S., et al. (1997) Prognosis of epilepsy: a review and further analysis of the first nine years of British National General Practice Study of Epilepsy, a prospective population-based study. Epilepsia 38, 47–55. 52. Semah, F., Picot, M.C., Adam, C., et al. (1998) Is the underlying cause of epilepsy a major prognostic factor for recurrence? Neurology 51, 1256–1262. 53. Annerges, J.F., Hauser, W.A., Coan, S.P., et al. (1998) A population-based study of seizures after traumatic brain injuries. New England Journal of Medicine 338, 20–24.

22

Cerebrovascular Manifestations of Neurocysticercosis Fernando Barinagarrementeria and Carlos Cantú

Introduction Arteritis or vasculitis refers to inflammation of the wall of an artery (arteritis) or vein (phlebitis). It has been attributed to a variety of aetiological agents1. Intracranial arteritis is a well-recognized complication of several infectious diseases2–4. The presence of Taenia solium metacestodes in human tissue triggers an inflammatory response that varies from patient to patient and from tissue to tissue. The severity of the inflammatory reaction is related to different stages of the cysticercus, being less intense in the foremost and last stages of its life cycle5. It may involve blood vessels located in the vicinity of the cysts. In the given circumstances, all three layers of the vessel wall may be affected, producing a true panarteritis6. Cysticercotic endarteritis has been classically considered as a small vessel disease related to cyst(s) located in close relation to basal arteries5,6. Therefore, small deep (lacunar) infarcts are frequent. However, major arteries may also be involved and are often thickened and narrowed by arteritis. There is histopathological evidence of adventitial thickening, medial fibrosis and endothelial hyperplasia, which evolve to occlusion of the arterial lumen and cerebral infarction. As a rule, cerebral arteritis is related to presence of chronic meningitis and focal or diffuse arachnoiditis7.

Cerebrovascular complications of neurocysticercosis (NC) were first described in the early part of the 19th century in a patient with cysticercal meningitis, in whom necropsy disclosed intracranial arteritis8. While several reports have emphasized the existing relationship between NC and stroke during the last few years, these have been limited to isolated case reports and small clinical series2,9–16. This clinical aspect of NC has been poorly reviewed in world literature and despite its global recognition, NC is usually not described as a cause of stroke in contemporary neurology and stroke textbooks.

Frequency of Cerebrovascular Disease in NC The frequency of stroke in several large published series of NC varies between 2% and 15%17–19. Among 352 consecutive patients with NC, Barinagarrementeria and Del Brutto, found seven (2%) instances of lacunar stroke10. On a different note, among more than 700 consecutive stroke patients who attended a stroke clinic until 1991, the same group reported 144 cases with lacunar syndromes; 12 (8%) of them were due to NC20. One may also obtain an idea about the incidence of cerebrovascular involvement by studying the frequency of angiographic

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

221

222

F. Barinagarrementeria and C. Cantú

abnormalities in NC. Thus, Monteiro et al. from Portugal found cysticercotic arteritis in 2% of patients with NC21. In comparison, Rocca and Monteagudo reported angiographic abnormalities compatible with arteritis in 23 (50%) of 46 patients with NC22. In our series of 28 patients with subarachnoid cysticercosis, angiographic abnormalities compatible with arteritis were noted in 15 (54%)23.

Thalamomesencephalic syndrome This is a condition with grave prognosis and stuttering but relentless progression, incidental to severe perimesencephalic arachnoiditis and occlusion of the thalamopeduncular branches of the mesencephalic artery25. Clinical features include impaired vertical gaze, pupillary abnormalities, somnolence, paraparesis and urinary incontinence.

Clinical Features Large territorial infarction In common with other non-atherosclerotic vasculopathies, cysticercotic arteritis is commonly encountered in young individuals. The mean age at diagnosis was 36 years in a series of 65 patients described by Cantú and Barinagarrementeria7. Generally, individuals with stroke due to NC have no underlying vascular risk factors. Cysticercotic arteritis can involve the small, medium and large sized vessels. Small vessel occlusion with consequent lacunar infarction is most frequent.

Lacunar syndromes The term ‘lacunar syndromes’ originally referred to clinical features associated with small infarcts resulting from atheromatous or embolic occlusion of penetrating branches of large arteries. It was later realized that these syndromes might also result from inflammatory arteriopathies. In the particular context of NC, Barinagarrementeria and Del Brutto described seven patients with lacunar syndromes due to NC10. The patients presented with typical lacunar syndromes including pure motor hemiparesis, ataxic hemiparesis and sensorimotor paralysis10,24. Lacunar infarctions were located in the posterior limb of internal capsule or corona radiata on computed tomography or magnetic resonance imaging (CT/MRI) (Fig. 22.1a–c). Four of these patients had evidence of a racemose cyst in the ipsilateral suprasellar cistern. It was surmised that the cyst and the surrounding meningeal inflammatory reaction and subsequent arachnoiditis led to occlusion of a penetrating branch of the proximal segment of the middle cerebral artery (Fig. 22.1a–c).

Occlusion of large blood vessels including the middle and anterior cerebral arteries and even the internal carotid artery may occur in NC13,15,16,25. Large infarctions are infrequent in comparison to deep small infarcts. Large vessel arteritis results from inflammatory degeneration of closely located cysticerci. On occasion, large vessel arteritis and consequent infarction is precipitated by an inflammatory response to the administration of anticysticercal drugs9,15. The latter should, therefore, be administered with caution in those patients with extensive cyst load, located particularly in relation to major arteries.

Haemorrhagic stroke Subarachnoid, parenchymal and intracystic haemorrhage may occur in the setting of NC3,25,26. These complications are extremely rare. Subarachnoid haemorrhage may result from the rupture of a mycotic aneurysm that develops in relation to a racemose cyst adherent to an artery (Fig. 22.2)25,26.

Clinicopathological Correlations Occlusive stroke characteristically occurs in the setting of meningeal racemose cysticercosis25. Among various locations and stages, stroke is more commonly seen with involvement of the basal cisterns and during the inflammatory stages as recognized by pleocytosis and/or increased protein upon cerebrospinal fluid (CSF) examination. Very rarely, arterial occlusion may occur in the set-

Cerebrovascular Manifestations of Neurocysticercosis

223

Fig. 22.1. (a) Axial T2-weighted MRI scan shows a cystic lesion in the left suprachiasmatic cistern, adjacent to the middle cerebral artery. (b) Axial T2-weighted MRI scan reveals cerebral infarction in the left middle cerebral artery territory secondary to vasculitis associated with a suprachiasmatic cyst. (c) Coronal T1-weighted Gd-MRI scan, taken several months after stroke onset, shows a persistent focal enhancement of the cyst and the old cerebral infarction in the ipsilateral corona radiata.

ting of parenchymal NC16. Besides, the occurrence of stroke is also determined by the extent of arachnoiditis. In a study of 65 patients with cerebrovascular complications of NC, Cantú and Barrinagarrementeria found that those with focal arachnoiditis had a sudden onset of the disease, implying the occurrence of a symptomatic cerebral infarction7. In comparison, only 20% of those with diffuse arachnoiditis had an apoplectic onset.

In the latter group, epilepsy and intracranial hypertension were the most frequent presenting manifestations. Headache in association with cerebral infarction occurred in about one-third of patients with focal arachnoiditis. It is possible to predict the occurrence, nature and severity of cerebrovascular involvement by studying the distribution of cysticercal disease and the severity of concomitant chronic arachnoiditis7. When cysts are confined to a

224

F. Barinagarrementeria and C. Cantú

Fig. 22.2. Mycotic aneurysm of the middle cerebral artery formed in relation to a degenerating cysticercus after surgical removal of both. (Source: Svetlana Agapejev, São Paulo, Brazil.)

focal area and with mild or no arachnoiditis, they involve small penetrating vessels with ensuing lacunar infarcts and syndromes. When focal cysticercosis is accompanied by marked inflammatory response as evidenced by severe abnormalities upon CSF examination, large vessels of the circle of Willis tend to get involved, thereby producing large cerebral infarct(s) (Fig. 22.3a and b, Fig. 22.4a and b). Finally, the most severe form of arteritis affecting both large and small arteries occurs when cysticerci are widely distributed throughout the subarachnoid space, associated with an intense inflammatory profile of the CSF.

Investigations Angiography The first angiographic study of cerebral arteritis in NC was made in 1932 by Moniz et al., who reported two patients with arteritis involving the intracranial portion of the internal carotid artery27. More recently, we reported angiographic abnormalities in 15 of 28 patients with subarachnoid cysticercosis23. A stroke syndrome was found in 80% of these patients. The most commonly involved vessels upon angiography were the middle (Figs

Fig. 22.3. (a) Coronal T1-weighted Gd-MRI scan demonstrates diffuse enhancement of the basal cisterns, extending to the proximal portion of the Sylvian fissures; small cysticerci are evident. (b) Lateral left angiogram discloses the common carotid artery with segmental stenosis of the middle cerebral artery (arrow and arrowhead).

Cerebrovascular Manifestations of Neurocysticercosis

225

Fig 22.4. (a) Coronal T1-weighted Gd-MRI scan shows numerous cysticerci in the basal cisterns and both Sylvian fissures, with only a mild meningeal enhancement. (b) Corresponding left anteroposterior carotid artery angiogram reveals a segmental narrowing of the trunk of the middle cerebral artery (arrow).

22.3b and 22.4b) and posterior cerebral arteries. The latter were involved in more than half of the patients. Single artery involvement was noted in eight patients. However, angiographic abnormalities were noted in two arteries in four patients and three or more arteries in three patients, respectively. A diffuse meningeal enhancement was observed by gadolinium (Gd)-MRI in five out of seven patients with involvement of more than one artery upon angiography. Interestingly, we observed asymptomatic cerebral arteritis in 20% of the patients with subarachnoid cysticercosis.

CSF examination CSF abnormalities correlate with the location of cysticercus and are more commonly seen in the setting of meningeal-racemose cysticercosis. Therefore, as a rule the CSF study is abnormal in individuals with cysticercotic arteritis. We noted CSF abnormalities in 58 (89%) of 65 patients with documented cysticercotic arteritis7. The abnormalities included lymphocytic pleocytosis (57; 88%), increased protein levels (44; 68%) and hypoglycorrhagia (24; 37%). CSF eosinophilia was noted in 33 (51%) patients, while immunological tests for cysticercosis were positive in

56 (86%). The intensity of inflammation depicted by the CSF study correlated with the severity and extent of arteritis and the degree of meningeal enhancement upon GdMRI, so that patients with diffuse basal involvement upon Gd-MRI exhibited severe and persistent CSF abnormalities.

MRI (including Gd-MRI) Gd-MRI outlines the presence and distribution of cysts, character and extent of arachnoiditis and the number and location of cerebral infarctions. In our series of 65 patients with cerebrovascular complications, MRI detected one or more cyst(s) in the subarachnoid space, commonly in the basal or Sylvian cisterns (Fig. 22.3a) in the neighbourhood of the ischaemic area in 54 (83%)7. Uncommonly, Gd-MRI may not visualize cysts but reveal only intense enhancement of the meninges. Based on the degree and extent of meningeal enhancement upon GdMRI, chronic arachnoiditis associated with cysticercotic arteritis can be categorized as focal or diffuse28. Focal arachnoiditis is identified by contrast enhancement restricted to a single cerebral cistern, whereas diffuse arachnoiditis is characterized by enhancement involving several cerebral cisterns.

226

F. Barinagarrementeria and C. Cantú

Transcranial Doppler (TCD) Although cerebral angiography is exquisitely sensitive for diagnosing cerebral arteritis, it has the limitations of being expensive and invasive. Moreover, cerebral vasculitis secondary to infectious chronic arachnoiditis is an evolving condition with variable morphological features. As a result, serial follow-up studies are often required to demonstrate its presence and outcome. It is desirable to have a non-invasive and reproducible diagnostic test for cerebral vasculitis. Several recent studies have suggested the utility of TCD in the setting of certain inflammatory conditions of the central nervous system29–31. A preliminary study explored the role of TCD in evaluation of cysticercotic arteritis in nine patients with subarachnoid cysticercosis and stroke32. Findings upon TCD were compared with cerebral angiography in all cases. Cerebral vasculitis was diagnosed sonographically by the finding of abnormal flow velocity in the main cerebral arteries, consistent with an occlusive or stenotic pattern. Sonographic abnormalities suggestive of cerebral vasculitis in major intracranial arteries were detected in all six patients with arterial lesions recognized by cerebral angiography. On the other hand, TCD and cerebral angiography were normal in three patients, thus reflecting involvement of small penetrating arteries as demonstrated by the MRI finding of small deep cerebral infarctions. In addition, TCD was found to be an excellent tool to monitor disease progression and prognosis. Five of the six patients with abnormal TCD at stroke onset were available for long-term follow-up. Over several months, a gradual return of blood flow velocities towards normal was observed in two patients. Resolution of the stenotic patterns of middle cerebral and basilar arteries

occurred within 4–6 months. Conversely, in three patients, serial TCD demonstrated persistence of occlusive and stenotic patterns, suggesting arterial scarring or fibrosis. Thus, TCD permitted evaluation of the natural history of cysticercotic inflammatory arteriopathy. The role of TCD vis-à-vis cerebral angiography in detecting stenosing lesions of the basal cerebral arteries was evaluated in 54 patients with chronic meningitis, including 27 patients with subarachnoid cysticercosis33. Specificity and positive and negative predictive values were excellent (95–100%). The reliability was rated as good to excellent (0.64–0.86). However, the sensitivity varied from 60 to 88%. Further experience with TCD in the detection and follow-up of cysticercotic vasculitis is required. At this time, we can surmise that TCD is a useful means for the detection of a concomitant arteriopathy in subarachnoid cycticercosis. Serial TCD monitoring provides insight into the temporal resolution or progression of this arteritis and may help to clarify its prognostic implications. It may be able to recognize patients at risk of cerebral occlusion and monitor therapeutic interventions.

Conclusions Stroke is an important but under-recognized complication of subarachnoid-meningeal cysticercosis. Deep lacunar infarcts, with characteristic lacunar syndromes occur because of the endarteritis involving small penetrating arteries. Large territorial infarctions are uncommon. Gd-MRI, CSF examination and cerebral angiography are standard tools for the evaluation of arteritis and its related pathological processes. TCD is emerging as an important non-invasive tool for diagnosing and monitoring arteritis.

References 1. Solé-Llenas, J., Pons-Tortella, E. (1978) Cerebral angiitis. Neuroradiology 18, 1–11. 2. Alarcón, F., Hidalgo, F., Moncayo, J., et al. (1992) Cerebral cysticercosis and stroke. Stroke 23, 224–228. 3. Ferris, E.J., Levine, H.L. (1973) Cerebral arteritis: classification. Radiology 109, 327–341. 4. Leeds, E.N., Goldberg, H.I. (1971) Angiographic manifestations in cerebral inflammatory disease. Radiology 98, 595–604.

Cerebrovascular Manifestations of Neurocysticercosis

227

5. Escobar, A. (1983) The pathology of neurocysticercosis. In: Palacios, E., Rodríguez-Carbajal, J., Taveras, J.M. (eds) Cysticercosis of the Central Nervous System. Charles C. Thomas, Springfield, Illinois, pp. 27–54. 6. Escobar, A., Nieto, D. (1972) Parasitic diseases. In: Minckler, J. (ed.) Pathology of the Nervous System. McGraw-Hill, New York, pp. 2503-2521. 7. Cantú, C., Barinagarrementeria, F. (1996) Cerebrovascular complications of neurocysticercosis: clinical and neuroimaging spectrum. Archives of Neurology 53, 233–239. 8. Nieto, D. (1982) Historical note on cysticercosis. In: Flisser, A., Willms, K., Laclete, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 1–7. 9. Woo, E., Yy, Y.L., Huang, C.Y. (1988) Cerebral infarction precipitated by praziquantel in neurocysticercosis – a cautionary note. Tropical and Geographical Medicine 40, 143–146. 10. Barinagarrementeria, F., Del Brutto, O.H. (1989) Lacunar syndromes due to neurocysticercosis. Archives of Neurology 46, 415–417. 11. Rodriguez-Carbajal, J., Del Brutto, O.H., Penagos, P., et al. (1989) Occlusion of the middle cerebral artery due to cysticercotic angiitis. Stroke 20, 1095–1099. 12. terPenning, B., Litchman, C.D., Heier, L. (1992) Bilateral middle cerebral artery occlusions in neurocysticercosis. Stroke 23, 280–283. 13. Levy, A.S., Lillehei, K.O., Rubinstein, D., et al. (1995) Subarachnoid neurocysticercosis with occlusion of a major intracranial artery: case report. Neurosurgery 36, 183–188. 14. Sangla, S., De Broucker, T., Abgrall, S., et al. (1995) Cerebral infarction disclosing neurocysticercosis. Revue Neurologique (Paris) 15, 277–280. 15. Bang, O.Y., Heo, J.H., Choi, S.A., et al. (1997) Large cerebral infarction during praziquantel therapy in neurocysticercosis. Stroke 28, 211–213. 16. Kohli, A., Gupta, R., Kishore, J. (1997) Anterior cerebral artery territory infarction in neurocysticercosis: evaluation by angiography and in vivo proton MR spectroscopy. Pediatric Neurosurgery (Basel) 26, 93–96. 17. Sotelo, J., Guerrero, V., Rubio, F. (1985) Neurocysticercosis: a new classification based on active and inactive forms. A study of 753 cases. Archives of Internal Medicine 145, 442–445. 18. McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri: review of 127 cases. Archives of Neurology 39, 534–539. 19. Grisiola, J.S., Wiederholt, W.C. (1982) CNS cysticercosis. Archives of Neurology 39, 540–544. 20. Barinagarrementeria, F. (1990) Non-vascular etiology of lacunar syndromes. Journal of Neurology, Neurosurgery and Psychiatry 53, 1111. 21. Monteiro, L., Almeida-Pinto, J., Leite, T., et al. (1994) Cerebral cysticercus arteritis: five angiographic cases. Cerebrovascular Diseases 4, 125–133. 22. Rocca, E., Monteagudo, E. (1966) An angiographic study of neurocysticercosis. International Journal of Surgery 86, 520–528. 23. Barinagarrementeria, F., Cantú, C. (1998) Frequency of cerebral arteritis in subarachnoid cysticercosis. An angiographic study. Stroke 29, 123–125. 24. Barinagarrementeria, F., Del Brutto, O.H. (1988) Neurocysticercosis and pure motor hemiparesis. Stroke 19, 1156–1158. 25. Del Brutto, O.H. (1992) Cysticercosis and cerebrovascular disease: a review. Journal of Neurology, Neurosurgery and Psychiatry 55, 252–254. 26. Soto-Hernandez, J.L., Gomez-Llata, S., Rojas-Echeverri, L.A., et al. (1996) Subarachnoid hemorrhage secondary to a ruptured inflammatory aneurysm: a possible manifestation of neurocysticercosis: case report. Neurosurgery 38, 197–200. 27. Moniz, E., Loff, R., Pacheco, I. (1932) Sur le diagnostic de la cysticercosis cérebrale. Encephale (Paris) 27, 42–53. 28. Chang, K.H., Han, M.H., Roh, J.K., et al. (1990) Gd-DTPA-enhanced MR imaging of the brain in patients with meningitis: comparison with CT. AJNR American Journal of Neuroradiology 11, 69–76. 29. Haring, H.P., Rotzer, H.K., Reindl, H., et al. (1993) Time course of cerebral blood flow velocity in central nervous system infections. A transcranial doppler sonography study. Archives of Neurology 50, 98–101. 30. Muller, M., Merkelbach, S., Huss, G.P., et al. (1995) Clinical relevance and frequency of transient stenoses of the middle and anterior cerebral arteries in bacterial meningitis. Stroke 26, 1399–1403. 31. Gupta, R., Mahapatra, A.K., Bhatia, R. (1995) Serial transcranial doppler study in meningitis. Acta Neurochirurgica (Wein) 137, 74–77.

228

F. Barinagarrementeria and C. Cantú

32. Cantú, C., Villarreal, J., Soto, J.L., et al. (1998) Cerebral cysticercotic arteritis: detection and follow-up by transcranial doppler. Cerebrovascular Diseases 8, 2–7. 33. Cantú, C., Soto, J.L., Villarreal, J., et al. (1998) Detection and follow-up of cerebral arteritis by transcranial doppler in patients with chronic meningitis. Neurology 50 (Suppl. 4), A400 (Abstract).

23

Taenia solium Cysticercosis: Uncommon Manifestations

Gagandeep Singh and Indermohan S. Sawhney

Introduction The most common manifestations of neurocysticercosis (NC) include seizures, headaches and focal neurological deficits. However, the disorder is known for its pleomorphic presentations. Medical literature is replete with reports of unusual presentations. Knowledge of these uncommon manifestations is important and failure to recognize them often leads to misdiagnosis and delay in management. Several unusual manifestations are reviewed in this chapter with emphasis on spinal cysticercosis.

Spinal cysticercosis Walton first described the occurrence of a cyst in the ventral portion of the cervical spinal cord at autopsy in 18811. Since then, only a limited number of cases of spinal cysticercosis have been described in literature, emphasizing the rarity of this condition. Its incidence at autopsy is about 3%2. Several authors consider that autopsy series underestimate the true frequency of spinal cysticercosis on account of the fact that the spinal cord is not routinely examined3–5. However, spinal cysticercosis is rare in clinical series of cysticercosis as well, its frequency being less than 2.5%4,6. There were

only two cases with spinal involvement in the large series of 450 patients of Dixon and Lipscomb6. The condition is likely to be over-represented in neurosurgical series as a number of such cases end up with surgical treatment7. Finally, spinal involvement was seen in 5 of 356 cases of a radiological series of NC8. Spinal cysticercosis is classified on the basis of anatomical localization of cysts. The disease may occur at extradural, intradural extramedullary and intramedullary locations. Extradural cysticercosis is extremely rare (Fig. 23.1a and b)9–13. Canelas et al. reviewed published literature and collected 35 cases of intradural extramedullary spinal cysticercosis (IDEMSC) and seven cases of intramedullary spinal cysticercosis (IMSC)4. Going by their survey of literature, IDEMSC is five times more common than IMSC. Pathologically, the former condition is represented by racemose cysts in the intradural compartment as well as arachnoiditis. IDEMSC represents the downward migration of intracranial-subarachnoid racemose cysts (Fig. 23.2a–c)4,10,14. Queiroz et al. performed elaborate calculations in order to estimate the probability of location of cysticerci in relation to the regional blood supply to various segments of the spinal cord5. They concluded that IMSC was acquired through a haematogenous route and

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

229

230

G. Singh and I.S. Sawhney

Fig. 23.1. Extradural spinal cysticercosis. CT myelographic (a) and histological (b) appearances. (Reproduced with permission from reference 11.)

Fig. 23.2. Intradural extramedullary spinal cysticercosis. T1 sagittal (a) and T2 axial (b) and sagittal (c) MRI sections demonstrating that intradural extramedullary cysticercosis represents an extension of cranial subarachnoid cysticercosis into the spinal canal. (Reproduced with permission from reference 27.) (Source: E. Citfci and A. Hayman, Baylor, Texas, USA.)

Uncommon Manifestations

explained the preference of intramedullary cysts to the thoracic spinal cord on the basis of increased proportion of arterial blood supply to the latter. Canelas et al. proposed a ventriculoependymal route for migration of cysts from the ventricles to the spinal cord4. From a mechanistic point of view, myelopathy occurs as a result of direct compression. However, unattached intradural extramedullary cysts, which have migrated from the cranium are probably asymptomatic15–18. They are soft, pliable and noncompressive. Degeneration of the cysts produces an intense inflammatory reaction leading to arachnoiditis and attendant complications, including vascular compromise, myelitis, degeneration of spinal cord and, rarely, syringomyelia4,14,19. Clinical symptoms and signs of myelopathy are discernable only during the inflammatory stage8.

Intradural Extramedullary Spinal Cysticercosis (IDEMSC) Clinical features Rocca stressed that IDEMSC was most common in the cervical spinal canal10. He suggested that the presence of septations in the cervical intradural space prevented the downward migration of cysts. However, our review of published cases of this condition suggests that cysts can produce symptoms at any location, with lumbosacral and cervical cord involvement being more common4,8,10,14–22. Zee et al. gave a lucid account of the clinical course of IDEMSC8. Their patient presented with intracranial hypertension due to hydrocephalus. Cisternal racemose cysticercosis was diagnosed and a cyst was demonstrated in the cisterna magna. It was later found to have migrated to the cervical spinal canal. The patient was asymptomatic at this stage. One year later, the patient rapidly developed a spinal cord syndrome. A number of cysts with intense arachnoiditis were observed upon radiological examination of the spine. The case illustrates the point that intracranial symptoms and signs precede myelopathy in IDEMSC. Further-

231

more, extramedullary spinal cysts are mostly asymptomatic by themselves and produce symptoms and signs of spinal involvement because of arachnoiditis when they degenerate. Canelas et al. classified spinal syndromes due to IDEMSC into three varieties: spinal cord compression syndrome, tabes dorsalis syndrome and meninigomyelitis4. We reviewed available English and Latin literature on this subject and could find the following clinical presentations4,8,10,14–22: 1. Cauda equina – Conus syndrome: Cardinal features include lumbar pain radiating to the lower limbs, crural paresis and sphincter disturbances developing over a few weeks– months. Clinical examination reveals evidence of involvement of the cauda equina and conus medullaris in varying combinations4,14,23. 2. Cervical or thoracic myeloradiculopathy: Cysts and arachnoiditis in the cervicothoracic spinal canal produce a painful, asymmetrical, patchy neurological deficit. The condition can be differentiated from other causes of myeloradiculopathy only by its association with intracranial cysticercosis. 3. Posterior column syndrome: Canelas et al. described two patients with what they referred to as a tabetiform syndrome and another presenting with subacute combined degeneration of the spinal cord4. Corresponding spinal imaging or pathological confirmation was not available but a cysticercal aetiology was inferred from an association with intracranial cysticercosis. 4. Amyotrophic lateral sclerosis syndrome: Meyer first described the syndrome of amyotrophic lateral sclerosis, i.e. severe bibrachial amyotrophy and spastic paraparesis, pathologically characterized by degeneration of the anterior horn cells and lateral funiculi and cysticercal arachnoiditis in the cervical spinal cord24. Only very few clinicopathological reports of this condition are available24–26. 5. Syringomyelia: Syringomyelia in association with syringobulbia can occur as a result of occlusion of the fourth ventricle outlet by cysticercal arachnoiditis and meningeal fibrosis19.

232

G. Singh and I.S. Sawhney

Spinal imaging Earlier diagnostic techniques included pantopaque (now banned) and metrizamide myelography. Multiple cysts and irregular patchy filling defects characteristic of arachnoiditis could be seen upon myelography. Unattached cysts were found located dorsal to the spinal cord, with the patient in the prone position. Cysts were also noted to migrate over a few vertebral segments with changes in body position during myelography15–18. A fluid level in the cyst was often noted upon metrizamide myelography, due to diffusion of metrizamide across the cyst wall8. Leite et al. reported spinal MRI findings in 12 patients with IDEMSC and emphasized upon the presence of enhancing cystic structures and sheet-like enhancement of the spinal subarachnoid space (Fig. 23.3a–c)20. Any vertebral level can be involved and multiple levels of involvement is most char-

acteristic. The presence of intracranial cisternal racemose cysticercosis supports a diagnosis of IDEMSC (Fig. 23.2a–c)27.

Management and outcome Unfortunately, adequately long follow-ups are not available for a number of the reported cases of IDEMSC. Few reports describe a limited follow-up, in particular, the immediate postoperative outcome4,7,10. Unattached cysts are easy to remove at surgery. In addition, irrigation of the spinal canal with physiological saline to remove additional cysts may be undertaken. Adherent degenerating cysts are difficult to excise and usually require microneurosurgical procedures28. A major determinant of the surgical outcome is the extent of arachnoiditis. Limited sectors of arachnoiditis may be dealt by microneurosurgical techniques7,28. Surgical results are poor with more extensive and intense arachnoidi-

Fig. 23.3. T2 (a) and T1 (b) and post-gadolinium (c) sagittal MRI showing the subarachnoid space filled with serpentine material giving a high signal on T2 and low signal on T1 images. (Reproduced with permission from reference 23.)

Uncommon Manifestations

tis. Some patients may improve partially after surgery and then deteriorate again due to ongoing arachnoiditis.

Intramedullary Spinal Cysticercosis (IMSC) A number of anecdotal case reports of IMSC are accompanied by reviews of published literature4,5,29. We reviewed clinical and laboratory features of 24 cases reported in English literature from 1976 onwards5,22,29–40.

Clinical features IMSC occurs mostly in young adults. In the 24 case reports, that we analysed, mean (±SD) age was 28 ±14 years (range: 10–60 years). There were 21 males and four females. Myelopathy due to IMSC develops over a few days–weeks. Exceptions to this rule have been one case reported by Holtzman et al. of a progressive myelopathy developing over 8 years and another reported by Sharma et al. of a patient with radicular pains of 10 years duration29,30. An acute spinal cord syndrome may be precipitated as a result of the administration of anticysticercal therapy for cerebral cysticercosis in an individual with otherwise asymptomatic IMSC34. The symptom complex of IMSC comprises of sensorimotor paralysis below the level of lesion with or without bladder and bowel involvement. Local pain is an important symptom29,31,32,35,36,38,40 but may be absent22,30,37,39. There may be signs of meningeal irritation32,40. IMSC is commonly located in the thoracic spinal cord. Exceptionally, it may involve the cervical spinal cord1,34,36 or conus 31 medullaris . There may be more than one intramedullary cyst or associated IDEMSC and arachnoiditis22,31. Castillo et al. reported the occurrence of multiple cysts in one individual31. Two cysts, located in the conus medullaris and thoracic spinal cord were of cysticercal aetiology and the third cystic lesion in the cervical spinal cord was attributable to hydromelia resulting from obstruction of the central canal by the former.

233

Spinal imaging MRI is the standard investigative procedure for diagnosis of IMSC. Upon MRI, the spinal cord may be focally enlarged. A focal cystic lesion can be seen that is hyperintense on T2and hypointense on T1-weighted images (Fig. 23.4). A review of published MRI descriptions of IMSC revealed that a scolex was visible in only two out of 12 case reports20,29,31,34,37. The scolex is isointense to the cord parenchyma in T1 sections and is not visible in T2 sections. The cyst wall and the surrounding cord parenchyma and meninges may enhance after contrast, whilst the scolex is non-enhancing. There may be surrounding oedema. Intramedullary cysts may be multiple and may be associated with hydromelia. In the latter situation, it is important to differentiate

Fig. 23.4. Intramedullary spinal cysticercosis. T2 (left) and T1 (right) sagittal MRI of the cervical spinal cord revealing a cystic intramedullary lesion. (Source: Prakash Singh, New Delhi, India.)

234

G. Singh and I.S. Sawhney

between the two conditions. Hydromelia appears hypointense on T2 sections because of mobility of fluid in the cavity. Other cystic lesions that may be considered in the differential diagnosis of intramedullary cysticercosis include primary and secondary neoplastic cysts, syringomyelia and hydatid cysts. Corral et al. reported MRI appearance of IMSC in a patient with multiple cerebral cysticercosis who was administered albendazole for treatment of cerebral cysts34. Spinal MRI revealed focal spinal cord enlargement, oedema and irregular enhancement with no definite cystic lesion. The authors surmised that these appearances were of an inflammatory parenchymal reaction to a dead cyst. It may be interesting to speculate a cysticercal aetiology in some of the cases of myelopathies with clinical and MRI features of non-specific myelitis in cysticercus endemic areas.

Ancillary investigations In contradistinction to IDEMSC, which is usually accompanied by intracranial involvement, it is not uncommon for IMSC to occur as an isolated lesion with no clinical or radiological evidence of cerebral involvement. However, the presence of cerebral cysticercosis is a supportive feature in the preoperative diagnosis of IMSC. Since IMSC is an oligocystic form of disease, stool evaluations for Taenia solium, blood eosinophilia, soft tissue calcifications and CSF examination are rarely contributory to the diagnosis5,22,32,39,40.

Pathology Morphological aspects of IMSC have been studied at necropsy and surgery. The cyst causes focal, smooth enlargement of the spinal cord. There may occur thickening and adhesions of the overlying leptomeninges5,29,31. The glistening white capsule of the cyst can be seen after a vertical myelotomy. The cyst is usually non-adherent and can be dissected from the cord without difficulty29,30,40. The fluid contained in the cyst may be turbid or xanthochromic29,30. The outer surface contains fine hair-like projec-

tions, while the inner surface has a smooth glistening texture30. A scolex may or may not be discernable. Calcific knobs may be seen39. Microscopically, there is surrounding gliosis and granulation tissue consisting of plasma cells and foamy macrophages29,30,40.

Management and outcome Until recently, surgery was advocated as standard treatment for IMSC. It was often diagnosed at surgery30,31 or rarely at necropsy5 because myelographic appearances of this condition were non-specific. Postoperative neurological outcome varied. As a general rule, there was partial recovery over few months with some residual permanent neurological deficit. The availability of MRI offered the unique opportunity of identifying intramedullary cysts before surgery and opened prospects for non-surgical management. To our knowledge, there are at least three reports of IMSC treated with albendazole for about a month34,37. The outcome has been extremely favourable in terms of neurological recovery in all three cases. It may be necessary to co-administer corticosteroids in order to manage inflammatory myelopathic exacerbations related to anticysticercal treatment. In view of the rarity of the condition, an accurate assessment of the role of non-operative management of IMSC will perhaps take time.

Sellar Cysticercosis The pituitary fossa and its neighbourhood are an infrequent site for cysticercosis. Besides a series of eight pathologically verified cases reported by Del Brutto and colleagues41, there have been isolated case reports of the condition in literature42–45.

Clinical features Asymptomatic sellar cysts On occasion, sellar cysts may be asymptomatic and present with sellar enlargement on skull radiographs2. Incidental sellar cysts have been reported at necropsy2,46.

Uncommon Manifestations

Visual loss This occurs as a result of chiasmal compression by the sellar or suprasellar cysts and optochiasmatic arachnoiditis. Loss of vision is usually bilateral; associated bitemporal field defects may be detectable41. It develops rapidly within 3–12 weeks in contrast to other pituitary tumours, where it may take months or years to manifest41,47. Ophthalmoscopic examination discloses optic atrophy. Papilloedema is a rare feature and signifies associated hydrocephalus due to meningeal cysticercosis or raised intracranial pressure due to involuting parenchymal cysticerci41. Exophthalmos may be observed uncommonly, reflecting growth of the cyst into the cavernous sinus41. Endocrine disturbances Several endocrinopathies, including panhypopituitarism, diabetes insipidus and galactorrhea have been reported in one-third to one-half of published cases41,44. Clinical manifestations due to associated cysticerci in other locations In the published literature, seizures have been reported in about 40% of the patients with sellar cysticercosis41. The occurrence of seizures should invoke a consideration of associated parenchymal cysticercosis. By comparison, seizures occur in less than 10% of all pituitary tumours and reflect involvement of the mesial temporal structures (Table 23.1)47. Similarly, the occurrence of intracranial hypertension indicates an association with hydrocephalus or oedematous parenchymal cysts41. On occa-

235

sion, a patient with limited sellar cysticercosis may develop hydrocephalus or parenchymal cysticercosis months after initial presentation41. Truly intrasellar cysticercosis does not cause cerbrovascular involvement. However cysts in a suprasellar location, or intrasellar cysts which have grown in size into the suprasellar cistern may occlude blood vessels and lead to infarcts. Radiological diagnosis Raised intracranial pressure may lead to sellar enlargement and erosion of the sella on lateral skull radiographs42,45. Calcified parenchymal cysts may be observed41. CT is more useful in the diagnosis of sellar cysticercosis. A cystic hypodense intrasellar mass can be seen on CT. The cyst wall may or may not enhance following contrast administration. Calcification of the cyst wall never occurs. Bone erosion is rarely evident in cases of sellar cysticercosis not associated with raised intracranial pressure. Coexistent features like parenchymal cysts, subarachnoid cysts and hydrocephalus, if noted, substantiate a diagnosis of cysticercal pathology in the sella turcica41. The differential diagnosis of a cystic mass in the sella turcica includes adenoma with an intra-adenomatous cyst, cysts of the Rathke’s cleft, arachnoid cyst, germinoma, epidermoid and empty sella syndrome. A dominant cystic component is clearly visualized and the cyst wall is easily demarcated on MRI. The cyst fluid may be isointense, hyperintense or hypointense to the CSF depending upon its protein content. The cyst wall usually does not enhance with con-

Table 23.1. Differentiating features between sellar cysticercosis and pituitary adenoma. Feature

Sellar cysticercus

Pituitary adenoma

Visual symptoms

Seizures Radiology

Always present at diagnosis; rapid progression (20 days– 8 months) Approximately 40% Cystic morphology: common

Recovery of visual function after surgery

Poor

May be absent; slow progression (months– years) Approximately < 10% Cystic morphology: rare and inconspicuous Good

236

G. Singh and I.S. Sawhney

trast. Multiplanar MRI is useful in demonstrating the anatomical extent of the cystic lesion. Sagittal and coronal sections clarify its relationship to the optic chiasma and may demonstrate arachnoiditis.

Laboratory diagnosis CSF examination was normal in five of eight patients studied by Del Brutto et al. All five patients had isolated sellar cysticercosis. Serological studies were also non-contributory in these patients41.

Management Surgical resection of the cyst is the standard management of sellar cysticercosis. A transfrontal approach is usually advocated in view of suprasellar growth of the cysts and the frequent association with optochiasmatic arachnoiditis41. However, if MRI studies rule out suprasellar growth and arachnoiditis, a transsphenoidal approach may be undertaken42. The prognosis for recovery of visual and endocrine function is dismal. None of the patients in the series reported by Del Brutto et al. showed good postoperative recovery in visual function41. This is in contrast to the good prognosis for recovery of visual function after surgery for pituitary adenomas, where complete recovery of vision may be noted in up to 20% and partial recovery in 80% of patients47. It may be surmised that optochiasmatic arachnoiditis, which often accompanies sellar and suprasellar cysticercosis, is responsible for poor postoperative outcome of visual function. There is no evidence so far that either praziquantel or albendazole help in resolution of sellar cysticercosis.

boy with CT features of cerebral cysticercosis48. The myoclonus resolved, as did the CT abnormalities after two courses of praziquantel, in addition to sodium valproate. Otero et al. reported the development of complex partial seizures and an acquired language disorder in a previously normal child at age 649. The child had comprehension deficits, literal and verbal paraphasias and telegraphic spontaneous speech. Electroencephalography revealed sharp and slow waves arising from the left centrotemporal region. MRI revealed a small subarachnoid cysticercus cyst situated deep in the left Sylvian fissure. The authors postulated that the unique location of the cyst and the age of the patient were responsible for the Landau–Kleffner-like presentation. The patient’s condition, including seizures and the language dysfunction, improved after a course of albendazole. Chung et al. gave an account of chronic intractable left mesial temporal lobe epilepsy of 20 years’ duration, in a middle-aged man50. Imaging studies revealed a calcified cysticercal cyst in the left medial temporal region in addition to ipsilateral hippocampal atrophy. The patient was seizurefree after standard left temporal lobectomy. Histological sections revealed degenerated cysticercus and scolex embedded in the hippocampus in addition to neuronal loss. The authors postulated that the calcified cysticercus cyst was responsible for the peculiar epileptological condition. Finally, there is documentation of periodic lateralized epileptiform discharges in massive parenchymal cysticercosis51,52. These rare electroencephalographic abnormalities are attributed to the inflammatory reaction in the brain to cystic degeneration either spontaneously or as a result of anticysticercal treatment.

Extrapyramidal Disorders Uncommon Epileptic Syndromes Partial or generalized tonic clonic seizures are commonly seen in a majority of the cases with parenchymal cysticercosis. Uncommon epileptic syndromes have been reported in few cases. Puri et al. described stimulussensitive generalized myoclonus in a young

Few of the earliest descriptions of NC in literature alluded to extrapyramidal manifestations. Bickerstaff recounted the case of a 51-year-old housewife of an Indian soldier, who developed progressive choreoathetosis along with mental impairment, a clinical picture resembling Huntington’s chorea53.

Uncommon Manifestations

Necropsy revealed cysticerci in both caudate and lentiform nuclei. There is a paucity of reports of extrapyramidal disorders in recent literature. Nevertheless, parkinsonism, unilateral tremors, chorea, facial myokymia and blepharospasm have been described in NC6,53–56. Racemose cysticercosis of the posterior fossa may present with ataxia57. Bickerstaff described the occurrence of progressive ataxia in a 50-year-old woman58. He reported operative findings of ‘a delicate elongated structure resembling a bunch of grapes lying over and around the lower brainstem and hanging on to the upper cervical region’. Ataxia may be intermittent as with cysts of the fourth ventricle, where intermittent obstruction (Bruns’ syndrome) is the cause of isochronal symptoms57. It may be asymmetric, when it results from racemose cysts of the cerebellopontine angle58.

Lingual Cysticercosis Lingual cysts are usually observed in the context of disseminated cysticercosis59. Rarely, cysticercosis may occur as an isolated tongue mass59. The differential diagnosis in such instances includes lingual carcinoma, haemangioma, mucocoele, papilloma and lingual thyroid.

Sudden Death Sudden death in otherwise asymptomatic persons may occur due to massive antigenic release from ruptured cysts in the brain parenchyma and surrounding meninges60,61. The massive antigenic release may result in a severe inflammatory response in the brain as well as systemic anaphylactic reaction with pulmonary and visceral oedema. In

237

one report of such a case, trauma from a vehicular accident led to rupture of cysts and sudden death61.

Conclusions The presenting manifestations of T. solium cysticercosis are primarily related to the location of cysticerci. Therefore, when cysticerci lodge in remote areas within the central nervous system, they produce uncommon manifestations. Among the protean manifestations, spinal cysticercosis, sellar cysticercosis and uncommon epileptic and extrapyramidal syndromes are reviewed. Spinal cysticercosis is classified in to extradural spinal cysticercosis, intradural extramedullary (IDEMSC) (most common), intramedullary (IMSC) and mixed forms. IDEMSC is commonly accompanied by intracranial cysticercosis; it is believed to result from the downward migration of intracranial subarachnoid-racemose cysticerci. When the spinal cysts degenerate, they lead to the clinical syndrome of a myeloradiculopathy involving the cervical spinal cord most commonly. Intramedullary cysticerci occur in isolation with preference for the thoracic spinal cord. MRI is the imaging modality of choice for spinal cysticercosis. The treatment of IDEMSC is surgical. Surgery is also advocated for IMSC, though reports of successful medical treatment are now accumulating. Sellar cysticercosis of the racemose variety presents with visual and endocrine disturbances. The diagnosis is established by MRI and the treatment is surgical. Several other uncommon manifestations reviewed here often present a diagnostic and therapeutic challenge to the treating physician both in endemic and non-endemic regions.

References 1. Walton, G.L. (1881) A case of cysticercosis in the substance of spinal cord. Boston Medical and Surgical Journal 105, 511–512. 2. Briceno, C.E., Biagi, F., Martinez, B. (1961) Cisticercosis: observaciones sobre 97 casos de autopsia. Presna Medicina México 26, 193–197. 3. Guccione, A. (1919) La cisticercosi del Sisterna Nervoso Centrale Umano. Societâ Editrice Libraria, Milan, Italy.

238

G. Singh and I.S. Sawhney

4. Canelas, H.M., Ricciardi-Cruz, O., Escalante, O.A.D. (1963) Cysticercosis of the nervous system: less frequent clinical forms. III. Spinal cord forms. Arquivos de Neuropsiquiatria 21, 77–86. 5. Queiroz, L.D.S., Filho, P.J., Callegaro, D., et al. (1975) Intramedullary cysticercosis: case report, literature review and comments on pathogenesis. Journal of the Neurological Sciences 26, 61–70. 6. Dixon, H.B.F., Lipscomb, F. (1961) Cysticercosis: an analysis and follow-up of 450 cases. Medical Research Council Special Report Series 299. Her Majesty’s Stationery Office, London, pp. 1–58. 7. Colli, B.O., Assirati, J.A., Jr, Machado, H.R., et al. (1994) Cysticercosis of the central nervous system. II. Spinal cysticercosis. Arquivos de Neuropsiquiatria 52, 187–199. 8. Zee, C.S., Segall, H.D., Ahmadi, J., et al. (1986) CT myelography in spinal cysticercosis. Journal of Computer Assisted Tomography 10, 195–198. 9. Gallani, N.R., Zambelli, H.J.L., Roth-Vargas, A.A., et al. (1992) Cisticercose medular. Relato de dois casos, revisao lieraturaa e comentarios sobre a paogenia. Arquivos de Neuropsiquiatria 50, 343–350. 10. Rocca, E.D. (1959) Cisticercosis intramedular. Revista Neuropsiquiatria (Lima) 22, 166–173. 11. Mohanty, A., Das, S., Sastry Kolluri, V.R., et al. (1998) Spinal extradural cysticercosis: a case report. Spinal Cord 36, 285–287. 12. Kurrien, F., Vickers, A.A. (1977) Cysticercosis of the spine. Annals of Tropical Medicine and Parasitology 71, 213–217. 13. Vlok, G.J., Wells, M.C. (1988) Vertebral cysticercosis. A case report. South African Medical Journal 73, 730–731. 14. Colli, B.O., Martelli, N., Assirati, J.A., et al. (1994) Cysticercosis of the central nervous system. I. Surgical treatment of cerebral cysticercosis. Arquivos de Neuropsiquiatria 52, 166–186. 15. Dorfsman, J. (1966) Radiological aspects of spinal cysticercosis. Acta Radiologica (Diagnostic) (Stockholm) 5, 1003–1006. 16. Zee, C.S., Segall, H.D., Boswell, W., et al. (1988) MR imaging of neurocysticercosis. Journal of Computer Assisted Tomography 12, 927–934. 17. Kim, K.S., Weinberg, P.E. (1985) Spinal cysticercosis. Surgical Neurology 24, 80–82. 18. Savoiardo, M., Cimino, C., Passerini, A., et al. (1986) Mobile myelographic filling defects: spinal cysticercosis. Neuroradiology 28, 166–169. 19. Escobar, A., Vega, J. (1981) Syringomyelia and syringobulbia secondary to arachnoiditis and fourth ventricle blockage due to cysticercosis. A case report. Acta Neuropathologica (Berlin) 7, 389–391. 20. Leite, C.C., Jinkins, J.R., Escobar, B.E., et al. (1997) MR imaging of intramedullary and intraduralextramedullary spinal cysticercosis. AJR American Journal of Roentgenology 6, 1713–1717. 21. Gupta, P.K., Sridhar, R., Rao, T.N., et al. (1995) Spinal subarachnoid cysticercosis. Neurology India 43, 60–61. 22. Isidro-Llorens, A., Dachs, F., Vidal, F., et al. (1993) Spinal cysticercosis. Case report and review. Paraplegia 31, 128–130. 23. Lau, K.Y., Roebuck, D.J., Mok, V. (1998) MRI demonstration of subarachnoid neurocysticercosis simulating metastatic disease. Neuroradiology 40, 724–726. 24. Meyer, E. (1906) Amyotrophische Lateralsklerosis combiniert mit multiplen Hirncysticerken. Archiv Psychiatrie Nervenkrankheiten 41, 640–652. (Cited in reference 45.) 25. Guillain, G., Perisson, J., Bertrand, I., et al. (1927) Cysticercose cerebrale racemeuse. Revue Neurologique (Paris) ii, 433–444. 26. Kahn, P. (1972) Cysticercosis of the central nervous system with amyotrophic lateral sclerosis: case report and review of the literature. Journal of Neurology, Neurosurgery and Psychiatry 35, 81–87. 27. Citfci, E., Diaz-Marchan, P.J., Hayman, L.A. (1999) Intradural-extramedullary spinal cysticercosis: MR imaging findings. Computer Medical Imaging Graphics 23, 161–164. 28. Colli, B.O., Martelli, N., Assirati, J.A., et al. (1995) Surgical treatment of cysticercosis of the central nervous system. Neurosurgery Quarterly 5, 34–54. 29. Sharma, B.S., Banerjee, A.K., Kak, V.K. (1987) Intramedullary spinal cysticercosis. Clinical Neurology and Neurosurgery 89, 111–116. 30. Holtzman, R.N.N., Hughes, J.E.O., Sachdev, R.K., et al. (1986) Intramedullary cysticercosis. Surgical Neurology 26, 181–191. 31. Castillo, M., Quencer, R.M., Donovan Post, M.J., et al. (1988) MR of intramedullary spinal cysticercosis. AJNR American Journal of Neuroradiology 9, 393–395. 32. Garza-Mercado, R. (1976) Intramedullary cysticercosis. Surgical Neurology 5, 331–332. 33. Mehta, D.S., Malik, G.B., Dar, J., et al. (1971) Intramedullary cysticercosis. Neurology India 19, 92–94. 34. Corral, I., Quereda, C., Moreno, A., et al. (1996) Intramedullary cysticercosis cured with drug treatment. A case report. Spine 21, 2284–2287.

Uncommon Manifestations

239

35. Sawhney, I.M., Singh, G., Lekhra, O.P., et al. (1998) Uncommon presentations of neurocysticercosis. Journal of the Neurological Sciences 154, 94–100. 36. Kishore L.T., Gayatri, K., Naiad, M.R., et al. (1991) Intramedullary spinal cord cysticercosis. A case report and literature review. Indian Journal of Pathology and Microbiology 34, 219–221. 37. Garg, R.K., Nag, D. (1998) Intramedullary spinal cysticercosis: response to albendazole: case reports and review of literature. Spinal Cord 36, 67–70. 38. Agrawal, V., Thomas, M., Maheshwari, M.C. (1995) Intramedullary cysticerci. Journal of the Association of Physicians of India 43, 138. 39. Singh, A., Aggarwal, N.D., Malhotra, K.C., et al. (1966) Spinal cysticercosis with paraplegia. British Medical Journal ii, 684–685. 40. Hesketch, K.T. (1965) Cysticercosis of the dorsal cord. Journal of Neurology, Neurosurgery and Psychiatry 28, 245–248. 41. Del Brutto, O.H., Guevara, J., Sotelo, J. (1988) Intrasellar cysticercosis. Journal of Neurosurgery 69, 58–60. 42. Prosser, P.R., Wilson, C.B., Forsham, P.H. (1978) Intrasellar cysticercosis presenting as a pituitary tumor: successful trans-sphenoidal cystectomy with preservation of pituitary function. American Journal of Tropical Medicine and Hygiene 27, 976–978. 43. Rafel, H., Gomez-Llata, S. (1985) Intrasellar cysticercosis. Case report. Journal of Neurosurgery 63, 975–976. 44. Dickenson, C.J. (1955) Cysticercosis and panhypopituitarism. Proceedings of the Royal Society of Medicine 48, 892. 45. Argenta, G. (1956) Su di un caso di cisticercosi generalizata con sindrome di adenoma ipofisario. Revue Neurologique (Paris) 26, 197–204. 46. Kufs, F. (1915) Über einen fall von basaler Cysticerken-meningitis mit cysticercus der Hypophysis und schwerer depressives Psychose und über andere Faile von Hirncystcerken. Zeitschrift Germaine Neurologie und Psychiatrie 30, 286–304. 47. McDonald, W.I. (1982) The symptomatology of tumours of the anterior visual pathways. Canadian Journal of Neurological Sciences 9, 381–390. 48. Puri, V., Chowdhury, V., Gulati, P. (1991) Myoclonus: a manifestation of neurocysticercosis. Postgraduate Medical Journal 67, 68–69. 49. Otero, E., Cardova, S., Diaz, F., et al. (1989) Acquired epileptic aphasia (the Landau–Kleffner syndrome) due to neurocysticercosis. Epilepsia 30, 569–572. 50. Chung, C.K., Lee, S.K., Chi, J.G. (1998) Temporal lobe epilepsy caused by intrahippocampal calcified cysticercus: a case report. Journal of Korean Medical Science 13, 445–447. 51. De Carvalho-Filho, P., Arruda, O.M., De Melo-Souza, S.E. (1989) Periodic lateralized epileptiform discharges in neurocysticercosis. Arquivos de Neuropsiquiatria 47, 94–99. 52. Vijayan, P., Suri, M.L., Sahai, B., et al. (1977) Periodic lateralized discharges in EEG in cerebral cysticercosis. Neurology India 25, 38–42. 53. Bickerstaff, E.R. (1955) Cerebral cysticercosis: common but unfamiliar manifestations. British Medical Journal i, 1055–1058. 54. Beydoun, S.R. (1994) Facial myokymia secondary to neurocysticercosis. Muscle Nerve 17, 1060–1061. 55. Jimenez-Jimenez, F.J., Molina-Arjona, J.A., Roldan-Montaud, A., et al. (1992) Blepharospasm associated with neurocysticercosis. Acta Neurologica (Napoli) 14, 56–59. 56. Assiss, J.L., Tenuto, R.A. (1948) Cisticerco racemoso intraventricular: estipaco cirurgica. Arquivos de Neuropsiquiatria 6, 247–253. 57. Lobato, R.D., Lamas, E., Portillo, J.M., et al. (1981) Hydrocephalus in cerebral cysticercosis. Pathogenic and therapeutic considerations. Journal of Neurosurgery 55, 786–793. 58. Bickerstaff, E.R., Cloake, P.C.P., Hughes, B., et al. (1952) The racemose form of cerebral cysticercosis. Brain 75, 1–17. 59. Gupta, S.C., Gupta, S.C. (1995) Cysticercosis of the tongue. Ear Nose Throat Journal 74, 177–178. 60. Ndhlovu, C.E. (1997) An uncommon presentation of cysticercosis. Central African Journal of Medicine 43, 207–209. 61. Verma, S.K., Agarwal, B.B.L., Agarwal, G. (1998) Sudden death in neurocysticercosis by trauma. Forensic Science International 95, 23–26.

24

The Story Behind Solitary Cysticercus Granuloma Vedantam Rajshekhar

Reasons for misdiagnosis as tuberculoma

Introduction Single, small, enhancing computed tomography lesions (SSECTLs) were noted by Bhargava and Tandon, in their report on the computed tomography (CT) appearance of ‘tuberculomas’ of the brain1. They reported lesions that were small (<10 mm), often solitary, enhanced with contrast injection and were associated with surrounding oedema in patients presenting predominantly with seizures, and labelled them as ‘microtuberculomas’ or ‘immature tuberculomas’. A histological diagnosis was however lacking in any of their patients. Subsequently, several Indian reports on CT appearance of tuberculoma identified similar lesions2–4. Wadia et al. suggested that at least a third and probably more of SSECTL were tuberculomas4. Their conclusion was based upon a study of 39 patients with SSECTL, of whom 10 had active pulmonary tuberculosis, two had histological evidence of tuberculosis and another patient developed tubercular meningitis while on antiepileptic drugs (AEDs) alone. They advocated antitubercular therapy (ATT) for all patients with SSECTL. Van Dyk, Kumar et al., and Domingo and Peter also considered SSECTL to be of tubercular aetiology5–7.

One or more of the following arguments were used to support the diagnosis of tuberculoma in patients with SSECTL: 1. Tuberculosis and intracranial tuberculomas were believed to be highly prevalent among Indian patients, constituting up to 25% of all intracranial space-occupying lesions. 2. There was similarity in the CT morphology of these lesions and the cerebral parenchymal enhancing lesions in patients with proven tubercular meningitis. 3. A number of these patients had evidence of healed pulmonary focus of tuberculosis on chest roentgenograms. 4. Often, there was a history of exposure to the disease from within the family or close neighbours. 5. Patients often had a positive Mantoux test. 6. Finally, the lesions appeared to respond when a course of ATT was administered to the patients1,2,4. Although the above arguments are sound in themselves, none of them supports a definitive diagnosis of tuberculosis. Some of the arguments were also founded upon outdated data:

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

241

242

V. Rajshekhar

1. Data showing high rates of intracranial tuberculomas in Indians were derived from published series of intracranial space-occupying lesions in the 1960s and 1970s8,9. Their incidence has fallen considerably since then, and at present less than 5% of all patients with intracranial space-occupying lesions in our department have tuberculomas10. 2. Apparently, CT morphology of the SSECTL and parenchymal brain lesions in those with tubercular meningitis or histologically proven multiple tuberculomas are quite similar. But these observations made in patients with multiple intracranial lesions cannot be extrapolated and applied to solitary lesions. It is also well known that the socalled typical appearance of a tuberculoma can be mimicked by various other pathological lesions including neoplasia. 3. Evidence of exposure to tuberculosis, history of tuberculosis and roentgenographic evidence of healed pulmonary tuberculosis may support but do not provide definitive proof for a diagnosis of intracranial tuberculoma in individuals from regions that are endemic for tuberculosis. Similarly, most individuals in endemic regions will have a positive skin test, regardless of whether or not they have active infection. 4. Therapeutic trials are frequently applied in medical practice to provide a diagnosis. But while looking for a ‘response’ to a therapeutic regimen, ATT in this case, the possibility of spontaneous resolution was not considered.

SSECTL A number of reports of patients with solitary enhancing CT lesions identified the latter as tuberculomas, solitary cysticercus granuloma (SCG), ‘disappearing’ or ‘vanishing’ CT lesions. We felt that their identification and management might be better if patients with these lesions were identified by the characteristics of their CT lesions namely, the single, small (contrast) enhancing, CT lesions (SSECTLs)12,13. The abbreviation SSECTL (Fig. 24.1) thus avoided attributing a defini-

The Disappearing CT Lesion A fortuitous discovery by Sethi et al. challenged the diagnosis of ‘microtuberculoma’ for SSECTL11. They reported spontaneous resolution of SSECTL in 11 individuals with seizures who had been prescribed ATT for their lesions but did not consume the medications. Thus for the first time, it became evident that the resolution of SSECTL was in no way linked to ATT but was a spontaneous phenomenon. This posed the first serious challenge to the aetiological consideration of ‘microtuberculoma’ for these lesions.

Fig. 24.1. Initial (a) and follow-up (b) contrastenhanced CT of patient with seizures showing complete resolution of the lesion in the follow-up scan performed after 6 months.

Solitary Cysticercus Granuloma

tive aetiology (tuberculoma or SCG) or implying a biological behaviour pattern (‘disappearing’) at the time of initial presentation.

SSECTL: cause or effect Some authors considered SSECTL to be the result of a breakdown of the blood–brain barrier and the surrounding oedema to be vasogenic in origin – after intense ictal activity that accompanied seizures14. They believed that the CT abnormality was not caused by a structural lesion but was the result of the seizure. Indeed, while few patients with prolonged seizures or status epilepticus may exhibit transient, enhancing lesions that follow the wavy contour of the cortical mantle, this pattern is distinct from the CT morphology of the SSECTL15. Furthermore, only few and not all individuals with status epilepticus or prolonged or repeated focal or generalized seizures exhibit this abnormality even if the CT is performed soon after the ictus. On the other hand, many patients with SSECTL have had their CT scan examination several days or weeks after their last seizure and it is unlikely that a physiological change linked to seizure activity would persist for several weeks or months.

Histological attributes of the SSECTL Histological study of SSECTL would have laid to rest the controversy regarding their aetiology and management. But this was not easily accomplished for several reasons. The lesions were small and most of them were situated in eloquent areas of the brain such as the sensorimotor region. As most of these lesions do not produce any changes in the overlying pia-arachnoid, localizing them was not easy. Moreover, there was a fair chance of producing neurological deficit with surgical excision of the lesion. Finally, there was justifiable reluctance in subjecting individuals with SSECTLs to surgery given the fact that these lesions could spontaneously resolve. We initially performed closed stereotactic biopsies of these lesions through a twist drill craniostomy or a burr hole in 10 patients.

243

However, the small bit of tissue (2 × 1 × 1 mm) that was obtained from stereotactic biopsy turned out to be inadequate to reveal the aetiological diagnosis. Only the inflammatory nature of the lesion was evident from this series of stereotactic biopsies. Studies such as culture of the tissue for acid-fast bacilli (AFB) and fungus, and staining the tissue for AFB and fungal elements were all negative. We concluded at that stage that the lesion represented a ‘focal encephalitis’ of undetermined aetiology16. It became evident that to obtain further insight into the aetiology of the lesion more tissue for pathological examination from the lesion, virtually involving excision of this small lesion, was required. This was achieved through excision following stereotactic craniotomy where stereotactic techniques were used to guide the placement of a craniotomy flap and then localize the intracranial target after the dura was opened. In 15 consecutive patients, who underwent an excision of their lesion, cysticercus granuloma was diagnosed in seven, parasitic granuloma without evidence of the parasite in five, chronic inflammation in two, and fibrous cicatrix in one13. Four of the five lesions without the parasite had been sectioned in the operating room after excision and before being placed in the fixative. It is possible that the parasite, which occupies the core of the granuloma, may have spilt out and have been lost. There were no tuberculomas or neoplasia in this series. We concluded that cysticercosis was the cause of most of these lesions and that empirical ATT should therefore be avoided in managing patients with these lesions. These histological findings have been subsequently confirmed in several selected patients who have undergone surgical excision of their lesions17.

Proving that the Disappearing SSECTL is an SCG We performed a study in 1987–1988, involving 30 consecutive patients presenting with seizures and SSECTL12. The initial five patients were managed conservatively with AEDs. The next ten patients underwent nonexcisional stereotactic biopsy. Only a tiny bit

244

V. Rajshekhar

of the lesion was sampled in the stereotactic biopsy and rest of the lesion was left in situ. These 15 patients constituted Group A and their lesions were monitored and followed up upon CT. Finally, 15 consecutive patients with similar clinical and imaging characteristics (Group B) had their lesions excised. Follow-up CT monitoring in 12 of 15 patients in Group A (three were lost to follow-up) revealed disappearance in six, calcific residue in five and reduced size in one. This observation confirmed the fact that the lesions in this larger homogeneous group of 30 patients were disappearing SSECTLs. The histology of the 15 lesions in Group B would therefore indicate the pathology of the disappearing SSECTLs. The pathology of the lesions in Group B has been presented above, i.e. 12 of the 15 biopsies revealed a cysticercus or a parasitic granuloma and the rest, residue of an inflammatory lesion. Therefore, we believe that this provided adequate proof that the ‘disappearing’ SSECTL is an SCG.

Problem of Persistent Lesions Sethi et al. noted resolution of the CT lesion in all of their patients after an interval of 6–24 weeks (with AEDs alone)11. Adopting this time frame, several physicians managing these patients with AEDs alone noted that SSECTLs often persisted upon follow-up CT, performed 3 months later. Moreover, several individuals with persistent lesions continued to have symptoms. The management of these persistent lesions posed a challenge because it was commonly believed that disappearing SSECTLs that resolved within about 3 months were different in aetiology from SSECTLs that were persistent beyond this time frame. It was not uncommon for physicians to resort to ATT in individuals with persistent lesions because of their belief that persistent lesions were likely to be tuberculomas. We looked at the histology of ‘persistent’ and ‘fresh’ lesions in 25 consecutive patients with SSECTL18. The duration of symptoms was less than 12 weeks (3–12 weeks) in six patients and ranged from 4 months to 5 years in 19 patients. Both groups were found to be essentially similar in their clinical and imaging attributes. Importantly,

the histological diagnoses in both groups were identical, revealing a cysticercus or parasitic granuloma in both. There were no tuberculomas or neoplasia in either group. Thus it was abundantly clear that the reason for persistence was not a difference in aetiology but a variable natural history of the SCG in different individuals. Thus we argued that persistent SSECTLs need not be treated any differently from those that resolved early, i.e. with AEDs, provided that patients did not have new symptoms or signs of progressive neurological deficit or raised intracranial pressure.

SSECTLs within the Perspective of Neurocysticercosis Ideally, the cysticercus granuloma should have been an active aetiological consideration in the case of SSECTLs that resolve spontaneously. The appearance of the cysticercus granuloma on CT was known to be identical to that of the SSECTL. Some of the authors who had labelled SSECTL as ‘microtuberculomas’ also commented upon this similarity1,2,19. Furthermore, spontaneous resolution of cysticercus granulomas has been adequately documented20–22. Punctuate calcifications that are sequelae of SSECTL were known to occur in NC well before specific therapy for cysticercosis was introduced. Finally, seizures are the commonest manifestation of NC23. All the above features suggest that a cysticercus granuloma is a likely aetiology for the SSECTL. Several authors, however, dismissed cysticercosis as a cause for SSECTL for one or more reasons2,11,14,19. The three commonly mentioned reasons included: (i) cysticercosis is uncommon among Indians; (ii) it is rare for NC to present as a solitary lesion; and (iii) a cysticercus granuloma would not be expected to resolve spontaneously. Counter-arguments to these are: (i) cysticercosis is endemic in all parts of India; (ii) the myth that solitary cysticercal lesions were rare was derived from data from the Western hemisphere; and (iii) finally, cysticercosis can resolve spontaneously. Several authorities exclude a cysticercal aetiology for the SSECTL on the premise of a negative serological test.

Solitary Cysticercus Granuloma

However, it is worth mentioning that serological tests for cysticercosis including both the ELISA and enzyme-linked immunoelectrotransfer blot (EITB) have poor sensitivity in patients with SCG (see Chapter 33)24,25. Therefore, a negative serological test has no relevance in the diagnostic scheme of SSECTL.

Reports of SSECTL in NC literature Early reports of the CT appearance of cerebral cysticercosis did not mention solitary granulomas26. Zee et al. first drew attention to this form of NC in 198027. Byrd et al. in their report on CT appearances of cerebral cysticercosis, described a group of lesions, which were mostly solitary and enhanced uniformly (the so-called disc lesions)28. These lesions measured between 10 mm and 20 mm in size and did not produce any mass effect. Most of patients harbouring these solitary lesions presented with seizures. Also, in 1983, Minguetti and Ferriera alluded to an entity of ‘single acute lesions’ measuring less than 20 mm in size, in patients presenting with seizures29. In 1988, Mitchell and Crawford described lesions which were obviously similar to SSECTL, in children and suggested that these were a distinctly benign form of NC30. They labelled these lesions as ‘acute lesions’. More recently, in 1995, Del Brutto referred to these lesions as ‘single acute encephalitic

245

form’ and noted that they carried a better prognosis than other forms of NC31.

Diagnostic criteria for SCG We evolved a set of diagnostic criteria for an initial presumptive diagnosis of SCG upon presentation (Table 24.1)32,33. These criteria were derived from clinical and CT observations in patients with histologically proven SCGs and solitary small tuberculomas. The criteria were evaluated and validated prospectively and proved to be extremely reliable in predicting the diagnosis of SCG in Indian patients with seizures. We studied 401 patients presenting with seizures and an SSECTL. Of these, 215 fulfilled all the criteria for the diagnosis of a SCG. A final diagnosis was considered to have been confirmed in 197; 16 patients were excluded due to inadequate follow-up. A false-positive diagnosis of SCG was made in only two patients; one had metastatic disease and the other had pyogenic abscess. A false-negative diagnosis was made in one patient with SCG who had severe oedema causing a midline shift and therefore underwent excision of the lesion. All eight solitary tuberculomas in our study could be clearly distinguished from SCG on the basis of the diagnostic criteria. Overall the diagnostic criteria had a sensitivity of 99.5%, specificity of 98.9%, positive predictive value of 99% and negative predictive value of 99.5%.

Table 24.1. Clinical and computed tomography (CT) criteria for diagnosis of solitary cysticercus granuloma (SCG).* A. 1. 2. 3. 4. B. 1. 2. 3. 4.

Clinical criteria Clinical presentation with seizures Absence of any evidence of a progressive neurological deficit Absence of any features of persistent raised intracranial pressure No clinical evidence of any systemic disease. CT criteria Solitary lesion The lesion should measure less than 20 mm in maximal dimension The lesion should enhance after contrast injection There may or may not be oedema associated with the lesion but it should not be severe enough to produce a shift of the midline structures.

* All criteria, without exception, must be fulfilled to make a diagnosis of SCG.

246

V. Rajshekhar

Confirming an initial diagnosis of SCG It is extremely important that all patients with seizures initially diagnosed to have SCG on the basis of the above listed diagnostic criteria (Table 24.1) be carefully followed up clinically and radiologically to confirm the diagnosis. On clinical follow-up, patients with SCG do not develop focal neurological deficits or features of raised intracranial pressure. Confirmation of the diagnosis of SCG is obtained by any one of the following events:

intense centre. It has a ring-enhancing pattern on gadolinium-enhanced images. MRI does not provide any advantage over a well performed (2–5 mm slice) contrast-enhanced CT scan. When a good quality CT scan reveals an SCG, gadolinium-enhanced MRI is unlikely to reveal additional lesions35. 3. Seizures associated with SCG will respond to a single AED in nearly 90% of cases34. 4. About 4% of patients with SCG have lesions that enlarge upon follow-up (enlarging SCG), but even these do not produce fea-

1. Spontaneous resolution (partial or complete) of the lesion: no other pathology, which causes a clinical-imaging syndrome similar to that of SCG, is known to resolve spontaneously (Figs 24.1 and 24.2). 2. Resolution of the lesion following anticysticercal therapy: the resolution of the lesion should be demonstrated within a short period of completion of anticysticercal therapy. 3. Adverse effects (seizures, headache, vomiting) occurring following the administration of anticysticercal drugs: the adverse effects are incidental to the rapid destruction of the parasite by the drugs and the host response to the parasitic antigens thus released. 4. Pathological diagnosis of cysticercus or parasitic granuloma in an excised lesion. This method of confirming the diagnosis is uncommon, as most patients with SCG will not undergo surgical excision.

Further studies on the behaviour and management of SCG Since our early studies on the pathology of SSECTL, we have studied various other aspects of its biological behaviour. Our findings are summarized below and elaborated in a monograph on the subject34. 1. It became evident from a search of the literature that the SCG was not an isolated regional phenomenon. Although more commonly reported from India, it has been reported from all over the world15. 2. MRI appearance of an SCG is typically seen on T2-weighted images where it appears as a hypointense ring with a hyper-

Fig. 24.2. Initial (a) and follow-up (after 6 months) (b) contrast-enhanced CT of another patient with seizures. No specific therapy apart from antiepileptic drugs was administered to this patient.

Solitary Cysticercus Granuloma

tures of raised intracranial pressure or progressive neurological deficit36. 5. Immunological tests, both the ELISA and EITB, have a poor sensitivity (<50%) in the diagnosis of SCG24,25. 6. Patients with SCG can have early withdrawal of their AED soon after the resolution of their CT lesion with only a less than 10% chance of seizure recurrence (see Chapter 25 for a detailed discussion). This is in contrast to the high rates of seizure recurrence in patients with multilesional NC34. 7. The duration of symptoms does not correlate with the presence or absence of the parasite or its parts in an excised granuloma17. 8. Albendazole therapy can hasten the resolution of about a third of the SCG, but about 40% of patients on albendazole therapy will develop some adverse effect including headache and/or seizures37,38. Steroid therapy does not appear to prevent these adverse reactions37. 9. Up to 3% of SCGs may present with episodic headache alone without any seizures. This presentation of SCGs should be recognized, as the clinical situation could be mistaken for that caused by subarachnoid haemorrhage or acute central nervous system infection39,40.

247

Conclusions Based on our study of the disease for over 13 years, we have proposed a management algorithm for patients with seizures and SSECTL (Fig. 24.3). Patients with SCG are managed primarily with symptomatic therapy, consisting of AEDs alone. An immunological test at presentation consisting of serological assay for cysticercus antibodies using either the ELISA or EITB may be useful if it is positive. A negative test, however, does not rule out cysticercosis. Close clinical monitoring focusing on the appearance of progressive neurological deficit or features of raised intracranial pressure is mandatory. Either of these should alert the physician to the possibility of an alternative diagnosis and prompt an immediate CT scan and histological verification of the lesion. If the patient is asymptomatic except for occasional seizures, a repeat CT scan is performed only at about 6 months after initial presentation. A persistent lesion does not mandate a change in the management strategy except for a possible trail of anticysticercal therapy. Early withdrawal of AEDs can be undertaken following radiological resolution of the granuloma.

References 1. Bhargava, S., Tandon, P.N. (1980) Intracranial tuberculomas: a CT study. British Journal of Radiology 53, 935–945. 2. Tandon, P.N., Bhargava, S. (1985) Effect of medical treatment on intracranial tuberculoma – a CT study. Tubercle 66, 85–87. 3. Vengsarkar, U.S., Pisipaty, R.P., Parekh, B., et al. (1986) Intracranial tuberculoma and the CT scan. Journal of Neurosurgery 64, 568–574. 4. Wadia, R.S., Makhale, C.N., Kelker, A.N., et al. (1987) Focal epilepsy in India with special reference to lesions showing ring or disc like enhancement on contrast computed tomography. Journal of Neurology, Neurosurgery and Psychiatry 50, 1298–1301. 5. Van Dyk, A. (1988) CT of intracranial tuberculomas with specific reference to the ‘target sign’. Neuroradiology 30, 329–336. 6. Kumar, R., Kumar, A., Kohli, N., et al. (1990) Ring or disc like enhancing lesions in partial epilepsy in India. Journal of the Tropical Pediatrics 36, 131–134. 7. Domingo, Z., Peter, J.C. (1989) Intracranial tuberculoma. An assessment of therapeutic 4-drug trial in children. Pediatric Neurology 15, 161–167. 8. Dastur, D.K., Lalitha, V.S., Prabhakar, V. (1968) Pathological analysis of intracranial space occupying lesions in 1000 cases including children. Journal of the Neurological Sciences 6, 575–592. 9. Mathai, K.V., Chandy, J. (1967) Tuberculous infections of the central nervous system. Clinical Neurosurgery 14, 145–177.

248

V. Rajshekhar

Patient with seizures and SSECTL

Antiepileptic drug(s) (AED(s)) Clinical monitoring Serological assay for cysticercus antibodies (ELISA/EITB) Repeat CT scan after 6 months

Lesion disappears/ calcific dot

Lesion same size/smaller

Lesion larger > 2 cm

Continue AEDs Clinical monitoring Repeat CT scan after 6 months Taper AED(s) over weeks

Albendazole treatment

Lesion disappears/ calcific dot

Lesion same size/ smaller

Taper AED(s)

Continue AED(s) Clinical and CT monitoring

Excisional biopsy

Lesion larger > 2 cm

Fig. 24.3. Management algorithm for patients presenting with single, small enhancing CT lesion (SSECTL).

Solitary Cysticercus Granuloma

249

10. Selvapandian, S., Rajshekhar, V., Chandy, M.J., et al. (1994) Predictive value of computed tomography-based diagnosis of intracranial tuberculomas. Neurosurgery 35, 845–850. 11. Sethi, K., Kumar, B.R., Madan, V.S., et al. (1985) Appearing and disappearing CT abnormalities and seizures. Journal of Neurology, Neurosurgery and Psychiatry 48, 866–869. 12. Chandy, M.J., Rajshekhar, V., Ghosh, S., et al. (1991) Single small enhancing CT lesions in Indian patients with epilepsy: clinical, radiological and pathological considerations. Journal of Neurology, Neurosurgery and Psychiatry 54, 702–705. 13. Chandy, M.J., Rajshekhar, V., Prakash, S., et al. (1989) Cysticercosis causing single small CT lesions in Indian patients with epilepsy. Lancet i, 390–391 (Letter). 14. Goulatia, R.K., Verma, A., Mishra, N.K., et al. (1987) Disappearing CT lesions in epilepsy. Epilepsia 28, 523–527. 15. Rajshekhar, V. (1991) Etiology and management of single small CT lesions in patients with seizures: understanding a controversy. Acta Neurologica Scandinavia 84, 465–470. 16. Chandy, M.J., Rajshekhar, V. (1988) Focal epilepsy in India. Journal of Neurology, Neurosurgery and Psychiatry 51, 1234 (Letter). 17. Rajshekhar, V., Chacko, G., Haran, R.P., et al. (1995) Clinicoradiological and pathological correlations in patients with solitary cysticercus granuloma and epilepsy: focus on presence of parasite and oedema formation. Journal of Neurology, Neurosurgery and Psychiatry 59, 284–286. 18. Rajshekhar, V., Chandy, M.J. (1992) Solitary small CT lesions in patients with epilepsy: outstanding issues and further observations. Progress in Clinical Neurosciences 8, 106–110. 19. Rajeswari, R., Sivasubramanian, S., Balambal, R., et al. (1995) A controlled clinical trial of shortcourse chemotherapy for tuberculomas of the brain. Tubercle and Lung Diseases 76, 311–317. 20. Kramer, L.D., Locke, G.E., Byrd, S.E., et al. (1989) Cerebral cysticercosis: documentation of natural history with CT. Radiology 171, 459–462. 21. McCormick, G.F., Zee, C., Heiden, J. (1982) Cysticercosis cerebri: review of 127 cases. Archives of Neurology 39, 534–539. 22. Miller, B., Grinell, V., Goldberg, M.A., et al. (1983) Spontaneous radiographic disappearance of cerebral cysticercosis. Three cases. Neurology 33, 1377–1379. 23. Medina, M.T., Rosas, E., Rubio-Donnadieu, F., et al. (1990) Neurocysticercosis as the main cause of late-onset epilepsy in Mexico. Archives of Internal Medicine 150, 325–327. 24. Rajshekhar, V., Oommen, A. (1997) Serological studies using ELISA and EITB in patients with solitary cysticercus granuloma and seizures. Neurological Infections and Epidemiology 2, 177–180. 25. Singh, G., Kaushal, V., Ram, S., et al. (1999) Cysticercus immunoblot assay in patients with single, small enhancing lesions and multilesional neurocysticercosis. Journal of the Association of Physicians of India 47, 476–479. 26. Mervis, B., Lotz, J.W. (1980) Computed tomography in parenchymal cerebral cysticercosis. Clinical Radiology 31, 521–528. 27. Zee, C.S., Segall, H.D., Miller, C., et al. (1980) Unusual neuroradiological features of intracranial cysticercosis. Radiology 137, 397–407. 28. Byrd, S.E., Locke, G.E., Biggers, S., et al. (1982) The computed tomographic appearance of cerebral cysticercosis in adults and children. Radiology 144, 819–823. 29. Minguetti, G., Ferriera, M.V.C. (1983) Computed tomography in neurocysticercosis. Journal of Neurology, Neurosurgery and Psychiatry 46, 936–942. 30. Mitchell, W.G., Crawford, T.O. (1988) Intraparenchymal cerebral cysticercosis in children: diagnosis and treatment. Pediatrics 82, 76–82. 31. Del Brutto, O.H. (1995) Single parenchymal brain cysticercus in the acute encephalitic phase: definition of a distinct form of neurocysticercosis with a benign prognosis. Journal of Neurology, Neurosurgery and Psychiatry 58, 247–249. 32. Rajshekhar, V., Haran, R.P., Prakash, S., et al. (1993) Differentiating solitary small cysticercus granulomas and tuberculomas in patients presenting with epilepsy: clinical and computerized tomographic criteria. Journal of Neurosurgery 78, 402–407. 33. Rajshekhar, V., Chandy, M.J. (1997) Validation of diagnostic criteria for solitary cerebral cysticercus granuloma in patients presenting with seizures. Acta Neurologica Scandinavia 96, 76–81.

250

V. Rajshekhar

34. Rajshekhar, V., Chandy, M.J. (2000) Solitary Cysticercus Granuloma: the Disappearing Lesion. Orient Longman, Chennai, India. 35. Rajshekhar, V., Chandy, M.J. (1996) A comparative study of contrast computerized tomography and magnetic resonance imaging in patients with solitary cysticercus granulomas and seizures. Neuroradiology 38, 542–546. 36. Rajshekhar, V., Chandy, M.J. (1994) Enlarging solitary cysticercus granulomas. Journal of Neurosurgery 80, 840–843. 37. Rajshekhar, V. (1993) Albendazole therapy for persistent, solitary cysticercus granulomas in patients with seizures. Neurology 43, 1238–1240. 38. Rajshekhar, V. (1998) Incidence and significance of adverse effects of albendazole therapy in patients with a persistent solitary cysticercus granuloma. Acta Neurologica Scandinavia 98, 121–123. 39. Rajshekhar, V. (2000) Severe episodic headache as the sole ictal presentation of solitary cysticercus granuloma. Acta Neurologica Scandinavia 102, 44–46. 40. Garg, R.K., Kar, A.M. (1997) Episodic headache in a non-epileptic patients having disappearing single (ring enhancing) CT lesion. Neurology India 45, 110–111.

25

Seizures Due to Solitary Cysticercus Granuloma J.M.K. Murthy

Introduction A single enhancing computed tomography (CT) lesion measuring less than 20 mm is a common finding upon CT of the brain of patients with seizures in the developing countries where Taenia solium cysticercosis is prevalent1,2. This lesion represents a solitary cysticercus granuloma (SCG) in the acute encephalitic phase3,4. Epileptic seizures are by far the most common clinical manifestation of the latter. Seizures are incidental to the inflammatory response of the brain and can be categorized as acute symptomatic (provoked) seizures (see Chapter 21)1,5. While there is an over-abundance of reports of patients with solitary cysticercus granuloma (SCG) from India, these lesions have been reported from all over the world1,6. The exact prevalence of this lesion in the community has not been studied. Most reports are those of hospital-based series1. In a hospitalbased study from South India, this lesion was the cause of 26% of symptomatic localizationrelated seizures7. In the regions where neurocysticercosis (NC) is prevalent, the probability of a patient with epileptic seizures, with no other obvious cause, harbouring this lesion would be very high. In a study from South India, this probability was as high as 39% (95%CI: 35–43%)8. This lesion was the cause of 50% of acute symptomatic seizures9.

SCG is one of the commonest forms of NC. Its true incidence in comparison to other forms of NC is not clear. In the hospitalbased studies the reported frequency of solitary cyst (either granuloma alone, or SCG and solitary live cysts taken together) varied between 3.5% and 43%2. In the Ecuadorian study, this lesion represented the single most common form of presentation of NC, accounting for 23% of the cases3. In human brain parenchyma, the larval form of T. solium undergoes four stages of evolution: vesicular, colloidal, granularnodular, and calcific10. The term cysticercus granuloma is used broadly to refer to parasites in the colloidal stage or the granularnodular stage. Colloidal cysticerci are dying (not dead) parasites, and not all the colloidal cysticerci die as a result of the host immunological attack. On the other hand, granular cysticerci are dead parasites. Histological evaluation of SCGs seems to span the entire spectrum of pathological process that results from the natural evolution of the parasite (see Chapter 31). Pathological studies of unselected SCGs revealed three types of pathology: (i) cavitary lesions containing parts of an intact or degenerated cysticercus; (ii) inflammatory cavitary lesions without the parasite; and (iii) a non-cavitary hyalinized fibrous nodule with inflammation4,11. Seizures associated with SCG are consequent

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

251

252

J.M.K. Murthy

upon the inflammatory response of the brain. The slow degeneration of the cyst probably acts as a constant source of antigen to induce the host immune response and may be an important factor responsible for recurrence of seizures5.

Solitary Cysticercus Granuloma and Seizures Seizures may be isolated or recurrent and may occur in clusters. The reported frequency of isolated seizures varies from 17.6% and 65%5,12,13 and that of a seizure cluster varies between 20% and 80%5,14,15. After the initial seizure, patients may not experience more attacks for several weeks to months, and at times for several years, only to have a recurrence later. Breakthrough seizures, i.e. seizures that occur after antiepileptic drug (AED) treatment has begun but before achieving remission, are common in patients with SCG13,16. In the author’s series, 37% of patients had breakthrough seizures5. Rarely, status epilepticus can be the presenting feature; its reported incidence in different series varied between 0.07% and 13%5,17,18. Seizures can be of any type. Simple or complex partial seizures with or without secondary generalization are most common and have been reported in 70–88% of patients5,14,16,19. Often these patients present with partial onset or generalized tonic–clonic motor seizures with no localization. Seizure semiology depends on the anatomical location of the lesion. Discordance between clinical localization based on seizure semiology and location of the lesion on neuroimaging is not uncommon. Patients with SCG may exhibit some postictal neurological deficit lasting for few minutes or even weeks.

When to suspect a diagnosis of SCG Patients with SCG present with partial or unlocalized tonic–clonic seizures with no obvious cause. Seizure clusters at presentation or during the course of illness occur in a significant proportion of patients. In the regions

where SCG is prevalent, the diagnostic predictive value of seizure clusters seems to be very high. In our study, the probability of a patient with seizure clusters at the initial presentation or during the course, harbouring this lesion was 88% (J.M.K. Murthy, Hyderabad, unpublished data). Clinical and radiological criteria for SCG have been reviewed by Rajshekhar in Chapter 24. These criteria are specific and sensitive. They have been validated in a prospective study involving 401 patients presenting with seizures and a solitary mass lesion on CT; of these 215 had SCG. The criteria had a sensitivity of 99.5%, specificity of 98.9%, and positive predictive value of 99% and a negative predictive value of 99.5%.

Factors that Influence Seizure Outcome Natural course The natural history of the SCG can take one of two courses: (i) it resolves entirely or (ii) it leaves a punctate calcification as residue. The duration or time of resolution of the lesion is quite variable, from a few weeks to more than a year20,21. A recent long-term follow-up study of the natural history of the CT lesion in patients with SCG suggests that within 6 months of initial presentation over 70% of lesions would show some degree of resolution and 54% of lesions would resolve completely22. The author’s experience, based on the interval between initial presentation and resolution of the CT lesion, suggests that these lesions can be divided into two types: (i) ‘rapid resolvers’, lesions that resolve within few weeks to months, and (ii) ‘persisters’, lesions that resolve over several months to years. Symptoms in patients with persistent lesions are often phasic. Seizures may cease for several months or years, but recur later. No characteristic CT or magnetic resonance imaging (MRI) morphological features distinguish between the two types of lesions. In the author’s study, a demonstrable mural nodule on CT was associated with high rates of seizure recurrence and longer disease duration23. Histological studies corroborate that the mural nodule on CT or MRI

Seizures Due to Solitary Cysticercus Granuloma

corresponds to the scolex and is a pathognomic sign of active cysticercosis24,25. It is possible that some of the lesions with this CT morphology may take several months to degenerate. The presence of a slowly degenerating cyst presumably acts as a constant source of antigen to induce host inflammatory reaction and may be responsible for the phasic nature of the symptoms.

Single small cerebral calcific CT lesion CT in individuals with a seizure disorder may also reveal a single small calcific lesion with or without contrast enhancement and with or without surrounding oedema. It is commonly believed that these lesions represent sequelae of SCG. In a study of the natural history of SCG (V. Rajashekhar, Vellore, personal communication), punctuate calcification was seen as a residue in 22% of patients with SCG. This lesion was seen in 0.65% of brain CT scans of patients with nonseizure disorders from North India26. In a hospital-based study from South India, this lesion was the putative aetiology in 9% of patients with localization related epilepsy23. In the author’s experience, a lesion is more likely to become calcified when the lesion persists for a long time and when there is a demonstrable scolex on CT. However, this needs to be established in prospective follow-up studies. Epileptic seizures associated with single small cerebral calcific CT lesion can be of any type; often these patients present with simple or complex partial seizures, with or without secondary generalization or generalized tonic–clonic seizures. History of previous unprovoked seizure may be noted in about 20% of patients. Neurological examination is usually normal. Discordance between clinical localization based on seizure semiology and location of the lesion on neuroimaging may be observed23,26. In our study the reported ictal semiology was clearly distinctive and allowed the seizure to be localized to the site of the calcific lesion on CT scan in only 26% of the patients23. Seizure remission rates in individuals with a single calcific lesion are similar to

253

those for any other remote symptomatic epilepsy. Of the 97 patients followed by Murthy and Reddy23, for 7 years, 71.5% (95%CI 53.7–85.4%) of patients achieved a 3year seizure remission and 66% (95%CI 32.4–88.2%) achieved a 5-year remission. Patients had a high rate of breakthrough seizures before remission and a high rate of relapse following the withdrawal of AEDs. Seizure relapse can be immediate or after several months to years. It appears these patients require AEDs for long periods of time.

Treatment Treatment of patients with SCG is primarily symptomatic and consists of treating seizures. Use of anticysticercal drugs and corticosteroids is debatable.

Antiepileptic drugs Patients with SCG and epileptic seizures should be treated with AEDs for two reasons: (i) seizures are likely to recur as long as the lesion persists; and (ii) the time period for the resolution of the CT lesion is quite variable. A characteristic feature of patients with SCG is the occurrence of breakthrough seizures in a significant proportion of patients. Most often, good seizure control can be achieved with a single conventional AED (monotherapy)5. As seizures are commonly partial with or without secondary generalization, either carbamezapine or phenytoin is the drug of choice. Acute symptomatic seizures due to SCG are often self-limiting and do not require long-term AED therapy. The latter can be discontinued once the underlying lesion disappears. The time duration of AED therapy in patients with seizures associated with SCG has not been settled. This is partly related to the risk of seizure recurrence with persistence of lesion and the variable time duration for spontaneous resolution5. The time period for resolution of the lesion may vary from a few weeks to more than a year, some times several years1,22. In the author’s series, in one patient who was treated symp-

254

J.M.K. Murthy

tomatically with AED(s) alone, the lesion persisted for 73 months5. Most clinicians treat seizures associated with SCG – for a 2–3 year seizure-free period – just as they would treat any other type of epilepsy27. Our long-term follow-up study has shown that seizures associated with SCG have a good prognosis and AED can safely be withdrawn after resolution of the CT lesion5. The mean period of follow-up was 45 months (range 19–101 months) and only one patient who had CT-demonstrable scar had recurrence of seizures. However, a recent study suggested that gliosis visible on magnetization-transfer spin-echo MRI, 2 years after initial presentation, was positively correlated with the risk of seizure recurrence. The authors argued that such patients should be treated with AEDs for long periods28. Our present policy is to treat patients with SCG with AEDs until such time their CT lesions resolve. Patients in whom follow-up CT scan shows calcification or gliotic scars should be treated as for any remote symptomatic epilepsy. In our series, recurrence of seizures occurred following AED withdrawal in two patients who had a gliotic scar demonstrable on CT.

Anticysticercal drug therapy The role of anticysticercal drug therapy in patients with SCG is not clear. The argument against anticysticercal therapy is that seizures associated with this lesion are because of the inflammatory response of the brain and the lesions are known to resolve spontaneously1. However, earlier reports suggested that anticysticercal therapy influenced the management of patients with SCG in several ways. In a few studies, anticysticercal therapy was shown to benefit most patients with persistent seizures by hastening resolution of the lesion5,27,29. Anticysticercal therapy given with AEDs has been shown to provide better control of seizures29,30. The chance of remaining seizure-free after the withdrawal of AEDs seems to be higher in patients with NC who were previously treated with albendazole31. These findings provide a rationale for the

use of anticysticercal drugs. However, the results of the two double-blind randomized, placebo-controlled studies using albendazole are contradictory. One study involving 75 adult patients did not show any benefit32, whereas another study involving 63 children revealed that anticysticercal therapy hastened resolution of the SCG33. In the author’s opinion, some parasites may involute rapidly over a period of weeks to few months (‘rapid resolvers’), while others involute over a period of several months to years (‘persisters’). Anticysticercal drug trials will be negative if the study mostly involves ‘rapid resolvers’. The real efficacy of anticysticercal therapy can only be tested in patients with lesions that persist for several months to years (‘persisters’). In an open-label study of 43 patients with lesions that persisted beyond 3 months, a response to albendazole was seen in 20 (46.5%) patients27. We did a retrospective analysis of efficacy of albendazole on the seizure-control profile. The baseline demographic characteristics of patients who did not receive albendazole and who did receive albendazole were similar. Clearly, albendazole produced benefits in terms of seizure-control profile in patients with persistent lesions even after 6 months of symptomatic treatment with AEDs (J.M.K. Murthy, Hyderabad, unpublished data). Our data also suggest that there is probably a role for anticysticercal therapy in patients with SCG with a visible scolex. Lesions with this CT morphology are likely to take longer to resolve and are associated with high seizure frequency5. The reader is referred to Chapter 38 for a detailed discussion on the role of anticysticercal therapy in NC.

Seizure Outcome and Prognosis Seizure outcome is good in patients with SCG. Breakthrough seizures before remission are common. Breakthrough seizures were seen in 37% of patients in the author’s series5 and in 14.5% in the series of patients studied by Rajashekhar and Chandy22. A recent longterm follow-up study suggests that epileptic seizures associated with SCG recur as long as the lesion persists; and AEDs can safely be

Seizures Due to Solitary Cysticercus Granuloma

withdrawn once the follow-up CT scan shows resolution of the lesion5. However, patients with calcific lesions should be treated as for any type of remote symptomatic epilepsy. It appears that patients with calcific lesions need AEDs for a long time and seizure relapse rates after drug withdrawal are very high.

Conclusions A single enhancing CT lesion measuring less than 20 mm is a common CT finding in patients with seizures in countries where NC is endemic. Pathological studies suggest that most of these lesions represent SCG.

255

Seizures are the most common manifestation of SCG. Patients with this lesion develop seizures because of the inflammatory response of the brain and their seizures may be categorized as acute symptomatic seizures. The natural history of SCG can usually take one of two forms: (i) it resolves entirely or (ii) a punctate calcification may be left as a residue. Seizure outcome is good even when patients are treated with AEDs alone. Long-term follow-up studies suggest that epileptic seizures associated with SCG can recur as long as the lesion persists; and AEDs can safely be withdrawn once the follow-up CT scan demonstrates resolution of the lesion. The role of anticysticercal therapy is not clear.

References 1. Carpio, A., Escobar, A., Hauser, W.A. (1998) Cysticercosis and epilepsy: a clinical review. Epilepsia 39, 1025–1040. 2. Rajashekhar, V., Chandy, M.J. (2000) Incidence of solitary cysticercus granuloma. In: Rajashekar, V., Chandy, M.J., (eds) Solitary Cysticercus Granuloma. Orient Longman, Chennai, India, pp. 12–28. 3. Del Brutto, O.H. (1995) Single parenchymal brain cysticercus in the acute encephalitic phase: definition of a distinct form of neurocysticercosis with a benign prognosis. Journal of Neurology, Neurosurgery and Psychiatry 58, 267–269. 4. Rajashekhar, V., Chacko, G., Haran, R.P., et al. (1995) Clinicoradiological and pathological correlation in patients with solitary cysticercus granuloma and epilepsy: focus on presence of the parasite and edema formation. Journal of Neurology, Neurosurgery and Psychiatry 59, 284–286. 5. Murthy, J.M.K., Reddy, Y.V.S. (1998) Prognosis of epilepsy associated with single CT enhancing lesion: a long-term follow-up study. Journal of the Neurological Sciences 169,151–155. 6. Rajashekhar, V. (1991) Etiology and management of single small CT lesions in patients with seizures: understanding a controversy. Acta Neurologica Scandinavia 144, 819–823. 7. Murthy, J.M.K., Yangala, R. (1998) Etiological spectrum of symptomatic localization related epilepsies: a study from South India. Journal of the Neurological Sciences 158, 65–70. 8. Murthy, J.M.K., Yangala, R., Mantha, S. (1998) The syndromic classification of the International League Against Epilepsy: a hospital based study from south India. Epilepsia 40, 48–54. 9. Murthy, J.M.K., Yangala, R. (1999) Acute symptomatic seizures – incidence and etiological spectrum: a hospital-based study from south India. Seizure 8, 162–167. 10. Escobar, A. (1993) The pathology of neurocyticercosis. In: Palacios, E., Rodriguez-Carbajal, J. (eds) Cysticercosis of the Central Nervous System. Charles C. Thomas, Springfield, Illinois, pp. 27–54. 11. Chacko, G., Rajashekhar, V., Chandy, M.J., et al. (2000) The calcified intracorporeal vacuole: an aid to the pathological diagnosis of solitary cerebral cysticercus granuloma. Journal of Neurology, Neurosurgery and Psychiatry 69, 525–527. 12. Bhatia, S., Tandon, P.N. (1988) Solitary ‘microlesions’ in CT: a clinical study and follow-up. Neurology India 36, 139–150. 13. Srinivas, H.V. (1992) Disappearing CT lesions – clinical features. Tropical and Geographic Medicine 2, 88–91. 14. Wadia, R.S., Makhale, C.N., Kelkar, A.V., et al. (1987) Focal epilepsy in India with special reference to lesions showing ring or disc-like enhancement on contrast computed tomography. Journal of Neurology, Neurosurgery and Psychiatry 50, 1298–1301. 15. Sethi, P.P., Wadia, R.S., Kiyawat, D.P., et al. (1994) Ring or disc enhancing lesions in epilepsy in India. Journal of Tropical Medicine and Hygiene 97, 347–353.

256

J.M.K. Murthy

16. Rajashekhar, V., Chandy, M.J. (2000) Clinical manifestations of solitary cysticercus granuloma. In: Rajashekhar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma. Orient Longman, Chennai, India, pp. 29–39. 17. Gulatia, R.K., Verma, A.K., Mishra, N.K., et al. (1987) Disappearing lesions in epilepsy. Epilepsia 28, 523–527. 18. Rajashekhar, V. (1999) Epilepsy associated with a solitary cysticercus granuloma. In: Murthy, J.M.K. (ed.) Epilepsy: the Indian Perspective. Care Foundation, Hyderabad, India, pp. 82–106. 19. Chopra, J.S., Sawhney, I.M.S., Suresh, N., et al. (1992) Vanishing CT lesion in epilepsy. Journal of the Neurological Sciences 107, 40–49. 20. Byrd, S.E., Locke, G.E., Biggers, S., et al. (1982) The computed tomography appearance of cerebral cysticercosis in adults and children. Radiology 144, 819–823. 21. Basauri, L., Zuleta, A., Loayza, P. (1983) Olivaces A. Microabscesses and presumptive inflammatory nodules of the brain. Acta Neurochirurgica (Wein) 68, 27–32. 22. Rajashekhar, V., Chandy, M.J. (2000) Outcome in patients with solitary cysticercus granuloma. In: Rajashekar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma. Orient Longman, Chennai, India, pp. 135–152. 23. Murthy, J.M.K., Reddy, V.S. (1998) Clinical characteristics, seizure spread patterns, and prognosis of seizures associated with single small cerebral calcific CT lesion. Seizure 7, 153–157. 24. Martinez, H.R., Rangle-Guerra, R.A., Elizondo, G., et al. (1989) MR imaging in neurocysticercosis: a study of 56 cases. AJNR American Journal of Neuroradiology 10, 1011–1019. 25. Martinez, H.R., Rangel-Guerra, R., Arredondo-Estrada, J.H., et al. (1995) Medical and surgical treatment in neurocysticercosis: a magnetic resonance study of 161 cases. Journal of the Neurological Sciences 130, 25–34. 26. Singh, G., Sachdev, M.S., Tirath, A., et al. (2000) Focal cortical-subcortical calcifications and epilepsy in the Indian sub-continent. Epilepsia 41, 718–726. 27. Rajashekhar, V., Chandy, M.J. (2000) Medical management of solitary cysticercus granuloma. In: Rajashekar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma. Orient Longman, Chennai, India, pp. 112–134. 28. Pradhan, S., Kathuria, M.K., Gupta, R.K. (2000) Perilesional gliosis and seizure outcome: a study based on magnetization transfer magnetic resonance imaging in patients with neurocysticercosis. Annals of Neurology 48, 181–187. 29. Del Brutto, O.H., Santibanez, R., Noba, C.A., et al. (1992) Epilepsy due to neruocysticercosis: analysis of 203 patients. Neurology 42, 389–392. 30. Del Brutto, O.H. (1994) Prognostic factors for seizure recurrence after withdrawal of antiepileptic drugs in patients with neurocysticercosis. Neurology 44, 1706–1709. 31. Del Brutto, O.H. (1993) The use of albendazole in patients with single lesions enhanced on contrast CT. New England Journal of Medicine 328, 356–357. 32. Padma, M.V., Behari, M., Misra, N.K., et al. (1994) Albendazole in single CT ring lesions in epilepsy. Neurology 98, 121–123. 33. Baranwal, A.K., Singhi, P.D., Khandelwal, N., et al. (1998) Albendazole therapy in children with focal seizures and single small enhancing computerized tomographic lesion: a randomized placebocontrolled, double blind trial. Pediatric Infectious Diseases Journal 17, 696–700.

26

Paediatric Neurocysticercosis Sudesh Prabhakar and Gagandeep Singh

Introduction Even in regions that are endemic for Taenia solium, childhood neurocysticercosis (NC) is rare. Nevertheless, NC does occur among children, raising issues of its exact prevalence in the paediatric age group, pathogenesis, clinical manifestations, diagnosis, treatment and prevention. These issues are confounded by uncertainty about the modes of transmission of cysticercosis to children. Another important question that needs to be considered is, do clinical manifestations and laboratory features of NC in the paediatric age group differ from those in adults? Are there any neurological manifestations that are unique to this age group? Finally, are there special considerations in drug therapy of paediatric cysticercosis? The authors focus on some of these issues in the present chapter.

Prevalence of T. solium Infection in the Paediatric Population Community-based data Coproparasitological surveys of children in developing countries have revealed high rates of helminthiasis, primarily, intestinal geohelminths (Ascaris, Trichuris)1–3. Indeed, analysis of age-specific prevalence rates of

intestinal geohelminthiasis indicate that the highest prevalences are recorded in the age group 10–20 years, followed by the age group of less than 10 years4,5. In contrast, adult Taenia infections are rare below the age of 10 years. Rates of infection with Taenia sp. typically peak from 15 to 40 years of age. The reasons for these age-specific patterns are not known but may reflect an overall low frequency of pork consumed during childhood. Epidemiological data on the seroprevalence of T. solium cysticercosis in the community may often have the limitation of poor sampling rates from the paediatric population of that community6,7. Nevertheless, population data from Mexico and Peru indicate that enzyme-linked immunoelectrotransfer blot (EITB)-based seropositivity rates in the paediatric population are lower than the average prevalence rates for the community and much lower than age-specific peak prevalence rates4–9. For instance, a survey in Peru found that none of the subjects below 5 years of age showed positive reactions in the EITB, whilst 6% of those in the age group 6–10 years were seropositive as against a mean seroprevalence of 8% and a peak seroprevalence of 19% in the age group of over 50 years7. Seropositivity rates increased dramatically after 5 years of age, indicating the vulnerability of this age group to environmental T. solium exposure in contrast to the relatively protected environ-

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

257

258

S. Prabhakar and G. Singh

ment of children below 5 years. One study, however, from Honduras found a higher seropositivity rate in the 0–9 years age group (18%) in comparison to average seropositvity (16.6%)10. Here, children accounted for 28.75% of the seropositives in the community. Differences in age-specific seroprevalence rates were however, not statistically significant. Interestingly, when computed tomography (CT) scans were performed on the subjects, two of 21 (9.5%) in the age group 0–9 years as opposed to five of 14 (35.7%) in the age group 40–49 years were found to have lesions compatible with NC (Ana L. Sanchez, Ontario, Canada, personal communication). These data indicate that, while NC was less common in the paediatric population, exposure to T. solium began at a very early age in the study village.

Hospital-based data Seropositive cases merely indicate exposure to T. solium and do not necessarily imply clinical NC and, therefore, do not provide an estimate of the neurological morbidity due to paediatric cysticercosis. The results of a study of neurological outpatients with seizures in Lima are of interest in this regard11. In this clinic-based population, 8% of patients with seizures, who were above 20 years, were seropositive in comparison to 2% seropositives among those below 20 years. These data, in common with population data indicate that both exposure to T. solium and clinical NC are uncommon below the age of 20 years. A number of published, hospital-based, large series of NC have either not included paediatric cases or not described the age structure of their cohorts12–14. For those series, where breakdown according to age is available, data indicate that the frequency of NC below the age of 15 years is about onetenth as its frequency above that age15,16.

Modalities of Transmission Among Children Taenia solium cysticercosis has a long incubation period; it may be as long as 5 years. Therefore, even if exposure to T. solium

occurred very early in life, cysticercosis would not manifest clinically until after 6 years of age. In most series of paediatric NC, the average age of presentation was around 8 years17–31. However, NC has been reported to manifest as early as 14 months of age32. Those cases that occur during later childhood probably represent acquisition of T. solium through food. Cases of cysticercosis during early childhood probably represent infections acquired through caregivers, including those within the family as well as housekeepers and food handlers that are employed within the household33. The possibility of transplacental transmission has been considered but never proven. Since children are often restricted to the confines of a well-protected home environment, their chances of exposure to T. solium are less in comparison to adults, who may also be exposed through food and water outside their homes. It becomes all the more important, therefore, to screen household family, caregivers and food handlers, in contact with children with NC, for adult and larval T. solium infection. Indeed, a survey of 51 household family contacts of 20 children with a solitary cysticercus granuloma showed that 14 (27%) had serological evidence of exposure to T. solium34. Among the seropositive contacts, a history of seizures was obtained in five. Imaging revealed evidence of active or inactive NC in four. These data underscore the importance of screening household family contacts of children with NC.

Clinical Manifestations A few of the earlier studies of cysticercosis in children suggested that whilst cysticercosis was rare among children, its manifestations were more severe. In one of the earliest reports of paediatric NC, Robles (1945) portrayed that the outcome in paediatric NC was far more serious than adults35. Some 16 years later, however, Dixon and Lipscomb disagreed36: ‘In the present series then there were no deaths among patients certainly or probably infected in childhood, and only one case of severe disablement… The findings suggest a prognosis far less gloomy…’.

Paediatric Neurocysticercosis

Some authors consider that more severe forms of NC, including cysticercotic encephalitis, are common in children37–39. It is not clear whether the latter condition represents a true age-dependent predisposition or a bias in case collection. A geographical bias however does exist in the pattern of clinical presentations of paediatric NC. Thus, reports of paediatric NC from developed countries like United States emphasize benign, self-limiting single lesions17–20. These lesions disappear in 6–12 months, and do not require any specific therapy apart from antiepileptic drugs for about 1–2 years. Patients with these lesions present to the emergency department with acute non-febrile seizures and have been reported in several states of the United States21. In comparison, reports of paediatric NC from endemic regions such as Latin America have emphasized the occurrence of features of intracranial hypertension in addition to seizures22–25. These are patients who have either multiple parenchymal cysts or intraventricular or subarachnoid NC. Intracranial hypertension has been reported consistently as the second most common manifestation of NC in reports from Latin America22–25. It may be conjectured that the former benign presentations arise out of brief, limited exposure to T. solium, while the later, more grave presentations in endemic regions are the result of more severe or repeated exposure to T. solium. Even in India, several of the earlier reports emphasized the occurrence of more severe presentations of intracranial hypertension and meningoencephalitis26–28. More recent reports however, have described the common single, benign self-limiting colloidal-granular NC very commonly in childhood29,30. In general, the common manifestations of childhood NC include seizures, headaches and focal neurological deficits. There is however no consensus of opinion regarding the role of NC as an aetiology in developmental delay, cerebral palsy, learning disability, developmental regression and behavioural disorders in children in areas where T. solium is endemic. Understandably, these disorders would be expected to occur only in the more severe cysticercotic syndromes such as cysticercotic hydrocephalus. A few authors have described the occurrence of mental retarda-

259

tion, hyperkinetic behaviour and cerebral palsy in children with definite NC31,39. However, to date, there has been no systematic study using contemporary tools of assessment of these neurological abnormalities in children with either active or inactive NC. There is however, anecdotal mention of agespecific neurological syndromes in children with NC. Otero et al. described the occurrence of Landau–Kleffner’s syndrome in a patient with NC in the left Sylvian fissure40. Similarly, Morales et al. described the occurrence of Lennox–Gastaut syndrome in a patient with NC with hydrocephalus31. Both cases, though extremely rare, could represent age-related expressions of a severe non-specific neurological insult, in these cases, NC.

Investigations Radiology, including CT and magnetic resonance imaging (MRI), is most often employed for establishing a diagnosis of NC. The diagnosis is further supported by ancillary tests such as eosinophil counts, stool examinations for Taenia sp. ova, soft tissue roentgenograms, cerebrospinal fluid (CSF) studies and serological studies (both, EITB in serum and ELISA in CSF). There is no evidence to suggest that the pattern or intensity of antibody responses in paediatric cases with NC are any different from those seen in adults. One confounding issue in clinical as well as community-based settings could be the presence of maternally transferred antibodies in children, for it has been demonstrated that children born to EITB-positive mothers are seropositive (Hector H. García, Lima, Peru, personal communication). However, given the low reproductive rate in humans it is unlikely that this could be a major source of error in population studies. A serological study based on ELISA indicated that serological responses were weaker in children with malnutrition in comparison to nutritionally healthy children41. This has not been observed in several of the recent EITBbased studies from Latin America. However, the effect of nutrition on the antibody status may be an issue in many developing countries where malnutrition is common.

260

S. Prabhakar and G. Singh

Treatment Specific treatment of NC consists of the drugs praziquantel and albendazole. Both drugs are safe and effective in children above 1 year of age. The safety of praziquantel below 1 year of age has not been demonstrated. Praziquantel is administered in a dose of 50–100 mg kg−1 day−1 in three divided doses for 4 weeks. Albendazole has a shorter halflife in children42. The drug may be given in three divided doses. The dose is 15 mg kg−1 day−1 for 4 weeks. The shorter duration of treatment, for instance, a 1-week course has not been used in children43,44. It is imperative that children presenting to the Emergency Room with new-onset seizures should be subjected to a CT scan in regions where NC is known to occur. In the event that CT reveals single or more enhancing lesions suggestive of NC, an antiepileptic drug with rapid onset of action should be instituted with a view to prevent seizure recurrence. Phenytoin sodium is a good choice, because serum levels for effective anticonvulsant action are achievable with the administration of oral or intravenous loading doses (15–20 mg kg−1). The drug is administered at the rate of 50 mg min−1 by the intravenous route under electrocardiographic guidance. Following loading, oral maintenance doses (5 mg kg−1 day−1) are advised till the disappearance of the acute encephalitic lesion(s), usually, 6–12 months. Since long-term administration is often not necessary, some of the side effects of longer durations of administration of phenytoin may not be an issue. Close monitoring for

anticonvulsant hypersensitivity syndrome and acute, subacute or chronic CNS toxicity is, however, mandatory. Fosphenytoin is not currently available in many countries where T. solium is endemic. Other antiepileptic drugs, such as carbamazepine and clobazam may also be used. Corticosteroids, mannitol and furosemide are used for the control of intracranial hypertension, if present. Surgery is rarely indicated. Finally, screening of adults and children within the household environment for adult and larval T. solium infection is crucial for the control of transmission of the parasite.

Conclusions Analysis of data from community and clinic-based paediatric populations indicate that both NC and adult T. solium infections are relatively uncommon in childhood. Nevertheless, NC does occur during childhood. Recent data indicate that the majority of the cases of paediatric NC are those of a single involuting cysticercus type, that resolves spontaneously over a few months. However, in highly endemic regions, complicated clinical pictures might be noted. Even in highly endemic regions, most cases are of the benign self-limiting variety that does not require any treatment apart from symptomatic seizure prophylaxis. Screening of household family contacts and caregivers is all the more important in the case of children with NC, because they are likely to have acquired the infection from within the protected environment of their homes.

References 1. World Health Organization. (1987) Prevention and control of intestinal parasitic infections. World Health Organization Technical Report Series No. 749, 1–86. 2. Kang, G., Mathew, M.S., Rajan, D.P., et al. (1998) Prevalence of intestinal parasites in rural southern Indians. Tropical Medicine and International Health 3, 70–75. 3. Sugunan, A.P., Murhekar, M.V., Sehgal, S.C., et al. (1996) Intestinal parasitic infestation among different population groups of Andaman and Nicobar Islands. Journal of Communicable Diseases 28, 253–259. 4. Acha, P.N., Aguilar, F.J. (1964) Studies on cysticercosis in Central America and Panama. American Journal of Tropical Medicine and Hygiene 13, 48–53. 5. Sarti, E., Schantz, P., Lara, R., et al. (1988) Taenia solium taeniasis and cysticercosis in a Mexican village. American Journal of Tropical Medicine and Hygiene 39, 194–198.

Paediatric Neurocysticercosis

261

6. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis and cysticercosis in human and pigs in a village in Morelos, Mexico. American Journal of Tropical Medicine and Hygiene 46, 677–685. 7. Diaz, F., García, H.H., Gilman, R.H., et al. (1992) Epidemiology of taeniasis and cysticercosis in Peruvian village. American Journal of Epidemiology 135, 875–882. 8. Diaz Camacho, S.P., Aurora, C.R., Ruiz, C., et al. (1991) Epidemiologic study and control of Taenia solium infections with Praziquantel in a rural village of Mexico. American Journal of Tropical Medicine and Hygiene 45, 522–531. 9. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community based epidemiological investigations of cysticercosis due to Taenia solium: comparison of serological screening tests and clinical findings in two populations in Mexico. Clinical Infectious Diseases 18, 879–885. 10. Sanchez, A.L., Lindbäck, J., Schantz, P.M., et al. (1999) A population-based case-control study for T. solium taeniasis and cysticercosis. Annals of Tropical Medicine and Parasitology 93, 247–258. 11. García, H.H., Gilman, R., Martinez, M., et al. (1993) Cysticercosis as a major cause of epilepsy in Peru. Lancet 341, 197–200. 12. Sotelo, J., Guerrero, V., Rubio, F. (1985) Neurocysticercosis: a new classification based on active and inactive forms. A study of 753 cases. Archives of Internal Medicine 145, 442–445. 13. McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri: review of 127 cases. Archives of Neurology 39, 534–539. 14. Grisiola, J.S., Wiederholt, W.C. (1982) CNS cysticercosis. Archives of Neurology 39, 540–544. 15. Scharff, D. (1988) Neurocysticercosis. Two hundred thirty-eight cases from a California hospital. Archives of Neurology 45, 777–780. 16. Veerendra Kumar, M. (1986) Clinico-pathological Study of Neurocysticercosis. Thesis. University of Bangalore, Bangalore, India. 17. Mitchell, W.G. (1997) Pediatric neurocysticercosis in North America. European Neurology 37, 126–129. 18. Wendy, G., Mitchell, M.D., Thomas, O., et al. (1988) Intraparenchymal cerebral cysticercosis in children: diagnosis and treatment. Pediatrics 82, 76–82. 19. Mitchell, W.G. (1999) Neurocysticercosis and acquired cerebral toxoplasmosis in children. Seminars in Pediatric Neurology 6, 267–277. 20. Mitchell, W.G., Snodgrass, S.R. (1985) Intraparenchymal cerebral cysticercosis in children: a benign prognosis. Pediatric Neurology 1, 151–156. 21. Rosenfeld, E.A., Byrd, S.E., Shulman, S.T. (1996) Neurocysticercosis among children in Chicago. Clinical Infectious Diseases 23, 262–268. 22. Antoniuk, S.A., Bruck, I., Wittig, E., et al. (1991) Neurocysticercosis in childhood. II Computed tomography of 24 patients according to symptomatic and praziquantel treatment. Arquivos de Neuropsiquiatria 49, 47–51. 23. Bruck, I., Antoniuk, S.A., Wittig, E., et al. (1991) Neurocysticercosis in childhood. I. Clinical and laboratory diagnosis. Arquivos de Neuropsiquiatria 49, 43–46. 24. Ferreira, M.S., Costa-Cruz, J.M., Nishioka, S.A., et al. (1994) Neurocysticercosis in Brazilian children: report of 10 cases. Tropical Medicine and Parasitology 45, 49–50. 25. Ruiz-Garcia, M., Gonzalez-Astiazaran, A., Rueda-Franco, F. (1997) Neurocysticercosis in children. Clinical experience in 122 patients. Childs Nervous System 13, 608–612. 26. Kalra, V., Paul, V.K., Marwah, R.K., et al. (1987) Neurocysticercosis in childhood. Transactions of the Royal Society of Tropical Medicine and Hygiene 81, 371–373. 27. Kalra, V., Deorari, A.K., Goulatia, R.K. (1987) Praziquantel therapy in childhood neurocysticercosis. Indian Pediatrics 24, 1095–1098. 28. Puri, V., Sharma, D.K., Kumar, S., et al. (1991) Neurocysticercosis in children. Indian Pediatrics 28, 1309–1317. 29. Baranwal, A.K., Singhi, P.D., Khandelwal, N., et al. (1998) Albendazole therapy in children with focal seizures and single small enhancing computerized tomographic lesions: a randomized, placebo-controlled, double-blind trial. Pediatric Infectious Diseases Journal 17, 696–700. 30. Singhi, P., Ray, M., Singhi, S., et al. (2000) Clinical spectrum of 500 children with neurocysticercosis and response to albendazole therapy. Journal of Child Neurology 15, 207–213. 31. Morales, N.M.O., Agapejev, S., Morales, R.R., et al. (1999) Clinical aspects of neurocysticercosis in children. Pediatric Neurology 22, 287–291. 32. Manreza, M.L.G. (1982) Neurocysticercosis in childhood: clinical aspects and diagnosis. Revista do Hospital Das Clinicas; Faculdad de Medicina da Universidade de São Paulo (São Paulo) 37, 2006–2111.

262

S. Prabhakar and G. Singh

33. Schantz, P.M., Moore, A.C., Muñoz, J.L., et al. (1992) Neurocysticercosis in an Orthodox Jewish community in New York City. New England Journal of Medicine 327, 692–695. 34. Singh, G., Ram S., Kaushal V., et al. (2000) Risk of seizures and neurocysticercosis in household family contacts of children with single enhancing lesions. Journal of the Neurological Sciences 176, 131–135. 35. Robles, C. (1945) Consideraciones acerea de la Cisticercosis cerebral en los ninos. Gaceta Médica México 75, 248. (Cited in reference 36.) 36. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an analysis and follow up of 450 cases. Medical Research Council Special Report. Series No. 299. Her Majesty’s Stationery Office, London, pp.1–58. 37. Rangel, R., Torres, B., Del Brutto, O., et al. (1987) Cysticercotic encephalitis: a severe form in young females. American Journal of Tropical Medicine and Hygiene 36, 387–392. 38. Del Brutto, O.H., Garcia, E., Talamas, O., et al. (1988) Sex-related severity of inflammation in parenchymal brain cysticercosis. Archives of Internal Medicine 148, 544–547. 39. Lopez-Hernandez, A., Garayzar, C. (1982) Analysis of 89 cases of infantile cerebral cysticercosis. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 127–138. 40. Otero, E., Cardova, S., Diaz, F., et al. (1989) Acquired epileptic aphasia (the Landau–Kleffner syndrome) due to neurocysticercosis. Epilepsia 30, 569–572. 41. Shasha, W., Pammenter, M.D. (1991) Sero-epidemiological studies of cysticercosis in school children from two rural areas of Transkei, South Africa. Annals of Tropical Medicine and Parasitology 85, 349–355. 42. Jung, H., Sanchez, M., González-Astiazaran, A., et al. (1997) Clinical pharmacokinetics of albendazole in children with neurocysticercosis. American Journal of Therapeutics 4, 23–26. 43. García, H.H., Gilman, R.H., Horton, J., et al. (1997) Albendazole therapy for neurocysticercosis: a prospective double blind trial comparing 7 versus 14 days of treatment. Neurology 48, 1421–1427. 44. Del Brutto, O.H., Campos, X., Sanchez, J., et al. (1999) A single-day praziquantel versus 1-week albendazole for neurocysticercosis. Neurology 52, 79–81.

27

Psychiatric Manifestations of Neurocysticercosis Orestes V. Forlenza

Introduction

Overview of Clinical Studies

Psychiatric disturbances typically present in the course of cerebral cysticercosis, both in association with other neurological syndromes, or as a dominant feature. Such abnormalities were extensively studied by neurologists and psychiatrists at the beginning of the 20th century, yielding important preliminary insights into organic mental disease. In the second half of the century, though, the concern on the subject waxed and waned. Cysticercosis was then regarded as a dying disease in Western Europe and North America, where it had almost completely disappeared as a result of improvements in sanitation and meat inspection. Notwithstanding, the prevalence of the tapeworm infection may still be high among sub-populations of migrants and ethnic minorities, rendering their acquaintances or employers exposed to the risk of faecal–oral contamination1,2. It is important that patients with diagnosed cerebral cysticercosis be assessed for psychiatric and neuropsychological morbidity, in addition to standard clinical and neurological procedures. Likewise, neurocysticercosis (NC) should be considered in the differential diagnosis of atypical presentations of psychiatric cases, especially in endemic areas.

From historical findings to more recent studies Most of the psychiatric knowledge on NC derives from studies conducted in mental institutions in the late 1800s and early 1900s, from which we have inherited detailed descriptions of the patients’ psychopathology – that in many cases would mimic major psychiatric syndromes such as schizophrenia and manic-depressive illness3–4. The frequency of NC was presumed to be high in psychiatric hospitals not only due to a causal relationship between the two conditions, but also because severely psychotic and demented patients were prone to become secondarily infected as a consequence of poor hygiene and coprophagia. Several psychiatric syndromes have been so far attributed to NC. From early classic papers on this subject, one can identify descriptions indistinguishable from dementia praecox, paranoia, neurosyphilis, Korsakoff’s psychosis and dementia5–6. Chronic delusions and hallucinations, as well as variations of mood compatible with the diagnoses of major depression and bipolar disorder were additionally reported7–8. Because the aetiology of these cases was seldom established in life, clinical findings were retrospectively

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

263

264

O.V. Forlenza

correlated to neuropathological observations of signs of the parasitic infection. Leukart (1886), for instance, suggested that cysticerci located in the ventricles and basal ganglia were more liable to induce mental abnormalities than cortical lesions9. In the majority of such cases, neuropsychiatric findings were compatible with major cognitive impairment, namely delirium and dementia9. Important contributions to this field of knowledge have also been made by clinicians from Brazil, Chile, Mexico, China and other countries where prevalence of the disease was high (Table 27.1). NC has further been claimed to cause mental illness through an association with intracranial hypertension, meningitis, and epilepsy, in which case, mood and perceptual disorders and acute and chronic psychoses have been described5–8,10–16.

In Europe, further interest in the disease was raised after the evaluation of cysticercosis in 450 British ex-servicemen who had acquired the disease during military placements in pre-1947 colonial India17. Among these patients, 39 (8.7%) had mental disorder as a prominent feature, including cases of organic deterioration, affective disorders and schizophrenia. Except for the former cases of unequivocal organic mental disease, medical records showed divergence on the aetiological relationship between the psychiatric condition and cysticercosis. A few recent studies have approached the psychopathology of patients with NC with the aid of contemporary psychometric methodologies. Most of the literature on the subject that has been published in the last decade consists of small series of cases

Table 27.1. Prevalence of psychiatric manifestations according to several different studies drawn from neurological and psychiatric samples. The far right column indicates (whenever available) an estimate of the frequency of pure psychiatric forms*.

Author/s and year of publication

Country

Source of patients

Küchenmeister (1857)4 Brinck and Beca (1936)7 Pupo et al. (1946)8 Arriagada and Corbalán (1961)12 Dixon and Lipscomb (1961)17 Canelas (1962)13 Lima (1966)34 Lefèvre et al. (1969)35 Arseni and Cristescu (1972)36 Yingkun et al. (1979)37 Manreza (1982)38 Schenone et al. (1982)39 Takayanagui and Jardim (1983)40 Sotelo et al. (1985)41 Takayanagui (1987)42 Scharf (1988)14 Vianna et al. (1990)43 Tavares Jr (1994)44 Forlenza et al. (1997)26

Germany Chile Brazil Chile UK Brazil Brazil Brazil Romania China Brazil Chile Brazil Mexico Brazil USA Brazil Brazil Brazil

Psychiatry Psychiatry Neurology Neurology Neurology Neurology Neurology Paediatrics Neurology Neurology Paediatrics Neurology Neurology Neurology Neurology Neurology Neurology Psychiatry Neurology

Prevalence of Pure Number of psychiatric psychiatric patients manifestations (%) forms* (%) † 16 285 145 450 276 355 54 181 158 100 583 500 753 151 238 67 188 38

20 75 20 9.4 8.7 22.8 25 11.1 62 10.1 28 23 11.5 20 11.5 3.4 4.5 5.3 65.8

† 12.5 0 0 0 0 2 0 0 0 0 – 0.4 4.7 0 – – – 0

*There is some controversy in the literature regarding the implications of ‘pure psychiatric presentations’. Brinck and Beca described psychiatric syndromes in 12 of their 16 patients; two of them had no other symptoms attributable to cysticercosis7. Lima emphasized that ‘pure psychiatric forms’ were cases without epilepsy, intracranial hypertension and meningitis, thus allowing the presence of minor neurological symptoms34. Takayanagui and Jardim noted that psychiatric forms were usually associated with other neurological manifestations although two ‘pure’ psychiatric cases were reported40. †Data not available.

Psychiatric Manifestations of Neurocysticercosis

drawn from neurological facilities, and case reports of particularly interesting or intense psychiatric syndromes14–16,18. There is a paucity of reports of mild psychiatric symptoms such as anxiety and dysthymia, possibly because such minor abnormalities of the mental state may be overlooked in the general-hospital setting if assessment is carried out without the aid of standardized psychiatric instruments16,19. In view of that, it has not been so far possible to ascertain the prevalence of psychiatric morbidity among patients with NC. Estimates vary from 3.4 to 75% (Table 27.1), as a result of the varying sensitivity of diagnostic methods, sampling bias, and other methodological limitations, which are perhaps understandable in view of the clinical and pathological heterogeneity of the disease.

Brain pathology and mental symptoms Attempts to classify the different psychiatric syndromes and relate them to the respective neurological conditions in which they are likely to be found have also been made, although never reaching consensus11. As a general rule, ventricular cysticercosis and subarachnoid cysticercosis, which are usually associated with meningitis and/or intracranial hypertension, may result in more cognitive dysfunction, with attention deficits, impaired consciousness and delirium20. On the other hand, patients with parenchymal cysts and calcifications are prone to experience the neuropsychiatric complications of epilepsy, intracranial hypertension and space-occupying lesions. In view of that, ventriculosubarachnoid forms are prone to present with psychomotor agitation, sleep–wake cycle disturbances and other behavioural symptoms suggestive of acute cognitive dysfunction. Dementia has been associated with massive and scattered infections of the brain parenchyma and subacute forms of intraventricular cysticercosis21,22. On the one hand, it may be acceptable that lesion location correlates with specific neuropsychological deficits, on the other, the same assumption cannot be made towards psychopathology. Except for the gross

265

dichotomy of parenchymal and ventriculosubarachnoid cysticercosis, there is no possible classification of the disease according to affected brain areas. Parenchymal cysts may develop at any locus within the brain, although there is a strong propensity for their location at the grey-white matter transition zone tissue23. As a result of such anatomical heterogeneity, one would need very large patient samples in order to correlate psychiatric findings and lesion location. In addition, there is also important variation in the ability of each individual cyst to become pathogenic, bearing in mind the long and unpredictable time lag between the appearance of cysts in the brain and their degeneration and calcification17. Most probably, degenerating cysts and the reactive inflammation within the adjacent nervous tissue, which are strong determinants of NCinduced epilepsy, may as well be the trigger of psychiatric symptoms, particularly among predisposed individuals.

Prevalence of psychiatric disorders In a cross-sectional study of 38 cases at a neurology outpatient clinic in Brazil, depression syndromes were the commonest psychiatric manifestation, as shown by the Present State Examination and the Schedule for Affective Disorders and Schizophrenia – Lifetime Version semi-structured interviews24–26. Signs of psychotic disorder were observed in five patients although none had a clear-cut schizophrenic or manic-depressive presentation. Only 13 patients (34.2%) were presumed mentally healthy by the aforementioned psychometric methods. Thirty-two patients were assessed by the Mini-Mental State Examination and the Strub and Black’s Mental Status Examination27,28. Neuropsychological dysfunction was identified in a majority of the cases (87.5%), although severe cognitive abnormalities were less frequent (15.6%)26. Attention deficits were detected in all the patients assessed, being probably influenced by the effect of antiepileptic drugs (carbamazepine and barbiturates). Anyhow, 59.4% had mild to moderate and 40.6% severe attention disturbance. Memory and

266

O.V. Forlenza

language were altered in 78% of the patients and higher cognitive functions in 87.5%. Other deficits included disorders of praxis and motor functions (50%). Reading and writing skills were less frequently affected (28% and 0.6% of patients, respectively). However, there was no clear pattern of localization for the neuropsychological dysfunction in the patients. In spite of the clinical heterogeneity of the test group, there was a mild correlation between the occurrence of depression and laboratory signs of active disease (defined by the presence of parenchymal cysts, not calcifications only, as shown by computed tomography (CT) and magnetic resonance imaging (MRI) scans, and/or inflammatory cerebrospinal fluid (CSF)) (P = 0.04), and modest correlation with the occurrence of intracranial hypertension (P = 0.1). Psychosis also possibly correlated with intracranial hypertension (P = 0.06) but not with disease activity (P = 0.5). No association was found between the psychiatric manifestations and the occurrence of epilepsy (P = 0.63), even when the epidemiological group of active epilepsy29 was considered (P = 0.72), nor with the current use of steroids (P = 1). Previous history of depressive disorders was strongly associated with current depression (P = 0.006) and psychosis (P = 0.04)26. These findings parallel several other studies that have addressed the aetiology of organic mood disorders. Family history of depression and history of depression before the onset of the organic disease are regarded as risk factors for developing depression in cerebrovascular disease and multiple sclerosis, through greater biological vulnerability30,31. Disease activity (which implies diffuse or localized central nervous system inflammation) is temporally related to organic mood disorders, as shown in other medical and neurological conditions, such as systemic lupus erythematosus and multiple sclerosis32,33.

Treatment There is a paucity of data regarding psychiatric treatment and outcome in NC. From the earlier classical papers it was made clear that patients with psychiatric syndromes

and cysticercosis were candidates for longterm inpatient care, suggesting refractory disease. In the present-day context, most patients with NC have chronic depression and mild or moderately severe brain pathology (few cysts and/or calcifications). In such cases, psychiatric treatment is very helpful and should follow the guidelines for the treatment of other organic mental illnesses. Regarding severe forms of NC, such as massive infections with intracranial hypertension, space-occupying parenchymal lesions, and intraventricular cysts, psychiatric treatment should follow neurological and neurosurgical procedures. Psychopharmacological treatment should be complementary to neurological care.

Conclusions The finding of mental abnormalities and cognitive dysfunction in 65.8% and 87.5%, respectively, of a cross-section of neurological outpatients with NC is an estimate of the high prevalence of psychiatric morbidity in such setting. Samples of psychiatric inpatients might provide a different profile of psychiatric findings, with more severe or even specific forms of mental disease, since psychiatric surveys based on patients from mental institutions in the first half of the 20th century reported up to 75% of severe mental disease in association with cysticercosis. Such a high rate might be explained by a long duration of the untreated organic disease, since many of the aforementioned patients had previous evidence of neurological syndromes before psychiatric admission, according to their medical records. Thus, it is possible that mental disease represented one of the consequences of the deteriorating organic illness, in the absence of effective therapeutic strategies for the parasitic infection at that time. Although there is consensus that NC may be responsible for most of the major psychiatric syndromes and dementia, a particularly interesting finding from the study of outpatients is the non-specific pattern of psychiatric morbidity, as well as the greater incidence of minor psychiatric and neu-

Psychiatric Manifestations of Neurocysticercosis

ropsychological abnormalities. Such manifestations were possibly underestimated by most of the studies that did not use instruments sensitive enough for an appropriate assessment, so that only the most dramatic cases of mental or behavioural abnormali-

267

ties were usually included. Attention and memory are also affected in a high proportion of patients, which is consistent with the findings of other authors in the past and reinforces the role played by NC as an aetiology of dementia.

References 1. Richards, F., Jr, Schantz, P.M. (1991) Laboratory diagnosis of neurocysticercosis. Clinics in Laboratory Medicine 11, 1011–1028. 2. Schantz, P.M., Sarti-Gutierrez, E. (1989) Diagnostic methods and epidemiologic surveillance of Taenia solium infection. Acta Leidensia 57, 153–163. 3. Griesinger, W. (1872) Cysticerken und ihre Diagnose. In: Psychiatrische und Nervenpathologishe Abhandlungen. Gesammelte Abhandlungen. Verlag von August Hirschwald, Berlin, pp. 399–443. 4. Küchenmeister, F. (1857) On Animal and Vegetable Parasites of the Human Body. A Manual of Their Natural History, Diagnosis and Treatment. The Syndenham Society, London. 5. Tretiakoff, C., Pacheco, E., Silva, A.C. (1924) Contribuição para o estudo da cysticercóse cerebral e em particular das lesões cerebraes toxicas á distancia n’esta affecção. Memórias do Hospício de Juqueri 1, 37–66. 6. Ribas, J.C. (1943) Psicoses por lesões cerebrais. Revista de Medicina 27, 31–39. 7. Brinck, G., Beca, F. (1936) Contribución al estudio de la cisticercosis cerebral. Revista Medica de Chile (Santiago) 64, 348–392. 8. Pupo, P.P., Cardoso, W., Reis, J.B., et al. (1946) Sobre a cisticercose encefálica. Estudo clínico, anátomo-patológico, radiológico e do liquido céfalo-raqueano. Archivos da Assistência aos Psicopatas de São Paulo 10–11, 3–123. 9. Leukart, R. (1886) The Parasites of Man, and The Diseases Which Proceed From Them. A Textbook for Students and Practitioners. Young J. Pentland, Edinburgh, UK, pp. 488–551. 10. Obrador, S. (1948) Clinical aspects of cerebral cisticercosis. Archives of Neurology and Psychiatry (Chicago) 59, 457–468. 11. Bastos, F.O. (1953) Aspectos psiquiátricos da neurocisticercose. Revista Paulista de Medicina 43, 162–164. 12. Arriagada, C., Corbalán, V. (1961) Clínica de la neurocisticercosis: manifestaciones neuropsiquiátricas de la cisticercosis encefálica. Neurocirurgia 19, 232–247. 13. Canelas, H.M. (1962) Neurocisticercose: incidência, diagnóstico e formas clínicas. Arquivos de Neuropsiquiatria 20, 1–16. 14. Scharf, D. (1988) Neurocysticercosis: two hundred thirty-eight cases from a California hospital. Archives of Neurology 45, 777–780. 15. Signore, R.J., Lahmeyer, H.W. (1988) Acute psychosis in a patient with cerebral cysticercosis. Psychosomatics 29, 106–108. 16. Castañeda, M.A., Torres, P., Crovetto, L., et al. (1993) Nuevos aspectos en la psicopatologia de la cisticercosis cerebral. Revista de Neuro-psiquiatria 56, 3–15. 17. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an Analysis and Follow-up of 450 Cases. F. Mildner and Sons, London. 18. Shandera, W.X., White, A.C., Jr, Chen, J.C., et al. (1994) Neurocysticercosis in Houston, Texas. A report of 112 cases. Medicine 73, 37–52. 19. Forlenza, O.V., Vieira, A.H.G., Machado, L.R., et al. (1998) Transtornos depressivos associados à neurocisticercose. Prevalência e correlações clínicas. Arquivos de Neuropsiquiatria 56, 45–52. 20. Gang-Zhi, W., Cun-Jiang, L., Jia-Mei, M., et al. (1988) Cysticercosis of the central nervous system. A clinical study of 1,400 cases. Chinese Medical Journal 101, 493–500. 21. Escobar, A., Aruffo, C., Cruz-Sanchez, F., et al. (1985) Hallazgos neuropatológicos en la neurocisticercosis. Archivos de Neurobiología 48, 151–156. 22. Wadia, N.H., Desai, S.B., Bhatt, M.B. (1988) Disseminated cysticercosis – new observations including CT scan findings and experience with treatment by praziquantel. Brain 11, 597–614. 23. Brown, W.J., Voge, M. (1985) Cysticercosis: a modern day plague. Pediatric Clinics of North America 32, 953–969.

268

O.V. Forlenza

24. Wing, J.K., Cooper, J.E., Sartorius, N. (1974) The Measurement and Classification of Psychiatric Symptoms. An Instruction Manual for The Present State Examination and CATEGO Program. Cambridge University Press, Cambridge, UK. 25. Spitzer, R.L., Endicott, J. Roteiro para distúrbios afetivos e esquizofrenia – versão para a vida toda – SADS-L, Trad. de Valentim Gentil Filho. São Paulo: Departamento de Psiquiatria da Faculdade de Medicina da Universidade de São Paulo, 1978–1979. [Mimeo]. Translated from: Spitzer, R.L., Endicott, J. Schedule for Affective Disorders and Schizophrenia (Life-time) – SADS-L. 3rd edn. Clinical Research Branch Collaborative Program on the Psychobiology of Depression, NIMH, Bethesda, USA. May, 1978 – September, 1979. 26. Forlenza, O.V., Vieira, A.H.G., Gouveia, M.F., et al. (1997) Psychiatric morbidity of cerebral cysticercosis: a study of 38 patients from a neurology clinic in São Paulo. Journal of Neurology, Neurosurgery and Psychiatry 62, 612–616. 27. Folstein, M.F., Folstein, S.E., Mchugh, P.R.H. (1975) Mini-Mental State: A practical method for grading the cognitive state of patients for the clinician. Journal of Psychiatric Research 12, 189–198. 28. Strub, R., Black, F.W. (1986) Mental Status Examination in Neurology, 2nd edn. FA Davis Company, Philadelphia, USA. 29. Commission on epidemiology and prognosis of the International League Against Epilepsy (1993) Guidelines for epidemiological studies on epilepsy. Epilepsia 34, 592–596. 30. Brumback, R.A. (1993) Is depression a neurologic disease? Behavioural Neurology 11, 79–104. 31. Popkin, M.K., Tucker, G.J. (1992) ‘Secondary’ and drug-induced mood, anxiety, psychotic, catatonic, and personality disorders: a review of the literature. Journal of Neuropsychiatry and Clinical Neuroscience 4, 369–385. 32. Miguel, E.C., Pereira, R.M.R., Pereira, C.A.B., et al. (1994) Psychiatric manifestations of systemic lupus erythematosus: clinical features, symptoms, and signs of central nervous system activity in 43 patients. Medicine 73, 224 – 232. 33. Moller, A., Wiedemann, G., Rohde, U., et al. (1994) Correlates of cognitive impairment and depressive mood disorders in multiple sclerosis. Acta Psychiatria Scandinavia 89, 117–121. 34. Lima, J.G.C. (1966) Cisticercose Encefálica: Aspectos Clínicos. Thesis. Escola Paulista de Medicina, Federal University of São Paulo, São Paulo, Brasil, pp.131. 35. Lefévre, A.B., Diament, A.J., Valente, M.I. (1969) Distúrbios píquicos na neurocisticercose em crianças. Arquivos de Neuropsiquiatria 27, 103–108. 36. Arseni, C., Cristescu, A. (1972) Epilepsy due to cerebral cysticercosis. Epilepsia 13, 253–258. 37. Yingkun, F., Shan, O., Xiuzhen, Z., et al. (1979) Clinicoelectroencephalographic studies of cerebral cysticercosis: 158 cases. Chinese Medical Journal 92, 770–786. 38. Manreza, M.L.G. (1982) Neurocisticercose na infância: aspectos clínicos e do diagnóstico. Revista do Hospital das Clínicas Faculdade de Medicina da Universidade de São Paulo 37, 206–211. 39. Schenone, H., Villarroel, F., Rojas, A., et al. (1982) Epidemiology of human cysticercosis in Latin America. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 25–38. 40. Takayanagui, O.M., Jardim, E. (1983) Aspectos clínicos da neurocisticercose. Análise de 500 casos. Arquivos de Neuropsiquiatria 43, 50–63. 41. Sotelo, J., Guerrero, V., Rubio, F. (1985) Neurocysticercosis: a new classification based on active and inactive forms. A study of 753 cases. Archives of Internal Medicine 145, 442–445. 42. Takayanagui, O.M. (1987) Neurocisticercose. Evolução Clínico-Laboratorial de 151 Casos. Doctoral thesis, Faculty of Medicine of Ribeirão Preto, University of São Paulo, Brazil. 43. Vianna, L.G., Macedo, V., Mello, P., et al. (1990) Estudo clínico e laboratorial da neurocisticercose em Brasília. Revista Brasileira de Neurologia 26, 35–40. 44. Tavares, A.R., Jr (1993) Psychiatric disorders in neurocysticercosis. British Journal of Psychiatry 163, 839 (Letter).

28

Taenia solium Cysticercosis: Ophthalmic Aspects Atul Kumar and Namrata Sharma

Introduction The earliest description of a living cysticercus in the human eye was made by Schott and Sommering in 18291. Studies by Alfred Graefe, as early as 1877–1882, clearly established the role of surgical management in ocular cysticercosis1. Since then ocular cysticercosis continues to be an important consideration among serious ocular disorders in several endemic regions of the world, as well as in other non-endemic areas, owing to increasing overseas travel and immigration. Though the literature is replete with sporadic reports of this diverse condition, consolidated accounts of the disorder are few. This review intends to familiarize the reader with the pleiomorphic clinical presentations, diagnostic modalities and available management options of ocular and orbital cysticercosis.

Epidemiology Frequency, geographical, age and sex distribution Ocular cysticercosis is a rare disease even in regions endemic for Taenia solium cysticercosis1. Only 111 cases were observed among 153,528 ophthalmic patients, giving a fre-

quency of a little more than seven in 10,000 in South America2. In another hospital study of all ophthalmic cases from South America, the frequency was 30 per 100,000 cases3. Most reports of ocular cysticercosis have been made from Latin America and India4–9. While in a large series reported by Junior, the youngest patient was 6 years of age and the oldest was 66, most patients with ocular cysticercosis are in the first four decades of their life1,10. Thus, Reddy and Reddy reported that 90% of their patients were less than 15 years of age and Malik et al. reported that 68% of their patients were in the age group, 10–30 years4,5. Kumar et al. observed that the highest frequency was in the age group, 31–40 years6. A definite male preponderance has been noted from India and Mexico2. Most patients with ocular cysticercosis are from communities with poor hygiene standards6,10. Junior noted that almost all his patients with cysticercosis were labourers or farm workers with primitive concepts of hygiene and the majority came from rural areas1. Similarly, 70% of a series of 33 patients from India were of low socio-economic status based upon an objective rating scale6. Ocular cysticerci have been found in association with immune disorders such as allergic sinusitis, rheumatic fever, erythema nodosum, asthma and melanoma8.

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

269

270

A. Kumar and N. Sharma

Localization Sites of predilection for cysticercosis include the central nervous system, subcutaneous tissue, skeletal and cardiac muscle, and eye10. Ocular involvement has been reported in 13–46% of large series of patients with cysticercosis4,10. In a hospital-based series of 110 cases collected over 10 years, the most common location was the subcutaneous tissue (24.5%) followed by brain (13.6%) and eye (12.8%)11. Data from the authors’ institute indicate that the most common extraocular site was the brain (18%)6. Ocular involvement is typically unilateral but bilateral involvement has been reported in cases of disseminated cysticercosis7,12,13. The left eye may be more commonly involved in comparison to the right, possibly because larvae may be preferentially routed to the left internal carotid artery, which directly originates from the aorta; however, this has not been substantially proven14. The medial side of the eye has been more commonly involved than the lateral side on account of the anatomic course of the ophthalmic artery which, after giving off lacrimal branches, runs along the medial side of the orbit before dividing into terminal branches5. Cysticerci can lodge in any part of the eye or its adnexae. They have been reported in the anterior chamber15,16, adherent to the extraocular muscle17, vitreous cavity18,19, subretinal space3,20,21 optic nerve head22,23, subconjunctival space4,24,25, lids26 and lacrimal gland27. Involvement of the lens has been anecdotally reported4. Cysticerci have also been reported to migrate within the eye28. Infestation of the ocular adnexae is probably through the anterior ciliary arteries27. Parasites reach the posterior segment through the posterior ciliary arteries, and lodge near the posterior pole and in the subretinal space20,29. From here, however, they often pass through a rent in the retina into the vitreous. A rhegmatogenous retinal detachment may develop or the perforation may be sealed by an inflammatory reaction, leaving a choroidoretinal scar30. Rarely, the parasite may pass from the vitreous, through the pupil, into the anterior chamber4. Giovannini et al. noted bilateral gravitational retinal epitheliopathy in response to a unilaterally located subretinal

cysticercus, suggesting that the parasite triggers a generalized autoimmune process directed against retinal photoreceptors31. Localization of the cyst to the optic disc may occur through the central retinal artery. Two separate translucent, undulating cysts attached to and obscuring the underlying optic nerve head have also been described32. There has been disparity in the reports from Latin America and India regarding the location of the cysts in the eye. In several large series from the former location, cysticerci were most commonly located in the vitreous, in contrast to an adnexal location found by Indian workers1,6,33–37. However, in a more recent report of 33 cases from India, ocular cysticerci were most frequently located in the vitreous (50%)6. Further, a higher incidence of orbital cysticercosis (in 6 out of 33 ophthalmic cases; 18%) was observed in this series, which was in contrast to the previous reports. The higher frequency of detection of intraocular and intraorbital cysticercis in this series was attributed to the use of ultrasonographic examination.

Clinical Presentation Lid and subconjunctival cysticercosis Involvement of the eyelids presents as a painless, subcutaneous mass that may remain unchanged over long periods of time26. Conjunctival involvement is usually in the form of subconjunctival cysts (Fig. 28.1); rarely subconjunctival abscess may occur24,25,38. A case of acute suppurative dacryoadenitis due to cysticercus cellulosae is on record27. Spontaneous extrusion of a subconjunctival or extraocular muscle cyst has been noted. Subconjunctival presentation could be a secondary stage in those cases in which the cyst may have extruded from the primary extraocular muscle site38.

Extraocular myocysticercosis Cysticercus of the extraocular muscles presents with recurrent inflammation, proptosis, restricted ocular motility and ptosis38. Cardinal

Ophthalmic Aspects of Cysticercosis

Fig. 28.1. Subconjunctival cyst.

manifestations include: (i) restricted motility in the direction of action of the involved extraocular muscle; (ii) restricted motility in the direction opposite to the involved extraocular muscle; (iii) recurrent inflammation (myositis) with conjunctival congestion; and (iv) acquired blepharoptosis38,39. A cyst of the superior rectus produces restricted infraduction, and a cyst of the levator palpebrae superioris results in acquired ptosis38. Orbital cysticercus may also present with proptosis40.

Vitreal, subretinal and anterior chamber cysticercosis Intraocular cysticercosis may be asymptomatic in the early stages when the parasite is minute. As the parasite increases in size, it can cause a gradual, painless, progressive loss of vision2,10. Patients may describe a round or irregularly shaped, dark, mobile mass (intravitreal location) or may experience visual field defects (subretinal or optic nerve location). An intravitreal cyst may present per se with retinal detachment (Fig. 28.2a) or overlying vitreal reaction (Fig.

271

28.2b). The cyst is usually well tolerated as long as the larva is alive. However, when the parasite dies, an intense inflammatory reaction to the toxic products released from the cyst occurs, and patient may present with a blind, painful eye2,10. Rarely the presence of a cysticercus larva in the anterior chamber may manifest as unilateral iritis41. The appearance of intravitreal live cysticercosis is unmistakable particularly when the medium is clear; the translucent, white cyst with a dense white spot formed by the invaginated scolex can be easily recognized4. Its shape and undulating movements are typical. The scolex with its suckers and hooks can be seen returning rapidly to the cyst when exposed to the light of an indirect ophthalmoscope13. In early stages, subretinal cysticercosis can appear as an acute central retinitis with retinal oedema and subretinal exudates. The subretinal parasite will eventually develop into a characteristic cyst3. The macular area is apparently the preferred site for the subretinal cysticercus to lodge, possibly because of rich vascularization of this area (Fig. 28.3). The parasite and its movements can be easily recognized through the thin macular tissues42. A choroidoretinal scar develops when the cyst migrates into the vitreous3. The term, ‘communicating cysticercus’ refers to the situation, wherein the main body of the cyst is located in the vitreous cavity, while the head remains in the suprachoroidal space (Fig. 28.4a–c)43. Peripherally located subretinal cysts are detected with difficulty. A yellowish, globular mass with poorly defined borders may be apparent and the movement of the parasite can be obscured. Fluorescein angiography and ultrasonography have been reported to be useful in delineating peripherally located subretinal cysts44. A diagnosis of ocular cysticercosis becomes difficult when the parasite dies and an intraocular inflammatory response develops6. Marked circumcorneal injection, keratic precipitates and flare in the anterior chamber and opacification of the vitreous similar to other inflammatory conditions are observed33. A cyst in the anterior chamber, which is rare, can excite uveal reaction and present as acute iridocyclitis41.

272

A. Kumar and N. Sharma

Fig. 28.2. Intravitreal cysticercus with retinal detachement (a) and overlying vitreal reaction (b).

Fig. 28.3. Subretinal cysticercus in macular location.

Ophthalmic Aspects of Cysticercosis

273

Fig. 28.4. Communicating cysticercus. A large (15 disc diameters) spheroid translucent cyst can be seen in the superotemporal quadrant, attached to, and obscuring the visibilty of the retina (a, b). The dense white structure within represents the scolex (a). This particular cyst was alive and made undulating movements, especially on exposure to the strong illumination of the ophthalmoscope. (c) Upon B-mode ultrasound scan, the posterior wall of the cyst was not distinguishable from the retinoscleral echo, raising suspicion that the cyst was communicating.

Associated symptoms and signs Ocular cysticercosis may be associated with neurological symptoms, such as headache, seizures, signs of hydrocephalus, or increased intracranial pressure as a result of

concomitant involvement of the central nervous system. Another indication of systemic involvement is the presence of multiple painless, subcutaneous nodules. A history of tapeworm infection and/or travel to endemic areas is helpful in establishing the

274

A. Kumar and N. Sharma

diagnosis. Ocular cysticercosis should be suspected in an individual who has lived in an endemic area and who develops uveitis, leukocoria and/or neurological symptoms. This diagnosis should also be suspected in individuals with subconjunctival cysts or lid nodules.

Differential diagnosis Hydatid cyst infestation may rarely occur in the extraocular muscles. The cysts are quite large in size, the average size being 3–5 mm, and can reach up to 10 cm. In children, the inflammatory response to a dying cysticercus should be differentiated from other causes of leukocoria, especially retinoblastoma and parasitic infections such as toxocariasis32. In the anterior chamber, the inflammation may be so severe that it is difficult to differentiate a cyst from a lens dislocated into the anterior chamber16.

Diagnosis Laboratory and immunologic tests Laboratory tests are of limited value in diagnosing intraocular cysticercosis. Complete blood count, serum chemistries and erythrocyte sedimentation rate may all be normal; eosinophilia is uncommon. Repeated stool samples may not show any proglottides or eggs of T. solium. An anterior chamber tap showing a high eosinophil count supports a diagnosis of intraocular cysticercosis44.

Radiological examination Orbital echography is often used to delineate the cystic lesions with a scolex in an enlarged extraocular muscle. Intraocular cysticercosis has characteristic echographic features30,44–46. The cyst may be seen underneath the retina, in the vitreous cavity, surrounded by inflammatory membranes, or, more rarely, in the anterior chamber. Standard A-scan ultrasonography reveals two equally high reflective echospikes corre-

sponding to the anterior and posterior walls of the cyst. Low amplitude spikes that are representative of the cavity of the cyst separate the high echospikes. An additional 100% high spike may be observed within the cyst when the beam passes through the scolex, which is usually located eccentrically. B-scan also demonstrates the complete cyst with an eccentric high-reflective opacity (scolex) and low-reflective, mobile opacities filling the cyst cavity (Fig. 28.5). Upon Bscan ultrasonography, the subretinal cysticercus appears as a round density connected to a curvilinear echo corresponding to the scolex and the cyst wall, respectively. Intravitreal cysticercus gives an appearance of a curvilinear cystic structure floating freely in the vitreous cavity. Intravitreal inflammatory reaction around the cyst, when present, is characterized by low-medium amplitude echoes in the vitreous cavity. Echography permits real-time, dynamic evaluation with direct visualization of the undulating movements of the parasite. In cases of communicating cysts, where the intravitreal cysticercus communicates subretinally, both A- and B-scan reveal the presence of a well defined anterior wall of the cyst, whereas the posterior wall of the cyst is not discernible separately from the retinal scleral echo (Fig. 28.4c)43. A careful ultrasonography is warranted in such cases, since demonstration of any subretinal extension may alter the surgical approach and possibly the surgical outcome43. Computed tomography (CT) of extraocular myocysticercosis may reveal the presence of cystic lesions in the extraocular muscle or diffuse myositis. A cystic lesion with a scolex on either CT scan or echography confirms a diagnosis of myocysticercosis. CT evidence of a cystic lesion without a scolex or diffuse myositis in the presence of a positive immunoserological test, preferably enzymelinked immunotransfer blot (EITB) for anticysticercal antibodies, is also considered diagnostic47. Magnetic resonance imaging (MRI) findings of neurocysticercosis have been extensively described (see Chapter 32). MRI appearances are characteristic; cysts in the extraocular muscle with a scolex within the cyst can be seen.

Ophthalmic Aspects of Cysticercosis

275

Fig. 28.5. B-mode ultrasound scan demonstrating the cystic nature of the lesion with an eccentric high reflective opacity representing the scolex.

Treatment Medical treatment No effective anticysticercal drug is available for the treatment of ocular cysticercosis. The lack of effective cysticidal action of praziquantel is attributed to insufficient concentrations of the drug in ocular tissue48,49. Two cases of subretinal cysticercosis that were treated without any success are on record48. Although the movements of the parasite stopped temporarily after 13–18 days, they were re-established subsequently. The authors concluded that the drug produced a mild toxic effect that was reversible. Albendazole (200–400 mg twice daily with corticosteroids or alone) has been used in extraocular myocysticercosis; preliminary results thereof are encouraging50. There are anecdotal reports of its use in subconjunctival cysticerci; spontaneous extrusion of the cysts was reported within 3–5 days in one such case51. Current opinion favours medical management for orbital cysticercosis. If a cystic lesion with scolex is demonstrated, oral albendazole with oral corticosteroids is recommended. If no scolex can be identified within the cyst or diffuse myositis is demonstrated, then an EITB

test may be of diagnostic help. If the latter is found to be positive, albendazole with oral steroids is recommended. If negative, oral corticosteroids are administered alone; a trial of treatment with albendazole may be considered in persisting cysts.

Surgical management Management of ocular cysticercosis is mostly surgical. The actual surgical approach employed is determined, for the most part, by the location of the cysticercus. Lid, conjunctival and anterior segment cysticercosis All subconjunctival cysts should be subjected to excision biopsy. The cyst can usually be easily removed from the lids, conjunctiva and the anterior chamber52. When inflammation is present in the anterior chamber, corticosteriods may decrease the uveal reaction, loosen the cyst attachment, and make removal of the cyst easier16. Cysticerci that are attached to the sheath of the extraocular muscles can be removed after partly sacrificing the sheath38.

276

A. Kumar and N. Sharma

Intravitreal cysticercosis Diathermy53, photocoagulation3,12, cryocoagulation30, open approach with lens extraction52and pars plana vitrectomy53 have been advocated in the management of posterior segment cysts. An early intravitreal cyst can be removed with a hypodermic needle54. For established intravitreal cysticercus, either a pars plana or an open sky vitrectomy has been advocated15,23,32,52,53. The drawback of open sky vitrectomy is that the lens must be removed, and glare or light scatter at the anterior surface of the vitreous body may hamper visibility of the larva. A safer and more effective method of removing the cysticercus involves the pars plana approach with a bimanual technique and use of endoillumination probes. A pars plana approach allows for clear visibility, maintenance of intraocular pressure, minimal vitreous loss and retention of the lens during the surgical procedure13,23,48,53,55. The cysticercus is impacted on the probe tip and rapidly cut and aspirated from the eye. All particles, including the scolex are easily cut and removed. A complete vitrectomy should be performed, after aspiration of the cyst, to remove any toxic products released from the cyst. If the intravitreal cysticercus is associated with a posterior pole retinal break but without retinal detachment, management of the break is not necessary because it is usually sealed by the strong inflammatory reaction previously induced by the cyst in the subretinal space30. However, if strong vitreous traction upon the retina is seen in the area of the break, the tractional membranes should be removed during the closed vitrectomy procedure30. Localized vitrectomy can be performed in the area of the cysticercus to remove toxins it may have released. Intraoperative complications during pars plana vitrectomy include migration and fragmentation of the parasite, retinal holes and haemorrhage. Migration occurs only if a large vitrectomy is done before the removal of the parasite. If a cysticercus breaks into two or three parts, each fragment forms a closed globular mass, often with no apparent spill of contents in the vit-

reous. Each fragment can be caught and aspirated again. Retinal tears and haemorrhage are mostly due to faulty technique. Postoperative macular oedema, preretinal membranes and uveitis are usually an exacerbation of preoperative conditions. The postoperative recovery period of the patient following pars plana vitrectomy is shorter and more easily managed. Systemic corticosteroids are administered 1 day before surgery, on the day of the surgery and for 1 day after surgery. Removal of the parasite from the macular region poses particular difficulties. To gain better access to the posterior pole of the eyeball, lateral canthotomy and division of the recti may be undertaken20; some surgeons even resort to the Krönlein, procedure3. Periocular and topical corticosteroids, in addition to mydriatics, are often all that are required to control the subsequent mild ocular inflammation13. In case of a cysticercus attached to the optic nerve head, the larva is dissected free of the optic nerve head by use of the blunt tip of an ocutome cutter and the endoillumination probe32. Once free from the optic nerve head surface, the larva is easily aspirated from the vitreous cavity by use of a combination of suction and cutting action of the ocutome probe. It is mandatory that before the dissection of the larva from the optic nerve head, all vitreal connections to the larva should be cut using standard vitrectomy cutting techniques. Subretinal cysticercosis If the cysticercus is subretinal, sclerotomy over the region of larva is the traditionally favoured technique22. In the past, destruction of subretinal cysts, less than 8 mm in diameter has been accomplished using xenon or argon photocoagulation. Initially a row of delimiting coagulations is placed in the normal retina, surrounding the parasite to prevent detachment3. Twenty shots of xenon Green I at 3° for 1–3 s, or 80 shots of 500 µm, 500–800 mW of argon for 0.2 s are recommended. The conversion of light to heat leads to coagulation of proteins and death of the parasite. Unlike a dead cysticer-

Ophthalmic Aspects of Cysticercosis

cus, the coagulated parasite produces only localized inflammatory reaction and does not induce severe endophthalmitis. Following photocoagulation, the patient is given periorbital and systemic corticosteroids for 3–6 weeks. The exudative reaction clears in 1 month, usually leaving an atrophic scar, with a white calcified scolex in the centre. Complications of photocoagulation include retinal rupture, survival of the parasite, macular scarring and severe uveitis3. Retinal rupture occurs when highenergy shots are applied to the edge of the parasite close to the normal retina or when the retina is thinned because of impending migration of the cyst into the vitreous. Rupture can hasten passage into vitreous. Survival of the parasite with return of contractile movements is due to insufficient treatment and requires further photocoagulation. Macular scarring is unavoidable when the parasite is in the macular location. Subretinal cysticercosis has also been managed by subretinal release of the cyst. The cyst must be precisely localized by indirect ophthalmoscopy and scleral depression. A deep, lamellar, L-shaped scleral dissection is made over the cyst13,29,48. Transillumination of the dissected scleral bed delineates large choroidal vessels and helps in avoiding them. The choroid is then exposed through a small incision in the scleral bed and, after adequate diathermy to avoid bleeding, it is perforated carefully to avoid rupture of the cyst. The cyst is then delivered through the choroidoscleral incision. Gentle pressure on the globe can help to release the cyst. Complications of the procedure include failure to remove the parasite, retinal detachment, retinal tear, vitreous loss and haemorrhage48. Removal of subretinal parasites via sclerotomy, however, carries risks. Extensive periocular surgery may be required to gain adequate exposure28,29,53,55–57. Inadequate localization may lead to non-removal of the parasite, perioperative migration of the cyst within the subretinal space and migration into the vitreous cavity. Other possible complications include retinal detachment, retinal tear with vitreous loss, vitreous haemorrhage and bacterial endophthalmi-

277

tis. Open sky and pars plana vitrectomies have been employed to remove subretinal cysticerci and have several advantages over classic sclerotomy1,15,17,26,28,31,34,52. The visibility of the parasite during surgery is excellent and the risk of subtotal cyst removal and choroidal bleeding, as with the external approach, is minimal. The risks of retinotomy can be further minimized by preoperative application of delimiting laser photocoagulation. This also prevents preoperative or perioperative cyst migration within the subretinal space. Following three-port pars plana vitrectomy incisions, the posterior vitreous overlying the cysticercus is exposed. Endodiathermy is used to create a retinotomy and enter the subretinal space over the cyst. The suction catheter is used as a cutter and is inserted through the retinotomy. The cyst is then removed from within the subretinal space. The scolex is brought into the midvitreous where it is examined, cut and aspirated. Internal drainage of subretinal fluid is followed by endolaser photocoagulation to surround the retinotomy. Internal tamponade is achieved either with silicone oil or a gas–fluid exchange performed using 12% perfluoropropane. After retinopexy, the cyst can also be pulled into the vitreous and extracted from the eye in one piece, after enlargement of the pars plana incision. The risk of spilling of cyst contents is minimal with this procedure as the cutting or aspiration of the cyst is avoided.

Conclusions Modern imaging techniques have made the diagnosis of ophthalmic cysticercosis easy. Nevertheless, clinical suspicion of the condition should be high and the diagnostic consideration may be invoked in any patient in endemic areas with a cystic lesion or uveitis, retinitis and endophthalmitis. This is particularly important because prognosis in untreated cases of intraocular cysticercosis is uniformly poor. Successful treatment lies in early and complete surgical removal of ocular cysticerci. When not treated, intravitreous or subreti-

278

A. Kumar and N. Sharma

nal cysticercus usually leads to blindness within 3–5 years. Without treatment, the cysticercus increases in size and begins to release toxins, leading to a profound inflammatory reaction with eventual destruction of the eye. Cysticerci located in

the eyelid and/or conjunctiva are more benign, and spontaneous extrusion of the subconjunctival cyst may occur. Once the infection is diagnosed, however, it is of the utmost importance to rule out central nervous system involvement.

References 1. Junior, L. (1949) Ocular cysticercosis. American Journal of Ophthalmology 32, 523–548. 2. Cano, M.R. Ocular cysticercosis. In: Ryan, S.J. (ed.) Retina, Vol. 2. CV Mosby, St Louis, Missouri, pp. 583–587. 3. Santos, R., Dalma, A., Ortiz, E., et al. (1979) Management of subretinal and vitreous cysticercosis: role of photocoagulation and surgery. Ophthalmology 86, 1501–1507. 4. Reddy, P.S., Reddy, D.B. (1957) Ocular cysticercosis. Current Medical Practitioner 1, 642. 5. Malik, S.R.K., Gupta, A.K., Choudhry, S. (1968) Ocular cysticercosis. American Journal of Ophthalmology 66, 1168–1171. 6. Kumar, A., Tewari, H.K., Goyal, H., et al. (1995) Socio-demographic trends in ocular cysticercosis. Acta Ophthalmologica Scandinavica 73, 438–441. 7. Balakrishnan, E. (1961) Bilateral intra-ocular cysticerci. British Journal of Ophthalmology 45, 150–151. 8. Cardenas, F., Quiroz, H., Plancarte, A., et al. (1999) Taenia solium ocular cysticercosis: findings in 30 cases. Annals of Ophthalmology 24, 25–28. 9. Mais, F.A. (1969) Criocirugia na cisticercose ocular. Revista Brasileira de Ophthalmologia 28, 99–106. 10. Katz, M., Despommier, D.D., Gwadz, R.W. (1982) Parasitic Diseases. Springer-Verlag, New York. 11. Nhan, N.T. (1981) Norew experience dans le diagnostic et dans le traitment chirugical de la cysticercose intraoculaire. Journal Francais d’Ophthalmologie 4, 387–392. 12. Rocha, H., Galvao, P.G. (1963) Case de cisticerco subretiniano yuxtapapilar treatade pela fotocoagulacao. Revista Brasileira de Ophthalmologia 22, 41–49. 13. Teekhasaenee, C., Ritch, R., Kanchanaranya, C. (1986) Ocular parasitic infection in Thailand. Review of Infectious Diseases 8, 350–356. 14. Bhaskaran, C.Y., Reddy, R.M., Venkatamuni, M., et al. (1978) Ocular cysticercosis. Indian Journal of Ophthalmology 26, 42–45. 15. Kapoor, S., Kapoor, M.S. (1978) Ocular cysticercosis. Journal of Pediatric Ophthalmology and Strabismus (Thorofare) 15, 170–173. 16. Kapoor, S., Sood, G.C., Aurora, A.L., et al. (1977) Ocular cysticercosis: report of a free floating cysticercus in the anterior chamber. Acta Ophthalmologica (Copenhagen) 55, 927–930. 17. DiLoreto, D.A., Kennedy, R.A., Neigel, J.M., et al. (1990) Infestation of extraocular muscle by cysticercus cellulosae. British Journal of Ophthalmology 74, 751–752. 18. Mandell, L.A., Ralp, E.D. (1985) Essentials of Infectious Diseases: Serology and Skin Testing. Scientific Publications, Boston, Massachusetts. 19. Danis, P. (1974) Intraocular cysticercus. Archives of Ophthalmology 91, 238–239. 20. Bartholomew, R.S. (1975) Subretinal cysticercosis. American Journal of Ophthalmology 79, 670–673. 21. Sabti, K., Chow, D., Wani, V. (2001) Resolution of bilateral multifocal subretinal cysticercosis without significant inflammatory sequelae. Canadian Journal of Ophthalmology 36, 408–413. 22. Bawa, Y.S., Wahi, P.L. (1962) Cysticercosis cellulosae of the optic disc with generalized cysticercosis. British Journal of Ophthalmology 46, 753–755. 23. Wood, R.R., Binder, P.S. (1979) Intravitreal and intracameral cysticercosis. Annals of Ophthalmology 11, 1033–1036. 24. Sen, D.K., Thomas, A. (1969) Cysticercus cellulosae causing subconjunctival abscess. American Journal of Ophthalmology 68, 714–715. 25. Sen, D.K., Thomas, A. (1969) Incidence of conjuctival cysticercosis. Acta Ophthalmologica 47, 359–399. 26. Jampol, L.M., Caldwell, J.B.H., Albert, D.M. (1973) Cysticercus cellulosae in the eyelid. Archives of Ophthalmology 89, 318–320.

Ophthalmic Aspects of Cysticercosis

279

27. Sen, D.K. (1982) Acute suppurative dacryoadenitis caused by a cysticercus cellulosa. Journal of Pediatric Ophthalmology and Strabismus (Thorofare) 19, 100–102. 28. Fishman, M., Kerman, B., Foxman, S. (1987) Intraocular cysticercosis: migratory. In: Ossoing, K.C. (ed.) Ophthalmic Echography. Proceedings of the 10th SIDUO Congress. Martinus Nijhoff, Dordrecht. 29. Aracena, T., Perez-Roca, F. (1981) Macular and peripheral subretinal cysticercosis. Annals of Ophthalmology 13, 1265–1267. 30. Kruger-Leite, E., Jalkh, A.E., Quiroz, H., et al. (1985) Intraocular cysticercosis. American Journal of Ophthalmology 99, 252–257. 31. Giovannini, A., Chillemi, P., Coccia, L., et al. (1985) Ocular cysticercosis. Apropos of a clinical case of presumed ocular cysticercosis. Journal Francais d’ Ophthalmologie 8, 789–795. 32. Zinn, K.M., Guillory, S.L., Friedman, A.H. (1980) Removal of intravitreous cysticerci from the surface of the optic nerve head: a pars plana approach. Archives of Ophthalmology 98, 714–716. 33. Sen, D.K., Mathur, R.N., Thomas, A. (1967) Ocular cysticercosis in India. British Jounal of Opthalmology 51, 630–632. 34. Kapoor, S. (1978) Ocular cysticercosis in India. Tropical and Geographical Medicine 30, 253–256. 35. Krishna, D., Mohan, H. (1978) Ocular cysticercosis in India. Journal of Pediatric Ophthalmology and Strabismus (Thorofare) 15, 96–102. 36. Reddy, P.S., Satyendran, O.M. (1964) Ocular cysticercosis. American Journal of Ophthalmology 57, 664–666. 37. Rao, A.V.M., Satayandran, O.M., Shiva Reddy (1967) Cysticercosis of the eye. Oriental Archives of Ophthalmology 6, 249–255. 38. Shekhar, G.C., Lemke, B.N. (1997) Orbital cysticercosis. Ophthalmology 104, 1599–1604. 39. Menon, V., Kumar, G., Prakash, P. (1994) Cysticercosis of extraocular muscle. Journal of Pediatric Ophthalmology and Strabismus (Thorofare) 31, 126–129. 40. Madan, N., Chopra, K., Popli, V. (1995) Proptosis as a manifestation of cysticercosis. Indian Pediatrics 32, 914–918. 41. Schmidt, U., Klauss, V., Stefani, F.H. (1990) Unilateral iritis by cysticercal larva in the anterior chamber. Ophthalmologica (Basil) 200, 210–215. 42. Segal, P., Mrzygold, S., Smolarz Dudarewicz, J. (1964) Subretinal cysticersosis in the macular region. American Journal of Ophthalmology 57, 655–664. 43. Kumar, A., Verma, L., Khosla, P.K., et al. (1989) Communicating intravitreal cysticercosis. Ophthalmic Surgery 20, 424. 44. Manschot, W.A. (1968) Intraocular cysticercus. Archives of Ophthalmology 80, 772–774. 45. Murthy, H., Kumar, A., Verma, L. (1990) Orbital cysticercosis – an ultrasonic diagnosis. Acta Ophthalmologica 68, 612–614. 46. Meyerson, L., Pienaar, B.T. (1961) Intra-ocular cysticercus. British Journal of Ophthalmology 45, 148–149. 47. Stewart, C.R., Salman, J.F., Murry, A.D., et al. (1993) Cysticercosis as a cause of severe medial rectus myositis. American Journal of Ophthalmology 116, 510–516. 48. Santos, R., Chavarria, M., Aguirre, A.E. (1984) Failure of medical treatment in two cases of intraocular cysticercosis. American Journal of Ophthalmology 97, 249–250. 49. Kestelyn, P., Taelman, H. (1985) Effect of praziquantel on intraocular cysticercosis: a case report. British Journal of Ophthalmology 669, 788–790. 50. Sihota, R., Honavar, S.G. (1994) Oral albendazole in the management of extraocular cysticercosis. British Journal of Ophthalmology 78, 621–623. 51. Raina, U.K., Taneja, S., Lamba, P.A., et al. (1996) Spontaneous extrusion of extraocular cysticercosis cysts. American Journal of Ophthalmology 121, 438–441. 52. Barraquer, J. (1963) Lens Extraction and Extraction of Cysticercus. American Academy of Ophthalmology and Otolaryngology Meeting, New York (Film presentation). 53. Hutton, W.L., Vaiser, A., Snyder, W.B. (1976) Pars plana vitrectomy for removal of intravitreal cysticercus. American Journal of Ophthalmology 81, 571–573. 54. Patnaik, B., Kalsi, R. (1983) Intraocular cysticercosis and its surgical management. In: Henkind, P. (ed.) Acta XXIV International Congress of Ophthalmology. JB Lippincott, Philadelphia, pp. 152–159. 55. Verdaguer, T.J., Lechuga, M., Ibanez, S. (1977) Tratamiento quirurgico da la cisticercosis intravitrea. Archivos de Chilian del Ophthalmologia 34, 49–54. 56. Gemolotto, G. (1955) Contributo alla terapia chirurgica del cisticerco andocular. Archives of Ophthalmology 59, 465–368. 57. Jain, I.S., Dhir, S.P., Chattopadhiya, P.R., et al. (1979) Ocular cysticercosis in North India. Indian Journal of Ophthalmology 27, 54–58.

29

Neurocysticercosis: Diagnosis and Treatment in Special Situations Ravindra Kumar Garg and Alok Mohan Kar

Introduction Neurocysticercosis (NC) is not only rampant in developing countries, but its frequency is also increasing in developed countries, due to increasing immigration and more frequent travel to endemic regions. In endemic and even in non-endemic regions’ cysticercosis is likely to occur with several other medical conditions. Concomitant illnesses may affect natural history and clinical behaviour of cysticercosis and consequently its management and prognosis. In addition, Taenia solium infection, along with several other parasitic infections, has been causally implicated in certain systemic and central nervous system (CNS) malignancies. In this chapter, we shall be reviewing the available literature on such associations with an emphasis on their clinical implications.

Neurocysticercosis in Acquired Immunodeficiency Syndrome (AIDS) AIDS is frequently complicated by opportunistic infections. There are geographic variations in the pattern of opportunistic infections depending upon the prevalence of microorganisms in the environment. Pneumocystis, Toxoplasma and Cryptosporidium are the main organisms associated with

human immunodeficiency virus (HIV) infection worldwide. A few other organisms could also potentially interact with HIV infection in their respective regions of endemicity. One such emerging example is the occurrence of NC in AIDS. Thornton et al. reported such an association for the first time in four African patients1. In three patients, the occurrence of seizures, a symptom related to NC, brought the patients to medical attention and eventually a diagnosis of HIV infection was made. White et al. later reported asymptomatic NC in a patient with HIV infection; this patient also had cryptococcal meningitis2. Soto Hernandez recently reported two more such patients3. One patient presented with intracranial hypertension. Neuroimaging revealed a solitary giant intracranial cyst, which was surgically removed. The second patient had brain toxoplasmosis and incidental NC. A summary of all these patients and one patient in whom NC was diagnosed at autopsy4 appears in Table 29.1.

Clinical implications of concomitant NC and HIV infection The association between NC and AIDS is a cause for several concerns. Firstly, there may be the possibility of the occurrence of NC in

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

281

282

R.K. Garg and A.M. Kar

Table 29.1. Summary of published experience of eight cases of neurocysticercosis in AIDS. Case No.

Ref. Clinical No. Age/Sex presentation

Associated condition

MRI/CT scan

Treatment

Outcome

1.

4

22/F

NA

NA

Died

2.

1

40/M

Toxoplasmosis, tuberculous abscess Generalized lymphadenopathy

Abendazole + Slight corticosteroids improvement

3.

1

36/M

4.

1

30/M

5.

1

25/M

Numerous intraparenchymal cystic lesions Multiple parenchymal cysts Numerous parenchymal cysts Multiple cortical cysts

6.

2

29/M

Asymptomatic

7.

3

29/M

8.

3

41/F

Headache, raised intracranial pressure Raised intracranial pressure, decreased attention, hemiparesis

NA; diagnosis was made incidentally on autopsy Headache, partial seizures, obtundation, papilloedema, hemianopia, hemiparesis Partial seizures, brachial monoparesis, hand incoordination Headache, left hemiparesis, left optic atrophy, visual field defect Generalized tonic–clonic seizure

Generalized lymphadenopathy, oral candidiasis Generalized lymphadenopathy Generalized lymphadenopathy, thrombocytopenia, cryptococcal meningitis

<200 CD4 cells Toxoplasmosis, Herpes zoster

Praziquantel + Improved phenytoin Praziquantel + Improved corticosteroids –

Single cystic lesion Single giant Surgery + cyst albendazole Racemose None cyst in Sylvian fissure

Died

Improved Impoved NA

NA: data not available.

other immunocompromised states as well. The alterations in the immune system of the host described in patients with NC may be in some cases a predisposition to, rather than a consequence of, HIV infection1. Second, the therapeutic response to anticysticercal drugs (praziquantel and albendazole) may differ in HIV-infected patients since successful anticysticercal treatment requires a simultaneous drug effect on both the parasite and host immune system. Third, clinical and serological manifestations of NC might be modified by HIV infection.

Taenia crassiceps cysticercosis in AIDS Klinker et al., in 1992, first reported the occurrence of subcutaneous cysticercosis due to T. crassiceps in AIDS5. Subsequently, Francois et al. described the development of a fluctuant painful subcutaneous and intramuscular tumour of the forearm due to T. crassiceps cysticercosis in AIDS6. Taenia crassiceps is ordinarily non-pathogenic to humans

and causes cysts in the subcutaneous tissue and viscera of rodents. It may, however, be added to the list of opportunistic infections that occur in AIDS.

Differential diagnosis of NC in AIDS Intracranial mass lesions are frequent in AIDS. The nature of these mass lesions can be broadly divided into three distinct groups: opportunistic infections, neoplasms and cerebrovascular disease7. Toxoplasmosis, a common cause of intracranial mass lesions in AIDS, can frequently be confused with NC because of similar clinical and imaging presentations. A point of difference upon imaging studies is that toxoplasma lesions involve subcortical structures such as basal ganglia, thalamus and cerebellum in comparison to NC, which is characteristically located at the cortical–subcortical interface. A reliable non-invasive diagnosis of toxoplasmosis is made with the help of positive antitoxoplasma serology and a good thera-

Diagnosis and Treatment in Special Situations

peutic response as confirmed by serial CT scans8–10. Primary CNS lymphoma is easily distinguishable from NC upon imaging studies by involvement of, and extension across the corpus callosum, exclusive involvement of the white matter, periventricular location and sub-ependymal spread8–10.

Treatment of NC in AIDS All reported cases of NC so far have been found in advanced HIV disease, frequently coexisting with other opportunistic infections, generalized lymphadenopathy or profound CD4 lymphoytopaenia. Reported experience from a limited number of cases of AIDS with NC suggests that the latter responds to treatment with albendazole or praziquantel in a manner similar to nonHIV-related NC. Surgery may also be considered in cases of solitary giant parenchymal cysts or racemose cysticercosis. However, greater emphasis should be given to treatment of coexisting diseases1–3.

Neurocysticercosis in Other Immunocompromised States A few reports of NC in other immunocompromised conditions are available, however, due to lack of sufficient data it is difficult to ascertain the significance of such associations.

283

immunosupressive drugs used in the management of renal transplant. A point to note, however, is that some antiepileptic drugs (AEDs) used for the treatment of seizure disorder due to cerebral cysticercosis, including phenobarbitol, phenytoin and carbamazeapine induce the hepatic CYP3A4 enzyme system. This can result in increased clearance and reduced blood levels of cyclosporin and FK 506 and, thereby, renal allograft rejection12,13. Therefore, blood levels of cyclosporin should be measured during AED co-administration and appropriate dose modifications be made.

Leukaemia Mauad et al. reported an unusual case of massive cardiopulmonary cysticercosis in acute leukaemia14. As pulmonary cysticercosis is extremely rare, the authors suggested that profound immunosuppression, produced by acute leukaemia, was responsible for this unusual presentation.

Concomitant CNS Infections with NC In endemic regions, NC is likely to occur coincidentally with other CNS infections that are common and peculiar to that region, with the possibility of mutually altering respective pathological and clinical courses of both the diseases. One such example is that of association of NC with Japanese B encephalitis.

Renal transplantation Some parasitic diseases such as strongyloidosis and schistosomiasis uncommonly occur in the post-transplant immunocompromised state. Gordillo-Paniagua et al. described the occurrence of cysticercotic encephalitis in a cadaveric renal transplant recipient11. Complete resolution of clinical and CT abnormalities were achieved following praziquantel therapy. More importantly, the complicating illness did not affect renal allograft function or in any way alter immunosuppressive drug action. The reported individual did not receive cyclosporin or FK 506, both standard

Japanese B encephalitis An unusually high frequency of NC has been reported in at least two autopsy series of brains studied for Japanese B encephalitis from India and China15,16. Shankar et al. found cerebral cysticercosis in 11 of 26 consecutive brain specimens examined for Japanese B encephalitis16. Fang et al. noted NC in eight of 26 brains with Japanese B encephalitis17. Other authors have described the association in living subjects using imaging and serological studies (Fig. 29.1a and b)17,18. From the point of view of

284

R.K. Garg and A.M. Kar

Fig. 29.1. Magnetic resonance image (fluid attenuation recovery sequence) showing solitary cysticercus granuloma (a) with a scolex and surrounding oedema and thalamic and sub-thalamic lesions (b) characteristic of Japanese B encephalitis.

diagnosis and treatment, it is important to differentiate this condition from cysticercotic encephalitis19. Several authors have tried to explain this association on the basis of anatomical derangements in the blood–brain barrier during the inflammatory phase of cerebral cysticercosis that facilitate viral entry15–18. Furthermore, T. solium larvae are also thought to sensitize the brain to more severe injury by Japanese B encephalitis. Indeed, it has been surmised that concomitant cerebral cysticercosis adversely determines the outcome of the encephalitis16,18. In our view, the swine population is an important reservoir for Japanese B encephalitis and also constitutes the intermediate host population for T. solium. Therefore, there is a likelihood of a chance association to occur in areas where free-ranging pigs are common.

mosis may produce clinical and imaging manifestations similar to that of NC. Toxoplasmosis is rare in immunocompetent hosts, while NC occurs rarely in immunosuppressed hosts20. A variety of investigative techniques including neuroimaging, thallium-201 single photon emission computed tomography, polymerase chain reaction analysis of CSF and special histopathological methods may be required to reliably differentiate acquired toxoplasmosis from cerebral cysticercosis20. Wallus and Young reported the rapid development of a large cystic parenchymal lesion in a young woman, which was surgically removed and found to contain pus rather than clear fluid21. The pus was cultured and grew Brucella melitensis. The case allegorizes bacterial superinfection of cerebral cysticercosis and as well as the point that clinicians should be aware of multiple simultaneous infections.

Other CNS infections

Neurocysticercosis in Pregnancy Another CNS infection that has been reported to occur in patients with NC is cerebral toxoplasmosis3,4. As mentioned earlier, toxoplas-

Like several other neurological disorders, NC may manifest for the first time during

Diagnosis and Treatment in Special Situations

pregnancy and the latter may occur in a woman with pre-existing NC22–24. Our experience on this association is largely based on anecdotal case reports22–24. NC can be responsible for new-onset seizures during pregnancy. However, seizures have a different connotation in pregnancy than otherwise. First, seizures are more commonly a manifestation of eclampsia and NC must be differentiated from this condition24. Second, both mother and fetus are at risk of death during and after a major seizure. Hypoxia and acidosis caused by convulsions, though, well tolerated by the mother, can be fatal to the fetus. Unsuspected NC may also pose diagnostic problems during pregnancy. The investigation of choice for the diagnosis of NC in pregnant women is magnetic resonance imaging (MRI); computed tomography (CT) scanning should be avoided as far as possible, especially during early part of pregnancy. Data is insufficient about safety of anticysticercal drugs during pregnancy. Praziquantel does not cause teratogenicity in mammalian assays or reproductive impairment in rats, mice or rabbits. There are no available data on human reproductive ill effects from this agent25. Anecdotal use in pregnant individuals who were not yet aware that they were pregnant, so were in very early pregnancy (at the time of maximal teratogenic potential), have not revealed any congenital anomalies25. Use in later gestation has not been associated with an increase in fetal or neonatal mortality or morbidity22. Though human data are lacking, albendazole has been found to be embryotoxic and teratogenic to laboratory animals; therefore its use during pregnancy, especially the first trimester, is not recommended. We recommend that if the patient is pregnant and seizures are in good control on antiepileptic drugs (AEDs) then definitive treatment with anticysticercal drugs can be delayed till after delivery. On the contrary, if the disease is progressive or seizures are not well controlled, then anticysticercal treatment should be considered during pregnancy22. Finally, note should be made of the fact that praziquantel is secreted in breast

285

milk and its effects on neonates and infants are not yet known22.

Neurocysticercosis and Malignancies Systemic malignancies Herrera et al. investigated the possibility of an association between NC and systemic cancer26. The authors reviewed 1271 autopsy files and selected those with malignancy cases. Autopsies revealing any nonmalignant disease served as controls. NC was significantly more frequent in haematological malignancies in comparison to controls. It was concluded that since human cancer arises from interaction of several factors including xenobiotics and endogenous constituents, it is difficult to establish NC as a causal agent of haematological malignancies; however, it should be considered as a potential risk factor for haematological malignancies in endemic countries. Mutagenic abnormalities including chromosomal aberrations and HPRTlocus mutations have been reported with increased frequency in individuals with NC27,28. Although some authors relate these abnormalities to the administration of praziquantel, the prevailing view is that these abnormalities are caused by NC itself and that they revert back with praziquantel administration27–29. Some authorities believe that T. solium infestation causes depression of cell-mediated immunity, in particular certain aspects of T-cell function30,31. Since the latter is involved in surveillance against cancer, it may be surmised that the parasiteinduced immunosuppression underlies the predisposition to malignancies.

Central nervous system malignancies In non-endemic regions where incidence of NC is very low, it is not surprising that lesions of NC are mistaken as cerebral tumour. Silver et al. reported one such example; a 9-year old girl presented with severe acute headache, vomiting and convulsions – imaging revealed a ring-enhancing CT

286

R.K. Garg and A.M. Kar

lesion32. On the basis of radiological impression and report of stereotactic needle biopsy, the lesion was diagnosed as malignant glioma. However, subsequently, the excised mass revealed cysticercus granuloma. More importantly, there are reports of a causal association between NC and CNS malignancies33,34. A systematic case–control evaluation found an increased frequency of NC among patients with cerebral glioma34. In this series, six out of eight individuals who demonstrated the association had calcified cysts in and around the neoplasm; suggesting that the severe inflammatory response to degenerating transitional cysticerci that lead to calcification was responsible for a neoplastic transformation35. Several mechanisms have been put forward for the causal association between NC and cerebral gliomas (Box 29.1)33–35.

Conclusions Neurocysticercosis is likely to be associated with other common medical conditions in endemic regions. Though data is limited, there is no evidence that associated immunological disorders such as AIDS and renal transplantation or physiological conditions such as pregnancy affect the natural course of cysticercosis. Such patients need the usual forms of treatment and there is a good outcome in the majority. In endemic regions, new-onset seizures in pregnancy should raise the consideration of NC as an aetiological possibility. If NC is diagnosed, anticysticercal treatment is preferably delayed till the postpartum period. Preliminary reports from Latin America indicate that NC may predispose to certain haematological and CNS malignancies. Further research effort is required to clarify this relationship.

Box 29.1. Suggested oncogenic mechanisms in neurocysticercosis 1. Immunological changes resulting in loss of regulatory mechanisms responsible for immune surveillance against cancer. 2. Transfer of genetic material from parasite to the host, causing DNA damage and malignant transformation of host cells. 3. Chronic inflammation with liberation of nitric oxide and inhibition of tumour suppressor genes. 4. Chromosomal aberrations in peripheral blood cells. 5. Intense gliosis around cysticercal calcified lesions may stimulate uncontrolled proliferation of glial cells. 6. Interaction with other unidentified oncogenic factors (e.g. environmental, genetic).

References 1. Thornton, C.A., Houston, S., Latif, A.S. (1992) Neurocysticercosis and human immunodeficiency virus infection. A possible association. Archives of Neurology 49, 963–965. 2. White, A.C. Jr, Dakik, H., Diaz, P. (1995) Asymptomatic neurocysticercosis in a patient with AIDS and cryptococcal meningitis. American Journal of Medicine 99, 101–102. 3. Soto Hernandez, J.L., Ostrosky Zeichner, L., Tavera, G., et al. (1996) Neurocysticercosis and HIV infection: report of two cases and review. Surgical Neurology 45, 57–61. 4. Mosowitz, L.B., Hensley, G.T., Chan, J.C., et al. (1984) The neuropathology of acquired immune deficiency syndrome. Archives of Pathology and Laboratory Medicine 108, 867–872. 5. Klinker, H., Tintelnot, K., Joeres, R., et al. (1992) Taenia crassiceps infection in AIDS. Deutsche Medizinische Wochenschrift 117, 133–138. 6. Francois, A., Favennec, L., Cambon-Michot, C., et al. (1998) Taenia crassiceps invasive cysticercosis: a new human pathogen in acquired immunodeficiency syndrome. American Journal of Surgical Pathology 22, 488–492.

Diagnosis and Treatment in Special Situations

287

7. Report of the quality standards subcommittee of American Academy of Neurology (1998) Evaluation and management of intracranial mass lesions in AIDS. Neurology 50, 21–26. 8. Price, R.W. (1996) Neurological complications of HIV infection. Lancet 348, 445–452. 9. Garg, R.K. (1999) HIV infections and seizures. Postgraduate Medical Journal 75, 317–390. 10. Jinkins, J.R., Provenzale, J.M. (1997) Brain and spine imaging findings in AIDS patients. Radiology Clinics of North America 35, 1127–1166. 11. Gordillo-Paniagua, G., Munoz-Arizpe, R., Ponsa-Molina, R., et al. (1987) Unusual complication in a patient with renal transplantation: cerebral cysticercosis. Nephron 45, 65–67. 12. Fahr, A. (1993) Cyclosporin: clinical pharamacokinetics. Clinical Pharmacokinetics 24, 472–495. 13. Andersen, G.D. (1998) A mechanistic approach to antiepileptic drug interactions. Annals of Pharmacotherapy 32, 554–563. 14. Mauaud, T., Battlehner, C.N., Bedrikow, C.L., et al. (1997) Case report: massive cardiopulmonary cysticercosis in a leukemic patient. Pathology, Research and Practice (Stuttgart) 193, 527–529. 15. Das, S.K., Nityanand, S., Sood, K., et al. (1991) Japanese B encephalitis with neurocysticercosis. Journal of the Association of the Physicians of India 39, 643–644. 16. Shanker, S.K., Rao, T.V., Mruthyunjayanna, B.P., et al. (1983) Autopsy study of brain during an epidemic of Japanese encephalitis in Karnataka. Indian Journal of Medical Research 78, 431–440. 17. Fang, L.Y., Lung, T.C., Kai, L. (1957) Cerebral cysticercosis as a factor aggravating Japanese encephalitis. Chinese Medical Journal 75, 101. 18. Desai, A., Shankar, S.K., Jayakumar, P.N., et al. (1997) Co-existence of cerebral cysticercosis with Japanese encephalitis: a prognostic modulator. Epidemiology and Infection 118, 165–171. 19. Rangel, R., Torres, B., Del Bruto, O.H. (1987) Cysticercotic encephalitis: a severe form in young females. American Journal of Tropical Medicine and Hygiene 36, 387–392. 20. Mitchell, W.G. (1999) Neurocysticercosis and acquired cerebral toxoplasmosis in children. Seminars in Pediatric Neurology 6, 267–277. 21. Walus, M.A., Young, E.J. (1990) Concomitant neurocysticercosis and brucellosis. American Journal of Clinical Pathology 94, 790–792. 22. Kurl, R., Montella, K.R. (1994) Cysticercosis as a cause of seizure disorder in pregnancy: case report and review of literature. American Journal of Perinatology 11, 409–411. 23. Paparone, P.W., Menghetti, R.A. (1996) Case report: neurocysticercosis in pregnancy. New Jersey Medicine (Lawrenceville, NJ) 93, 362–367. 24. Suarez, V.R., Iannucci, T.A. (1999) Neurocysticercosis in pregnancy: a case initially diagnosed as eclampsia. Obstetrics and Gynecology 93, 816–818. 25. Machemer, L., Lorke, D. (1978) Mutagenicity studies with praziquaentel, a new antihelminthic drug, in mammalian systems. Archives of Toxicology 39, 187–197. 26. Herrera, L.A., Benita-Bordes, A., Sotelo, J., et al. (1999) Possible relationship between neurocysticercosis and hematological malignancies. Archives of Medical Research (Mexico) 30, 154–158. 27. Herrera, L.A., Ramirez, T., Rodriguez, U., et al. (2000) Possible association between Taenia solium cysticercosis and cancer: increased frequency of DNA damage in peripheral lymphocytes from neurocysticercosis patients. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 61–65. 28. Montero, R., Flisser, A., Madrazo, I., et al. (1994) Mutation at the HPRT locus in patients with neurocysticercosis treated with praziquantel. Mutation Research 305, 181–188. 29. Flisser, A., Gonzalez, D., Plancarte, A., et al. (1990) Praziquantel treatment of brain and muscle porcine Taenia solium cysticercosis. 2. Immunological and cytogenic studies. Parasitology Research 76, 640–642. 30. Molinari, J.L., Tato, P., Reynosa, O.A. (1990) Depressive effect of a Taenia solium cysticercus factor on cultured human lymphocytes stimulated with phytohaemagglutinin. Annals of Tropical Medicine and Parasitology 84, 205–208. 31. Thussu, A., Sehgal, S., Sharma, M., et al. (1997) Comparison of cellular responses in single- and multiple-lesion neurocysticercosis. Annals of Tropical Medicine and Parasitology 91, 627–632. 32. Silver, S.A., Erozan, Y.S., Hruban, R.H. (1996) Cerebral cysticercosis mimicking malignant glioma: a case report. Acta Cytclologica 40, 351–357. 33. Agapejev, S., Alves, A., Zanini, M.A., et al. (1992) Cystic oligodendroglioma and positivity of reactions for cysticercosis: report of a case. Arquivos de Neuropsiquiatria 50, 234–238. 34. Del Brutto, O.H., Castillo, P.R., Mena, I.X., et al. (1997) Neurocysticercosis among patients of cerebral glioma. Archives of Neurology 54, 1125–1128. 35. Del Brutto, O.H., Dolezal, M., Castillo, P.R., et al. (2000) Neurocysticercosis and oncogenesis. Archives of Medical Research (Mexico) 31, 151–155.

30

The Pathology of Neurocysticercosis Alfonso Escobar and Karen M. Weidenheim

Introduction The pathological spectrum of neurocysticercosis (NC) is as wide as the range of its clinical manifestations. A thorough description of its pathology and morbid anatomy is important for an understanding of the clinical expressions and natural history, and requires a wide variety of clinical material, studied with several diagnostic protocols1,2. The basic approaches to the study of the pathology of NC, the pathological stages of evolution of cysticerci and the host tissue responses are discussed in this chapter.

The Contribution of Autopsy Necropsy has contributed immensely to our knowledge of Taenia solium cysticercosis. Some of the earliest insights into the disorder were based purely on autopsy, since at that time sophisticated neuroradiological investigations were not available3–5. Pooled autopsy data from general hospitals have also been used as a parameter in the study of the epidemiology of the disease, in particular the burden of disease in given populations (see Chapter 11, also)1,6,7. Moreover, autopsy studies have helped to clarify issues regarding clinical behaviour and variables associated with disease manifesta-

tions. For instance, it is often believed that the severity of the clinical features and pathological reaction to cysticerci is related to the number of parasites, their location and age in the central nervous system. An interpretation of the pathology of NC involves careful consideration of all factors mentioned above. One may, however, be misled to believe that the clinical picture is likely to be more severe with larger number of, and older age of the parasites8–11. However, this is not necessarily true. It is common to note incidental cerebral cysticercosis in routine autopsies performed in general hospitals in Mexico (Fig. 30.1)12. These are those cases that have remained asymptomatic with specific regard to neurological symptoms during their lifetime. In our autopsy experience, cysticerci located in eloquent cortical zones such as the motor cortex have an equal chance of either manifesting with clinical symptoms and signs, for instance, partial motor seizures, or remaining asymptomatic13. Conversely, in a case of fatal intracranial hypertension, autopsy may disclose hydrocephalus that has developed due to a single cyst lodged in the fourth ventricle or cerebral aqueduct (see Chapter 20). This underscores the significance of the location of the parasite as well as the nature of the host immune response upon the clinical outcome.

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

289

290

A. Escobar and K.M. Weidenheim

Fig. 30.1. Parenchymal cysticercosis. Coronal section of the brain with multiple cysts lodged in cortical grey and subcortical white matter and leptomeningeal space. Some of the cysts display a characteristic larva inside the vesicle. Notice also that the parasites in the right putamen, and at the tip of third frontal and first temporal convolution in the left hemisphere, have lost their vesicular morphology and transformed into homogenous colloidal/granular nodular structures. This is an example of cysticerci in different stages of resolution at one time.

Identification of the Parasite The identification of cysticerci in brain biopsies is crucial to the pathological diagnosis of NC. The material sent to the pathology laboratory is usually a well-preserved cyst or may consist of clumps of membranous structures (Fig. 30.2a and b). In the former case, an unwary pathologist may erroneously diagnose a colloid cyst instead of cysticercosis if s/he has been told that the specimen came from the third ventricle. Microscopic examination, however, establishes the correct diagnosis. At the laboratory of one of the authors in Mexico City, it is routine to open any vesicular structure in order to expose the larva, which may be lying within. The larva is then separated from the membranous structure, placed between two glass slides, and pressed until it is completely flattened. Pressure is maintained by applying masking tape at both ends of the two slides. Light-

microscopic examination with a scanning lens permits identification of rudimentary strobila and scolex formed by a rostellum with four suckers and 20 pairs of hooks arranged in the form of a crown (Fig. 30.3). When the available pathological material comprises membranous structures alone, histological examination reveals its three-layered structure. The external, cuticular layer appears as a festooned syncytium covered by microtriches. It is lined by glycocalyx giving the appearance of a homogeneous eosinophilic layer. Beneath lies the middle or cellular layer. Here, lymphocyte-like elements accumulate in single, double, or sometimes triple rows. The innermost or reticular layer is most prominent and exhibits fibrillary aspect with multiple excretory canaliculi similar to capillaries (Fig. 30.4a and b). In addition, small, oval or round calcareous corpuscles may be identified within this layer. The latter represent the calcified stage

The Pathology of Neurocysticercosis

291

Fig. 30.2. (a) Vesicular stage of a cyst found in the fourth ventricle. The C-shaped larva protrudes from the previously opened vesicular membrane. (b) Two meningeal cysticerci with hyaline change within their vesicular membranes.

of intracorporeal vacuoles, which are sometimes present in the reticular layer during the early, viable stages of the cysticercus (Fig. 30.4c). In order to be able to identify the scolex, serial sections are often required. The scolex appears as a more compact structure very similar to the membrane in which infoldings of the spiral canal and the suckers may be identified. If the hooklets are present, they appear as a cornified semitransparent structure (Fig. 30.5a).

Evolutionary Stages of Human Cysticercosis: Pathological Correlates Human NC offers the possibility of observing, in autopsy or biopsy material, the several stages through which the parasites evolve during their lifetime in the brain. Four stages are described below14–18. Their corresponding features upon imaging studies are reviewed in Chapter 32.

292

A. Escobar and K.M. Weidenheim

Fig. 30.3. Rostellum, suckers and crown of hooklets identify a cysticercus cellulosae. Fresh specimen prepared according to the technique for rapid diagnosis, as described in the text (scale bar: 330 m).

Vesicular stage In the vesicular stage the metacestode has a thin, friable, translucent whitish membrane. Inside, a round curled and invaginated larva, 4–5 mm in length, and bathed in a transparent fluid, is visible (Figs 30.5a and 30.6). There is minimal, if any, surrounding inflammatory response.

30.5b), with concomitant breakdown of the blood–brain barrier. If the location is subarachnoid, there is an exudative inflammatory reaction eventually leading to meningeal fibrosis. It is at this stage that the earliest signs of angiitis begin to develop, usually affecting the small pial vessels, and sometimes the medium to large arteries. The resulting vascular thrombosis and occlusion may eventually produce distal infarction.

Colloidal stage Granular nodular stage The colloidal stage is characterized by degenerative changes in the aging parasite consequent upon host immunological response. The transparent fluid within the cyst is replaced by jelly-like whitish material. The larva is still identifiable, but it exhibits hyaline degeneration and early mineralization. Due to the microscopic resemblance to a colloid cyst, this stage has been named the ‘colloidal stage of the vesicular form’ of cysticercosis. In a more advanced stage, the cyst begins to decrease in size, its walls become thicker, and its contents undergo mineralization with calcium salts, and are transformed into coarse granules. If the cyst is located in the parenchyma, granulation tissue appears around the lesion (Fig.

In the granular nodular stage, there occurs retractional involution of cyst/s. Its contents are mineralized and tend to appear granular. The larva becomes fragmented, but careful histological examination still permits identification of the remaining parts of the festooned membrane and scolex (Fig. 30.7). Both structures are difficult to identify; however, the use of Masson’s trichrome technique may permit identification. With this stain, the membrane appears bright red, while the scolex has a red and blue tint because of collagen tissue. The collagen capsule around the cysts is thick, stains heavily blue, and is infiltrated and surrounded by a decaying inflammatory reaction.

The Pathology of Neurocysticercosis

293

Fig. 30.4. (a) The vesicle of a live cysticercus cellulosae displays the characteristic three-layered structure; notice the microtriches covering the festooned surface of the cuticle (haematoxylin and eosin; scale bar: 35 m). (b) Advanced hyaline change and disappearance of the three layers in the vesicular membrane of a dead meningeal cysticercus. Concomitant intense inflammatory infiltrate and multinucleated giant cells cover the surface of the membrane (haematoxylin and eosin; scale bar: 90 m). (c) Calcareous corpuscles in the reticular layer of the vesicular membrane of a viable cysticercus (haematoxylin and eosin; scale bar: 90 m).

294

A. Escobar and K.M. Weidenheim

Fig. 30.5. Parenchymal cysticercosis. (a) Cysticercus in the vesicular stage. The histological section displays the spiral canal, hooklets and the well preserved vesicular membrane. (b) Parenchymal cysticercus showing a marked inflammatory infiltrate both inside the locus and outside it in the adjacent parenchyma. (c) Dead parenchymal cysticercus with a hyalinized vesicular membrane is completely surrounded by an intense inflammatory exudate both inside the locus and outside it into the adjacent parenchyma. There are multiple foci of perivascular cuffing (haematoxylin and eosin; scale bar: 225 m).

The Pathology of Neurocysticercosis

295

Fig. 30.6. Parenchymal cysticercosis. A live vesicular stage cysticercus appears lodged in the right dorsomedial thalamic nucleus. The larva can be seen through the translucent vesicle. Another parasite is partially exposed in the dorsal portion of the internal capsule on the opposite side (scale bar: 5 mm).

Fig. 30.7. Meningeal cysticercus in an advanced colloidal to granular nodular stage. A thick collagen membrane encases the parasite and its vesicular membrane; notice the total loss of the structure of the strobila (Masson’s trichrome technique; scale bar: 2.5 mm).

296

A. Escobar and K.M. Weidenheim

Nodular-calcified stage The granular material seen in the previous stage gets completely mineralized. The nodular-calcified cysticercus is small, about one-half to one-quarter the size of the vesicular cysticercus. It is of hard consistency on account of its collagenous capsule. When sectioned, the exposed surface appears whitish but may also be heterogenous and of yellow-brown colour. The surrounding inflammatory infiltrate is minimal or absent.

Histological Study of Host Reaction to the Cysticercus Inflammatory reaction 9,14–16 The nature and intensity of the inflammatory reaction around the cysticercus in the human nervous system is extremely variable. The inflammatory response primarily depends upon the evolutionary stage of the cysticercus. Though some degree of inflammatory reaction can be found around all stages of the cysticercus, its intensity generally declines through the successive stages of evolution. Thus, the

most severe inflammation can be found in the vicinity of a cysticercus in the colloidal stage, whilst only scattered foci of inflammatory cells remain in the nodular-calcified stage. However, on occasion, a dead cysticercus may evoke strong inflammatory reaction in the adjacent brain parenchyma (Fig. 30.5c) or the meninges. The inflammatory reaction itself is composed of round mononuclear lymphocytic and plasma cells clumped within the collagenous strands that constitute the capsule surrounding the cystic membrane (Fig. 30.8). Inflammatory cells, primarily lymphocytes and plasma cells and a variable number of eosinophils, are also found in the perivascular spaces in the adjacent nervous tissue. The intensity of the tissue eosinophilic reaction is variable and unpredictable. It occurs in most cases but may be absent in the case of parenchymal cysticercosis. Foreign body, multinucleated giant cells are invariably present in the surrounding inflammatory zone (Figs 30.4b and 30.9d). These cells may be identified through all successive evolutionary stages of the cysticerci, including the nodularcalcified stage, when the inflammatory response in general has faded away. Giant cells are derived from macrophages.

Fig. 30.8. High power photomicrograph of the inflammatory parenchymal infiltrate and reactive astrocytic gliosis in the acute encephalitic phase of parenchymal cysticercosis. The vesicular membrane lies next to the parenchymal wall of the locus (haematoxylin and eosin; scale bar: 90 m).

The Pathology of Neurocysticercosis

297

Fig. 30.9. Basal cysticercotic meningitis. (a) Photomicrograph displaying hyalinized membranes of cysticercus and an arterial branch with partial destruction of the lamina elastica. There is partial occlusion of the lumen due to an atheromatoid plaque, a common finding in the vicinity of the parasites (haematoxylin and eosin). (b) An arteriole with intense inflammatory periarteritis and endarteritis associated with collagen proliferation (Masson’s trichrome stain; scale bar: 22 m). (c) Hyalinized membranes of cysticercus and abundant debris adherent to the markedly fibrotic leptomeninges (Masson’s trichrome stain). (d) Intense inflammatory infiltrate and multinucleated macrophages that surround debris of the cysticercus membranes (Masson’s trichrome stain; scale bar: 90 m).

Vascular reaction14,19–21 Significant histological reactions occur in arteries, arterioles, and venules and these have important clinical consequences, primarily stroke, which is discussed in detail in Chapter 22. Histological aspects of cysticercal vasculitis are therefore of interest14,19–21. Vasculitis or angiitis is a common finding. Vessel walls show thickening of the adventitia with medial fibrosis and endothelial hyperplasia. In smaller arteries and arterioles, a fibrotic reaction may completely replace the media that proliferates towards the endothelial layer in a concentric fashion leading to complete occlusion of the vessel lumen. The adventitia also thickens sometimes to the extent that it may be difficult to recognize different layers of the vessel wall.

Finally, the elastica of the artery splits and breaks up. In severe cases it is common to find areas of hyaline fibrinoid necrosis15. Occasionally, the vessels may be completely necrotic in a manner akin to that seen in immunoallergic reactions. With time however, the occluded vessels become recanalized14,19–21. In large arteries, for example, the basilar artery, atheroma-like deposits appear in the endothelium. These may partially occlude the vessel lumen (Fig. 30.9a). The above changes are invariably associated with an inflammatory cell infiltrate that may involve all three layers of the vessel wall/s (Fig. 30.9b). The intensity of inflammatory response varies, and is not related to the intensity of changes in the vessel wall/s. The inflammatory infiltrate in the vessel walls is particularly severe in cases of basal cysticer-

298

A. Escobar and K.M. Weidenheim

cotic meningitis. Venules are generally spared, but in severe cases, as in the basal cysticercotic leptomeningitis, they are also affected; in such situations, their walls thicken, but the lumen is rarely occluded. Features of angiitis are usually restricted to vessels located in the vicinity of the parasites. When a single cysticercus is found in the leptomeninges or in the parenchyma, the vascular changes, as well as the granulomatous inflammatory reaction, remain localized emphasizing the point that the parasite usually triggers a local vascular reaction.

Tissue reaction 9,14–16,19,22,23 In the case of subarachnoid cysticercosis, parasites commonly lodge in the sulci on the convexity of the brain, and tend to displace the adjacent cerebral cortex. The adjacent parenchymal tissue has a beehive appearance due to the presence of oedema. Secondary reactive astrocytic gliosis can usually be noted around the capsule. Some rod-shaped hypertrophic microglial cells may be seen. A variable degree of neuronal degeneration is discernible. Uncommonly, some neurons may be shrunken and ferruginated. A few vessels may display perivascular cuffing with mononuclear inflammatory cells. The above mentioned changes are usually well circumscribed in the area around the parasite. Tissue reactions around parenchymal cysticerci are essentially similar to those described above. The inflammatory reaction around parenchymal cysticerci is of variable intensity; however, it tends to be more locally circumscribed. However, in some cases, the host inflammatory reaction is severe in intensity, and this reaction is termed the acute encephalitic phase of NC24. Astrocytic gliosis may also be of variable intensity. A small rim of demyelination may be identified in the vicinity of the parasite. In a significant number of instances there may be no inflammatory reaction around the parasite. It is common for intraventricular cysticercal cysts to be attached to the ependymal lining of the ventricles. Subependymal astrocytic glial proliferation engulfing the parasite is commonly noted in such cases. At

times, the astrocytic proliferation is so marked that it could be mistaken for an astrocytoma. Gliosis is particularly marked in fourth ventricular cysticercosis that leads to obstruction of cerebrospinal fluid (CSF) circulation. When the cysticercus does not obstruct CSF flow, gliosis is less intense and appears intermingled with loose irregular strands of connective tissue that tend to form part of the capsule surrounding the parasite. The ependymal lining commonly displays a granular ependymitis (Fig. 30.10a and b). It exhibits disruptions by proliferating subependymal glial cells. Small clumps of these subependymal glial cells can be seen protruding into the ventricular cavity. Granular ependymitis is usually restricted to the area in the vicinity of the parasite, although at times it may extend farther (Fig. 30.10c)15,19. The choroid plexuses may be involved by the granulomatous reaction. In our experience, it is common to find a pathological reaction composed of inflammatory cells, proliferating fibroblasts and hyaline changes in blood vessels of the choroid plexus in fourth ventricular cysticercosis.

Regional Pathology Depending upon anatomical location, NC is classified into meningeal (subarachnoid), ventricular, parenchymal and mixed forms10,15,19. In our experience, meningeal and ventricular forms predominate, but the incidence of individual forms will vary according to the source of data.

Meningeal cysticercosis 4,14–16,20,25 Three types of pathological syndromes due to meningeal cysticercosis are recognized. Convexity-meningeal cysticercosis In this condition, cysticerci are lodged in the depth of sulci over the cerebral convexity. Half of the autopsy-confirmed cases of cysticercosis correspond to this type. Cysticerci may lie free on the surface or float in the subarachnoid space, but are mostly firmly attached to the

The Pathology of Neurocysticercosis

299

Fig. 30.10. Intraventricular cysticercosis. (a) Vesicular cysticercus in the temporal horn of the right lateral ventricle. There is granular ependymitis on the walls of the ventricle (scale bar: 5 mm). (b) The fourth ventricle is occluded by a cysticercus in the granular-nodular stage (scale bar: 5 mm). (c) Photomicrograph of the aqueduct blocked by the membrane of a cysticercus partially hyalinized. Note the marked fibrosis, inflammatory infiltrate and gliosis around the parasite (Masson’s trichrome technique; scale bar: 300 m).

300

A. Escobar and K.M. Weidenheim

leptomeninges (Fig. 30.7). The parasites may even burrow a complete cavity into the cortical grey matter. The parasites may either be in the vesicular stage with a slight thickening of the leptomeninges or in the granular-nodular stage. Occasionally a large meningeal cysticercus may become totally surrounded by a thick collagenized capsule, which in neuroimaging studies may be wrongly interpreted as primary or metastatic brain tumour; precise identification can be achieved by histological examination (Fig. 30.11a and b).

Basal racemose cysticercosis (Traubenhydatiden)1,4,15,19,25 When the parasites are located at the base of the brain, in the cisterns around the brain stem and cerebellum (Fig. 30.12a), or inside the Sylvian fissure, the vesicles tend to be multilobulated and joined together to form conglomerates, that constitute the so-called ‘racemose form of cysticercosis’. Sometimes there is a large multilobulated vesicle with a single cavity. Most of the time, however, the

Fig. 30.11. Encapsulated cysticercus. (a) An ovoid structure wrongly interpreted as a brain tumour upon magnetic resonance imaging. Gross examination of the specimen displayed coarse granular fragments and amorphous homogenous structures. (b) Histological section of (a) shows hyaline membranes, debris and the scolex and hooklets of the cysticercus inside a thick collagen capsule with the use of Masson’s trichrome technique (scale bar: 30 mm).

The Pathology of Neurocysticercosis

301

Fig. 30.12. Basal subarachnoid-cisternal cysticercosis. (a) Racemose cysticercosis. A clump of vesicular cysticerci lie under the base of the cerebellum at the cisterna magna. (Reproduced with permission from reference 25.) (b) Basal cysticercotic meningitis: Close up view of the base of the brain showing marked fibrosis of the leptomeninges over the ventral wall of the diencephalon and the brain stem, obscuring the vascular structures and cranial nerves. It is possible to identify a few cysticerci partially buried within the gummatous arachnoiditis. (c) Thickening of the basal leptomeninges in this coronal section at the level of the optic chiasma extending into both sylvian fissures (white solid arrow) and a large empty vesicle on the left. Notice also the increased thickness of the vessels trapped in the meningitis and the granular ependymitis on the walls of the third ventricle.

302

A. Escobar and K.M. Weidenheim

racemose forms appear to be made up of multiple vesicles, some of them multilobulated, of variable size and shapes giving the peculiar aspect that led Virchow to name them ‘Traubenhydatiden’5. A racemose cyst does not contain a scolex. However, careful examination of cystic contents sometimes leads to the identification of hooklets; this appears to indicate that a scolex was present initially but underwent hydropic degeneration subsequently. On rare occasions a complete larva may be identified. Basal cysticercotic meningitis 9,14,15,19,22,25 In endemic regions, the pathologist may on occasion be confronted by a specimen displaying marked thickening of the leptomeninges. The appearance is one of a thick layer of fibrous granulomatous tissue covering the entire basal surface of the brain from the optochiasmatic region to the caudal portion of the medulla and extending over the sides to the dorsal mesencephalon and cerebellopontine angle (Fig. 30.13a and b, Fig. 30.12b and c). When examined with the naked eye, no cystic parasites are seen and, in their absence, pathological appearances are indistinguishable from tubercular meningitis. Examination of multiple sections through the leptomeningeal thickening may discern cysts. Often a diagnosis of cysticercal basal meningitis is based upon the histological demonstration of cysts or cystic remnants (Fig. 30.14a and b). A good example of the latter situation is the identification of degenerative festooned membranes surrounded by granulomatous reaction with the aid of Masson’s trichrome technique (Fig. 30.9c and d). Vascular reactions of angiitis including endarteritis and periarteritis, endothelial proliferation, and hyaline and fibrinoid necrosis are usually conspicuous in cysticercotic basal meningitis (Fig. 30.9a and b). Cranial nerves also become encased in the leptomeningeal fibrosis and display interstitial and perineural inflammation. The underlying parenchyma shows marginal gliosis, inflammatory infiltrates, perivascular cuffing and multiple ischaemic infarcts. Finally, basal cysticercotic meningitis may lead to ventricular dilation due to obstruction of the

foramina at the outlet of the fourth ventricle or CSF cisternal pathways.

Intraventricular cysticercosis 19,26,27 The fourth ventricle is the most common location of intraventricular cysticercosis. More often than not, the cyst is single (Fig. 30.10a). When the cysts lodge at the foramen of Monro, the aqueduct of Sylvius or the fourth ventricle cavity (Fig. 30.10b and c), the result is an obstructive symmetrical hydrocephalus19,26,27. Secondary syringomyelia and syringobulbia28 may rarely develop as a complication of the chronic obstructive hydrocephalus due to fourth ventricular cysticercosis. This is incidental to sustained increased intraventricular pressure and to the disruption of the ependymal lining with marked subependymal glial proliferation.

Parenchymal cysticercosis Cysticerci are usually located in the grey matter owing to its rich blood supply. Parasites are mostly located in the cortex, though a few may be found in deep grey structures. It is also possible to find cysts in the subcortical white matter. The number of parasites may reach several hundred, but commonly one finds only a scattered few. Parenchymal cysts are mostly homogenous and less than 10 mm in size. They are round or ovoid (Figs 30.1 and 30.6). The inflammatory reaction around parenchymal cysts is well circumscribed and less intense in comparison to leptomeningeal cysticerci. However, in the acute encephalitic type of NC, the host immune response is intense, leading to diffuse inflammatory reaction and oedema16,24,29.

Mixed forms Most often, there occurs a combination of the different types of cysticerci. In our pathological material, we commonly encounter a combination of meningeal and ventricular forms. However, any combination is possible.

The Pathology of Neurocysticercosis

303

Fig. 30.13. Basal cysticercotic meningitis. (a) Axial section of lower brain stem showing intense thickening of the leptomeninges over the ventral surface of the upper medulla. The fourth ventricle appears enlarged due to blockage of the draining foramina and there is granular ependymitis. (b) Two axial sections of the midbrain. There are fibrotic leptomeninges and occlusion of the aqueduct. The latter was due to a cysticercus identified on histological examination (see Fig. 30.10). The substantia nigra appears pale.

Conclusions The pathological spectrum of NC is as wide as its clinical spectrum. A good knowledge of usual as well as uncommon

pathological features is important for pathologists in both endemic and nonendemic areas, keeping in mind the increasing recognition given to NC in developed countries.

304

A. Escobar and K.M. Weidenheim

Fig. 30.14. Basal cysticercotic meningitis. Macrophotographs of histological slides of sections (a) through the middle pons, and (b) upper medullary level. The hyalinized membranes of cysticerci are encased by the fibrotic leptomeninges. There is also granular ependymitis (Masson’s trichrome technique; scale bar: 2 mm).

References 1. Aluja, A., Escobar, A., Escobedo, F., et al. (1987) Cisticercosis. Una recopilación actualizada de los conocimientos básicos para el manejo y control de la cisticercosis causada por Taenia solium. Fondo de Cultura Económica, México DF, México, pp. 115. 2. Richards, F.O., Schantz, P.M., Ruiz-Tiben, E., et al. (1985) Cysticercosis in Los Angeles County. Journal of the American Medical Association 254, 3444–3448.

The Pathology of Neurocysticercosis

305

3. MacArthur, W.P. (1934) Cysticercosis as seen in the British army, with special reference to the production of epilepsy. Transactions of the Royal Society of Tropical Medicine and Hygiene 27, 343–363. 4. Henneberg, R. (1936) Die tierischen Parasiten des Zentralnervensystems. In: Bumke, O., Foerster, O. (eds) Handbuch der Neurologie, Vol. 14. Springer Bd, Berlin, pp. 286–322. 5. Virchow, R. (1860) Traubenhydatiden der weichen Hirnhaut. Archiv für pathologische Anatomie und Physiologie und für klinische Medizin pp. 528 – 536. 6. Zenteno-Alanís, G.H. (1965) Diagnósticos neuroquirúrgicos en 2000 pacientes estudiados en la unidad de neurología y neurocirugía del hospital general de la ciudad de México. Revista Médica de Hospital General (México) 28, 515–528. 7. Villagrán-Uribe, J., Olvera-Rabiela, J.E. (1988) Cisticercosis humana. Estudio clínico y patológico de 481 casos de autopsia. Patología (México) 26, 149–156. 8. Costero, I. (1946) Tratado de Anatomía Patológica, Vol. 2. Atlante, México, pp. 1485–1495. 9. Escobar, A. (1952–53) Cisticercosis cerebral con el estudio de 20 casos. Archivos Mexicanos de Neurología y Psiquiatría 1, 145–167. 10. Fuentes, M. (1948) Formas anatomoclínicas de la cisticercosis cerebral. Gaceta Médica de México 78, 155–173. 11. Pitella, J.E.H. (1997) Neurocysticercosis. Brain Pathology 7, 681–693. 12. Shenone, H., Villarroel, F., Rojas, A. (1982) Epidemiology of human cysticercosis in Latin America. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 25–38. 13. Carpio, A., Escobar, A., Hauser, W.A. (1998) Cysticercosis and epilepsy: a critical review. Epilepsia 39, 1025–1040. 14. Escobar, A. (1991) Pathology of neurocysticercosis. Neuropathology (Japan) (Suppl. 4), 348–351. 15. Escobar, A. (1983) The pathology of neurocysticercosis. In: Palacios, E., Rodríguez-Carbajal, J., Taveras, J.M. (eds) Cysticercosis of the Central Nervous System. Charles Thomas, Springfield, Illinois, pp. 27–54. 16. Silva, P., Escobar, A. (1996) Cysticercosis, other parasites and tuberculosis. American Society of Neuroradiology, Core Curriculum in Neuroradiology. Part II. Neoplasms and Infectious Diseases, pp. 193–200. 17. Zee, C.S., Destian, S., Colletti, P., et al. (1990) Gadolinium enhanced MR imaging in neurocysticercosis. Radiology 177, 232. 18. Zee, C.S., Segall, H.D., Boswell, W., et al. (1988) MR imaging of neurocysticercosis. Journal of Computer Assisted Tomography 12, 927–934. 19. Escobar, A., Nieto, D. (1972) Parasitic disease. In: Minckler, J. (ed) Pathology of the Nervous System, Vol. 3. McGraw-Hill, New York, pp. 2507–2515. 20. Redalie, L. (1921) Deux cas de cysticercose cérébrospinale avec méningite chronique et endartérite oblitérante cérébrale. Revue Neurologique (Paris) 28, 241–266. 21. Rodríguez-Carbajal, J., Del Bruto, O.H., Penagos, P., et al. (1989) Occlusion of the middle cerebral artery due to cysticercotic angiitis. Stroke 20, 1095–1099. 22. Escobar, A. (1960) Cisticercosis cerebral. Acta Politécnica (México) 2, 275–284. 23. Escobar, A. (1978) Cerebral cysticercosis. New England Journal of Medicine 298, 403–404. 24. Rodríguez-Carbajal, J., Salgado, P., Gutiérrez-Alvarado, R., et al. (1983) The acute encephalitic phase of neurocysticercosis: computed tomographic manifestations. American Journal of Neuroradiology 4, 51–55. 25. Escobar, A. (2000) Enfermedades parasitarias. Infecciones por metazoarios. In: Cruz-Sánchez, F.F. (ed.) Neuropathologia: Diagnóstica y Clínica. Editores Médicos SA, Madrid, Spain, pp. 315–337. 26. Nieto, D. (1956) Cysticercosis of the nervous system. Diagnosis by means of the spinal fluid complement fixation test. Neurology 6, 725–737. 27. Escobar, A., Vega, R., Herrera, M.P., et al. (1998) Neurocisticercosis de localización en el cuarto ventrículo. Gaceta Médica de México 134, 359–361. 28. Escobar, A., Vega, J.G. (1981) Syringomyelia and syringobulbia secondary to arachnoiditis and fourth ventricle blockage due to cysticercosis. Acta Neuropathologica (Berlin) (Suppl. 7), 389–391. 29. Salgado, P., Rojas, R., Sotelo, J. (1997) Cysticercosis. Clinical classification based on imaging studies. Archives of Internal Medicine 157, 1991–1997.

31

Single Small Enhancing Computed Tomography Lesions – Pathological Correlates Geeta Chacko

Introduction The aetiology of single small enhancing computed tomography lesions (SSECTLs) in patients presenting with seizures remained controversial despite several radiological and immunological tests (reviewed by Rajshekhar in Chapter 24). The issue was resolved with the biopsy evidence that the majority of these lesions are caused by cysticercus1–4. Before considering the pathological correlates of SSECTL, it is recommended that the reader should review the morphological appearance and stages of development and regression of a cysticercus given in the previous chapter (Escobar and Weidenheim, Chapter 30).

fast and birefringent hooklets. The cyst has three distinct layers: an outer cuticular layer, middle or cellular layer and an inner or reticular layer. The inner or reticular layer has a loose stroma containing fluid-filled spaces, thin-walled vacuoles, excretory canaliculi and calcareous corpuscles. These calcified concretions or calcareous corpuscles probably represent calcification of the intracorporeal vacuoles (see Escobar and Weidenheim, Chapter 30). Four stages are recognized in the development and regression of cysticercus in the central nervous system, namely the vesicular, colloidal, granular–nodular and fibrocalcified stages. These are reviewed in detail in the previous chapter.

SSECTL: Pathology Morphology and Evolution of Cysticercus Briefly, cysticerci are round or oval milky white cysts of varied size, usually in the range of 5–15 mm, with a translucent wall. Each cyst is filled with clear fluid and contains a pearly-white, invaginated scolex (protoscolex). The protoscolex is attached to the cyst by means of a neck and has a spiral canal, four large suckers and a rostellum with a double row of large and small acid-

Cysticercus cellulosae is the form of cysticercus observed in SSECTLs. As these lesions are by definition less than 2 cm in diameter, the racemose form, which is larger (4–12 cm), is not encountered. The macroscopic appearance of an SSECTL could vary from the typical thin-walled cyst to a well-circumscribed firm nodule. On microscopic examination however, the cavitary nature of the lesion is apparent accounting for the typical radiological appearance of a ring-enhancing lesion. A minority of cases appear as hyalin-

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

307

308

G. Chacko

ized nodules (nodular or fibro-calcified stage). The wall of the cavity is typically lined by palisaded epithelioid histiocytes, surrounded by dense infiltrates of inflammatory cells, chiefly, lymphocytes, plasma cells and eosinophils. Neutrophil polymorphs and multinucleated giant cells may also be present. The severity of the inflammatory reaction is highly variable. The adjoining cerebral parenchyma is often gliotic with perivascular chronic inflammation and variable amounts of fibrosis. Chacko et al.5 noted viable (cystic or vesicular stage) or degenerate (colloidal or granular stage) forms of the cysticercus in about 50% of the cases of SSECTLs. When viable, although the morphology of the parasite is well discerned, one often encounters only parts of the parasite. The degenerate form is seen as an eosinophilic structure in which parts of the scolex and bladder are identifiable in various stages of degeneration (Fig. 31.1). The calcareous corpuscles or calcified intracorporeal vacuoles described in the reticular layer of cysticercus cellulosae stand out prominently in the degenerate forms and may on occasion be the sole parasitic remnant seen in a biopsy (Fig. 31.2)5.

In cases of SSECTL, where the parasite is not detected at biopsy further steps need to be taken to arrive at a final diagnosis6: 1. Ensure that all the tissue submitted has been processed. 2. Sections at multiple levels to look for the parasite. 3. Special stains for fungal elements and Mycobacterium tuberculosis.

Histological Differential Diagnosis The histological differential diagnosis in the absence of the cysticercus includes parasitic granuloma of unestablished aetiology, tuberculoma, fungal granuloma and microabscess6. The salient features of each of these are as follows.

Parasitic granuloma The dominant features are a cavitary lesion with an inner lining of palisaded histiocytes and the presence of eosinophils in the inflammatory infiltrate. Furthermore, there should be no caseous necrosis, acid-fast bacilli or fungal elements.

Fig. 31.1. Degenerated cysticercus outlined by calcified intracorporeal vacuoles (haematoxylin and eosin; 200).

Single Small Enhancing CT Lesions

309

Fig. 31.2. Calcified bodies in amorphous debris without any typical cysticercus parts (haematoxylin and eosin; 200).

Tuberculoma Pathologically, a caseating granuloma composed of epithelioid histiocytes, lymphocytes and Langhans’ multi-nucleated giant cells is noted. Acid-fast bacilli may be identified with the Ziehl-Neelsen stain.

and a wall composed of non-specific inflammatory granulation tissue. However, microabscesses, in the clinical and radiological setting of a typical SSECTL, with negative cultures, and no extracranial focus of infection may represent acute degeneration of the parasite6.

Fungal granuloma

Conclusions

A granuloma containing multinucleated giant cells, lymphocytes and plasma cells is visible. Fungal elements can be demonstrated with special stains. Microabscess This is a non-granulomatous cavitary lesion with inflammatory exudate in the cavity

In conclusion, an SSECTL may be seen at any stage in the natural evolution of Cysticercus cellulosae. At one end of the spectrum the entire parasite might be identified while at the other end calcareous residues might be the only evidence of a cysticercal aetiology of the granuloma. The vast majority are seen as cavitary lesions while a minority shows a fibrous cicatrix.

References 1. Rajshekhar, V. (1991) Etiology and management of single small enhancing CT lesions in patients with seizures: understanding a controversy. Acta Neurologica Scandinavica 84, 465–470. 2. Chandy, M.J., Rajshekhar, V., Ghosh, S., et al. (1991) Single, small, enhancing CT lesions in Indian patients with epilepsy: clinical, radiological and pathological considerations. Journal of Neurology, Neurosurgery and Psychiatry 54, 702–705.

310

G. Chacko

3. Rajshekhar, V., Haran, R.P., Prakash, S.G., et al. (1993) Differentiating solitary small cysticercus granulomas and tuberculomas in patients with epilepsy: clinical and computerized tomographic criteria. Journal of Neurosurgery 78, 402–407. 4. Rajshekhar, V., Chacko, G., Haran, R.P., et al. (1995) Clinicoradiological and pathological correlations in patients with solitary cysticercus granuloma and epilepsy: focus on presence of parasite and edema formation. Journal of Neurology, Neurosurgery and Psychiatry 59, 284–286. 5. Chacko, G., Rajshekhar, V., Chandy, M.J., et al. (2000) The calcified intracorporeal vacuole: an aid to the pathological diagnosis of solitary cerebral cysticercus granulomas. Journal of Neurology, Neurosurgery and Psychiatry 69, 525–527. 6. Chacko, G. (2000) Pathogenesis and pathology of neurocysticercosis. In: Rajshekhar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma – the Disappearing Lesion. Orient Longman, Chennai, India, pp. 96–111.

32

Imaging and Spectroscopy of Neurocysticercosis

Deepshikha Sharda, Sanjeev Chawla and Rakesh K. Gupta

Introduction Neurocysticercosis (NC) can be classified into cranial (parenchymal, ventricular, subarachnoid-cisternal), spinal and mixed, depending upon the site of involvement. Parenchymal NC is characterized by one or several rounded or oval cyst/s measuring from 5 mm to 15 mm in diameter, with a thin, translucent, membranous wall1. Each cyst is filled with clear fluid and contains a pearly white invaginated scolex2. Larger cysts, 2–4 cm in diameter, are rare2. Racemose forms of cysticercosis are less frequent. Racemose cysts are 4–12 cm and are devoid of a scolex. The coexistence of cellulose and racemose forms of cysticercosis is observed in about 10% cases1. The number and location of parasites vary widely. Solitary cysticerci are found in 2–53% of the cases3. When multiple, the cysticerci are usually few in number; the finding of hundreds of parasites, characterizing the disseminated form, is rare4. Neurocysticercosis is a disorder with a prolonged and variable course. Not infrequently, it may remain asymptomatic, being detected only upon imaging or autopsy. Cysts may remain viable in the central nervous system (CNS) for several years (usually 1–3 years), depending on the host immune tolerance. Morphologically, four stages of development and regression of the cysticer-

cus in the CNS are recognized1,5.These form the basis of the understanding of imaging findings in NC (see Chapter 30). 1. Cystic or vesicular stage: The cyst is viable and has a well-defined, fluid-filled membrane, which unlike the hydatid cyst contains only one scolex. It is surrounded by a discrete fibrillary astrocytosis. 2. Colloid stage: This is the earliest stage in the involution of the cyst. The fluid contents of the cyst become more turbid and the scolex begins to degenerate. 3. Necrotic, granular stage: This stage is characterized by parasite necrosis and surrounding inflammation. The cyst gives an appearance of an eosinophilic structure in which the bladder and scolex are in various stages of disintegration. The adjacent neural tissue shows moderate to intense fibrillary astrocytosis. Oedema and/or necrosis of the surrounding neural tissue may be present in some cases. 4. Fibro-calcified nodule: With time, fibrosis develops, progressively occupying the entire lesion. This stage can be macroscopically recognized as a nodule of a smaller size than the bladder in the preceding stage, with a whitish, white-greyish or greyish central area surrounded by a thin capsule of greyish or somewhat whitish colour, corresponding to the necrotic cysticercus and fibrosis, respectively. A residual cellular infiltrate

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

311

312

D. Sharda et al.

may be seen in some instances. The fibrous nodule frequently calcifies, as seen in 57–64% of cases on computed tomography (CT)3,6. Calcification as noted upon CT may represent partial dystrophic calcification of a necrotic larva or the calcareous corpuscles1,2. Dystrophic calcification is a long process and may take from 2 to 10 years to be detected on roentgenographs. When multiple, lesions are often at different stages of their development, a phenomenon that could reflect different infectious episodes. The sequence of events for any single lesion is from an innocuous cyst to granuloma and then to a calcified nodule. However, a cysticercus may move from one stage to another stage by skipping the regular sequences of stages or may disappear completely with or without undergoing any sequence of degeneration. This may take several years in untreated lesions and several months for treated lesions.

Plain Skull Roentgenograms Parenchymal lesions are characterized by either mass effect or intracranial calcification. Signs of raised intracranial tension such as sutural diastasis, enlargement of sella turcica and erosion of anterior and posterior clinoid processes may be seen upon skull roentgenograms. Calcification is representative of dead larva(e). However, the presence of calcification does not exclude the presence of live larvae; active cysts have been demonstrated concomitantly with calcified lesions. Typically, the calcified cysticercus gives the appearance of slightly off-centre spherical calcification of 1–2 mm in diameter representing the dead scolex. It may be surrounded by a 7–12 mm, partially or totally calcified sphere representing the body of the cystic larva (Fig. 32.1a)7. Old shrunken (5–7 mm) cysts may lose their spherical shape, yet maintain a recognizable morphology. One often finds that innumerable calcified cysts are distributed in the brain in a pattern perfectly compatible with the proportion of blood supply as judged on stereoscopic frontal and lateral

views7. The small (2–3 mm) rounded shape of cerebral cysticercosis is distinguishable from the larger oat-shaped calcification in muscle (Fig. 32.1b). Cyst calcification is less frequent in the neuraxis than in muscle. Also, NC frequently coexists with muscle cysticercosis. Therefore, in the past, soft-tissue radiography would often establish a diagnosis of cysticercosis when skull roentgenograms were normal8.

Cranial Conventional Angiography In the pre-cross-sectional imaging era, conventional angiography was used to demonstrate mass effect. Displacement of the vessels and early venous drainage due to soft-tissue masses produced by live parenchymal larvae have been described (Fig. 32.2)9. Angiography is also useful in demonstrating vasculitis in association with meningeal racemose cysticercosis. Findings range from mild arterial narrowing to complete occlusion along with distortion of carotid and/or vertebral arteries (see Chapter 22)10. Abnormalities are most severe in the immediate vicinity of racemose cysts. On occasion, an angiogram may reveal an inflammatory aneurysm in the vicinity of a racemose cyst11. In the present-day context, however, conventional angiography is rarely required and has been replaced by CT and magnetic resonance imaging (MRI).

Negative and Positive Contrast Ventriculography Negative contrast (air) studies are hazardous and of historical importance only. One finds ample illustrations of hydrocephalus, asymmetry of the lateral ventricles and atrophy of the brain parenchyma as well as large ventricular cysts in older literature (Fig. 32.3a)7,12. Positive contrast cisternography and ventriculography with the aid of intraventricular metrizamide outlines cisternal and ventricular cysts (Fig. 32.3b). Ependymitis and ventricular synechiae may be visualized as septate ventricular loculations7.

Imaging and Spectroscopy of Neurocysticercosis

(a)

313

(b)

Fig. 32.1. (a) Calcified intracranial cysticercosis. Lateral view of skull radiograph showing innumerable calcified cysts scattered in the brain. Few of them (arrows) show an off-centre spherical calcification of 1–2 mm representing the scolex. (b) Calcified cysticercosis of the skeletal muscles. Radiograph of the lower limb showing multiple oblong calcified densities along the plane of the muscle fibres.

Computed Tomography Parenchymal neurocysticercosis Computed tomography is useful in studying the natural course of disease, identifying evolutionary stages of cysticercosis with an intention of determining therapeutic strategy and prognosis as well as monitoring response to anticysticercal drugs. Machado et al. studied the profile of evolution of NC based on CT13. Cysts were intact in consecutive CT scans up to 11 months and exhibited signs of degeneration by about 18 months after praziquantel drug therapy. Nodular calcifications appeared by about 25 months. Therefore, the entire life history of a cyst discovered in the brain upon CT spanned at least 36 months.

Vesicular stage (living larvae) On non-contrast CT, vesicular cysticercus gives an appearance of a round cyst of 5–20 mm size, with density similar or slightly higher (10–20 HU) than cerebrospinal fluid (CSF) (0–10 HU) (HU = Hounsfield unit). A 2–4 mm, mural nodule representing its scolex may be identified14,15. The latter is partially or completely calcified and placed eccentrically within the cyst (Fig. 32.4a and b). The blood–brain barrier remains intact during this stage. Therefore, as a rule, the cyst wall and scolex do not enhance following administration of contrast. Cysticercus cysts in the vesicular stage need to be differentiated from arachnoid cysts, porencephalic

314

D. Sharda et al.

Fig. 32.2. Conventional cranial angiogram (lateral view). The mass effect on the distal branches of the middle cerebral artery secondary to the cluster of intraparenchymal cysts in the left parietal region is noted.

Fig. 32.3. (a) Air-contrast study demonstrating dilatation of the right lateral ventricle owing to obstruction of the right foramen of Monro. The obstructing cyst is not clearly made out. (b) Metrizamide ventriculogram followed by introduction of air through lumbar puncture demonstrating the dilated lateral ventricles and the outline of a cyst within.

cysts and cystic astrocytoma14. Vesicular cysticercus does not produce symptoms; when single it is detected as an incidental finding upon imaging studies. In the case of

multiple cysticercosis, other lesions at different stages of evolution may be seen; the latter are responsible for bringing the patient to attendance.

Imaging and Spectroscopy of Neurocysticercosis

315

Fig. 32.4. Vesicular (a) and calcified (b) stage of neurocysticercosis. Non-contrast computed tomography scan at supraventricular level showing multiple cysts each with an eccentrically placed nodule representing the scolex (a). The cysticerci are not surrounded by oedema. Calcified cysticerci can be made out in addition to the vesicular cysticerci (b).

Colloidal stage (degenerating larvae) Contrast-enhanced (CE) CT reveals a cystic lesion with enhancing walls surrounded by irregular hypodensity representing perilesional oedema. In the early stages of the degeneration, an eccentrically placed scolex may be seen. Granular–nodular stage Non-contrast CT reveals an isodense cyst with a hyperdense-calcified scolex and surrounding oedema. The walls of the granuloma may be hyperdense because of calcium deposition16. Granulomas are of variable sizes, but even if quite small, they usually have a definite ring or disc pattern of contrast enhancement around a low-density centre (Fig. 32.5a and b). The ring is of variable thickness, but usually thicker than that in pyogenic abscess17. The evolutionary stages form a continuous spectrum. Hence, the cyst wall and scolex may be identifiable even during the granular–nodular stage. Multiple homogeneously hypodense nodules with surrounding oedema and contrast enhance-

ment may simulate metastasis. In the absence of demonstration of scolex, imaging features are non-specific. Similar findings may be seen in tubercular, sarcoid and fungal granulomas, metastasis, multiple sclerosis, glioblastoma multiforme and other neoplastic lesions. Nodular-calcified stage This stage is represented by a small (7–11 mm), round, punctate or oval, highattenuation areas (80–360 HU)14–16. Rarely calcifications may be reasonably large. Calcified granulomas are not associated with mass effect and do not enhance after contrast administration. However, perifocal oedema may be present, particularly if CT is undertaken within 24–72 hours of a seizure (Fig. 32.6a–c)14. Calcified cysticerci may be single or multiple. They are usually located within the grey matter or at grey–white matter junctions. Rarely, they may be seen in basal ganglia and deep white matter. The differential diagnosis of multiple, dispersed calcifications includes toxoplasmosis and tuberous sclerosis14.

316

D. Sharda et al.

Fig. 32.5. Granulomatous stage of neurocysticercosis. Non-contrast computed tomography (a) at supraventricular level showing a hypodense lesion. Contrast-enhanced computed tomography (b) at same level revealing a ring-enhancing lesion with surrounding oedema.

Acute encephalitic parenchymal cysticercosis This serious and occasionally fatal condition is characterized by non-calcified high-density nodules that enhance upon CECT9,18,19. Cysts may be multiple or diffuse (85%) or, less commonly, localized12. Lesions vary in sizes and are located in the cerebral cortex; but may also be seen in the white matter and basal ganglia. They are associated with florid oedema, which, in the absence of contrast, appears as a diffuse, low-density area with irregular contour. The description of throttled ventricles with or without high attenuating sago-grain lesions is typical20. The encephalitic phase lasts from 2 to 6 months, with oedema persisting for some time after resolution of pathological enhancement13. CT may detect small calcifications as early as 8 months after the acute phase19.

Monro, aqueduct or fourth ventricle may result in focal or asymmetrical dilatation of the ventricular system. A cyst may also cause displacement of the choroid plexus. Ventricular obstruction and hydrocephalus may be intermittent since the cyst is freely movable. The possibility of relocation of an intraventricular cyst between initial imaging and surgery should be kept in mind and imaging should be repeated immediately before planned surgery. Positive contrast (metrizamide) CT ventriculography is useful in demonstrating intraventricular cysts (Fig. 32.7a and b). Delayed CT scans may divulge fluid levels within the cysts because of diffusion of metrizamide across the cyst wall17,21. Intraventricular cysts can be confused with intraventricular tumours such as colloid cyst, ependymal cyst, choroid plexus cyst and intraventricular epidermoid10.

Intraventricular cysticercosis Subarachnoid-racemose cysticercosis Intraventricular cysticercosis may not be identified upon CT because of a thin wall, approximate CSF-equivalent content and lack of contrast enhancement. Therefore, evidence for intraventricular cysticercosis is often indirect. For instance, an expanding cyst or obstruction of the foramen of

Visualization of subarachnoid-racemose cysts on CT scan depends upon their size and location. Cysts have a density identical to the CSF. Furthermore, cyst walls are too thin to be identified. Therefore, their recognition depends upon deformity of

Imaging and Spectroscopy of Neurocysticercosis

317

Fig. 32.6. Calcified stage of neurocysticercosis. Non-contrast computed tomography (a) and T2weighted axial magnetic resonance imaging (b) showing a calcified lesion. One year later, after the patient had a seizure, a post-gadolinium T1-weighted image revealed a ring-like enhancement and surrounding oedema (c).

the normal configuration of cisterns. Relatively large cysts are required to deform the quadrigeminal, cerebellopontine and suprasellar cisterns. Smaller cysts are readily detected in the Sylvian fissure and cortical sulci. Cysts are usually pliable

and conform to the shape of the cisterns in which they lie. Despite this, chronic pressure effects with bone remodelling may be noted. CECT scan may show leptomeningial enhancement in the basal cisterns around cysts or more diffusely. The

318

D. Sharda et al.

(a)

(b)

Fig. 32.7. Intraventricular neurocysticercosis. T1-weighted magnetic resonance imaging (a) showing asymmetric dilatation of the lateral ventricles with no discernable intraventricular lesion. Metrizamide computed tomography ventriculography (b) clearly depicting two intraventricular cysticerci. (Source: Svetlana Agapejev, São Paulo, Brazil.)

ensuing fibrosis may obliterate portions of cisterns. If more diffuse, meningeal fibrosis leads to communicating hydocephalus. When cysticercal meningitis causes vasculitis, CT manifestations include luxury perfusion and/or infarction, typically in the vicinity of racemose cysts (Fig. 32.8a and b). Positive contrast CT cisternography is useful in outlining subarachnoid-racemose cysts. Intrathecal metrizamide (4–5 ml at a maximal concentration of 250 mg ml1) opacifies the basal cisterns, permitting demonstration of subarachnoid cysts20.

Magnetic Resonance Imaging Parenchymal neurocysticercosis Magnetic resonance imaging is superior to CT for the study of parenchymal NC. It may reveal multiple cysticerci in individuals with normal appearing CT22. MRI findings of parenchymal cysticercosis are protean, due to the various evolutionary stages of the cysts23–29.

Early pre-vesicular stage At a very early stage, soon after invading the brain parenchyma, the embryo is non-cystic; MRI does not show any abnormality. During its initial development into a larva, focal non-enhancing areas of oedema may be seen, that may progress to a small homogeneously enhancing lesion in a few months28,30. These abnormalities are incidental to the immature blood–brain barrier during this stage. Vesicular stage After 3–12 months, the cysticercus is fullygrown with a bladder containing clear fluid. This is the vesicular stage, which gives an appearance of a round cyst with a mural nodule representing the scolex23–29. The cyst is hyperintense on T2-weighted images and hypointense on proton density (PD)- and T1weighted images, whilst the scolex is seen as an eccentrically placed nodule, hypointense on T2-weighted images and hyperintense on PDand T1-weighted images (Fig. 32.9a). There is no perifocal oedema. Post-contrast study does not reveal enhancement (Fig. 32.9b)30.

Imaging and Spectroscopy of Neurocysticercosis

319

Fig. 32.8. Racemose cysticercosis with cerebrovascular manifestations. Contrast-enhanced computed tomography (a) and corresponding post mortem pathological study (b) depicting multiple racemose cysts (arrows) in the right Sylvian cistern, left cistern and the interhemispheric fissure and area of infarction (Inf). (Source: Svetlana Agapejev, São Paulo, Brazil.)

Fig. 32.9. Vesicular neurocysticercosis. T1-weighted axial (a) and post-gadolinium T1-weighted coronal magnetic resonance imaging (b) showing the clear cystic contents, the eccentric scolex and the lack of enhancement or surrounding oedema. (Source: Eric Kossof, Baltimore, USA.)

320

D. Sharda et al.

Colloidal stage As the larva begins to degenerate, cystic fluid becomes turbid, the surrounding capsule thickens and an intense inflammatory cell response appears around the cyst. The increased signal intensity of cystic fluid, thickening of cyst wall, surrounding oedema and contrast enhancement are evident upon MRI (Fig. 32.10a, b and d)23–30. The signal intensity of cystic fluid is higher than that of CSF on T1- and PD-weighted images owing to a higher protein content. At times the cystic fluid may appear bright on T1 images31,32. On T2-weighted images, the cystic fluid and surrounding oedema appear hyperintense, whereas the cyst wall and the scolex appear isointense or hypointense relative to brain parenchyma. Contrast enhancement is usually ring shaped. A fluid level may be seen within the cyst32. During or early after institution of anticysticercal treatment, degenerative changes are accelerated, which is reflected by an increase in surrounding oedema, increased intensity of cystic fluid on T1- and PD-weighted images and more marked contrast enhancement28,33. Nodular–granular stage In this stage, the larva retracts and its fluid content is absorbed. Its inflammatory capsule becomes thick and collagenous. The lesion appears isointense to the normal brain parenchyma on T1-weighted images and isointense to hypointense with or without a central hyperintense signal on T2weighted images (Fig. 32.11a–c). On contrast-enhanced T1-weighted images, it appears as a homogeneously enhancing or ring-shaped enhancing nodule with or without surrounding oedema. These appearances are in common with tuberculoma, other granulomatous conditions, small abscess and metastatic tumours23–29. Nodular-calcified stage The shrunken mineralized larva appears iso–hypointense on T1-weighted images and

hypointense on T2-weighted images. Hypointensity in T2-weighted images could be incidental to fibrosis or calcification. Demonstration of susceptibility on T2* imaging can differentiate calcified from non-mineralized, fibrosed larvae.

Intraventricular cysticercosis Magnetic resonance imaging permits visualization of scolex, rim of the cyst wall and subependymal tissue reaction. The different intensities between cystic contents and CSF are readily appreciable on MRI28,34. Cyst contents are hyperintense, relative to CSF on T1- and PD-weighted images due to higher protein content and cellular debris35. In the healing stages, the cyst wall may be adherent to the ventricular wall, with ensuing ependymal and subependymal inflammation that is reflected by subependymal rim of high intensity on PD- and T2-weighted images28,35. In general, T1- and PD-weighted images are better than T2-weighted images because the high signal intensity of cystic fluid is indistinguishable from CSF and subependymal oedema on T2-weighted images. Sagittal T1 sections are particularly useful for evaluation of aqueductal stenosis that may occur as a result of fibrotic adhesions secondary to ependymal inflammation. It is also useful for differentiating fourth ventricular cysticercosis from a dilated fourth ventricle. However, the two conditions may be indistinguishable on conventional MRI at times28.

Subarachnoid racemose cysticercosis Cisternal cysticercosis is readily identifiable on MRI as multiple cystic masses within basal cisterns28. Racemose cysts may be large and lobulated causing compression of adjacent structures. The signal intensity of cyst contents usually parallels that of CSF on all MRI pulse sequences. The cyst walls may be seen as septum-like curved lines on T1-weighted images but are usually masked by high intensity of CSF on T2-weighted

Imaging and Spectroscopy of Neurocysticercosis

321

Fig. 32.10. T2-weighted axial image (a) at the level of midbrain shows multiple hyperintense areas bilaterally with perifocal oedema in some. T1-weighted image (b) shows hypointense nature of these lesions. On magnetization transfer-T1-weighted image (c), peripheral hyperintensity is seen in some of the lesions. Post-contrast T1-weighted image (d) shows ring-enhancement of the lesions in the left frontal and right occipital region.

322

D. Sharda et al.

Fig. 32.11. T2 hypointense cysticerci. T2-weighted axial image (a) through the level of midbrain/pons shows evidence of T2 hypointense areas in the cerebellar hemispheres, bilateral temporal lobes and in the left crus cerebri. A hyperintense lesion is also seen in the right temporal lobe. On magnetization-transfer T1-weighted image (b) visualization of these lesions is difficult and the magnetization-transfer ratio from the T2 hypointense areas was more than 35%. Only T2 hyperintense areas are seen on T1-weighted image (c) and rest of the lesions are isointense and not visible.

images28. The scolex cannot be seen as it has already degenerated in racemose cysts. There is no appreciable enhancement of the cyst wall after contrast administration. The visualization of a large multilobulated cyst(s), lacking a mural nodule in specific cisternal location with surrounding leptomeningeal enhancement strongly points towards a diagnosis of racemose cysticercosis, especially in endemic areas.

Chronic granulomatous meningitis and fibrosis in the basal cisterns may result in communicating hydrocephalus. Contrastenhanced MRI may reveal various degrees of leptomeningeal enhancement in the basal cisterns. Proliferative endarteritis either due to basal exudates or due to the presence of a cyst close to the vessel wall may cause lacunar infarction or, rarely, infarction in the territory of a major artery36.

Initially solid, later cystic developing larva Cystic with fluid-filled thin membrane, single scolex, no inflammatory response Cystic with hyaline degeneration, cyst fluid thicker and proteinaceous, breach in blood–brain barrier and surrounding inflammation Retractedinvoluted larva with fragemented contents (including scolex) thick capsule, inflammation less Mineralized larva, inflammation may or may not be seen

Pathological characteristics

May be normal or reveal calcification

Hypodense with surrounding oedema

Hypodense, surrounding oedema may be present

Isodense / ? hypodense

Normal

NCCT

May be enhancing

Ring- or discshaped contrast enhancement

Usually no contrast enhancement except in early stages of degeneration ( 3 months) Ring or disc shaped contrast enhancement

Normal / ? hyperdense specs

CECT

Isointense/ hypointense

Intensity  CSF

Hypointense

–

Proton density

Hypointense

Iso-/ hypointense

Iso-/hypointense – with central hyperintensity

Hyperintense

Intensity  CSF

Isointense

Hyperintense

Isointense

T2

Hypointense

Isointense / hypointense

T1

NCCT: Non-contrast CT; CECT: Contrast-enhanced CT; CSF: Cerebrospinal fluid.

Fibrocalcified

Granularnodular

Colloidal

Vesicular

Prevesicular

Stage

MRI

May be enhancing

Usually not, except in early degenerating stage

No

Oedema

Not usually seen

May be present

Usually present

May be Always present (T1 present isointense, T2 iso-/ hypointense)

Present

Not seen

Scolex

Ring-/noduleOccasionlike enhancement ally present

Enhances after contrast

Non-enhancing

May enhance very early

Postcontrast

Table 32.1. Correlation of histopathological and computed tomography (CT) and magnetic resonance imaging (MRI) features of various stages of neurocysticercosis.

Imaging and Spectroscopy of Neurocysticercosis 323

324

D. Sharda et al.

Novel Imaging Techniques Magnetization transfer MRI has been recently applied to the differentiation of cysticercus granuloma from tuberculoma37. Magnetization transfer ratios in T2 hypointense portions of cysticercus granulomas are significantly lower in comparison to those in tuberculoma as well as normal grey and white matter.37 This is because of higher protein and amino acid content of cysticercus granulomas in comparison to tuberculomas (Fig. 32.11a–c)37. Lately, we have demonstrated the relationship between the perilesional gliosis as observed on magnetization transfer MRI and epileptogenic potential of healed cysticercus granulomas (Fig. 32.10c)38,39. Identification of perilesional gliosis on magnetization transfer MRI may predict late onset seizures, i.e. seizures after the cysticercus granuloma has healed. The identification of such individuals is important, because there is a subset, however small in number, that are prone to seizure recurrence after the granuloma has healed40. Calcified larvae are difficult to differentiate from occult vascular malformation or cavernous haemangioma on T2-weighted images. Use of phase imaging utilizing the difference in phase of these two conditions permits this41. Calcification exhibits positive phase while occult vascular malformations demonstrate negative phase. Three-dimensional constructive interference in steadystate MRI sequences are able to demonstrate intraventricular cysticercosis better than conventional techniques42,43. This modality may be potentially useful in distinguishing intraventricular cysticercosis from a dilatedtrapped ventricle. In vivo proton magnetic resonance spectroscopy has been anecdotally used to study NC44,45. Lactate, succinate, acetate, alanine and an unassigned resonance at 3.3 ppm were among the metabolites detected. A few of these have also been observed in hydatid cysts and brain abscesses. Cysticercus and tubercular granulomas can also be differentiated on the basis of NAA/Cho, NAA/Cr and Cr/Cho ratios (Cho, choline; Cr, creatine; NAA, N-acetylaspartate)45. A high NAA and Cr content

has been reported in the former45. We performed ex vivo and in vitro magnetic resonance spectroscopy in cysticercus granulomas and did not find any NAA in these lesions. Therefore, it is possible that NAA signal is a result of partial volume effect of the voxel. On the contrary, we have observed succinate and lactate in our in vivo studies (Fig. 32.12a–d). Contamination of the voxel from the surrounding oedematous brain parenchyma may be responsible for this signal46. Anecdotal experience of positron emission tomography (PET) in NC revealed areas of decreased cerebral uptake of [18F] 2-fluoro-2-deoxyglucose corresponding in location to resolving cysticercus granuloma47.

Conclusions In conclusion, the radiological manifestations of NC are as varied as its clinical presentations. Critical appreciation of the stages of evolution of the cysticercus is important and forms the basis of the understanding of its neuroimaging features. Each stage in the involution of the cysticercus has characteristic imaging attributes. Conventional crosssectional imaging has few limitations, especially with regard to extraparenchymal NC. Research is currently focusing on the development of improved techniques for identification of atypical and uncommon forms and their differentiation from other infectious disorders. Contrast CT ventriculography and the newer MRI technique of three-dimensional constructive interference in steady-state imaging are useful in delineating intraventricular cysticercosis. In vivo proton magnetic resonance spectroscopy and the magnetization transfer ratios of the T2 hyperintense portions of the cysticercus granuloma are useful in differentiating it from other granulomatous disorders. The identification of perilesional gliosis upon magnetization transfer MRI is predictive of late seizure recurrence in patients with NC. Finally, phase-contrast imaging and T2* imaging are useful in the identification of the calcified stage of NC.

Imaging and Spectroscopy of Neurocysticercosis

325

Fig. 32.12. T2-weighted image (a) through the supraventricular region shows a hyperintense mass with hypointense rim and associated perifocal oedema. The lesion appears hypointense on T1-weighted image (b). In vivo proton-MRS done using spin echo shows a prominent resonance at 2.4 ppm consistent with succinate (S) and a small resonance of lactate at 1.33 ppm (L). The resonances at 2.02, 3.02 and 3.22 ppm are seen as contaminant from the parenchyma around the cyst assigned to N-acetylaspartate (NAA; 1), creatine (Cr; 2), and choline (Cho; 3) respectively (c). Ex vivo proton-MRS confirmed the assignments seen in vivo (d).

326

D. Sharda et al.

References 1. Rabiela Cervantes, M.T., Rivas-Hernandez, A., Rodrigues-Ibarra, J., et al. (1982) Anatomopathological aspects of human brain cysticercosis. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 179–200. 2. Orihel, T.C., Ash, L.R. (1995) Parasites in Human Tissues. American Society of Clinical Pathologists, Chicago, Illinois. 3. McCormick, G.F., Zee, C.S., Heiden, J. (1982) Cysticercosis cerebri. Review of 127 cases. Archives of Neurology 39, 534–539. 4. Wadia, N., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis. New observations, including CT scan findings and experience with treatment by praziquantel. Brain 111, 597–614. 5. Ahuja, G.K., Roy, S., Kamla, G., et al. (1978) Cerebral cysticercosis. Journal of the Neurological Sciences 35, 365–374. 6. Sotelo, J., Guerrero, V., Rubio, F. (1985) Neurocysticercosis: a new classification based on active and inactive forms. A study of 753 cases. Archives of Internal Medicine 145, 442–445. 7. Santin, G., Vargas, J. (1966) Roentgen study of cysticercosis of central nervous system. Radiology 86, 520–527. 8. Sutton, D. (1990) Infection T. In: Young, J.W.R., Sutton, D. (eds) A Short Textbook of Clinical Imaging. Springer Verlag, London, pp. 774. 9. Carabajal, J.R., Palacious, E., Azar-Kia, B., et al. (1977) Radiology of cysticercosis of the central nervous system including computed tomography. Radiology 125, 127–131. 10. Gonzalez, C.F., Palaci, E. (1985) Infections and inflammatory diseases. In: Gonzalez, C.F., Grossman, C.B., Masdeu, J.C. (eds) Head and Spine Imaging. John Wiley & Sons, New York, pp. 397–431. 11. Soto, H.J.L., Gomez, L.A.S., Rojas, E.L.A., et al. (1996) Subarachnoid hemorrhage secondary to a ruptured inflammatory aneurysm: possible manifestation of neurocysticercosis: case report. Neurosurgery 38, 197–199. 12. Bhargava, S. (1983) Radiology – including computed tomography – of parasitic diseases of the central nervous system. Neurosurgical Review 6, 129–137. 13. Machado, L.R., Nobrega, J.P., Barros, N.G., et al. (1990) Computed tomography in neurocysticercosis: a 10-year long evolution analysis of 100 patients with an appraisal of a new classification. Arquivos de Neuropsiquiatria 48, 414–418. 14. Noujaim, S.E., Rossi, M.D., Rao, S.K., et al. (1999) CT and MR imaging of neurocysticercosis. American Journal of Roentgenology 173, 1485–1490. 15. Enzmann, D.R. (1994) Central nervous system infections. In: Putman, C.E., Ravin, C.E., Bowie, J.D., et al. (1988) Textbook of Diagnostic Imaging. WB Saunders, Pennsylvania, pp. 241–242. 16. Silva, J.E., Diefenthaler, A.P., Palma, J.K. (2000) Frequency of suspected cases of neurocysticercosis detected by computed skull tomography in Santa Maria, R.S., Brazil. Revista do Instituto de Medicina Tropical de Sao Paulo 42, 57–58. 17. Enzmann, D.R. (1984) Cysts. In: Imaging of Infections and Inflammations of the Central Nervous System: Computed Tomography, Ultrasound and Nuclear Magnetic Resonance. Raven Press, New York, pp. 103–119. 18. Carabajal, J.R., Palacious, E., Azar, K.B., et al. (1977) Radiology of cysticercosis of the central nervous system including computed tomography. Radiology 125, 127–131. 19. Rodriguez, C.J., Salgado, P., Gutierrez, A., et al. (1983) The acute encephalitic phase of neurocysticercosis: computed tomographic manifestations. AJNR American Journal of Neuroradiology 4, 51–55. 20. Carabajal, J.R., Duran, B.B., Dorfsman, J., et al. (1987) The role of computed tomography (CT) in the diagnosis of neurocysticercosis. Child’s Nervous System 3, 199–202. 21. Zee, C.S., Tasi, F.Y., Segall, H.D., et al. (1981) Entrance of metrizamide into an intraventricular cysticercosis cyst. American Journal of Neuroradiology 2, 189–191. 22. Sharma, K., Gupta, R.K. (1993) Negative scan in neurocysticercosis. Pediatric Neurosurgery 19, 206–207. 23. Teitelbaum, G.P., Otto, R.J., Lin, M., et al. (1989) MR imaging of neurocysticercosis. American Journal of Neuroradiology 153, 857–866. 24. Zee, C.S., Segall, H.D., Boswell, W., et al. (1988) MR imaging of neurocysticercosis. Journal of Computer Assisted Tomography 12, 927–934. 25. Suss, R.A., Maravilla, K.R., Thompson, J. (1986) MR imaging of intracranial cysticercosis: comparison with CT and anatomopathologic features. American Journal of Neuroradiology 7, 235–242.

Imaging and Spectroscopy of Neurocysticercosis

327

26. Jena, A., Sanchetee, P.C., Gupta, R.K., et al. (1988) Cysticercosis of brain shown by magnetic resonance imaging. Clinical Radiology 39, 542–546. 27. Creasy, J., Alacron, J. (1994) Magnetic resonance imaging of neurocysticercosis. Topics in Magnetic Resonance Imaging 6, 59–68. 28. Chang, K.H., Cho, S.Y., Hesselink, J.R., et al. (1991) Parasitic diseases of the central nervous system. Neuroimaging Clinics of North America 1, 159–178. 29. Chang, K.H., Lee, J.H., Han, M.H., et al. (1991) The role of contrast enhanced MR imaging in the diagnosis of neurocysticercosis. American Journal of Neuroradiology 12, 501–513. 30. Rajshekhar, V., Chandy, M.J. (1996) Comparative study of CT and MRI in patients with seizures and a solitary cerebral cysticercus granuloma. Neuroradiology 38, 542–546. 31. Spickler, E.M., Lufkin, R.B., Teresi, L., et al. (1989) High-signal intraventricular cysticercosis on T1weighted MR imaging. American Journal of Neuroradiology 10, S64 (Case Report). 32. Suh, D.C., Chang, K.H., Han, M.H., et al. (1989) Unusual MR manifestations of neurocysticercosis. Neuroradiology 31, 396–402. 33. Jena, A., Sanchetee, P., Tripathi, R., et al. (1992) MR observations on the effects of praziquantel in neurocysticercosis. Magnetic Resonance Imaging 10, 77–80. 34. Rhee, R.S., Kumasaki, D.Y., Sarwar, M., et al. (1988) MR imaging of intraventricular cysticercosis. Journal of Computer Assisted Tomography 11, 598–601. 35. Gupta, R.K., Jain, V.K., Kumar, S., et al. (1993) Unusual MRI appearance of cysticercus within the fourth ventricle. Neuroradiology 35, 457–458. 36. Del Brutto, O.H. (1992) Cysticercosis and cerebrovascular disease: a review. Journal of Neurology, Neurosurgery and Psychiatry 55, 252–254. 37. Gupta, R.K., Kathuria, M.K., Pradhan, S. (1999) Magnetization transfer MR imaging in central nervous system tuberculosis. American Journal of Neuroradiology 20, 867–875. 38. Gupta, R.K., Kathuria, M.K., Pradhan, S. (1999) Magnetization transfer MR imaging demonstration of perilesional gliosis: its relationship with epilepsy in treated or healed neurocysticercosis. Lancet 354, 41–42. 39. Pradhan, S., Kathuria, M.K., Gupta, R.K. (2000) Perilesional gliosis and seizure outcome: a study based on magnetization transfer magnetic resonance imaging in patients with neurocysticercosis. Annals of Neurology 48, 181–187. 40. Del Brutto, O.H., Santibanez, R., Noboa, C.A., et al. (1992) Epilepsy due to neurocysticercosis: analysis of 203 patients. Neurology 42, 389–392. 41. Yamada, N., Imakita, S., Sakuma, R.T., et al. (1996) Intracranial calcification on gradient-echo phase image depiction of diamagnetic susceptibility. Radiology 198, 171–178. 42. Yang, D., Korogi, Y., Ushio, Y., et al. (2000) Increased conspicuity of intraventricular lesions revealed by three-dimensional constructive interference in steady state sequences. American Journal of Neuroradiology 21, 1070–1072. 43. Govindappa, S.S., Narayanan, J.P., Krishnamoorthy, V.M., et al. (2000) Improved detection of intraventricular cysticercal cysts with the use of three-dimensional constructive interface interference in steady state MR sequences. American Journal of Neuroradiology 21, 679–684. 44. Chang, K.H., Song, I.C., Kim, S.H., et al. (1998) In vivo single voxel proton MR spectroscopy in intracranial cystic masses. American Journal of Neuroradiology 19, 401–405. 45. Jayasundar, R., Singh, V.P., Raghunathan, P., et al. (1999) Inflammatory granulomas: evaluation with proton MRS. Nuclear Magnetic Resonance in Biomedicine 12, 139–144. 46. Garg, M., Chawla, S., Prasad, K.N., et al. (2002) Differentiation of hydatid cyst from cysticercus cyst by proton MR spectroscopy. NMR in Biomedicine (in press). 47. Nagayama, M., Sbinohara, Y., Nagakura, K., et al. (1996) Distinctive serial magnetic resonance changes in a young woman with rapidly evolved neurocysticercosis, with positron emission tomography results. Neuroimaging 6, 198–201

33

Taenia solium Cysticercosis: Immunodiagnosis of Neurocysticercosis and Taeniasis Patricia P. Wilkins, Marianna Wilson, James C. Allan and Victor C.W. Tsang

Introduction Clinical diagnosis of neurocysticercosis (NC) is complicated by the wide spectrum of clinical presentations associated with the disease1,2. Definitive diagnosis of NC is made by direct demonstration of the parasite in tissues, either by histological demonstration of the parasite in brain tissue or radiological demonstration of the taeniid scolex in cystic lesions using computed tomography (CT) or magnetic resonance imaging (MRI). Neuroimaging studies are the most commonly used techniques for diagnosing NC, but these techniques are expensive and generally not available in areas where the disease is most prevalent. Immunodiagnosis is a valuable method for confirmation of disease, but highly sensitive and specific tests were not available before 19893. Methodologies exist today to detect both antibodies, which indicate present or past infection, and circulating antigens, which indicate current infection4. For the sake of our review here, we will limit our discussion to the most commonly used antibody-detection methods. Antigen detection methods for identifying NC will be discussed in Chapter 34 in this book. Because detection of the adult worm infections,

known as taeniasis, is so crucial to controlling NC, we will also discuss immunodiagnostic methods for detection of taeniasis cases. The antibody-detection assays available today provide a reliable and useful adjunct to the diagnosis of NC. However, that has not always been the case and a variety of tests were developed before the invention of the enzyme-linked immunoelectrotransfer blot (EITB*) had varying degrees of usefulness in diagnosing NC. Complement fixation, indirect haemagglutination, ELISA and EITB tests are among the types of immunodiagnostic assays that have been developed5–7. Today, the EITB and ELISA are the antibody-detection test formats that are most frequently used for diagnosis of NC. Our discussion will focus on these two assays and on studies that have directly compared the two assays.

EITB for Diagnosis of Neurocysticercosis The EITB, which was developed at the Centers for Disease Control (CDC), Atlanta, Georgia, USA has had a profound impact on the diagnosis of cysticercosis6,7. Because of its excellent performance, EITB has been

*In this text and elsewhere in the book, EITB will refer specifically to the enzyme-linked immunoelectrotransfer blot, developed at the CDC5; immunoblot refers to other blot assays, in general. © CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

329

330

P.P. Wilkins et al.

included in a proposed algorithm for the diagnosis of NC8. Of the antibody-detection tests available today, it performs best, with exquisite specificity and excellent sensitivity. Briefly, cysts, collected from naturally infected pigs, are homogenized and proteins are solubilized in urea. The resultant extract is eventually purified using lentil lectin affinity chromatography. The lentil lectin-bound glycoproteins (LLGP) are separated using sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and then electrophoretically transferred to nitrocellulose membranes. The EITB detects antibodies to any one of seven cyst-derived glycoproteins (Fig. 33.1). These proteins are designated as GP50, GP39–42, GP24, GP21, GP18, GP14

gp 50 gp 42 gp 24 gp 21 gp 18 gp 14 gp 13

Fig. 33.1. Enzyme-linked immunoelectrotransfer blot (EITB) for immunodiagnosis of cysticercosis. Individual sera from persons with possible cysticercosis were analysed by the EITB assay; lane 1: negative control sera; lane 2: positive control sera; lanes 3–11 patient specimens. Sera in lanes 3–6 and 8–9 demonstrate positive antibody reactivities to Taenia solium cyst lentil lectin-purified antigens, lane 8 is a weak positive; sera in lanes 7, 10 and 11 are negative. Positions of the defined LLGPs are marked on the left side of the blot.

and GP13, based on relative molecular weight determinations using SDS-PAGE. In cases where two or more cysts are present, this assay is very sensitive, 100% and 95%, using serum or cerebrospinal fluid (CSF), respectively, and is 99% specific for either sample6. Mainly because of its ease of collection for epidemiological studies, saliva was also evaluated as a source of anticysticercal antibodies using EITB. However, saliva was inferior to serum as an antibody source; of the cases that were detected using serum, only 70% were positive using saliva9. EITB is highly sensitive in patients with multiple, enhancing intracranial lesions1,2,10,11. The original description and evaluation of the EITB was performed using sera from biopsy proven cases of NC, typically with multiple lesions as detected by skeletal radiographs6. Continued monitoring of the test performance, compared with clinical findings using newer imaging techniques, such as CT and MRI, suggested that the sensitivity of the assay was lower in cases with single lesions or calcified cysts (see Chapter 36)12. Several studies demonstrated that the test is less sensitive, between 60% and 80%, using sera from patients with a single parenchymal cyst or only calcified lesions11–13, perhaps because of insufficient immune stimulation11,14. In these situations, the test sensitivity using CSF also drops considerably, to approximately 35%13. Intraventricular cysticercosis occurs much less frequently than parenchymal NC10. While MRI is very efficient in revealing the presence of intraventricular cysts, CT is not, yet access to MRI is generally not available in developing countries. Consequently, there is very little published data on the usefulness of the EITB in intraventricular cysticercosis. A study of four patients with intraventricular cysts from Texas found that all four were EITB positive15. It is our experience, using results that have been accumulated over more than a decade in the Parasitic Diseases Reference Diagnostic Laboratory at CDC from patients with intraventricular cysticercosis, that the great majority of these patients are EITB positive (Table 33.1). In patients with intraventricular cysts, as opposed to those with parenchymal cysts, it appears that

Immunodiagnosis of Neurocysticercosis and Taeniasis

331

Table 33.1. Enzyme-linked immunoelectrotransfer blot (EITB) results in serum or cerebrospinal fluid (CSF) samples from patients with pathologically proven intraventricular neurocysticercosis. Cysticercosis patients detected Single cyst Cyst classification

Two or more cysts*

n

EITB+ (%)

n

EITB+ (%)

Active Calcified Mixed

13 1

12 (92) 1

9 2 9

8 (89) 2 (100) 9 (100)

Totals

14†

13 (93)

20†

19 (95)

*Patients had two or more intraventricular cysts, or had both one or more intraventricular cysts and one or more parenchymal cysts. †Thirteen of the 34 patients with intraventricular cysts had paired serum and CSF samples; 10 of 13 pairs were EITB positive, one of 13 pairs was serum positive but CSF negative, and two pairs were EITB negative (one pair from a patient with a single active cyst, one pair from a patient with two active cysts).

the antibody response is influenced more by the location of cysts than by the number of cysts. Intraventricular cysts are constantly bathed in CSF allowing easy access of immune cells and mediators, which may be involved in initiating the humoral response. The presence of antibodies to any of seven glycoprotein antigens is considered diagnostic for NC using the EITB. Over 98% of the time, sera from infected individuals contain antibodies that react with one or more of the seven immunodiagnostic proteins6. In a recent hospital-based study in Peru, about half of NC patients had serum antibodies that reacted to all seven diagnostic proteins16. The proteins most frequently recognized are the GP39–42 complex (95%) and GP24 (94%); the lower molecular weight proteins, GP14 and GP13, are recognized the least6. A recent study examined the presence of anticysticercal antibodies in serum of NC patients before and after anticysticercal treatment11. At admission, approximately half of the patients had antibodies that recognized all seven diagnostic proteins. Of these persons, those who were successfully treated still had antibodies that reacted to all seven proteins 1 year after treatment. Of the patients with antibodies to fewer than seven proteins, 7% were seronegative after 1 year

and 12% showed a decrease in the number of proteins recognized in the EITB 1 year after treatment. These data suggest that antibody persistence is proportional to the intensity of the initial immune response. The diagnostic utility of EITB vis-à-vis CT was evaluated in a cohort of 383 individuals undergoing CT16. When non-specific CT abnormalities such as single lesions and isolated hydrocephalus were excluded, CT scans revealed abnormalities diagnostic of NC in 44% of the EITB-positive individuals. Several explanations may be offered for positive EITB results in individuals with normal CT, such as the presence of extra-neural cysticercosis, or past resolved cerebral cysticercosis with persisting antibodies. It is important to note that serological results should be used in conjunction with neuroimaging studies, clinical manifestations and exposure history for consistent, accurate diagnosis of NC8,13.

ELISA for Diagnosis of NC Although EITB is accepted as the best diagnostic test available today, ELISA continues to be used extensively for both epidemiological surveys17 and for clinical diagnosis, mainly because of its technical simplicity as

332

P.P. Wilkins et al.

compared to EITB. There is extensive literature describing the usefulness of ELISA as a method for diagnosing NC; much of that work has been reviewed elsewhere18. ELISA has been shown to be a useful adjunct for diagnosing NC if CSF, not serum, is tested. In one study, an ELISA, which detected antigen-specific immunoglobulin M (IgM), demonstrated a sensitivity of 87% and specificity of 95% in CSF specimens from patients with active or inactive NC19. However, many ELISA tests have high false positive and false negative rates, so results should be interpreted with caution3. Most ELISAs detect antibodies to antigens that are present in crude cyst extracts or cyst vesicular fluid. Because the parasite antigens used in these assays are not typically purified, ELISA has historically demonstrated a lower specificity and sensitivity than EITB. For this review, we have elected to discuss the ELISA in the context of the EITB and examine studies where the two tests were compared directly; when the ELISA was directly compared with the EITB, the EITB has always outperformed the ELISA (Table 33.2). In one study, sera and CSF from patients with parasite-confirmed NC were tested using both ELISA and EITB20. Using EITB, 94% and 86% of all confirmed cases were detected using serum and CSF, respectively. ELISA detected 65% and 62% of cases, respectively, using the same samples. In this particular study EITB proved to be 99% (1/83) specific, possibly falsely detecting one case of Hymenolepis nana infection among 59

control sera. In contrast, ELISA gave presumably false positive results with sera from patients with several other cestode infections, including those caused by Taenia saginata, H. nana and Echinococcus granulosus. However, the heterologous infection sera used in this study were collected in a region in Peru known to be endemic for diseases caused by all of these parasites; therefore, it is possible that these samples were collected from persons with subclinical cysticercosis or prior exposure to T. solium. A similar study compared the ability of both ELISA and EITB to detect anticysticercal antibodies in paired serum and saliva samples from clinically defined NC patients9. In this study, the sensitivity using serum samples was 100% with EITB and 74% with ELISA. However, in saliva samples, the sensitivity was 70% using EITB and 82% with ELISA. These data suggest that ELISA with saliva may be a useful screening test for cysticercosis in the epidemiological setting. However, its sensitivity does not equal that of EITB in serum and specificity remains an issue. In yet another study, comparing a commercially available ELISA (LMD Laboratories, Carlsbad, CA, USA) with EITB, the latter performed with higher sensitivity and specificity than ELISA21. Although there was a good level of concordance between the two tests (85%), this study demonstrated the lack of specificity often seen with ELISA; 9% of sera were positive that were collected from persons with no clinical or epidemiological evidence of cysticercosis.

Table 33.2. Studies comparing the ELISA and enzyme-linked immunoelectrotransfer blot (EITB) for diagnosis of neurocysticercosis (NC). Cysticercosis cases detected Clinical NC cases (sensitivity)

Non-NC cases (specificity)

Reference

Sample

EITB+ (%)

ELISA+ (%)

EITB+ (%)

ELISA+ (%)

20 20 21 9 9

Serum CSF Serum Serum Saliva

32/34 (94) 18/21 (86) 25/28 (89) 21/21 (100) 19/27 (70)

22/34 (65) 13/21 (62) 26/28 (93) 20/27 (74) 23/28 (82)

1/83 (99) NT 1/69 (99) 0/55 (100) 0/27 (100)

16/83 (81) NT 9/258 (97) NT NT

NT, not tested.

Immunodiagnosis of Neurocysticercosis and Taeniasis

The sensitivity of ELISA for detecting cases of NC characterized by single lesions has not been discussed in the literature. Consequently, using data accumulated in the Parasitic Diseases Reference Diagnostic Laboratory at the CDC, we compared the sensitivity of EITB with that of LMD ELISA by testing 31 samples from persons with either pathologically proven or clinically documented cases of NC with single lesions (Table 33.3). EITB was positive in 55% of the cases, while ELISA was positive in 29%. These data indicate that the ELISA is less effective than EITB for detecting NC cases with single lesions. EITB and ELISA were compared in one community-based study in Mexico to identify NC cases and risk factors associated with the disease17. Positive results in each test were correlated with epidemiological and clinical data. Twelve of 42 persons, reporting a history of seizures, were identified using EITB, but none were detected using ELISA. These data demonstrate the superiority of EITB, even in the community setting, as an important epidemiological tool for identifying NC.

Recent Advances in Immunodiagnosis of Neurocysticercosis Because of the technical difficulties associated with EITB procedures, researchers are attempting to develop novel tests that would not only retain the sensitivity and specificity

333

of the EITB, but also utilize a simpler assay format, such as that of the ELISA. Some investigators have focused on less complex sources of parasite material, such as T. solium cyst fluid22,23. Other scientists have focused on purification and characterization of the seven individual glycoprotein antigens that are components of the LLGP fraction used in EITB24–26. Still others have opted for using a more available source of parasite material present in heterologous rodent Taenia species, T. crassiceps, as an antigen source27. Virtually simultaneously, several laboratories reported purification of individual antigens, cloning of complementary DNA (cDNAs) and incorporation of corresponding recombinant or synthetic antigens in new immunodiagnostic assays for NC28–30. Many, but not all, of the recombinant antigens reported are components of the LLGP fraction28 and others, although not directly purified from the LLGP fraction29,30, appear to be closely related to the protein antigens found in the LLGP fraction. One of the primary research goals in this field is development of simpler assays for immunodiagnosis of NC; therefore, these findings merit a more extensive discussion, presented below. Utilizing the LLGP fraction employed in EITB, several investigators identified native 10-, 14- and 18-kDa antigens that are similar (Fig. 33.2a)25,26. Using amino-terminal amino acid sequencing, these three native proteins share identity in 13 of 19 amino acid cycles for which meaningful sequence was obtained, and similarity at remaining positions. Both

Table 33.3. Comparison of ELISA and enzyme-linked immunoelectrotransfer blot (EITB) for detection of neurocysticercosis (NC) cases with single lesions. Clinical classification

n

Biopsy proven, single lesion Enhancing Calcified Total

10 2 12

3 0 3 (25)

2 0 2 (17)

Clinically consistent with NC Enhancing Calcified Total

13 6 19

10 4 14 (74)

5 2 7 (37)

Total

31

17 (55)

9 (29)*

*All ELISA positives were also EITB positive.

EITB+ (%)

ELISA+ (%)

334

P.P. Wilkins et al.

Fig. 33.2. Alignment of cloned diagnostic antigens of neurocysticercosis (NC). CLUSTAL_ alignment of the deduced amino acid sequences of some recombinant polypeptides reported to have value as diagnostic antigens for detection of NC65. (a) Sequences 1–4, 6 and 8 represent deduced polypeptides reported by Greene et al.28; sequences 5, 7 and 9–10 are reported in Sako et al.30; (b) sequence 11 was reported in Chung et al.29.

groups used native purified proteins in EITB assays and showed these proteins to be sensitive and highly specific for detecting anticysticercal antibodies, although the 10- and 14-kDa antigens appeared more sensitive than the 18-kDa antigen26. These three antigens, the 10-, 14- and 18-kDa proteins were all shown to be components of the larger diagnostic antigens present in the LLGP fraction. The 10-kDa antigen was identified by separate purification

of both the 24- and 39–42-kDa components of the LLGP fraction and, upon reduction, yielded two similar, but not identical, 10-kDa proteins25. The 14- and 18-kDa antigens were purified following reduction of larger LLGPs, which ranged in size from 25 kDa to 45 kDa26. Polyclonal antibodies were generated by both groups that further indicated that these antigens are components of larger protein antigens. Plancarte et al. generated polyclonal

Immunodiagnosis of Neurocysticercosis and Taeniasis

antibodies against purified GP24 or GP39–42 that reacted with the 10-kDa antigen25. Conversely, Greene et al. produced polyclonal antibodies to the 14-kDa protein that reacted with six distinct moieties, co-migrating with GP14, GP18, GP21, GP24, and GP42 antigens in the LLGP fraction28. The cDNAs for the 14- and 18-kDa antigens were subsequently cloned and sequenced. During the process of cloning, a total of five distinct cDNA clones were identified and all were closely related at both the nucleic acid and predicted amino acid levels. Polypeptides that represent the mature proteins were chemically synthesized (synthetic Taenia solium, sTS) 14 and sTS18), and evaluated as diagnostic antigens using an ELISA. sTS14 demonstrated greater utility than sTS18 and was recognized in a disease-specific manner using defined sera from persons with cysticercosis or other helminthic infections. However, only 53% of sera from persons with cysticercosis reacted with this synthetic version of TS1428 although 76% of sera reacted with the native 14-kDa molecule in an immunoblot format26. When all of the data pertaining to the purified LLGP antigens are evaluated, several things become apparent. One, all of the proteins in the 10–42-kDa range appear to be antigenically and structurally related. And two, the 24-kDa and larger antigens appear to be comprised of subunits of at least two smaller (10–14-kDa) proteins28. The precise manner in which these subunits are assembled to form larger proteins remains a subject of intense investigation. Other significant advances towards developing simplified immunodiagnostic methods for NC have been made using purified T. solium cyst fluid. The soluble antigens present in cyst fluid were further purified using isoelectric focusing (pH 9.2–9.6) for use in ELISA or immunoblot formats. Three cysticercosis-specific antigens were identified by immunoblotting: a 10-kDa and a 26-kDa antigen, and a third antigen between 10 kDa and 26 kDa23. The high level of specificity and sensitivity seen in both the ELISA and immunoblot led to cDNA cloning and expression of the recombinant proteins representing the native cyst antigens30. Four

335

related cDNAs were cloned that predicted polypeptides ranging in size from 9.6 kDa to 13 kDa. Escherichia coli-expressed, thioredoxin-fusion proteins were evaluated for specificity and sensitivity. A chimeric construct was created using the cDNA sequences from the two most promising recombinants, expressed in E. coli, and the resultant recombinant chimeric protein was evaluated in an ELISA. Although a limited number of sera (53 NC sera) were evaluated, the chimeric protein demonstrated remarkable sensitivity (100%) and specificity (90%). Another 10-kDa antigen has been isolated from cyst fluid that has been evaluated for its utility as a diagnostic antigen for detection of NC cases. This antigen is a subunit component of a 150-kDa complex. When the native 10-kDa antigen was evaluated in the immunoblot format, the assay had a sensitivity of 85%; and only sera from persons with echinococcosis showed low-level cross-reactivity (~10% of these particular sera reacted)22. A full-length cDNA encoding this 10-kDa antigen has been cloned and a glutathione-Stransferase (GST)-fusion protein was expressed and evaluated in an ELISA. The overall sensitivity, using 200 sera from persons with NC, was 88% and was 97% in detecting active cases of NC. Using approximately 200 sera from persons with other helminthic infections, this assay demonstrated a specificity of 98%. The cDNA sequence of this protein revealed that it, too, is related to the other cDNAs and proteins encoding cyst fluid antigens, described above29,30. However, this cDNA and amino acid sequence appears to be the most distinct of the sequences described to date (Fig. 33.2b). The five cDNA clones encoding the antigens in cyst fluid are not only all related to one another, but are also related to the cDNA clones, which encode the LLGP antigens (Fig. 33.2b). All polypeptides encoded by these cDNAs have similar structural characteristics: N-terminal hydrophobic regions, which are predicted to be signal sequences with signal sequence cleavage sites; all encode polypeptides with predicted sizes of 7.6 kDa to 12.9 kDa; all have similar amino acid compositions with isoelectric points between 8.0 and 9.6; and 10 of the 11 cloned

336

P.P. Wilkins et al.

antigens contain a conserved IAQLAK amino acid sequence near the middle of the polypeptide. Clearly these proteins are members of a larger family of antigenic Taenia proteins that are expressed in the metacestode stage of the parasite.

Diagnosis of Taeniasis Accurate diagnosis of adult Taenia tapeworm infections is a critical element of any strategy to control or eliminate cysticercosis. Definitive diagnosis of tapeworm carriers is accomplished by demonstration of ova and/or proglottides in stool samples. However, because of the intermittent nature of egg excretion, this method underestimates the prevalence of taeniasis31,32. Direct parasitological examination of stool samples is the only diagnostic method that is considered unequivocal. The diagnosis of taeniasis is made when eggs, gravid proglottides, or both are present in the sample. However, eggs of T. solium and T. saginata cannot be distinguished from each other, therefore, speciation of the taeniid can be determined only if gravid proglottides are present. Gravid proglottides from T. solium bear ten or fewer uterine branches on each side of the central uterus; proglottides of T. saginata have 12 or more branches33. In very rare cases, a scolex may be present in the sample. If so, then definitive species diagnosis of T. solium or T. saginata can be made by the presence of an armed (with hooks) or unarmed (without hooks) scolex, respectively34. Taenia solium and T. saginata are sometimes present within the same geographic area, making speciation particularly critical for epidemiological studies. Although microscopic-based parasitological techniques are simple and relatively inexpensive, these techniques lack both sensitivity and specificity. Furthermore, there are cultural problems associated with the collection of faecal samples in some areas. There is the biohazard the material itself presents; collection of faecal samples carries with it the potential for exposure to, and infection with Taenia eggs, which may be present in the sample. From a practical viewpoint, it can often be difficult to ensure unambiguous patient–sample association in field settings. Indeed confusion of sam-

pling pots between family members in field studies has occurred in the past (James C. Allan, Sandwich, UK, personal observation).

Detection of coproantigens The principle behind coproantigen detection is the immunological detection of parasite material in the faeces of the host. Coproantigens may include products shed as a result of turnover of the parasite’s surface or products that are excreted or secreted by the tapeworm. Products, associated with parasite metabolism should be present in faeces independently of parasite reproductive material, such as eggs or proglottides. Unlike tests based on the detection of host antibody, however, they should be present only if the parasite is present. Detection of taeniid coproantigens in faeces was first demonstrated by Babos and Nemeth in the 1960s35. Using sera from rabbits hyperimmunized with cyst fluid from E. granulosus metacestodes, parasite antigens were demonstrated by double diffusion in the faeces of dogs infected with E. granulosus. Antigen was detected before patency but cross-reactions were seen with antigens present in faeces from individuals infected with Taenia. Subsequently, antigens were detected in the faeces of a variety of hosts infected with intestinal cestodes36–47. These assays used polyclonal antibodies from rabbits hyperimmunized with adult worm products; others used both rabbit polyclonal and murine monoclonal antibodies48,49. These assays are highly specific and sensitive and are able to detect antigens before patency and in samples that have been frozen or collected in formalin.

Coproantigen detection in human taeniasis To date, all assays for taeniid coproantigen in humans have been based on polyclonal rabbit antibodies, either to adult worm somatic38, excretory–secretory (ES)43 or surface antigens44,46. These tests have been shown to be genus specific; samples from both T. solium and T. saginata infections are

Immunodiagnosis of Neurocysticercosis and Taeniasis

positive in assays using antibodies against one species or the other38. Levels of specificity with faeces from infections other than Taenia sp. have been demonstrated to be greater than 99%39–41, resulting in a high positive predictive value in most T. solium endemic areas. No cross-reactions have been shown with faeces from other helminth infections, including H. nana, H. diminuta, Ascaris lumbricoides, Trichuris and hookworm39–41. In a field study where all of the Taenia tapeworms identified to the species level were shown to be T. solium, a microtitre plate-based coproantigen assay detected 2.6 times more tapeworm carriers than microscopic detection of Taenia eggs in faeces (55 cases diagnosed versus 21)41. The coproantigen test diagnosed 98% of all cases detected in the study while microscopy diagnosed 38% (55/56 cases and 21/56 cases, respectively). Coproantigen tests for human taeniasis become negative within approximately 1 week after successful treatment of intestinal infection38,43. In canine Taenia infections they are positive several weeks before patency and give results independently of egg output39,42. Indeed, the possible detection of at least one pre-patent case of human intestinal T. solium has been reported in a field study32. A visually interpreted dipstick assay has been used for detection of Taenia coproantigens in faeces directly after collection in rural communities in both Guatemala and Mexico40. In a total of 41 cases of taeniasis, diagnosed by either coproantigen testing, microscopy, or questioning, the dipstick test detected 31 (76%) of all cases. This compared to 23 cases diagnosed by microscopy (56%) and five by questioning (12%). The dipstick format is known to be less sensitive than the microtitre-based ELISA, but can be performed with minimal facilities, making it an extremely attractive option for epidemiological studies. The results from studies that employed coproantigen detection assays for the identification of Taenia carriers have indicated that these assays are considerably more sensitive than microscopy and have working characteristics suitable for practical application in the field in T. solium endemic areas. Further

337

improvements to these assays, especially the capability to differentiate T. solium and T. saginata, would broaden their applicability.

Immunodiagnosis of intestinal Taenia infection A number of immunodiagnostic techniques have been applied to the diagnosis of human T. solium and T. saginata taeniasis. Early studies involved the application of intradermal tests but these were shown to have high false-positive and false-negative rates50–54. In particular, the tests were shown to remain positive for long periods following treatment of the infection53. In some cases, reactions were detected only after treatment or became stronger after treatment53. Intradermal testing for T. solium gave false-positive rates of 3–7% and a sensitivity of approximately 76%54, however, 12% of individuals treated for this parasite continued to give positive results for long periods after treatment, some patients remaining positive for up to 18 months. These techniques have never been applied on a large scale. Serum antibody detection in T. saginata infection by use of the indirect haemagglutination technique was also demonstrated55. Prolonged persistence of antibodies after treatment, between 5 and 19 months in some patients, was reported. Another study reported that test sensitivity was 56%, with a falsepositive rate of 1.35%, leading to the conclusion that this approach was of limited applicability56. In contrast to the situation with human taeniasis, serum antibody detection has been more thoroughly investigated in canine taeniasis. Studies in this area indicated both the presence and diagnostic applicability of serum antibodies for the diagnosis of a number of different taeniid species in dogs. A variety of antigenic preparations have been used including adult worm somatic and ES products and oncosphere antigens57–60. These studies demonstrated that antibody could be detected before patency and with high levels of specificity, although cross-reactions occurred between sera from dogs infected with different taeniid species. Tests for antibodies took some time to become negative after treatment; those

338

P.P. Wilkins et al.

for antibodies to oncosphere products becoming negative within a few weeks after treatment. The ability to test for antibody in saliva was also demonstrated61.

This serological assay for T. solium taeniasis is a valuable method for identifying T. solium tapeworm carriers which overcomes many of the obstacles associated with ova and parasite examination or coproantigen detection.

EITB-T for detection of T. solium taeniasis

Conclusions In an effort to develop a serological assay for detection of human taeniasis carriers, an immunoblot assay, EITB-T, using ES antigens of adult T. solium tapeworms was developed. ES proteins were collected following in vitro culture of T. solium tapeworms, which were harvested from immunosuppressed hamsters approximately 30 days after infection with porcine cysts37,38. Proteins that reacted with antibodies in the taeniasis positive serum pool, but not antibodies in the cysticercosis pool were identified as potential diagnostic targets. Antigens, ranging in size from 32.7 kDa to 42.1 kDa, appeared to be specific for taeniasis infections. Individual sera from patients with confirmed taeniasis or cysticercosis were analysed and 95% (69/73) of sera tested from parasitologically confirmed T. solium carriers contained antibodies to these proteins. Antibodies in sera from persons with other helminthic diseases, such as those caused by H. nana, Echinococcus, Ascaris, Trichuris and other parasites, did not cross-react with the ES proteins, demonstrating an assay specificity of 100%. Furthermore, using sera from a limited number of parasitologically confirmed taeniasis cases, the EITB-T detected only T. solium taeniasis and not T. saginata cases62.

Remarkable advances have been made in the immunodiagnosis of NC in the past two decades. A disease that was once diagnosed only after surgery, can now be accurately diagnosed using non-invasive techniques. The EITB for NC has not only revolutionized diagnosis of NC; it has also been crucial in defining the magnitude of the disease worldwide7,63. Future prospects for development of simpler tests that would retain the exquisite sensitivity and specificity of EITB for diagnosis of NC are bright. Advances in immunodiagnosis of NC and taeniasis engender promise, not only for better and more rapid diagnosis of NC, but also for better understanding of the pathogenesis of the disease and the factors associated with transmission dynamics. New methods such as the coproantigen assays and the EITB-T are tools that permit sensitive identification of tapeworm carriers. Furthermore, these assays may ultimately help identify important epidemiological variables such as the relationship between taeniasis and NC64; the prevalence of taeniasis in a given community; the lifespan of the adult tapeworm; and other parameters necessary to develop meaningful strategies for controlling or eliminating NC2.

References 1. García, H.H., Del Brutto, O.H. (2000) Taenia solium cysticercosis. Infectious Diseases Clinics of North America 14, 97–119. 2. White, A.C., Jr. (2000) Neurocysticercosis: update on epidemiology, pathogenesis, diagnosis and management. Annual Review of Medicine 51, 187–206. 3. Ramos-Kuri, M., Montoya, R.M., Padilla, A., et al. (1992) Immunodiagnosis of neurocysticercosis. Disappointing performance of serology (eynzyme-linked immunosorbent assay) in an unbiased sample of neurological patients. Archives of Neurology 49, 633–636. 4. Flisser, A., Plancarte, A., Correa, D., et al. (1990) New approaches in the diagnosis of Taenia solium cysticercosis and taeniasis. Annals of Human and Comparative Parasitology 65, 95–98. 5. Rydzewski, A.K., Chisholm, E.S., Kagan, I.G. (1975) Comparison of serologic tests for human cysticercosis by indirect hemagglutination, indirect immunofluorescent antibody, and agar gel precipitin tests. Journal of Parasitology 61, 154–155.

Immunodiagnosis of Neurocysticercosis and Taeniasis

339

6. Tsang, V.C., Brand, J.A., Boyer, A.E. (1989) An enzyme-linked immunoelectrotransfer blot assay and glycoprotein antigens for diagnosing human cysticercosis (Taenia solium). Journal of Infectious Diseases 159, 50–59. 7. Tsang, V.C.W., García, H.H. (1999) Immunoblot diagnostic test (EITB) for Taenia solium cysticercosis and its contribution to the definition of this underrecognized but serious public health problem. In: García, H.H., Martinez, S.M. (eds.) Taenia solium Taeniasis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 245–256. 8. Del Brutto, O.H., Wadia, N.H., Dumas, M., et al. (1996) Proposal of diagnostic criteria for human cysticercosis and neurocysticercosis. Journal of the Neurological Sciences 142, 1–6. 9. Feldman, M., Plancarte, A., Sandoval, M., et al. (1990) Comparison of two assays (EIA and EITB) and two samples (saliva and serum) for the diagnosis of neurocysticercosis. Transactions of Royal Society of Tropical Medicine and Hygiene 84, 559–562. 10. White, A.C., Jr, Robinson, P., Kuhn, R. (1997) Taenia solium cysticercosis: host–parasite interactions and the immune response. Chemical Immunology 66, 209–230. 11. García, H.H., Gilman, R.H., Catacora, M., et al. (1997) Serologic evolution of neurocysticercosis patients after antiparasitic therapy. Journal of Infectious Diseases 175, 486–489. 12. Rawlings, D., Ferriero, D.M., Messing, R.O. (1989) Early CT re-evaluation after empiric praziquantel therapy in neurocysticercosis. Neurology 39, 739–741. 13. White, A.C., García, H.H. (1999) Recent developments in the epidemiology, diagnosis, treatment, and prevention of neurocysticercosis. Current Infectious Diseases Report 1, 434–440. 14. Wilson, M., Bryan, R.T., Fried, J.A., et al. (1991) Clinical evaluation of the cysticercosis enzyme linked immunoelectrotransfer blot in patients with neurocysticercosis. Journal of Infectious Diseases 164, 1007–1009. 15. Cuetter, A.C., Garcia-Bobadilla, J., Guerra, L.G., et al. (1997) Neurocysticercosis: focus on intraventricular disease. Clinical Infectious Diseases 24, 157–164. 16. García, H.H., Herrera, G., Gilman, R.H., et al. (1994) Discrepancies between cerebral computed tomography and Western blot in the diagnosis of neurocysticercosis. American Journal of Tropical Medicine and Hygiene 50, 152–157. 17. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community based epidemiological investigations of cysticercosis due to Taenia solium: comparison of serological screening tests and clinical findings in two populations in Mexico. Clinical Infectious Diseases 18, 879–885. 18. Flisser, A. (1994) Taeniasis and cysticercosis due to Taenia solium. Progress in Clinical Parasitology 4, 77–116. 19. Rosas, N., Sotelo, J., Nieto, D. (1986) ELISA in the diagnosis of neurocysticercosis. Archives of Neurology 43, 353–356. 20. Diaz, J.F., Verastegui, M., Gilman, R.H., et al. (1992) Immunodiagnosis of human cysticercosis (Taenia solium): a field comparison of an antibody-enzyme-linked immunosorbent assay (ELISA), and antigen-ELISA, and an enzyme-linked immunoelectrotransfer blot (EITB) assay in Peru. American Journal of Tropical Medicine and Hygiene 46, 610–615. 21. Sloan, L., Schnieider, S., Rosenblatt, J. (1995) Evaluation of enzyme-linked immunoassay for serological diagnosis of cysticercosis. Journal of Clinical Microbiology 33, 3124–3128. 22. Yang, H.J., Chung, Y.K., Yun, D., et al. (1998) Immunoblot analysis of a 10 kDa antigen in cyst fluid of Taenia solium metacestodes. Parasite Immunology 20, 483–488. 23. Ito, A., Plancarte, A., Nakao, M., et al. (1999) ELISA and immunoblot using purified glycoproteins for serodiagnosis of cysticercosis in pigs naturally infected with Taenia solium. Journal of Helminthology 73, 363–365. 24. Plancarte, A., Fexas, M., Flisser, A. (1994) Reactivity in ELISA and dot blot of purified GP24, an immunodominant antigen of Taenia solium, for the diagnosis of human neurocysticercosis. International Journal of Parasitology 24, 733–738. 25. Plancarte, A., Hirota, C., Martinez-Ocana, J., et al. (1999) Characterization of GP39–42 and GP24 antigens from Taenia solium cysticerci and of their antigenic GP10 subunit. Parasitology Research 85, 680–684. 26. Greene, R.M., Wilkins, P.P., Tsang, V.C. (1999) Diagnostic glycoproteins of Taenia solium cysts share homologous 14- and 18-kDa subunits. Molecular Biochemistry and Parasitology 99, 257–261. 27. Bueno, E.C., Vaz, A.J., Machado, L.D., et al. (2000) Specific Taenia crassiceps and Taenia solium antigenic peptides for neurocysticercosis immunodiagnosis using serum samples. Journal of Clinical Microbiology 38, 146–151.

340

P.P. Wilkins et al.

28. Greene, R.M., Hancock, K., Wilkins, P.P., et al. (2000) Taenia solium: molecular cloning and serologic evaluation of 14- and 18-kDa related, diagnostic antigens. Journal of Parasitology 86, 1001–1007. 29. Chung, J.Y., Bahk, Y.Y., Huh, S., et al. (1999) A recombinant 10-kDa protein of Taenia solium metacestodes specific to active neurocysticercosis. Journal of Infectious Diseases 180, 1307–1315. 30. Sako, Y., Nakao, M., Ikejima, T., et al. (2000) Molecular characterization and diagnostic value of Taenia solium low-molecular-weight antigen genes. Journal of Clinical Microbiology 38, 4439–4444. 31. Hall, A., Lathman, M.C., Cromton, D.W., et al. (1981) Taenia saginata (Cestoda) in western Kenya: the reliability of faecal examinations in diagnosis. Parasitology 83, 91–101. 32. Allan, J.C., Velasquez-Tohom, M., Garcia-Noval, J., et al. (1996) Epidemiology of intestinal taeniasis in four rural, Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157–165. 33. Proctor, E.M. (1972) Identification of tapeworms. South African Medical Journal 46, 234–238. 34. Eldson-Dew, R., Proctor, E.M. (1965) Distinction between Taeniarhynchus saginata and Taenia solium. South African Journal of Science 61, 215–217. 35. Babos, S., Nemeth, I. (1962) Az echinococcis szerodiagnoztikajanak kerderehez. Magyar Allatorvosok Lapja 17, 58–60. 36. Machnicka, B., Krawczuk, S. (1988) Hymenolepis diminuta antigen: detection in faeces of rats. Bulletin of Polish Academy of Science and Biological Science 36, 103–106. 37. Allan, J.C., Craig, P.S. (1989) Coproantigens in gut tapeworm infections: Hymenolepis diminuta in rats. Parasitology Research 76, 68–73. 38. Allan, J.C., Avila, G., Garcia-Noval, J., et al. (1990) Immunodiagnosis of taeniasis by coproantigen detection. Parasitology 101, 473–477. 39. Allan, J.C., Craig, P.S., Garcia-Noval, J., et al. (1992) Coproantigen detection for immunodiagnosis of echinococcossis and taeniasis in dogs and humans. Parasitology 104, 347–356. 40. Allan, J.C., Mencos, F., Garcia-Noval, J., et al. (1993) Dipstick dot ELISA for the detection of Taenia coproantigens in human. Parasitology 107, 79–85. 41. Allan, J.C., Velasquez-Tohom, M., Torres-Alvarez, R., et al. (1996) Field trial of the coproantigenbased diagnosis of Taenia solium taeniasis by enzyme-linked immunosorbent assay. Amercian Journal of Tropical Medicine and Hygiene 54, 352–356. 42. Deplazes, P., Gottstein, B., Stingelin, Y., et al. (1990) Detection of Taenia hydatigena coproantigens by ELISA in dogs. Veterinary Parasitology 36, 91–103. 43. Deplazes, P., Exkert, J., Pawlowski, Z.S., et al. (1991) An enzyme-linked immunosorbent assay for diagnostic detection of Taenia saginata copro-antigens in humans. Transactions of the Royal Society of Tropical Medicine and Hygiene 85, 391–396. 44. Maass, M., Delgado, E., Knobloch, J. (1991) Detection of Taenia solium antigens in merthiolate-form preserved stool samples. Tropical Medicine and Parasitology 42, 112–114. 45. Maass, M., Delgado, E., Knobloch, J. (1992) Isolation of an immunodiagnostic Taenia solium coproantigen. Tropical Medicine and Parasitology 43, 201–202. 46. Machnicka, B., Dziemian, E., Zwierz, C. (1996) Detection of Taenia saginata antigens in faeces by ELISA. Applied Parasitology 37, 106–110. 47. Machnicka, B., Dziemaian, E., Zwierz, C. (1996) Factors conditioning detection of Taenia saginata antigens in faeces. Applied Parasitology 37, 99–105. 48. Sakai, H., Furusawa, R., Oku, Y., et al. (1996) Echinococcus multilocularis copro-antigen detection in golden hamster, an alternative definitive host. Experimental Animals 45, 275–278. 49. Malgor, R., Nonaka, N., Basmadjian, I., et al. (1997) Copro-antigen detection in dogs experimentally and naturally infected with Echinococcus granulosus by a monoclonal antibody-based enzyme-linked immunosorbent assay. International Journal of Parasitology 27, 1605–1612. 50. Ramsdell, S. (1927) A note on the skin reaction in Taenia infestation. Journal of Parasitology 14, 102–105. 51. Brunner, M. (1928) Immunological studies in human parastic infestation. Journal of Immunology 15, 83–101. 52. Podyapolskaya, V.P., Kamalova, A.G. (1942) Cutaneous test as a method of diagnosis of taeniasis and cysticercosis. Meditsinskaia Parazitologiia I Parazitarnye (Bolezni) 11, 99–105. 53. Machinicka Roguska, B., Zweirz, C. (1970) Intradermal test with antigenic fractions in Taenia saginata infection. Acta de Parasitologica Polonica 18, 293–299. 54. Slusarski, W., Zapart, W. (1971) Diagnostic value of intradermal test with acid-soluble protein fractions in Taenia infections in man. Acta de Parasitologica Polonica 19, 445–455. 55. Machinicka Roguska, B., Zweirz, C. (1971) Hemagglutination reaction in people with Taenia saginata invasion. Wiadomosci Parazytologiczne (Warsaw) 14, 27–33.

Immunodiagnosis of Neurocysticercosis and Taeniasis

341

56. Flentje, B., Padelt, H. (1981) Value of a serologic diagnosis of Taenia saginata infestation in the human. Angew Parasitology 22, 65–68. 57. Jenkins, D.J., Rickard, M.D. (1985) Specific antibody responses to Taenia hydatigena, Taenia pisiformis and Echinococcus granulosus infection in dogs. Australian Veterinary Journal 62, 72–78. 58. Heath, D.D., Lawrence, S.B., Glennie, A., et al. (1985) The use of excretory and secretory antigens of the scolex of Taenia ovis for the serodiagnosis of infection in dogs. Journal of Parasitology 71, 192–199. 59. Jenkins, D.J., Rickard, M.D. (1986) Specific antibody responses in dogs experimentally infected with Echinococcus granulosus. American Journal of Tropical Medicine and Hygiene 35, 345–349. 60. Gasser, R.B., Lightowlers, M.W., Obendorf, D.L., et al. (1988) Evaluation of a serological test system for the diagnosis of natural Echinococcus granulosus infection in dogs using E. granulosus protoscolex and oncosphere antigens. Australian Veterinary Journal 65, 369–373. 61. Kinder, A., Carter, S.D., Allan, J., et al. (1992) Salivary and serum antibodies in experimental canine taeniasis. Veterinary Parasitology 41, 321–327. 62. Wilkins, P.P., Allan, J.C., Verastegui, M., et al. (1999) Development of serologic assay to detect Taenia solium taeniasis. American Journal of Tropical Medicine and Hygiene 60, 199–204. 63. Tsang, V.C.W., Wilson, M. (1995) Taenia solium: an underrecognized but serious public health problem. Parasitology Today 11, 124–126. 64. Gilman, R.H., Del Brutto, O.H., García, H.H., et al. (2000) Prevalence of taeniosis among patients with neurocysticercosis is related to severity of infection. Neurology 55, 1062. 65. Thompson, J.D., Gibson, T.J., Plewniak, F., et al. (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876–4882.

34

Antigen-based Immunoassays in the Diagnosis of Taenia solium Cysticercosis

Dolores Correa, Raquel Tapia-Romero, Antonio Meza-Lucas and Olga Mata-Ruiz

Introduction Establishing a diagnosis of Taenia solium cysticercosis usually involves several investigations including immunological tests principally based upon antibody detection in cerebrospinal fluid (CSF) or serum (reviewed in Chapter 33). In general, the presence of antibodies in symptomatic cases in association with computed tomography (CT) or magnetic resonance imaging (MRI) compatible with neurocysticercosis (NC) is considered diagnostic. Antibody-based immunoassays have also been used in epidemiological studies of T. solium cysticercosis1–3. They permit the detection of transmission ‘hot spots’ and the identification of risk factors. One limitation of antibody-based tests is that antibodies may be detected in a certain proportion of individuals who do not have active disease, for instance, those with calcified lesions4. In addition, two-thirds of seropositive individuals have no lesion identifiable upon CT scans5. Thus, the presence of antibodies does not constitute direct evidence of a living parasite within the host. In order to overcome the limitations of antibodybased immunoassays, several attempts have been made to develop antigen-based assays in the belief that the detection of antigens would correlate with presence of live and active cysticerci6–19. In the present chapter we

review literature related to polyclonal and monoclonal antibody (PoAb and MoAb)based antigen detection assays, and their role in clinical and epidemiological studies.

Overview of Studies on Antigens in Human Fluids Taenia solium metacestode antigens were first studied in the CSF by latex agglutination using PoAb7. A sensitivity and specificity of 77% and 97% respectively were reported. Subsequently, two PoAb-based direct ELISAs were described wherein CSF samples were directly used to coat the ELISA plates, as antigen source, and developed with rabbit PoAbs8,9. These methods were able to detect 59–77% of cases of NC. Following these initial studies, several direct or capture ELISA and high pressure liquid chromatography-ELISA (HPLC-ELISA) formats employing MoAbs or PoAbs have been developed (Table 34.1)7–10,12–14,16–19. Their reported sensitivity varied between 0 and 93%. Most studies have focused upon the presence of antigens in CSF, while only a few have perused their presence in serum20–22. So far, most of the studies have found an antigen or a group of antigens of molecular weight of around 200 kDa, both in CSF and serum. Estrada et al. detected two antigens of

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

343

CSF

CSF

CSF

ELISA/homologous capture

ELISA/homologous capture

Serum CSF CSF

ELISA/direct ELISA/homologous capture

anti-CE: Anti-crude extract. anti-AgB: Anti-antigen B. ND: Not determined. PoAb: Polyclonal antibody.

CSF

CSF

ELISA/heterologous capture

HPLC-ELISA/direct

CSF

ELISA/direct Dot-ELISA/direct EITB

Serum

CSF

Sample

Agglutination

Method

ND ND

150

Fraction 400 Fraction 33–240

255 16 231

212

–

75

25

31 –

ND 100 200

–

–

200

ND

18

17

215

No. of patients

190, 230

ND

ND

Antigens: molecular weight (kDa)

40 ND

ND

–

ND 5

24 – ND

–

–

18

48

31

No. of controls

MoAb: Monoclonal antibody. CSF: Cerebrospinal fluid. EITB: Enzyme-linked immunoelectrotransfer blot. HPLC-ELISA: High pressure liquid chromatography-ELISA.

Anti-CE PoAb/ MoAb 1F11 MoAb 4F8 MoAb

Anti-CE

H7 MoAb

Anti-CE PoAb Anti-CE PoAb Anti-CE PoAb HP10 MoAb HP12 MoAb Porcine anti-CE Porcine anti-AgB

Antibody (capture system)

Table 34.1. Overview of studies of antigen detection in human cysticercosis.

0 82 77 (NC) / 97 (subcutaneous cysticercosis)

13

56

44 29

48 48 52

72

72

77 59 78

77

Sensitivity (%)

100 ND

ND

100

100

ND

100 100

100

100

100 100 100

97

Specificity (%)

19

18

17

16

14

12,14

13

10

8,9

7

Reference

344 D. Correa et al.

Antigen-based Immunoassays in Diagnosis

molecular weight 230 kDa and 190 kDa, in 14 of 18 CSF samples using an immunoblot assay10. Similarly, a sensitivity of 75–86% was obtained when CSF of patients with NC were evaluated with the HP10 MoAb11–13. The latter is specific for a 200-kDa glycoprotein. A molecule of similar molecular weight was also detected by another MoAb (H7) in more than 50% of cases in CSF and serum of patients with NC14. We have found five different antigens using an immunoblot assay in multilesional cysticercosis. A 200-kDa band was most frequent among the five antigens, both in CSF and serum14,15. The 200-kDa antigen that has been identified in most studies is best recognized by a capture assay using the HP10 MoAb in a homologous system12,13. It is a glycoprotein, having a repetitive epitope11. However, it is not species-specific and this might interfere with its diagnostic role in extracerebral cysticercosis in areas where other cestode infections are also prevalent. Among other molecules that have been found in CSF or serum of patients with NC, a fraction larger than 400 kDa was detected in 29% of patients’ CSF16. Studies by our group and Cho et al., using PoAb and MoAb respectively, have revealed the presence of a 150-kDa molecule in 13% of CSF samples from NC cases6,15,17. Besides, bands of 183 kDa and 50 kDa have been found in the serum and the CSF respectively of NC patients in very few instances15. Two MoAb-based methods reported high sensitivities (77–97%), but the antigens recognized were not identified18,19. An interesting finding from one of these studies was that individuals with subcutaneous cysticercosis presented with antigens in CSF more frequently than those with intracranial involvement alone19.

Limitations of Antigen Detection Lack of antigens or sequestration? A variety of antibody responses in sera and CSF of patients with NC have been demonstrated with low-resolution procedures like immunoelectrophoresis as well as by more contemporary and highly sensitive tests such as enzyme-linked immunoelectrotransfer

345

blot (EITB)20,23,24. In contrast, antigens are uncommonly detected. One reason for this observation could be the rapid sequestration of antigens. Several findings support this notion. We detected antigen B, a component of the excretory–secretory products of cysticercus, in only 14% of the CSF samples of patients with NC12,25,26. This particular antigen is immunodominant, i.e. it elicits a strong antibody response23,27. It binds to collagen with high affinity, as well as to the C1q component of the complement cascade28,29. We surmise that soon after secretion by the parasite, the antigen is sequestered in the host tissues or serum. In a similar manner, other antigens that elicit antibody responses can either be sequestered in host tissues adjacent to the parasite, ingested by phagocytes or transported to lymphoid tissues, where they may thus escape detection.

Evidence of immune complexes in neurocysticercosis Immune complex formation may be one of the mechanisms by which antigens disappear and evade detection. There is evidence for the presence of immune complexes in cysticercosis. Community-based epidemiological studies have attempted to detect both antibodies and antigens in sera of individuals21,22,30. However, it is extremely rare to find antigens and antibodies concurrently in a given serum sample. In two different studies of epileptics in rural communities of Mexico21 and Brazil (I. Gomes, A. MezaLucas, M. Veiga, et al., Universidade Federal da Bahia, Brazil, unpublished observations) respectively, the relation between age and prevalence of antibodies was found to be inverse to that between age and antigens. The inability to detect antigens and antibodies in concurrent samples is likely to be related to the formation of immune complexes. Indirect evidence for the existence of immune complexes also came from a report of nephrotic syndrome complicating cysticercosis31. Renal biopsy revealed membranous glomerulonephritis, implicating the production of immune complexes, surmised to occur in response to cysticercal infection.

346

D. Correa et al.

Swine antibodies against a crude cysticercus extract detected antigens in 48% of human CSF samples, but gave negative results with sera of cysticercotic pigs12,32. The observed discrepancy between human CSF and pig sera could be explained by the similarity between native antibodies in infected pigs and the experimentally generated antibodies. Antigen epitopes may be blocked by native antibodies leading to immune complex formation; the failure of experimentally generated antibodies to detect antigens in pig sera may be related to this immune complex formation.

Absence of antigens or technical problems? The low yield of antigen detection assays could be related to several of the technical problems described below. In the capture assays, PoAbs produce high backgrounds, confounding discrimination between positive and negative samples. On the other hand, when MoAbs are used, small quantities of antigen may escape detection. Furthermore, in homologous-antibody capture systems, it is necessary to have antibodies that react with repetitive epitopes of the antigenic molecule. The latter problem is overcome in direct capture assays since the sample is directly adsorbed. Estrada and Khun developed an ELISA where CSF antigens were directly bound to polystyrene wells8. All four confirmed cases and one out of seven patients with a strong clinical suspicion of NC were positive by this assay. Likewise, the sensitivity of a similar assay in a larger group of patients was 75%9. While direct capture systems preclude the need for repetitive epitopes, they require large antigen concentrations and therefore give positive results only in those individuals with a large cyst load. Another technical point that has bearing on the positive yield is that concentrated serum samples inhibit the signal obtained due to antigen. Dilution improves this signal but may reduce antigen concentration as well, thereby compro-

mising the sensitivity of the assay. Accordingly, a balanced dilution needs to be determined in order to optimize performance of the assay.

Potential Applications of Antigen Detection in the Study of T. solium Infection Species specific antigens PoAbs against crude preparations of metacestodes cross-react with antigens of other cestodes as well. This holds true for MoAbs that have been developed for T. solium antigen detection. Indeed, certain MoAbs that detect T. solium antigens were raised against T. saginata antigens12,13,32. Antigen detection assays are therefore only genus-specific, and their use is limited in areas where hydatidosis and cysticercosis are co-endemic. Recently, we developed a MoAb against the adult T. solium which reacts much less strongly or not at all with T. saginata and other parasitic antigens (Y. Medina-Flores, R. García-Rodea, D. Correa, Instituto de Diagnóstico y Referencia Epidemiológicos & Instituto Nacional de Pediatría, Ministry of Health, México City, México, unpublished observations). Its use for antigen detection in cysticercosis deserves further investigation.

Stage specific antigens Positive antigen seroassays do not necessarily imply a diagnosis of T. solium cysticercosis because of sharing of antigens between the metacestode and adult stages of T. solium. We found circulating antigens in sera of almost 20% of cases with taeniasis in an endemic community of Mexico21. In the hamster model of taeniasis, adult antigens have been demonstrated to cross the intestinal epithelium and enter the circulation (G. Avila, M. Benitez, L. Aguilar, et al., Universidad Nacional Autónoma de México, México DF, México,

Antigen-based Immunoassays in Diagnosis

unpublished observations). The elaboration of stage-specific antigens may turn out to be useful in the differentiation of infection due to the adult and metacestode forms of T. solium.

Antigens of live and degenerating cysticerci It is desirable to have serological test(s) that differentiate between live-viable and dyingdegenerating cysticerci. In experimental T. saginata cysticercosis, antigens appear within 4 weeks of infection, and disappear rapidly when the parasites are eradicated by treatment11. Conceivably, the detection of these antigens may indicate the presence of live parasite. With specific reference to T. solium, the HP10 MoAb was found to be specific for a surface component of the metacestode, while another (HP12) reacted against a vesicular fluid component11. A capture assay employing the former was 72–86% sensitive in CSF of humans with NC12,13. In contrast, the HP12 MoAb gave comparatively lower sensitivity; it failed to detect massive infection in pigs, and was able to detect antigens in only half of the human cases12,32. Another MoAb developed by Cho et al. against an antigen of vesicular fluid produced positive antigen bands in 11% cases; out of these, a number of instances became positive only after praziquantel treatment17. The discrepant results obtained with MoAbs against surface and vesicular fluid components could be related to the evolutionary stage of cysticerci. Therefore, CSF or sera of individuals with live, viable cysticerci are likely to be surface antigen-positive and vesicular fluid antigennegative, while those with dying-degenerating cysticerci are expected to be both surface and vesicular fluid antigen positive. A caveat of this principle is that in actual clinical situations, live and dying cysticerci often coexist at any given time. Nevertheless, antigen studies may be useful in follow-up and monitoring disease progression and response to anticysticercal treatment33.

347

Antigen Detection Assays: Community-based Epidemiological Applications The application of antigen detection assays in community based serosurveys has been limited on account of their poor yield in the serum in comparison to CSF. A survey of an endemic community in Mexico indicated an antigen positivity rate of 1%20. In this study, 16% of individuals with late-onset epilepsy presented antigens in their sera. In a similar study in another endemic region of Mexico, 19% of individuals with late-onset epilepsy were positive by antigen-based assays in their sera21. However, no association between the antigen positivity and lateonset epilepsy was found in a survey in Burundi30. Further studies are needed to establish the utility of antigen-detection assays for epidemiological studies and control programme surveillance.

Conclusions Antigen-detection assays have been used infrequently in comparison to antibody based serodiagnosis in clinical and epidemiological studies of T. solium cysticercosis. There are several potential advantages of systems that employ antigens for serodiagnosis. The detection of antigens correlates with the presence of live cysticerci. Studies of antigens thereof may be useful in monitoring disease progression and response to anticysticercal therapy. Preliminary evidence suggests that it might be possible to differentiate between T. solium infection due to adult and metacestode forms and also between live and dying-degenerating stages of cysticercosis. A major limitation of antigen-detection systems however, is the lack of sensitive assays that would be able to pick up oligolesional disease. The challenge is to improve their diagnostic yield by the use of standardized, low-background specific monoclonal antibody cocktails and of amplifying systems such as the polymerase chain reaction.

348

D. Correa et al.

References 1. García, H.H., Del Bruto, O.H. (2000) Taenia solium cysticercosis. Infectious Disease Clinics of North America 14, 97–119. 2. Antoniuk, S. (1999) Epidemiology of neurocysticercosis. Revue Neurologique 29, 331–334. 3. Sarti, E., Schantz, P.M., Avila, G., et al. (2000) Mass treatment against human taeniasis for the control of cysticercosis: a population-based intervention study. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 85–89. 4. Tsang, V.C.W., Brand, J.A., Boyer, A.E. (1989) An enzyme linked immunoelectrotransfer blot assay and glycoprotein antigens for diagnosis of human cysticercosis (Taenia solium). Journal of Infectious Diseases 59, 50–59. 5. Schantz, P.M., Sarti, E., Plancarte, A., et al. (1994) Community-based epidemiological investigations of cysticercosis due to Taenia solium: comparison of serological screening tests and clinical findings in two populations in Mexico. Clinical Infectious Diseases 18, 879–885. 6. Correa, D. (1998) Los Antígenos del Cisticerco de Taenia solium: Aspectos Básicos y Aplicación en el Diagnóstico Clínico y en Estudios Epidemiológicos. PhD thesis, Instituto de Investigaciones Biomédicas, UNAM, México. 7. Velasco, O.C., Guzmán, B.C., Gutiérrez, Q.M., et al. (1983) Comparación de una técnica de detección de antígenos solubles de Cysticercus cellulosae. Salud Pública de México 25, 205–208. 8. Estrada, J.J., Kuhn, E.R. (1985) Immunochemical detection of antigens of larval Taenia solium and anti-larval antibodies in the cerebrospinal fluid of patients with neurocysticercosis. Journal of the Neurological Sciences 71, 39–42. 9. Tellez-Girón, E., Ramos, M., Dufour, L., et al. (1987) Detection of Cysticercus celullosae antigens in the cerebrospinal fluid by dot enzyme-linked immunosorbent assay (Dot-ELISA) and standard ELISA. American Journal of Tropical Medicine and Hygiene 37, 169–173. 10. Estrada, J.J., Estrada, A.J., Kuhn, E.R. (1989) Identification of Taenia solium antigens in cerebrospinal fluid and larval antigens from patients with neurocysticercosis. American Journal of Tropical Medicine and Hygiene 41, 50–55. 11. Harrison, L.J.S., Joshua, G.W.P., Wright, S.H., et al. (1989) Specific detection of circulating surface/secreted glycoproteins of viable cysticerci in Taenia saginata cysticercosis. Parasite Immunology 11, 351–370. 12. Correa, D., Sandoval, M.A., Harrison, L.J., et al. (1989) Human neurocysticercosis: comparison of enzyme immunoassay capture techniques based on monoclonal and polyclonal antibodies for the detection of parasite products in cerebrospinal fluid. Transactions of the Royal Society of Tropical Medicine and Hygiene 83, 814–816. 13. García, H.H., Harrison, L.J., Parkhouse, R.M., et al. (1998) A specific antigen-detection ELISA for the diagnosis of human neurocysticercosis. Transactions of the Royal Society of Tropical Medicine and Hygiene 92, 411–414. 14. Correa-Beltrán, M.D., Proaño-Narvaez, J., Allan, J.C., et al. (1997) Immunodiagnóstico de neurocisticercosis mediante la determinación de anticuerpos y antígenos en líquido cefalorraquídeo y suero. In: Arraigada, C., Nogales-Gaete, J., Apt, W. (eds) Neurocisticercosis. Aspectos Epidemiológicos, Patológicos, Immunológicos, Clínicos, Imagenológicos y Terapéuticos. Arrynog ediciones, Santiago de Chile, pp. 279–286. 15. Mata-Ruiz, O. (1996) Caracterización de los Antígenos de la Larva de Taenia solium Presentes en el Suero y el Liquido Cefalorraquídeo de Pacientes Cisticercosos. Thesis, Facultad de Estudios Superiores, Cuautitlán, UNAM, México. 16. Choromanski, L., Estrada, J.J., Kuhn, R.E. (1990) Detection of antigens of larval Taenia solium in the cerebrospinal fluid of patients with the use HPLC and ELISA. Journal of Parasitology 76, 69–73. 17. Cho, S.Y., Kong, Y., Kim, S.I., et al. (1992) Measurement of 150 kDa protein of Taenia solium metacestodes by antibody-sandwich ELISA in cerebrospinal fluid of neurocysticercosis patients. Kisaengchunghak Chapchi 30, 299–307. 18. Wang, C.Y., Zhang, H.H., Ge, L.Y. (1992) A MAb-based ELISA for detecting circulating antigen in CSF of patients with neurocysticercosis. Hybridoma 11, 825–827. 19. Wang, C.Y., Li, Q.S., Zhang, H.H., et al. (1993) Detection of cAg in CSF of 231 cerebral cysticercosis patients. Chung kuo Chi Sheng Chung Hsueh Yu Chi Shang Chaung Ping Tsa Chih 11, 276–278.

Antigen-based Immunoassays in Diagnosis

349

20. Aranda-Alvarez, J.G., Tapia-Romero, R., Alcántara-Anguiano, I., et al. (1995) Human cysticercosis: risk factors associated with circulating serum antigens in an open community of San Luis Potosí, México. Annals of Tropical Medicine and Parasitology 89, 689–692. 21. Correa, D., Sarti, E., Tapia-Romero, R., et al. (1999) Antigens and antibodies in sera from human cases of epilepsy or taeniosis from an area of Mexico where Taenia solium cysticercosis is endemic. Annals of Tropical Medicine and Parasitology 93, 69–74. 22. García-García, L., Torres, M., Correa, D., et al. (1999) Prevalence and risk factors for cysticercosis and taeniosis in an urban population represented by soldiers and their relatives. American Journal of Tropical Medicine and Hygiene 61, 386–389. 23. Flisser, A., Woodhouse, E., Larralde, C. (1980) Human cysticercosis: antigens, antibodies and nonresponders. Clinical and Experimental Immunology 39, 27–37. 24. Larralde, C., Montoya, R.M., Scuitto, E., et al. (1989) Deciphering Western blots of tapeworm in antigens of Taenia solium, Echinococcus granulosus and Taenia crassiceps resolving with sera from neurocysticercosis and hydatid disease patients. American Journal of Tropical Medicine and Hygiene 40, 282–290. 25. Laclette, J.P., Merchant, M.T., Willms, K. (1987) Histological and ultrastructural localization of antigen B in the metacestode of Taenia solium. Journal of Parasitology 73, 121–125. 26. Laclette, J.P., Rodríguez, A., Landa, A., et al. (1989) The coexistence of Taenia solium cysticerci and the pig: role of antigen B. Acta Leidensia 57, 115–122. 27. Espinoza, B., Ruiz-Palavios, G., Tovar, A., et al. (1986) Characterization by enzyme linked immunosorbent assay of the humoral immune response in patients of neurocysticercosis and its application in immunodiagnosis. Journal of Clinical Microbiology 24, 536–541. 28. Plancarte, A., Flisser, A., Larralde, C. (1983) Fibronectin-like properties in antigen B from the cysticercus of Taenia solium. Cytobios 36, 83–93. 29. Laclette, J.P., Shoemaker, C., Richter, D., et al. (1992) Paramyosin inhibits complement C1. Journal of Immunology 148, 124–128. 30. Newell, E., Vyungimana, F., Geerts, S., et al. (1997) Prevalence of cysticercosis in epileptics and members of their families in Burundi. Transactions of the Royal Society of Tropical Medicine and Hygiene 91, 389–391. 31. Rabenantoandro, R., Rasoloarijaona, L., Raharivelina, C., et al. (1996) Extramembranous glomerulonephritis and cysticercosis. Santé (Montrouge, France) 6, 254–257. 32. Rodriguez-del-Rosal, E., Correa, D., Flisser, A. (1989) Swine cysticercosis: detection of parasite products in serum. Veterinary Record 124, 488. 33. Yonghao, Z., Junping, L., Minru, Z., et al. (1995) Observations on circulating antigen from patients with cysticercosis before and after treatment. Chung kuo Chi Sheng Chung Hsueh Yu Chi Shang Chaung Ping Tsa Chih 13, 224–227.

35

Polymerase Chain Reaction in the Diagnosis of Taenia solium Cysticercosis Taru Meri and Seppo Meri

Introduction In general, molecular methods offer faster, more sensitive and/or more specific diagnosis of microbial infections than traditional methods (e.g. cultivation, serology or microscopic analysis). Detection of microbes from their virulence factors, for example from the production of toxins or from the presence of antimicrobial resistance genes, is possible with molecular methods. This allows rapid identification decreasing overall patient care costs, avoiding unnecessary treatments and guiding more accurate medical care. Techniques in molecular diagnostics usually incorporate nucleic-acid-based assays to detect pathogens or products of pathogens, like toxins. A reporter DNA or RNA molecule called a probe or a primer, is used to either amplify (in polymerase chain reaction or PCR) or detect (by hybridization) DNA or RNA sequences of pathogens. In the hybridization assay, target nucleic acids are immobilized on a solid phase and detected using labelled nucleic acid probes. When a target DNA is digested, electrophoretically separated and detected with a probe, the procedure is called Southern blotting. When the target molecule is RNA, the procedure is called Northern blotting. Nucleic acid amplification using the PCR, nowadays a rapid and automated procedure, will be discussed in detail in the next section of this chapter. In addition to providing an accurate and

specific diagnosis, sequencing can give information on virulence factors and mutations and help in the identification of ‘new’ pathogens1. With specific reference to parasitology, molecular methods can be used for distinguishing between morphologically or antigenically similar parasites and their variants. More importantly, they allow detection of an organism from a very small parasitic load, which could sometimes be difficult with traditional methods. The results of PCR assays are independent of the patient’s immunocompetence and previous clinical history. Also, PCR results are positive regardless of the state of infection, for example whether it is acute or latent. The organisms detected need not be alive or viable. There are only a few nucleicacid-based radioisotopic assays described for the diagnosis of flukes (Trematoda), which are traditionally diagnosed by the presence of worm eggs in patients’ samples2. Nematodes, on the other hand, are usually smaller in size, and the number of species infecting humans is larger. A PCR-based analysis of trichinellosis was able to differentiate domestic isolates from the sylvatic ones3. In particular, since the infective microfilariae of most nematodes are small in size and the number can vary considerably during infection, species identification with traditional methods is laborious and difficult. Also, in some species the presence of microfilariae in the peripheral blood varies periodically and in a species-

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

351

352

T. Meri and S. Meri

specific manner. PCR-based amplification assays specific for e.g., Wuchereria bancrofti, Loa loa, Onchocerca volvulus, Setaria digitata and Dirofilaria sp., have been developed for use in research and diagnostics4–8. New PCR-based methods for the diagnoses of multicellular parasites are now being developed.

Overview of PCR Technique Polymerase chain reaction is based on amplification of a known sequence from the target DNA with two oligonucleotide primers. The sequence to be amplified

5

should be specific for the target organism. The process consists of three steps. The first involves heating of the double-stranded sample DNA to denature it into two singlestranded DNA templates. In the second step, the sample is cooled down for primers to anneal to the single-stranded DNA targets. The annealing temperature is important for the specificity and function of the PCR. The final step entails amplification, during which a thermostable DNA-polymerase synthesizes new DNA strands to the unfinished single strands from the nucleotides provided in the mixture so that both strands are fully built (Fig. 35.1). These amplification

3 Target double-stranded DNA

3

5

Heating of the reaction mixture → Double strand is denatured, Primers anneal to target binding sites 5

3 Primer A

Cycle 1 Primer B 3 5 Elongation of target DNA leading to formation of two double-stranded DNA with strands of variable lengths

Annealing, binding of primers and elongation Cycle 2

Annealing, binding of primers and elongation

Cycle 3

Fig. 35.1. Polymerase chain reaction. The template DNA, primers, nucleotides and DNA polymerase are mixed in the presence of a suitable salt concentration. One reaction cycle consists of three steps: denaturation, annealing and elongation. During each cycle, the amount of DNA is duplicated.

PCR in the Diagnosis of Cysticercosis

cycles are usually repeated 25–35 times to produce a detectable amount of the amplified target DNA. In each cycle the amount of DNA is duplicated. PCR is a very effective and sensitive method; under optimized circumstances as little as 1 pg of a template is enough to produce 1 g of the target DNA after 30–35 cycles.

Template The total genomic DNA from the target organism can be used as a starting material for a diagnostic PCR. Steps involved in the extraction of DNA from cyst, biopsy or tissue samples are explained in the Appendix. In normal laboratory experiments, less than 1 g of total genomic DNA is sufficient for PCR analysis. The amount of template is important in the reaction. If the DNA sample is too dilute, for instance, if it is taken from individual cell or paraffin-embedded tissues, the probability of collision between the template and the primers is reduced in the reaction leading to formation of primer–dimers and other artefacts9. The amount of sample DNA can be determined either by agarose gel electrophoresis or more accurately by measuring the absorbance of the sample (at 260 nm) before performing the PCR analysis.

Primer design Primers are usually 15–30 bases long and their concentrations in the reaction mixture vary from 0.05 mol to 0.5 mol. Primers should be exact matches to the desired target sequence and should not have homology to any other sequence in the template mixture. When selecting a primer for PCR, its CGcontent, which also determines the annealing temperature, should be similar to that of the fragment being amplified. Primers should not contain major secondary structures or be complementary to each other to avoid selfannealing. Computer programs can be used to design primers. The use of previously published and established primers is recommended for routine diagnostic work.

353

DNA polymerases The discovery of a thermostable DNA polymerase, which is able to catalyse polymerization at high temperatures, has allowed the automation of the PCR and improved the method in more specific and sensitive direction. The most widely used thermostable DNA polymerase (Taq polymerase) comes from the bacterium, Thermus aquaticus. It is used by most of the PCR protocols for diagnostic work. Nowadays, a number of themostable DNA polymerases are commercially available. Their enzymatic properties have been reviewed elsewhere10. Taq polymerase is suitable, for example, in the Taenia PCR. The amount of Taq polymerase used is usually 2–2.5 units per 100 l reaction.

Polymerase Chain Reaction in T. solium Cysticercosis In cysticercosis, the number, location and morphology of the cysts is not always optimal for diagnosis with traditional methods. Computed tomography (CT) and magnetic resonance imaging (MRI) are very useful in establishing a diagnosis of NC in routine clinical practice. Indirect evidence for cysticercosis may be provided by demonstration of intestinal taeniasis by microscopic detection of eggs in faecal specimens or by a somewhat more sensitive analysis of coproantigens11. However, at times the results of imaging, serology and faecal examination are ambiguous and inadequate for firm diagnosis. Thus, additional tools, e.g. histology and/or PCR of a removed cyst-like structure, are needed. DNA probes specific for various Taenia sp. have been used to detect eggs, and proglottides from human faecal samples as well as adult worms or cysts12–16. They have also been used in the diagnosis of cysticercosis with atypical presentations17. The sample for PCR analysis of cysticercosis can be an entire or part of a suspicious cyst. A simultaneous histopathological examination of the sample is advisable to corroborate PCR results.

354

T. Meri and S. Meri

DNA extraction Extraction of DNA should be performed from the sample before using it in the PCR and the amount of DNA extracted should be checked. The sample should not be fixed with formalin, because this might affect the composition and behaviour of the DNA. If the sample has to be stored, for example, during transport, either 70% ethanol or freezing are preferred options. Different modifications of DNA isolation methods have been published, but these are mostly based on extraction of the DNA with phenol-chloroform. The tissue samples are first homogenized, and subsequently, cells are lysed in the presence of proteinase K, sodium dodecyl sulphate (SDS) and ethylenediamine tetra-acetic acid (EDTA). The nucleic acids are extracted with phenol–chloroform–isoamyl alcohol, precipitated with ethanol in the presence of high salt concentration and harvested by centrifugation. The basic protocol has been reviewed in Sambrook et al.18.

Selection of DNA probes for the detection of Taenia sp. Flisser and colleagues used a DNA hybridization assay involving total genomic radioactive-labelled/biotinylated DNA for detecting T. saginata eggs12. In similar experiments, two DNA probes, HDP1 and HDP2 were hybridized to genomic DNA from T. solium, T. saginata as well as other Taenia sp.14. The first probe hybridized with both T. solium and T. saginata, while the other identified T. saginata genomic DNA. Gottstein and Mowatt reported that primers for the PCR diagnosis of Echinococcus multilocularis, BG1 (5–TCAGTCTATTCTCCTCTCAATGCC–3 ) and BG2 (5-GCAGTCTATTCTCCTCTCAACTGCC-3), were able to detect T. saginata and T. taeniaeformis producing 0.55-kb and 0.6-bp fragments, respectively19. However, with E. multilocularis, the same primers produced a 2.6-kb fragment from the genomic DNA that was used as a sample19. Chapman et al. developed Taenia sp.

specific probes from the genomic DNA libraries of T. solium and T. saginata and used them in hybridization assays for Taenia eggs with high sensitivity and specificity13. A 158-bp DNA sequence constituted the T. solium specific DNA probe while another DNA segment encoding cytochrome c oxidase 1 gene was recognized by the T. saginata specific probe. The probes reliably differentiated between T. saginata and T. solium eggs. In addition the probes did not significantly hybridize to genomic DNA of E. granulosus and other Taenia sp. We used primers designed to amplify the 18S ribosomal RNA gene of T. solium (forward primer: 5–GGTGGCGGTGAGGATGATGGTG–3; reverse primer: 5–TGCTCTATTTCGTGCGCGGCTTCTCC –3) in a PCR assay for neurocysticercosis17. Oligonucleotides for the diagnosis of both T. solium and T. saginata in a multiplex PCR were designed from the sequence of 3954 bp (HDP2). Three oligonucleotides, (PTs7S35F1 5–CAGTGGCATAGCAGAGGAGGAA–3, PTs7S35F2 5–CTTCTCAATTCTAGTCGCTGTGGT–3 and PTS7s35r1 5– GGACGAAGAATGGAGTTGAAGGT–3) used in the assay produced two bands sized 600 bp and 170 bp for T. saginata and one band of 170 bp for T. solium from 1 ng of genomic DNA. When the same primers were used for amplification of an E. granulosus sample, two bands of 900 bp and 550 bp were seen16.

Controls and contamination risks Quality controls are extremely important when performing a diagnostic PCR. First, the amplification cycle itself should always have a positive (T. solium DNA) and a negative control (the sample volume of distilled water added to the reaction mixture) to ensure that the DNA polymerase and other reagents in the mixture are functioning. When tissue sample is used for diagnosis, the PCR may be negative. To check that the extraction of the DNA from the sample has succeeded, primers amplifying a human gene (e.g. human actin gene) should be used as a control. If the sample

PCR in the Diagnosis of Cysticercosis

cyst is from pig tissue, primers amplifying a pig gene are needed as control. Contamination of the reaction mixtures with parasite DNA from positive controls or from previous amplifications gives false-positive results. The working areas should be arranged so that the samples are not in contact with other reagents. More information about preventing laboratory contamination and quality control of PCR is available20. Details of the arrangements of a PCR working laboratory have also been reviewed elsewhere21.

355

Conclusions Several PCR based assays for the detection of T. solium eggs, proglottides and larval material from human and porcine tissues have been described. Preliminary evaluation has shown these assays to be reliable, sensitive and specific. A major limitation of this exciting technology is the lack of its widespread availability. These methods still need to be evaluated in comparison with conventional parasitological methods in both clinical and epidemiological settings.

References 1. Dumler, J.S., Valsamakis, A. (1999) Molecular diagnostics for existing and emerging infections. Complementary tools for a new era of clinical microbiology. American Journal of Clinical Pathology 112 (Suppl), 33–39. 2. Weiss, J. (1995) DNA probes and PCR for diagnosis of parasite infections. Clinical Microbiology Reviews 8, 113–130. 3. Dick, T.A., Lu, M.C., deVos, T., et al. (1992) The use of the polymerase chain reaction to identify porcine isolates of Trichinella. Journal of Parasitology 78, 145–148. 4. Dissanayak, S., Min, X., Piessens, W.F. (1991) Detection of amplified Wuchereria bancrofti DNA in mosquitoes with a non-radioactive probe. Molecular Biochemistry and Parasitology 45, 49–56. 5. Klion, A.D., Raghavan, N., Brindley, P.J., et al. (1991) Cloning and characterization of a species-specific repetitive DNA sequence from Loa loa. Molecular Biochemistry and Parasitology 45, 297–305. (Published erratum appears in Molecular Biochemistry and Parasitology 47, 265) 6. Meredith, S.E., Lando, G., Gbakima, A.A., et al. (1991) Onchocerca volvulus: application of the poymerase chain reaction to identification and strain differentiation of the parasite. Experimental Parasitology 73, 335–344. 7. Wijesundera, W.S., Chandrasekharan, N.V., Karunanayake, E.H. (1999) A sensitive polymerase chain reaction based assay for the detection of Setaria digitata: the causative organism of cerebrospinal nematodiasis in goats, sheep and horses. Veterinary Parasitology 91, 225–233. 8. Favia, G., Lanfraqncotti, A., della Torre, A., et al. (1997) Advances in the identification of Dirofilaria repens and Dirofilaria immitis by a PCR- based approach. Parasitology 39, 401–402. 9. Kidd, K.K., Ruano, G. (1994) Optimizing PCR. In: McPherson, M., Hames, B., Taylor, R. (eds) PCR 2: a Practical Approach. Oxford University Press, Oxford, UK, pp. 1–21. 10. Abramson, R. (1995) Thermostable DNA polymerases. In: Innis, M., Gelfand, D., Sninsky, J. (eds). PCR Applications. Academic Press, San Diego, pp. 33–47. 11. Allan, J.C., Velasquez-Tohom, M., Torres-Alvarez, R., et al. (1996) Field trial of the coproantigenbased diagnosis of Taenia solium taeniasis by enzyme-linked immunosorbent assay. American Journal of Tropical Medicine and Hygiene 54, 352–356. 12. Flisser, A., Reid, A., Gracia-Zepeda, E., et al. (1988) Specific detection of Taenia saginata eggs by DNA hybridisation. Lancet ii, 1429–1430 (Letter). 13. Chapman, A., Vallejo, V., Mossie, K., et al. (1995) Isolation and characterization of species-specific DNA probes from Taenia solium and Taenia saginata and their use in an egg detection assay. Journal of Clinical Microbiology 33, 1283–1288. 14. Harrison, L.J., Delgado, J., Parkhouse, R.M. (1990) Differential diagnosis of Taenia saginata and Taenia solium with DNA probes. Parasitology 100, 459–461. 15. Rishi, A.K., McManus, D.P. (1988) Molecular cloning of Taenia solium genomic DNA and characterization of taeniid cestodes by DNA analysis. Parasitology 97, 161–176. 16. Gonzalez, L.M., Montero, E., Harrison, L.J., et al. (2000) Differential diagnosis of Taenia saginata and Taenia solium infection by PCR. Journal of Clinical Microbiology 38, 737–744.

356

T. Meri and S. Meri

17. Meri, T., Jokiranta, T.S., Granat, S., et al. (1999) Diagnosis of atypical neurocysticercosis by polymerase chain reaction analysis: a case report. Clinical Infectious Diseases 28, 1331–1332. 18. Sambrook, J., Fritsch, E.F., Maniatis, T. (2000) Molecular Cloning: a Laboratory Manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 19. Gottstein, B., Mowatt, M.R. (1991) Sequencing and characterization of an Echinococcus multilocularis DNA probe and its use in the polymerase chain reaction. Molecular Biochemistry and Parasitology 44, 183–193. 20. Dragon, E.A., Spadoro, J.P., Madej, R. (1993) Quality control of polymerase chain reaction. In: Persing, D., Smith, T., Tenover, F., et al. (eds) Diagnostic Molecular Microbiology: Principles and Applications. American Society for Microbiology, Washington, DC, pp. 160–168. 21. McCreedy, B.J., Callaway, T.H. (1993) Laboratory design and work flow. In: Persing, D., Smith, T., Tenover, F., et al. (eds) Diagnostic Molecular Microbiology: Principles and Applications. American Society for Microbiology, Washington, DC, pp. 149–159.

PCR in the Diagnosis of Cysticercosis

Appendix This is a general overview of the methods needed for PCR analysis of T. solium cysticercosis. The selection of primers for the sample and for the controls is different for different laboratories, but we recommend the selection of primers from among those published for T. solium PCR diagnosis. Annealing temperature of the PCR cycle is dependent on the primer selected. A positive (T. solium DNA) and negative control are mandatory. If eggs, proglottides or worms are used as a sample, primers for both T. solium and T. saginata are needed. To control DNA extraction from human samples, primers amplifying human DNA need to be used, for example, primers for the human actin gene. It is recommended that the products of the PCR analyses be purified and sequenced, particularly when the method is being introduced to a new laboratory. A positive PCR assay should be corroborated by other means of diagnosis.

Buffers and other reagents • DNA extraction buffer: 50 mM Trishydrochloric acid (Tris-HCl), pH 7.5, 50 mM EDTA, pH 8.0, 0.5% sodium dodecyl sulphate (SDS), proteinase K 200 g ml1; • Proteinase K; • Tris/EDTA-buffer: 10 mM Tris-HCl, 0.1 mM EDTA (pH 8.0); • Phenol (must be equilibrated to a pH >7.8); • Chloroform; • Isoamyl alcohol; • Ethanol; • 3 M sodium acetate (pH: 6.0); • For PCR: deoxynucleotide triphosphates (dATP, dGTP, dCTP, dTTP), reaction buffer (500 mM potassium chloride (KCl), 15 mM magnesium chloride (MgCl2) 100 mM Tris-HCl (pH: 9.0 at room temperature)), Taq DNA-polymerase (Perkin Elmer, Foster, CA, USA); • 5 Tris/borate buffer: 450 mM Tris base, 450 mM boric acid, 10 mM EDTA (pH 8.0); • Ethidium bromide (stock solution 10 mg ml1);

357

• SeaKem agarose (Sigma Chemical, St Louis, MO, USA); • PCR marker (e.g. Promega, Madison, WI, USA); • Gel-loading buffer (10  buffer): 5 mg ml1 bromophenol blue, 5 mg ml1 cylene cyanol.

Sample preparation from cysts Samples of cysts are placed in 0.9% sodium chloride (NaCl) immediately after removal and frozen as soon as possible (preferably to 70°C) before PCR analysis.

DNA extraction 1. Grind the frozen sample to a fine powder; suspend it in DNA extraction buffer and heat at 55°C for 1 h. 2. The sample is extracted twice (or until no protein is visible at the interface) with phenol :chloroform :isoamyl alcohol (25 : 24 :1). 3. DNA is harvested with ice-cold 100% ethanol and one-tenth of the sample volume, 3 M sodium acetate (pH 6.) is added. Keep the tube at 20°C for 1 h and centrifuge for 30 min (full speed) in a microcentrifuge. The pellet is washed with 70% ethanol and recovered by centrifugation (12,000 g for 10 min at 4°C). The nucleic acids are then resuspended in the TE-buffer. 4. The amount of DNA in the sample is measured, e.g. with a spectrophotometer. DNA is diluted with distilled water (dH2O) and absorbance in the wavelength of 260 nm is measured. In double-stranded DNA the OD260 of 1.0 equals 50 g DNA ml1.

PCR amplification PCR reactions are performed in a volume of 100 l. 1. The PCR master mix/reaction contains: (i) 10 pmol of each primer; (ii) 12.5 mM of each nucleotide (dATP, dGTP, dCTP, dTTP); (iii) one vol. reaction buffer containing 50 mM potassium chloride, 1.5 mM

358

T. Meri and S. Meri

MgCl2, and 10 mM Tris-HCl. Make up the volume with dH2O. 2. The PCR master mix is prepared for all samples and controls. Add the sample DNA (approximately 500 ng per reaction), taking care to prevent contamination. Subsequently, prepare the Taq polymerase (2 U per reaction). 3. The amplification is performed in a programmable thermal cycler. This is a suggested protocol if primers from reference 17 are used, otherwise the amplification protocol is chosen according to the primers selected; 94°C, 10 min (initial denaturation) followed by 35 cycles of 94°C for 1 min (denaturation), 58oC for 1 min (annealing),

72°C for 1 min (extension) and 72°C for 10 min (final extension). 4. Electrophoretic analysis of reaction products: (i) Prepare an agarose gel into 1 TBE buffer (the percentage of the gel depends on the size of the target product; 3% for the target DNA  500 bp, 2% for the target DNA sized 500–1000 bp and 1.5% for 1000–2000 bp). Add ethidium bromide stock solution to the gel (3 l per 100 ml); (ii) Add 3 l of 10 loading dye to each sample, remember to have the PCR marker in one lane; (iii) Electrophorese the gels; (iv) Analyse the results of PCR under ultraviolet light.

36

Immunodiagnosis in Solitary Cysticercus Granulomas Anna Oommen

Introduction Hospital-based studies indicate that over 60% cases of neurocysticerosis (NC) in India are solitary granulomas1. This is based on evidence from imaging studies that show that solitary cysts can be viable, dying or calcified and varied in their location. Solitary cysticercal granulomas (SCG) are also reported from other parts of the world – the disease not being peculiar to the Indian sub-continent2,3. A serodiagnostic test for the disease should therefore be capable of detecting a low antigenic stimulus from a spectrum of the disease. It is pertinent to pathophysiology to delineate events that limit Taenia solium egg ingestion to a solitary cyst in the brain or to multiple cysts. Is SCG accompanied by taeniasis and/or subcutaneous cysticercus infestation? What cellular interactions and immune responses are elicited in the infection of the central nervous system (CNS) by a solitary cysticercus? How early in the disease is the immune response manifested and for how long does it persist? Which T. solium metacestode antigens are immunodominant and what is their molecular composition? Are excretory–secretory proteins of the larva more antigenic? Answers to these questions may be helpful in the rational design of immunodiagnostic tests for SCG. The number of solitary to multiple cysticercus granulomas cited in hospital-based

studies is not a true reflection of the disease status in the community. Indeed the incidence and prevalence of NC in India are not known and there is need to determine and understand the burden of the disease in the population. It is therefore evident that although imaging is an excellent investigation for NC, diagnostics for the disease must incorporate tests that are inexpensive and which can be carried out in laboratories with minimal infrastructure. This is true for most countries where NC is prevalent. This needs focused work on the serodiagnosis of NC. Although several serodiagnostic approaches have been tried, including passive haemagglutination4 and complement fixation5,6, enzyme linked immunoelectrotransfer blot (EITB) and ELISA have proved to be the most useful in both diagnosis and epidemiological studies7–9.

Overview of Serodiagnosis In Neurocysticercosis The EITB using lentil lectin-specific cyst glycoproteins is 100% specific and up to 98% sensitive in detecting anticysticercus antibodies in serum of NC patients with two or more cysts7. ELISA estimating serum IgG antibodies against cyst fluid proteins or antigens extracted from whole cysts report sensitivity and specificity of

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

359

360

A. Oommen

60–90% for multiple NC10. Cerebrospinal fluid (CSF) IgM is more sensitive and specific for NC (90% in ELISA)11 but as most patients with NC do not require a lumbar puncture for other investigations, serum is the preferred fluid for testing. IgG antibodies have been detected in all phases of the disease in CSF, serum and saliva while IgA and IgE are more frequently seen in the inactive form of NC12. Taenia solium cyst glycoprotein purification by Tsang et al.7 for the EITB is laborious and cyst antigens requiring simpler methods of purification have been investigated. Recent work by Ito et al.13 to purify cyst glycoprotein antigens of 10–26 kDa by isoelectric focusing, is highly specific and sensitive for NC in ELISA and immunoblots. These antigens, obtained in the range of pH 9.2–9.6, perform well in ELISA and do not exhibit the usual cross-reactivity of anticysticercus antibodies with Echinococcus. In contrast to the seven cyst glycoproteins purified over lentil lectin, which give rise to a high background in ELISA, hence restricting their use to immunoblots, the use of these antigens is comparatively simple13. Recombinant 10 kDa protein prepared and purified by Chung et al.14,15 and used in immunoblots is claimed to distinguish active NC from the inactive disease. Patients with chronic calcified cysts exhibit weak reactivity against the 10-kDa protein while a strong reaction is seen in patients with active NC. Serodiagnostic tests for NC should benefit from ongoing studies elucidating carbohydrate structures of antigenic glycoproteins of T. solium metacestodes as well as from the use of synthetic immunodominant peptides16,17(reviewed in Chapter 33).

Serodiagnostic Studies in Solitary Cysticercus Granulomas All serodiagnostic tests for NC established to date are with reference to multiple cyst conditions. In studies where cases of SCG have been included, the tests are invariably

disappointing. A low antibody response arising from an antigen challenge of only a single (few) cyst(s) in these patients may explain poor serodiagnostic performance18. The poor serodiagnostic yield is also observed in larger series of SCG. Singh et al. demonstrated a sensitivity of 57% for ELISA in 37 patients with single, small enhancing computed tomography lesions19. In 205 patients with radiologically diagnosed SCG that were both viable and calcified, we found that an ELISA to detect serum IgG antibodies using cyst fluid antigens from locally acquired cysts was 46% and 54% sensitive and specific. The patients were from different regions of India. Using a commercial ELISA (not made in India) the test was 31% and 50% sensitive and specific for SCG. This demonstrates the advantage of using antigens from the local parasite in immunodiagnosis, for their enhanced performance in detecting diseases of the region. The common cross-reactivity of tuberculomas reported with T. solium antigens in commercial kits was not observed in the in-house ELISA. The largest source of cross-reactivity in this study was seen in patients with astrocytomas. The EITB for SCG retains high specificity but sensitivity falls to 50% among hospital patients. This is seen in studies from different centres and indicates that as for ELISA, the test underestimates the prevalence of disease19,20. However Singh et al.21 have also shown the EITB to be 85% sensitive in children with a recent history of seizures and radiologically detected to have SCG. The test was 80% sensitive in family contacts of SCG patients who had a history of seizures. Healthy controls with no seizures and radiologically clear but EITB-positive were considered to be infected with T. solium extraneurally. Their study validates EITB as a specific and sensitive test for SCG in persons with seizures in India. Although it is not clear why these results are so different from others on SCG in India or from most reports of EITB and SCG in literature, they offer promise in using the test for SCG.

Immunodiagnosis in Solitary Cysticercus Granulomas

Conclusions Currently, there are no serodiagnostic tests that can unequivocally be recommended for routine diagnosis for SCG. However, our increased understanding of the

361

immune response to T. solium in different populations and of antigen characterization, as well as high amplification detection systems for immunological reactions now available, argue that reliable serodiagnosis of SCG is possible.

REFERENCES 1. Rajshekhar, V., Chandy, M.J. (2000) Incidence of solitary cysticercus granulomas. In: Rajshekhar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma. The Disappearing Lesion. Orient Longman, Chennai, India, pp. 12–28. 2. Wadley, J.P., Shakir, R.A., Rice, E.J.M. (2000) Experience with neurocysticercosis in the UK: correct diagnosis and neurosurgical management of small enhancing brain lesion. British Journal of Neurosurgery 14, 211–218. 3. Mitchell, W.G., Crawford, T.O. (1988) Intraparenchymal cerebral cysticercosis in children: diagnosis and treatment. Pediatrics 82, 76–88. 4. Ferreira, A.P., Vaz, A.J., Nakamura, P.M., et al. (1997) Hemagglutination test for the diagnosis of human neurocysticercosis: development of a stable reagent using homologous and heterologous antigens. Revista do Instituto de Medicina Tropical de São Paulo 39, 29–30. 5. Mahajan, R.C., Chopra, J.S., Chitkara, N.L. (1975) Comparative evaluation of indirect hemagglutination and complement fixation tests in serodiagnosis of cysticercosis. Indian Journal of Medical Research 62, 1310–1313. 6. Garcia, E., Ordonez, G., Sotelo, J. (1995) Antigens from Taenia crassiceps cysticerci used in complement fixation, enzyme-linked immunosorbent assay, and Western blot (immunoblot) for diagnosis of neurocysticercosis. Journal of Clinical Microbiology 33, 3324–3325. 7. Tsang, V.C.W., Brand, J.A., Boyen, A.E. (1989) An enzyme-linked immunoelectrotransfer blot assay and glycoprotein antigens for diagnosing human cysticercosis (Taenia solium). Journal of Infectious Diseases 159, 50–59. 8. Da Silva, A.D., Quagliato, E.M., Rossi, C.L. (2000) A quantitative enzyme-linked immunosorbent assay (ELISA) for the immunodiagnosis of neurocysticercosis using a purified from Taenia solium cysticerci. Diagnostic Microbiology and Infectious Disease 37, 87–92. 9. García, H.H., Harrison, L.J.S., Parkhouse, R.M.E., et al. (1988) A specific antigen detection ELISA for the diagnosis of human neurocysticercosis. Transactions of the Royal Society of Tropical Medicine and Hygiene 92, 411–414. 10. Shinguekawa, K.Y.M., Mineo, J.K., Pajuaba de Moura, L., et al. (2000) ELISA and Western blotting tests in the detection of IgG antibodies to Taenia solium metacestodes in serum samples in human neurocysticercosis. Tropical Medicine and International Health 5, 443–449. 11. Rosas, N., Sotelo, J., Nieto, D. (1986) ELISA in the diagnosis of neurocysticercosis. Archives of Neurology 43, 353–356. 12. Bueno, E.C., Vaz, A.J., Machado, L.D., et al. (2000) Neurocysticercosis: detection of IgG, IgA and IgE antibodies in cerebrospinal fluid, serum and saliva samples by ELISA with Taenia solium and Taenia crassiceps antigens. Arquivos de Neuropsiquiatria 58, 18–24. 13. Ito, A., Plancarte, A., Ma, L., et al. (1998) Novel antigens for neurocysticercosis: simple method for preparation and evaluation for serodiagnosis. American Journal of Tropical Medicine and Hygiene 59, 291–294. 14. Chung, J.Y., Bahk, Y.Y., Huh, S., et al. (1999) A recombinant 10 kDa protein of Taenia solium metacestodes specific to active neurocysticercosis. Journal of Infectious Diseases 180, 1307–1315.

362

A. Oommen

15. Plancarte, A., Hirota, C., Martinez-Ocana, J., et al. (1999) Characterization of GP 39–42 and GP 24 antigens from Taenia solium cysticerci and of their antigenic GP10 subunit. Parasitology Research 85, 680–684. 16. Restrepo, B.I., Obregon-Henao, A., Mesa, M., et al. (2000) Characterization of carbohydrate components of Taenia solium metacestode glycoprotein antigens. International Journal of Parasitology 30, 689–696. 17. Hernandez, M., Beltran, C., Garcia, E., et al. (2000) Cysticercosis: towards the design of a diagnostic kit based on synthetic peptides. Immunology Letters 71, 13–17. 18. Ohsaki, Y., Matsumoto, A., Miyamoto, K., et al. (1999) Neurocysticercosis without detectable specific antibody. Internal Medicine 38, 67–70. 19. Singh, G., Kaushal, V., Ram, S., et al. (1999) Cysticercus immunoblot assay in patients with single small enhancing lesions and multilesional cysticercosis. Journal of the Association of Physicians of India 47, 476–479. 20. Rajshekhar, V., Oommen, A. (1997) Serological studies using ELISA and EITB in patients with solitary cysticercus granulomas and seizures. Neurological Infections and Epidemiology 2, 177–180. 21. Singh, G., Ram, S., Kaushal, V., et al. (2000) Risk of seizures and neurocysticercosis in household family contacts of children with single enhancing lesions. Journal of the Neurological Sciences 176, 131–135.

37

Pharmacology of Anticysticercal Therapy Helgi Jung and Dinora F. González-Esquivel

Introduction Until recent years ago, there was no specific pharmacological treatment for neurocysticercosis (NC) and surgery and steroids were the only available options. The era of specific anticysticercal therapy began in 1979 when Robles and Chavarría described a patient with parenchymal NC who was successfully treated with praziquantel1. Uncontrolled studies, isolated case reports, and medical letters stressing the utility of praziquantel in NC followed2–4. However, most of these initial studies were uncontrolled and included a variety of forms of NC; therefore precise evaluation of the effectiveness of praziquantel was difficult. In 1984, a controlled study examined the effects of praziquantel (25 mg kg1 day for 2 weeks) in 26 patients with active parenchymal NC; more than 90% of the patients improved5. One year later, the same authors confirmed the efficacy of praziquantel in a long-term follow-up of 35 patients with parenchymal NC6. Albendazole was first tested for human NC in 1987, when Escobedo and co-workers demonstrated its efficacy in patients with parenchymal brain cysts in whom an 86% reduction in the number of lesions was documented7. The initial regimen for albendazole was 15 mg kg1 for 30 days; nevertheless additional studies showed that the duration

of therapy could be shortened to one week without compromising the efficacy of the drug. Other reports have confirmed the efficacy of albendazole for the treatment of parenchymal NC8,9. Albendazole also destroys subarachnoid and ventricular cysts, because of its better penetration of cerebrospinal fluid (CSF), as also giant cysts and large clumps of cysts10. This chapter covers the pharmacokinetic and pharmacodynamic aspects of the two drugs that are currently used for the treatment of NC.

Praziquantel Clinical chemistry Praziquantel (2 cyclohexylcarboyl -(1,2,3,6,7 11b)-hexahydro 4,11 pyrazino (2,1 a) isoquinoline) (Fig. 37.1) was identified in 1972, from a group of heterocyclic pyrazinoisoquinoline derivatives and found to have unusually broad anthelmintic activity. It was later jointly developed by E. Merck and Bayer. With its broad spectrum of activity and excellent tolerance, it became the drug of choice for the treatment of a range of human and animal helminths including trematodes (Schistosoma japonicum and Clonorchis sinensis) and adult and larval cestodes (Echinococcus granulosus and Taenia solium)11.

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

363

364

H. Jung and D.F. González-Esquivel

Therefore, drug concentrations in the CSF and brain tissue should be much higher than minimal effective concentration14.

Pharmacokinetics: absorption, distribution, metabolism, elimination and bioavailability

Fig. 37.1. Chemical structure of praziquantel.

The chemical is crystalline, almost colourless with a distinctly bitter taste; it is practically insoluble in water and freely soluble in organic solvents.

Mechanism of action In vitro studies have revealed that praziquantel penetrates the tegument and rapidly moves through helminthic tissues. A diverse range of actions has been described. Primary effects include muscle contraction or paralysis and tegumental damage. Other (secondary) effects include changes in carbohydrate metabolism, decrease in enzymatic activities and changes in the properties of surface membranes. Molecular mechanisms underlying the effect of praziquantel on parasite tegument are not fully understood. At concentrations of 3.2  107 M to 3.2  104 M, the drug produced vacuolization at the base of the syncytial layer of the tegument of susceptible trematodes and cestodes12. These vacuoles then increase in size forming blebs on the surface that finally burst. It is believed that the vacuolization is triggered by changes in the flux of divalent cations, particularly calcium, which follow drug-induced increase in membrane permeability13. The minimal effective concentration of praziquantel that inflicts severe damage to the strobilocerci in vitro is 0.03 M l1. In human nervous tissue, the surrounding granulomatous infiltrate and cyst wall pose barriers to penetration of drug in to the larval tissue.

After oral administration, praziquantel is rapidly absorbed from gastrointestinal tract. Peak plasma concentrations are attained 1.5–2 h after administration of doses of 6.25–50 mg kg1. Serum concentrations show considerable inter-individual variability, probably due to differences in metabolism. Praziquantel undergoes extensive first pass biotransformation to a series of metabolites that lack anthelminthic activity in humans15. The predominant metabolite is 4-hydroxycyclohexylcarbonyl analogue of praziquantel16. Most of this metabolic conversion occurs in cytochromes P450 2B1 and 3A17. Praziquantel is rapidly distributed to body tissues. Approximately 80% of the drug is bound to plasma proteins18. Drug concentration in breast milk is about 25% of plasma concentration19. The elimination half-life of praziquantel is 1.7–2.7 h and for its metabolite is 4–5 h20. Cumulative renal excretion of praziquantel and its metabolites is 80%. Pharmacokinetics of praziquantel are dosedependent. Leopold et al. observed that at doses of 5, 10, 20 and 50 mg kg1, serum concentrations were 0.15, 0.25, 0.8 and 4.22 mol l1 respectively and that the areas under the curve (AUC) increased 20-fold with a tenfold increase in dose, indicating saturation of the metabolic capacity of liver21. Praziquantel permeates the blood–brain barrier, thus explaining its effectiveness in parenchymal NC. It enters CSF more readily than subcutaneous cysts22. High concentrations can be expected in brain parenchyma on account of the high lipid solubility and pH of the drug. In 11 patients with parenchymal NC, who received praziquantel (50 mg kg1 day1 in three separate doses), mean drug concentration in CSF was 24% of the plasma concentration at steady state23. Effective anticysticercal action was observed at the given CSF concentration.

Pharmacology of Anticysticercal Therapy

365

with moderate liver disease and four times higher in patients with severe liver disease when compared with either normal volunteers or patients with schistosomiasis who had no detectable liver involvement. An increased likelihood of side effects in individuals with liver disease has been suggested; whether the dose in such patients should be reduced is not clear.

Bioavailability Given the lack of parenteral formulation, the absolute bioavailability of praziquantel can not be determined in humans. Animal studies indicate an extensive first-pass metabolism so that only a small proportion of the active drug reaches the systemic circulation19. Mandour et al. investigated the pharmacokinetics of a new formulation of praziquantel (Distocide) in comparison to the reference product (Biltricide) in a crossover study24. Healthy volunteers received single oral doses of 40 mg kg1 of both preparations. Significant differences were found in the maximal concentration (Cmax) of the two products. However, the AUCs of the two formulations were not significantly different.

Food and drug interactions Co-administration with food enhances bioavailability of praziquantel in comparison to the fasting state24,26. Castro et al. demonstrated significantly higher Cmax level, mean plasma concentration and AUC upon concurrent administration with diet with high lipid as well as high carbohydrate content (Fig. 37.2)26. Cmax and AUC were higher and larger respectively with the carbohydrate diet in comparison with the lipid diet. Considering this, it was proposed that carbohydrates were responsible for the increased bioavailability of praziquantel26.

Pharmacokinetics in hepatic disease A study evaluated pharmacokinetics of praziquantel in 30 patients with S. japonicum infection, in whom liver disease was carefully assessed25. The Cmax and bioavailability were more than twice as high in patients

Plasma concentration (ng ml–1)

1500 Fasting Lipid diet Carbohydrate diet 1000

500

0

2

4

6

8

Time (h) Fig. 37.2. Mean plasma concentration (± SEM) of praziquantel in healthy volunteers administered a single oral dose of 1800 mg (three tablets of 600 mg) during fasting () or immediately after high fat () or high-carbohydrate () meal. (Reproduced with permission from reference 26.)

366

H. Jung and D.F. González-Esquivel

It is often necessary to co-administer dexamethasone along with praziquantel in order to manage immunological reactions associated with praziquantel mediated parasite destruction. A cross-over study in eight patients who received praziquantel alone or with dexamethasone showed that plasma levels of praziquantel were lowered by 50% with concurrent administration of dexamethasone (Fig. 37.3)27. Therefore, the routine administration of corticosteroids, particularly dexamethasone, throughout a course of treatment with praziquantel is discouraged; rather tailored intermittent treatment only to manage inflammatory adverse reactions that may develop, is recommended. Bittencourt et al. studied the influence of antiepileptic drug (carbamazapine and phenytoin, both potent hepatic enzyme inducers) administration on praziquantel metabolism28. Both were found to reduce the oral bioavailability of praziquantel, although the mechanism of this effect was not clear. The magnitude of drug interaction was found to be significant enough to account for failure of therapeutic response to praziquantel. The authors recommended a minimum dose of praziquantel of 50 mg kg1 in those individuals receiving con-

comitant treatment with enzyme-inducing antiepileptic drugs in contrast to a lower dose of 25 mg kg1 in those not on antiepileptic drugs. Co-administration of cimetidine increases plasma level, the AUC and half-life of praziquantel in healthy volunteers (Fig. 37.4)29. This suggests that addition of cimetidine to a single day regimen of praziquantel increases plasma level of the latter with a possibility of improved efficacy in the treatment of NC.

Adverse reactions Praziquantel is well tolerated by patients with a wide variety of parasitic disorders. Most adverse events are manifestations of inflammatory exacerbations resulting from drug-induced parasite destruction in the central nervous system30. Frequent but minor side effects include drowsiness, headache, mild abdominal pain, dizziness, nausea and skin rash22. No hepatotoxicity, nephrotoxicity and bone marrow toxicity has been reported31. Furthermore, praziquantel is not genotoxic, mutagenic or teratogenic at usual therapeutic doses32,33.

Plasma concentration (g ml–1)

6 5

PZQ PZQ + Dexamethasor

4 3 2 1 0 0

2

4 Time (h)

6

8

Fig. 37.3. Plasma levels of praziquantel when administered alone () and during dexamethasone therapy () (n = 8). (Reproduced with permission from reference 27.)

Pharmacology of Anticysticercal Therapy

367

5 PZQ + Cimetidine PZQ Plasma concentration (g ml–1)

4

3

2

1

0 0

2

4

6

8

10

12

Time (h) Fig. 37.4. Mean plasma levels of praziquantel in eight healthy volunteers after three oral doses of 25 mg kg1 administered every 2 hours when given alone () and with cimetidine (). (Reproduced with permission from reference 29.)

Therapeutic regimens A single dose of praziquantel (10 mg kg1) eradicates intestinal taeniasis (see Chapter 41) and regimens of 3–6 days (25–50 mg kg1 day1) eradicate subcutaneous cysticerci34. The dosage regimen currently used for the treatment of NC is 50–100 mg kg1 day1 divided into three doses every 8 hours for 15 days. With this schedule, the percentage of disappearance of parenchymal brain cysticerci is 60–70%35. A novel regimen consisting of the administration of three doses of praziquantel (25 mg kg1, each), 2 hours apart on a single day has been evaluated. The rationale for this regimen is based on the pharmacokinetic principle that plasma concentration of the drug peaks 1–2 h after administration and declines rapidly thereafter29. With this regimen, it would be possible to maintain higher concentrations of the drug for a longer period. The schedule has been evaluated in a clinical trial, and

promises to be an adequate alternative to currently used protocols with the advantage of reducing time and cost of treatment36.

Dosage forms Praziquantel is available in tablets containing 150, 500 and 600 mg. Some commonly used brand names are: Cesol, Cisticid, Distocide and Biltricide.

Albendazole Clinical chemistry Albendazole (methyl (5-[propylthio]-1Hbenzimidazol-2-yl) carbamic acid methyl ester) (Fig. 37.5) is a broad-spectrum anthelminthic benzimidazole, active against liver flukes, tapeworms, lung and gastrointestinal round worms37. It is also very

368

H. Jung and D.F. González-Esquivel

S

N

CH3 — CH2 — CH2

NH — CO — OCH3 N H Albendazole

O S CH3 — CH2 — CH2

N NH — CO — OCH3 N H

Albendazole sulphoxide

O S CH3 — CH2 — CH2

N NH — CO — OCH3

O N H

Albendazole sulphone Fig. 37.5. Chemical structure of albendazole, albendazole sulphoxide, the main active metabolite, and of albendazole sulphone.

effective against the larval form of T. solium30,38,39. It is widely used in human and veterinary medicine. Albendazole is a colourless powder, insoluble in water, soluble in strongly acid solutions and slightly soluble in some organic solvents. The solubility of its metabolite, albendazole sulphoxide (ALBSO) is comparatively less40,41.

Mechanism of action All benzimidazoles are thought to have a similar mode of action, and differences in efficacy of the drugs against different parasites probably reflect variations in their

bioavailability. They cause selective degeneration of parasitic cytoplasmic microtubules. This eventually leads to a decrease in adenosine triphosphate levels and energy depletion. The antimitotic activity of albendazole is the result of binding to tubulin molecules, which causes inhibition of the formation of microtubules resulting in disruption of cell division37. In addition, there occurs loss of transport of secretory vesicles and failure of intestinal cells to take up glucose, leading to starvation of the parasite. Considering these mechanisms of action, the onset of anthelmintic action is slower than that of drugs that act directly on ion channels42,43.

Pharmacology of Anticysticercal Therapy

Pharmacokinetics: absorption, metabolism and elimination Albendazole is extensively metabolized in the liver to its active metabolite, ALBSO44,45. The latter is further sulphonated to albendazole sulphone, one among seven other inactive metabolites40,45. The parent compound is undetectable while the active metabolite, ALBSO, is readily recovered in the plasma of rat, cattle and sheep. In humans, the first-pass metabolism to ALBSO is rapid and apparently complete45. Two distinct microsomal enzymatic pathways are responsible for the sequential sulphoxidation of albendazole. The first, a flavin-containing mono-oxygenase system (FMO), is involved in the oxidation of albendazole to ALBSO through an NADPHdependent reaction (NADPH = nicotinamide-adenine dinucleotide phosphate (reduced form))46. The other, cytochrome P450 is involved in oxidation of ALBSO to albendazole sulphone. Involvement of both systems, FMO and cytochrome P-450, in albendazole metabolism have been demonstrated in rat, sheep, cattle and pig liver microsomes, as well as in a differentiated human hepatoma cell line47. The kinetic disposition of ALBSO in humans is characterized by marked intersubject variability45,48. This has been attributed to poor absorption of albendazole due to the low solubility of the drug. In different pharmacokinetic studies, the concentrations of ALBSO in plasma were found to be quite variable, however the clinical efficacy of the parent compound was consistently demonstrated40,45,48. The Cmax of ALBSO varied between 0.45 g ml1 and 2.96 g ml1 and elimination half-life was found to vary between 14 h and 20 h after an oral dose of the parent compound of 15 mg kg1 in cysticercotic individuals48. In healthy volunteers, mean Cmax of 0.24 g ml1 and mean half-life of 8 h was noted40. The chiral behaviour of ALBSO has been investigated in man as well as experimental animals49,50. In healthy volunteers, administered albendazole (10 mg kg1), the ratio of (+) ALBSO to () ALBSO was found to be 80(+) : 20() within the AUC of ALBSO49.

369

This enantioselective disposition of ALBSO has also been observed in individuals with NC. When a multiple dose regimen of albendazole (5 mg kg1 every 8 h for 8 days) was administered, differences in pharmacokinetics of (+) ALBSO and () ALBSO were found. For (+) ALBSO, the mean Cmax, AUC and apparent plasma clearance were 301.6 ng ml1, 1719.2 ng ml1 h1 and 5.8 l h1 kg1, respectively, while the corresponding values for () ALBSO were 54.9 ng ml1, 261.4 ng ml1 h1 and 54.0 l h1 kg1, respectively. The mean proportion of (+) ALBSO to () ALBSO with the AUC was 8.0, indicating plasma accumulation of (+) enantiomer51. In vitro studies indicate differences in protein binding by albendazole and ALBSO. While albendazole is 89–91% protein bound, ALBSO is 63–65% protein bound at a concentration range of 0.5–4.0 g ml1. The high protein binding of albendazole is of no clinical significance as it is rapidly and completely converted to ALBSO41. ALBSO has been demonstrated in CSF after oral administration of albendazole. The mean ALBSO concentration in CSF was found to be 43% of mean plasma level in one study23. Although drug concentrations in CSF were found to be variable, these were not related to age, sex or the presence of inflammation in the subarachnoid space. In addition, therapeutic effectiveness was confirmed for the wide range of observed concentrations. Peak plasma levels of ALBSO are lower in children in comparison to adults administered similar doses according to body weight52. In addition, elimination half-life is short (2.3–8.3 h) in children (Fig. 37.6). Available data, therefore, argue for thrice-daily dosages schedule and dose calculation based upon body surface area rather than body weight in children.

Food and drug interactions Considering that oral absorption of albendazole is relatively poor, the drug should be taken with meals. Marriner et al. observed a 3.5-fold increase in ALBSO availability, in

370

H. Jung and D.F. González-Esquivel

1.6 Age < 2 years

1.4

6 –15 years 1.2

33 – 68 years

Cp (g ml–1)

1.0 0.8 0.6 0.4 0.2 0 0 2 4 6 8

12

24

48

Time (h) Fig. 37.6. Comparison of mean plasma levels of albendazole sulphoxide in patients of different ages after single oral dose of 15 mg albendazole per kg body weight. (Reproduced with permission from reference 52.)

one subject when administered albendazole with olive oil in milk (20 ml per 100 ml); however, in three other subjects, there was little change in plasma levels45. In another study, co-administration with a fatty meal (fat content: 40 g) increased ALBSO concentrations fivefold; Cmax values increased from 0.45 mol l1 to 1.60 mol l1 during fasting state to 2.0–9.0 mol l1 after food, while AUC increased from 2.0–9.0 mol l1 h1 to 9.6–29.5 mol l1 h1, respectively53. The facilitation of albendazole absorption by fatty meal presumably results from an increased bile acid flow in response to neutral fat in the duodenum. Several drug interactions can be expected as albendazole and ALBSO share common hepatic metabolic pathways with several pharmacological agents. Their interaction with dexamethasone is of interest, primarily on account of the necessity of co-administering the two to forestall or manage inflammatory reactions to albendazole’s parasiticidal action. Jung et al. investigated the nature of this interaction in eight patients who were treated with albendazole (15 mg kg1 day1) and dexametha-

sone (8 mg day1) for 8 days54. The plasma levels of ALBSO increased by 50%, an effect that was attributed to impaired elimination. This finding has been exploited to the advantage of albendazole since simultaneous corticosteroid therapy is often required during anticysticercal treatment55. Homeida et al. evaluated pharmacokinetic interactions between praziquantel (40 mg kg1) and albendazole (400 mg) in healthy volunteers56. The authors found that the AUC of ALBSO increased 4.5-fold and Cmax values increased from 126 ±15 to 350 ±51 ng ml1. Despite high plasma concentration of ALBSO, no adverse systemic, haematological or hepatic effect was noted. Although the mechanism of this interaction is not clear, the finding is significant considering that trials of combination chemotherapy are in consideration in the future. In human cystic echinococcosis, cimetidine was found to increase mean ALBSO concentrations in samples of bile and hydatid cyst fluid by about twotimes57. Combined administration of the two drugs was recommended with a view to improve therapeutic efficacy of albendazole.

Pharmacology of Anticysticercal Therapy

Therapeutic dosage regimens Albendazole was initially administered at doses of 15 mg kg1 day1 for 1 month, based upon previous regimens used for treatment of human hydatidosis7, 58. Subsequent clinical experience showed that the length of therapy could be shortened from 30 to 8 days without compromising drug efficacy55,59–61. Dosage intervals for albendazole have been established on empirical grounds. Considering that the average half-life of ALBSO is 11 h in patients with NC, a twice-daily regimen is recommended59. In order to compare the regimen currently used for albendazole (5 mg kg1, three times a day) versus a regimen of 7.5 mg kg1 twice a day, a randomized crossover pharmacokinetic study was performed in ten patients with parenchymal NC. Results showed that in spite of an interindividual variability observed, no statistically significant differences were found in several pharmacokinetic parameters between both regimens59. This suggested that a dosage regimen of 7.5 mg kg1 every 12 h could favourably replace the regimen of 5 mg every 8 h. Albendazole appears to be as effective in paediatric and geriatric populations as in others and no drug-related problems have been observed in patients as young as 1 year or older than 65 years. However, there is no specific information comparing use of albendazole in the elderly with other age groups.

Adverse reactions Albendazole has a high therapeutic index. Its low solubility may prevent absorption of quantities necessary to produce toxicity and hence account for the low toxicity profile. Clinical experience indicates that albendazole is well tolerated. Headache, nausea and vomiting occur in 6–11% of patients and are the most common adverse effects. These are related to acute inflammation secondary to sudden destruction of cysticerci30,39. When administered in high doses (600–800 mg day1) over longer periods of time (1 month), elevated liver enzymes, headache, hair loss, neutropenia, fever, rash and acute renal failure have been reported62. In particu-

371

lar, hepatoxicity can occur at any time during the course of treatment and does not appear to be related to ALBSO levels47. Liver function tests and white blood cell counts should be performed at baseline and every 2 weeks during therapy. Albendazole has not been studied in pregnant women. However, studies in animals have shown that it is embryotoxic and teratogenic37,62.

Dosage forms Albendazole is approved in several European and most Third World countries. In 1996, albendazole received marketing approval from Food and Drug Administration, USA for use against parenchymal NC. The drug is available in oral suspension and in tablets containing 200 and 400 mg, each. Some commonly used brand names are Zentel, Eskazole and Albenza.

Conclusions Praziquantel is a heterocyclic pyrazino-isoquinoline derivative. It causes an influx of calcium ions leading to muscle contraction and paralysis. The drug is well absorbed after oral administration, has an extensive first-pass metabolism, is 80% protein bound and has an elimination half-life of 1.7–2.7 h. It crosses the blood–brain barrier. Food increases and antiepileptic drugs decrease its bioavailability. Plasma levels of praziquantel are reduced to one-half upon dexamethasone co-administration. The recommended dosage regimen is 50 mg kg1 day1 for 2 weeks. Albendazole, a benzimidazole compound, causes selective degeneration of parasitic microtubules. It is metabolized in the liver to an active compound, ALBSO. High levels of both albendazole and ALBSO have been demonstrated in the CSF. Of interest, is their interaction with dexamethasone; the latter increases ALBSO levels by 50%. Recommended dosage regimens of albendazole are 15 mg kg1 day1 for 8–15 weeks.

372

H. Jung and D.F. González-Esquivel

References 1. Robles, C., Chavarría, M. (1979) Presentación de un caso clínico de cisticercosis cerebral tratado médicamente con un nuevo fármaco: Praziquantel. Salud Pública de Mexico 21, 603–618. 2. Gómez, J.G., Peña, G., Patiño, R., et al. (1981) Neurocysticercosis treated with praziquantel. Neurología en Colombia 5, 665–670. 3. Spina Franca, A., Nobrega, J.P., Livramento, J.A. (1982) Administration of praziquantel in neurocysticercosis. Tropical Medicine and Parasitology 33, 1–4. 4. Markvalder, K., Hess, K., Valvanis, A. (1984) Cerebral cysticercosis: treatment with praziquantel: report of two cases. American Journal of Tropical Medicine and Hygiene 33, 273–280. 5. Sotelo, J., Escobedo, F., Rodriguez Carbajal, J., et al. (1984) Therapy of parenchymal brain cysticercosis with praziquantel. New England Journal of Medicine 310, 1001–1007. 6. Sotelo, J., Torres, B., Rubio-Donnadieu, F. (1985) Praziquantel in the treatment of neurocysticercosis: long term follow-up. Neurology 35, 752–755. 7. Escobedo, F., Penagos, P., Rodríguez, J., et al. (1987) Albendazole therapy for neurocysticercosis. Archives of Internal Medicine 147, 738–741. 8. Sotelo, J., Escobedo, F., Penagos, P. (1992) Albendazole vs. praziquantel for therapy of neurocysticercosis. A controlled trial. Archives of Neurology 49, 290–294. 9. Alarcón, F., Escalante, L., Dueñas, G., et al. (1989) Neurocysticercosis: short course of treatment with albendazole. Archives of Neurology 46, 1231–1236. 10. Sotelo, J. (1997) Treatment of brain cysticercosis. Surgical Neurology 48, 110–112. 11. Groll, E. (1984) Praziquantel. Advances in Pharmacology and Chemotherapy 20, 219–238. 12. Harnett, W. (1988) The anthelminthic action of praziquantel. Parasitology Today 4, 144–146. 13. Pearson, R., Guerrant, R. (1983) Praziquantel: a major advance in anthelminthic therapy. Annals of Internal Medicine 99, 195–198. 14. Overbosch, D., Van des Nes, J.C.M., Groll, E., et al. (1987) Penetration of praziquantel into cerebrospinal fluid and cysticerci in human cysticercosis. European Journal of Clinical Phamacology 33, 287–292. 15. Buhring, K., Diekman, H., Muller, H., et al. (1978) Metabolism of praziquantel in man. European Journal of Drug Metabolism and Pharmacokinetics 3, 179–190. 16. Andrews, P., Thomas, H., Pohlke, R., et al. (1983) Praziquantel. Medicinal Research Reviews 3, 147–200. 17. Masimerembwa, C., Hasler, J. (1994) Characterization of praziquantel metabolism in rat liver microsomes using cytochrome P450 inhibitors. Biochemical Pharmacology 48, 1779–1783. 18. Spina Franca, A., Machado, L.R., Nobrega, J.P.S., et al. (1985) Praziquantel in the cerebrospinal fluid in neurocysticercosis. Arquivos de Neuropsiquiatria 43, 244–259. 19. Steiner, K., Garbe, A., Diekman, H., et al. (1976) The fate of praziquantel in the organism. Pharmacokinetics in animals. European Journal of Drug Metabolism and Pharmacokinetics 1, 86–95. 20. Patzchke, K., Putter, J., Wegner, L.A., et al. (1979) Serum concentrations and renal excretion of praziquantel after oral administration in humans. Results of three determination methods. European Journal of Drug Metabolism and Pharmacokinetics 3, 149–156. 21. Leopold, G., Ungenthum, W., Groll, E., et al. (1978) Clinical pharmacology in normal volunteers of praziquantel, a new drug against schistosomes and cestodes. European Journal of Clinical Pharmacology 14, 281–291. 22. Bittencourt, P.R.M., Gracia, C.M., Gorz, A.M., et al. (1990) High-dose praziquantel for neurocysticercosis: serum and CSF concentrations. Acta Neurologica Scandinavica 82, 28–33. 23. Jung, H., Hurtado, M., Medina, M., et al. (1990) Plasma and CSF levels of albendazole and praziquantel in patients with neurocysticercosis. Clinical Neuropharmacology 13, 559–564. 24. Mandour, M., Turabit, E., Homeida, M., et al. (1990) Pharmacokinetics of praziquantel in healthy volunteers and patients with schistosomiasis. Transactions of Royal Society of Tropical Medicine and Hygiene 84, 389–393. 25. Watt, G., White, N., Padre, L., et al. (1987) Pharmacokinetics and side effects of praziquante in Schistosoma japonicum infected patients with liver disease. European Journal of Clinical Pharmacology 33, 287–292. 26. Castro, N., Medina, R., Sotelo, J., et al. (2000) Bioavailability of praziquantel increases with concomitant administration of food. Antimicrobial Agents and Chemotherapy 44, 2903–2904. 27. Vázquez, M.L., Jung, H., Sotelo, J. (1987) Plasma levels of praziquantel decrease when dexamethasone is given simultaneously. Neurology 37, 1561–1562. 28. Bittencourt, P.R.M., Gracia, C.M., Martins, R., et al. (1992) Phenytoin and carbamezapine decrease oral bioavailability of praziquantel. Neurology 42, 492– 496.

Pharmacology of Anticysticercal Therapy

373

29. Jung, H., Medina, R., Castro, N., et al. (1997) Pharmacokinetic study of praziquantel administered alone and in combination with cimetidine in a single day therapeutic regimen. Antimicrobial Agents and Chemotherapy 41, 1256–1259. 30. Sotelo, J. (1995) Neurocysticercosis. Clinical, prognostic and therapeutic aspects. In: Rose, C. (ed.) Recent Advances in Tropical Neurology. Elsevier Science, Oxford, UK, pp. 87–97. 31. Gracia, C.M., Gorz, A.M., et al. (1990) High dose praziquantel for neurocysticercosis: efficacy and tolerability. European Neurology 30, 229–234. 32. Herrera, L., Ramírez, T., Rodríguez, U., et al. (2000) Possible association between Taenia solium cysticercosis and cancer: increased frequency of DNA damage in peripheral lymphocytes from neurocysticercosis patients. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 66–70. 33. Bartsch, H., Kuroku, T., Malanett, T. (1978) Absence of mutagenicity of praziquantel, a new effective antischistosomal drug in bacteria, yeasts, insects and mamalian cells. Mutation Research 58, 229–234. 34. Groll, E.W. (1982) Chemotherapy of human cysticercosis with praziquantel. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 207–218. 35. Del Brutto, O.H., Sotelo, J., Roman, G. (1993) Therapy of neurocysticercosis: a reappraisal. Clinics in Infectious Diseases 17, 730–735. 36. Corona, T., Lugo, R., Medina, R., et al. (1996) Single day praziquantel therapy for neurocysticercosis. New England Journal of Medicine 334, 125. 37. McKellar, Q.A., Scott, E.W. (1990) Benzimidazole anthelminthic agents. Journal of Veterinary Pharmacology and Therapeutics 13, 223–247. 38. Del Brutto, O.H. (1995) Medical treatment of cysticercosis – effective. Archives of Neurology 52, 102–104. 39. Sotelo, J. (1997) Neurocysticercosis. In: Roos, K.L. (ed.) Central Nervous System Infectious Diseases and Therapy. Marcel Dekker, New York, pp. 545–572. 40. Penicaut, B., Maugein, P.H., Maisonneuve, H., et al. (1983) Pharmacocinétique et métabolisme urinaire de l’albendazole chez l’homme. Bulletin de la Societe de Pathologie Exotique (Paris) 76, 698–708. 41. Jung, H., Medina, L., García, L., et al. (1998) Absorption studies of albendazole and some physicochemical properties of the drug and its metabolite albendazole sulphoxide. Journal of Pharmacy and Pharmacology 50, 43–48. 42. Lacey, E. (1990) Mode of action of benzimidazoles. Parasitology Today 6, 112–115. 43. Martin, R.J., Robertson, A.P., Bjorn, H. (1997) Target site of anthelminthics. Parasitology 114, S111–124. 44. Gyurik, R.J., Chow, A.W., Zaber, B., et al. (1981) Metabolism of albendazole in cattle, sheep, rats and mice. Drug Metabolism and Disposition 19, 503–508. 45. Marriner, S.E., Morris, D.L., Dickson, B., et al. (1986) Pharmacokinethics of albendazole in man. European Journal of Clinical Pharmacology 30, 705–708. 46. Villaverde, C., Alvarez, A.I., Redondo, P., et al. (1995) Small intestinal sulphoxidation of albendazole. Xenobiotica 25, 433–441. 47. Steiger, U., Cotting, J., Reichen, J. (1990) Albendazole treatment of echinococcosis in humans: effects on microsomal metabolism and drug tolerance. Clinical Pharmacology and Therapeutics 47, 347–353. 48. Jung, H., Hurtado, M., Sanchez, M., et al. (1992) Clinical pharmacokinetics of albendazole in patients with brain cysticercosis. Journal of Clinical Pharmacology 32, 28–31. 49. Delatour, P., Benoit, E., Besse, S., et al. (1991) Comparative enantioselectivity in the sulphoxidation of albendazole in man, dogs and rats. Xenobiotica 21, 217–221. 50. Benoit, E., Besse, S., Delatour, P. (1992) Effect of repeated doses of albendazole on enantiomerism of its sulfoxide metabolite in goats. American Journal of Veterinary Research 53, 1663–1665. 51. Marques, M.P., Takayanagui, O.M., Bonato, P.S., et al. (1999) Enantioselective kinetic disposition of albendazole sulfoxide in patients with neurocysticercosis. Chirality 11, 218–223. 52. Jung, H., Sanchez, M., González-Astiazaran, A., et al. (1997) Clinical pharmacokinetics of albendazole in children with neurocysticercosis. American Journal of Therapeutics 4, 23–26. 53. Lange, H., Eggers, R., Bircher, J. (1988) Increased systemic availability of albendazole when taken with a fatty meal. European Journal of Clinical Pharmacology 34, 315–317. 54. Jung, H., Hurtado, M., Medina, M.T., et al. (1990) Dexamethasone increases plasma levels of albendazole. Journal of Neurology 237, 279–280. 55. Sotelo, J., Penagos, P., Escobedo, F., et al. (1988) Short course of albendazole therapy for neurocysticercosis. Archives of Neurology 45, 1130–1133.

374

H. Jung and D.F. González-Esquivel

56. Homeida, M., Copeland, W.L.S., Ali, M.M.M., et al. (1994) Pharmacokinetic interaction between praziquantel and albendazole in a Sudanese man. Annals of Tropical Medicine and Parasitology 88, 551–559. 57. Wen, H., Zhang, W., Muhmut, M., et al. (1994) Initial observations on albendazole in combination with cimetidine for the treatment of human cystic echinococcosis. Annals of Tropical Medicine and Parasitology 88, 49–52. 58. Saimot, A.G., Cremieux, A.C., Hay, J.M., et al. (1983) Albendazole as a potential treatment for human hydatidosis. Lancet ii, 652–656. 59. Sánchez, M., Suásteguí, R., González-Esquivel, D., et al. (1993) Pharmacokinetic comparison of two albendazole dosage regimens in patients with neurocysticercosis. Clinical Neuropharmacology 16, 77–82. 60. García, H.H., Gilman, R.H., Horton, J., et al. (1997) Albendazole therapy for neurocysticercosis: a prospective double-blind trial comparing 7 versus 14 days of treatment. Neurology 48, 1421–1427. 61. Botero, D., Uribe, C.S., Sanchez, J.L., et al. (1993) Short course of albendazole treatment for neurocysticercosis in Colombia. Transactions of the Royal Society of Tropical Medicine and Hygiene 87, 576–577. 62. Rossignol, J.F., Maisonneuve, H. (1984) Albendazole: a new concept in the control of intestinal helminthiasis. Gastroenterologique Clinique et Biologique (Paris) 8, 569–576.

38

Controversies in the Drug Treatment of Neurocysticercosis Bhim S. Singhal and Rodrigo A. Salinas

Introduction Therapy for Taenia solium cysticercosis aims at clearance of cysts in the brain and amelioration of immediate and delayed symptoms and signs. Despite the known anticysticercal effect of at least two pharmacological agents (praziquantel and albendazole), controversies persist regarding their usage for several reasons outlined below1–5. One is the spontaneous resolution of the cyst(s). In the landmark papers of cysticercosis occurring in British troops stationed in India, Dixon and Hargreaves6 and Dixon and Lipscomb7 observed that ‘many patients improved spontaneously and that the prognosis is much better than has hitherto been thought’. Another reason is the uncertainty of long-term benefits such as improved seizure control following the administration of anticysticercal drugs8,9. Finally, the need for anticysticercal drugs depends on the risk–benefit ratio. Viable living cysticerci (seen as non-enhancing cysts with a scolex on imaging studies) in the brain parenchyma are usually asymptomatic. Symptoms such as seizures, headache and focal neurological deficits are related to degeneration of cysticerci (transitional forms). Degeneration of cysticerci evokes inflammatory reaction in the surrounding host tissue such as brain

parenchyma, manifesting clinically with seizures, headaches and focal neurological deficits. Degeneration of cysts may occur spontaneously, or as a consequence of the administration of anticysticercal drugs. This propensity of these agents to produce inflammatory adverse events that may occasionally be serious and fatal has excited the viewpoint that anticysticercal drugs may be potentially harmful and should preferably be avoided10,11. Even today, there are several controversies with regard to the medical treatment of cysticercosis. Most importantly, debate continues over the usefulness of anticysticercal drugs. Other issues where opinion varies include the specific drug (praziquantel versus albendazole) to be used; the drug dosage and duration of treatment; the specific role, indications and duration of corticosteroid co-medication and antiepileptic drugs (AEDs).

Parenchymal Neurocysticercosis and Drug Therapy Parenchymal neurocysticercosis (NC) occurs as a single cyst, two or three cysts forming clumps (conglomerate lesions), multiple cysts (which can be counted) or disseminated (miliary) forms, where the brain is studded with innumerable cysts.

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

375

376

B.S. Singhal and R.A. Salinas

Multiple cysts of neurocysticercosis In this form of NC, imaging studies disclose scattered cysts, which can be counted. Cysts may be in the same or different stages of development (live cysts, dying cysts and calcified cysts). They may or may not be associated with subcutaneous or muscular cysticercosis. Some lesions, especially the degenerating ones, may resolve spontaneously. Ever since the seminal description of the use of praziquantel in parenchymal NC by Robles and Chavarría in 1979, several workers have recommended use of anticysticercal drugs1–3,12. Sotelo et al. demonstrated clinical improvement with reduction in the number of cysts in 26 patients treated with praziquantel for 15 days as opposed to no change or worsening in 17 untreated ‘historical’ controls followed over a period of 9 months2. Subsequently, Robles et al. reported on the beneficial results of a large but uncontrolled trial of praziquantel (50 mg kg1 day1 for 15 days with or without corticosteroids) in 141 patients with NC3. Perceived benefits included resolution of symptoms after 5 years of observation and of imaging abnormalities. Escobedo et al. used albendazole, the other available anticysticercal drug, in a dose of 15 mg kg1 day1 for 30 days in seven patients with parenchymal NC and reported an 86% reduction in the total number of cysts4. However, Padma et al. in the only randomized controlled trial (albendazole, 15 mg kg1 day1 for 7 days in 16 patients and placebo in 13 patients) conducted on this presentation of disease, found no statistically significant difference in the number of cysts that disappeared upon computed tomography (CT) at 1 week and 3 months after the beginning of treatment13.

NC14. All three patients reported by the authors died; two of them died soon after praziquantel was administered. This was possibly due to severe inflammatory reaction and oedema resulting from death of the cysts and release of antigens. The muscles also swelled up. The poor prognosis was recognized as early as in 1933 by MacArthur, who stated, ‘…the destruction of large numbers of these parasites at the same time – supposing that some chemical of lethal power were forthcoming – might only make matters worse for the sufferer…’15. Gupta et al. reported worsening or death in two such patients treated with albendazole whereas four such patients treated with corticosteroids alone improved16. It stands to reason that if anticysticercal drugs are to be given to such patients, they should be carefully monitored and preferably pre-administered corticosteroids and AEDs. Contrariwise, some Chinese authors have reported the successful use of praziquantel (Biltricide, 100 mg kg1 day1 for periods ranging from 1 week to 1 month) in patients with disseminated cysticercosis17,18. An improvement in both neurological and non-neurological symptoms, including resolution of pseudohypertrophy has been recorded in these Chinese reports. The reasons for the difference in outcome between the Indian and Chinese studies are not clear. García and Del Brutto described 11 LatinAmerican patients with massive brain infestation with viable cysticerci19. The number of cysts was in hundreds as opposed to much larger cyst loads in the disseminated variety. Their patients tolerated the anticysticercal treatment and showed considerable clinical and radiological improvement.

Disseminated neurocysticercosis

Cysticercotic encephalitis

In this variety the brain, subcutaneous tissue and muscles are riddled with innumerable cysticerci. Patients may present with seizures, features of raised intracranial pressure, focal deficits or dementia. Wadia et al. have cautioned against the use of anticysticercal drugs in this disseminated variety of

Patients with cysticercotic encephalitis (usually children and adolescents) will require high-dose corticosteroids with or without osmotic diuretics or rarely decompressive surgery, depending on their clinical status20,21. In the series of patients reported by Rangel et al. only one patient was adminis-

Controversies in Drug Treatment of Neurocysticercosis

tered praziquantel; others were treated only symptomatically for intracranial hypertension21. The prognosis in terms of outcome was uniformly dismal in this series. Some workers have treated severe forms of NC with albendazole and demonstrated favourable outcome in such patients22,23. Nevertheless, we recommend that the use of anticysticercal drugs is best avoided. If used, they should be given with caution and in conjunction with corticosteroids.

Solitary cysticercus granuloma Solitary cysticercus granuloma (SCG) is a common form of parenchymal NC24,25. Controversy regarding the use of anticysticercal drugs in this form of the disease stems from the fact that during the followup, many of these lesions resolve spontaneously (see Chapter 24). Padma et al. performed a double blind, randomized controlled trial of albendazole in 75 patients with seizures and SCG26. Albendazole (15 mg kg1 day1) or placebo was administered for 7 days and serial CT scans obtained at the end of 1 week, 1 month and 3 months after beginning of treatment. A group of 40 patients received albendazole and 35 patients received placebo. A total of 35 patients given albendazole and 33 patients given placebo demonstrated resolution of the CT abnormality at 3 months. The difference between the two groups was not statistically significant. In an open study reported by Singhal and Ladiwala, clinical and radiological follow-up of patients with SCG showed no significant difference in seizure control and resolution of the lesion in patients treated with AEDs alone and those treated with AEDs and anticysticercal drugs24. Chopra et al. reported that of the 78 patients with SCG (treated with AEDs alone), there was complete disappearance of CT lesions in 47 patients and significant reduction in the size of the lesion and surrounding oedema in another 24 patients upon follow-up CT in 6–12 weeks27. These and other workers found no advantage in giving anticysticercal drugs in patients with SCG.

377

There are however, other workers who advocate the use of anticysticercal agents. In a recent double blind, placebo-controlled study, Baranwal et al. observed significant benefit in terms of disappearance of lesions in children who received albendazole therapy9. In this study, 65 paediatric patients with SCG on CT scan were randomly assigned to receive either albendazole (15 mg kg1 day1) or placebo for 4 weeks. Follow-up CT scans were performed, 1 and 3 months after beginning of albendazole therapy. After 3 months, 23 of 31 patients who received albendazole and only 15 of 32 of placebo-treated patients showed complete resolution of CT lesions. We have to consider, however, that 12.5% of the patients were lost to follow-up in this trial, and that when the results of this study were pooled, in a meta-analysis, with those obtained by Padma et al.26 they are not statistically significant any more. It has been suggested that the empirical use of anticysticercal drugs facilitates the diagnosis of SCG in doubtful cases by hastening the resolution of these lesions28. Del Brutto administered albendazole (15 mg kg1 day1) for 8 days to 20 patients with SCG29. CT undertaken after 2 weeks showed disappearance of lesion in 11 patients, partial resolution in five and no change in four patients. The favourable response to albendazole in 16 of 20 patients was construed as supportive of a diagnosis of NC. In three out of the four who had not responded to albendazole, the diagnoses were ultimately revised upon follow-up; two were ultimately diagnosed to have gliomas and another one, tuberculoma. In a later study, albendazole was used in 39 patients with seizures and a single lesion upon CT30. Overall 32 (82%) patients responded to the drug and showed reduction in the size of the lesion after 2–4 weeks of therapy. Further investigations in the nonresponders revealed tuberculomas (two), astrocytoma (one), metastatic tumour (one), granulomatous lesion of unknown aetiology (one) and cysticercus (one). The author recommended the use of albendazole not only for clearance of cysts but also as a diagnostic tool to support the diagnosis of NC as the cause of the lesion. Rajshekar suggested that

378

B.S. Singhal and R.A. Salinas

patients with SCG may be treated with symptomatic therapy (AEDs) alone initially and neuroimaging studies repeated after 8–12 weeks31. In patients with persistent SCG after 12 weeks, anticysticercal drugs may be used to hasten the resolution. In an open trial of the use of albendazole (15 mg kg1 day1 for 14 days) in patients with persistent SCG (defined as persistence beyond 12 weeks of symptomatic therapy), repeat CT scan showed total resolution in two and more than 50% resolution in another two of a total of 11 patients. In the extension of this study in 43 patients, a favourable response to albendazole was demonstrated in 20 patients32. Murthy and Reddy suggested the use of albendazole therapy in patients whose SCG revealed a scolex on the CT scan (ring with dot pattern)33. They surmised that the presence of a scolex corresponded to a more active stage of the parasite as compared to SCG without a scolex and that patients with this imaging attribute might benefit from anticysticercal therapy.

Two or three cysts in clumps (conglomerate lesions) It is not uncommon to see two or three cysts clumped together upon brain imaging of individuals presenting with seizures. Possibly, two or three larvae have reached the same site in the brain at the same time. They can be seen as two or three ringenhancing or disc-enhancing lesions on CT and magnetic resonance imaging (MRI). The inflammatory reaction and oedema is more than that with a single cysticercus. Besides seizures, the patients may also experience headache. It is necessary to identify different types of parenchymal forms of NC and evaluate the results of therapy in these different subsets. The conglomerate form is more likely to take longer time to resolve and perhaps heal by leaving a bigger scar or gliotic area or heal by calcification (Bhim S. Singhal, Mumbai, India, unpublished observations). In such cases it might be preferable to use anticysticercal drugs with anti-inflammatory agents (like corticosteroids) at an early stage and continue AEDs for longer periods.

Occult neurocysticercosis In endemic regions, the administration of praziquantel or albendazole for treatment of intestinal taeniasis or other helminthiasis, in doses that are considerably small in comparison to doses used for anticysticercal effect in the brain, are also known to induce inflammatory reaction and trigger degeneration of asymptomatic cysticerci in brain. Flisser et al. recorded an unusually high frequency of headaches as an adverse event, when praziquantel was administered in doses of 5 mg kg1 for community treatment of intestinal taeniasis34. The authors conjectured that in some of the individuals, headaches might be linked to inflammatory degeneration of cysticerci in the brain. They were able to demonstrate this phenomenon in at least one individual. The possibility of unmasking of symptoms of NC as a result of the administration of anthelmintic drugs should be kept in mind in endemic areas.

Role of anticysticercal drugs in relation to stage of neurocysticercosis Some authors recommend an expectant policy with symptomatic therapy alone in those in whom imaging reveals a predominance of transitional cysticerci on the premise that the parasite in these lesions has probably died24,35. An Ecuadorian trial studied the effect of anticysticercal drugs (praziquantel, 50 mg kg1 day1 for 15 days and albendazole, 15 mg kg1 day1 for 8 days in addition to prednisolone) in comparison with no anticysticercal treatment in 175 patients with live active parenchymal NC8. There were no differences in the proportion of patients that were free of NC lesions at 6 and 12 months. Furthermore, there were no differences in the proportion of patients who were seizure-free at 24 months. In clinical practice, one often encounters an intermixture of live-active, transitional and inactive cysticerci upon brain imaging studies. Here, the clinician should exercise his judgement based upon the stage of most cysticerci, the number of lesions and the risk of inflammatory exacerbation. Finally, a patient presenting with

Controversies in Drug Treatment of Neurocysticercosis

seizure and healed calcified lesion(s) on CT (healed cysticercus cyst(s)) will require only symptomatic therapy (AEDs).

Does anticysticercal therapy improve seizure control? Besides the resolution of the lesion on CT scan, outcome measures should also relate to clinical benefit. In the case of SCG, it should relate to improved seizure control. Only two randomized, controlled trials have addressed the question of seizure relapse after anticysticercal therapy8,9. They found no statistically significant difference in seizure relapse rates between the groups treated or not treated with anticysticercal therapy. The pooled odds ratio for seizure relapse with anticysticercal treatment versus no anticysticercal treatment was 0.92 (CI95%: 0.47–1.81). Kramer wondered whether the good radiological outcome reported with anticysticercal drugs is also reflected upon seizure outcome10. He and others, have suggested that the enhanced inflammatory response following therapy may produce a more profound cerebral cicatrix, thereby adversely affecting seizure outcome11,36. This hypothesis, however, has never been tested. On the other hand, use of anticysticercal drugs in such patients was claimed to permit better control of seizures with AEDs29,37. Besides, the likelihood of remaining seizurefree after withdrawal of AEDs was reported to be greater in patients who were previously treated with albendazole38,39. In the study reported by Singhal and Ladiwala from Mumbai, India, seizures were equally well controlled in patients treated either with AEDs alone (92%) or with AED plus anticysticercal drugs (93%)24.

Extraparenchymal Neurocysticercosis While for parenchymal NC, the unresolved issue remains whether to administer anticysticercal treatment or not, in extraparenchymal NC, there is controversy on the role of medical therapy as against surgical treatment. A major apprehension regarding the use of

379

anticysticercal drugs is inflammatory exacerbations provoked by anticysticercal therapy leading to sequelae, which are more serious in the case of extraparenchymal NC in comparison to parenchymal NC. These sequelae are mainly in the form of meningitis, arachnoiditis, stroke and hydrocephalus. Recently, albendazole has been suggested to be effective for subarachnoid forms with resolution of even giant racemose subarachnoid cysts40,41. Martinez et al. reported total resolution of subarachnoid cysticercosis in three out of four patients treated with praziquantel and in all 41 patients treated with albendazole42. Del Brutto reported significant benefit with the use of albendazole in 17 patients with subarachnoid NC43. There was total resolution of cysts in 14 patients when CT scan was repeated after 3 months. Recently, Proano et al. described their experience with medical treatment of 33 patients with giant (5 cm) subarachnoid NC with intracranial hypertension44. Patients were administered multiple courses of albendazole (15 mg kg1 day1 for 4 weeks) and 10 of them were given an additional course of praziquantel (100 mg kg1 day1 for 4 weeks). After a median follow-up of 59 weeks, cysts had either disappeared or calcified in all patients. The study was however, uncontrolled; therefore the possibility of spontaneous resolution can not be excluded. Nevertheless, the report emphasized the safety of medical treatment as well as the need for longer duration and multiple courses of treatment in such situations. There are also isolated reports of the effectiveness of anticysticercal drugs in intraventricular NC40, 42, 45. Proano et al. used a 2-week course of albendazole in ten patients of fourth ventricular cysticercosis with an additional praziquantel course in two patients46. There was complete disappearance of the cyst in eight patients, decrease in size in one patient and failure of response in one patient. The authors recommended ventriculoperitoneal shunt before anticysticercal therapy. Such a decision however, should be taken on an individual basis. For detailed consideration of the specific role, merits and demerits of anticysticercal treatment in relation to other modalities of therapy, the reader is referred to Chapters 18, 20 and 22.

380

B.S. Singhal and R.A. Salinas

Esoteric Forms of Cysticercosis Although uncommon, an occasional patient may present with features of spinal cord compression. The cyst may be intramedullary or leptomeningeal in location. MRI helps to clarify such a lesion. One cannot always be certain about the nature of the lesion and it might be prudent to remove the lesion using microneurosurgical techniques47. However, there are isolated case reports of the benefit with anticysticercal agents, which should preferably be combined with steroids to reduce the inflammatory reaction48,49. The reader is referred to Chapters 23 and 28 for an overview of the management of spinal cysticercosis and ocular cysticercosis respectively.

Anticysticercal Treatment: Drug, Duration and Dosage Considerations Which drug should be preferred as an anticysticercal agent – albendazole or praziquantel? Praziquantel was the first drug used for NC and albendazole was introduced later. Both have been used extensively for the treatment of NC. Takayanagui and Jardim compared their efficacy in a non-randomized trial of 22 patients treated with praziquantel, 21 with albendazole and 16 given only symptomatic treatment50. Both, praziquantel and albendazole were found to be effective as compared to the control. Albendazole was found to be more effective in reducing the number of cysts as compared to praziquantel (80% versus 50%, respectively). Cruz et al. also reported similar benefits of albendazole over praziquantel51. Albendazole is generally preferred because it is cheaper and as effective, if not more so, than praziquantel. Besides, the coadministered drugs like dexamethasone reduce the plasma levels of praziquantel whereas dexamethasone increases the concentration of albendazole in the CSF (see Chapter 37). This may offer albendazole an advantage over praziquantel especially in the treatment of subarachnoid variety of

NC. Side effects such as headache, vomiting and seizures resulting from an increase in inflammation and oedema around dying cyst(s) can be seen with either of the drugs, even though they have different mechanisms of action.

What should be the duration of the therapy? The duration of therapy with praziquantel and albendazole remains a somewhat contentious issue. Earlier, praziquantel was recommended at a dose of 50 mg kg1 day1 for 15 days2,3. Corona et al. have reported beneficial effects with an ultra-short course of praziquantel52. Praziquantel was administered in a single day with a total dose of 75 mg kg1 divided into three 25 mg kg1 doses with each dose being given at 2hourly intervals. Four hours later, 10 mg of intramuscular dexamethasone or 80 mg of prednisolone (orally) was administered. The phamacokinetic principles behind and rationale for this approach have been described in Chapter 37. Recently, the single-day regimen was used in 26 patients with single enhancing brain lesions53. In 14 treated patients, the lesions resolved completely in 11 and partially in two while in the untreated group of 12 patients, the lesion persisted in six patients. Adverse events were noted in only one patient in the treated group. The authors recommended singleday praziquantel as the treatment of choice, in view of its demonstrated efficacy, and reduced duration and costs of treatment. In another study, however, the authors demonstrated resolution of imaging abnormalities in patients with single enhancing brain lesions but not in those with multiple NC, implying a poor efficacy of the single-day praziquantel regimen in multiple NC54. The duration and dosage schedule of albendazole was initially based upon extrapolation of regimens used for the treatment of hydatidosis. Escobedo et al. reported excellent results (reduction of cysts by 86%) with albendazole administered at the dosage of 15 mg kg1 day1 for 30 days in seven patients with parenchymal

Controversies in Drug Treatment of Neurocysticercosis

NC4. Cruz et al. noted similar effectiveness when 800 mg of albendazole was given to patients with parenchymal NC for a variable period (8 days for 19 patients, 15 days for 23 patients and 30 days for 11 patients)55. Garcia et al. compared the efficacy of 1 week versus 2 weeks of albendazole therapy and noted no significant difference56. Current opinion favours a 1week course of albendazole therapy57. Finally, Del Brutto et al. compared a singleday praziquantel therapy with 1 week of albendazole for NC and found similar favourable results58. Clearly, more double blind controlled studies are needed to assess the efficacy of praziquantel and albendazole using different dosage and duration schedules.

Should patients with non-responding or partially responding lesions receive a second course of anticysticercal agents? It is well known that not all patients will show complete resolution of cysts with anticysticercal drugs. Chong et al. reported a patient with multiple parenchymal NC, in whom cysts persisted even after repeated courses of albendazole and praziquantel59. In clinical experience, it is not uncommon to see patients with a partial response upon brain imaging in terms of the number and size of cysts that have resolved after anticysticercal treatment. It is not clear whether such individuals should be offered a second course of anticysticercal treatment. It is also not clear as to what would be the appropriate time to repeat the anticysticercal drug and if a different drug or the same drug should be used for the repeat course of anticysticercal therapy.

Symptomatic Therapy of Neurocysticercosis Corticosteroids Corticosteroids are often administered in NC on the premise that they reduce inflam-

381

mation and oedema (responsible for symptoms) around dying cyst(s)60. However, the dose, duration, form, mode and, most significantly, timing of administration of corticosteroids are not clear. In most cases the clinicians use their own judgement to decide whether or not to use corticosteroids. Corticosteroids are recommended as an important part of therapy for cysticercotic encephalitis in children and disseminated NC. They are also recommended for treatment of acute neurological deficit resulting from oedema, vasculitis and large subarachnoid cysts. The use of corticosteroids may modify the plasma levels of anticysticercal drugs and affect the efficacy of these drugs. Concomitant administration of corticosteroids reduces the plasma level of praziquantel (see Chapter 37). Shandera et al. observed that patients treated with praziquantel and corticosteroids were more likely to require a second course of praziquantel than those treated with praziquantel alone61. It has been suggested that as the half-life of praziquantel is 2–3 h, corticosteroids should be given 4 hours after the dose of praziquantel to have optimal anticysticercal and anti-inflammatory effects. Plasma levels of albendazole increase when given concurrently with dexamethasone and therefore many recommend the use of albendazole in preference to praziquantel as an anticysticercal agent. The administration of intermittent long-term treatment with corticosteroids has been demonstrated to improve chances of ventriculoperitoneal shunt patency in patients with hydrocephalus due to NC. An open controlled study evaluated clinical status, incidence of shunt malfunction and CSF abnormalities for up to 2 years in patients in whom a ventriculoperitoneal shunt had been inserted for cysticercotic hydrocephalus62. Two of the 13 patients given prednisolone (50 mg, three times a week) required shunt revision, while 18 of 30 patients in the control group required shunt revision when followed up for 2 years. The difference was statistically significant; better shunt function in the prednisolone-treated group was related to improvement in cerebrospinal fluid abnormalities.

382

B.S. Singhal and R.A. Salinas

Non-steroidal anti-inflammatory agents Some authors recommend the use of antihistamines, such as chlorpheniramine (chlorphenamine) or anti-inflammatory agents such as ketoprofen as an alternative to corticosteroids22,23. They recommend the routine pre-administration with anti-histaminic agents and for 4–6 months after a course of albendazole. We have no personal experience with these agents but believe that severe inflammatory exacerbations are often life-threatening and should be better managed with high potency corticosteroids.

Anti-cerebral oedema measures If raised intracranial pressure is a feature (seen mostly with multiple NC or disseminated NC), judicious use of intravenous mannitol, furosemide, oral glycerol along with intravenous dexamethesone is justified. Neurosurgical intervention should be sought for consideration of ventriculoperitoneal shunt if there is hydrocephalus, or decompression by craniotomy if there is risk of herniation. Suitable analgesics should be given for symptomatic relief of headache.

Antiepileptic drugs AEDs constitute standard therapy for parenchymal NC. A discussion on the controversies regarding the optimal duration of AEDs can be found in Chapter 21.

Conclusions Despite advances in the diagnosis (using imaging and immunological methods) and availability of anticysticercal drugs (praziquantel and albendazole) the treatment of NC still remains controversial. Outcome measures should include resolution of cysts on imaging studies and immediate and longterm relief from the symptoms. Salinas and Prasad reviewed the drug therapy for NC63. The objective was to assess the effect of drug treatment in human NC in relation to sur-

vival, cyst persistence (defined as incomplete resolution on radiographic studies), subsequent seizures and hydrocephalus. They included randomized or quasi-randomized trials comparing an anticysticercal drug with a placebo or a control group receiving symptomatic therapy in patients with NC. Only four studies involving 305 people met the inclusion criteria8,9,13,26. A difference just approaching significance was detected between anticysticercal therapy and placebo in relation to cyst persistence at 6 months (relative risk: 0.83; 95%CI: 0.70–0.99). Two trials reported on seizure rates after 1–2 years follow-up and found no difference (relative risk: 0.95; 95%CI: 0.59–1.51)8,9. In the study by Carpio et al., there was no difference detected in rates for development for hydrocephalus (relative risk: 2.19; 95%CI: 0.29–16.55)8. The authors concluded that there was insufficient evidence to determine whether anticysticercal therapy is associated with beneficial results in NC63. They emphasized that: the clinicians should be aware of the lack of evidence to either support or refute the use of anticysticercal therapy in NC. This lack of evidence, added to the potential harm recognized with treatment, means that the clinicians have to weigh the benefits and risks of anticysticercal therapy very carefully in each individual patient.

The Cysticercosis Working Group in Peru is conducting a randomized double blind, placebo-controlled trial of albendazole and dexamethasone in 120 patients with parenchymal NC (Hector H. García, Lima, Peru, personal communication). The number of seizures on follow-up, before and after withdrawal of AEDs and number of lesions upon MRI at 6 months and CT at 12 and 24 months will be evaluated. Results were expected after breaking the code in September 2002. Another multicentre, randomized, placebo-controlled double blind clinical trial is currently underway in Ecuador to determine whether anticysticercal therapy added to symptomatic treatment influences resolution of lesions and long-term outcome. Patients with active or transitional cysts will be randomized to symptomatic treatment alone (cortico-

Controversies in Drug Treatment of Neurocysticercosis

steroids and AEDs) or to symptomatic treatment with albendazole. Patients with both intraparenchymal and extraparenchymal cysts will be included but randomized independently. The primary outcome measure will be reduction of cysts at 1 year after treatment. Secondary outcome measures

383

will include the persistence of seizures and the late development of hydrocephalus (Arturo R. Carpio, Cuenca, Ecuador, personal communication). The results of these two randomized, double blind placebo-controlled trials of anticysticercal therapy in NC are keenly awaited.

References 1. Robles, C., Chavarría, M. (1979) Presentaction de un caso clinico de cisticercosis cerebral curado medicamente con un nuevo formaco: Praziquantel. Salud Publica de Mexico 21, 603–618. 2. Sotelo, J., Escobedo, F., Rodriguez-Carabajal, J., et al. (1984) Therapy of parenchymal brain cysticercosis with praziquantel. New England Journal of Medicine 310, 1001–1007. 3. Robles, C., Sedano, A.M., Vargas-Tentori, N., et al. (1987) Long-term results of praziquantel therapy in neurocysticercosis. Journal of Neurosurgery 66, 359–363. 4. Escobedo, F., Penagos, P., Rodriguez, J., et al. (1987) Albendazole therapy for neurocysticercosis. Archives of Internal Medicine 147, 738–741. 5. Sotelo, J., Escobedo, F., Penagos, P. (1988) Albendazole vs. praziquantel for therapy for neurocysticercosis. A controlled trial. Archives of Neurology 45, 532–534. 6. Dixon, H.B.F., Hargreaves, W.H. (1944) Cysticercosis (Taenia solium). A further 10 year study covering 284 cases. Quarterly Journal of Medicine 13, 107–121. 7. Dixon, H.B.F., Lipscomb, F.M. (1961) Cysticercosis: an analysis and follow-up of 450 cases. Medical Research Council Special Report Series No. 299. Her Majesty’s Stationery Office, London, pp. 1–58. 8. Carpio, A., Santillan, F., Leon, P., et al. (1995) Is the course of neurocysticercosis modified by treatment with anthelminthic agents? Archives of Internal Medicine 155, 1982–1988. 9. Baranwal, A.K., Singhi, P.D., Khandelwal, N., et al. (1998) Albendazole therapy in children with focal seizures and single small enhancing computerized tomographic lesions: a randomized, placebo-controlled, double-blind trial. Pediatric Infectious Diseases Journal 17, 696–700. 10. Kramer, L.D. (1990) Anthelminthic therapy for neurocysticercosis. Archives of Neurology 47, 1059. 11. Kramer, L.D. (1995) Medical treatment of cysticercosis – ineffective. Archives of Neurology 52, 101–102. 12. Vasconcelos, D., Cruz-Segura, H., Methos-Gomez, H., et al. (1987) Selective indications for the use of praziquantel in the treatment of brain cysticercosis. Journal of Neurology, Neurosurgery and Psychiatry 66, 383–388. 13. Padma, M.V., Behari, M., Misra, N.K., et al. (1995) Albendazole in neurocysticercosis. National Medical Journal of India 8, 255–258. 14. Wadia, N.H., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis: new observations including CT scan findings and experience with treatment by praziquantel. Brain 111, 597–614. 15. MacArthur, W.P. (1933) Cysticercosis as a cause of epilepsy in man. Transactions of the Royal Society of Medicine and Hygiene 26, 525–528. 16. Gupta, P.M., Kalita, J., Misra, U.K. (1998) Should patients with numerous cysticerci be treated with corticosteroids only? Annals of the Indian Academy of Neurology 1, 25–28. 17. Zhu, D., Xu, W. (1983) Effect of biltricide on cysticercosis cellulosae with muscular pseudohypertrophy: a report of three cases. Chi Sheng Chung Hsueh Chi Sheng Chung Ping Tsa Chi 1, 185–186. 18. Xu, Z., Chen, W., Zong, H., et al. (1985) Praziquantel in the treatment of cysticercosis cellulosae. Report of 200 cases. Chinese Medical Journal 98, 489–494. 19. García, H.H., Del Brutto, O.H. (1999) Heavy nonencephalitic cerebral cysticercosis in tapeworm carriers. Neurology 53, 1582–1584. 20. Del Brutto, O.H., Sotelo, J. (1988) Neurocysticercosis: an update. Review of Infectious Diseases 10, 1075–1087. 21. Rangel, R., Torres, B., Del Bruto, O., et al. (1987) Cysticercotic encephalitis: a severe form in young females. American Journal of Tropical Medicine and Hygiene 36, 387–392. 22. Agapejev, S., Meira, D.A., Barraviera, B., et al. (1989) Neurocysticercosis: treatment with albendazole and dextrochlorophenirimine. Transactions of the Royal Society of Tropical Medicine and Hygiene 83, 377–383.

384

B.S. Singhal and R.A. Salinas

23. Agapejev, S., Da Silva, M.D., Ueda, A.K. (1996) Severe forms of neurocysticercosis. Treatment with albendazole. Arquivos de Neuropsiquiatria 54, 82–93. 24. Singhal, B.S., Ladiwala, U. (1995) Neurocysticercosis in India. In: Rose, F.C. (ed.) Recent Advances in Tropical Neurology. Elsevier Amsterdam, Netherlands, pp. 99–109. 25. Del Brutto, O.H. (1995) Single parenchymal brain cysticercus in the acute encephalitic phase: definition of a distinct form of neurocysticercosis with a benign prognosis. Journal of Neurology, Neurosurgery and Psychiatry 58, 247–249. 26. Padma, M.V., Behari, M., Misra, N.K., et al. (1994) Albendazole in single CT lesions in epilepsy. Neurology 44, 1344–1346. 27. Chopra, J.S., Sawhney, I.M.S., Suresh, N., et al. (1992) Vanishing CT lesions in epilepsy. Journal of the Neurological Sciences 107, 40–49. 28. Rawlings, D., Ferriero, D.M., Messing, R.O. (1989) Early CT reevaluation after empiric praziquantel therapy in neurocysticercosis. Neurology 39, 739–741. 29. Del Brutto, O.H. (1993) The use of albendazole in patients with single lesions enhanced on contrast CT. New England Journal of Medicine 328, 356–357. 30. Del Brutto, O.H. (2000) Solitary cysticercus granuloma in Latin America. In: Rajshekhar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma – The Disappearing Lesion. Orient Longman, Hyderabad, India, pp. 153–166. 31. Rajshekhar, V., Chandy, M.J. (2000) Outcome in patients with solitary cysticercus granuloma. In: Rajshekhar, V., Chandy, M.J. (eds) Solitary Cysticercus Granuloma – The Disappearing Lesion. Orient Longman, Hyderabad, India, pp. 135–152. 32. Rajshekhar, V. (1991) Etiology and management of single small CT lesions in patients with seizures: understanding a controversy. Acta Neurologica Scandinavica 84, 465–470. 33. Murthy, J.M.K., Reddy, Y.V.S. (1998) Prognosis of epilepsy associated with single CT enhancing lesion: a long term follow up study. Journal of the Neurological Sciences 159, 151–155. 34. Flisser, A., Madrazo, I., Plancarte, A., et al. (1993) Neurological symptoms in occult neurocysticercosis after single taeniacidal dose of praziquantel. Lancet 342, 748 (Letter). 35. Mitchell, W.G., Crawford, T.O. (1988) Intraparenchymal cerebral cysticercosis in children: diagnosis and treatment. Pediatrics 82, 76–82. 36. Vazquez, V., Sotelo, J. (1992) The course of seizure after treatment of cerebral cysticercosis. New England Journal of Medicine 327, 696–701. 37. Del Brutto, O.H., Santibanez, R., Noboa, C.A., et al. (1992) Epilepsy due to neurocysticercosis: analysis of 203 patients. Neurology 42, 389–392. 38. Del Brutto, O.H. (1994) Prognostic factors for seizure recurrence after withdrawal of antiepileptic drugs in patients with neurocysticercosis. Neurology 44, 1706–1709. 39. Sotelo, J., Del Brutto, O.H., Roman, G.C. (1996) Cysticercosis. In: Remington, J.S., Schwartz, M.N. (eds) Current Clinical Topics in Infectious Diseases, Vol. 16. Blackwell Science, Cambridge, Massachusetts, pp. 240–259. 40. Del Brutto, O.H., Sotelo, J. (1990) Albendazole therapy for subarachnoid and ventricular cysticercosis: case report. Journal of Neurosurgery 72, 816–817. 41. Del Brutto, O.H., Sotelo, J., Aguirre, R., et al. (1992) Albendazole therapy for giant subarachnoid cysticerci. Archives of Neurology 49, 535–538. 42. Martinez, H.R., Rangel-Guerra, R., Arredondo-Estrado, J.H., et al. (1995) Medical and surgical treatment in neurocysticercosis: a magnetic resonance study of 161 cases. Journal of the Neurological Sciences 130, 25–34. 43. Del Brutto, O.H. (1997) Albendazole therapy for subarachnoid cysticercosis: clinical and neuroimaging analysis of 17 patients. Journal of Neurology, Neurosurgery and Psychiatry 62, 659–661. 44. Proano, J.V., Madazo, I., Avelar, F., et al. (2001) Medical treatment for neurocysticercosis characterized by giant subarachnoid cysts. New England Journal of Medicine 20, 879–885. 45. Allcut, D.A., Coulthard, A. (1991) Neurocysticercosis: regression of a fourth ventricular cyst with praziquantel. Journal of Neurology, Neurosurgery and Psychiatry 54, 461–462. 46. Proano, J.V., Madrazo, I., Garcia, L., et al. (1997) Albendazole and praziquantel treatment in neurocysticercosis of the fourth ventricle. Journal of Neurosurgery 87, 29–33. 47. Aghakhani, N., Comoy, J., Tadie, M., et al. (1998) Isolated intramedullary cysticercosis. Case report. Neurochirurgie 44, 127–131. 48. Corral, I., Quereda, C., Moreno, A., et al. (1996) Intramedullary cysticercosis cured with drug treatment: a case report. Spine 21, 2284–2287.

Controversies in Drug Treatment of Neurocysticercosis

385

49. Garg, R.K., Nag, D. (1998) Intramedullary spinal cysticercosis: response to albendazole: case reports and review of literature. Spinal Cord 36, 67–70. 50. Takayanagui, O.M., Jardim, E. (1992) Therapy for neurocysticercosis: comparison between albendazole and praziquantel. Archives of Neurology 49, 290–294. 51. Cruz, M., Cruz, I., Horton, J. (1991) Albendazole versus praziquantel in the treatment of cerebral cysticercosis: clinical evaluation. Transactions of the Royal Society of Tropical Medicine and Hygiene 85, 244–247. 52. Corona, T., Lugo, R., Medina, R., et al. (1996) Single-day praziquantel therapy for neurocysticercosis. New England Journal of Medicine 334, 125. 53. Pretell, E.J., García, H.H., Custodio, N., et al. (2000) Short regimen of praziquantel in the treatment of single enhancing brain lesions. Clinical Neurology and Neurosurgery 102, 215–218. 54. Pretell, E.J., García, H.H., Gilman, R.H., et al. (2001) Failure of one-day praziquantel treatment in patients with multiple neurocysticercosis lesions. Clinical Neurology and Neurosurgery 103, 175–177. 55. Cruz, I., Cruz, M.E., Carrasco, F., et al. (1995) Neurocysticercosis: optimal dose treatment with albendazole. Journal of the Neurological Sciences 133, 152–154. 56. García, H.H., Gilman, R.H., Horton, J., et al. (1997) Albendazole therapy for neurocysticercosis: a prospective double blind trial comparing 7 versus 14 days of treatment. Neurology 48, 1421–1427. 57. Sotelo, J., Penagos, P., Escobedo, F., et al. (1988) Short course of albendazole therapy for neurocysticercosis. Archives of Neurology 45, 1130–1133. 58. Del Brutto, O.H., Campos, X., Sanchez, J., et al. (1999) A single-day praziquantel versus 1-week albendazole for neurocysticercosis. Neurology 52, 79–81. 59. Chong, M.S., Howkins, C.P., Cook, C.G., et al. (1991) A resistant case of neurocysticercosis. Postgraduate Medical Journal 6, 577–578. 60. Minguetti, G., Ferreira, M.V. (1982) Effect of corticoids in the acute phase of neurocysticercosis: preliminary note. Arquivos de Neuropsiquiatria 40, 77–85. 61. Shandera, W.X., White, A.C., Jr, Chen, J.C., et al. (1994) Cysticercosis in Houston, Texas: a report of 112 patients. Medicine 73, 37–51. 62. Roman, R.A.S., Soto-Hernandez, J.L., Sotelo, J. (1996) Effects of prednisone on ventriculoperitoneal shunt function in hydrocephalus secondary to cysticercosis: a preliminary study. Journal of Neurosurgery 84, 629–633. 63. Salinas, R., Prasad, K. (2000) Drugs for treating neurocysticercosis (tapeworm infection of the brain). In: Cochrane Review, The Cochrane Library, Issue 3, Oxford, UK.

39

Neurocysticercosis: Neurosurgical Perspective Bhaiwani S. Sharma and P. Sarat Chandra

Introduction The management of neurocysticercus (NC) includes both medical and surgical treatments. These are complementary to each other in a number of cases. Medical treatment consists of control of seizures with antiepileptic drugs and cerebral oedema with decongestants in addition to anticysticercal drugs.

Rationale for surgical treatment Anticysticercal drugs, namely, albendazole and praziquantel, trigger cyst degeneration and are more effective against active cysts in the brain parenchyma. Though reported to be effective in other forms of NC, there is still no consensus about their efficacy in extraparenchymal locations1–5. Giant cysticerci (parenchymal, ventricular or cisternal) are most often of the racemose form and do not appear to respond well to anticysticercal drugs. The possibility of decompensation of intracranial pressure (ICP) and transtentorial herniation, caused by increase in oedema and inflammatory reaction provoked by cyst degeneration, cautioned against the use of anticysticercal drugs in individuals with giant cysts with mass effect or disseminated cysticercosis6. Furthermore, these medications

with or without corticosteroids do not prevent occurrence of complications such as hydrocephalus. Prompt surgical excision of the cyst may prevent chronic inflammation and granuloma formation (focus of epilepsy)7 around the cyst(s) in parenchymal locations, and ependymitis and ventricular entrapment due to intraventricular cysticercosis. Therefore, some patients with NC benefit from neurosurgical intervention. The latter is usually palliative and at times curative. The indication for neurosurgical approach to management is usually based on the presence of specific clinical manifestations with explicit underlying pathophysiological mechanisms, often posing a threat to life or vision by local compression or raised ICP8,9.

Preoperative Selection and Work-up Indications for surgery In general, neurosurgical intervention is required when: Hydrocephalus is present. A cyst exhibits tumour-like effect. Viable intraventricular NC is diagnosed. Abrupt or rapid rise of ICP refractory to medical treatment is noted. 5. Diagnosis is in doubt (for instance, single small enhancing lesions upon CT). 1. 2. 3. 4.

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

387

388

B.S. Sharma and P.S. Chandra

Choice of surgical procedure A range of surgical procedures has been described (Table 39.1). Appropriate surgical intervention is tailored according to pathophysiological mechanisms underlying specific clinical manifestations. In other words, clinical presentations primarily determine the need for, and choice of, neurosurgical approach8,10–12. Indeed, earlier attempts at surgical management relied solely upon clinical manifestations. Accordingly, clinical classifications were evolved to determine the nature of surgical intervention. Thus, Stepien and Chorobski described a classification, which was used to decide the requirement for, and prognosis after, surgery11. They classified patients who required operation into three groups: group I included those with focal tumour-like presentation with focal neurological deficits with or without raised ICP; group II included those with profuse multiple cysticerci giving rise to a pseudotumoral form; and group III comprised patients with raised ICP due to hydrocephalus. Colli et al. classified their surgical series into two main groups, i.e. those with local compression,

for instance in the optochiasmatic, cerebellopontine or quadrigeminal cisterns or in the fourth ventricle; and those due to raised ICP10. The latter group was further sub-classified into three subgroups: 1. Raised ICP owing to hydrocephalus resulting from: ● mechanical obstruction of ventricles/basal cisterns by cysticercal cysts; ● inflammatory reaction (ependymitis or arachnoiditis); ● impairment of CSF absorption due to parasagittal arachnoiditis and involvement of arachnoid villi. 2. Raised ICP owing to tumour-like syndrome (space occupancy; tumoral form). 3. Raised ICP owing to diffuse cerebral oedema (encephalitic; pseudotumoral form). At present, neuroradiological studies form the cornerstone of the preoperative evaluation of candidates being considered for neurosurgical intervention. Plain and contrast computed tomography (CT) provides rough guidelines for neurosurgical treatment. However, it alone does not form the basis for intervention. In general, CT is not adequate for the evaluation of ventric-

Table 39.1. Surgical options for neurocysticercosis. 1. Cerebrospinal fluid diversion procedures: (a) Ventriculoperitoneal/ventriculoatrial shunt (b) Third ventriculostomy (c) Torkildsen’s operation (d) Ventricular reservoir implantation 2. Lesion excision: (a) Open craniotomy and excision (i) Infratentorial ● Midline suboccipital craniotomy for cysts in the fourth ventricle, cisterna magna and quadrigeminal cistern ● Unilateral suboccipital craniotomy for cysts in the cerebellopontine angle cistern (ii) Supratentorial ● Lateral/third ventricle cysts – transcortical/transcallosal approach ● Optochiasmatic/sylvian/suprasellar cysts – pterional craniotomy ● Pseudotumour form – bitemporal decompressive/unilateral frontal or temporal lobectomy ● Prepontine/perimesencephalic cisternal cysts – subtemporal approach ● Giant parenchymal/cisternal cysts – according to location – frontal, temporal, parietal or occipital craniotomy and excision. (b) Minimally invasive procedures: (i) Stereotactic surgery in deep-seated and periventricular cysts and for localization purpose (ii) Endoscopic surgery for intraventricular neurocysticercosis

Neurocysticercosis: Neurosurgical Perspective

ular and cisternal NC. At best, CT provides strong suspicion of ventricular or cisternal cysts in individuals at risk. Magnetic resonance imaging (MRI) including contrast enhanced and fluid attenuation inversion recovery (FLAIR) studies are more useful than CT but these may also be equivocal at times, particularly, for instance in the case of fourth ventricle cysts (see Chapter 20)13. Contrastenhanced MRI is expressly useful in the identification of arachnoiditis and meningeal inflammation around cisternal cysts and ependymitis in the case of intraventricular NC. In general, the presence of contrast enhancement of the pericystic meninges or the ventricular lining constitutes a contraindication for definitive exeresis of the cyst. CT cisternography after administration of intrathecal contrast permits accurate delineation of cisternal cysts and, if the contrast permeates the foramina of Luschka and Magendie, of intraventricular cysts as well. For the preoperative evaluation of intraventricular NC, a ventriculo-CT, after contrast administered through a ventriculostomy or a ventricular reservoir, is ideal.

389

Operative Strategies Hydrocephalus resulting from inflammatory impediment to CSF flow As a rule, in all instances of hydrocephalus, where preoperative evaluation discerns the presence of inflammation associated with the cysticerci, for instance, ependymitis in association with intraventricular cysticercosis and meningitis and arachnoiditis surrounding cisternal cysts, it is best to proceed directly to ventriculoperitoneal shunt (VPS) (Fig. 39.1). In the particular case of communicating hydrocephalus due to cisternal cysts, exeresis is not an effective procedure as they are usually multiple and adherent to cranial nerves, vessels and neural tissue owing to arachnoiditis14,15. Surgery may have disastrous consequences and removal of a cyst does not prevent the progression of inflammatory reaction that is already underway. Obstruction by an inflammatory process is also frequent at the fourth ventricular outlet. Such patients are best treated with insertion of VPS since they do not benefit from direct posterior fossa exploration and lysis of inflammatory adhesions, which invariably recur within a short time.

Magnetic resonance imaging or computed tomography ventriculography

Obstruction by free cyst

Surgical excision

Communicating hydrocephalus

Inflammatory obstruction

Ventriculoperitoneal shunt

Fig. 39.1. Management of hydrocephalus due to neurocysticercosis.

Inflammatory obstruction + cyst

Ventriculoperitoneal shunt + partial excision

390

B.S. Sharma and P.S. Chandra

When CT ventriculography or MRI do not allow differentiation between obstruction due to inflammatory or free cysts, surgery is indicated. It is easy to differentiate between viable, active and inflamed cysts at operation. The former have a translucent membrane and contain colourless fluid. On the other hand, inflamed cysts are characterized by a thick opaque membrane and their contents are hazy. Such cysts are often adherent and it is difficult to remove them. If at posterior fossa exploration, ependymitis or arachnoiditis is found or a cyst is found adherent to the ependyma, partial excision of the free portion of the cyst may be performed. Ventriculoperitoneal shunt insertion is indicated immediately after partial cyst removal as these patients develop inflammatory blockade of cerebrospinal fluid (CSF) circulation and rise in ICP within a few weeks. Corticosteroids are used when inflammation (ependymitis, arachnoiditis or basal meningitis) is observed at surgery, CSF studies reveal evidence of inflammation, the cyst is only partially excised and intraoperative rupture is noted. Shunt complications include blockade and infection. Shunt obstruction rates approach 50% within the first 4 months and more than half of the patients require revision of shunt during first postoperative

year15. In order to improve and optimize shunt function and minimize post-shunt morbidity, several efforts have been made to modify shunt design. Sotelo et al. have devised a new shunt device that operates upon the principle of drainage according to CSF production rather than pressure16–18. Structurally, it is characterized by the absence of a valve mechanism and a long (9 cm) peritoneal end of the catheter of diameter 0.017 inches (Fig. 39.2). Functionally, it is specified by a constant rate of drainage under the balanced influence of the gravitational effect and ventricular pressure (Fig. 39.3a and b). The device prevents overdrainage. More significantly, with regard to cysticercotic hydrocephalus, the constant flow through it prevents clogging and obstruction by inflammatory and cystic debris. Several other operative procedures have been undertaken for the management of cysticercotic hydrocephalus. Third ventriculostomy involves the establishment of a communication between the third ventricle and the interpeduncular cistern10,19. The communication may be made by open surgery, endoscopically or under stereotactic guidance. The procedure is effective in selected cases with aqueductal stenosis due to cysticercotic arachnoiditis in the interpe-

Fig. 39.2. Illustration of an unassembled ventriculoperitoneal shunt designed by Sotelo et al. (see text for explanation). The ventricular catheter (above) and the peritoneal catheter (below) are shown. Scale shows centimetres. (Reproduced with permission from reference 16.)

Neurocysticercosis: Neurosurgical Perspective

New shunt 0

Differential pressure valves 550

0

200

100 200

400

550

200

Gravity effect (mm)

Ventricular pressure

391

100

0

–100

100

0

–100 0

200

400

600

800

0

10,000

20,000

30,000

Daily drainage (ml) Fig. 39.3. Comparison of functional characteristics of shunt devised by Sotelo et al. (left) and conventional shunts (right). Hatched area represents the combination of ventricular pressure and gravity effect at which conventional shunts remain non-functional. (Reproduced with permission from reference 16.)

duncular and perimesencephalic cisterns. A major limitation is that it will fail if the subarachnoid spaces in the CSF pathway distal to the interpeduncular cistern are occluded because of cysticercotic arachnoiditis. Torlkidsen’s operation involves the creation of a communication between the third ventricle and the cisterna magna20. This procedure is useful in cases of third or fourth ventricle obstruction. In the case of a unilateral hydrocephalus due to obstruction at the foramen of Monro, a septum pellucidotomy may be undertaken either after open craniotomy, stereotactic localization or endoscopically (see Chapter 40)10. An uncommon situation is the occurrence of a trapped fourth ventricle21,22. This occurs in the event of dual obstruction; aqueductal stenosis due to perimesencephalic arachnoiditis or ependymitis causes hydrocephalus and fourth ventricle outlet obstruction because of intraventricular cysticercosis or arachnoiditis obliterates the foramina of Luschka and Magendie. In such an event, the lateral ventricles and the third ventricles are decompressed by a VPS in the lateral vent-

ricle. However, the fourth ventricle dilates and balloons out, often leading to the complication of posterior fossa mass with transforaminal or reverse herniation. It is important to distinguish this condition from a fourth ventricle cyst because the surgical approaches to the two conditions are different. A trapped fourth ventricle may require the insertion of a separate shunt in the fourth ventricle21.

Hydrocephalus in association with viable, free intraventricular or cisternal cysts In the absence of evidence of inflammation associated with intraventricular and cisternal cysts, in the form of ependymitis and meningitis/arachnoiditis respectively, a primary removal of the cyst can be recommended (Figs 39.1 and 39.4)23,24. This often obviates the need for VPS. Surgical excision of the cyst needs to be accomplished for several reasons. First, the role of medical treatment in intraventricular and cisternal NC is controversial. There is a theoretical risk of inflammatory exacerbation of symptoms with anticysticer-

392

B.S. Sharma and P.S. Chandra

Neurocysticercosis

Active parenchymal cyst(s)

Small cyst(s)

Giant or large (> 4 cm) cyst(s)

Anticysticercal therapy

Cisternal cyst(s)

Small cyst(s)

Spinal cyst(s)

Large cyst(s)

Asymptomatic

Intraventricular cyst(s)

Intramedullary cyst(s)

Focal compression

Subarachnoid cyst(s)

Free cyst(s)

Adherent cyst(s)

Trial with anticysticercal drugs/ corticosteroids

Follow-up Ventriculoperitoneal shunt + partial excision

Increase in size

Excision Fig. 39.4. Flow chart showing management protocol for neurocysticercosis.

cal drugs. Second, free-floating intraventricular cysts are at risk of obstructing the CSF flow across several points, including the foramen of Monro, aqueduct and the fourth vetricular outlet, by a ball-valve phenomenon. This can lead to acute hydrocephalus with rise in ICP, manifesting clinically with altered sensorium, leading to coma and cardiorespi-

ratory arrest. Finally, free and viable intraventricular as well as viable cisternal cysts are at risk of inflammatory degeneration during the natural course of their evolution. This elicits an inflammatory reaction in the ventricular walls leading on to ependymitis and meningitis in the case of intraventricular NC, and meningitis and arachnoiditis in the case

Neurocysticercosis: Neurosurgical Perspective

of cisternal cysticercosis. Therefore intraventricular and cisternal cysts should be ideally removed in order to prevent the above mentioned complications. Cysts may be removed by open surgical intervention in the case of cisternal forms and by either open craniotomy using microsurgical technique or endoscopically in the case of intraventricular NC. Stereotactic localization may be performed before craniotomy in case of difficulty. Free cysts located in the lateral or third ventricle are operated using anterior interhemispheric transcallosal or transcortical approach through the middle frontal gyrus23,24. Intraventricular cysts are more commonly located in the occipital horns of the lateral ventricles and these might be approached by an occipital incision with occipital lobectomy. A complication that must be endured in such event is the occurrence of visual field

393

defects. A cyst located within the fourth ventricle is approached via posterior fossa craniotomy. The free cyst may protrude spontaneously through the foramen of Magendie towards the cisterna magna or it may be gently pulled out of the fourth ventricle (Fig. 39.5a–c). When the cyst is adherent to the wall of the ventricle or if the foramen of Magendie is stenosed or obstructed, it needs to be opened or widened with section of the inferior portion of the vermis to facilitate visualization of the inner part of the ventricle. Madrazo et al. proposed pipette suction technique for atraumatic extraction24,25. They devised a special long pipette, which attaches to the cyst by suction and permits removal without rupture. They considered intraoperative cyst rupture as a dangerous event24. Others, however, do not share this view15,23. However, in all cases of intraoperative rupture of cyst, intraventricu-

Fig. 39.5. Surgical exposure of fourth ventricle cysticercosis. An active cyst is seen protruding from the foramen of Magendie (a, b). A degenerating cyst with thick opaque walls that was delivered by section of the inferior portion of the vermis (c). (Source: B.O. Colli, São Paulo, Brazil.)

394

B.S. Sharma and P.S. Chandra

lar lavage with Ringer’s lactate solution at body temperature is advocated in addition to the systemic administration of high potency corticosteroids. Endoscopic excision has been advocated both for supratentorial and infratentorial intraventricular cysts26–28. Endoscopic third ventricular cyst removal may be carried out very effectively using a rigid rod lens endoscope through a frontal burr hole. The foramen of Monro may be identified upon entering the lateral ventricle by noting the presence of the choroid plexus and the thalamostriate vein. It is not uncommon in long-standing hydrocephalus, to find multiple perforations within the septum, hence it is important to identify the correct portal of entry into the third ventricle. It is usually not possible to remove the cyst in toto, and the cyst usually gets ruptured during removal. Intraventricular injection of corticosteroids to prevent anaphylactic reaction remains controversial27,28. Endoscopic removal is reviewed in detail in Chapter 40.

been tried but experience with this procedure is limited and not favourable31.

Diffuse cerebral oedema (encephalitic or pseudotumoral form) Miliary infestation with diffuse inflammatory reaction and oedema in the brain parenchyma, constitutes the clinical syndrome of cysticercotic encephalitis. Intracranial pressure is raised and a major determinant of the poor outcome in this condition. There is increase in parenchymal volume with corresponding reduction in ventricular and cisternal volumes. The primary treatment of this form is with decongestants and corticosteroids. The latter prevent secondary inflammatory reaction triggered by acute destruction of the parasites23. In exceptional cases, where intracranial hypertension is refractory to medical treatment and threatens life or vision, decompressive bitemporal craniotomy, or unilateral temporal or frontal craniotomy and lobectomy may be considered (Fig. 39.6)29,30,32.

Tumour-like syndrome (space occupancy or tumoral form) Local compression Cysticercal cyst(s) may grow in size in the parenchyma, cistern(s) or ventricle(s) and may produce mass effect and intracranial hypertension. Such cases are best treated by direct surgical excision. Active cysts adhere weakly to neural tissue and can easily be excised completely (Fig. 39.4). In the degenerative phase, intense inflammatory reaction around the cyst(s) makes them firmly adherent to nervous tissue or blood vessels and their complete excision carries a risk of producing neurological deficit. Such cysts are treated by cyst decompression or partial resection via a direct/stereotactic/endoscopic approach. Cyst puncture is a relatively simple procedure for decompressing giant cysts. However, it rarely produces lasting results because cysts are often multiple and the possibility of cysts refilling29,30. The establishment of a shunt between the cyst and the subarachnoid space is not recommended because of its proclivity to cause cysticercotic meningitis and arachnoiditis10. Cystoperitoneal drainage has also

All forms of NC may produce symptoms and signs of compression of neural tissue when cysts grow to large or giant proportions. The location of the pathology dictates the surgical approach (Table 39.1; Figs 39.5 and 39.7a and b).

Fig. 39.6. Surgical specimen of frontal lobectomy for disseminated neurocysticercosis.

Neurocysticercosis: Neurosurgical Perspective

395

Fig. 39.7. (a and b) Exposure for cysts in the suprasellar region showing surgical anatomy of the region. c, Cysticercus cyst; IC, internal carotid artery; ON, optic nerve. (Reproduced with permission from reference 10.)

Cisternal cysts Well-defined cysts within the cisterns are excised irrespective of their size when they cause local compression. Cysts located in the optochiasmatic region may be approached via a transcranial route, preferably the pterional or the fronto-temporo-orbital route (Fig. 39.7a and b). Cysts in the cerebellopontine angle cistern may be approached through a unilateral suboccipital craniotomy. Parenchymal form Cysticerci may lodge within the brain parenchyma as a single cyst, two or three cysts forming clumps, countable multiple or innumerable cysts. Seizures are the most common clinical manifestation. Tubercular granuloma, microabscess, focal encephalitis, postictal enhancement, vascular lesions and neoplasms need to be considered in the differential diagnosis. Surgery (excisional biopsy) may be required for confirmation of diagnosis33,34.

Parenchymal cyst(s) may grow in size to produce a tumour-like syndrome. Cysts larger than 4 cm produce local compression of brain paranchyma and focal neurological deficits. Stereotactic/open craniotomy and cyst removal is advocated in cases of a single giant cortical cyst or large clumps exhibiting tumour-like behaviour, when located in a surgically accessible area. The other indications for excision include progressive focal neurological deficit, lack of response to anticysticercal therapy and uncertainty in diagnosis. Deep-seated (thalamic, basal ganglia) cysticerci are uncommon but difficult to manage surgically. They may be approached using a transcortical or transylvian route. Minimally invasive techniques such as stereotactic or imageguided system for neuronavigation may be used to accurately localize the cyst for biopsy or excision10,30,35.

396

B.S. Sharma and P.S. Chandra

Surgical Outcome and Postoperative Management The high postoperative mortality and morbidity observed in the past has been reduced to a minimum by the following. 1. Better identification of patients with free intraventricular cysts with ventriculo-CT or MRI. 2. Use of microsurgical techniques. 3. Satisfactory control of aseptic meningitis with perioperative and postoperative corticosteroids. 4. Availability of better functioning shunt devices.

Hydrocephalus Cysticercotic hydrocephalus constituted group III of Stepien and Chorobski’s classification of clinical presentations requiring neurosurgical intervention11. Individuals with this presentation were treated with total or partial cyst exeresis or, in cases where this was not possible, by decompression. Understandably, results were poor and postoperative mortality was high. The use of VPS improved outcome of cysticercotic hydrocephalus. However, as experience with VPS accumulated, it was realized that this procedure was associated with a high rate of shunt malfunction particularly due to occlusion within the first 2 years after its insertion. Thus Colli et al. noted that 54% of 144 patients who were submitted to shunting, required reoperation, mostly in the first 2 years10. Others have similarly reported high incidence of shunt malfunction14. The frequency of shunt malfunction correlates with the degree of abnormality in CSF cell count and protein. In general, mortality in cysticercotic hydrocephalus is as high as 50% within the first year. Those who survive and do not develop complications in the initial 1 or 2 years generally do well. Intermittent long-term prednisolone therapy after VPS reduces shunt malfunction and improves functional status of the patient36. In these cases, prednisolone is started within the first postoperative week at a dose of 50 mg three times a week.

Sotelo et al. reported excellent results with their new shunt device that has been described in an earlier section of this chapter. Their shunt was reported to be functional for a mean period of 9 ±2 months in 25 patients; only one patient required shunt revision16. However, while the new device took care of shunt occlusion, inadequate drainage became a problem17. Clinicoradiological follow-up of the patients revealed conversion of a hypertensive hydrocephalus to normotensive hydrocephalus17. Thus the clinical picture changed from one of intracranial hypertension to that of a frontal lobe gait disorder, dementia and incontinence. Radiological studies revealed inadequate resolution of ventricular size. In order to obviate this complication, the authors increased the cross-sectional area of the peritoneal catheter from 0.126 mm2 to 0.146 mm2. Further experience with the revised shunt device including longterm follow-up is awaited.

Tumoral form The prognosis is far better than other forms. Out of 55 patients with this presentation in Stepien’s series, 35% recovered, 40% showed improvement, 2% showed no improvement and 24% died in the postoperative period12. This led him to conclude: ‘It is tempting to conclude, therefore, that in every case in which a diagnosis of localized cerebral cysticercosis is made, operation should be performed’. Colli et al. operated on 12 patients with giant intracranial cysticercosis and observed good postoperative outcome in all 1210.

Pseudotumoral form Surgery is rarely required and advocated in this form of cerebral cysticercosis. The outcome after surgery is not good. Thus, in 34 patients who were operated on for pseudotumoral cerebral cysticercosis in Stepien’s series, about half had partial improvement, 14% had no change in their clinical status and 32% died after surgery12. Colli et al. performed bitemporal decompressive surgery in five patients. Three patients improved, while two died a few days later10.

Neurocysticercosis: Neurosurgical Perspective

Compressive form The surgical outcome is dependent upon the presence of inflammation and its sequelae. When cysts in the fourth ventricle, cerebellopontine angle cisterns and the optochiasmatic region are free and not associated with either ependymitis or meningitis/arachnoiditis, there is improvement in the neurological deficit10. The improvement in ICP is sustained in such cases. Those individuals with inflammatory cysts in any of the above locations demonstrate transient improvement in ICP but ultimately require VPS, if the latter has not been already undertaken.

Conclusions In conclusion, surgery for NC is required in the presence of free intraventricular

397

cysts, hydrocephalus, tumour-like effect, diffuse disseminated form refractory to medical treatment and doubt in diagnosis. The choice of surgical procedure is dictated by the pathophysiological mechanism producing the clinical manifestation. Hydrocephalus due to obstruction by a free intraventricular cyst is best treated by direct open/endoscopic excision of the cyst. Communicating hydrocephalus or hydrocephalus due to inflammatory intraventricular obstruction are treated with VPS. Large parenchymal cisternal, ventricular or spinal cysts producing local compression are excised. The pseudotumoral form resistant to medical treatment may rarely need decompressive craniotomy. Anticysticercal treatment may be required for residual or additional cysts.

References 1. Proano, J.V., Madrazo, I., Garcia, L, et al. (1997) Albendazole and praziquantel treatment in neurocysticercosis of fourth ventricle. Journal of Neurosurgery 87, 29–33. 2. Del Brutto, O.H., Quintero, L.A. (1995) Cysticercosis mimicking brain tumour: the role of albendazole as a diagnostic tool. Clinical Neurology and Neurosurgery 97, 256–258. 3. Allcut, D.A., Coulthard, A. (1991) Neurocysticercosis: regression of a fourth ventricular cyst with praziquantel. Journal of Neurology, Neurosurgery and Psychiatry 54, 461–462. 4. Sotelo, J. (1997) Treatment of brain cysticercosis. Surgical Neurology 48, 110–112. 5. Sotelo, J., Del Brutto, O.H., Penagoes, P., et al. (1990) Comparison of therapeutic regimen of anticysticercal drugs for parenchymal brain cysticercosis. Journal of Neurology 237, 69–72. 6. Wadia, N.H., Desai, S., Bhatt, M. (1988) Disseminated cysticercosis. New observations including CT scan findings and experience with treatment by praziquantel. Brain 11, 597–614. 7. Del Brutto, O.H., Santibanez, R., Nobla, C.A., et al. (1992) Epilepsy due to neurocysticercosis: analysis of 203 patients. Neurology 42, 389–392. 8. Colli, B.O., Martelli, N., Assirati, J.A., et al. (1995) Surgical treatment of cysticercosis of the central nervous system. Neurosurgery Quarterly 5, 34–54. 9. Sharma, B.S., Gupta, S.K., Khosla, V.K. (1998) Neurocysticercosis: surgical considerations. Neurology India 46, 177–182. 10. Colli, B.O., Martelli, N., Assirati, J.A., et al. (1994) Cysticercosis of the central nervous system. I. Surgical treatment of cerebral cysticercosis. Arquivos de Neuropsiquitria 52, 166–186. 11. Stepien, L., Chorobski, J. (1949) Cysticercosis cerebri and its operative treatment. Archives of Neurology and Psychiatry (Chicago) 61, 499–527. 12. Stepien, L. (1962) Cerebral cysticercosis in Poland. Clinical symptoms and operative results in 132 cases. Journal of Neurosurgery 19, 505–513. 13. Salazar, A., Sotelo, J., Martinez, H., et al. (1983) Differential diagnosis between ventriculitis and a fourth ventricle cyst in neurocysticercosis. Journal of Neurosurgery 59, 660–663. 14. Sotelo, J., Marin, C. (1987) Hydrocephalus secondary to cysticercotic arachnoiditis. A long-term follow-up review of 92 cases. Journal of Neurosurgery 66, 686–689. 15. Lobato, R.D., Lamas, E., Portillo, J.M. (1981) Hydrocephalus in cerebral cysticercosis. Pathogenic and therapeutic considerations. Journal of Neurosurgery 55, 786–793.

398

B.S. Sharma and P.S. Chandra

16. Sotelo, J., Rubalcava, M.A., Gormez-Llata, S. (1995) A new shunt for hydrocephalus that relies on CSF production rather than on ventricular pressure. Initial clinical experiences. Surgical Neurology 43, 324–332. 17. Sotelo, J. (1996) Update: the new ventriculoperitoneal shunt at the Institute of Neurology at Mexico. Surgical Neurology 46, 19–20. 18. Sotelo, J. (1993) A new ventriculoperitoneal shunt for treatment of hydrocephalus. Experimental results. European Journal of Biomedical Engineering 15, 257–262. 19. Darlymple, S.J., Kelly, P.J. (1992) Computer assisted stereotactic third ventriculostomy in the management of non-communicating hydrocephalus. Stereotactic and Functional Neurosurgery 59, 105–110. 20. Tolkidsen, A. (1939) A new palliative operation in cases of inoperable occlusion of the Sylvian aqueduct. Acta Chirurgica Scandinavica 82, 117–130. 21. DeFeo, D.R., Foltz, E.L., Hamilton, E. (1975) Double compartment hydrocephalus in a patient with cysticercotic meningitis. Surgical Neurology 4, 247–251. 22. Colli, B.O., Pereira, C.U., Assirati, J.A., et al. (1993) Isolated fourth ventricle in neurocysticercosis: pathophysiology, diagnosis and treatment. Surgical Neurology 39, 305–310. 23. Apuzzo, M.L.J., Dobkin, W.R., Zee, C.S., et al. (1984) Surgical considerations in treatment of intraventricular cysticercosis: an analysis of 45 cases. Journal of Neurosurgery 60, 400–407. 24. Madrazo, I., Gracia, J.A., Sondoval, M., et al. (1983) Intraventricular cysticercosis. Neurosurgery 12, 148–152. 25. Madrazo, I., Sanchez Cebreza, J.M., Maidonado Leon, J.A. (1979) Pipette suction for atraumatic extraction of intraventricular neurocysticercus cysts. Technical note. Journal of Neurosurgery 50, 531–532. 26. Culdip, S.A., Wilkins, P.R., Marsh, H.T. (1998) Endoscopic removal of a third ventricular cyst. British Journal of Neurosurgery 12, 452–454. 27. Bergsneider, M., Hooloy, L.T., Lee, J.H., et al. (2000) Endoscopic management of cysticercal cysts within the lateral and third ventricles. Journal of Neurosurgery 92, 14–23. 28. Bergsneider, M. (1999) Endoscopic removal of cysticercal cysts within the fourth ventricle. Technical note. Journal of Neurosurgery 91, 340–345. 29. Couldwell, W.T., Zee, C.S., Apuzzo, M. (1991) Definition of the role of contemporary surgical management in cisternal and parenchymatous cysticercosis cerebri. Neurosurgery 28, 231–237. 30. Stern, W.E., (1981) Neurosurgical considerations in cysticercosis of the central nervous system. Journal of Neurosurgery 55, 382–389. 31. Araujo, L.P., Martelli, N., Marquez, J.O. (1982) Forma gigante da neurocisticercose. Relato de caso. Arquivos de Brasilla Neurocirurgica 3, 119–123. 32. Colli, B.O., Matelli, N., Assirati, J.A., et al. (1986) Results of surgical treatment of neurocysticercosis in 69 cases. Journal of Neurosurgery 65, 309–315. 33. Chandy, M.J., Rajshekhar, V., Ghosh, S., et al. (1991) Single small enhancing CT lesions in Indian patients with epilepsy: clinical, radiological and pathological considerations. Journal of Neurology, Neurosurgery and Psychiatry 54, 702–705. 34. Rajshekhar, V. (1991) Etiology and management of single small CT lesions in patients with seizures: understanding a controversy. Acta Neurologica Scandinavica 84, 465–470. 35. Ramina, R., Hynhevicz, S.C. (1986) Cerebral cysticercosis presenting as mass lesion. Surgical Neurology 25, 89–93. 36. Suastegui Roman, R.A., Soto-Hernández, J.L., Sotelo, J. (1996) Effects of prednisone on ventriculoperitoneal shunt function in hydrocephalus secondary to cysticercosis: a preliminary study. Journal of Neurosurgery 84, 629–633.

40

Endoscopic Management of Intraventricular Cysticercosis Marvin Bergsneider and Jaime H. Nieto

Introduction

Rationale for an endoscopic approach

Intraventricular cysticercosis can be a challenging clinical disorder owing to its unpredictable nature and potentially devastating consequences. These lesions typically come to clinical attention as a result of hydrocephalus and therefore require therapeutic intervention. In general, three treatment options are available: anticysticercal agents, cerebrospinal fluid (CSF) diversion, and/or surgical extirpation of the cyst. The removal of cysts can either be accomplished via an open craniotomy or endoscopically. To date, there is no consensus as to which treatment is superior because all of the reported experience in the literature is anecdotal. In our opinion, the ideal management for intraventricular cysticercosis should reverse hydrocephalus (if present), immediately eliminate the risk of acute obstructive hydrocephalus, reduce the risk of delayed postinflammatory ependymitis and arachnoiditis, and have a low treatment-related morbidity. Here, we will argue that the endoscopic removal of intraventricular cysts best satisfies these treatment requirements and therefore is the preferred treatment for most patients.

Clinical presentations of intraventricular cysticercosis are reviewed in Chapter 20. Briefly, clinical symptomatology is related to three phenomena1. First, free-floating cysts within the lateral or third ventricles can suddenly obstruct the aqueduct of Sylvius or less commonly one foramen of Monro. This ‘ballvalve’ phenomenon can be responsible for drop attacks, transtentorial herniation, and even sudden death2. Second, fourth ventricular cysts tend to enlarge progressively giving rise to considerable mass effect. Finally, once intraventricular cysts begin to degenerate, a delayed communicating hydrocephalus can develop as a result of a chronic ependymitis and arachnoiditis3–7. This immunological reaction does not occur in all patients, but if severe and advanced, carries a grave prognosis regardless of treatment8,9. Given these considerations, the ideal management of intraventricular cysticercosis should be removal of the cyst from the ventricle, thereby eliminating the risk of acute obstructive hydrocephalus and the formation of delayed postinflammatory communicating hydrocephalus. In this regard, only the surgical extirpation of intraventricular cysts

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

399

400

M. Bergsneider and J.H. Nieto

meets these goals. The other two options, anticysticercal drugs and CSF shunt diversion, each have significant drawbacks that have been considered in detail Chapters 20 and 39. The definitive removal of the cysticercal cyst from the ventricle requires a surgical procedure. Primary removal of intraventricular cysticercal cysts has been advocated by many authors2,3,6,8,10–18. Classically, these lesions have been approached as if they were neoplasms that required a wide surgical exposure for direct visualization and removed2,8,10,15,16,19,20. For cysts located in the lateral or third ventricles, the interhemispheric–transcallosal or transcortical approaches via a craniotomy have been the standard procedures21. The potential morbidity associated with these procedures, especially the third-ventricle approach, is dependent upon surgical experience and can be devastating22–24. For cysts within the lateral and third ventricles, a surgical approach using a flexible neuroendoscope through a burr hole–transcortical approach is significantly easier, safer, and comparably effective compared with the classic open craniotomy approach. In addition, an endoscopic approach has several important advantages over craniotomy. One disadvantage of the open craniotomy approach is that intraventricular cysts can migrate within the ventricular system25,26. This is especially true of lateral ventricle cysts that frequently settle in the occipital horn if the patient is in the supine position. In cases of cysts located in both lateral ventricles, open craniotomy approaches become increasingly destructive in order to gain access to both occipital horns. An easily performed septum pellucidotomy with an endoscope allows near complete access to the entirety of both lateral ventricles and the third ventricle. Compared with an open craniotomy approach, access to the third ventricle with a flexible neuroendoscope is nearly effortless. The posterior third ventricle can be explored without manipulating the fornices or structures within the velum interpositum. Lastly, compartmentalized hydrocephalus can be effectively and easily treated using the endoscopic approach since it allows the surgeon to perform a third ventriculostomy and/or a septum pellucidotomy27,28.

Historically, the surgical removal of fourth ventricular cysts has generally been considered to require a standard suboccipital craniectomy for direct visualization of the fourth ventricle10,20,29–34. The endoscopic approach to the fourth ventricle is technically more difficult compared with that of the lateral and third ventricles especially when arachnoid adhesions are present. In appropriately selected patients, however, the endoscopic approach to the fourth ventricle (described below) is safe, effective and associated with decreased operative time, less blood loss and less postoperative pain compared with the suboccipital craniotomy35.

Patient Selection and Preoperative Management At our institution, every patient with documented intraventricular cysticercal cysts is considered for endoscopic removal of the cysts. In our experience, only a few of these cysts are incidental findings – testifying to the high proclivity of intraventricular cysts to cause clinical problems. Whereas, magnetic resonance imaging (MRI) including contrast, proton density and fluid attenuated inversion recovery (FLAIR) imaging constitute the standard investigative approach to intraventricular cysticercosis, the most definitive neuroimaging study is the ventricular contrast computed tomography (CT) scan (Fig. 40.1). This study, however, requires access to the CSF system (most often via a ventriculostomy catheter placed for acute hydrocephalus) and a suitable anatomic situation. For example, a study showing only one compartment of a multiloculated hydrocephalus may fail to show cysts in other compartments. When the diagnosis is suspected and the MRI study is inconclusive or not obtainable, we instill 5 ml of CSF-compatible non-ionic contrast via a ventriculostomy and obtain a CT scan approximately 20–30 min later. The results of this study can also be helpful in assessing the need for septum pellucidotomy or third ventriculostomy. There are several relative contraindications to endoscopic resection of intraventricular cysts. First, the presence of ependymal enhancement immediately adjacent to an

Endoscopic Management of Intraventricular Cysticercosis

401

Fig. 40.1. Coronal gadolinium-enhanced T1-weighted magnetic resonance imaging (left) demonstrating mild hydrocephalus and ependymitis in the fourth ventricle (arrowhead). The study was suspicious but not definitive for a fourth ventricular cyst. Axial computed tomography contrast ventriculogram (right) showing a multilobulated filling defect confirming a fourth ventricle cysticercal cyst in this patient (see Fig. 40.4). The degree of hydrocephalus had increased between the two studies.

intraventricular cyst increases the chances that the cyst may be adherent to the ventricular wall (Fig. 40.2). We have found that many of these cysts, which are degenerating and causing inflammation, can be safely removed using a judicious endoscopic technique (see below). An endoscopic exploration is not attempted in cases when there is extensive enhancement of the ependymal surfaces (Fig. 40.2) and subarachnoid spaces. In such cases, even open craniotomy approaches may not be effective9,36. Careful attention must be paid to the fourth ventricular outlet since an enhancement pattern in this area may signify a technically difficult, if not impossible, endoscopic approach to the fourth ventricle. A second relative contraindication to the neuroendoscopic approach is the lack of hydrocephalus. With slit ventricles, the endoscopic retrieval of the cyst may be technically difficult and therefore riskier. In our limited experience we have not come across such a situation since all of our patients have had some degree of ventricular enlargement. In rare cases, very large cysts containing solid components that are larger than the peel-away sheath may require an open craniotomy and corticec-

tomy in order to have enough room to remove the cyst and nodule. Symptomatic patients who have acute hydrocephalus should be treated emergently with a ventriculostomy catheter. It is important not to overdrain and collapse the ventricles since this will make endoscopy much more difficult or even impossible. All patients are given dexamethasone 4–10 mg intravenously just before surgery and every 6 h thereafter for 24 h. Standard perioperative antibiotics are given as well.

Endoscopic Technique Lateral and third ventricle cysts Instrumentation Anecdotal reports of endoscopic approaches to the lateral and third ventricles for cysticercosis have used a variety of techniques and instruments2,3,25,30,33,37,38. To maximize surgical possibilities and effectiveness, we prefer a flexible endoscope such as the Codman 4mm steerable flexible neuroendoscope (Johnson & Johnson Professional, Inc., Raynham, MA, USA). A rigid-lens endo-

402

M. Bergsneider and J.H. Nieto

scope can be used in selected cases but does not offer a significant advantage in our opinion. A separate cannula, such as a No. 14 French peel-away sheath, is required since the flexible endoscope may need to be reinserted several times. A transendoscopic grasping instrument of some type is required39. This may be a toothed grasper or a snare device (Figs 40.3 and 40.4). We use gravity-fed Plasma-Lyte (Baxter, Deerfield, IL, USA) or lactated-Ringer’s solution for irrigation which matches with the pH of CSF. The irrigation tubing is connected to the endoscope using an irrigation adapter (Codman Neuroglide, Johnson & Johnson Professional, Inc., Raynham, MA, USA). The endoscope is secured by a moveable holding system such as a Bookwalter set-up26,27.

Fig. 40.2. Axial gadolinium-enhanced T1-weighted MRI demonstrating severe ependymitis. With this degree of ependymitis, the retrieval of intraventricular cysts, if present, may not be possible with any surgical approach.

Operating room set-up and patient positioning We prefer to position the patient so that there will be a minimum amount of subdural and intraventricular air after surgery. The patient

Fig. 40.3. Video image-captures demonstrating the removal of a third ventricle cyst via a right precoronal burr hole. (a) The free-floating cyst is identified in the posterior aspect of the third ventricle. (b) A transendoscopic snare grasping instrument is used to capture the cyst. (c) The cyst is secured with the instrument and maintained just distal to the tip of the endoscope. (d) Delivering the cyst through the foramen of Monro into the right lateral ventricle.

Endoscopic Management of Intraventricular Cysticercosis

403

Fig. 40.4. Video image-captures of an endoscopic removal of fourth ventricular cysts. (a) Extradural view as the endoscope approaches the small dural opening. The dura is retracted with a suture on either side of the opening. No bone has been removed as noted by the intact opisthion. (b) The endoscope has entered the cisterna magna and is navigated cephalad. The cysticercal cysts are seen protruding from the foramen of Magendie. An incidental choroid plexus cyst is present (possibly a migrating transchoroidal cysticercal cyst). (c) The transendoscopic grasping is oriented so that the jaws open horizontally, thereby decreasing the risk of injuring the brainstem. (d) The cysts are retrieved keeping the tip of the grasping instrument just beyond the endoscope. (e) The cyst and the endoscope are withdrawn simultaneously. (f, g) Inspection of the fourth ventricle reveals another large cyst that is retrieved in a similar manner. (h) Note the ependymitis of the floor of the fourth ventricle. (i) Final inspection of the ventricle showing the aqueduct of Sylvius. The subependymal haemorrhage present likely occurred when the cyst passed from the third to the fourth ventricle before the surgical procedure.

is positioned in a semi-recumbent position with the head on a horseshoe head-holder to assure that the precoronal suture is the highest point (Fig. 40.5). Since the head is usually quite elevated, it is necessary to build a platform with metal standing steps at the head of the bed where the surgeon will stand. The assistant surgeon stands directly above the patient’s head. The primary surgeon stands on the operating side of the head. The television monitor and endoscopy trolley are placed in front of the surgeon on the opposite side of the bed where the anaesthetist is. The

irrigation bag is positioned about 60 cm above the patient’s head level. Usually, the preparation and draping of the patient for a ventriculoperitoneal shunt are planned in the event that it is determined intraoperatively that the endoscopic procedure will not alleviate the hydrocephalus. A frontal, precoronal semicircular skin incision is marked out with the idea that it could be used for a shunt if needed. Approaches to the right lateral and third ventricles are usually done from the right side. A solitary left-lateral ventricle cyst is approached via a left frontal burr hole.

404

M. Bergsneider and J.H. Nieto

Fig. 40.5. Intraoperative set-up for an endoscopic approach to the lateral and/or third ventricle. The patient is positioned semi-recumbent with the head further flexed and resting on a horseshoe apparatus. This enables the burr hole to be the most superior point of the head and therefore minimizes the amount of postoperative intracranial air. The primary surgeon stands to the right looking directly at the video monitor. The body of the flexible endoscope is suspended via a fixed Bookwalter mount.

Surgical technique A No. 14 French, blunt-tipped, peel-away catheter is inserted into the lateral ventricle aiming towards the ipsilateral foramen of Monro. The surgeon has to be careful to avoid plunging or pulling the peel-away sheath out of the ventricle when manipulating the peel-away mechanism. Once the lateral ventricle is entered, the flexible endoscope is navigated to locate the cyst. An assessment is made to establish the safety of the cyst removal. At times the entire ependymal surface appears to be carpeted with a fine fibrinous material indicative of ongoing ependymitis not visible upon neuroimaging studies. If the cyst is not freely floating in the ventricle, continuous irrigation and the mechanical presence of the endoscope is used in an attempt to separate the cyst from the ependymal wall and choroid plexus. Non-extractable cysts will appear highly opaque and there will be no identifiable interface between the cyst and ependymal wall. In such cases, no attempt should be

made to remove the cyst and the patient should be shunted and treated with corticosteroids if necessary. To remove a cyst, the transendoscopic grasping instrument is advanced down the working channel of the endoscope (Fig. 40.3). After grasping the cyst wall, the grasping instrument is retracted to the point at which the cyst is approximately 5 mm from the distal tip of the endoscope. No attempt is made to withdraw the cyst through the working channel of the endoscope because this channel is too small to accommodate the entire cyst. The endoscope is slowly withdrawn just to the point distal to the peelaway catheter. The anaesthetist is asked to perform a gentle and sustained Valsalva manoeuvre (to approximately 30 mmHg airway pressure) while the endoscope is slowly pulled back through the peel-away sheath with the cyst in tow. If a ventriculostomy catheter is present, the ventricular system can be gently pressurized by a hand-held syringe in lieu of a Valsalva manoeuvre as the cyst is being removed through the peel-

Endoscopic Management of Intraventricular Cysticercosis

away cannula. The cyst is retained just beyond the distal end of the endoscope and delivered to the specimen cup. If the cyst wall tears, the fragmented piece is delivered and the capture and withdrawal technique repeated until the entire cyst is removed. The endoscope is navigated back into the ventricle and additional cysts, if present, removed using the aforementioned technique. Once all cysts are removed, irrigation is continued until cloudiness and particulate material within the ventricular fluid has cleared. For the wound closure, we prefer to leave a piece of Gelfoam in the burr hole to prevent rundown bleeding into the ventricle and use a titanium (or equivalent) burr hole cover. The scalp is closed in a routine watertight fashion. For patients who have a ventriculostomy catheter placed preoperatively, this catheter is left in place for 24 h to monitor intracranial pressure (ICP) and discontinued if ICP is normal. Septum pellucidotomy A septum pellucidotomy is performed if there is need to inspect and remove other cysts in the contralateral ventricle or if the ependymal irritation is marked and there is potential for unilateral hydrocephalus. The perforation is made using a monopolar cautery wire (Codman ME2, Johnson & Johnson Professional, Inc., Raynham, MA, USA) or by using the neodymium:yttrium aluminiumgarnet (Nd:YAG) laser. The fenestration can be mechanically enlarged by the endoscope. Third ventriculostomy A third ventriculostomy can be performed when hydrocephalus is associated with aqueductal stenosis and the obstruction cannot be alleviated by removal of the cyst. We identify the standard anatomic landmarks and then puncture the tuber cinereum, just posterior to the vascular discoloration imparted by the infundibular recess, using the straight end of a vascular guide wire (diameter: 0.81 mm/0.032 inch). A No. 3 French Fogarty or Cook elliptical balloon catheter is used to expand the perforation and the flexible endoscope is navigated into

405

the interpeduncular cistern to confirm the fenestration of the membrane of Liliequist.

Fourth ventricular approach Instrumentation The below-described approach requires a flexible neuroendoscope such as a Codman 4-mm flexible neuroendoscope (Johnson & Johnson Professional, Inc., Raynham, MA, USA). A rigid or semi-flexible endoscope cannot be used owing to the risk of injuring the brainstem. A separate cannula (such as a peel-away sheath) is not used, nor required. A transendoscopic grasping instrument is needed. We use gravity-fed Plasma-Lyte or lactated-Ringer’s solution for irrigation. The irrigation tubing is connected to the endoscope using an irrigation adapter (Codman Neuroglide, Johnson & Johnson Professional, Inc., Raynham, MA, USA). The endoscope is secured by a moveable holding system such as a Bookwalter set-up28,35. Operating room set-up and patient positioning The patient is placed prone in the so-called ‘Concorde’ position with the head secured in a three-point rigid skull fixation device (Fig. 40.6). The neck is flexed to the same degree that is used for a standard suboccipital craniectomy. The ventriculostomy catheter, if present before surgery, is kept open to drainage during induction of anaesthesia, but afterwards is closed and used for monitoring of ICP only. The endoscope is set up and secured to the accompanying endoscope holder and secured to a Bookwalter mount. The primary endoscopist stands at the patient’s left side and the assistant stands at the right side. The television monitor is situated at the patient’s right side, next to the anaesthetist. A gravityfed irrigation solution similar in pH and osmolarity to CSF, such Plasma-Lyte (Baxter, Deerfield, IL, USA), is preferable to 0.9 M saline because the low pH of the latter may interfere with the respiratory drive centres adjacent to the fourth ventricle while the patient recovers from anaesthesia.

406

M. Bergsneider and J.H. Nieto

Fig. 40.6. Intraoperative set-up for an endoscopic approach to the fourth ventricle. The patient is positioned prone with the head further flexed and immobilized with a Mayfield three-point holder (‘Concorde’ position). The primary surgeon stands to the patient’s left looking directly at the video monitor. The body of the flexible endoscope is suspended via a fixed Bookwalter mount.

Surgical technique A vertical linear, 2.5-cm incision is marked on the skin directly overlying the midline aspect of the posterior arch of the first cervical vertebra (C1). If a ventriculostomy is not already in place, the scalp is shaved in the right occipital area so that an emergency ventriculostomy can be placed if needed. The muscle and the soft-tissue dissection are limited to an exposure of the posterior arch of C1 and less that 10 mm of the opisthion. Either a Cloward cervical retractor (Cloward Instrument Corp., Honolulu, HI, USA) or an Adson cerebellar retractor works well in providing exposure for this small skin and muscle opening. If the craniocaudal exposure of the dura between the opisthion and C1 is less than 10 mm, a Kerrison rongeur is used to remove the inferior 2–5 mm of the opisthion. A vertical, midline incision is made in the dura to within 1 mm of the bone exposure, and the dural edges are tented back with sutures. The arachnoid is opened under direct visualization. Under direct visualization, the tip of the endoscope is positioned at the dural opening. While using continuous irrigation, the endoscope tip is flexed upward as the sub-

arachnoid space is entered (Fig. 40.7). Navigating the flexible endoscope toward the fourth ventricle sometimes necessitates that the endoscope lightly slides directly on the upper cervical cord and brainstem. For a right-handed endoscopist the amount of force applied by the endoscope to the spinal cord and to the brainstem is limited by the left hand. Resting the hypothenar eminence of this hand on the neck of the patient, combined with rigidly supporting the base of the endoscope, provides excellent tactile feedback and prevents inadvertent plunging of the endoscope. Using this method, the orthogonal vector force applied to the spinal cord and/or brainstem is negligible. The endoscopic landmarks that must be identified include the brainstem and cervical spinal cord ventrally and the tonsils of the cerebellum laterally (Fig. 40.4). The tonsillar branches of each posterior inferior cerebellar artery are landmarks identifying the midline and tonsillar vallecula. The endoscope is gently advanced toward the foramen of Magendie by using minute back-and-forth motions and continuous irrigation to dissect the fine arachnoid bands that are normally present. Often the cyst may be visibly protruding out of the foramen of Magendie.

Endoscopic Management of Intraventricular Cysticercosis

Fig. 40.7. Artist’s illustration showing the surgical corridor and endoscopic route for removal of a fourth ventricle cysticercal cyst. A midline durotomy is made between the opisthion and the posterior arch of C1. A flexible endoscope traverses the foramen of Magendie so that a transendoscopic grasping instrument can be used to retrieve the cyst.

The endoscope is advanced slowly by using the same dissection technique until the floor of the fourth ventricle is seen. The degree of arachnoidal scarring may vary from minor to near complete occlusion of the fourth ventricular outlet. If a thickened arachnoid membrane is encountered, it can be fenestrated using the straight end of a vascular guide wire (diameter: 0.81mm/0.032 inch) passed down the working channel of the endoscope. A No. 3 French embolectomy balloon catheter can then be used to expand the small perforation made by the guide wire and, thereby, gain access to the fourth ventricle.

407

Once in the fourth ventricle, the cysticercal cyst is easily recognized. The endoscope is then used to inspect the relation of the entire cyst with the ependymal wall and the choroid plexus. The continuous irrigation and the mechanical presence of the endoscope help to separate the cyst wall from the ependymal wall and the choroid plexus. Once it is confirmed that the cyst is not inseparably adherent to an ependymal surface, the transendoscopicgrasping instrument is advanced down the working channel of the endoscope. After grasping the cyst wall, the grasping instrument is pulled back until the cyst is approximately 5 mm from the distal tip of the endoscope. It is important to retain visualization of the surrounding fourth ventricular surfaces. No attempt is made to withdraw the cyst through the working channel of the endoscope. The anaesthetist is asked to perform a gentle and sustained Valsalva manoeuvre (to approximately 30 mmHg airway pressure) while the endoscope is carefully backed out and withdrawn from the dural opening. The cyst is maintained just beyond the distal end of the endoscope and placed into a specimen cup. If the cyst wall tears, some spillage of the contents of the cyst into the fourth ventricle or the subarachnoid space may occur. In such cases, the grasper is reapplied and the withdrawal technique repeated until the entire cyst is removed. The endoscope is navigated back into the fourth ventricle, and additional cysts, if present, are removed using the aforementioned technique. Once all cysts are removed, the fourth ventricle is inspected a final time (Fig. 40.4), and irrigation is continued until any cloudiness of the ventricular fluid has cleared. The dural opening is closed using interrupted No. 4-0 nylon sutures in a watertight fashion. The wound is closed in layers using absorbable synthetic suture in a routine manner. A course of prophylactic antibiotics and low dose dexamethasone (4 mg every 6 h) is continued for 24 h.

Results Success in removal of cysts In our experience of 17 patients, we have had a 94% success rate in removing cysticercal

408

M. Bergsneider and J.H. Nieto

cysts endoscopically. In one case, a cyst in lateral ventricle could not be removed owing to ependymal adhesions. One fourth ventricular approach had to be aborted due to excessive arachnoidal scarring at the foramen of Magendie that did not allow entry into the fourth ventricle with the endoscope. In this case, conversion to a standard microscopic suboccipital craniectomy was required. Despite this exposure, the fourth ventricle cysts found were too adherent to be removed. One exploration of the third ventricle was negative. In retrospect, the MRI proton density abnormality was reinterpreted as a flow artefact.

Success in avoiding a CSF shunt In one study by the senior author, seven out of ten (70%) patients that underwent endoscopic resection of lateral and third ventricular cysts did not require a CSF shunt after surgery26. In this study, 30% of the patients underwent a third ventriculostomy in addition to cyst removal to treat an acquired aqueductal stenosis. Four patients had a septum pellucidotomy to evaluate the opposite lateral ventricle for the presence of cysts. In one of these four patients, the septum pellucidotomy was performed to alleviate unilateral hydrocephalus. For patients who had fourth ventricular cysts removed, avoidance of a CSF shunt depended upon the degree of arachnoiditis in the basal cisterns. To date, four out of seven patients with fourth ventricular cysts have required CSF shunt. One of the four patients had a shunt placed at a different hospital before the endoscopic procedure. The other three needed a CSF shunt after the endoscopic removal of the cyst failed to alleviate the hydrocephalus.

Complications Neuroendoscopy is a very safe procedure provided that appropriate techniques and equipment are used. In our experience of 17 patients, two have suffered an increased neurological deficit after surgery. The first patient had mild, temporary left pronator drift following a biportal endoscopic approach to a cysticercal cyst in the roof of the third ventricle. The aetiology of the hemiparesis was not apparent upon neuroimaging studies. A second patient had a waxing and waning mental status after multiple surgeries to remove a total of 156 cysts from all of the ventricles26. He had had multiple bouts of hydrocephalus from shunt failures, each one prompting an endoscopic exploration. One patient had a deep venous thrombosis 2 weeks after the endoscopic procedure26. Pneumocephalus has been an infrequent occurrence following the endoscopic approach to the fourth ventricle. In our experience, even though rupture of the cyst is not uncommon, we have not experienced a complication secondary to rupture of cysts during removal. The use of copious amounts of irrigation and intravenous corticosteroids appears to obviate this complication.

Conclusions The neuroendoscopic management of intraventricular cysticercosis should be considered as the primary treatment whenever possible since it is safe, effective and provides a definitive treatment for this disorder. In addition to avoiding a CSF shunt in many cases, removal of the cyst(s) offers a reduced risk of inflammatory sequelae. Neurosurgeons with familiarity and experience with flexible neuroendoscopes should find these cases straightforward and highly gratifying.

References 1. Zee, C.S., Segall, H.D., Apuzzo, M.L., et al. (1984) Intraventricular cysticercal cysts: further neuroradiologic observations and neurosurgical implications. American Journal of Neuroradiology 5, 727–730. 2. Apuzzo, M.L., Dobkin, W.R., Zee, C.S., et al. (1984) Surgical considerations in treatment of intraventricular cysticercosis. An analysis of 45 cases. Journal of Neurosurgery 60, 400–407. 3. Del Brutto, O.H., Sotelo, J., Roman, G.C. (1993) Therapy for neurocysticercosis: a reappraisal. Clinical Infectious Diseases 17, 730–735.

Endoscopic Management of Intraventricular Cysticercosis

409

4. Del Brutto, O.H., Sotelo, J. (1988) Neurocysticercosis: an update. Reviews of Infectious Diseases 10, 1075–1087. 5. Colli, B.O., Martelli, N., Assirati Junior, J.A., et al. (1994) Cysticercosis of the central nervous system. I. Surgical treatment of cerebral cysticercosis: a 23 years experience in the Hospital das Clinicas of Ribeirao Preto Medical School. Arquivos de Neuropsiquiatria 52, 166–186. 6. Lobato, R.D., Lamas, E., Portillo, J.M., et al. (1981) Hydrocephalus in cerebral cysticercosis. Pathogenic and therapeutic considerations. Journal of Neurosurgery 55, 786–793. 7. Pittella, K.E. (1977) Neurocysticercosis. Brain Pathology 7, 681–693. 8. Estanol, B., Kleriga, E., Loyo, M., et al. (1983) Mechanisms of hydrocephalus in cerebral cysticercosis: implications for therapy. Neurosurgery 13, 119–123. 9. Sotelo, J., Marin, C. (1987) Hydrocephalus secondary to cysticercotic arachnoiditis. A long-term follow-up review of 92 cases. Journal of Neurosurgery 66, 686–689. 10. Colli, B.O., Martelli, N., Assirati, J.A., Jr, et al. (1986) Results of surgical treatment of neurocysticercosis in 69 cases. Journal of Neurosurgery 65, 309–315. 11. Cuetter, A.C., Garcia-Bobadilla, J., Guerra, L.G., et al. (1997) Neurocysticercosis: focus on intraventricular disease. Clinical Infectious Diseases 24, 157–164. 12. Sandoval, M., Madrazo, I., Garcia-Renteria, J.A., et al. (1990) Obstruction on the ventricular catheter of a CSF shunt system due to the own cyst of Taenia solium. Archivos de Investigation Medica 21, 95–98. 13. Couldwell, W.T., Zee, C.S., Apuzzo, M.L. (1991) Definition of the role of contemporary surgical management in cisternal and parenchymatous cysticercosis cerebri. Neurosurgery 28, 231–237. 14. Duplessis, E., Dorwling-Carter, D., Vidaillet, M., et al. (1988) Intraventricular neurocysticercosis. Apropos of 3 cases. Neurochirurgie 34, 275–279. 15. Madrazo, I., Sanchez Cabrera, J.M., Leon, J.A. (1979) Pipette suction for atraumatic extraction of intraventricular cysticercosis cysts. Technical note. Journal of Neurosurgery 50, 531–532. 16. Madrazo, I., Garcia-Renteria, J.A., Sandoval, M., et al. (1983) Intraventricular cysticercosis. Neurosurgery 12, 148–152. 17. Loyo, M., Klergia, E., Estanol, B. (1980) Fourth ventricular cysticercosis. Neurosurgery 7, 456–458. 18. Martinez, H.R., Rangel-Guerra, R., Arredondo-Estrada, J.H., et al. (1995) Medical and surgical treatment in neurocysticercosis: a magnetic resonance study of 161 cases. Journal of the Neurological Sciences 130, 25–34. 19. King, J.S., Hosobuchi, Y. (1977) Cysticercus cyst of the lateral ventricle. Surgical Neurology 7, 125–129. 20. Stern, W.E. (1981) Neurosurgical considerations of cysticercosis of the central nervous system. Journal of Neurosurgery 55, 382–389. 21. Apuzzo, M.L., Chikovani, O.K., Gott, P.S., et al. (1982) Transcallosal, interfornicial approaches for lesions affecting the third ventricle: surgical considerations and consequences. Neurosurgery 10, 547–554. 22. Apuzzo, M.L.J. (1987) Surgery of the Third Ventricle. Williams & Wilkins, Baltimore, Maryland, pp. 369–389. 23. Jeeves, M.A., Simpson, D.A., Geffen, G. (1979) Functional consequences of the transcallosal removal of intraventricular tumours. Journal of Neurology, Neurosurgery and Psychiatry 42, 134–142. 24. Apuzzo, M.L.J. (1993) Brain Surgery: Complication Avoidance and Management. Churchill Livingstone, New York, pp. 541–579. 25. Neal, J.H. (1995) An endoscopic approach to cysticercosis cysts of the posterior third ventricle. Neurosurgery 36, 1040–1043. 26. Bergsneider, M., Holly, L.T., Lee, J.H., et al. (2000) Endoscopic management of cysticercal cysts within the lateral and third ventricles. Journal of Neurosurgery 92, 14–23. 27. Bergsneider, M., Holly, L.T., Lee, J.H., et al. (1999) Endoscopic management of cysticercal cysts within the lateral and third ventricles. Neurosurgery Focus 6: Article 7. 28. Bergsneider, M. (1999) Endoscopic removal of cysticercal cysts within the fourth ventricle. Technical note. Journal of Neurosurgery 91, 340–345. 29. Colli, B.O., Pereira, C.U., Assirati, J.A., Jr, et al. (1993) Isolated fourth ventricle in neurocysticercosis: pathophysiology, diagnosis and treatment. Surgical Neurology 39, 305–310. 30. Couldwell, W.T., Apuzzo, M.L.J. (1989) Management of cysticercosis cerebri. Contemporary Neurosurgery 19, 1–6. 31. De, Morais-Rego, S.F., Latuf, N.L. (1978) Cysticercosis of the fourth ventricle simulating a posterior fossa neoplasm in cerebral scintillography. Report of a case. Aquivos de Neuropsiquiatria 36, 371–374. 32. Koziarski, A., Kroh, H., Olszeqski, E. (1992) A case of cysticercosis of the IV cerebral ventricle. Neurologia i Neurochirurgia Polska 26, 115–120.

410

M. Bergsneider and J.H. Nieto

33. Loyo-Varela, M., del Valle-Robles, R., Guinto-Balanzar, G., et al. (1996) Infestations and the fourth ventricle: Cysticercosis. In: Cohen, A.R. (ed) Surgical Disorders of the Fourth Ventricle. Blackwell Science, Cambridge, Massachusetts, pp. 397–411. 34. Madrazo, I., Flisser, A. (1993) Cysticercosis. In: Apuzzo, M.L.J. (ed.) Brain Surgery: Complication Avoidance and Management, Vol. 2. Churchill Livingstone, New York, pp. 1419–1430. 35. Bergsneider, M. (1999) Endoscopic removal of cysticercal cysts within the fourth ventricle: technique and results. Neurosurgery Focus 6: Article 8. 36. Estanol, B., Corona, T., Abad, P. (1986) A prognostic classification of cerebral cysticercosis: therapeutic implications. Journal of Neurology, Neurosurgery and Psychiatry 49, 1131–1134. 37. Couldwell, W.T., Chandrasoma, P., Apuzzo, M.L., et al. (1995) Third ventricular cysticercal cyst mimicking a colloid cyst: case report. Neurosurgery 37, 1200–1203. 38. Loyo-Verela, M. (1997) Surgical treatment of cerebral cysticercosis. European Neurology 37, 129–130. 39. Bergsneider, M. (1997) Transendoscopic instrumentation and techniques. In: King, W.A., Frazee, J.G., De Salles, A.A.F. (eds) Endoscopy of the Central and Peripheral Nervous System. Thieme, New York, pp. 16–22.

41

Control of Taenia solium with Emphasis on Treatment of Taeniasis James C. Allan, Philip S. Craig and Zbiginew S. Pawlowski

Introduction Taenia solium is susceptible to control at several points in its life cycle (reviewed in Chapter 1)1. Although other hosts can be infected with one stage or the other, either experimentally or naturally, man is the sole natural definitive host and domesticated swine represent the main intermediate host for this cestode. In comparison with many other parasitic zoonoses, this theoretically leaves the parasite particularly amenable to control1. Indeed, having formerly been much more widespread, the parasite has disappeared from much of Europe2. This elimination has been achieved horizontally over several decades through a number of means that included general improvements in sanitation and hygiene, as well as changes in pig husbandry practices and elimination of infected swine carcasses from the human food chain by rigorous meat inspection. However, the parasite remains endemic throughout much of the developing world where sanitary conditions are poor and the economy weak. As described elsewhere in this book this imposes a huge health and socio-economic burden on the developing countries. Methods that have been implicated in the reduction or elimination of this parasite from the majority of countries in Western Europe and in the United States,

such as meat inspection, have in contrast been demonstrated to be failing in much of the current endemic area3. Moreover, movement of T. solium tapeworm carriers or infected swine have been shown to have spread the disease from endemic to nonendemic areas causing either periodic localized outbreaks of cysticercosis or establishment of the parasite in new areas such as Irian Jaya, Indonesia4–6. A number of developments mean that new or improved tools can be used in the control of this parasite to supplement more traditional approaches. These include wider public access to news media for the transmission of public health messages; developments in vaccine technology that could result in a safe and effective porcine vaccine and the availability of a number of drugs that are highly efficacious against either the cystic stage in pigs or the adult tapeworm in man7–11. These approaches are reviewed more extensively elsewhere in this book (Chapters 42–44) and a synopsis is provided in Table 41.1. In this chapter we will focus on the possibility of controlling T. solium through mass or focus-oriented treatment of the intestinal tapeworm in humans. This approach should be viewed in the context of one of several potential options that can be used in concert to control parasite transmission; its role may vary according to the local situation.

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

411

Disadvantages ● Pigs in many endemic countries do not go to formal slaughter ● Infected pigs can be diagnosed ante mortem (tongue inspection) and slaughtered outside regulated system to avoid condemnation of carcasses ● Economically difficult in many existing endemic areas

● Improved knowledge does not always result in change of practices ● Inefficient as sole strategy ● Would require repeated interventions for long-term control ● Requires specific infrastructure; not self-sustainable ● Praziquantel should be used with caution in cases of cysticercosis ● Many existing producers in endemic areas do not currently vaccinate against other diseases with high economic impact on swine production ● Vaccines not available now (other than at experimental level) ● Producers often do not treat for other economically important parasites despite economic benefits ● Existing systems of avoiding meat inspection reduce economic advantages

Advantages

● Known contribution to elimination of parasite from several developed countries ● Relatively easy to integrate with meat inspection for several other important diseases

● Known contribution to elimination of parasite from several developed countries ● Provides benefits beyond control of T. solium

● Provides benefits beyond control of T. solium ● New media now widely available

● Highly efficacious drugs available now (some generically produced niclosamide may have low efficacy) ● Demonstrated short-term benefits ● Removes known significant transmission risk

● Long-term protection ● Possible to integrate with existing veterinary and/or pig husbandry practices ● Provides economic benefit to end user (avoidance of carcass condemnation) ● Compliance monitoring possible (serological testing)

● Drugs available now ● Highly effective ● Producers have economic motivation (avoidance of carcass condemnation) ● Other production benefits: can affect other economically important parasites of swine

Intervention strategy

Elimination of infected pig carcasses (meat inspection)

Improved sanitation, hygiene and pig husbandry

Health education

Treatment of intestinal taeniasis

Vaccination of swine

Chemotherapy of infected swine

Table 41.1. Synopsis of intervention strategies available for Taenia solium taeniasis–cysticercosis.

412 J.C. Allan et al.

Control of T. solium via Treatment of Taeniasis

Epidemiological Characteristics of T. solium Infection Since humans constitute the sole natural definitive host of the parasite, reduction of the numbers of intestinal infections to a level at which the parasite population is no longer self-sustaining (i.e. the basic reproductive rate falls below one) will lead over time to extinction of the parasite within its host population. Reduction of this parasite population in humans through chemotherapy is a realistic option, especially as effective, safe and inexpensive taeniacidal drugs are readily available. Identification of ‘hot spots’ of human or porcine cysticercosis and of intestinal T. solium taeniasis can point to areas or populations of high disease risk12. The treatment of T. solium taeniasis cases detected in relation to these foci provides an opportunity to interrupt localized transmission of the parasite where most of the cases exist13. The kind of data necessary to identify T. solium foci can be obtained either through passive or active surveillance12. The approach taken will vary depending on the existing epidemiological and epizootiological situation and the medical or veterinary health infrastructure present. Targeting treatment specifically at individual cases of taeniasis is, however, not easy. T. solium infected individuals are not easy to diagnose, symptomatology is non-specific, and a large number of infected individuals may be unaware of their infection14. As discussed elsewhere in this book (Chapter 33), traditional parasitological methods for diagnosis lack sensitivity. More modern immunological or molecular approaches, while overcoming some of the drawbacks of traditional methods, have not been applied on a large scale and are expensive14–16. The epidemiological characteristics of taeniasis–cysticercosis also present some issues with respect to the targeting of treatment. Identification of foci of taeniasis– cysticercosis may be easier than finding individual cases. Risk of infection with human cysticercosis has been shown both in endemic and in non-endemic areas, to be closely associated with the presence of T. solium tape-

413

worm carriers within the household or immediate environment17–22. The epidemiology of porcine infection is complicated, being strongly affected by husbandry practices, specifically the degree of access to human faeces, within endemic communities23–25. Intestinal T. solium prevalence is generally low ( 5%), even in communities considered highly endemic. Some, but not all, studies have indicated that females carry a slightly greater risk of infection than males26–28 and overall prevalence can vary greatly within relatively small areas28. Surprisingly, little information is available on the age prevalence of the intestinal stage, and although some age groups may be at higher risk than others, the effect is not particularly pronounced. For instance, Guatemalan and Ecuadorian studies both indicate that children of 4 years of age or less have the lowest rates of infection while adults have the highest rates27,28. There is an increased occupational risk amongst certain groups such as pork vendors29. Although taeniasis infection appears to cluster within families, the degree of clustering is such that risk in family members of indicator cases may only be slightly higher than that of the general population27,28. Furthermore, although both porcine and human cysticercosis may cluster within households or localities, the degree of clustering means that there remains a substantial number of intestinal infections outside such clusters. Targeting of clusters alone may therefore leave significant numbers of cases untreated. From the viewpoint of population-level control, the epidemiology of the intestinal stage indicates that, although it may be possible to identify risk groups within a population, it may be difficult to identify all individuals within those populations that can be targeted for treatment. This is distinct from some of the intestinal geohelminths such as Ascaris, where school-age children are known to be at high risk of infection and where targeted treatment, of this relatively accessible population, has been shown to significantly influence overall transmission within the entire population30,31. To detect sufficient taeniasis cases would require the application of a large-scale, active surveillance system and this would be rela-

414

J.C. Allan et al.

tively expensive if manageable at all. Work of this nature has been undertaken in China, where T. solium taeniasis–cysticercosis is highly endemic throughout most of the country12. Several interventions that have included mass targeted treatment have been undertaken there, but the results have not been formally published outside the local prefectural public health bureaus. For example, a T. solium ‘elimination programme’ was undertaken by the AntiEpidemic Station of Wujiang County, Zhangye Prefecture in north-central Gansu Province in 1978 when the baseline rate of human taeniasis was 1512 per 100,000 for the county. A total of 312 T. solium carriers were identified after purgative treatment using the traditional medicines of areca nut and pumpkin seed extract. The porcine cysticercosis rate was 7.7%. Following biannual targeted treatment of carriers (including use of praziquantel from 1983) in conjunction with emphasis on confining or restraining pigs by tying and health education propaganda in the media, the incidence of human taeniasis was officially reported to have reduced to 21 per 100,000, and the porcine rate to 0.27%, by 1988 (X. Lie, Y. Zhang, Zhanyi, Gansu, China, and P.S. Craig, unpublished observations). Since the above outlined approach requires a great deal of effort in the identification of T. solium carriers, control through mass untargeted treatment of entire highrisk populations has been promoted and undertaken on an experimental basis. These studies have used low-cost, yet highly efficacious drugs, where the cost of population-based treatment is lower than the cost of diagnosis and treatment followup of carriers. It should be noted that this approach might also be applicable outside endemic areas in relation to the treatment of high-risk groups such as immigrant populations moving from endemic areas to non-endemic areas32. From a public health standpoint, however, there is the opportunity to reduce transmission of T. solium at a local level through trace-back of cases of taeniasis and neurocysticercosis (NC) diagnosed clinically to their family and immediate contacts. The clus-

tered nature of these infections means that there is an increased likelihood of detecting another case of T. solium within the contact group. Such cases, particularly tapeworm carriers, are clearly important to treat from a disease management and transmission standpoint. A number of studies have demonstrated that the presence of a case of taeniasis within the household is a significant risk factor for cysticercosis17,19–22. Similarly cases of taeniasis are significantly more likely to have cysticercosis; data even suggest that they will tend to have higher cyst loads22,33. There is, therefore, value in determining whether a case of NC also has taeniasis. Studies in populations with no immediately apparent risk for T. solium have also indicated that trace-back of contacts of NC cases can result in detection of taeniasis cases4,5. The long latency period from initial infection with NC to the onset of symptoms may reduce the chances of detecting the case of taeniasis that caused the NC infection but, given the clustered nature of NC, trace-back may also allow diagnosis of other NC cases that may benefit from case management34,35. For these reasons, from the standpoints of preventive medicine and that of improved case management, there is value in following up contacts of T. solium cases diagnosed in the clinical setting.

Chemotherapeutic Agents Two anthelminthics, praziquantel and niclosamide, are currently both indicated and widely available for treatment of human intestinal taeniasis. Both are recommended for treatment of intestinal T. solium infection as a single oral dose with efficacy greater than 90%9,36.

Praziquantel Praziquantel is an acylated isoquinolinepyrazine discovered jointly by E. Merck and Bayer AG in 19729. This molecule has a wide spectrum, being active in man against both trematodes and cestodes, including both larval and adult T. solium. The approved therapeutic

Control of T. solium via Treatment of Taeniasis

dose for intestinal T. solium is 5–10 mg kg1 bodyweight. It should be noted that with the available 150 mg tablets the given doses are approximate mg kg1 values. The molecule has a half-life of only a few hours in man and thus does not have any prophylactic effect. The molecule increases calcium permeability in cestodes and flukes leading to muscle contraction, paralysis and death. The drug is very bitter and can cause gagging if bitten or chewed during administration. Praziquantel is very well tolerated in humans and cheap (as little as US$0.20 per treatment)9.

Niclosamide Niclosamide is a halogenated salicylanilide first patented by Bayer AG in 195936. This drug has activity against a variety of intestinal cestodes of man including T. solium. The molecule is not absorbed after oral administration. Its anthelminthic action is either through inhibition of oxidative phosphorylation or by stimulating ATPase. The recommended dose is 2 g in adults, 1 g in children of 11–34 kg and 1.5 g in children over 34 kg. The tablet should be chewed36. As with any drug, the recommended storage conditions and shelf-life should be carefully adhered to. It is known that polymerization occurring through long-term storage can lower drug efficacy. This has been seen with some generically produced niclosamide.

Benzimidazoles A number of other older drugs are known to be efficacious against cestodes but, generally because of poorer efficacy or adverse side effects, they are not now widely used36. Further to this, some of the benzimidazoles, including albendazole, are known to be efficacious against cestodes but generally require administration over 3 consecutive days and appear to have lower efficacy against intestinal taeniids than either niclosamide or praziquantel37,38. The benzimidazoles are, however, also active against a broad spectrum of gastrointestinal helminths including hookworm, Trichuris and Ascaris.

415

Suitability of anthelminthic agents for mass chemotherapy Of the two main drugs dealt with here, praziquantel may be cheaper than niclosamide (by a factor of five times or more). The efficacy of this molecule at its indicated dose also appears to be somewhat higher than that of niclosamide and it is becoming easier to obtain. An early report indicated that praziquantel could be effective against Taenia sp. taeniasis in doses of 2.5 mg kg1 for purposes of control programmes where cost may be an issue39. Indeed, earlier work on the therapeutic efficacy of the molecule suggested that this dose was highly effective against the parasite9. Recently it has, however, been recommended that the drug be used at a higher recommended dose of 10 mg kg1 40. In addition there is a possibility that praziquantel, even at the low dose used to treat taeniasis, may occasionally cause complications, such as cerebral inflammation in individuals with NC, through its anticysticercal properties. Such a possibility, which was not linked to praziquantel treatment with absolute certainty, has been reported in a female, subsequently shown to harbour numerous intracerebral cysticerci, who developed severe headache within 24 h of treatment with 5 mg kg1 praziquantel, a condition that lasted for approximately 10 days41. Indeed the manufacturer’s label for praziquantel frequently includes warnings with respect to the drug use in individuals with T. solium cysticercosis, especially ocular cysticercosis. Niclosamide does not act against the cystic stage and thus would not cause such potential complications. Safety of niclosamide has, however, not been tested during pregnancy and the drug is contraindicated with alcohol. With both drugs, control intervention programmes should consider the possibility of adverse drug reactions occurring and have mechanisms in place for monitoring for their occurrence and dealing with any that occur. Therefore, there are a number of factors including cost, ease of administration, availability, efficacy, stability and possible contraindications that should be considered when a decision is being made as to which molecule is appropriate in the circumstances of particular mass treatment programmes.

416

J.C. Allan et al.

Experimental Control Interventions A relatively small number of trials have been carried out using mass chemotherapy as a control intervention against T. solium. The majority have involved the use of praziquantel although one has involved niclosamide18,27,40,42,43. These trials have varied in size, from a few hundred individuals up to several thousand. Although most have indicated beneficial effects on levels of T. solium infection following the intervention18,27,40,42 this has not always been the case43. Most of these studies have involved follow-up assessments of within approximately 1 year after the intervention, but one study involved assessment at 42 months after the intervention40. A variety of measures have been used to assess the outcome of these mass treatment studies. These have included analysis of rates of human taeniasis, serological rates of human cysticercosis, incident cases of late onset epilepsy and rates of porcine cysticercosis. It is generally agreed that rates of swine cysticercosis are the most sensitive indicator of environmental contamination with T. solium and hence the presence of tapeworm carriers in the locality27,44. The relatively short lifespan of pigs in rural communities also means that they act as good indicators of recent levels of infection and are useful for the follow-up of interventions27,44. This contrasts with the situation with human cysticercosis where, at any one time during short-term follow-up of an intervention, most cases in a community are probably existing long-term cases, infected before the intervention. Although comparison of recent incident cases of late-onset epilepsy has been shown to be a useful variable in the analysis of the effects of control interventions, the rates of this are comparably low and the costs involved in detecting cases are comparatively high40. Detection of new cases of human taeniasis has, however, proved useful in assessing the effects of intervention19,27,29,40,42. A difficulty that is faced in the assessment of mass treatment interventions is that there have often been substantial changes in other factors that influence infection levels. Some of these, such as health education, have actually been part of the study protocol28,42.

Others, such as changes in knowledge, attitudes and practices for T. solium taeniasis–cysticercosis may be indirect consequences of the work carried out during the intervention. In both cases, these will alter the risk of infection. This should be taken into account when the results are interpreted. Other changes can occur that, while not associated with the studies themselves, can have significant implications for the interpretation of their results. Indeed, in Mexico, long-term (42 month) follow-up evaluation of a chemotherapeutic intervention with praziquantel indicated that the percentage of individuals in the target community with access to a latrine had approximately doubled over the period and the rate of outdoor defecation declined by around 25%. Additionally the proportion of pigs with access to human faeces declined from 26% to 7%42. Access of pigs to human faeces has been shown to be a substantial risk factor for infection24,25. These changes are likely therefore to have considerably altered taeniasis–cysticercosis transmission patterns independent of the chemotherapeutic intervention. Clearly, collection of reliable baseline data in relation to both parasitological and socio-economic factors is vital prior to embarking on a control intervention. Bearing the above outlined points in mind, however, as stated previously, a beneficial outcome has been indicated in the majority of mass chemotherapeutic control interventions in Latin America. A large study in Ecuador, involving treatment of over 10,000 people in two provinces with praziquantel at approximately 5 mg kg1 led to a significant shortterm decline in the prevalence of intestinal taeniasis and porcine cysticercosis (the latter from 11.4% before the intervention to 2.6% after 1 year)27. Another study in Mexico indicated a 100% reduction in the number of taeniasis cases 1 year after an intervention involving treatment of 339 people with 10 mg kg1 praziquantel18. In this case, however, the initial prevalence of taeniasis had been 1.32% and the small sample size meant that the reduction in taeniasis rate following chemotherapy was not significant. In contrast, a different study involving approximately 1500 people in another area of Mexico actually detected an

Control of T. solium via Treatment of Taeniasis

approximate doubling in the rate of infection in pigs, 1 year after chemotherapy (from 6.6% to 11%)43. This study, which had also involved health education, did, however, show good levels of knowledge about the parasite among school-age children 2 years after the intervention43. A longer term Mexican study, designed to test the effects of mass treatment alone, without health education or other strategies, indicated significant improvements in several indicators for infection over both short term (6 months) and long-term (42 months) postintervention periods. The longer term results in that study may, as discussed previously, have been due to concomitant socio-economic changes in the community. The study also indicated that use of a 5 mg kg1 dose of praziquantel may not be suitably efficacious in such interventions (having achieved only 67% efficacy) and recommended a higher dose of 10 mg kg1 40. Furthermore, this study also suggested that a case of, previously undiagnosed, NC might have had neurological symptoms induced by the praziquantel treatment41. Only one Taenia mass treatment study has been carried out using niclosamide. This study, carried out in two Guatemalan communities and involving treatment of over 1500 people, indicated that both tapeworm prevalence (from 3.5% to 1%) and the rate of cysticercosis seroprevalence in pigs (from 55% to 7%) were substantially reduced 10 months after intervention. The incidence of new cases of taeniasis detected over the 10 months of the study indicated that it would probably take several years for the rate of taeniasis to return to baseline. No specific health education was given during the study period42. In none of these mass treatment studies was treatment coverage complete. Typically, between 75% and 87% of the target populations were treated. The practicalities of treating 100% of a population are very difficult. Besides a rate of treatment refusal within the target communities, there are other problems, for example, niclosamide is not indicated for use during pregnancy. Furthermore, problems of contacting all individuals at the time of an intervention will occur as studies have indicated that there are significant levels of travel out of endemic communities27,28.

417

Remaining Issues and Sustainability Chemotherapy of T. solium taeniasis either on a mass or a targeted basis is clearly an option to be considered in short-term strategies designed at controlling this parasite. The elimination of taeniasis–cysticercosis is a long-term process, which cannot be based on chemotherapy alone. Mass chemotherapeutic treatment of tapeworm carriers, combined with health education, has been successfully applied in the control of other zoonotic cestodes, such as Echinococcus granulosus (where dogs were treated)45. Whether the approach is cost-effective with regard to T. solium remains open to question. Only a small number of studies have been carried out and, although most report a reduction in transmission situation following the intervention, they still leave a number of questions to be answered. Unlike the situation with canine taeniids (such as E. granulosus), the behaviour and practices of both the definitive host (man) and intermediate host (pig) of T. solium are highly variable12. For instance, rates of open-air defecation and pig husbandry practices both vary within endemic areas at any one time and often change over time. Alterations in these have implications not only for T. solium infection rates but also for other infectious diseases. Thus strategies involving improved health education, hygiene and pig husbandry have public health and socio-economic implications beyond T. solium. The tools for monitoring the success of intervention are now increasingly becoming available. For instance, a variety of diagnostic tools for baseline and surveillance use in both humans and pigs have become available over recent years14,46,47. These make determining the rates of infection in a population easier than before. Epidemiological studies have improved our knowledge of T. solium and its transmission within endemic communities. Taking all these factors into account, therefore we are now in an improved situation with respect to being able to assess the need for and implications of a control programme.

418

J.C. Allan et al.

Conclusions The long-term sustainability of an intervention programme is important if it is to be successful. The chemotherapeutic intervention studies described here have tended to indicate short-term improvements in taeniasis–cysticercosis indicators. Integration of this approach with others, such as health education, may make these interventions more sustainable. Health education will also help to make such interventions more acceptable to target communities and lead

to changes in practices that could have significant impact on T. solium transmission. There is the possibility of further integration with other prevention and control strategies, such as vaccination or chemotherapy of swine, which could potentially have direct economic benefits within the target communities and thus may be self-sustainable. No comprehensive studies looking at the sustainability of various intervention strategies or their cost–benefit ratio and cost-effectiveness have, however, been reported.

References 1. Centers for Disease Control and Prevention. (1993) Recommendations of the International Task Force for Disease Eradication. Morbidity Mortality Weekly Report 42, 1–27. 2. Schantz, P.M., Cruz, M., Sarti, E., et al. (1993) Potential eradicability of taeniasis and cysticercosis. Bulletin of the Pan American Health Organization 27, 397–403. 3. Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the sierra of Peru. Bulletin of the World Health Organization 71, 223–228. 4. Schantz, P.M., Moore, A.C., Munoz, J.L., et al. (1992) Neurocysticercosis in an Orthodox Jewish community in New York City. New England Journal of Medicine 327, 692–695. 5. Moore, A.C., Lutwick, L.I., Schantz, P.M., et al. (1995) Seroprevalence of cysticercosis in an Orthodox Jewish community. American Journal of Tropical Medicine and Hygiene 53, 439–442. 6. Wandra, T., Subahar, R., Simanjuntak, G.M., et al. (2000) Resurgence of cases of epileptic seizures and burns associated with cysticercosis in Assologaima, Jayawijaya, Irian Jaya, Indonesia, 1991–95. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 46–50. 7. Sarti, E., Flisser, A., Schantz, P.M. (1997) Development and evaluation of a health education intervention against Taenia solium in a rural community in Mexico. American Journal of Tropical Medicine and Hygiene 56, 127–132. 8. Lightowlers, M.W. (1999) Eradication of Taenia solium cysticercosis: a role for vaccination of pig. International Journal of Parasitology 29, 811–817. 9. Andrews, P., Thomas, H., Pohlke, R., et al. (1983) Praziquantel. Medical Research Reviews 3, 147–200. 10. Gonzalez, A.E., García, H.H., Gilman, R.H., et al. (1996) Effective, single dose treatment of porcine cysticercosis with oxfendazole. American Journal of Tropical Medicine and Hygiene 54, 391–394. 11. Kramer, L.D. (1990) Anthelminthic therapy for neurocysticercosis. Archives of Neurology 47, 1059–1160. 12. Craig, P.S., Rogan, M., Allan, J.C. (1996) Detection, screening and community epidemiology of taeniid zoonoses: cystic echinococcosis, alveolar echinococcosis and neurocysticercosis. Advances in Parasitology 38, 169–250. 13. Pawlowski, Z.S. (1991) Control of Taenia solium taeniasis and cysticercosis by focus-oriented chemotherapy of taeniasis. Southeast Asian Journal of Tropical Medicine and Public Health 22, 284–286. 14. Allan, J.C., Velasquez Tohom, M., Torres Alvarez, R., et al. (1996) Field trial of diagnosis of Taenia solium taeniasis by coproantigen enzyme linked immunosorbent assay. American Journal of Tropical Medicine and Hygiene 54, 352–356. 15. Wilkins, P.P., Allan, J.C., Verastegui, M., et al. (1999) Development of a serologic assay to detect Taenia solium taeniasis. American Journal of Tropical Medicine and Hygiene 60, 199–204. 16. Chapman, A., Vallejo, V., Mossie, K.G., et al. (1995) Isolation and characterization of species-specific DNA probes from Taenia solium and Taenia saginata and their use in an egg detection assay. Journal of Clinical Microbiology 33,1283–1288. 17. Diaz Camacho, S., Candil Ruiz, A., Uribe Beltran, M., et al. (1990) Serology as an indicator of Taenia solium tapeworm infections in a rural community in Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene 84, 563–566.

Control of T. solium via Treatment of Taeniasis

419

18. Diaz Camacho, S.P., Candil Ruiz, A., Suate Peraza, V., et al. (1991) Epidemiologic study and control of Taenia solium infections with praziquantel in a rural village of Mexico. American Journal of Tropical Medicine and Hygiene 45, 522–531. 19. Sarti-Gutierrez, E.J., Schantz, P.M., Lara-Aguilera, R., et al. (1988) Taenia solium taeniasis and cysticercosis in a Mexican village. Tropical Medicine and Parasitology 39, 194–198. 20. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1992) Prevalence and risk factors for Taenia solium taeniasis and cysticercosis in humans and pigs in a village in Morelos, Mexico. American Journal of Tropical Medicine and Hygiene 46, 677–685. 21. Sarti, E., Schantz, P.M., Plancarte, A., et al. (1994) Epidemiological investigation of Taenia solium taeniasis and cysticercosis in a rural village of Michoacan state, Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene 88, 49–52. 22. Garcia-Noval, J., Allan, J.C., Fletes, C., et al. (1996) Epidemiology of Taenia solium taeniasis and cysticercosis in two rural Guatemalan communities. American Journal of Tropical Medicine and Hygiene 55, 282–289. 23. Sarti, E., Schantz, P., Aguilera, J., et al. (1992) Epidemiologic observations on porcine cysticercosis in a rural community of Michoacan State, Mexico. Veterinary Parasitology 41, 195–201. 24. Rodriguez-Canul, R., Allan, J.C., Dominguez, J.L., et al. (1998) Application of an immunoassay to determine risk factors associated with porcine cysticercosis in a rural area of Yucatan, Mexico. Veterinary Parasitology 79, 165–180. 25. Widdowson, M.A., Cook, A.J., Williams, J.J., et al. (2000) Investigation of risk factors for porcine Taenia solium cysticercosis: a multiple regression analysis of a cross-sectional study in the Yucatan Peninsula, Mexico. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 620–624. 26. Richards, F.O., Jr, Schantz, P.M., Ruiz-Tiben, E., et al. (1985) Cysticercosis in Los Angeles County. Journal of the American Medical Association 254, 3444–3448. 27. Cruz, M., Davis, A., Dixon, H., et al. (1989) Operational studies on the control of Taenia solium taeniasis/cysticercosis in Ecuador. Bulletin of the World Health Organization 67, 401–407. 28. Allan, J.C., Velasquez Tohom, M., Garcia Noval, J., et al. (1996) Epidemiology of intestinal taeniasis in four rural Guatemalan communities. Annals of Tropical Medicine and Parasitology 90, 157–165. 29. García, H.H., Araoz, R., Gilman, R.H., et al. (1998) Increased prevalence of cysticercosis and taeniasis among professional fried pork vendors and the general population of a village in the Peruvian highlands. American Journal of Tropical Medicine and Hygiene 59, 902–905. 30. Bundy, D.A., Wong, M.S., Lewis, L.L., et al. (1990) Control of geohelminths by delivery of targeted chemotherapy through schools. Transactions of the Royal Society of Tropical Medicine and Hygiene 84, 115–120. 31. Chan, L., Kan, S.P., Bundy, D.A. (1992) The effect of repeated chemotherapy on age-related predisposition to Ascaris lumbricoides and Trichuris trichura. Parasitology 104, 371–377. 32. Schantz, P.M., Wilkins, P.P., Tsang, V.C.W. (1998) Immigrants, imaging and immunoblots: the emergence of neurocysticercosis as a significant public health problem. In: Scheld, W.M., Craig, W.A., Hughes, J.M. (eds) Emerging Infections, Vol. 2. ASM Press, Washington, DC, pp. 213–242. 33. Gilman R.H., Del Brutto, O.H., García H.H., et al. (2000) Prevalence of taeniasis among patients with neurocysticercosis is related to severity of infection. Neurology 55, 1062. 34. Gracia, F., Chavarria, R., Archbold C., et al. (1990) Neurocysticercosis in Panama: preliminary epidemiologic study in the Azuero region. American Journal of Tropical Medicine and Hygiene 42, 67–69. 35. Singh, G., Ram, S., Kaushal, V., et al. (2000) Risk of seizures and neurocysticercosis in household family contacts of children with single enhancing lesions. Journal of the Neurological Sciences 176, 131–135. 36. Campbell, W.C. (1986) The chemotherapy of parasitic infections. Journal of Parasitology 72, 45–61. 37. de Kaminsky, R.G. (1991) Albendazole treatment in human taeniasis. Transactions of the Royal Society of Tropical Medicine and Hygiene 85, 648–650. 38. Chung, W.C., Fan, P.C., Lin, C.Y., et al. (1991) Poor efficacy of albendazole for the treatment of human taeniasis. International Journal of Parasitology 21, 269–270. 39. Pawlowski, Z.S. (1990) Efficacy of low doses of praziquantel in taeniasis. Acta Tropica 48, 83–88. 40. Sarti, E., Schantz, P.M., Avila, G., et al. (2000) Mass treatment against human taeniasis for the control of cysticercosis: a population-based intervention study. Transactions of the Royal Society of Tropical Medicine and Hygiene 94, 85–89. 41. Flisser, A., Madrazo, I., Plancarte, A., et al. (1993) Neurological symptoms in occult neurocysticercosis after single taeniacidal dose of praziquantel. Lancet 342, 748.

420

J.C. Allan et al.

42. Allan, J.C., Velasquez-Tohom, M., Fletes, C., et al. (1997) Mass chemotherapy for intestinal Taenia solium taeniasis: effect on prevalence in humans and pigs. Transactions of the Royal Society of Tropical Medicine and Hygiene 91, 595–598. 43. Keilbach, N.M., de Aluja, A.S., Sarti, E. (1989) A programme to control taeniasis–cysticercosis (Taenia solium): experiences in a Mexican village. Acta Leidensia 57, 181–189. 44. Gonzalez, A.E., Gilman, R.H., García, H.H., et al. (1994) Use of sentinel pigs to monitor environmental Taenia solium contamination. American Journal of Tropical Medicine and Hygiene 51, 847–850. 45. Lawson, J.R., Roberts, M.G., Gemmell, M.A., et al. (1988) Population dynamics in echinococcosis and cysticercosis: economic assessment of control strategies for Echinococcus granulosus, Taenia ovis and T. hydatigena. Parasitology 97, 177–191. 46. Tsang, V., Brand, A.J., Boyer, A.E. (1989) An enzyme imunoelectrotransfer blot assay and glycoprotein antigens for diagnosing human Taenia solium cysticercosis. Journal of Infectious Diseases 159, 50–59. 47. Gonzalez, A.E., Cama, V., Gilman, R.H., et al. (1990) Prevalence and comparison of serologic assays, necropsy, and tongue examination for the diagnosis of porcine cysticercosis in Peru. American Journal of Tropical Medicine and Hygiene 43, 194–199.

42

Taenia solium Vaccination: Present Status and Future Prospects Carlton A.W. Evans

Introduction Infection of pig tissues with Taenia solium larvae, and of the human bowel with adult tapeworms, constitute the natural life cycle that is essential for the continuing existence of the parasite. This propagation depends upon evasion or modulation of host immunity ensuring that the adult and larval parasites survive without being overwhelmingly lethal to their hosts and without being destroyed by host immunity. Therefore, the evolution of the parasite would be expected to select parasites that cause minimal interference to host survival and reproduction while maintaining viable infection of human intestines and pig tissues. Similarly, many parasites have evolved mechanisms to protect their hosts from acquiring dangerously heavy parasite loads. The complex immunology of this host–parasite relationship may be modifiable with vaccination, potentially facilitating control of the parasite.

Taeniasis: Immunology and Prospects for Protective Vaccination Because a small number of individuals with tapeworms may infect vast numbers of pigs with cysticercosis over many years,

tapeworm carriers are an appealing target for the control of T. solium1. There is evidence in experimental animal models that the immune response in the definitive host can reject tapeworms or cause them to destrobilate2. Furthermore, epidemiological studies have confirmed that tapeworm reinfection occurs, but human taeniasis invariably involves only a single worm, implying that the presence of one intestinal pork tapeworm may induce immune responses that allow continuing infection while protecting against super-infection3. However, in common with other human cestodes, protective immunity against the adult tapeworm has not been demonstrated and adult tapeworm carriage does not appear to protect against cysticercosis. In addition to the immunological obstacles to developing a vaccine against taeniasis, the occult nature of this infection, which makes tapeworm carriers difficult to detect, and the minimal morbidity associated with this intestinal infection, make taeniasis a poor candidate for human vaccine development. Vaccination against taeniasis does not, therefore, appear to be immunologically or logistically feasible at present. The introduction of oral vaccines derived from transgenic plants may, possibly, modify this situation in the future.

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

421

422

C.A.W. Evans

Overview of the Immune Response To T. solium Cysticercosis

Overview of Cysticercosis Prevention and Control

Immunological tolerance to cysticerci

Cysticercosis is a disease of poverty and social underdevelopment. Human cysticercosis may be controlled by provision of sanitation and treatment of tapeworm carriers. The parasite life cycle may also be broken by preventing human taeniasis by enforcing meat inspection, and adequately freezing or cooking pork. Porcine cysticercosis may be prevented by corralling pigs or by large-scale commercial pig rearing that denies pigs access to human faeces. Such improvements in public health and animal husbandry have led to the virtual eradication of human and porcine cysticercosis in wealthy countries, but these measures are not currently practicable in many developing regions. Indeed, their use in trials in several Latin American countries has produced only transient reductions in cysticercosis prevalence. There is, therefore, a great need for ‘short-cuts’ to economic development, i.e. inexpensive strategies that will interrupt the life cycle of the parasite in the absence of socio-economic development. There is economic incentive for people rearing pigs to utilize cysticercosis control strategies because cysticercotic pigs are of considerably reduced value. It is hoped that an inexpensive vaccine that effectively protects pigs against cysticercosis would be sought after and used by subsistence as well as commercial farmers in endemic areas, because of resultant economic benefits. However, the failure of implementation of the swine cholera vaccine programme in developing countries, including Peru, suggests that considerable publicity, government funding or compulsory vaccination would be required for widespread vaccination by subsistence farmers. An alternative to conventional protective vaccination, which must be administered before exposure to infection, is therapeutic vaccination, which aims to cure or modify the course of established infection as well as strengthening protection against further challenge in the future.

The immunopathogenesis of neurocysticercosis is highly relevant to vaccine design because the immune response to this parasite may be protective, curative or pathogenic. Taenia solium larvae commonly live as ‘accidental’ intermediate hosts for many years without causing symptoms or significant inflammation in humans. Symptomatic disease usually results from failure of this immune tolerance when one or more cysticerci degenerate within the brain. This association between cysticercal degeneration and the onset of symptoms is suggested by: (i) the contrasting appearances of morphologically intact asymptomatic and degenerating symptomatic intracerebral lesions in radioimaging, biopsy or autopsy studies; (ii) the time-course of human infections (disease often occurring years after infection); and (iii) the transient adverse effects that may occur as a result of anticysticercal therapy. The pig is the natural intermediate host for T. solium larvae and the usual absence of illness in infected pigs is remarkable considering that thousands of cysticerci are often scattered throughout neural and other tissues at autopsy. The absence of seizures or other neurological signs in cysticercotic pigs, in contrast to humans with cysticercosis, may be explained by the fact that pigs are slaughtered in their first year of life, before cysticerci degenerate and cause inflammation. Alternatively, T. solium larvae may be able to evade immune recognition more effectively in pigs when compared with humans. Taenia solium larvae therefore usually survive within pig and human tissues without causing symptomatic inflammation, despite the presence of circulating antibodies4. Our understanding of the complex mechanisms involved is central to vaccine design and involves parasite sequestration, concomitant immunity, antigenic masking and active modulation of host immunity. These processes are reviewed in detail in Chapter 2.

Vaccination: Present Status and Future Prospects

Vaccination Against Human Cysticercosis Human protective or therapeutic vaccination to prevent cysticercosis has not been widely considered as an appropriate intervention in endemic regions because little is known about the immunology of human cysticercosis and cysticercosis is generally not considered a public health priority, perhaps because of underdiagnosis. It has been suggested that cysticercosis occurs with greater than expected frequency in immunologically deficient children, but this uncontrolled observation may reflect a chance association or diagnostic bias rather than an effect of immunodeficiency on susceptibility5. Cysticercosis has not been noted to be common in immunosuppressed or immunodeficient adults6. There is, therefore, no evidence of protective immunity against cysticercosis in humans and little prospect of human vaccination against this parasite in the foreseeable future.

Therapeutic Vaccination for Porcine Cysticercosis Therapeutic vaccination is an appealing alternative to protective vaccination for use in endemic areas where cysticercosis is routinely diagnosed ante mortem in pigs by tongue palpation. If therapeutic vaccination led to the disappearance of cysticerci and effective conversion of measly (low-value) pork to normal meat before slaughter, then this intervention would be widely used. The incentive for use would be economic, increasing the financial reward for the pig owner; in addition, parasite transmission would also be interrupted. Therapeutic vaccination may also overcome the problem of free-roaming pigs often being infected in the first few days of life, so protective vaccination before infection occurs may not be feasible7. This is a particularly important concern because there is some evidence that protective vaccination is less effective in young pigs, making it less likely that pigs could be protected from cysticercosis before they become naturally infected8.

423

Cysticerci may be destroyed by immunological intervention. Herbert and Oberg infected nine pigs with cysticercosis at the age of 2 months and reinfected four of these pigs 2 months later9. Paradoxically, autopsy revealed significantly fewer cysticerci in the pigs that had been infected twice, suggesting that reinfection accelerated cysticercus degeneration and absorption. Similarly, reinfection of cows infected with T. saginata and of sheep infected with T. hydatigena caused degeneration of established cysticerci. Deliberate reinfection is clearly not a sustainable intervention, but therapeutic vaccination with cysticercal extracts similarly caused the resolution of cysticercosis in two pigs10. This therapeutic vaccination was then evaluated in a field trial in which the prevalence of porcine cysticercosis fell significantly in two villages when pigs were vaccinated repeatedly11. However, there was no control group and cysticercosis was diagnosed by tongue palpation only. Seven cysticercotic pigs given therapeutic vaccination were studied in more detail and 73% of cysts excised from them failed to evaginate, compared with 5% in seven untreated cysticercotic pigs. In a subsequent randomized, controlled and blinded study, pigs naturally infected with T. solium cysticercosis were inoculated with cysticercal antigen, resulting in a significant reduction in cysticercal viability12. The proportion of cyst that showed no evidence of viability was more than doubled in the group of pigs given crude cysticercal extract and most of these animals developed new enzyme-linked immunoelectrotransfer blot (EITB) bands, confirming an antibody response to the intervention. However, more highly purified cysticercal antigens were less effective and despite treatment with antigen, all pigs remained macroscopically heavily infected and most of the cysticerci in the majority of the treated animals remained viable for causing human disease. The statistically significant effect of therapeutic vaccination on parasite viability illustrates the active nature of the host–parasite interaction and the potential for manipulating this relationship in the treatment of this infection. However, therapeutic vaccines reported so

424

C.A.W. Evans

far have been insufficiently effective to eradicate cysticercosis and protection against reinfection has not been studied.

Protective Vaccination Against Porcine Cysticercosis Vaccination of pigs to prevent porcine cysticercosis is an appealing strategy to improve animal health, meat yield and to break the parasite life cycle, preventing taeniasis and consequently preventing human cysticercosis. Considerable progress has been made in this endeavour, which is reviewed below.

Historical background The complex host–parasite interaction in parasitic infections has traditionally hampered vaccine development, but great progress has been made with immunization against experimental infection with metacestode parasites13. These studies have used a variety of antigens; and among crude parasitic antigens, those derived from the infecting oncosphere stage have generally been the most effective14. The best example of an effective metacestode vaccine is that developed for the prevention of T. ovis15. This recombinant antigen is produced entirely in the laboratory without the need for parasite material and similar vaccines based on the 45W, 45WB/X, 16K and 18K antigens have proved to be 90–100% effective16. Vaccination against infection of cattle with larvae of the beef tapeworm has been attempted with partial success using hatched ova, but limited antigen supply has necessitated the use of recombinant DNA technology for sustainable vaccine production17. Unfortunately, the T. ovis vaccine was not effective against bovine infection with T. saginata, so genes were cloned from T. saginata that express proteins homologous to the host-protective T. ovis antigens. This strategy led to the development of a recombinant vaccine (combined TSA-9 and TSA-18 antigens) that induced up to 99.8% protection against infection with T. saginata eggs18. A similar recombinant T. ovis antigen vaccine has been used successfully to protect pigs from T. solium, as described below19.

Crude vaccines against porcine cysticercosis In laboratory and field studies, a variety of antigens have demonstrated effective partial protection against T. solium challenge and these results are summarized in Fig. 42.1. Molinari et al. showed that vaccination of healthy pigs with antigens derived from whole T. solium cysticerci caused partial protection against the subsequent development of porcine cysticercosis10. A similar (65–75%) degree of protection was achieved in Yorkshire pigs immunized with antigens extracted from the scolices of T. solium cysticerci20. Greater than 99% protection was achieved with chromatographically purified antigens from T. solium scolices, with tenfold greater protection from the first Sephadex peak than the second21. There is considerable antigenic similarity between various Taenia species. A crude antigenic extract from murine T. crassiceps cysts administered to pigs induced 50% protection against subsequent T. solium egg challenge22,23. Approximately 96% protection was achieved with purified protein extracts from T. crassiceps cyst fluid22. As discussed above, many parasites exhibit stage-specific antigens and some studies have utilized T. solium oncosphere antigens to specifically induce an immune response against the infecting stage. The only published study of immunization with oncosphere extracts reported 83–89% protective efficacy with oncosphere extracts19. Likewise, immunization of pigs with excretory–secretory products of T. solium oncospheres caused a decrease in the number of cysticerci that developed from subsequent challenge infection24.

Field studies of vaccines against porcine cysticercosis Immune response to vaccination in controlled laboratory experiments is likely to differ considerably from rural field use where malnutrition, simultaneous antigenic challenges and co-infections are frequent. The above experiments that demonstrated the efficacy of T. crassiceps antigen vaccine

Vaccination: Present Status and Future Prospects

425

10,000 Cyst extract (Molinari et al., 1983)10

Encystment rate (cysticerci per 100,000 eggs)

T. crassiceps cyst extract (Huerta et al., 2000)8

1,000 T. crassiceps cyst extract (Huerta et al., 2000)8

T. crassiceps cyst fluid (Manoutcharian et al., 1996)22

100 T. crassiceps cyst fluid extract (Manoutcharian et al., 1996)22

Scolex extract (Nascimento et al., 1995)20

10 Scolex extract (Kumar et al., 1987)21

Scolex extract (Kumar et al., 1987)21

1 Oncosphere secretions (Pathak and Gaur,1990)24

Oncosphere extract (Plancarte et al.,1999)19

0 Controls

Vaccinated

Recombinant T. ovis antigen (Plancarte et al., 1999)19

Fig. 42.1. Overview of Taenia solium vaccination trials involving experimental challenge infections. The number of cysticerci per 100,000 T. solium eggs administered is shown for control and vaccinated pigs. Each line represents a published experiment involving several pigs. Details of each experiment, including the dose of parasites used for the challenge infection, are given in the text. The viability of cysticerci is not shown.

were performed with well-nourished, adult York-Landrace pigs22,23. In an attempt to mimic typical rural conditions for subsistence pig rearing in Mexico, vaccination and subsequent T. solium challenge were performed in outbred, malnourished younger pigs8. Under these conditions, vaccination no longer affected the number of cysticerci, although the degree of histological degeneration was greater in vaccinated animals. This illustrates the difficulty in extrapolating results of laboratory experiments to the field. In a Mexican field trial, cysticercosis was found to disappear from several endemic communities following repeated administration of crude T. solium cysticercal antigens to pigs11. In a subsequent, improved, controlled study, vaccination with the same antigen was associated with a fall in the prevalence

of cysticercosis by tongue palpation from 2.4% to 0.45%25. Despite limitations of the monitoring of concurrent controls in these studies and the insensitive method of diagnosing cysticercosis, the results of this largescale operational study were encouraging because they suggested that a laboratorydeveloped vaccine could have significant efficacy in the field setting.

Parasite supply for testing porcine cysticercosis vaccines One of the major problems that hampers the development of a vaccine to protect against cysticercosis is the difficulty in obtaining supplies of T. solium eggs from tapeworm carriers. It is ethically necessary to treat any

426

C.A.W. Evans

tapeworm carrier upon diagnosis, because of their risk of developing cysticercosis. Successful Taenia propagation in immunosuppressed chinchillas has recently been reported and gravid segments from the tapeworms grown in this animal model caused cysticercosis infection in pigs, raising the hope that this may allow a constant laboratory supply of Taenia eggs (reviewed in Chapter 4)26.

Recombinant antigens An additional difficulty is the supply of T. solium antigens for vaccine production. While cysticerci and their scolices are currently plentiful in endemic areas, oncospheres remain difficult to obtain and the standardization of antigens extracted from any parasite stage is problematic. These problems in antigen supply and standardization may be overcome with recombinant DNA technology. cDNA libraries have been produced for T. solium, but there have been no published porcine trials of recombinant vaccines derived from T. solium DNA. However, a combination of the 45WB/X, 16K and 18K recombinant T. ovis antigens caused 74–93% protection against porcine cysticercosis. These recombinant antigens are completely standardized and are easier to produce on an industrial scale than those purified from parasite material. Importantly, a protective T. ovis antigen with homology to a T. solium antigen has recently been cloned, and experiments are in progress to establish whether this fulfils its potential for high levels of protection against porcine cysticercosis27. Similarly, vaccination with the KETc1 and KETc12 recombinant T. crassiceps antigens is highly protective against this murine parasite and sequence analysis reveals considerable homology with T. solium antigens28,29. This family of antigens is therefore a strong candidate for testing as T. solium vaccines, possibly in combination with other recombinant antigens. Recombinant DNA technology also allows the inclusion of parasite antigens in vectors or organisms that may increase immunogenicity or, most importantly, allow oral administration. Oral vaccination against T. solium has not yet been reported.

DNA vaccines The inoculation of DNA elicits both humoral and cellular immune responses against the antigens coded for by that DNA. Although this strategy appears to have considerable potential for inducing protective immune responses in laboratory experiments, initial enthusiasm has been tempered by concerns about the safety of introducing viral vectors containing pathogenic DNA into the food chain. Furthermore, administration of 45W, 18K and 16K DNA vaccines caused little or no antibody response to these T. ovis antigens, in contrast to the corresponding protein vaccines30. Indeed, nucleic acid vaccination against T. ovis had only modest efficacy even in combination with a conventional protein vaccine31. In contrast, direct inoculation of a DNA vaccine against T. crassiceps into mouse spleens in vivo elicited protective cellular immune responses against this parasite32. A reduction in T. crassiceps parasite load also occurred after the administration of macrophages pulsed ex vivo with a cDNA expression library containing several antigenic clones33. Of more relevance to possible field use, protective responses were obtained after intradermal and intramuscular inoculation of a KETc7 DNA vaccine for murine cysticercosis34. It remains to be seen whether DNA vaccination will protect pigs and whether this technology will be acceptable for vaccinating animals that are to be consumed by humans.

Comparative Evaluation of Protective Vaccine Trials Methodological considerations are critical to the comparison of different vaccine studies and the potential utility of vaccines for use in the field setting. For example, three vaccine subcutaneous injections at 20-day intervals had far greater efficacy than vaccination with a single dose, but a vaccine that required multiple doses would be of limited practical value in the resource-poor settings where porcine cysticercosis is most common8,20. The majority of authors regard the proportion of infection challenge eggs that successfully form cysticerci, in vaccinated and unvaccinated (or adjuvant treated) pigs, as a measure

Vaccination: Present Status and Future Prospects

of the efficacy of vaccination. Where the necessary raw data have been published, this is the approach used for calculating efficacy rates in this review and it yielded results similar to those presented by the original authors (Fig. 42.1). Clearly, the wide range of vaccine efficacy and infection efficacy shown is likely to result from differences in the proportion of Taenia eggs obtained from gravid versus immature proglottides and differences in autopsy procedures that may leave many cysticerci undiscovered. Besides, variation in the adjuvants used may also contribute to discrepant results because the latter may cause cysticercal degeneration in control animals. For example, saponin adjuvant is much less likely to cause cysticercal degeneration than incomplete Freund’s adjuvant or Corynebacterium parvum8,20,22,23. Although these issues do not negate the clear effect of some vaccines compared with controls within individual, blinded experiments, they do hamper comparison of results between different experiments. There has also been no standardization of the size of the infection challenge used to test cysticercosis vaccines. The number of T. solium eggs administered has varied from 8400 eggs in one experiment, to 10,000 eggs, 15,000 eggs, 25,000 eggs, and as many as 100,000 eggs in the study with the least effective results8,10,19–22,24. These methodological differences are important because the natural infecting dose in the field is likely to vary over an even greater range. Only one group has formally tested the effect of pig age on vaccine efficacy8. Although their vaccine administered to malnourished outbred pigs did not have any effect on cyst numbers, a significant effect on cyst viability was greater in older than young pigs. Furthermore, there was no detectable antibody response to vaccination in pigs inoculated at 40 (rather than 70) days of age. It is interesting to note that immunization caused cysticerci to degenerate, compared with control animals, despite the absence of a detectable antibody response, implicating a cellular immune response to vaccination in this process8. The goal of effective vaccination must be prevention of infection and absence of cysticerci from pig tissues at autopsy. Such total

427

efficacy would reinforce the financial incentive for farmers to protect their livelihood from this infection, which at least halves the value of pigs in many endemic areas. However, it is noteworthy that the least effective study presented here observed no effect on cyst numbers but did report a marked effect of vaccination on cyst histopathology8. The actual viability of cysticerci for causing human taeniasis is traditionally assessed by evagination assays, but these are infrequently used12. No cysticercosis vaccines have yet been reported to be 100% effective and it is desirable that future studies should assess the ability of cysticerci to evaginate, as well as their absolute numbers19. It may be that the few parasites that encyst despite previous vaccination are immunologically damaged and unable to evaginate and cause human taeniasis.

Conclusions Vaccines derived from cysticercal extracts have already proved their utility in field trials and recombinant vaccines are now sufficiently effective under controlled conditions to warrant widespread evaluation of this sustainable intervention. Rapid recent progress with the sequencing and comparison of antigens from T. solium and related parasites makes it likely that more effective T. solium vaccines will be developed soon. Although the effect of malnutrition, constant exposure to antigens, and the transfer of immunity from pregnant sows await investigation, this progress in the transfer of molecular biology from the laboratory to the field has provided a powerful new tool for the control of cysticercosis. Combined with treatment of human tapeworm carriers, the imminent expectation of an effective recombinant vaccine against porcine cysticercosis makes eradication of cysticercosis a feasible goal.

Acknowledgement The author is funded by the Wellcome Trust as a Career Development Fellow in Clinical Tropical Medicine.

428

C.A.W. Evans

References 1. Lightowlers, M.W. (1996) Vaccination against cestode parasites. International Journal of Parasitology 26, 819–824. 2. Andreassen, J. (1991) Immunity to adult cestodes: basic knowledge and vaccination problems. A review. Parasitologia 33, 45–53. 3. Allan, J.C., Velasquez-Tohom, M., Torres-Alvarez, R., et al. (1996) Field trial of the coproantigenbased diagnosis of Taenia solium taeniasis by enzyme-linked immunosorbent assay. American Journal of Tropical Medicine and Hygiene 54, 352–356. 4. White, A.C., Jr, Robinson, P., Kuhn, R. (1997) Taenia solium cysticercosis: host–parasite interactions and the immune response. Chemical Immunology 66, 209–230. 5. Flisser, A., Willms, K., Laclette, J.P., et al. (1982) Discussion. In: Flisser, A., Willms, K., Laclette, J.P., et al. (eds) Cysticercosis: Present State of Knowledge and Perspectives. Academic Press, New York, pp. 611. 6. SotoHernandez, J.L., Ostrosky-Zeichner, L., Tavera, G., et al. (1996) Neurocysticercosis and HIV infection: report of two cases and review. Surgical Neurology 45, 57–61. 7. Aluja, A.S., de Martinez, J.J., Villalobos, A. (1998) Taenia solium cysticercosis in young pigs: age at first infection and histological characteristics. Veterinary Parasitology 76, 71–79. 8. Huerta, M., Sciutto, E., Garcia, G., et al. (2000) Vaccination against Taenia solium cysticercosis in underfed rustic pigs of Mexico: roles of age, genetic background and antibody response. Veterinary Parasitology 90, 209–219. 9. Herbert, I., Oberg, C. (1974) Cysticercosis in pigs due to infection with Taenia solium Linneaus 1758. In: Soulsby, E.J.L. (ed.) Parasitic Zoonoses: Clinical and Experimental Studies. Academic Press, London, pp. 187–195. 10. Molinari, J.L., Meza, R., Tato, P. (1983) Taenia solium: cell reactions to the larva (Cysticercus cellulosae) in naturally parasitized, immunized hogs. Experimental Parasitology 56, 327–338. 11. Molinari, J.L., Soto, R., Tato, P., et al. (1993) Immunization against porcine cysticercosis in an endemic area in Mexico: a field and laboratory study. American Journal of Tropical Medicine and Hygiene 49, 502–512. 12. Evans, C.A., Gonzalez, A.E., Gilman, R.H., et al. (1997) Immunotherapy for porcine cysticercosis: implications for prevention of human disease. American Journal of Tropical Medicine and Hygiene 56, 33–37. 13. Lightowlers, M.W., Rickard, M.D. (1993) Vaccination against cestode parasites. Immunology and Cell Biology 71, 443–451. 14. Lightowlers, M.W. (1994) Vaccination against animal parasites. Veterinary Parasitology 54, 177–204. 15. Johnson, K.S., Harrison, G.B., Lightowlers, M.W., et al. (1989) Vaccination against ovine cysticercosis using a defined recombinant antigen. Nature 338, 585–587. 16. Lightowlers, M.W. (1999) Eradication of Taenia solium cysticercosis: a role for vaccination of pigs. International Journal of Parasitology 29, 811–817. 17. Babiker, H.A., Eldin, E.S. (1987) Preliminary observations on vaccination against bovine cysticercosis in the Sudan. Veterinary Parasitology 24, 297–300. 18. Lighowlers, M.W., Rolfe, R., Gauci, C.G. (1996) Taenia saginata: vaccination against cysticercosis in cattle with recombinant oncosphere antigens. Experimental Parasitology 84, 330–338. 19. Plancarte, A., Flisser, A., Gauci, C.G., et al. (1999) Vaccination against Taenia solium cysticercosis in pigs using native and recombinant oncosphere antigens. International Journal of Parasitology 29, 643–647. 20. Nascimento, E., Costa, J.O., Guimaraes, M.P., et al. (1995) Effective immune protection of pigs against cysticercosis. Veterinary Immunology and Immunopathology 45, 127–137. 21. Kumar, D., Gaur, S.N.S., Pathak, M.L. (1987) Immunization of pigs against the cysticercus of Taenia solium using fractionated first and second peaks of Cysticercus cellulosae scolex antigens. Indian Journal of Animal Sciences 57, 932–935. 22. Manoutcharian, K., Rosas, G., Hernandez, M., et al. (1996) Cysticercosis: identification and cloning of protective recombinant antigens. Journal of Parasitology 82, 250–254. 23. Sciutto, E., Fragoso, G., Trueba, L., et al. (1990) Cysticercosis vaccine: cross protecting with Taenia solium antigens against experimental murine T. crassiceps cysticercosis. Parasite Immunology 12, 687–696. 24. Pathak, K.M.L., Gaur, S.N.S. (1990) Immunization of pigs with culture antigens of Taenia solium. Veterinary Parasitology 34, 353–356.

Vaccination: Present Status and Future Prospects

429

25. Molinari, J.L., Rodriguez, D., Tato, P., et al. (1997) Field trial for reducing porcine Taenia solium cysticercosis in Mexico by systematic vaccination of pigs. Veterinary Parasitology 69, 55–63. 26. Flisser, A., Lightowlers, M.W. (2001) Vaccination against Taenia solium cysticercosis. Memorias do Instituto Oswaldo Cruz (Rio de Janeiro) 96, 353–356. 27. Lightowlers, M.W., Flisser, A., Gauci, C.G., et al. (2000) Vaccination against cysticercosis and hydatid disease. Parasitology Today 16, 191–196. 28. Toledo, A., Fragoso, G., Rosas, G., et al. (2001) Two epitopes shared by Taenia crassiceps and Taenia solium confer protection against murine T. crassiceps cysticercosis along with a prominent T1 response. Infections and Immunology 69, 1766–1773. 29. Toledo, A., Larralde, C., Fragoso, G., et al. (1999) Towards a Taenia solium cysticercosis vaccine: an epitope shared by Taenia crassiceps and Taenia solium protects mice against experimental cysticercosis. Infections and Immunology 67, 2522–2530. 30. Drew, D.R., Lightowlers, M.W., Strugnell, R.A. (2000) A comparison of DNA vaccine expressing the 45W, 18k and 16k host-protective antigens of Taenia ovis in mice and sheep. Veterinary Immunology and Immunopathology 76, 171–181. 31. Rothel, J.S., Waterkeyn, J.G., Strugnell, R.A., et al. (1997) Nucleic acid vaccination of sheep: use in combination with a conventional adjuvanted vaccine against Taenia ovis. Immunology and Cell Biology 75, 41–46. 32. Cano, A., Fragoso, G., Gevorkian, G., et al. (2001) Intraspleen DNA inoculation elicits protective cellular immune responses. DNA Cell Biology 20, 215–221. 33. Manoutcharian, K., Terrazas, L.I., Gevorkian, G., et al. (1999) DNA pulsed macrophage-mediated cDNA expression library immunization in vaccine development. Vaccine 18, 389–391. 34. Cruz-Revilla, C., Ross, G., Fragoso, G., et al. (2000) Taenia crassiceps cysticercosis: protective effect and immune response elicited by DNA immunization. Journal of Parasitology 86, 67–74.

43

Control of Taenia solium with Porcine Chemotherapy Armando E. Gonzalez

Introduction Control or eradication of Taenia solium cysticercosis has been achieved to date only in Europe and North America. Significant improvements in sanitary conditions and developing functional slaughterhouse control systems were primarily responsible for control in these regions (see Chapter 7). In endemic areas of developing countries, the life cycle of T. solium is sustained because pigs have access to infected faeces, and cysticercosis-infested pork is available for consumption. Moreover, control in developing countries is limited by economic and sanitary conditions. Interventional trials with massive human taeniacidal chemotherapy (reviewed in Chapter 41), immunotherapy (reviewed in Chapter 42) and health education (reviewed in Chapter 41) have not proved to be sustainable in the long-term to date. For instance, a study in rural Mexico evaluated the effects of health education through discourses and demonstrations given to primary and secondary grade school children and taeniacidal treatment of the human population1. Two years later, 78% of the children and 2% of the adults successfully answered a questionnaire on the life cycle of the parasite; however, porcine infection rates were found to have increased twofold.

Therefore, while the strategy brought about significant changes in knowledge about T. solium, it was not successful in controlling levels of T. solium endemicity in the population. Other interventional strategies employing mass cestocidal treatment have proved successful in the short term, though (reviewed in Chapter 41). Theoretically, strategies for control of T. solium in humans would be ineffective because transmission could subsequently occur from infected pigs. Therefore, eradication of T. solium from a disease-endemic area by employing human treatment alone would require consecutive interventions, for at least the average life span of the porcine reproductive stock. Furthermore, the interval between interventions should not exceed the pre-patent period, so that if new adult tapeworm infections occur, they would not have enough time to infect more pigs. This holds true also, if the porcine population alone is targeted by the interventional strategy. Such interventions would have to be made for the entire life span of the tapeworm, implying that the pig population has to be treated within the interval required for cyst maturation. In order to obviate the problems associated with treatment of either human or pig population alone, concurrent treatment of both human and porcine populations has been

© CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

431

432

A.E. Gonzalez

proposed. It has been suggested that targeting both hosts would reduce the time required to eradication and thereby increase the likelihood of success. Finally, the inspection and condemnation of pork in abattoirs, which is advocated by the Pan American Health Organization and the World Health Organization as an important control measure, paradoxically encourages high rates of infection by failing to cover the informal pork markets that are major circuits for the sale of pork in developing countries2. While the benefits of various interventions described above should not be underestimated, results of a community intervention in Peru (described below) indicated that a practical approach towards eradication of porcine cysticercosis should incorporate economic incentives in order to be successful2. In explicit terms, since porcine cysticercosis reduces the economic value of pork in the market, a chemotherapeutic intervention that targets swine and eliminates cysticerci in pork should not only interrupt the transmission cycle of T. solium but also improve the economic value of pork sold in the market. However, in order to improve the commercial value of pork, the cysticerci need to be visually and palpably eliminated. Any chemotherapeutic intervention should consider this aspect for success in the field. Indeed, the economic benefits of selling clean meat rather than the accrued health benefits may drive farmers to volunteer their pigs for chemotherapy. Better market prices for treated pork and access to the formal marketing system will be strong incentives for farmers to treat their pigs, and community cooperation will be ensured. Any disease eradication programme that considers the economic factor is more likely to be successful and sustainable, and also to result in the acceptance of health education campaigns. In the present chapter, the author has focused on control of T. solium through chemotherapy of infected pigs, drawing particular attention to its major advantage of providing economic incentives to pork-producing farmers through the sale of clean carcasses.

Porcine Chemotherapy Praziquantel Several chemotherapeutic agents have been evaluated for the treatment of porcine cysticercosis. Early efforts with flubendazole3 were followed by evaluation of praziquantel administered in a dose of 50 mg kg1 day1 for 15 days4,5. A variable efficacy was noted in these initial studies and not all the cysts disappeared upon computed tomography by day47 after treatment4. Later, 1 day treatment with praziquantel (in three different doses of 100 mg kg1, 50 mg kg1 and 25 mg kg1) in three divided doses was reported to kill all cysts in 16 of 18 pigs (88.9%)5. The highest dose was most efficacious in causing degeneration of the cysts. This study, however, did not evaluate the disappearance of cysts from the carcasses, since pigs were killed 1 month after treatment.

Albendazole The successful treatment of porcine cysticercosis with albendazole at a dose of 15 mg kg1 daily for 30 days was first reported in 19956. However, the need for multiple doses made this regimen impractical for use in field control programmes. At about the same time, a randomized trial evaluated the efficacy of two different schemes of administration of albendazole for the treatment of porcine cysticercosis7. Seventeen naturally infected pigs were divided into three groups and treated by mouth with albendazole (50 mg kg1 single dose), albendazole (30 mg kg1 day1 for 3 days) or placebo, respectively. All animals treated with the single dose of albendazole exhibited side effects (extreme prostration, complete anorexia and reluctance to move), and one of the pigs died 3 days after treatment. Those treated for 3 days (30 mg kg1 day1) also exhibited side effects (lethargy and anorexia). No side effects were noted in the placebo group. Importantly, single-dose albendazole therapy left some viable cysts remaining in the meat, while 3-day albendazole therapy killed all but one cysts. The 3day regimen was found to be effective as a strategy that targeted the porcine population. The meat, however, remained measly with

Control of T. solium with Porcine Chemotherapy

dead and degenerating cysts – leaving it unsightly as a food product.

Oxfendazole Oxfendazole (methyl [5-(phenylsulphinyl)-1H benzimidazole- 2-yl] carbamate; SynanthicTM) was first identified as having anthelminthic properties against larval and adult gastrointestinal cestodes and nematodes in various animal species by Syntex Research, Palo Alto, California. Structurally, it comprises of a benzimidazole carbamate that is characteristic of this group of drugs (which includes albendazole), with a phenylsulphinyl substituent in position-58. The efficacy of single-dose oxfendazole alone, praziquantel alone, and oxfendazole and praziquantel in combination, in the treatment of porcine cysticercosis were compared in a randomized, placebo-controlled study. Oxfendazole, used in a single dose of 30 mg kg1, was found to be highly effective for the treatment of porcine cysticercosis9. Both oxfendazole alone and in combination with praziquantel killed all the parasites, leaving behind only microcalcifications and minuscule scars in the meat, giving it a clean appearance. The appearance of the meat was suitable for marketing, and no apparent differences in taste were found by organoleptic experts from the pork sold in markets of Lima. In contrast, a single dose of praziquantel alone (50 mg kg1) showed no benefit when compared with the controls. Cysts appeared clearly visible in the carcasses of the praziquantel and control groups. No detectable side effects were seen in any of the groups. This study demonstrated the safety and efficacy of a single dose (30 mg kg1) of oxfendazole in the treatment of porcine cysticercosis. All other regimens were either ineffective, needed multiple dosing, had side effects or left the meat unsuitable for sale3–7,9.

Overview of Laboratory and Field Trials with Oxfendazole Dose considerations The dose of oxfendazole (30 mg kg1) was calculated from previous experience with alben-

433

dazole and may over-estimate the amount of drug needed for treatment of porcine cysticercosis. Consequently, an experiment was designed to establish the minimal effective single dose of oxfendazole that would kill all cysticerci in pigs10. Three doses of oxfendazole were tested: 10 mg kg1, 20 mg kg1 and 30 mg kg1. After treatment, more than 75% of cysts in pigs from the control group (not treated) were viable, irrespective of their anatomical location. Four animals among those administered a dose of 10 mg kg1 exhibited viable cysts; the latter were present in the muscle (three pigs), the tongue (two pigs), and the brain (two pigs). Viable cysts were also found in four animals in the 20 mg kg1 group, although they were present only in the muscle (one pig) and the brain (three pigs). The number of viable cysts recovered from the treated animals was very low: 18 of 216 (8%) animals that were administered the 10 mg kg1 dose, and 11 out of 198 (6%) given the 20 mg kg1 dose. No viable cysts were recovered from animals that were administered 30 mg kg1 oxfendazole. Carcasses of pigs treated with 30 mg kg1 oxfendazole had a normal appearance, and were considered suitable for human consumption.

Time response of anticysticercal effect The time for cysts to die and disappear after oxfendazole administration is critical to the determination of the specific timing of treatment of live infected pigs. A controlled study was designed to determine the time period between treatment and death of cysticerci11. A clear decrease in viability and number of cysts was noted after the first week following treatment with oxfendazole, though few live cysticerci were found in many tissues even at 4 weeks. Twelve weeks after oxfendazole treatment, the meat examined was clear and only minuscule scars were observed, except in one animal that had viable cysts in the brain. The predicted time to total decay depended on the organ. The time to zero viability in muscle and heart were 4 and 3 weeks, respectively. Interestingly, the time to cyst disappearance in the tongue, a voluntary muscle was 5

434

A.E. Gonzalez

weeks. This study demonstrated that immediate pre-slaughter treatment of pigs with oxfendazole does not result in death and disappearance of cyticerci.

Field trial with oxfendazole The availability and documented success of oxfendazole led to its use in a field trial for control of T. solium through porcine chemotherapy; such approaches were considered impractical primarily due to the duration of treatment, and found expensive before the use of oxfendazole. The Cysticercosis Working Group in Peru carried out an interventional study that evaluated the effect of combined mass therapy targeting both human and porcine populations in the Peruvian highlands (Hector H. García, Lima, Peru, unpublished data). Eight highly endemic villages located in the Mantaro valley were selected for the study. The selected population underwent a cysticercosis control programme that included mass treatment of human and porcine populations. All pigs were treated twice with oxfendazole (single dose, 30 mg kg1) at the beginning of the experiment (month 0 and month 4). Following baseline sampling and 30 days after treating the pigs, the villagers in the treatment branch of the study received praziquantel in taeniacidal doses. The strategy was shown to be successful in the short term. Benefits of the intervention as measured by incident cases of porcine cysticercosis remained statistically significant up to 16 months (P = 0.04). However, within 2 years, the prevalence of the porcine cysticercosis rose to its original levels. Sentinel pig trials corroborated that environmental contamination returned to baseline levels 18 months after intervention. The biotic potential of T. solium ultimately recovered to steady-state baseline values. The study demonstrated that information regarding variables affecting the biotic potential were important; these were used to calculate the number of interventions and the minimum treatment coverage required for a strategy using either common sense or mathematical approaches (reviewed in Chapter 44).

Protection of successful treatment with oxfendazole Since treated pigs can theoretically acquire new infections, the estimation of the duration of protective effect conferred by oxfendazole treatment is critical to the understanding of the development of pig chemotherapy-based control interventions. Another controlled study was designed to determine if cysticercosis-infected pigs could acquire new infections after having been treated with oxfendazole12. A group of 20 cysticercotic pigs were treated with oxfendazole and later matched with 41 naive (unexposed to T. solium eggs) pigs. Both groups were then exposed to a natural challenge of T. solium eggs in a hyperendemic area. Seroprevalence of cysticercosis among native pigs at the field site at the time of the experiment was 75% (73/97 animals). From the original 61 pigs, 51 (84%) were recovered at the end of the study, 19/20 in the treatment group (95%), and 32/41 (78%) in the control group. New infections were demonstrated in 15/32 (47%) using EITB serology and in 12/32 (38%) by tongue palpation in the control group. At necropsy, viable cysts were found in the carcasses of seven pigs (viable only: three; viable and degenerated: four) while degenerated cysts alone were noted in another five animals. The numbers of cysts in these newly infected animals ranged between five and 30 per pig. Conversely, no viable cysts were found in the carcasses of any of the 19 treated pigs. In field conditions, most pigs live for around 9 months (see Chapter 15). Cysts take about 2 months to develop, so it is reasonable to assume that pigs will be infective only after 3–4 months of age. Therefore, if treated at 3–4 months of age, cured pigs are unlikely to be re-infected at least until 7 months of age, and it is very probable that this protection will extend for longer periods and thus cover the remaining lifetime of the pig. This means that oxfendazole is potentially an effective control agent because once treated, pigs are refractory to re-infection even in the event of ongoing exposure to the source of T. solium eggs. Obviously, other concomitant measures are still needed since seronegative pigs still remain susceptible to infection.

Control of T. solium with Porcine Chemotherapy

Conclusions Porcine chemotherapy, previously impractical and expensive, is now an important option in the short-term control of T. solium. Several drugs including flubendazole, praziquantel, albendazole and oxfendazole have been used as chemotherapeutic agents in experimental and field conditions. Most drugs, like albendazole and praziquantel, have to be administered over several days; this is a major limitation to their use in field conditions. Oxfendazole, however, has the advantage that that it can be administered in single doses (30 mg kg1). The drug has been

435

demonstrated to cause complete disappearance of cysts at 12 weeks after treatment. More importantly, the pork meat is rendered clean with no residual cysts or scars, thereby increasing its economic value in the pork market. Mass porcine chemotherapy with oxfendazole could, therefore, be a useful strategy against T. solium, by providing health as well as economic benefits. Until a vaccine for porcine cysticercosis is available, treatment of infected pigs is a logical approach for controlling transmission of T. solium, and should therefore be considered an important, cost-effective measure to control cysticercosis.

References 1. Keilbach, N.M., De Aluja, A.S., Sarti, E. (1989) A programme to control taeniasis–cysticercosis (Taenia solium): experiences in a Mexican village. Acta Leiden 57, 181–189. 2. Cysticercosis Working Group in Peru (1993) The marketing of cysticercotic pigs in the Sierra of Peru. Bulletin of World Health Organization 71, 223–228. 3. Tellez-Giron, E., Ramos, M., Montante, M. (1981) Effect of flubendazole on cysticercus cellulosae in pigs. American Journal of Tropical Medicine and Hygiene 30, 135–138. 4. Flisser, A., Gonzalez, D., Shkurovich, M., et al. (1990) Praziquantel treatment of porcine brain and muscle Taenia solium cysticercosis. 1. Radiological, physiological and histopathological studies. Parasitology Research 76, 263–269. 5. Torres, A., Plancarte, A., Villabos, A., et al. (1992) Praziquantel treatment of porcine brain and muscle cysticercosis. 3. Effect of 1-day treatment. Parasitology Research 25, 1443–1450. 6. Kaur, M., Joshi, K., Ganguly, N.K., et al. (1995) Evaluation of the efficacy of albendazole against the larvae of Taenia solium in experimentally infected pigs, and kinetics of the immune response. International Journal of Parasitology 25, 1443–1450. 7. Gonzalez, A.E., García, H.H., Gilman, R.H., et al. (1995) Treatment of porcine cysticercosis with albendazole. American Journal of Tropical Medicine and Hygiene 53, 571–574. 8. Marriner, S.E., Bogan, J.A. (1981) Pharmacokinetics of oxfendazole in sheep. American Journal of Veterinary Research 42, 1143–1145. 9. Gonzalez, A.E., García, H.H., Gilman, R.H., et al. (1996) Effective, single dose treatment of porcine cysticercosis with oxfendazole. American Journal of Tropical Medicine and Hygiene 54, 391–394. 10. Gonzalez, A.E., Falcon, N., Gavidia, C., et al. (1997) Treatment of swine cysticercosis with oxfendazole: a dose–response trial. Veterinary Record 141, 420–422. 11. Gonzalez, A.E., Falcon, N., Gavidia, C., et al. (1998) Time–response curve of oxfendazole in the treatment of swine cysticercosis. American Journal of Tropical Medicine and Hygiene 59, 832–836. 12. Gonzalez, A.E., Gavidia, C., Falcon, N., et al. (2001) Cysticercosis pigs treated with oxfendazole are protected from further infection. American Journal of Tropical Medicine and Hygiene 65, 15–18.

44

Use of a Simulation Model to Evaluate Control Programmes Against Taenia solium Cysticercosis

Armando E. Gonzalez, Robert H. Gilman, Hector H. García and Teresa Lopez

Introduction Taenia solium produces widespread livestock production losses caused by the intermediate stage of cysticercosis infecting the pig1. The rates of porcine infection are variable, but in endemic regions, over 20–30% of pigs may be infected2. An improved understanding of the relationship between T. solium and the pig production systems in endemic areas is crucial. McLeod suggested that a simulation model that included a disease component over a herd structure dynamic assisted in this goal3. Thus, it was possible to relate the presence of T. solium to pig production activities. A dynamic–stochastic model that simulates pig and T. solium populations over time was developed to produce estimates of the economic impact of disease, and to quantify the costs of control measures through financial analyses*. The model was designed to assess

a number of proposed control strategies in terms of changes in both the adult and intermediate populations of T. solium. An economic component was also included to calculate the net financial benefit of proposed control strategies. An important objective was to simulate pig population dynamics, infection in both human and porcine populations, the effect of different control strategies on T. solium and the financial benefit of control strategies. The model comprised a set of algorithms that uncovered various aspects of the disease, identified functional relationships between host and its environment, established measures of effectiveness and constraints and calculated economic indicators. The model used stochastic processes to simulate variable outputs4. The element of stochastic variation enabled the model to predict the likelihood of discrete events and to determine the value from a relevant distribution for an

*A number of strategies evaluate the effect of disease in a population. When a disease outbreak is modelled directly, an epidemic curve can be drawn which depicts changes in disease prevalence. If some economic variables are considered, the economic changes during the epidemic curve can be assessed. Another strategy is to model the population but not the disease. By running the model with and without disease parameters, the cost of disease can be calculated. A third and more flexible approach is to combine population and disease parameters in a single model and evaluate the effect of disease and control strategies from the final output3. Development of a simulation model is the process of building a mathematical and/or logical model of a system or a decision problem, and experimenting with the model to obtain insight into the system’s behaviour or to assist in making decisions concerning the problem. Simulation models are designed so that they mimic the system under study as closely as possible in order to achieve a substantial degree of epidemiological realism. Thus, building the model is making use of information about a disease in the form of algorithms and equations4,5. Continued on next page © CAB International 2002. Taenia solium Cysticercosis (eds G. Singh and S. Prabhakar)

437

438

A.E. Gonzalez et al.

individual in the population3. The model combined population and disease models into an epidemiological model.

General Description of the Simulation Model Assumptions It was assumed that the effective reproductive rate of the adult tapeworm (R) is equal to one6. This assumption considers that each adult tapeworm produces one adult tapeworm as an offspring. Therefore, the average number of tapeworms remains constant through time. Also, that the infection rates for humans were the same for each individual in the population. This assumption need not hold true in actual conditions; however, there are no data to support a more plausible assumption regarding T. solium egg contamination patterns. Regarding porcine cysticercosis, it was assumed that the infection rate is the same for all pigs, and that in highly endemic areas, if a pig is exposed at birth to a contaminated environment, it will become infected during the first 6 months of life. Assumptions were also made for human infection. The number of new cases of human and swine cysticercosis depends on the number of adult tapeworms present, the number of new cases of tapeworm infection depends on the number of infected pigs consumed in that day and finally, that the number of exposed humans remains constant throughout the simulation.

Basic structure of the model The simulation of related events was programmed in routines and algorithms that represent the basic units of the programme.

The latter in turn were organized in components according to overall objectives. Calls to specific components came from modules and sub-modules. The program was structured in three modules, namely: ‘input’, ‘simulation’ and ‘output’. Obviously, the core of the program lay in the simulation module, which contained two sub-modules, ‘baseline’, and ‘intervention’. The former ran a simulation without any disease control while the latter simulated the selected control strategy. The model was developed using Visual Basic 4.0 (Fig. 44.1). The model considers input, simulation and output forms. Three forms were designed to set values to input variables. Briefly, the first two consider input values for the simulation model itself; swine and human population, disease parameters, financial parameters and seasonality factors. The third input form was designed to select the choice of output presentation. Two output forms present results in either economic evaluations or disease evolution graphs.

Main procedures Changes in tapeworm population There are three disease states for a tapeworm carrier: infected with an immature tapeworm, infected with a mature tapeworm, and postinfection contamination. The latter is very important because, even though the human host no longer harbours the tapeworm, a number of the produced eggs still remain infective in the environment. The routine deals with environmental contamination and assigns a number of infective days after the tapeworm is eliminated. This value varies from place to place, according to climactic and hygiene conditions, and is required in the input form. The routine

Continued from previous page A stochastic process is a system of countable events, where the events occur according to some well-defined random process5. Stochastic simulation modelling encompasses a range of techniques to mathematically describe the impact of uncertainty on a problem. Each uncertain parameter within the model is represented by a probability function. The shape and size of these distributions defines the range of values that the parameter may take and their relative probabilities. Following hypothesis testing and investigation of the effect of a range of control measures, through a series of time steps they can show the changes that take place in a population between the present and some future time.

Simulation Model Evaluation of Control Programmes

439

Input frame

Choice form: average number of infective pigs

Enter value

Calculate value

Set repetitions

Pre-simulation

Seed value to the programme

Input of control strategy

SIMULATION

Output choice

Economic output

Disease graphs

Fig. 44.1. Form flow of the Taenia solium simulation program.

assigns the infection status of the host according to the length of each period (also required as input). The routine adds 1 day to tapeworm age and modifies the host disease status according to age limits. This algorithm does not include a random process to determine the daily outcome. It only changes the

disease status and counts the number of infective tapeworms for the simulated day. Two infective forms are considered to calculate the infection potential for the simulated day: the number of adult tapeworms and the number of hosts with residual environmental contamination.

440

A.E. Gonzalez et al.

Porcine population component The number of farrowings per day is a random number drawn from a Poisson distribution. The input is the number of expected farrowings per day and the output is the number of farrowings on the simulated day. Once the number of farrowings for the day is set, the routine determines litter sizes with successive calls to the Poisson–Monte Carlo algorithm. The routine then sets values to the age and disease status of the piglet. Finally, the routine assigns a sex to each piglet. The mortality routine is called for every simulation day. The routine determines the sex and age groups of each pig from the pig–age and pig–sex arrays respectively. Subsequently, the program assigns a daily mortality probability according to the age and sex groups of the pig. The mortality or survival outcome for each pig is then determined by a Monte Carlo procedure. Swine cysticercosis component The swine cysticercosis component has two routines: one that simulates the number of new cases, and another that simulates disease evolution. The former simulates new infections using a Monte Carlo algorithm. The simulation determines whether a pig is infected or not during the simulation day. The disease evolution routine verifies the infection status of each pig and then changes its variable values according to the period limits set in the input sub-module. There are five infection states, depending on the infection and the presence of acquired or maternally transferred antibodies (Fig. 44.2). Piglets become blot positive or negative according to their mother’s serological status. If the sow is positive, the piglet will be positive to antibody tests for a period of 8 months (Armando E. Gonzalez, unpublished data). In this case, the enzyme-linked immunoelectrotransfer blot (EITB) test detects antibodies, regardless of whether the piglet is actually infected or not. Piglets, either with or without maternal antibodies, can be infected during the first 6 months of life. Following acquired infection, it takes 15 days to produce detectable amounts of antibody7,

hence, there is a period of time during which the infected pig remains negative to the EITB assay. Once a pig is infected, another lapse of time (90 days) is considered to allow the cysts to develop to fully infective forms. Finally, once treatment is administered, cysts may remain viable for 28 days. If a pig with immature cysts is treated, the pig can be considered free of infective forms immediately. Change from one category to the other depends on infection and/or time. Human cysticercosis component The human cysticercosis component determines the number of new human cases. The component does not simulate evolution of the disease, nor does it assign symptoms or any other related variable. The main objective of this component is to calculate the expected number of new cases to assess the control strategy in terms of its impact on this variable. The input for the routine, the expected number of cases per day, is calculated from the number of exposed humans and the age range of the exposed group. The number of new cases during the exposure period is equal to the human cysticercosis prevalence. The routine uses the daily number of new cases as the input for the Poisson routine, which returns the number of cases for the day. Financial component The financial component calculates the net financial benefit for the simulation. This component is nested in the mortality routine. The mortality routine identifies the age and sex of each pig and assigns the mortality/offtake probability from a probability array. Prices of pigs are organized in an array that has the same structure as the mortality/offtake array, therefore, the pig price can be determined in the same algorithm. An additional line of code verifies if the pig that is about to leave is infected with visible cysts or not. Thus, every time that a pig leaves the cohort, the routine is able to assign a gain according to the age, sex and infection status of the pig. Also, part of the financial component is nested in the control algorithm. Every time that a control procedure is simulated,

Simulation Model Evaluation of Control Programmes

Positive sow

Newborn pig

8 months

Uninfected pig Blot positive (maternal antibodies)

441

Negative sow

Uninfected pig Blot negative

Infection

Infected pig Blot negative Immature cysts

Infection

15 days

Treatment

Infected pig Blot positive Immature cysts 75 days

Treated pig Blot positive not infective

Infected pig Blot positive Mature cysts

Treatment

28 days

Treated pig Blot positive viable cysts

Status change due to event Status change due to time Fig. 44.2. Graphical description of the changes among disease status compartments.

the routine assigns a cost to the human or porcine treatment. Costs and benefits are added for every day of the simulation. At the end of the simulation period, a small routine performs a net benefit analysis. Intervention component The objective of the intervention component is to simulate mass taeniacidal treatment of humans and/or anticysticercal treatment of pigs. This strategy is defined by the number of interventions and the interval between

them. The objective of this particular variable is to coordinate human and porcine strategies. Briefly, the component is run starting from the date of the first intervention for the given number of human mass treatments. The interval between interventions is set to a default value, which can be modified. TAENIASIS CONTROL. The human control simulation component uses a Monte Carlo algorithm to simulate the outcome of the intervention on an individual basis. Two key probability values can be identified in field

442

A.E. Gonzalez et al.

conditions. First, the likelihood of receiving treatment, and second, the probability of killing the tapeworm. For practical purposes, the routine combines these two probabilities in a single value, i.e., the probability of being successfully treated on the intervention day. The routine used for swine cysticercosis control is similar to the one described for tapeworms and is run for each pig in the village. If the pig is treated, then the programme changes the disease status and sets the appropriate variable values to treated pig values. Among these variables, the one that counts the number of days since the treatment is crucial. Death of cysts does not occur immediately; it takes 4 weeks to make the cyst viability equal to zero8. The disease evolution component takes this fact into account, identifying the pig as treated and simulating the treatment effect over a period of time. SWINE CYSTICERCOSIS CONTROL.

The effect of seasonality is considered for a number of events. It was considered that mortality, infection, price of pigs and farrowing were affected by seasonal variations. Seasonality input was entered in variable arrays with 12 values, one for each month. A seasonality factor was then calculated for each variable.

SEASONALITY.

Output module The graphical output presents the daily gains, the number of tapeworms, rate of truly infected pigs (excluding maternally transferred antibodies; called true cysticercosis prevalence), antibody prevalence, number of new porcine cysticercosis cases and total economic gains for the day. The program stores the values of these variables in memory arrays and then plots them in different combinations. The output combinations are selected in an output choice form. Steadystate values for each day are also available, and can be plotted with simulation values. The numerical output presents the results of the financial component. It also shows the final result for the number of new cases of human cysticercosis for the simulated period.

Use of the Simulation Model Input Values used for biological parameters were taken from available scientific literature. The variables included, among others, incubation periods, life span of the parasite and duration of passive immunity. Population dynamics and field-related variables were estimated from a participatory rural appraisal (PRA) exercise and a follow-up study (Armando E. Gonzalez, unpublished data). Human population input The number of humans considered as exposed to cysticercosis was obtained from a follow-up study whose data were used to validate the model. It was estimated that approximately 2000 individuals were exposed. Also, it was calculated that humans are exposed to the disease for an average of 45 years (Hector H. García, Lima, Peru, personal communication). Adult tapeworm and human taeniasis A prevalence figure of 3% was used as input for human taeniasis. The pre-patent period was assumed to be 90 days and the average life span of the adult tapeworm was assumed to be 3 years. Strictly speaking, time to egg production follows a normal distribution, consequently, the use of a point estimate may not accurately handle this variable. According to Allan9, human taeniasis incidence in a year was around one third of total prevalence, thereby suggesting that the adult tapeworm had a shorter life span. Porcine cysticercosis input The porcine population input considered the age and sex of the pig. The number of piglets per litter used was estimated from PRA interviews. Swine cysticercosis prevalence figure used as an input for the model was 45%. The number of days to cyst maturity was assumed to be 60 days10. The period of time from treatment to zero-viability of cysts was 28 days8.

Simulation Model Evaluation of Control Programmes

Financial input The discount rate used was 10%. The cost of treating a human against the adult tapeworm with praziquantel entered was US$1.6011,12. The cost of treating a pig with oxfendazole entered was US$1.608. The price of pigs by sex and age was estimated from the PRA interviews and from previously published literature13.

443

Output Output without intervention When no interventions were applied, there were small changes due to seasonal effects but otherwise the number of tapeworms and cysticercosis prevalence remained more or less constant over time. Mass treatment of human population

Seasonality factors Seasonality factors were determined from the follow-up study, PRA interviews and from a pork marketing study in Huancayo, Peru13. Seasonality effects were considered for porcine mortality/offtake rate, infection probability, prices of pigs and farrowing. Control strategies A set of control strategies was tested after optimizing their effects against the parasite. First, the effect of mass treatment of humans in controlling T. solium with several schemes using different coverage and interintervention periods was evaluated. The best approach was then further improved by adding intervention/s against porcine cysticercosis. Simulation input The time period for simulation depended upon its objective. It was considered that simulating more than 67 months was less likely to provide information that could be used to design or evaluate a control programme. The simulation was run for a total of 2000 days. The simulation model was designed to test the effect of different strategies on T. solium populations. Therefore, the main output of the model was devoted to document changes in adult and larval forms over time in a graphical manner. This constitutes a limitation of the model since the output does not allow direct quantitative comparison of two strategies. The final graph was made after averaging the daily results of a number of repetitions.

Several mass human treatment protocols with different numbers of, and intervals between, interventions were evaluated. For practical purposes, the number of interventions was limited to a maximum of 17 consecutive treatments. The model was then run for every period and number of interventions. The input for both treatment coverage and efficacy was set at 100%. The main outputs evaluated were the numbers of adult tapeworms and the prevalence of actively infected pigs. Mass human chemotherapy resulted in T. solium extinction in populations when at least 11 interventions were made. The 90-days interval was the most efficient strategy because it took less time to eradicate both forms of the cycle (Table 44.1; Fig. 44.3a and b). Mass human chemotherapy resulted in T. solium extinction in populations when at least 11 interventions were made. The 90-days interval was the most efficient strategy because it took less time to eradicate both, adult and larval forms of the cycle (Table 44.1; Fig. 44.3a). Not surprisingly, the efficacy of mass treatment of humans depended upon the maximum life expectancy of pigs. The control strategy blocked the transmission at the tapeworm level, not considering the intermediate host. Consequently, as long as there was the small possibility of survival of an infected pig, the disease could always be re-established. The second variable evaluated for the human intervention was the human treatment coverage. When human coverage was reduced from 100% to 90%, T. solium could not be eradicated from the area even after 17 interventions. At 90% treatment coverage, 18 interventions with 90-day intervals were required, implying a total treatment period of 4.4 years.

444

A.E. Gonzalez et al.

Table 44.1. Results of different intervention schedules in humans, considering a treatment coverage of 100%. Number of interventions until parasite extinction

Intervention interval

8

9

10

11

12

13

14

15

40 50 60 70 80 90 100

No No No No No No No

No No No No No No No

No No No No No No No

No No No No No Yes Yes

No No No Yes Yes

No No No

No No No

No No Yes

Mass treatment of human and porcine population It was observed that treating the human population alone was insufficient; the strategy required 800 days, and involved a large number of interventions and considerable cost and effort. Therefore, the effect of adding pig treatment to human mass chemotherapy was evaluated systematically. Briefly, the starting point considered was 11 consecutive interventions in the human population with a 90-day interval and a 100% human coverage. Then, a number of interventions in pigs were added, also assuming 100% coverage and an interval of 90 days. The addition of one intervention in the porcine population did not decrease the number of human interventions (Fig. 44.3c). However, the addition of two interventions in the porcine population reduced the number of human interventions to three (Fig. 44.3d). Further increase in the number of porcine interventions did not improve T. solium control. Evaluation of the strategies that considered 100% coverage in the porcine population and 90% in the human population demonstrated that intervening in both humans and pigs decreased the total number of interventions in the human population. Table 44.2 presents the results of evaluating a range of strategies to control T. solium. It was found that intervening twice in the porcine population with an interval of 180 days decreased the required number of interventions in humans from 18 to 12 mass treatments. This effect could be further enhanced, if five interventions were considered in the

porcine population. The latter strategy required nine interventions in humans to eliminate the parasite from both human and porcine populations. Evaluating control programmes based on human and porcine populations with less than 90% coverage gave disappointing results in terms of eradication of the parasite. The success of the different schemes was attributed to the high coverage rates in either or both populations. However, a target coverage of 100% is unrealistic since not all humans accept the treatment and it is very difficult to treat all the pigs. Besides, it is dangerous and culturally unacceptable to handle and treat sows in the later weeks of pregnancy. Financial analysis A partial financial analysis was made for the simulated strategies. This financial analysis was made considering two variables, sale of pigs and cost of intervention. The analysis took no account of financial or economic costs of human cases. The present value, at the first day of intervention, of pig sales and cost was calculated. Table 44.3 presents the discounted benefit for the control strategies over the 2000 days of the simulation. Only the most successful strategy, with three interventions in humans and two interventions in pigs resulted in a discounted benefit greater than no intervention. One of the arguments used to promote cysticercosis control was that it would result in economic benefits for the peasants. The results of the simulation experiment contradict this argument, limiting its scope to those strategies that success-

Simulation Model Evaluation of Control Programmes

(a)

61

0.5

49

0.4

37

0.3

24

0.2

12

0.1

May 96 (b)

61

Number of tapeworms Cysticercosis prevalence

May 98

May 99

May 00 0.5

49

0.4

37

0.3

24

0.2

12

0.1

May 97

May 98

May 99

May 00

Simulation date

61

0.5

49

0.4

37

0.3

24

0.2

12

0.1

May 96 (d)

May 97

Simulation date

May 96 (c)

445

May 97

May 98

May 99

May 00

Simulation date

61

0.5

49

0.4

37

0.3

24

0.2

12

0.1

May 96

May 97

May 98

May 99

May 00

Simulation date

Fig. 44.3. (a) Evolution of Taenia solium population after 11 interventions in humans (90-day interval; 100% treatment coverage). Simulation starts November 1995. (b) Evolution of T. solium population after 15 interventions in humans (50-day interval; 100% treatment coverage). Simulation starts November 1995. (c) Evolution of T. solium population after ten interventions in humans (90-day interval; 100% treatment coverage) and one intervention in pigs (100% treatment coverage). Simulation starts November 1995. (d) Evolution of T. solium population after three interventions in humans (90-day interval; 100% treatment coverage) and two interventions in pigs (90-day interval; 100% treatment coverage). Simulation starts November 1995.

446

A.E. Gonzalez et al.

Table 44.2. Effect of control strategies that considered mass treatment of human and porcine populations. Human population treatment (90% coverage)

Porcine population treatment (90% coverage)

Number of interventions

Intervention interval

Number of interventions

Intervention interval

Success in control

14 10 11 12 9 9

90 90 90 90 90 90

2 2 2 2 3 5

90 180 180 180 180 90

No No No Yes Yes Yes

Table 44.3. Financial analysis of control strategies. Interventions in the human population Coverage (%)

Number of interventions

100 100 100 100 100 90 100 90 90 90 No intervention

15 12 12 11 11 18 3 12 9 9

Interventions in the porcine population

Intervention interval

Coverage (%)

Number of interventions

Intervention interval

60 70 80 90 100 90 90 90 90 90

0 0 0 0 0 0 100 100 100 100

0 0 0 0 0 0 2 2 3 5

0 0 0 0 0 0 90 180 180 90

fully eliminate the parasite in the short-term. Results of the benefit analysis also call into question control programmes that depend on the sustainability of the strategy. Apparently, there were no benefits in the short and mid term, unless the strategy eradicated the disease within 6 months. Consequently, control programmes that are unlikely to produce financial gains may result in failure to retain the confidence of the producers. It is recognized that this analysis disregards the long-term benefits (after 2000 days) that would accrue from parasite elimination from the pig population. However, it is argued that possible benefits more than 5 years in the future would be of little interest to the people concerned. A major disadvantage of using financial analysis to determine economical feasibility is that, their impact upon public health is not

Discounted benefit (UK£) 9,147.00 28,422.00 28,965.00 35,885.00 35,381.00 –1,160.00 91,720.00 53,834.00 54,245.00 54,595.00 83,090.00

considered. Table 44.4 presents the estimated number of new infections of human cysticercosis with different control strategies. Although human neurocysticercosis represents a severe disease, the symptoms depend not only on the infection burden, but also on the location of the cysts in the brain. Therefore, it would be difficult to simulate severity of illness and ultimately, the effect of disease on other economic variables that would be relevant to the economic appraisal of different control strategies.

Limitations The most important finding of the use of the simulation model was that treating both human and porcine populations had a greater impact upon control of the parasite

Simulation Model Evaluation of Control Programmes

447

Table 44.4. Expected number of new cases of human cysticercosis during the simulation period (2000 days). Interventions in the human population Coverage (%) 100 100 100 100 100 90 100 90 90 90 No intervention

Interventions in the porcine population

Number of interventions

Intervention interval

Coverage (%)

Number of interventions

Intervention interval

15 12 12 11 11 18 3 12 9 9

60 70 80 90 100 90 90 90 90 90

0 0 0 0 0 0 100 100 100 100

0 0 0 0 0 0 2 2 3 5

0 0 0 0 0 0 90 180 180 90

than treating one population alone. The key variables were treatment coverage and number of interventions. It was clear that lower treatment coverage required more interventions and, therefore, demanded more time and financial resources. A cut-off point of 80% coverage for human and porcine populations was therefore established. The omission of human and pig movements into the population excluded the possibility of reintroduction of parasite during an eradication programme. However, in practice, it would be pointless to attempt the elimination of parasites from a single community that is surrounded by more infected communities. Therefore, the model is appropriate for the evaluation of parasite elimination strategies at the community level, only in the context of a wider programme of control involving multiple communities. The presence of clusters of T. solium infections has been documented in the past14,15. However, simulating the events that determine these clusters may obstruct rather than assist the interpretation of the simulation output. The main factors that determine the presence and nature of infection clusters are human behaviour and the management of pigs. The simulation of activities related to those factors is beyond the scope of this model. Infection clusters represent the worst-case scenario for control programmes, because they require high treatment cover-

Number of new cases of human cysticercosis 26.36 26.50 25.47 26.48 27.20 25.10 27.65 28.63 27.80 26.63 27.60

age in order to treat effectively all infected hosts. Another limitation of the simulation model is that it does not consider additional measures that could have an impact on T. solium populations. Simulating the effect of additional measures against T. solium also requires quantitative estimates of the impact of such measures. The direct and indirect effect of other measures, such as education or vaccination, is still in debate. Assuming apriori parameter values and event procedures to simulate the effect of any measure without previous knowledge could jeopardize the focus of the model. In addition, the simulation model was designed to provide information of control strategies in the short and medium term. Although measures such as health education and improvement of sanitary infrastructure have an important effect on T. solium, these measures are more likely to be implemented within a long-term integral development plan for rural communities rather than as specific actions against T. solium.

Conclusions A description of the major factors that regulate T. solium and its relationship to porcine productions systems is crucial to an understanding of the transmission dynamics and thus to the planning of control programmes.

448

A.E. Gonzalez et al.

A simulation model that includes porcine, human and tapeworm populations will assist in this goal. An economic component in this model can produce estimates of the financial impact of the disease, and help to quantify the costs of control measures through cost–benefit analyses, considering not only effects on human and animal health, but also economic optimization. When predicting the impact of any control intervention on cestode populations, there is a need not only to consider how effective the measure will be in epidemiological terms,

but also to define the benefits and costs for the institution or community applying the control16. A number of schedules with various combinations and durations of human and porcine treatment were evaluated in a simulation model. Mass human chemotherapy alone proved insufficient to eradicate T. solium. Concurrent human and porcine treatment was more effective in terms of control of T. solium. None of the interventions was economically more advantageous than no intervention, emphasizing that the core problem is economic.

References 1. Murrel, K.D. (1991) Economic losses resulting from food-borne parasitic zoonosis. Southeast Asian Journal of Tropical Medicine and Public Health 22, 377–381. 2. Gonzalez, A.E., Cama, V., Gilman, R.H., et al. (1990) Prevalence and comparison of serologic assays, necropsy, and tongue examination for the diagnosis of porcine cysticercosis in Peru. American Journal of Tropical Medicine and Hygiene 43, 194–199. 3. McLeod, A. (1993) A model for infectious diseases of livestock. PhD thesis. University of Reading, Reading, UK. 4. Vose, D. (2000) Risk Analysis. A Quantitative Guide, 2nd edn. John Wiley & Sons, New York, 417 pp. 5. Evans, J.R., Olson, D.L. (1998) Introduction to Simulation and Risk Analysis. Prentice Hall, Englewood Cliffs, New Jersey, pp. 279. 6. Gemmell, M. (1996) Current knowledge of the epidemiology of the family Taeniidae: operational research needs in planning control of Taenia solium. In: García, H.H., Martínez, M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo, Lima, Peru, pp. 231–258. 7. Roth, J.A. (1992) Immune system. In: Leman, A.D., Straw, B.E., Mengeling, W.L., et al. (eds) Diseases of Swine. Iowa State University Press, Ames, Iowa, pp. 21–39. 8. Gonzalez, A.E., García, H.H., Gilman, R.H., et al. (1996) Effective, single dose treatment of porcine cysticercosis with oxfendazole. American Journal of Tropical Medicine and Hygiene 54, 391–394. 9. Allan, J.C. (1996) Detection of Taenia solium antigens in faeces. In: García, H.H., Martínez, M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo, Lima, Peru, pp. 327–340. 10. Craig, P., Rogan, M., Allan, J. (1996) Detection, screening and community epidemiology of taeniid cestode zoonoses: cystic echinococcosis, alveolar echinococcosis and neurocysticercosis. Advances in Parasitology 38, 169–249. 11. Gilman, R.H., García, H.H., Gonzalez, A.E., et al. (1999) Shortcuts to development: methods to control the transmission of cysticercosis in developing countries. In: García, H.H., Martínez, M. (eds) Taenia solium Taeniasis/Cysticercosis. Editorial Universo, Lima, Peru, pp. 313–326. 12. Gilman, R.H., García, H.H., Gonzalez, A.E., et al. (1996) Métodos para controlar la transmision de la cisticercosis. In: García, H.H., Martínez, M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo, Lima, Peru, pp. 327–340. 13. Cysticercosis Working Group in Peru. (1993) The marketing of cysticercotic pigs in the Sierra of Peru. Bulletin of the World Health Organization 71, 223–228. 14. Diaz, F., García, H.H., Gilman, R.H., et al. (1992) Epidemiology of taeniasis and cysticercosis in a Peruvian village. American Journal of Epidemiology 135, 875–882. 15. García, H.H., Gilman, R., Gonzalez, A.E., et al. (1996) Epidemiología de la cisticercosis en el Perú. In: García, H.H., Martínez, M. (eds) Taeniasis/Cisticercosis por T. solium. Editorial Universo, Lima, Peru, pp. 313–226. 16. Roberts, M.G. (1994) Modeling of parasitic populations: cestodes. Veterinary Parasitology 54, 145–160. 17. Dijkhuizen, A.A., Stelwagen, J., Renkema, J.A. (1986) A stochastic model for the simulation of management decisions in dairy herds, with special reference to production, reproduction, culling and income. Preventive Veterinary Medicine 4, 273–289.

Index

Acacia nilotica 165 Acquired immune deficiency syndrome 105, 281–283 Adnexal cysticercosis 270 Albendazole absorption 369 administration in active neurocysticercosis 378 cysticercal clumps 378 cysticercotic encephalitis 190 extraocular myocysticercosis 275 giant racemose cysticercosis 184, 379 heavy multilesional neurocysticercosis 191, 376 intraventricular neurocysticercosis 184, 205–206, 379 meningeal cysticercosis 205–206, 379 multiple parenchymal cysticercosis 376 paediatric neurocysticercosis 260 porcine cysticercosis 432–433 pregnancy 285, 371 single small enhancing CT lesions 247, 248, 254, 377–378 solitary cysticercus granuloma see single small enhancing CT lesions spinal cysticercosis 234 taeniasis 415 adverse reactions 371 dosage 371, 380, 381 interactions with cimetidine 370 dexamethasone 370, 380, 381 food 369–370 praziquantel 370 mechanism of action 368 structure 367–368

Albendazole sulphone metabolism 369 structure 368 Albendazole sulphoxide chiral behaviour 369 elimination 369 half-life 369 in children 369 metabolism 369 structure 368 Amyotrophic lateral sclerosis 231 Angiography 182, 221–222, 224–225, 312, 314 Animal models adult T. solium 35–36 intramuscular oncosphere assay 79, 153–154 T. solium cysticercosis in mice 27–29 natural infection 36 in pigs 36 T. crassiceps cysticercosis 36–38 establishment of 38–39 hereditary factors in 59–60 immune responses in 18–19, 37–38, 40–42 in Qa-2 transgenic mice 59–60 intracranial 38–42 intraocular 36–37 intraperitoneal 38 major histocompatibility complex in 59–60 sex hormone interactions 38 Mesocestoides corti cysticercosis hosts 38 immune responses in 40–42 neurocysticercosis immune responses in 40–42 449

450

Index

Animal models continued T. saginata asiatica in NOD SCID mice 48 Anterior chamber ocular cysticercosis 271, 275 Anticysticercal drugs see Albendazole, Praziquantel Antibodies to metacestode factor 29 to metacestode proteases 31–32 monoclonal, to diagnostic antigens 343–347 polyclonal, to diagnostic antigens 343–347 transplacental transfer of 79, 146 see also immunoglobulins, 324–338, 343, 440 Antigens antigen B see Paramyosin in diagnostic use adult Taenia see Coproantigen detection glycoproteins 330–331 in antigen ELISA 343–347 crude extract 344 HP10 345 H7 344 1F11 344 4F8 344 HP12 347 in porcine cysticercosis 147–148 synthetic 333–335 surface 336–337, 347 from T. crassiceps 333 excretory–secretory 2, 25, 147, 336, 337–338 for vaccination from T. ovis 424, 426 from T. crassiceps 424, 425, 426 from T. saginata 424 recombinant 426 Antigen ELISA see Antigens Arachnoiditis see Meningeal cysticercosis Areca catecho 165 Arteritis 179, 180, 201, 222, 224, 292, 297–298, 302, 312 Asian Taenia see T. saginata asiatica Astrocytes see Astrocytosis Astrocytosis 298 Asymptomatic cysticercosis 15, 18, 25, 105, 378, 415 Atarabine 165 Ataxia 201, 236–237 Atheroma 297 Attention deficit 265 B lymphocytes 40 see also Plasma cells Blasenwürmer 160 Blepharospasm 237 Brucella militensis 284 Brun’s syndrome 237 Calcareous corpuscles 290, 308, 309, 312 Calcified cysticercus 105, 312, 313

Canine cysticercosis 113 Canine tapeworm 2 see also T. hydatigena, T. ovis, T. pisiformis Carbon tetrachloride 165 Cauda equina syndrome 181, 231 CD4+ cells 16–18, 26, 31–32 CD8+ cells 16–18, 31–32 Cellular layer 290 Cerebral palsy 259 Cestocidal therapy see Albendazole, Niclosamide, Oxfendazole, Praziquantel Cestodaria 1 Charaka Samihita 158 Childhood neurocysticercosis see Paediatric neurocysticercosis Chinchillas 36, 426 Chlorpheniramine 382 Choreoathetosis 236–237 Colloidal stage CT 315, 323 MRI 320, 321, 323 pathology 292, 294, 295, 307, 308, 311, 323 Communicating cysticercosis 271, 273, 274 Complement 20, 26 Compulsory notification 107 Computed tomography (CT) 313–318, 323 cysticercotic encephalitis 190, 316 disseminated cysticercosis 193–194 extradural spinal cysticercosis 230 heavy non-encephalitic neurocysticercosis 191 intraventricular neurocysticercosis 202, 316, 318 meningeal cysticercosis 181–182, 316–318, 319 ocular cysticercosis 274 pseudomuscular hypertrophy 193–194 racemose cysticercosis see Meningeal cysticercosis sellar cysticercosis 235 single small enhancing CT lesions 252–25 Control with health education see Health education with human taeniacidal therapy 11, 88, 411–417, 431, 443–446 with porcine chemotherapy 412, 432–434, 444–446 simulation of 438–446 with vaccination see Vaccination, 411, 412 Conus medullaris syndrome 231, 233 Coproantigen detection 336–337 Coproparasitological examination see Stool examination Corticosteroids interactions with anticysticercal drugs 366, 370, 380, 381 administration in cysticercotic encephalitis 190, 376–377, 381 disseminated cysticercosis 195

Index

heavy multilesional neurocysticercosis 191 hydrocephalus 184–185, 381, 390 intraventricular cysticercosis 184 ocular cysticercosis 275, 276, 277 spinal cysticercosis 232, 234 Cranial nerve palsies 169, 178, 181, 190, 302 Cucurbitini 157–158 Cuticular layer 290 Cysticercotic encephalitis 173, 189–190, 302, 316, 376, 394, 396 Cysticercus bovis 2 Cysticercus cellulosae development 2, 5, 9–10, 25–26 morphology 2–3, 9–10, 177–178, 290–291, 307 Cysticercus tenuicollis 147–148 Cysticercus racemosus see Meningeal cysticercosis

Delirium 265 Dementia 169, 170, 175, 192–193, 263, 264, 265–266 Dendritic cell 40 Dexamethasone see Corticosteroids Diabetes insipidus 235 Disseminated cysticercosis 192–195, 376–377 DNA extraction see Polymerase chain reaction DNA probes 354 DNA vaccines 426 Dog cysticercosis see Canine cysticercosis Dot blot assay 5 Dryopteris filix 165

Echinococcus granulosus 332, 417 Economics of porcine cysticercosis 9, 150–151, 440–441, 444–446 Eggs environmental distribution 75–76, 148, 416, 438–439 morphology 5, 8–9, 336 survival 9 Enzyme-linked immunoelectrotransfer blot (EITB) anticysticercal treatment, effect of 331 in calcified cysticercosis 330, 333, 359–361 in cerebrospinal fluid 330 glycoproteins in 330 in family contacts 117, 258, 360–361 in intraventricular neurocysticercosis 202, 330–331 in meningeal cysticercosis 183 prevalence in children 257–258 prevalence in CT unit 78, 212, 331 prevalence in community 333, see also Epidemiology in porcine cysticercosis 76, 79, 85, 148–150 in saliva 332 sensitivity of 16, 330–331 in single small enhancing CT lesions 16, 247,

451

330, 333, 360–361 vaccination, effect of 423 Enzyme-linked immunoelectrotransfer blottaeniasis (EITB-T) 338 ELISA 331–333, 359–360 in cerebrospinal fluid 332, 343–345, 359–360 in children 259 in community surveys 107–108, 113, 333, see also Epidemiology comparison with EITB 87, 332–333, 359–360 in intraventricular neurocysticercosis 202 in meningeal cysticercosis 183 in porcine cysticercosis 145–146 in saliva 332 in serum 121, 332 in single small enhancing CT lesions 247, 333, 360–361 soluble antigens in 335 Encapsulated cysticercosis 300 Endoscopic approach 400–408, see also 204–205, 388, 390, 394 Eosinophil 15, 18, 27, 37, 178, 296, 308 Eotaxin 18 Ependymitis 201, 204, 298, 299, 302, 312, 389, 390, 391 Epidemiology human cysticercosis in Africa 134–135 in Argentina 65, 69 in Bali 113 in Benin 65, 131, 133 in Bolivia 64, 67 in Brazil 107–108 in Burundi 131, 133–134, 347 in Cambodia 114 in Cameroon 131, 133 in Central African Republic 131, 133 in Cheju Island 120 in China 65, 118 in Ecuador 64, 67, 416 in Europe 66 in Guatemala 64, 67, 94, 95, 96, 417 in Honduras 64, 67, 94, 95, 96, 258 in India 116–117 in Irian Jaya 65, 70, 113–114, 411 in Japan 65 in Jewish community of New York 130–131, 141–142 in Kenya 131 in Korea 65, 121 in Laos 114 in Madagascar 65, 131, 133–134 in Mexico 66–67, 85–87, 89, 347, 416 in Nicaragua 96 in Norway 69 in Pakistan 65 in Panama 64, 96

452

Epidemiology continued human cysticercosis continued in Papua New Guinea 70, 113–114 in Peru 64, 67, 76–77, 94, 213, 257–258 in Philippines 65, 113 in Senegal 65 in South Africa 65, 131, 133, 134 in Spain 69 in Togo 131, 132–133 in Uruguay 65 in United States 69, 70 in Vietnam 65, 113 porcine cysticercosis in Bali 113 in Brazil 102 in Burundi 134 in Guatemala 97 in Honduras 97 in Indonesia 113 in Irian Jaya 113 in Korea 121 in Mexico 85, 87 in Philippines 114 in Peru 70, 75–77, 79 in Tanzania 65–66 in Togo 134 seizures 211–213, 259 taeniasis in Bolivia 67 in Central American immigrants 92, 142 in China 118, 414 in Ecuador 67 in Guatemala 67, 69, 91–92 in Honduras 67, 92 in Brazil 102 in Burundi 133–134 in Indonesia 112–113 in Irian Jaya 112–113 in Latin America 67 in Korea 118, 120 in Mexico 67, 69, 83–85, 87 in Papua New Guinea 112 in Peru 69–70, 76–77 in Togo 134 Excretory–secretory products see Antigens Exophthalmos 235 Extradural spinal cysticercosis 229–230 Extraocular myocysticercosis 270–271 treatment of 275 Extrapyramidal syndrome 236–237 Foreign body giant cells 296, 308 Gamma-delta T cells 40–42 Geographic information system (GIS) 151–152

Index

Glia see Astrocytosis Gliosis see Astrocystosis Granular nodular stage CT 315, 316, 323 MRI 320, 322, 323 pathology 292, 294, 295, 307, 308, 311, 323 Granuloma 296, 302

Headache 107, 132, 169, 190, 200–201, 223, 247 Health education 88, 411, 412, 417, 431 Heat shock protein 42 Heavy non-encephalitic cysticercosis 191 Histology of calcified cysticercus 312 cysticercus 290–296, 307 inflammatory reaction 27–29, 294, 296, 297 parenchymal cysticercosis 302 Historical contribution of Aristophanes 157 Aristotle 63, 157 Carl Linnaeus 139, 158 Freidrich Küchenmeister 63, 160 Johann Goeze 139, 158–159 Hamilton Fairley 160, 165 Henry B.F. Dixon 160, 162–164, 165–166 Rudolph Leuckart 158–159 Rudolph Virchow 160–16, 177, 302 van Benden 158 Verster 2 Vosgien 160 William P. MacArthur 160, 162–164, 165–166 Yoshino 8, 9 Hooklets 291 Human immunodeficiency virus 281–283 Human leucocyte antigens in human neurocysticercosis 59 in single small enhancing CT lesions 57–59 Hyaline degeneration 291, 297 Hydrocephalus corticosteroids in 184–185, 381, 390 incidence 169 in intraventricular neurocysticercosis 200–202, 207, 302, 316, 387, 388, 393–394 in meningeal racemose cysticercosis 179, 181, 184–185, 387 medical treatment of 185, 390 outcome 396 septum pellucidotomy in 405 shunt occlusion in 185, 390, 396 surgical treatment of 184–185, 204–205, 389–394 Torlkidsen’s procedure for 388, 391 ventriculography in see Ventriculography ventriculoperitoneal shunts for 184–185, 204–205, 389–394 ventriculostomy for 204, 388, 390, 400, 405 Hymenolepis nana 19, 25, 332, 337

Index

Iridocyclitis 271 Immunity cellular 16–18 humoral 16–17 concomitant 19 evasion of 19–20, 25–32 molecular mimicry in 20 suppression of 20 in taeniasis 421 vaccination, role in 20, 422 Immunoblot 53, 113, 335, 343–345, 360 Immunoelectrophoresis 16, 87 Immunoglobulins 16, 17, 19, 20 Immunologically privileged sites 19 Indirect haemagglutination assay 87, 107, 337 Interferon-gamma 16–18, 29, 37, 40–41 Interleukins 16–18, 20, 29, 37, 40–41 Intracorporeal vacuoles 291, 308 Intracranial hypertension in cysticercotic encephalitis 189–190 in heavy non-encephalitic cysticercosis 191 incidence in 105, 132, 169, 170, 175, 179, 259 in intraventricular neurocysticercosis 201 in meningeal cysticercosis 179, 180 surgical treatment of 387–394 Intradermal test 337 Intradural extramedullary spinal cysticercosis 229–233, see also 181, 182, 233, 302 Intramedullary spinal cysticercosis 229, 232–234 Intramuscular oncosphere assay see Animal models Intraventricular neurocysticercosis 199–206 CT in 316, 318 EITB in 330–331 ELISA in 202 endoscopic treatment see Endoscopic approach MRI in 320 pathology 302 pipette suction in 393–394 surgical treatment of 389–394 Intravitreal cysticercosis 271–272 treatment of 276–277

Japanese B encephalitis 283–284

Ketoprofen 382

Lacunar syndromes 180, 221, 222 Landau Kleffner’s syndrome 236 Latex agglutination 343 Lennox Gastaut syndrome 259 Lentil lectin bound-glycoproteins 330–331, 335, 359 cDNA to 333–334

453

GP 13 330–331 GP 14 330–331 GP 18 330–331 GP 21 330–331 GP 24 330–331 GP 39–42 complex 330–331 Leukaemia see Neoplasia Lid cysticercosis 270, 275 treatment of 275 Lingual cysticercosis 170, 237 Lymphocyte 15, 26–27, 29, 178, 290, 296, 308

Macrophage 15, 17, 29, 296, 308 Magnetic resonance imaging (MRI) 318–324 cysticercotic encephalitis 190 heavy non-encephalitic neurocysticercosis 191 intradural extramedullary spinal cysticercosis 232 intramedullary spinal cysticercosis 233–234 intraventricular neurocysticercosis 202, 204, 320 meningeal cysticercosis 181–182, 320, 322 ocular cysticercosis 274 racemose cysticercosis see Meningeal cysticercosis sellar cysticercosis 235–236 single small enhancing CT lesion 246, 252–253 stroke 182, 225 Magnetic resonance spectroscopy 324–325 Magnetization transfer MRI 321, 322, 324 Major histocompatibility complex in single small enhancing CT lesions see Human leucocyte antigen in human neurocysticercosis see Human leucocyte antigen in experimental T. crassiceps cysticercosis 59–50 Mast cell 40 Meat inspection 146, 412, 422 in Africa 148 in Brazil 102 in Central America 68, 96–97 in Korea 121 in Mexico 68, 85 in Peru 68, 151–153 Meningeal cysticercosis 177–185 arachnoiditis 223, 232, 389, 390, 391 ataxia in 236–237 basal meningeal cysticercosis 300–301 cortical meningeal cysticercosis 295, 298, 300 CT in 316–318 meningitis in 297, 301–303 MRI in 319–320, 322 pathology 295, 298–304 surgical treatment of 388–395 Meningitis see Meningeal cysticercosis Mental retardation 259

454

Index

Mesocestoides corti see Animal models Metacestode factor 26–29, 30 Metacestode proteases 29, 31–32 Metacestodes development see Cysticercus cellulosae morphology see Cysticercus cellulosae of T. saginata 2–3 of T. saginata asiatica 2–3 of T. solium 2–3 Mini-mental state examination 265–266 Mitochondrial genome cestodes 49–53 platyhelminthes 49–53 T. solium 49–53 polymorphisms in 50–51 specimen collection for 52 Mood disorder 263, 265–266 Mycotic aneurysm see Subarachnoid haemorrhage Myelography 182, 232 Myoclonus 236

National Epidemiological Surveillance (in Mexico) 83–85, 85–86, 88 Neoplasia central nervous system 285–286 haematological 20, 283, 285 Neurocysticercosis active 172, 199 anatomical classification 172 diagnostic criteria 170–171 evolutionary classification 172–173, 199, 291–295, 311–312, 313–315, 318–320, 323 geographic variations in 174 inactive 172–173, 199 surgical classification 171–172, 388, 396 transitional 172, 199 Neutrophils 27, 37, 308 NK cells 40 Niclosamide dosage 415 for mass chemotherapy 415, 417 structure 415 Nodular calcified stage CT 312, 315, 317, 323 MRI 320, 323 pathology 296, 307, 311, 323

Ocular cysticercosis 132, 139, 170, 269–278 experimental see Animal models Omphalia lapidescens 165 Onchocerciasis 132 Oncosphere morphology 2–5, 9 penetration of 25 Optochiasmatic cysticercosis 178, 180

Ova see Eggs Ovary (of Taenia sp.) 2–5 Oxfendazole dosage 433 in porcine cysticercosis 433–435, 444, 446 structure 433 Paediatric neurocysticercosis 257–260 Panhypopituitarism 235 Paramyosin 20, 26 Pars plana vitrectomy 276–277 Persisting lesions 244, 252–253, 254 Phase MRI 324 Photocoagulation 276–277 Phylogeny of cestodes 1–2, 47–48 T. saginata asiatica 1–2, 47–48 T. solium 1–2, 47, 49–52, 158–160 Pig husbandry 411, 412, 422, 440 Pig population in Brazil 102 in China 117 in India 116 Plasma cells 15, 17, 27, 308 Polymerase chain reaction 351–355, 357–358 Pork markets in Peru 151–152, 433, 440–441 Pork tapeworm see T. solium Post-ictal lesions 243 Positron emission tomography 324 Praziquantel absorption 364 adverse reactions 366 administration in active neurocysticercosis 378 cysticercotic encephalitis 190, 376–377 disseminated cysticercosis 194, 376 giant racemose cysticercosis 184, 379 intraventricular neurocysticercosis 205 meningeal cysticercosis 379 ocular cysticercosis 275 occult neurocysticercosis 15, 18, 25, 105, 378, 415 paediatric neurocysticercosis 260 porcine cysticercosis 432 taeniasis 88, 378, 414, 415–418, 431, 443–446 bioavailability 365 distribution 364–365 dosage 367 duration of treatment 367, 380–381 elimination 364–365 interactions with albendazole 370 carbamazepine 366 cimetidine 366–367 dexamethasone 366, 380, 381 food 365 phenytoin 366

Index

mechanism of action 364 metabolism 364–365 pharmacokinetics 364–365 in liver disease 365 range of action 363–364 structure 363–364 single day treatment 367, 380 therapeutic regimens 367 use in children 260, 367 use in pregnancy 285, 366 Prednisolone see Corticosteroids Pregnancy 284–285 Prevalence human cysticercosis at autopsy 66, 85, 93–94, 96–97, 103–105, 116, 130, 289 CT based 78, 93, 95–96, 103, 107, 113, 117, 331 in epilepsy see Seizure disorder gender, effect of 92 hospital based 66, 77–78, 130, 213 longitudinal study of 77 in neurological disorders 77–78, 79, 121, 132 in seizure disorders 67–68, 78, 96, 113, 121, 131–132, 213 serological see Epidemiology taeniasis age, effect of 69, 91, 93, 257 with antigen assays 147 gender, effect of 69, 83, 93 at necropsy 66, 67 in neurocysticercosis 79, 142, 191, 192 see also Epidemiology porcine cysticercosis age, effect of 79 at necropsy see Meat inspection serological 67, 70, 75–77, 79, 85, 87, 148, see also Epidemiology by tongue examination 66, 67, 79, 85, 87, 145, 148, 423 Proglottides structure T. saginata 2–5, 336 T. saginata asiatica 2–5 T. solium 2–5, 336 Pseudomuscular hypertrophy 192–195 Psychiatric disorders incidence 264 treatment of 265 Queen Alexandria Military Hospital 160–166 Racemose cysticercosis see Meningeal cysticercosis Raigan 165 Renal transplant 283 Reticular layer 290 Rodent tapeworm see T. crassiceps

455

Schizophrenia 263 Scolex T. saginata 2–5, 290–291 T. saginata asiatica 2–5 T. solium 2–5, 290–291, 336 Seizures 211–218, 251–255 antiepileptic drugs in 216–217, 241, 246, 247, 253–254, 260, 283, 285 electroencephalography in 214–215 effect of anticysticercal treatment 215–217, 247, 254, 379 EITB in 211–212, 213 epidemiology of 211–213, 259 hippocampal atrophy in 215, 236 in meningeal cysticercosis 181 incidence 107, 113, 131, 169, 175, 192, 212, 251 in intraventricular neurocysticercosis 200 mesial temporal sclerosis in 215, 236 outcome 216–219, 246, 247, 254–255 Sellar cysticercosis 234–236 Sentinel pig model 149–150 Seroprevalence see Epidemiology Single small enhancing CT lesions 241–248 aetiology 174 antiepileptic drugs in 241, 248, 252, 253–254, 377–378 albendazole in 247, 248, 254, 377–378 CT in 252–253 calcified 253 in children 259 diagnostic criteria 252 EITB in 247, 330, 333, 360–361 ELISA in 247, 333, 360–361 enlarging 246–247, 248 genetic factors in 57–60 headache in 247 hereditary factors in see Genetic factors in human leucocyte antigen in see Human leucocyte antigen incidence 251, 311 in international literature 245, 251 MRI in 246, 252–253 outcome 254–255 pathology 243, 251–252, 307–309 persisting lesions 244, 252–253, 254 post-ictal 243 prognosis 254–255 seizures in 246, 252–253 tuberculoma as 241–242, 309 Single small enhancing lesions see Single small enhancing CT lesions Skull roentgenogram 162–163, 312, 313 Slaughterhouse inspection see Meat inspection Soft tissue roentgenogram 162–163, 193, 195, 312–313 Solitary cysticercus granuloma see Single small enhancing CT lesions

456

Index

Spinal cysticercosis incidence 175, 229 in meningeal cysticercosis 181 see also Extradural cysticercosis, Intradural extramedullary cysticercosis, Intramedullary cysticercosis Stereotactic approach 243, 393 Stool examination 2–4, 336 Strobila 5–7 Stroke 221–226 angiography in 182, 312, 314 arteritis in 179, 180, 201, 292, 297–298, 302, 312 in meningeal cysticercosis 180 incidence in 175 Subarachnoid cysticercosis see Meningeal cysticercosis Subarachnoid haemorrhage 180, 222, 224 Subconjunctival cysticercosis 270, 271, 274, 275 Subcutaneous nodules 65, 117, 121, 132, 192–193 Subretinal cysticercosis 271–272 treatment of 276–277 Sudden death 237 Synthetic TS 14 (sTS14) 335 Synthetic TS 18 (sTS18) 335 Syringomyelia 231, 302

T lymphocytes 16–18, 37, 40–42, see also CD4+ cells, CD8+ cells T2* MRI 320 T. crassiceps 2, 36–42, 59–60, 282, 333, 424, 425, 426 T. hydatigena 2, 148, 160 T. saginata antigens 424 coproantigen detection in 336–337 differences from T. solium 2–5 morphology 2–5 speciation 2 T. saginata asiatica differences from T. solium 2–5 in NOD SCID mice 48 morphology 2–5 speciation 2, 47–48 T. pisiformis 2, 160 T. multiceps 2 T. ovis 2, 424, 426 T. solium antigens 424–426 coproantigen detection in 336–337 developmental stages 5–10 EITB-T 338 immune responses in 15, 21, 421 immunodiagnosis 336–338 intradermal test in 337 hosts experimental 5

natural 5 life cycle of 5–10 life span 8 morphology 2–5, 336 mitochondrial genome 49–53 phylogeny of 1–2, 41, 49–52 reproductive potential 9, 10, 413, 438 reproductive system 7–8 taeniacidal therapy 414–417, 431, 443, 445 treatment see above vaccination 421 T. taeniaeformis 2 Taeniaestatin 8, 26 Taeniidae 1, 2 Taxonomic status of T. saginata asiatica see Phylogeny of T. solium see Phylogeny of Taeniidae see Phylogeny Testes 7 Thalamomesencephalic syndrome 180, 222 Th1 response 16–19, 37, 40–42 Th2 response 16–19, 37, 40–42 The Cysticercosis Working Group in Peru 75–80, 382–38 Three-dimensional constructive interference MRI 324 Thymol 165 Toxoplasmosis 281, 284 Transcranial Doppler 226 Transmission of cysticercosis 9, 68–70, 130, 162 imported disease 69–70, 121–122, 140, 141 introduced disease 69, 70, 111–114 risk factors 68–70, 87–88, 102, 112, 130, 211–212, 413–414 through flies 87–88 through fruits 87–88 through household contacts 141–142, 258, 414 through immigrants 51, 69–70 through water 9, 130 Trapped ventricle 324, 391 Traubenhydatiden 160, 177, 300, 302 Tuberculoma 241–242, 309 Tumour necrosis factor-alpha 18, 29 Tumour necrosis factor-beta 16, 17

Ultrasound 273, 274, 275

Vaccination cysticercosis 20, 411, 412, 422–427 DNA 426 in field studies 424–427 preparation of 424, 425–426

Index

protective 422, 424, 426–427 recombinant antigens in 426 therapeutic 422, 423–424 taeniasis 421 Vagina 2–4, 7 Vasculitis see Arteritis Ventriculography 312, 314, 316, 318, 389, 390

Vesicular stage CT 311, 314, 315, 323 MRI 318, 319, 323 pathology 291, 292, 294, 295, 307, 333 Wandtafeln 158–159

457