Contributors to V o l u m e 217 Article numbers are in parentheses following the names of contributors. Affiliations li...
33 downloads
1273 Views
21MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
Contributors to V o l u m e 217 Article numbers are in parentheses following the names of contributors. Affiliations listed are current.
GIOVANNA F E R R O - L u z z 1 A M E S ( 3 2 ) , Department of Molecular and Cell Biology, Division of Biochemistry, University of California, Berkeley, Berkeley, California 94720
lina, Chapel Hill, North Carolina 27599 RICHARD L. CATE (29), Biogen, Inc., Cambridge, Massachusetts 02142 KARL X. CHA1 (23), Department qf Biochemistry and Molecular Biology, Medical University of South Carolina. Charleston, South Carolina 29425 JULIE CHAO (23), Department of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston, South Carolina 29425
SILV1A B~HRING (5), Institutfi~r Molekularhiologie, Abteilung Molekulare Zellgenetik, D-Ill5 Berlin-Buch, Germany VLADIMIR [. BARANOV (9), RiboGene, Inc., Hayward, California 94545 CARL A. BATT (18), Department of Food Science, Cornell University, Ithaca, New York, 14853
LEE CHAO (23), Department of Biochemistry and Molecular Biology, Medical University of South Carolina, Charleston. South Carolina 29425
JEAN-PAUL BEHR (41), Laboratoirede Chi. mie Gdndtique, Universitd Louis Pasteur, CNRS URA 1386, F-67401 lllkirch, France
LIN CHEN (7), Department of Chemistry, Harvard University, Cambridge, Massachusetts 02138
MARTIN W. BERCHTOLD (8), lnstitut fiir Pharmakologie und Biochemie, Universitiit Ziirich-lrchel, Ch-8057 Zurich, Switzerland
YUNJE CHO (18), Field of Microbiology. Cornell University, Ithaca, New York 14853 CHRISTOPHER COLECLOUGH (11), Department of Immunology, St. Jude Children's Research Hospital, Memphis, Tennessee 38101 MATTHEW COTTEN (42), Research Institute of Molecular Pathology, A-I030 Vienna. Austria
MAX L. BIRNSTIEL (42), Research Institute of Molecular Pathology, A-I030 Vienna, Austria JOHN E. BOYNTON (37), Department of Botany, Duke University, Durham, North Carolina 27706 |RENA BRONSTEIN (29), Tropix, Inc., Bedford, Massachusetts 01730 LAKI BULUWELA (28), Department of BiDchemistry, Charing Cross and Westminster Medical School, London W6 8RF, England ZELING CAI (17), Department oflmmunology, Mayo Clinic, Rochester, Minnesota 55905 CELESTE CANTRELL (31), Department of Pharmacology, University of North Caroix
RICHARD G. H. COTTON (19), Olive Miller Protein Laborato~, Murdoch Institute. Royal Children's Hospital, Parkville Victoria 3052. Australia HENRY DANIELL (38), Department of Botany and Microbiology, Auburn Universit3", Auburn, Alabama 36849 BIMALENDU DASMAHAPATRA (10), Department of Antiviral Chemotherapy, Schering-Plough Research Corporation, Bloomfield, New Jersey 07003
X
CONTRIBUTORS TO VOLUME 217
NORMAN DAVIDSON (33), Division of Biol-
MICKEY C-T. Hu (33), Department of Ex-
ogy, California Institute of Technology, Pasadena, California 91125 ANTONIA DESTREE (39), Therion Biologics Corporation, Cambridge, Massachusetts 02142 V. J. DWARK! (43), Vical Inc., San Diego, California 92121 FRITZ ECKSTEIN (13), Abteilung Chemie, Max-Planck-lnstitut fiir Experimentelle Medizin, D-3400 GOttingen, Germany CHRISTIAN W. EHRENFELS (29), Biogen, Inc., Cambridge, Massachusetts 02142 J. VICTOR GARCIA (40), Department of Virology and Molecular Biology, St. Jude Children's Research Hospital, Memphis, Tennessee 38101 NICHOLAS W. GILLHAM (37), Department of Zoology, Duke University, Durham, North Carolina 27706 ALEXANDER N. GLAZER (30), Department of Molecular and Cell Biology, Division of Biochemistry and Molecular Biology, University of California, Berkeley, Berkeley, California 94720 MICHAEL M. GOTTESMAN (4), Laboratory of Cell Biology, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892 RICHARD P. HAUGLAND (30), Molecular Probes, Inc., Eugene, Oregon 97402 STEFEAN N. Ho (17), Department of Pathology, Stanford University Medical School, Stanford, California 94305 BERND HOFER (12), Abteilung Mikrobiologie, Gesellschaft far Biotechnologische Forschung, D-3300 Braunschweig, Germany CHRISTA HORICKE-GRANDPIERRE (6), Abteilung Genetische Grundlagen der Pflanzenziichtung, Max-Planck-lnstitut fiir Ziichtungsforschung, D-5000 KOIn 30, Germany
perimental Hematology, Amgen, Inc., Amgen Center, Thousand Oaks, California 91320 TIM C. HUFFArER (21), Section of Biochemistry, Molecular and Cell Biology, Cornell University, Ithaca, New York 14853 HENRY D. HUNT (17), Department of Immunology, Mayo Clinic, Rochester, Minnesota 55905 ANDREW C. JAMIESON (18), Melvin Calvin Laboratory, University of California, Berkeley, California 94730 R. JILK (22), Department of Biochemistry, College of Agricultural and Life Sciences, University of Wisconsin-Madison, Madison, Wisconsin 53706 SUSAN E. KANE (4), City of Hope National Medical Center, Duarte, California 91010 PETR KARLOVSKY (24), Institute of Plant Pathology, University of GOttingen, D-3400 Gdttingen, Germany DAVID C. KASLOW (20), Molecular Vaccine Section, Laboratory of Malaria Research, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland 20892 M. P. KREBS (22), Department of Chemistry, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139
ROBERT M. HORTON (17), Department of
Biochemistry, Gortner Laboratories, University of Minnesota, St. Paul, Minnesota 55108
BIRGIT Kt)HLEIN (12), Max-Planck-lnstitut
far Experimentelle Endocrinologie, D-3000 Hannover, Germany ERIC LAI (31), Department of Pharmacol-
ogy, University of North Carolina School of Medicine, Chapel Hill, North Carolina 27599 ANDRE LIEBER (5), Abteilung Molekulare
Zellgenetik, lnstitut fiir Molekularbiologie, D-1115 Berlin-Buch, Germany JEAN-PHILIPPE LOEFFLER (41), lnstitut de
Physiologie, CNRS URA 1446, F-67084 Strasbourg, France
CONTRIBUTORS TO VOLUME 217
Xi
CARMEL M. LYNCH (40), Targeted Genetics
HENRig 0RUM (2), Department of Biochem-
Corporation, Seattle, Washington 98101 CHRISTOPH MAAS (6), Abteilung Genetische Grundlagen der Pflanzenziichtung, MaxPlanck-lnstitut fiir Ziichtungsforschung, D-5000 KOln 30, Germany KURTIS D. MACFERRIN (7), Department of Chemistry, Harvard University, Cambridge, Massachusetts 02138 KAYO MAEDA (1), European Molecular Biology Laboratory, Hamburg Outstation, D-2000 Hamburg, Germany ANNA MASR (39), Integrated Genetics, Inc., Framingham, Massachusetts 01701 J. C. MAKRIS* (22), Lawrence Livermore National Laboratory, Livermore, California, 94551 ROBERT W. MALONE (43), Department of Pathology, University of California, Davis Medical Center, Sacramento, Califi~rnia, 95817 RICHARD A. MATHIES (30), Department of Chemistry, University of California, Berkeley, Berkeley, California 94720 GAIL P. MAZZARA (39), Therion Biologics Corporation, Cambridge, Massachusetts 02142 A. DUSTY MILLER (40), Program in Molecular Medicine, The Fred Hutchinson Cancer Research Center, Seattle, Washington 98104 DANIEL G. MILLER (40), Program in Molecular Medicine, The Fred Hutchinson Cancer Research Center, Seattle, Washington 98104 CESAR MILSTEIN (28), Medical Research Council Laboratory of Molecular Biology, Cambridge CB2 2QH, England OWEN J. MURPHY (29), Tropix, Inc., Bedford, Massachusetts 01730 P. L. NORDMANN (22), Department of Microbiology, Biozentrum, University of Basel, CH-4056 Basel, Switzerland DAVID B. OLSEN (13), Merck Sharp and Dohme, Research Laboratories, West Point, Pennsylvania 19486
istry B, The Panum Institute, Research Center for Medical Biotechnology, University of Copenhagen, DK-2200 Copenhagen N, Denmark
* Deceased.
GARY V. PADDOCK (25), Department of Mi-
crobiology and Immunology, Medical University of South Carolina, Charleston, South Carolina 29425 R. PADMANABHAN (14), Department of Bio-
chemistry and Molecular Biology, University of Kansas Medical Center. Kansas City, Kansas 66013 THOMAS L. PAULS (8), lnstitutfiir Pharma-
kologie und Biochemie, Universitdt Zt~rich-lrchel, CH-8057 Zurich, Switzerland LARRY R. PEASE (17), Department of Immu-
nology, Mayo Clinic', Rochester, Minnesota 55905 HUNTINGTON POTTER (34), Department of
Neurobiology, Harvard Medical School, Boston, Massachusetts 02115 LAgs K. POULSEN (2), Department of Mi-
crobiology, Denmark Technical University, DK-2800 Lyngby, Denmark ANNEMARIE POUSTKA (26, 27), lnstitut j'~r
Virusforschung, Angewandte Tumorvirologie, Deutsches Krebsforschungszen(rum, D-6900 Heidelberg, Germany JEFFREY K. PULLEN (17), Department of
Immunology, Mayo Clinic, Rochester. Minnesota 55905 MARK A. QUESADA (30), Department of
Chemistry, University of California, Berkeley, Berkeley, California 94720 DAVID J. RAWLINGS (20), Howard Hughes
Medical Institute, University of California, Los Angeles, Los Angeles, California 90024 W. S. REZNIKOFF (22), Department of Bio-
chemistry, College of Agricultural and Life Sciences, University of WisconsinMadison, Madison, Wisconsin 53706 J. A. RUSSELL (36), Department of Horticul-
tural Sciences, New York State Agricul-
xii
CONTRIBUTORS TO VOLUME 217
tural Experiment Station, Cornell University, Geneva, New York 14456 HAYS S. RYE (30), Department of Molecular
and Cell Biology, Division of Biochemistry and Molecular Biology, University of California, Berkeley, Berkeley, California 94720 JENNIFER A. SALEEBA (19), Department of Biological Science, Dartmouth College, Hanover, New Hampshire 03755 VOLKER SANDIG (5), lnstitutfiir Molekularbiologie, Abteilung Molekulare Zellgenetik, D-1115 Berlin-Buch, Germany J. C. SANFORD (36), Department of Horti-
cultural Sciences, New York State Agricultural Experiment Station, Cornell University, Geneva, New York 14456 JON R. SAYERS (13), School of Biological Science, University of North Wales, Bangor, Gwynedd, Wales LL57 2DG JEFF SCHELL (6), Abteilung Genetische
Grundlagen der Pflanzenziichtung, MaxPlanck-lnstitut fiir Ziichtungsforschung, D-5000 KOln 30, Germany STUART L. SCr~REIRER (7), Department of Chemistry, Harvard University, Cambridge, Massachusetts 02138 JAMIE K. SCOTT (15), Division of Biological
Sciences, University of Missouri, Columbia, Missouri 65211 GEORG SCZAKIEL (1), Angewandte Tumorvirologie, Deutsches Krebsforschungszentrum, D-6900 Heidelberg, Germany VENKATAKRISHNASHYAMALA(32), Chiron
Corporation, Emeryville, California 94608 JOHN R. SIMON (35), Department of Biologi-
cal Chemistry and Laboratory of Biomedical & Environmental Sciences, University of California School of Medicine, Los Angeles, California 90024 F. D. SMITH (36), Department of Horticul-
tural Sciences, New York State Agricultural Experiment Station, Cornell University, Geneva, New York 14456 GEORGE P. SMITH (15), Division of Biologi-
cal Sciences, University of Missouri, Columbia, Missouri 65211
WOLFGANG SOMMER (5), lnstitut far Mole-
kularbiologie, Abteilung Molekulare Zellgenetik, D-Ill5 Berlin-Buch, Germany ALEXANDER S. SPIRIN (9), Institute of Protein Research, Academy of Sciences, 142292 Pushchino, Moscow Region, Russia HANS-HENNING STEINBISS (6), Abteilung Genetische Grundlagen der Pflanzenziichtung, Max-Planck-lnstitut far Ziichtungsforschung, D-5000 KOln 30, Germany MICHAEL STRAUSS (5), Max-Planck Group of the Humboldt University, MaxDelbriick Center for Molecular Medicine, D-I 115 Berlin-Buch, Germany MICHAEL P. TERRANOVA(7), Department of Chemistry, Harvard University, Cambridge, Massachusetts 02138 RICHARD TIZARD (29), Biogen, Inc., Cambridge, Massachusetts 02142 REINHARD TOPFER (6), Abteilung Genetische Grundlagen der Pflanzenziichtung, Max-Planck-lnstitut far Ziichtungsforschung, D-5000 KOln 30, Germany SHIGEZO Ut)AKA (3), Department of Food Science and Technology, Faculty of Agriculture, Nagoya University, Nagoya 464, Japan GREGORY L. VERDINE (7), Department of Chemistry, Harvard University, Cambridge, Massachusetts 02138 INDER M. VERMA (43), Molecular Biology and Virology Laboratory, The Salk Institute, San Diego, California 92186 JOHN C. VOYTA (29), Tropix, Inc., Bedford, Massachusetts O1730 ERNST WAGNER (42), Research Institute of Molecular Pathology, A-I030 Vienna, Austria MARY M. Y. WAYE (16), Department of Biochemistry, Chinese University of Hong Kong, Hong Kong M. WEINREICH (22), Department of Biochemistry, College of Agricultural and Life Sciences, University of WisconsinMadison, Madison, Wisconsin 53706
CONTRIBUTORS TO VOLUME 217 T. WIEGAND (22), Department of Biochem-
istry, College of Agricultural and Life Sciences, University of Wisconsin-Madison, Madison, Wisconsin 53706 LAI-CHu W c (28), Davis Medical Center, Departments of Medical Biochemistry and Internal Medicine, The Ohio State University, Columbus, Ohio 43210 HIDEO YAMAGATA (3), Department of Food Science and Technology, Faculty of Agriculture, Nagoya University, Nagoya 464, Japan C. YUNG YU (28), Departments of Pediatrics and Medical Microbiology and lm-
Xlll
munology, The Ohio State University and Children's Hospital Research Foundation, Columbus, Ohio 43205 STEPHEN YUE (30), Molecular Probes, Inc.,
Eugene, Oregon 97402 Q.-X. ZHANG (14), Department of Biochem-
istry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas 66103 L.-J. ZHAO (14), Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas 66103
[1]
E. coli EXPRESSIONPLASMIDpPLEX
[1] V e c t o r p P L E X
By
3
for E x p r e s s i o n o f N o n f u s i o n P o l y p e p t i d e s in E s c h e r i c h i a coli
GEORG SCZAKIEL a n d KAYO MAEDA
Introduction Escherichia coli bacteria are a powerful tool for the production of heterologous proteins in large quantities, which is of general experimental importance in many fields of natural sciences, for example, in biochemical and biophysical studies. The functional genes coding for polypeptides of interest are introduced stably into E. coli bacteria by E. coli vectors (e.g., plasmids, bacteriophages, cosmids, and phagemids). The expressed polypeptides originate from a unique type of coding DNA and thus, in E. coli from nonspliceable mRNAs, the peptide sequence of expressed molecules is defined exactly, that is, they are monoclonal. For many studies, monoclonal polypeptides are of great advantage in comparison with protein preparations from natural sources, which may consist of numerous closely related but not identical isoforms. Escherichia coli is one of the best studied organisms and many well-established methodologies used in molecular biology can be applied to modify and handle vectors and coding sequences. 1,2 Polypeptides of interest can be expressed in E. coli as fusion proteins, usually extended at the amino terminus with prokaryotic portions intended to provide increased translational initiation, stability, solubility, alternative purification protocols, and yield, or to allow secretion. Fusion proteins can be used for immunological studies, such as the production of antisera, or as antigens in enzyme-linked immunosorbent assay (ELISA) or Western analysis. However, their use in other studies, for example, those concerning enzymatic activities and three-dimensional structures, is limited, especially in the latter case, where the expression of nonfusion proteins is desirable. The necessary elements that an expression plasmid should supply are an origin of replication, a dominant selection marker for plasmid propagation and maintenance, and transcriptional (promoter) and translaLT. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982. 2 F. M. Ausubel, R. Breut, R. E. Kingston, D, D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl, "Current Protocols in Molecular Biology." Wiley, New York, 1987.
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
4
VECTORS FOR EXPRESSING CLONED GENES
[1]
tional initiation sites (Shine-Dalgarno sequence and start codon), as well as termination signals for translation and transcription. Transcription directed by strong promoters can down-regulate plasmid replication, which may result in the loss ofplasmid. For this reason transcription from strong promoters usually needs to be terminated by efficient transcriptional terminators, A number of other parameters for successful expression of heterologous eukaryotic sequences in E. coli must be considered and tested: (1) DNA sequence and primary and secondary structure of the transcript in the vicinity of the start codon, 3 (2) codon usage, 4 (3) possible toxicity of expression products for E. coli, (4) posttranslational modifications, (5) RNA editing of eukaryotic sequences in the homologous system, 5'6 which does not occur in E. coli, and (6) evaluation of the ability of expressed portions of proteins to form defined structures. The techniques for prokaryotic gene expression have been described in detail. 7 Principle of Method The expression vector pPLEX 8 contains all elements necessary for the expression of open reading frames in E. coli. For transcription the bacteriophage h-derived strong PL Promoter9 and the t R terminator are used. The PL promoter can be regulated, that is, repressed or induced by the thermolabile h ci857 repressor,10 which is active at the permissive temperature of 28 ° but is inactive at 37 or 42 °. The gene coding for the ci857 repre s sor can be plasmid encoded or can be integrated into the host cell chromosome (e.g., E. coli strain NF 1). The translational control elements, that is, the ribosomal binding site and stop codons in all three reading frames as well as unique cloning sites in between, are indicated in Fig. 1. Materials and Methods
Escherichia coli Strains NF1 (K12) AH1 H): F - A(bio- uvrB) lacZam hNam7 Nam53 ci857 AH1 (cro-F-A-J-b2 ) 3 H. A. De Boer and A. S. Hui, this series, Vol. 185, p. 103. 4 p. M. Sharp and W.-H. Li, Nucleic Acids Res. 15, 1281 (1987). 5 L. Simpson and J. Shaw, Cell 57, 355 (1989). 6 A. M. Weiner and N. Maizels, Cell 61, 917 (1990). 7 D. V. Goeddel, this series, Vol. 185, p. 3. 8 G. Sczakiel, A. Wittinghofer, and J. Tucker, Nucleic" Acids Res. 15, 1878 (1987). 9 E. Remaut, P. Stanssens, and W. Fiers, Gene 15, 81 (1981). l0 M. Lieb, J. Mol. Biol. 16, 149 (1966). ii H.-U. Bernard, E. Remaut, M. V. Hershfield, H. K. Das, D. R. Helinski, C. Yanowsky, and N. Franklin, Gene 5, 59 (1979).
[1]
E. coli EXPRESSION PLASMID p P L E X
5
(130) NCOI
SalI
HindIII
HpaI
BclI
I CCATr~GTCGAC AAG CTT AC;TTAACTOATCA (o)
~
Stul
Pvu[
/
/
/ I-
\
/
"\ \
(3450)"~ ( {
PstI l \
/
pPLEX
i
\
/ /¢~/
fO /
/
(~ Ms 2 Shine- Datgarno Sequence: EcoR 1 GAATTCCGAC
TGCGAGCTTA
TTGTTAAGGC
AATGCAAGGT
CTCCTAAAAG
ATGGAAACCC
GATTCCCTCA
GCAATCGCAG
CAAACTCCGG
CATCTACTAA
TAGACGCCGG
CCATTCAAAC
ATGAGGATTA
CCCATGG
Nco 1 ®
%tR
Sequence:
TAAATAACCC
CGCTCTTACA
CATTCCAGCC
CTGAAAAAGG
Nsi I GCATCAAATT
AAACCACACC
TATGGTGTAT
GCATACATTC
AATCAATTGT
TATCTAAGGA A A T A C T T A C A
GCATTTATTT TATG
FIG. 1. Structure of the E. coli expression plasmid pPLEX and sources of sequence elements: A, MS 2 Shine-Dalgarno (S.D.) sequence [G. Simons, E. Remaut, B. Allet, R. Devos, and W. Fiers, Gene 28, 55 (1984)]; B, htR fragment; C, galactokinase gene [C. Debouck, A. Riccio, D. Schlumperli, K. McKenney, J. Jeffers, C. Hughes, and M. Rosenberg, Nuclei(" Acids Res. 13, 1841 (1985)]; D, fragment from pPLc245 containing the ,kpL promoter [E. Remaut, P. Stanssens, and W. Fiers, Nucleic Acids Res. 11, 4677 (1983)]. Note that BclI is sensitive to Dam methylation. In order to use the BclI site pPLEX must be grown in a dam- E. coli strain. An additional AccI site located on the pBR322 sequence that is present in the original plasmid pPLEX but was filled in with Klenow fragment and nucleotide triphosphates, that is, it was destroyed in pPLEXAcc • (J. Tucker, unpublished observations, 1986.)
6
VECTORS FOR EXPRESSING CLONED GENES
[1]
W6 (origin not known): su-, cI (wild type) unc195912: lacI Q lacL8 thr-1 ara-14 leuB6 A(gpt-proA) 62 lacY1 1on-22 supE44 galK2 h- sulA27 hisG4 rpsL31 xyl-5 mtl-1 thi-1
Cloning Methods of recombinant DNA technology are essentially performed following the protocols of Maniatis et al.1 For cloning pPLEX-derived constructs we use E. coli strain W6, containing the h wild-type cI repressor integrated into its chromosome. The wild-type repressor is able to shut off the PL promoter efficiently, thus allowing stable replication and high copy numbers of recombinant pPLEX-derived constructs. In principle an E. coli strain harboring the thermolabile ci857 repressor is also suitable at the permissive temperature of 28°; however, the clearly decreased growth rate at this temperature seems to be a disadvantage. For induction of the PL promoter, E. coli host strains NFI and unc1959, both containing a cI857-carrying plasmid, are used. Transformation of E. coli cells is performed following the CaCI2 method 13 for W6 and NF1 or the protocol developed by Hanahan 14 for DH2/6. The transformation yields for 1 /xg of pPLEX DNA with freshly prepared bacteria are in the range of 5 × 105 for W6 and 1 × 106 for NF1. The transformation frequency after storage of transformation-competent cells in 5% (v/v) glycerol at - 7 0 ° is decreased by a factor of approximately 10.
Induction of hPL Promoter The protocol for the induction of the hPL promoter of E. coli strains carrying pPLEX constructs is depicted schematically in Fig. 2. As an alternative way of induction of the LMM expression plasmid pEXLMM74 a temperature shift to 42 ° may be performed for 15 min with subsequent incubation at 37° for 4 hr. To raise the temperature quickly to 42 ° for large volumes (e.g., 10 liter), an appropriate amount of fresh medium preheated to 60 ° is added. On induction, suppression of the htR terminator results in transcription of a bicistronic mRNA consisting of the heterologous open reading frame and the coding sequence for galactokinase. Thus, an increase in galactokinase activity monitors efficient hpL-directed transcription.
12 Obtained from B. Bachman, E. coli Genetic Stock Centre, New Haven, Connecticut. I3 M. Mandel and A. Higa, J. Mol. Biol. 53~ 159 (1970). 14 D. Hanahan, J. Mol. Biol. 166, 557 (1983).
[1]
E. coli EXPRESSION PLASMID pPLEX
7
Grow 1 ml overnight culture of E. coli strain NF1 transformed with pPLEX construct in medium (standard I or L-broth supplemented with 100 p.g/ml ampiciUin) at 28° $ Inoculate 1 ml of fresh medium with 10/xl of dense overnight culture Incubate for 1 hr at 28° $ Divide culture in two 0.5-ml aliquots
/
\
4 hr, 28° (uninduced control)
4 hr, 28° (induced control)
l
Protein analysis
Protein analysis
1
FIG. 2. Protocol for the induction of the PL promoter-driven expression cassette of pPLEX. In analysis of expression products by SDS-polyacrylamide gel electrophoresis induced cultures have higher cell densities, i.e., protein concentrations, than do control cultures grown at 28°.
Analysis o f Expression Products Soluble Protein Fraction. Escherichia coti cells are harvested by centrifugation (30 sec, r o o m t e m p e r a t u r e , 7000 rpm, E p p e n d o r f centrifuge) and the cell pellet is r e s u s p e n d e d with 1 ml 50 m M Tris-HCl (pH 7.4). After centrifugation the pellet is r e s u s p e n d e d vigorously in 0.5 ml lysis buffer containing 50 m M Tris-HCl (pH 7.4), 0.5 m M dithioerythritol (DTE), 0. I m M phenylmethylsulfonyl fluoride (PMSF), and 1 m M ethylenediaminetetraacetic acid (EDTA). L y s o z y m e (3/zl, 10 mg/ml in 10 m M Tris-HCl p H 8.0, 1 m M E D T A ) is added and the mixture is maintained for 10 to 20 min at r o o m t e m p e r a t u r e . Sodium d e o x y c h o l a t e (3/zl, 40 mg/ml in water) is added and the solution is kept for 15 min at r o o m temperature. After centrifugation (15 min, 4 °, E p p e n d o r f centrifuge) soluble proteins are contained in the clear supernatant. Sodium Dodecyl Sulfate-Soluble Proteins. Escherichia coli cells are spun d o w n by centrifugation (30 sec, r o o m t e m p e r a t u r e , 7000 rpm, E p p e n d o r f centrifuge), the cell pellet is r e s u s p e n d e d once with 1 ml of 50 m M Tris-HC1 (pH 7.4), and cells are centrifuged again (30 sec, r o o m
8
VECTORS FOR EXPRESSING CLONED GENES
[1]
temperature, 7000 rpm, Eppendorf centrifuge). The cell pellet is resuspended in 1 × sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer [3 x sample buffer: 62.5 mM Tris-HCl (pH 6.8), 15% (v/v) glycerol, 2.5% (w/v) SDS, 5% (v/v) 2-mercaptoethanol, and 0.001% (v/v) bromphenol blue] and boiled for 5 rain to lyse cells. Hot samples are applied to polyacrylamide gels by using a Hamilton syringe. Proteins Soluble in 8 M Urea. 8 M urea-soluble fraction contains expression products that form so-called inclusion bodies: stable aggregates of partially denatured and partially structured particles, held together mainly by hydrophobic interactions. However, inclusion bodies do not necessarily have to be insoluble. (For a review of solubilization of inclusion bodies and subsequent renaturation see Ref. 15.) Examples for Use of pPLEX Figure 3 describes the expression of a subfragment of rabbit fast skeletal muscle myosin, that is, a 74-kDa portion of light meromyosin (LMM), which is a structural domain of the myosin heavy chain, a component of myosin. The quaternary structure of LMM is assumed to be a coiled coil formed by two molecules.16 The structure of the recombinant LMM74 is similar to that of the native protein, as indicated by electron microscopy. 17 Moreover, recombinant LMM74, like native LMM, can be enriched by high-salt solubilization with 0.5 M KC1 and precipitation by dialysis with low-salt buffers (for details, see the caption to Fig. 3). This property of LMM74 makes it feasible to use this LMM fragment for the generation of fusion proteins with the possible advantages listed above and, in addition, these fusion proteins could be enriched or purified by the high/low-salt method described here [e.g., LMM/human immunodeficiency virus 1 (HIV-1) Tat fusion proteins18]. It should be mentioned that the smaller (-64-kDa) band in Fig. 3 is a product of internal initiation and not a result ofprotease-mediated degradation of LMM74.17 This phenomenon might be of general importance, because it is reasonable to assume that there is no selection pressure against prokaryotic regulatory elements in sequences of higher eukaryotic cells (e.g., cDNA). Other examples for the use of pPLEX to express heterologous open reading frames in E. coli are listed in Table I. 15 R. Rudolph, in "Modern Methods in Protein- and Nucleic Acid Research" (H. Tschesche, ed.), p. 149. de Gruyter, Berlin, 1990. 16 C. Cohen and D. A. D. Parry, Proteins 7, 1 (1990). 17 K. Maeda, G. Sczakiel, W. Hofmann, J.-F. Menetret, and A. Wittinghofer, J. Mol. Biol. 205, 269 (1989). ~8 V. Wolber, K. Maeda, R. Schumann, B. Brandmeier, L. Wiesmiiller, and A. Wittinghofer, Biotechnology 10, 900-904 (1992).
E. coli EXPRESSION PLASMID p P L E X
[1]
A 12
3 4 5 6 7
9
B 1 2
3
4
5
6
7
116 m,, 97 66,,, 4 5 m,-
2 9 m,.
FIG. 3. Expression of a portion of a rabbit fast skeletal muscle light meromyosin (LMM) by use of pPLEX analyzed by SDS-polyacrylamide gel electrophoresis and immunoblotting. Bacterial extracts were collected and enriched fractions of recombinant LMM were applied to a 10% (w/v) polyacrylamide gel [U. K. Laemmli, Nature (London) 227, 680 (1970)] and either stained with Coomassie Blue (A) or blotted onto nitrocellulose and reacted first with a polyclonal rabbit anti-myosin antibody, then with horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G (Sigma, St. Louis, MO) according to the method of Towbin, T. Staehlin, and J. Gordon Proc Natl. Acad. Sci. U.S.A. 76, 4350 (1979) (B). Lanes numbered from 1 to 7 contain the following samples: total lysate of E. coli strain NF1 transformed with pPLEX and grown at 28° (lane 1) and at 42° (lane 2); total lysate of NF1 transformed with pEXLMM 74 (cDNA coding for a 74-kDa portion of the rabbit skeletal muscle LMM inserted into pPLEX) and grown at 28° (lane 3) and after induction for 1, 3, and 5 hr at 42 ° (lanes 4 to 6, respectively); LMM74 after two cycles of high-salt and low-salt buffer as described below (lane 7). Bacterial extracts, that is, soluble proteins, were prepared following the scheme outlined in Fig. 2. For enrichment of expressed LMM (see lane 7) bacteria were harvested by centrifugation after a 5-hr induction at 42 ° and washed once with 50 mM TrisHCI (pH 7.5). Subsequently the cell pellet was lysed. After addition of sodium deoxycholate, KCI was added (final concentration, 0.6 M). The lysate was further incubated for 15 min at room temperature and was centrifuged. The supernatant was dialyzed overnight against 10 mM potassium phosphate (pH 6.5) containing 0.1 M KCI. After dialysis the precipitate was pelleted by centrifugation and dissolved in 10 mM potassium phosphate (pH 6.5) containing 0.6 M KC1. Insoluble proteins were separated again by centrifugation and the cycle was repeated once w;th the supernatant.
l0
VECTORS FOR EXPRESSINGCLONED GENES
[1]
TABLE I pPLEX-DIRECTED EXPRESSIONOF HETEROLOGOUS SEQUENCESIN Escherichia coli Heterologous expression product Wheat Rubisco (ribulose-bisphosphate carboxylase), small subunit Spinach Rubisco activase, two isoforms (41 and 45 kDa) Human papillomavirus type 16, E7 protein Human papillomavirus type 18, E7 protein Dengue virus type 2, nonstructural protein (NS5) Portions of rabbit skeletal muscle light meromyosin (74 and 59 kDa) Portion of human cardiac/3-myosin heavy chain (subfragment l, amino acid residues 1-524)
Detection method, isolation
Reference
Western analysis
a
Purified proteins
b
NF1 and unc 1959 NF1
Western analysis
c
Western analysis
c
N4830-1
Western analysis
d
NFl
Purified protein
e
NFI
Western analysis
f
Host strain N4830-1 and NF1 UT421
M. A. Kaderbhai, M. He, R. B. Beecbey, and N. Kaderbhai, DNA Cell Biol. 9, 11 (1990). b j . B. Shen, E. M. Orozco, and W. L. Ogren, J. Biol. Chem. 266, 8963 (1991). c I. Jochmus and L. Gissmann, personal communication (1991). d A. Bartholomeusz and P. J. Wright, personal communication (1991). e K. Maeda, G. Sczakiel, W. Hofmann, J.-F. Menetret, and A. Wittinghofer, J. Mol. Biol. 205, 269 (1989). f M. Pfordt, Ph.D. thesis, University of Heidelberg, 1991.
C o n c l u d i n g R e m a r k s and Discussion Figure 3 and Table I list e x a m p l e s for the use o f the e x p r e s s i o n plasmid p P L E X . Certainly for p P L E X , and p r e s u m a b l y for o t h e r e x p r e s s i o n vectors as well, there h a v e b e e n a fair n u m b e r o f u n s u c c e s s f u l a t t e m p t s to e x p r e s s h e t e r o l o g o u s p r o t e i n - c o d i n g s e q u e n c e s in E. coli. T h e p a r a m e t e r s generally listed u n d e r T r o u b l e s h o o t i n g (below) are helpful; h o w e v e r , often the s e a r c h f6r i m p r o v e m e n t s r e m a i n s empirical. Critical p a r a m e t e r s for successful p r o d u c t i o n o f p P L E X - e n c o d e d proteins include the c o n d i t i o n s o f induction, that is, the time period and t e m p e r a t u r e o f h e a t shock. B e c a u s e the induction o f the )kpL p r o m o t e r usually is m e d i a t e d b y a t e m p e r a t u r e shift to 42 °, the h e a t - s h o c k r e s p o n s e o f E. coli cells, w h i c h is a c c o m p a n i e d b y i n d u c e d e x p r e s s i o n o f E. coli p r o t e a s e s , 19 c a n affect the stability o f e x p r e s s e d proteins. In addition 19D. W. Mount, Annu. Rev. Genet. 14, 279 (1980).
[1]
E. coli EXPRESSIONPLASMIDpPLEX
11
the time period of induction determines the accumulation of expression products, which has a crucial effect on yields and the physical form of the expression products. In some instances high intracellular concentrations of expressed polypeptides lead to a high potential of formation of insoluble inclusion bodies, whereas low intracellular concentrations result in a higher probability of leaving the expression products in a soluble form. Alternative expression systems for the production of eukaryotic polypeptides (baculovirus and yeast systems, and eukaryotic tissue culture cells) can circumvent some of the fundamental critical points for expression in E. coli as summarized above, particularly posttranslational modifications (e.g., glycosylation). However, expression in E. coli is still one of the most reasonable ways to mass produce structural and enzymatically active polypeptides. One of the more recent improvements of pPLEX was the insertion of additional restriction sites (XbaI, BamHI, SmaI, KpnI, and SstI) between the SalI and BclI sites, creating the modified vector pPLEXI9. 2° Troubleshooting Troubleshooting should include codon usage; secondary structure around start codon (mutations); clonal variability, that is, testing a larger number of transformants; internal translational start sites; and different E. coli strains (e.g., protease-deficient ones, such as unc1857). When heterologous expression products are known to be toxic for E. eoli expression, products can be obtained with expression vector systems that allow almost complete shut-off of the promoter. In this regard the hPc promoter has an advantage over many other widely used promoters, for example, tacp, trcp, or lacp. However, expression systems offering expression cascades (e.g., T7pol-T7 promoter zl) might be alternatives. Acknowledgments We thank B. Miiller for mapping pPLEX restriction sites. 20 j. B. Shen, E. M. Orozco, and W. L. Ogren, J. Biol. Chem. 266, 8963 (1991). 21 F. W. Studier and B. A. Moffatt, J. Mol. Biol. 189, 113 (1986).
12
VECTORS FOR EXPRESSING CLONED GENES
[2]
[2] I n - F r a m e G e n e F u s i o n By HENRIK ~RUM and LARS K. POULSEN Introduction Gene fusion (the joining of unrelated genes) is an extensively used approach in the analysis of a multitude of biological problems. ~To facilitate in vitro gene fusion several vector systems have been developed that carry multiple cloning sites in any of the three reading frames. 2 When the gene of interest has been cloned and sequenced, the desired gene fusion can usually be made by choosing the appropriate vector and restriction site. Alternatively, when there are some means of detecting the gene product, for example, by antibodies, the DNA can be randomly inserted into an expression vector and the clones expressing the desired product identified by subsequent screening with the antibody. Often, neither the sequence of the gene nor an assay for its product is available. In these cases gene fusions can be selected by using vectors known as ORF vectors (open reading frame vectors). 3 ORF vectors utilize the fact that the lacZ gene-encoded fl-galactosidase enzyme is usually active when an additional polypeptide is inserted near its N terminus. Thus, when an open reading frame DNA fragment is inserted near the 5' end of the lacZ gene, the correct fusion (a tripartite gene) will have a Lac ÷ phenotype whereas the incorrect fusions will be L a c - . To confer the Lac ÷ phenotype, the DNA insert must contain an ORF and be in frame with the lacZ gene at both its 5' and 3' ends. Thus, to secure in-frame cloning of a DNA fragment of defined length (i.e., generated by restriction enzyme cleavage) nine different ORF vectors are required. Clearly, handling nine different vectors to make an inframe cloning is impractical. Instead, a single ORF vector is used and in-frame cloning is facilitated by size randomizing the DNA insert prior to cloning. We discuss here a novel in-frame cloning principle that simplifies inframe cloning of DNA fragments of defined length to involve a single vector.
I T. J. Silhavy and J. R. Beckwith, Microbiol. Rev. 49, 398 (1985). 2 p. H. Pouwels, B. E. Enger-Valk, and W. J. Brammer, "Cloning Vectors: A Laboratory M a n u a l . " Elsevier, Amsterdam, 1985. 3 G. M. Weinstock, Genet. Eng. 6, 31 (1984).
METHODS IN ENZYMOLOGY,VOL. 217
Copyright © 1993 by AcademicPress, Inc. All rights of reproduction in any form reserved.
[2]
13
IN-FRAME GENE FUSION
l-"BssXlI-~ rBssHll-- I
r-B,s,X~l -i ]
GCGCGCGCGC CGCGCGCGCG
s ' - cGcGc
GCGCG-S"
REARING F R A M E l
S ' - CGC,;CGC
~CG- S"
REARING FRAME 3
I S' - CGCGCGCGC GCG- S" I I
[,,. REARING FRAME 2
I
i
FIG. 1. The digestion patterns of the BssHlI box. The sequence GCGCGCGCGC [(GC)5] contains three overlapping BssHIl restriction sites, each corresponding to one of the three reading frames. Because cleavage at any one site destroys the two other sites, a particular (GC) 5 box can be cleaved only once.
Materials All chemicals and apparatus referred to in this chapter are commercially available. Except for BssHII [New England Biolabs (Beverly, MA) and Stratagene (La Jolla, CA)] all enzymes were obtained from Boehringer Mannheim (Indianapolis, IN). T4 DNA ligase was purchased in two concentrations [1 unit(U) and 8 U//zl] for use in sticky-end and blunt-end ligation reactions, respectively. Escherichia coli strains DH5a and JM 109 were used as hosts. Principle of Method The restriction enzyme BssHII recognizes and cleaves the alternating sequence GCGCGC and generates 4-b protruding 5' termini. Consequently, the alternating sequence, GCGCGCGCGC [(GC)5], contains three overlapping, mutually exclusive BssHII restriction sites, each corresponding to one of the three different reading frames (see Fig. I). When contained in a vector, the (GC)5 motif is cleaved at an approximate ratio of 2 : 1 : 2, resulting in a mixture of vectors carrying cloning sites in all three reading frames. 4 Thus, by using either one or two (GC)5 boxes, vectors can be 4 H. 0rum and L. K. Poulsen, Nucleic Acids Res. 17, 3107 (1989).
14
VECTORS FOR EXPRESSING CLONED GENES
[2]
/--(-BssHI I) x 3 Mlul / Kpnl / nindllI
/
I I
?
~. % /
T
Pstl
~ I/
plFF 8
SoII/AccI/HIncl i
"Ir
1
hm,,
Smal/Xmal ApaI
~ II~ SP6 1 \
2 8 0 9 bp
A•
\
~
Sacll
\ (B.,.,,). L..NotI
T7promoter EcoRl (BssH ll) x 3 Mlul Kpnl Hindlll Pstl P TRRTACGACTCACTATAGGGCGARTTCAGCGCGCGCGCARCGCGTGGTACCAA GCTrGGCTGCAG I
I
I
I
I
I
I
I
I
!
I
I
!
I
i
I
I
I
I
I
I
I
Sall Xmal Reel Smal Ncol XIncll BamHl Rp,a.l, Secll (DssHll) x 3 Notl GTCGRCGGATCCCCGGGCCCATGGCCGCGGTCGCGTATATGCGCGCGCGCARRGCTGGCGGCCGC I
I
I
!
I
I
i
I
i
I
I
i
!
I
!
I
I
SP6 promoter A GCTI'GAGTATTCTITI'AGTGTG A G CTA A ATAGCTFG 6C GTAATC ATG GTC AT I
I
I
I
I
|
I
I
I
|
I
I
I
I
I
I
|
I
!
I
!
I
'~ Plac
I
lacZ Initiation I ¢odon I
FIG. 2. Schematic representation of the ORF vector plFF8. The sequence of the 5' part of the lacZ-c~ gene including the lacZ initiation codon, the ORF multiple cloning site, the two (GC)s boxes, the NotI site, and the SPG and T7 promoters are shown. Pt,c designates the lacZ promoter. The vector carries the /~-lactamase gene (bla), conferring resistance to ampicillin.
constructed that allow in-frame cloning of DNA fragments of defined length at one or two fusion points, respectively. Figure 2 shows a schematic representation of an ORF vector, termed pIFF8 (in-frame fusion) constructed by this principle. It is derived from a previously described vector, pIFF5, 4 and carries the inducible lacZ gene
[2]
IN-FRAME GENE FUSION
15
promoter and the lacZ a fragment. Inserted near the 5' end of the lacZ ct fragment are two (GC) 5 BssHII recognition boxes that allow cleavage randomization at two cloning points. In the previous vector, plFF5, a 1.2kilobase (kb) fragment was inserted between the two (GC)5 boxes to avoid the possibility that close proximity of these boxes would prevent cleavage at some of the BssHII sites. In plFF8 this spacer fragment is replaced by a multiple cloning site that has two features: (1) it does not contain stop codons in any of the three reading frames; and (2) it restores the lacZ reading frame, giving the plFF8 vector a Lac ÷ phenotype. As discussed in Procedure 1.2 (below), these new features facilitate in-frame cloning by an indirect procedure. To allow verification of selected clones, the plFF8 vector further carries a unique NotI site located upstream of the 5'-most (GC)5 box (Section 4). Furthermore, the vector contains an SP6 and T7 promoter sequence that allows transcription through the multiple cloning site. Methods 1. Preparation of Vector for In-Frame Cloning The pIFF8 vector can be used to select open reading frames in DNA/ cDNA fragments carrying BssHII-compatible sticky ends (fragments generated by BssHII and/or MluI cleavage) or blunt ends. To prepare the vector for either type of cloning, it is first cleaved with BssHII to produce the nine possible cloning combinations. It is important that the vector sample is totally cleaved at this step because residual uncleaved pIFF8 will give rise to false positives in subsequent transformation/plating (both the desired recombinant pIFF8 vector as well as the pIFF8 vector itself have a Lac + phenotype). After cleavage with BssHII, the vector is treated with calf intestinal phosphatase (CIP) to remove the terminal 5'-phosphate groups. This treatment prevents the vector from recircularizing without insert and thus eliminates yet another source of false positives ( - 3 5 % of recircularized pIFF8 vectors will have a Lac + phenotype). If blunt-ended DNA fragments are to be cloned, the vector is further treated with Klenow polymerase in the presence of all four dNTPs to fill in the BssHII sticky ends. Although very little vector is used in a cloning experiment, it is convenient to prepare an excess amount that can subsequently be stored as a "ready to use" vector. The following procedures will usually give a good result. Procedure 1.1: BssHII Cleavage. Mix 10 tzg of vector (purified by CsCI gradient centrifugation) and 50 U of BssHII enzyme in a 100-tzl reaction
16
VECTORS FOR EXPRESSING CLONED GENES
12]
containing 25 mM NaCI, 6 mM Tris-HCl, pH 7.4, 6 mM MgCI2, and 5 mM dithiothreitol (DTT). Overlay the reaction with a drop of paraffin oil and incubate 3 hr at 50 °. Place the reaction on ice; remove a 3-/zl aliquot (-0.3 /zg of vector) and analyze the extent of cleavage by electrophoresis through a 1% TAE (tris-acetate-ethylenediaminetetraacetic acid) agarose gel using appropriate DNA size markers. If more than one vector band is observed, add more BssHII enzyme and continue the incubation. When the cleavage is complete, extract twice with phenol and chloroform and precipitate the DNA with 1/10 vol of 2.5 M sodium acetate, pH 5.2, and two vol of 96% ethanol for 30 min at - 2 0 °. Recover the DNA by centrifugation at 12,000 g for 30 min at 4 ° and redissolve in 20 ~1 of TE [I0 mM Tris CI, pH 8.0 and I mM ethylenediaminetetraacetic acid (EDTA)]. Procedure 1.2: Phosphatase Treatment. Mix the BssHII-cleaved vector and 3 U of CIP enzyme in a 50-/xl reaction containing 50 mM Tris-HCl, pH 9.0, 1 mM MgCI 2, 1 mM ZnC12, and 1 mM spermidine. Incubate at 37 ° for 30 min, add an additional 2 U of CIP enzyme, and continue the incubation for another 30 min. Add 5 tzl of STE buffer (100 mM Tris C1, pH 8.0, 1 M NaCI, and I0 mM EDTA), 5/zl of 10% (w/v) sodium dodecyl sulfate (SDS), and 40 ~1 of distilled water. Incubate 15 min at 70 °, extract with phenol and chloroform, and precipitate the DNA as above. Redissolve the vector in TE buffer to a final concentration of 50 ng//zl (usually between 150 and 200/~1). Store the vector at - 2 0 ° to prevent evaporation. Note: It is advisable to test the efficiency of the dephosphorylation step by trying to recircularize the vector in the absence of added insert. To do this, set up a "vector alone" standard ligation (Section 2, procedure 2.1 without target DNA) and transform and plate competent E. coli cells as described in Section 3, procedure 3.1. Optimally, there should be no colonies on the plate. Usually, however, even properly dephosphorylated vector preparations give rise to several colonies. If there are many colonies on the plates and these are predominantly blue (Lac+), the problem relates to incomplete cleavage with the BssHII enzyme (uncleaved plFF8 vector is Lac÷). In contrast, if the main part of the colonies are white (Lac-), the problem relates to the dephosphorylation step (about 65% recircularized vectors are Lac-). Procedure 1.3: Filling-In Reaction. Mix I0/zg of BssHII-cleaved/dephosphorylated vector and 5 U of Klenow polymerase in a 100-/zl reaction containing 50 mM Tris-HC1, pH 8.0, 10 mM MgCI 2 , 100 mM NaCI, and 0.5 mM dATP, dCTP, dTTP, and dGTP. Incubate at 23-25 ° for 30 min, heat to 70 ° for 10 min, extract with phenol and chloroform, and precipitate the vector as above. Dry and redissolve the vector in TE buffer to a
[2]
IN-FRAME GENE FUSION
17
final concentration of 100 ng//zl (-75-100/xl). Store at - 2 0 ° to prevent evaporation.
2. Preparation and Cloning of DNA Fragments Any of several reliable methods can be used to prepare DNA/cDNA for cloning in pIFFS. For direct in-frame cloning in pIFF8 (prepared as above) the foreign DNA fragment must carry either BssHII-compatible ends or blunt ends. There are presently only two enzymes (BssHII and MluI) that will provide BssHII-compatible sticky ends and the recognition sequence for the BssHII enzyme appears to be rare in DNA. Consequently, it may not be possible to locate the gene of interest to a BssHII and/or MluI-generated DNA fragment of a size suitable for cloning. In contrast, there is a whole range of enzymes that will generate blunt ends and as such it will usually be possible to locate the gene of interest in a properly sized blunt-ended fragment. Alternatively, the DNA fragment of interest can be cloned in frame by a simple, indirect procedure. First, the DNA fragment is cloned into one of the several unique restriction sites in the ORF multiple cloning site of pIFFS. This cloning destroys the lacZ reading frame, allowing the desired recombinant to be selected by its L a c - phenotype. Second, purified vector from the selected L a c - clone is cleaved with BssHII, extracted with phenol and chloroform, precipitated with ethanol, and religated using T4 DNA ligase (Section 2, procedure 2.3). This ligation shuffles the BssHIIexcised insert/vector fragments, with the result that a subset of inserts are brought in frame with the lacZ gene. Clones containing these vectors can then be selected by their Lac + phenotype. When using the indirect inframe cloning procedure as outlined above, self-circularization of vectors during the shuffling step will produce a background of false positives, that is, Lac + vectors without insert. As described in the following section, these vectors can often be distinguished from the desired recombinants by the intensity of the blue color of the resulting colonies. Alternatively, the BssHII-excised insert can be isolated by agarose gel electrophoresis and cloned in a premade pIFF8 vector (Section l) to avoid the selfcircularized vector background. The optimal conditions for ligating vector/DNA fragments carrying blunt ends or sticky ends are somewhat different. We usually obtain a good result using the following conditions.
Direct In-Frame Cloning Procedure 2.1.: Ligation of Vector and DNA Fragments with Sticky Ends. Mix 100 ng of prepared vector (Section l) and target DNA in a molar
18
VECTORS FOR EXPRESSING CLONED GENES
[2]
ratio of 1 : 3 with I U of T4 DNA ligase (1 U//A) in a 20-~1 reaction containing 50 mM Tris-HC1, pH 7.8, 5 mM MgCI2, 1 mM ATP, 20 mM DTT, and 50/.tg/ml of bovine serum albumin (BSA). Incubate for 4-16 hr at 16° and store at - 2 0 ° until use. Procedure 2.2: Ligation of Vector and DNA Fragments with Blunt Ends. Mix 200 ng of prepared vector (Section 1) and target DNA in a molar ratio of 1 : 3 with 12 U of T4 DNA ligase (8 U//A) (efficient blunt-end ligation requires a great deal ofT4 DNA ligase) in a 20-/xl reaction containing 50 mM Tris-HCl, pH 7.8, 5 mM MgCI 2 , 1 mM ATP, 20 mM DTT, 5% (w/v) polyethylene glycol (PEG) 6000, and 50/xg/ml BSA. Incubate for 4-16 hr at 23-25 ° and store at - 2 0 ° until use.
Indirect In-Frame Cloning Procedure 2.3: Shuffling of Vector and Insert. Mix 100 ng of BssHIIcleaved vector obtained from a L a c - clone with 1 U of T4 DNA ligase (1 U//xl) in a 20-/zl reaction containing 50 mM Tris-HCl, pH 7.8, 5 mM MgCI2, 1 mM ATP, 20 mM DTT, and 50/zg/ml of BSA. Incubate for 4-16 hr at 16° and store at - 2 0 ° until use. 3. Transformation and Selection of Recombinants The plFF8 vector uses lacZ a complementation to produce a Lac ÷ phenotype and therefore requires E. coli strains carrying the lacZ AM15 gene as host; that is, E. coli DH5a, XLl-blue, JM101-109, etc. To prepare the cells for transformation, we use the CaC1 method 5 or, where improved transformation efficiencies are required, the method of Hanahan. 6 Procedure 3.1: Transformation. Mix 100/xl of competent cells and 2/A of the ligation reaction in an Eppendorf tube and incubate on wet ice for 1 hr. Place the tube in a water bath at 42 ° for 45 sec and return the tube to the wet ice for 2 min. Add 900/~1 of LB medium [1% (w/v) Bactotryptone, 0.5% (w/v) Bacto-yeast extract (Difco, Detroit, MI) 1% (w/v) NaCI, pH 7.5] and incubate the tube at 37° for 1 hr in a shaking incubator. To facilitate subsequent isolation of individual clones, plate 20- and 200/A samples onto LB agar plates containing 0.5 mM isopropyl-~/-o-thiogalactopyranoside (IPTG), 40/zg/ml 5-bromo-4-chloro-3-indolyl-fl-D-galactopyranoside (X-Gal) and 50/zg/ml of ampicillin. Incubate the plates (head up) overnight at 37 °. Following transformation and plating, one should in principle obtain 5 j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed., pp. 182-184. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989. 6 D. Hanahan, in " D N A Cloning" (D. M. Glover, ed.), Vol. 1, p. 109. IRL Press, Washington, D.C., 1985.
[2]
IN-FRAME GENE FUSION
19
(1) white colonies (Lac-) containing vectors with either a DNA fragment that is not an ORF or an ORF DNA fragment inserted out of frame with the lacZ gene and (2) blue colonies (Lac ÷) containing vectors with a correctly fused ORF DNA. Unfortunately, it is rarely as simple as that. Thus, blue colonies may also contain (1) a vector with a DNA fragment that is not in frame with the 5' end of the lacZ gene but contains a translation initiation site in frame with the 3' part of the lacZ ~ gene or (2) vectors without a DNA insert (caused by either insufficient BssHII cleavage or vector self-circularization). To show that an inserted DNA fragment contains an ORF, it must therefore subsequently be verified that Lac" vectors contain the DNA insert and that translation initiates at the lacZ translation start site. In selecting a number of candidate clones for these analyses the color of the colonies may be of some help. Thus, depending on how the insert DNA affects transcription and/or translation of the tribrid gene/mRNA, affects folding and stability of the tribrid protein, and so on, colonies containing the correct fusion will range in color from deep to light blue (for a detailed discussion of factors affecting clonal color development, see Ref. 3). Similarly, the blue color of colonies containing a vector where translation initiates within the insert will depend on several factors, including how efficiently translation initiates within the insert. In contrast, Lac ÷ colonies containing vectors without a DNA insert will always be deep blue. Thus, when colonies exhibit different shades of blue one usually selects a number of clones from each group for further verification, with preference for those that are light blue. 4. Verification of Selected Clones To verify that the inserted DNA contains an ORF, the first step is to prepare a vector minipreparation from each of the selected clones. For this we use the alkaline lysis method, which is both rapid and reliable. 7 Next, purified vectors are digested with restriction enzymes followed by electrophoresis in agarose or polyacrylamide gels to determine which of the vectors contain the correct insert. Digestion with BssHII excises the insert, thus allowing its size to be determined against coelectrophoresed DNA size markers. However, BssHII is an expensive enzyme and for this reason the use of alternative restriction enzymes should be considered. For instance, combined digestion with EcoRI and NotI also excises the insert. Alternatively, when the size of the insert is such that vector plus insert can be distinguished from vector alone, any restriction enzyme that cleaves only once in the vector can be used (in this case several fragments 7 H. C. Birnboim and J. Doly, Nucleic Acids Res. 7, 1513 (1979).
20
VECTORS FOR EXPRESSING CLONED GENES
[2]
A Notl
P~.c ~
i:~c'::~c~] INSERT llacZ-a ~-RTG
I
(RTG)
'~................. ...................................
B
TRIBRID GENE
•
mRNA
~-Lac +
TRRNSLATI ON STARTS WITHIN INSERT
... Lac +
TRANSLATION STARTS RTlacZ 5" END
J DIGESTWITHNotiFILL IN TXE STICKY E N D S - RELIGATE.
Insertion 4bp.
of
Plac ~ C ~ c S ~ C C c S C . ~
INSERT
~" RTG
i lacZ
(ATG)
- ~
I
TRIBRIO GENE
i~
mRNA
i !
: .............
.... ~
-
~
"
"~
Lac'l"
Lac-
TRANSLATION STARTS WITHIN INSERT TRANSLATION STARTS ATIacZ 5" ENn
FI6.3. Schematic outline of the strategy to distinguish between translation initiation at the lacZ translation start site or from within the insert. (A) The recombinant vector isolated from a Lac + clone; translation initiation at the lacZ translation start site or from within the insert both confers a Lac + phenotype on the host. (B) Introduction of 4 bp between the lacZ translation initiation site and the 5' end of the insert disrupts the lacZ reading frame read from the lacZ translation initiation site, but does not affect the reading frame initiated from translation start sites within the insert. Thus the phenotype of vectors containing a correctly fused insert where translation initiates at the lacZ start site will change from Lac + to Lacwhereas incorrectly fused inserts will remain Lac +.
may result from the digestion depending on whether target sequences for the enzymes are present in the insert or not). Those vectors that contain the correct DNA insert are then analyzed to distinguish between the possibility that translation initiates at the lacZ translation start site or within the insert. The rationale behind this analysis is shown schematically in Fig. 3. First, the selected vectors are digested with NotI. Provided there are no NotI sites in the insert (NotI recognizes an 8-bp DNA sequence and its target sequence is thus rare in DNA), this digestion linearizes the vector between the lacZ translation start site and
[2]
IN-FRAME GENE FUSION
21
the 5' end of the DNA insert. The NotI site is then filled in with Klenow polymerase in the presence of all four dNTPs (Section 1, procedure 1.3) and the vector is recircularized using T4 DNA ligase (the ligation reaction is similar to procedure 2.3 except that the reaction volume is increased to 100/xl to favor vector self-circularization). This treatment introduces 4 bp between the 5' end of the lacZ gene and the insert, thereby disrupting the lacZ reading frame read from the lacZ translation start site. In contrast, the lacZ reading frame read from any spurious translation start site within the insert is not affected. Thus, the phenotype of vectors containing the correctly fused insert will change from Lac + to Lac , whereas vectors that do not will remain Lac +. Examples
Selection of Open Reading Frames in DNA/cDNA The pIFF series of vectors, and in particular pIFF8, are recent vector constructions and examples on experimental applications are therefore limited at present. The pIFF5 vector has been used to select the ORF in a 1.6-kb cDNA fragment encoding an internal part of the enzyme phenylalanine ammonia-lyase from the basidiomycete yeast Rhodotorula glutinis.4 In a parallel experiment the corresponding genomic pal gene fragment did not contain an ORF, as evidenced by the lack of blue colonies, and this was later shown to be due to the presence of several small introns. 8 The major difference between pIFF8 and pIFF5 is in the spacing of the two (GC)5 boxes. In pIFF5, these boxes are separated by a 1.2-kb spacer fragment whereas in pIFF8 they are separated by a small ORF multiple cloning site. To determine whether the decrease in spacing between the two (GC)5 boxes in pIFF8 would affect the pattern of BssHII cleavage, pIFF8 was cleaved with BssHH and the small multiple cloning site fragment purified from a 2% (w/v) agarose gel. The purified fragment was then dephosphorylated with calf intestinal phosphatase, labeled with [7-32p]ATP and T4 DNA kinase, and digested with PstI, which cleaves the labeled fragment into two unequal halves. Finally, the labeled products were separated by electrophoresis in a polyacrylamide sequencing gel and autoradiographed. Two sets of bands corresponding to cleavage at all BssHII sites in the 3'-most (GC)5 box [31, 33, and 35 nucleotides (nt)] and 5'-most (GC)5 box (50, 52, and 54 nt) were detected on the film, showing that all BssHII sites in both (GC) 5 boxes were accessible to cleavage. Moreover, the bands corresponding to 33 and 52 nt were less intense than 8 j. G. Anson, H. J. Gilbert, J. O. Oram, and N. P. Minton, Gene 58, 189 (1987).
22
VECTORS FOR EXPRESSING CLONED GENES
[2]
the bands corresponding to 31, 35, 50, and 54 nt, supporting the previous observation that the center BssHII site in a (GC)5 box is cleaved less frequently than the flanking BssHII sites. From this we conclude that the close proximity of the two (GC)~ boxes in plFF8 does not have any major distortive effect on BssHII cleavage characteristics compared to the characteristics of previously described plFF vectors. Discussion Applications and Limitations
This chapter has focused on the use of (GC)5 boxes in the construction of gene-fusion vectors. When applied to ORF vectors the system offers the major advantage that DNA fragments generated by restriction enzyme cleavage can be cloned in frame without the need for prior size randomization. In addition to simplifying the use of ORF vectors in general, this feature potentially expands their uses. For instance, information on possible introns and a rough map of protein-coding domains in a cloned gene can be rapidly provided by subcloning specific restriction fragments in plFF8 and such information may be useful in setting up a sequencing strategy. Likewise, provided a correctly fused ORF DNA insert is sufficiently large so that the ORF can be considered biologically significant, the reading frame can be established by sequencing through the vector/ insert junctions, and this knowledge is useful in subsequent interpretation of sequencing data. As with other ORF vectors, the proper function of plFF8 requires that the lacZ-encoded part of the fusion protein retain enzymatic activity. In plFF8, the foreign DNA is inserted into the small lacZ ~ gene, which must successfully complement the host encoded product of the lacZ AM 15 gene to produce the Lac ÷ phenotype. Thus, compared to other ORF vectors that usually carry the entire lacZ gene, it may be expected that insertion of foreign ORF DNA fragments in plFF8 has a more pronounced effect on the Lac ÷ phenotype. Consistent with this notion, insertion of a 1.6-kb pal cDNA fragment in plFF8 produced light blue colonies that, however, turned deep blue when the lacZ t~ gene was substituted by the entire lacZ gene. This suggests that the functional limits of plFF8 can be expanded by insertion of the entire lacZ gene. On the other hand, when using the indirect in-frame cloning procedure, the present construction is probably advantageous in that a clear effect of the DNA insertions on the Lac ÷ phenotype allows an easier distinction between the desired recombinants and the false positives (i.e., vectors without insert).
[3]
HETEROLOGOUS
PROTEIN PRODUCTION
BY
B. brevis
23
[3] H i g h - L e v e l S e c r e t i o n o f H e t e r o l o g o u s P r o t e i n s b y Bacillus brevis By SHIGEZO U D A K A a n d H I D E O YAMAGATA Introduction
Among various host-vector systems for the production of foreign proteins in microorganisms, the use of Bacillus breois as a host offers the advantage that proteins are secreted directly into the culture medium, where they are accumulated at high levels in a relatively pure state. The secreted proteins are usually correctly folded, soluble, and biologically active. Bacillus brevis is known to be a harmless inhabitant of soil, milk, and cheese. Many of these advantages are shared with another thoroughly studied Bacillus species, B. subtilis. The major advantage of B. brevis over B. subtilis, however, is a very low level of extracellular protease activity, so that secreted proteins are usually stable and not significantly degraded. 1 For example, human a-amylase was secreted in quantities of up to 60 mg/liter by B. brevis, 2 whereas none was produced by B. subtilis. 3 Bacillus brevis 47 was isolated from soil as a protein-hyperproducing bacterium and was found to show little extracellular protease activity. 1.4 The two main proteins secreted by B. brevis 47 were indistinguishable from the two major proteins found in the outer two protein layers of the cell wall. The major cell wall proteins (CWP) synthesized during the logarithmic phase of growth form hexagonal arrays on the cell surface. During the early stationary phase of growth, the protein layers begin shedding concomitantly with a prominent increase in protein secretion. 5 During the stationary growth phase, cells continue to synthesize and secrete the cell wall proteins. These proteins do not stay on the cell surface, but instead accumulate in the medium as extracellular proteins with concentrations up to 20 g/liter of culture. The amount of extracellular protein reaches more than twice that of intracellular proteins. The genes coding for the major cell wall proteins (an outer wall protein and a middle wall I H, Takagi, K. Kadowaki, and S. Udaka, Agric. Biol. Chem. 53, 691 (1989). 2 H. Konishi, T. Sato, H. Yamagata, and S. Udaka, Appl. Microbiol. Biotechnol. 34, 297 (1990). 3 T. Himeno, T. Imanaka, and S. Aiba, FEMS Microbiol. Lett. 35, 17 (1986). 4 S. Udaka, Agric. Biol. Chem. 40, 523 (1976). 5 H. Yamada, N. Tsukagoshi, and S. Udaka, J. Bacteriol. 148, 322 (1981).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
24
VECTORS FOR EXPRESSING CLONED GENES
[3l
protein) were cloned, and an operon (cwp) for cell wall protein genes was f o u n d . 6,7
Taking advantage of these characteristics of B. brevis, we developed a host-vector system for efficient production of heterologous proteins. The 5' region of the cell wall protein gene containing the powerful promoter and the signal peptide-coding sequence is utilized to construct expression-secretion vectors that are introduced into the protein-hyperproducing B. brevis. Media and Reagents
T2U medium contains 10 g of polypeptone (Nihon Pharmaceutical, Tokyo, Japan; tryptone, Difco, Detroit, MI), 5 g of meat extract (Wako Pure Chemical Industries, Osaka, Japan), 2 g of yeast extract (Difco), 0.1 g of uracil, and 10 g of glucose per liter. PM medium contains 20 g of polypeptone, 10 g of meat extract, 4 g of yeast extract, 0.1 g of uracil, and 10 g of glucose per liter and 2 mM CaC12 (pH is adjusted to 7 with NaOH). Solid medium contains 15 g of agar per liter. Erythromycin (10/zg/ml) or neomycin (60/xg/ml) is added for the growth of plasmid-bearing bacteria. MTP is prepared as follows: 20 ml of 0.1 M sodium maleate (pH 6.5), 10 ml of phosphate buffer [7% (w/v) K2HPO4 and 2.5% (w/v) KH2PO4)], and 18 ml of H20 are mixed and sterilized by autoclaving; after cooling the mixture, 2 ml of 1 M MgCI2 and 50 ml of T2U medium are added. Polyethylene glycol (PEG) solution is prepared by dissolving 40 g of PEG 6000 (average M r 7500) in 20 ml of 0.1 M sodium maleate (pH 6.5) and adjusting the volume to 100 ml with H20. TE contains 10 mM Tris-HCl (pH 8) and 1 mM disodium salt of ethylenediaminetetraacetic acid (EDTA). Sterilization of all the solutions, except for antibiotics, is carried out by autoclaving at 120° for 15 min. Host Bacterium Bacillus brevis 47-5Q is derived from strain 47-5, which is a uracilrequiring mutant of the wild-type 47. 4 Strain 47-5Q generally shows one or two orders of magnitude higher transformability and certain plasmids are more stably maintained in this strain than in strain 47-5. Bacillus brevis 47-5Q shows little protease activity in its culture supernatant. This bacterium hardly sporulates when cultured in ordinary media. 6 H. Yamagata, T. Adachi, A. Tsuboi, M. Takao, T. Sasaki, N. Tsukagoshi, and S. Udaka, J. Bacteriol. 169, 1239 (1987). 7 S. Tsuboi, R. Uchihi, T. Adachi, T. Sasaki, S. Hayakawa, H. Yamagata, N. Tsukagoshi, and S. Udaka, J. Bacteriol. 170, 935 (1988).
[3]
HETEROLOGOUS PROTEIN PRODUCTION BY B. brevis
25
Preservation of Bacteria Bacillus brevis cells, including those having plasmids, can be preserved at or below - 80° in the presence of 20% (w/w) glycerol for several years. Routinely, they may be maintained at room temperature on plates (T2 agar is appropriate) by transferring every 2-3 weeks. The bacteria will die at 4°. It is advisable to keep cells harboring plasmids containing foreign genes at or below - 80°, becuase both plasmids and hosts tend to mutate so that they no longer produce the foreign proteins.
Plasmids pUB 1108 is a high-copy-number plasmid in B. brevis, useful for overproduction of polypeptides from cloned genes. The neomycin resistance gene on this plasmid can be used as a selective marker for transformation. However, B. breois 47 spontaneously gives rise to mutants resistant to this drug at a relatively high frequency, so that examination for the presence of the plasmid is necessary to distinguish transformants from the spontaneous mutants. pHWl 9 is a low-copy-nu.mber plasmid and is useful as a cloning vector, especially when products of the cloned gene are deleterious to the host cells. Therefore, pHW 1 was used for cloning the genes encoding the middle wall protein (MWP) and the outer wall protein (OWP) ofB. brevis 47. The erythromycin resistance gene (Em0 on this plasmid, originally found in pE 194, is useful for selection of transformants because almost no spontaneous erythromycin-resistant mutants appear under the standard transformation conditions, pRU100 was constructed by inserting a multicloning site derived from M13mpl9 between the EcoRI and PvulI sites of pHWl. Another series of vectors was constructed from a low-copy-number cryptic plasmid, pWT481, found in B. brevis 481. l° pHY481 was constructed by inserting the erythromycin resistance gene into pWT481 and is stably maintained in B. brevis 47 even in the absence of the selective drug. H Although pHY481 and its derivatives have not been used extensively to date, results suggest that these plasmids are useful for efficient protein production. 6 8 T. McKenzie, T. Hoshino, T. Tanaka, and N. Sueoka, Plasmid 15, 93 (1986). 9 S. Horinouchi and B. Weisblum, J. Bacteriol. 150, 804 (1982). 10 H. Yamagata, W. Takahashi, K. Yamaguchi, N. Tsukagoshi, and S. Udaka, Agric. Biol. Chem. 48, 1069 (1984). fl H. Yamagata, K. Nakagawa, N. Tsukagoshi, and S. Udaka, Appl. Environ. Microbiol. 49, 1076 (1985).
VECTORS FOR EXPRESSING CLONED GENES
26
[3]
60
Mfl I
ATCAGATCCGCTATCCTOTCTTACAACTTOOCTOTTOTAAACTTTOAAAATOCATTAOOA 120
AATTAACCTAATTCAAGCAAGATTATOAO(]TTTT(]AACCAAATTGGAAAAAGOTTCAGTC
l~ 18o 0TGACAGGCCGCCATATOI'CCCCTATAATACGGATTOTGGCOGATGTCACTTCOTACATA 240 ATGGACAGOTGAATAACGAACCACGAAAAAAACTTTAAATTTTTTTCGAAGGGGCCGCAA
Z~ 300 CTTTTOATTCGCTCAGGCOTTTAATAGGATOTGACACGAAAAACOGGOAAT~rOTOTAAAA EcoRI SpeI 3~ 360 AAOATTCACGAATTCTAGCAC, TTGTGTTACACTAGTGATTGTTGCATTTTACACAATACT
41 5~ SDI 4zo GAATATACTAOAGATTTTTAACACAAAAAGCGAGGCTTTCCTGCGAAAGGAGGTGACACG 480 COCTTGCAGGATTCGGGCTTTAAAAAGAAAGATAGATTAACAACAAATATTCCCCAAGAA fHetGlnAspSerGlyPhebysLysLysAspArgLeuThrThrAsnlleProGlnGlu S D 2 Hpal 540 CAATTTGTTTATACTAGAGGAGGAGAACACAAGGTTATGAAAAAGGTCGTTAACAGTGTA GlnPheValTyrThrArgG-G-f~yGi'uIllsgysVa i Me t bys Lys ValValAsnSer Val
ApaLI Ncol PstI B a m H I Sall TTGOCTAOTOCACTCGCACTTACTGTTOGTCCCATOUGTTTCOCTGCAGGATCGOTCGAC beuA l a S e r A l a b e u A l m b e u T h r V a l A l a P r o M e t A l a P h e A l a
,l.XcTb:IGA~PTA~CABG~ITICITCXTIC°~Gg: i~'~77~CIT~
"
EcoRI,,
/
/<
FIG. 1. Structure of the expression-secretion vector pNU210. The closed bar indicates the 5' region of the mwp gene containing multiple promoters and the signal peptide-coding sequence. The open bar indicates a multicloning site (MCS). The DNA and amino acid
[3]
HETEROLOGOUS PROTEIN PRODUCTION BY B. brevis
27
Preparation of Plasmid DNA from Bacillus brevis Cells The method of Birnboim and Doly 12 can be used to obtain plasmid DNA. This method can be scaled up to obtain large amounts of plasmid DNA and DNA can be purified by CsCl-ethidium bromide centrifugation 13 or adsorption to glass powder in a high-salt solution and elution with water (e.g., The GeneClean II kit; Bio 101, San Diego, CA). Construction of Expression-Secretion Vector, pNU210 As described above, the cell wall proteins (OWP and MWP) are synthesized and secreted into the medium efficiently, even during the stationary phase of growth in B. brevis 47. This suggested that the 5' region of the cwp operon would greatly facilitate the expression of downstream heterologous genes and secretion of the gene products. A 600-bp AluI fragment containing the five tandem promoters, dual translation initiation sites, and the MWP signal peptide-coding region6,14was isolated and used to construct expression-secretion vectors. The structure of the one such expression-secretion vector thus far constructed, pNU210, is shown in Fig. 1. pNU210 is a multicopy plasmid with the replication origin of pUB 110 and the Em r gene of pHWI. The multicloning site on the plasmid is convenient for the insertion of foreign genes to construct transcriptional fusion with the cwp operon or translational fusion with the 5' terminal portion of the mwp gene. In the latter case, the gene product will be fused to the MWP signal peptide. An ApaLI or NcoI site located within the MWP signal peptide-coding region is useful for constructing transcriptional or translational fusions of the MWP gene with foreign genes (see Fig. 1). By inserting the appropriate synthetic DNA fragment encoding the COOH-terminal portion of the MWP signal peptide between the ApaLI or NcoI site and the foreign gene, the foreign proteins directly fused with the MWP signal peptide can be 12 H. C. Birnboim and J. Doly, Nucleic Acids Res. 7, 1513 (1979). ~3 j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989. 14T. Adachi, H. Yamagata, N. Tsukagoshi, and S. Udaka, J. Bacteriol. 171, 1010 (1989).
sequences of these regions are shown in upper part of the figure. Vertical arrows along the top of the DNA sequence indicate transcription start sites, 1 to 5. SD1 and SD2 are the ribosome-binding sites located upstream of the dual translation initiation sites (TTG at nucleotides 424 to 426 and ATG at nucleotides 517 to 519). The signal peptide-coding sequence is underlined. All restriction sites shown here, except HpaI, NcoI, MflI, and SacI, are unique to pNU210.
28
VECTORS FOR EXPRESSING CLONED GENES
(Nrul) pBR322
ApaLI
NcoI
[3]
PstI BamHI SalI
AGTGCACTCGCACTTACTGTTGCTCCCATGGCTTTCGCTGCAGGATCCGTCGAC TCACGTGAGCGTGAATGACAACGAGGGTACCGAAAGCGACGTCCTAGGCAGCTG
AlaPheAla
MWP Signal P e p t i d e ~ ~
,MCS |
Cleavage site
XbaI
KpnI
BglII XhoI
SacI
HindIII
EcoRI
TCTAGAGGTACCAGATCTCTCGAGGAGCTCAAGCTT pBR3 2 2 AGATCTCCATGGTCTAGAGAGCTCCTCGAGTTCGAA
MCS
/
FIG. 2. Structure of pBR-AN3, used for making subconstructs in E. coli. The DNA having the nucleotide sequence shown is inserted between the NruI and HindlII sites of pBR322. The sequence from the 5' terminus to the Pst! site encodes the COOH-terminal portion of the MWP signal peptide. Downstream from the cleavage site of the signal peptide is a multicloning site (MCS), the same as that inserted in pNU210 (Fig. 1). The ampicillin resistance gene on pBR322 was replaced by that of pUC18. Therefore, all restriction sites shown above the DNA sequence except ApaLI are unique to pBR-AN3.
synthesized and processed efficiently. This results in accumulation in the medium of the foreign proteins with no additional amino acid residues at their NH2 termini. A PstI site located at the cleavage site of the MWP signal sequence can also be used for the production of foreign proteins with the correct N H 2 terminus. To express genes efficiently, transcription termination is presumed to be important. However, when certain terminator DNA fragments, such as that of a bacterial a-amylase gene, were inserted downstream from the foreign gene, no marked difference in gene expression was observed. Construction of Plasmid pBR-AN3 for Insertion of Foreign Genes To construct a plasmid for the production of the heterologous protein in B. brevis, an Escherichia coli vector, pBR-AN3, useful for linking the foreign gene with the cell wall protein (MWP) signal sequence ofB. brevis 47, was prepared (Fig. 2). Construction procedures are as follows. 1. Insert the foreign gene between the NcoI or PstI site and one of the multicloning sites (e.g. HindIII) in pBR-AN3. The direction of transcription for the inserted DNA must be from the NcoI site to the HindIII site. In the case of the NcoI site, a synthetic linker may be used to connect the
[3]
HETEROLOGOUS PROTEINPRODUCTIONBY B. brevis
29
MWP signal sequence and the DNA encoding foreign mature protein. This connection must be done so that the fused gene encodes exactly the same amino acid sequence as the mature foreign protein directly following the MWP signal peptide. 2. Introduce the plasmid DNA thus prepared into competent cells of E. coli HB 101 (or any other appropriate strain) according to the standard method. 13 Transformants are selected on LB agar plates containing 50 ~g/ml ampicillin following incubation at 37° for one day. 3. Purify the plasmid DNA from the transformant and digest it with A p a L I and any enzyme of the multicloning site on pBR-AN3. After electrophoresis on agarose gel, elute the DNA fragment containing the m w p foreign gene fusion and purify it by means of a glass powder method (e.g., The Gene Clean II kit; Bio 101, San Diego, CA) or electrophoresis. 4. Ligate the DNA thus obtained to the large fragment of pNU210 generated by digestion with A p a L I and the enzyme used to cut the 3' flanking region of the foreign gene. Use the ligated DNA to transform B. brevis 47-5Q. From among transformants, select clones that produce foreign proteins.
Transformation of Bacillus brevis
Tris-Polyethylene Glycol Method The original method 15 was modified as follows. 1. Take onto a toothpick a small amount ofB. brevis 47-5Q cells grown on a T2U plate, and inoculate it into 5 ml of T2U medium and grow overnight with shaking at 37° . 2. Dilute the overnight culture 100-fold in 5 ml of the same medium and incubate at 37° with vigorous shaking for 4 to 5 hr. Alternatively, suspend fresh cells grown overnight on a T2U plate in 5 ml T2U medium with an initial OD660of approximately 0.05 and incubate as above. 3. The following steps must be done at room temperature. At the logarithmic phase of growth (from middle to late, i.e., when the OD660 is 1.0-1.7), collect cells in a 30- to 50-ml screw-capped plastic centrifuge tube by centrifugation at 4000 g for 5 rain at room temperature (never cool). Wash the pellet at room temperature with 5 ml of 50 mM Tris-HCl, pH 7.5. Resuspend the pellet in 5 ml of 50 mM Tris-HCl, pH 8.5, and incubate the cells for 30 to 60 min at 37° with slow shaking. 15 W. Takahashi, H. Yamagata, K. Yamaguchi, N. Tsukagoshi, and S. Udaka, J. Bacteriol. 156, 1130 (1983).
30
VECTORS FOR EXPRESSING CLONED GENES
[3]
4. Spin as above and wash the cell pellet with 1 ml of MTP. Spin again and resuspend the pellet evenly in 0.5 ml of MTP. 5. Add plasmid DNA dissolved in less than 50/xl of TE or MTP to the cell suspension and mix well. Quickly, add 1.5 ml of the PEG solution and immediately mix well without vigorous agitation. Keep the mixture at room temperature for about 2 min with occasional gentle mixing. Add 5 ml of MTP and mix well. Collect the cells by centrifugation at 4000 g for 10 min at room temperature. Suspend them in 1 ml of T2U medium containing 20 mM MgC12 and incubate at 37° for 2.5 hr with moderate shaking. When erythromycin is used as a selective drug, it must be added to a final concentration of 0.1 /~g/ml after 30 min of incubation. 6. Spread aliquots (0.1-0.2 ml) of the culture on T2U agar plates containing the selective drug (I0/xg/ml of erythromycin or 60/xg/ml of neomycin) and incubate the plates at 30 or 37°. Colonies should appear after about 2 days at 37° or after about 3 days at 30 °. Transformation of B. brevis with plasmids harboring a heterologous gene is often more successful at 30°. Some 104 to 105 transformants can be obtained when 1/zg of intact pNU210 is used.
Electroporation 1. Take a small amount ofB. brevis 47-5Q cells grown on a T2U plate, inoculate it into 5 ml of T2U medium, and grow overnight with shaking at 37°. Dilute the overnight culture 100-fold in 100 ml of the same medium and incubate at 37° with vigorous shaking for approximately 4.5 hr. 2. At the early stationary phase of growth (the OD660is approximately 3.5), chill the culture in an ice/water bath, and then collect cells in a 500-ml screw-capped plastic centrifuge tube by centrifugation at 4000 g for 5 min at 4 °. Wash the pellet at 4° with 200 ml of cold solution A, which contains 93 g of sucrose and 150 g of glycerol in 1 liter of 0.1 mM sodium phosphate buffer, pH 7.4. Then wash the cells with 100 ml and then with 4 ml of cold solution A. Resuspend the washed cells in 0.5 ml of cold solution A. Transfer 45 /~1 each of the cell suspension to small plastic centrifuge tubes. Cool the tubes to - 7 0 ° in a dry ice-ethanol bath and stock them in a - 8 0 ° freezer (competent cells). 3. Take out the tube containing frozen competent cells and keep it cold. Add plasmid DNA dissolved in less than 2 /.d of TE to the cell suspension and mix. Transfer the cell suspension to a 0. l-cm cuvette of the Gene pulser apparatus (Bio-Rad, Richmond, CA). Set the apparatus at 0.9 kV, 25/xF, and 200 l). After delivering the pulse, quickly add 1 ml of cold T2U medium containing 20 mM MgCI2, keep it at 4 ° for 10 min, and then incubate at 37° with shaking for 2.5 hr. Spread aliquots of the
[3]
HETEROLOGOUS PROTEIN PRODUCTION BY B. brevis
31
culture on T2U agar plates containing the selective drug. Other details are similar to the procedure described above in the previous section. The frequency is about 105 transformants//xg of DNA. Salts in the plasmid DNA solution reduce the transformation frequency. Production of Heterologous Proteins Clones that produce heterologous proteins of bacterial origin are obtained rather easily by the procedure described above. On the other hand, transformants that efficiently produce mammalian proteins are found often at a low frequency (sometimes very low). Mammalian proteins are often toxic to B. brevis cells so that cells producing such a protein grow slowly or die rather easily. Therefore it is necessary to screen a large number of transformants for particular clones that are producing large amounts of mammalian protein. Unless a special procedure to detect the heterologous protein is available, immunoassays are convenient for measuring the protein productivity of clones. Plates with transformants are covered with a sterile membrane (e.g., pure nitrocellulose membrane; Bio-Rad) for 1-3 hr. After removal, the membrane is treated with antibody against the heterologous protein and processed for a color reaction using a standard protocol, t6 The area of the membrane corresponding to protein-producing colonies is stained. The size of the stained halo varies depending on the extent of protein production and the type of protein. Identified transformants that produce the protein are immediately picked up from plates and grown on fresh plates. After 1 day of growth at 37 ° (or 30°), cells are removed from the plates, resuspended in T2 medium plus 20% (w/w) glycerol, and stored at or below - 8 0 °. Several clones thus selected are examined by culturing in liquid medium to measure the amount of protein secreted. The production efficiency for each protein varies greatly with the culture conditions, which include the medium composition and growth temperature. Optimal conditions are unique for each protein and must be determined for efficient production. We found that varying the amounts of MgC12 and CaC12 in PM medium often allowed efficient protein production. Also, the addition of glucose to a final concentration of 3% (w/v) after 2 days of growth often improved the efficiency of protein production.
Examples of Secretory Protein Production We succeeded in producing a number of proteins by the B. brevis system. Most of the bacterial enzymes tested could be produced at a yield t6 V. Nagarajan, this series, Vol. 185, p. 214.
32
VECTORS FOR EXPRESSING CLONED GENES
[3]
of more than 1 g/liter. For example, about 3 g/liter thermophilic a-amylase of Bacillus stearothermophilus was secreted. 17On the other hand, production of mammalian proteins was often much less efficient than that of bacterial proteins, although it was much more efficient than production by other hosts such as B. subtilis, E. coli, and Saccharomyces cerevisiae. So far, among mammalian proteins, human epidermal growth factor (EGF) was the one most efficiently produced [0.24 g/liter ~8and 1 g/liter (unpublished observations). Active human salivary a-amylase 2 and swine pepsinogen 19 were secreted up to 60 and 11 mg/liter, respectively. High-level production of EGF and human a-amylase 2 was achieved only after extensive improvements were made mainly for the vector (use of a derivative of pHY481) and host (mutant isolation), respectively. Certain animal proteins such as human interleukin 2 were secreted in large amounts (more than 50 rag/liter) only when the signal peptide was altered to become more hydrophobic (e.g., leucine tripeptide was inserted into the hydrophobic region of the MWP signal peptide). Discussion of Problems As described above, transformants that produce mammalian proteins are often found at a low frequency, probably because efficient production of the proteins is toxic for bacterial cells. One way to circumvent this problem is to use B. subtilis as an initial host. In B. subtilis, cwp promoters direct only weak expression and hence the plasmid with the desired construct tends to be stably maintained. All B. brevis vectors described here can replicate in B. subtilis and the drug-resistance genes on the plasmids can be used as selective markers. A large amount of plasmid DNA can be prepared from B. subtilis transformants. This DNA can be used to transform B. brevis to obtain a large number of transformants. Even when positive transformants of B. brevis are found, these cells sometimes cannot maintain the correct plasmid. Deletions of the foreign gene or cwp promoter are frequently found. Serial single-colony isolation of positive clones is helpful. Mutagenesis ofB. brevis with N-methyl-N'nitro-N-nitrosoguanidine (NTG) prior to transformation is also helpful to obtain clones that can maintain the plasmid with the correct structure. When clones maintaining the plasmid can be obtained but the amount of foreign proteins produced is not large, mutants producing the protein 17 H. Takagi, A. Miyauchi, K. Kadowaki, and S. Udaka, Agric. Biol. Chem. 53, 2279 (1989). ~8 H. Yamagata, K. Nakahama, Y. Suzuki, A. Kakinuma, N. Tsukagoshi, and S. Udaka, Proc. Natl. Acad. Sci. U.S.A. 86, 3589 (1989). 19 M. Takao, T. Morioka, H. Yamagata, N. Tsukagoshi, and S. Udaka, Appl. MicrobioL Biotechnol. 30, 75 (1989).
[3]
HETEROLOGOUS PROTEIN PRODUCTION BY B. brevis
33
with improved yields can be isolated by mutagenesis of the clones with NTG. The procedures to mutagenize B. brevis with NTG are as follows. 1. Grow B. brevis freshly in 5 ml of T2 medium at 30° with shaking until the OD660 is 0.6. 2. Collect the cells by centrifugation for 5 min at 4000 g at room temperature and wash the cells with 5 ml of 200 mM phosphate buffer (KHzPO4-NaEHPO 4 , pH 6.4) and centrifuge again as above. 3. Resuspend the cells in 0.5 ml of phosphate buffer containing 200 t~g/ml of NTG and incubate the cell suspension at 30° for 30 min. 4. Wash the cells with 5 ml of phosphate buffer as above and resuspend the cells in 5 ml of T2 medium supplemented with 20 mM MgC12 . 5. Grow the cells for more than 3 hr at 30° with shaking. After a 102to 104-fold dilution with T2 medium, spread 0.1 ml of the cell suspension on an appropriate plate. Conclusion Taking advantage of the unique characteristics of B. brevis, which secretes large amounts of proteins into the medium but hardly any proteases, we have developed a novel host-vector system for efficient synthesis and secretion of foreign proteins. The multiple promoters and the signal peptide-coding region of the gene for one of the major cell wall proteins of B. brevis 47 were used to construct expression-secretion vectors. With this system, many bacterial proteins and human epidermal growth factor were efficiently secreted at yields of more than 1 g/liter. The yield of other mammalian proteins was less, but still l0 to 100 times higher than has been reported with other systems. In addition to the direct use of the produced proteins, this system should be useful for engineering proteins by random or localized mutagenesis. Because the active proteins are secreted efficiently into the medium, clones producing proteins of altered properties can be easily screened by direct assay of the culture medium.
34
VECTORS FOR EXPRESSING CLONED GENES
[4]
[4] U s e o f M u l t i d r u g R e s i s t a n c e G e n e in M a m m a l i a n Expression Vectors
By SUSAN E. KANE and MICHAEL M. GOTTESMAN Introduction As the fields of molecular biology, cell biology, and human genetics converge, and technological advancements in gene cloning, gene expression, and gene therapy multiply, the need for efficient, flexible systems for expressing foreign genes in mammalian cells is increasing. The terms "foreign" and "heterologous" genes will be used interchangeably in this chapter to refer to cloned DNAs of interest that are to be expressed in tissue culture cells or in animals. These DNAs generally do not have a selectable phenotype and must either be expressed transiently or cotransferred into cells with a selectable marker. For general reviews of gene expression and expression vectors, see Refs. 1 and 2. Virus-based vector systems, such as retroviruses, vaccinia virus, and bovine papiUomavirus, have proved useful for both stable and transient gene expression. Gene transfer can be efficient and reproducible with such viruses and infection of a variety of cell types is often possible. Many plasmid vectors make use of strong promoter elements for high-level gene expression in transfected cells, and tissue-specific or inducible promoters allow expression under more controlled conditions. Amplifiable selection systems have been developed for stable overexpression of foreign sequences, the most common of these being based on dihydrofolate reductase, which confers resistance to folate analogs. This chapter will discuss the theory and applications of another such amplifiable selection system, based on the human multidrug resistance gene (MDR1), and resistance to a variety of clinically relevant drugs, such as colchicine, adriamycin (doxorubicin) and vinblastine. Multidrug Resistance as Dominant Selectable Marker The discovery that cultured cells could develop cross-resistance to multiple cytotoxic drugs led to the cloning of the mouse 3 and human 4 mdr S e e a r t i c l e s in this s e r i e s , Vol. 185, pp. 4 8 5 - 6 1 1 . 2 S. E. K a n e , Genet. Eng. 13, 167 (1991). 3 p. G r o s , J. C r o o p , a n d D. H o u s m a n , Cell 47, 371 (1986).
4C.-J. Chen,J. E. Chin, K. Ueda, D. Clark, I. Pastan, M. M. Gottesman,and I. B. Roninson, Cell 47, 381 (1986). METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
[4]
M D R 1 GENE IN MAMMALIAN EXPRESSION VECTORS
35
cDNAs. These cDNAs encode a 170,000-Da transmembrane glycoprotein that is an energy-dependent drug efflux pump known variously as P170, P-glycoprotein, or the multidrug transporter. Increased expression of the multidrug transporter leads to resistance to a variety of cytotoxic drugs, including the anticancer drugs doxorubicin, daunorubicin, vinblastine, vincristine, VP-16, VM-26, actinomycin D, and taxol, and other cytotoxic agents such as colchicine, puromycin, emetine, ethidium bromide, and mithramycin. Selections of increasing stringency (i.e., stepwise increases in drug concentration) in any of these drugs results in cross-resistant cells with overexpression of the MDR1 gene (for human), frequently as a result of amplification of this gene (for a review, see Ref. 5). The cloning of the cDNA for the multidrug transporter made it possible to create retroviral expression vectors for the mouse 6 and human 7 cDNAs. When introduced into drug-sensitive cells, these vectors confer the complete phenotype of multidrug resistance on these cells. Virtually all cells, except those that are drug resistant to begin with, are susceptible to transformation with the MDR1 cDNA, making it a flexible, dominant selectable marker. An MDR1 cDNA was introduced into the germline of transgenic mice.S In one line of MDRl-transgenic mice, P-glycoprotein is expressed on the surface of bone marrow cells, rendering these mice resistant to the marrow-toxic effects of a variety of natural product anticancer drugs. 9 Thus, the MDR1 cDNA is a good dominant selectable marker in vivo as well as in vitro.
Applications of MDR1-Based Selections to Foreign Gene Expression The cloned MDR1 cDNA has been adapted for use in gene transfection of tissue culture cells, in retroviral transfer of foreign sequences, and in bone marrow transplantation studies. MDR1 expression can be selected by growth with a variety of cytotoxic drugs (see above) or by cell-sorting technology (see [14] this volume). Coexpression of heterologous coding sequences as well as antisense or catalytic RNA sequences can be achieved in a variety of cell types. 5 S. E. Kane, I. Pastan, and M. M. Gottesman, J. Bioenerg. Biomembr. 22, 593 (1990). 6 p. Gros, Y. B. Neriah, J. M. Croop, and D. E. Housman, Nature (London) 323, 728 (1986). 7 K. Ueda, C. Cardarelli, M. M. Gottesman, and I. Pastan, Proc. Natl. Acad. Sci. U.S.A. 84, 3004 (1987). 8 H. Galski, M. Sullivan, M. C. Willingham, K.-V. Chin, M. M. Gottesman, I. Pastan, and G. T. Merlino, Mol. Cell. Biol. 9, 4357 (1989). 9 G. Mickisch, G. T. Merlino, H. Galski, M. M. Gottesman, and I. Pastan, Proc. Natl. Acad. Sci. U.S.A. 88, 547 (1991).
36
VECTORS FOR EXPRESSING CLONED GENES
[4]
Cotransfection and Coamplification
The most common application of MDR1 selection is in tissue culture transfection experiments. MDR1 as a selectable marker was originally used in cotransfections, with MDR1 and foreign cDNAs carried on separate plasmids. 1°'11 The MDR1 plasmid, called pHaMDR, has the human MDR1 cDNA under the control of Harvey murine sarcoma virus long terminal repeats (LTRs). Foreign sequences on a separate plasmid can be regulated by any transcription control elements. Using transfection methods that lead to tandem integration of cotransfected sequences, selection for uptake and expression of MDR1 results in cell lines that also express the foreign sequences with good efficiency. Subsequent selection for amplified expression of MDR1 allows coamplification of foreign gene expression as well. A modification to pHaMDR places MDR1 and heterologous sequences on the same plasmid molecule.12 The modified vector, termed pSK 1.MDR, maintains MDR1 under control of retroviral LTRs and includes a simian virus 40 (SV40) promoter and polyadenylation signal plus a unique cloning site for insertion of heterologous sequences. This vector is efficient for coexpression of MDR1 and foreign sequences and should be useful with transfection methods that yield single-copy or multiple, unlinked integrations of the transferred sequences. The most commonly used selecting agent in transfection experiments is colchicine because it is effective and inexpensive. Colchicine disrupts microtubules and thus inhibits cell division. Cells that are not multidrug resistant become multinucleated and eventually die in the presence of colchicine, while those that take up and express MDR1 are resistant to the drug. By increasing the selective pressure (colchicine concentration) on these cells, they must express progressively more MDR1 gene product to remain drug resistant. This is accomplished either by bona fide gene amplification ~° or by enrichment for cells in a population that already express high levels of MDR1. lz By either mechanism, the end result is a cell line that is resistant to high concentrations of colchicine and that also expresses high levels of cotransferred foreign sequences. Retroviral Transfer o f MDR1
The MDR1 expression and selection system has also been adapted for use as a retroviral vector. In pHaMDR/A, MDR1 cDNA (lacking its own l0 S. E. Kane, B. R. Troen, S. Gal, K. Ueda, I. Pastan, and M. M. Gottesman, Mol. Cell. Biol. 8, 3316 (1988). 11 R. Konig, G. Ashwell, and J. A. Hanover, Proc. Natl. Acad. Sci. U.S.A. 86, 9188 (1989). 12 S. E. Kane, D. H. Reinhard, C. M. Fordis, I. Pastan, and M. M. Gottesman, Gene 84, 439 (1989).
[4]
M D R 1 GENE IN MAMMALIAN EXPRESSION VECTORS
37
polyadenylation signal) is flanked by retroviral LTRs and the primary MDR1 transcript contains viral packaging signals near the 5' end. The pHaMDR/A plasmid is transfected into retrovirus packaging cell lines, T M transfected cells are selected for resistance to colchicine, and virus containing the MDR1 coding sequences is isolated from the culture supernatant. This approach has been used to isolate virus with the human MDR1 gene ~5 and, in a separate construction, with a mouse mdr gene. ~6 These viruses can infect and confer multidrug resistance on rodent, dog, and human cell lines in culture. In addition, primary mouse bone marrow cells have been infected in vitro with M D R I virus and multidrug resistant granulocyte-macrophage progenitor colonies were subsequently isolated by colchicine selection. Bone marrow infected with the MDR1 virus can reconstitute mice and form spleen foci containing M D R ! cDNA sequences with a moderate efficiency.17 These results suggest that M D R ! can be used as a selectable marker in a retroviral vector system. To demonstrate that MDR1 virus can also be useful in cotransfer experiments, Germann et al. constructed a fusion gene, with M D R 1 and human adenosine deaminase (ADA) coding sequences linked to encode a fusion protein of the two gene products. 18,~9 When virus carrying the fusion gene is used to infect mouse fibroblasts, a bifunctional fusion protein is produced. Thus, infected cells selected for resistance to colchicine express MDR1 and also express functional ADA. ~9 The fusion protein is membrane associated in the drug-resistant cells, consistent with the membrane localization of the MDR1 gene product acting as a multidrug transporter. When transformed mouse cells are infected with the fusion gene virus, resulting drug-resistant cells can be used to form tumors in nude mice. Such tumors grow in vivo in the absence of drug and maintain expression of the bifunctional fusion protein even when removed from the mouse and grown in culture without colchicine. ~9 This work with MDR fusion proteins and retroviral gene transfer indicates that the MDR1 expression system has potential for use in mammalian gene therapy and bone marrow transplantation studies. It should also be possible to improve the retroviral vector either by encoding two distinct ~3 R. Mann, R. C. Mulligan, and D. Baltimore, Cell 33, 153 (1983). 14 A. D. Miller, M.-F. Law, and I. M, Verma, Mol. Cell. Biol. $, 431 (1984). 15 I. Pastan, M. M. Gottesman, K. Ueda, E. Lovelace, A. V. Rutherford, and M. C. Willingham, Proc. Natl. Acad. Sci. U.S.A. 85, 4486 (1988). 16 B. C. Guild, R. C. Mulligan, P. Gros, and D. E. Housman, Proc. Natl. Acad. Sci. U.S.A. 85, 1595 (1985). ~7 j. R. McLachlin, M. A. Eglitis, K. Ueda, P. W. Kantoff, I. H. Pastan, W. F. Anderson, and M. M. Gottesman, J. Natl. Cancer Inst. 82, 1260 (1990). ~8 U. A. Germann, M. M. Gottesman, and I. Pastan, J. Biol. Chem. 2,64, 7418 (1989). 19 U. A. Germann, K.-V. Chin, I. Pastan, and M. M. Gottesman, FASEB J. 4, 1501 (1990).
38
VECTORS FOR EXPRESSING CLONED GENES
[4]
genes, MDR1 and the heterologous gene, on a polycistronic messenger RNA or by including a separate promoter plus foreign sequences inside the LTRs. In either case, MDR1 and foreign genes should both be packaged into virions with some efficiency.
Selection and Amplification o f Multidrug-Resistant Cells Whether gene transfer is by DNA-mediated transfection or virus-mediated transduction, selection for multidrug resistance and subsequent amplification to high-level gene expression follow the same procedure. Although MDR1 can confer resistance to a variety of drugs, colchicine has been used exclusively in the studies discussed in this chapter. There is some evidence to suggest that the particular MDR1 allele included in the pHaMDR and pSK1.MDR vectors confers preferential resistance to colchicine over other drugs, 2° suggesting that selection with colchicine might be more efficient and yield more resistant colonies than selection with other agents. This possibility has not been tested. The selection and amplification processes are relatively simple and rapid. In general, transfected or infected cells are initially plated in a low concentration of colchicine (see p. 40 for details on drug concentrations) for 10-14 days. This allows cells that take up, stably integrate, and express MDR1 to grow into individual colonies; colonies are pooled or single colonies are expanded at the initial low drug concentration. Selection for amplified expression proceeds by stepwise increases in the concentration of colchicine in the culture medium. Cells expressing MDR1 gene product on the cell surface can also be selected by magnetic activated cell sorting (MACS) technology, using a monoclonal antibody directed against an external epitope of the multidrug transporter (see Ref. 21 and [14] this volume). While this approach is promising for sorting out drug-resistant cells from a mixed population of resistant and sensitive tumor cells, for example, MACS has not been adequately tested for performing initial selection of transfected cells that take up and express MDR1. A potential problem is that only a small percentage of cells that express P-glycoprotein on their cell surface at early times after transfection will go on to establish stable expression of the protein at longer times after transfection. Therefore, cells selected early with MACS might lose their transfected sequences with subsequent passage. Later selection with MACS might miss the small percentage of MDRl-expressing cells that have been overgrown by nonexpressing cells. 20 K. Choi, C.-J. Chen, M. Kriegler, and 1. B. Roninson, Cell 53, 519 (1988). 21 R. Padmanabhan, T. Tsuruo, S. Kane, M. Willingham, B. Howard, M. M. Gottesman, and I. Pastan, J. Natl. Cancer Inst. 83, 565 (1991).
[4]
M D R I GENE IN MAMMALIAN EXPRESSION VECTORS
39
The value of MACS or the related technique of fluorescence-activated cell sorting might be in sorting out very high MDR1 expressers in a population of cells previously selected for multidrug resistance. Cells, DNA, and Transfection Methods The MDRI expression system has been used in a variety of cell types. Initially tested in mouse fibroblasts, N I H 3T3 cells, 1° many human cells, such as epithelial A431 cells, 2~ KB-3-I fibroblasts, and SK-Hep hepatoma cells, as well as Chinese hamster ovary cells ~1 and transformed NIH 3T3 cells, ~° have been transfected with the MDR1 cDNA, The retrovirus carrying the MDR1 cDNA has been used to infect mouse bone marrow, 17 mouse myoblasts, 22 dog MDCK cells, 15 transformed NIH 3T3 cells, 19 as well as mouse leukemia and lymphoma cells, human FEM-X melanoma cells, human colon cancer HT-29 cells, and human breast cancer MCF-7 cells. It should also be possible to use other cell lines that are not inherently resistant to colchicine, because MDR1 is a dominant selectable marker. Cell type often determines the transfection method that must be utilized for DNA transfer (transfection techniques are reviewed in Ref. 1). The MDR1 system has been used primarily with calcium phosphate-mediated transfection and retroviral infection, as discussed above. The former method is particularly useful for introducing multiple tandem copies of the transferred sequences into the host cell genome. This might be important for establishing colonies that survive initial selection with colchicine. Once high-level expression is achieved by colchicine amplification, the integrated sequences appear to be stable on long-term culturing in the presence of drug. Other transfection methods, such as electroporation and lipofection, have not been rigorously tested yet with the MDRI system. It is possible that techniques that lead to single or low-copy integration events within a single cell will be less efficient at producing multidrug-resistant colonies, or that those colonies that do survive initial selection will not be amplified with good efficiency. However, the results with retroviral-mediated MDR1 transfer suggest that initial selection, at least, is possible with low MDR1 copy number. The discussion so far has focused on high-level expression of foreign DNAs that code for proteins. MDR1 selection and amplification have also been exploited for overexpression ofantisense RNA sequences (E. Cantin, personal communication), which are often required in high dosage relative to the level of their target mRNA. The MDR1 system should be adaptable 22 A. Salminen, H. F. Elson, L. A. Mickley, A. T. Fojo, and M. M. Gottesman, Hum. Gene Ther. 2, 15 (1991).
40
VECTORS FOR EXPRESSING CLONED GENES
[4]
for catalytic ribozyme expression as well, and for generating high-copy DNA or RNA elements that potentially interact with soluble trans-acting factors within cells. Methods Following is a description of DNA transfer, colchicine selection and amplification, and analysis of multidrug-resistant cells for expression of transferred sequences. The protocols primarily refer to using the pSK1.MDR expression vector with N I H 3T3 cells and calcium phosphatemediated transfection, with comments on variations included when relevant.
Cloning Foreign Sequences into pSK1.MDR Figure 1 is a partial restriction map of the pSK1.MDR vector. Using standard enzyme digestions and cloning techniques, foreign sequences are inserted into the unique SalI site [base pair (bp) 69 on the map] located between the SV40 promoter and polyadenylation signal. The orientation of the insert can be determined by restriction enzyme analysis, using the indicated restriction sites as reference. Transcription proceeds in a clockwise direction from the SV40 promoter, so insert orientation should be 5' to 3' (left to right) on this map. MDR1 transcription also proceeds clockwise from the LTR and can either terminate at its own polyadenylation signal or continue to the downstream LTR polyadenylation site.
Determination of Colchicine Dose Before beginning any transfection or infection with MDR1, it is important to determine the concentration of colchicine that will be used for the initial selection step. This can vary significantly from cell line to cell line. With N I H 3T3 cells, transfectants are selected with 60 ng/ml ofcolchicine. Most human cell lines tend to be 10-fold more sensitive to colchicine, however, and should be selected with approximately 6 ng/ml of colchicine. Colchicine inhibition of human cells is sensitive to drug concentration, however, so the exact dosage to use should be determined carefully. At the other end of the spectrum, Chinese hamster ovary cells are inherently resistant to colchicine and require concentrations of 200 ng/ml or more of drug. To determine the concentration of colchicine for selection: 1. In standard growth medium for the cells, seed 100-300 cells into each well of a 12-well tissue culture plate. Allow the cells to attach to the bottom of the well.
[4]
MDRI GENE IN MAMMALIANEXPRESSIONVECTORS
41
Sphl 15453I Sphl 15381 I
BamHI 15116. /
44 69
SV40
Hindlll Pstl 1
2852
Pstl 12171 3635
pSK1.MDR 15585 bp
Stul 11189 J Hindlll 11147
LTR
Pstl 10122 J Stul 9822
~ ~ 1 BamHI 6031 BamHI 6062
Stul 8916 I Hindlll 8791 FIG. 1. A partial restriction map of the pSKI .MDR expression vector. Foreign DNAs are inserted into the unique SalI restriction site at bp 69. Expression of the foreign sequences is controlled by an SV40 promoter and polyadenylation signal (black box). Expression of the MDR1 selectable marker is controlled by retroviral LTRs (gray boxes). Arrows indicate direction of transcription. Included on the map are all the sites recognized by restriction enzymes BamHI, HindlII, PstI, SphI, and StuI. These enzymes are useful for determining the orientation of foreign sequences inserted at the Sa/I site.
2. R e m o v e the m e d i u m and replace with complete medium plus increasing concentrations o f colchicine. F o r example: 0, 2, 3, 4, 5, 6, 7, and 8 ng/ml of colchicine in duplicate wells for h u m a n cells; 0, 10, 20, 30, 40, 50, 60, 70, 80, and 100 ng/ml in duplicate wells for mouse cells. 3. I n c u b a t e cells under standard t e m p e r a t u r e and CO2 conditions for the cells, for 5-10 days. 4. R e m o v e the m e d i u m and stain cells with 0.5% (v/v) methylene blue in 50% (v/v) ethanol.
42
VECTORS FOR EXPRESSING CLONED GENES
[4]
5. Choose the concentration of drug at which no cells grow to form colonies. Confirm that this concentration of drug gives no (or few) surviving colonies when cells are plated at transfection densities (5 x 105 cells/ 100-mm tissue culture dish).
Transfection and Initial Selection Calcium phosphate-mediated transfections are performed essentially as described by Graham and van der E b 23 and Gorman et al. 24
Reagents CaCI 2, 2.5 M Sterile HzO HBS (2 x): 50 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES), pH 7.1,280 mM NaCI, 1.5 mM Na:HPO4 Filter sterilize all reagents and store at 4 °. The pH of the 2 x HBS is critical and should be checked periodically and adjusted to pH 7.05-7.1 if necessary.
Protocol l. On the afternoon of day 0, plate 5 x 105 cells/10-cm tissue culture dish. Set up one dish per DNA to be transfected plus a negative control dish for a mock transfection without DNA. 2. On day 1, change the medium of the cells 3 hr before the transfection. Use complete medium. 3. For the transfection, set up two 15-ml conical tubes for each transfection: tube I: 250/zl 2 x HBS tube 2: D N A , 24a 25 ~1 2.5 M CaC12 , H20 to 250/zl 4. Using a 1-ml pipette, bubble air into the solution of 2 x HBS; at the same time, add DNA solution dropwise to the HBS. Continue bubbling air through the solution for 5 sec after all the DNA is added. 5. Let the mixture sit at room temperature for 30 min to allow precipitate to form. 6. Add DNA/HBS mix to cells in complete medium, dropwise with
23 F. L. Graham and A. J. van der Eb, J. Virol. 52, 456 (1973). 24 C. M. Gorman, G. T. Merlino, M. C. Willingham, I. Pastan, and B. H. Howard, Proc. Natl. Acad. Sci. U.S.A. 79, 6777 (1982). 24a Use a total of 5-10/~g DNA. If using pSK1.MDR, 5-10/zg; if using pHaMDR plus a separate plasmid with foreign sequences, use approximately equal molar amounts of the two plasmids.
[4]
MDR1 GENE IN MAMMALIAN EXPRESSION VECTORS
43
gentle swirling. For stable transfections, allow the precipitate to remain on the cells overnight ( - 1 6 hr). 7. On day 2, wash the cells two or three times with phosphate-buffered saline (PBS) (plus Ca2+/Mg 2+) or serum-free medium and add fresh complete medium overnight. 8. On day 3, split the cells 1 : 4 into selective medium, 60 ng/ml colchicine for NIH 3T3 cells. Change the medium once, after 5 days in colchicine, being careful not to disrupt colonies. Notes 1. On day 3, the cells should be split into three or four dishes or flasks, depending on the purpose of the experiment. In general, include one dish for staining colonies to quantitate transfection efficiency and the rest for picking individual colonies or for pooling colonies to expand and amplify in colchicine (see below). The density at which cells should be plated at this stage will vary from cell type to cell type. Under the conditions described above, N I H 3T3 cells split 1 : 4 on day 3 will result in 100-300 colonies per 10-cm dish by 10-14 days after addition of colchicine. 2. Colchicine is stored as 10- or 1-mg/ml stock solutions, in dimethyl sulfoxide (DMSO). Tubes are kept wrapped in foil and frozen at - 2 0 °. The concentration of DMSO in selection medium should not exceed 0.5% (v/v). 3. Colonies will appear by 7-14 days after selection is initiated (again, this should vary with cell type). To stain colonies, remove the growth medium and replace with 5 ml 0.5% (w/v) methylene blue in 50% (v/v) ethanol. Let sit for 5 min on the cells and wash off with several rinses of H20. Background will appear light blue because drug-sensitive cells are not killed by colchicine but are prevented from dividing. Infection of Drug-Sensitive Cells with an MDR1 Retrovirus The pHaMDRA vector has been packaged in both ecotropic and amphotropic mouse 3T3 packaging cell lines.~5 Viral titers of approximately 8 x 104 transforming units per milliliter of supernatant have been obtained. To infect drug-sensitive cell lines with these supernatants we use the following protocol: 1. Cells are plated at 1-2 x 104 cells/100-mm dish and allowed to attach to the plastic substrate overnight. Up to 105 cells/dish can be used if retroviral transformation frequencies are low. 2. Viral supernatant at a dilution of 1/10 or 1/5 (1 or 2 ml of virus in a total of 10 ml of complete medium containing 2/zg/ml Polybrene, Abbott Laboratories) is added to the cell monolayer. Higher dilutions of virus can also be used.
44
VECTORS FOR EXPRESSING CLONED GENES
[4]
3. After 24 hr, virus is removed and selection medium containing an appropriate concentration of colchicine is added (see above). 4. Colchicine-resistant colonies will appear after 7-14 days. A mocktreated control should show no colonies if the selection conditions are appropriate.
Amplification in Colchicine Before beginning the amplification process, it is important to have healthy, drug-resistant cells growing at a low drug concentration (60-80 ng/ml of colchicine for N I H 3T3 cells). Individual colonies can be isolated and expanded until they are growing in T75s. Alternatively, a dish of selected colonies can be trypsinized and pooled into a single T75 flask and grown for two or three passages at low drug concentration until only drug-resistant cells persist. Some multinucleated drug-sensitive cells might survive the early passages.
Protocol 1. From a confluent T75 or 10-cm dish at low drug concentration, trypsinize cells and replate in a twofold higher drug concentration. Do not plate cells at less than about 25% confluence at any time during the amplification process. 2. Maintain cells at this drug concentration for at least two passages. 3. Repeat the amplification in twofold increments of drug concentration, again passaging at least two times at each level and maintaining at least 25% confluence.
Notes 1. It is a good idea to freeze aliquots of cells at each drug concentration during amplification, and maintain some cells at selected concentrations for further analysis (see the next section). 2. The maximum drug concentration to which cells can be amplified will vary. With N I H 3T3 cells, transferred DNA is stable through longterm culturing in 1/.tg/ml colchicine. 3'5 Chinese hamster ovary cell amplification has been reported to 12.8/xg/ml colchicine, n Analysis of Multidrug-Resistant Cells Once individual clones or populations of cells have been amplified to high colchicine resistance, they can be analyzed by a variety of methods to confirm that they harbor and express human MDR1 as well as the foreign sequences of interest. Described briefly below are some approaches and tools for measuring MDR1 expression.
[4]
M D R I GENE IN MAMMALIAN EXPRESSION VECTORS
45
DNA Detection. Transfected MDR1 DNA can be detected by isolating genomic DNA from multidrug-resistant cells and performing Southern analysis 25 on EcoRI restriction enzyme digestion products. Filters are hybridized with a 3-kb EcoRI fragment derived from human MDR1 cDNA 26that detects a 3-kb band specific to transfected MDR1 sequences. This probe is completely internal to the MDR! cDNA, so it will not detect the number of different integration sites per cell line. To determine whether the transferred sequences are truly amplified during the course of stepwise colchicine selection, individual clones must be isolated, expanded, and selected in increasing concentrations of colchicine. Southern analysis should be performed on genomic DNA from cells growing at each drug concentration. The intensity of the 3-kb MDR1 band should increase as multidrug resistance and amplification increase. RNA Detection. MDR1 RNA can be measured by Northern analysis 27 or by primer extension. 28 In both cases, probes are available that will distinguish between transfected MDRl-specific transcription and transcription from endogenous genes in the transfected cell lines. Using human cells as transfection recipients, transfected MDRI and host MDRI detected by the probes are different in size. With nonhuman cells as host, the probes do not cross-react with other species of the multidrug resistance mRNA. Using the same 3-kb EcoRI fragment mentioned above as probe in a Northern hybridization, MDR1 mRNA transcribed from pSK1.MDR or from pHaMDR will be detected as 6- and 11-kb species. 7 Endogenous human MDR1 mRNA is 4.5 kb. Primer extension analysis using a human MDRl-specific primer 26 results in transfected and endogenous extension products that are different in size by about 13 nucleotides. As for DNA, RNA analysis should be performed on individual amplified clones of transfected cells rather than on mixed populations of cells in order to measure amplification of expression during the course of colchicine selection. Analysis for P-Glycoprotein Immunoprecipitation, Western blotting, indirect immunofluorescence, and fluorescence-activated cell analysis (FACS) can all be used to measure expression of P170, the MDR1 gene product. With the MDR1 selection 25 E. M. Southern, J. Biol. Chem. 98, 503 (1975). ,.6 K. Ueda, D, P. Clark, C.-J. Chen, I. B. Roninson, M. M. Gottesman, and I. Pastan, J. Biol. Chem. 262, 505 (1987). ,~7p. S. Thomas, Proc. Natl, Acad. Sci. U.S.A. 77, 5201 (1980). ~8 G. Merlino, J. S. Tyagi, B. de Crombrugghe, and I. Pastan, J. Biol. Chem. 257, 7254 (1982).
46
VECTORS FOR EXPRESSING CLONED GENES
[4]
system described in this chapter, the correlation between high MDR1 expression and high expression of cotransfected sequences is excellent (see Refs. 3 and 5; S. Kane and C. M. Fordis, unpublished observations). In addition, expression can be very stable. As stated earlier, amplified cultures can be maintained in colchicine for months without loss of MDR1 or cotransfected sequences. Furthermore, in transfected NIH 3T3 cells, amplified cells can be grown in the absence of colchicine for at least 2 weeks and still maintain expression of cotransfected sequences (S. Kane, unpublished observations). The best reagent for immunofluorescence and FACS is a monoclonal antibody called MRK-16. 29 MRK-16 is directed against an epitope of human MDRI that lies on the outside of the cell when P170 is in its native conformation in the plasma membrane of multidrug-resistant cells. Immunofluorescence can be used to analyze a population of cells for variability in MDR1 expression or an individual clone for level of expression. It can also be used preparatively by staining live colonies to identify clones that express significant levels of P170. These colonies can be isolated and expanded if they are already growing in high colchicine concentration, or they can be further amplified if they are at lower concentrations of drug. Fluorescence-activated cell analysis can likewise be used to identify high MDR1 expressers and cell-sorting capability can be used preparatively to isolate high expressers from a mixed population. As mentioned previously, magnetic bead-sorting technology, using the MRK-16 antibody, has been applied to MDR1 cell sorting and is described elsewhere in this volume. Immunoprecipitations can be performed by standard methods, with the following special considerations. 1. P170 is a stable protein (half-life, 48-72 hr), requiring long labeling times to detect newly synthesized protein. Label cells with [35S]methionine or a comparable labeling-grade mix of 35S-labeled amino acids, 200 /zCi/ml of labeling medium. Label overnight in 5 ml of culture medium (lacking methionine) plus 5% (v/v) serum. 2. The MRK-16 monoclonal antibody or C219 (Centocor, Malvern, PA) monoclonal antibody can be used in immunoprecipitations. In addition, polyclonal antibody 400730 is highly efficient in immunoprecipitations. Polyclonal antibody 4007 will cross-react with nonhuman species of P170,
29 H. Hamada and T. Tsuruo, Proc. Natl. Acad. Sci. U.S.A. 83, 7785 (1986). 30 S. Tanaka, S. J. Currier, E. P. Bruggemann, K. Ueda, U. A. Germann, I. Pastan, and M. M. Gottesman, Biochem. Biophys. Res. Commun. 166, 180 (1990).
[5]
HIGH-LEVEL GENE EXPRESSION BY T7 RNA POLYMERASE
47
and C219 is not entirely specific for P-glycoprotein.31 A series of antibodies directed against human P170 peptides has been described. 32Most of these antibodies, except for MRK-16, can be used on Western blots. 3. After resuspending immunoprecipitated material in sodium dodecylsulfate (SDS)-sample buffer for a Laemmli-type gel,33 elute antibody-P170 conjugate at room temperature for 15 min. Boiling will cause P170 to aggregate and it will not enter an SDS-polyacrylamide (PAGE) gel. 4. The MDRI gene product will migrate on SDS-PAGE as a diffuse band of approximately 170K. Apparent molecular weight will vary depending on the cell type being used for expression, probably due to differential glycosylation patterns. Cell lines expressing P-glycoprotein on their surfaces can also be detected by indirect immunofluorescence as described by Willingham et al.34 Positive cells can also be detected and sorted by FACS. For this purpose, we use 10/xg MRK-16/106 cells 29 with 85 /zg fluorescein isothiocyanate (FITC) goat anti-mouse IgG per 10 6 cells as a second antibody for fluorescence detection. 3~ F. Thiebaut, T. Tsuruo, H. Hamada, M. M. Gottesman, I. Pastan, and M. C. Willingham. J, Histochem. Cytochem. 37, 159 (1989). 3: E. P. Bruggemann, V. Chaudhary, M. M. Gottesman, and I. Pastan, BioTechniques 10, 202 (1991). 33 U. K. Laemmli, Nature (London) 227, 680 (1970). 34 M. C. Willingharn, N. D. Richert, M. M. Cornwel|, T. Tsuruo, H. Hamada, M. M. Gottesman, and I. Pastan, J. Histochem. Cytochem. 35, 1451 (1987).
[5] S t a b l e H i g h - L e v e l G e n e E x p r e s s i o n in M a m m a l i a n by T7 Phage RNA Polymerase
Cells
By A N D R E LIEBER, VOLKER SANDIG, WOLFGANG SOMMER, SILVIA BAHRING, and MICHAEL STRAUSS Introduction Various routes for high-level foreign gene expression in mammalian cells have been explored over the years) '2 However, there are not that many different principles to choose from; the choice is between transient and stable expression systems. Expression vectors for the first kind of I M. Strauss, U. Kiessling, and M. Platzer, Biol. Zentralbl. 105, 209 (1986). 2 j. Sambrook and M.-J. Gething, Focus 10, 41 (1987).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
48
VECTORS FOR EXPRESSING CLONED GENES
[5]
systems are mainly derived from viruses, such as vaccinia virus, 3-5 baculovirus, 6'7 simian virus 40 (SV40), 8'9 and others. Some of these systems
allow for very high expression levels, but only for the short period of 1-3 days.2,5,7 High-level transient expression is therefore useful for producing large amounts of a particular protein for further biochemical studies. However, under certain demanding conditions, it is desirable to express foreign genes continuously at a relatively high level. Stable expression of foreign genes can be achieved using constructs that either integrate into the host cell genome or have the ability to replicate at a moderate level. Vectors of the second type are preferentially derived from bovine papilloma virus (BPV) 1°-12 and from Epstein-Barr virus (EBV). 13 Integrating plasmid vectors can be amplified by linkage to genes such as that for dihydrofolate reductase (DHFR) 14A5or metallothionein 16 and subsequent selection with increasing drug concentrations. However, when genes are amplified by more than 100-fold the increase in the expression level is often less than 10-fold. 1~Additionally, differences in the level of expression achieved with various strong viral or mammalian promoters are within one order of magnitude when analyzed in transient expression assays.~7 Differences in the expression levels between individual clones derived from one and the same transfection can be enormous, ranging between only a few nanograms and several micrograms per 106 cells/ml/day. N,15 In searching for a stable expression system that is not restricted by the availability of host cell transcription factors and RNA polymerase, we became interested in the use of a bacteriophage promoter/polymerase system for which a highly selective function in prokaryotic host cells was 3 D. Panicalli and E, Paoletti, Proc. Natl. Acad. Sci. U.S.A. 79, 4927 (1982). 4 M. Mackett, G. L. Smith, and B. Moss, Proc. Natl. Acad. Sci. U.S.A. 79, 7415 (1982). 5 T. R. Fuerst and B. Moss, J. Mol. Biol. 206, 333 (1989). 6 G. E. Smith, M. J. Fraser, and M. D. Summers, J. Virol. 46, 584 (1983). 7 V. A. Luckow and M. D. Summers, Bio/Technology 6, 47 (1988). 8 M.-J. Gething and J. Sambrook, Nature (London) 293, 620 (1981). 9 j. T. Elder, R. A. Spritz, and S. M. Weissman, Annu. Rev. Genet. 15, 295 (1981). 10N. Sarver, P. Gruss, M.-F. Law, G. Khoury, and P. M. Howley, Mol. Cell. Biol, 1, 486 (1981). ii N. Hsiung, R. Fitts, S. Wilson, A. Milne, and D. Hamer, J. Mol. Appl. Genet. 2, 497 (1984). 12 D. DiMaio, in "The Papillomaviruses," p. 293. Plenum, New York, 1987. 13 p. B. G. M. Belt, H. Groeneveld, W. J. Teubel, P. van de Putte, and C. Backendorf, Gene 84, 407 (1989). 14 R. J. Kaufman and P. A. Sharp, J. Mol. Biol. 159, 601 (1982). 15 R. J. Kaufman, L. C. Wasley, A. J. Spiliotes, S. D. Gossels, S. A. Latt, G. R. Larsen, and R. M. Kay, Mol. Cell. Biol. 5, 1750 (1985). 16 G. N. Pavlakis and D. Hamer, Proc. Natl. Acad. Sci. U.S.A. 80, 397 (1983). 17 D. R. Hurwitz, R. Hodges, W. Drohan, and N. Sarver, Nucleic Acids Res. 15, 7137 (1987).
[5]
HIGH-LEVEL GENE EXPRESSION BY
T7 R N A POLYMERASE
49
known. Like other uneven T phages, the T7 phage codes for an RNA polymerase that is selective for phage promoters.~8-2° The latter, in turn, are so different in sequence from bacterial promoters that they cannot be transcribed by the bacterial RNA polymerase. ~8Moss and co-workers 2~'20were first in using this principle for the short-term vaccinia expression system. In this chapter we describe the adaptation of the transcriptional machinery of phage T7 to the mammalian cell system for highly selective stable gene expression. Principle In our original publication of T7 RNA polymerase-dependent gene expression in mammalian cells 23 we showed that the expression of the T7 RNA polymerase gene leads to cytoplasmic localization of the polymerase. This, in fact, is potentially useful for efficient transient expression from transfected plasmids and it is an ideal prerequisite for expression using vaccinia vectors. 24 For stable foreign gene expression a nuclear localization of the T7 polymerase is required. This has been achieved by fusion of a nuclear location signal to the amino terminus of the polymerase 25 or by substituting the nuclear location signal for the N-terminal 5% of the polymerase. 23 Cell lines can be established with this modified gene that harbor the T7 polymerase exclusively in the nucleus. Transfection of a foreign gene under control of a T7 promoter into such cells should result in transient as well as stable expression of the particular gene driven by the T7 polymerase. In fact, using chloramphenicol acetyl transferase (cat) 23 and other reporter genes we could demonstrate efficient expression within the range obtained with the strong Rous sarcoma virus (RSV) and cytomegalovirus (CMV) promoters. Human growth hormone has been expressed stably at levels of 20-30/zg/ml/106 cells/day. 26 However, we verified an effect that has been noticed before by ourselves and by other 18 j. j. Dunn and F. W. Studier, J. Mol. Biol. 166, 477 (1983). 19 p. Davanloo, A. H. Rosenberg, J. J. Dunn, and F. W. Studier, Proc. Natl. Acad. Sci. U.S.A. 81, 2035 (1984). 20 B. A. Moffat, J. J. Dunn, and F. W. Studier, J. Mol. Biol. 173, 265 (1984). 21 T. R. Fuerst, E. G. Niles, F. W. Studier, and B. Moss, Proc. Natl. Acad. Sci. U.S.A. 83, 8122 (1986). 22 B. Moss, O. Elroy-Stein, T. Mizukami, W. A. Alexander, and T. R. Fuerst, Nature (London) 348, 91 (1990). 23 A. Lieber, U. Kiessling, and M. Strauss, Nucleic Acids Res. 17, 8485 (1989). 24 O. Elroy-Stein and B. Moss, Proc. Natl. Acad. Sci. U,S.A. 87, 6743 (1990). 25 j. j. Dunn, B. Krippl, K. E. Bernstein, H. Westphal, and F. W. Studier, Gene 68, 259 (1988). 26 A. Lieber and M. Strauss, unpublished observations (1990).
50
VECTORS FOR EXPRESSING CLONED GENES
[5]
users of the system. It turned out that the T7 promoter can be transcribed by a cellular polymerase (probably polymerase II) quite efficiently if present in the context of a pGEM plasmid. This background expression level amounts to 10-50%, depending on the cell type. Thus, the T7 promoter in pGEM is actually a reasonably efficient promoter in mammalian cells, which allows the use of one and the same construct for expression in prokaryotic and eukaryotic cells as well as in a cell-free system. We will describe this interesting aspect elsewhere. 27 To establish an exclusive expression system for mammalian cells it was necessary to generate a modified T7 promoter that does not function with the cellular RNA polymerases and is still active with the T7 polymerase. Because we have succeeded in isolating several mutant promoters fulfilling these requirements we will describe the procedure in the first part of the experimental section (cloning and isolation of mutant T7 promoters). The strategy involves the synthesis of randomly mutagenized promoter oligonucleotides, their repeated incubation with HeLa cell nuclear extracts, the incubation of the unbound fraction with purified T7 polymerase, and amplification and cloning of the polymerase-bound fraction. Individual clones are assayed for function with T7 polymerase in vitro and within the cell using human growth hormone (hGH) as the test gene. The second part of the method to be outlined concerns gene transfer and the selection of clones expressing foreign genes under control of modified T7 promoters. The preferred protocol involves the use of a selectable marker also under control of a T7 promoter. There are three general variants of the procedure: (1) transfer of the gene of interest into cells already expressing the polymerase gene, (2) cotransfer of test gene, polymerase gene, and selectable marker, and (3) establishment of cells carrying a silent T7 promoter/test gene construct with subsequent gene activation by retroviral transfer of the polymerase gene. All three variants have their advantages and disadvantages. Finally, we will describe applications of the T7 expression system for purposes where this system is unique. Besides high-level expression of proteins from cDNA or genomic DNA it is exceptionally useful for expressing polycistronic mRNA and antisense RNA. Materials
Cell Lines
Mouse L t k - cells, Chinese hamster ovary (CHO) cells, and mouse myeloma cell line Sp2/0 Ag 14 are used as recipient cells for the polymerase gene and for cotransfections. 27 V. Sandig, A. Lieber, S. B~ihring, and M. Strauss, Gene, submitted (1992).
[5]
HIGH-LEVEL GENE EXPRESSION BY T 7 R N A POLYMERASE ~
I
1
f
r "Ec° R1369
\
I
51
f
-
/
I"7R N A !~ymemse ~
II T7 P.NA ! ~
~n~
1 ¢,, BsmHl --_ ~,_ ~ . . . ~ T R • Pat 11019
i LTR1 Pvu
M6SVTTN ~ 1 bp I12392 a 12467
rCLS/•x.bBtt
I
tit Pol
I"7R N A ~ y n ~ r a ~
FIG. 1. M a p s of plasmid v e c t o r s carrying the gene for a nuclear T7 R N A polymerase.
PMN clone A5 is a derivative of Ltk- cells expressing T7 RNA polymerase at a high level from the construct pMTT7N (Fig. 1) and has been selected with cadmium for the presence of the mouse metallothionein gene. 23 CHO185 is a clone of CHO cells that has been selected for the presence of pMTT7N. Ltk- cells, CHO cells, and their derivatives are grown in Dulbecco's modified Eagle's medium (DMEM) with 5% (v/v) fetal calf serum (GIBCO, Grand Island, NY) at 5% COz. Myeloma cells are grown in RPMI 1640 medium with 10% (v/v) fetal calf serum and 1 mg/ml of gentamycin.
Vectors and Oligonucleotides The vector family pGEM (Promega Madison, WI) was used originally for cloning and expression of reporter and selectable marker genes. In the studies described here only pT7neo is used from this series. For cloning
VECTORSFOR EXPRESSINGCLONEDGENES
52
HindI11.1~LHine!1.XImi ~ . _ ~_~Bam/~Bgm74
j
IS]
modit-a~l"l'7/a,omo~ !'''~Hindll125
"\
#
F,r.oR1396 BarnHI414 ~ / ~Xho!445 modit'l~lT7~ ~ ~ S p h 1445
hl~
7881~H~
~H
poly(A)signal Sph12640
Sph17.320
FIG. 2. Maps of plasmid vectors with marker genes driven from wild-type or mutant T7 promoters.
of the modified (mutant) T7 promoters pUC 19 is used. The standard vector with the most suitable promoter mutation (No. 86) is named pT7 m. Reporter and test genes are cloned into this vector and named accordingly pT7mhGH, pT7mluc, etc. (Fig. 2). The sequence of the synthetic T7 promoter is as follows: Wild type: Mutant 86:
5'-TTAATACGACTCACTATAGGGAGATA-3' ..... T ............ C .......
pMTT7N is derived from pMTT7 by replacing the BgllI/NarI fragment with a synthetic sequence coding for the nuclear location signal of SV40 large T antigen (Fig. 1). Because the sequence given in the original article 23 mistakenly contained two additional nucleotides, we give the correct sequence here (bold: sequence of the SV40 nuclear location signal):
[5]
HIGH-LEVEL GENE EXPRESSION BY T 7 R N A POLYMERASE
53
5'-AGATCTTTGCAAAAAGC T TTGC AAG A TGGATAAAGTT T TTAGAAAC TCCAGTAGG Me t A s pLy s V a 1 P h e A r g A s n S e r S e t A r g ACT
CCT CCA
A A A AAG AAG A G A AAG G T A GAA C G T C T A G A T C - 3 '
Thr-Pro-Pro-Ly
s -Ly s-Ly
s -Ar g-Ly
s -Va I -GI u ArgLeuAsp
pCMVT7N is constructed by inserting the 3.3-kbp BgllI/PvulI fragment of pMTT7N between the BgllI and SmaI sites of pCMVLT2. 28 pM6SVT7N contains the BgllI/PvulI fragment of pMTT7N inserted into the BgllI site of the retroviral vector construct pM6pac 29 (Fig. I).
Reagents All reagents should be of the highest purity available. The main compounds and enzymes used in our laboratory are from the following suppliers: Geneticin: GIBCO/BRL (Grand Island, NY)/Bethesda Research Laboratories (Gaithersburg, MD), Life Sciences Puromycin: Sigma (St. Louis, MO) DEAE-dextran (Mr 500,000): Pharmacia (Uppsala, Sweden) T7 RNA polymerase: New England BioLabs (Beverly, MA) Restriction enzymes: Boehringer Mannheim (Mannheim, Germany), Bethesda Research Laboratories, New England BioLabs Salts: Sigma BD-cellulose: Serva Feinchemica (Heidelberg, Germany)
Equipment Oligonucleotide synthesis: Performed using an Applied Biosystems (Foster City, CA) DNA synthesizer model 380 on the basis of methoxyamidites Electroporation experiments: Performed using the GenePulser (BioRad, Richmond, CA) Luciferase assays: Performed using a liquid scintillation counter PW 4700 (Philips, The Netherlands) or a luminometer LB 9501-1 Lumat (Berthold, Germany) General Methods
Purification of Plasmids for Transfection Plasmids are purified by two rounds of cesium chloride gradient centrifugation or, preferentially, superior purity is achieved by column z8 M. Strauss, S. Hering, L. Lfibbe, and B. E. Griffin, Oncogene 5, 1223 (1990). z9 M. Wirth, R. G r a n n e m a n n , and H. H a u s e r , J. Virol. submitted.
54
VECTORS FOR EXPRESSING CLONED GENES
[5]
chromatography on BD-cellulose as follows: A cleared alkaline lysate is neutralized, phenol treated, and precipitated with ethanol as in the standard procedure. The pellet is dissolved in TE buffer [10 mM TrisHCI, 1 mM ethylenediaminetetraacetic acid (EDTA), pH 7.6]; RNA and protein are selectively precipitated by addition of ammonium acetate to a final concentration of 2.3 M. The precipitate is removed by centrifugation at 6000 rpm/min for 10 min at 4°. The DNA is precipitated from the supernatant with 70% (v/v) ethanol. After centrifugation the pellet is dissolved in 3 ml TE buffer with 0.3 M NaCI (pH 8). Two milliliters of BD-cellulose in TE buffer plus 0.3 M NaCI is filled into a 4- to 5-ml plastic column or syringe and the DNA solution is applied. The column can be spun; however, for maximal yields it should be run by gravity and the flow-through should be applied a second time. After washing with five column volumes of the same buffer the plasmid DNA is eluted with TE buffer plus 1 M NaCI and precipitated with 70% (v/v) ethanol.
Transfection Procedures For transfection of fibroblasts we generally use a modification of the standard calcium phosphate coprecipitation method. 23'3° The highest efficiencies (approximately 10 -3) a r e obtained as follows: 10 /zg of plasmid DNA in 220/xl of TE buffer plus 30/zl of 2 M CaCI2 are mixed in a test tube, and 250 t-d of 2 × HBS [50 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES), 280 mM NaCI, 1.5 mM sodium phosphate (equal amounts of mono- and dibasic), pH 6.96] is added dropwise with simultaneous vortexing. The precipitate is directly added to 5 ml of culture medium containing 10% (v/v) fetal calf serum in 25cm 2 tissue culture flasks with cells that have been seeded the day before. For transfection of myeloma cells 31 8/xg of plasmid DNA is precipitated with ethanol, resuspended in 250 ~1 of RPMI 1640-25 mM HEPES (pH 7.15), 250 /zl of RPMI 1640/HEPES containing 1 mg/ml DEAEdextran is added to the DNA with vortexing, and the mixture is incubated with the cells on 10-cm petri dishes for 30 min. After washing with RPMI 1640, 7 ml of medium with serum plus 0.1 mM chloroquine are added for 3.5 hr. Cells are washed again and supplied with fresh medium. Electroporation of 10 7 cells/ml in culture medium with 10% (v/v) fetal calf serum is generally performed on ice with 10-50/xg of linear DNA using the following conditions for different cell types: 1.5 kV/cm 30 F, L. Graham and A. van der Eb, Virology 52, 456 (1973). sl A. Lieber, M. Teppke, G. Herrmann, and M. Strauss, FEBS Lett. 282, 225 (1991).
[5l
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE
55
for 3.5 msec with Sp2/0 and 3.0 kV/cm for 3.5 msec with CHO or Ltkcells.
Reporter Gene Assays Chloramphenicol Acetyltransferase Activity. Our assay is a modification of the original procedure of Gorman et al. 32 as described previously .23 Luciferase Activity. Cells are trypsinized and incubated with medium plus 10% (v/v) calf serum for 30 min and are subsequently washed with phosphate-buffered saline (PBS). Then 106 cells are lysed in 1 ml buffer containing 25 mM Tris-phosphate (pH 7.8)/8 mM MgC12/1 mM dithiothreitol (DTT)/I% (v/v) Triton X-100/I% (v/v) bovine serum albumin/15% (v/v) glycerol/0.4 mM phenylmethylsulfonyl fluoride (PMSF). Cell debris is removed by centrifugation. The enzyme reaction mixture contains 50/xl lysate, 2.5 ~1 of 10 mM ATP, and 5 p~l of 1 mM luciferin. The latter is added 10 sec before introducing the reaction tube into the scintillation counter. Photon emission is counted for 10 sec. Photon emission is counted immediately with the luminometer. Between 10 sec and 5 min after addition of luciferin the photon emission does not decrease significantly. There is a linear dependence of emission from the enzyme concentration between 102 and 10 7 counts. Growth Hormone Detection. An enzyme-linked immunosorbent assay (ELISA) is used in which a monoclonal anti-hGH antibody (1:2000 in PBS) is fixed to a microtiter plate by overnight incubation at 4°. After washing three times with water and with PBS plus 0.05% (v/v) Tween 20 the cavities are blocked with 150 /~i of 0.5% (v/v) bovine serum albumin in PBS at 37° for 1 hr. Then 50 /~1 of cell culture supernatant is added to the coated cavities, incubated at 37° for I hr, and washed off with PBS plus 0.05% (v/v) Tween 20. After adding 50 /~I of a rabbit anti-hGH antiserum (1 : 5000), incubating at 37° for 1 hr, and washing, 50/~1 of peroxidase-conjugated goat anti-rabbit antibodies is added. Following incubation at 37° for 1 hr and extensive washing with water, 100 p,l of the staining solution is added containing 25 mg/ml o-phenyldiamine (OPD) in 0.1 M phosphate-citrate buffer (pH 5.0). The color intensity is measured in a photometer. A commercial hGH (Serono, Switzerland) is used as a standard. Linear response is observed between 0.5 and 10 ng/ml. Detection of Tissue Plasminogen Activator. The tissue plasminogen activator (tPA) protein was determined using an ELISA exactly as described for hGH. 32 C. Gorman, L. F. Moffat, and B. Howard, Mol. Cell. Biol. 2, 1044 (1982).
56
VECTORS FOR EXPRESSING CLONED GENES
[5]
Experimental Procedures Cloning and Isolation of Mutant 77 Promoters Mutant Oligonucleotide Synthesis. The sequence of the T7 promoter with additional flanking restriction sites is synthesized using a modification of the mutagenic procedure published previously. 31 To 2.9 ml of the main phosphoamidite solution (0.13 M) in each position 78/xl of each of the other three amidite solutions is added, resulting in an impurity of 8% for each solution. The oligonucleotide mixture is vacuum dried and dissolved in TE buffer. One microgram of the oligonucleotide mixture is annealed to 1/xg of a 18-mer primer completely complementary to the 3' end of the promoter/linker sequence in 10/.tl of TE by heating to 95 ° and slow cooling to room temperature. The tube is briefly centrifuged. Double-strand synthesis is performed in a total volume of 25/zl with I0 U of Klenow fragment of DNA polymerase in the presence of a 0.4 mM concentration of all four deoxynucleotide triphosphates and 1 /zCi of [32p]ATP for 1 hr at room temperature. Double strands are purified by gel electrophoresis in a 6% (w/v) polyacrylamide gel, excission of the top band, maceration, and elution in 0.5 M ammonium acetate at 37° overnight. The eluate is applied to a C18 column (SepPak; Waters Chromatography Division, Millipore, Milford, MA), the latter is washed with water, and elution is done with I vol of 60% (v/v) methanol. The eluate is dried in a vacuum centrifuge (SpeedVac) and redissolved in TE buffer. HeLa Nuclear Extracts. HeLa cells are grown in roller bottles to a total of 101° cells. Extracts are prepared according to the procedure described by Manley, 33 which is not outlined here. Following precipitation with (NH4)zSO 2 the extract is dialyzed against a 1000-fold volume of 20 mM Tris-HCl (pH 7.9)-20% (v/v) glycerol-0.2 mM EDTA-10 mM 2-mercaptoethanol-0. I M KC1-0.5 mM PMSF. Extracts with a protein concentration of 15 mg/ml are stored in aliquots in liquid nitrogen. Promoter Adsorption to Nuclear Proteins. Salt conditions must be optimized. From our experience we recommend the following composition: Tris-HCl (pH 7.9), 12 mM KCI, 50 mM MgClz, 10 mM 2-Mercaptoethanol, 10 mM EDTA, 0.2 mM Glycerol (15%, v/v) 33 j. L. Manley, in "Transcription and Translation: A Practical Approach" (B. D. Hames and S. J. Higgins, eds.), p. 91. 1RL Press, Oxford, England, 1987.
[5]
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE
57
The incubation mixture contains this buffer and the following additives in a total of 20 txl: H e L a extract (10-20/xg) diluted in dialysis buffer Escherichia coli DNA (2/xg) and 1 /xg hDNA After preincubation at room temperature for 5 min, 20 ng of end-labeled double-stranded mutant oligonucleotides is added. Following incubation at room temperature for 20 min and addition of 2/xl electrophoresis sample buffer the sample is run in a 5% (w/v) nondenaturing polyacrylamide gel at low ionic strength (6.8 mM Tris-HC1, pH 7.9/1 mM EDTA/3.3 mM sodium acetate) with buffer circulation. The wet gel is exposed to X-ray film for 30 min and the band corresponding to unbound oligonucleotides is excised. After elution with 0.5 M ammonium acetate (1.5 ml) at 37° overnight and purification over a C18 column, 50/zg of proteinase K and 1 mM CaC12 are added. The treatment is stopped after 15 min at 37° by addition of 5 mM EDTA and an equal volume of phenol. The oligonucleotides are precipitated with 10 vol of ethanol in the presence of 5 /xg dextran T-500. After amplification by polymerase chain reaction (PCR) the incubation with HeLa extract is repeated three times. Amplification by Polymerase Chain Reaction. The oligonucleotides are redissolved in 30/xl H20 and 300/zg total of both primers corresponding to the nonmutated flanking sequences of the T7 promoter is added together with 12.5 ~1 of a 20% (v/v) Chelex 10034solution. After heating to 95 ° for 5 min and cooling on ice, Taq buffer, 2 mM concentrations of all four deoxynucleotides, and I U Taq polymerase are added. Thirty cycles (1 min at 94 °, 45 sec at 50 °, 30 sec at 74 °) are performed with a 10-rain postincubation at 74 °. After estimation of the amount of oligonucleotides, 20 ng is treated again with HeLa extracts as above. Binding to T7 RNA Polymerase. Conditions for incubation of oligonucleotides with T7 RNA polymerase are exactly as described above for HeLa extracts, using 250 U of enzyme instead of extract. Following electrophoresis the retarded band was excised, purified, and amplified as described. Cloning of Mutant Promoters. One microgram of the polymerasebinding mutant oligonucleotides is cleaved with 100 U of both restriction endonucleases having sites in the flanking sequences (EcoRI and XbaI in our case) and ligated to the human growth hormone gene in pUC19. Following transformation bacterial colonies are screened for inserts by using end-labeled PCR primers. Transcription in Vitro. Plasmid minipreparations can be used after 34 j. Singer-Sam, R. L. Tanguay, and A. D. Riggs, Amplifications 3, 11 (1989).
58
VECTORS FOR EXPRESSING CLONED GENES
[5]
extensive RNase treatment. Individual mutant promoter plasmids are tested for transcription with T7 polymerase in the presence or absence of HeLa cell extract by incubating in the following reaction mixture (25/A): HeLa extract (8 mg/ml) or dialysis buffer, 12.5/xl MgC1z, 10 mM RNasin, 2 U ATP, GTP, and UTP, 500/zM [32p]CTP (0.5/zCi), 50/xM T7 RNA polymerase, 50 U Plasmid DNA, 1/~g After incubation at 30 ° for I hr, samples are applied to Whatman (Clifton, NJ) GF/C filters, precipitated with 10% trichloroacetic acid (TCA), washed with TCA, ethanol, and acetone, and measured in a liquid scintillation counter. Cellular Expression Assay. Both CHO and CHO185 cells are transfected with a mixture of 20/zg test plasmid, 2/xg pRSVLuc, 35 and 1 /~g pT7neo using the protocol described above. Assays for hGH secretion and luciferase (transfection standard) are performed after 3 days and one-tenth of the cells are subjected to selection with 600/zg/ml G418 (Geneticin) to generate pools of about 100 colonies for testing stable expression levels. We have analyzed 61 mutant promoters) 6 The expression levels obtained for some of them are given in Table I. The higher transcription of the mutants in vitro in the presence of HeLa extracts reflects the reduced binding of inhibitory factors whereas the reduced expression in CHO cells in vivo is probably due to loss of polymerase II binding. Selection of Cell Clones Carrying T7 R N A Polymerase Several selectable marker genes were cloned downstream of the wildtype or mutant T7 promoter and have been tested for selectability in both CHO and CHO185 cells as well as after cotransfer with pMTT7N. From our experience we recommend using the neo gene. It is actually expressed from the wild-type T7 promoter only in cells expressing T7 polymerase. In contrast, other selectable marker genes can be expressed at a functional level by cellular RNA polymerases from the wild-type T7 promoter. Data of two experiments using the neo gene and selection with Geneticin are given in Table II. In cases in which the rapid establishment of the T7 expression system 35 j. R. de Wet, K. V. Wood, M. DeLuca, D. R. Helinski, and S. Subramani, Mol. Cell. Biol. 7~ 725 (1987). 36 A. Lieber, V. Sandig, and M. Strauss, Eur. J. Biochem. submitted (1992).
[5]
H I G H - L E V E L G E N E EXPRESSION BY TABLE
T7
RNA
59
POLYMERASE
I
PROPERTIES OF MUTANT T 7 PROMOTERS
Promoter
Sequence -18
Wild type Mutant 13 Mutant 44 Mutant 57 Mutant 68 Mutant 86
-10
+1
Transcription"
Expression ~'
in vitro (%)
in vioo I%)
-HeLa
+HeLa
CHO185
CHO
100 70 82 73
10 46 40 46
115 64 70 54
100 6 20 4
50 80
43 55
37 67
8 4
+8
TTAATACGACTCACTATAGGGAGATA ........ G ............ G .... -C - C ................... T- ..... T ............ C - T ..... ...... T ..... C ........ TT- - ..... T ............ C .......
" Transcription by T7 polymerase in vitro was done in the absence or presence of H e L a nuclear extracts. Counts obtained for the wild-type promoter in the absence of extract were taken as 100c;~. h Stable expression of human growth hormone was determined in populations of 100-200 colonies obtained after cotransfer with pT7neo and selection with Geneticin. The level obtained for the wildtype promoter in CHO cells is the 100% value.
in a particular cell type is required we suggest a cotransfer of the gene of interest under control of the mutant T7 promoter together with pMTT7N and pT7neo at a ratio of 20 : ! : 1. In this case 100% of the resulting colonies express T7 polymerase and more than 90% will express the gene of interest. Physical linkage of the gene of interest to pT7neo would guarantee
T A B L E II T 7 R N A POLYMERASE-DEPENDENT SELECTION FOR neo GENE EXPRESSION Colonies a Plasmid pUCII8
pT7neo pT7neo + pMTT7N
C H O cells
C H O 1 8 5 cells
0/0 2/0 100/60
0/1 200/300 ND
T w o d a y s a f t e r t r a n s f e c t i o n w i t h 6 / . t g o f the respective plasmid, the calcium phosphate techn i q u e w a s u s e d to s e e d 1 × 105 cells into 10-cm d i s h e s w i t h D M E M plus 5% ( v / v ) fetal c a l f s e r u m plus 600 p . g / m l G e n e t i c i n . S e l e c t i o n w a s f o r 2 weeks, with medium changes and colony counts m a d e e v e r y third day.
60
VECTORS FOR EXPRESSING CLONED GENES
[5]
expression in 100% of the colonies. This can also be achieved by using bicistronic structures (see below). However, we observed a significantly lower colony number in this kind of cotransfection experiment compared to experiments with cells already expressing T7 polymerase. In most clones, the level of T7 polymerase expression is considerably lower than that expected for metallothionein promoter constructs. It appears that there is a counterselection against cells expressing high levels of T7 polymerase. This conclusion is also supported by the observed difficulty in establishing stable clones with pCMVT7N (Fig. 1), in which T7 RNA polymerase expression is driven by the strong CMV promoter. If high-level expression is the final goal we recommend the use of a two-step protocol: pMTT7N is cotransfected with pT7neo at a ratio of 10 : 1 and cells are selected with the desired concentration of Geneticin depending on the cell type, usually between 400 and 800 ~g/ml. The pool of colonies can be used directly for the second transfection with the respective gene under control of a mutant T7 promoter together with either pT7mpac, pT7mhyg (see Vector and Oligonucleotides, above) or any other marker gene. Bicistronic constructions can also be useful in this case (see below).
Alternative Strategies for T7-Driven Gene Expression If the expression of a particular gene product is disadvantageous for the host cell or should be switched on at a fixed time point it is desirable to have a cell line carrying a silent gene. Two different ways are imaginable for activation of a gene under control of a mutant T7 promoter. First, a tightly regulated promoter could be used. We are currently exploring the usefulness of bacterial operator/repressor systems for this purpose. The use of eukaryotic regulatory elements such as hormone-response elements turned out to be inefficient in this context. The second alternative is the use of retroviral vectors to introduce the T7 polymerase gene efficiently into nearly 100% of the cells. To this end we have developed vectors based on pM6pac expressing the T7 polymerase gene from the retroviral long terminal repeat (LTR) or from CMV or SV40 promoters (Fig. 1). The experimental strategy is as follows. A vector containing the particular gene downstream of the T7m promoter is cotransfected with a selectable marker. After selection individual clones are analyzed for the presence of integrated and intact gene constructions by Southern blotting or PCR. The cells are then infected with a retroviral vector carrying the polymerase gene. We have tested this protocol for expression of the neo gene. Linear pT7neo (6 tzg) was transfected by the calcium phosphate technique into
[5]
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE
61
5 x 105 NIH 3T3 cells together with 0.5 p~g of pY337 and selection with 50 /zg/ml of hygromycin was started the day after. Resulting colonies were pooled and tested for growth in 400/zg/ml of Geneticin. No survival of cells was observed. The cells were then infected with the retroviral vector pM6SVT7N (Fig. 1), which has been packaged by transfection of GP + E86 cells and was selected with 4/zg/ml of puromycin. The titer of the virus has been estimated on N I H 3T3 cells to be 1 x 105. The cells carrying the silent neo gene (105/5-cm dish) were infected with different aliquots of M6SVT7N virus stock (0.01, 0.1, and 1 ml). One day later cells were seeded at a concentration of 1000/5-cm dish in triplicate and selected with 400 /~g/ml of Geneticin. Parallel dishes without selection allowed the determination of plating efficiency. With the highest amount of virus (1 ml) the number of colonies in Geneticin equaled the plating efficiency without selection, suggesting a nearly 100% induction of expression of the neo gene. 38
Applications High-Level Foreign Gene Expression Stable Expression of the Genomic Human Growth Hormone Gene. All previous experiments for high-level expression have been performed with the wild-type T7 promoter. Because we have isolated optimized mutant promoters only recently, we have at present no long-term expression data. However, the preliminary data suggest that the levels of expression from the wild-type and mutant promoters are comparable. Here we describe our protocol, which leads to high-level expression of human growth hormone. A plasmid pGGH2.2 is constructed by cloning a 2.1-kbp genomic human growth hormone gene between the BamHI and EcoRI sites of pGEM2. Ten micrograms of linearized plasmid is cotransfected with 0.5 tzg pSV2neo 39 into 3 x 105 polymorphonuclear (PMN) mouse cells (clone A5) by the calcium phosphate technique as described above. After an overnight incubation with the DNA precipitate, cells are washed and supplemented with fresh medium. After 2 days cells are trypsinized, divided 1 : 6 into new dishes, and subjected to selection with 400/zg/ml of Geneticin. Medium is changed every third day for a period of 3 weeks. Colonies are trypsinized all together and seeded into 96-well microtiter plates at a dilution of 1 cell per every second well. Medium with Geneticin 37 K. Blochlinger and H. Diggelmann, Mol. Cell. Biol. 4, 2929 (1984). 38 W. Sommer and M. Strauss, manuscript in preparation (1992). 39 p. j. Southern and P. Berg, J. Mol. Appl. Genet. 1, 327 (1982).
62
VECTORS FOR EXPRESSING CLONED GENES
[5] kD
-
97
-
66
-
45
- 24 -4----
hGH
FIG. 3. Electrophoretic pattern of immunoprecipitated hGH produced by a PMN cell clone harboring a T7hGH plasmid. Lanes 1 and 2 are immunoprecipitates from extracts of 10 6 cells, lanes 3 to 8 are precipitates from 100/.d of culture supernatant. Lane 1 is fresh extract, lane 2 is extract incubated at 37° for I hr, lanes 3 to 5 are successive 24-hr supernatants of logarithmic cells, and lanes 6 to 8 represent the same culture supernatant of a confluent monolayer after 24, 48, and 72 hr. Immunoprecipitation was done by subsequent incubation with antiserum and protein A-Sepharose. The precipitates were run in a 12% (w/v) polyacrylamide gel.
is changed once a week. After 3 weeks supernatants are assayed for growth hormone secretion by the ELISA described above. High producers (more than 10/zg/ml hGH) are recloned to guarantee later stability of the clones. Using this protocol we succeeded in isolating several clones producing considerably more than 10/xg/ml/106 cells/day from approximately 250 primary colonies, with 2 clones producing 20 and 30 tzg/ml. These levels are slightly above those obtained using CMV or metallothionein promoter constructs. 36 However, the percentage of good producers is much lower (about 1 out of 400) in the latter case. The yield of growth hormone is best if the medium is changed every day and better in the exponential growth phase compared to a stationary culture. A typical pattern of growth hormone in cell extracts and in the medium after immunoprecipitation is shown in Fig. 3.
[5]
63
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE AAYA~
AA'TAAA
A VA
#"~
~ T ~
~TJO~
B PA
P'A
C
iI
T7prom.
V. rnouw
CI~ huml~'l
VKm~.
,
,
~-,khurrmn
FIG. 4. Maps of bi- and polycistronic constructions driven by a T7 promoter,
Stable Expression of Tissue Plasminogen Activator cDNA. The cDNA for human tissue plasminogen activator is cloned into pGEM downstream to the T7 promoter. The linear plasmid (6 tzg) is cotransfected with pSV2neo (0.5 /~g) into CHO185 cells. After 3 days, selection with 600 /xg/ml of Geneticin is started. Three weeks later colonies are pooled and cloned in microtiter plates as described for growth hormone expression. Clones producing more than 2 /~g/10 6 cells/day are recloned three times before stable expression levels can be detected. The highest level obtained in our experiments was 5 /zg/10 6 cells/day. Expression of Bi- and Polycistronic mRNA Selection of Expressing Clones. The coding sequence of the neo gene is cloned downstream to the gene of interest. The presence of a polyadenylation signal does not interfere with transcription of the bicistronic mRNA. We used fusion with the tPA cDNA as a model. A plasmid pGtPAAneo is constructed (Fig. 4A) and transfected into PMN cells (clone A5). Selection is performed using 400/zg/ml of Geneticin. The number of colonies obtained is about 10-fold lower as compared to transfections with pSV2neo (20 colonies/5-cm dish). However, all colonies give rise to stable clones expressing moderate to high levels of tPA. No colonies can be obtained in CHO cells due to the function of the polyadenylation signal as a transcriptional terminator. Alternatively, the luciferase coding sequence can be fused downstream to the gene of interest to allow for rapid quantitation of gene expression. We use a tPA-luc fusion gene. The plasmid pGtPAAL (Fig. 4B) is cotrans-
64
VECTORS FOR EXPRESSING CLONED GENES
[5]
fected with pT7mpaC into CHO cells expressing T7 polymerase. Selection is carried out with 4/.tg/ml ofpuromycin. Colonies are tested for luciferase expression, which can be detected at the level of 1-10 cells. However, the luciferase activity is decreased by a factor of five when the cistron is expressed in the second position instead of in the first position. The level of tPA synthesis correlates very well with the luciferase activity. No luciferase activity can be detected in CHO cells with this construction. As soon as a semiquantitative in situ assay for luciferase activity is available this kind of gene fusion will allow rapid identification of producer clones. Expression of Chimeric lmmunoglobulins. A plasmid pT7Ig may be constructed (Fig. 4C) in which the genomic sequences for variable regions of a mouse antibody to pig transferrin (a gift of Dr. S. Deev, Moscow) are fused to the genomic sequences for the constant regions of human IgE. The plasmid, containing two internal polyadenylation signals (which do not influence transcription by T7 polymerase), is cotransfected by electroporation with pT7mpac into Sp2/0 myeloma cells previously selected for expression of T7 RNA polymerase. After selection and subcloning in 96well microtiter plates secretion of IgE is determined using a commercial ELISA. Average levels of 100 ng/ml of IgE are detectable. Extracts are prepared and subjected to electrophoresis, and the gel is blotted to nitrocellulose and probed with anti-IgE. A 75-kDa heavy chain and a 25-kDa light chain are found. Using a solid-phase adsorption assay for pig transferrin, specific binding activity of the chimeric antibody is confirmed. Northern blot analysis shows the presence of a major transcript of about 8 kb. 4°
Synthesis of Antisense RNA and Ribozymes Recent applications of the T7 expression system in o u r laboratory have been directed toward the high-level synthesis of antisense RNA and ribozymes. The principle is described in brief: The T7 system allows expression of several thousand up to 30,000 RNA molecules per cell. For mRNAs of low or moderate abundance this level of antisense RNA might be sufficient to knock out the mRNA. We have tested this assumption by expression of a 365-bp fragment from the first exon of the human Rb-1 gene. We generated stable cell lines from CHO cells and primary human fibroblasts. In both systems no synthesis of the RB protein was detectable. Whereas the first were converted into tumorigenic cell lines, the latter have a dramatically shortened cell cycle.41 The tumorigenic cell lines might be immortalized, which is currently under investigation. 4o A. Lieber and M. Strauss, manuscript in preparation. 41 M. Strauss, S. Hering, A. Lieber, G. Herrmann, B. E. Griffin, and W. Arnold, Oncogene, in press (1992).
[5]
HIGH-LEVEL GENE EXPRESSION BY T7 R N A POLYMERASE
65
,p --- UAeC C eeUCUC CA UCUAU---"Rm ~ n GGAGGACAUGCGGGGC~ ACUGUCGUUGCAGAUA
AA %GA AGcGAGU ~'
GC AGua
FIG. 5. Structure of a ribozyme construction directed to the mRNA of hGH.
For mRNAs of higher abundance the use of hammerhead ribozymes 42'43 might be more efficient than using simple antisense RNA. We have designed a ribozyme construction against the mRNA for hGH (Fig. 5). The hammerhead structure and the flanking complementary sequences were synthesized as three overlapping oligonucleotides, annealed, filled in with Klenow polymerase, and cloned into the EcoRI site of pGEM1 together with the coding sequence of the neo gene. The resulting plasmid, pRZGHneo, was used to transfect PMN cells already expressing hGH from the T7 promoter. Following selection with Geneticin clones were analyzed for hGH secretion. The levels varied between 25 and 2.5% of the original hGH synthesis, with the majority of clones producing very low levels of hGH. Discussion and Comments The heterologous gene expression system described here has several advantages over others. However, several problems must be considered. First, the T7 promoter is not exclusively transcribed by T7 polymerase within the nucleus of mammalian cells. Second, the levels of expression obtained with the T7 system are not significantly higher than those obtained with strong eukaryotic promoters under optimal conditions. An third, high-level expression of the T7 RNA polymerase is disadvantageous to the host cell. The considerable expression level caused by the cellular RNA polymerase with the wild-type promoter does not significantly influence the expression by T7 polymerase. Thus, we may recommend the use of the wildtype promoter in most cases where high-level stable gene expression is 42 A. C. Forster and R. H. Symons, Cell 49, 211 (1987). 43 C. C. Sheldon, A. C. Jeffries, C. Davies, and R. H. Symons, in "Nucleic Acids and Molecular Biology" (F. Eckstein and D. M. J. LiUey, eds.), Vol. 4, p. 227. SpringerVerlag, Berlin, 1990.
66
VECTORS FOR EXPRESSING CLONED GENES
[6]
required. The advantage over other stable expression systems is the ease of selecting producer clones, not the height of expression. The expression levels are always lower in stable systems compared with the lytic viral ones. We tried to make use of the excess of T7 polymerase present in the nucleus of some clones by using episomal origin vectors. However, up to now the levels of expression could be enhanced only two- to fourfold. 44 We are currently working on the establishment of regulated systems that might allow a higher level of expression for a short period of time. The chief advantage of the modified T7 system based on mutant promoters is the strong dependence on transcription by T7 RNA polymerase. Thus, the system can be used for all purposes of selective gene expression. Cell lines or even transgenic mice carrying silent genes under the control of a mutant promoter can be established and their expression can be stimulated via subsequent introduction of T7 polymerase, for example, by retroviral vectors. Alternatively, inducible repressor systems could be used to repress either the T7 promoter or T7 polymerase expression. Additional useful applications are the expression of bi- or polycistronic mRNA as well as the efficient expression of antisense RNA or ribozymes. 44 V, Sandig and M. Strauss, unpublished observations 0991),
[6] E x p r e s s i o n V e c t o r s f o r H i g h - L e v e l G e n e E x p r e s s i o n in Dicotyledonous and Monocotyledonous Plants By REINHARD TOPFER, CHRISTOPH MAAS, CHRISTA H(SRICKE-GRANDPIERRE, J E F F SCHELL,
and
H A N S - H E N N I N G STEINBISS
Introduction High-level expression of selectable marker genes as well as that of agronomically important genes is a crucial aspect of plant molecular biology. The first chimeric genes for plant transformation experiments consisted of bacterial antibiotic resistance genes controlled by promoters derived from genes carried by the T-DNA region ofAgrobacterium tumefaciens Ti plasmids. ~-3 A second generation of constructs made use of the L. Herrera-Estrella, M. De Block, E. Messens, J.-P. Hernalsteens, M. Van Montagu, and J. Schell, EMBO J. 2, 987 (1983). M. Bevan, R. B. Flavell, and M.-D. Chilton, Nature (London) 304, 184 (1983).
METHODS IN ENZYMOLOGY,VOL.217
Copyright© 1993by AcademicPress, Inc. All rightsof reproductionin any formreserved.
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
67
s t r o n g e r 355 R N A p r o m o t e r o f the cauliflower m o s a i c virus ( C a M V ) , w h i c h in fact has p r o v e d to be o n e o f the m o s t effective and best c h a r a c t e r ized plant p r o m o t e r s . 4-7 This p r o m o t e r has b e e n u s e d to create e x p r e s s i o n v e c t o r c a s s e t t e s s u c h as pDH51,8 p M O N 3 1 6 , 9 and pRT100,~° with w h i c h high levels o f gene e x p r e s s i o n c a n be o b t a i n e d in a variety o f plant tissues. Interestingly, the transcriptional activity o f this p r o m o t e r could be stimulated up to 10-fold b y duplication o f the C a M V 355 e n h a n c e r s e q u e n c e s ~ or b y insertion o f a 42-bp S h r u n k e n 1 e x o n 1 s e q u e n c e j u s t d o w n s t r e a m o f the t r a n s c r i p t i o n start site. 12 M o r e o v e r , it has b e e n s h o w n that gene e x p r e s s i o n c a n also be m o d u l a t e d significantly at the posttranscriptional level. I n c l u s i o n o f introns in the t r a n s c r i p t i o n unit s e e m to influence stability o f the transcript, leading to an e n h a n c e m e n t o f gene e x p r e s s i o n of up to 150-fold. t2-14 T h e use o f different 3' p o l y ( A ) cassettes resulted in differences in gene e x p r e s s i o n o f up to 60-fold. ~5 T h e translational effic i e n c y o f c h i m e r i c transcripts w a s s h o w n to be increased by insertion o f viral u n t r a n s l a t e d leader s e q u e n c e s in the 5' u n t r a n s l a t e d region o f the t r a n s c r i p t i o n unit, resulting in an e n h a n c e d level o f gene e x p r e s s i o n o f up to 3 5 - f o l d ) 6A7 This c h a p t e r d e s c r i b e s sets o f v e c t o r s that are derivatives of the expression v e c t o r c a s s e t t e pRT100, w h i c h uses the C a M V 355 R N A p r o m o t e r in c o m b i n a t i o n with v a r i o u s r e p o r t e r and selectable m a r k e r genes. F u r t h e r m o r e , w e i n t r o d u c e a set o f e x p r e s s i o n v e c t o r s f o r e n h a n c e d gene expression in m o n o c o t y l e d o n o u s plants, especially a g r o n o m i c a l l y i m p o r t a n t ce-
3 R. T. Fraley, S. G. Rogers, R. B. Horsch, P. R. Sanders, J. S. Flick, S. P. Adams, M. L. Bittner, L. A. Brand, C. L. Fink, J. S. Fry, G. R. Galuppi, S. B. Goldberg, N. L. Hoffmann, and S. C. Woo, Proc. Natl. Acad. Sci. U,S.A. 80, 4803 (1983). 4 j. T. Odell, F. Nagy, and N.-H. Chua, Nature (London) 313, 810 (1985). D. W. Ow, J. D. Jacobs, and S. H. Howell, Proc. Natl. Acad. Sci. U.S.A. 84, 4870 (1987). 6 R.-X. Fang, F, Nagy, S. Sivasubramaniam, and N.-H. Chua, Plant Cell 1, 141 (1989). 7 p. N. Benfey and N.-H. Chua, Science 250, 959 (1990). 8 M. Pietrzak, R. D. Shillito, T. Hohn, and I. Potrykus, Nucleic Acids Res. 14, 5857 (1986). 9 S. G. Rogers, H. J. Klee, R. B. Horsch, and R. T. Fraley, this series, Vol. 153, p. 253. I0 R. TOpfer, V. Matzeit, B. Gronenborn, J. Schell, and H.-H. Steinbiss, Nucleic Acids Res. 14, 5890 (1987). 11R. Kay, A. Cahan, M. Daly, and J. McPherson, Science 236, 1299 (1987). ~2C. Maas, J. Laufs, S. Grant, C. Korfhage, and W. Werr, Plant Mol. Biol. 16, 199 (1991). ~3j. Callis, M. Fromm, and V. Walbot, Genes Dev. 1, 1183 (1987). t4 V. Vasil, M. Clancy, R. J. Ferl, 1. K. Vasil, and C. Hannah, Plant Physiol. 91, 1575 (1989). ~51. L. W. Ingelbrecht, L. M. F. Herman, R. A. Dekeyser, M. C. Van Montagu, and A. G. Depicker, Plant Cell 1, 671 (1989). 16S. A. Jobling and L. Gehrke, Nature (London) 325, 622 (1987). 17D. R. Gallie, D. E. Sleat, J. W. Watts, P. C. Turner, and T. M. A. Wilson, Nucleic Acids Res. 15, 3257 (1987).
68
VECTORS FOR EXPRESSING CLONED GENES
[6]
reals. These vectors have been constructed as basic tools applicable for transient gene expression as well as for stable integration of foreign genes into plant genomes. Improved Vector Cassettes for Gene Expression in Dicotyledonous Plants
Expression Vector Cassettes pRTIO0 to pRTI08 General Properties of Vectors. The vectors pRTI00-pRT108 (Fig. 1) are plant expression vector cassettes that permit expression of any gene of interest under the control of the 35S RNA promoter of CaMV and its corresponding polyadenylation [poly(A)] signal. The common feature of this set of vectors is the symmetrical arrangement of restriction sites (HindlII, SphI, and PstI) bordering both regulatory elements, providing the possibility for the simple transfer of a given chimeric construct to other vectors. The various vectors carry different polylinker sequences separating promoter and poly(A) signal sequences, as indicated schematically in Fig. 1 and at the nucleotide level in Fig. 2. With respect to application, some vectors are suitable for translational and others for transcriptional fusions. Vectors Suitable for Translational Fusions. pRT100, pRT102, pRT103, pRT104, pRTI07, and pRT108 carry an NcoI site providing an ATG codon, which can be used as the ATG codon for translational fusions. In pRT103, pRT104, pRTI07, and pRT108 the ATG is embedded in the consensus sequence for optimal ribosome initiation. ~8 Vectors Suitable for Transcriptional Fusions. pRT101, pRTI05, and pRT106 were designed to create transcriptional fusions, pRT105 and pRTI06 carry the pBluescript ~9multiple cloning site in both orientations. Construction ofpRTlO0 to pRTI08. All cloning was performed according to standard protocols as described by Sambrook et al. 2° The intergenic region of the CaMV genome carrying the 35S RNA promoter and the corresponding poly(A) signal were obtained as an 800-bp EcoRI fragment of CaMV Cabb B-D subcloned in phage fdl 1-6.z~An HphI site (at position 7437, referring to CaMV isolate CM184122) separating the promoter and 18 M. Kozak, Nucleic Acids Res. 2, 857 (1984). 19 Stratagene, 11099 North Torrey Pines Road, La Jolla, CA 92037. 2o j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NewYork, 1989. 21 V. Matzeit, Thesis. University of Cologne, Cologne, Germany, 1982. 22 R. C. Gardner, A. J. Howarth, P. Hahn, M. Brown-Luedi, R. Shepherd, and J. Messing, Nucleic Acids Res. 9, 2871 (1981).
:= ~ ,,4
v~ x
z,,,
z
m
x
'0
~, ~ - < [.-,
Y_ ~ W -"-/ ~ /
,--
-~ ~..T~
~ ~., 0
~ ~
> .=
0 "~ "~
6.~
~o
~ =
~,,
,8
X
0 8
0
~
~ < ~
69
'~
70 pRTIO0
VECTORS FOR EXPRESSING CLONED GENES ACctcgag...ggcccatgggcgagctcggtaccc
..........
[6]
ggggatcctctagagtcCG
pRTI01ACctcgag...aattc ...... gagctcggtaccc .......... ggggatcctctagagtcCG pRTI02 ACctcgag...ggcccatgggcgagctcggtaccc .......... gg ............... CG pRT103 ACctcgagtggccaccatgggcgagctcggtaccc .......... ggggatcctctagagtcCG pRTI04 ACctcgagtggccaccatgggcgagctcggtacccccgaattcggggggatcctctagagtcCG pRT105 ACccgagctccaccgcggtggcggccgctctagaactagtggatcccccgggctgcaggaattc gatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccagtcCG pRT106 ACcgggtaccgggccccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcag cccgggggatccactagttctagagcggccgccaccgcggtggagctcCG pRTI07 ACctcgagtggccaccatgggcgagctccaccgcgggggcggccgctctaEaactagtggatcc cccgggctgcaggaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccgg tacccgggtactcCG pRTl08 ACctcgagtggccaccatgggcgagctccaccgcEgtggcggccgctctagaactagtggatcc cccgggtactcCG FIG. 2. The nucleotide sequences of the multiple cloning site between the 35S R N A promoter and the corresponding poly(A) signal of each of the vectors pRT100 to pRTI08 are given. Nucleotides indicated in capital letters belong to the promoter (AC) and poly(A) signal sequence (CG), respectively. Lower-case letters describe the enti~ multiple cloning site.
poly(A) signal 4 bp downstream of the transcription initiation site was cut, converted to blunt ends with Klenow polymerase in the absence of nucleotides, and further digested with either HinclI (position 7016 of CM 1841) or RsaI (po sition 7639 of CM 1841 ). The promoter was subcloned into the HinclI and XhoI sites (filled in) of a modified pUC19 vector, which carried XhoI and NcoI restriction sites instead of SmaI and KpnI, respectively. The poly(A) signal was subcloned in the HinclI site of pUC18, a3 Promoter and terminator were combined using ScaI (in the ampicillin resistance gene of pUC) and SstI (in the multiple cloning site of pUC), resulting in the expression vector cassette pRT100 (Fig. 1). Sequence analysis of the construct revealed a 3-bp deletion at the 3' end of the promoter-carrying fragment, which most likely occurred during removal of the sticky ends of the HphI cleavage site, while leaving intact the transcription initiation site (Fig. 2). Thus, the CaMV sequence elements in pRT100 correspond to bp 7016-7434 (promoter) and bp 7436-7639 [poly(A) signal] of the CaMV isolate CM1841. 22 In addition to pRTI00, derivatives were constructed with modified multiple cloning sites between promoter and terminator (Figs. 1 and 2). 23 C. Yanisch-Perron, J. Vieira, and J. Messing, Gene 33, 103 (1985).
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
71
pRT101 to pRT104 have been described elsewhere. 24 pRT105 and pRT106 were created by insertion of KpnI and SstI linkers, respectively, into either the XhoI or XbaI site of pRT104 (compare with Fig. 2) and replacement of its polylinker by the pBluescript multiple cloning site. To obtain the vector pRT107, a KpnI linker was cloned in the S 1 nuclease-treated XbaI site of pRT104 following insertion of the pBluescript multiple cloning site into the KpnI and SstI sites, pRT108 is pRT107 with a Sinai deletion.
Plant Expression Vectors Based on these expression vector cassettes a number of fusions with different reporter genes have been constructed (Fig. 3), which were then used to investigate transient gene expression 25-z7or to establish transgenic plants. To use these expression vector cassettes for further constructions, restriction sites for cloning were chosen in such a way that a minimum of sites were maintained between promoter, structural gene, and poly(A) signal sequence. As indicated below, the sticky ends of a number of restriction fragments created during the cloning procedure were converted to blunt-ended fragments by S1 nulcease treatment prior to ligation. 1. The dhfr gene, conferring methotrexate resistance, was excised from plasmid pFR400 z~ using XbaI/NsiI and ligated with the expression vector pRT100, which was restricted with NcoI/XbaI. The sticky ends of these restriction fragments were removed by SI nuclease treatment and cloning resulted in the vector pRTlOOdhfr. 2. The hpt gene, coding for hygromycin resistance, was derived as a BamHI fragment from pHyml329 (B. Nelsen-Salz, unpublished results, 1982, which was treated with S1 nuclease. This fragment was cloned into the vector pRT100 (restricted with NcoI/XbaI) and treated with SI nuclease, leading to the plasmid pRTlOOhpt. 3. The choramphenicol acetyltransferase (cat) gene of pCAP2123o was subcloned as a BamHI fragment into both pRT101 and M13mp9, leading to pRTlOlcat 25 and M13mp9cat, respectively. An Ncol site at the first .,4 R. TOpfer, V. Matzeit, B. Gronenborn, J. Schell, and H.-H. Steinbiss, Nucleic Acids Res. 14, 5890 (1987). 25 M. Pr61s, R. T6pfer, J. ScheIl, and H.-H. Steinbiss, Plant Cell Rep. 7, 221 (1988). 26 R. T6pfer, M. Pr61s, J. Schell, and H.-H. Steinbiss, Plant Cell Rep. 7, 225 (1988). .,7 R. T6pfer, B. Gronenborn, J. Schell, and H.-H. Steinbiss, Plant Cell 1, 133 (1989). 28 C. C. Simonsen and A. D. Levinson, Proc. Natl. Acad. Sci. U.S.A. 80, 2495 (1983). 29 Originally, the HPT coding sequence is derived from pVU 1011 (P. J. M. van den Elzen), which is equivalent to pLG90 [P. J. M. van den Elzen, J. Townsend, K. Y. Lee, and J. R. Bedbrook, Plant Mol. Biol. 5, 299 (1985)] but carries ATA instead of ATG in the untranslated 5' leader. 30 j. Velten and J. Schell, Nucleic Acids Res. 13, 6981 (1985).
72 HSPHII
VECTORS FOR EXPRESSING CLONED GENES
EV X Sc
Ss
---~m:~m~m-~'~ I pRT100dhfr
HSPHII
[6]
PSH
r////.g---
I
EV XSm E P
PSH
F/////2-
pRT'lOOhpt
HSPHII
EVXBN
BN Sc
PSH
pRTlO3cat HR
HSPHII
EVXBN
~VI~
---~.'.~-~JH~ii~iL~
EV
I
PSH
HII
I
~////2-
pRTlO3gus
HSPHII EVXBN P ~mamHwJ~.i( I
SN
II
PSH p-///,Y,L_.
pRTlO3neo HR
HSPHa
EVXBH
pRT103pat
S~ SS K
PSH ~bp
Fro. 3. Scheme describing the various expression vectors based on expression vector cassettes (Fig. 1). pRTI00 and pRTI03 were used to insert the coding sequences for dehydro-
folate reductase (DHFR), hygomycin phosphotransferase (HPT), chloramphenicol acetyltransferase (CAT), /3-glucuronidase (GUS), neomycin phosphotransferase (NPT II), and phosphinotricin acetyltransferase (PAT). In all of these constructs the cloning sites between the coding sequence and poly(A) signal have been deleted. Restriction endonuclease cleavage sites are abbreviated: B, Bali; E, EcoRI; EV, EcoRV; H, HindllI; HII, HinclI; K, KpnI; N, NcoI; P, PstI; S, SphI; Sa, Sail; Sc, ScaI; Sin, Smal; Ss, SstI; X, XhoI. The bar indicates 100 bp.
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
73
ATG codon of the CAT-coding region in M 13mp9cat was introduced using site-directed mutagenesis. 3~The modified cat gene was then inserted into pRTI03 using NcoI and BamHI. Finally, the remaining restriction endonuclease cleavage sites for BamHI and XbaI were removed using S1 nuclease, resulting in plasmid pRTlO3cat. 26 4. An NcoI/EcoRI fragment of pRAJ275,3z carrying the/3-glucuronidase (gus) gene, was cloned into pRT104. Deletion of the restriction sites EcoRI, BamHI, and XbaI was achieved by using S I nuclease treatment, thus creating pRTlO3gus. 26 5. pRTlO3neo z6 resulted from cloning of an NcoI (partially digested)/ BamHI fragment of pRT 100neo, carrying the neomycin phosphotransferase (neo) gene, into pRT 103 followed by removal of the remaining BamHI and XbaI site with S1 nuclease. 6. The bialaphos resistance (bar) gene from pGSFR133 was subcloned into pRT104 as an NcoI/BamHI fragment, subsequently digested with BamHI and XbaI, and the 5' protruding ends converted to blunt ends by S1 nuclease treatment, resulting in the plasmid pRTlO3pat. These vectors (except for the cat vectors) have also been used to create a related set of expression vectors: pRT55, pRT66, pRT77, pRT88, and pRT99 (Fig. 4). They are based on a pUC18 derivative whose PstI site has been substituted by NsiI and which carries a chimeric neomycin phosphotransferase II (NPT II) gene inserted into the MaeI site at position 1554 of pUC18. The NPT II gene of this basic construct, pRT99, 34 has been replaced by the structural genes for dehydrofolate reductase (DHFR--pRT55), hygromycin phosphotransferase (HPT--pRT66), phosphinotricin acetyltransferase (PAT--pRT77), and fl-glucuronidase (GUS--pRT88) using XhoI and PstI. These vectors are suitable for expression and transformation studies and they allow the possibility of cloning a fragment of DNA into the multiple cloning site, taking advantage of the blue/white selection via the lacZ system as in pUC plasmids. 23 Improved Vectors for Gene Expression in Monocotyledonous Plants As already described, the CaMV 35S RNA promoter is highly active in dicotyledonous plants. However, use of this promoter in monocotyle31 W. Kramer, V. Drutsa, H.-W. Jansen, B. Kramer, M. Pflugfelder, and H. Fritz, Nucleic Acids Res. 12, 9441 (1984). 32 R. A. Jefferson, Plant Mol. Biol. Rep. 5, 387 (1987). 33 M. De Block, J. Botterman, M. Vandewiele, J. Dockx, C. Thoen, V. Gossel& N. Rao Movva, C. Thompson, M. Van Montagu, and J. Leemans, EMBO J. 6, 2513 (1987). 34 R. T6pfer, J. Schell, and H.-H. Steinbiss, Nucleic Acids Res. 16, 8725 (1988).
~::~ ~.~ ~
0", I'ne
0~0 ~
In
.i..-
x'
0..
-R
I00
,,e
I.-- u'~
l:'--
re"
,,.., ~
.
i
,.o~
4.
I--n,-
.a .,/
,"~w
C 0
"~
=
~, . _
o
r,-
,..,~
. o .~
< ~ ~ ~ ~ .-~ 0
I
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
75
donous plants revealed that gene expression from the CaMV 35S RNA promoter is only 0.1-1% of the level that can be achieved in dicotyledonous plants. Therefore, to increase gene expression in monocotyledonous plants, regulatory elements of the maize Shrunken 1 gene 35 were inserted into the expression vector pRTlOlcat 25(Fig. 5), resulting in the cassettes ~2 described in detail in the following section.
Vector Construction The constructs made use of sequences from the 5' untranslated region of the maize Shrunken 1 gene (Sh 1). A HinclI Sh 1 intron 1 fragment ( + 43 to + 1084) was isolated from a Shrunken 1 promoter clone containing sequences from - 1076 to + 1084 (pSP1076 + 108412). This Sh 1 intron 1 was inserted into the untranslated leader of the chimeric gene of pRT 101 cat by using the unique SmaI site, leading to the construct pRT-int/s-cat (Fig. 5). A sequence from the untranslated Sh 1 exon 1 ( + 4 C C C T C C C T C C CTCCTCCATT GGACTGCTTG CTCCCTGTT+42CCC) was synthesized and inserted into the Sinai site of pRTlOlcat, giving rise to the construct pRT-ex/s-cat (Fig. 5A). The 3'-CCC of the inserted oligonucleotide restored the SmaI site in pRT-ex/s-cat, which was used to insert the HinclI Sh 1 intron I fragment (+ 43 to + 1084) isolated from the Shrunken 1 clone pSP1076 + 1084, thus giving rise to the construct pRt-ex/s-int/s-cat (Fig. 5A).
Expression Studies To analyze these constructs protoplasts of a barley (Hordeum vulgare L. cv. 'Golden Promise '36) and tobacco suspension cell line (Nicotiana tabacum L. cv. W 38; H.-H. Steinbiss, unpublished observations) were used. Preparation of protoplasts from barley and tobacco was essentially as described for maize 37 except that an osmolarity of 720 mOsm was used. Transfection and analysis of CAT activity was as described previously.12'38 Transfection was carried out by using 25/zg plasmid DNA, 100/,~g sonicated calf thymus DNA, polyethylene glycol (PEG 1500) [25% (v/v) PEG, 0.1 M MgClz, pH 6.0], and 1 × 106 protoplasts. Expression was assessed after 40 hr of cultivation. Due to high CAT activities in undiluted extracts, dilutions were made (1 : 10, 1 : 100, and I : 1000) to obtain CAT activities in a linear range for densitometric scanning of autoradiographs. The results -~ W. Werr, W.-B. Frommer, C. Maas, and P. Starlinger, EMBO J. 5, 1373 (1985). 36 R. Liihrs and H. L6rz, Planta 175, 71 (1988). 37 C. Maas and W. Werr, Plant Cell Rep. 8, 148 (1989). ~8 C. Maas, S. Schaal, and W. Werr, EMBO J. 11, 3447 (1990).
76
VECTORS FOR EXPRESSINGCLONED GENES
•
A
HindllI
/
\ LSphI
(
~PstI
p R T 101cat
\\"
/ / BamHI
Hind III \ sphi ~ Pst I ~ H~ncI
/ / /~ / ..~.~Y
~
Xhol/
\ 4 42
II
pRT-ex/s-cat
Sma I
43
1084
I
~'
I
Sst I HindIII 4 42/43 []
~
tel. CAT activity 22 74
pRT-int/s-cat,
Barn HI XbaI 1084 1
!
Sst 1 HindIII
B
[6]
pRT-ex/s-int/s-cat
Barn HI XbaI
tobacco ex+int
(-)
barley 940
ex+int int
130
ex (-)
9 1 controls
no DNA CM only CAT enzyme 1,3
3
1
CM
[6]
GENE EXPRESSION IN DICOTS AND MONOCOTS
77
of the 1/10 dilution (equal to 1 × 105 protoplasts) of the extracts (adjusted to give comparable amounts of protein) are shown in Fig. 5B. Comparison of pRTlOlcat expression in protoplasts of the monocot barley and the dicot tobacco clearly reveals the reduced activity of the CaMV 35S RNA promoter in monocotyledonous plants (Fig. 5B). Expression driven from this promoter in barley was enhanced up to 940-fold by the combined action of a Sh 1 exon 1 and an intron 1 segment inserted into the transcription unit (pRT-ex/s-int/s-cat). Individual stimulation of gene expression by either the Sh 1 exon 1 (pRT-ex/s-cat) or the Sh 1 intron 1 (pRT-int/s-cat) is also observed. These results compare quite well with the data obtained by using protoplasts of other monocotyledonous plant species: Oryza sativa, Panicum maximum, Pennisetum purpureum, and Zea mays. 12,14 Data obtained from these experiments imply that the ninefold stimulation by Sh 1 exon 1, which is conserved among angiosperms, must occur at the transcriptional level. A position just downstream of the transcription start site is highly unusual for an RNA polymerase II-dependent transcriptional activator. However, reports concerning the human glial fibrilliary acidic protein 39 and the adenovirus IVa2 gene 4° have revealed other members of this new class of RNA polymerase II-dependent transcriptional activators. The dramatic 130-fold stimulation of gene expression by the Shrunken 1 intron 1 appears to be closely linked to the splicing process. Stimulation 39 y . Nakatani, M. Horikoshi, M. Brenner, T. Yamamoto, F. Besnard, R. Roeder, and E. Freese, Nature (London) 348, 87 (1990). 4o j. Carcamo, E. Maldonado, P. Cortes, M.-H. Ahn, I. Ha, Y. Kasai, J. Flint, and D. Reinberg, Genes Dev. 4, 1611 (1990).
FIG. 5. (A) Chimeric gene constructions used in transient gene expression experiments. From the maize Shrunken 1 (Sh 1) gene the Sh 1 exon (represented by the black boxes) and/or the Sh 1 intron 1 (represented by the open boxes, "intron 1") were inserted into the Sinai site of plasmid pRTlOlcat. The position of the terminal nucleotides of both Sh 1 elements is indicated. Restriction sites relevant for cloning have been included, ex, exon 1; int, intron 1 ; s, sense orientation of the insert. (B) Result of a CAT assay performed with a 1 : 10 dilution of crude extracts of tobacco and barley protoplasts that were homogenized 40 hr after DNA delivery, Relative CAT activity of barley protoplasts transfected with pRTlOlcat (--) is referred to 1. The constructions used have been indicated in abbreviated form beside the corresponding lane: (--), pRTlOlcat; ex, pRT-ex/s-cat; int, pRT-int/s-cat; ex + int, pRT-ex/s-int/s-cat. Autoradiographs were scanned densitometrically. CM, [~4Clchloramphenicol; CAT enzyme, chloramphenicol acetyltransferase enzyme; CM only, only [t4C]chloramphenicol was loaded; no DNA, protein extract of untransfected protoplasts was used; 1, 3, 3, 1, CM, acetylation products of the CAT reaction.
78
VECTORS FOR EXPRESSING CLONED GENES
[6]
can be observed only when intron 1 is positioned in the transcription unit and in the sense orientation. 12Data obtained from animal model systems imply that the molecular nature of stimulation by insertion of intron sequences is mainly due to the formation of spliceosomes and an increased resistance of the primary transcript to turnover processes by nuclease attack in the nucleus. 41 The failure of exon 1/intron 1 to stimulate gene expression in tobacco (pRT-ex/s-int/s-cat shows a 70% reduced value as compared to pRTlOlcat) could be due to apparent differences in the splicing process (e.g., formation of spliceosomes by correct splice site recognition) between monocotyledonous and dicotyledonous cells. 42'43 In conclusion, improvement of the cassette pRTlOlcat to produce pRT-ex/s-int/s-cat gave us a construct leading to a high level of gene expression in monocotyledonous plants and in particular in agronomically important cereals. The construct pRT-ex/s-int/s-cat has been constructed to facilitate the replacement of the CAT-coding region as a BamHI or XbaI fragment or an exchange of the promoter region as a HinclI/XhoI or HinclI/KpnI fragment. The entire chimeric gene can be transferred to other vectors using PstI or SphI. Moreover, the construct pRT-ex/s-int/scat might be helpful for the analysis of plant promoters or to achieve high levels of gene product in transgenic plants. Acknowledgment A part of this work was supported financially by Hoechst AG Frankfurt am Main, Germany.
41 A. R. Buchman and P. Berg, Mol. Cell Biol. 8, 4395 (1988). 42 B. Keith and N.-H. Chua, EMBO J. 5, 2419 (1986). 43 G. J. Godall and W. Filipowicz, Cell 30, 763 (1989).
[7]
OVERPRODUCTION OF PROTEINS USING ECPCR
79
[7] O v e r p r o d u c t i o n o f P r o t e i n s U s i n g E x p r e s s i o n - C a s s e t t e Polymerase Chain Reaction By K U R T I S D . M A C F E R R I N , L I N C H E N , MICHAEL P. TERRANOVA, STUART L . SCHREIBER, and GREGORY L . VERDINE
Introduction
Decades of basic research into the genetics of the enteric bacterium Escherichia coli 1 have yielded an outcome of immense practical value: a
working knowledge of gene architectures that afford high-level protein biosynthesis in this organism, and the means by which to construct them. This ability to rationally "engineer" protein-overproducing strains of E. coli has revolutionized protein science by making large quantities of recombinant proteins routinely available for study. Nonetheless, until recently the construction of overproducing E. coli strains was an often difficult and time-consuming task, primarily because of two factors: (1) the requirement that the gene or cDNA to be expressed be refashioned from a molecularly monoclonal source (such as a homgeneous plasmid, as opposed to a polyclonal source such as a library), and (2) the requirement to precisely assemble specific DNA sequences during construction of the recombinant (overexpressing) gene. We 2 and others 3-5 recognized the potential of the polymerase chain reaction 6 to overcome both these problems simultaneously by rapidly and selectively amplifying a target sequence from a mixed population, while at the same time allowing defined sequence alterations to be made in the amplification products. 7-9 In this chapter we briefly review the architecture of a gene construct suitabl~ for high-level, regulated expression in E. coli (henceforth called an overprot F. C. Neidhardt, "'Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology" (J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger, eds.), Vols. 1 and 2. American Society for Microbiology, Washington, D.C., 1987. 2 K. D. MacFerrin, M. P. Terranova, S. L. Schreiber, and G. L. Verdine, Proc. Natl. Acad. Sci. U.S.A. 87, 1937 (1990). 3 C. M. Skoglund, H. O. Smith, and S. Chandrasegaran, Gene 88, 1 (1990). 4 j. V. Gray, B. GolineUi-Pimpaneau, and J. R. Knowles, Biochemistry 29, 376 (1990). 5 X. R. Gu and D. V. Santi, DNA Cell Biol. 9, 273 (1990). 6 R. K. Saiki, S. Scharf, F. Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich, and N. Arnheim, Science 230, 1350 (1985). v W. Bloch, Biochemistry 30~ 2735 (1991). 8 K. B. Mullis and F. A. Faloona, this series, Vol. 155, p. 335. 9 H, A. Erlich, D. Gelfand, and J. J. Sninsky, Science 252, 1643 (1991).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
80
VECTORS FOR EXPRESSING CLONED GENES
[7l
ducer) and discuss in detail our polymerase chain reaction (PCR)-based method for making overproducers--the expression-cassette polymerase chain reaction (ECPCR). 2 A r c h i t e c t u r e of O v e r p r o d u c e r T h e g e n e r a l a r c h i t e c t u r e o f a n o v e r p r o d u c e r is s h o w n in Fig. 1. Virtually all s u c h c o n s t r u c t s p o s s e s s as b a c k b o n e a p l a s m i d v e c t o r c o n t a i n i n g a s e l e c t a b l e p h e n o t y p i c m a r k e r (such as r e s i s t a n c e to ampicillin) a n d a
promoter
ribosome binding site (RBS)
coding sequence
vector ~ / / / ' J
....-
.I
L..
[ ....
transcription terminator L~--~X,~ vector
overproducer
. . . . . . . . :--:-,.,____ .....................
[ -35 transcriptional -10 " ' ] ""] /sequence spacer sequence I Shine- translational| start E. coil ...TTGACANNNNNNNNNNNNNNNNNTATAAT... Dalgamo spacer / codon nominalp r o m o t e r ...AGGAGGNNNNNNNNATG... T7 ...GAAATTAATACGACTCACTATAGGGAGA...
I
II transcriptional L . . . . . . . . . . -,,.control
I
transcription translational control
...A GGA G GNNNNNNNNA UG.. "1
mRNA
I translation -.=-. . . . . . .
J
ro,e, I nl FIG. 1. Architecture of an overproducer. At the top is a schematic diagram of the sequence elements that are present in an overproducer; in the expansions below are subelements and actual sequences that yield high-level expression in E. coll. The promoter and ribosomebindingsite (RBS) control the initiationof transcription and translation, respectively. Promoters recognized by both the E. coil and bacteriophage T7 RNA polymerase are shown; either promoter can function with the same RBS sequences. For simplicity, the start and stop codons are not depicted; in subsequent figures, they are shown explicitly wherever necessary. All sequences correspond to the coding strand, written in the 5' ~ 3' direction reading from left to right.
[7]
OVERPRODUCTION OF PROTEINS USING E C P C R
81
high-copy-number origin of replication (not shown). Fused directly to the upstream end of the coding sequence (start codon, not shown) is the ribosome-binding site or RBS, which functions in the transcript to control the efficiency of translation initiation, w The RBS is composed of two subelements: (1) the Shine-Dalgarno sequence, which is believed to basepair with the 16S subunit of the ribosome, and (2) the translational spacer, which positions the start codon on the ribosome relative to the anchored Shine-Dalgarno sequence. In the transcript, formation of secondary structure involving the RBS apparently reduces its efficiency, l° and because the flanking gene sequence is different in each construct, it is perhaps unsurprising that no universally optimal RBS has been discovered. Nonetheless, the following general rules can be applied to the design of RBSs: (1) the Shine-Dalgarno sequence should contain all or part of the sequence 5'-AGGAGG-3'--some evidence suggests that longer sequences are preferred; and (2) although there appears to be no strict sequence requirement for the translational spacer, the most efficient appear to possess four to eight nucleotides having an adenine/thymine-rich composition. ~° Fortunately, several RBSs have been discovered that seem to work well with most coding sequences (see below). Upstream of the RBS [often - 1 0 - 1 0 0 base pairs (bp)] is positioned the promoter, which controls the initiation of transcription by binding directly to a DNA-dependent RNA polymerase. 1~ Promoters that are recognized by E. coli RNA polymerase 12 and bacteriophage T7 RNA polymerase 13 are in common use today (Fig. 1). The consensus E. coli promoter has the following physical organization: (1) the hexanucleotide sequence 5'TTGACA-3', centered approximately 35 bp upstream of the transcription start point (and thus designated the - 3 5 sequence), followed by (2) a 16to 17-bp sequence-independent spacer, followed by (3) the hexamer 5'TATAAT-3' ( - 10 sequence). The most efficient T7 promoter, on the other hand, consists of a 17-bp nominal promoter (positions - 1 to - 17) flanked on each end by additional defined sequences that contribute modestly to the efficiency of transcription initiation. 13-~5 Promoters used for protein overproduction should not only be strong, but should also be tightly regulated. Expression systems controlled by the E. coli lac repressor, espel0 L. Gold, Annu. Rev. Biochem. 57, 199 (1988). Ii p. H. von Hippel, D. G. Bear, W. D. Morgan, and J. A. McSwiggen, Annu. Rev. Biochem. 53, 389 (1984). t2 W. R. McClure, Annu. Rev. Biochem. 54, 171 (1985). 13 W. F. Studier and J. J. Dunn, J. Mol. Biol. 166, 477 (1983). 14 Z. D. Schneider and G. D. Stormo, Nucleic Acids Res. 17, 659 (1989). 15 E. D. Jorgensen, R. K. Durbin, S. S. Risman, and W. T. McAllister, J. Biol. Chem. 266, 645 (1991).
82
VECTORS FOR EXPRESSING CLONED GENES
[7]
cially those having the lacUV5,16,17 tac, 18,19and trc 2° promoters, have been most widely used, because they can be induced simply by the addition of isopropyl-fl-o-thiogalactopyranoside (IPTG) to the medium. Another highly successful system utilizes the bacteriophage k promoter P L in combination with the temperature-sensitive k repressor mutant cI85721'22; these can be induced thermally by shifting the temperature of the growth medium from - 3 0 to 42° . The features of these and other systems have been discussed in detail elsewhere. 23,24 Finally, downstream of the coding sequence (with no precise distance requirements) most overproducers possess a transcription terminator,~l,~2 which forms a stem-loop structure in the transcript and thereby aborts transcription, independent of the factor rho. This element enhances the economy of nucleotide utilization and increases plasmid stability by preventing unnecessary transcription beyond the 3' boundary of the recombinant gene. Because many sequences are capable of functioning as transcription terminators, and these elements are generally included as part of the overexpression vector, they are not discussed further here. In summary, the promoter and transcription terminator are transcriptional control elements, they do not have to be positioned precisely with respect to the coding sequence, and their efficiency is essentially independent of the coding sequence; the RBS, on the other hand, is a translational control element, it must be positioned precisely with respect to the start codon, and varies in efficiency (for a given RBS sequence) with different 5'-coding sequences. Finally, construction of an overproducer involves the assembly of these expression and coding elements in the required configuration.
Overproducer Construction Using Expression-Cassette Polymerase Chain Reaction In assessing various general strategies for overproducer construction, we were attracted by the concept of treating the RBS and coding sequence as linked units, because they exert a coordinate influence over translation 16 C. Yanisch-Perron, J. Vieira, and J. Messing, Gene 33, 103 (1985). 17 F. W. Studier and B. A. Moffat, J. Mol. Biol. 189, 113 (1986). ~s H. de Boer, L. J. Comstock, and M. Vasser, Proc. Natl. Acad. Sci. U.S.A. 80, 21 (1983). 19 E. Amman, J. Brosius, and M, Ptashne, Gene 25, 167 (1983). 2o E. Amman and J. Brosius, Gene 40, 183 (1985). 21 S. Tabor and C. C. Richardson, Proc. Natl. Acad. Sci. U.S.A. 82, 1074 (1985). 22 W. Whalen, B. Ghosh, and A. Das, Proc. Natl. Acad. Sci. U.S.A. 85, 2494 (1988). 23 A. Das, this series, Vol. 182, p. 93. 24 D. V. Goeddel (ed.), this series, Vol, 185.
[7]
OVERPRODUCTION OF PROTEINS USING E C P C R
R. site
L_
expression cassette: transcription vector:
stop codon
start codon
RBSI
I~//,/,~:. I
83
coding sequence
I i l l i . - a. site d
promoter ~ t .
term.
.
site(s) promoter
start codon RBS I R. site
X'R"
overproducer
stop codon I t. term. R, site
FIG. 2. A strategy for overproducer construction that treats the coding sequence and RBS as linked units. In this scheme, an expression cassette containing all of the required translational information is inserted into a vector containing all of the required transcriptional information (transcription vector). R. site, Restriction endonuclease cleavage site; t. term, transcription terminator.
initiation. Implementation of this strategy in overproducer construction (Fig. 2) would require assembly of an expression cassette containing the RBS and coding sequence, and then insertion into a vector containing the necessary transcriptional control elements (transcription vector). Expression could then be optimized by changing the sequence of the RBS within the expression cassette, without having to alter the sequence of the vector. We also wanted to be able to package readily any contiguous coding sequence into the expression cassette, regardless of where it was found within the wild-type coding sequence (donor); this would make it possible to overproduce predetermined segments of a gene corresponding to, for example, individual domains of a protein. Although the construction of such expression cassettes has been accomplished by conventional recombinant DNA methodology, we wanted to avoid the demands of time and specialized training associated with such methods. Finally, we wanted to be able to synthesize expression cassettes directly from donors that are present in libraries, so as to avoid having to reclone known genes or to obtain molecular clones from elsewhere. The method that has emerged from these design considerations, ECPCR, fulfills the foregone objectives by using PCR in the synthesis 25,26 of expression cassettes. 25 K. Mullis, F. Faloona, S. Scharf, R. Saiki, G. Horn, and H. Erlich, Cold Spring Harbor Symp. Quant. Biol. 51, 263 (1986). 2~ S. J. Scharf, G. T. Horn, and H. A. Erlich, Science 233, 1076 (1986).
84
VECTORS FOR EXPRESSING C L O N E D GENES
[7]
A schematic diagram of ECPCR is presented in Fig. 3. Two synthetic oligonucleotide are designed to equip a coding sequence with translational control information and restriction sites during PCR (Fig. 3A); use of these primers in PCR furnishes an expression cassette that contains all of the information necessary for cloning and translation in E. coli (Fig. 3B). Specifically, the 5' primer contains an N-terminal coding sequence for the desired recombinant protein, preceded by a start codon (which may or may not be present in the donor), translational spacer, Shine-Dalgarno sequence, restriction site, and an end clamp (which facilitates cleavage by the restriction enzyme). The 3' primer contains a C terminal anticoding sequence for the desired recombinant protein, preceded by a stop anticodon, restriction site, and end clamp. Polymerase chain reaction amplification of the donor using 5' and 3' primers yields the desired expression cassette, which can be cloned into a transcription vector either directly or after restriction cleavage (cf. Fig. 2). More detailed aspects of primer design, sources of donor DNA, and experimental procedures are provided below. In our first reported example, ECPCR was used to construct overproducers encoding specific fragments of CD4, the cell surface receptor for major histocompatibility complex class II antigens (complexed to the T cell receptor and peptide antigens) and the human immunodeficiency virus (HIV) surface glycoprotein gpl20. 2 Based on the known domain organization of the immunoglobulin-like CD4, we designed two 5' primers that respectively encoded the N termini of CD4 domains 1 and 2, and 3' primers that encoded the C termini of domains 1 and 2, fused to the required translational control and cloning sequences. Polymerase chain reaction using these primers in specific combinations (and a human CD4 donor) yielded expression cassettes that encoded CD4 domain 1, domain 2, and domains 1 + 2 (Fig, 4). On insertion into a transcription vector (see below), these expression cassettes directed high-level biosynthesis of the respective CD4 fragments, and these are now being used in ongoing studies to assess their individual contributions to overall receptor binding--this approach we have termed "domainal analysis. ''2 Design of Primers 5' Primer
In our original ECPCR study, 5' primers [Fig. 3A (a)] were used, with coding sequence corresponding to CD4 residues Lys ~ to Asp ~° (putative N terminus of domain 1) and Asn ~°3 to Gin lj2 (putative N terminus of domain 2), in addition to the initiator methionine codon. The translational
[7]
OVERPRODUCTION OF PROTEINS USING E C P C R
A
85
5'-Drimer" RBS
(a) (b) (c) (d)
end restrictionr Shine- translationa~ start codingsequence clamp sit~ Dalgarno spacer codon (N-terminus) 5'-CGCGCGAATTCAGGAGGAA'FI'TAAAATG-(30 nucleotides)-3' 5'-TAGGGCGAATTCAAGGAGATATACCATG-(26 nucleotides)-3' 5'-TAGGGCGAATTCAAGGAGATATACATATG-(26 nucleotides)-3' 5'-TAGGGCGAATTCTTAACCAGGGAGCTGA'I-rATG-(26 n'tides)-3'
[
I
J
.I
Donor:
l
n
ni i i i i i i
,
r .............. (e) (f)
protei"-cedingDNA
Exoresslon
. . . . . . . . . . --.L'.'.---:'..J ..J . J
r ..... s = " ; = /
/
...... ; ....... /
PCR
cassette
5' restrictionsite end clamp
t~_~ _~ ~J~ !
3'-(30 nucleotides)-ATTTTCGAAACGCG-5' 3'-(26 nucleotides)-ATT TTCGAAACGGATCT-5' anticodingsequence stop restriction end (C-terminus) anticodon site clamp
~ B
of coding strancl
complementary region of anticoding strand
3'-orimer:
.J
:::::::::::::::::::::: ............ com,,.men,ary,eg,on
"i t'"r ...... . ....... . ~ [-r ..... f: ........ ~
.J
3' restrictionsite
RiS r'-- start co(Ion
)
I I derived from 5'-primer
derived from donor
stopcodon
)
1
end clamp
I I derived from 3'-primer
FIG. 3. Schematic diagram of ECPCR. (A) D N A components used in ECPCR, and (B) structure of an ECPCR expression cassette. In ECPCR, a 5'-primer and a 3'-primer are used to simultaneously amplify a target coding sequence from a donor and to equip that sequence with translational control and cloning information. The Y-primer (a-d) contains coding sequence for the N terminus of the desired protein, in addition to a start codon, RBS, restriction site, and end clamp. The 3'-primer (e and f) contains anticoding sequence for the C terminus of the desired protein, in addition to a stop anticodon, a restriction site, and end clamp, Use of a 5'- and 3'-primer to amplify a donor coding sequence results in the synthesis of an expression cassette in which parts of the coding sequence are primer derived and parts are donor derived.
86
[7]
VECTORS FOR EXPRESSING C L O N E D G E N E S
(A)
{B)
(C)
tn
CD4 SM
cDNA
1353 603 310 \ 281/271 234/--"
Primers
Start-1
+
+
-
Start-2 Halt-1
+
+
-
+ -
+
+
Halt-2
-
+
+
+
+
+
+
+
+
+
+
+
-
-
FIG. 4. PCR synthesis of CD4 expression cassettes using various donors. 2(A) CD4 cDNA; (B) Human KBM-7 myeloblastoid cell cDNA library, human HPB-ALL T cell cDNA library, and total Jurkat T cell RNA; (C) BALB/c mouse mRNA from various tissues. The Start-1 and Start-2 primers correspond to primer (a) of Fig. 3A, with coding sequence for the N termini of CD4 domains 1 (Lys I to Asp j°) and 2 (Asn 1°3to Glnm), respectively; the Halt-1 and Halt-2 primers correspond to primer (e) of Fig. 3A, with anticoding sequence corresponding to the C termini of CD4 domains I (Va198to His I°7)and 2 (VaP 68to Leut77), respectively. " R N A " samples are actually R N A - D N A hybrids generated from first-strand cDNA synthesis. Lane SM, DNA size markers (HaeIII-digested 4~X174), with fragment sizes indicated in bp. In (B) only the products from amplification using the Start-2 and Halt-2 primers (domain 2 expression cassettes) are shown; the other two primer combinations give rise to their respective expression cassettes. In (C) the products from amplification using the Start-1 and Halt-1 primers (domain 1 expression cassettes) are shown. The expression cassettes in (C) encode murine-human chimeras, with the primer-derived sequences being human and the donorderived sequences being murine (cf. Fig. 3B). Further details are provided in Ref. 2.
[7l
OVERPRODUCTION
OF PROTEINS USING E C P C R
Sma I Xma I EcoR I
87
Acc I Sal I BamH I
Pst I
Hind III
I ...GAATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTT...I
rminalor
(ampicillin
resistance
"
transcription vector
gene)
FIG. 5. Physical map and polylinker sequence of the transcription vector pHN 1 +.
spacer element, 5'-AATTTAAA-3', was designed to possess 8 bp of A/Trich sequence plus a low-frequency restriction site (DraI, 5'-TTT $ AAA3'), which would allow for future insertion of a periplasmic signal sequence. The consensus Shine-Dalgarno, 5'-AGGAGG-3', was used. The EcoRI site, 5'-GAATTC-3', was chosen for use in the 5' primer, because in the transcription vector we use (pHN 1 +) (Fig. 5; also see below) the EcoRI site is closest to the promoter; this site was flanked by a 5-bp GC clamp, according to the suggestion of Scharf. 27 Since that report, we have tested a number of additional 5' primers, the best of which are shown in Fig. 3A (b-d). Primers (b) and (c) contain variants of an RBS sequence from T7 gene 10, which have seen popular use in transcription/translation vectors 2~'24; the use of the primer (c) trans27 S. J. Scharf, PCR Protocols 1, 84 (1990).
88
VECTORS FOR EXPRESSING CLONED GENES
[7]
lational spacer for ECPCR was first reported by Liu et al. 28 Primer (d) contains the RBS from the E. coli ada gene, which we have also found to be highly efficient in several cases. 29 Although the RBSs of primers (b-d) are all strong, we have observed dramatic variations in their individual efficiencies when linked to the same gene, with no consistent trend among the RBSs when comparing them linked to different genes. 29 These results underscore the advantage of screening several RBSs as a strategy for maximizing expression. With regard to the restriction site in the 5' primer, we have almost exclusively used the E c o R I site, because it is the most promoter-proximal site available in pHN 1 + (Fig. 5). In one case we have observed a marked decrease in expression level when changing from a 5'-EcoRI expression cassette to an otherwise identical B a m H I cassette [made using a 5' primer, (d) in Fig. 3A, in which the restriction site was 5'-GGATCC-3'], each cloned into the corresponding polylinker site of pHN1 +.3° Secondary structure analysis 31 on the two transcripts has suggested that the mRNA of the B a m H I construct is able to form a stable hairpin that renders its Shine-Dalgarno sequence unavailable for pairing with the ribosome, and that this problem might be overcome by changing the RBS. At the design stage, there are perhaps two reasons why one would need to change the restriction site from E c o R I to another: (1) if the cleaved E c o R I site (5'AATT-3' overhang) is not compatible with sites available in the transcription vector, or (2) if there is an E c o R I site within the coding sequence to be included in the expression cassette. Because cleavage of a restriction site near an end is much slower than at an internal site, 32one can effectively rule out using partial digestion to cut a primer-derived site in an expression cassette without affecting an internal site. We have sometimes experienced considerable difficulty with restriction digestion of expression cassettes having GC clamps [as in Fig. 3, primers (a) and (e)], and so now avoid their use altogether. The end-clamp sequences in primers (b-d) were chosen because they flank the E c o R I site in common polylinker sites, and are thus known not to inhibit cleavage; they have performed well without exception in our hands. In general, we prefer to use end clamps of 5 bp or more--even though reports indicate that shorter sequences are efficiently cleaved by some restriction endonu28 j. Liu, M. W. Albers, C. M. Chen, S. L. Schreiber, and C. T. Walsh, Proc. Natl. Acad. Sci. U.S.A. 87, 2304 (1990). 29 L. Chen, W. Chang, K. Ezaz-Nikpay, C. J. Larson, M. P. Terranova, and G. L. Verdine, unpublished observations. 3o L. Myers and G. L. Verdine, unpublished observations. 3~ D. E. Cane, personal communication. 32 W. E. Jack, B. J. Terry, and P. Modrich, Proc. Natl. Acad. Sci. U.S.A. 79, 4010 (1982).
[7]
OVERPRODUCTION OF PROTEINS USING E C P C R
89
cleases33,34--because the relative cost of tracking down a recalcitrant cleavage site far outweighs that of adding a few base pairs to the primer. Design considerations that apply to the coding sequences in the 5' primer are discussed below.
3'-Primer In our original ECPCR study, 3' primers [(e) in Fig. 3] were used, with anticoding sequence corresponding to CD4 residues Va198 to His ~°7 (putative C terminus of domain 1) and Va1168 to L e u 177 (putative C terminus of domain 2), fused to a stop anticodon, HindlII site, and GC clamp (see also Fig. 4). The design of the 3' primer has since changed only in that we have replaced GC clamps with mixed-sequence end clamps [Fig. 3A, primer (f)]. There are three possibilities for the stop anticodon, namely 5'-TTA-3', CTA, and TCA, and all should work equally well except in suppressor (sup) E. coli strains, which may read through one of the three. 35 The choice of restriction site is dictated by those available in the transcription vector and absent from the coding sequence. We chose HindlII because it is the polylinker site farthest from EcoRI in pHN1 + (Fig. 5).
Coding and Anticoding Sequences in Expression-Cassette Polymerase Chain Reaction Primers Many of the design considerations that apply to the donor-homologous regions of ECPCR primers apply in general to primer design in most PCRbased methods, and this subject has received a great deal of attention. In the domainal analysis of CD4, 2 we used 30-bp donor-homologous sequences in the 3' and 5' primers [Fig. 3A, primers (a) and (e); Fig. 4]. We have since found that sequences of this length are generally not necessary, and in fact longer sequences are sometimes undesirable because of their greater probability to participate in PCR side reactions. If a primer longer than a 60-mer must be used, programs such as Fold and Squiggles (GCG) are useful in determining the stability of potential secondary structures, which may be reduced through alternative primer formulations. We have found that 18 bp of donor-homologous sequence is generally sufficient,29 33 D. L. Kaufman and G. A. Evans, BioTechniques 9, 304 (1990). 34 New England Biolabs 1990-1991 catalog, p. 132. 35 B. Lewin, "Genes IV," pp. 150-153. Oxford Univ. Press, Oxford, and Cell Press, Cambridge, England, 1990.
90
VECTORS FOR EXPRESSING CLONED GENES
[7]
especially if one is using a monoclonal donor. An overview of principles for primer design is given by Innis and Gelfand. 36 Materials and Methods
Oligonucleotides All oligonucleotides were synthesized on a 381A automated DNA synthesis machine (Applied Biosystems, Foster City, CA) on a 0.2-~mol scale, using/~-cyanoethylphosphoramidites. Oligonucleotides were either purified Trityl-on using OP cartridges (Applied Biosystems) or, for Trityloff oligonucleotides, by acrylamide gel electrophoresis as follows37: following ammonia deprotection and lyophilization, the solid oligonucleotide was dissolved in 200/~1 formamide loading dye, heated to 90° for 2 min, and loaded onto a 20% (w/v) denaturing acrylamide gel (20 × 20 × 0.3 cm; 19 : I acrylamide : methylenebisacrylamide; 7 M urea). The gel was run until the bromphenol blue marker migrated out of the gel, then the gel was removed, wrapped in Saran (plastic wrap), and placed on top of a fluorescent-backed thin-layer chromatography (TLC) plate. The gel was then visualized by illumination with short-wave ultraviolet (UV) light, and the uppermost band was cut out with a sharp scalpel. The gel slices were transferred to a 15-ml Corning tube and crushed thoroughly with a glass rod. Following the addition of 10 ml 1 M aqueous triethylammonium bicarbonate (TEAB) (made by adding solid CO2 to a triethylamine solution until the pH reaches 8.0), the tube was shaken moderately for 8-12 hr at room temperature. The solution was removed, being careful to avoid the gel bits (higher recoveries can be obtained if the gel slices are washed with 10 ml of 25 m M TEAB), and transferred to a syringe fitted with a SepPak C1s cartridge (Waters Associates, Milford, MA); the SepPak had previously been washed with the following: 20 ml of CHaCN, 10 ml of 30% (v/v) CH3CN in 0.1 M TEAB, and 20 ml of 25 mM TEAB. The oligonucleotidecontaining solution was passed twice through the SepPak at approximately 1 drop/sec (this can be done conveniently using a syringe pump), followed by a wash of 10 ml 25 mM TEAB. The oligonucleotide was then eluted using 5 ml of 30% (v/v) CH3CN in 0.1 M TEAB and lyophilized (SpeedVac; Savant Instruments, Farmingdale, NY) to dryness. Dry oligonucleotides from cartridge or gel purification were redissolved in 100/xl TE buffer (10 mM Tris-HC1, 1 mM EDTA, pH 8.0) and were quantified by measuring the absorbance at 260 nm of 1 /.~1ofoligonucleotide solution diluted in 1 ml 36 M. A. Innis and D. H. Gelfand, PCR Protocols 1, 3 (1990). 37 T. Ellenberger, personal communication.
[7]
OVERPRODUCTION OF PROTEINS USING E C P C R
91
TE buffer. The absorbance was multiplied by 64,000 and divided by the number of bases in the oligonucleotide to provide a rough estimate of concentration in units ofpicomoles per microliter. We have found cartridge purification to be sufficient in most cases, especially for <30-mer oligonucleotides. The gel method is preferred for >30-mers, and is somewhat more convenient for large-scale purifications (greater than 200 nmol).
Template DNA We have successfully generated expression cassettes using the following donors: minipreparation monoclonal plasmids, a hgt 10 library, a phagemid library (minipreparation), a first-strand cDNA library ]generated from total RNA primed with poly(dT) and extended with reverse transcriptase--the R N A - D N A hybrid mixtures were used directly], and total E. coli DNA. In the case of CD4, we were able to generate mouse/human chimeras in which the primer-encoded sequences were human and the donor-encoded sequences murine (see Fig. 3, bottom; Fig. 4C) by using human primers to amplify murine first-strand cDNA libraries." (The success of such chimera experiments depends on the number and location of mismatches.) While we take no particular care to purify the donor, it is a general rule in PCR that purer is better.
Overexpression System We generally use the transcription vector pHN 1 + 38.39(Fig. 5), a phagemid in which cloned genes are under the control of the tac promoter 18'~9 and rrnBT~T 2 transcription terminator. 4° Owing to the high copy number of p H N I + constructs, they are best maintained in E. coli strains that express a high titer of the lac repressor, for example XA90 (F' laclQIproAB) [~lac pro XIII ara nal argE(am) thi rifr]. Other transcription plasmids such as pKK223-34~ (tac promoter, rrnBT~T2 transcription terminator) and some members of the pET series 24(T7 promoter and terminator; Novagen, Madison, WI) are equally suitable.
Enzymes~Reagents Thermus aquaticus (Taq) DNA polymerase was obtained from Promega (Madison, WI). The Sequenase kit (U.S. Biochemical, Cleveland, 38 L. C. Myers, M. P. Terranova, H. M. Nash, M. A. Markus, and G. L. Verdine, Biochemistry 31, 4541 (1992). 39 S. L. Schreiber and G. L. Verdine, Tetrahedron 47, 2543 (1991). 4o j. Brosius, T. J. Dull, D. D. Sleeter, and H. F. Noller, J. Mol. Biol. 148, 107 (1981). 4t j. Brosius and A. Holy, Proc. Natl. Acad. Sci. U.S.A. 81, 6929 (1984).
92
VECTORS FOR EXPRESSING CLONED GENES
[7]
OH) was used for all DNA sequencing. All other enzymes were obtained from Boehringer Mannheim (Indianapolis, IN) or New England BioLabs (Beverly, MA). Deoxynucleotide triphosphates were obtained from Pharmacia (Piscataway, N J). Perfect Match was obtained from Stratagene (La Jolla, CA).
Thermal Cycler A programmable thermal controller (MJ Research, Cambridge, MA) was used for all amplifications.
Software The University of Wisconsin Genetics Computer Group (Madison, WI) version 7.0 suite (GCG) 42of nucleic acid and protein analysis software was accessed on a VAX 8700 running VMS 5.4-2.
Amplification There are a large number of published protocols for PCR, and the optimal conditions seem to vary somewhat with different donor and primer preparations. The optimization of PCR has been well discussed elsewhere, 36 but the parameters that in our experience are most likely to require adjustment are donor and primer concentration, annealing temperature, and number of cycles. In general, we have found the procedure used to produce CD4 expression cassettes 2 to be a good starting point: in a sterile 0.5-ml microcentrifuge tube are combined 1/zl of a 40 pM donor solution (for monoclonal donors), 5/.d of a solution containing 10/zM concentrations of each primer, 5/xl of a solution containing 2.5 mM concentration of each dNTP (N = A, C, G, T), 0.5/zl Taq polymerase (5 U/t~I), and 5/~1 of 10 x Taq buffer [supplied by Promega: 500 mM TrisHC1 (pH 9.0 at 25°), 500 mM NaC1, 100 mM MgCI2, I% (w/v) Triton X-100]. Then, 28.5/xl of sterile double-distilled water is added to produce a final volume of 50 p,l. The capped tube is shaken and microcentrifuged briefly, and overlaid with mineral oil until the aqueous layer is fully covered (-25/zl). The tube is placed in a temperature cycler and heated at 94 ° for 1 min. The following cycle is then repeated 30 times: heat at 94° for 30 sec; 42 °, 1 rain; 70 °, 1 min. After this the reaction is held at 70 ° for 10 min to ensure complete extension. The reaction is then allowed to cool to room temperature and microcentrifuged briefly. The amplification procedure is essentially the same when using nonmonoclonal donor sources, such as cDNA libraries or crude first-strand 42 j. Devereux, P. Haeberli, and O. Smithies, Nucleic Acids Res. 12, 387 (1984).
[7]
OVERPRODUCTION OF PROTEINS USING E C P C R
93
cDNA preparations, although in this case it is worthwhile to carry out serial dilution of the donor. We have successfully used 1 /zl or less of a 10-ng/tzl cDNA library, and 1 /xl or less of a 1-ng//xl first-strand cDNA preparation as the source of donor DNA in ECPCR. An aliquot (5 /xl) of the crude PCR reaction should be analyzed by agarose gel electrophoresis using ethidium bromide staining (5/zl of a 10mg/ml solution per 100-ml gel solution) and visualized using short-wave UV light, to evaluate the success of the reaction (Fig. 4). Size markers should be used to aid in determining the size of the PCR products. Because unreacted primers can often be seen as blurred bands in the low molecular weight range, and template DNA may also be visible in some cases, it is worthwhile to include these samples as controls. It is also worthwhile to carry out a diagnostic restriction analysis of the PCR product before inserting it into a vector, so as to confirm that it is the expected product. The PCR reaction mixture is worked up as follows: after brief microcentrifugation, the reaction mixture is frozen by placing it in a - 20° freezer for a few minutes, then the mineral oil is removed with a pipette. TE buffer (50 tzl) is added, followed by an equal volume ( - 100 tzl) of phenol/ chloroform solution (equal volumes of phenol and chloroform saturated with 0.1 M Tris-HCl, pH 7.6), and the mixture is vortexed gently. The tube is microcentrifuged for 15 min, and the upper (aqueous) layer is removed and added to a new 1.5-ml microcentrifuge tube. The extraction is repeated once, and then the tube is spun for 1-2 min in a centrifugal lyophilizer (SpeedVac) to remove traces of chloroform. The volume is then adjusted to 500/zl with TE buffer, followed by the addition of 50/zl sodium acetate buffer (3.0 M, pH 6.0) and 1 ml of 100% ethanol chilled to - 20 °. The tube is vortexed briefly and chilled at - 20° for 30 min. (Sodium acetate should be used instead of ammonium acetate to avoid problems with inhibition of ligase by ammonium ion, and to more selectively precipitate DNA rather than oligonucleotides.) The tube is then microcentrifuged for 15 min, the solution is carefully decanted or removed by pipette, and the pellet (which may not be visible in some cases) is washed with 1 ml of 95% ethanol (room temperature). The tube is then left to air dry, after which 50/zl of TE buffer is added and repeatedly pipetted to effect dissolution. There are many adequate protocols for the remaining steps: digestion, ligation, and transformation. We favor the following protocols.
Digestion and Ligation The EcoRI and HindlII restriction sites of the CD4 expression cassettes 2 are cleaved in one digest as follows: in a 0.5-ml microcentrifuge tube 4/zl of the expression cassette in TE buffer (see above) is added to
94
VECTORS FOR EXPRESSING CLONED GENES
[7]
1/xl of a 1-mg/ml bovine serum albumin (BSA) solution, 1/xl of 0.1 M dithiothreitol (DTT) solution, and 1 /xl of 10 x buffer (500 mM NaCI, 100 mM MgCI2, 100 m M Tris-HC1, pH 7.7). Then 0.5/~1 EcoRI (8 units/p.l) and 0.5 ~1HindlII (12 units//.d) are added, followed by 2/xl doubly distilled water, to make a final volume of 10 ~1. The tube is vortexed gently and microcentrifuged briefly to ensure mixing of the reactants, then warmed to 37° for more than 1 hr. The tube is cooled to room temperature and spun briefly to collect the condensate. Agarose loading dye [2/xl: 50% (v/v) glycerol, 0.25% (v/v) xylene cyanole] is then added. Method A: Low-Melting-Point Agarose. 43 The entire sample of DNA in loading solution is loaded onto a 1% (w/v) SeaPlaque agarose (FMC, Rockland, ME) minigel (Hoefer, San Francisco, CA) in TBE buffer (90 mM Tris base, 90 mM boric acid, 2 mM EDTA). The gel and running TBE buffers are supplemented with ethidium bromide solution (1/.d of a 10 mg/ml ethanolic ethidium bromide stock solution per 100 ml gel solution and running buffer). Electrophoresis proceeds at 75 V for 1 hr, after which the gel is visualized with long-wavelength UV light, and the desired band is excised with a sharp scalpel. The gel slice is then trimmed with the scalpel to remove excess (nonfluorescing) gel. The trimmed gel slice (typically around 20/zl in volume) is added to a 0.5-ml microcentrifuge tube and diluted with an equal amount of sterile double-distilled water. The tube is heated to 70° for 5 min, shaken and microcentrifuged briefly, and placed in a 42 ° bath. A 5-/zl aliquot of the cleaved expression cassette in melted low-meltingpoint (LMP) agarose is transferred to a new 0.5-ml Eppendorf tube, preheated to 50 °. To this is added 5/xl of vector solution that had been purified similarly in LMP agarose (after restriction cleavage of 1/~g vector, followed by 5' dephosphorylation--it is convenient to purify the vector and the insert on the same gel). After mixing at 50°, 4/xl of 5 x T4 ligase buffer (10 m M DTT, 10 m M MgCI2, 0.6 m M ATP, 20 mM Tris-HCl, pH 7.6) and 5/xl sterile double-distilled water are added, and the tube is allowed to cool to room temperature. T4 DNA ligase (1 /zl at 1 U/~I) is added, the tube is shaken and microcentrifuged briefly, and the ligation mixture is then incubated at 16° overnight (about 12 hr). The ligation solution often resolidifies, but this does not prevent ligation. It is advisable to perform a control ligation in parallel, in which only vector and no insert DNA is present, to judge the background level of vector religation. Method B: Purification on Ceramic Beads, Ligation in Solution. The purification of the restriction-cleaved expression cassette is carried out using the GeneClean kit (BIO 101, La Jolla, CA) according to the proce43 L. S h e w c h u k , personal c o m m u n i c a t i o n .
[7]
OVERPRODUCTION OF PROTEINS USING E C P C R
95
dure provided by the manufacturer, with one additional step: after dissolution of the gel and addition of the ceramic beads, the mixture is incubated on ice for 5 min, shaking gently about once per minute to resuspend the beads. The DNA is eluted from the beads into 20/zl TE buffer, and this solution is used directly in ligation. A 5-tzl aliquot of the cleaved expression cassette in TE buffer is transferred to a new 0.5-ml Eppendorf tube. To this is added 5/xl of vector in TE buffer (which had been purified in parallel with the expression cassette, after restriction cleavage of 1/.~g vector, and 5' dephosphorylated), 10/xl 5 x T4 DNA ligase buffer (see above), 24/xl sterile, doubly distilled water, and 1 ~1 T4 DNA ligase (1 U//~I). The ligation is allowed to proceed overnight at 16°. It is advisable to perform a control ligation in parallel, in which only vector and no insert DNA is present, to judge the background level of vector religation.
Transformation Component E. coli XA90 is prepared and transformed by the method of Hanahan (protocol 1). 44 For DNA prepared by method A, the following changes are made: the ligation mixture is warmed to 42 ° for 5 rain (to melt any solid agarose), and 5/zl is added to the competent cells on ice, after which the transformation mixture is repeatedly and gently pipetted. After growth in SOB medium, 44 the transformed cells are spread on an LMA plate [1% (w/v) Bacto-tryptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCI, 1.5% (w/v) Bacto-agar, 10 mM MgCIz, 0.1 mg/ml ampicillin-sodium salt], and the plate is incubated at 37° until colonies become visible (about 16 hr). Individual colonies are used to inoculate 3 ml sterile LBA medium [1% (w/v) Bacto-tryptone, 0.5% (w/v) yeast extract, 1% (w/v) sodium chloride, 0.1 mg/ml ampicillin-sodium salt], being sure to sample a range of colony sizes (overproducers often form smaller colonies than nonoverproducers). After being shaken 12 hr at 37°, the cells (1.5-ml inoculate) are harvested by microcentrifugation, plasmid DNA is isolated, 45 and the plasmids are checked for the presence of the insert by digestion with EcoRI plus HindIII, and insert-positive clones are sequenced. 46 Regarding the choice of method A vs. method B: we generally prefer method B, because it is less technically demanding and usually yields a
44 D. Hanahan, in " D N A Cloning" (D. M. Glover, ed.), Vol. 1, p. 119. IRL Press, Washington, D.C., 1985. 45 G. Del Sal, G. Manfioletti, and C. Schneider, BioTechniques 7, 514 (1989). 46 F. Sanger, S. Nicklen, and A. R. Coulson, Proc. Natl. Acad. Sci. U.S.A. 74, 5463 (1977).
96
VECTORS FOR EXPRESSING C L O N E D GENES
[7]
larger number of insert-positive transformants. However, with some difficult ligations, particularly those involving blunt ends, method A is sometimes superior to method B. By using method B in ligation of sticky-ended expression cassettes we typically obtain 100-200 colonies per plate, of which approximately 90% are the desired overproducer. 29 Induction Testing directly for induced overexpression of the desired protein can be used as an alternative to restriction screening of plasmids (but does not obviate the need for sequencing). If one has a convenient activity assay for the protein, it may be possible to assay crude cell lysates directly. Perhaps the most exciting method involves analysis of whole-cell protein by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE), in which case expression of the cassette-encoded protein can often be observed visually. SDS-PAGE also offers a convenient way to screen a series of expression cassettes that differ in their RBS sequences, which (as mentioned above) is an effective strategy for maximizing gene expression. We favor the following procedure for induction tests: single colonies from a fresh transformation (grown on plates for less than 1 week) are used to inoculate 1 ml sterile LBA medium, and these are grown overnight with shaking at 37 °. To 3 ml of fresh sterile LBA is added 60/zl of the overnight culture. This is shaken at 37 ° and monitored spectrophotometricaUy until the OD6o0 = 0.4-0.6 (one should include an extra culture or two from which samples can be removed; these samples lose their sterility during handling and should not be returned to the culture tubes. For simplicity, one can assume that all of the cultures grow at the same rate). At this point, 1 ml of each culture is transferred to a 1.5-ml Eppendorf tube, and in the remaining 2 ml of cells protein synthesis is induced by the addition of 40/xl of 0.1 M aqueous IPTG. The 1-ml uninduced sample is microcentrifuged for 1 min, the supernatant is decanted and discarded, and the cell pellet is frozen at - 2 0 °. The induced cultures are shaken at 37 ° for another 2-6 hr, and then 1 ml of each is transferred to a 1.5-ml Eppendorf tube and microcentrifuged for 1 min. The supernatants are again discarded, and at this point the cell pellets can all be stored at - 20° or directly taken on to the next step. Each cell pellet is resuspended, by repeated pipetting, in 100/xl SDS-PAGE loading buffer. The samples are then heated in a boiling water bath for 3 min (with caps of tubes either left open or weighted down). Samples (1-5 /zl) should be loaded onto an S D S - P A G E gel while still warm to hot, because we have observed that some proteins precipitate on cooling. Samples that are too viscous to be
[7]
OVERPRODUCTION OF PROTEINS USING E C P C R
97
pipetted easily should be diluted with an equal volume of SDS-PAGE loading buffer and reheated before loading. A clone transformed with the insert-free overproduction vector should be included in the induction test as a negative control. To facilitate comparison, each uninduced sample is loaded alongside the corresponding induced sample. It is best to avoid overloading the SDS-PAGE gel, because this can sometimes make the induced protein band difficult to identify, especially if the level of induction is modest. We often find it worthwhile to load each sample twice, varying the amount loaded. A minigel apparatus such as the Hoefer MightySmall II is convenient for induction screening, because large numbers of clones can be analyzed rapidly; however, in some cases minigels may have insufficient resolution to permit clear identification of the induced protein band. If one suspects that the recombinant protein may form inclusion bodies in E. coli, it may be worthwhile to screen pellets from induced cells that have been lysed by sonication or French press. In this way, the protein of interest can be significantly enriched and thereby detected more easily (but only if it is insoluble). When using this approach, however, it should be borne in mind that some proteins partition into both soluble and insoluble material. Finally, there is the issue of how many clones to screen. If the plasmid has already been shown by sequencing to contain the desired construct, we typically test four colonies. With transformants obtained directly from ligation of an expression cassette into a vector, we typically test 10-12 clones, even if they have already been analyzed by restriction digestion and shown to contain the desired insert.
Polymerase Chain Reaction-Generated Mutations The error rate of Taq polymerase is a source of serious concern when using any PCR-based method. 7 Although we have observed only one PCRrelated mutation during our numerous overproducer constructions using ECPCR, all such constructs should be sequenced thoroughly. New England BioLabs and Stratagene are now marketing thermophilic DNA polymerase enzymes (Vent 47and Pfu polymerases, respectively) that possesses proofreading (3' ~ 5' exonuclease) activity as well as exceptional thermal stability, which may make these the enzymes of choice for future ECPCR constructions.
47 A. Neuner, H. W. Jannasch, S. Belkin, and K. O. Stetter, Arch. Microbiol. 153, 205 (1990).
98
VECTORS FOR EXPRESSING CLONED GENES
[7l
Troubleshooting
Amplification If no expression-cassette product is visible on an agarose gel, the quality of the enzyme should be checked by running a control PCR reaction (for example, PCR the polylinker of pUC19 using sequencing primers)--we have found the quality of Taq polymerase from different sources to vary greatly. If the enzyme is found to be reasonably active, reaction conditions should be modified as suggested by Innis and Gelfand? 6 Polymerase chain reactions using libraries as donors are more demanding than those using monoclonal donors. If the recommended PCR optimization routines fail when trying to perform PCR from a library, one can either try a different library or try using a nested PCR approach to increase specificity. 7 If side products make isolation or visualization of the desired product difficult, this can sometimes be overcome by repeating the PCR with a sliver of gel containing the desired product. The PCR products should be electrophoresed on a SeaPlaque (FMC) low-melting agarose gel with a minimum of ethidium bromide (1/zl/60 ml agarose solution) and visualized using long-wavelength UV light only. A portion of the gel corresponding to the size of the desired product is excised with a scalpel. The gel slice is then melted in TE buffer and serially diluted to a final value of -10,000fold. The PCR is then repeated, using this diluted DNA as donor. Alternatively, the addition of 1 tzl of I U//zl Perfect Match (Stratagene) can sometimes reduce the amount of undesired products.
Digestion Failure to obtain transformants having the desired insert can result from a number of factors. The most common problem that we have encountered has been the failure of the restriction enzyme to cleave the sites at the ends of expression cassettes. This problem is much worse when the restriction sites are flanked by GC-rich sites such as in a GC clamp; therefore, we strongly recommend the avoidance of such sites in ECPCR. If one suspects a problem in restriction digestion, the best course of action is to end label the cassette with 32p, digest it, and run the products on a 20% (w/v) denaturing polyacrylamide gel. Oligonucleotide size markers corresponding to the sizes of the expected cleavage products should be run in parallel. If this digestion works, scale up all components of the digestion arithmetically, including the enzyme. It is best to bear in mind that restriction digestion of terminal sites is always significantly slower than restriction digestion of internal ones. If the ends are altogether resis-
[7]
OVERPRODUCTION OF PROTEINS USING E C P C R
99
tant to digestion, one should try ligating the PCR product prior to restriction digestion, as described. 48 Another possible source of trouble is that the vector has not been digested adequately. This problem may be difficult to track down, because the polylinker fragment removed during vector preparation is generally difficult to visualize on a gel. For this reason, whenever possible we prefer to digest vectors having a large insert (such as another expression cassette) rather than a polylinker, so that one can readily observe cleavage of the insert on a gel. Ligation Blunt-ended ligation may be effective if one has experienced difficulty preparing the vector or insert for sticky-ended ligation. If the expression cassette is to be used in a blunt-ended ligation, the Klenow fragment of E. coli DNA polymerase (about 0.5 /zl of a 6 U//xl solution) should be added at the end of the PCR (after the reaction has cooled to 37°), and the tube should be incubated at 37 ° for 30 min. This extra step ensures that the Y-A overhangs frequently added by Taq polymerase are removed by the exonucleolytic activity of Klenow. 49~5° All subsequent steps are the same as described above, with the exception that the restriction digestion step is replaced by 5' phosphorylation using T4 polynucleotide kinase. -st Transformation or Loss o f Overproduction High-level overproducers, particularly those present at high copy number, place a severe metabolic tax on the host cell. Inadequate repression of the promoter of the overproducer may lead to problems in cell viability, which may result in failure to obtain overproducing transformants. One should take particular note of this problem when using E. coli promoters that are controlled by the lac repressor (e.g., lac, tac, and trc). Whenever possible, one should transform such overproducers into E. coli cells that overproduce lac repressor, such as lacl Q o r lacI QI strains. As noted above, overproducers should not be maintained on plates, but should be freshly transformed before each growth of new protein. In our hands, plates 48 V. Jung, S. B. Pestka, and S. Pestka, Nucleic Acids Res. 18, 6156 (1990). 49 j. M. Clark, Nucleic Acids Res. 16, 9677 (1988). 50 A. Hemsley, N. Arnheim, M. D. Toney, G. Cortopassi, and D. J. Galas, Nucleic" Acids Res. 17, 6545 (1989). 5t S. Tabor, in "Current Protocols in Molecular Biology" (F. M. Ausubel, R. Brent, R. E, Kingston, D. D. Moore, J. A. Smith, J. G. Seidman, and K. Struhl, eds.), Vol. 1, Unit 3.10, p. 2. Wiley, New York, 1987.
100
VECTORS FOR EXPRESSING CLONED GENES
[7]
freshly streaked from glycerol stocks are not as reliable as freshly transformed cells. Poor Levels of Expression Not every gene can be overexpressed at high levels in E. coli. In particular, genes having codons that are used at low frequency in E. coli may be inherently difficult to express. In many other cases, however, expression can be increased by changing the RBS. We recommend that one try one or all of the RBS sequences in Fig. 3A. Because ECPCR allows one to carry out several overproducer constructions in parallel, we sometimes screen all of the RBS sequences in Fig. 3A, and use induction testing to determine the efficiency of each. Insoluble Protein On occasion, proteins overexpressed in E. coli fail to undergo proper folding to yield soluble, active protein. This can be readily identified on lysis of induced cells followed by centrifugation, whereupon the desired protein is found in the pellet fraction rather than in the supernatant. However, before concluding that the protein is insoluble, one should first try to wash the lysis pellet with 1 M salt, which will release proteins that are active but tightly bound to chromosomal DNA (as with many DNAbinding proteins). The various strategies for recovery of active folded protein from these insoluble aggregates have been reviewed by Marston. 52-54
Concluding Remarks ECPCR offers a rapid and reliable means for the construction of E. coli overproducers. This method requires little specialized training in molecular biology, such that we have found it to be rapidly mastered even by undergraduate students with no prior experience. By taking advantage of the ability of PCR to modify DNA sequences rapidly, ECPCR considerably reduces the time required to construct an overproducer: we have frequently completed the entire process from primer synthesis to overproducer sequencing in a week and, in our hands, the process has almost always been completed within 2 weeks. Another advantage of ECPCR is 52 F. A. O. Marston, Biochem. J. 240, 1 (1986). 53 F. A. O. Marston, in " D N A Cloning" (D. M. Glover, ed.), Vol. 3, p. 59. IRL Press, Washington, D.C., 1987. 54 C. H. Schein, Biotechnology 7, 1141 (1989).
[71
OVERPRODUCTION OF PROTEINS USING E C P C R
101
that donor DNA present in small quantities or in a library may be used. This feature has the significant benefit of eliminating the need to physically transfer clones from one laboratory to another. The generality of ECPCR is amply demonstrated by the broad range of proteins that have been overproduced using it: inter alia human CD4 2 and intracellular adhesion molecule (ICAM)-155 domains, human cyclophilins A 28 and B :6 E. coli cyclophilin, 57 human FK506 binding protein (FKBP- 12)58 and FKBP- 13,59 E. coli histidine-tRNA synthetase,6° human arylamine N-acetyltransferases NAT1 and NAT2, 61 E. coli D-alanine ligases Ddla and Ddlb, 6z Trypanosoma cruzi trypanothione reductase, 63 human transcription factor KBF1, 64 E. coli DNA repair proteins Ada, AlkA, and Fpg, 29Haernophilus aegyptus DNA cytosine 5-methyltransferase M.HaelII, 65 E. coli CMP-NeuAc synthetase, 66 Bacillus subtilis DNA polymerase 1II, 67 and the homeodomain of Saccharomyces cerevisiae a2 repressor. 68 In principle ECPCR should allow the overexpression of proteins in other organisms as well. Of particular interest in this regard are the transcription vectors that have been developed for expression in baculovirus.69 Although not much is yet known about optimal sequences for translation initiation in baculovirus, as more information becomes available we expect ECPCR will provide a powerful means by which to maximize expression in this eukaryotic system. We and others are exploring useful variations on ECPCR. In one, which we term selectable ECPCR, degenerate RBS sequences are used in s5 K. D. MacFerrin, S. L. Schreiber, and G. L. Verdine, unpublished observations. 56 E. R, Price, L. D. Zydowski, M. Jin, C. H. Baker, F. D. McKeon, and C. T. Walsh, Proc. Natl, Acad. Sci. U.S.A. 88, 1903 (1991). 57 j. Liu and C. T. Walsh, Proc, Natl. Acad. Sci. U.S.A. 87, 4028 (1990). 5s R. F. Standaert, A. Galat, G. L. Verdine, and S. L. Schreiber, Nature (London) 346, 671 (1990). 59 p. Martin and S. L. Schreiber, unpublished observations. C. Francklyn and P. Schimmel, Proc. Natl. Acad. Sci. U.S.A. 87, 8655 (1990). 61 D. M. Grant and J. M. Dupret, FASEB J. 5, 1205 (1991). 6z L. E. Zawadske, T. D. H. Bugg, and C. T. Walsh, Biochemistry 30, 1673 (1991). 63 F. X. Sullivan and C. T. Walsh, Mol. Biochem. Parasitol. 44, 145 (1991). M. Sodeoka, C. J. Larson, L. Chen, K. P. LeClair, W. S. Lane, and G. L. Verdine. submitted for publication. 65 L. Chen, A. M. MacMillan, W. Chang, K. Ezaz-Nikpay, W. S. Lane, and G. L. Verdine, Biochemistry 30, 11081 (1991). 66 y. [chikawa, G.-J. Shen, and C.-H. Wong, J. Am. Chem. Soc. 113, 4698 (1991). 67 R. A. Hammond, M, H. Barnes, S. L. Mack, J. A. Mitchener, and N. C. Brown, Gene 98, 29 (1991). 68 C. L. Phillips, A. K. Vershon, A. D. Johnson, and F. W. Dahlquist, Genes Dev. 5, 764
(1991). 69 N. R. Webb and M. D. Summers, Technique 2, 173 (1990).
102
VECTORS FOR EXPRESSING CLONED GENES
[8l
the 5' primer, and the resulting library of transformants is screened or selected for those that o v e r p r o d u c e at the highest level. 29 In another, which we h a v e termed leapfrog E C P C R , nested primers are used to add long stretches of sequence information to the donor sequence during PCR. 55 Particularly valuable extensions of E C P C R involve the addition of periplasmic export sequences, 55 cysteine " h a n d l e s " for specific chemical modification, 29 or peptide " t a g s " for affinity purification to proteins. 66 Finally, we wish to note that methods similar to E C P C R have b e e n d e v e l o p e d for use in the in vitro production of proteins. While the amounts of protein obtained are generally small, these methods require no cloning. 70-7~
Acknowledgments We wish to thank members of the Schreiber and Verdine groups, especially H. Nash, R. Standaert, J. Liu, K, Ezaz-Nikpay, and P. Martin for helpful discussions and comments. We are grateful to T. Ellenberger and the Harrison group for sharing their protocol for purification of synthetic oligonucleotides. We thank S. Burakoff, B. Bierer, S. Reddy, B. Cochran, B. Seed, M. L. Hedley, T. Maniatis, M. Ptashne, and M. Sekiguchi for supplying materials. R. Standaen provided expert experimental assistance. We thank Professor D. E. Cane and C.-H. Wong for sharing results prior to publication. K.D.M. is the recipient of a National Science Foundation graduate fellowship. This work was supported by the National Institutes of Health (Grant GM30738-09, to S.L.S.). and by fellowships from the NSF (Presidential Young Investigator Program), the Searle Scholar Program, Alfred P. Sloan Foundation, Eli Lilly, Hoffmann-La Roche, and Bristol Myers-Squibb (to G.L.V.). 7oC. Wychowski, S. U. Emerson, J. Silver, and S. M. Feinstone, Nucleic Acids Res. 18, 913 (1990). 71E. R. Mackow, M. Y. Yamanaka, M. N. Dang, and H. B. Greenberg, Proc. Natl. Acad. Sci. U.S.A. 87, 518 (1990). 72 K. C. Kain, P. A. Orlandi, and D. E. Lanar, BioTechniques 10, 366 (1991).
[8] E f f i c i e n t C o m p l e m e n t a r y Expression
Using Polymerase
DNA
Amplification
Chain Reaction
and
Technology
B y THOMAS L. PAULS and MARTIN W. BERCHTOLD
Introduction and Principles of Methods E x p r e s s i o n of foreign genes in bacteria is a powerful method in molecular biology that allows the a c h i e v e m e n t of a variety of goals, including the production of large a m o u n t s o f rare proteins or peptides to be used for basic research or directly for therapeutic applications. In addition, once a
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
[8]
cDNA CLONINGBY PCR
103
protein can be expressed in bacteria, site-directed mutagenesis is often carried out to establish structure-function relationships. Many different protocols are available to generate specific cDNA and clone these molecules into appropriate expression vectors. In this chapter we describe a rapid and efficient method that takes advantage of the speed and efficiency of polymerase chain reaction (PCR) technology for the steps mentioned above. Since PCR was first proposed and shown to be useful as a routine laboratory tool in 19851 this technique has been rapidly introduced in research and diagnostic laboratories in academia, industry, and hospitals. Literature dealing with technical improvements and novel practical applications as well as simply with the utilization of standard PCR procedure is increasing dramatically (for collections of applications and protocols, see Refs. 2-4). The PCR is not only the method of choice for directly amplifying minute quantities of genomic DNA from a complex background but has also been used successfully to amplify specific cDNA molecules obtained by reverse transcription of complex mixtures of mRNA. 4 So far, application of the PCR to isolate specific cDNA has required knowledge of DNA sequences flanking the region of interest. Our laboratory 5'6 and others 7'8 have proposed PCR methods that use only one specific oligonucleotide and a second unspecific primer. This is particularly interesting if 3' and 5' flanking regions of a coding sequence of interest are not known. Using this method (outlined in Fig. 1) we have cloned the 3' part of human parvalbumin cDNA 9 and the full-length cDNA for the human ribosomal large subunit protein L17A. 1° Subcloning of PCR products is often a problem. Restriction sites at the flanking sequences of PCR products introduced by attachment at the 5' end of the oligonucleotides are in many cases efficiently cleaved only when several additional nucleotides I R. K. Saiki, S. Scharf, F. Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich, and N. Arnheim, Science 230, 1350 (1985). ' H. A. Erlich (ed.), "PCR Technology." Stockton, New York, 1989. 3 M. A. lnnis, D. H. Gelfand, J. J. Sninsky, and T. J. White eds., "PCR Protocols" Academic Press, Inc., San Diego (1990). 4 E. S. Kawasaki and A. M. Wang, in "PCR Technology" (H. A. Erlich, ed.), pp. 89-97. Stockton, New York, 1989. s M. W, Berchtold, Nucleic Acids Res. 17, 453 (1989). T. M. J. Leu, C. C. Kuenzle, and M. W. Berchtold, in "Methods in Gene Technology" (J. W. Dale and P. G. Sanders, eds.), pp. 239-265. JAI Press, London, 1990. 7 M. A. Frohman, M. K. Dush, and G. R. Martin, Proc. Natl. Acad. Sci. U.S.A. 85, 8998 (1988). O. Ohara, R. L. Dorit, and W. Gilbert, Proc. Natl. Acad. Sci. U.S.A, 86, 5673 (1989). 9 M. Berchtold, J. Mol. Biol. 201, 417 (1989). l0 M. Berchtold and M. C. Berger, Gene 102, 283 (1991).
104
VECTORS FOR EXPRESSING CLONED GENES
5'
3'
(A) n 3'
re,erse
5' directed PCR
transcription]
I
1
3' directed PCR ,
(T)25 5' I
I
[8]
(T)25
5'
tailing by [ [terminal tranaferaae[ 2
3' (A)50_100 1
[
1
(T)25 5' 3
PCR 20 cyc es
1 4 "nested" PCR 25 cycea [
30-40 cyclesl [PCR
÷
t
__\
¢
I o'on'o0'oto" direct sequencing
J__ [
FIG. 1. General strategy for 3'- and 5'-directed PCR. I f only minimal information on a sequence of interest [down to 20 nucleotides (nt)], which may be mixed owing to codon degeneracy, is available, full-length cloning can be achieved by the following strategy. After reverse transcription using oligo(dT) as primer, 3'-directed PCR with a gene-specific primer and oligo(dT) is carried out (shown on the right). The new sequence information obtained from sequencing the PCR product is used to design primers for 5'-directed PCR (shown on the left). The template for this reaction is dA-tailed eDNA (by terminal transferase). Two rounds of Y-directed PCR with a °'nested" primer for the second round are generally needed to obtain specific PCR products that can be sequenced directly or after cloning into the desired vectors. Horizontal arrows indicate the direction of DNA synthesis. Primer 1, oligo(dT) with additional sequence; primer 2, gene-specific primer for 3'-directed PCR; primer 3, gene-specific primer for 5'-directed PCR; primer 4, " n e s t e d " primer for Y-directed PCR. Open squares, additional " a n c h o r e d " primer sequences (25 nt); blackened rectangles, XbaI restriction site; arrowhead at the 5' ends of the primers and in the PCR products, SacI restriction site.
[8]
cDNA CLONINGBY PCR
105
(e.g., GC clamps) are added, ll Several other possibilities exist to avoid the problem of cloning PCR products. In the TA cloning procedure, dA that is normally added to the PCR product by the intrinsic terminal transferase activity of Taq polymerase 12 is annealed to a dT tail at both ends of the vector that have been artificially added by terminal transferase 13 or by the Taq polymerase.14 A possibility for increasing the restriction enzyme efficiency on both ends of the PCR product is to create concatamers of the PCR product by self-ligation followed by digestion with restriction enzymes.15 A ligase-free subcloning method has been published.16 Sequences preceding the ATG initiation sites and that are known to allow optimal translation can be incorporated into the PCR product by including them at the 5' end of the oligonucleotide. For our expression system we took advantage of the naturally highly efficient initiation site of T7 bacteriophage gene 10 that encodes the T7 major capsid protein and is present in the pGEMEX vector. For precise insertion of the coding sequence of interest into this vector, PCR is carried out with a 5' primer containing the ATG codon within an N d e I site that is also present in the vector (Fig. 2). The final part of this chapter deals with the heterologous expression of genes in bacteria under the control of the inducible T7 promoter in a modified pGEMEX vector according to Studier et al. J7 and quantitation as well as isolation of the recombinant protein from crude bacterial extracts. Procedures are described in the order that they are carried out in a typical experiment, starting with a tissue or a cell culture. As an experimental test system we chose to amplify and clone the cDNA for the rat Ca2+-binding protein parvalbumin, 18using rat brain as a source for RNA preparation. Conditions for protein expression, quantitation, and isolation were used to achieve parvalbumin production with high efficiency. For detailed information concerning reagents and preparation of solutions see Materials and Reagents (below). For standard molecular biology procedures, consult the laboratory manual by Sambrook et al.19 tt D. L. Kaufman and G. A. Evans, BioTechniques 9, 305 (1990). t~ j. M. Clark, Nucleic Acids Res. 16, 9677 (1988). i_~T. A. Holton and M. W. Graham, Nucleic Acids Res. 19, 1156 (1991). 14 D. Marchuk, M. Drumm, A. Saulino, and F. S. Collins, Nucleic Acids Res. 19, 1154 (1991). 15 V. ]ung, S. B. Pestka, and S. Pestka, Nucleic Acids Res. 18, 6156 (1990). 16 A. R. Shuldiner, L. A. Scott, and J. Ross, Nucleic Acids Res. 18, 1920 (1990). 17 F. W. Studier, A. H. Rosenberg, J. J. Dunn, and J. W. Dubendorff, this series, Vol. 185, p. 60. ~s M. W. Berchtold, Biochim. Biophys. Acta 1009, 201 (1989). ~9j. Sambrook, E. F. Fritsch, and T. Maniatis, "'Molecular Cloning: A Laboratory Manual." 2rid Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989.
106
VECTORS FOR EXPRESSING CLONED GENES ATG
[8]
TAA
I
I mRNA
I 0.06
"I'
~
__Sac I 0.07
T7 terminator
~
~-
NdQI
PCR
MEX paEMEx 4.00~-k,-~ Kb
gene 10 \~L__..Nde i 0.91 ',q=_ / T7 promoter
P ORJ ATG
TAA
Sac~
Nd~I
Ligation
FIG. 2. Strategy for cloning of PCR products into expression vectors. Rat parvalbumin cDNA was amplified by PCR after reverse transcription of brain mRNA. Two gene-specific primers (bold arrows) containing the indicated restriction sites were used. After cutting the PCR product and the vector with NdeI and SacI restriction enzymes, ligation of these molecules was carried out to obtain the expression vector pGEMEX-PV.
[8]
cDNA CLOYINGBY PCR
107
Material and Reagents For R N A Isolation
Guanidinium denaturing solution: 4 M guanidinium isothiocyanate (Fluka, Ronkonkoma, NY), 25 mM sodium citrate, pH 7.0 (adjusted with acetic acid), 0.5% (w/v) N-laurylsarcosine. Before use, add 150 tzl 2-mercaptoethanol to 20 ml of the above mixture Sodium acetate, 3 M, pH 4.0 (adjusted with acetic acid): Suspend sodium acetate in a minimum of water and dissolve by adding glacial acetic acid until the desired pH is attained. Adjust volume with water Phenol for RNA extraction: Mix liquid phenol with 1 vol of water. Upper (aqueous) layer should have pH 4.0. Store at 4° (do not use for DNA treatment) Chloroform-isoamyl alcohol mixture (49: 1, v/v) TE buffer, pH 7.5:10 mM Tris-HCl, pH 7.5, 1 mM EDTA 2-Propanol LiC1, 4 M Sodium dodecyl sulfate (SDS), 10% (w/v) For Reverse Transcription
Reverse transcriptase: Cloned, from Moloney murine leukemia virus (Mo-MuLV) (13 U/tA) (Bethesda Research Laboratories, Gaithersburg, MD) Reverse transcription reaction buffer [5 × concentrated: 250 mM TrisHCI, pH 8.3 (at 40°), 150 mM KCI, 40 mM MgC12,50 mM dithiothreitol (DTT)], stored at - 2 0 ° Primer for reverse transcription: Oligo(dT) with additional primer 5'-GCAGCTTGCGACGGTGTCTAGACGC(T)25 or defined genespecific primers (10 p~Meach). Primers are generally purified on a 15% (w/v) polyacrylamide gel containing 7 M urea, followed by reversedphase chromatography using a SepPak CI8 cartridge (Waters Chromatography Division, Millipore Corporation, Milford, MA), lyophilization, and redissolving in HzO dNTP stock solution: dATP, dCTP, dGTP, dTTP (ultrapure; Pharmacia, Piscataway, NJ) in one stock solution; 10 mM each in TE buffer Ribonuclease inhibitor (RNasin), 50 U/~I (Boehringer Mannheim Biochemicals, Indianapolis, IN) Hydrolyzing solution: 0.3 N NaOH, 30 mM ethylenediaminetetraacetic acid (EDTA)
108
VECTORS FOR EXPRESSING CLONED GENES
[8]
Organic solvents: Phenol for DNA extraction (preparation as described in Ref. 19), dichloromethane, 100% ethanol, 2-propanol DNA terminal transferase kit (Boehringer Mannheim)
For Polymerase Chain Reaction Polymerase chain reaction buffer, 5 × concentrated (5 × PCRB): 83 mM ammonium sulfate, 335 mM Tris-HC1, pH 8.8 at 25°, 50 mM 2-mercaptoethanol, 1 mg/ml bovine serum albumin (BSA) (Dnasefree quality; Boehringer Mannheim) dNTP stock solution: As described for reverse transcription, above, but at a concentration of 1 mM each AmpliTaq (cloned Taq DNA polymerase; Perkin-Elmer Cetus, Norwalk, CT), 5 U//xI: Prior to use, dilutions of 0.2 U//zl are made in I x PCRB TEC buffer: Carrier DNA poly(dI-dC), poly(dI-dC), 25 /zg/tzl (Pharmacia) in TE, pH 7.5 Mineral oil, extra light (Sigma, St. Louis, MO): Autoclaving is not necessary Primers (purified as described above, 10 tzM stocks) according to the type of PCR to be carried out
For Cloning of Polymerase Chain Reaction Products Glycogen (20 mg/ml), DNAse free (Boehringer Mannheim) TE buffer, pH 8.0:10 mM Tris-HCl, pH 8.0, 1 mM EDTA NdeI (I0 U/p.l) and SacI (12.5 U//zl) restriction enzymes (Boehringer Mannheim) Organic solvents: Phenol for DNA extraction (preparation as described in Ref. 19), 100% ethanol Agarose and other material for gel electrophoresis (as described in Ref. 19) pGEMEX vector, obtained from Promega (Madison, WI), modified by M. Ziak and R. Jaussi to eliminate a second NdeI site at position 3259 ATP stock solution, 10 mM (Pharmacia) DTT, 100 mM (Bio-Rad, Richmond, CA) T4 ligase, 5 U//zl (Pharmacia) Ligation buffer, 10 x : 20 mM Tris-HCl, pH 7.6, 50 mM MgC12 Spermidine, 10 mM (Sigma)
[8]
cDNA CLONINGBY PCR
109
Reagents for transfection (see Ref. 20) Reagents for sequencing (see Ref. 19) Generation of eDNA The starting point is a tissue or a cell culture that contains a mRNA encoding a protein of interest to be expressed in bacteria. Only limited sequence information of this mRNA is required. Several criteria are important for the evaluation of an optimal RNA isolation procedure. RNA must be protected against degradation by RNase present in tissues and on laboratory material. The yield of purified RNA should be high and reproducible, and the method should be fast and easy. Several companies offer ready-to-use kits for the isolation of total and poly(A) + RNA. We generally obtain good results using a single-step extraction with guanidinium thiocyanate-acidic phenol-chloroform, 21 followed by lithium chloride precipitation. 22
Experimental Procedure RNA Isolation. Fresh or frozen ( - 8 0 °) tissues or cultured cells (100 mg wet weight) are homogenized at room temperature in 1 ml guanidinium denaturing solution using a glass or Teflon homogenizer. To the homogenate, 100 ~1 of a chloroform-isoamyl alcohol mixture is added, followed by vortexing for at least 1 min. This solution is centrifuged at 10,000 g for 20 min at 4 °. The upper phase containing RNA is saved and 1 ml phenol (pH 4.0) and 200/~1 chloroform-isoamyl alcohol mixture are added. This solution is vortexed, followed by centrifugation at 10,000 g for 20 min at 4°. RNA is precipitated from the upper phase by addition of an equal volume of 2-propanol ( - 20°, 1 hr). RNA is collected by centrifugation at 15,000 g for 20 min at 4 ° and redissolved in 300 ~1 guanidinium denaturing solution followed by reprecipitation by adding 2-propanol as described above. The RNA pellet is resuspended in 200 /A of 4 M LiCl to solubilize polysaccharides. The insoluble RNA is pelleted at 10,000 g for 10 min at 4°. This pellet is dissolved in 200 p,1 of TE buffer, followed by addition of 10 IA SDS (10%, w/v) and 200/A chloroform-isoamyl alcohol mixture and centrifugation at 3000 g for 10 rain at 4 °. The aqueous phase is precipitated with 200 ~1 2-propanol and 200 p.l 3 M sodium acetate, pH 4.0. The RNA pellet is dissolved in 50/.d H20 and the optical density at h260 and h280 is 20 D. Hanahan, J. Mol. Biol. 166, 557 (1983). zE p. Chomczynski and N. Sacci, Anal. Biochem. 162, 156 (1987). -'2 C. Puissant and L.-M. Houdebine, BioTechniques 8, 148 (1990).
1 I0
VECTORS FOR EXPRESSING CLONED GENES
[8]
measured. Good-quality RNA has an OD260/280 of 1.6 to 1.9 ( 1 0 D at h260 equals 40 ~g RNA/ml). We generally obtain yields in the range of 150-200 /zg RNA/100 mg of tissue. Notes: To avoid RNase contamination, the use of latex gloves is recommended. Solutions and laboratory equipment should be sterilized, autoclaved, or treated with 0.1 N NaOH followed by rinsing with distilled water. Generally, total or cellular RNA can be directly used for reverse transcription without poly(A) + enrichment. If this is desired, for example, if the mRNA of interest is present in low abundance for special applications, standard oligo(dT) affinity purification protocols as described in Ref. 19 may be applied. Reverse Transcription Reaction. In a final volume of 25/.d the following components are assembled: Reverse transcription reaction buffer (5 x concentrated), 5/.d dNTP stock solution (10 mM each), 2.5/zl RNasin (50 U/ml), 0.25/zl Primer (10/zM), 1 /zl RNA [total cytoplasmic or poly(A)+], 0.1-5 tzg pretreated for 3 min at 70 ° and quenched on ice, 10/zl Reverse transcriptase (Mo-MuLV, cloned) (13 U//zl), 2.5/zl Distilled H20, 3.75/zl The reaction is carried out at 42 ° for 60 min and stopped by adding 25 tzl of hydrolyzing solution. The sample is neutralized by adding 12.5/zl of 1 M Tris-HCl, pH 8.0. The cDNA is phenol extracted by adding 65/xl phenol-dichloromethane mixture (I : 1, v/v) once and the upper phase is washed with 65/xl dichloromethane followed by centrifugation. The cDNA in the upper phase is precipitated after adding 1 M NaCI to a concentration of 100 mM, followed by mixing with 130/~1 ethanol. After cooling at - 2 0 ° for 1 hr the cDNA is collected by centrifugation at 15,000 g for 20 min at 4°. The pellet is washed with 75% (v/v) ethanol and dried, followed by redissolving in TE buffer to a concentration of 1-25/zg cDNA/Izl. Notes: It may be advisable to reduce the primer concentration by a factor of 102 to 103 if a gene-specific primer is used for the reverse transcription of a low-abundance transcript to avoid unspecific priming. For calculation of dNTP incorporation, one of the dNTPs is added in the 3Zp-labeled form as described in Ref. 19. It is not necessary to remove the RNA after reverse transcription if PCR is followed immediately. If cDNA must be stored we recommend alkali treatment as described above. If small amounts of RNA (<0.5/.~g) are used it may be necessary to
[8]
cDNA CLONINGBY PCR
111
precipitate the produced cDNA by the use of 5/zg tRNA (phenol extracted according to Ref. 19). Polymerase Chain Reaction. Analytical PCR is carried out in 10/xl and preparative PCR in 100/xl PCR buffer. A "typical" analytical PCR contains the following components: PCRB (5 x ), 2/zl dNTP stock solution (1 mM each), 2/xl MgCI 2 (15 mM), 1 /zl Primer 1 (10/~M), 1/xl Primer 2 (I0 IxM), 1 /zl Taq polymerase (AmpliTaq, 0.2 U/tzl), 1 tzl Template (0.1-1 ~g cDNA//A TEC buffer), 1 /zl Distilled H20, 1 /zl The samples are covered with a drop of mineral oil. Depending on the abundance of the specific cDNA to be amplified, 20 to 40 cycles are performed. Excessive cycle numbers often lead to a decrease in yield and efficiency. As a standard protocol to generate products smaller than 1000 bp the following conditions are applied: 95 ° melting for 30 sec, 50° annealing for 30 sec, 73 ° synthesis for 1 min. These conditions must be optimized, depending on the properties of the PCR cycler, the length and GC content of the primers, and the expected product length. Three types of PCR (internal, 3' directed, and 5' directed) are described as outlined in Fig. 1. Internal polymerase chain reaction: Two gene-specific primers are used for this classical type of PCR for a single round of PCR. 3'-Directed polymerase chain reaction: The reaction mixture contains, along with the usual components of the PCR mix, a single-stranded cDNA template (in 1/xl TEC buffer) carrying a (dT)25 extension on its 5' end and a gene-specific PCR primer complementary to the template sequence with a restriction site and the nonspecific primer, (dT)25. Typically, PCR is carried out over 30-40 cycles. If no specific PCR products are obtained, a second round of PCR with a second, "nested" gene-specific primer that is placed 3' of the first, gene-specific primer may be carried out. 5'-Directed polymerase chain reaction: For 5'-directed PCR the cDNA must be tailed at its 3' end. We generally use dA for tailing. Conditions should be applied that produce a poly(dA) tail of about 50-100 nucleotides. Ten to 50 ng of single-stranded cDNA is used for the reaction. The Boehringer Mannheim terminal transferase kit contains all the necessary reagents. Conditions indicated in the manual should be applied. Two rounds of PCR are generally required for optimal specificity. In 23 A. P. Feinberg and B. Vogelstein, Anal. Biochem. 132, 6 (1983).
112
VECTORS FOR EXPRESSING CLONED GENES
[8]
the first round, the single-stranded cDNA template (in 1/xl TEC buffer) is a reverse transcript of an mRNA, which is generated by the use of either oligo(dT) or a gene-specific oligonucleotide primer, and which carries a poly(dA) extension on its 3' end, generated by terminal transferase. This template is added to 9/zl of a premix that contains, along with the usual components, a first gene-specific primer (identical to the cDNA sequence) and the nonspecific primer, (dT)zs. Typically, this first round of PCR is carried out over 20 cycles. For the second round of PCR, the products of the first round are diluted 10- to 100-fold with H20, and 1 /zl is transferred to a fresh reaction tube (preloaded with 9/zl of premix) to serve as a new template. This premix contains, along with the usual components, a second, nested gene-specific PCR primer and the nonspecific primer, (dT)25. Typically, the second round is carried out over 25 cycles. Notes: DNA carryover is a major problem in all types of PCR. To reduce carryover contamination it is recommended that the reagents be divided into aliquots to be used only once or twice, that pre- and postPCR operations be separated physically, and that different pipettes be used for pre- and post-PCR work. Ultraviolet (UV) irradiation of PCR reagents (except DNA) may be helpful to prevent DNA carryover. A control PCR in the absence of template is recommended to check for contaminated solutions. In our hands, the use of oligo(dT) with an additional 5' extension of 25 randomly selected nucleotides for reverse transcription 3'- and 5'-directed PCR gives superior product specificity. The sequence successfully used for our experiments is 5'-GCAGCTTGCGACGGTGTCTAGACGC(T)25, carrying an XbaI site at its 5' end. For convenience this oligonucleotide is referred to as oligo(dT) in text. However, when only the 25-nucleotide (nt) 5' extension was used as a primer starting with the second round of the PCR cycle no further increase in specificity was observed. MgCI 2 and dNTP concentrations are critical for obtaining the desired PCR products. These two parameters should be varied (with final concentrations of MgCI2,1-10 mM and dNTP, 50-250/zM) if yield and specificity are not sufficient. In addition, optimizing the annealing temperature may increase PCR efficiency. It is advisable to run control PCRs with a single primer to check specificity. For PCR, different heat-stable polymerases were tested: Taq polymerase AmpliTaq (Perkin-Elmer Cetus), Taq polymerase (Boehringer Mannheim), and Replitherm (Epicentre Technologies, Madison, WI). All gave basically the same results. These polymerases have different Mg 2÷ requirements. Analysis of polyrnerase chain reaction products: The reaction mixtures can be applied directly to polyacrylamide or agarose gels depending on the expected product length. DNA is stained with ethidium bromide and
[8]
cDNA CLONINGBY PCR
1l 3
visualized at 300-nm UV light according to standard procedures.~9 The specificity of PCR products may be tested by Southern blot analysis.~9 Transfer of DNA from polyacrylamide gels (5%, w/v) to nylon membranes is conveniently done by alkaline DNA blotting. To probe for specific products of 3'- and 5'-directed PCR, radiolabeled products of an internal PCR can be used, provided the internal product extends considerably into the sequence delineated by the nested primer used in the second round of PCR. To obtain DNA probes of high specific activities, the random oligonucleotide-labeling method 23 is used. It is highly recommended that PCR products be sequenced before continuing further work. Many different methods exist for sequencing PCR products either directly or after cloning into an appropriate vector (reviewed in Ref. 24). Cloning of Polymerase Chain Reaction Products. The required steps for cloning of PCR products into an expression vector are outlined in Fig. 2. As an example, cloning of the rat parvalbumin cDNA into pGEMEX is shown, mRNA from brain tissue is used as a template for reverse transcription. Preparative PCR (100/xl in two 50-/xl portions) is carried out under standard conditions with the following primers: The upstream primer is 5'-CCCGGATCCAAGTTGCCATATGTCGATG, corresponding to rat parvalbumin cDNA positions 56-8225 with a BamHI site near the 5' end and an NdeI site in the center. The downstream primer is 5'GAGGTCGACGAGCTCGGTACCAAGCAGGCAGGA with a SacI site near its 5' end. The cycler was programmed as follows: 95 ° melting for 40 sec, 50° annealing for 40 sec, 73 ° synthesis for 1 min, 30 cycles. The PCR product is run on an 8% (w/v) polyacrylamide gel. The gel piece with the PCR product of the correct size (689 bp) is then dissected and crushed into small pieces using a Teflon rod. The DNA is eluted with 8 voi of H20 overnight at room temperature on a shaker. Gel fragments are separated by centrifugation for 5 min at high speed, using an Eppendorf microfuge. The pellet is resuspended in 2 vol of H20 and centrifuged as above. Both supernatants are pooled. The DNA is precipitated, using glycogen as a carrier (20 tzg/ml). The DNA is resuspended in TE buffer, pH 8.0 and is digested with NdeI and SacI restriction enzymes. For a detailed description of restriction enzyme digestion, phenol extraction, and ethanol precipitation see Sambrook et al. 19 After digestion and phenol extraction the DNA is ethanol precipitated and resuspended in TE. The NdeI/SacIdigested PCR product is purified by preparative polyacrylamide gel electrophoresis as described above. An aliquot of the purified PCR product is 24 U. B. Gyllenstein, BioTechniques 7, 700 (1989). 25 M. W. Berchtold, P. Epstein, A. L. Beaudet, M. E. Payne, C. W. Heizmann, and A. R. Means, J. Biol. Chem. 262, 8696 (1987).
114
VECTORS FOR EXPRESSING CLONED GENES
[8]
run on a 1-2% (w/v) agarose gel for estimation of the DNA concentration. The pGEMEX vector is prepared as follows: Initially, the vector is digested with NdeI and SacI restriction enzymes. Separation of the pGEMEX vector (3200 bp) from the T7 gene 10 sequence (800 bp) is carried out by 1% (w/v) agarose gel electrophoresis and subsequent GeneClean (B10 101, La Jolla, CA) purification of the 3200-bp fragment. Ligation and transfection: For ligation the NdeI/SacI-digested, truncated pGEMEX vector and the PCR product are mixed with different molar ratios of I : 1, 1 : 2, and 2 : 1 (80 ng : 20 ng, 160 ng: 20 ng, 40 ng: 20 ng). A typical ligation mixture contains the following: Vector/PCR product mix, 8.5 tA Ligation buffer (10x), 1.5 IA Spermidine (10 mM), 1.5/zL ATP (10 mM), 1.5/zl DTT (100 mM), 1.5/zl T4 DNA ligase (5 U//zl), 0.5/xl The ligation mix is incubated at 15° overnight. Ligation mix (7/zl) is used for transfection into Escherichia coli JM 101 according to Hanahan. 2° Colonies are characterized by restriction enzyme mapping. Clones with inserted PCR products are sequenced using the dideoxy-sequencing method according to Ref. 19. Notes: Primers should exceed the restriction site by several bases to ensure effective digestion. The PCR products are purified by polyacrylamide gel electrophoresis because of inhibitory effects of traces of PCR reagents on the NdeI restriction enzyme. Isolation of PCR products by agarose gel electrophoresis and GeneClean causes substantial inhibition of NdeI digestion. Expression of Cloned Polymerase Chain Reaction Products, Protein Quantitation, and Isolation The pGEMEX expression vector from Promega is based on the T7 bacteriophage polymerase/promoter expression system developed by Studier et al. 17 High-level expression of cloned genes in vivo is obtained by an optimized vector/host combination. One major advantage of this system is the stringent specificity of T7 RNA polymerase for its own promoter, which is not utilized by E. coli RNA polymerase. T7 RNA polymerase initiates transcription efficiently and elongation is about fivefold faster in comparison to E. coli RNA polymerase. Furthermore, T7 RNA polymerase is relatively unaffected by the presence of non-T7 transcription terminators and thus is able to produce complete transcripts from almost any DNA linked to a T7 promoter.
[8]
cDNA CLONINGBY PCR
115
p G E M E X Vector This vector was developed by Promega for expressing cloned DNA under the control of the T7 promoter from bacteriophage T7 (Fig. 2). This promoter, along with the ribosome-binding site ofT7 gene I0, is positioned upstream from a T7 gene 10 leader sequence encoding the amino-terminal part of the major capsid protein. A T7 transcription terminator is incorporated downstream from the multiple cloning site in the original cloning procedures. Sequences cloned into pGEMEX vector polylinker sites in the correct reading frame are expressed as T7 gene 10 fusion proteins with a gene 10 product amino-terminal part of 260 amino acids. Alternatively, the gene of interest can also be expressed without a gene 10 fusion part. Taking advantage of an NdeI restriction site at the initiation codon of gene 10, the T7 gene 10 fragment can be directly replaced by any DNA of interest, as long as the new DNA fragment contains a NdeI restriction site (CATATG) at the ATG initiation codon and any restriction site at the 3' end that is compatible with the pGEMEX polylinker. A novel NdeI restriction site, if not present in the DNA, can be introduced conveniently by site-directed mutagenesis using conventional methods or PCR. pGEMEX contains, in addition to the NdeI site at the gene 10 translation initiation site, a second NdeI restriction site at position 3259. The latter site was eliminated by partial digestion of the plasmid and religation after creation of blunt ends (M. Ziak and R. Jaussi, University of Ztirich, Switzerland, personal communication 1991). pGEMEX contains an ampicillin resistance gene for selection of transfected bacteria and the fl origin of replication in order to generate singlestranded DNA for sequencing and mutagenesis. Host Strains for Expression The bacterial hosts for expression are E. coli JM 109 (DE3) [recAl supE44 endAl hsdR17 gyrA96 relA1 thi A(lac/prbAB) F'(traD36 proAB ÷ lacl 9 lacI 9 lacZ AM15)] from Promega and BL 21 (DE3) pLysE [hsds gal (~cIts857 indl Sam7 nin5 lacUV5-T7 gene 1)], kindly provided by Dr. W. Studier (Brookhaven, Upton, NY). Both strains were constructed by cloning T7 gene 1 (encoding T7 RNA polymerase) into the ~ vector D 69 and then integrating this DNA into the chromosome of the two E. coli strains.IV The T7 RNA polymerase gene is under control of the lacUV5 promoter and is therefore inducible by addition of isopropyl-/3-D-thiogalactopyranoside (IPTG) to the culture medium. A basal level of T7 RNA polymerase is expressed in JM 109 (DE3) even in the absence of IPTG, leading to some constitutive expression of the gene of interest. Certain proteins, even when expressed at low levels,
116
VECTORS FOR EXPRESSING CLONED GENES
[8]
may be toxic to the host. To overcome this problem, BL 21 (DE3) pLysE can be used as host strain. Due to the additional pLysE vector this strain produces large amounts of T7 lysozyme, which will bind and inhibit all T7 polymerase produced at a low constitutive level. On IPTG induction, T7 RNA polymerase expression exceeds by far the amounts that are inhibited by the lysozyme present. This leads to transcription of the cloned DNA, which is under the control of the T7 gene 10 promoter in pGEMEX. The presence of pLysE has the further advantage of facilitating the preparation of cell extracts. T7 lysozyme expressed in BL 21 (DE3) pLysE is unable to pass through the inner membrane and therefore cannot disrupt the E. coli cell wall. Treatments that damage the inner membrane (freezethawing or treatment with detergents, e.g., Triton X-100) allow T7 lysozyme to penetrate, causing rapid lysis of cells that contain even small amounts of T7 lysozyme, pLysE confers resistance to chloramphenicol.
Materials and Reagents For Expression of Cloned Polymerase Chain Reaction Products Glycerin stocks for host strains: For long-term storage, 700 #1 of growing or saturated culture is mixed with 100 ~1 of 85% (v/v) glycerol, giving a final concentration of about 10%. Tubes are stored in a - 80° freezer. Bacteria survive for many months in a - 2 0 ° freezer. However, to maintain bacteria for longer periods of time, they should be stored at 80 ° Growth media: LB medium and LB plates are produced according to Sambrook et al. 19Several alternative media are described by Studier ~7 Antibiotics: Antibiotics are added to liquid or solid-growth media with typical concentrations of 20 ~g/ml for ampicillin and 25/zg/ml for chloramphenicol. If agar plates do not contain chloramphenicol, 30 ~1 of a chloramphenicol stock solution (17 mg/ml in ethanol) is plated onto the agar IPTG stock solution: 500 mM in water, sterile filtered Lysis buffer: 50 mM Tris-HCl, pH 8.0, 2 mM NazEDTA, 0.1% (w/v) Triton X-100 Sample buffer, 1 x : 50 mM Tris-HC1, pH 6.8, 2 mM Na2EDTA, 1% (w/v) sodium dodecyl sulfate, 1% (w/v) mercaptoethanol, 8% (v/v) glycerol, 0.025% (w/v) bromphenol blue _
For Quantitation of Polymerase Chain Reaction Products Materials for SDS-polyacrylamide gel electrophoresis (PAGE): See Ref. 19
[8]
cDNA CLONINGBY PCR
117
Coomassie Brilliant blue G-250 (Bio-Rad) Scanning equipment: Laserscan 220 (LKB-Pharmacia, Piscataway, N J) For Recombinant Protein Isolation Reagents for bacterial media, antibiotics, and IPTG: See Materials and Reagents for expression of cloned PCR products Medium for suspension of bacterial culture: 2.4 M sucrose, 40 mM TrisHCI, pH 8.0, 10 mM EDTA Solution for lysis of bacteria: 50 mM N-2-hydroxyethylpiperazine-N'2-ethanesulfonic acid (HEPES)-HCI, pH 8.0, I00 mM KCI, 1 mM EDTA, 1 mM dithiothreitol, lysozyme (100 t~g/ml) (Sigma); dithiothreitol and lysozyme are added just before use Ammonium sulfate: 100% Saturated solution, pH 7.0, adjusted with 5 N NaOH Trichloroacetic acid: 100% (w/v) in H20 Imidazole: 200 mM stock solution, pH 7.0 Dialysis membrane: SpectraPor, No. 3, molecular cutoff Mr 3500 (Spectrum Medical Industries, Los Angeles, CA) DEAE-Sephacel (Pharmacia) Experimental Procedure Protein Expression. Frozen glycerol cultures of JM 109 (DE3) or BL 21 (DE3) pLysE, both containing pGEMEX vector with the insert of interest, are plated on LB agar containing ampicillin or ampicillin and chloramphenicol, respectively. Plates are incubated at 37° to produce single colonies. These colonies are used to inoculate liquid media. Colonies should be stored for no longer than a few days, because of potential damage or loss of pGEMEX during longer periods at 4 °. Single colonies are used to inoculate LB medium containing 20/~g/ml ampicillin as the selective antibiotic [and also 25 pg/ml chloramphenicol if BL 21 (DE3) pLysE is used]. Bacteria are grown at 37° on a shaker. When the culture reaches an OD600 of 0.6-1.5, IPTG is added to a final concentration of 0.4 mM and shaking is continued at 37°. Cells are usually harvested 2-3 hr after induction. This is sufficient for substantial accumulation of recombinant protein and prevents overgrowth of cells that have lost the plasmid or are otherwise unproductive. To stop bacterial growth, the culture is placed on ice followed by purification of the protein of interest. For analysis of the recombinant protein, SDS-PAGE is performed according to Sambrook et al. ~9 In a typical analytical expression experiment bacteria are collected from 1 ml of culture by centrifugation at 5000 g
118
VECTORS FOR EXPRESSING CLONED GENES
18]
for 5 min. The bacterial pellet is resuspended in 100/zl of lysis buffer. After subsequent freezing at - 20° for 30 min and thawing at room temperature for 10 min, 300/xl of 1 × sample buffer is added. Samples are heated for 3-5 min in boiling water and 20 /zl is directly applied to the gel. Generally, this is a sufficient amount for visualizing proteins by staining with Coomassie Brilliant blue (Fig. 3). Notes: The use of freshly grown single colonies from LB plates for expression experiments cannot be overemphasized. Owing to possible instability of the recombinant plasmid it may become lost. Cells that lack the plasmid can rapidly overgrow the culture due to degradation of ampicillin by/3-1actamase that is released into the medium by bacteria containing pGEMEX. If the plasmid is to be maintained in a significant fraction of bacteria, they must never be allowed to grow in the absence of antibiotics. (For a detailed description of problems concerning the loss of plasmids, see Studier et al.17) When the target protein to be expressed may have toxic effects on the host strain, BL 21 (DE3) pLysE should always be used as a host. To maintain the pLysE plasmid, the culture should always be grown in the presence of chloramphenicol. Recombinant Protein Quantitation. Proteins in 20/zl of concentrated E. coli extracts are separated by SDS-PAGE and stained with Coomassie Brilliant blue. The protein concentration of each lane is analyzed by laserscanning densitometry (using Laserscan 220; LKB-Pharmacia). Figures 3 and 4 represent examples of SDS-PAGE and the corresponding scanning profiles of protein extracts from JM 109 (DE3) and BL 21 (DE3) pLysE producing the rat Ca2÷-binding protein parvalbumin. 18 Recombinant Protein Isolation. The procedure for the isolation of recombinant parvalbumin is outlined in Fig. 5. Single colonies of JM 109 (DE3) and BL 21 (DE3) pLysE, both containing the pGEMEX vector with the insert of interest, are used to inoculate 1 liter of LB medium containing 20/~g/ml ampicillin or 20/zg/ml ampicillin combined with 25 /zl/ml chloramphenicol as the selective antibiotics. Bacteria are grown at 37 ° on a shaker. When the culture reaches an OD600 of 0.6-1.5, IPTG is added to a final concentration of 0.4 mM and shaking is continued. Bacteria are harvested 2-3 hr after IPTG induction by centrifugation using a Sorvall (Norwalk, CT) centrifuge (H 6000A rotor) at 4500 rpm. The pellet (approximately 3-4 g) is resuspended in 10 ml of 2.4 M sucrose, 40 mM Tris-HC1, 10 mM EDTA, pH 8.0. The suspension is incubated on ice for 30 min, followed by addition of 40 ml of 50 mM HEPES-HC1, pH 8.0, 100 mM KCI, 1 mM EDTA, 1 mM DTT, and 100/xg/ml lysozyme. Lysis of bacteria is performed at 4° overnight. The lysed bacteria are centrifuged at 47,000 g for 30 min in a Sorvall centrifuge (SS34 rotor), at 4-7 °.
[8]
cDNA CLONINGBY PCR
119
JM 109 (DE3) BL 21 (DE3) pLysE
Mr
A BC
97,400 66,200 45,000 31,000
D E F
AB
C D E F
CoomMsie Gel
21,000 14,400 97,400 66,200 45,000 31,000 21,000
J
Western Blot Analysis
14,400 Fro. 3. Expression of recombinant rat parvalbumin in pGEMEX-PV. Coomassie bluestained acrylamide gels and Western blot analysis of protein extracts are shown for the two E. coli strains JM 109 (DE3) and BL 21 (DE3) pLysE. Lane A, HPLC-purified rat parvalbumin; lane B, low molecular weight standard; lanes C and D, control extracts of host strain without expression vector pGEMEX-PV in the absence (lane C) and in the presence (lane D) of IPTG; lanes E and F, protein extracts of host strain with expression vector pGEMEX-PV encoding rat parvalbumin in the absence (lane E) and in the presence (lane F) of IPTG. Highlevel expression of parvalbumin was observed for both strains. JM 109 (DE3) showed constitutive parvalbumin expression in the absence of IPTG. On IPTG induction parvalbumin production per liter of bacterial culture was further increased and total bacterial protein production was drastically reduced. For BL 21 (DE3) pLysE no parvalbumin expression was detectable with Coomassie staining in the absence of 1PTG. However, using Western blot analysis a faint but parvalbumin-specific signal was observed, indicating some marginal parvalbumin expression in the absence of IPTG. On IPTG induction parvalbumin expression was highly increased,
The clear supernatant is heated rapidly in a boiling water bath at 65-80 ° for 5 min, and then cooled immediately on ice. The denatured proteins are removed by centrifugation at 47,000 g for 30 min at 4-7 °. The supernatant is cooled on ice and 40 ml of 100% saturated ammonium sulfate (pH 7.0) is slowly added to attain a final saturation of 45%. Slow stirring is continued for 1 hr (or overnight). The precipitated proteins are removed by centrifugation at 47,000 g for 15 min at 4-7 °. The parvalbumin-containing supernatant is placed onto an ice water bath and proteins are precipitated by adding slowly a onesixth volume of 100% trichloroacetic acid under constant stirring. Precipi-
120
VECTORS FOR EXPRESSING CLONED GENES + IPTG
- IPTG
Mr
[8]
14,400
45,000
14,400
45,000
I
I
I
I
ILl ~Z W
(5
OZ.
l
JM 109 (DE3) I
IM
0 Q. 4-
> X
IM II/
O Q. t
BL 21 (DE3) pLYS E
> W
÷ __.I!II]IIILI
FIG. 4. Quantitation of recombinant rat parvalbumin expression. SDS gels from Fig. 3 with total bacterial extracts of both JM 109 (DE3) and BL 21 (DE3) pLysE were analyzed using laser-scanning densitometry (laser scan 220, LKB-Pharmacia). JM 109 showed some moderate parvalbumin production of 6-7% in the absence of IPTG and 25-30% in the presence of IPTG with respect to total bacterial protein. In contrast, BL 21 (DE3) pLysE showed no parvalbumin expression in the absence of IPTG, whereas on IPTG induction PV production was 9-12% of total bacterial protein. Using different concentrations of HPLCpurified rat muscle parvalbumin [M. W. Berchtold, C. W. Heizmann, and K. J. Wilson, Anal. Biochem. 129, 120 (1983)] as a standard, JM 109 (DE3) and BL 21 (DE3) pLysE showed a maximal parvalbumin production of 100-140 and 50-70 mg, respectively, per liter bacterial culture.
[8]
c D N A CLONING BY P C R
1 I bacterial culture
A
B C
121
DE
F G
lysis (lysozyme) (over night) supernatant
heat step o (5min., 65-80 C) supernatant
1 ,1
45% (NH~O4 precipitation
supernatant
DEAE-Sephacel 0-200 mM NaCI
parvalbumin immunoreactive peak at 70-80 mM Yield: 25 mg parvalbumin FI6.5. Purification of recombinant rat parvalbumin. In a four-step procedure parvalbumin was purified, taking advantage of its strong heat stability, which is typical for many high affinity hand Ca2+-binding proteins. Trichloroacetic acid precipitation of the 45% saturated ammonium sulfate supernatant was found to be necessary for the binding of parvalbumin to the following DEAE-Sephacel column. Lane C shows the protein composition of total bacterial extract of JM 109 (DE3) pGEMEX-PV after 3 hr of IPTG induction. Lanes D-G represent the protein compositions during subsequent purification steps. Lane A, rat muscle parvalbumin; lane B, low molecular weight standard; lane C, whole bacteria extract; lane D, lysate supernatant; lane E, heat step supernatant; lane F, 45% saturated ammonium sulfate supernatant: lane G, parvalbumin elution peak from DEAE-Sephacel.
tation is continued for 1 hr. The parvalbumin-containing precipitate is collected by centrifugation at 10,000 g (Sorvall GSA rotor) for 30 min, at 4-7 °. The protein pellet is resuspended slowly with 10 ml of 20 mM imidazole buffer (pH 7.0) on a roller shaker at 4° for several hours. The pH is readjusted to pH 7.0 several times with 5 N NaOH. This solution is dialyzed against I00 vol of 20 mM imidazole, pH 7.0, overnight using a SpectraPor dialysis membrane (No. 3, M r c u t o f f 3500). The dialysis buffer is exchanged four times. The dialyzed proteins are loaded onto a DEAESephacel ion-exchange chromatography column (20-ml total volume), preequilibrated with 20 mM imidazole, pH 7.0. For protein elution a linear
122
VECTORS FOR EXPRESSING CLONED GENES
[8]
salt gradient of 0-200 mM NaC1 is used. Parvalbumin immunoreactive fractions are identified using a dot-blot immunoassay :6 with antibodies directed against rat muscle parvalbumin. Parvalbumin elutes at approximately 70-80 m M NaCI. A final yield of 25 mg parvalbumin per liter of bacterial culture is obtained. Notes: Supernatants of subsequent purification steps can be frozen at - 2 0 ° at any time and purification continued at a later time point. Conclusions This chapter describes the detailed methodology for bacterial expression and isolation of heterologous proteins in E. coli. To carry out the described techniques a tissue or cell culture that expresses a gene of interest is required. In addition, a limited amount of sequence information must be available, the minimal requirement being the sequence of a short segment of the protein that allows one to deduce the nucleotide sequence, which is a mixed population of defined sequences owing to codon degeneracy. Initially, the 3' end of a cDNA is amplified by PCR and the PCR product sequenced. This results in a specific cDNA sequence that can be used to generate new oligonucleotides for 5' cDNA amplification. The coding region of the cDNA can then be PCR amplified directly by using the complex mixture of mRNA as a template. Oligonucleotides for this step are designed for convenient cloning directly into the ATG translation start codon of the highly expressed vector gene, which is inducible by IPTG. In conclusion, we present a fast and efficient laboratory protocol for PCR amplification of cDNA, followed by expression, quantitation, and isolation of heterologous proteins, starting with a tissue or cell culture that produces a protein of interest. Acknowledgments This work was supported by Swiss National Foundation Grant 31-28847.90 and Swiss Cancer League Grant 406.89.1. T. M. J. Leu, (Massachusetts Institute of Technology, Cambridge, MA) is acknowledged for advice on PCR as well as for critical reading of the manuscript. We thank M. Ziak and R. Jaussi for their gift of a modified pGEMEX vector and F. W. Studier for several bacterial strains. M. W. B. is supported by a fellowship for independent researcher from the Cloetta Foundation, Zurich.
26 H. Towbin, T. Staehelin, and J. Gordon, Proc. Natl. Acad. Sci. U.S.A. 76, 4350 (1979).
[9]
PREPARATIVE-SCALE
GENE
EXPRESSION
123
[9] G e n e E x p r e s s i o n in C e l l - F r e e S y s t e m o n Preparative Scale
By
VLAD1MIR I. BARANOV a n d A L E X A N D E R S. SPIRIN
Various cell-free systems of protein synthesis and gene expression have been described repeatedly in this series. 1-8 Virtually all of them are based on a crude cell extract (the so-called $30) or a combination of isolated ribosomes and ribosome-free extract (S100) incubated in a test tube with a fixed volume for a short time (up to 1 hr, rarely a few hours). Cell-free translation systems use isolated mRNA or synthetic polynucleotides as templates for proteins or polypeptides to be synthesized. Cellfree coupled transcription-translation systems exploit DNA fragments, plasmids, or isolated genes, which are transcribed by the endogenous R N A polymerase of the bacterial extract coupled with translation of the transcript by ribosomes. Routinely the protein synthesis is recorded by radioactive amino acid incorporation. Specific proteins synthesized can be assayed by their enzymatic or other biological activity, or by reaction with antibodies. The yield is low, so that the systems cannot be used for preparative purposes. Instead of using the batch process in cell-free systems, the continuousflow principle can also be utilized.9 In this case a feeding solution containing amino acids, ATP, and GTP is continuously passed through the incubation mixture, limited by an ultrafiltration membrane. The product is continuously removed from the incubation mixture because it passes through the membrane, while the components of the protein-synthesizing machinery are retained. It proves that the continuous-flow cell-free (CFCF) sysi M. W. Nirenberg, this series, Vol. 6, p. 17. 2 L. M. Gold and M. Schweiger, this series, Vol. 20, p. 537. 3 S. M. Heywood and A. W. Rourke, this series, Vol. 30, p. 669. 4 A. Marcus, D. Efron, and D. Weeks, this series, Vol. 30, p. 749. s W. C. Merrick, this series, Vol. 101, p. 606. 6 E. C. Henshaw and R. Panniers, this series, Vol. 101, p. 616. 7 C. W. Anderson, J, W. Straus, and B. S. Dudock, this series, Vol. 101, p. 635. s H.-Z. Chen and G. Zubay, this series, Vol. 101, p. 674. 9 A. S. Spirin, V. I. Baranov, L. A. Ryabova, S. Y. Ovodov, and Y. B. Alakhov, Science 242, 1162 (1988).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
124
VECTORS FOR EXPRESSING C L O N E D GENES
[9]
tems can work for many hours with constant activity, giving preparative yields of protein products. Reactors
Amicon 8MC Microultrafiltration System The simplest device to realize the continuous-flow process for cellfree translation or coupled transcription-translation is the commercial instrument, Amicon (Danvers, MA) 8MC. This instrument must be placed in a thermostat-controlled box to maintain the temperature of incubation in the ultrafiltration chamber. The incubation mixture containing ribosomes, template polynucleotide, tRNAs, and all necessary protein factors and enzymes is put into the chamber. The type of ultrafiltration membrane, from PM10 or XM30 to YM100 or XM300 (Amicon), is selected depending on the size of polypeptide synthesized, in order to allow it to pass through the membrane. From the beginning of incubation a feeding solution containing substrates (amino acids and nucleoside triphosphates) in a corresponding buffer is pumped into the chamber. The reservoir with the feeding solution is kept cold (in ice or in a refrigerator box nearby). The filtrate containing the polypeptide product is pumped out at the same rate, into a fraction collector placed in the cold. If the volume of the incubation mixture is 1 ml, the flow rate must be 1 to 3 ml/hr. Gentle stirring proceeds during incubation. The process can be continued for 20 to 100 hr. A diagram of the process is shown in Fig. 1. It is important that the incubation mixture be kept sterile. Sterilized water must be used for preparation of all buffers and mixtures. A sterilization filter is recommended on the line from the feeding solution reservoir to the incubation chamber. The presence of NaN3 is desirable in the feeding solution. To prevent oxidation processes from occurring during incubation, the pressure of an inert gas (e.g., He2) can be established in the incubation chamber and in the feeding solution reservoir. This pressure (about 0.5 to 2 additional atmospheres) can be used instead of the force pump. The most serious technical problem in this system is the maintenance of a constant volume of the incubation mixture throughout the process. For this purpose the rates of pumping in and pumping out must be precisely adjusted. In the course of the process, however, the membrane may be partially clogged and thus the rate of filtration can be changed (slowed down), resulting in the influx exceeding the outflux. Therefore, the pumps must be periodically readjusted.
[9l
PREPARATIVE-SCALE GENE EXPRESSION
t Fee~incj s o l u t i o n : i . . Amino•acids." • ATP ...: .'." "GTP " . • Buffer-.". •
.
.
•
~ • "
•
.
.
,
'"".
.
.
•
.
125
.
ULTRAFILTRATION MEMBRANE
: : .i
~V._2
FORCEPUMP
I POM;©
OUTLET
PRODUCT F1G. 1. Scheme of bioreactor for translation based on Amicon 8MC microultrafiltration system.
For technical reasons it is convenient to modify the cap (upper lid) of the incubation chamber in such a way that the feeding solution enters the chamber from the top, not from the bottom.
Upflow Ultrafiltration Column System Another device for CFCF systems is based on a chromatography microcolumn equipped with an ultrafiltration membrane at the outlet and a standard column adaptor at the inlet (Fig. 2). The column is waterjacketed, thus providing easy temperature control. The volume of the incubation mixture in the column is set by the adaptor, so that no air layer exists and no problems with maintaining the volume constancy arise. The column is positioned "upside down," that is, the membrane is up and the adaptor is down. Thus the lighter feeding solution enters the heavier incubation mixture from the bottom and results in convectional intermixing; no stirring is required. The system needs just one pump.
126
[9]
VECTORS FOR EXPRESSING CLONED GENES
Feeding solution:
. ..'i.' . '"
i.
..
' i
Amino acids ATP
GTP
.' • . • .......,
~
! • Buffer .". ,. . i . ] " . " ' " " ' ". ' ~ .I
Ultrafiltration membrane
I~-"-~Cell-free
system
i
['....i....
". '..'.
? ~y_.J PUMP
PRODUCT
FIG. 2. Scheme of bioreactor for translation based on upflow ultrafiltration column system.
Materials and Reagents Plasmid DNA Isolation Plasmid DNA is prepared by the alkaline extraction method ~° with subsequent gel filtration through Sephacryl S-1000. The method based on plasmid DNA precipitation by polyethylene glycol (PEG)-6000 H is also acceptable. Plasmid DNA is stored frozen at - 2 0 ° in TE buffer [10 mM Tris-HC1, pH 8.0, 0.1 mM ethylenediaminetetraacetic acid (EDTA)]. mRNA Preparation Phage. MS2 RNA, brome mosaic virus (BMV) RNA 4, and globin mRNA are isolated according to published procedures, lz-~4Other mRNAs l0 H. C. Birnboim, this series, Vol, 100, p. 243. II R. Treissman, Cell 43, 889 (1985). 12H. O. Voorma, R. Benne, and T. J. A. den Hertog, Eur. J. Biochem. 18, 451 (1971). 13j. D. Stuhbs and P. Kaesberg, Virology 33, 385 (1967). 14A. W. Nienhucs, A. K. Falvey, and W. E. Anderson, this series, Vol. 30, p. 621.
[9]
PREPARATIVE-SCALE GENE EXPRESSION
127
can be prepared by in vitro transcription as described.~5 mRNAs are stored as ethanol precipitates at - 2 0 °. Cell Extract Preparation There are no special requirements for preparation of cell extracts or purified components of cell-free translation systems. Different versions of cell-free extracts may be used. Commercially available extracts are also acceptable. The extracts with a high synthetic capacity, low nuclease activity, and low background of endogenous template translation must be selected. Procedures described in this series may be exploited for preparation of Escherichia coli $30 extracts,8 bacterial 70S ribosomes and SI00 extracts, 2~6 wheat germ extracts, 7 or rabbit reticulocyte lysates) The extracts are stored at - 7 0 °.
Procedures and Results The yield of CFCF systems depends on various factors; such as the synthetic capacity of the cell-free extract used, the expressivity of the template (plasmid DNA, isolated gene, or mRNA), and the solubility of the polypeptide product. Ionic conditions, especially proportions of divalent ( M g 2+) and monovalent (K + and/or NH4 +) ions, are also essential. It should be emphasized, however, that the ionic concentrations used in the examples described below are optimal for each given template; the synthesis of other specific polypeptides in the cell-free systems may require adjustment for optimization. The procedures and results of gene expression in the CFCF systems are illustrated by the following examples. Continuous-Flow Cell-Free Translation Systems In contrast to standard cell-free translation systems, in which saturating amounts of mRNA are generally used, limiting amounts of mRNA in CFCF translation systems are recommended. The excess of mRNA over ribosomes in the incubation mixture may decrease the activity of the system, probably due to degradation of the excess mRNA by endogenous nucleases and competition among RNA fragments for ribosomes. t5 D. A. Melton, P. A, Krieg, M. R. Rebagliati, T. Maniatis, and K. Zinn, Nucleic Acids Res. 12, 7035 (1984). ~6G. H. Chambliss, T. M. Henkin, and J. M. Leventhal, this series, Vol. 101, p. 598.
128
VECTORS FOR EXPRESSING CLONED GENES
[9]
Experiment 1: Synthesis of MS2 Coat Protein in Escherichia coli System 9 Stock solutions Ribosomal buffer (RB): 20 mM Tris-HCl, pH 7.4, 100 mM NH4C1, 10 mM MgCI 2, I mM dithiothreitol (DTT), 0. I mM EDTA (total volume, 100 ml). Store frozen in 5-ml aliquots at - 2 0 ° Salts buffer, 10 × (10 × SB): 160 mM Tris-HCl, pH 7.4, 800 mM NH4 C1, 80 mM MgC1z, 0.8 mM EDTA, 0.2% (w/v) NaN 3 (total volume, 10 ml). Store frozen in 1-ml aliquots at - 2 0 ° Master mixture, 10 x (10 x MM): 50 mM phosphoenol pyruvate (PEP); 10 mM ATP, 2 mM GTP, 8 mM DTT, 0.4 mM folinic acid (total volume, 10 ml). Store frozen in 1-ml aliquots at - 2 0 ° Protein inhibitors mixture, 20 × (20 × PIM): 0.002 mg/ml aprotinin, 0.002 mg/ml leupeptin, 0.002 mg/ml chymostatin (total volume, I ml). Store frozen in 0.05-ml aliquots at - 2 0 ° Mixture (40 x ) of 19 amino acids without leucine (40 × AA-L~u), 1 mM each. Solution of 40 x AA -Leu in water is stored frozen at - 2 0 ° Low-activity radioactive [3H]leucine (LR[3H]Leu), 1.25 mM (specific activity, 0.52 Ci/mmol). Solution of LR[3H]Leu in water is stored frozen at - 20 ° Pyruvate kinase (PK), 1 mg/ml (specific activity, 500 U/rag). Solution in 50% (v/v) glycerol is stored at - 2 0 ° Human placenta ribonuclease inhibitor (HPRI), 25,000 U/ml: Solution in 50% (v/v) glycerol is stored at - 2 0 ° Total tRNA from E. coli (tRNA), 30 mg/ml: Solution of tRNA in water is stored frozen in 0.02-ml aliquots at - 2 0 ° Phage MS2 RNA (MS2): Store in small aliquots as an ethanol precipitate at - 20 °. Before use the RNA precipitate is centrifuged and the pellet is dissolved in water to a final concentration of about 1 mg/ml 70S ribosomes (70S), 32.2 mg/ml: Solution in RB buffer is stored frozen in 0.05-ml aliquots at - 7 0 ° S100 ribosome-free extract from E. coli (S100), 10 mg/ml: Solution in RB buffer is stored frozen in 0.1-ml aliquots at - 7 0 °
Incubation procedure 1. Assemble the bioreactor using an Amicon PM30 ultrafiltration membrane. Adjust the temperature of the reaction chamber to 37°. Wash the reactor and tubings by passing 20 ml RB buffer containing 0.02% (w/v) NaN3 through the whole assembled system at a flow rate of 20 ml/hr.
[9]
129
PREPARATIVE-SCALE GENE EXPRESSION
2. Thaw stock solutions on ice and prepare the incubation mixture and the feeding solution as follows, in the sequence as tabulated below. Stock solutions
I n c u b a t i o n mixture (ml)
F e e di ng solution (ml)
Doubly distilled H20 40 × A A - L e u 10 x MM 10× SB 20 × PIM PK HPRI tRNA RB 70S SI00 LR[3H]Leu MS2 Total v o l u m e
0.416 0.025 0.100 0.100 0.050 0.007 0.002 O.O20 0.050 0.050 0.100 0.020 0.060 1.000
15.15 0.75 3.00 3.00 1.50 ---6,0 --0.60 -30.00
Thus, 1 ml reaction mixture contains 0.6 nmol (1.6 mg) of 70S ribosomes, 1 mg of S100 protein, 0.6 mg of total tRNA, 0.06 nmol (60/xg) of MS2 phage RNA, 7/xg of pyruvate kinase with a specific activity of 500 U/mg, 50 activity units of human placenta ribonuclease inhibitor, and 0.1/xg each of aprotinin, leupeptin, and chymostatin. Both the incubation mixture and the feeding solution contain 20 mM Tris-HCl, pH 7.4, 100 mM NH4CI, 10 mM MgC12, 1 mM DTT, 40/xM folinic acid, 0.1 mM EDTA, 0.02% (w/v) NaN 3 , 1 mM ATP, 0.2 mM GTP, 5 mM phosphoenol pyruvate, 25 /xM [3H]leucine (specific activity, 0.52 Ci/mmol), and 25/~M each of the other 19 amino acids (Table I, experiment 1). 3. Place the reservoir with the feeding solution in the cold (4°) and connect it with the force pump. Fill the pump and tubings with the feeding solution. 4. Keep the incubation mixture for 5 rain at 37° and then put it into the reaction chamber. Pump the feeding solution through the reaction chamber with a flow rate of I ml/hr. 5. Collect the filtrate with a fraction collector (e.g., fractions of 1 ml each) and analyze the fractions. The results of the experiment are shown in Fig. 3. The incorporation of radioactivity into the product synthesized is analyzed by hot trichloroacetic acid precipitation of 0.5-ml aliquots from each fraction. The product is synthesized linearly over 20 hr at 37°. The yield of MS2 coat protein is about 0.1 mg (6 nmol) from 1 ml of incubation mixture, corresponding to
130
VECTORS F O R E X P R E S S I N G C L O N E D G E N E S
[9]
TABLE I COMPOSITION OF INCUBATION MIXTURES AND FEEDING SOLUTIONS FOR C F C F SYSTEMS Experiment Components Incubation mixture only 7 0 S r i b o s o m e s f r o m E. coli (nmol/ml) SI00 ribosome-free extract f r o m E. coli ( m g / m l ) $ 3 0 e x t r a c t f r o m E. coli
1
2
3
4
0.6
.
.
.
.
1.0
.
.
.
.
5
6
m
--
--
--
50
50
(Az60/ml) $30 extract from wheat
--
17
--
--
--
17
e m b r y o s (A260/ml) Rabbit reticulocyte lysate
--
--
200
--
--
--
(A415/ml) T o t a l t R N A f r o m E. coli
0.6
--
--
0.2
0.5
0.06 ----
. 0.1 ---
(mg/ml) MS2 phage RNA (nmol/ml) BMV RNA 4 (nmol/ml) G l o b i n m R N A (/xg/ml) Plasmid pDF34 DNA with gene encoding DHFR (/zg/ml) Plasmid pSP65 DNA with gene encoding DHFR (/xg/ml) Plasmid pSP65 DNA with gene encoding CAT (/zg/ml) SP6 RNA polymerase [ ( U / m l ) × 10 -3] Creatine kinase (U/ml) Pyruvate kinase (U/ml) HPRI (U/ml) A p r o t i n i n (/xg/ml) C h y m o s t a t i n (/xg/ml) L e u p e p t i n (/~g/ml) P e p s t a t i n (/xg/ml) Feeding mixture HEPES, pH 7.6 (mM) T r i s - a c e t a t e , p H 8.2 ( m M ) Tris-HC1, pH 7.4 (mM) NH4CI (mM) Potassium acetate (raM) CaCI2 ( r a M ) Magnesium acetate (mM) MgC12 ( m M )
.
.
. -6.0 --
.
.
.
.
.
-3.5 50 0.1 0.1 O. 1 --
.
. 22.5 . 50 0.1 . O. 1
.
.
40 -. . 112
--10
--
17.5 . 50 -. --
100
2
2
2
--
--
22.5
17.5
---
25
25 0.1
25 0.1
0.1 0.1
0.1 0.I
. 0.1
. --
O. 1
--
0.1
25 --
-55
50 --
40
25
76
100
112
100
. .
. .
150 --
9.5
1.0
.
50
--
. .
1.9
.
----
.
.
0.1
--20 100 --
--150
100
.
400
.
.
.
7
.
11
-14
1.5
1.5
.
(continued)
[9]
PREPARATIVE-SCALE GENE EXPRESSION
13 l
TABLE I (continued) Experiment Components Feeding mixture (continued) Spermidine ( m M ) DTT EDTA
(raM) (mM)
Folinic acid Glycerol [ % PEG-6000
I
2
3
4
5
6
7
--
0.25
0.60
--
0.05
0.25
0.60
1.0
6.0
1.2
4.0
4.0
4.0
0.1
--
--
--
0.1
--
--
--
--
1.5
(/xM)
40
--
--
10
20
(v/v)]
--
1.5
--
--
--
[% (w/v)]
--
--
--
1.6
--
1.5
--
--
--
Hemin ( / z M ) NaN3 ( % ) ATP ( r a M ) CTP ( m M ) GTP ( r a M )
--
--
20
--
--
--
20
0.02
--
--
0.02
0.02
--
--
1.0
2.0
1.0
0.8
1.0
1.0
1.0
--
--
--
0.8
0.4
0.4
0.4
0.2
0.05
0.2
0.8
0.4
0.4
0.4
UTP
--
--
--
0.8
0.4
0.4
0.4
6.0
10.0
(mM)
Creatine phosphate ( m M ) Phosphoenol pyruvate ( m M ) 1 9 amino acids ( - L e u ) (/zM) Low-labeled [ 3 H ] L e u ( / z M ) 1 9 amino acids ( - M e t ) (/zM) Low-labeled [ 3 5 S ] M e t ( / x M )
--
8.0
10.0
--
--
5
--
--
5
10
--
--
25
25
--
100
--
--
--
25
25
--
--
--
--
--
40
--
40
40
40
--
--
40
--
40
40
40
100
about 100 copies of the polypeptide synthesized per copy of MS2 RNA (Table II, PM30). Polyacrylamide gel electrophoresis analysis 17 of the filtrate reveals that the phage coat protein, stained by Coomassie G250, is a predominant polypeptide band. Experiment 2: Synthesis of Brome Mosaic Virus Coat Protein in Wheat Germ System 9 Similar results are obtained with brome mosaic virus (BMV) RNA 4 translation in the wheat embryo extract (Fig. 4). All procedures are the same as described in experiment 1. Composition of the incubation mixture and feeding solution is summarized in Table I, experiment 2. The reaction chamber is equipped with an Amicon XM50 ultrafiltration membrane. One milliliter of incubation mixture is used. The flow rate of the feeding solution is 1 ml/hr at 27 ° (Table II, XM50). Protein synthesis is monitored over 20 hr. The total protein yield is about 0.2 mg (I0 nmol). The product is visualized by Coomassie G250 staining as a predominant 20-kDa polypeptide band in the gel electrophoresis slab. 17 U. K. Laemmli, Nature (London) 227, 680 (1970).
--
132
VECTORS FOR EXPRESSING CLONED GENES
[9]
7.5 o
E "" ~E
I00
•a ~. 5.o
g8 ._. 09
50
0
I
I
I0
20
Time,
hrs
FIG. 3. Kinetics of MS2 coat protein synthesis in the E. coli CFCF translation system. (Inset) Electrophoretic pattern of translation products.
Experiment 3: Synthesis of Globin in Rabbit Reticulocyte System 18 The application of the same flow principle for the translation of isolated globin mRNA in the commercially available micrococcal nuclease-treated rabbit reticulocyte lysate (Amersham, Buckinghamshire, England) was previously demonstrated. ~8 Composition of the incubation mixture and feeding solution is presented in Table I, experiment 3. The reaction chamber is equipped with an Amicon XM100 ultrafiltration membrane. Onehalf milliliter of incubation mixture is used. In this experiment the flow rate is increased to 3 ml/hr. This results in a protein yield of I00 nmol or 2 mg of the product from a 0.5-ml incubation mixture after I00 hr (Table II, XM100). In this experiment Coomassie staining of the gel could not give quantitative information due to an excess of endogenous globin. Therefore, after electrophoresis the synthesized product is visualized by autoradiography. Again, only one main band corresponding to globin contains radioactive material. r8 L. A. Ryabova, S. A. Ortlepp, and V. I. Baranov, Nucleic Acids Res. 17, 4412 (1989).
[9]
133
PREPARATIVE-SCALE GENE EXPRESSION
"5 E
,oilo -t
;2oo
20.I
4.4
--
"~ ca. o3
I00 o O_
0
I0
0
Time, hrs FIG. 4. Kinetics of BMV coat protein synthesis in the wheat germ CFCF translation system. (Inset) Electrophoretic pattern of translation products.
Continuous-Flow Cell-Free Coupled Transcription-Translation System (with Endogenous RNA Polymerase) The CFCF translation systems described above require isolated individual mRNAs. An alternative approach makes use of the coupled transcription-translation in a cell-free extract. Bacterial extracts are known to contain a DNA-dependent R N A polymerase necessary for transcription. The application of the flow-through principle to the coupled transcription-translation system using the endogenous RNA polymerase and exogenous DNA (gene or plasmid) has the advantages of the CFCF translation systems, resulting in the production of preparative amounts of proteins. A system of this kind, however, is limited by the use of bacterial extracts.
Experiment 4: Synthesis of Dihydrofolate Reductase and fl-Lactamase in Escherichia coli System 19 Figure 5 demonstrates the DNA-directed synthesis of both/3-1actamase (Bla) and dihydrofolate reductase (DHFR) in the CFCF coupled transcription-translation system based on the nucleic acid-free E. coli $30 extract. 19 V. I. Baranov, I. Y. Morozov, S. A. Ortlepp, and A. S. Spirin, Gene 84, 463 (1989).
134
[9l
VECTORS FOR EXPRESSING CLONED GENES T A B L E II MEMBRANES, PARAMETERS, AND YIELDS IN C F C F SYSTEMS Amicon ultrafiltration membrane
Parameter
PM30
XM50
Volume of incubation mixture (ml) Temperature (°C) Time of operation (h) Flow rate (ml/hr) Yield (mg) MS2 phage coat protein BMV R N A 4 coat protein Globin (/3-Lactamase + D H F R ) DHFR CAT Efficiency of system (ttg product) per hour per milliliter of incubation mixture Specific activity (U/~mol)
1.0
1.0
0.5
37 20 1.0
27 20 1.0
30 100 3.0
0. l ---. . 5
. 0.2 ---
.
.
XM100
.
. 10
.
.
YM100
XM300
1.0
0.5
0.5
0.5
37 50 2- 3
37 24 1.5
24 24 1.5
34 35 1.5
. .
. .
. 0.22 .
40
.
YM100
. . 2.0 -.
.
XM100
. 4.4
.
. .
.
. .
-0.011
. -0.09
0.9
7.5
.
14
--0.06 3.5
25
Plasmid pDF34, carrying the two corresponding genes, s° is expressed for 50 hr at 37°. The reaction chamber is equipped with an Amicon XM100 ultrafiltration membrane (Table II, XM100). One milliliter of incubation mixture is used. The feeding solution containing all 4 nucleoside triphosphates and 20 amino acids (Table I, experiment 4) is passed through the incubation chamber with a variable flow rate. The synthesis rate directly depends on the flow rate: the switch from 3 to 2 ml/hr decreases the synthesis rate more than twofold, and the subsequent switch from 2 to 3 ml/hr restores the synthesis rate. The total protein yield is more than 0.2 mg. Only two bands corresponding to fl-lactamase and dihydrofolate reductase are detected in approximately equimolar amounts by polyacrylamide gel electrophoresis and subsequent fluorography.
Continuous-Flow Cell-Free Transcription-Translation Systems with Phage (SP6 or T7) RNA Polymerase There are several limitations in the use of the endogenous RNA polymerase of bacterial extracts. Most of them are caused by problems of transcriptional regulation, proper promoters, termination of transcription, 20 N. V. Murzina and A. T. Gudkov, Protein Eng. 3, 709 (1990).
135
P R E P A R A T I V E - S C AGENE L E EXPRESSION
[9]
300 ¢0 o
E~ 4
200
N O
IO0 13..
"5 i
t3 l/h o
I
I
I
20
40
60
Time, hrs FIG. 5. Kinetics of expression of/3-1actamase and dihydrofolate reductase-encoding genes in the E, coli CFCF system with endogenous RNA polymerase. (Inset) Electrophoretic pattern of translation products.
and so on. As a rule, a complete circular plasmid with the gene of interest, a selectable marker gene, and all the necessary regulatory elements are involved. The selection gene is also transcribed and translated. For example, in experiment 4 the gene of interest (fol), encoding dihydrofolate reductase, was expressed together with the selection gene (bla) coding fl-lactamase. In addition, as mentioned above, such a system is applicable only to bacterial extracts. The next experiments demonstrate that these limitations may be overcome by the use of the CFCF transcription-translation systems with an exogenous bacteriophage RNA polymerase instead of an endogenous cellular RNA polymerase. Phage SP6 or T7 RNA polymerases are the most widely used now for the in vitro synthesis of mRNA by transcription from plasmid DNA or synthetic genes. A set of commercially available vectors containing promoters for these polymerases, such as pSP65, pSP73, or pGEM, have been constructed from E. coli plasmids. It has been found that both T7 and SP6 polymerases can efficiently transcribe mRNA from the DNA plasmid in the CFCF systems, utilizing both pro-
136
VECTORS FOR EXPRESSING CLONED GENES
[9]
karyotic and eukaryotic extracts (V. I. Baranov, L. A. Ryabova, O. B. Yarchuck, and A. S. Spirin, 1990, unpublished observations). Hence, instead of preparing mRNA one can use the DNA plasmid directly for preparative gene expression in the CFCF systems based on cell-free extracts from different types of cells.
Experiment 5: Synthesis of Dihydrofolate Reductase in Escherichia coli Continuous-Flow Cell-Free Transcription-Translation System Plasmid pSP65 containing the bla gene under the control of the E. coli RNA polymerase promoter and DHFR gene under the control of the SP6 promoter, kindly provided by Drs. N. V. Murzina and A. T. Gudkov (Institute of Protein Research, Russian Academy of Sciences). The reaction chamber is equipped with an Amicon YM100 ultrafiltration membrane. A 0.5-ml aliquot of incubation mixture containing the SP6 RNA polymerase is used. The feeding solution contains all 4 nucleoside triphosphates, 20 amino acids, and rifampicin, the inhibitor of bacterial RNA polymerases (Table I, experiment 5). The flow rate of the feeding solution is 1.5 ml/hr at 37 °. The protein synthesis is monitored over 24 hr (Fig. 6). The total protein yield is about 0.01 mg (0.6 nmol). One main band corresponding to DHFR may be detected by electrophoretic analysis with subsequent autoradiography. In parallel, the enzyme activity is measured 2a as well. The specific activity of DHFR is about 14 U//xmol (Table II, YM100).
Experiment 6: Synthesis of Dihydrofolate Reductase in Wheat Germ Continuous-Flow Cell-Free Transcription-Translation System Figure 7 illustrates the expression of the plasmid pSP65 containing the gene encoding DHFR under the control of the SP6 promoter in the wheat embryo extract supplemented with SP6 RNA polymerase (Table I, experiment 6). The reaction chamber is equipped with an Amicon YM100 ultrafiltration membrane. A 0.5-ml aliquot of incubation mixture is used. The flow rate of the feeding solution is 1.5 ml/hr at 24° (Table II, YM100). Protein synthesis is monitored over 24 hr. The total protein yield is about 0.09 mg (5 nmol). One main band corresponding to DHFR is detected by electrophoretic analysis with subsequent autoradiography. In parallel, the enzyme activity is measured 21 as well. The specific activity of DHFR is about 25 U/tzmol. 2J D. P. Baccanari and S. S. Joyner,
Biochemistry 20, 1710 (1981).
[9]
137
PREPARATIVE-SCALE GENE EXPRESSION
kOa 97.468,0
-
0.6
10 DHFR
o - -
184 -
~
t~ .-a
0.4
EL
0.2
I
I
I
5
I0
15
,
I
20
Time, hrs FIG. 6. Kinetics of expression of dihydrofolate reductase-encoding gene in the E. coli CFCF system with bacteriophage SP6 RNA polymerase. (Inset) Electrophoretic pattern of translation products.
Experiment 7: Synthesis of Chloramphenicol Acetyltransferase in Rabbit Reticulocyte Continuous-Flow Cell-Free Transcription-Translation System In this experiment chloramphenicol acetyltransferase (CAT) is synthesized in a rabbit reticulocyte lysate supplemented with SP6 RNA polymerase (Fig. 8). Composition of the incubation mixture and feeding solution is listed in Table I (experiment 7). The reaction chamber is equipped with an Amicon XM300 ultrafiltration membrane. A 0.5-ml aliquot of incubation mixture is used. The flow rate of the feeding solution is 1.5 ml/hr at 34° (Table II, XM300). The protein synthesis is monitored over 35 hr. Total protein yield is about 0.06 mg (2.5 nmol). The enzyme activity is measured 22 in parallel.
22 W. M. Hodges and D. E. Hruby, Anal. Biochem. 1611, 65 (1987).
138
VECTORS FOR EXPRESSING
CLONED
[9]
GENES i
'100
4
4°= ~'C3
50
03 03
o~ -',1
No z
._= -~
03 >..
eg
D..
l
r
5
I0
I
15
I
20
Time, hrs
FIG. 7. Kinetics of expression of dihydrofolatereductase-encodinggene in the wheat germ CFCFsystemwithbacteriophageSP6RNApolymerase.(Inset)Electrophoreticpattern of translation products.
Discussion and Remarks
Advantages It is clear that the first and main advantage of the CFCF systems is their long lifetime, as compared with standard cell-free systems. The CFCF systems display linear kinetics of polypeptide synthesis over tens of hours. This provides preparative yields of corresponding polypeptides and proteins. According to our experience with the CFCF systems, the yield can vary from 50/zg to 4 mg of polypeptide or protein from 1 ml of incubation mixture depending on the molecular mass of the product, its solubility, expressibility of template, type and quality of the cell extract, and so on. Another important advantage of CFCF systems of gene expression is the relative purity of the polypeptide or protein product. Indeed, in this case the product is in the filtrate but not in a complex mixture of the cell extract; the only contaminants are cell extract proteins leaking out from the incubation mixture. With highly expressible mRNA the purity of the
[9]
PREPARATIVE-SCALE GENE EXPRESSION
12
Q) ~0
kcChl - -
Chl t-
139
I B
/
~50 t~
I
--
0
~
¢/) t--
oE
f 0
I
1
IO
O
25
I
t
20
L
I
50
Time, hrs F i t . 8. Kinetics of expression of chloramphenicol acetyltransferase-encoding gene in the rabbit reticulocyte CFCF system with bacteriophage SP6 RNA polymerase. (Inset) Thinlayer chromatography of chloramphenicol acetyltransferase assay products. Functional activity of protein synthesized in the CFCF system after (1) 0 hr of incubation; (2) 12 hr of incubation.
product in the filtrate can reach 80%, especially if the fractions collected during the first few hours are discarded. For instance, 20 hr of expression of interleukin 4 mRNA in an experimental large-scale reactor with the use of wheat germ extract gave 50 mg of the protein with 80% purity, in 1 liter of the filtrate (Y. B. Alakhov, S. Y. Ovodov, and L. M. Vinokurov, Institute of Protein Research, Russian Academy of Sciences unpublished observations, 1990).
Unexplained Features of Continuous-Flow Cell-Free Systems The flow rate of the feeding solution through the incubation mixture is found to be the most critical factor in maintaining the system activity for a long period of time. It is not clear yet whether the continuous removal of inhibitory low molecular mass products or their derivatives (e.g., nucleotides and phosphates), or the elimination of some regulatory elements of
140
VECTORS FOR EXPRESSING CLONED GENES
[9]
the cell extract, or the prevention of a feedback inhibition of ribosomes by newly synthesized polypeptides is responsible for this effect. Another interesting feature of CFCF systems is the relative stability of RNA templates during many hours of incubation at physiological temperatures. At least in the cases of CFCF translation systems (Figs. 3 and 4), mRNA was present in a limiting amount, so that any degradation of mRNA could be seen from the change of the kinetic curve slope. Thus, m R N A seemed to be resistant against phosphodiesterase activities present (although at a low level) in all the types of extracts used. Our explanation of this phenomenon is that mRNA in an actively working system is protected by translating ribosomes. The most striking observation with CFCF systems is the absence of transmembrane leakage, or very slow leakage, of tRNAs and low molecular mass proteins involved in translation. The systems work linearly during tens of hours even when the Amicon ultrafiltration membrane of the YM100 type is used. This membrane is permeable to tRNAs, prokaryotic IF-1 and IF-2, some eukaryotic IFs, as well as, to a less extent, prokaryotic EF-T,, EF-Ts, RF, and eukaryotic eEF-1L and eRF. EF-G, eEF-2 and several aminoacyl-tRNA synthetases should be added to this list in the case of the XM300 membrane. We believe that tRNAs and all other proteins listed above are retained in the translation mixture due to their participation in dynamic complexes with other components of the proteinsynthesizing machinery, so that they virtually do not exist as free individual molecules. Problems and Limitations
With weakly expressed messages, however, contaminating proteins are still a problem in CFCF systems. Leakage of many proteins from the incubation mixture continues for a long time, so that the product polypeptide cannot be seen as a predominant band in electrophoresis during the first 6 to 20 hr of incubation. In this case radioactive amino acid incorporation is required to identify the protein synthesized among other bands in an electrophoretic pattern. This problem can be partially solved by the better choice of an ultrafiltration membrane and, more radically, by the use of a better (more expressible) construct of the corresponding gene or mRNA. Unfortunately, construction of highly translatable messages is not a simple and predictable matter. Many viral RNAs are known to be strong messages. These RNAs are also effectively expressed in CFCF translation systems (see, e.g., Figs. 3 and 4). Viral RNA leaders can be used for
[9]
PREPARATIVE-SCALE GENE EXPRESSION
141
construction of chimeric messenger RNAs containing a required sense sequence to be translated in vitro. 23-25 The CFCF systems are seriously limited by the use of cell extracts with low ribonuclease activities. That is why only the $30 extracts of wheat germs and rabbit reticulocytes and the SI00 extract ofE. coli MRE600 have been used up to now. High quality of the extracts is a strict prerequisite for successful experiments with CFCF systems. The $30 extract of E. coli MRE-600 gives nonreproducible results in CFCF translation systems, presumably because of ribonuclease damage to mRNA. Exonuclease-proof constructs of mRNAs seem to be possible and demanded. A search for new universal inhibitors of ribonucleases is an important task. The specific problem of CFCF systems is an inevitably high dilution of the product in the filtrate. Concentration by subsequent ultrafiltration is recommended; at the same time the use of the concentrating ultrafiltration with a properly chosen membrane provides the removal of smaller contaminating proteins. The other ways to concentrate and purify the product are salting out with ammonium sulfate, or specific adsorption and subsequent elution. Immunoadsorbents or affinity columns can be used in line with the reactor. Some newly synthesized proteins have a tendency to aggregate, either directly in the incubation mixture or on the surface of the ultrafiltration membrane. In both cases it results in clogging of the membrane pores and slowing down of the flow, up to a full stop. The kinetic curve deviates from linearity and goes down. Protein aggregation and pore clogging were the main reason why the synthesis of viral coat proteins was not continued after 20 hr (Figs. 3 and 4). Sometimes the substitution of a new filter for the clogged one in the course of incubation helps and does not change the linearity of the kinetic curve. On the whole, the aggregation may be a significant problem in the cell-free synthesis of subunit, large, and hydrophobic proteins. Perspectives
First of all, the CFCF systems have undoubtedly good prospects for use in the preparative syntheses of polypeptides and proteins that are poorly expressed in vivo. This involves primarily cytotoxic products. 23 S. A. Jobling and L. Gehrke, Nature (London) 325, 622 (1987). 24 D. R. Gallie, D. E. Sleat, J. W. Watts, P. C. Turner, and T. M. A. Wilson, Nucleic Acids Res. 15~ 3257 (1987). z5 S. K. Jang, M. D. Davies, R. J. Kaufman, and E. Wimmer, J. Virol. 63, 1651 (1989).
142
VECTORS FOR EXPRESSING CLONED GENES
[9]
Furthermore, polypeptides and proteins unstable in the cell can be produced better under cell-free conditions. One of the scientific applications is the synthesis of protein-folding intermediates. 26 Due to the fact that the product is filtered out of the incubation mixture and can be visualized as the only newly synthesized peptide, identification and isolation of expression products of open reading frames is possible, even without knowing their properties and functions. For the same reasons, CFCF systems seem to be ideal for the synthesis of theoretically designed proteins. 27 The long-term process offered in CFCF systems and the flux principle used open new possibilities for studies of transcriptional and translational regulation. In particular, various effectors can be added to the incubation mixture for a short time (e.g., as a pulse in the flowing feeding solution) to follow the prolonged aftereffects. One of the most promising applications of CFCF systems will be in vitro protein engineering. Synthetic or isolated site-specifically altered genes can be directly expressed, and all products, independent of their functional and physical properties, can be visualized and investigated. With the use of artificial (anticodon changed) and misacylated tRNAs, protein variants may be obtained without site-specific mutagenesis at the level of genes, but through in vitro site-specific incorporation of different amino acids. Using the same approach, site-specific incorporations of unnatural and labeled amino acids into proteins is possible. 28 Realization of co- and posttranslational modifications of newly synthesized proteins in cell-free conditions is one of the most important and worthy tasks. In any case, involvement of intracellular membrane fractions in the cell-free translation process must be considered for the future.
26 A. N. Fedorov, B. Friguet, L. Djavadi-Ohaniance, Y. B. Alakhov, and M. E. Goldberg, J. Mol. Biol. in press. (1992). ~7 A. N. Fedorov, D. A. Dolgikh, V. V. Chemeris, B. K. Chernov, A. V. Finkelstein, A. A. Schulga, Y. B. Alakhov, M. P. Kirpichnikov, and O. B. Ptitsyn, J. Mol. Biol. 225, 927 (1992). 28 C. J. Noren, S. J. Anthony-Cahill, M. C. Griffith, and P. G. Schultz, Science 244, 182 (1989).
[10]
INSECT VIRUS TRANSLATIONAL INITIATION SIGNAL
143
[10] C e l l - F r e e E x p r e s s i o n V e c t o r : U s e o f I n s e c t V i r u s T r a n s l a t i o n a l I n i t i a t i o n S i g n a l for in Vitro G e n e E x p r e s s i o n
By
B I M A L E N D U DASMAHAPATRA
Highly efficient in vitro transcription of DNA, L2 coupled with cellfree translation of transcribed RNAs into protein, 3'4 greatly enhances the ability to express and study genes outside living cells. 5'6 Gene expression in a cell-free system avoids various cellular regulatory mechanisms that often pose serious problems for in vivo gene expression. Some of these problems are (1) rapid degradation of the expressed gene products by host enzymes, 7 (2) the adverse effect of the foreign protein on the normal host metabolism, and (3) sensitivity of the heterologous RNA transcripts to various cellular regulatory controls, such as splicing and transportation into the cytoplasm. In addition, cell-free gene expression makes it possible to study the expressed gene products without their prior purification from host cell proteins of similar structure and function. 6 Cell-free expression is limited, however, to the use of genes that carry their own signals to initiate translation efficiently. Translational initiation signals are contained within sequences in the 5' untranslated region (UTR) as well as in the vicinity of the initiator ATG ofa eukaryotic mRNA, where ribosomes bind and function to initiate protein synthesis. 8 Eukaryotic mRNAs, unlike prokaryotic mRNAs, do not have a consensus ribosomebinding sequence and show enormous variation in their 5' UTR in both sequence and in length. 9 This variability in translational initiation signals may result in differences in the quantity of protein molecules produced in a given cell-free expression system. To overcome these problems we have cloned a short duplex oligonuclet D. A. Melton, P. A. Krieg, M. R. Rebagliati, T. Maniatis, K. Zin, and M. R. Green, Nucleic Acids Res. 12, 7035 (1984). 2 E. T. Butler and M. J. Chamberlin, J. Biol. Chem. 257, 5772 (1982). 3 p. A. Krieg and D. A. Melton, Nucleic Acids Res. 12, 7057 (1984). 4 M. Spiess and H. Lodish, Cell 44, 177 (1986). s D. S. Gill, D. Chattopadhyay, and A. K. Banerjee, Proc. Natl. Acad. Sci. U.S.A. 83, 8873 (1986). 6 G. D. Parks, G. M. Duke, and A. C. Palmenberg, J. Virol. 60, 376 (1986). 7 K. Talmadge and W. Gilbert, Proe. Natl. Acad. Sci. U.S.A. 79, 1830 (1982). 8 M. Kozak, Cell 22, 7 (1980). 9 M. Kozak, Microbiol. Rev. 47, 1 (1983).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
144
VECTORS FOR EXPRESSING CLONED GENES
[10]
otide, which contains the 5' UTR and the initiator ATG of black beetle virus (BBV) RNA 1,1°into the plasmid pGEM2 (Promega Biotec, Madison, WI) to construct the cell-free expression plasmid pBD7 (Fig. I). 11 The unique restriction sites immediately after the BBV sequence provide multiple cloning sites for inserting genes or gene segments to be expressed. The chimeric RNAs produced in cell-free transcription will, therefore, have a built-in BBV translational initiation signal. As an example of the general utility of the vector, we describe here the use of the BBV signal to direct the cell-free expression of a biologically active coxsackievirus (CV) 3C protease.
Materials and Methods Bacterial Strains Escherichia coli strain JM 101 is used in all cloning and plasmid DNA amplification experiments. Enzymes, Plasmids, and Radiochemicals
All restriction endonucleases as well as DNA-modifying enzymes are obtained from New England BioLabs (Beverly, MA). The plasmid, pGEM2, the rabbit reticulocyte cell-free translation kit, T7 RNA polymerase, and RNasin may be purchased from Promega Biotech. The cap analog, GpppG, and the ribonucleotides are obtained from Pharmacia (Piscataway, NJ). L-[35S]Methionine (I 100 Ci/mmol) is supplied by Amersham (Arlington Heights, IL). The recombinant DNA methods, which include (1) digestion of DNA with various restriction endonucleases, (2) modification of the ends of DNA by Klenow fragment of E. coli DNA polymerase, and (3) joining of DNA molecules by T4 DNA ligase, are performed according to the recommendation of the suppliers. Agarose gel electrophoresis to separate DNA molecules of different sizes and electroelution of DNA molecules from agarose gel slices are carried out according to the procedures described by Maniatis et al. 12
10 B. Dasmahapatra, R. Dasgupta, A. Ghosh, and P. Kaesberg, J. Mol. Biol. 182, 183 (1985). ii B. Dasmahapatra, E. J. Rozhon, and J. Schwartz, Nucleic Acids Res. 15, 3933 (1987). ~2T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982.
[10]
INSECT
VIRUS
TRANSLATIONAL
INITIATION
145
SIGNAL
! !
;> o L )
u~ e
g2~ ~
m
0
--
~ ~.~ [.. ~
.g<
me~
o~
]~
u~8 I
N
. "~.
-
~X"
•
~
~
I ~Sd ._~ <
146
VECTORS FOR EXPRESSING CLONED GENES
[10]
Construction of Plasmid DNAs Expressing Native and Mutant 3C Protease o f Coxsackievirus The plasmid pCB 111 35 (Fig. 2) encoding the 3C protease and flanking regions of the coxsackievirus B3 polyprotein ~3is digested with XbaI and AvaI and the 1826-bp DNA fragment containing the viral sequence from nucleotide 4947 to nucleotide 6773 TMis gel purified. To construct a CV 3C protease expression plasmid including the BBV translational initiation signal, the gel-purified viral DNA fragment is cloned into XbaI/AvaIcut pBD7 (Fig. 2). Thus the resulting plasmid, pC1B1, contains the CV sequence encoding the carboxy-terminal 26 amino acids of 2C, all of 3A, 3B, and 3C, and the amino-terminal 288 amino acids of 3D, fused in-frame with the BBV initiator ATG. The plasmid pC11B9, which expresses a mutant 3C protease, is constructed as follows: the plasmid pC 1B 1 is linearized with Bali restriction endonuclease and ligated to a 12-base pair (bp) oligonucleotide linker (GGATCCGGATCC; New England BioLabs). Instead ofphosphorylating the linker prior to its ligation to the linearized pC1B 1 DNA, nonphosphorylated oligonucleotide linker is ligated, in a 100 M excess with the gelpurified Bali-cut pC 1B 1 DNA, using T4 DNA ligase. Because the linkers are not phosphorylated, they cannot self-ligate, which ensures that a single copy of the linker molecule is inserted. Cell-Free Transcription of Plasmid DNAs Plasmids pC1BI and pCl IB9 are linearized with AvaI and purified by extraction with phenol/chloroform and precipitation with ethanol prior to being used in transcription reactions.~5 Transcription Protocol l. The reaction mixture contains the following: 10/~1 5 × transcription buffer (200 mM Tris-HC1, pH 7.5, 30 mM MgCI2, 10 mM spermidine, 50 mM NaC1) 5/xl 4 mM ATP, CTP, UTP (prepared by mixing equal amounts of rNTP stocks) 5/xl 2 mM GTP 5/xl 10 mM GpppG 1/~1 500 mM dithiothreitol (DTT) I3 S. Tracy, N. M. Chapman, and H. L. Liu, Arch. Virol. 85, 157 (1985). I4 A. M. Lindberg, P. K. Stalhandske, and U. Pettersson, Virology 156, 50 (1987). ~5 M. M. Konarska, R. A. Padgett, and P. A. Sharp, Cell 38, 331 (1984).
[10]
INSECT
VIRUS
TRANSLATIONAL
INITIATION
147
SIGNAL
e~ ~D
I~^V
-V-] J I
I
i
i
I
r..)
C O ,°,
u~ I~qX e-, x
"4
-0) e-
IlSd
e~
'
~
03
" ro ¢q
I~S-
~
o
7~ ,-
o
I
IOO S
>P
l~^V/l~m S -iHtUg 8 I ~qx
;>
1 lSd
t~ r~ c~
148
VECTORS FOR EXPRESSING CLONED GENES
[10]
2/.d linearized plasmid DNA (1 /zg//zl) in water or in Tris-ethylenediaminetetraacetic acid (EDTA) buffer RNasin [final concentration = 1 unit (U)/tzl] T7 RNA polymerase (10 U) Bring the volume up to 50/xl with diethyl pyrocarbonate (DEPC)-treated water. Each of the components should be added in the order shown and the mixture should be kept at room temperature during the addition of each successive component, because DNA can precipitate in the presence of spermidine if kept at 4 °. Nucleotide stock solutions should be neutralized to pH 7. 2. Incubate at 37 ° for 60 min. 3. Add RNase-free DNase to a concentration of ! U//zg DNA. 4. Incubate for 15 min at 37°. 5. Extract with an equal volume of phenol-chloroform. 6. Add 0.5 vol 7.5 M ammonium acetate and 2.5 vol ethanol to precipitate the RNA. 7. Spin, wash the pellet with 70% (v/v) ethanol, and dry the pellet. 8. Resuspend the RNA in 20/.d DEPC-treated water. Transcripts may be analyzed by electrophoresis on an RNase-free agarose gel) 2 Cell-Free Translation of in Vitro-Synthesized RNA Cell-free translations of in vitro synthesized RNA using rabbit reticulocyte lysates are carried out in the presence of [35S]methionine according to the protocol described by Promega Biotec. Translation Protocol 1. Combine the following: 35/xl nuclease-treated reticulocyte lysate (slowly thawed in ice-water) 6 ~l DEPC-treated water 1/A RNasin (40 U//zl) 1/xl 1 mM amino acid mixture (minus methionine) 2/xl RNA transcript (I-2/xg) 15a 5/xl [35S]methionine (1150 Ci/mmol) at 9.2 mCi/ml 2. Incubate at 30° for 60 min. 15a Optimal concentrations for RNA transcripts are determined by translating different amounts of the RNA transcript with the same amount of assay mixture. Also, denaturing RNA transcripts by keeping them at 65° for 5 min prior to translation removes secondary structure and may improve translational efficiency.
[10]
INSECT VIRUS TRANSLATIONAL INITIATION SIGNAL
C
1
149
2
P1 3CD 3D
VP1
3C i
i i
F1G. 3. SDS-PAGE analysis of cell-free protein synthesis from plasmids pC1BI and pC 11B9. Plasmid DNAs were transcribed in vitroand the products were translated in reticulocyte lysates as described in Materials and Methods. Lanes 1 and 2 represent translation mixtures programmed with RNA molecules derived from plasmids pCI1B9 and pC1BI, respectively. Lane C contains 35S-labeled proteins produced in the CVB3-infected HeLa cells.
Analysis o f Coxsackievirus 3C Protease Expression Sodium dodecyl sulfate-polyacrylamide gel electrophoresis ( S D S P A G E ) 16 is used to analyze the CV3C protease expression in reticulocyte lysates. A 2-/A aliquot of [35S]methionine-labeled cell-free translation products is diluted with sample buffer [0.0625 M Tris-HC1, p H 6.8, 2% (w/v) SDS, 5% (v/v) 2-mercaptoethanol, 10% (v/v) glycerol, and 0.001% (v/v) b r o m p h e n o l blue] and heated at 90 ° for 5 rain before loading onto an S D S - p o l y a c r y l a m i d e gel as described in Fig. 3. After electrophoresis the 16U. K. Laemmli, Nature (London) 227, 680 (1970).
150
VECTORS FOR EXPRESSING CLONED GENES
[10]
gel is soaked in 40% (v/v) methanol containing 10% (v/v) acetic acid, dried under vacuum, and exposed to Kodak (Rochester, NY) XAR-5 film. Results The cell-free expression plasmid, pBD7, contains the 5' UTR and initiator ATG of BBV RNA 1 downstream of the promoter for T7 RNA polymerase (see Fig. 2). Therefore, RNA transcripts made from pBD7 derivatives by the bacteriophage RNA polymerase have the BBV translational initiation signal at their 5' termini. The expression plasmid pC1B I contains the coxsackievirus coding sequence fused in frame to the BBV initiator ATG. The chimeric RNA transcribed from the AvaI-linearized pC 1B 1 encodes a protein with a molecular weight of 72,000 that derives the initiator methionine and the second amino acid, threonine, from the vector sequence and the rest from CV polyprotein (Fig. 2). In coxsackievirus-infected cells a single large viral polyprotein (250K) is produced that, in its nascent form, is proteolytically processed by two viral proteases, 2A and 3C, into several mature viral proteins. 17.18The 72K CV protein encoded in the pC 1B 1 transcript contains 26 amino acids from the carboxyl end of 2C, all of 3A, 3B, the protease 3C, and the aminoterminal 288 amino acids of the polymerase 3D. 14The 3C protease autocatalytically cleaves itself out of the viral precursor polyprotcin between glutamine and glycine pairs present 183 amino acids apart, thus creating its own amino and carboxy termini. 17The RNA transcript produced from the plasmid pC 11B9 contains an in-frame insertion of four amino acids (P, D, P, D) within the 3C protease sequence of the same 72K protein encoded by the pC1B1 transcript. The mutant 3C protease encoded by the pC1 IB9 transcript is defective in its autocatalytic activity. 18aChimeric RNAs were translated in rabbit reticulocyte lysates, and synthesis of CV-specific proteins with the BBV translational initiation signal was analyzed by SDS-polyacrylamide gel electrophoresis. The results (Fig. 3) showed that a major protein, with an approximate molecular weight of 72K, was synthesized from pC 11B9 transcripts encoding the mutant 3C protease (Fig. 3, lane 1). As expected, the 72K protein was absent in the translation ofpC1Bl-transcripts (Fig. 3, lane 2). Instead, several other proteins ranging from 20K to 56K, presumably produced by the autocatalytic activity of the 3C protease, were seen (Fig. 3, lane 2). 17 H. G. Krausslich and E. Wimmer, A n n u . Rev. Biochem. 57, 701 (1988). 18 A. C. Palmenberg, in "Positive Strand RNA Viruses" (M. A. Brinton and R. R. Rueckert, eds.), p. 25. New York, 1987. taa B. Dasmahapatra, E. J. Rozhon, A. M. Hart, S. Cox, S. Tracy, and J. Schwartz, Virus Res. 20, 237 (1991).
[10]
INSECT VIRUS TRANSLATIONAL INITIATION SIGNAL
151
The 20K protein comigrates with the native 3C protease produced in CVB3-infected HeLa cells. This indicates that the 3C protease sequence contained in the 72K protein is autocatalytically active. The other prominent protein bands represent the products of the autocatalytic activity in the 72K protein. These results suggest that the BBV translational initiation signal is able to direct synthesis of CVB3-specific protein in vitro. Comments The BBV sequence contained in the plasmid pBD7 is sufficient to direct translational expression of the coxsackievirus coding sequence, which lacks its own signal for the initiation of translation. The expressed gene products are biologically active. The plasmid pBD7 has also been used for the cell-free expression of c-fos and Epstein-Barr virus Zta genes, in which the BBV sequence has been reported to yield at least 20-fold more Zta protein than the translational initiation signal provided by the Zta leader sequence. ~9 Untranslated leader sequences of eukaryotic mRNAs contain information that not only guides ribosomes to initiate protein synthesis correctly, but also regulates the efficiency of translation. Some of these parameters influencing the efficiency of translation of an mRNA are the cap structure at the 5' end of the mRNA, the sequences flanking the initiator ATG codon, the presence or absence of upstream ATG codons, and the secondary structure in the 5' U T R . 9'2°'21 The BBV sequence contained in the plasmid pBD7 is not predicted to form stable secondary structure. Moreover, it contains an adenosine residue at the - 3 position relative to the initiation codon. The chimeric RNAs produced from pBD7 derivatives are capped at their 5' termini. Native viral RNAs are translated efficiently.22'23 These may explain the relative efficiency of the BBV sequence in pBD7 in directing translation of heterologous coding sequences. Acknowledgments I wish to thank Dr. P. Kaesberg, University of Wisconsin (Madison), for permission to use the BBV sequence in this study. I also want to express my appreciation to A. Hart for technical assistance.
t9 y . N. Chang, D. L. Y. Dong, G. S. Hayward, and D. Hayward, J. Virol. 64, 3358 (1990). 2o A. J. Shatkin, Cell 9, 645 (1976). 2r M. Kozak, Nature (London) 3118, 241 (1984). z2 p. D. Friesen and R. R. Rueckert, J. Virol. 49, 116 (1984). 23 p. D. Friesen, P. Scotti, J. Longworth, and R. R. Rueckert, J. Virol. 35, 741 (1980).
152
VECTORS FOR EXPRESSING CLONED GENES
[1 1l
[11] Cell-Free Expression of Large Collections of cDNA Clones Using Positive-Selection h Phage Vectors By
CHRISTOPHER COLECLOUGH
Cell-free transcription and translation is frequently used to gain information about the structure and activity of proteins encoded by cDNA clones. Hitherto it has generally been applied to specific, individual clones, identified and isolated by some other means. The analogous procedure of microinjection of translationally competent RNA transcribed from collections of recombinants has, however, been used successfully in isolating clones encoding proteins with known biological activities (see Ref. 1 for an example). Here I describe vectors and technology appropriate to the analysis of large groups of clones as well as individual clones, in terms of their protein-coding capacity. This methodology can be used not only in searches for clones encoding specific proteins, but also in the analysis of complex mRNA populations. This chapter is concerned chiefly with technical details, but some applications of the methodology will be discussed. Vector Design A general problem in cDNA cloning is the dilution of true recombinants in libraries by nonrecombinant genome types, lacking cDNA sequences. At present, most libraries are made with a view to recovering one or a few particular clones for which specific probes--nucleic acid or antibody--are available. As the plaque-screening methods used can usually be applied to very large numbers of plaques, a high frequency of nonrecombinants is therefore most often accommodated by simply making larger libraries. A low incidence of true recombinants, however, becomes a severe problem if more complicated screening schemes are envisaged. The frequency of nonrecombinant types can be greatly reduced if true recombinants develop a selectable phenotypic trait not possessed by the parental vector. ~gtl0 is the most commonly used vector that allows such selection. 2 It is a temperate phage, which forms turbid plaques on its usual host Escherichia coli strain, due to partial repression. On hfl (highi y . Noma, P. Sideras, T. Naito, S. Bergstedt-Lundquist, C. Azuma, E. Severinson, T. Tanabe, T. Kinashi, F. Matsuda, Y. Yaoita, and T. Honjo, Nature (London) 324, 70 (1986). 2 T. V. Huynh, R. A. Young, and R. W. Davis, in "DNA Cloning: A Practical Approach" (D. M. Glover, ed.), Vol. I, p. 49. IRL Press, Oxford, England, 1985.
METHODS IN ENZYMOLOGY,VOL. 217
Copyright© 1993by AcademicPress, Inc. All rights-ofreproductionin any formreserved.
[11]
h PHAGEVECTORS
153
frequency lysogeny) varients ofE. coli, however, repression is so efficient that plaque formation by parental hgtl0 is entirely suppressed, cDNA insertion into the hgtl0 genome is directed to the cI gene (which encodes the phage repressor) and when this gene is thus disrupted, the inability of recombinants to elaborate active repressor leads to clear plaque formation, even on hfl strains. Although this device is quite effective, it places an absolute restriction on the context into which cDNA can be inserted. It therefore precludes, for example, juxtaposition of cDNA with a promoter for T7 or SP6 RNA polymerase, desirable if in vitro expression is planned. (Modified versions of hgtl0 that include these promoters do exist, but they have lost the capacity for genetic selection.) I have constructed a family of vectors that allows a strong genetic selection for true recombinants, yet is much more flexible with regard to the context into which cDNA can be inserted. This is because the phenotypic difference between parental and recombinant types results in part from the acquisition of a cDNA-linked marker, rather than from the disruption of a vector function. This marker is the chi recombination target, which being only 8 nucleotides long can easily be incorporated into the oligo(dT)-containing primer used in cDNA synthesis. Two vectors, hjac and hecc, are illustrated in Fig. 1; they are based on hgtWES.hB 3 and inherit its general structure and amber mutations, differing from it around the site of cDNA insertion. These vectors are r e d - but contain functional gam genes, so are spi ÷ (sensitive to P2 interference) and do not form plaques on E. coli lysogenic for phage P2. Preparation of hjac and hecc to receive cDNA inserts deletes the g a m gene; r e d - gam - h phage are s p i and will form plaques on P2 lysogens, but grow exceedingly poorly (when host recombination systems are active) unless they contain chi sites, which hjac and hecc lack. The necessary chi sites are provided in the primer-restriction end adapter (PRE adapter) used to initiate cDNA synthesis. (See Stahi 4 for a review of spi and chi.)
Primer-Restriction End Adapters Several years ago, to reduce the number of steps in cDNA cloning schemes, we introduced the use of bifunctional PRE adapters that serve both as primers for reverse transcription and as restriction ends for ligation to vectors. 5'6 The PRE adapters used to insert cDNA into hjac and hecc 3 p. 4 F. C. 6 C.
Leder, D. Tiemeier, and L. Enquist, Science 196, 175 (1977). W. Stahl, Sci. Am. 2S6, 53 (1987). Coleclough and F. Erlitz, Gene 34, 305 (1985). Coleclough, this series, Vol. 154, p. 64.
154
[11]
VECTORS FOR EXPRESSING CLONED GENES
cosL]
nin5 Wam
Eam
~gtWES.,
35
36
PL
;P6
Xjac XZ ,ST SZ
SZ NZ~ t
I
i
TSP6~PT7 PL
. . _ T T 7 PSP6~ (zm
t
~,
PL
i~
,1.ecc NZ s'r
SZ
SZ XI"
FIG. 1. Structure of hjac and hecc. hjac and hecc are based on hgtWES.hB, the structure of which is illustrated, highlighting the areas altered in the new vectors. Numbers 32-36 indicate the sequence coordinates on the conventional h map, not the physical distance from the left-hand end. PL, h phage PL promoter; PSP6, promoter for SP6 RNA polymerase; TSP6, terminator for SP6 RNA polymerase; PT7, promoter for T7 RNA polymerase; TT7, terminator for T7 RNA polymerase. Restriction enzyme cleavage sites: ERI, EcoRI; NI, NotI; SI, Sail; XI, Xhol.
are shown in Fig. 2. The adapters are used in two ways: (1) to convert a staggered restriction end into a 3' homopolymer tail, and (2) to provide cDNA molecules both with a chi site and with a staggered restriction end suitable for ligating to vector molecules. Each function requires a pair of partially complementary partner oligonucleotides. PRE adapters can be designed for sequence-specific or, as here, general cDNA synthesis (see Ref. 6) and for ligation to any staggered restriction end. Oligo(dC) tailing of ~,jac requires a pair of PRE adapters, (iii) and (iv) in Fig. 2, suitable for ligation to XhoI ends, while a pair compatible with NotI ends, (v) and (vi) in Fig. 2, is used for hecc. Pair (i) and (ii) in Fig. 2, used for cDNA synthesis and ligation to a SalI end, can be used with either vector. Following standard solid-phase synthesis, elution, and deprotection of the oligonucleotides, purify them by polyacrylamide gel electrophoresis (PAGE), DEAE-cellulose chromatography, and filtration on Sephadex G-50 superfine. Adapters (i), (iii), and (v) should be fully 5' phosphorylated before use. Incubate them at 1-5/zM with 50-100 units of T4 polynucleotide kinase in l mM ATP, 50 mM Tris-HC1 (pH 7.6), 10 mM MgCI2, 5 mM dithiothreitol (DTT), 1 mM spermidine, 1 mM ethylenediaminetetraacetic
[1 II
h PHAGE VECTORS
155
(i) (ii)
ch£ 5' TCGAC~CCACCAGCTCTTTTTTTTTTTTTTTT 3' GTtGGTGGTC~AGAAAAA 5'
(iii) (iv)
5' TCGAGTCTAGACGCGTTCCCCCCCCCC 3' CAGATCTGCGC 5'
(v) (vi)
5' GGCCGCTCTAGATCTCTTCCCCCCCCCC 3' CGAGATCTAGAG 5'
3'
3'
3'
FIG. 2. PRE adapters for use with kjac and hecc. Set (i) and (ii) provides a primer for reverse transcription, a SalI end, and contain a chi site. Set (iii) and (iv) converts a Xhol end into an oligo(dC) tail and is used for tailing hjac. Set (v) and (vi) converts an Nod end into an oligo(dC) tail and is used with hecc.
acid (EDTA), for 3 hr at 37 °. R e c o v e r the oligonucleotide by filtration through G-50 superfine. T o check that phosphorylation is efficient, set up a parallel reaction with a small quantity of the starting oligonucleotide and a known molar excess of ATP to which is added some fresh [y-32p]ATP: the incorporation of radiolabel should approximate the molar ratio. Store the oligonucleotides in 1 m M E D T A at - 2 0 °.
Vector Preparation Preparation of hjac or hecc D N A to receive e D N A inserts consists of four steps, illustrated in Fig. 3, which for simplicity shows only the preparation of hjac; the preparation of hecc is similar, but uses different restriction e n z y m e s and adapters, as will be described. The steps are the following: (I) restriction e n z y m e digestion, (2) ligation to PRE adapters, (3) digestion with a second restriction enzyme, and (4) removal of small fragments. 1. Digest kjac D N A with X h o I , hecc D N A with N o t I , to completion; r e c o v e r D N A by p h e n o l - C H C l , extraction, and ethanol precipitation. 2. For e v e r y 100/xg of digested, redissolved vector DNA: add 3/xg of adapter (iii) or (v) and 1.3/xg of adapter (iv) or (vi)--using (iii) and (iv) for hjac; (v) and (vi) for h e c c w r o u g h l y a 40-fold molar excess of PRE adapters over vector ends. Treat with T4 D N A ligase at 150 Weiss units/ml in 50 m M Tris-HCl (pH 7.8), 10 m M MgCI:, 10 m M DTT, 1 m M ATP, 100/xg/ ml bovine serum albumin (BSA) for 16 hr at 16° in a final volume of I00 /xl. Precipitate vector DNA, now ligated at cos ends and with two oligo(dC)
156
[11]
VECTORS FOR EXPRESSING CLONED GENES
~.jac: digest with XhoZ anneal and Ilgate to (il) and (iv) 11am
1
cos
cccccl.II II
mRNA: reverse transcribe using (i) as primer. Tail with TdTase
ccccc
and d GTP
SalZ
1
digest with SalZ, remove small fragments
3" GGGG~%,.-~J-~TTT I~JAGC~ 5"
!
TCGA
-C06 ~--
fractlonate, if desired CCCCC
J anneal with (ll) Ilgate and gap-fill
1
COS
TCGA" - ~
CCCCC
AA~
TCGA~
COS
CCCCC
package in vitro
1 plate on I:>2lysogen FIG. 3. Flow chart for inserting cDNA into hjac.
tails, by addition of NaCI to 0.5 M and polyethylene glycol (PEG) 6000 to 8%, 7 3. Digest DNA with SalI to completion. 4. Separate the finished vector (39 kb) from the smaller digestion products [0.7, 0.5 kilobases (kb)], by centrifugation through a 10-40% sucrose gradient. 8 mRNA Isolation A library intended for cell-flee expression should ideally be constructed from a pure mRNA preparation. In practice, it is impossible to state with confidence that any RNA preparation contains only mRNA, that is, only those molecules actually translatable into complete polypeptides. A rigorous mRNA preparation protocol would include careful purification of polysomes free from other ribonucleoprotein (RNP) particles, specific release and purification of mRNP from the polysomes, and purifi7 j. Lis, this series, Vol. 65, p. 347. 8 j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989.
[11]
h PHAGEVECTORS
157
cation of mRNA from mRNP, avoiding throughout any nucleolytic cleavage. In contrast, it has become standard practice to recover " m R N A " from guanidinium lysates of cells, neglecting any subcellular fractionation. The following is a compromise that removes much, but not all, unwanted RNA of nuclear origin and is appropriate for all but the most nucleaseridden sources. Cells are lysed with nonionic detergent, in the presence of vandium-ribonucleoside complexes to inhibit RNase, 9 and nuclei are pelleted before extracting RNA from the supernatant. Artifactual degradation can be further avoided by keeping samples cold and working quickly. Use of a microfuge greatly speeds up the process so that the initial steps take only 2-3 min, and should be used for l0 s cells or less; if the microfuge is at room temperature, remove and prechill the rotor head. Vanadylribonucleoside complex (VRC) should be prepared, not purchased, carefully following published protocols for avoiding oxidation, J0 and stored in aliquots under liquid N 2 . Wash cells in 0.9% (w/v) NaC1. Using about 1 ml/10 s cells, resuspend cells in ice-cold 10 mM Tris-HCl (pH 8.6), 12 mM MgCI 2, 10 mM VRC. Add 20-50/~l/ml cold 10% (v/v) Triton X-100 and vortex 5 sec, or homogenize using a Dounce homogenizer for 6 strokes. Spin at 10,000 g for 5 rain in a preparative centrifuge, or 15 sec in a microfuge. Transfer supernatant and add, for each milliliter, 30/zl of 5 M NaC1, 50/zl of 0.5 M EDTA, 50 kd of 20% technical grade sodium dodecyl sulfate (SDS) and 0.6 ml of phenol/CHCl3/8-hydroxyquinoline (50 : 50 : 0.2), saturated with 0.1 M NaC1, 10 mM sodium acetate, pH 6.0, 1 mM EDTA.~I Mix vigorously for 5 sec and spin at room temperature to separate phases. Reextract the upper, aqueous phase after addition of 20/.d/ml 20% SDS by shaking 2 min with an equal volume of phenol/CHC13 . Repeat the extraction, with 3 min of shaking, and precipitate RNA by addition of 2 vol of ethanol and storage at - 2 0 °. This lysis buffer itself will throw a bulky ethanol precipitate, probably a mixture of sulfates. This does not interfere with oligo(dT)-cellulose chromatography; however, if it is desired to avoid the chromatography step, it may be necessary to purify the RNA further, or to omit VRC from the lysis buffer. Purify poly(A)-containing RNA by passage over oligo(dT)-cellulose. It is important to find a grade of highcapacity oligo(dT)-cellulose that will efficiently retain mRNA in 0.15 M NaC1, or less. Use a small column: a 0.5-ml bed should be sufficient to recover mRNA from up to 20 mg of cytoplasmic RNA. After two cycles 9 S. L, Berger and C. S. Birkenmeier, Biochemistry 18, 5134 (1979). ~0G. E. Lienhard, I. I. Secemski, K. A. Koehler, and R. N. Lindquist, Cold Spring Harbor Symp. Quant. Biol. 36, 45 (1971). fl R. P, Perry, J. La Torre, D. E. Kelley, and J. R. Greenberg, Biochim. Biophys. Acta 262, 220 (1972).
158
VECTORS FOR EXPRESSING CLONED GENES
[1 II
of binding and elution, separated by a heat treatment of 2 min at 65 °, remove SDS and any fines by adding potassium acetate to 0.2 M and shaking with phenol/CHCl3 ; precipitate RNA by adding 2 vol of ethanol. Store purified mRNA at 1 mg/ml in diethyl pyrocarbonate-treated water, in aliquots at - 7 0 °. cDNA Preparation More details of this reaction can be found in the article in this series by Coleclough. 6 The quality of the reverse transcriptase is the principal determinant of the quality of a cDNA library. Use XL grade AMV reverse transcriptase from Life Sciences (St. Petersburg, FL). It is convenient to dispense the enzyme into 5-/zl aliquots of 65 unitsmsufficient enzyme to copy 5 /zg of mRNA--diluting the reverse transcriptase with RNasin (Promega, Madison, WI), if necessary; store them at - 7 0 °. Prepare 10 × RT buffer by combining 0.7 M KCI, 0.5 M Tris-HCl, pH 8.78 at 25 °, and 0.1 M MgC1z ; store at - 20° in aliquots. To 5/zl of 1 mg/ml mRNA, add 5/zl of freshly diluted 20 mM methylmercuric hydroxide (Alfa, Ward Hill, MA). After 2 min at room temperature, transfer the reaction tube to an ice bath and add, in this order: 10/xl of a 20-/xg/ml solution of PRE adapter (i); 5/~1 of a solution of dATP, dCTP, dGTP, and dTTP (20 mM each); 1/~1 of fresh [a-3ep]dCTP (I0 mCi/ml); 1 /zl of water; 5 /xl of 10 × RT buffer; 6 ~1 of freshly diluted 300 mM 2-mercaptoethanol; 2.5 /zl of actinomycin D (1 mg/ml); 0.5 ~1 of polynucleotide kinase (10,000 units/ml); 4 tzl of RNasin (I0,000 units/ml); and 5/~1 of reverse transcriptase, aliquoted as above. Incubate 2 min at 16°, 20 min at 43 °, and 5 min at 48 °. Add 2/zl of 0.5 M EDTA, 3 tzl of 20% (w/v) SDS, 1 tzl of proteinase K (10 mg/ml), and incubate 20 min at 48 °. Add 1/xl 100 mM phenylmethylsulfonyl fluoride (PMSF) in dimethyl sulfoxide (DMSO), chill, extract with phenol/CHCl3, and ethanol precipitate. Dissolve the pellet in 20/xl of 0.2 M NaOH and 1 mM EDTA, and incubate at 60° for 20 min. Cool and dilute the sample with water to 50/xl, then load onto a calibrated column of Sephacryl S-500 HR (Pharmacia, Piscataway, NJ), previously washed in 10 mM NaOH. Collect and pool cDNA longer than 300 nucleotides. Neutralize and concentrate the solution to 50 txl by extraction with 2-butanol, then recover cDNA by ethanol precipitation. The object of the gel-filtration step is to eliminate PRE adapter molecules not incorporated into cDNA. S-500 columns formed in siliconized Pasteur pipettes can resolve single-stranded DNA chains a few hundred nucleotides long well enough to achieve this and, with appropriate care, are sufficiently reproducible that calibration of one of a batch of columns
[11]
X PHAGEVECTORS
159
with marker DNA fragments should allow removal of low molecular weight species, without the need for analysis of all fractions. The yield of cDNA can be calculated from the molar incorporation of dCTP and should be 2-3 tzg. For reactions of this size, it is worth checking the yield spectrophotometrically, as the incorporation of nucleotide may be misleadingly low. The recipe given above generates cDNA with a specific activity of (very roughly) 30,000 Cerenkov counts per minute (cpm)//xg. cDNA is elongated with a 3'-oligo(dG) tail by treatment with terminal transferase: adjust volumes so that the final cDNA concentration is 60 tzg/ ml (or less) in 50 # M dGTP, 600 units/ml terminal transferase, and 100 mM potassium cacodylate; 25 mM Tris base; 1 mM CoC1 z; 0.2 mM DTT, pH about 6.9 (see Ref. 12); incubate exactly 3 min at 16°, then add EDTA to 10 mM, SDS to 1% (w/v), extract with phenol/CHC13 and ethanol precipitate; redissolve the cDNA in 10 mM NaOH and I mM EDTA, filter it through Sephacryl S-500 HR in 10 mM NaOH, neutralize, concentrate, and ethanol precipitate it, all as above. Single-stranded DNA at low concentration tends to stick to surfaces and interfaces, so whenever possible these manipulations should be performed on cDNA in quantities of 1 /zg or more; parceling out a cDNA preparation into samples of about 100 ng, with a view to avoid wasting it, is more likely to result in the loss of the entire sample. cDNA Fractionation by Subtractive Hybridization Insertion of cDNA into hjac or hecc is performed in approximate molar equivalence of cDNA and vector. As this requires about a 70-fold mass excess of vector DNA, use of much more than 100 ng of cDNA becomes prohibitively expensive. Therefore, as more cDNA will probably be made than can be used, unless the application demands construction of a representative library, it is worthwhile considering ffactionating the cDNA, by size or by molecular hybridization, before cloning. We have found hybridization with biotinylated mRNA, followed by liganding with streptavidin and phenol/chloroform removal of complexes, ~3 to be a simple, efficient, and high-yield tactic for enrichment of differentially expressed sequences prior to cloning. mRNA is biotinylated by treatment with a photoactivatable biotin derivative, as described by Forster e t al. 14 RNA at l mg/ml in water is ~2R. Roychudhury and R. Wu, this series, Vol. 65, p. 43. 13H. L. Sive and T. StJohn, Nucleic Acids Res. 16, 10937(1988). 14A. C. Forster, J. L. Mclnnes, D. C. Skingle, and R. H. Symons, Nucleic Acids 745 (1985).
Res.
13,
160
VECTORS FOR EXPRESSING CLONED GENES
[11]
mixed under subdued light with an equal volume of photobiotin (Calbiochem, La Jolla, CA) dissolved at 1.5 mg/ml in water; the mixture is sealed in a siliconized glass capillary and exposed to light from a 275-W sunlamp bulb (available from Bethesda Research Laboratories, Gaithersburg, MD) 10 cm away for 20 min. The solution is kept cold by immersion in a shallow ice/water bath. Biotinylated RNA is recovered by flushing out the contents of the capillary with 100/zl of 0.1 M Tris-HCl, pH 9.0, twice extracting with n- or 2-butanol, and precipitation with 2 vol of ethanol after addition of NaCI to 0.2 M. Hybridization reactions contain biotinylated mRNA at 0.5-2.0 mg/ml, 250/xg/ml oligo(C), 2 mg/ml poly(A), 0.6 M NaCI, 50 mM piperazineN,N'-bis(2-ethanesulfonic acid) (PIPES) (pH 6.8), 5 mM EDTA, and 0.5% (w/v) SDS and are held at 65° typically for 5-15 hr. Optimally, such reactions are constantly agitated, for example, by rotating the mixture sealed in a capillary tube with a few glass beads, but they can be performed in tightly capped microcentrifuge tubes with some loss of efficiency. The efficiency of RNA-driven hybridization of DNA and the effects of salt concentration and other parameters on the hybridization rate are fully discussed by Van Ness and Hahn. ~5 Oligo(C) is prepared by limited hydrolysis ofpoly(C)~6:4 mg ofpoly(C) in 10 mM Tris-HC1, pH 7.5, is mixed with 0.5 ml of 0.4 M NH4HCO3/ NH4OH, pH I0.0, and the mixture sealed in a glass ampoule and placed in a boiling water bath for 1 hr. At the completion of the hybridization reaction, the mixture is diluted 30-fold with water, BSA is added to 300/zg/ml, and streptavidin to 30 /zg/ml. The mixture is then vortexed with an equal volume of phenol/ chloroform and spun in a microcentrifuge for ! min. After reextraction with 1 vol of phenol/chloroform, nucleic acids are precipitated from the aqueous phase with 2.5 vol of ethanol. We have usually used two rounds of subtractive hybridization before cloning. Finally, cDNA is freed of RNA by alkaline hydrolysis and separation on Sephacryl S-500 HR, as above. Insertion of cDNA into Vector Molecules cDNA insertion is a one-tube, two-stage reaction (see Fig. 3). In the first stage, the 5' end ofcDNA is rendered partially duplex by hybridization of the PRE adapter (i) sequence, which forms the cDNA 5' terminus, with 15 j. Van Ness and W. E. Hahn, Nucleic Acids Res. 10, 8061 (1982). 16j. M, Coffin, J. T. Parsons, L. Ryrno, R. K. Haroz, and C. Weissman, J. Mol. Biol. 86, 373 (1974).
[11]
,k PHAGE VECTORS
161
the partner adapter (ii), then covalently attached to the SalI end of the vector. At the same time, the 3' oligo(dG) tail of the cDNA hybridizes to the other, oligo(dC) vector terminus, cDNA, thus forming a singlestranded bridge linking left-hand and right-hand X arms. In the second stage, cDNA is at last rendered double stranded in a gap-filling reaction of DNA polymerase, and remaining nicks are sealed. Figure 4 illustrates the structure of a typical hjac recombinant, which was recovered from a small library of about 5000 clones made from 2 ng of cDNA. This clone encodes the T cell receptor/3 chain expressed by the AKR mouse thymorea line BW5147, frequently used as a T cell hybridoma parent. A representative reaction was performed as follows: 60 ng of tailed cDNA and 4.5/xg of appropriately prepared hecc DNA were combined in 20 txl together with 5 ng of adapter (ii) and 2.5/xl of 1 M Tris-HCl, pH 7.8, and 100 mM MgC12. This mix was annealed by placing the reaction tube in a beaker of water, initially at 60°, which was allowed to cool to 20° over the course of about 1 hr. The reaction volume was then increased to 25 ~zl with the addition of BSA to 50/xg/ml, DTT to 10 raM, ATP to 300/xM, and 3 Weiss units of T4 DNA ligase, and incubated at 16°C for 16 hr. The second stage of the reaction was performed in conditions of molecular crowding by polyethylene glycol (PEG)iV: to the 25-/xl first-stage reaction was added 15/xl of 50% PEG 6000 and 5/zl of 10 x stage 2 buffer (see below), and the volume was brought to 50 ~!, adding dATP, dCTP, dGTP, and dTTP (each to 500 ~M), 3 units each ofE. coli DNA polymerase I and T4 DNA polymerase, and 0.2/xg of E. coli DNA ligase. To prepare 10 x stage 2 buffer, combine 1 M NaCI, 0.02 M (NH4)2SO4, 0.1 M Tris-HCl (pH 7.5), 60 mM MgC12,50 mM DTT, 10 mM spermidine, and 3 mM NAD. The reaction was allowed to stand for 3 hr at room temperature, then DNA was pelleted by spinning in a microfuge for 2 rain and resuspended in 4 /xl of water. Ligated DNA can now be packaged into infectious )t particles using a commercial packaging kit. Unfortunately, the in vitro packaging reaction, treated here as a black box, is the most sensitive step in the whole process: when cloning attempts yield greatly fewer plaques than expected, this is most likely due to inhibition of the packaging reaction. DNA purified from agarose gels can carry contaminants--probably charged polysaccharides--which do not affect any of the enzymes used, but profoundly inhibit packaging. Also, carryover of PEG into the packaging reaction must be minimized: at low concentrations PEG is noninhibitory, but slight increases can precipitate components of the packaging mix with disastrous results. The cDNA-vector i7 S. B. Zimmerman and B. Harrison, Proc. Natl. Acad, Sci. U.S.A. 84, 1871 (1987).
162
VECTORS FOR EXPRESSING CLONED GENES
zl
CO
~
o
0 0 0
0 0
,-.= "-~
,]i °
°° Ig
oo G.~
X
0 0 < Z
£ 0
~._o
[ l 1]
[11]
h PHAGEVECTORS
163
ligation reactions should therefore be performed in microfuge tubes that resist wetting, allowing complete removal of the supernatant after pelleting the ligated DNA. Forming a Sectored Library The selective host for spi- recombinants of hjac and hecc is LE392/ P2, a P2 lysogenic derivative of the supE supF E. coli strain LE392. Grow these bacteria in L broth [1% (w/v) tryptone, 0.5% (w/v) yeast extract, 0.5% (w/v) NaCI] containing 0.4% (w/v) maltose and 10 mM MgSO4 to stationary phase at room temperature, shaking vigorously, then pellet them at 2000 g for 10 min and resuspend them in a two-thirds volume of 10 mM MgSO4. Dilute packaged, recombinant phage to 0.5 ml with phage buffer and plate no more than 20 ~1 of this suspension on one 100-mm petri dish, using 0.2 ml of LE392/P2 and 2.5 ml of 0.6% (w/v) top agar. Mix the phage and bacteria and incubate for 20 min at 37°, then add the agar (cooled to 43 °) and plate. Phage buffer contains 0.1 M NaCI, 25 mM Tris-HCl (pH 7.5), 10 mM MgSO4, 0.02% (w/v) gelatin. Bottom agar for plates is 1.2% (w/v) agar in L broth containing 10 mM MgSO4 and 0.1% (w/v) maltose; top agar contains 0.6 or 0.3% (w/v) agar, as indicated, in the same medium. The quality of the packaging mix is the primary determinant of the efficiency of clone formation; about 2000 clones/ng of cDNA is routine. A sectored library is desirable for many applications using these vectors. Division of the library into sectors is preferably performed on the primary plates. Sectors can be of any complexity; 500-1000 clones per sector is probably the most generally useful size for nonenriched libraries. Decide the number of pie-type sectors into which each plate should be divided, draw a template on the lid of a petri dish, and use this as a guide for each plate. Using a straight-edged nickel spatula, scrape the top agar from each sector into a 15-ml polypropylene tube, taking care not to touch other sectors. Between each sector, wash the spatula in 80% ethanol, flame it, and rinse it in 10 mM MgSO4. To the collected agar in each tube add 1 ml of phage buffer containing 20% (v/v) glycerol and 1 ml of CHCI 3 ; cap and shake it for 20 rain. Spin the tubes at 2000 g for 10 rain, transfer the clear supernatant to vials, and store them at - 70°. This is the primary sectored library. Expanding Sectors and Clones Single clones, sets of clones, and library sectors are all expanded in the same fashion to produce a standard, high-titer stock that can be used
164
VECTORS FOR EXPRESSING CLONED GENES
[11]
to seed cultures for DNA preparation. To 150/~1 of a suspension of LE392/ P2, prepared as above, add the equivalent of one plaque of phage and after absorption plate with 3 ml of 0.3% (w/v) top agar. Use a fairly fresh plate. A bacterial lawn should be visible after 4 hr, and confluent lysis evident after about 7 hr. Scrape the sloppy top agar into a 15-ml polypropylene tube, add 1 ml of phage buffer containing 50% (v/v) glycerol and 2-3 ml of CHC13, and shake and spin as above. This generates a phage stock of about 101~plaque-forming units (pfu)/ml, stable at - 70 °; expanded primary library sectors are termed secondary sectors. Preparing DNA for Cell-Free Expression Use LE392/P2 for all growth of spi- recombinants on plates, and LE392 for growth in suspension culture. Reportedly spi-h grows better on recD E. coli, so substitution of LE392 by the supE supF recD strain TAP90 ~s might well increase the phage yield from these cultures; I have not compared the two strains. Prepare LE392 for infection as above. Allow 1 /~1 of high-titer phage stock to absorb to 250/xl of bacteria in a 50-ml polypropylene tube. Add 20 ml of L broth containing 10 mM MgSO 4 and 0.01% (w/v) maltose and shake the tube vigorously in a horizontal position at 37°. Lysis should be evident after 5 hr. Add a drop of CHCI 3, spin out debris (there may be very little), and precipitate phage by addition of 1.2 g of NaC1 and 2 g of PEG 6000. Hold at least 1 hr on ice. Pellet phage at 3000 g, for 10 rain at 4°, and resuspend in 800/zl of 10 mM Tris-HCl, pH 7.5 and 10 mM MgCI2 containing 10/.tg/ml each of DNase I and RNase A. Shake at 37° for 10 min. Add 0.5 ml of CHCI3, mix well (do not vortex), spin briefly, and transfer the supernatant to a microfuge tube. Add 25/zl of 0.5 M EDTA, 50/xl of 20% (w/v) SDS, and 12/zl of proteinase K (10 mg/ml), and incubate 45 min at 37°. Add I0 gl of I00 mM PMSF in DMSO, hold 5 min, then add 50 /zl of 4 M KC1, extract with phenol/CHCl3, shaking by hand, and precipitate DNA with 0.6 ml of 2-propanol. The routine yield is 7-10/zg of DNA, which is fine for restriction enzyme analysis and, often, for transcription too; the degree of contamination with degraded bacterial nucleic acid, however, may be sufficient strong to inhibit RNA polymerase. It would probably be worthwhile investigating other, more selective agents for precipitating large DNA, such as PEG 7 or spermine, 19 with a view to eliminating this contamination, but gel filtration on Sephacryl S-1000, which is effective if somewhat tedious, has been routinely in~s T. A. Patterson and M. Dean, Nucleic Acids Res. 15, 6298 (1987). 19 B. C. Hoopes and W. R. McClure, Nucleic Acids Res. 9, 5493 (1981).
[11]
X PHAGEVECTORS
165
cluded, k DNA reproducibly begins to elute after 0.9 ml of washing of a Pasteur pipette S-I000 column, while small nucleic acid fragments appear after passage of 1.5 ml. This fraction can be collected from many columns run simultaneously in 30 mM potassium acetate, 5 mM Tris-HC1, pH 7.5, and 0.5 mM EDTA, and concentrated about fivefold by 2-butanol extraction; then the DNA may be recovered by ethanol precipitation and dissolved at about 100/xg/ml in 10 mM Tris-HC1, pH 7.5, 1 mM EDTA.
Transcription Sense-strand, translatable transcripts of recombinants of hjac or hecc are referred to as "ersatz m R N A " to emphasize that they can substitute for genuine, natural mRNA for most purposes. Ersatz mRNA is generated from hjac recombinants with SP6 RNA polymerase, and from hecc recombinants with T7 R N A polymerase. Both vectors have fairly effective terminators immediately distal to the site of cDNA insertion, so it is not necessary to digest DNA with restriction enzymes to produce discrete transcripts. A standard transcription reaction is 30/xl, which includes 6/zl of DNA, prepared as above, 500/xM ATP, CTP and UTP, 150/xM GTP, and 500/xM m7GpppG. It is convenient to add about 1/zCi of [a-3Zp]GTP to each reaction to help trace the RNA product. Final reaction conditions for SP6 RNA polymerase are as follows: 40 mMTris-HCl (pH 7.9); 6 mM MgCI2, 10 mM DTT, 100/xg/ml BSA, 500 units/ml RNasin. Conditions for T7 RNA polymerase are similar, except that the MgCI2 concentration is 10 raM. Use 1/zl of either polymerase, as obtained commercially, for each reaction; this usually contains about 5 units of the SP6 enzyme, but much more T7 polymerase. The T7 enzyme is produced commercially from synthetic constructs in E. coli, and at the moment is routinely supplied at much higher activity than the SP6 enzyme. Reactions are incubated at 37° for 90 rain. Ersatz mRNA is most simply purified by binding to a tiny oligo(dT)-ceUulose column: to the 30/zl transcription reaction, add 1/xl of 0.5 M EDTA, 2/xl of 20% (w/v) SDS, 5/.tl of 5 M NaCI, and 12 of/xl water, and extract with 50/xl of phenol/CHCl s. Apply the extract directly to a small (about 20 p.l) column of oligo(dT)-cellulose, formed in a plugged 1-ml micropipette tip. Wash the column with 200/zl of 0.5 M NaCI, 10 mM TrisHCI (pH 8.0), 1 mM EDTA, 0.2% (w/v) SDS, and elute with applications of 15, 15, and 70/xl of 5 mM Tris-HCl (pH 8.0), 0.5 mM EDTA, 0.1% (w/v) SDS, using the first two batches to rinse the sides of the column and pooling the eluates. Add I/xg of calf liver tRNA (Boehringer Mannheim, Indianapolis, IN) and 5/xl of 5 M potassium acetate to the eluted RNA, extract with 100/xl of phenol/CHC13 and precipitate with 2 vol of ethanol.
166
VECTORS F O R E X P R E S S I N G C L O N E D G E N E S
[11]
Typical yields are 0.5-1.0/.,g of ersatz mRNA when SP6 polymerase is used, and 2-3/zg with the higher-activity T7 enzyme. The cap dinucleotide can be omitted for RNA to be used for some other purpose than translation. Even though all transcripts from a ~,ecc, or from a hjac, library share a common 5' terminal sequence--contributed by the vector and by the PRE adapter used for tailing the vectormdifferent clones vary greatly in their dependence on a 5' cap for translation. Some are unaffected by the lack of a cap, while the translation of others is entirely cap dependent; therefore, unless the object is to assay a species known to be cap independent, all ersatz mRNA for translation should be transcribed in the presence of m7GpppG. Translation For routine analytical purposes, rabbit reticulocyte, nuclease-treated lysate #N90 from Amersham (Arlington Heights, IL) is used to translate ersatz and genuine mRNA, using [35S]methionine as label. A typical reaction will include all of the product of a standard SP6 transcription reaction, or one-third of a T7 transcription, in a final volume of 20 ~1, of which 16 /zl is reticulocyte lysate. Incubate for 90 min at 30°, then add 1 /.d of RNase A (2 mg/ml; to degrade aminoacyl-tRNA), and incubate for 10 min. Polypeptide products can now be displayed on polyacrylamide gels; it must be borne in mind that the hemoglobin concentration in the translation reaction is about 60 mg/ml, limiting the fraction of the reaction that can be applied to a typical gel lane. The routine here is to dilute 4/zl with 25 /zl of 3% (w/v) SDS loading buffer for application to a 4 × 0.75 mm well. The reticulocyte lysate will generate a labeled protein complex endogenously, which usually has an apparent molecular weight of about 45K on SDS-PAGE, when methionine is used as label. [35S]Cysteine does not label this complex. Two-dimensional (2D) gel patterns of in vitro translation products of the same mRNA preparation labeled alternatively in methionine or in cysteine are surprisingly different, those labeled with [35S]cysteine usually showing the greater number of spots; this suggests that methionine and cysteine should both be labeled when complete representation of the complexity of an mRNA sample is desired. Discussion Ersatz mRNA, transcribed from cDNA clones, can substitute genuine mRNA in any application; thus it can be translated, hybridized, reverse transcribed, and microinjected. A vast array of experimental possibilities is therefore available for the exploitation of libraries in hjac or hecc;
[11]
x PHAGEVECTORS
167
here examples are shown only of the use of gel electrophoresis to probe relatively complex collections of clones. The analysis of proteins, translated in vitro from natural or ersatz mRNA, can be viewed in two ways: (1) in the absence of a high-resolution separation method for large R N A molecules, complex collections of mRNA molecules are best analyzed by translation into proteins for which high-resolution analytical methods do exist, and (2) in vitro translation products may resemble naturally biosynthesized proteins sufficiently closely as to allow the identification of cDNA clones that encode proteins of interest through the physical or biological properties of the cell-free translation products of ersatz mRNA. The first of these statements, which does not presuppose any identifiable relationship between in vivo and in vitro translation products of the same mRNA species, is certainly true. The second, and more exciting, is true in some but not all cases. As yet we do not know to what fraction of cases it applies, although we know it is a sizable fraction. It may well turn out to be possible, with adequate attention, to relate the great majority of proteins physically detectable in cell extracts directly to cognate cDNA clones, which can be retrieved without the need for sequence information or sequence-specific probes. 2°'2~
Two-Dimensional Gel Analysis of Translation Products Running many 2D gels with high and reproducible resolution demands considerable expertise. The examples shown here were run in the laboratory of Dr. I. Lefkovits, of the Basel Institute for Immunology. Technical details for 2D gel electrophoresis or computer-assisted image analysis have not been included in this chapter; both of these aspects have generated a considerable technical literature, which should be consulted by potential users. However, occasional 2D gel electrophoresis should be within the compass of most laboratories; it is most easily accomplished in commercially available equipment following the recommendations of the supplier, and it is extremely valuable for the analysis of hecc or Xjac libraries, even if the quality of the gels is less than pristine. This is particularly so in evaluating "difference" libraries, formed from cDNA that has been enriched for species of interest by subtractive hybridization. The construction of difference libraries, enriched for some cDNA species of interest, has become a popular tactic, especially since its successful 20 C. Coleclough, L. Kuhn, and I. Lefkovits, Proc. Natl. Acad. Sci. U.S.A. 87, 1753 (1990). 21 I. Lefkovits, J. Kettrnan, and C. Coleclough, lmmunol. Today 11, 157 (1990).
168
VECTORS FOR EXPRESSING CLONED GENES
[11]
use in the cloning of T cell antigen receptor genes. 22 However, so far it has failed to achieve the status of an analytical tool: it has not been possible, by simple inspection of a difference library, to determine by how many species two mRNA populations differ. Use of hjac or hecc as vectors for difference library construction, together with 2D gels for their analysis, may redress this deficiency, as indicated in Fig. 5. Here, we were interested in mRNA species induced by lectin treatment of a T cell hybridoma. Comparison of 2D gels of the cell-free translation products of mRNA from treated and untreated cells did not reveal any obvious differences, so we could not use the direct, sib-selection approach previously successful in retrieving clones of interest. 2° Instead we constructed a difference library, enriching for induced cDNA species by subtractive hybridization with mRNA from untreated cells, as described above, prior to insertion into hecc. Figure 5B shows the translational readout of that difference library, while Fig. 5A shows the translation product of natural mRNA from untreated ceils. There are no spots that clearly occur on both gels: evidently subtractive hybridization efficiently removed most common species, allowing induced mRNAs, too sparse for their translation product to be detected after the translation of total mRNA, to dominate the difference library. This situation can be contrasted with the gels shown in Fig. 5C and D. These two gels show proteins expressed from two random sectors, both containing about 1000 clones, from an unenriched library of the mRNAs expressed in BW5147. In collaboration with Dr. I. Lefkovits we are currently attempting to catalog all of the genes detectably expressed in this cell line, by computer-assisted comparison of a large number of sectors like those shown in Fig. 5C and D. 21 mRNA species abundant in the cell will be represented in many of these sectors--as each random sector contains about 1000 clones, any mRNA species that makes up more than 0,1% of the total mRNA complement will have a good chance of being represented in any sector. Therefore, unlike the evaluation of the difference library in Fig. 5A and B, in this case one expects to see species common to both gels. Indeed, many such species can be discerned; 12 are indicated. NOTE ADDED IN PROOF. Since preparing this manuscript further observations, and a number of technical modifications that increase efficiency, have been made. They are listed here:
22 S. M. Hedrick, E. A. Nielsen, J. Kavaler, D. I. Cohen, and M. Davis, Nature (London) 308, 153 (1984).
IX 1] A
h PHAGE VECTORS
169
B
FIG. 5. Two-dimensional gels of cell-free translation products. (A) Polypeptides translated from mRNA of untreated BW5147 cells, using a nuclease-treated reticulocyte lysate, labeling with [35S]methionine. (B) Cell-free expression product of a hecc difference library, formed from concanavalin A-treated BW5147 cDNA, subtractively hybridized with mRNA from untreated cells. (C and D) Cell-free expression products of random sectors, each containing about 1000 clones, from a representative hecc library of BW5147 cDNA.
1. Strain TAP90, mentioned briefly above, is now used to grow recombinant phage in liquid culture for DNA preparation. DNA yields are severalfold increased over growth in LE392. However, it must be appreciated that there is no genetic selection for recombinants in this strain and therefore it should be used only for recombinants that have been through at least two rounds of selection in the P2 lysogen derivative of LE392. TAP90 can be obtained from the American Type Culture Collection (ATCC; Rockville, MD).
170
VECTORS FOR EXPRESSING CLONED GENES
[11]
2. Polyethylene glycol precipitates of phage from lysed liquid cultures are considerably cleaner if DNase and RNase are added immediately after lysis, before removal of bacterial debris. Add both enzymes to 1-2 tzg/ml of culture and shake at 37° for 10 min before addition of NaC1 to 1 M and centrifugation as described above. The precipitates formed by the addition to the supernatant of PEG to 10% can now, after pelleting, be dissolved directly in 10 mM EDTA, 25 mM Tris-HC1 (pH 8.6), 1% (w/v) SDS, containing 100/zg/ml proteinase K, then processed as described above. 3. Conditions now used are modified from those recommended by Gurevitch et al. 23for transcription of phage DNA. Twenty-microliter reactions contain 80 mM H E P E S / K O H , (pH 7.5), 10 mM DTT, 2 mM spermidine, 3 mM each of ATP, UTP, CTP and mVGpppG, 1 mM GTP, 0.5-1.0 /xg of phage DNA, 30 units T7 RNA polymerase, and 80 units RNase inhibitor. Incubation is at 38° for 3 hr. 4. Recent batches of Amersham reticulocyte lysate N90 have, alarmingly, proved almost entirely incapable of translating capped, ersatz mRNA generated by in vitro transcription of hecc recombinants, although these lysates were highly active on genuine mRNA. Fortunately the nuclease-treated reticulocyte lysate retailed by Ambion (Austin, TX) was capable of translating the same ersatz mRNA preparations, and the translation products yielded appeared normal on gel electrophoresis. The biochemical basis of this disturbing problem has not been determined; it is obviously imperative for users of the technology described here to screen several sources of lysate for activity on their in vitro transcripts, and to consider buying or making sufficient amounts of active lysate before embarking on any sizable series of experiments. Acknowledgments I thank I. Lefkovits and L. Kuhn for performing 2D gel analyses. St. Jude Children's Research Hospital is supported by Grant CA 21765 from the National Cancer Institute and by the American Lebanese Syrian Association (ALSAC).
23 V. V, Gurevich, I, D, Pokrovskaya, T. A. Obukhova, and S. A. Zozulya, Anal. Biochem. 195, 207 (1991).
[12]
EFFICIENT MUTAGENESIS IN PLASMIDS
173
[12] Site-Specific M u t a g e n e s i s in Plasmids: A G a p p e d Circle M e t h o d
By
B E R N D H O F E R a n d BIRGIT K ~ H L E I N
Site-specific mutagenesis is one of the key techniques in molecular genetics and protein engineering. The DNA segments to be mutagenized are usually contained in plasmids. The possibility of carrying out sitespecific mutagenesis with these plasmids directly, that is, without any subcloning steps, represents a substantial simplification and acceleration of this technique. A number of such procedures have in fact been described. However, the earlier methods either gave low yields of the desired mutation 1-7 or were not generally applicable as they needed a unique restriction site close to the target region of mutagenesis. 8-t° More recently, other laboratories devised techniques that circumvent these problems.l~-~4 Procedures using the polymerase chain reaction have also been developed tS-~s that are fast
R. B. Wallace, P. F. Johnson, S. Tanaka, M. Sch61d, K. Itakura, and J. Abelson, Science 209, 1396 (1980). 2 G. Dalbadie-McFarland, L. W. Cohen, A. D. Riggs, C. Morin, K. Itakura, and J. H. Richards, Proc. Natl. Acad. Sci. U.S.A. 79, 6409 (1982). 3 E. D. Lewis, S. Chen, A. Kumar, G. Blanck, R. E. Pollack, and J. L. Manley, Proc. Natl. Acad. Sci. U.S.A. 80, 7065 (1983). 4 B. A. Oostra, R. Harvey, B. K. Ely, A. F. Markham, and A. E. Smith, Nature (London) 304, 456 (1983). 5 S. M. Hollenberg, J. S. Lai, J. L. Weickmann, and T. Date, Anal. Biochem. 143, 341 (1984). 6 y. Morinaga, T. Franceschini, S. Inouye, and M, Inouye, Bio/Technology 2, 636 (1984). 7 K. Foss and W. H. McClain, Gene 59, 285 (1987). s W. Mandecki, Proc. Natl. Acad. Sci. U.S.A. 83, 7177 (1986). 9 G.-J, J. Chang, B. J. B. Johnson, and D. W. Trent, DNA 7, 211 (1988). 10 A. V. Bellini, F. de Ferra, and G. Grandi, Gene 69, 325 (1988), H B. Hofer and B. Kiihlein, Gene 84, 153 (1989). 12 M. Sugimoto, N. Esaki, H. Tanaka, and K. Soda, Anal. Biochem. 179, 309 (1989). 13 S. N. Slilaty, M. Fung, S.-H. Shen, and S. Lebel, Anal. Biochem. 185, 194 (1990). 14 D. B. Olsen and F. Eckstein, Proc. Natl. Acad. Sci. U.S.A. 87, 1451 (1990). J5 R. Higuchi, B. Krummel, and R. K. Saiki, Nucleic Acids Res, 16, 7351 (1988). z6 R. M. Nelson and G. L. Long, Anal. Biochem. 180, 147 (1989). r7 A. Hemsley, N. Arnheim, M. D. Toney, G. Cortopassi, and D. J. Galas, Nucleic Acids Res. 17, 6545 (1989). t8 M. Tomic, I. Sunjevaric, E. S. Savtchenko, and M. Blumenberg, Nucleic Acids Res. 18, 1656 (1990).
METHODS IN ENZYMOLOGY,VOL. 217
Copyright © 1993by AcademicPress, Inc. All rightsof reproductionin any form reserved.
174
MUTAGENESIS AND GENE DISRUPTION
[12]
but require an additional cloning step. This chapter details a method that yields average frequencies of mutants of around 60%. Principle of Method The fundamental prerequisite for site-specific mutagenesis is the presence of the DNA target region in single-stranded form to allow annealing of the mutagenic oligonucleotide. One way to achieve this (which has a number of advantages; see below) is the combination of two plasmid single strands of different origin to form a gapped plasmid. 4 This is shown in Fig. l, steps 2-4. An aliquot of the plasmid is cleaved with one or two restriction enzymes in such a way that the target segment for mutagenesis is cut out, and the nontarget segment is isolated. A second aliquot of the plasmid is linearized to allow physical separation of the two DNA strands in the following step. The respective cut must lie outside the target region to regenerate circular molecules in the subsequent reaction. Both double-stranded DNA (dsDNA) species are then mixed, "melted," and reannealed. As shown in Fig. l, this strategy in fact yields two complementary gapped circular molecules in equal amounts. As the mutagenic oligonucleotide will anneal to only one of them, the other will lead to wild-type progeny. To eliminate this "undesired" gapped circle, it is linearized and separated. Linearization is achieved by restriction endonuclease cleavage after selective annealing of an appropriate "restriction oligonucleotide" to its single-stranded region (Fig. 1, steps 5a and b). Subsequently, the remaining circular molecule can easily be separated from the linear species (which would be partially converted into circular molecules during the following elongation/ligation reaction) by agarose gel electrophoresis (AGE). To suppress the progeny from the wild-type strand of the heteroduplex, different mechanisms of biological selection have been exploited. 19-24The only one of these that is independent from any plasmid-based feature has been described by Kunkel et al. 21 for M13 vectors. The strand to be selected against is isolated from a d u t - u n g - host and consequently contains some dU residues. Such a DNA strand is preferentially degraded 19 S. Hirose, T. Kazuyuki, H. Hori, T. Hirose, S. Inayama, and Y. Suzuki, Proc. Natl. Acad. Sci. U.S.A. 81, 1394 (1984). 20 W. Kramer and H.-J. Fritz, this series, Vol. 154, p. 350. 21 T, A. Kunkel, J. D. Roberts, and R. A. Zakour, this series, Vol. 154, p. 367. 22 p. Carter, H. Bedouelle, and G. Winter, Nucleic Acids Res. 13, 4431 (1985). 23 M. A. Vandeyar, M. P. Weiner, C. J. Hutton, and C. A. Batt, Gene 65, 129 (1988), 24 j. Messing, this series, Vol. 101, p. 20.
[121 STEP 1
3/2
EFFICIENT MUTAGENESIS IN PLASMIDS
175
AQBtransform > reisolate A ~ B dut-g..ng-strain piasmid >
C cleave at A, f3 [ isolate non~ target fragment
C
|
I cleave at C A
4
5a
5b
6
denature and reanneal
B
J
anneal restriction a igonuc eotide D
l cleave at D
isolate gapped circ e
FIG. 1. Scheme illustrating the preparation of the plasmid substrate for mutagenesis. Normal and dU-containing DNA strands are distinguished by thick and thin lines, respectively. A, B, C, and D are restriction sites. The target segment for mutagenesis is indicated by zigzag lines. The linear products formed during reannealing are omitted for clarity. [Reprinted from B. Hofer and B. Kiahlein, Gene 84, 153 (1989) with permission.]
176
MUTAGENESIS AND GENE DISRUPTION
[12]
in strains that are wild type in this trait. The strategy (annealing of strands of different origin) used to form the gapped circle easily allows the combination of a dU-containing template strand with a normal complementary one (Fig. 1, steps 1-4). In addition, the use of a gapped circle, as compared to a completely single-stranded circle, has a number of advantages for mutagenesis. First, in vitro DNA synthesis is facilitated. Second, the major part of the DNA molecule is protected against unintentional annealing of the mutagenic oligonucleotide, which may lead to unwanted mutations (see Unintentional Mutations in General, below). Third, the probability of masking the target region by formation of stable intramolecular secondary structures is considerably reduced. This suggests, therefore, that the smaller one makes the gap, the better. One extreme is that the whole gap can be filled by the oligonucleotide. In this case unintentional annealing virtually cannot occur, and moreover the DNA polymerase reaction (which presumably reduces the mutant yield) is no longer necessary. However, if mutations are to be introduced into the same DNA segment at different sites, it is economical to choose a gap size that allows the same gapped circle to be used as a substrate for all mutagenesis experiments. Once the gapped circle has been isolated, the actual mutageneses are carried out in a conventional way. The phosphorylated oligonucleotide is annealed to the gapped circle, the gap is filled by a DNA polymerase, the remaining nicks are closed by a DNA ligase, and the resulting heteroduplex molecule is introduced into a bacterial cell.
Materials and Reagents
Strains CJ23625 [dutl ungl thil relA1/pCJl05 (Cmr)] BMH71-18mutS 26 [A(lac-proAB) thi supE mutS215::Tn10/F' l a d q ZAM15 proA +B +] DH127 [endA1 hsdRl7 (rk-, mk ÷) supE44 thil recA1 gyrA96 relA1] Media LB (per liter): 10 g Bacto-tryptone, 5 g Bacto-yeast extract, 10 g NaCI, pH adjusted to 7.5 with NaOH. For plates, 15 g Bacto-agar is added ,.5 j. Geisselsoder, F. Witney, and P. Yuckenberg, BioTechniques 5, 786 (1987). :6 B. Kramer, W. Kramer, and H.-J. Fritz, Cell 38, 879 (1984). 27 D. Hanahan, J. Mol. Biol. 166, 557 (1983).
[12]
E F F I C I E N T M U T A G E N E S I S IN P L A S M I D S
177
TB (per liter): Dissolve 12 g Bacto-tryptone and 24 g Bacto-yeast, extract in 900 ml water, add 4 ml glycerol, and autoclave. Dissolve 12.5 g K2HPO 4 and 2.31 g KH2PO 4 in 100 ml water and autoclave. Mix both solutions
Buffers and Solutions TE: 10 mM Tris-HC1 (pH 8.0), 1 mM ethylenediaminetetraacetic acid (EDTA) (pH 8.0) 8x HB (hybridization buffer): 1.5 M KC1, 0.1 M Tris-HCl (pH 7.5) 5 x KB (kinase buffer): 300 mM Tris-HCl (pH 8.0), 50 mM MgC12 , 0.5 mg/ml bovine serum albumin (BSA) 2 x MB (mutagenesis buffer): 23 mM Tris-HCl (pH 7.5), 9 mM MgC12, 4 mM dithiothreitol (DTT), 1.5 mM ATP, 0.8 mM each dNTP 5 x TMN: 200 mM Tris-HCl (pH 8.0), 50 mM MgCI2, 250 mM NaCI TENA: 40 mM Tris base, 1 mM EDTA, 20 mM sodium acetate, adjusted to pH 8.3 with acetic acid GMM (gel loading mix): 40% (v/v) glycerol, 50 mM EDTA (pH 8.0), 0.05% (w/v) bromphenol blue, 0.05% (w/v) xylene cyanol Solution I (minipreparation): 50 mM glucose, 25 mM Tris-HC1 (pH 8.0), 10 mM EDTA (pH 8.0) Solution II (minipreparation): 0.2 N NaOH, 1% (w/v) sodium dodecyl sulfate (SDS) Phenol solution: 227 g phenol, 100 ml I M Tris-HCl (pH 8.0), 12.5 ml water, 12.5 ml m-cresol, 0.5 ml 2-mercaptoethanol, 0.25g 8-hydroxyquinoline PCI solution: Phenol solution chloroform/isoamyl alcohol (50/48/2, v/v/v) CI solution: Chloroform/isoamyl alcohol (2/1, v/v) tRNA solution: 1/xg//xl tRNA (Bethesda Research Laboratories, Gaithersburg, MD) in TE
Enzymes T4 and T7 DNA polymerases (Pharmacia, Uppsala, Sweden), T4 DNA ligase (Boehringer Mannheim, Mannheim, Germany), T4 polynucleotide kinase (New England BioLabs, Beverly, MA), and restriction enzymes (Pharmacia, New England BioLabs, Bethesda Research Laboratories, and Boehringer Mannheim) are commercial preparations
Oligonucleotides Oligonucleotides are synthesized from phosphoramidite monomers on a "Gene Assembler" (Pharmacia) according to the instructions of the manufacturer and are purified by polyacrylamide gel electrophoresis.
178
MUTAGENESIS AND GENE DISRUPTION
[12]
Other Materials "Qiagen" columns (Qiagen, Chatsworth, CA) Method
Preparation of Gapped Circle Preparation ofdU-Containing Linear Plasmid. The plasmid to be mutagenized is isolated from a dut- ung- strain such as CJ236. It is cleaved at a preferably unique restriction site located outside the target region for mutagenesis. The DNA is purified and taken up in a buffer of low ionic strength or in water. This is necessary for formation of the gapped circles. For the plasmid isolation we initially used a standard CsC1 gradient protocol (see, for example, Ref. 28). When we tried a small-scale procedure, we encountered problems in formation of the gapped circles. However, when the minipreparation procedure was combined with a purification step using a Qiagen column, these problems could be overcome. Procedure 1. Prepare competent cells of a dut- ung- strain (e.g., CJ236) and transform them with the plasmid. We use the Hanahan procedure z7 with some slight modifications29: RbCI, DTT, and dimethyl sulfoxide are replaced by KC1, 2-mercaptoethanol, and dimethylformamide, respectively. 2. Screen a few transformants for the presence of intact plasmid: Isolate the plasmids by a quick minipreparation procedure (see, for example, Ref. 30), cleave them with a frequently cutting restriction enzyme and with the enzymes to be used for the mutagenesis, and check by AGE if the fragment patterns are as expected. 3. For a medium-scale preparation grow the transformed cells in a rich medium (e.g., TB) containing uridine (0.25 /zg/ml) and the appropriate antibiotic. The plasmid may be isolated using a standard CsC1 gradient protocol (see, for example, Ref. 28) or a Qiagen column as described by the supplier. 4. Linearize about 10 pmol of plasmid with an appropriate restriction enzyme. 5. Add EDTA to complex all divalent cations and purify the DNA by repeated extraction with the PCI solution. Remove the organic phase from the bottom of the tube to minimize the loss of plasmid. 28 D. Ish-Horowicz and J. F. Burke, Nucleic Acids Res. 9, 2989 (1981). 29 B. Hofer, Eur. J. Biochem. 167, 307 (1987). 30 D. S. Holmes and M. Quigley, Anal. Biochem. 114, 193 (1981).
[12]
EFFICIENT MUTAGENESIS IN PLASMIDS
179
6. After the last removal transfer the remaining aqueous phase to a new tube. Ethanol precipitate the plasmid and resolve it in 0.1 x TE. Preparation of Unmodified Nontarget Segment. Unmodified plasmid is isolated from a normal (i.e., dut + ung +) strain. The target segment is cut out with appropriate restriction enzyme(s). The nontarget segment is isolated by AGE and taken up in a buffer of low ionic strength or in water. For the isolation we use low melting gels and a modified version of the protocol of Wieslander. 31
Procedure 1. Isolate the unmodified plasmid as described in Preparation of dUContaining Linear Plasmid (above). 2, Digest about 10 pmol of the plasmid with the restriction enzyme(s) appropriate to cut out the target segment. 3. Add EDTA to complex all divalent cations and extract once with PCI solution. 4. To the aqueous phase add 0.25 vol of GMM and load on about 150 mm 2 of an appropriate low-melting-agarose gel. We generally use a horizontal submarine 0.8% (w/v) gel [14 (length) x 11 x 0.4 cm] prepared with TENA buffer containing 0.5 t~g/ml ethidium bromide. Run the gel in the same buffer at 70-100 V. 5. Mark the position of the nontarget fragment during brief illumination at 360 nm and cut out the gel piece. 6. Melt the gel piece at 65 ° . 7. Add 1 vol of phenol solution prewarmed to 65 °, vortex for 45 sec, and spin in an Eppendorf centrifuge at full speed for 2 min. Remove the organic phase, briefly recentrifuge the aqueous phase, and transfer it to a new tube. 8. Extract twice with 1 vol of PCI solution. 9. Extract once with 1 vol of CI solution, 10. Concentrate approximately twofold by extraction with 2.5 vol of l-butanol: vortex and spin for 30 sec each. I 1. Add 0.1 vol of 3 M sodium acetate, pH 4.8 (with acetic acid) and precipitate with 3 vol of ethanol, wash with 70% (v/v) ethanol, dry, and dissolve in 0. ! x TE. Formation of Gapped Circles. The dU-containing linear plasmid and the unmodified nontarget segment of the plasmid, both in water or in buffer of low ionic strength, are mixed. The duplexes are converted into single strands by heat, and these are reannealed by increasing the ionic strength followed by cooling to room temperature. This yields two complementary 31 L. Wieslander, Anal. Biochem. 98, 305 (1979).
180
MUTAGENESIS AND GENE DISRUPTION
1
gc~ lin~ fr~
2
[12]
3
~OC
-,~l lin
FIG. 2. Verification of gapped circle formation by AGE. Lane 1, mixture of the linearized plasmid (lin) and the nontarget fragment fir); lane 2, same as lane 1, but after the denaturation/ renaturation step (gc, gapped circle); lane 3, reference containing linear din) and open circular (oc) plasmid. [Reprinted from B. Hofer and B. Kiihlein, Gene 84, 153 (1989) with permission.]
gapped circle species (inseparable by AGE) as well as the linear starting products. In our experience, this step is susceptible to the purity and ionic strength of the DNA solutions, to the DNA concentration, and to minor changes in the melting/reannealing procedure. Therefore it is highly advisable to check the reaction by AGE (Fig. 2). The gapped circle migrates somewhat faster than the open circle (a by-product in most plasmid preparations, and which usually is a good marker), depending on the size of its gap. It may happen that the gapped circle band coincides with one of the linear DNA bands and may thus be hidden. This problem can always be resolved by altering the agarose concentration, which (along with other factors such as temperature) influences the relative mobilities of linear and circular DNA. We normally use a three- to fivefold excess of linear plasmid over nontarget segment, A poor formation of gapped circles was observed below as well as above certain DNA concentrations. In our hands, amounts of 1-5 pmol (2-10/zg) of linear plasmid in a final volume of 200 /~1 work well. The mixture of the gapped circles was found to be somewhat unstable even when stored at - 2 0 °. Presumably the gapped molecules are reconverted into the thermodynamically more stable starting products. Therefore, this mixture should be used within 1-2 weeks.
[12]
E F F I C I E N T M U T A G E N E S I S IN P L A S M I D S
181
The following procedure is a modification of the protocol of Kramer and Fritz. z°
Procedure 1. Mix 2.5 pmol of linear dU-containing plasmid, 0.75 pmol of unmodified nontarget segment, and H20 to yield a volume of 175/M. 2. Hold the mixture at 70 ° for 5 rain. 3. Add 25/zl of 8 × HB, prewarmed to 70 °, and continue the incubation at 70 ° for another 3 rain. 4. Cool the tube to room temperature in air (5 rain). Cleavage and Separation of Undesired Gapped Circle. To selectively cleave the undesired gapped circle, a "restriction oligonucleotide" is used that specifically anneals to it. This oligonucleotide contains one strand of a restriction site that must not occur outside the gap, but that may occur in the gap more than once. A 20-mer usually is of sufficient length to obtain complete cleavage at 370.9 Incubation with the restriction enzyme should not be extensively long as this may lower the yield of the desired gapped circle. Presumably some annealing of this DNA to the complementary gapped circular (or, after cleavage, gapped linear) species and/or to the oligonucleotide (via its restriction "half-site," which in most cases will be self-complementary) accounts for this decrease. Therefore, the enzyme concentration and incubation time given in the procedure should be regarded only as a guideline and may have to be determined empirically. Cleavage is analyzed by AGE. The intensity of the band representing the gapped circle(s) should have decreased by 50%. The remaining gapped circle is isolated from a preparative gel.
Procedure I. Mix 200/zl of the gapped circle solution with 50 pmol of the "restriction oligonucleotide." Supplement and adjust appropriately for the subsequent restriction digest. 2. Incubate for 5 min at 65 ° and for 5 min at room temperature (air). 3. Add 60 units of restriction enzyme and incubate at the appropriate temperature for 45 min. 4. Withdraw an aliquot for AGE; store the remainder at - 2 0 °. 5. If the reaction is complete, complex Mg 2+ with EDTA, extract once with PCI solution, ethanol precipitate (if the volume is too large, butanol concentrate or add carrier), and take up in 25/zl TE. 6. Add 0.25 vol of GMM and load on about 30 mm 2 of an appropriate low-melting-agarose gel. Run at 70-85 V. 7. Isolate the gapped circle as described in Preparation of Unmodi-
182
MUTAGENESIS AND GENE DISRUPTION
[12]
fled Nontarget Segment (above). Prior to elution add 4/xl tRNA solution to the gel piece as a carrier. (The tRNA remains in the mixture. There are no indications that it interferes with the mutagenesis procedure.) 8. Finally, take up the gapped circle in about 100/zl TE (corresponding to a DNA concentration of about 1 fmol//~l).
Oligonucleotide-Directed Mutagenesis Phosphorylation of Mutagenic Oligonucleotides: Procedure 1. Incubate 20 pmol of mutagenic primer in 15/zl KB, 10 mM DTT, 0.1 mM ATP with 1 unit T4 polynucleotide kinase for 30 min at 37 °. 2. Incubate for 10 min at 70 °, and briefly quench in ice. Use without purification.
Conversion of Gapped Circle into Covalently Closed Heteroduplex Circle. The mutagenic oligonucleotide is annealed to the isolated gapped circle, the remainder of the gap is filled by a DNA polymerase, and the nicks are closed by a DNA ligase. T4 DNA polymerase (at 37 °) consistently led to higher mutant yields than Klenow enzyme (at room temperature), as has also been reported by others. 25'32 The reason for this increase may be that the T4 enzyme has a reduced capacity to displace double-stranded structures. 33 However, T4 polymerase is more sensitive to secondary structures in the template. If this is a problem, addition of the T4 ssDNA-binding protein or of a small amount of Klenow enzyme is recommended. 34
Procedure 1. Mix 3.0/~1 of phosphorylated primer with 2.5/zl of isolated gapped circle, 1.0/zl H20, and 0.5/xl 8 × HB. 2. Incubate for 5 min at 65° and for 3 min at room temperature (air). Add 10.0/zl 2 × MB, 1.0/zl H20, 1/xl T4 DNA ligase (2 units//xl), and 1 /xl T4 DNA polymerase (1 unit//zl) 4. Incubate for I0 min at room temperature followed by 110 min at 37 °. 5. Add 2/xl 150 mM EDTA (pH 8.0). Transformations. Two subsequent transformations are carried out. In the first transformation, the strain must be wild type for dut and ung. It should also be deficient in mismatch repair, which seems to act efficiently .
32 W. Kramer, A, Ohmayer, and H.-J. Fritz, Nucleic Acids Res. 16, 7207 (1988). 33 N. G. Nossal, J. Biol. Chem. 249, 5668 (1974). 34 K. C. Deen, T. A. Landers, and M. Berninger, Anal. Biochem. 135, 456 (1983).
[12]
EFFICIENT MUTAGENESIS IN PLASMIDS
183
not only on incorrectly paired or unpaired bases, but also on bulge loops .35 Different strains 2°'35 are available that are deficient in the dam-instructed repair system; this seems to be responsible for the majority of repair events .35 As the primary transformants were found occasionally to contain progeny from both the normal (mutant) and the dU-substituted (wild-type) strand, a second transformation is carried out. The cells from the first transformation are therefore not spread on plates, but used to inoculate a liquid broth, from which plasmids are then isolated. A strain of choice is subsequently transformed with this plasmid mixture, and the cells are plated out. Procedure
1. Use 1-4/xl of the mixture of in vitro mutagenesis to transform 80 /xl of competent dut + ung + cells as described in Preparation of dUContaining Linear Plasmid (above). 2. After the 1-hr incubation in SOC medium, 27 use 200 ~zl of the cell suspension to inoculate 2 ml LB medium containing the appropriate antibiotic. Grow this culture overnight. 3. Isolate plasmid DNA from 1 ml of this culture by a fast minipreparation procedure (see, for example, Ref. 30) and take up in 50/xl 0.1 x TE. 4. Use 1/xl of a 1 : 100 dilution of this preparation to transform 20 pJ of competent cells (e.g., strain DH1). 5. Spread 3 /zl of the resulting 100 /zl on LB plates containing the appropriate antibiotic. A few hundred colonies are usually obtained. Screening for and Analysis of Mutants
Normally the analysis of three colonies of an individual mutagenesis experiment is sufficient to find at least one mutant clone. Therefore, DNA sequencing can be used for screening. However, if many mutageneses are carried out simultaneously, single-base sequencing or restriction analysis (when feasible) may be considered. Whatever screening method is used, we emphasize that it is insufficient to demonstrate only the presence of the intended mutation, and that it is absolutely necessary to sequence the whole region relevant for subsequent investigations to verify the absence of any unintentional mutation (see Unintentional Mutations, below). Isolation o f Plasmids. When RNase is omitted, plasmids prepared by the following minipreparation procedure 36 yield excellent sequencing 35 R. A. Fishel, E. C. Siegel, and R. Kolodner, J. Mol. Biol. 188, 147 (1986). 36 G. Morelle, Focus U , 7 (1989).
184
MUTAGENESIS AND GENE DISRUPTION
[12]
results. About 3 ml of each culture grown in LB medium was sufficient with our plasmids. A lower copy number may be compensated for by using a richer medium (e.g., TB).
Procedure 1. Pellet cells from 2.8 ml of each culture for 1 min at 8,000 rpm in an Eppendorf centrifuge; remove supernatants completely. 2. Resuspend pellets in 150/zl of ice-cold solution I by vortexing; leave at room temperature for 5 min. 3. Add 300 ~1 of solution II (freshly prepared), mix by inverting the tubes several times, and place on ice for 5 min. 4. Add 225/zl of 7.5 M ammonium acetate and mix by inverting the tubes several times; place on ice for 10 min. 5, Centrifuge at full speed for 5 rain, and carefully transfer about 600 /zl of the supernatants into new tubes. 6. To the supernatants add I vol of 2-propanol, mix, place on ice for 10 min, spin at full speed for I0 min, and discard supernatants. 7. To the pellets add ! ml of 70% (v/v) ethanol, vortex briefly, spin at full speed for 3 min, carefully remove the supernatants, and dry the pellets under vacuum for a few minutes. 8. Resolve the pellets in 100/zl 0.1 x TE. Double-Stranded DNA Sequencing. The plasmids isolated by the minipreparation procedure described above were denatured essentially as reported by Hattori and Sakaki. 37 If necessary, this step can be checked by AGE: the denatured plasmid migrates somewhat faster than the native form. The sequencing reaction was adopted from Tabor and Richardson 38 with a few modifications. When relatively high primer-to-template ratios were used (see Procedure, below), the signal-to-background ratio of the autoradiographs was usually indistinguishable from that obtained with CsCI gradient-purified DNA.
Procedure 1. Mix 80/xl of minipreparation and 20/zl of 1 N NaOH, 1 mM EDTA. Leave at room temperature for 5 min. 2. Mix with 40/zl 5 M ammonium acetate and 420/zl ethanol. Place in a - 7 0 ° freezer for 15 min, spin at full speed for 10 min (4°), and remove the supernatant. 3. Add 1 ml 70% (v/v) ethanol (-20°), vortex briefly, spin for 3 min 37 M, Hattori and Y. Sakaki, Anal. Biochem. 152~ 232 (1986).
3~ S. Tabor and C. C. Richardson, Proc. Natl. Acad. Sci. U.S.A. 84, 4767 (1987).
[12]
E F F I C I E N T M U T A G E N E S I S IN P L A S M I D S
185
as above, carefully remove supernatant, and dry the pellet under vacuum for a few minutes. 4. Resolve the pellet in 32 p~! H20. 5. Mix 7 t~l (about 0.25 pmol) of this solution with 2 t~l 5 × TMN and I/~1 primer (5 pmol). Incubate at 65° for 5 min, then at room temperature (air) for 3 rain. 6. Perform the primer elongations, for example, as described by Tabor and Richardson. 38 We take only half their dNTP concentration in the labeling step and use unmodified T7 DNA polymerase. Limitations and Modifications of the Method There are no limitations as far as the type (substitution, deletion, or insertion) and position of the mutation are concerned. However, three restriction sites (A, B, and C) are required to generate the gapped circles (Fig. 1). Sites A and B are likely to be found in any recombinant plasmid, because the cloning site(s) may serve this purpose. Site C (outside the target region), preferably unique but not necessarily, is also likely to be available in any plasmid. There is no absolute need for an additional site D to linearize the undesired gapped circle, as in most instances it should be possible to make use of either site A or site B for this purpose. In both gapped circles site A (or B) is incomplete. To our knowledge, there are no data in the literature on the substrate properties of incomplete (distinct from single-stranded) restriction sites. It is tempting to assume that such sequences are generally uncleavable; however, preliminary results indicate that this is not the case (see below). Three situations may be envisaged. 1. The site is not cleaved in both gapped circles. Therefore selective cleavage is possible by using a "restriction oligonucleotide" (or limited enzymatic elongation). 2. The site is cleaved in both gapped circles. In this case it cannot be used as site D. 3. The site is cleaved in only one of the two gapped circles. This gapped circle is then chosen to be the undesired one and can be selectively linearized without the need for a restriction oligonucleotide (or limited enzymatic elongation). The third case most likely applies only to sites produced by staggered cuts, as only then are the structures of the sites in the complementary gapped circles not identical. To illustrate this, when the gap has been generated using EcoRI and HindIII, the structures of the sites in the gapped circles (termed "gc + " and " g c - ") are as follows:
186
MUTAGENESIS AND GENE DISRUPTION
gc +
........ G AGCTT ........ ........ CTTAAG .......................... TTCGAA ........ / / /
gc-
[12]
/
........ GAATTC .......................... AAGCTT ........ ........ CTTAA A ........
The internucleotide linkages that would be cut by the endonucleases in the complete recognition sequences are indicated by slash marks (/). For each enzyme, the respective internucleotide linkages are located in the single-stranded segment of one gapped circle, but in the double-stranded segment of the other. Preliminary results indicate that HindlII is unable to cut either of its truncated sites, whereas EcoRI is able to cleave the site in g c - , but not in gc +. Therefore, when EcoRI is used, g c - is defined as the "undesired" gapped circle and can be linearized even without a restriction oligonucleotide. Unintentional Mutations
Mutant screening frequently was done by single-base or complete DNA sequencing. The application of this technique resulted in the accumulation of a substantial body of information on unintentional mutations (UMs).
Unintentional Mutations in General About one-half of the UMs observed can be explained by unintentional annealing of the mutagenic oligonucleotide in combination with the enzymatic activities of the in vitro system. An example is shown in Fig. 3. Evidently, even a single base pair at the 5' end of such a hybrid can be sufficient to stabilize the structure long enough to reach replication. The residual UMs comprised large deletions (hundreds of base pairs), which also might be mediated by template-primer interactions, and a few point mutations, which might be due to errors by a DNA polymerase (in vitro or in vivo). With some oligonucleotides the yield of UMs was high (about 40%) or even appeared to be coupled to the generation of the desired mutation. Thus it became a problem to obtain the intended mutation without the simultaneous introduction of the unintended one. In these cases an additional high-temperature incubation with the DNA polymerase prior to
[12]
187
EFFICIENT MUTAGENESIS IN PLASMIDS T
C C A @ A @ @ T T
T
@ A
@ T T C
T T
C TAAA©ACA@C
TA C@ @ATA A A C
A
I
3'
C @ CoC O
T,@ @C
AAT
TEMPLATE
@C@
AT
oT ~
. ojjJ'° @C TA TA TC@
@
ILPR33
@
T T @@C Co
C@ TA¢ T A Tc T @T @ T A A A T T C A A A A T OTA C @@Q;AAOT T C CcTOCTT
5' FIG. 3. Formation of an unwanted mutation by unintentional annealing of the primer ILPR33 to the template. The structure shown was calculated by a program of Zuker and Stiegler [M. Zuker and P. Stiegler, Nucleic Acids Res. 9, 133 (1981)] originally written for RNA, The G • T pair in the hybrid is indicated by a circle. Exonucleolytic degradation of the unannealed 3' end of the primer (8 nt), elongation, and finally ligation yielding a covalently closed circular (ccc) plasmid would explain the observed mutation.
elongation at room temperature (as originally described by Strauss e t al. 39 to increase the yield of site-specific deletions) proved to be most helpful. In these experiments we used the Klenow enzyme (under conditions de39 M. Strauss, C. H. Streuli, and B. E. Griffin, Gene 49, 331 (1986).
188
MUTAGENESIS AND GENE DISRUPTION
[12]
scribed by Kramer et al.4°). We have evidence, however, that the hightemperature step might also work with T4 polymerase (see below). After annealing of template and primer for 5 min at 68 ° (or, if lower, at the calculated Tm of the hybrid39), dNTPs, salts, and Klenow enzyme (0.75 units) were added and the incubation was continued at the same temperature for another 5 min. Only then was the mixture cooled to room temperature (in air for 5 min), after which 0.4 units of DNA polymerase and 5 units of DNA ligase were added, and the standard protocol was followed. This modified procedure was performed with three "problematic" primers. No UMs were found in 18 clones analyzed while the intended mutations were obtained at the same frequency as with the standard protocol. Experiments with 5'-labeled primers demonstrated that all unannealed molecules were partially degraded by the 3'-exonucleolytic activity of the Klenow enzyme during the high-temperature (68 °) incubation. This gives a rationale for the observed suppression of UMs formed by unintentional annealing. So far, we have not needed to use the additional high-temperature step when mutagenesis reactions were carried out with T4 DNA polymerase. If necessary, it should be possible to apply the T4 enzyme successfully in the high-temperature protocol. A pilot experiment as described in the preceding paragraph, but under T4 mutagenesis conditions, showed that after the 68 ° step the selective degradation of unannealed 28-mer primers was, as may be expected, even more pronounced than when the Klenow enzyme was used. Unintentional M u t a t i o n s in Insertions
When mutant DNAs were sequenced that originated from experiments with oligonucleotides designed to generate insertions, as many as 17 of a total number of 47 (36%) showed sequence deviations in the regions originating from the mutagenic primers. We observed substitutions and deletions of one or two adjacent or nonadjacent nucleotides (nt). Remarkably, all of these sequence errors were located in the insertions (varying from 27 to 45 nt in length), that is, in those parts of the primers that did not base pair with the template. They are probably due to errors in chemical synthesis and not to some biological loop "repair" mechanism. When we used one of these primers in a modified mutagenesis procedure (currently under investigation) in which the wild-type strand was degraded beyond 40 W. Kramer, V. Drutsa, H.-W. Jansen, B. Kramer, M. Pflugfelder, and H.-J. Fritz, Nucleic Acids Res. 12, 9441 (1984).
[13]
HIGH-EFFICIENCY
SITE-DIRECTED
MUTAGENESIS
189
the position of the loop prior to transformation, unintentional mutations again were found in some of the inserts. 41 Results reported by Clackson and Winter42 also argue against a biological phenomenon. They replaced 383-nt-long DNA segments by site-directed mutagenesis using polymerase chain reaction (PCR)-generated primers. Despite the formation of 383-ntlong (interior) loops on annealing of the polynucleotides, all 14 positive clones sequenced were found to be correct. Acknowledgments The authors wish to thank H. Bl6cker, R. Frank, and co-workers for oligonucleotide synthesis, P. Artelt, J. Hoppe, and H.-J. Fritz for the gifts of vectors and strains, and R. Brownlie for linguistic advice. This work was supported by the Bundesministerium fiir Forschung und Technologie through Grant No. 03 8706 9. 4J R. Wefel and B. Hofer, unpublished observations (1991). 4: T. Clackson and G. Winter, Nucleic Acids Res. 17, 10163 {1989),
[13] S i t e - D i r e c t e d M u t a g e n e s i s of S i n g l e - S t r a n d e d a n d Double-Stranded DNA by Phosphorothioate Approach
By DAVID B. OLSEN, JON R. SAVERS, and FRITZ ECKSTEIN Introduction
Oligonucleotide-directedmutagenesis allows the introduction of almost any precisely defined mutation into a cloned, sequenced gene. The mutation may comprise single or multiple mismatches or it may involve the insertion or deletion of a large number of bases. There are a number of methods described in the literature for the efficient production of site-directed mutations. The gapped duplex,l uracilcontaining template, 2 and coupled primer approaches3 have all been used to improve the basic method described in detail by Zoller and Smith. 4-6 However, these methods are limited to protocols using single-stranded vectors, involve the transfection of heteroduplex DNA (resulting in the W. Krammer and H.-J. Fritz, this series, Vol. 154, p. 350. z T. A. Kunkel, J. D. Roberts, and R. A. Zakour, this series, Vol. 154, p. 367. P. Carter, this series, Vol. 154, p. 382. 4 M. J. Zoller and M. Smith, Nucleic Acids Res. 10, 6487 (1982). -~M, J. Zoller and M. Smith, this series, Vol. 100, p. 468. M. J. Zoller and M. Smith, this series, VD1. 154, p. 329.
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
190
MUTAGENESIS AND GENE DISRUPTION
[13]
need for specialized E s c h e r i c h i a coli strains such as mismatch repairdeficient cells, d u t - u n g - , etc.), and very often require plaque purification steps. The original phosphorothioate-based mutagenesis method 7 has undergone a number of improvements, s-t° and has several advantages over the previously mentioned methods. The fundamental difference is that selection against the wild-type sequence is carried out in vitro. Therefore, special cell lines and plaque purification are avoided. Very high mutational efficiencies are obtainable, on the order of 70-90%, 9A° which allows for direct genotypic screening by DNA sequencing) 1 In addition, random mutagenesis procedures, such as those developed by Knowles and coworkers, ~2:3 are also possible due to the high efficiency that is essential for the productive application of such protocols. Finally, the phosphorothioate approach is not limited to the use of single-stranded or phagemid 14 DNA but has been extended to double-stranded DNA vectors. ~°'~5
Principle of Phosphorothioate-Based Mutagenesis Methodology for Single-Stranded DNA The phosphorothioate-based oligonucleotide-directed mutagenesis method exploits the observation that several restriction endonucleases cannot linearize DNA containing certain phosphorothioate internucleotidic linkages. 8'16-19The first step of the procedure involves annealing of a mismatch oligonucleotide primer to the (+)strand of a single-stranded
7 j. W. Taylor, J. Ott, and F. Eckstein, Nucleic Acids Res. 13, 8765 (1985). s K. L. Nakamaye and F. Eckstein, Nucleic Acids Res. 14, 9679 (1986). 9 j. R. Sayers, W. Schmidt, and F. Eckstein, Nucleic Acids Res. 16, 791 (1988). 10 D. B. Olsen and F. Eckstein, Proc. Natl. Acad. Sci. U.S.A. 87, 1451 (1990). u L. Serrano, A. Horovitz, B. Avaron, M. Bycroft, and A. R. Fersht, Biochemistry 29, 9343
(1990). 12 j. D. Hermes, S. M. Parekh, S. C. Blacklow, H. Koester, and J. R. Knowles, Gene 84, 143 (1989). 13 j. D. Hermes, S. C. Blacklow, and J. R. Knowles, Proc. Natl. Acad. Sci. U.S.A. 87, 696 (1990). 14 j. Vieira and J. Messing, this series, Vol. 153, p. 3. i5 D. B. Olsen and F. Eckstein, in "Directed Mutagenesis: A Practical Approach" (M. J. McPherson, ed.), p. 83. IRL Press, Oxford, England, 1991. 16 j. W. Taylor, W. Schmidt, R. Cosstick, A. Okruszek, and F. Eckstein, Nucleic Acids Res. 13, 8749 (1985). 17j. R. Sayers, D. B. Olsen, and F. Eckstein, Nucleic Acids Res. 17, 9495 (1989). 18 D. B. Olsen, G. Kotzorek, and F. Eckstein, Biochemistry 29, 9546 (1990). 19 D. B. Olsen, G. Kotzorek, J. R. Sayers, and F. Eckstein, J. Biol. Chem. 265, 14389 (1990).
[13]
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS
A
B
C
D
19l
E
SCHEME[. Schematic representationof the phosphorothioate-based mutagenesis method. Single-stranded DNA, annealed with a mismatch primer [ t , position of the mismatch nucleotide(s)] (A), is converted to RFIV DNA using T7 DNA polymerase, T4 DNA ligase, and dNTPaS mix (B). The region containing phosphorothioate internucleotidic linkages in the newly synthesized ( - )strand is drawn with bold lines. The wild-type ( + )strand is specifically hydrolyzed by reaction with a restriction endonuclease resulting in a nicked DNA product (C). The nick is taken as the starting point for digestion by either a 3' ~ 5'- or a 5' ---, 3'-exonuclease (D). A fully complementary homoduplex RFIV molecule, which is ready for transformation, is generated on repolymerization (E).
circular phage DNA (Scheme IA). The primer is extended by T7 DNA polymerase using a mixture of three deoxynucleoside triphosphates and the Sp-diastereomer of a deoxynucleoside 5'-O-(l-thiotriphosphate) (dNTPo~S) such as dCTPaS (Fig. 1). The resulting ( - )strand of the newly synthesized RFIV DNA contains phosphorothioate groups (see bold lines in Scheme IB). This strand asymmetry is exploited by reaction with a restriction enzyme (e.g., NciI 8) that hydrolyzes only the wild-type (+)strand (Scheme IC). The resulting nick is converted to a gap by reaction with an exonuclease (Scheme ID). The gapped DNA is repolymerized using the mutant strand as the template, resulting in the formation of a mutant homoduplex with the mutant sequence present in both strands (Scheme IE). The DNA can be transformed into any E. coli host strain.
NH 2
-0-,,
o
o
o
II
II
!
P~O
I
O.
P ~ O ~ P ~ O
I
O-
....
t
S OH
FIG. 1. Structure of the Sp-diastereomer of deoxycytidine 5'-O-(1-thiotriphosphate), dCTPaS. The sulfur atom replaces a nonbridging oxygen atom of the a-phosphorus.
192
MUTAGENESIS AND GENE DISRUPTION
[13]
Experimental
Media 2YT medium: 16 g tryptone, l0 g yeast extract, 5 g NaC1 per liter; autoclave B-broth soft agar: 0.5 g tryptone, 0.4 g NaCI, 50/zl 1% (v/v) B~ solution, 0.3 g agar in 50 ml H20; autoclave Bx solution: l0 mg/ml thiamin hydrochloride
Reagents TE buffer: 10 mM Tris-HCl (pH 8), l mM ethylenediaminetetraacetic acid (EDTA); autoclave NTE buffer: 100 mM NaCI, I mM EDTA, 10 mM Tris-HC1 (pH 8); autoclave DNA buffer: 20 mM NaCI, 1 mM EDTA, 20 mM Tris-HCl (pH 8); autoclave 4 x dNTP mix: l0 mM dATP, l0 mM dCTP, 10 mM dGTP, 10 mM dTTP; sterile filter dCTPaS mix: 5 mM dATP, 5 mM dCTPaS, 5 mM dGTP, 5 mM dTTP; sterile filter dGTPaS mix: 5 mM dATP, 5 mM dCTP, 5 mM dGTPaS, 5 mM dTTP; sterile filter Buffer A (10 x ): 100 mM MgCI z , 50 mM dithiothreitol (DTT), 500 mM Tris-HC1 (pH 8) Buffer B (10 x): 1 M Tris-HCl (pH 8), 1 M NaC1; autoclave Buffer C (10 x ): 70 mM MgC12, 50 mM DTT, 100 mM Tris-HCl (pH 8), 600 mM NaC1; sterile filter. Prepare immediately prior to use Buffer D (10 x ): 80 mM MgClz, 400 mM NaCI, 500 mM Tris-HCl (pH 7.4); autoclave Isopropyl-/3-o-thiogalactopyranoside (IPTG) solution: 30 mg IPTG in 1 ml H20; sterile filter 5-Bromo-4-chloro-3-indolyl-3-galactoside) (X-Gal) solution: 20 mg X-Gal in 1 ml deionized dimethylformamide (do not sterilize!) EcoRI nicking buffer (10 x ): 4 mM CoClz, 1 M NaC1, 1 M Tris-HC1 (pH 7.4) Ethidium bromide solution: 0.5 mg/ml
Materials and Enzymes The Sp-diastereomers of the deoxynucleosides [5'-O-(1-thiotriphosphates)] were purchased from Amersham (Amersham, England) or syn-
[13]
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS
193
thesized according to the procedure of Ludwig and Eckstein) ° Qiagen (Diisseldorf, Germany) tip 500 was used for the isolation of plasmid DNA. Nitrocellulose filters (SMl1336, 13 mm in diameter, 0.45-/xm pore size) were supplied by Sartorius. Filter units were from Millipore (Bedford, MA). Centricon-100 filtration units were obtained from Amicon Corporation (Danvers, MA). The enzymes T7 DNA polymerase, T4 polynucleotide kinase, and T7 exonuclease were obtained from United States Biochemicals (Cleveland, OH). All restriction endonucleases and exonuclease III were purchased from New England Biolabs (Beverly, MA) and E. coli DNA polymerase I was from Boehringer Mannheim (Mannheim, Germany). T4 DNA ligase 16and T5 exonuclease 21were prepared as previously described. Preparation of Single-Stranded Template DNA The first step toward successful completion of a mutagenesis experiment is effective growth and isolation of phage DNA. One of the biggest mistakes that can be made is to attempt site-directed mutagenesis with DNA that is not free from RNA or DNA fragments that are capable of acting as primers in the polymerization reaction. Even the novice can prepare sufficiently pure DNA without the need to perform RNase treatments or cesium chloride density gradient purifications. The method we recommend (procedure 1) is given below and includes two polyethylene glycol phage precipitation steps that are important factors in the preparation of suitable template DNA. Although the procedure is stretched over several days, it requires only a minimal amount of time during the first 3 days. When performing this procedure, it is important to avoid allowing phage particles to contact any of the solutions used for transformation of the mutated DNA.
Procedure 1: Preparation of Template DNA The phage carrying a sequenced insert must be present in a singlestranded DNA vector such as one of the M13 vectors characterized by Messing. 22
Day 1 1. Plate out the phage so as to give single plaques. 2. Prepare an overnight culture of, for example, SMH50 or TG1 cells 20 j. Ludwig and F. Eckstein, J. Org. Chem. $4, 631 (1989). 21 j. R. Sayers and F. Eckstein, J. Biol. Chem. 265, 18311 (1990). 22 j. Messing, this series, Vol. 101, p. 20.
194
MUTAGENESIS AND GENE DISRUPTION
[13]
in 3 ml 2YT medium by picking a colony from a glucose-minimal medium plate. (If starting with DNA, follow procedure 12 for the transformation of competent cells).
Day 2 1. Prepare fresh cells by adding I drop of overnight culture into 3 ml fresh 2YT medium and incubate at 37° for 3 hr in a shaker. 2. Prepare a phage solution by picking a single plaque into 100/xl of fresh cells and incubate overnight at 37 °. 3. Set up another 3-ml overnight cell culture.
Day 3 1. Inoculate 100 ml 2YT medium (in a 250-ml flask) with l ml of fresh cells (prepared as described above) and grow at 37°, with shaking, to an A660of 0.3. 2. Add the phage solution and continue incubation for 5 hr. 3. Transfer the solution to centrifuge tubes and pellet the cells by centrifugation for 20 min at 23,000 g in a Sorvall (Norwalk, CT) centrifuge using a GSA rotor. 4. Immediately decant the supernatant and add 1/5 vol of 20% (v/v) polyethylene glycol (PEG) 6000 in 2.5 M NaC1. Allow the phage to precipitate for 30 min (or overnight) at 4 °.
Day 4 1. Centrifuge at -3500 g in a Sorvall centrifuge using a GSA rotor for 20 min at 4 °. Discard the supernatant and remove traces of liquid with a tissue or drawn-out pipette. 2. Add 10 ml TE buffer and resuspend the phage pellet. 3. Centrifuge at -3500 g for 20 rain at 4 °. Transfer the phage containing supernatant to a clean centrifuge tube. 4. Add 2.2 ml 20% (v/v) PEG in 2.5 M NaCI. Precipitate at 4 ° for 30 min. Centrifuge at -3500 g for 20 min at 4 °. 5. Discard the supernatant, remove any excess liquid using a drawnout pipette, and then dissolve the phage pellet in 500/.d NTE buffer and transfer to a sterile microcentrifuge tube. 6. Add 200/zl of buffer-equilibrated phenol, vortex for 30 sec, and spin briefly in a microcentrifuge. Transfer the aqueous (upper) layer to a new microcentrifuge tube. 7. Repeat step 6. 8. Add 500/xl H20 saturated diethyl ether, vortex for 30 sec, and spin briefly in a microcentrifuge. Discard the upper (ether) layer. Repeat the process three more times.
[13]
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS
195
9. Add 50 ~l 3 M sodium acetate (pH 6), vortex, and divide the solution equally between two microcentrifuge tubes. 10. Add 700/A absolute ethanol to each tube, and cool to - 7 0 ° in a dry ice/2-propanol bath for 60 min. Centrifuge for 5 min at 14,000 rpm in a microcentrifuge. 11. Discard the supernatant, add 700/A 70% (v/v) ethanol, and invert the tube to drain off the solvent, taking great care not to dislodge the pellet. 12. Label the tubes X and Y and add 50 IA DNA buffer to tube X. Resuspend the pellet by vortexing and transfer the buffer containing DNA from tube X to tube Y. 13. Add 50 ~1 of DNA buffer to tube X, vortex, centrifuge briefly, and transfer the contents to tube Y. Vortex to resuspend the pellet. 14. Take a 10-/.d sample, dilute to 1000/A, and determine the optical density on an ultraviolet (UV) spectrometer at 260 and 280 nm in a 1-mi quartz cuvette. The ratio of A260/280should be 1.8 or higher; if not, repeat the phenol extraction and the following steps. One A260unit corresponds to - 3 7 / ~ g single-stranded DNA. Keep this sample as a standard for gel analysis (14/~1 diluted with stop mix). We highly recommend that a self-priming test (procedure 2, below) be performed on all newly isolated single-stranded DNA. After the test, the DNA can be analyzed by agarose gel electrophoresis. If significant amounts of polymerized material are observed we recommend that procedure 1 be repeated. Figure 2 shows the results after each stage of a typical single-stranded DNA mutagenesis experiment. The novice should compare results after each stage of the mutagenesis procedure with the results presented in Fig. 2.
Procedure 2: Self-Priming Test for Single-Stranded DNA 1. To a 1.5-ml sterile microcentrifuge tube, add Buffer B, 2.5 p.l Single-stranded DNA template, 5/~g 2. Adjust the final reaction volume to 23 ~l with H20. 3. Briefly vortex and spin down the solution. 4. Incubate at 70 ° for 5 min in a hot water bath. Transfer immediately to a heating block at 37 ° and leave for 20 rain. Place on ice. Then add Buffer A, 3.5 ~1 4 × dNTP mix, 2 pA ATP (10 mM), 5 pA
196
MUTAGENESIS AND GENE DISRUPTION
[13]
/ FIG. 2. Analysis of single-stranded DNA mutagenesis intermediates by agarose gel elec-
trophoresis.
DNA polymerase I, 5 units T4 DNA ligase, 5 units 5. Bring the volume of the solution to 35/zl using sterile H20. 6. Briefly vortex and spin down the solution. 7. Incubate at 37° for 2 hr. Remove a 2-/zl sample for gel analysis. This analysis should be carried out with a control reaction containing an appropriate primer that can anneal to the single-stranded DNA.
Phosphorothioate-Based Mutagenesis Using Single-Stranded DNA Vectors
Mutant Oligonucleotide The sequence of the mutant oligonucleotide determines how the target DNA sequence is to be mutated. Different types of changes such as transition or tranversion mutations as well as insertions and deletions are all possible with the phosphorothioate-based procedure. As previously
[13]
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS
197
pointed out, 23 this method provides a distinct advantage when performing insertion mutagenesis because the selection step against the wild-type strand occurs in vitro. Preferentially, the oligonucleotide should have 6-7 bases on the 3' end to protect it from the 3' --~ 5' exonuclease proofreading activity of the polymerase. 24 For single- or double-base mismatches we routinely use oligomers of 18-22 nucleotides in length with the mismatch(s) positioned toward the center. Another important concern is that the oligonucleotide does not contain a high degree of self-complementarity. This could cause problems in the annealing step due to self-association. Finally, the primer should not normally contain a recognition site for the restriction enzyme that is to be used in the nicking reaction. Such a site, if present, would lead to the linearization of the DNA during the nicking reaction as the primer does not contain any phosphorothioate groups. However, it is possible to use a primer with such a recognition site provided that the primer is chemically synthesized with phosphorothioate groups at the positions required to protect it from endonuclease-catalyzed hydrolysis. 25 Procedure 3 below provides a simple procedure for the phosphorylation of the mutant oligomer. A phosphorylated primer is required so that ligation can occur after complete synthesis of the mutant strand resulting in the conversion of RFII to RFIV DNA.
Procedure 3: Phosphorylation of Mismatch Oligonucleotide 1. Add the following to a sterile 1.5-ml microcentrifuge tube: Buffer A (10x), 3.5/xl ATP (I0 mM), 3/xl Oligonucleotide primer (stock of 5 A260units/ml for an oligomer of 18-24 bases), 2/xl 2. Bring the volume to 34/zl using sterile H20. 3. Add 5 units of polynucleotide kinase. 4. Briefly vortex and spin down the solution. 5. Incubate in a heating block at 37 ° for 15 min and then heat inactivate the enzyme at 70° for 10 min in a water bath. Store on ice.
23 T. A. Kunkel, in "Nucleic Acids and Molecular Biology" (F. Eckstein and D. M. J. Lilley, eds.), Vol. 2, p. 124. Springer-Verlag, Berlin, 1988. 24 S. Tabor, H. Huber, and C. C. Richardson, J. Biol. Chem. 252, 16212 (1987). 25 R. P. Iyer, L. R. Phillips, W. Egan, J. B. Regan, and S. L. Beaucage, J. Org. Chem. 55, 4693 (1990).
198
[13]
MUTAGENESIS AND GENE DISRUPTION TABLE I RESTRICTION ENDONUCLEASES UNABLE TO HYDROLYZE PHOSPHOROTHIOATECONTAINING DNA
Enzyme A v a I b'c AvalI b BamHI BanII b EcoRI EcoRV b FspI HindII
HindIII KasI NciI b,c PstI b
PvuI b PvulI SacI SmaI
DNA ~ M13mp2 qbX174 M13mp2 M 13mpl 8 Ml3mp2 M 13mp 18 M 13mp 18 M13mpl8 Ml3mpl8 M13mp2 M13mp9 M13mpl8 M 13mp 18 M 13mp2 M 13mp2 M13mpl8 M 13mp9 M13mpl8 pUC19 M13mp2 Ml3mpl8 M13mpl8 M13mpl8
Analog used for polymerization
Ref.
dCTPaS dTTP~S dGTPczS dATPc~S/dGTPaS dCTP~S/dNTPaS f
d d d e d, f, g
dCTPaS/dGTPaS f
dATPaS/dGTPczS dATPaS dGTP~xS dGTPczS
e e, g, h i d, i
dATPaS/dTTPo~S dGTPczS dCTPczS
e i d, j
dGTPaS
dCTPaS dCTPczS/dGTPt~S dCTPaS/dGTPaS
dGTPaS k
d, g, j
d e e l
a The initial nicking conditions were determined using the DNA vectors listed. We recommend that all nicking reactions be carried out according to the buffer and incubation conditions given in the original reference. o Most consistent results have been obtained using these enzymes. c This restriction endonuclease recognizes a degenerate recognition sequence and therefore incorporation of a different phosphorothioate might be required for the inhibition of hydrolysis with different DNA vectors. a j. W. Taylor, W. Schmidt, R. Cosstick, A. Okruszek, and F. Eckstein, Nucleic Acids Res. 13, 8749 (1985). e j. R. Sayers, D. B. Olsen, and F. Eckstein, Nucleic Acids Res. 17, 9495 (1989). f B a n l I recognizes the sequence 5'-GPuGCPy/C-3'. Our results [D. B. Olsen, G. Kotzorek, J. R. Sayers, and F. Eckstein, J. Biol. Chem. 265, 14389 (1990)] indicate that to inhibit this enzyme a phosphorothioate must be at the two positions designated by asterisks in the following sequence: 5'-GPuGCPy*C*N-3'. For M13mp2, rap7, mp8, mp9, or mpl0, the 3'-N is a cytosine in the ( - ) strand and therefore is protected by the presence of only dCMPS. However, Ml3mpl8 has a G in the ( - ) strand 3' to the recognition sequence and therefore the DNA must contain dCMPS and dGMPS groups.
[13]
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS
199
Preparation of RFIV Heteroduplex DNA Annealing. For most mutations two molar equivalents of primer are annealed to the target sequence in a high-salt buffer, as described in Procedure 4. Procedure 4: Annealing of Primer to Template DNA 1. Add the following to a sterile microcentrifuge tube: Buffer B (10 ×), 3.5 ~1 Phosphorylated primer solution from procedure 3, 6 ~1 Single-stranded DNA template (from procedure 1, typically 2-5/xg//~l), 10/xg 2. Adjust the final reaction volume to 35/xl with H20. 3. Briefly vortex and spin down the solution. 4. Incubate at 70 ° for 5 min in a hot water bath, transfer immediately to a heating block at 37°, and incubate for 20 min before placing on ice. Polymerization. The choice of deoxynucleoside phosphorothioate for the polymerization reaction is dependent on which restriction enzyme is to be used in the subsequent nicking reaction (see Table I for a list of appropriate restriction endonucleases). The restriction enzymes NciI and AvaI have been used most extensively and both require the incorporation of dCMPS groups into M13mpl8 DNA to limit the hydrolysis to the wildtype strand. Native T7 DNA polymerase is the enzyme of choice for extension of the mutant oligonucleotide and complete synthesis of the mutant ( - )strand. This enzyme has several advantages over other DNA polymerases in that it is very processive, it does not strand displace, and pure enzyme is commercially available. In addition, this enzyme efficiently incorporates dNMPS analogs and the polymerization reaction is normally complete after short incubation periods. Alternatively, the Klenow fragment of DNA polymerase I yields acceptable results when used at 16° overnight.
g D. B. Olsen and F. Eckstein, Proc. Natl. Acad. Sci. U.S.A. 87, 1451 (1990). h D. B. Olsen, G. Kotzorek, and F. Eckstein, Biochemistry 29, 9546 (1990). i C. Krekel and J. R. Sayers, unpublished observations. J K. L. Nakamaye and F. Eckstein, Nucleic Acids Res. 14, 9679 (1986). k Nicking using Sinai requires 40/zg/ml ethidium bromide in the reaction in addition to dGMPS at the site of cleavage. J. R. Sayers, W. Schmidt, A. Wendler, and F. Eckstein, Nucleic Acids Res. 16, 803 (1988).
200
MUTAGENESIS AND GENE DISRUPTION
[13]
Procedure 5: Polymerization Reaction
1. Add the following reagents to the template/primer mixture (procedure 4) after the annealing mixture has been cooled on ice for 10 min: dCTPaS, 8/xl ATP (10 mM), 8/zl Buffer A (10×), 8/zl T7 DNA polymerase, 26 6 units T4 DNA ligase, 10 units 2. Adjust the volume to 80/zl with sterile H20. 3. Briefly vortex and spin down the solution. 4. Incubate for 1 hr at 37 °. Heat inactivate at 70° for 10 min and remove a 2-/zl sample for agarose gel analysis (see Fig. 2). Removal o f Wild-Type Single-Stranded DNA. The nitrocellulose filtration step described below is designed to remove any unpolymerized singlestranded DNA that remains after the polymerization reaction. Even though our procedure uses an excess of oligonucleotide for priming, some single-stranded DNA usually remains after the reaction, which can greatly reduce mutational efficiency. Procedure 6: Nitrocellulose Filtration z7
1. Using forceps place the rubber seal and two nitrocellulose filters (do not use autoclaved filters) in the female end of the filter housing. 2. Carefully apply 40/zl 500 mM NaCI to moisten the filter disks and then assemble the unit. 3. Attach a 2-ml disposable syringe to the outlet side of the filter unit using a l-cm length of silicone tubing. 4. Add 6/xl 5 M NaCI to the polymerization reaction. Mix and apply to the inlet side. 5. Slowly draw the sample through the filter unit using the syringe plunger. If necessary tap the housing gently to collect the filtrate. 6. Add 50/zl 500 mM NaC1 to the top of the filter unit and draw the wash through. 7. Carefully remove the filter unit and transfer the filtrate into a fresh, sterile microcentrifuge tube. 8. Rinse the syringe with 50/zl 500 mM NaC1 and combine with the filtrate. 26 It is important to add the T7 DNA polymerase after the nucleotide mix; otherwise, the strong proofreading activity associated with the enzyme may digest the mutant oligonucleotide. 27 The phosphorothioate-based mutagenesis kit supplied by the Amersham Corporation contains filter units that are operated by centrifugal force instead of a syringe system.
[13]
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS
201
9. Add 400/zl cold absolute ethanol, mix, and place at - 7 8 ° for 15 min. 10. Spin in a microcentrifuge for 15 min at 14,000 rpm at room temperature. 11. Discard the supernatant (a small pellet of salt/DNA should be visible). 12. Carefully add 400/zl of 70% ethanol and invert the tube. Check that the pellet has not been dislodged. Open the cap to release the liquid, being careful not to disturb the pellet. 13. Remove the remaining amount of liquid using a Speed-Vac concentrator (Savant Instruments, Inc., Farmingdale, NY) for 2-3 min at room temperature.
Preparation of Mutant Homoduplex Strand-Selective Hydrolysis of Wild-Type DNA. There are a number of restriction endonucleases that can be used to hydrolyze the unmodified (nonphosphorothioate containing) strand of the mutant heteroduplex DNA (Table I). Below we have provided conditions for nicking reactions with the enzymes NciI and AvaI. After the nicking reaction is complete, we recommend that the user analyze the reaction products by agarose gel electrophoresis. There should be no RFIV DNA visible on the gel. Procedure 7: Restriction Endonuclease Nicking of Heteroduplex DNA NciI reaction 1. Resuspend the pellet (from procedure 6) in 190/zl H20 and add Buffer A (10 x ), 25/zl NciI, 120 units 2. Bring the volume to 250 txl with sterile H20. 3. Briefly vortex and spin down the solution. 4. Incubate at 37° for 90 min. Heat inactivate the enzyme at 70 ° for 10 min. Keep a 6-/zl sample for gel analysis (see Fig. 2). Alternatively, the DNA may be nicked with the enzyme AvaI. 1. Resuspend the DNA pellet in 160/xl H20 and add Buffer C (10 x ), 25/zl AvaI, 70 units 2. 3. 4. a 6-/zl
Bring the volume to 250/~1 with sterile H20. Briefly vortex and spin down the solution. Incubate at 37 ° for 180 rain. Heat inactivate at 70° for 10 min. Take sample for gel analysis (see Fig. 2).
202
MUTAGENESIS AND GENE DISRUPTION
[13]
Hydrolytic digestion of wild-type DNA by exonuclease digestion. The 5'--* 3' activity of T7 exonuclease gaps nicked double-stranded DNA and removes almost all the nicked wild-type strand under normal gapping conditions. Partially gapped DNA species are not detected by agarose gel analysis, indicating the highly processive character of this enzyme. Commercial samples of T7 exonuclease normally are endonuclease free and therefore prolonged incubation times are possible. In theory, this exonuclease can be used in combination with any restriction endonuclease because it removes almost all of the (+)strand in less than 15 min using nicked M13mpl8 as substrate. The T7 gapping protocol is given below. 9 Procedure 8: Gapping Using T7 Exonuclease. Exonuclease T7 functions in either buffer used for performing the nicking reaction. 1. Add I0 units T7 exonuclease per microgram double-stranded DNA. 2. Briefly vortex and spin down the solution. 2. Incubate at 37 ° for 30 min. 3. Heat inactivate the exonuclease at 70 ° for 15 min and place directly into a 37° heating block for 20 min. 4. Remove a 14-/A sample for gel analysis (see Fig. 2) and then place on ice. A band that runs close to a single-stranded DNA marker should be evident. Alternatively, exonuclease III can be used as the gapping enzyme. It digests double-stranded DNA containing a free 3' terminus in the 3' ~ 5' direction. We have found that exonuclease III gaps best in a buffer containing - 1 2 0 mM NaCI, 50 mM Tris-HC1 (pH 8), 6 mM MgCI2, 10 mM DTT, and 15 units of exonuclease per microgram of nicked DNA. Gel analysis of the reaction product revealed a distinct band whose electrophoretic mobility increases progressively with longer incubation time, 28 indicative of a distributive gapping mechanism, z9 Therefore, this enzyme is ideally suited for gapping in conjunction with a restriction endonuclease that produces a nick at the 3' side of the mutation in the (+)strand. We have frequently used the M13mpl8 DNA vector together with the NciI nicking/exonuclease III gapping combination to degrade the wildtype (+)strand. NciI has sites at positions 1924, 6247, 6248, and 6838 in this vector. Interestingly, neither DNA strand of the double site in the polylinker of M13mpl8 (CCCGGG 6247/8) is hydrolyzed when dCMPS is present in the (-)strand. 8 The nearest downstream NciI site to the polylinker is at position 6838. Because exonuclease III gaps nicked DNA at a 28 W. Schmidt, "Untersuchungen zum Abbau von DNA mit Exonuklease III," Diplomarbeit. University of Goettingen, Goettingen, Germany, 1986. 29 S. G. Rogers and B. Weiss, this series, Vol. 65, p. 201.
[13]
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS
203
rate of about 150 nucleotides/min,9'29 a mismatch site in the middle of the polylinker in an insert of 1000 bases would require approximately 20 min (allowing a safety margin) to gap past the mismatch. Exonuclease III may of course be used in conjunction with restriction endonucleases other than NciI, provided that the buffer conditions are adjusted accordingly. Note that higher salt concentrations are essential for reproducible gapping of the DNA with exonuclease III.
Procedure 9: Gapping Using Exonuclease IIl 1. To the nicked DNA from procedure 7, add NaC1 to a concentration of 120 mM (3/zl of a 5 M solution for the AvaInicked and 6/zl for the NciI-nicked DNA) Exonuclease III, 300 units 2. Briefly vortex and spin down the solution. 3. Incubate at 37° for the time period required to gap at least several hundred bases past the mismatch. 4. Heat inactivate the exonuclease at 70° for 15 min and place directly into a 37° heating block for 20 min. 5. Remove an 8-/M sample for gel analysis (see Fig. 2) and place on ice. Repolymerization. The DNA resulting from either gapping procedure described above must be repolymerized to the double-stranded form to obtain high transformational efficiencies. Even exhaustive gapping with either T7 exonuclease or exonuclease III leaves a small stretch of doublestranded DNA that can be used as the primer for repolymerization. Obviously, the mutant DNA strand is used as a template for the reaction resulting in the formation of a mutant homoduplex.
Procedure 10: Formation of Mutant Homoduplex I. To the gapped DNA solution prepared as described above, add
E. coli DNA polymerase I (not the Klenow fragment), l0 units dNTP mix (4 x ), 5/zl ATP (10 raM), 20/zl T4 DNA ligase, 10 units 2. Incubate at 16° overnight or at 37° for 2 hr. 3. Remove a 14-/zl sample for gel analysis (see Fig. 2).
Transformation of Competent Cells As mentioned previously, special cell lines are not required for transformation when using the phosphorothioate-based mutagenesis method. We
204
MUTAGENESIS AND GENE DISRUPTION
[13]
recommend the cell lines SMH503° or TG1, 31 because they yield consistently high transformational efficiencies even if little or no RFIV DNA is visible by agarose gel electrophoresis after repolymerization. A transfection protocol is described for competent cells prepared by the CaC12 method (see procedure 11). There are a number of other transformational protocols available. 32'33 In some instances the presence of nucleoside triphosphates can result in low plaque yields. 34 This may be countered by purification of the DNA by precipitation or 35 one-step spun-column chromatography. 36
Procedure 11: Preparation of Competent Cells 1. Add 3 ml of an overnight culture (see procedure 1) to 100 ml of sterile 2YT medium in a 250-ml flask. 2. Incubate in a shaker at 37° until the A660 is 0.6 ( ~ 1 hr). 3. Transfer cells to suitable sterile centrifuge tubes, cap, and spin at -3000 g for 15 min at 4 °. 4. Discard the supernatant and resuspend the cells in a total volume of 50 ml prechilled sterile 50 mM CaCI2 solution. 5. Leave on ice for 30 min. Centrifuge as in step 3. 6. Discard the supernatant and resuspend the cells in a total volume of 20 ml prechilled sterile 50 mM CaCI2 solution. 7. The cells can be used for 1 week if stored at 4 °. 8. For long-term storage of the competent cells, take 10 ml of the competent cells and mix gently with 2 ml of 87% (v/v) glycerol (sterilized by autoclaving). 9. Portion the cells (300/~1), using a wide-bore disposable pipette, into sterile polypropylene tubes and quick freeze using liquid nitrogen. Store at - 80 °. The frozen cells can be used for several months without a serious decrease in transformational ability. 30 j. E. LeClerc, N. L. Istock, B. R. Saran, and R. Allan, J. Mol. Biol. 180, 217 (1984). 31 p. Carter, H. Bedouelle, and G. Winter, Nucleic Acids Res. 13, 4431 (1985). 32 D. Hanahan, in " D N A Cloning: A Practical Approach" (D. M. Glover, ed.), p. 109. IRL Press, Oxford, England, 1985. 33 C. T. Chung, S. L. Niemela, and R. H. Miller, Proc. Natl. Acad. Sci. U.S.A. 86, 2172 (1989). 34 A. Taketo, J. Biochem. (Tokyo) 75, 895 (1974). 35 T. Maniatis, E. F. Fritsch, and J. Sambrook, in "Molecular Cloning: A Laboratory Manual," p. 461. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982. 36 T. Maniatis, E. F. Fritsch, and J. Sambrook, in "Molecular Cloning: A Laboratory Manual," p. 466. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982.
[13]
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS
205
Procedure 12: Transformation of Escherichia coli with the Mutated DNA 1. Place 5 sterile polypropylene tubes containing 3-ml portions of B-broth soft agar in a 55 ° water bath. 2. Place a tube containing 300/~1 of competent cells (procedure 11) on ice. 3. Dilute 20/zl repolymerized DNA with 30/A sterile H20. 4. Add 2-, 5-, 10-, and 20-/~1 aliquots of diluted DNA to the competent cells. 5. To the fifth tube make a mock transfection with 20 tzl sterile H20 used in diluting the DNA. Swirl the tubes gently to mix the contents and place on ice for - 3 5 min. 7. Combine 1400/zl flesh cells with 280/zl IPTG solution and 280 tzl X-Gal solution. 8. To each aliquot of transformed competent cells (from steps 4 and 5) add 270/xl of fresh cell mix from step 7. 9. Add 3 ml top agar to each tube and pour immediately onto plates prewarmed to 37 °. Allow to set and invert. 10. Incubate overnight at 37°. 11. Pick two to five plaques and prepare single-stranded DNA for direct genotypic screening of mutants by DNA sequencing. .
Principle of Phosphorothioate-Based Plasmid Mutagenesis Method As stated in the introduction, the phosphorothioate-based mutagenesis method has been extended to double-stranded or plasmid DNA vectors. 10 This is an important extension of the previous protocols because the user now avoids time-consuming subcloning steps of the gene of interest into a M13 type single-stranded DNA vector. 22 Alternatively, subcloning may also be avoided if the gene is present in a phagemid vector. 14 However, working with these constructs may require prior experience to obtain single-stranded DNA suitable for mutagenesis. The plasmid mutagenesis method is based on the creation of a specific region of single-stranded DNA to which a mismatch oligonucleotide can anneal. A strand asymmetry is created on polymerization by the specific incorporation of phosphorothioate internucleotidic linkages in a certain region of the DNA. A subsequent step using a restriction endonuclease that is unable to hydrolyze phosphorothioates containing DNA removes all the remaining wild-type DNA. Mutational efficiencies using this protocol have reached those obtained with high-efficiency methods for singlestranded DNA.
Mutatio~~HindIII Pst l
Site
A
~ HindIII/Ethidium Bromide
3"
BOQ O® cQQ ExonucleaseIII O
~
Productivelygapped
1. Add mismatch primer ~ e D 2. "1"7DNA polymerase dGTP(zS mix 3. T4 DNA Ligase Pst I
Pst I
o00
Pst l
.4--- Mutant Heteroduplex
I Pstl nicking/linearization
0 I Q
T7 Exonuclease
F
~
E . c o / i DNA Polymerase I 4 dNTPs,T4 ligase, ATP
G
Q
Transform Competent Cells
~
MutantHomoduplex
[13]
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS
207
Plasmid Mutagenesis Strategy Scheme II outlines one combination of enzymatic reactions that can be used for the mutagenesis of double-stranded DNA. The first step involves the site-specific nicking of the vector in the vicinity of the desired mutation (Scheme IIB). This reaction, which is not strand specific, is accomplished by incubation of the plasmid DNA with a restriction endonuclease in the presence of ethidium bromide. The nick can be used as the starting point for digestion by a nonprocessive exonuclease such as exonuclease III (Scheme IIC). Two differently gapped products are obtained, depending on which strand contains the nick. We have designated the DNA species that has a small stretch of single-stranded DNA complementary to the synthetic mutant oligonucleotide as "productively gapped." After strand-selective hybridization of the primer to the "productively gapped" DNA, the surrounding gaps are filled in by polymerization using T7 DNA polyrnerase, three dNTPs, and one dNTPaS. As with the single-stranded mutagenesis method described above, the choice of dNTPaS is dependent on the restriction enzyme to be used in the following step (Scheme liD). As shown, the desired mutation is present as a heteroduplex in only one of the various plasmid DNA species present after polymerization. The introduction of phosphorothioate groups into the mutant strand during the polymerization step allows for strand selection, which is required for highly efficient plasmid mutagenesis. Subsequent reaction with a restriction endonuclease such as PstI (Scheme IIE), which is unable to cleave phosphorothioate-containing DNA (Table I), hydrolyzes all the wild-type DNA in solution. This includes the linearization of roughly 50% of the DNA population that was not "productively gapped." In contrast, the heteroduplex DNA containing phosphorothioates in the mutant strand at the recognition site of PsiI is only nicked. This situation is very similar to the mutagenesis procedure described above. The nick is again used as the starting point for exonuclease digestion (Scheme IIF). The mutant
SCHEME II. Schematic of the oligonucleotide-directed plasmid mutagenesis technique. (A) Plasmid DNA site of mutation and several convenient restriction endonuclease sites; (B} products from HindIII/ethidium bromide nicking reaction; (C) products of limited exonuclease III digestion; (D) the mutant heteroduplex after annealing of the mutant oligonucleotide and polymerization; (E) products from PstI nicking/linearization reaction; (F) products after T7 exonuclease digestion of the wild-type DNA; (G) repolymerized mutant homoduplex. O, Mismatch bases within the mismatch oligonucleotide. Heavy lines indicate the area where phosphorothioates have been incorporated. The plasmids that have been linearized are crossed off because they transform inefficiently.
208
MUTAGENESIS AND GENE DISRUPTION
[13]
FIG. 3. Analysis of pUC19 plasmid mutagenesis intermediates by 2% (w/v) agarose gel electrophoresis.
strand is then used as a template for repolymerization, resulting in the formation of a mutant homoduplex species carrying the desired changes in both strands (Scheme IIG). Figure 3 shows the agarose gel electrophoretic results after each stage of a typical plasmid mutagenesis experiment. The novice should compare results after each stage of the procedure with the results presented in Fig. 3.
Preparation of Plasmid DNA The purity of the plasmid DNA is very important for the successful completion of the mutagenesis protocol. There are two important variables that we have found to decrease mutational efficiencies significantly. First, the plasmid preparation should be free of large amounts of concatemeric DNA. If this is a problem, the plasmid can be grown in a RecA- strain of E. coli such as JM109. Second, small amounts of RNA that remain after many typical plasmid isolation procedures (including CsC1 centrifugation) must bc removed. In our hands plasmid DNA isolated according to the Qiagen plasmid DNA maxipreparation procedure is of sufficient purity for use without further manipulation.
[13]
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS
209
Preparation of Mutant Heteroduplex
Site-Specific Restriction Endonuclease/Ethidium Bromide Nicking of Plasmid To create a stretch of single-stranded DNA to which the mutant oligonucleotide can anneal, the double-stranded DNA must be nicked in a region near the site of mutation. Although it is unimportant if the nicking site is upstream or downstream from the mutation site, it is advantageous if it is within several hundred base pairs so that subsequent digestion by the exonuclease does not have to proceed very far. Nicking can be carried out by incubation of the DNA with one of a number of restriction endonucleases that is unable to cleave both strands of DNA when incubated in the presence of ethidium bromide. 10,37-41Procedure 13 outlines the protocol for nicking plasmid DNA with the restriction enzymes HindlII and EcoRI. The use of these enzymes should be most universal because they are found at either the upstream or downstream end of a number of different multiplecloning sites in popular plasmid vectors. The protocol requires a large amount of plasmid DNA, which allows convenient monitoring of each enzymatic reaction by agarose gel electrophoresis. The amount of DNA and reaction volumes can be scaled down if desired. If one of the restriction enzymes mentioned above does not have a site, or is present at multiple positions, within the vector to be mutated then nicking conditions must be determined for another enzyme. Normally, it is a simple process to find proper nicking conditions with alternative restriction endonucleases. Almost all restriction endonucleases cleave two strands of double-stranded DNA in a stepwise fashion. It is believed that the decrease in enzyme-catalyzed hydrolysis of the second strand in the presence of ethidium bromide is due to the intercalation of the dye into the relaxed DNA. The delay between scission of the two strands can be optimized by testing several reaction conditions using suboptimal salt, pH, and/or temperature conditions for the enzyme and 10-100 tzg/ml ethidium bromide. It is advisable to use an endonuclease that does not 37 G. Dalbadie-McFarland, L. W. Cohen, A. D. Riggs, C. Morin, K. Itakura, and J. H. Richards, Proc. Natl. Acad. Sci. U.S.A. 79, 6409 (1982). 38 M. Osterlund, S. Luthman, S. V. Nilsson, and G. Magnusson, Gene 20, 121 (1982). 39 R. C. Parker, R. M. Watson, and J. Vinograd, Proc. Natl. Acad. Sci. U.S.A. 74, 851 (1977). 4o D. R. Rawlins and N. Muzyczka, J. Virol. 36, 611 (1980). 4i D. Shortle and D. Nathans, Proc. Natl. Acad. Sci. U.S.A. 75, 2170 (1978).
210
MUTAGENESIS AND GENE DISRUPTION
[13]
exhibit star activity under adverse buffer conditions. 42 It is not important to nick 100% of the plasmid DNA because any unreacted DNA will be destroyed in a later step.
Procedure 13: Nicking of Plasmid DNA 1. Add the following reagents to a 1.5-ml sterile microcentrifuge tube: Plasmid DNA (Qiagen purified), -20/.tg Buffer D (10×), 24/zl Ethidium bromide solution (500/.Lg/ml), 20/zl HindlII, 200 units 2. 3. 4. 5.
Adjust the volume to 240/xl using sterile distilled H20. Briefly vortex and spin down the solution. Incubate at 30 ° for 60 min. Remove 2/zl for agarose gel electrophoresis (see Fig. 3).
Alternatively, the DNA can be nicked using EcoRI with the conditions given below. 1. Combine the following reagents: Plasmid DNA, -20/.tg EcoRI nicking buffer (10 × ), 26/zl Ethidium bromide (500/zg/ml), 72/zl EcoRI, 600 units 2. 3. 4. 5.
Adjust the volume to 260 txl using sterile distilled H20. Briefly vortex and spin down the solution. Incubate at 16° for 15 hr. Remove 2/xl for agarose gel electrophoresis (see Fig. 3).
Successful nicking of the plasmid should result in greater than 50% nicked DNA as determined by agarose gel electrophoresis (e.g., see Fig. 3). It may be necessary to increase or decrease the amount of enzyme in the reaction. After the nicking reaction is complete the enzyme and ethidium bromide must be removed. This is accomplished by phenol extraction followed by spin dialysis using a Centricon-100 (Amicon, Danvers, MA) microconcentrator (procedure 14). 42 A l t h o u g h the restriction e n d o n u c l e a s e E c o R I is k n o w n to exhibit star activity, it has been s h o w n that w h e n Co 2+ is u s e d as the metal cofactor, the e n z y m e exhibits very stringent substrate specificity. 43 43 j. L. W o o d h e a d , N. Bhave, and A. D. B. Malcolm, Fur. J. Biochem. 115, 293 (1981).
[13]
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS
211
Procedure 14: Extraction and Spin Dialysis 1. Add 200/~l buffer-equilibrated phenol and vortex vigorously for 30 see.
2. Briefly spin the tube and remove the aqueous top layer with a pipette. 3. Repeat steps 1 and 2 using 200 t*1 H20 saturated chloroform/isoamyl alcohol (24 : 1). 4. Repeat steps 1 and 2 using 1 ml H20 saturated diethyl ether. 5. Remove the final traces of ether by heating the tube with the cap open at 37° for 10 min. 6. Dilute the sample with 2 ml of distilled sterile H20. 7. Add the sample to a Centricon-100 and spin for 20 min at 1000 g with a Sorvall SS34 fixed angle rotor at room temperature. 8. Repeat steps 6 and 7 two more times. 9. Collect the sample, and transfer solvent-containing DNA (50-60 >1) to a sterile 1.5-ml microcentrifuge tube.
Preparation of Single-Stranded Gap to Which Mutant Oligonucleotide Can Anneal The DNA is now prepared for reaction using a 3' --~ 5' nonprocessive exonuclease that will gap the nicked DNA in a defined direction. The size of the gap must encompass not only the site to which the mutant oligonucleotide is to anneal, but it must also gap past the second restriction endonuclease site. A nonprocessive exonuclease (one in which the time of incubation determines the number of hydrolyzed bases) is required so that on repolymerization phosphorothioate residues are incorporated into distinct regions of the DNA. The protocol for gapping using the enzyme exonuclease III is given below. Alternatively, the 5' ~ 3' activity of T5 exonuclease can also be used for this step 44 and this enzyme will be commercially available in the near future from Amersham and United States Biochemicals.
Procedure 15: Gapping with Exonuclease III 1. Adjust the volume of the solution to 80/~1 with H20 and add Buffer C (10 × ), 10/~1 NaCI (1 M), 4/~1 Exonuclease III, 100 units 2. Briefly vortex and spin down the solution. 44 j. R. Sayers and F. Eckstein, Nucleic Acids Res. 19, 4127 (1991).
212
MUTAGENESIS AND GENE DISRUPTION
[13]
3. Incubate at 37° for the time required for digestion past the mismatch and the second restriction enzyme site. 45 4. Remove 2/zl for agarose gel electrophoresis (see Fig. 3). It is important that the products of the gapping reaction are checked by agarose gel electrophoresis. Digestion of the DNA should not proceed to such an extent that on repolymerization, phosphorothioate residues are incorporated into the wild-type strand in the vicinity of the second restriction endonuclease site. This will protect the unwanted wild-type DNA from hydrolysis, resulting in a decrease in mutational efficiency. In general, there should be a distinct increase in mobility of the gapped DNA when compared to a marker of the nicked DNA sample. Figure 3 shows an example of a T5 exonuclease-gapped pUC19 plasmid in which several hundred bases were removed.
Annealing of Mutant Oligonucleotide The oligonucleotide sequence will determine the type of mutation (point mutation, insertion, or deletion; see discussion above). Mutagenesis with plasmid DNA has two strands to which the mutant oligonucleotide can potentially anneal. Therefore, careful consideration must be given to the sequence of the oligonucleotide because it is dependent on the directionality of the exonuclease employed (procedure 15) and whether the initial nicking of the plasmid occurred upstream or downstream of the site of mutation (Scheme III). Before the oligonucleotide can be annealed to the gapped plasmid (procedure 16) it must be phosphorylated (procedure 3). One advantage of the plasmid mutagenesis procedure is that nonspecific binding of oligomer to target DNA is decreased because only a portion of the plasmid remains double-stranded after exonuclease digestion.
Procedure 16: Annealing of Mutant Primer to Single-Stranded Region of Plasmid 1. Add the following reagents to the solution containing the gapped DNA: NaCI (1 M), 10/xl Two to three molar equivalents of phosphorylated primer (procedure 3) with respect to the amount of plasmid DNA 2. Briefly vortex and spin down the solution. 45 See p r o c e d u r e 9 for information regarding the time of the gapping reaction using exon u c l e a s e III.
[13]
213
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS EcoRI
Mutation Site
Hind ll
,a,
Ethidium Mutation Site
B
Bromide
5'
Mutation Site
5'
Limited Exonudease III gapping
C
5'
5'
3'~
~
3" Anneal mutant oligomer
D 5' 3'===
~
~
5'~= 3'
oligo A A
oligo B
SCHEMEIII. Representation of two differently gapped plasmid species, both of which were "productively gapped" using exonuclease IIl. Downstream (HindIII) or upstream nicking (EcoRI) can dictate the proper sequence of the mutant oligonucleotide (either A or B) required for the production of the same genotypic change. The lettering is the same as for the steps in Scheme II. The DNA species can be nicked either upstream or downstream of the site of mutation (B). Subsequent gapping using the 3' ~ 5' activity of exonuclease III leaves two different DNA species (C). The proper mutant oligonucleotide (primer A or primer B) is required to anneal to the single-stranded DNA region.
3. I n c u b a t e at 70 ° for 10 m i n a n d t h e n p l a c e the t u b e into a 56 ° h e a t i n g b l o c k a n d cool s l o w l y to 37 ° o v e r - 3 0 min.
Polymerization Reaction T h e g a p p e d D N A is filled in u s i n g n a t i v e T7 D N A p o l y m e r a s e , t h r e e d N T P s , and one d N T P ~ S analog. The choice of nucleoside phosphorothioate is d e p e n d e n t o n the r e s t r i c t i o n e n d o n u c l e a s e u s e d in the n e x t step. W e s u g g e s t u s i n g dGTPo~S in c o m b i n a t i o n with PstI.
214
MUTAGENESIS AND GENE DISRUPTION
[13]
An improvement in the plasmid mutagenesis procedure is the use of T7 DNA polymerase for the creation of the mutant heteroduplex. This enzyme does not strand displace the mutant oligonucleotide on polymerization even when used at 37°. Products of the reaction should be checked by agarose gel electrophoresis. There should be a new DNA band that migrates differently than the supercoiled plasmid DNA marker on the gel. The polymerized DNA must be separated from the salt, nucleotides, and enzyme before being nicked.
Procedure 17: Preparation of Mutant Heteroduplex 1. Add the following reagents to the sample solution: Buffer A (10 × ), 21/xl dGTPaS mix, 20 t~l ATP (10 mM), 20 t~l T7 DNA polymerase, 10 units T4 ligase, 15 units 2. Add sterile distilled H20 to bring the volume to 210/xl. 3. Briefly vortex and spin down the solution. 4. Incubate at 37 ° for 2 hr. 5. Remove 6/.d for agarose gel electrophoresis (see Fig. 3). 6. Repeat procedure 14 to prepare the DNA for the nicking/linearization reaction. Preparation of Mutant Homoduplex
Strand-Selective Hydrolysis of Wild-Type DNA The dGMPS-containing DNA is now ready for the strand-selective nicking/linearization reaction catalyzed by PstI (procedure 18). There are a number of other restriction endonucleases that can be used for this step 8'16-19 (see Table I) as long as the enzyme chosen has its recognition site(s) located within the region protected by phosphorothioate groups in the mutant strand. As seen in Scheme II, reaction with PstI will linearize roughly 50% of the DNA in solution. Therefore, analysis by agarose gel electrophoresis should reveal a large amount of linear DNA as well as a nicked plasmid product. Most importantly, there should be no trace of covalently closed circular DNA seen on the gel.
Procedure 18: Pst! Nicking and Linearization Reaction 1. After extraction and spin dialysis, bring the volume to 85/xl with sterile HzO and add
[13]
HIGH-EFFICIENCY SITE-DIRECTED MUTAGENESIS
215
Buffer D (10 x ), 10/~1 PstI, 70 units 2. 3. 4. 5.
Briefly vortex and spin down the solution. Incubate at 37° for 80 min. Remove 3/xl for agarose gel electrophoresis (see Fig. 3). Repeat extraction and spin dialysis (procedure 14). 46
Exonuclease Digestion of Mutant Heteroduplex Wild-Type Strand The nicked DNA is gapped most efficiently using T7 exonuclease and the conditions given in procedure 19. This enzyme is very processive and will digest virtually the entire wild-type strand after short incubation periods. In many cases it is not possible to observe the fully gapped product after reaction by agarose gel electrophoresis (compare with Fig. 3) because of the poor ability of DNA to bind ethidium bromide (because it is essentially single-stranded DNA). It is possible, however, to see that the nicked and linear DNA resulting from procedure 19 has been digested when compared to the DNA analyzed after PstI nicking. In some instances, where the nick is downstream to the mutation in the wild-type strand, the user may use exonuclease III for this step. 10However, we have obtained the most reproducible results using T7 exonuclease.
Procedure 19: Gapping of Nicked Mutant Heteroduplex 1. Adjust the volume of the solution to 90/xl with H20 and add Buffer C (10 x ), 10/zl T7 exonuclease, 100 units 2. Briefly vortex and spin down the solution. 3. Incubate at 37° for 30 min. 4. Heat inactivate the enzyme by incubation at 70° for 10 min and place directly into a 37° heating block for 20 min. 5. Remove 10/.d for agarose gel electrophoresis (see Fig. 3). In theory, the gapped DNA could be used directly to trasnsform competent cells because the wild-type DNA has been almost completely hydrolyzed. However, we have observed an increase in mutational efficiency of up to 20% if the DNA is first repolymerized with E. coli DNA polymerase I, 46 It is important to repeat the extraction/dialysis procedure after PstI nicking because this enzyme binds tightly to the nicked phosphorothioate-containing DNA, which can inhibit exonuclease digestion?
216
MUTAGENESIS AND GENE DISRUPTION
[13]
TABLE II TROUBLE-SHOOTING FOR MUTAGENESISOF SINGLE-AND DOUBLE-STRANDED DNA VECTORS Problem
Possible causes
Polymerization results in RFII DNA
Nonspecific priming by mutant oligonucleotide Inactive ligase
Incomplete nicking by the restriction endonuclease Restriction endonuclease reaction results in linearization of the DNA
Restriction endonuclease activity too low
Incomplete nicking of plasmid
Restriction endonuclease activity too low
No cccDNA observable by agarose gel electrophoresis after repolymerization
Low product yield DNA was destroyed during exonuclease reaction
False restriction endonuclease/ dNTPaS combination Restriction enzyme site in mutant oligonucleotide sequence
Remedy Decrease primer concentration Check enzyme and ATP concentrations Increase incubation time or enzyme concentration Check Table I for correct dNTPc~S/restriction enzyme combination Choose another restriction enzyme or protect site in the oligonucleotide with phosphorothioatecontaining oligomer (see text) Increase enzyme concentration or reaction temperature Attempt transformation Repeat procedure using fresh gapping buffer and new batch of T7 exonuclease
f o u r n o r m a l d N T P s , A T P , a n d T4 ligase. 10 T h e n i c k - t r a n s l a t i o n a c t i v i t y o f t h e p o l y m e r a s e m i g h t r e m o v e s o m e D N A still b o u n d to t h e m u t a n t o l i g o n u c l e o t i d e a f t e r e x o n u c l e a s e d i g e s t i o n , w h i c h c o u l d a c c o u n t for t h e i n c r e a s e in m u t a t i o n a l e f f i c i e n c i e s .
Procedure 20: Preparation of Mutant Homoduplex 1. A d d t h e f o l l o w i n g r e a g e n t s to t h e s o l u t i o n c o n t a i n i n g the g a p p e d DNA: B u f f e r A (10 x ), 5 ~1 D N A p o l y m e r a s e I, 10 u n i t s 4 x dNTP Mix, I0/zl A T P (10 m M ) , 2 0 / x l T4 D N A l i g a s e , 15 units 2. A d d s t e r i l e d i s t i l l e d H 2 0 to b r i n g t h e v o l u m e to 220/~I. 3. Briefly v o r t e x a n d s p i n d o w n t h e s o l u t i o n .
[ 13]
HIGH-EFFICIENCY SITE-DIRECTEDMUTAGENESIS
217
4. Incubate at 37° for 3 hr. 5. Remove 14 p,l for agarose gel analysis (see Fig. 3). 6. Remove 2 tzl for transformation of competent cells (procedure 21). Transformation of Competent Cells It is sometimes difficult to observe a band corresponding to covalently closed circular plasmid DNA. We recommend that a sample of the DNA be transformed nonetheless. The competent cells prepared according to procedure 11 can be used for the transformation with the mutated DNA according to procedure 21. Procedure 21: Transformation o f Competent Cells
1. Place tube containing 100 /zl of competent cells, prepared as in procedure 11, on ice. 2. Add at least 2/zl of repolymerized DNA from procedure 20, mix gently, and place on ice for 10-40 min. 3. Add 300/zl 2YT medium and shake at 37° for 60 min. 4. Take 2, 10, and 80/zl and spread onto agar plates containing the appropriate antibiotic selection marker. 5. On another plate spread 10/zl of competent cells that have not come in contact with any DNA. 6. Incubate the plates overnight at 37° and pick two to five colonies for DNA characterization. Troubleshooting One advantage of performing in vitro site-directed mutagenesis is that each step of the procedure may be conveniently analyzed by agarose gel electrophoresis. We recommend that the novice check the products after each enzymatic reaction before proceeding to the next step. Figures 2 and 3 give examples of how the different DNA species should appear after agarose gel analysis. It is important to run the gels in the presence of ethidium bromide and 2-mercaptoethanol because these compounds increase resolution as well as the stability of the DNA. 7'47 Table II gives a brief summary of potential pitfalls that might become evident after electrophoretic analysis. Acknowledgments We kindlyexpress our appreciationto A. Fahrenholzand A. Kroggelfor expert technical assistance and to R. Mackinfor critical reading of the manuscript. 47B. V. L. Potter and F. Eckstein,J. Biol. Chem. 259~ 14243 (1984).
218
MUTAGENESISAND GENEDISRUPTION
[14]
[14] P o l y m e r a s e C h a i n R e a c t i o n - B a s e d Point Mutagenesis Protocol
By L.-J.
ZHAO,
Q. X.
ZHANG,
and R. PADMANABHAN
Introduction Since its inception in 1985, the polymerase chain reaction I (PCR) has become an extremely useful technique in molecular biology. Its use ranges from clinical diagnostics to structure and functional studies involving sitedirected mutagenesis. The PCR involves the selective amplification of a segment of DNA template flanked by two synthetic complementary oligodeoxynucleotide primers by repeated cycles of three basic steps: heat denaturation of the template DNA, annealing of the primers to the template to form stable duplexes, and extension of the 3' ends of the primers by a DNA polymerase. Each new cycle of PCR amplification gives rise to twice the number of copies of the template DNA from the previous cycle as a result of annealing and extension of these primers by DNA polymerase. Thus the region between the two primers is amplified exponentially by approximately 2n-fold, where n is the number of cycles. 1,2Initially, Escherichia coli DNA polymerase I (Klenow fragment) was used for DNA synthesis from the annealed primers,3 but was replaced later by the thermostable DNA polymerase from Thermus aquaticus (Taq), which allowed the automation of this amplification method. One of the powerful applications of the PCR is in site-directed mutagenesis protocol to carry out the structural and functional analysis of genes encoding proteins or regulatory elements. Deletions, insertions, and point mutagenesis can be carried out using the PCR. Previous methods for deletion mutagenesis involve the wide use of either BAL 31 nuclease, which progressively shortens a double-stranded DNA fragment from both the 5' and 3' ends, or exonuclease III, which digests the target DNA from the 3' ends. The latter method can be applied to digest target DNA unidirectionally. 4 The extent of digestion in both cases is controlled by incubation time or the temperature of the reaction or both. Before the i R. K. Saiki, D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis, and H. A. Erlich, Science 239, 487 (1988). 2 K. B. Mullis and F. A. Faloona, this series, Vol. 155, p. 335. 3 R. K. Saiki, S. Scharf, F. Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich, and N. A r n h e i m , Science 230, 1350 (1985). 4 S. Henikoff, Gene 28, 351 (1984).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993by AcademicPress, Inc. All rights of reproduction in any form reserved.
[14]
PCR-BASED POINT MUTAGENESIS PROTOCOL
219
advent of the PCR technique, the insertion mutagenesis method commonly involved the ligation of synthetic restriction site linkers to the target DNA linearized by partial digestion with nonspecific deoxyribonuclease I (DNase I) in the presence of Mn 2÷ . An alternate method for obtaining linear DNA is by digestion with a restriction enzyme having a tetranucleotide recognition site in the presence of ethidium bromide. 5,6The insertional mutagenesis is random when DNase I is used, or limited to those regions containing the restriction sites on the target DNA. Several methods have been described to introduce point mutations along the segment of DNA. 6 These methods include mutagenesis by (1) treatment with sodium bisulfite, which deaminates deoxycytidine to deoxyuridine, resulting in the substitution of an A : T base pair for a G : C base pair in approximately 50% of the template molecules after one round of replication, 7'8 (2) enzymatic incorporation of nucleotide analogs,9 or misincorporation of normal nucleotides or ct-thionucleotide l°'~t by DNA polymerases. Oligo-directed mutagenesis has been extremely useful to generate deletion, insertion, and point mutations at preselected sites on the DNA molecule. Prior to mutagenesis, the target DNA is cloned into an M13 vector so that singlestranded wild-type DNA template can be produced. The oligo mutagen is then annealed to this template, producing a noncomplementary (looped out) region on the oligo primer or on the template, resulting in an insertion or a deletion, respectively. A third possibility is a base pair mismatch between the template and the primer in the case of point mutagenesis. Although these methods are efficient, they are still time consuming because of the number of steps involved, such as cloning of the target DNA into an MI3 vector, screening for the mutants by DNA sequence analysis, and recloning of the mutant DNA segments back into the parent plasmid for functional studies. On the other hand, the PCR-based mutagenesis methods 12-16 are simple and rapid compared to the more conventional methods described above.
5 R. C. Parker, R. M. Watson, and J. Vinograd, Proc. Natl. Acad. Sci. U.S.A. 74, 851 (1977). M. Smith, Annu. Rev. Genet. 19, 423 (1985). 7 D. Shortle and D. Nathans, Proc, Natl. Acad. Sci. U.S.A. 75, 2170 (1978). 8 D. Botstein and D. Shortle, Science 229, 1193 (1985). 9 W. Mueller, H. Weber, F. Meyer, and C. Weissmann, J. Mol. Biol. 124, 343 (1978). to R. A. Zakour and L. A. Loeb, Nature (London) 295, 708 (1982). tt D. Shortle, P. Grisafi, S. Benkovic, and D. Botstein, Proc. Natl. Acad. Sci. U.S.A. 79, 1588 (1982). t2 R. Higuchi, B. Krummel, and R. K. Saiki, Nucleic Acids Res, 16, 7351 (1988). t3 F. Vallette, E. Mege, A. Reis, and M. Adesnik, Nucleic Acids Res. 17, 723 (1989). 14 H. Kadowaki, T. Kadowaki, F. E. Wondisford, and S. 1. Taylor, Gene 76, 161 (1989).
220
MUTAGENESIS AND GENE DISRUPTION
[14]
We have utilized this PCR-mediated point mutagenesis protocol to analyze the function of the nuclear localization signal (NLS) domain in the 140-kDa adenovirus DNA (AdPol) that is required for replication of the adenovirus genome. AdPol contains three clusters of basic amino acids (R8ARR, R25RRVR, and R41ARRRR, BS I-III) which resemble the NLS domain of the simian virus 40 (SV40) large T antigen type, and therefore could potentially be involved in the nuclear targeting of AdPol or the heterologous cytoplasmic protein, E. coli fl-galactosidase (fl-Gal). 17 To examine the contribution of the basic amino acids in each cluster and the interactions between these positively charged regions in the nuclear targeting function, the PCR point mutagenesis protocol described here was used to introduce mutations into BS I-BS III (Fig. 1). Principle of Method To analyze the function of a DNA segment, either encoding a protein or a regulatory region, saturation mutagenesis in a defined region is a useful experimental approach to examine the contribution of the defined region to the overall function. It is also important that point mutations could be introduced at will along any stretch of DNA without the necessity of having convenient restriction sites in close proximity to the mutagenesis site. In the methods described to date for point mutagenesis by the PCR, the desired mutation is incorporated into one of the oligo primers. Amplification between the normal and mutant primers gives rise to the desired mutant DNA fragment. One drawback of this approach is that it requires one mutant oligo for each desired point mutation. Moreover, in cases in which the mutational analysis of a region of DNA is exploratory due to a lack of information regarding its function, it is best to produce several nucleotide substitutions at defined regions in the target DNA in a minimum number of steps. In the PCR mutagenesis protocol described here, mixedsite oligo in which the mutations are preselected along the length of a mutagenic oligo primer are chemically synthesized and used for the PCR to give rise to a mixture of PCR-generated mutant DNA fragments. To carry out functional analysis of mutations, the mutant fragment needs to be substituted for the wild-type fragment in the plasmid. To achieve this aim, the double-stranded mutant DNA fragments obtained in the first PCR were used as primers for amplification on wild-type templates. Different 15 M. Kammann, J. Laufs, J. J. Schell, and B. Gronenborn, Nucleic Acids Res. 17, 5404 (1989). 16 S. N. Ho, D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease, Gene 77, 51 (1989). 17 C. Dingwall and R. A. Laskey, Annu. Rev. Cell Biol. 2, 367 (1986).
[14]
221
PCR-BASED POINT MUTAGENESIS PROTOCOL
A oligo
#i BS M
A
L
V
Q
A
H
R
A
I R
R
L
H
A
E
CCATG-GCC-CTT-GTT-CAA-GCT-CAC-CGG-GCC-CGT-CGT-CTT-CAC-GCA-GAG-GCG GGTAC-CGG-GAA-CAA-GTT-CGA-GTG-GCC-CGG-GCA GCA GAA-GTG-CGT-CTC oligo
A
CGC
13
GCC-CGG-GCA-GCA-GAA-GT T T BS P
D
S
G
D
Q
P
P
R
R
II R
V
R
Q
Q
P
P
R
A
CCA-GAT-TCA-GGA-GAT-CAA-CCG-CCG-CGT-CGT-CGC-GTT-CGC-CAG-CAA-CCT-CCG-CGC-GCA GGT-CTA-AGT-CCT-CTA-GTT-GGC-GGC-GCA-GCA-GCG-CAA-GCG-GTC-GTT-GGA-GGC-GCG-CGT GC-GGC-GCA-GCA-GCG-CAA T T T Oligo BS A
P
A
P
A
R
A
R
GC
14
III R
R
R
A
P
A
P
S
P
GCA-CCA-GCT-CCT-GCC-CGC-GCG-CGG-CGC-CGA-CGT-GCC-CCT-GCC-CCC-TCT-CCC CGT-GGT-CGA-GGA-CGG-GCG-CGC-GCC-GCG-GCT-GCA-CGG-GGA-CGG-GGG-AGA-GGG GG-GCG-CGC-GCC-GCG-GCT-GCA-CGG-GGA-CGG-GGG-AGA~GGG A A T A T A A A
Oligo
15
B #13 Ncol
#14
I-En--I ----
#5
~
[
# 15
# 6 ~,
BSIH
]
PCR ~mplate
Kpnl
I
] I st PCR products :# 8¢ - - - - - . ~
I
-]
I I
2nd PCR products
I Cloning and sequenceanalysis
KpnI
FIG. 1. (A and B) Two-step PCR point mutagenesis strategy. The application of this mutagenesis method is to analyze the function of three clusters of basic amino acids (BS I-III) in the N-terminal region of adenovirus DNA polymerase. 2° (A) The first-step PCR was carried out between oligo 1 as primer 1, and oligo 13, 14, or 15 as primer 2 for mutagenesis of BS I, BS II, or BS III, respectively. (B) The second PCR was carried out initially by using the first PCR product as primers, and later by the addition of oligo 1 as primer 1, and oligo 5 or 6 as primer 2. The plasmid template (pGZ1) used for PCR contained the full-length coding sequence of adenovirus DNA polymerase.
222
MUTAGENESIS AND GENE DISRUPTION
[14]
primers were then added for the second PCR step. These primers contained sequences flanking two convenient restriction sites on the wildtype plasmid template (Fig. 1B). It was found that this two-step PCR mutagenesis method was effective in introducing multiple mutations in a defined region preselected by mixed-site mutagenic oligodeoxynucleotides. Materials and Reagents The reagents for PCR were purchased from Perkin-Elmer-Cetus (Norwalk, CT) as a kit. Escherichia coil (HB101 or DH5 strain) was used for all plasmid transformations. Triton X-100 was from Sigma Chemical (St. Louis, MO). The deoxynucleoside triphosphates used initially were from the PCR kit; in later experiments they were purchased from Pharmacia (Piscataway, N J). Oligo primers were synthesized using BioSearch model 8600 (Milligen,Burlington,MA). Reagents for the synthesis of DNAprimers were purchased as kits from MilliGen Biosearch. Mixed-site oligo primers were synthesized using the automatic mixed-site capability of the DNA synthesizer. During the coupling step, each monomer is alternately sampled and mixed before arriving at the column. The PCR was carried out using the thermocycler from Coy Laboratory Products (Ann Arbor, MI) and in later experiments using the GeneAmp instrument (Perkin-ElmerCetus). Screening the mutants was done by DNA sequencing of the recombinants using the DNA isolated from 4-ml cultures. 18The DNA sequencing was carried out by the dideoxy chain termination method of Sanger, using T7 DNA polymerase (Sequenase; U.S. Biochemicals, Cleveland, OH) from a kit.
Polymerase Chain Reaction Mutagenesis Method First Polymerase Chain Reaction Step. This mutagenesis strategy involves a two-step PCR amplification, cloning, and screening the mutants by DNA sequence analysis. The first-step PCR was initiated between wildtype oligo 1,5'-CGCCATTTGACCATTCACCA-3', corresponding to nucleotides 20-40 in pRSV-LTR vector, 19and either mixed-site oligo 13 (for BS I), oligo 14 (for BS II), or oligo 15 (for BS III) (see Fig. 1) to give rise to mutant PCR products that were amplified on the wild-type PCR template 18 T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982. 19 C. Gorman, G. Merlino, M. Willingham, I. Pastan, and B. H. Howard, Proc. Natl. Acad. Sci. U.S.A. 77, 313 (1980).
[14]
PCR-BASED POINT MUTAGENESIS PROTOCOL
223
(the plasmid pGZ1, containing the AdPol coding sequence cloned into the RSV-LTR plasmid vector). The PCRs were carried out using Taq polymerase (Perkin-Elmer-Cetus) or Vent DNA polymerase (New England BioLabs, Beverly, MA) according to the conditions of the manufacturer. Briefly, the incubation mixture (I00 ~1) contained 6.6 fmol of template (pGZ1 plasmid) 1 ~M each of the PCR primers, 200/~M dNTPs, 50 mM KCI, 10 mM Tris-HCl (pH 8.3 at room temperature), 1.5 mM MgCI2, 0.01% (w/v) gelatin, and 2.5 units of Taq polymerase. The sample was then overlaid with 100 ~1 paraffin oil (Fisher Scientific, Pittsburgh, PA). The PCR was carried out either in the thermocycler from Coy Laboratory Products or in GeneAmp from Perkin-Elmer-Cetus. The conditions of the three basic PCR steps were denaturation at 94° for 2 min 30 sec in the first cycle and 1 min 30 sec for cycles 2-25, annealing at 45-50 ° for 2 rain 30 sec, and polymerization at 72 ° for 2 rain. At the end of 25 cycles, the time of polymerization was extended to 10 rain, and the PCR DNA was subsequently stored at 4° until further use. The products were analyzed by electrophoresis on a polyacrylamide gel (8%) (Fig. 2A). Second Polymerase Chain Reaction Step. The first, double-stranded PCR product was diluted 10- to 50-fold, depending on the yield of the first PCR product, and was used in the second PCR as primers for elongation and subsequent amplification directed by oligo primers. These oligo primers were chosen from the sequences flanking two convenient restriction sites so that the amplified products from the second PCR could be cloned into those sites on a suitable plasmid vector and screened by DNA sequence analysis. The second PCR reaction mixture (100/zl) contained the template (1.6 fmol), 2.5-10% of the first PCR incubation mixture containing an about 500-fold molar excess of the first PCR product over the wildtype template concentration, and the rest of the components of the first PCR except the oligo primers. The DNA fragment from the first PCR product that contained the desired mutation was allowed to extend on wild-type template in the second PCR step. The second PCR was carried out for seven cycles in the absence of any additional primers except those oligos present as a carryover from the first PCR. The oligo primers 1 and 6 or 1 and 5 (Fig. 1B) were then added to the reaction at 1/zM concentration, and the PCR was continued for an additional 18 cycles. The conditions of this two-step PCR mutagenesis are given in Table I. The desired DNA fragments (311 bp between oligos 1 and 6, and 173 bp between oligos I and 5, as shown in Fig. 2B) were purified from the second PCR on an 8% (w/v) polyacrylamide gel by standard techniques of electroelution, 1~ NENSorb (Du Pont, Wilmington, DE) column purification, followed by lyophilization of the column eluate according to the protocol of the manufacturer. The purified DNA was then either digested with NcoI alone
224
MUTAGENESIS AND GENE DISRUPTION
A
1
[14]
B 2
3
1
2
3
a
b C
d e ¸
f
a
b " 1 3 9 bp c d
,311
bp
, 9 2 lap e f ,9192 bp
FIG. 2. Analysis of PCR products by electrophoresis on polyacrylamide gels. The PCR products were analyzed on polyacrylamide gels (8%) as described/8 (A) Lane 1, DNA size markers; a - f represent 344, 298,220, 201,154, and 134 bp. Lanes 2 and 3, first PCR products obtained in experiments 1 and 2 of Table I, respectively. The arrowheads indicate the 92and 139-bp products. (B) Lane l, same as in (A). Lanes 2 and 3, second PCR was initiated by the first PCR products as primers on the template pGZ1 as shown in Table I, and later continued by the addition of oligo 1 and 6 as terminal primers. The arrowheads show the final product of 311 bp (lanes 2 and 3) and, in addition, some of the first PCR product (92 bp in lane 2).
(for 173 bp) and cloned in the NcoI-SmaI-digested plasmid pLZ401,20 or digested with NcoI plus KpnI (311 bp) and cloned in the NcoI-KpnI sites of a pBR322 derivative. The transformants were screened by DNA sequence analysis. The frequency and the number of point mutations introduced into the various domains, BS I-III, were obtained from the DNA sequence analysis data, and are shown in Table II. 2o L.-J. Zhao and R. Padmanabhan, Cell 55, 1005 (1988).
[14]
PCR-BASED POINT MUTAGENESIS PROTOCOL
225
TABLE I EXPERIMENTAL CONDITIONS FOR Two-STEP POLYMERASE CHAIN REACTION MUTAGENESIS PROTOCOLa
Experiment
First PCR primers
Size of first PCR product b (bp)
Second PCR primers 1-7 cycles b 8-25 cycles
1
Oligo 1 + oligo 13
92
92 bp (50 ng)
2
oligo I + oligo 14
139
139bp (50 ng)
3
oligo 1 + oligo 15
209
209 bp (50 ng)
oligo 1 + oligo 5 (or 6) oligo 1 + oligo 5 (or 6) oligo 1 + oligo 6
Size of second PCR product' (bp) 173; 311
173; 311
311
The XhoI-linearized wild-type plasmid containing the AdPol coding sequence was used as the template (6.6 fmol for the first PCR and 1.6 fmol for the second PCR). All oligo primers were used at 1 p.M final concentration. b The primers for the second PCR during the first seven cycles were the 92-, 139-, and 209-bp double-stranded first PCR products obtained in experiments 1-3, respectively. c The sizes of the second PCR products were 173 and 311 bp, respectively, when oligo pairs 1 + 5 and 1 + 6 were used during cycles 8-25.
Discussion The PCR mutagenesis protocol described above gives rise to multiple point mutations as shown in Table II. The total number of sites varied in a mutagenic oligo dictated the number of point mutations introduced in the final product obtained as the predominant species. For example, in the mutagenesis of BS I, two sites in oligo 13 were varied, and hence 85% of the clones screened contained two point mutations (Table II). In the case of BS II and BS III, because there are three or more mixed sites in oligos 14 and 15 (Fig. 1A), there is a preponderance of clones with three or more point mutations. It is possible that during the synthesis of mixed-site oligos, the oligos with multiple mutations were disproportionately abundant over oligos with single point mutations. The nature of the nucleotide chosen for a particular site of mutation and the overall yield of the chemical synthesis at each of the mixed sites could influence the abundance of a mutant oligo in the mixture. An alternate explanation for the generation of clones with more than one point mutation is as follows. At the annealing temperature of the PCR (45-50°), the mutagenic oligos with double or more mutations could form more stable hybrids with the mutant amplified DNA, produced within a few cycles of the first PCR containing a single shared mutation, than with the wild-type template. Further amplification
226
[14]
MUTAGENESIS AND GENE DISRUPTION
T A B L E II FREQUENCY AND NUMBER OF POINT MUTATIONS ACCUMULATED USING TwO-STEP POLYMERASE CHAIN REACTION MUTAGENESlS METHOD N u m b e r of point mutations b Size o f second P C R product cloned (bp) 173 173 311 311 311
Mutant domain BS BS BS BS BS
I II I II III
F r e q u e n c y of mutation a
1
2
3
4
1.0 1.0 0.9 0.65 0.69
2 0 3 0 0
11 1 6 3 2
-10 -8 13
---3
F r e q u e n c y of mutation r e p r e s e n t s the ratio of the n u m b e r of m u t a n t s obtained divided by the total n u m b e r of t r a n s f o r m a n t s screened. b Total n u m b e r o f m u t a n t t r a n s f o r m a n t s obtained containing one, two, three, or four point m u t a t i o n s in the various domains.
resulting from this stable annealing would give rise to mutant DNA with multiple mutations in subsequent cycles. If this explanation is correct, then it would suggest that the use of excess wild-type template (in the range of 80-160 fmol) and a fewer number of cycles (about 10) in the first PCR might give rise to clones with single point mutations. However, in some structure-function studies the mutagenesis protocol described here should be useful. For example, in functional studies involving a regulatory region isolation and characterization of multiple mutations in several defined regions would be helpful to identify the contributions of individual regions toward the overall function. We also noticed that Vent DNA polymerase (isolated from the extreme thermophile Thermococcus litoralis, and sold by New England BioLabs) could also be used for this mutagenesis procedure successfully (BS I and BS II mutations in the first two rows of Table II), except that a lower annealing temperature (42-45 °) was required. At a higher annealing temperature, the frequency of mutations was considerably reduced. This attribute of Vent DNA polymerase might be related to its exceedingly stable 3' ~ 5' proofreading exonuclease activity as advertised by the manufacturer, which might effectively reduce the concentration of the mutagenic oligo, but not the fraction of the wild-type oligo annealing to the wild-type template in the first PCR. For the second PCR, the double-stranded mutant DNA obtained in the first PCR was used as primers for elongation by Taq DNA polymerase on a wild-type template. We varied the amount of the first PCR product added to the second PCR from 2.5 to 10% of the incubation mixture without the
[14]
PCR-BASED POINT MUTAGENESIS PROTOCOL
227
need for phenol extraction or gel purification step. The amount of the first PCR product needed as primers for a successful second PCR had to be established empirically. Therefore, it is recommended that the second PCR be carried out using two or three different concentrations of the first PCR product as primers for elongation and subsequent amplification. Use of double-stranded mutant DNA as primers for the PCR has been reported. 2~'z2 In one report, 2~ the two independent point mutants of exon 4 (182 bp) of the tyrosinase gene were amplified from the M13/exon 4 subclones, using oligo primers flanking the mutational sites. The doublestranded amplified DNA product was used as a primer in the second-step PCR for obtaining a longer fragment containing exons 2, 3, and 4, which was then inserted to replace the corresponding portion of the wild-type gene in an expression plasmid. In the second report, 22the mutagenic oligo containing a single mutation was used as one PCR primer. The hybrid primer, in which the 3' end contained sequences from the template region to be amplified, and the 5' end contained unique sequences not present in the template, was used as the second primer. The double-stranded mutant DNA was used as primer in the second-step PCR, in addition to two oligos, one from a site upstream of the mutation, and the other containing the 5' end sequences of the hybrid primer used in the first PCR. This strategy-'" allowed the selection of mutant DNA against the wild-type DNA. However, it required three oligonucleotides flanking a mutational site, and one mutagenic oligo for each desired point mutation. The method described here is well suited for introducing multiple mutations in a defined region. Although the transformants need to be screened by DNA sequence analysis in this procedure, different mutants can be identified by a single sequencing gel. Sequencing the transformants also achieves the purpose of verifying the accuracy of the PCR amplification, as would be required for any mutagenesis protocol. 2E L. B. Giebel and R. A. Spritz, Nucleic Acids Res. 18, 4947 (1990). 22 R. M. Nelson and G. L. Long, Anal. Biochem. 180, 147 (1989).
228
MUTAGENESIS AND GENE DISRUPTION
[15]
[15] L i b r a r i e s o f P e p t i d e s a n d P r o t e i n s D i s p l a y e d o n Filamentous Phage
By GEORGE P. SMITH and JAM1E K. SCOTT Introduction A "fusion phage" is a flamentous virion displaying on its surface a foreign peptide fused to a coat protein, and harboring the gene for the fusion protein within its genome.l'2 In this chapter we will emphasize an application for which these surface expression vectors are particularly well suited: construction of epitope libraries. In such a library--at least the kind so far constructed--the phages display "random" foreign peptides encoded by degenerate synthetic oligonucleotides spliced into the coat protein gene, the library as a whole representing up to billions of peptide sequences. 3-5 If a phage displays a peptide that is a strong ligand for an antibody or other binding protein, it can be readily affinity purified out of a library--even one containing a vast excess of nonbinding clones. Affinitypurified phages are eluted without destroying their infectivity; and the peptide sequences responsible for binding are easily ascertained by infecting the eluted phages into bacteria, propagating the resulting phage clones, and sequencing the relevant part of their viral DNAs. In this way, billions of peptide epitopes can be encompassed in a few microliters of solution and effectively surveyed for tight binding to a given protein, using simple microbiological and recombinant DNA procedures. The number of peptides that can be accommodated with this technology exceeds by at least a factor of 100-1000 the number that can be screened with conventional expression systems, in which the epitope is not displayed as part of the propagatable unit that encodes it. At the end of the chapter we will touch on more complex libraries, in which the displayed ligands are whole folded domains. Such constructs include most notably libraries of "phage antibodies" that would (it is hoped) display an array of binding specificities large enough to accommodate almost any possible antigen; these libraries hold out the promise of l G. P. Smith, Science 228, 1315 (1985). 2 S. F. P a r m l e y and G. P. Smith, Gene 73, 305 (1988). 3 j. K. Scott and G. P. Smith, Science 249, 386 (1990). 4 j. j. Devlin, L. C. Panganiban, and P. E. Devlin, Science 249, 404 (1990). 5 S. E. Cwirla, E. A. Peters, R. W. Barrett, and W. J. Dower, Proc. Natl. Acad. Sci. U.S.A. 87, 6378 (1990).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993by AcademicPress, Inc. All rights of reproduction in any form reserved.
[15]
LIBRARIES OF PEPTIDES DISPLAYED BY PHAGE
229
dramatically simplifying the isolation of monoclonal antibodies to almost any antigen. To simplify the discussion we will consistently use the term ligate to refer to the molecule that specifically binds a phage-borne peptide or protein domain and ligand to refer to a molecule (whether phage-borne or not) that specifically binds a ligate. In the case of epitope libraries displaying short peptides, the ligate is almost always a binding protein such as an antibody or receptor; in this case our terminology conforms with the convention that refers to the smaller, less structured partner of a binding pair as the ligand. As the phage-borne ligand becomes more and more structured, however, especially in the case of phage antibodies, smaller and smaller molecules can serve as ligates, including simple, nonproteinaceous determinants; in such circumstances, our terminology reverses the usual convention. In this chapter we describe the basic methods of fusion-phage technology, emphasizing the random hexapeptide epitope library that has been studied in our laboratory, but touching on alternative developments.
Design of Fusion Phage Vectors Representative published fusion-phage constructs are listed in Table l, along with key features that will be described in this section; some of the entries are specific constructs rather than general cloning vectors. All are based on the Ff class of filamentous phage: the class that infects bacteria harboring the F episome and that includes wild-type strains M13, fl, and fd. The filamentous phage infection cycle 6'7 is initiated by the attachment of phage coat protein pIII (product of phage gene III) to the tip of the F pilus, followed by internalization of the single-stranded viral DNA (ssDNA). This so-called plus strand serves as template for minus-strand synthesis, which starts at a specific origin and results in a double-stranded replicative form (RF). The RF is the template for mRNA transcription, RF replication, and production of progeny ssDNA. Progeny virions are assembled, not in the cytoplasm, but rather by extrusion of ssDNA through the bacterial envelope without killing the cell or preventing cell division. As it emerges from the cell, the ssDNA acquires its extracellular sheath of coat proteins from the membrane. The coat consists of a tubular array 6 G. P. Smith, in "Vectors: A Survey of Molecular Cloning Vectors and Their Uses" (R. L. Rodriquez and D. T. Denhardt, eds.), p. 61. Butterworths, Boston, 1988. 7 p. Model and M. Russel, in "The Bacteriophages" (R. Calendar, ed.), Vol. 2, p. 375. Plenum, New York, 1988.
230
MUTAGENESIS AND GENE DISRUPTION
[15]
TABLE I FUSION-PHAGE CONSTRUCTS
Name
Gene
fUSE5
III
fAFF1 M 13LP67 phGH-M 13glII
1II 111 III
pSEX
Ili
pCBAK8
VIII
fdH
VIII
pKfdH
VIII
Features Defective for (-)strand synthesis Noncomplementary, non-selfcomplementary termini Tetracycline resistance Infectivity requires insert Same as fUSE5 Ampicillin resistance Phagemid Human growth hormone fused directly to C-terminal domain of pill Must be complemented with helper to supply wild-type plII, other phage functions Ampicillin resistance Phagemid Single-chain antibody Fv domain fused to full-length plII Must be complemented with helper to supply other phage functions Ampicillin resistance Phagemid Antibody Fab domain fused to pVIll Must be complemented with helper to supply wild-type pVIII, other phage functions Ampicillin resistance Tolerates only foreign peptides with ---six amino acids Plasmid, not a phagemid: not suitable for library construction Must be complemented with helper to supply wild-type pVIII, other phage functions Ampicillin resistance
Sequence at amino terminus of mature hybrid protein ~
Ref.
ADc~Xd3GAETVESCLAK--
b
X.chCLAK--
c
X,,flAETVESCLAK--
d
e
f
g
AEVX.NDP--
h
AEVXnNDP- -
h
" Only general cloning vectors are entered, a, V, A, D, E, or G;/3, S, P, T, or A; cb, any amino acid but W, Q, M, K, or E. b j. K. Scott and G, P. Smith, Science 249, 386 (1990).
[15]
LIBRARIES OF PEPTIDES DISPLAYED BY PHAGE
231
of thousands of pVIII molecules (product of phage gene VIII) and four minor coat proteins, including five copies of pIII incorporated into the trailing tip of the emerging virion. Both pIII and pVIII are synthesized with posttranslationally cleaved signal peptides, and before incorporation into the virion are anchored in the inner membrane with the N-terminal portion (the bulk of the protein in the case ofpIII) exposed in the periplasm. The gene III protein appears to have two functional domains, each roughly 200 residues long: an exposed N-terminal domain that binds the F pilus but is not required for virion assembly, and a C-terminal domain that is buried in the particle and is an integral part of the capsid structure. In the virion, the C-terminal portion of pVIII appears to be inside the virion, close to the DNA, while the N terminus is exposed to the solvent. In most fusion-phage constructs the foreign amino acids are inserted just downstream of the pIII signal peptide, and propagation of the recombinant phage requires that the recombinant pIII retain its functions. In a wild-type filamentous phage background, defects in gene III (and in most other phage genes) cause the phages to kill the cell with almost no phage production. In mutants with a defective minus-strand origin of replication, however, gene III defects are tolerated, probably as a result of reduced RF copy number. Such phages still replicate as a result of adventitious minus-strand initiations; and if all the other phage genes are functional the virions are infective, even giving small plaques. Many of the fusion-phage vectors, including the fUSE vectors and fAFF1, derive from fd-tet, which has a tetracycline (Tc) resistance determinant spliced into the minus-strand origin. This phage can be propagated like any Tc-resistance plasmid, independently of pIII function. 8 This allows a gene III frameshift to be engineered into the cloning site, so that vector without insert is noninfective; in such "frame-shifted" vectors, only clones bearing frame-restoring inserts contribute infectious particles to a library. Use of low copy number vectors may also help accommodate inserts that partially debilitate pIII 8 G. P. Smith, Virology 167, 156 (1988).
" S. E. Cwirla, E. A. Peters, R. W. Barrett, and W. J. Dower, Proc. Natl. Acad. Sei. U.S.A. 87, 6378 (1990). d j. j. Devlin, L. C. Panganiban, and P. E. Devlin, Science 249, 404 (1990). e S. Bass, R. Greene, and J. A. Wells, Proteins: Struct., Funct. Genet. 8, 309 (1990). f F. Breitling, S. Dubel, T. Seehaus, I. Klewinghaus, and M, Little, Gene 104, 147 (1991). g A. S. Kang, C. F. Barbas, K. D. Janda, S. J. Benkovic, and R. A. Lerner, Proc. Natl. Acad. Sci. U.S.A. 88, 4363 (1991). h j. Greenwood, A. E. Willis, and R. N. Perham, J. Mol. Biol. 220, 821 (1991).
232
MUTAGENESIS AND GENE DISRUPTION
[15]
and might be strongly selected against in high copy number vectors because of cell killing. A recombinant coat protein gene can be transplanted from the phage genome into a type of plasmid called a p h a g e m i d . 9 Phagemids contain the filamentous phage intergenic region comprising the origins of plus- and minus-strand synthesis and all other cis-acting elements needed for synthesis of ssDNA and packaging it into virions. They also contain a nonphage origin of replication and an antibiotic resistance gene so they can be propagated like any plasmid independently of phage function. When a cell harboring a phagemid is infected by filamentous helper phage, it secretes the phagemid (as well as the helper phage) in the form of infectious virions. These virions display a mixture of recombinant coat protein molecules encoded by the phagemid and wild-type molecules encoded by the helper. Phagemid virions are readily distinguishable from helper virions in that they transduce antibiotic resistance into any cell they infect. In the phagemid pSEX of Breitling et al. ~othe foreign domain is fused to the N terminus of wild-type pill, while in phagemid hGH-MI3glII of Bass et al. 11 the foreign domain r e p l a c e s the exposed N-terminal domain of the wild-type protein. Either design might allow display of foreign domains that would otherwise interfere with infectivity, which does not seem to require that all pill molecules on a particle be functional. Once infected into cells, clones are propagated as ampicillin resistance plasmids independently of pill or pVIII function. Kang et al. 12 (phagemid pCBAK8) and Greenwood et al. t3 (phage fdH and plasmid pKfdH) have spliced foreign inserts into the major coat protein pVIII, resulting in virions with many more displayed copies of the foreign peptide than in the case of gene I I I fusions. Peptides of up to six amino acids can be directly spliced into phage gene VIII, thereby being displayed on all copies of pVIII (2700 in wild-type particles). ~3 By transferring the recombinant gene V I I I to a phagemid or other plasmid and complementing with a helper phage to supply wild-type pVIII, much larger peptides-indeed, a 50-kDa antibody Fab domain12--can be displayed in dozens to hundreds of copies along the length of the virion. Such virions can be used directly as highly effective immunogens for eliciting antibodies against the 9 D. A. Mead and B. Kemper, in "Vectors: A Survey of Molecular Cloning Vectors and Their U s e s " (R. L. Rodriquez and D. T. Denhardt, eds.), p. 85. Butterworths, Boston, 1988. 10 F. Breitling, S. Dubel, T. Seehaus, I. Klewinghaus, and M. Little, Gene 104, 147 (1991). li S. Bass, R. Greene, and J. A. Wells, Proteins: Struct., Funct. Genet. 8, 309 (1990). 12 A. S. Kang, C. F. Barbas, K. D. Janda, S. J. Benkovic, and R. A. Lerner, Proc. Natl. Acad. Sci. U . S . A . 88, 4363 (1991). 13 j. Greenwood, A. E. Willis, and R. N. Perham, J. Mol. Biol. 220, 821 (1991).
[15]
LIBRARIES OF PEPTIDES DISPLAYED BY PHAGE
233
foreign peptides.13 Such a vector could be of particular utility in vaccine development. To create a library, RF or plasmid DNA is restricted and spliced to the foreign DNA insert. Several vectors have two restriction sites yielding single-stranded termini that are neither complementary nor self-complementary; after the short "stuffer" between the sites has been removed, the linear vector DNA cannot be self-ligated, so that circularization requires that a compatible foreign insert be spliced in. TM Table I shows (for the general cloning vectors) the N-terminal primary sequence of the recombinant pill or pVIII encoded by clones carrying a frame-preserving or frame-restoring insert, assuming signal peptidase cleaves in the usual position. The variable part of the sequence, which the user is completely free to specify in the insert, is abbreviated Xn. As can be seen, two of the vectors (fAFF1 and M13LP67) allow the user to specify even the N-terminal residue of the mature gene Ili protein; most amino acids seem to be accepted at the first position after the signal peptide without impairing phage yield or infectivity, 5 although it has not yet been shown that signal peptidase actually cleaves such fusion proteins at the expected position. In the other vectors, insert-specified residues are preceded in the mature protein by a few vector-specified residues. Unless specifically noted, the procedures in this chapter are those used with the fUSE vectors in our laboratory. Although for the most part these procedures exemplify methods in general use with filamentous fusion phage, a few will have to be changed--usually in obvious ways--when applied to other vector systems. Bacterial Strains K-91 is a h- derivative of K-3815; it is Hfr Cavalli and has chromosomal genotype thi. K-91Kan is K-91 with the "mini-kan hopper" element, j6 a kanamycin-resistance transposon without its own transposase gene, inserted into the lacZ gene. K-80217is F - and has chromosomal genotype galK2 galT22 metB1 (lac-3 or lacY1) supE44 hsdr2. MC1061, ]8 the host for electroporation, is F - and has chromosomal genotype hsdR mcrB araD139 A(araABC-leu)7679 AlacI74 galU galK strA thi. z4 A. Aruffo and B. Seed, Proc. Natl. Acad. Sci. U.S.A. 84, 8573 (1987). 15 L. B. L y o n s and N. D. Zinder, Virology 49, 45 (1972). 16 j. C. Way, M. A. Davis, D. Morisato, D. E. Roberts, and N. Kleckner, Gene 32, 369 (1984). 17 W. B. Wood, J. Mol. Biol. 16, 118 (1966). ]8 p. S. Meissner, W. P. Sisk, and M. L. B e r m a n , Proc. Natl. Acad. Sci. U.S.A. 84, 4171 (1987).
234
MUTAGENESIS AND GENE DISRUPTION
[15]
Recipes ABTS solution: Dissolve 2,2'-azinobis(3-ethylbcnthiazoline-6-sulfonic acid) (Sigma, St. Louis, MO) at 0.22 mg/ml in a 386 : 614 (v/v) mixture of 0.2 M Na2HPO 4 and 0.1 M citric acid; then add 1/1000 vol of 30% (w/v) H202 and use within 15 min Avidin-peroxidase complex: ABC reagent (Vector Laboratories, Burlingame, CA) is prepared in TBS (see below) with 0.1% (v/v) Tween 20 as recommended by supplier. Presumably other avidin-peroxidase or streptavidin-peroxidase complexes can be substituted Bovine serum albumin (BSA): Unless otherwise indicated, this is bovine serum albumin fraction V (Sigma); the protein is dissolved at 50 mg/ml in water, filter-sterilized, and stored at 4 or - 2 0 ° Acetylated BSA: This nuclease-free protein, which is used as a carrier for DNA reactions, is purchased from Promega (Madison, WI) as a l-mg/ml stock and stored at - 2 0 ° Dialyzed BSA: We use dialyzed fraction V BSA (Sigma) as a carrier protein when small amounts of contaminating biotin might interfere; a 50-mg/ml stock solution is prepared and stored as for nondialyzed BSA Blocking solution: 5 mg/ml dialyzed BSA, 0.1 M NaHCO3, 0.1 tzg/ml streptavidin, 0.02% (w/v) NaN3 ; filter sterilized and stored in refrigerator; can be reused many times Blotto solution: 5 g nonfat dry milk in 100 ml TBS/azide (see below) Bonding coat: Mix 20 tzl 7-methacryloxypropyltrimethoxysilane (Sigma) with 20 m195% (v/v) ethanol, then add a mixture of 60 tzl glacial acetic acid and 600 tzl water; use within 1 hr Buffered glucose: 50 mM glucose, 25 mM Tris-HCl (pH 8.0), 10 mM EDTA, pH 8 (see below). Store in refrigerator EDTA, pH 8 (250 mM stock): 0.25 M ethylenediaminetetraacetic acid disodium salt (N%EDTA), pH adjusted to 8.0 with NaOH; the stock is autoclaved and stored at room temperature Elution buffer: 0.1 N HC1 adjusted to pH 2.2 with glycine, 1 mg/ml BSA; store in refrigerator. The glycine hydrochloride buffer is made as a 4 × stock, filter sterilized, and stored at room temperature Ethanol: 100% ethanol is poured into a sterile glass-stoppered bottle and used directly; 70% (v/v) ethanol is 64.9% (w/w) ethanol in sterile water Formamide load buffer: Mix 6.65 ml formamide, 280 IA 0.5 M Na2EDTA (pH adjusted to 8.0 with NaOH), 3.5 mg bromphenol blue, 3.5 mg xylene cyanol FF, and 70 tzl water; store at - 2 0 ° GB B (40 × stock): 1.68 M Tris, 0.8 M sodium acetate, 72 mM Na2EDTA, pH adjusted to 8.3 with glacial acetic acid; store at room temperature
[15]
LIBRARIES OF PEPTIDES DISPLAYED BY PHAGE
235
Kinase buffer (10 × stock): 0.5 M Tris-HCl (pH 7.5), 100 mM MgC12, 50 mM dithioerythritol, 1 mM spermidine, 1 mM EDTA (pH 8). Store at - 2 0 °, thaw, and refreeze as needed LB medium: See Sambrook e t a l . 19 Ligation buffer (5 × stock): 150 mM Tris-HCl (pH 7.5), 10 mM dithiothreitol (DTT), 1 mM EDTA (pH 8), 5 mM spermidine, 1.25 mM ATP (added as 100 mM stock neutralized to pH -7), 150 mM NaCI, 37 mM MgCI 2 , 500-800/xg/ml acetylated BSA NaN 3 (5% stock): A 5% (w/w) solution is made up, taking precautions to avoid exposure to the toxic chemical; store in refrigerator NAP buffer: Autoclave 90 ml 88 mM NaC1; when cool add 10 ml sterile 0.5 M NH4H2PO 4 (pH adjusted to 7.0 with NH4OH; made as 0.5 M stock, which is separately autoclaved in tightly closed bottle and stored at room temperature) NZY medium: Same as NZYM (Sambrook e t al. 19) without added MgSO4; autoclave and store at room temperature NZY agar medium: For 1 liter (about forty 100-mm petri dishes) autoclave 11 g Bacto-agar (Difco, Detroit, MI) in 500 ml water in a 2-liter plastic flask; while still hot add 500 mi sterile 2 x NZY at room temperature (and antibiotics and other heat-labile components as appropriate), mix by gentle swirling, and pour - 2 5 ml per 100-mm petri dish NZY/Tc agar medium: NZY/agar medium with Tc at 40/~g/ml NZY/Tc medium: NZY with 20/zg/ml Tc PEG/NaC1 solution: Mix 100 g polyethylene glycol (PEG) 8000 (Fisher, St. Louis, MO), 116.9 g NaCI and 475 ml water, heating if necessary to dissolve all the solid; store at room temperature or in refrigerator. Can be autoclaved, but must be mixed occasionally as it cools to prevent separation of phases Sequencing gel solution: The 40% (w/w) acrylamide stock is 38% (w/w) acrylamide, 2% (w/w) bisacrylamide; it is made up taking precautions to avoid exposure to the neurotoxic monomer, and stored up to - I year in the refrigerator. The 6% acrylamide gel solution (500 ml) is made by mixing 75 ml 40% acrylamide stock, 125 ml water 250 g ultrapure urea, and 100 ml 5 x TBE buffer (see below); the solution is filtered through a 0.45-~m nitrocellulose filter, degassed, and stored for up to - 2 months at room temperature in an amber bottle SOC medium: See Sambrook e t a l . 19
19 j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed., Vols. 1-3. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989.
236
MUTAGENESIS AND GENE DISRUPTION
[15]
Sodium acetate buffer (3 M stock): 3 M sodium acetate adjusted to pH 6.0 with acetic acid; autoclave with cap tight, store at room temperature Soft agar: Autoclave 1 g Bacto-tryptone, 0.5 g NaC1, and 0.75 g Bactoagar in 100 ml water; store at room temperature; for use, melt in microwave oven and dispense -3-ml portions into sterile 13 × 100 mm tubes in a 50° heating block as needed TBE buffer (5 x stock): 0.5 M Tris, 0.5 M H3BO3, I0 mM NazEDTA; store at room temperature TBS (10 x stock): 1.5 M NaCI, 0.5 M Tris-HCl (pH 7.5); dilute and autoclave as needed; both the 1 × and 10x solutions are stored at room temperature TBS/Tween: make by diluting 0.5 ml Tween 20 in 100 ml TBS; autoclave and store at room temperature TBS/gelatin: 0.1% (w/v) gelatin in TBS; autoclave and store at room temperature TBS/azide: TBS with 0.02% (w/v) NaN3 ; store at room temperature TE: l0 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH 8); make as 10 × stock, dilute and autoclave as needed; store at room temperature Termination mixes and termination diluent: Diluent contains 67 ~M dNTPs (purchased from Pharmacia, Piscataway, N J, as 100 mM stock solutions neutralized to pH -7), 16.7 mMTris-HC1 (pH 7.5), 66.7 mM NaCI, 13.3 mM dithioerythritol, and 100 ~g/ml acetylated BSA. The Q, R, W, M, K, and S mixes contain in addition the following ddNTPs (purchased from Pharmacia as 5 mM stock solutions neutralized to pH -7): R, 3.2/~M ddATP and ddGTP, 0.32/~M ddCTP; Q, 3.2/~M ddTTP and ddATP, 0.32/~M ddCTP; W, 3.2/~M ddATP and ddTTP; M, 3.2/~M ddATP and ddCTP; K, 3.2/~M ddGTP and ddTTP; S, 3.2 /~M ddGTP and ddCTP. All these solutions are stored at - 2 0 ° and thawed and refrozen as needed Tetracycline (Tc) (20-mg/ml stock): Dissolve solid in water at 40 mg/ml, filter sterilize into an equal volume of autoclaved, cooled glycerol, mix, and store at - 2 0 ° General Procedures
Phenol Extraction, Chloroform Extraction, and Ethanol Precipitation from Sodium Acetate Solution The steps are carried out as outlined by Sambrook et al. 19 Removal of Supernatant. In some procedures it is advantageous to remove almost all supernatant from a pellet; to accomplish this, decant or aspirate the supernatant, recentrifuge the tube (maintaining the same
[15]
LIBRARIES OF PEPTIDES DISPLAYED BY PHAGE
237
orientation in the rotor), and aspirate or pipette off the residual supernatant that is thus driven to the bottom of the tube. Electroporation. Large-scale transfections for library construction are accomplished by electroporation. 2° Frozen Escherichia coli MCl061 cells 2° (40-50 /~l) are thawed, mixed with DNA (up to - l p~g in 1-5 p,l water), transferred to a cold 2-ram cuvette (Bio-Rad Laboratories, Richmond, CA) connected in parallel with a 400-f~ resistor, and shocked by charging a 25-/~F capacitor to 2.5 kV and discharging it through the resistor. The shocked cells are immediately suspended in SOC medium containing 0.2/~g/ml Tc, transferred to a sterile 15-ml culture tube, and shaken at 37 ° for 30-60 min before spreading 200-/~1 portions on NZY/Tc agar medium in 100-mm petri dishes or inoculating into liquid NZY/Tc medium. Small-scale transfections (e.g., for strain constructions) are accomplished by the CaCl 2 method as described. 21 Vector DNA. Noninfective phage (e.g., fUSE vectors) should be propagated in an F - (uninfectable) host to guard against accumulation of infective pseudorevertants; infective phage can be grown in male (F +, F', or Hfr) strains. Cultures are grown to stationary phase in 1 liter of LB medium containing 15 /.Lg/ml Tc. Cells are suspended in 40 ml buffered glucose and RF is extracted by alkaline lysis (Sambrook et al.19), except that no lysozyme is required. The crude DNA, dissolved in l0 ml TE, is extracted twice with phenol and once with chloroform, reprecipitated with ethanol, and purified by CsCl-ethidium bromide density gradient centrifugation (Sambrook et al., 19pp. 1.42-1.43); one tube for the VTi50 rotor (Beckman Instruments, Fullerton, CA) accommodates DNA from up to 2 liters of culture; because of the large amount of RNA in the lysate, at least 25 mg ethidium bromide should be included to ensure enough free dye to saturate the DNA. Purified DNA is cleaved with appropriate restriction enzyme(s) and extracted with phenol and chloroform. To remove a "stuffer" fragment released by cleavage at two restriction sites, the cleaved DNA (37/~g/ml in restriction buffer or a dilution thereof) is precipitated by adding 1/9 vol 3 M sodium acetate buffer and 2/3 vol 2-propanol, incubating on ice 20 min, microfuging 30 rain at room temperature, removing all supernatant (see Removal of Supernatant, above), washing gently in 70% (v/v) ethanol, and again removing all supernatant. The precipitate is dried briefly under vacuum, dissolved in TE, ethanol precipitated, and quantified spectrophotometrically. Large-Scale Purification o f Virions. The following procedure is for derivatives of fd-tet, which yield about 5 x l0 ll particles/ml of culture. 20 W. J. Dower, J. F. Miller, and C. W. Ragsdale, Nucleic Acids Res. 16, 6127 (1988). 2i F. K. Nelson, S. M. F r i e d m a n , and G. P. Smith, Virology 108, 338 (1981).
238
MUTAGENESIS AND GENE DISRUPTION
[15]
One liter of stationary-phase culture (previous section) is freed of cells by two successive 10-min centrifugations [5000 and 8000 rpm in three 500-ml bottles in the Sorvall (Norwalk, CT) GS3 rotor at 4 °]; the final supernatant is distributed equally in three 500-ml centrifuge bottles. (If needed, RF can be prepared from the cell pellet, as described in the previous section.) After adding 0.15 vol PEG/NaC1 solution, the supernatnat is thoroughly mixed and incubated overnight in the refrigerator. Precipitated virions are collected by a 30-min centrifugation (8000 rpm in the Sorvall GS3 rotor at 4°), removing all supernatant. The precipitate is dissolved and pooled in a total of 30 ml TBS, transferred to a single Oak Ridge tube (Nalge, Rochester, NY), cleared by a 10-min, 15,000-rpm centrifugation (Sorvall SS34 rotor), and reprecipitated from the supernatant by adding 4.5 ml PEG/ NaCI solution and incubating at least 1 hr in the refrigerator. Virions are collected by centrifugation (again taking care to remove all supernatant), dissolved in 10 ml TBS, and cleared by centrifuging at 15,000 rpm for 10 rain at 4 ° (Sorvall SS34 rotor). The final supernatant is transferred to a tared vessel and TBS added to bring the total net weight to I0.75 g; 4.83 g CsC1 is added to bring the density to 1.30 g/ml. The CsC1 solution is transferred into a ~ × 2½ in. polyaUomer tube (topping with mineral oil if necessary) and centrifuged at 37,000 rpm for at least 40 hr in the SW41 rotor (Beckman Instruments) at 4 °. (Note: For phage other than fd-tet derivatives, the particle yield is - 2 × 1012virions/ml, and the virions from 1 liter of culture should be distributed into three or four SW41 tubes.) After centrifugation light-scattering bands are visualized by shining a bright light downward through the tube and looking through the wall of the tube at right angles to the light beam. The translucent, nonflocculent phage band lies near the middle of the tube just above a sharp, white, flocculent band; 1015 particles can give a band - I cm wide. The phages are collected by puncturing the side of the tube with a 16-gauge needle attached to a 3-ml syringe. Phages from one or two tubes are transferred to 26-ml polycarbonate bottles for the Beckman 60Ti rotor; the bottles are filled with TBS and centrifuged at 50,000 rpm for 4 hr at 4° to pellet virions. After removing all supernatant (see Removal of Supernatant, above), the virion pellet in each bottle is dissolved in 3.2 ml TBS, divided into three 1.5-ml microcentrifuge tubes (800/zl each), and cleared by microfuging 3 min; supernatants are transferred to polyallomer microcentrifuge tubes for the Beckman TLA-100.1 rotor and centrifuged at 57,000 rpm for 90 mip. at 4 °. After again removing all supernatant, the pellets from 1 liter of original culture are dissolved and pooled in a total volume of 3 ml TBS. Virions are quantified spectrophotometrically by scanning a 1/50 dilution from 240 to 320 nm, giving a broad peak at 260-280 nm with peak absorp22 L. A. Day, J. Mol. Biol. 39, 265 (1969).
[15]
LIBRARIES OF PEPTIDES DISPLAYED BY PHAGE
239
tion at 269 n m . 22 Virion concentration (physical particles per milliliter) can be estimated a s A269 X 6 X 10t6/(bases/ssDNA); a typical yield for fd-tet derivatives is 3 x 10 u virions/ml of culture supernatant. Starved Cells. Filamentous phages infect E. coli strains displaying the sex pilus encoded by the F episome (Hfr, F*, or F' strains). Because phages adsorb slowly to cells at log-phase concentrations ( - 5 x 10s cells/ ml), we concentrate cells to - 10~°cells/ml after starvation. 23 Cells are first grown in 20 ml NZY medium at 37 ° with vigorous shaking to an optical density of - 0 . 4 - 0 . 6 at 600 nm; shaking is then slowed for 5 min, and care is taken in subsequent steps to avoid shearing the fragile F pili. The culture is centrifuged (2200 rpm for 10 rain in a Sorvall SS34 rotor), the supernatant is poured off, and the cells are gently resuspended in 20 ml 80 mM NaCI and shaken gently in a 125-ml culture flask at 37 ° for 45 rain to starve the cells. The cells are collected as above and resuspended in 1 ml cold NAP buffer; they can be stored in the refrigerator for about 5 days without affecting titers. Titering Transducing Units. Infections are ordinarily carried out either in disposable 15-ml culture tubes (if only a few infections are involved) or in wells of a 24-well culture dish (Costar, Cambridge, MA). To 20/zl phage (appropriately diluted in TBS/gelatin) is added 20/zl starved cells; after 10 min at room temperature the mixture is diluted with 0.2-2 ml NZY medium containing 0.2/xg/ml Tc and incubated with shaking (gentle shaking in the case of 24-well culture dishes) for 20-40 min. These cultures or appropriate dilutions of them (using NZY with or without 0.2 gg/ml Tc as diluent) are then spotted (20/.d/spot) or spread (50-200/zl/100-mm dish) on NZY/Tc agar medium. Colonies are counted after 16-36 hr at 37 °, each colony representing a transducing unit (TU). Biotinylation. The following protocol is used for biotinylating antibodies and antibody Fab fragments; it may have to be modified for other ligates. The protein must be freed of primary and secondary amines, azide. and strong buffers that would prevent pH adjustment in the next step. Antibody (10-50/~g in 20/xl) is brought to pH 8-9 in a siliconized 1.5-ml microtube by adding 4.4/zl 1 M NaHCO3. Sulfosuccinimidyl-6-(biotinamido)hexanoate (NHS-LC-biotin, M r 556.6; Pierce Chemical, Rockfold, IL) is dissolved at 0.5 mg/ml (0.88 mM) in 2 mM sodium acetate buffer and 20/xl is immediately added to the antibody; the NHS-LC-biotin, which is freely water soluble because of the sulfo group, is slowly depleted by hydrolysis in aqueous solution. Coupling is allowed to progress 2 hr at room temperature, then quenched by adding 200/~1 1 M ethanolamine (pH adjusted to 9.0 with HCI) and incubating two additional hours at room temperature. Carrier protein (20/xl 50-mg/ml dialyzed BSA) is added and 2~ H. Tzagoloff and D. Pratt,
Virology 24, 372 (1964).
240
MUTAGENESIS AND GENE DISRUPTION
[].5]
the reaction mixture is diluted with 1 ml TBS and concentrated and washed twice with TBS and once with TBS/azide on a 30-kDa Centricon ultrafilter (Amicon, Danvers, MA) according to the directions of the supplier. The concentration of biotinylated antibody is calculated from the volume of the final concentrate (usually 35-50/~1), assuming no loss. Processing Small Cultures. Colonies are inoculated into 1.5 ml NZY/ Tc medium in 15-ml disposable culture tubes or in 18 x 150 mm glass culture tubes. The tubes are secured vertically in a shaker incubator and shaken vigorously at 37° for 12-24 hr. Each culture is poured into a 1.5-ml microtube and microfuged - 1 min to pellet cells; 1 ml of the culture supernatant is pipetted into a fresh microtube containing 150/xl PEG/NaC1 solution, and after thorough mixing virions are allowed to precipitate overnight in the refrigerator. Precipitated virions are collected by microfuging (15 min at - 4 ° or at room temperature) and removing all supernatant (see Removal of Supernatant, above), and dissolved in 1 ml TBS; virion concentration is - 5 x 10 u particles/ml. A sequencing template can be prepared from 200/.d of this solution. Alternatively, if phage are to be used for enzyme-linked immunosorbent assay (ELISA) they can be further purified as described in the next section. Partial Purification of Phage for ELISA. The dissolved first PEG precipitate (1 ml; see previous section) is cleared by microfuging - 1 min, and supernatant pipetted into a fresh microtube containing 150 txl PEG/NaCI solution. Phage are precipitated and collected as in the previous section, and dissolved in 110/xl unbuffered 0.15 M NaCI. The solution is cleared by microfuging - 1 min, and 100 ~1 of the supernatant is transferred to a fresh microtube containing 11 /xl 1 M acetic acid; after I0 min at room temperature and 10 min on ice, acid-precipitated virions are collected by microfuging 30 min at - 4 ° and removing all supernatant. The final virion pellet is dissolved in 500 txl TBS, giving a phage concentration of - 5 x 10u particles/ml. A sequencing template can be prepared from 200/xl of this solution. Sequencing Template. Phages (200 tzl containing -1011 particles purified by at least one PEG precipitation, as in previous two sections) are extracted once with phenol and once with chloroform in 500-tzl microtubes. The final aqueous phase (100-150 /xl) is transferred to a 1.5-ml microtube containing 250 ~1 TE and 40 ~1 3 M sodium acetate buffer (see Recipes, above), and the viral ssDNA precipitated by adding 1 ml ethanol. After at least 1 hr at 4 °, ssDNA is collected by microfuging 30 min, aspirating the supernatant, gently adding - 1 ml 70% (v/v) ethanol, and removing all supernatant; the DNA is dried briefly in vacuo, dissolved in 7.5/xl water, and stored at - 2 0 ° until use. Sequencing Reactions. We use an 18-base primer complementary to the wild-type gene III sequence 18-32 bases 3' of the cloning sites in the
[15]
LIBRARIES OF PEPTIDES DISPLAYED BY PHAGE
241
fUSE vectors. The primer is end labeled by mixing 267 ng of the 5'-OH oligonucleofide with 200/xCi [y-32p]ATP [specific activity -7000 Ci/mmol; crude preparation from ICN Biochemicals (Costa Mesa, CA) is used within - 4 weeks of reference date], 1 /zl 10 x kinase buffer, and 1 /zl T4 polynucleotide kinase, in a total volume of 10/zl in a 1.5-ml microtube; incubating at 37° for 30 min; and adding 125/zl TE and heating to 65-70 ° for 15 min to inactivate the enzyme. If sequences are to be "piggy-backed," this end-labeled primer is freed of unincorporated isotope and other impurities by adsorption to NENSORB 20 (New England Nuclear, Boston, MA), washing with adsorption buffer and water, and eluting with a 1 : 1 (v/v) ethanol-water mixture as in the supplier instructions; the radioactive fractions are dried in vacuo and dissolved in water. Water and stock solutions are added to the labeled primer (whether NENBSORB purified or not) to give final concentrations of 128 mM Tris-HC1 (pH 7.5), 160 mM NaCI, and 48 mM DL-isocitrate (pH adjusted to 7-7.5 with NaOH) in a final volume of 200-900/zl; this solution is called 2 x primer-buffer, and is stored for up to 4 weeks at - 2 0 °. Just before use, the required volume of 2 x primer-buffer is mixed with an equal volume of 16 mM MnCI 2, and 6.7 p~l of the mixture is added to sequencing template in 7.5/~1 water (previous section); after microfuging briefly to mix the solutions, the mixture is heated at 65-70 ° for 5-10 min, then allowed to cool gradually to room temperature over a period of at least 30 min; the resulting primed templates can be stored in the refrigerator or freezer for at least 4 days, during which time they turn brown without apparent ill effects. The primed template is microfuged briefly to drive condensation to the bottom, and 3-/zl droplets are deposited in a grid pattern on a polystyrene petri dish--two droplets (R and Q) per template for two-lane sequencing, four droplets (W, M, K, and S) for four-lane sequencing. Up to 40 droplets fit easily in a single 100-mm dish; it is convenient to deposit droplets to be loaded on the sequencing gel at different times on different dishes. T7 DNA polymerase (e.g., Sequenase version 1 or 2 from United States Biochemical, Cleveland, OH) is added to the appropriate volume of one of the termination mixes (diluted with termination diluent if appropriate) in a siliconized microtube to give a concentration of 0.25 units//zl; 3-/zl portions of the mixture are immediately deposited on each of the appropriate droplets on the petri dish. This process is repeated with the remaining termination mix(es), and the petri dish is floated on a 37 ° water bath for 5-10 min. Polymerization reactions are stopped by depositing a 4-/.d droplet of formamide load buffer on each droplet. The petri dish can be stored at - 2 0 ° for several days if convenient. Pouring and Running Sequencing Gels. Sequencing gels (38 cm long, 30.5 cm wide, and 0.4 mm thick) are run in a standard sequencing gel
242
MUTAGENESIS AND GENE DISRUPTION
[15]
apparatus (e.g., model $2; Bethesda Research Laboratories, Gaithersburg, MD). The short glass plate is coated twice with - 7 ml Rain-X 24 (Unelko, Scottsdale, AZ); after each coat has been applied with a Kimwipe, the reagent is allowed to dry, then the plate is wiped with 95% (v/v) ethanol and buffed with a Kimwipe. Meanwhile, the long plate is coated three times with - 6 ml bonding coat (see Recipes, above); after each coat has been applied with a Kimwipe, the reagent is allowed to dry and the plate is buffed with a Kimwipe. It is crucial not to cross-contaminate the plates. The acrylamide bonds covalently to the coated long plate, and after electrophoresis can be dried onto the glass surface without cracking. Plates are assembled into a sandwich with a spacer along the bottom as well as each side, and clamped together with clips; there is no need to seal the sandwich with tape. Sequencing gel solution (100 ml) is measured into a beaker and mixed with 1 ml 10% (w/w) freshly dissolved ammonium persulfate. A 3-ml portion is mixed with 3/xl N,N,N',N'-tetramethylethylenediamine (TEMED) in a test tube and immediately pipetted down one edge of the sandwich, which is laid flat as the gel polymerizes ( - 5 min), sealing the edges and bottom of the sandwich. Then 21 /zl TEMED is added to the remainder of the gel solution, which is mixed, poured into a 250-ml squirt bottle, and injected between the glass plates. The nonserrated eges of sharkstooth combs are inserted to create a flat surface, and the gel is polymerized 2-24 hr. The gel is assembled into the electrophoresis apparatus with sharkstooth combs, creating either forty-nine 6-mm or ninety-seven 3-mm wells, and preelectrophoresed until the surface temperature is - 5 0 °. Just before loading, the petri dish containing the reactions (previous section) is floated with its lid off on a water bath at 80-90 ° for 3 min, thus denaturing the DNA and evaporating the samples to - 4 - 5 / x l . After wells are rinsed to remove urea, samples are loaded (4 /zl/6-mm well, 2/zl/3-mm well) and the gel is electrophoresed until the xylene cyanol FF (blue-green) band has migrated 21 cm for a normal 6% (w/v) gel. On a piggy-back gel, xylene cyanol FF is run to 14 cm, then a second set of samples is loaded and run until the xylene cyanol FF from the first stample has run 24 cm. This allows reliable reading of strands from the first load with lengths between 55 and 80 bases (including the primer), without interference from primer breakdown products from the second load. This is adequate for clones from our hexapeptide epitope library, in which the 18-residue sequence encoding the variable hexapeptide corresponds to strand lengths between 61 and 78 bases. After electrophoresis, the gel, which is bonded to the long glass plate, 24 R. S. Barnett and J. N. Davidson, in " F o c u s , " (N. Sasavage, ed.) Vol. 11, p. 75. Bethesda Research Laboratories, Bethesda, Maryland, 1989.
[15]
LIBRARIES OF P E P T I D E S D I S P L A Y E D BY P H A G E
243
is washed twice with 600-1000 ml 10% (v/v) methanol, 10% (v/v) acetic acid (the second wash can serve as the first wash of the next gel), dried onto the plate (e.g., - 3 hr at room temperature under a current of air), and autoradiographed at room temperature. Overnight exposure is usually sufficient for short sequences with undiluted termination mixes; 24-48 hr usually suffices for longer sequences. After use, the long glass plate is soaked in 1 N NaOH to remove the gel and cleave off the bonding coat; the gel is scooped into radioactive waste, while the alkaline solution can be reused several times. The plate is then rinsed and recoated as described above. Making a Library
Design of Degenerate Oligonucleotide Insert Most libraries to date have used synthetic degenerate oligonucleotides as the insert. A degenerate oligonucleotide is a mixture of sequences created in a single synthesis by coupling mixtures of nucleotides, rather than single nucleotides, at selected positions in the growing chain. At the codon level degeneracy can be of two general types: fully degenerate codons encode all 20 amino acids with no bias beyond what is entailed by the unequal degeneracy of the genetic code; while doped codons are biased toward one particular amino acid in order to introduce random substitutions into a base peptide or polypeptide sequence. The first two positions of each fully degenerate codon are synthesized by adding an equimolar mixture of dA, dC, dG, and T to the growing oligonucleotide; the third position has an equal mixture of dG and T (dG and dC are also acceptable). The resulting mixture of 32 triplets encodes all 20 amino acids, and includes only the amber chain termination codon. Doped codons are synthesized by doping each nucleotide encoding the base peptide sequence with a mixture of the other three nucleotides. For instance, a nucleotide substitution rate of 30% results if, during synthesis, 60% of the nucleotide in each step is specified and 40% comes from an equimolar mixture of all four nucleotides. Whatever its design, the inserted coding sequence must fuse correctly to the coat protein reading frame at both ends of the cloning site in order to retain or restore gene function and thereby be expressed on the virion.
Construction of Library Efficient cloning of oligonucleotides with long degenerate sequences presents a special problem. Even if as few as six degenerate codons are
244
MUTAGENESIS AND GENE DISRUPTION
[15]
represented, the overall complexity exceeds that of the entire human genome, and it is not practical to create a double-stranded degenerate insert simply by annealing complementary degenerate oligonucleotides. Two ways of circumventing degeneracy have been used: polymerase chain reaction (PCR) amplification of a single-stranded degenerate oligonucleotide template with primers corresponding to nondegenerate flanking sequences3; and creation of "gapped duplexes," in which the degenerate region remains as a single-stranded gap in an otherwise double-stranded insert. 5 To synthesize a double-stranded degenerate insert by PCR, nondegenerate sequences with appropriate restriction sites are positioned on both sides of the degenerate codons in the chemically synthesized template. The template is PCR amplified using 5'-biotinylated primers corresponding to the flanking regions. A 1-ml PCR mixture containing -40 pmol template and 750 pmol of each biotinylated primer is incubated with 25 units of AmpliTaq DNA polymerase (Perkin-Elmer-Cetus, Norwalk, CT) in the buffer recommended by supplier; after five temperature cycles (2.5 min at 95°, 4 min at 42°, 4.4 min at 72°) and 5 min at 72°, polymerization is stopped by the addition of 4/A 250 mM EDTA, pH 8. The product is precipitated with ethanol and dissolved in 100/A TE and crudely quantified by gel electrophoresis next to appropriate double-stranded oligonucleotide standards. A 300-ng portion is digested in a 500-/B reaction mixture containing 1200 units of a restriction enzyme that will produce appropriate overhanging ends for splicing into linearized vector DNA. The digestion is stopped by addition of 22 /A 250 mM EDTA, pH 8, and mixed with streptavidin-agarose beads [Bethesda Research Laboratories; 200/A 50% (w/v) suspension] that have previously been washed l0 times with 0.1 M NaCl in TE by suspension and centrifugation. After 30 min of gentle agitation, the beads are centrifuged and the supernatant is removed to another tube. Beads are washed twice with 200/A water, and the supernatants are pooled with the main supernatant. The final product is extracted with phenol and chloroform, concentrated by evaporation in vacuo, and quantified roughly by gel electrophoresis. The ligation reaction contains 5 p,g/ml linearized vector DNA, a twofold molar excess of double-stranded degenerate insert, and 10 units/ml T4 DNA ligase in ligation buffer. After incubation at 20° for 12-18 hr, products are analyzed by running a 20-/A portion of the ligation mixture on a 0.8% (w/v) agarose gel containing 4 x GBB and 1.5 /xg/ml ethidium bromide. The product usually consists of a mixture of nicked circular, covalently closed circular, and residual linear RF DNA, which comigrate with linear double-stranded marker fragments of -11, - 5 , and 9.2 kbp, respectively. A good ligation produces - 2 × l07 Tcresistant transfectants per microgram vector input by electroporation.
[15]
L I B R A R I E S O F P E P T I D E S D I S P L A Y E D BY P H A G E
245
In the gapped duplex method, 5 a long degenerate oligonucleotide is annealed to two short oligonucleotides ("patches") complementary to nondegenerate regions at its 5' and 3' ends. When ligated to linearized vector DNA (essentially as described above), this gapped duplex produces transfectants at about the same frequency as do double-stranded inserts. When the degenerate region is short (e.g., six codons), most phage in a library produced by either procedure have inserts with the correct reading frame and sequence. When long degenerate sequences (e.g., 20 codons) are cloned as gapped duplexes, however, the incidence of rearranged sequences increases (J. K. Scott, unpublished observations, 1991); this problem can be at least partially ameliorated by filling in the long singlestranded gaps with DNA polymerase plus ligase. The ligation product is transfected into cells by 50-100 separate electroporations; the transfected cells are propagated in 10 to twenty l-liter flasks containing 100 ml NZY/Tc medium (5 electroporations/flask) at 37 ° with vigorous shaking for 24 hr. The cultures are pooled and the virions purified and quantified spectrophotometrically (see Large-Scale Purification of Virions, above); the concentration of infectious particles is determined by titering transducing units. Gross clonal bias and sequence abnormalities can be detected by sequencing individual clones of electroporated cells. Affinity Purification of Phage from Epitope Library
Biopanning This affinity purification technique z relies on the superstrong biotin-streptavidin reaction to attach ligate-binding phage to a solid surface (Fig. 1). Alternative techniques are discussed in the next section. Into a 60-mm polystyrene petri dish is pipetted 2 ml 0.1 M NaHCO3 ; 20 tzl 1-mg/ ml streptavidin is pipetted into the buffer, and the dish is jiggled until the entire bottom surface remains wetted. The dish is covered with the lid and kept overnight at - 4 ° in a humid chamber, preferably on a rocker. The next day the lid is discarded, the streptavidin solution is poured off, and the dish is filled with blocking solution (see Recipes, above) and rotated or rocked 1-2 hr at room temperature. The blocking solution is poured back into its container for reuse, and the dish is washed three times by filling it with TBS/Tween, pouring out the buffer, and slapping the dish on a clean paper towel (the last wash is not poured off until just before the ligate-reacted phages are added). Meanwhile, a phage mixture--typically 5 ~1 of a library--is reacted overnight with up to 1/xg biotinylated ligate (typically in 5/zl TBS/Tween) in a 1.5-ml microtube in the cold. The reaction is diluted with 1 ml TBS/
246
MUTAGENESIS AND GENE DISRUPTION
[15]
() Oligo Insert encoding epltope
q
Epltope ( ~.
Blotlnylated
antibody
Streptavldin-coated petri dish FIG. 1. Biopanning. Phages in the epitope library are represented with different oligonucleotide inserts in their DNA and the corresponding peptides displayed on pill at one tip of the virion; only one recombinant pill molecule is shown, although there are actually five per particle. Phages displaying a ligand for the biotinylated ligate (an antibody in this example) are captured on the dish by binding of the biotin moiety to immobilized streptavidin.
Tween and immediately pipetted onto the streptavidin-coated dish, which is rocked at room temperature for 10-15 min; during this incubation, phages whose displayed ligands have bound to the biotinylated ligate are in turn attached to the plastic surface via biotin-streptavidin bonds (Fig. 1). The fluid is poured out, and the plate is washed 10 times with TBS/Tween, each time rocking the dish a few minutes, decanting the wash, and slapping the dish face down on a clean paper towel to remove residual wash; the entire process takes 15-60 min. Bound phages are eluted by pipetting 800/zl of elution buffer (see Recipes, above) into the dish, rocking it 5-15 min, and pipetting the eluate into a 1.5-ml microtube containing 48/xl 2 M Tris (pH unadjusted), raising the pH of the eluate to - 8 . The first round of biopanning is critical to success. Ordinarily each clone in the original library is represented by only - I 0 0 infectious units (TU) in the initial 5-p.l aliquot. Because biopanning gives only a 1% yield with strongly binding phage, many binding clones will be represented (if at all) by a single TU. That is why a large amount of biotinylated ligate
[15]
LIBRARIES OF PEPTIDES DISPLAYED BY PHAGE
247
(1 g.g) is used in the first round, to maximize yield even at the cost of reduced discrimination. Ordinarily a single round of biopanning is not sufficient to purify binding clones from a large, complex library. Consequently, phages in the first eluate are biopanned again after amplification. Because it is important to represent as many of the phages as possible (previous paragraph), the eluate is first concentrated (and washed once or twice with TBS) on a Centricon 30-kDa ultrafilter so that the entire eluate can be amplified. The retentate ( - 5 0 tzl) is mixed with 50 /xl starved cells (usually K-91 or K-91Kan; no more than I day old; see General Procedures, above) in a sterile 15-ml tube; after 10 min at room temperature, 2 ml NZY medium containing 0.2/xl/ml Tc is added and the tube is incubated at 37 ° (with shaking if possible) for 45-60 min. The culture is then spread on ten 100-mm dishes (200/zl/dish) containing NZY/Tc agar medium and grown 24-48 hr at 37°; usually there are 500-5000 colonies per dish. The phages (along with the cells that have secreted them) are harvested from the petri dish by scraping them into a total of 30 ml TBS. The suspension is cleared by two centrifugations (5000 and 10,000 rpm, 10 min each, in Oak Ridge tubes in the Sorvall SS34 rotor), and the phages are precipitated from the cleared supernatant in an Oak Ridge tube by adding 0.15 vol of PEG/NaCI solution, mixing thoroughly by multiple inversions, and chilling in the refrigerator at least 4 hr. The precipitate is collected by centrifugation (10,000-15,000 rpm for 15 min in the Sorvall SS34 rotor), and after removing all supernatant (see Removal of Supernatant, above) the pellet is dissolved in 1 ml TBS and transferred to a 1.5-ml microtube. The phage solution is cleared by microfuging a few minutes, the supernatant is transferred to a fresh microtube, and the phages are reprecipitated by adding 150 tzl PEG/NaC1 solution, mixing thoroughly by multiple inversions, and chilling in the refrigerator at least 1 hr. The precipitate is collected by microfuging 5-10 min, all supernatant is removed, the pellet is dissolved in 100/xl TBS, and the solution is cleared by microfuging a few minutes and transferring the cleared supernatant to a fresh microtube. This amplified eluate typically has a titer of 10W 1013TU/ml; the yield is not dependent on the number of colonies per dish, as long as that number exceeds -500. A 5-/~1 portion of the amplified eluate is biopanned in the same manner as the original library. If binding clones predominate in the eluate, there can be as much as 4 pmol phage-borne ligand in 5 ~1 of amplified eluate. By using substantially less than 4 pmol ligate in the second round of biopanning, it is possible to set up a competition among binding clones, thus potentially increasing discrimination. This reduces the yield of binding clones, of course; but because 5 ~1 of amplified first eluate will contain at least 105 TU/TU in the original unamplified first eluate, high yields are
248
MUTAGENESIS AND GENE DISRUPTION
[15]
not nearly as important as in the first round of biopanning. Usually a 50/zl portion of the second eluate (unconcentrated) is amplified as described above, except that only 1 ml of NZY medium with 0.2/zg/ml Tc is added, the infected cells are grown in only five 100-mm petri dishes, and the final PEG pellet is dissolved in 50/zl TBS. Although this amplifies only 6% of the second eluate, this still represents the yield from at least 6000 TU/TU in the original unamplified first eluate. A 5-tzl portion of the amplified second eluate is then subjected to yet a third round of biopanning. The final (usually third) eluate is titered to give well-separated colonies (see titering transducing units), so that individual colonies can be propagated and analyzed (see Analysis of Affinity-Purified Phage, below).
Other Methods of Affinity Purification Two affinity matrices other than a polystyrene surface have been used for affinity purifying phage: agarose beads 1°,25 and oxirane acrylic particles. 11The agarose beads are large and have pores that are large compared to the ligate but small compared to the long dimension of the virion; it seems likely, therefore, that only a tiny fraction of immobilized ligate will be available to virions. The nature of binding to such an affinity matrix is not clear. Because the virions are presumably thin enough to partially penetrate the pores end first, for example, phage might bind a ligate just inside the interior and become "caged" in the immediate vicinity of the ligate; this could promote binding by increasing the effective off-time. The oxirane acrylic particles are small (-1/zm), hydrophilic, and nonporous; because they are not retained by any standard chromatography bed support, bound virions are separated from free virions by repeated centrifugation. Bound phages can be dissociated from immobilized ligand by means other than low pH, including competing free ligate or ligand and high pH (up to pH 11 for a few minutes). Phages are also resistant to urea (6 M for - 1 0 min, 4 M for >20 rain), sulfhydryl (e.g., 50 mM dithiothreitol), and trypsin (and probably many other specific proteases). Sometimes specific binding will be reversible, especially when the ligate is monovalent (see Discussion, below); in such circumstances binding will be manifested as delayed release even in a nondissociating wash buffer.
Quantifying Enrichment The progress of enrichment of binding clones can be followed crudely by spot-titering the input and output of the second and subsequent rounds 25 j. McCafferty, A. D. Griffiths, G. Winter, and D. J. Chiswell, Nature (London) 348, 552 (1990).
[15]
L I B R A R I E S O F P E P T I D E S D I S P L A Y E D BY P H A G E
249
of biopanning (see Titering Transducing Units, above). The input for each round is the amplified eluate from the previous round. Yields substantially in excess of 3 x 10-5%--the background yield with wild-type phage--indicate enrichment of binding clones, although the binding responsible for enrichment is not necessarily specific. Yields on the order of 1-5 x 10-4% are often associated with sequence motifs that recur regardless of ligate specificity, as will be discussed later. Yields higher than 0.01% usually (but not always) indicate the presence of a strong binding sequence motif in the phage-borne peptide. Seldom is the yield higher than - 1 % , even when ligate is in excess, and the individual clones that predominate in the input give higher yields when propagated and tested individually. Analysis of Affinity-Purified Phage Biopanning and other affinity purification techniques yield clones even when there is no specific binding of the ligate to phage-borne ligand-hence the need for independent confirmation of specific binding. The amino acid sequences of the displayed ligands (determined by sequencing the coding nucleotides in the viral DNA) are the primary and most informative data, but in many instances it is useful to supplement those data with direct binding assays, including ELISA and a miniaturized version of biopanning we call "micropanning." Analysis starts by processing small cultures of individual affinity-purified clones.
Sequencing The experimenter with many affinity-purified clones to analyze faces an unusual sequencing problem: the number of clones to process is large (we usually sequence 20 per experiment), but the number of unknown bases is small (e.g., 18 for a hexapeptide epitope library). Moreover, the penalty for mistakes is low, because little work has been invested in individual clones. The protocol described in General Procedures (see Sequencing Template, Sequencing Reactions, and Pouring and Running Sequencing Gels, above) attempts to meet this demand; its main features are (1) use of an end-labeled primer, eliminating the need for a separate "labeling" reaction for each template to be sequenced, (2) use of combinations of dideoxy terminators at different concentrations to reduce the number of lanes per template from four to two ("two-lane sequencing"), and (3) piggy-backing two sets of sequences on a single sequencing gel. The essence of two-lane sequencing is the use of termination mixes containing combinations of ddNTPs: the Q mix contains high concentrations of ddATP and ddCTP and a 10-fold lower concentration of ddCTP;
250
MUTAGENESIS::~vND GENE DISRUPTION
[15]
while the R mix contains high concentrations of ddATP and ddGTP and a 10-fold lower concentration of ddCTP. When Q and R reactions are run side by side in a sequencing gel, a strong band in both lanes signifies an A residue in the synthesized strand; a strong band in the Q lane (and no band in the R lane) signifies T; a strong band in the R lane (and no band in the Q lane) signifies G; and a weak band in both lanes signifies C. Because this method depends on reliable intensity differences, MnCI2 is substituted for MgCI2 in the buffer to reduce nonuniform incorporation of ddNTPs. 26 Two-lane sequencing works well for up to - 6 0 bases; beyond that point it becomes difficult to see the weak C bands over the entire sequence without multiple exposures of the X-ray film. For longer sequences we use four termination mixes with combinations of ddNTPs at a uniformly high concentration: mixture W has ddATP and ddTTP; M has ddATP and ddCTP; K has ddGTP and ddTTP; and S has ddGTP and ddCTP. The W, M, K, and S reactions are run in that order in the sequencing gel. Bands in both the W and M lanes signify A in the synthetic strand; bands in the W and K lanes signify T; bands in the M and S lanes signify C; and bands in the K and S lanes signify G. This system provides considerable redundancy of information (e.g., any three of the lanes contain enough information to deduce the sequence), and requires only side-by-side alignment of bands, thus greatly reducing ambiguity in ordering residues in the sequence. The concentrations of ddNTPs in the termination mixes are appropriate for sequencing up to - 6 0 bases from the primer. When longer inserts are to be sequenced, the termination mixes are diluted with termination diluent, which has no ddNTPs but contains all the other components of the termination mixes; a one-fourth dilution is suitable for sequencing up to -200 bases, and a one-eighth dilution for up to -400 bases.
ELISA and Other Binding Assays Binding of ligate to the phage-borne ligand can be demonstrated by ELISA; this serves to confirm binding in a way that is quite different from the affinity purification that isolated clones in the first place. Here we describe an ELISA in which phage themselves are immobilized in the wells of microtiter dishes. Phage are partially purified for ELISA, and 35-/zl portions containing - 2 × 101° virions are placed in microtiter wells overnight in the refrigerator; it is a good idea to include negative control phage prepared in the same way. The wells are filled with 100/xl Blotto solution (see Recipes, above), emptied by shaking out the solution and slapping the dish face down on a clean paper towel to remove 26 S. T a b o r and C. C. Richardson, Proc. Natl. Acad. Sci. U.S.A. 86, 4076 (1989).
[15]
LIBRARIES OF PEPTIDES DISPLAYED BY PHAGE
251
residual solution, refilled with 350 /zl Blotto solution, and incubated at least 90 min at room temperature to block nonspecific binding sites on the plastic surface. The wells are emptied, washed three times with TBS/ Tween, and filled with biotinylated ligate in 35/xl TBS/Tween/azide containing 1 mg/ml BSA. Biotinylated monoclonal IgG and Fab fragments are typically used at concentrations of 1 and 300 nM, respectively; other ligates may require different concentrations. After reaction for 1-24 hr at - 4 °, the wells are emptied, washed once with TBS/Tween, filled with 85 t~l avidin-peroxidase complex (see Recipes, above), and incubated at room temperature for 15-30 min. The wells are emptied, thoroughly washed 10 times with TBS/Tween, and filled with 85/~1 freshly prepared ABTS solution (see Recipes, above). The wells are then allowed to react - 1 hr at room temperature before being read on a plate reader. The difference between A405 and A495 is taken as the signal, although A405 alone serves well enough. The strongest signals amount to -0.6, while background is -0.02. Only relatively strong ligands give signals in this assay. The foregoing method requires that phages be partially purified to reduce impurities that might interfere with adsorption to the plastic or give a high background signal. Purification is a tedious undertaking when hundreds of clones are to be assayed, and in many cases it can be circumvented with the aid of an anti-phage antibody directed against the major coat protein. Labeled anti-phage antibody can be used for specific detection of phages that have bound immobilized ligate25; alternatively, immobilized anti-phage antibody can be used for specific capture of phages in order to follow their reaction with labeled ligate] 7 An attractive alternative to binding assays that use the phages themselves is chemical synthesis of the phage-borne peptides on plastic pins in a microtiter array. 28 The pin-borne peptides can be used directly in a microtiter assay that confirms binding of the ligate to the peptides in an entirely independent way.
Micropanning Micropanning is a miniaturized version of biopanning designed to test affinity purification on many individual clones] We will give here a method appropriate for confirming tight binding of an antibody to phage, then discuss modifications for detecting weak binding. To each well of a microtiter dish (e.g., Immulon-2; Dynatech, Alexandria, VA) containing 20/~10.1 M NaHCO3 is added 1/x1200/zg/ml streptavi.,7 W. J. Dower, personal c o m m u n i c a t i o n , 1991. 28 H. M. G e y s e n , Immunol. Today 6, 364 (1985).
252
MUTAGENESIS AND GENE DISRUPTION
[15]
din; the streptavidin is allowed to coat the plastic overnight in a humidified chamber in the refrigerator. Meanwhile, the wells of another microtiter dish are filled with 20/zl 0.1-1 nM biotinylated antibody in TBS/azide with 1 mg/ml dialyzed BSA, and 1/xl of each culture supernatant (typically 4.5 × l 0 7 T U ) is added to one of the wells; the reaction is allowed to proceed overnight in the refrigerator in a humidified chamber. The next day the wells of the streptavidin-coated plate are emptied, filled with blocking solution, reacted 1 hr at room temperature, and emptied and washed four times with TBS/Tween. Meanwhile, the phage-antibody reactions are diluted with 90/zl TBS/Tween and 15-/zl portions are transferred into the streptavidin-coated wells. After I0 min at room temperature the wells are emptied, washed I0 times with TBS/Tween, and eluted with 20/xl elution buffer. After 10 min at room temperature the elution buffer is neutralized by adding 140 /xl of a 69:1 (v/v) mixture of TBS and 2 M Tris (pH unadjusted). Four-microliter portions of the neutralized eluates are pipetted into the wells of a microtiter dish containing 10/~1 K-91 starved cells, and after 10 min at room temperature 336 ~1NZY medium containing 0.2/zg/ml Tc is added to each well. After incubation at 37 ° for 30-45 min, 20-/xl portions are spotted onto NZY/Tc agar medium. Strongly positive clones give >50 colonies per spot, indicating a yield of - 1 % , while negative clones give 0-1 colony per spot, possibly representing contamination from neighboring wells rather than genuine yield. This procedure can be modified at several points to detect weaker binding: (1) the phage-antibody reactions need not be diluted before the 15-/.,1 portions are pipetted into the streptavidin-coated dish; (2) eluates can be neutralized with 1.2 ~12 M Tris; (3) 20-~1 portions of the neutralized eluates can be spotted directly on an NZY/Tc agar medium that has previously been seeded with 1 ml of log-phase K-91 culture poured in - 3 ml soft agar. When weak binding is to be detected, it is also advantageous to titer dilutions of the original culture supernatants to control for variations in phage yield.
Summary of Results In this section we emphasize experiments with our hexapeptide epitope library, in which the N-terminal sequence of pIII is ADGAX6GAAGA-, X6 being the variable peptide. We have biopanned the library with at least five monoclonal antibodies (MAbs) that were known or suspected in advance to be specific for continuous peptide epitopes--that is, epitopes composed of amino acids that are contiguous in the primary sequence of the eliciting antigen. All of them identified peptide ligands with a Consensus sequence similar to that of the
[15]
LIBRARIES OF PEPTIDES DISPLAYED BY PHAGE
253
eliciting epitope. Often there were a few differences between the phageborne peptides and the eliciting epitope; but in those cases in which the specificity of the MAb had been studied independently by binding studies with synthetic peptides, the differences turned out to be mostly at positions that are tolerant of multiple substitutions. When binding of the antibody to phage has been checked by ELISA, strong binding is evident (ELISA signal, 0.3-0.6). The foregoing results contrast with those using ligates that were not known in advance to bind continuous epitopes. In Table II we summarize results of three parallel biopannings with such ligates. MAb 3-4B is a mouse monoclonal IgM that reacts with the large subunit of Caenorhabditis elegans RNA polymerase II and with a fusion protein containing 148 residues of that polypeptide] 9 Insulin normally binds a cell surface receptor, although it has also been shown to bind a hexapeptide. 3° IL-2R~ is the extracellular binding domain of the small (o0 subunit of the IL-2 receptor; it binds the polypeptide hormone IL-2 without the large subunit. 31'32 For each ligate the table shows the peptide sequences (X6) displayed by each affinity-purified clone, and the ELISA signal with each of the three ligates. As Table II shows, a single peptide sequence PTWRSM predominates among the clones affinity purified with MAb 3-4B. Phage displaying this peptide reacted weakly with the MAb (ELISA signal, 0.03), but still at least 10-fold above the background signal and all the other ELISA signals reported in Table II (0.000-0.003). The consensus peptide shows no convincing similarity to any continuous hexapeptide segment of the antigen. This contrasts with our results using antibodies specific for continuous epitopes discussed above, and raises the possibility that PTWRSM is an example of what Geysen and coUeagues 33'34 call a " m i m o t o p e " m a short peptide that mimicks the binding properties of an assembled epitope (one formed from residues distant in the primary sequence of the antigen but contiguous in its folded structure). A few other MAbs specific for assembled epitopes have identified putative mimotopes in our epitope library, ~9 j. Prenger, M. Golomb, and J. Jones, personal communication (1991). 30 V. P. Knutson, J. Biol. Chem. 263, 14146 (1988). ~ B. F. Treiger, W. J. Leonard, P. Svetlik, L. A. Rubin, D. L. Nelson, and W. C. Greene, J. lmmunol. 136, 4099 (1986). 32 j. Haikimi, C. Seals, L. E. Anderson, F. J. Podlaski, P. Lin, W. Danho, J. C. Jenson, A. Perkins, P. E. Donadio, P. C. Familletti, Y. E. Pan, W. Tsien, R. A. Chizzonite, L. Casabo, D. L. Nelson, and B. R. Cullen, J. Biol. Chem. 36, 17336 (1987). 33 H. M. Geysen, S. M. Rodda, and T. J. Mason, in "Synthetic Peptides as Antigens" (R. Porter and J. Whelan, eds.), p. 130. Wiley, New York, 1986. 34 H. M. Geysen, S. M. Rodda, and T. J. Mason, Mol. Immunol. 23, 709 (1986).
254
[15]
MUTAGENESIS AND GENE DISRUPTION T A B L E 1I RESULTS OF BIOPANNING EXPERIMENTa
E L I S A signal ( × 103) with Ligate
N u m b e r of clones
MAb3-4B
10 1 1 1 1 1 1 1 I 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 I 1 1
Insulin
IL-2Ra
X 6 sequence
PTWRSM TRMRPG VLLSVA INQVRF WCSRLF PCHCSF RGYFFK ATWAVL AVMTSS SWFLQW REWlSH YTALLI CYLCSV LFSSGK VWHLLH VPWWVP LSRILF PGHSPW WNLRSS IALMDY RAWSYV KGRYQQ EHGRPQ GCSDVL NLLSMT CLGEHD RFYGGS ILPLRI LSRSYF NLYLVH AWFRRL LRGKLS VDVGRS
M A b 3-4b
Insulin
IL-2Ra
30-33 2 1 2 2 1 0 0 0 0 0 0 - 1 1 3 0 1 1 0 0 0 1 0 - 1 - I 0 - 1 1 0 2 0 - 1 1
0-3 3 3 3 3 1 2 I 1 1 1 1 0 4 0 1 0 0 1 1 0 0 0 1 0 1 0 1 1 0 0 1 1
0-3 3 2 3 2 1 1 1 1 1 1 1 1 2 1 0 1 1 1 1 2 1 2 2 1 1 1 1 1 1 1 1 2
a The experiment is explained in text.
but most such antibodies have given results similar to those with insulin and IL-2Ra to be discussed in the next paragraph. Unlike MAb 3-4B, neither insulin nor IL-2Ra yielded affinity-purified clones with a consensus sequence; nor did any of the phages bind either ligate by ELISA (Table II). At best, therefore, these phages display weak ligands with little sequence specificity; and it is entirely possible that they
[15]
L I B R A R I E S O F P E P T I D E S D I S P L A Y E D BY P H A G E
255
represent merely the low background of nonspecific yield observed when any nonbinding phage is subjected to the biopanning procedure ( - 3 x 10-5%). These data are included here merely as an example of sequence and ELISA results we ordinarily regard as negative, and should not be overinterpreted. For instance, we did not show by any independent experiment that either biotinylated ligate retained its binding capacity. Furthermore, unlike antibodies, both these ligates are monovalent and for that reason may release even tight-binding phages during the long washes of the biopanning procedure (see Discussion, below). Two consensus sequences are observed repeatedly with a variety of antibodies and other ligates: PWflWLX (where fl is usually either A or E), and GDWVFI and related variants. Presumably, these peptides bind some component of the system other than the ligate. The binding must be weak, because the peptides never appear when strong ligands are identified with antibodies against continuous epitopes. The presence of these peptide sequences indicates that the ligate has not identified a strong ligand in the library. Although the absence of a strong ligand is presumably a necessary condition for observing these peptides, it probably is not a sufficient condition: if none of these weak ligands happens to survive the first round of biopanning, when each clone is represented by only -100 TU, it obviously cannot become a consensus sequence after further rounds. Discussion
Biopanning and Kinetics of Binding The mechanism of purifying binding phages from the library is complex. Phages are reacted with a biotinylated ligate, then the complexes are diluted, bound to streptavidin-coated plates, washed extensively, and eluted. The apparent off-rate of phage-borne peptides must be low for them to remain bound through 30-60 rain of washing. In cases where dissociation constants of free peptides were known, the off-rates of phages bearing a peptide of known sequence were orders of magnitude lower than the presumed off-rate of the corresponding free peptide. This discrepancy may be explained by assuming that the phages, which bear up to five copies of each epitope, allow multivalent binding to the antigen-binding sites on antibodies (and some receptors). This "avidity boost" would greatly reduce the apparent binding off-rate, because once binding has occurred there would be a much lower chance of both binding sites being released simultaneously. It is also possible that other factors, such as the slower diffusion rate of phage compared with free peptide, may play a role in this effect. In every case tested, when intact, bivalent antibody contin-
256
MUTAGENESIS AND GENE DISRUPTION
[15]
ues to bind phage after extensive washing, the corresponding Fab' does also; however, about a 100-fold higher concentration of Fab' is required to produce the same effect. Although this may reflect true monovalent affinity of the binding site for phage-borne ligand, it is equally possible that it is due to the presence of a small fraction of bivalent species in the Fab' preparations. If multivalency of binding sites is required for biopanning to be successful, it is not surprising that, as yet, even moderateaffinity peptides have not been identified when the hexapeptide library has been screened with monovalent ligates such as insulin and IL-2Ra (see above). The effect of valency on binding off-rate awaits testing with indisputably monovalent ligates or phage-borne epitopes.
Can Ligands Be Found for Most Binding Proteins? In the beginning we hoped the hexapeptide epitope library would contain strong ligands for virtually any binding protein. In the case of antibodies against continuous peptide epitopes this hope has been fulfilled, but as discussed above there are many ligates--particularly antibodies against assembled epitopes--for which tight ligands cannot be isolated from the hexapeptide epitope library. There are at least two possible reasons for this failure. First, some binding sites may require structural features that cannot be effectively mimicked by short peptides. Second, the particular invariant residues that flank the hexapeptide epitope in our library may be nonpermissive for binding to some ligates. These difficulties might be overcome with epitope libraries that display longer variable regions, or with "constrained" epitope libraries in which structural constraints restrict the variable residues to particular conformations. Such constraints might be imposed by disulfide bonds, or by displaying the variable residues in the context of a small structured domain fused to the coat protein (see the next section). We speculate that a limited number of structured libraries might suffice to provide strong ligands for almost any ligate.
Cloning Structured Domains A variety of small protein domains have been fused to pIII and pVIII for the purposes of making libraries and studying mutant proteins. Bass and co-workers H expressed human growth hormone (hGH) on virions using a construct in which the exposed N-terminal domain of pIII was replaced with the 191-residue hormone. The hGH-phage retained full infectivity, as no more than one of the five pIII proteins on each virion was recombinant; the remaining pIII molecules were supplied by a helper phage, and were wild type. The hGH-phage bound hGH receptor and MAbs that recognize only the native structure, showing that the fusion
[15]
LIBRARIES OF PEPTIDES DISPLAYED BY PHAGE
257
protein folded properly, and could be specifically enriched from nonrecombinant phage on hGH receptor-coated beads. McCafferty et al. z5 constructed an N-terminal pIIl fusion displaying a single-chain antibody specific for hen egg-white lysozyme. These so-called "phage antibodies" retained native specificity and could be enriched from nonrecombinant phage on lysozyme affinity columns. Parallel work by Kang et al. 12 shows that as many as 30 Fab domains can be displayed along the length of virions as fusions to the gene VIII protein; the bulk of the pVIII molecules are wild-type subunits encoded by a helper phage. These examples demonstrate that foreign domains displayed by phage can retain at least partial native folding and activity, and that phage displaying these fusion products can be selectively enriched by affinity purification. This capability suggests the feasibility of libraries in which sequence variability (ranging from a low frequency of substitutions to totally random sequences) can be targeted to specific regions in a folded protein domain. P h a g e - A n t i b o d y Libraries
Phage-antibody libraries may be seen as an extreme form of constrained epitope library. The immunoglobulin framework residues provide a rigid scaffolding for displaying six variable peptides--the so-called complementarity-determining regions (CDRs), three of which are present in both the light and heavy chain variable regions. It is the CDRs that primarily determine the binding specificity of an antibody. Different clones in the phage-antibody library would display different antibody domains with different specificities. A great diversity of specificities would be incorporated into the library as a whole, either by cloning the natural repertoire of antibody genes present in animals, or by randomizing the CDRs. An ideal phage-antibody library--not yet a reality--would include antibodies specific for any antigen. It would be manufactured on a large scale and distributed to multiple experimenters, who would use their chosen antigens to affinity purify out of the library those phage whose displayed antibody domains bind with highest affinity. Affinity might be improved by subjecting these initial clones to further rounds of random mutagenesis and selection by affinity purification. These may be the monoclonal antibodies of the future: produced without need for animals or animal cells in culture, and available to any laboratory able to carry out simple recombinant DNA techniques.
258
MUTAGENESIS AND GENE DISRUPTION
[16]
[16] U s e o f M 1 3 P i n g - P o n g V e c t o r s a n d T 4 D N A P o l y m e r a s e in O l i g o d e o x y n u c l e o t i d e - D i r e c t e d M u t a g e n e s i s B y MARY M . Y . W A V E
Introduction Oligodeoxynucleotide-directed mutagenesis has undergone rapid improvement since its introduction. 1 Although "single priming" without strand selection using a repair host strain generally gives acceptable resuits, 2,3 various methods of improving the efficiency of mutagenesis have been developed. They rely on selection against the parental template, via (1) the use of EcoK/EcoB selection, 2'4 (2) the use of nonsense c o d o n s Y (3) the use of hemimethylated D N A , 6'7 (4) the use of phosphorothioatemodified DNA, 8-1° or (5) the use of a uracil-containing parental template that is inactivated by uracil N-glycosylase. 11.12Deletion mutagenesis using oligodeoxynucleotides can be problematic without any selection. The frequency of deletion mutants can vary from 0.4 to 2 0 % . 4'13 This chapter describes a new vector, M13B119, and an improved strategy for "cyclic selection" that is especially useful for creating multiple mutations with large deletions. Another new vector, M13K119W, is also used to demonstrate how the conditions for oligodeoxynucleotide-directed mutagenesis can be optimized. For example, an improvement of 2- to 18-fold can be obtained with deletional mutagenesis using T4 DNA polymerase. However, the use of different polymerases, including T4 polymerase, Sequenase (trade name for a modified T7 DNA polymerase; United States Biot M, Smith, Annu. Rev. Genet. 19, 423 (1985). 2 p. Carter, H. Bedouelle, and G. Winter, Nucleic Acids Res. 13, 4431 (1985). 3 p. Carter, this series, Vol. 154, p. 382. 4 M. M. Y. Waye, M. E. Verhoeyen, P. T. Jones, and G. Winter, Nucleic Acids Res. 13, 8561 (1985). 5 W. Kramer, V. Drutsa, H. W. Jansen, B. Kramer, M. Pflugfelder, and H.-J. Fritz, Nucleic Acids Res. 12, 9441 (1984). 6 W. Kramer, K. Schughart, and H.-J. Fritz, Nucleic Acids Res. 10, 6475 (1982). 7 A. Marmenout, E. Remaut, J. Van Boom, and W, Fiers, Mol. Gen. Genet. 195, 126 (1984). 8 D. B. Olsen, J. R. Sayers, and F. Eckstein, this volume [13]. 9 j. W. Taylor, W. Schmidt, R. Cosstick, A. Okruszek, and F. Eckstein, Nucleic Acids Res. 13, 8749 (1985), 10j. W. Taylor, J. Ott, and F. Eckstein, Nucleic Acids Res. 13, 8765 (1985). ii T. A. Kunkel, Proc. Natl. Acad. Sci. U.S.A. 82, 488 (1985). lZ T. A. Kunkel, J. D. Roberts, and R. A. Zakour, this series, Vol. 154, p. 367. 13 V.-L. Chan and M. Smith, Nucleic Acids Res. 12, 2407 (1984).
METHODS IN ENZYMOLOGY.VOL. 217
Copyright© 1993by AcademicPress, Inc. All fightsof reproductionin any formreserved.
[16]
M13 VECTORS FOR SITE-DIRECTED MUTAGENESIS
259
chemical Corporation, Cleveland, OH), and pollk (the Klenow fragment of Escherichia coli DNA polymerase), gives similar ratios of true mutants to spurious deletional mutants. The use of higher temperature (37 or 20° instead of 15°) helps to reduce the percentage of spurious deletional mutants by approximately 10-20%.
Principles of Method
Design of Oligonucleotide Primers The design of oligonucleotide primers has been reviewed, z Competing priming sites can be avoided by comparing the proposed sequence of the oligonucleotide with that of the vector and cloned insert by using a computer program such as ANALYSEQ. ~4 Furthermore, it is necessary to ensure that the two primers do not have large regions of homology when using "coupled primer" selection. More recently, computer programs, for example, Primer Designer, GeneJockey, and Oligo have also been developed to evaluate primer designs. Primer Designer is available from Scientific and Educational Software (PA), GeneJockey is available from Biosoft (Cambridge, England), and Oligo is available from National Biosciences (Plymouth, MN).
Use of EcoK/EcoB Selection If double-stranded DNA containing an EcoK site is introduced into a K strain (rK + mK+), the DNA will be either modified if one strand is already modified or it will be restricted if neither strand is modified. ~5-17The same principles apply to EcoB sites introduced into a B strain (rB + mB+). 18 Because the M13 DNA replicates rapidly and the amount of EcoK enzyme in a bacterium is limiting, a substantial amount of DNA escapes restriction if only one copy of EcoK is used as a selection site. This problem can be overcome by using four tandem copies of the EcoK site as the selection site. 4 This chapter describes the use of new vectors with four overlapping copies of EcoB or EcoK sites so that the selection primer and the selection site can be smaller and more portable. 14 R. Staden, Nucleic Acids Res. 12, 521 (1984). 15 N. C. Kan, J. A. Lautenberger, M. H. Edgell, and C. A. Hutchison IIl, J. Mol. Biol. 130, 191 (1979). 16 p. Modrich, Q. Rev. Biophys. 12, 315 (1979). 17 R. Yuan, Annu. Rev. Biochem. 50, 285 (1981). i8 j. A. Lautenberge, M. H. Edgell, C. A. Hutchison III, and G. N. Godson, J. Mol. Biol. 131, 871 (1979).
260
MUTAGENESIS AND GENE DISRUPTION
[16]
Use of M13 Ping-Pong Vectors The technique described in this chapter is designed to increase mutant yield by selecting against progeny phage from the parental M13. One oligonucleotide is used to construct the "silent" deletion or mutation of interest and a second primer (selection primer 1) to remove a selectable marker (four overlapping copies of EcoB) in the template. These two primers are then extended by T4 DNA polymerase and the nascent strands ligated to the kinased primers. The heteroduplex DNA is then used to transfect an E. coli host strain that has the EcoB restriction enzyme so that the template strands and any progeny that copied the EcoB sites will be selected against. Only the progeny phage from which the selectable marker (four overlapping copies of EcoB) has been removed will be viable. At the same time that the first selection marker (four overlapping copies of EcoB) is removed, another selection marker (four overlapping copies of EcoK) is introduced by the first selection primer so that the process can be repeated again for constructing a second, "silent" deletion or mutation of interest. The second silent deletion will be accompanied by a second selection primer 2, which will remove a selectable marker (four overlapping copies of EcoK) from the template and add another selection marker (four overlapping copies of EcoB). Thus, multiple deletion or mutations can be constructed by cycling between these two selectable markers.
Use of Different DNA Polymerases The three different polymerases used in this study have different properties. T4 DNA polymerase has a 5' ~ 3' polymerizing activity and a 3' ~ 5'-exonuclease activity; unlike E. coli DNA polymerase, it does not have a 5' ~ 3'-exonuclease activity.19 The Klenow fragment of E. coli DNA polymerase I has a 5' ~ 3' polymerizing activity and a 3' --~ 5'-exonuclease activity, but lacks the 5' ~ 3'-exonuclease activity, z° Sequenase, which is a modified T7 DNA polymerase, has high processivity and low 3' ~ 5'-exonuclease activity. 2~ T4 DNA polymerase has been used for oligodeoxynucleotide-directed mutagenesis in preference to the Klenow fragment of E. coli DNA polymerase 1222due to its lack of strand displacement of the mutagenic primer, z3 This chapter describes the use of the EcoK/EcoB vectors in choosing between the three polymerases and in optimizing the temperature of the polymerization/ligation reaction. 19 N. G. Nossal, J. Biol. Chem. 249, 5668 (1974). 20 H. Jacobsen, H. Klenow, and K. Overgaard-Hansen, Eur. J. Biochem. 45, 623 (1974). 2l S. Tabor and C. C. Richardson, Proc. Natl. Acad. Sci. U.S.A. 84, 4767 (1987). 22 j. Geisselsoder, F. Witney, and P. Yuckenberg, BioTechniques 5, 785 (1987). 23 M. Goulian, Z. J. Lucas, and A. Kornberg, J. Biol. Chem. 243, 627 (1968).
[16]
M13
VECTORS
FOR
261
SITE-DIRECTED MUTAGENESIS
TABLE I M13 VECTORS WITH EcoK/EcoB SELECTION MARKER(S) MI3 strains MI3KI8 M13K19 M13BI8 M13BI9 M13Kll MI3K11RX M13KII9 M13BI19W MI3KII9W MI3BlI9
EcoK
EcoB
Blue/White
EcoB in II a
Ref.
---
B B
---
b b
1x
B
--
b
1x
-+ + -----
b
---4 × ovlp -4 x ovlp
B B B B W W B
1x 1x
4x 4x 4x 4x
--tdm" tdm tdm -ovlp" --
c d d d, e d, f
" EcoB in II: the presence of EcoB site in gene H of M 13; tdm, tandem; ovlp, overlapping. b p. Carter, H. Bedouelle, and G. Winter, Nucleic Acids Res. 13, 4431 (1985). ' M. M. Y. Waye, M. E. Verhoeyen, P. T. Jones, and G. Winter, Nucleic Acids Res. 13, 8561 (1985). d M. M. Y. Waye, F. Mui, and K. Wong, Technique 1, 188 (1989). e Starting clone for studies of different polymerases and polymerization/ligation temperature. Starting vector used for c-fos cyclic deletion experiments described as an example in this chapter. Materials
and Methods
Experimental Details Enzymes. T4 DNA polymerase and T4 DNA ligase are purchased from P h a r m a c i a ( P i s c a t a w a y , N J ) ; p o l I k , t h e K l e n o w f r a g m e n t o f E. coli D N A p o l y m e r a s e I, is p u r c h a s e d f r o m e i t h e r B e t h e s d a R e s e a r c h L a b o r a t o r i e s ( G a i t h e r s b u r g , M D ) o r P h a r m a c i a ; S e q u e n a s e is p u r c h a s e d f r o m U S B (United States Biochemical Corporation). B a c t e r i a l S t r a i n s a n d V e c t o r s . T h e f o l l o w i n g E. coli s t r a i n s a r e u s e d : A C 2 5 2 2 : A n E. coli s t r a i n t h a t h a s E c o B b u t n o E c o K r e s t r i c t i o n e n z y m e : B / r , H f r , sul-124 J M 1 0 1 : a n E. coli s t r a i n t h a t h a s E c o K b u t n o E c o B r e s t r i c t i o n e n z y m e 25 T G I : A n E. coli K - 1 2 s t r a i n t h a t h a s n o E c o K r e s t r i c t i o n e n z y m e 26 Vector M13K119W: Used to test the different conditions Vector M13Bl19: Used as the starting vector for the cyclic deletion e x p e r i m e n t s ( s e e T a b l e I) 24 H. Boyer, J. Bacteriol. 91, 1767 (1966). -,5 j. Messing, Recomb. DNA Tech. Bull. 2, 43 (1979). 26 T. J. Gibson, Ph.D. thesis. University of Cambridge, Cambridge, England, 1984.
262
MUTAGENESIS AND GENE DISRUPTION
[16]
Methods for mutagenesis are essentially the same as those described previously, 2'27'28 except for the following:
Hybridization 1. Anneal primer and template together in an Eppendorf tube: Kinased primer 1 (5 pmol//zl), 2/zl Kinased primer 2 (5 pmol//zl), 2 ~1 Template (1 /~g/~l), 1 /xl TM buffer (10 × ) [100 mM Tris-HC1 (pH 8.0), 100 mM MgClz], 1/zl Water, 4/zl 2. Place the tube containing the sample in a small beaker of hot water (80°), and let cool to room temperature. This will take about 30 min.
Extension/Ligation I. Add to the annealing mix: TM Buffer (I0 x ), 1 p.l rATP (5 mM), 1 /xl dNTPs (5 mM), 1 /xl Dithiothreitol (DTT) (100 mM), 1 p.l Water, 4/xl 2. Place on ice and then add T4 DNA ligase (10 U; Pharmacia) and Klenow fragment of DNA polymerase (3 U; Pharmacia). Then incubate 12-20 hr at 15° or other specified temperatures. For experiments on testing different polymerases, either Sequenase (3 U) or T4 DNA polymerase (3 U) was used instead of the Klenow fragment of DNA Polymerase, and the temperature of extension/ligation was either 15, 20, or 37°.
Results of Experiment The four times-overlapping EcoB vector was used to delete all three introns of the c-fos gene by a double-primer strategy (see Fig. 1 for a schematic diagram, Fig. 2 for the DNA sequence of the selection primers, and Fig. 3 for the polylinker region of the vector M13B 119). The following oligonucleotides were used: The 45-mer (sel 1): 5'-CCC TA(G CAC GCA CCG GTT AGT TGC ACG CAC ACG TTA GTT) TCA TTG-3' was used to construct M13K119. The nucleotides in parentheses are complementary to nucleotides that 27 W.-Y. Shen and M. M. Y. Waye, this series, Vol. 218, pp. 58-71. 28 W. Shen and M. M. Y. Waye, Gene 70, 205 (1988).
[16]
263
M13 VECTORS FOR SITE-DIRECTEDMUTAGENESIS 4X ECOB
Grow M13 c-fos in TG1 (EcoK," Ecol')
B
+ DEL #1 PRIMER + SEL #1 PRIMER (4 X ECOK ) M13 C-FOS
AC2522
ECOWECOB SELECTION
( ECOB +)
+ SEL#2 PRIMER (4 X ECOB) + DEL #3 PRIMER
B
SELECT IN JM101 ( ECOK + )
0
+ SEL #1 PRIMER ( 4 X ECOK)
K L.
+ DEL #2 PRIMER l
(9 SELECT IN AC2522 ( ECOB +)
K
i3cFosl intron -
FIG. 1. A schematic diagram of the cyclic deletion strategy using double primers and the MI3Bl19 vector. Intron 1 was removed first, followed by removal of introns 3 and 2.
h a v e four overlapping copies of the EcoK site. The deletion primer for deleting the introns were (deI1):5'-dGTCAACGCGCAGGACTTCTGCACG (deI2):5'-dAAGGTGGAACAGTTATCTCCAGAA (del3):5'-dACACTCCAAGCGGAGACAGACCAA The sequencing p r i m e r (spl) for analyzing the deletion in the first intron was 5 ' - d T C C C G T T G T G A A G A C C A .
Cloning of c-fos D N A Insert into an M13 Ping-Pong Vector M13B119. The plasmid pF4 (which has the 5.4-kb BamHI fragment of the h u m a n
264
MUTAGENESIS AND GENE DISRUPTION l E(X~ I
[16]
TGN~NNNNNNNTGCT TGANNNNNNNNTGCT TGANNNNNNNNTGCT
I
T j GANNNNNNNNTC.-,CT
M13B119 IA'I-rCCCAACCTGAAACTGACGTGCTGATGCTGATGTGCTCGTGC'I-rAAGGGGATCC 3' 56-MER ITAAGGGTTGGACTI-I'GACTGCACGACTACGACTACACGAGCACGAATTCCCCTAGG 5' # 2 51-MER Ir CTTAAGGG'I-I'ACTI-rGACTGCACGACTACGACTACACGAGCACGATCCCCT. 5' #1 45-MER & 3 ' GI'I'AC'ITI'GA'I-I"GCACACGCACGI-I'GA1-FGGCCACGCACGATCCC5' M13K119W [ 5' CAATGAAACTAACGTGTGCGTGCAACTAACCGGTGCGTGCTA~3' AACNNNNN~TGC E(X]K AACNNNNNNGTGC l AACNNNNNNGTGC
I
I'
MC,NNNNNNGT~ FIG. 2. The DNA sequence of the selection primers 1 and 2 used for the cyclic deletion strategy described in Fig. 1 and the 56-mer oligonucleotide used for constructing the vector M I3B 119. The overlapping EcoK and EcoB sites are shown below and above the primers, respectively.
c-los gene 29'3°) was obtained from N. Miyamoto (Ontario Cancer Institute, Toronto, Canada). The AurlI-NotI fragment (2.657 kb) ofpF4 was cloned into the EcoRV site of vector M 13B 119 and the orientation was confirmed by D N A sequencing using the universal priming site. The resultant clone was named M13 c-fos and single-stranded D N A template was grown in TG1 (EcoK-, EcoB-). Removal of First Intron. Both the selection primer (sel 1, a 45-mer with four copies of EcoK) and the deletion primer (del 1) were used for the mutagenesis experiment and the heteroduplex was transformed into AC2522 (EcoB +). When selection was used (by transfecting AC2522 with the heteroduplex), 28% of the transformants obtained were hybridization positive with the deletion primer and 30% of the clones sequenced were true positive. (Thus an overall percentage true positive of 28% x 30% = 8%.) However, when no selection was applied (by using either TG1 cells or by omitting the selection oligonucleotide, only 1 or 0% of overall true positive clones were obtained (see Table II and Table III). Removal of Third Intron. Both the selection primer (sel 2, a 51-mer with four copies of EcoB) and the deletion primer (del 3) were used for the mutagenesis experiment and the heteroduplex was transformed into JM101 (EcoK+). 29 T. Curran, W. P. MacConnell, F. Van Straaten, and I. M. Verma, Mol. Cell. Biol. 3, 914 (1983). 3o F. Van Straaten, R. MOiler, T. Curran, C. Van Veveren, and I. M. Verma, Proc. Natl. Acad. Sci. U.S.A. 80, 3183 (1983).
[16]
M13 VECTORS FOR SITE-DIRECTED MUTAGENESIS
lacZ ~ M T M I T ATGACCATGATT~ TACIWoG~ACTAA -
265
AccI SalI Hind II
Hind Ill
TAC~L~GATATCGAG TCTCL~ATAGCI~ Xbal EcoRV
PstI
Four EcoB sites . o . °
° . o °
° o o °
. . ° °
::: ::: ::: ::: GGTAGGAA~CmAACTGA~~YGIGCTCGTCf2AAA CF_ATCCI~~CITIW_~~CTACGACTACACGA~_ACV_~ATTT ECORI
FXa recognition site 4V---R G E I GGGC~TCCGTCGACCTA~TGGA _ T'IV_A~ CCCL~AGGCA~T C~GAGCTACCTAGGGC4X~~AAGSC~EF/;G - -~I SacI - Bar~qI SalI AccI BamHI EcoRI SmaI FspI
HgiEII
// PvuI
Bgl
Ystll
universal sequencing primer
FIG. 3. The DNA sequence of the polylinker region of the vector MI3B119. The colons above the sequence indicate the first 3 bp of the EcoB restriction sites. The dots above the sequence indicate the last 4 bp of the EcoB restriction sites.
Removal of Second Intron. Both the selection primer (sel l, a 45-mer with four copies of EcoK) and the deletion primer (del 2) were used for the mutagenesis experiment and the heteroduplex was transformed into AC2522, which is EcoB +. Conditions for the mutagenesis experiment used in deleting the introns of c-los were as previously described, 4 except that two primers were used in this study and the starting vectors were different. Test of different DNA Polymerases and Temperature of Extension/ Ligation. The phage M 1 3 K l l 9 W , which has four copies of EcoK and a
266
[16]
MUTAGENESIS AND GENE DISRUPTION
T A B L E II EFFECT OF E c o K OR E c o B SELECTION ON FREQUENCY OF HYBRIDIZATION POSITIVES a Oligo used
Results obtained with hybridization E. coli used
Deletion oligo
Selection oligo
A1 A1 A1
N u m b e r of base pairs deleted
EcoK/B
Strain
45-mer 45-mer None
EcoB +
AC2522 TG 1 TG1
753
A2 A2 A2
45-mer 45-mer None
EcoB ÷
AC2522 TG1 TG1
431
A3 A3 A3
51-mer 51-mer None
EcoK +
JM101 TG1 TGI
113
---
---
---
Number positive
Number screened
Percentage positive
Improved ratio
27 16 32
97 200 200
28 8 16
23x
65 38 37
197 200 200
33 19 19
1.7x
35 13 15
85 88 88
41 15 17
2.6x
Oligo, oligodeoxynucleotide. Improved ratios were obtained by dividing the percentrage positive of the first row by the average percentage positive of the controls (second and third rows) for each group.
white phenotype, was used for the experiments described in Figs. 4 and 5 of this study. The selection primer (a 56-mer oligonucleotide) was used to generate M13B 119, which has four overlapping copies of EcoB, using M13K119W as the template. Mutants that have lost the EcoK sites were selected by transfecting the heteroplex into JM101 cells, which have the EcoK restriction enzyme. The 56-mer deleted the four copies of EcoK while introducing the four copies of EcoB. The use of higher temperatures (37 or 20 ° instead of 15°) increases the efficiency of mutagenesis T4 DNA polymerase by 10-20% (see Fig. 4, compare bars on the left or bars on the right). In the presence of selection (i.e., by transfecting the heteroduplex in JM101), Sequenase and T4 DNA polymerase or pollk do not differ significantly in their ability to generate T A B L E III EFFECT OF E c o K OR E c o B SELECTION ON FREQUENCY OF CLONES WITH CORRECT SEQUENCE Results obtained by sequencing
Oligo used E. coli used
Deletion oligo
Selection oligo
AI A1 AI
45-met 45-mer None
EcoK/B
Strain
True positives
Spurious mutants
EcoB
AC2522 TGI TG1
3 1 0
10 7 10
---
Percentage true positives (3/10), 30% (1/7), 14% (0/10), 0%
Overall percentage true positives a (28% x 30%) = 8% (8% × 14%) = 1% (16% × 0%) = 0%
a Oligo, oligodeoxynucleotide. Overall percentage true positives are obtained by multiplying the percentage hybridization positives from Table II by the percentage true (sequenced) positives from Table III.
[16]
M I 3 VECTORS FOR SITE-DIRECTED MUTAGENESIS
267
80
6O
4o
20
0 3.25
6.25
Units of Enzyme used FIG. 4. The difference in the efficiency of mutagenesis obtained at different temperatures of incubation. Black bars, T4, 37°, JM + ; white bars, T4, 20°, JM + ; gray bars, T4, 15°, JM +.
nonspurious deletional mutants (compare the black bars in Fig. 5); in the absence of selection, T4 polymerase gives higher percentages of mutants (compare the open bars in Fig. 5). DNA sequence analysis was performed to confirm that blue plaques are bona fide mutants: 24 of 24 clones sequenced have the correct sequence, whereas white plaques have either 80
60
40
~-
20
T4 pol
Pollk
Sequenase
E n z y m e used FIG. 5. The effect of using different enzymes on the frequency of mutation, n , With selection; [], without selection. T4 pol, T4 DNA polymerase; Pollk, Klenow fragment of E. co/i DNA polymerase; Sequenase (trade name for modified T7 DNA polymerase).
268
MUTAGENESIS AND GENE DISRUPTION
[16]
shifted reading frames (15 out of 24 sequenced) or their universal priming site deleted (9 out of 24 sequenced).
Schemes 1. Synthesize the following selection primers: The 45-mer (sel 1): 5'-CCC (TA(G CAC GCA CCG GTT AGT TGC ACG CAC ACG TTA GTT) TCA TTG-3' and the 51-mer (sel 2): 5'-TCC CCT (AGC ACG AGC ACA TCA GCA TCA GCA CGT CAG TTT CA)T TGG GAA TTC-3'. Purify the primers by polyacrylamide gel electrophoresis. 2. Design and synthesize the appropriate mutagenic and sequencing oligonucleotides for analysis of the deletion junction. 3. Grow (e.g., 50/zg from 100-ml cultures) RF of M13Bl19 in TG1 cells, digest the vector DNA and also the DNA of interest, then clone the insert into any unique restriction site upstream of the EcoB selection sites of M13Bl19 (e.g., the EcoRV site). 4. Grow single-strand DNA template of the recombinant M13 in TG1 for mutagenesis (e.g., 18/xg from 6-ml cultures). 5. Kinase the deletion primer and selection primer 1. Anneal the recombinant phage DNA with the two primers, extend using T4 DNA polymerase, and ligate with T4 DNA ligase at 37°. Prepare overnight cultures of AC2522. 6. Transform AC2522 with the heteroduplex using the method of Hanahan. 3~Pick plaques and grow them on agar plates as infected colonies (the expected number of plaques is approximately 200//zg of heteroduplex transformed). Hybridize the infected colonies with 32p-labeled deletion primer 1 and plaque purify putative positive clones (optional). 7. Sequence putative positive clones (-20) with an appropriate sequencing primer. 8. Plaque purify and grow up the resultant true positive clone in AC2522 and mutagenize with the second deletion primer and selection primer 2. Prepare overnight cultures of JM 101 for Hanahan transformation the next day. 9. Repeat steps 6 to 8 to isolate and characterize any additional mutants.
Troubleshooting for Ping-Pong Mutagenesis Method Table IV lists problems, possible causes, and remedies useful in PingPong mutagenesis studies. 3I D. Hanahan, J. Mol. Biol. 166, 557 (1983).
[16]
269
M13 VECTORS FOR SITE-DIRECTED MUTAGENESIS
TABLE IV TROUBLESHOOTING FOR PING-PONG MUTAGENESIS METHOD
Problem Low number of transformants (close to background)
Possible causes Polymerase or ligase activity too low
Use flesh polymerase or ligase
Primers degraded
Use fleshly kinased primers Use lower temperature for annealing/extension and ligation reaction Repeat with gel-purified primers Use RNase or PEG ppt to purify DNA templates Redesign primers or use higher temperature for annealing/extension and ligation reaction Remove EcoK or EcoB sites by primers if possible Repeat with plaquepurified template DNA Repeat with cells whose genotype have been reconfirmed Check primers design
Primer too nonspecific
Primers impure High frequency of spurious mutants
All plaques tested were same as parent clone
No plaque observed (even in the control with no primers)
Remedy
Template has too much contaminating RNA Primer has partial homology with several positions along the template Template DNA has EcoK or EcoB sites Template is contaminated with recombinants Incorrect cell strain used
Primer used hybridized to other locations Hanahan procedure failed
Template DNA degraded
Repeat with freshly prepared competent cells Repeat with freshly prepared template DNA
Concluding Remarks F r o m t h e n u m b e r o f p o s i t i v e c l o n e s t h a t h y b r i d i z e d p o s i t i v e l y to the mutagenic oligonucleotide, we have shown that the combined use of the s e l e c t i o n w i t h f o u r c o p i e s o f E c o K / E c o B in t h e v e c t o r / p r i m e r s y s t e m i m p r o v e d the f r e q u e n c y o f h y b r i d i z a t i o n p o s i t i v e c l o n e s a p p r o x i m a t e l y t w o f o l d ( c o m p a r e r o w s 1 a n d 3, 4 a n d 6, a n d 7 a n d 9 o f T a b l e II). T h i s i m p r o v e m e n t is n o t d u e to t h e m e r e p r e s e n c e o f t w o p r i m e r s b e c a u s e t h e u s e o f t h e n o n s e l e c t i v e h o s t TG1 ( E c o K - , E c o B - ) d o e s n o t g i v e a signific a n t i n c r e a s e in t h e f r e q u e n c y o f h y b r i d i z a t i o n - p o s i t i v e c l o n e s , e v e n w i t h
270
MUTAGENESIS AND GENE DISRUPTION
[17]
double primers (compare rows 2 and 3, 5 and 6, and 8 and 9 of Table II). There is no direct relationship between the length of D N A deleted and the percentage o f positive clones obtained (Table II). When the D N A sequences o f the putative positive clones were analyzed, the improvement of the f r e q u e n c y of mutation was even more dramatic (Table III). The percentage of true positive clones as determined by sequence analysis was 30% when selection was used but no mutant was obtained without selection. This result is similar to that obtained when the M I 3 K l l R X vector, which has four tandem copies of EcoK, was used. 4 H o w e v e r , the design of this series of deletion experiments is more flexible than the previous design 4 because the four copies of the EcoK/EcoB site are adjacent to rather than inside the loop of D N A to be deleted. In summary, novel M13 cloning vectors with four overlapping copies o f EcoK (M 13K 119W) and EcoB (M 13B 119) were designed for improving the efficiency o f mutagenesis using oligodeoxynucleotides. These vectors complement the v e c t o r series with four tandem copies of EcoK, M 1 3 K l l R X , which has been shown to be useful in the generation of a series o f unidirectional deletional mutants by a mixture of oligodeoxyribonucleotides. 4,28 Furthermore, we have shown that with the combined use of T4 D N A polymerase and EcoK selection, a high efficiency of mutagenesis of up to 75% can be obtained for large deletions. Acknowledgments I thank the members of the laboratory: V. Li and F. Mui for conducting the sequence analysis, Ken Wong for help in cloning c-fos into the M13 vector. In addition, thanks go to Dr. T. Kunkel for helpful advice and Dr. J. Ferrier for reading the manuscript. K. Wong is a recipient of an MRC summer Farquharson Research Scholarship. This work is supported by a group grant from the Medical Research Council of Canada and a University of Toronto Cannanght research grant.
[17] G e n e S p l i c i n g b y O v e r l a p E x t e n s i o n
By ROBERT M. HORTON, STEFFAN N. H o , JEFFREY K. PULLEN, HENRY D. HUNT, ZELING CAI, and LARRY R. PEASE Introduction Conventional methods o f engineering recombinant D N A make use o f restriction enzymes to cut molecules apart at specific nucleotide METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
[17]
GENE SPLICING BY OVERLAP EXTENSION
271
sequences and ligases to rejoin the parts. A significant limitation of this technology is that restriction enzymes are sequence dependent and these recognition sequences appear more or less randomly in DNA. That is, restriction enzymes cut where recognition sites are located and not necessarily at optimal positions along the gene for purposes of genetic engineering. The polymerase chain reaction (PCR) has made possible a sequence-independent engineering method that we have referred to as "gene splicing by overlap extension" or " S O E . " This technology is especially useful in complicated constructions that require precise recombination points, such as joining two coding sequences in frame, and it also provides a straightforward way of performing site-directed mutagenesis. ~,2
Method The basic scheme of gene splicing by overlap extension is illustrated in Fig. 1. 3 The process requires two steps. First, the specific fragments to be joined are isolated by PCR. The ends of the amplified fragments are modified during this step so that the two fragments "overlap," or share complementary sequences on the strands to be joined. Following denaturation and reannealing, strands from the two fragments act as primers on each other. Extension of the overlap by DNA polymerase results in the recombinant product. A detailed depiction of the overlap region is shown in Fig. 2). The first step in the SOE reaction is an application of "mispriming," in which extra, unrelated sequences added to the 5' end of a PCR primer become incorporated into the end of the product. 4 It is a conventional reaction, but it uses specially designed primers. The second step (overlap extension) is as simple to carry out as the first; it just requires the two purified fragments to be put together under"PCR conditions," with buffer, dNTPs, polymerase, and thermal cycling. Only one strand from each of the original PCR products is actually incorporated into the final product. The two strands act as primers on each other to form a single fused molecule. Inclusion of PCR primers for the distal ends of each fragment allows the final product to be amplified.
1 R. M. Horton, H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease, Gene 77, 61 (1989). 2 S. N. Ho, H. D. Hunt, R. M. Horton, J. K. Pullen, and L, R. Pease, Gene 77, 51 (1989). 3 R. M. Horton, Z. Cai, S. N. Ho, and L. R. Pease, BioTechniques 8, 528 (1990). 4 K. Mullis and F. Faloona, this series, Vol. 155, p. 335.
272
MUTAGENESIS AND GENE DISRUPTION
[17]
G e n e II
PCR 2 J,~l II!11~1 U
_ _ _ J
. . . .
AP~
/
HecomDlnant proouct FIG. 1. The general concept of overlap extension. First, two PCR products are made in separate reactions; primers a and b produce product AB from gene I and primers c and d are used to amplify fragment CD from gene H. DNA segments are depicted as paired antiparallel strands. An arrowhead indicates the 5'-to-3' direction of each strand of the primers and PCR products; the ends of the template genes are not shown. Primers b and c have had sequences added to their 5' ends so that the right end of AB matches the sequence at the left end of CD. When these products are mixed in an SOE reaction, the top strand of AB "overlaps" with the bottom strand of CD, their 3' ends being oriented toward each other. This allows them to act as primers on one another to make a giant "primer dimer," which is the recombinant product. The other strands, which point in the wrong directions, do not form product and are not necessary to the reaction. (Reprinted from Horton e t al. 3 with permission from the publisher.)
GENE SPLICING BY OVERLAP EXTENSION
[17]
273
Product AD (433 bp)
~
AGAGGTCAAATTCCACC-~ TCTCCAGTTTAAGGTGG"s' +
~"AGAGGTCAAATTCCACC~ , ~
S'-TCT COAGTT T AAGGT(~:~~ , ~ " ~",,~" Product EH (581 lop)
........................
.~.:..~...~
'~
................... i
~'~ i ~
~
/~AGAGGTCAAATTCCACC.-~~ ~r'TCTCCAGTTTAAGGTO~
~'%
e
i
i ........................
~
..................
AGAGGTCAAATTCCACC~--~ J P ' ~ ~ TCTCCAGTTTAAGGT~,~ ~ 7 Reeomi~antProduct
"
X
(997 bp)
FIG. 2. Detail of ends of fragments being spliced together. In this figure, the two products being joined are AD and EH. The design of this construct is discussed elsewhere) Strands with the 5'-to-3' direction going left to right are shown in white, and the opposite strands are shown in black. The right end of AD has the same sequence as the left end of EH. When AD and EH are mixed in an SOE reaction, heated, and reannealed, the 3' end of the white strand of AD overlaps with the 3' end of the black strand from EH, Extension of this overlap by DNA polymerase creates the recombinant product.
Examples Site-Directed Mutagenesis A simple example of the use of overlap extension is for site-directed mutagenesis. As illustrated in Fig. 3, the same template is used to make both fragments AB and CD. Differences from the template sequence are introduced in the primers that generate the overlap regions in the amplified fragments generated in the primary PCR (Fig. 4A).
Splicing Genes Together An example of gene splicing by overlap extension is the construction of a chimeric class I major histocompatibility complex molecule using parts from two different members of this multigene family. The purpose was to examine the functional role of the a helices in these molecules by switching them from one molecule to the other. This construction is complex because it involves splicing together four fragments in consecutive reactions, as illustrated in Fig. 5. Notice also that the segments originated from different exons in the original templates, but that the intron has been
274
MUTAGENESIS AND GENE DISRUPTION
[17]
C
(1) ~ a~
b
(2) 1 c+~
d
AB CO (a)
~ ~ NB4.CO
. . . . .
oo...
o . . . . . e o ~ .
J
MUTANT FU~ON PRODUCT
FIG. 3. Mutagenesis by overlap extension. In simple mutagenesis, both of the products to be joined are amplified from the same template. Changes to the original sequence, represented by the black rectangle, are made by "mispriming" using primers b and c. (Reprinted from Ho e t al. 2 with permission from the publisher.)
A
5' CGGTACATGTCTGTCGGCTACGTC 5' .... GCCCCGGTACATGGAAGTCGGCTACGTC.... .... CGGGGCCATGTACCTTCAGCCGATGCAG.... 5' CGGGGCCATGTACAGACAGCCG 5'
B
template
5' TCCCTGCGGCGGCTGCGCACAGGTGC 3' 5' AGGGACGCCGCCGA 5'
FIG. 4. Examples of primers used in overlap extension reactions. (A) Site-directed mutagenesis: The relationships between the mutagenic oligonucleotides and the template are indicated. Mutations to be introduced are indicated by asterisks. (B) Gene splicing by overlap extension: The regions of the oligonucleotides that allow them to act as primers on the appropriate template are underlined. The complementary regions of overlap between the pairs of primers that allow them to be spliced together are indicated by asterisks.
[17]
GENE SPLICING BY OVERLAP EXTENSION
275
deleted in the final construct. This precise "splicing" of exon sequences is a trivial exercise using SOE, but the reader is invited to consider how difficult such a construction might be using conventional restriction enzyme methods, unless useful sites are serendipitously present at the exon boundaries. General Considerations In designing a project using SOE, it is essential to keep the strands and their orientations straight. The notation used in Figs. 1, 3, and 5 is useful in this regard. Each strand is represented by an arrow that indicates the 5'-to-3' direction. This is the direction in which DNA polymerase can extend the strand when it acts as a primer. By convention, DNA sequences are usually written out so that the reading frame of reference reads left to right, and the top strand has its 5' end at the left and its 3' end at the right. If only one strand is shown, it is assumed to be the top strand. When designing SOE primers, it is useful to write out the sequence of both strands of the recombinant product (or mutant) wanted, as in Fig. 4, and to copy the primer sequence from this. It is important to design the primers carefully because their sequences must be exactly correct. Although these words of caution may sound superfluous, it has been our experience that most errors associated with this approach occur in the planning phase. Each primer extension event requires sequence homology between the primer and the template to permit hybridization. We have empirically designed our primers to overlap with the template by approximately 16 to 20 bp. In our experience, oligonucleotides with a minimum 16-bp region of homology have consistently provided adequate amplifications. Given the decreasing cost of oligonucleotide synthesis, we have not spent significant effort in working out parameters such as the minimum number of overlapping nucleotides or the base composition of the overlapping region that is required for SOE or mutagenesis using this approach. In general, we try to avoid sequences with significant internal homology. When given the option, we choose sequences containing more or less equal amounts of all four nucleotides. An example of an overlapping region we have used successfully is shown in Fig. 4B. In the few cases in which a given oligonucleotide did not provide adequate amplification, resynthesis of the same sequence usually resulted in successful amplifications. Gene splicing by overlap extension is clearly the method of choice for certain constructs that would be difficult to carry out using conventional techniques such as restriction enzyme digestion and ligation. A common example of such a project is engineering fusion proteins, in which the reading frame and the sequence of the desired protein place rigid con-
MUTAGENESIS AND GENE
276
[17]
DISRUPTION
A exon 2
~,y
infron 2
exon 3
y....~
PCRI (1) fra~,n~ AS
.
~"I~
ePCR~(3)~-'"f fraQment ~..
..
_
c( heix
~
¢*----1""~
c( heix v . H_2Ld 81~w~lfleetrWnolleklB
t -,
'A
•
~ X
H-2K 10......... t"............... r.r........-~......... ..w.......~...w.L...*............................. ..~m.......w............ .~.....~....r.~............. .~....:~
c F'CR~(2)'"-d
g
PCR~(4)
T
h
T
. . . . . . . . . . . . . . . . . . . . . . . . . .--% ~.__
~=====================:-=============l====== ~.
fragment CO
fragment GH
B fragnmnt AB
T" . . . . . . . . . . . . . . . . . . . . . . .
fragment CD
SOEI( 1) fragm6nt EF b/c joint ..................... ~ fragment AD .::. i SOEI(3) exon 2 Z 09
a-.-~
:'::";'":;':;;;;;":;"::";;':;':;":':: I fragment GH SOE~(2) f/g joint =='=;=';;=".==='"';=;'=;='=;'"==;='='='; fragment EH exon 3
oc helix Y:mtron deleted at die joint
:::~:::::,*::7,:',::::
o¢helix ~ X
:::::::::::::::::::::::::::::::::::
e.
.e.~
g..
......
~":
':'-
~":
"' h
b
"d f Recombinant Molecule
FIG. 5. Strategy for c o n s t r u c t i n g a c o m p l e x fusion protein by splicing parts together. (A) P C R - g e n e r a t e d f r a g m e n t s . (B) S O E reactions. (Reprinted f r o m H o r t o n e t al. i with p e r m i s s i o n f r o m the publisher.)
straints on how the recombination can be made. However, SOE has certain drawbacks that make it less appealing for "ordinary" applications. First, because anything done with PCR involves in vitro synthesis of DNA (both chemical and enzymatic), there is an increased probability of errors being introduced. Thus, for many applications, especially when the product is
[17]
GENE SPLICING BY OVERLAP EXTENSION
277
to be cloned, the possibility exists that several clones may have to be sequenced to find one that is entirely correct. We have found error frequencies (i.e., the proportion of incorrect nucleotides in the final product) between 0.026 and 0.06% in overlap extension reactions using Taq DNA polymerase. ~,2 Other polymerases with lower error rates would presumably lower this frequency even further. The cloning strategy used in the examples shown here is a "cassette" approach, in which the final product is cloned into a plasmid vector in the conventional manner. Several groups have demonstrated that products can be spliced directly into vectors. 5-8 While these techniques remove some of the limitations inherent in using restriction enzymes, and may simplify and speed up the cloning process, the cassette approach has the advantage that only the cassette portion of the final construct has been subjected to DNA synthesis in vitro, limiting the amount of sequencing that must be done to be sure of having an error-free clone. Other interesting examples of this and related technologies have appeared in the literature. 9-12
Protocols
Solutions and Reagents Standard PCR buffers and conditions are suitable for SOE. Because a high [Mg z+ ] appears to lead to increased rates of misincorporation by Taq polymerase,13 it is advisable to use the lowest concentration of magnesium compatible with amplification of the specific segments of interest. Generally, a titration from 0.5 to 2.5 mM will reveal a range of [Mg 2+] that gives good amplification; working on the low end of this range should result in lower error rates. For these titrations, it is convenient to have the MgC% separate from the buffer [10 x buffer is 500 mM KC1, 100 mM Tris-HC1 (pH 8.3)]. 5 D. H. Jones and B. H. Howard, BioTechniques 8, 178 (1990). 6 A. R. Schuldiner, K. Tanner, L. A. Scott, C. A. Moore, and J. Roth, Anal. Biochem. 194, 9 (1991). 7 G. S. Sandhu and B. K. Kline, Minn. PCR Symp. abstract and poster (1991). 8 A. R. Schuldiner, L. A. Scott, and J. Roth, Nucleic Acids Res. 18, 1920 (1990). 9 G. Sarkar and S. S. Sommer, BioTechniques 8, 404 (1990). ~0R. M. Horton and L. R. Pease, in "Directed Mutagenesis: A Practical Approach" (M. J. McPherson, ed.), p. 217. IRL Press, Oxford, England, 1991. u B. Berkhout, A. Gatignol, A. B. Rabson, and K.-T. Jeang, Cell 62, 757 (1990). 12 C. Abate L. Patel, F. J. Rauscher III, and T. Curran, Science 249, 1157 (1990). 13 K. A. Eckert and T. A. Kunkel, Nucleic Acids Res. 18, 3739 (1990).
278
MUTAGENESIS AND GENE DISRUPTION
[17]
Polymerase Chain Reaction Conditions Polypropylene tubes (0.6 ml) (Robbins Scientific, Sunnyvale, CA) Native Taq DNA polymerase (Perkin-Elmer-Cetus, Norwalk, CT) Ultrapure dNTP mix (Pharmacia, Piscataway, N J) Mineral oil, light (Sigma, St. Louis, MO) DNA thermal cycler (we use a model from Perkin-Elmer Cetus); for 25 cycles: Denaturation at 94 ° for 1 min Annealing at 50 ° for 2 min Extension at 72 ° (1 to 3 min, as determined by an enzyme rate of 1000 bases/min) The shortest denaturation and annealing temperatures required will vary from instrument to instrument. Very short cycling times have been used successfully by some investigators 14
Overlap Extension 1. Amplify the intermediate products AB and CD in separate tubes: Template, 100-500 ng/100/zl Primer 1, 1/zM Primer 2, 1 IzM Buffer, 1 x Mg 2+, empirically determined dNTPs, 200/~M Taq polymerase, 0.025 U//xl Final volume, 100 tzl Mineral oil: Add 2-3 drops to assembled reaction mixtures In the first reaction, the template is gene I and the primers are a and b. This produces product AB. In the second reaction, to produce product CD, the primers are c and d, and the template is gene H. For simple sitedirected mutagenesis, both reactions use the same template. A broad range of template concentrations will work. On theoretical grounds, we recommend starting with as much as 0.5/~g of template, if possible. This reduces the number of rounds of replication required to amplify a workable amount of product. Too much template DNA can inhibit the reaction, however; for plasmids we have found that concentrations above 1 tzg/100 ~1 commonly cause inhibition. The actual number of rounds of synthesis (doublings) is not the same as the number of cycles of heating/cooling the sample has been exposed to; once the reaction reaches 14 C. T. Wittwer, G. C. Fillmore, and D. J. Garling, Anal. Biochern. 186, 328 (1990).
[17]
GENE SPLICING BY OVERLAP EXTENSION
279
a maximum, further cycling has little effect. Therefore, we have made no attempt to minimize the number of cycles, and generally let it go for 20 or 25. 2. Gel-purify products AB and CD: Fragments larger than about 300 bp can be electrophoresed through an agarose gel in TAE buffer [40 mM Tris-acetate, 1 mM ethylenediaminetetraacetic acid (EDTA), pH 8.2], then the desired band can be cut out and the DNA recovered by the glass bead elution procedure (GeneClean; Bio 101, La Jolla, CA). For small fragments, better resolution can be obtained with high-percentage agarose gels [1% (w/v) normal agarose plus 1-3% NuSieve GTG agarose (FMC BioProducts, Rockland, ME)]. Fragments smaller than about 200 bp cannot be recovered efficiently from glass beads, so an alternative procedure should be used, such as running the band into a well cut in the gel, 15adding 10/zg yeast tRNA (Bethesda Research Laboratories, Gaithersburg, MD) as a carrier, and precipitating with ethanol. 15 Other workers use less extensive purification schemes, ~6 or do not purify the intermediates at all. ~7 In our experience, gel purification of the intermediates reduces the background of unwanted side products, sometimes quite dramatically. 3. SOE fragments AB and CD: The SOE reaction is done under the same conditions as the PCRs, except that two templates are used instead of one: Template 1 (product AB), - 2 5 % of total Template 2 (product CD), - 2 5 % of total Primer 1 (primer a), 1 ~M Primer 2 (d), I /xM Buffer, 1 × Mg 2+, emperically determined dNTPs, 200/xM Taq polymerase, 0.025 U//xl Again, a wide range of template concentrations will work, but larger amounts of template theoretically will lead to lower error frequencies. We recommend using about one-fourth of the purified product from a 100-/sl reaction to permit additional reactions, should the first be unsuccessful. Although we usually use roughly equimolar amounts of the two SOE templates, this is not necessary. The reaction will work even if one template is in gross excess over the other. ~5T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982. 16 R. Higuchi, B. Krummel, and R. K. Saiki, Nucleic Acids Res. 15, 7351 (1988). 17 j. Yon and M. Fried, Nucleic Acids Res. 17, 4895 (1989).
280
MUTAGENESIS AND GENE DISRUPTION
[18]
[18] S e l e c t i o n o f O l i g o d e o x y n u c l e o t i d e - D i r e c t e d M u t a n t s By CARL A. BATT, YUNJE CHO, and ANDREW C. JAMIESON Introduction Mutational analysis has been used for many years to probe the genetic basis of a given phenotype. Prior to advances in in vitro nucleic acid enzymology this was usually accomplished by treating the targeted organism with a chemical or physical agent to enhance the rate of mutation. Depending on the particular mutagenic agent, base substitutions, deletions, or insertions could be anticipated. The challenge was then to devise a suitable screening protocol to identify mutations of interest and characterize them within the limits of the available biochemical methods. The ability to manipulate nucleic acids in vitro, coupled with techniques for precisely determining changes to a given sequence, has permitted the directed mutation of DNA. Although methodologies for chemical and random enzymatic mutagenesis have been established, where the target sequence and desired change can be defined, oligonucleotide site-directed mutagenesis is usually the method of choice. Examples of the potential of site-directed mutagenesis include probing the role of specific amino acid residues in the structure of a protein, incorporating desired restriction sites, and studying the effect of altering a nucleotide sequence on binding of a regulatory protein.
Principle of Method Oligonucleotide-mediated site-directed mutagenesis allows the selective substitution, insertion, or deletion of one or more targeted nucleotides. 1 A mutagenic primer containing the desired nucleotide sequence change is annealed to a template and the remainder of the sequence is synthesized enzymatically. For single-stranded templates (i.e., M 13mp 19) one would intuitively assume that the population of molecules recovered by transformation would be a ratio of 50 : 50, wild type : mutant. This in practice is never the case and the frequency of mutants can be as low as <0.0001%. There are a number of factors contributing to this low frequency of mutant recovery, including failure to complete second-strand I D . B o t s t e i n a n d D . S h o r t l e , Science 2 2 9 , 1193 (1985).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
[18]
OLIGONUCLEOTIDE-DIRECTED MUTANTS
281
synthesis and perhaps a biological bias against the in vitro synthesized mutant strand. Several different approaches have been developed for selective enrichment of the mutant strand either in vivo or in vitro. The basic strategy is to introduce a chemical modification that distinguishes the parental (nonmutant) strand from the mutant strand. This modification is coupled to a biological selection either in vitro or in vivo for the mutant strand and consequently to eliminate the parental strand. In one case, a mutant host strand of Escherichia coli is used to produce a parental template that is selected against during transfection into nonmutant E. coli strains. 2 The second approach to enrich for mutations involves the synthesis of the mutant strand using deoxynucleotide analogs that ensures that the mutant (but not the parental) strand is resistant to certain restriction enzymes. The parental strand is nicked and removed, using an exonuclease. An example is the incorporation of phosphorothioate into the mutant strand, which renders it resistant to cleavage by N c i I . 3'4 The protocol developed in our laboratory involves synthesizing a mutant strand that is resistant to restriction? The second strand is synthesized from a mutagenic primer using the standard deoxynucleotides, except 5-methyldeoxycytodine triphosphate (d5'-MeCTP) replaces dCTP. The d5'-MeCTP renders the mutant strand resistant to a number of restriction enzymes, including MspI and Sau3A. These enzymes share the ability to nick the nonmethylated strand of a hemimethylated DNA molecule.6 The enzyme HhaI is added to this restriction mixture because it can cleave any single-stranded (uncopied) parental template. The nicked parental strand is then removed using exonuclease III. There is no need to resynthesize the exonuclease-digested strand and regenerate a double-stranded molecule before transformation. The methylated single-stranded mutant DNA is then transformed into an E. coli m c r A B - strain. The m c r A B mutant does not restrict the d5'-MeCTP DNA as compared to other strains of E. coli. The resulting plaques (or colonies when phagemids or plasmids are used) are screened for the desired mutation by sequencing using a second primer that binds approximately 50-75 bp from the site of the mutation. Alternatively, where a restriction site is to be introduced, the replicative form is isolated and subjected to restriction analysis. 2 T. A. Kunkel, J. D. Roberts, and A. Zakour, this series, Vol. 154, p. 367. 3 K. L. Nakamaye and F. Eckstein, Nucleic Acids Res. 14, 9679 (1986). 4 j. W. Taylor, W. Schmidt, R. Cosstick, A. Okruszek, and F. Eckstein, Nucleic Acids Res. 13, 8749 (1985). 5 M. A. Vandeyar, M. P. Weiner, C. J. Hutton, and C. A. Batt, Gene 65, 129 (1988). 6 M. Nelson and M. McClelland, Nucleic Acids Res. 15 (Suppl.), r219 (1987).
282
MUTAGENESIS AND GENE DISRUPTION
[18]
Materials and Reagents
Bacterial Strains. Any one of a number ofE. coli strains that carry the mcrAB- mutation can be used, including JM2r-,5 SDM (U.S. Biochemical, Cleveland, OH), SURE (Stratagene, La Jolla, CA), DH5aMCR (BRLLife Technologies, Gaithersburg, MD), and ER1451, (available from New England BioLabs, Beverly, MA). For all strains that do not carry an F' necessary for replication of M13, an indicator strain must be used but this strain need not be a mcrAB- derivative. Primers. The synthetic oligonucleotide primers are designed to have 8-10 bp flanking the mismatched region. Routinely the primers are used directly after deprotection and do not need any further high-performance liquid chromatography (HPLC) purification. Enzymes and Reagents. The initial methodology we developed used T4 DNA polymerase (U.S. Biochemical or Pharmacia, Piscataway, N J). Subsequently, T7 DNA polymerase (native) was tested and found to be superior with respect to its rate of second-strand synthesis. Although a number of restriction enzymes will cleave the nonmethylated strand of hemimethylated DNA we routinely use MspI [Boehringer Mannheim (Indianapolis, IN), New England BioLabs, U.S. Biochemical] and IthaI to cleave any residual single-stranded template. Exonuclease III is purchased from U.S. Biochemical and d5'-MeCTP is obtained from Pharmacia.
Method The following is a detailed protocol for the individual steps in our sitedirected mutagenesis system. Each step can be carried out sequentially without any precipitation or phenol extraction between steps. The enzymes, where necessary, are heat inactivated between each step. Kinasing of Mutagenic Oligonucleotide Primer. The first step is to kinase the primer in order to permit the enzymatic extension of the nucleotide sequence. It is possible to have this step performed chemically when the primer is synthesized, obviating the need for an enzymatic phosphorylation. The reaction is carried out with 50 pmol of primer, 100 mM TrisHCI (pH 8.0), l0 mM MgCI2, ! mM ATP, using 1 unit T4 kinase in a total volume of 50/zl. The reaction is carried out at 37° for 30 rain and then the enzyme is inactivated at 70 ° for l0 min. Annealing Primer to Template. The kinased primer is then annealed to the single-stranded target. Approximately 3 pmol of kinased primer is added to 2 /zg of template DNA in 20 mM Tris-HC1 (pH 7.5), 10 mM MgCl~, 50 mM NaC1 in a total volume of 20/zl. The mixture is heated to 65 ° for 5 min and then cooled slowly to room temperature.
[18]
OLIGONUCLEOTIDE-DIRECTED MUTANTS
283
Second-Stand Synthesis. The second strand is synthesized enzymatically, during which d5'-MeCTP is incorporated. To the annealed product dATP, dGTP, dTTP, and d5'-MeCTP (prepared in Tris-HCl, pH 7.5) at a final concentration of 0.5 mM, 1 mM ATP, 2 units T4 ligase, and 5 units of T4 (or T7) DNA polymerase are added in a final volume of 50/zl. The reaction is incubated at 37° for 90 min, then at 70° for 10 min to inactivate the polymerase and ligase. Removal of Parental Strand by Restriction and Nuclease Digestion. The parental strand is removed on the basis of the ability of MspI to restrict this nonmethylated strand. To the heat-inactivated second-strand synthesis mixture I0 units HhaI and 10 units Msp! are added and the reaction incubated at 37° for 1 hr. Next, 100 units ExoIII is added and the mixture is incubated at 37° for 45 min, then inactivated at 70° for 10 min. The final reaction mixture is approximately 55/~1, depending on the unit activity of the enzymes used. Transformation. Approximately 2 ~1 of the ExoIII reaction is used without any further treatment to transform E. coli JM2r- as per standard M13 transfection protocol using calcium chloride-treated cells. 7 Competent cells can also be generated by electroporation 8 with efficiencies on the order of 103 times greater than for calcium chloride treatment. Briefly, 500 ml of L broth is inoculated and grown to a n OD600 of approximately 0.5. The cells are washed with sterile distilled water and concentrated 500fold. These cells can be stored at - 70° in 10% (v/v) glycerol and used for electroporation at 12.5 kV/cm, with a 25-/~F capacitor and a 200 f~ (ohm) in series. The electroporated cells are then incubated for 30 min at room temperature and plated in a top agar layer with an appropriate indicator strain. Again it is not necessary that the F + indicator strain be an mcrAB strain. Results. The site-direct mutagenesis protocol described here has been used to produce a considerable number of mutations containing up to four consecutive base-pair mismatches. Mutations have been recovered at frequencies ranging from 14 to 100%. Table I is a listing of the mutagenic primers and the frequency at which those mutations were recovered that has been compiled from our own laboratory in addition to others. In certain cases in which primers with wildcard codons (all 64 possible codons at the target incorporated at random during primer synthesis) have been used, not all of the expected mutations are recovered. This occurred, for example, with primer 7 T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982. 8 W. J. Dower, J. Miller, and C. W. Ragsdale, Nucleic Acids Res. 16, 6127 (1988).
284
[18]
MUTAGENESIS AND GENE DISRUPTION TABLE
I
MUTAGENIC PRIMERS, SEQUENCES, AND FREQUENCIES Primer USB 1 USB2 J 13 J 16 B L G C 121S BLGV104C B L G A 132C BLGF136A XIW49A XlW188F XlW188A XIH101Q X I H 101S XIH101N XIH271N XIT141A
Primer sequence a GGTTTTCCTTAGTCACGA GCCCAGGGTTTTCCCATGGGTCACGACGTTGTAAAA AAGCAAGTTGTGGACG GGAAGCAAGTTGTGGACGTC TGCCAGTCCCTGGTCAG AAGTACCTGT_...GCTTCTGCATG GACGAGT__.GGCCTGGAGA TGGAGAAAG___C_CCGACAAAG GGTGTCGCGTAGCAG GACCGCCTAQCAGGAC ACCGCCCGCCACGAC CCACATCTTGGAAGCAAT
CCACATCGGAGAAGCAAT ATCCACATCNNNGAAGCAATA GCGTCGCNNNGTTAGCTTC GTTGGCGCGTCCCCA
AG b -
30.4 79.7 29.3 36.8 36.2 35.9 31.0 28.6 22.7 36.6 37.4 36.6 32.6 37.6 33.0 38.9
Percentage e 79 50 50 50 d 100 14 66 66 14 e 100 80 75 40 90 f 80 g 20
o Sequence of mutagenic primer. Nucleotide(s) underlined are mismatches to targeted sequence. b kcal -+ 10%. F r o m I. T i n o c o , P. N . B o r e r , B. D. D e n g l e r , M . D . L e v i n e , O . C. Uhlenbeck, D . M . Crothers, and J. Gralla, Nature (London) New Biol. 246, 40 (1973). c Frequency of desired mutation as determined by sequence analysis. d Single-base pair deletion of mismatched T observed in 17% of the plaques. e Single-base pair deletion of mismatched C observed in 33% of the plaques. f O n l y two mutant codons, TAT and CGT, were recovered. g A total of 14 different mutant codons was recovered.
XIH101N (Table I), where only TAT and CGT, in addition to the nonmutant codon CAC, were obtained. An examination of the potential hairpin structures within the mutagenic primer revealed that TAT and CGT disrupted a potential hairpin, therefore allowing those primers to bind more efficiently. In contrast, a total of 14 different codons was obtained using the XIH271N primer. Another observation was the occurrence of single-base pair deletions (primer XIW188F and J16). In those cases the deletions occurred within the mismatch and fell at the apex of a small hairpin. In experiments in which these deletions occurred, the desired mutation was also recovered and the deletion was observed approximately 33% of the time. Predicting the appearance of these deletions is difficult because in the case of primers J13 and J16 the deletion was observed only in J16, whose sequence includes primer J13, for which no deletions were observed.
[18]
OLIGONUCLEOTIDE-DIRECTED MUTANTS
285
Conclusions
The methodology described above has been in place in our laboratory for the past 4 years. In addition to being used for substituting nucleotides, it has also proved efficient for inserting and deleting specific nucleotides (P. Flicke, personal communication, 1992). Most of the problems that we have encountered relate to the transformation frequency of the E. coli JM2r strain using calcium chloride. Therefore, we usually employ electroporation to transform this strain. (Frozen competent E. coli SDM cells are, however, available from United States Biochemical.) The selection of DNA polymerase is predicated on the absence of any strand displacement activity, which may result in the dislodging of the mutagenic primer after the first round of second-strand synthesis, leading to the synthesis of a subsequent second-strand molecule without the appropriate mutation. Although T4 DNA polymerase has proved satisfactory, efforts have indicated that the number of progeny (but not the frequency of mutations) is increased when T7 DNA polymerase is used (J. Webb, personal communication, 1990). 9 This is presumably due to the ability of T7 DNA polymerase to be highly processive, incorporating thousands of nucleotides before dissociating from the template. This ensures that the majority of the template molecules are fully copied.l° We have not exhaustively compared the performance of the enzymes (polymerases, restriction enzymes, and exonucleases) from different suppliers. The choices listed under Materials and Reagents (above) are only suggestions. Because the MspI and HhaI restrictions are carried out in the same buffer, some problems may be encountered with any given enzyme from any given supplier. We have found that the enzymes available from the suppliers cited above are compatible but that does not preclude the potential utility of enzymes from other sources. In our laboratory we have successfully obtained all site-specific substitutions attempted, although this does not imply that the methodology is infallible. Clearly, the annealing conditions described are not optimized (nor in fact modified) for each individual primer sequence. In retrospect for the case of XIH101N, a wider distribution of substitutions might have been obtained using either higher annealing temperatures or including a small concentration of formamide to reduce secondary structure. There is no obvious correlation between the AG for a given primer and the mutation frequency (Table I). In fact, for the only easily comparable case, J13 vs 9 C. A. Batt, J. Webb, P. Oren, and P. Flick, BioTechniques 9, 555 (1990). ~0 R. Lechner, M. Engler, and C. C. Richardson, J. Biol. Chem. 258, 11174 (1983).
286
MUTAGENESIS AND GENE DISRUPTION
[19]
J16, although the latter has a lower AG by 7.5 kcal, there was no difference in the frequency at which mutations were obtained. The methodology for carrying out site-directed mutagenesis has evolved greatly over the past few years. Beyond techniques based on similar methodology as described here, the most significant advance has been in the application of the polymerase chain reaction (PCR) to generate site-directed mutations. A number of protocols have been developed using either two or three oligonucleotide primers. Due to the practical limits of the PCR using Taq DNA polymerase, only a short region is amplified and then cloned into a recipient vector. One potential problem, which has not been extensively documented, is the known lack of fidelity of these thermostable DNA polymerases, especially Taq DNA polymerase, which may introduce second-site mutations in the target. Acknowledgments The authors acknowledge the contributions of Clara Finch, Jonathan Miller, Parke Flick, and Jennifer Webb for supplying data on the mutation frequencies. This work was supported by a grant from the Cornell Biotechnology Program, which is sponsored by the New York State Science and Technology Foundation, a consortium of industries, the U.S. Army Research Office, and the National Science Foundation.
[19] C h e m i c a l C l e a v a g e o f M i s m a t c h to D e t e c t M u t a t i o n s By JENNIFER A. SALEEBA and RICHARD G. H. COTTON Introduction The chemical cleavage of mismatch (CCM) method allows mutation sites to be detected in kilobase-length pieces of nucleic acids. J A screening method such as this obviates the need to sequence lengths of DNA to determine mutation sites. The method can be widely applied. It can be used to compare a clone of known or unknown sequence to samples of mutant origin, and for applications such as confirmation of in vitro mutagenesis. It has been
J R. G. H. Cotton, N. R. Rodrigues, and D. R. Campbell, Proc. Natl. Acad. Sci. U.S.A. 85, 4397 (1988).
METHODS IN ENZYMOLOGY.VOL. 217
Copyright© 1993by AcademicPress, Inc. All rightsof reproductionin any formreserved.
[19]
CHEMICAL CLEAVAGE OF MISMATCH METHOD
287
widely applied to diagnosis of human inherited disease 2-7 and to mutation detection in other organisms. 8-1°
Principle of the Chemical Cleavage Method Chemical cleavage is based on the principle that mismatched or unmatched residues are more reactive to modification by the chemicals hydroxylamine and osmium tetroxide than matched bases. This can be used to advantage for detection of point mutations and small insertions and deletions. Heteroduplex molecules can be formed by annealing a control and a test piece of DNA. Sites at which residues are mismatched or unmatched will be modified by the chemical hydroxylamine, in the case of cytosine residues, and osmium tetroxide, in the case of thymine residues. Cleavage of the DNA at the site of the modified residues is achieved by subsequent reaction with piperidine. Cleavage products are resolved by denaturing gel electrophoresis, and detection usually takes place by autoradiography (Fig. I). If necessary the exact change present in a mutant is then determined by sequencing the region identified by CCM. Mismatched or unmatched guanine and adenine residues are detected by virtue of the fact that their complementary cytosine and thymine residues are reactive. Cytosine and thymine residues surrounding mismatch sites may have a limited reactivity with hydroxylamine and osmium tetroxide, due to disruption of the helix.11 Analysis of a number of DNA fragments screened for mutations by chemical cleavage has shown that some T residues in T. G mismatches are resistant to modification by osmium tetroxide, and subsequent piperidine 2 j. F. Bateman, S. R. Lamande, H.-H. M., Dahl, D. Chan, T. Mascara, and W. G. Cole, J. Biol. Chem. 264, 10960 (1989). 3 M. Grompe, C. T. Muzny, and C. T. Caskey, Proc. Natl. Acad. Sci. U.S.A. 86, 5888 (1989). 4 A. J. Montandon, P. M. Green, F. Giannelli, and D. R. Bentley, Nucleic Acids Res, 17, 3347 (1989). 5 D. W. Howells, S. M. Forrest, H.-H. M. Dahl, and R. G. H. Cotton, Am. J. Hum. Genet. 47, 279 (1990). I. Dianzani, S, M. Forrest, C. Camaschella, G. Saglio, A. Ponzone, and R. G. H. Cotton, Am. J. Hum. Genet. 48, 631 (1991). 7 S. M. Forrest, H.-H. M. Dahl, D. W. Howells, I. Dianzani, and R. G. H. Cotton, Am. J. Hum. Genet. 49, 175 (1991). 8 R. G. H. Cotton and P. J. Wright, J. Virol. Methods 26, 67 (1989). 9 M. Han and P. W. Steinberg, Cell 63, 921 (1990). l0 M. Grompe, J. Versalovic, T. Koeuth, and J. R. Lupski, J. Bacteriol. 173, 1268 (1991). tl R. G. H. Cotton and R. D. Campbell, Nucleic Acids Res. 17, 4223 (1989).
288
MUTAGENESIS AND GENE DISRUPTION
--T --A
G C
--G ----C
[19]
C G,
I formation Heteroduplex -~C
#
G
~A
C#--'~
I Cleavage H
OT
FIG. 1. Principle behind chemical cleavage. Wild-type and mutant DNAs are heated and annealed to give heteroduplex molecules. Mismatched T resides are reactive to osmium tetroxide (*) and mismatched C residues are reactive to hydroxylamine (#). Cleavage of DNA strands occurs at these sites by reaction with piperidine. Cleavage products are resolved by denaturing gel electrophoresis, and detected by autoradiography or silver staining. A probe band in the first lane and cleavage products after reaction with hydroxylamine (H) and osmium tetroxide (0T) are indicated.
cleavage. 12 The sequence context surrounding the mismatch appears to be important in determining whether a particular T. G mismatch will be modified by osmium tetroxide. Fortunately, a heteroduplex containing a T. G mismatch is always accompanied by a complementary heteroduplex containing an A. C mismatch. An unreactive T- G mismatch can therefore be easily detected by the complementary A. C mismatch, which is highly reactive to hydroxylamine. With this approach, a strategy offering complete detection of mutations by chemical cleavage can be achieved. When using radiolabeled detection, probes are made from both test and control DNAs and used either separately or together in CCM reactions. If using 12 R. G. H. Cotton, manuscript in preparation.
[19]
CHEMICAL CLEAVAGE OF M1SMATCH METHOD
289
a nonradioactive mode, where all DNA is detected, one set of CCM reactions will allow all mutations to be identified. Internally and end-radiolabeled probes and unlabeled DNA may be used to detect cleavage products in CCM. End-labeled probes will be cleaved to reveal one detectable cleavage product for each mutation. This type of probe is best applied to examples in which a number of mutations are expected. If the exact position of the mutation must be known, a single strand should be labeled. Internally radiolabeled probes will give two cleavage products per mutation. These probes are easy to prepare and are therefore well suited to mutation detection in a number of samples in which few or no mutations are expected. Radiolabeled probes made from control and test DNAs must be included either together in one experiment, or separately in a series of experiments, to ensure detection of any unreactive T. G mismatches by their complementary A. C mismatch and completely screen a region of DNA for mutations. Unlabeled DNA may also be used, in which case cleavage products can be detected by methods such as silver staining. All DNA is identified in experiments performed in this way, and therefore complete mutation screening is assured. A variety of nucleic acid templates may be used in chemical cleavage. Cloned fragments, polymerase chain reaction (PCR)-amplified fragments, cDNA, and RNA have all been successfully applied to the identification of mutations.
Materials and Reagents Annealing buffer (2 x ): 1.2 M NaCI, 12 mM Tris-HCl (pH 7.5), 14 mM MgCi2; store at room temperature Formamide annealing buffer: 80% formamide, 40 mM piperazine-N, N'bis(2-ethanesulfonic acid) (PIPES) (pH 6.4), 1 mM ethylenediaminetetraacetic acid (EDTA), 0.4 M NaC1; store at - 2 0 ° Hydroxylamine solution: Dissolve 1.39 g hydroxylamine hydrochloride or hydroxylammonium chloride (BDH, Poole, England) in 1.6 ml warm distilled HEO in glass. Add 1.75 ml diethylamine dropwise. Final pH should be 6.0. Store at 4° for up to 2 months Osmium tetroxide buffer (10x): 100 mM Tris-HCl (pH 7.7), I0 mM EDTA, 15% (v/v) pyridine (Sigma, St. Louis, MO); store at -20°C Osmium tetroxide solution: Dissolve contents of a 0.5-g ampoule of osmium tetroxide (Johnson Matthey, Herts, England or Aldrich, Milwaukee, WI) in 12.5 ml distilled H20 in a glass container (not plastic). Stand at room temperature 2-3 days until dissolved. Store well sealed at 4° for up to 3 months. The solution is diluted (1 part in 5 parts)just before use. Should be used in a fume hood
290
MUTAGENESIS AND GENE DISRUPTION
[19]
HOT stop: 0.3 M sodium acetate (pH 5.2), 0.1 mM EDTA, 25/zg/ml tRNA; store at - 2 0 ° Piperidine: Store at room temperature; 10 M stock (Fluka, Ronkonkoma, NY) is diluted (1 part in 10 parts) before use. Should be used in a fume hood Formamide dye: 90% formamide, 20 mM EDTA, 0.3 mg/ml xylene cyanol, 0.3 mg/ml bromphenol blue; store at - 2 0 ° Acryl/bisacrylamide denaturing gels (8%, w/v): 21 g urea, 10 ml 5 × TBE buffer, 40% acrylamide, distilled H20 to 50 ml. Add 250/zl 10% (w/v) ammonium persulfate and 100/zl N,N,N',N'-tetramethylethylenediamine (TEMED) to set the gel TBE buffer (5 × ): 0.45 M Tris, 0.45 M boric acid, 40 mM EDTA; adjust pH to 8.3 with NaOH Acrylamide (40%, w/v): Make 38 g acrylamide and 2 g N,N'-methylenebisacrylamide up to 100 ml in distilled H20. Deionize by mixing with Bio-Rad (Richmond, CA) analytical-grade mixed bed resin AG501X8(D) 20-50 mesh Bind silane solution: Bring 1 liter distilled H20 to pH 3.5 with acetic acid; add 4 ml Bind Silane (LKB, Rockville, MD) and stir for 15 min Silver staining fixing solution: 10% (v/v) ethanol, 5% (v/v) acetic acid; store at room temperature Silver staining solution: 0.011 mol/liter AgNO3 in distilled H20; make fresh Silver staining developer: 0.75 tool/liter NaOH, 0.1 mol/liter formaldehyde solution, 0.0023 mol/liter sodium borohydride; make fresh Silver staining stop solution: 5% (v/v) acetic acid; store at room temperature Methods
General Method Gel Purification for Probe Preparation. Probes may be gel purified from agarose by dialysis 13 or from a 4% (w/v) nondenaturing acrylamide gel, extracting the DNA by soaking the gel slice in 0.6 M sodium acetate overnight. This allows probe fragments to be separated from contaminants, such as PCR artifacts from PCR-amplified probes, other digestion products from probes made by digestion of larger pieces of DNA, and unincorporated nucleotides from labeled probes. 13 j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989.
[19]
CHEMICAL CLEAVAGE OF MISMATCH METHOD
291
DNA-DNA Duplex Formation. Mix test and control DNAs in equal proportions in 1 x annealing buffer to a final volume from 100 to 400/xl for heteroduplex samples. Homoduplex samples are made using one DNA sample only. Cap the tubes with punctured lids. Incubate in a boiling water bath for 5 min, then quench on ice. Briefly centrifuge the tubes to return water drops to the sample volume. Replace the pierced caps with complete caps and incubate at 42 ° for 1 hr. Place the samples on ice. Ethanol precipitate with 0.3 M sodium acetate (pH 5.3) and 70% (v/v) ethanol. Precipitate the DNA at - 20 ° for 30 min, then centrifuge in a microcentrifuge 13,000 rpm at 4 ° for 15-30 min. Wash the samples with ice-cold 70% (v/v) ethanol. Remove all ethanol drops and air dry the pellets for a few minutes. Resuspend the pellets in distilled H=O. Duplex formation is not necessary if the DNA is PCR amplified because heteroduplex molecules will form during the PCR reaction. 14When heteroduplexes are required between a test and a control DNA, the PCR amplification is performed with both DNA samples in one reaction. Hydroxylamine Modification. Mix 6/xl of duplex with 20/zl hydroxylamine solution. It may be necessary to dissolve the crystals in the hydroxylamine solution at 37 ° before adding it to the DNA samples to begin the reaction. Incubate the samples at 37° for up to 3 hr. (Typical time points are 0 min, 30 min, 1 hr, 2 hr, and 3 hr.) The reaction is stopped by the addition of 200/xl HOT stop and 750/zl ethanol. Precipitate the DNA at - 2 0 ° for 30 rain, spin 13,000 rpm at 4° 15-30 min, and wash pellets in icecold 70% (v/v) ethanol. Air dry pellets for a minute. A time course may be performed in pilot work to identify the best reaction conditions. A zero time point should be included by adding HOT stop before adding the hydroxylamine solution. Homozygous control samples should be included in chemical cleavage experiments. Any banding pattern produced can be assigned as background when these control lanes are compared with heteroduplex samples in which mutations are detected. Osmium Tetroxide Modification. Add 2.5 /xl 10 × osmium tetroxide buffer to 6/zl of duplex samples. Add 15 /xl of freshly diluted osmium tetroxide solution to start the reaction. Mix gently with a pipette tip. A yellow precipitate may form. Incubate samples for up to 5 min at 37°. (Typical time points are 0, 1, and 5 min but may be up to 60 rain in some cases.) Stop the reaction with HOT stop and 70% (v/v) ethanol and precipitate the DNA as described for hydroxylamine reactions. Piperidine Cleavage. Resuspend dry pellets in 50/zl of freshly diluted piperidine. Incubate the samples at 90 ° for 30 rain. Transfer the tubes to 14 C. M. N a g a m i n e , K. C h a n , and Y. F. Lau, A m . J. Hum. Genet. 45, 337 (1989).
292
MUTAGENESIS AND GENE DISRUPTION
[19]
ice. Add 50/zl 0.6 M sodium acetate (pH 5.2), 40/zg glycogen, and 300/zl ethanol. Precipitate the DNA as described for hydroxylamine reactions. Resuspend the samples in 5/zl distilled HzO. Add 2/~1 formamide dye. Electrophoresis. Denature the samples at 95 ° for a few minutes or until the sample volume has decreased to 3-4/zl. Quench the tubes on ice. Run the samples alongside size markers on denaturing acrylamide gels [4-8% (w/v) acrylamide] prewarmed to approximately 50 °. After electrophoresis, dry the gels on Whatman (Clifton, N J) 3MM paper. Autoradiography. Dried gels are placed directly against X-ray film. Initial exposures of 10-16 hr are performed, followed by longer exposures as necessary.
Variations of Method
32p Mode. End labeled or internally radiolabeled [32p]dNTP probes may be used in CCM (refs. 3 and 7, respectively); 6000 disintegrations per minute (dpm) of probe is used in each hydroxylamine or osmium tetroxide reaction. Probes up to 2 kb have been used (Fig. 2). 35S Mode. 35S-Labeled dATP probes may also be used in CCM. In this case 50,000 cpm is used per hydroxylamine or osmium tetroxide reaction. 35S-Labeled probes can give better resolution of larger cleavage products. J5 Probes of sufficiently high specific activity can be difficult to obtain with some DNA samples. Probes of up to 2 kb have been used. Unlabeled Mode. Unlabeled DNA may be screened by CCM. Cleavage products are detected by silver staining. This mode of CCM has the advantage of not requiring use of radioisotopes, but is less sensitive than radiolabeled methods in the detection of multiple cleavage products. Cleavage products from 50 to 550 bp can be detected and DNA fragments of up to 600 bp may be screened for mutations. Fifty nanograms of test and 50 ng of control DNA are used to form heteroduplexes and 100 ng of DNA is used to form homoduplexes. 16Reactions are carried out as outlined in the general method. Acrylamide gels are adhered to gel plates to facilitate staining. Before gels are poured the glass plate is soaked in bind silane solution for 1 hr. The plate is rinsed in clean water and air dried. The gels are then poured as usual. After electrophoresis the gel adhered to a glass plate is briefly rinsed in distilled H20, followed by treatment in fixing solution for 30 min. The gel is rinsed in distilled HzO, then soaked for 2 hr in staining solution. Two brief rinses in distilled H20 follow, then 10-20 min in developer. The gel 15 j. A. Saleeba and R. G. H. Cotton, Nucleic Acids Res. 19, 1712 (1991). 16 S. J. R a m o s and R. G. H. Cotton, Hum. Murat. 1, 63 (1992).
[19]
CHEMICAL CLEAVAGE OF MISMATCH METHOD
293
CONTROL MUTANT H O H O 10 60 1 5 10 60 1 5
425 bp 295 bp
t
1
245 bp
I Q
O
-~-- 115 bp
FIG. 2. Autoradiograph showing mutation detection by chemical cleavage using a [32p] dCTP-labeled probe. The control lanes show homoduplex DNA. No cleavage products are seen after reaction with hydroxylamine for 10 or 60 min, or with osmium tetroxide for I or 5 min. Cleavage products are seen with mutant heteroduplex DNA. Hydroxylamine (H) reaction gives products of 295 and 245 bp. Osmium tetroxide (O) reaction gives products of 425, 295, 245, and 115 bp. (Autoradiograph courtesy of S. M. Forrest of the Murdoch Institute.)
is then stored in stop solution. All incubations are performed with gentle rocking. DNA-RNA Duplexes. A useful adaption of CCM allows DNA-RNA duplexes to be screened for mutation sites.17 In this case 5-10/zg of total RNA or 1 /zg poly(A) RNA is annealed with 5 ng probe DNA. Duplexes are formed by mixing DNA and RNA in 1 x formamide annealing buffer, i7 H.-H. M. Dahl, S. R. Lamande, R. G. H. Cotton, and J. F. Bateman, Anal. Biochem. 183, 263 (1989).
294
MUTAGENESIS AND GENE DISRUPTION
[19]
incubating at 80 ° for 5 min, then at 48 ° for 1 hr. Samples are then precipitated and reactions are performed as described in the general method. Hybond Method. Gogos et al. 18have published an adaptation of CCM whereby probe DNA is hybridized to DNA applied to a membrane. This allows time-consuming ethanol precipitation steps to be simplified. DNA is transferred from one reaction to the next by lifting the membrane between tubes.
Concluding Remarks and Discussion of Problems The CCM method is based on chemical and not enzymatic reactions, and therefore the problems often encountered in molecular biology, for example enzyme reactions that are sensitive to contaminants such as those present in some DNA preparations, do not occur here. However, care must be taken with CCM in correct solution preparation. Overreaction by piperidine is sometimes seen in chemical cleavage. This is indicated by the presence of a ladder of cleavage products at each base position. Repeat the reaction with reduced piperidine reaction time, and check that the piperidine stock is diluted 1 in 10 before use. Lack of mutation detection may be due to a failure to form heteroduplex molecules. Heteroduplexes may be destroyed after formation by heating samples to dissolve DNA pellets. Alternatively, a lack of reaction may be due to aging chemical solutions. These should be remade. Lack of hydroxylamine and osmium tetroxide modification of mismatches is identified by failure of the probe to decrease in intensity with increased incubation time in the presence of these chemicals. In the case of diploid organisms, heteroduplex molecules will be formed if selfoDNA is heated and annealed, when a heterozygous mutation is present. The mutation can then be identified by CCM. If a homozygous mutation is present, CCM with self-DNA will not identify the mutation. In this way heterozygous and homozygous mutations can be distinguished. ~9 Screening more than 2-kb stretches of DNA for mutations may require that a series of probes be designed. These should be arranged so that each probe will overlap neighboring probes by 20-30 bp. Mutations at the ends of probes may be missed by CCM because breathing of the duplex can occur at fragment ends. H Probes obtained by PCR amplification will also Is j. A. Gogos, M. Karayiorgou, H. Aburatani, and F. C. Kafatos, Nucleic Acids Res. 18, 6807 (1990). ~9 I. Dianzani, S. M. Forrest, C. Camaschella, E. Gottardi, and R. G. H. Cotton, Am. J. Hum. Genet. 48, 423 (1991).
[20]
RAPID INTRODUCTION OF RESTRICTION SITES
295
lead to mutations being missed at the ends of probe fragments because regions covered by primers will have primer sequence and not the sequence of mutations, if they were originally present at those sites before amplification. In conclusion, chemical cleavage offers a reliable screening method for mutation detection.
[20] I n t r o d u c i n g R e s t r i c t i o n Sites i n t o D o u b l e - S t r a n d e d Plasmid DNA
By
D A V I D C . K A S L O W a n d DAVID J. RAWLINGS
General Introduction Double-stranded DNA plasmids are the workhorses of molecular biology, especially for cloning foreign genes and expressing recombinant protein. Although a number of pBR322/pUC-derived plasmids now contain a large choice of restriction enzyme sites, many of the specialized vectors for prokaryotic or eukaryotic expression have only a few restriction sites in the cloning area. Oftentimes these sites are incompatible with the fragment to be cloned, or in a case such as ours, a blunt end site and a site for an enzyme that cuts infrequently in the target DNA are not present but are required for high-efficiency blunt end ligation.t The classical approach to introducing new restriction sites is to construct a pair of synthetic oligonucleotides that anneal to one another to yield a double-stranded product that contains single-stranded overhangs at each end complementary to the restriction sites in the vector. This approach is necessary if the restriction site(s) in the vector produce two 5' overhangs, two 3' overhangs, or if one of the sites is blunt ended, if, on the other hand, one of the sites results in a 5' overhang, and the other site has a 3' overhang, then conceivably a single-stranded oligonucleotide could anneal to each end (Fig. 1). This would leave a single-stranded gap in the plasmid that on transformation is filled in by host (bacterial) DNA repair mechanisms. Principle of Method The following is a rapid method for introducing new restriction enzyme sites or any short DNA sequence of choice into virtually any doublei p. Upcroft and A. Healey, Gene 51, 69 (1987).
METHODS IN ENZYMOLOGY,VOL. 217
296
MUTAGENESIS AND GENE DISRUPTION
[20]
A 5 'P- IGATCCCGCGGAGATCTATCGATCTGCA 13 '
3 ' IAGCT
B 123456M
m
I
il
II
FIG. 1. (A) Schematic depiction of the introduction of a single-stranded oligonucleotide into a double-stranded plasmid. Shown are the complete nucleotide sequence of kinased 27mer (box), protruding single-stranded ends of BamHI/PstI-digested pUC19 (open ended boxes), new Bglll site in 27-mer (bold), and 5' phosphate removed from protruding 5' end of plasmid by bacterial alkaline phosphatase (italics). (B) Ethidium bromide-stained 1% (w/ v) agarose-TAE gel. BgllI digest of plasmid DNA from nonhybridizing colony (lane 1) and hybridizing colonies (lanes 2-6) of colony lift probed with 27-mer (Table I). M, Molecular weight markers; CC, closed circular (uncut); L, linear (single cut).
stranded plasmid containing at least one site that produces a 5' overhang and one that produces a 3' overhang. A single-stranded synthetic oligonucleotide containing the new restriction sites is constructed such that one end contains the complementary sequence to the 5' overhang and the other end contains the complementary sequence to the 3' overhang (Fig. 1). As each end of the single-stranded oligonucleotide can anneal to a complementary sequence in the plasmid, the cost and time of producing a second oligonucleotide are avoided. Since first describing this method, 2 we have found that dephosphorylating the 5' overhang in the vector increases the relative efficiency of 2 D. C. Kaslow and D. J. Rawlings, Nucleic Acids Res. 17, 10135 (1989).
[20l
RAPID INTRODUCTION OF RESTRICTION SITES
297
the technique by reducing the background, that is, absolute number of nonrecombinant clones. This background is due to the presence of (1) uncut vector, (2) religation of the vector digested with only the 3' overhang restriction enzyme or with only the 5' overhang restriction enzyme (incomplete digestion by the other restriction enzyme), or (3) intramolecular ligation of the vector by the 5' overhang ligating with the 3' overhang to yield a single-stranded blunt end ligation product. Based on the requirement for a 5'-phosphate for efficient ligation, we reasoned that the latter two undesired products could be significantly decreased by removing the 5'-phosphate present on the 5' overhang (Fig. 1A, italics) of the vector. We further reasoned that because Escherichia coli alkaline phosphatase preferentially hydrolyzes the 5'phosphate from protruding 5' ends of double-stranded DNA at 37 ° but inefficiently removes the 5'-phosphate from recessed 5' ends at that temperature (temperature optimum for blunt or recessed 5' ends is 60°), 3 bacterial alkaline phosphatase (BAP) treatment of the doubly digested vector would mainly result in dephosphorylation of the unused 5' overhang (Fig. 1A, italics). Experimentally, we find that BAP treatment of the doubly digested vector reduces the number of nonrecombinant plasmids in the ligation. Materials, Reagents, and Their Use Oligonucleotides: 5'-GATCCTGCA-3' (9-mer), 5'-CGATGTCGACC GC-Y (13-mer), 5'-CGATGTCGACTGCA-3' (14-mer), 5'-GATC CATCGATCTGCA-Y (16-mer), 5'-GATCCCGCGGAGATCTATC GATCTGCA-3' (27-mer), 5'-GATCCGCGCGCGGCCGCGATAT CGCAGCTGAAGCTTGCA-3' (39-mer, nucleotides annealing to vector in bold). Following synthesis on an Applied Biosystems (Foster City, CA) DNA synthesizer, the oligonucleotides were cleaved from the resin in 1 ml of concentrated ammonium hydroxide by incubation at room temperature for I hr, deprotected by incubation for 4 to 24 hr at 55 °, and lyophilized in a speed vacuum centrifuge. The resulting crude oligonucleotides were resuspended in 1 x TE [10 mM Tris-HCl (pH 8.0), 1 mM ethylenediaminetetraacetic acid (EDTA)] to a final concentration of 1.5/~g/ml, as determined by absorbance at 260 nm, and used without any further purification Vector DNA: pUC19 supercoiled DNA was prepared from saturated cultures of transformed DH10B E. coli by the Qiagen (Qiagen, Inc., Chatsworth, CA) method, and resuspended in 1 x TE at a final concentration of 1 /xg/~l 3 F. Cobianchi and S. H. Wilson, this series, Vol. 152, p, 99.
298
MUTAGENESIS AND GENE DISRUPTION
[20]
T4 Polynucleotide kinase, 5 x forward reaction buffer: 300 mM TrisHC1 (pH 7.5), 75 mM 2-mercaptoethanol, 50 mM MgCI2, 1.65/zM ATP T4 DNA ligase, 5 x ligase buffer: 0.25 M Tris-HCl (pH 7.6), 50 mM MgCI 2 , 5 mM ATP, 5 mM dithiothreitol (DTT), 25% (w/v) polyethylene glycol (PEG) 8000 Restriction enzymes and buffers: Purchased from Bethesda Research Laboratories (Gaithersburg, MD) Electroporation competent cells: Electrocompetent DH10B E. coli cells can be purchased (Bethesda Research Laboratories) or prepared as follows (Dr. J. Jessee, personal communication, 1992). Host bacterial cells, such as DH10B, are grown to saturation overnight in 5 ml of LB broth at 37°. One milliliter of the overnight growth is diluted with 100 ml of SOB [2% (w/v) tryptone (Difco, Detroit, MI), 0.5% (w/v) yeast extract (Difco), 10 mM NaCI] and allowed to grow at 37° to midto late log phase (OD600 of 0.5 to 0.8). The bacterial pellet collected by centrifugation at 3000 g for 15 min is washed twice in 100 ml of 10% (v/v) glycerol in high-performance liquid chromatography (HPLC)-grade water (the water used in this wash must be of the highest puritymwe use Baxter HPLC water, Baxter Healthcare Corp., Muskegon, MI). The final pellet is resuspended in 10% (v/v) glycerol in HPLC-grade water to an optical density at 600 nm of 250, and stored at - 7 0 ° in 25-t~1 aliquots. The diluted ligation mix (see below) is added to 20 t~l of electrocompetent cells that have been thawed on ice. The transformation mix is transferred to a 0.1-mm cuvette (Bio-Rad, Richmond, CA) and electroporated at 1.8 mV, 25 /zF, 200 1~ (Bio-Rad). The sample is immediately transferred to 1 ml of SOC [2% (w/v) tryptone (Difco), 0.5% (w/v) yeast extract (Difco), 10 mM NaCI, 2.5 mM KC1, 10 mM MgC12, 10 mM MgSO 4, 20 mM glucose], and then incubated for 1 hr at 37°. One, 10, 100, and 400 tzl of the medium are plated onto LB agar-ampicillin (50/zg/ml) plates, and incubated overnight at 37° Filters for hybridization: Bacterial colonies on LB agar-ampicillin plates are transferred to nylon membranes by placing the dry, sterile filters directly on the plates. The filters are punctured asymmetrically with a 23-gauge needle, then transferred from the plates to 1-ml pools of denaturing buffer (0.5 N NaOH, 1.5 M NaC1) on plastic wrap. After denaturation for several minutes, the filters are briefly air dried on Whatman (Clifton, N J) paper. The denaturation process is repeated twice again. The filters are placed in 1-ml pools of neutralizing buffer (1 M ammonium acetate, 20 mN NaOH) for several minutes, baked for 30-60 min at 80 °, washed [6 × SSC (1 × SSC is 0.15 M NaC1, 0.015 M sodium citrate), 1.0% (w/v) sodium dodecyl sulfate (SDS)] for four
[20]
RAPID INTRODUCTION OF RESTRICTION SITES
299
or more hours at 65 °, and then prehybridized [6 × SSC, 0.5% (w/v) SDS, 0.2% (w/v) polyvinylpyrrolidone, 0.2% (w/v) Ficoll, 0.2% (v/v) bovine serum albumin, 20 mM NaHPO4 (pH 6.8), 200/zg/ml heparin (Sigma, St. Louis, MO) in a sealed plastic bag for 15 min at 10° below the estimated Tin. Ten nanograms of 5' end-radiolabeled oligonucleotide is injected into the sealed bags with a syringe. After hybridization for two or more hours, the filters are washed four times [6 × SSC, 1.0% (w/v) SDS] at room temperature for 5 min, then at 5° below the estimated Tmfor 3-5 min. The filters, placed between plastic wrap, are autoradiographed at - 7 0 ° for 1-4 hr with intensifying screens Method The method used is as follows: 2/zl (3.0/xg) of the oligonucleotide is phosphorylated by adding 14/xl of 5 × forward reaction buffer (Bethesda Research Laboratories), 31/xl of distilled water, 10/zl of 10 mM ATP, and 3/zl of T4 polynucleotide kinase (Bethesda Research Laboratories). After incubation at 37° for 30 min, the enzyme is inactivated by incubation at 65 ° for 10 min. Up to 7.5/zg ofBamHI-PstI-digested pUC19 is phospharased with 1 /zl of BAP for 30 min at 37 ° in the BamHI-PstI restriction enzyme buffer. An additional 1/.tl of BAP is added and the 30-min incubation at 37 ° is repeated. The linearized, phosphatased vector is size fractionated by TAE-agarose gel electrophoresis (TAE: 40 mM Tris, pH 7.8, 8.3 mM Na acetate, 1.1 mM EDTA) and recovered by the concentrated NaI-glass bead technique (Biol01, La Jolla, CA). One microliter (50 ng) of the phosphorylated oligonucleotide, 1/zl (50 ng) of BamHI-PstI doubledigested vector, 2 /zl of 5 × ligase buffer (Bethesda Research Laboratories), 5/zl of distilled water, and 1/zl (1 U) of T4 DNA ligase are gently mixed together and the ligation reaction allowed to incubate at room temperature for up to 4 hr. One microliter of ligation reaction is diluted in 4/zl of distilled water and used to transform E. coli by electroporation. Recombinant plasmids are identified by colony lift hybridization, using the oligonucleotide as the probe (optional). A restriction digest analysis confirms that the ligation has been successful (Fig. 1B). Concluding Remarks and Discussion Dephosphorylation of the vector, length of the oligonucleotide, and length of the overhang for annealing were examined as factors influencing the efficiency of this method of introducing a DNA sequence into a doublestranded DNA plasmid. Bacterial alkaline phosphatase treatment of the vector reduced the total number of colonies observed following transfor-
300
MUTAGENESIS AND GENE DISRUPTION
[20]
TABLE I RECOMBINATION EFFICIENCY OBTAINED USING DIFFERENT LENGTHS OF O L I G O N U C L E O T I D E S a
Oligonucleotide length
Vector
Efficiency (%)
27-mer 27-mer 9-mer 39-mer
Untreated BAP treated BAP treated BAP treated
17/229 (7%) 38/108 (35%) 10/10 (100%) 2/5 (40%)
The methods used are described in text. The BamHIPstI-digested pUC 19 vector was used before (untreated) or after (BAP treated) treatment with bacterial alkaline phosphatase. For the 27-mer, efficiency was determined by identifying recombinant plasmids by colony lift hybridization (numerator) and by counting the total colonies on the LB agar-ampicillin plate from which the lift was taken (denominator). Digestion of plasmid DNA from five randomly selected, hybridizing colonies confirmed the presence of the new BgllI site (Fig. IB). For the 9-mer, 10 randomly selected colonies were assayed by restriction digest analysis for the presence of BamHI and PstI sites and for the absence o f a SalI site. For the 39-mer, five randomly picked colonies were assayed for the introduction of a new NotI site.
mation, and the total number of recombinants (data not shown), but increased the percentage of recombinants such that screening with radiolabeled oligonucleotide was no longer necessary (Table I). Routinely, we now pick 5 to 10 random colonies and assay for the presence of the newly introduced restriction site by digestion of minipreparation plasmid DNA with the desired enzyme. Four oligonucleotides (9, 16, 27, and 39 nucleotides in length) were examined to determine if oligonucleotide length influenced efficiency. We found that the total number of colonies (data not shown) and the percentage of recombinants are higher with the 9-mer as compared with either the 27mer or the 39-mer (Table I). Therefore, it appears from this limited study that shorter oligonucleotide may have a higher efficiency than longer ones. Despite repeated experiments, including synthesis of the 16-mer three times, we were never able to isolate a recombinant plasmid containing this DNA sequence. Finally, to determine whether a two-base overhang is adequate for ligation, a 13-mer compatible with the two-base overhangs created by digestion of the vector with ClaI and SstII was synthesized and ligated
[21]
E X P R E S S I O N OF M U T A G E N I Z E D G E N E S IN Y E A S T
301
into ClaI-SstlI-digested plasmid DNA. The plasmid we used was that created by insertion of the 27-mer oligonucleotide into pUCI9. We tried BAP-treated and untreated vector. We were unable to identify a recombinant either by random selection of colonies (0/24), or by screening with radiolabeled oligonucleotide. A 14-met was tested that was compatible with the two-base 5' overhang for ClaI and the four-base 3' overhang for PstI. Again we were unable to isolate a recombinant either by random selection (0/24) or by hybridization of colony lifts. Based on this preliminary data it appears that, unlike four-base overhangs, a two-base overhang is not sufficient for the rapid introduction of a new restriction site in double-stranded DNA plasmids.
[21] E x p r e s s i o n a n d S c r e e n i n g in Y e a s t o f G e n e s M u t a g e n i z e d in Vitro
By
TIM
C.
HUFFAKER
Introduction Analysis of mutant genes has proved to be a powerful approach in the study of a number of biological processes. Using current recombinant DNA technology, it is possible to create in vitro any specific mutation in any cloned gene. The altered gene can then be reintroduced into the cell to observe the mutant phenotype. Alternatively, a random mutagenesis protocol can be used to create an array of mutations in a given gene. Cells transformed with this pool of mutagenized DNA can then be screened for a desired phenotype (i.e., conditional lethality). The ideal experiment is one in which the mutant allele replaces the wild-type allele. This makes it possible to compare two organisms that differ only by the mutation made in vitro. In the yeast, Saccharomyces cerevisiae, this type of experiment has become routine. Yeast can grow mitotically as either haploid or diploid cells. Because many mutations are recessive, it is usually desirable to examine the mutant phenotype in a haploid cell that contains only the mutant allele. If the gene is essential for growth, elimination of the wild-type copy must occur simultaneously with or after the introduction of the mutant allele. This chapter describes and compares two methods that allow the introduction and expression of mutant alleles in yeast. Both satisfy the above requirements. One method produces mutations that reside in the chromosome; the other produces mutations that reside on plasmids. METHODS IN ENZYMOLOGY, VOL. 217
Copyright ~ 1993 by Academic Press, Inc. All rights of reproduction in any form reserved
302
MUTAGENESIS AND GENE DISRUPTION
[21]
Materials Yeast plasmids are grouped into several classes based on their mode of replication. All commonly used yeast plasmids are shuttle vectors; that is, they can be propagated in both yeast and Escherichia coli. Most are derivatives ofpBR3221 or pUC 2 that contain the ampicillin resistance gene and a bacterial DNA origin of replication for selection and maintenance in E. coll. YIp plasmids (yeast integrating plasmids) contain a yeast gene that can be used as a selectable marker for yeast transformation. For example, YIp53 was constructed by inserting the yeast URA3 gene into pBR322. YIp plasmids do not contain sequences that allow autonomous replication in yeast and can be propagated only following integration into the yeast chromosome. YCp and YEp are replicating plasmids and can be maintained independently in yeast cells. In addition to a yeast selectable marker, YCp plasraids contain two other sequence elements called ARS and CEN. An ARS element 3 is a sequence from the yeast genome that allows autonomous replication of the plasmid by providing an origin of DNA replication. The CEN element 4 contains one of the yeast centromeres. Plasmids containing CEN elements show little segregation bias and are maintained in low copy number. YEp plasmids (yeast episomal plasmids) contain sequences from a naturally occurring yeast plasmid called the 2~m circle. 5 These sequences allow extrachromosomal replication and maintenance of the plasmid in high copy number (20-50 copies/cell). YEp vectors are often used for high-level expression of genes. These plasmids can be introduced into virtually any genetically marked yeast strain. Chromosomal alleles of several yeast genes exhibit low reversion frequencies (less than 10-8), allowing the wild-type copies of these genes to be used as selectable markers on plasmids. The most commonly employed markers are ura3, leu2, his3, trpl, and lys2, because doublepoint mutations, Ty insertions, or deletions of these genes are available. Transformation is usually performed by the lithium acetate method 6 or electroporation 7 because these techniques produce colonies that can be I F. Bolivar, R. L. Rodriguez, P. J. Greene, M. C. Betlach, H. L. Heynecker, and H. W. Boyer, Gene 2, 95 (1977). 2 C. Yanisch-Perron, J. Vieira, and J. Messing, Gene 33, 103 (1985). 3 K. Struhl, D. T. Stinchcomb, S. Scherer, and R. W. Davis, Proc. Natl. Acad. Sci. U.S.A. 76, 1035 (1979). 4 L. Clarke and J. Carbon, Nature (London) 287, 504 (1980). 5 j. R. Broach, this series, Vol. 101, p. 307. 6 H. Ito, Y. Funkuda, K. Murata, and A. Kimura, J. Bacteriol. 153, 163 (1983). 7 D. M. Becker and L. Guarente, this series, Vol. 194, p. 182.
[21l
EXPRESSION OF MUTAGENIZED GENES IN YEAST
303
replica plated directly. Prototrophic transformants are selected on synthetic medium 8 lacking the nutrient for the auxotrophy that is complemented by the plasmid marker. For two of these markers, a negative selection also exists, ura3 cells can be selected using 5-fluoroorotic acid (5-FOA) 9 and lys2 cells can be selected using a-aminoadipate, l° These compounds are used to obtain cells that have lost plasmids carrying either URA3 or L YS2. Generation of Chromosomal Mutations by Integration Principles of Method The procedure for generating chromosomal mutations depends on the properties of YIp plasmids. YIp plasmids do not contain sequences that allow autonomous replication in yeast and can be propagated only following integration into the yeast chromosome. They integrate via recombination between yeast sequences carried on the plasmid and the homologous sequences present in the yeast genome. Cutting the plasmid DNA within the yeast sequences prior to transformation stimulates homologous recombination and will increase the transformation frequency from 10- to 1000fold. ~ When two yeast genes are present on a plasmid, cutting within one of the sequences will direct integration to its chromosomal location. Figure 1A depicts the integration of a YIp plasmid containing YFG (your favorite gene) and the marker URA3. The URA3 gene will be used as a positive selectable marker for transformation and later as a negative selectable marker. The plasmid is cut with a restriction enzyme that recognizes a single site within the YFG gene. It is then transformed into a ura3 haploid cell selecting for uracil prototrophy. Because the plasmid is cut within the YFG sequence, it preferentially integrates into the chromosomal YFG locus. This process creates a duplication of the YFG gene separated by the remaining plasmid DNA, which includes the URA3 marker. If the plasmid-borne copy of YFG contains a mutation, integration will place the mutation in one of the chromosomal copies of YFG: the other copy of YFG will remain wild type. A recessive mutation cannot be detected by this scheme because a wild-type copy of YFG still exists in the genome. 8 F. Sherman, this series, Vol. 194, p. 3. 9 j. D. Boeke, J. Trueheart, G. Natsoulis, and G. R. Fink, this series, Vol. 154, p. 164. to B. B. Chatoo, F. Sherman, D. A. Azubalis, T. A. Fjellstedt, D. Mehnert, and M. Ogur, Genetics 93, 51 (1979). H T. L. Orr-Weaver, J. W. Szostak, and R. J. Rothstein, Proc. Natl. Acad. Sci. U.S.A. 78, 6354 (1981).
304
A
INTEGRATION YFG ~.__
MUTAGENESIS AND GENE DISRUPTION
URA3
B
l URA3
YFG
~
[21]
URA3
INTEGRATION intactYFG
l disrupted YFG URA3
L
I
r
EXCISION l •. , , , , ~ r - ~ l l - - ] , v ~ , wild type
I
1 or mutant
El6. l. Integration of mutant alleles. (A) A plasmid is constructed that contains URA3 and a complete copy of YFG. It is mutagenized in vitro and singly cut to direct integration to the chromosomal YFG locus. Integration results in a transformant beating two copies of the YFG gene that flank the URA3-selectable marker. One copy of YFG contains the mutation; the other is wild type. (B) A plasmid is constructed that contains URA3 and a copy of YFG lacking either its N- or C-terminal coding region. It is mutagenized in vitro and singly cut to direct integration to the chromosomal YFG locus. Integration results in a transformant beating an intact and a disrupted YFG gene flanking the URA3-selectable marker. In this case, the mutation (*) is located on the far side of the cut site and, thus, resides in the intact copy of YFG in the transformant. Excision of the plasmid from this transformant can result in either a wild-type or mutant YFG strain. Solid bar, YFG sequences derived from plasmid; solid line, flanking plasmid sequences; open bar, YFG sequences derived from chromosome; sawtooth line, flanking chromosomal sequences.
To detect a recessive mutation, the wild-type copy of YFG must be eliminated. This can be accomplished by altering the structure of the YIp plasmid as diagrammed in Fig. lB. 12 Instead of inserting the entire YFG gene into the plasmid, a fragment of the gene is inserted. This fragment must lack either the N- or C-terminal coding region of the YFG. Integration of this plasmid into the chromosomal locus also produces a duplication of YFG sequences separated by plasmid DNA. One of the segments encodes the entire YFG gene but the other encodes a nonfunctional gene lacking either its N or C terminus. Depending on the location of the mutation relative to the site of recombination, the mutation may come to reside in the intact copy of YFG and be expressed. Because the other copy of YFG is disrupted, it is possible to screen transformants for recessive phenotypes directly. 12 D. Shortle, P. Novick, and D. Botstein, Proc. Natl. Acad. Sci. U.S.A. 81, 4889 (1984).
[2 1]
EXPRESSION OF MUTAGENIZED GENES IN YEAST
305
The site of recombination is roughly determined by the site that is used to linearize the plasmid. Using a cut site that lies near the truncated end of YFG in the plasmid allows a larger segment of the plasmid sequence to reside in the intact expressed YFG copy on the chromosome. If YFG has been mutagenized using a random mutagenesis protocol, this should allow the recovery of more mutant alleles. Obviously, the whole gene cannot be mutagenized if the plasmid copy is truncated at one end. However, by mutagenizing both N- and C-terminal deletion plasmids, mutations in each half of YFG can be obtained independently. A standard genetic cross can be performed to demonstrate that any phenotype observed is due to a mutation in YFG. The mutant haploid is mated to a ura3 haploid and the resulting diploids sporulated. The URA3 gene is linked to YFG because it was introduced as part of the plasmid. If the phenotype is due to a mutation in YFG, all Ura + spores will display the phenotype. After screening for the mutant phenotype, cells in which the plasmid sequences have been excised can be selected. Excision of the plasmid from the genome occurs at a low frequency by recombination between the duplicated sequences (Fig. 1B). If URA3 has been used as the plasmid marker, Ura- cells can be selected on medium containing 5-FOA. Excision is the reverse of integration except that recombination is not confined to any particular region of the homologous sequences. Depending on the site of recombination, excision of the plasmid can result in a strain that has retained or lost the mutation. These are easily distinguished by screening for the mutant phenotype. Thus the final product of this two-step procedure is a yeast chromosome that is altered only by the changes comprising the mutation, just as if the mutation had been made in vivo.
Example: Isolation of Conditional-Lethal TUB2 Alleles Yeast contains a single essential gene encoding fl-tubulin called TUB2.13 Conditional-lethal alleles of this gene were produced by in vitro mutagenesis and integration of the mutagenized gene into the yeast gehome. 14 The plasmid that was mutagenized was made by cloning a 2.8kilobase (kb) fragment containing the TUB2 sequence into YIp5. One end of the fragment was in the fourth codon of TUB2 and the other end was 1.4 kb beyond the C-terminal end of the coding sequence. Thus, the plasmid contained a copy of TUB2 with a truncated 5' end; it lacked the first three codons and all upstream sequences. t~ N. F. Neff, J. H. Thomas, and D. Botstein, Cell 33, 211 (1983). 14 T. C. Huffaker, J. H. Thomas, and D. Botstein, J. Cell Biol. 106, 1997 (1988).
306
MUTAGENESIS AND GENE DISRUPTION
[2 II
Because it was not known which mutations would create conditionallethal alleles, this plasmid was mutagenized in vitro using a technique that creates random alterations in the plasmid sequence. The pool of mutagenized plasmid was used to transform a ura3 haploid yeast strain selecting for uracil prototrophy at 26°. Plasmid integration was directed to the chromosomal copy of TUB2 by cutting the plasmid at the single KpnI site prior to transformation. The KpnI site lies in the TUB2 gene approximately 400 bp from the truncated 5' end of the cloned fragment. Homologous recombination, occurring near the KpnI site, produces a strain containing one intact and one disrupted copy of TUB2. If a mutation on the plasmid lies between the KpnI site and the 3' end of the gene, the integrated mutation will likely reside in the intact copy of TUB2 and even a recessive phenotype can be observed directly. If a mutation on the plasmid lies between the 5' end of the gene and the KpnI site, the integrated mutation will likely reside in the disrupted copy of TUB2 and will not be detected. Thus, recessive mutations recovered by this particular protocol should reside in the 3' 70% of the TUB2 coding region beyond the Kpnl site. Approximately 17,000 transformants were replica plated and incubated at 26, 14, and 37 °. Colonies that grew at 26° but failed to grow at either 14 or 37° were picked and purified as single colonies. Eight colonies retested as cold sensitive; none retested as temperature-sensitive. One of these mutants was cold sensitive for uracil prototrophy due, most likely, to mutation of the plasmid-borne URA3 gene: it grew at 14° on plates supplemented with uracil. Results of tetrad analysis showed that five of the other seven cold-sensitive strains contained tub2 mutations; these five coldsensitive mutations were linked to the integrated plasmid sequences marked by URA3. Excision ofplasmid sequences was selected by growing the primary transformants on 5-FOA plates to select against URA3. Colonies that grew on this medium were assayed for cold sensitivity. Those that remained the cold-sensitive allele were saved for further study. Mapping and sequencing of the cold-sensitive alleles showed that each mutation resided on the 3' side of the KpnI site, as expected. All alleles were recessive.
Generation of Plasmid-Borne Mutations by Plasmid Shuffle
Principles of Method A second protocol for introducing mutant alleles into cells, termed plasmid shuffle,9 relies on the properties of the yeast replicating plasmids. Either YCp or YEp plasmids can be used. The basic scheme is diagrammed
[21]
EXPRESSION OF MUTAGENIZED GENES IN YEAST
307
© ©
mutagenize in vitro
select Leu + transformants
select Ura" cells screen for mutant phenotype
(
Fie. 2. The recipient strain contains a disruption of the chromosomal copy of YFG marked by HIS3. YFG function is provided by an autogenous plasmid carrying YFG and URA3. A second plasmid containing YFG and LEU2 is mutagenized in vitro and tranformed into the recipient strain. Strains that have lost the URA3 plasmid are then selected and screened for mutant phenotypes.
in Fig. 2. A recipient strain is constructed in which the only copy of YFG is located on a replicating plasmid; the chromosomal copy of YFG is disrupted. YFG on a second replicating plasmid is mutagenized and transformed into the recipient strain. The resulting strain contains two plasmids: one with a wild-type copy of YFG, the other with a mutated copy of YFG. To observe the mutant phenotype, strains that have lost the original plasmid bearing the wild-type copy of YFG are selected. Thus, the mutant allele replaces the wild-type allele by plasmid exchange. The recipient strain is usually made by first disrupting one copy of YFG in a diploid cell using one of the gene replacement strategies described by
308
MUTAGENESIS AND GENE DISRUPTION
[21]
Rothstein. ~5Gene replacement generally introduces a marker gene, called the disruption marker, into the YFG chromosomal location. Tetrads formed by sporulation of this diploid should contain two spores with an intact YFG and two spores with the disrupted YFG. If YFG is essential for growth, the two spores containing the disruption will be inviable. These inviable spores can be rescued by introducing a plasmid containing wildtype YFG into the diploid cell before sporulation. The plasmid chosen should also possess a marker that can later be used for negative selection. When the diploid containing the plasmid is sporulated, some of the spores containing the YFG disruption will obtain the plasmid and be rescued. In the example shown in Fig. 2, the recipient strain was constructed using HIS3 as the disruption marker and URA3 as the plasmid marker. Thus, the spores containing the YFG disruption and the plasmid can be identified as Ura + and His +. YFG on another plasmid is mutagenized in vitro and introduced into the recipient strain. This plasmid must contain a third selectable marker; LEU2 is used in Fig. 2. The resulting strain contains two plasmids: one with a wild-type copy of YFG and the other with a mutated copy of YFG. To observe the phenotype of the mutated YFG, cells that have lost the plasmid carrying the wild-type copy of YFG are obtained by selecting against its plasmid marker. In Fig. 2, negative selection of URA3 is used to eliminate the plasmid carrying wild-type YFG. Both null alleles and conditional-lethal alleles can be identified by this approach. Strains carrying null alleles of YFG will not survive loss of the wild-type copy of YFG and fail to grow on medium that selects against this plasmid. Strains carrying conditional-lethal alleles of YFG will be unable to survive loss of the wild-type copy of YFG only at the restrictive condition. It is also possible to check that any phenotype observed is due to a mutation in YFG. This is done by determining the phenotype of cells before selecting against the first plasmid that carries wild-type YFG. At this stage, recessive mutations in YFG will be complemented by the wildtype copy of YFG. Thus any cells that display a mutant phenotype in the presence of the first plasmid could be assumed to possess a mutation in some other gene. Unfortunately, dominant mutations in YFG will also be eliminated by this approach. Example: Isolation of Conditional-Lethal TUB1 Alleles
Yeast contains two genes encoding a-tubulin, TUB1 and TUB3.16 TUB1 produces most of the a-tubulin in the cell and is essential for growth. TUB3 15 R. Rothstein, this series, Vol. 194, p. 281. t6 p. j. Schatz, L. Pillus, P. Grisafi, F. Solomon, and D. Botstein, Mol. Cell. Biol. 6, 3711 (1986).
121]
EXPRESSION OF MUTAGENIZED GENES IN YEAST
309
produces minor amounts of a-tubulin and is not essential for growth. When TUB3 is placed on a high copy number YEp plasmid, it can compensate for loss of TUB1 )7 To obtain conditional-lethal alleles of TUB1, the gene was mutagenized in vitro and introduced into yeast by the plasmid shuffle protocol, t8 A recipient strain was constructed that contained disruptions of both the TUB1 and TUB3 genes, a-Tubulin was provided by TUB3 on a YEp plasmid that also contained the URA3 marker. A YCp plasmid containing TUBI and the LEU2 marker was mutagenized in vitro using a technique that creates random alterations in the plasmid. The pool of mutagenized plasmid was transformed into the recipient strain selecting for leucine prototrophy at 26°. Approximately 56,000 transformants were replica plated to 5-FOA plates that select against that URA3 plasmid and to control plates that allow both plasmids to be maintained. Replicas on each medium were incubated at 14, 26, and 37° . One hundred and sixty strains failed to grow on 5-FOA plates at any temperature, indicating that their mutant TUBI alleles were unable to provide sufficient a-tubulin for growth. Seventy of the strains contained conditional-lethal TUB1 alleles: they were able to grow on 5-FOA plates at 26° but not at either 14 or 37°. Sixty-seven of these alleles were cold sensitive, one was temperature sensitive, and two were both cold and temperature sensitive. Each plasmid containing a conditional-lethal TUB1 allele was isolated and reintroduced into the recipient strain. All of them retested as conditional-lethal alleles on 5-FOA plates, confirming that the mutations resided in the TUBI gene on the plasmid.
Comparisons
of Methods
Ease of Obtaining Mutant Alleles In comparing the ease with which a number of mutant alleles can be obtained for a single gene, the plasmid shuffle method has several advantages. First it allows the entire gene to be mutagenized in one step. The integration method requires the mutagenesis of at least two separate plasmids to mutagenize the entire gene effectively. This is because each integration plasmid must lack one end of the gene. In addition, mutations made in vitro in the integrating plasmid need to reside in the intact copy of the gene after integration in order to be detected. Thus, recombination must occur on the correct side of the mutation. Because recombination is 17 p. j. Schatz, F. Solomon, and D. Botstein, Mol. Cell. Biol. 6, 3722 (1986). 18 p. j. Schatz, F. Solomon, and D. Botstein, Genetics 120, 681 (1988).
310
MUTAGENESIS AND GENE DISRUPTION
[21]
initiated by the linear ends of the plasmid, the cross-over point should be roughly determined by the cut site. However, branch migration of the recombination joint may move the cross-over point some distance from the cut site. Another complication is that the double-strand break can be enlarged to a gap by cellular nucleases. Both branch migration and nuclease digestion could make it difficult to observe a mutation near the plasmid cut site. In a random mutagenesis screen, this should not be a major problem if both N- and C-terminally deleted plasmids are used and they have a fairly large region of internal coding sequence in common. However, the process of integration will certainly prevent some plasmidborne mutations from residing in the intact copy of the gene where their phenotype can be observed. This is expected to lower the frequency of recovered mutations. For integration of a specific mutation at a known site, it is best to cut the plasmid at a site between the mutation and truncated end of the gene as far from the mutation as possible. Plasmid shuffle is probably not a good approach for all genes. Cells are sensitive to the copy number of some genes. For example, eliminating one copy of TUB1 in a diploid cell causes chromosomal abnormalities.17 Introducing a single extra copy of TUB2 into a haploid produces highly variable colony sizes.19 At one point in the plasmid shuffle protocol, cells must harbor two copies of the gene of interest: one putative mutant copy and one wild-type copy. For this reason, the integration method is preferable for mutagenesis of genes, like TUB2, that affect cell growth when present in extra copies.
Ease of Detecting Spurious Mutations In any screen it is possible to obtain mutations that are not in the gene of interest. For the integration method, evidence indicates that the frequency of spurious mutations can vary greatly. TUB2, ACT1 encoding actin, and TOP2 encoding topoisomerase have all been mutagenized in vitro and integrants screened for conditional-lethal phenotypes. The observed frequency of conditional-lethal mutations in the desired gene to the number obtained in the screen are as follows: five of seven cold sensitive mutations resided in TUB2,14 five of six temperature sensitive mutations resided in TOP2, 2° and three of sixteen temperature sensitive mutations resided in ACT1. ~2 Spurious mutations also occur in the plasmid shuffle method. In the case of RPA190, five of seven temperature sensitive mutations isolated resided in the gene of interest. 2~The source of these spurious 19 W. Katz, B. Weinstein, and F. Solomon, Mol. Cell. Biol. 10, 5286 (1990). 20 C. Holm, T. Goto, J. C. Wang, and D. Botstein, Cell 41, 553 (1985). 21 M. Wittekind, J. Dodd, L. Vu, J. M. Kolb, J. Buhler, A. Sentenac, and M. Nomura, Mol. Cell. Biol. 8, 3997 (1988).
[21]
EXPRESSION OF MUTAGENIZED GENES IN YEAST
311
mutations is unclear but their occurrence emphasizes the need to make sure any new mutation resides in the desired gene. It is easier to eliminate spurious mutations using the plasmid shuffle method. As described above, this is done by checking the phenotype of cells before selecting against the first plasmid that carries the wild-type copy. This can be accomplished by replica plating. For mutants generated by the integration method, a cross must be performed to demonstrate that a mutant phenotype is linked to the integrated plasmid marker. This is a rather laborious technique, especially if a large number of mutations are to be examined. C h r o m o s o m a l vs P l a s m i d Location
The integration method produces mutant alleles that reside in their normal chromosomal location. After excision of the plasmid sequences, these mutant alleles are as stable as any chromosomal gene. Plasmid shuffle produces mutations that reside on autonomous plasmids. These are considerably less stable; the copy number of even YCp can vary from cell to cell. 22 Because the copy number of a mutant allele may influence its phenotype, cells in the population may not exhibit a uniform phenotype. For this reason, before undertaking an extensive phenotypic analysis, it is usually desirable to obtain the mutant allele in its normal chromosomal location, where it will be stably propagated as a single-copy gene. Moving a gene from a YCp or YEp plasmid to its chromosomal locus is not trivial. One scenario involves subcloning the gene onto a YIp plasmid (YCp or YEp plasmids cannot be integrated directly into the chromosome), integrating it into its chromosomal location to create a gene duplication, selecting cells that have excised the plasmid marker, and screening these for the mutant phenotype. When the mutant allele has been integrated into the chromosome in single copy, there is no guarantee that its phenotype will be exactly the same as that of the plasmid-borne allele that was able to adjust its copy number. A mutant allele that could support growth in multiple copies could be lethal in a single copy. The molecular analysis of a mutant allele is simplified by having it located on a plasmid. It is relatively easy to recover a gene that resides on a plasmid. Yeast plasmid preparations z3 can be performed quickly and the plasmid amplified in E. coli for sequence analysis. The recovery of a mutant allele from the yeast chromosome onto a plasmid is commonly done but involves several additional steps (e.g., see Ref. 24). However,
2z M. A. Resnick, J. Westmoreland, and K. Bloom, Chromosoma 99, 281 (1990). 23 j. N. Strathern and D. R. Higgins, this series, Vol. 194, p. 319. 2~ j. H. Thomas, N. F. Neff, and D. Botstein, Genetics 112, 715 (1985).
312
MUTAGENESIS
AND GENE
DISRUPTION
[22]
the advent of polymerase chain reaction (PCR) technology allows mutant alleles to be sequenced directly from genomic DNA and eliminates the need for subcloning. Conclusion Both of the techniques compared in this chapter have been used successfully to introduce and identify mutant alleles of known yeast genes following in vitro mutagenesis. Each technique has advantages and disadvantages. The choice of one over the other will probably be influenced by the gene under investigation, the type of mutagenesis performed, and the ultimate goal of the study. Acknowledgments Muchof the workdescribedin thischapterwas performedin the laboratoryofD. Botstein, whose support and encouragement I greatlyappreciate. I also thank T. Fox for comments on the manuscript.Supportedby grantsfromthe NationalInstitutesof Healthand the Cornell BiotechnologyProgram.
[22] T n 5 lacZ T r a n s l a t i o n F u s i o n E l e m e n t : I s o l a t i o n a n d Analysis of Transposition Mutants
By W. S. REZNIKOFF, R. JILK, M. P. KREBS, J. C. MAKRIS, P. L. NORDMANN, M. WEINREICH, and T. WIEGAND Transposition is a genome rearrangement process in which a segment of defined DNA sequence " m o v e s " to a different site either on the same chromosome or on a different chromosome (see Fig. I). The sequence that moves is termed a transposable element (or in some cases an insertion sequence or transposon). Transposition events occur in many types of organisms and are the causative process behind a variety of phenomena, including the development of variegated flower petals and speckles of color in Indian corn kernels, and major medical problems [e.g., the integration of the human immunodeficiency virus I (HIV-I) DNA into the human T cell genome]. Transposable elements are associated with several forms of genome rearrangements such as deletions, inversions, and chromosome fusions. In addition, the biochemical processes involved in transposition are likely to be similar to those associated with other DNA recombination events. Thus analyzing the METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
[22]
Tn50RF lac transposase
II
313
(~ 11
E
E
®
® 1
)ql
I1~
FIG. 1. Transposable element and conservative transposition. A typical transposable element is defined by specific end sequences (E's) and encodes a transposase (circle over wavy arrow). A simplified model for a conservative transposition event includes the following steps: (1) the transposase is synthesized; (2) the transposase binds to E's; (3) the transposasebound E's come together; (4) the E's are cut free from adjacent DNA sequences; and (5) the transposable element is inserted into the target sequence X, causing a small duplication.
transposition process and defining the participating macromolecules and their roles are of considerable importance. There are several factors involved in transposition. These include: 1. two functions encoded by the transposable element, the transposase and the specific terminal D N A sequences that define the ends of the element (see Fig. 1) 2. host proteins that are directly involved in the transposition process and/or that regulate its frequency 3. the D N A target site into which the element inserts
314
MUTAGENESIS AND GENE DISRUPTION
[22]
Defining the transposase and the transposable element end sequences is important but relatively straightforward. The host DNA target site(s) have varying degrees of specificity depending on the element being studied. Its analysis is also straightforward. The host proteins are considerably more difficult to define. They are frequently essential to the host, their role can be conditional depending on other factors, and they can have both direct and indirect effects. In this chapter we shall describe a genetic approach for identifying and studying host- and element-encoded functions for one particular model transposable element, the bacterial transposon Tn5. This approach analyzes the frequency of activation of the reporter gene lacZ (encoding/3galactosidase) carried on the element. This general strategy has been used to study transposition and related genome rearrangements for a variety of transposable elements. As with all genetic strategies, this approach is best used as a guide with which to design biologically relevant biochemical experiments. Genetic tools designed to analyze one phenomenon frequently provide resources for studying other problems. We shall describe at the conclusion of this chapter how the Tn5 reporter element can be used to study genome structure, to "tag" interesting proteins, and to study the topology of membrane associated proteins. Tn5 Tn5 is a composite transposable element that is found and functions in a variety of gram-negative organisms (reviewed by Berg1). Tn5 is composed of two nearly identical 1.5-kbp insertion sequences (IS50L and IS50R) that bracket genes encoding three antibiotic resistance determinants. 2-5 The functions relevant to the transposition process are encoded by the IS50 sequences, the cis-active transposase (encoded by IS50R2'6), a shorter peptide read in the same reading frame that inhibits transposition, 7,8 and the terminal sequences. The terminal sequences of IS50 are related but nonidentical 19 bp called the "outside end" (OE) and "inside I D. E. Berg, in "Mobile D N A " (D. E. Berg and M. M. Howe, eds.), p. 185. American Society for Microbiology, Washington, D.C., 1989. 2 S. J. Rothstein, R. A. Jorgensen, K. Postle, and W. S. Reznikoff, Cell 19, 795 (1980). 3 E.-A. Auerswald, G. Ludwig, and H. Schaller, Cold Spring Harbor Symp. Quant. Biol. 45, 107 (1980). 4 E. Beck, G. Ludwig, E.-A. Auerswald, B. Reiss, and H. SchaUer, Gene 19, 327 (1982). 5 p. Mazodier, P. Cossart, E. Giraud, and F. Gasser, Nucleic Acids Res. 13, 195 (1985). 6 R. C. Johnson and W. S. Reznikoff, J. Mol. Biol. 177, 645 (1984). 7 R. C. Johnson, J. C.-P. Yin, and W. S. Reznikoff, Cell 30, 873 (1982). s R. R. Isberg, A. L. Lazaar, and M. Syvanen, Cell 30, 883 (1982).
[22]
T n50R F lac
315
TABLE 1 HOST FUNCTIONS IN Tn5 TRANSPOSITION Function
Possible role
Ref.
polA gyrA dnaA sulA dam 1HF HU FIS
Repair gaps (?) Target super coiling Binds to OE Unknown negative role Regulates transposase synthesis and IE use Unknown positive role in dam conditions Unknown positive role Unknown positive role; inhibits IE use and transposase synthesis in dam- cells
a, b c d, e f g, h i j k
'~ C. Sasakawa, Y. Uno, and M. Yashikawa, Mol. Gen. Genet. 182, 19 (1981). o M. Syvanen, J. D. Hopkins, and M. Clements, J. Mol. Biol. 158, 203 (1982). " R. R. Isberg and M. Syvanen, Cell 30, 9 (1982). d R. S. Fuller and A. Kornberg, Proc. Natl. Acad. Sci. U.S.A. 80, 5817 (1983). J. C.-P. Yin and W. S. Reznikoff, J. Bacteriol. 169, 4637 (1987). f C, Sasakawa, Y. Uno, and M. Yashikawa, Biochem. Biophys. Res. Commun. 142, 879 (1987). J. C.-P. Yin, M. P. Krebs, and W. S. Reznikoff, J. Mol. Biol. 199, 35 (1988). h j. C. Makris, P. L. Nordmann, and W. S. Reznikoff, Proc. Natl. Acad. Sci. U.S.A. 85, 2224 (1988). i j. C. Makris, P, L. Nordmann, and W. S. Reznikoff, J. Bacteriol. 172, 1368 (1990). J M. Weinreich and W. S. Reznikoff, unpublished observations (1991). k M. Weinreich and W. S. Reznikoff, J. Bacteriol. 174, 4530 (1992).
end" (IE).9,~° The terminal sequences define what transposes. Tn5 transposition uses two outside ends and IS50 transposition uses one OE and one IE. To a first approximation the DNA between the ends is irrelevant, except that the transposase needs to be encoded in cis for efficient transposition. Notice that this description is an oversimplification that itself can be tested by the system to be studied. For instance, because the DNA encoding the transposase carboxy-terminal sequence overlaps with the inside end sequence, altering that precise relationship may affect the frequency of transposition. The frequency of Tn5 (or IS50) transposition is known to be affected by a number of host-encoded factors as outlined in Table I. Notice that 9 R. C. Johnson and W. S. Reznikoff, Nature (London) 304, 280 (1983). E0C. Sasakawa, G. F. Carle, and D. E. Berg, Proc. Natl. Acad. Sci. U.S.A. 80, 7293 (1983).
316
MUTAGENESIS AND GENE DISRUPTION lacZ, Y, A' II OE
tet R I
I
I
[22]
IS50R II II IE OE transposase (pl) transposition inhibitor (p2)
FIG. 2. Tn5 ORE lac. Tn5 ORE lac contains lacZ sequences, which lack transcription and translation initiation signals, immediately adjacent to the outside end (OE) sequences. The lacZ gene (and lacY) will be expressed as a result of a transposition event into an expressed gene in the correct orientation and reading frame such that a fusion peptide will be synthesized. Tn5 ORF lac also encodes tetracycline resistance and contains an intact IS50 element that encodes the cis-active transposase (pl) and transposition regulatory protein (p2). (See Krebs and Reznikoff lj for more details.)
the i n v o l v e m e n t of s o m e host factors is manifested only under certain conditions, suggesting that there m a y be alternative means of fulfilling the s a m e functions. Tn50RF
lac
While maintaining the crucial Tn5 elements required for transposition (outside end sequences and t r a n s p o s a s e gene), we have engineered a Tn5 derivative that allows the use of the l a c Z r e p o r t e r gene as a m e a s u r e of transposition frequencies. 11 The construct (Fig. 2) places almost the entire l a c Z open reading f l a m e (ORF) immediately adjacent to the O E sequence. Lacking in the construct are p r o m o t e r , translation initiation, and N-terminal sequences for l a c Z expression. This silent gene can be activated by any g e n o m e r e a r r a n g e m e n t that places the l a c Z sequence within an expressed gene in the correct reading frame such that a hybrid protein is made. This construct is typically carried on a c o l E l : : T n 5 0 R F l a c - b a s e d plasmid, but other delivery vehicles are possible. To visualize transposition events from this construct, we use an indicator agar with the following characteristics: 1. L a c - and L a c + cells both grow and form colonies due to the presence of alternative c a r b o n and energy sources. 2. L a c ÷ cells will grow faster than (or continue growing longer than) L a c - cells due to the high concentration of lactose or other fl-galactoside compounds. 3. L a c + cells can be distinguished f r o m L a c - cells due to the producn M. P. Krebs and W. S. Reznikoff, Gene 63, 277 (1988).
[22]
Tn50RF lac
317
tion of a color. This can be an indirect test (lactose MacConkey contains a pH indicator that turns red when fermentation of the lactose indirectly yields lactic acid) or a direct test [5-bromo-4-chloro-3-indolyl-fl-o-galactoside (X-Gal) is a colorless substrate of fl-galactosidase that yields indigo as an indirect consequence of cleavage]. 12 As shown in Fig. 3, when L a c - cells carrying colE l::Tn5 ORF lac are plated on appropriate indicator agar, a Lac- colony develops. However, with prolonged incubation Lac + papillae appear. These papillae consist of Lac + cells derived from genome rearrangements, usually transposition events, which fuse in-frame the lacZ ORF to an expressed gene. At any point in time, typically after 2 to 3 days of incubation at 37°, the number of papillae per colony is a qualitative measure of the transposition frequency. This is studied using a dissecting scope. 1~ This simple approach has a major advantage for genetic experiments; it provides a screen for analyzing the Tn5 transposition phenotype for individual colonies. Thus one can examine -100 colonies per plate for differences in transposition phenotype. Applications of T n 5 0 R F lac Analysis of Element-Encoded Functions An obvious use of T n 5 0 R F lac is to screen for Tn5 mutations that alter its frequency of transposition. The Tn50RF-containing vehicle is exposed to some form of mutagenesis (e.g., randomized chemical treatment, passage through a mutagenic host, or introduction of a synthetic DNA sequence containing random or specific changes) and is transformed into a suitable L a c - host (e.g., RZ211; ~lac-pro ara recA56 thi srl- StrF). The transformation mixture is diluted to yield -100 colonies on lactose MacConkey agar. The plate is incubated at 37° and inspected at approximately daily intervals for papillae formation. This general protocol was first used to isolate and analyze a pseudorevertant of a transposase ochre mutation located 26 codons upstream from the carboxy terminus.11 The starting construct did not transpose and did not yield any papillae after 3 to 4 days of incubation; however, after a week rare papillae became apparent. Cells derived from one of these papillae yielded a pseudorevertant that was an ochre-to-glutamine change (glutamic acid is the normal amino acid at this location). Surprisingly, this pseudorevertant displayed an elevated transposition phenotype, transpostz j. H. Miller,"Experimentsin MolecularGenetics." ColdSpringHarborLaboratory,Cold Spring Harbor, New York, 1972.
318
[22]
MUTAGENESIS AND GENE DISRUPTION
=
!~
i~¸ ~ i
" ~i!i ¸
!
FIG. 3. T n 5 0 R F lac papillation. C o l E I : : T n 5 0 R F lac was transformed into a Lac- host (RX211). The transformants were diluted and spread on lactose MacConkey agar and incubated at 37°. Photographs were taken at (a) 25, (b) 50, (c) 75, and (d) 100 hr after plating. Overall colonies are white and the papillae, which appear as dark spots in these photographs, are red. (From Krebs and Reznikoff. H)
ing 3.6 times as frequently as the wild-type element. Other transposase mutants that elevate the frequency of transposition have also been isolated and characterized using the papillation assay.13 The papillation technique was also used to analyze the importance of specific OE and IE nucleotide pairs in the transposition process. 14 The J3 T. W. Wiegand and W. S. Reznikoff, J. Bacteriol. 174, 1229 (1992). 14 j. C. Makris, P. L. Nordmann, and W, S. Reznikoff, Proc. Natl. Acad. Sci. U.S.A. 85, 2224 (1988).
Tn50RF lac
[22l
/
319
kk ~
Kpnl
ColE1 FiG. 4. £ o l E I : : T n 5 0 R F lac modified for cloning O£ sequence variants. The Tn50RF lac has been modified by replacing the [$50 OE. Mutant O£ sequences can be generated synihetically and then cloned into the SphI-KpnI-cut DNA.
T n 5 0 R F lac construct was modified such that convenient restriction sites bracketed the end sequence distal from the N terminus of lacZ (see Fig. 4). This allowed synthetic sequences to be cloned in place of an OE and to be tested for their support of the transposition process. The actual experiment involved generating a double-stranded mixed oligonucleotide population in which each position had a 5% misincorporation rate. The transposition phenotype of individual colonies was scored after 4 to 5 days of incubation. The DNA was isolated from individual colonies, sequenced, and retransformed into a suitable host for a quantitative transposition test. (Note: Tn5 ORF lac also encodes tetracycline resistance, and thus the frequency with which this marker is transferred to an F element or h prophage could be quantitated through a mating out or transduction test.) This analysis showed that mutations at nearly every position in the end sequences significantly decreased transposition.
Analysis of Host Functions Two separate approaches have been used to analyze host functions for their influence on the frequency of Tn5 transposition. In the first procedure, known host functions are studied. Isogenic strains that differ only in the host function to be tested are transformed with the colE l::Tn5 ORF lac construct. The transformed cells are plated on the appropriate indicator agar and the number of papillae that appear over time is quantitated for a representative number of colonies. Examples of host functions that have been studied in this manner include IHF, HU, LexA, and dam. 15'16 The 15j. C. Makris, P. L. Nordmann, and W. S. Reznikoff, J. Bacteriol. 172, 1368 (1990). 16M. Weinreich, J. C. Makris, and W. S. Reznikoff, J. Bacteriol. 173, 6910 (1991).
320
MUTAGENESIS AND GENE DISRUPTION
[22]
FIG. 5. Isolation of host mutant that enhances transposition. Lac- Lex- cells containing C o l E I : : T n 5 0 R F lac were mutagenized by infection with Mu d kan and then plated on minimal agar containing glucose, casamino acids, 0.05% (w/v) phenyl-/3-o-galactoside, and X-Gal. 12 Colonies were white overall with blue papillae (dark spots) resulting from Lac ÷ transposition events. One colony pictured had an excess of papillae and turned out to contain a host mutant that enhanced Tn5 transposition 10-fold.
advantage of using the papillation test is that mutations in some candidate host functions interfere with DNA mobilization assays of transposition that require h excision and/or replication, F replication, and/or conjugative transfer. A major caveat for this analysis is that a host defect that alters the dynamics of colony growth may change the apparent papillation frequency. The second approach is to use the papillation assay to screen for new host mutants that alter the papillation frequency. In this case the colE 1: : T n 5 0 R F lac construct is transformed into a randomly mutagenized host, and the resulting colonies are screened for rare candidates that show evidence of a significant difference in papillation frequency. The host mutant then is transferred to a second test strain and reexamined for its effect on Tn5 transposition. An example of this application involved a study of the SOS response and transposition. 16 lexA-defective cells support a much lower frequency of transposition for unknown reasons. A lexA lac cell containing T n 5 0 R F lac was randomly mutagenized with a M u d kan phage selecting for inserts by virtue of kanamycin resistance. The resulting colonies were screened for rare isolates with enhanced papillation frequencies (see Fig. 5). The
[22]
Tn50RF lac
321
host function that was presumed to be tagged by the M u d kan insert could then be transferred to a new background for reanalysis. There are cautionary notes involving random host analyses. In addition to the possible complication of differential colony development, either because of position effects of the colony on the plate or because of the effect of the host mutation, it should be clear that papillation is a statistical phenomenon. Colonies will manifest different numbers of papillae by chance. Thus it is necessary to retest the papillation phenotype of candidate colonies. Other Uses of T n 5 0 R F lac Tn5 ORF lac is a mobile genetic "tag" allowing interrupted genes to be physically identified and the N terminus of the encoded protein to be isolated. It is convenient to use because Tn5 transposes in a wide variety of gram-negative bacteria, its target sequence specificity is quite random, and because the tet marker provides a convenient marker for subcloning or transduction experiments. Moreover,/3-galactosidase is a convenient "handle" for purifying the resulting fusion protein. Other Tn5 derivatives have been described that are useful for the s a m e p u r p o s e s . 17'18 /3-Galactosidase manifests a high level of in vivo activity only when it is localized in the cytoplasm. This property has allowed Beckwith and coworkers ~9to use the lacZ fusion system as a tool for studying the topology of membrane proteins. Multiple in-frame Tn5 ORF lac inserts are isolated in the encoding gene. Those that manifest high levels of in vivo activity are presumed to have their fusion point in a cytoplasmic domain while fusions with a low level of activity defined membrane or periplasmic domains. An elaboration of these observations is the use of the Lac phenotype of membrane domain fusions to isolate mutants that prevent membrane localizationfl ° The desired mutants would be found among Lac + isolates. Tn5 ORF lac can also be used for studying genome rearrangements other than transposition. For instance, an adjacent deletion from the end of Tn5 ORF lac that ends in frame in a vector gene will also activate lacZ. 2~ Deletions, and perhaps other rearrangements, may be products of 17 C. M. Berg, D. E. Berg, and E. A. Groisman, in "Mobile D N A " (D. E. Berg and M. M. Howe, eds.), p. 879. American Society for Microbiology, Washington, D.C., 1989. 18 V. deLorenzo, M. Herrero, U. Jakubzik, and K. N. Timmis, J. Bacteriol. 172, 6568 (1990). 19 S. Froshauer, G. N. Green, D. Boyd, K. McGovern, and J. Beckwith, J. Mol. Biol. 200, 501 (1988). 20 D. B. Oliver and J. Beckwith, Cell 30, 311 (1982). 21 R. A. Jilk, J. C. Makris, L. Borchardt, and W. S. Reznikoff, submitted (1992).
322
MUTAGENESIS AND GENE DISRUPTION
[22]
intermediates in the transposition process. Adjacent deletions can occur under conditions in which transposition cannot occur, and probably are the result of aborted transposition events. Thus T n 5 0 R F lac can also be used to identify and study mutants (host or element encoded) that block or alter different steps in the transposition process. Concluding Comments T n 5 0 R F lac is proving to be a convenient genetic tool for studying the transposition process. It is also a powerful mobile genetic " t a g " that can be used in the analysis of bacterial genome structure and some protein structures. It has several particularly useful characteristics. LacZ + fusions are easy to detect and have a growth advantage on appropriate media. The transposition process is quite random in regard to target sequences. The element can be delivered to cells using a variety of vehicles. Not mentioned in this chapter is the possibility of further engineering the T n 5 0 R F lac with a series of genetic or biochemical signals such as origins of replication and rare restriction e n z y m e target sites. This will further enhance its utility and is currently being pursued. Acknowledgments This work was funded by grants from the National Institutes of Health (NIH GM 19670) and the National Science Foundation (DMB-9020517). M.P.K. and M.W. were supported in part by NIH Training Grant GM07215. P.L.N. was supported in part by Elf-Aquitaine Company (Paris, France).
[23]
IMMUNOSCREENING
WITH
RADIOLABELED
ANTIGEN
325
[23] S c r e e n i n g of C o m p l e m e n t a r y D N A L i b r a r y Using Radiolabeled Antigen
By J U L I E
C H A O , K A R L X . CHA1,
and LEE
CHAO
Introduction The isolation of cDNA clones from expression libraries constructed with bacteriophage h or plasmid vectors has widespread applications in molecular biology. These vectors provide a bacterial promoter and ribosomal recognition sequence near a multiple cloning site. Under the control of the bacterial promoter, cDNA inserts cloned into these vectors can direct the synthesis of proper protein products, depending on the reading frame, the orientation, and the completeness of the inserts. Identification of bacterial colonies expressing fusion proteins encoded by cloned cDNA inserts in expression libraries can be achieved by several different approaches. Screening ofcDNA clones with immunological methods is popular because only specific antibodies are required so that protein sequencing and oligonucleotide construction are bypassed. ~-4 The cDNA clones expressing fused proteins of interest can be identified by polyclonal antiserum or a mixture of specific monoclonal antibodies directed against different epitopes.5 For signal detection of the translated products from cDNA expression libraries, autoradiographic, chromogenic, and immunogold methods have been described. 1-6These procedures are based on antibodies tagged with radiolabeled protein A, radiolabeled secondary antibody, secondary antibodies conjugated to enzymes such as alkaline phosphatase or horseradish peroxidase, biotinylated antibody followed by avidin-conjugated horseradish peroxidase, or gold-labeled secondary antibody. We present a procedure for the immunoscreening of expression cDNA libraries with radiolabeled antigen. The method is simple and has proved to be exceptionally sensitive and accurate in identifying correct clones in both primary and secondary screenings. We have used this method to R. A. Young and R. W. Davis, Science 222, 778 (1983). 2 D. M. Helfman, J. R. Feramisco, J. C. Fiddes, G. P. Thomas, and S. H. Hughes, Proc. Natl. Acad. Sci. U,S.A. 80, 31 (1983). 3 R. A. Young and R. W, Davis, Proc. Natl. Acad. Sci. U.S.A. 80, 1194 (1983). 4 T. V. Huynh, R. A. Young, and R. W. Davis, in " D N A Cloning: A Practical Approach" (D. M. Glover, ed.), Vol. 1, p. 49. IRL Press, Oxford, England, 1985. 5 D. Ginsburg, R. Zeheb, A. Y. Yang, U. M. Rafferty, P. A. Andreasen, L. Nielsen, K. Dano, R. V. Lebo, and T. D. Gelehrter, J. Clin. Invest. 78, 1673 (1986). 6 H. E. W. Pohl, J. Hock, and W. Muller-Esterl, Anal. Biochem. 175,414 (1988).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
326
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[23]
isolate cDNA clones encoding rat arantitrypsin 7,8 and rat kallikrein-binding protein 9 from a rat liver expression cDNA library, as well as human kininogen from a human liver expression cDNA library. This improved method can be applied in general for screening expression libraries, provided the specific antiserum and labeled antigen are available. Principle of cDNA Screening Using Radiolabeled Antigen Figure 1 shows a schematic illustration of the principle and the key steps of the method. The procedures utilize a radiolabeled antigen overlay method described originally for the immunoblotting of plasma proteins. 10 Bivalent antibodies with two antigen-binding domains have the ability to associate with two proteins that possess identical epitopes. In screening a cDNA library, recombinant polypeptide products encoded by the cDNA inserts are immobilized onto nitrocellulose filters on which they are reacted with their specific antibodies. Following the reaction, the bivalent antibodies bound monovalently to the recombinant proteins on the nitrocellulose filters will have one of their antigen-binding domains occupied, and the other one flee. If radiolabeled antigens are added to the filters, they will be bound to the second antigen-binding domain of these antibodies. When exposed to X-ray film, bound radiolabeled antigens will provide signals that locate the cDNA clones coding for the protein of interest. Materials and Reagents
Escherichia coli strain Y1090 [AlacU169 proA + Alon araD139 strA hflA supF (chr: :Tnl0), pMCg] is commonly used for immunoscreening of cDNA libraries constructed with hgtl 1 vectors. The procedures should be similar when applied to other vector-host cell pairs. Reagents TBST (Tris-buffered saline with Tween 20): 50 mM Tris-HCl (pH 8.0), 150 mM NaC1, 0.05% (v/v) Tween 20 BLOTTO '1 [5% (w/v) powdered milk in phosphate-buffered saline]: 5% (w/v) dry milk (Carnation brand, nonfat milk), 0.01 M sodium 7 S. Chao, L. Chao, and J. Chao, BioTechniques 7, 68 (1989). 8 S. Chao, K. X. Chai, L. Chao, and J. Chao, Biochemistry 29, 323 (1990). 9 j. Chao, K. X. Chai, L. Chen, W. Xiong, S. Chao, C. Woodley-Miller, L. Wang, H. S. Lu, and L. Chao, J. Biol. Chem. 265, 16394 (1990). i0 B. Lammle, M. Berrettini, and J. H. Griffin, Anal. Biochem. 156, 118 (1986). II D. A. Johnson, J. W. Gautxch, J. D. Spoasman, and J. H. Elder, Gene Anal. Technol. 1, 3 (1984).
[23]
327
IMMUNOSCREENING WITH RADIOLABELED ANTIGEN
Plate cDNA library in soft agarose with host cells
Soak NC filter in IPTG
O l
Overlay NC filter on plate and incubate at 37°
Lift, wash with TBST, and block with BLOTTO
Incubate with antibody
/
|
~
-
g',,'////,,'/-/,,',.',,'///',,',,'//,//'9,,'//,/,
Wash |
=,.•125 g
Incubate with 1251-labeled antigen
@
y/f,~.,',f fT.6~///L~//.,- j / f / / / / / Z
Wash
l
f
Autoradiography
J
FIG, 1. Schematic flow chart for immunoscreening of cDNA library with radiolabeled antigen. NC, Nitrocellulose.
328
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[23]
phosphate (pH 7.4), 0.14 M NaCl, 1 ~M p-amidinophenylmethylsulfonyl fluoride, 1 mg/liter thimerosal, 200 rag/liter NAN3, 0.01% (w/v) antifoam; store at 4 ° Phosphate-buffered saline (PBS): 0.01 M sodium phosphate, 0.14 M NaC1, pH 7.4 LB medium with maltose and magnesium: Dissolve 10 g of tryptone (Difco, Detroit, MI), 5 g of yeast extract (Difco), 5 g of NaCI, 2 g of maltose, and 2.5 g of MgSO4 • 7H20 in 1 liter of water. Sterilize in aliquots of 125 ml by autoclaving and store at room temperature LB agar plate: Autoclave 1 liter of LB medium containing 17 g of agar. Mix the contents well after autoclaving. Cool to 55 ° before pouring into petri dishes. Stack no more than 10 large (150 × 15 mm) plates and no more than 20 small (100 × 15 mm) plates; leave at room temperature for 1 week before use. For long-term storage, seal the plates in plastic bags and store at 4 °. To use plates stored in the cold, prewarm the plates in bags to room temperature the day before use LB top agarose: Autoclave 150 ml of LB medium containing 0.9 g of agarose in a suitable medium bottle. Cool to 55 ° and mix the contents by gentle shaking. Store in a water bath at the same temperature to keep liquid until used. For long-term storage, keep as a solid and reheat to melt before each use Isopropyl-fl-o-thiogalactoside (IPTG) solution (10 mM): Dissolve 238 mg of IPTG in 100 ml water; filter to sterilize SM buffer (for diluting X phage): Each liter of SM buffer contains 5.8 g of NaCI, 2 g of MgSO4 • 7H20, 50 ml of 1 M Tris-HC1 (pH 7.5), and 2% (w/v) gelatin. Autoclave to sterilize. Store in 50-ml aliquots
Materials Nitrocellulose filters (0.45/~m pore size, 137- and 82-rilna diameters) used in the screenings (Millipore Corporation, Bedford, MA) Petri dishes (150 × 15 mm and 100 × 15 mm in size) used for the library plating (Fisher Scientific, Pittsburgh, PA) X-Ray films (X-OMAT AR type, 14 × 17 in. in size) used in autotadiography (Eastman Kodak Company, Rochester, NY)
Apparatus Flat-bottom cylindrical Plexiglas containers (160 mm in diatnetct, with wall 1 cm thick × 10 cm tall). Blunt-ended forceps used to handle nitrocellulose filters (Oel~atl Sciences, Ann Arbor, MI) Orbital shakers with adjustable speed (Bellco Glass, Vin~land, N J)
[23]
IMMUNOSCREENING WITH RADIOLABELED ANTIGEN
329
Autoradiography cassettes equipped with Du Pont Lightening Plus intensifying screens (Sigma Chemical Company, St. Louis, MO) Methods
Time Considerations The whole process of screening a cDNA library with radiolabeled antigen, starting with plating of the library and ending with confirmation of the isolated cDNA clones, takes approximately 1 week, which is divided into two identical cycles, primary or high-density and secondary or lowdensity screenings.
Radiolabeling of Antigens Purified proteins (2.5 to 5.0 tzg) are labeled with 125Iby a lactoperoxidase method. Labeled antigens are separated from free 125Ion a Sephadex G-100 column, t2 Alternatively, antigens are labeled by an Iodogen method. Briefly, 1 mg of Iodogen (Pierce, Rockford, IL) is dissolved in 25 ml of dichloromethane and a 50-/xl aliquot is dried in an Eppendorf microfuge tube. Fifty microliters of 250 mM sodium phosphate (pH 7.1), 5 ~g of protein, and 0.5-0.9/.~Ci of lzsI are added to the tube containing Iodogen (the total volume varies with the antigen and the isotope) and the contents are mixed gently by vortexing and incubated at room temperature for 10 min. The reaction mixture is applied to a prepacked Excellulose GF-5 column (Pierce, Rockford, IL) equilibrated with 50 mM sodium phosphate (pH 7.4) containing 0.1% (w/v) bovine serum albumin (BSA). The column is then eluted with the same buffer and fractions of 0.5 ml are collected and counted.
Plating eDNA Library for Primary Screening 1. The day before plating the library, prepare a liquid culture of host cells by inoculating one colony of Y1090 from an LB agar plate at 37° overnight in 5 ml of LB medium in a sterile 15-ml glass culture tube with cap. 2. The next day, inoculate 0.5 ml of the overnight bacteria culture into 10 ml of fresh LB medium and shake the tube at 100 rpm in a gyratory shaker at 37 ° until the turbidity reaches a point at which the optical density reading at 600 nm (LB as background) is around 0.2 (-+ 0.05). The size of the fresh culture should be upscaled when plating a large number of plates. 3. Prewarm LB agar plates at 37° by putting them upside down in the 12 K. Shimamoto, J. Chao, and H. S. Margolius, J. Clin. Endocrinol. Metab. 51, 840 (1980).
330
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[23]
incubator. While the fresh culture is growing, prepare a number of 10-fold serial dilutions of the library to be plated in SM buffer, so that pipetting of 30,000 plaque-forming units (pfu) can be handled with less than 200/.d but greater than 10/~1, to allow pipetting accuracy. 4. Mix 300 /zl of fresh host cells (in the exponential growth phase) and 30,000 pfu of phage (in less than 200/zl) in sterile 1.5-ml Eppendorf microfuge tubes and incubate the mixture at 37 ° for 20 min to achieve adsorption of phage to host cell. 5. During the adsorption time, prewarm 15-ml sterile glass culture tubes in a heating block at 44 ° for 5 min and aliquot hot LB top agarose into these tubes to cool to the same temperature. For primary screening, use 7.5 ml of LB top agarose for each 150-ram plate. 6. Add each adsorption mixture to a tube of LB top agarose (one at a time), vortex at low speed to mix (do not generate air bubbles), and pour the entire content on a prewarmed (37°) LB agar plate on a level bench surface. Quickly rotate the plate sideways to let the melted agarose cover the whole plate. Allow the plates to solidify with the cover on for at least 5 rain at room temperature. 7. Incubate the plates upside down at 42 ° for 4 hr.
Note: Sometimes freshly made plates tend to contain too much moisture and water streaks could form on the surface of the top agarose during incubation. These water streaks will carry phage particles and cause contamination. This problem can be solved by incubating the plates in the upright position with the cover off for 30 min before covering and incubating upside down. Transferring of Recombinant Polypeptides to Nitrocellulose Filters 1. When the plates are in the incubator, wet nitrocellulose filters in 10 mM IPTG solution for 1 min and let air dry completely on a sheet of clean Whatman (Clifton, NJ) 3MM filter paper. Partially wet filters will trap air bubbles when overlayed on plates. 2. After a 4-hr incubation (when plaques are 1-1.5 mm in diameter), remove the plates from the 42 ° incubator. 3. Number the dried filters with a No. 2 pencil, and number each plate accordingly with a permanent marker on the bottom of the plate. 4. Remove the plate cover, and use two pairs of blunt-ended forceps to hold a completely dried nitrocellulose filter. Align the filter with the plate and let the middle of the filter touch the plate first. When the filter appears to be wet in the middle, slowly let the forceps down so that the wetted area of the filter can spread throughout the filter with no trapped air bubbles (which can be seen as an area of lighter intensity as compared to the air-tight background).
[23]
IMMUNOSCREENING WITH RADIOLABELED ANTIGEN
331
5. Use a clean needle to punch three asymmetrically arranged holes through the filter and the agar in a vertical manner, near the perimeter of the plate. Shake the needle head when retrieving so that the filter does not lift with the action. Mark the bottom of the plate at the position of the holes and cover each plate. 6. Incubate the plates at 37° upside down for 6 hr (do not leave longer than 9 hr).
Binding of Specific Antibodies to Immobilized Protein 1. Remove the plates from the incubator. Uncover a plate, and use a clean needle to lift a small portion of the filter so that a pair of blunt-ended forceps can hold the filter tightly. Slowly peel back the filter with the forceps and immediately submerge the filter in a cylindrical container with a sufficient amount (->100 ml) of TBST. Note that the face toward the plate should face up when submerging and the operations are carried out at room temperature until exposure of the filters to X-ray film. 2. In each container, a maximum of six filters can be processed together. Agitate the filters slowly (50-60 rpm) in TBST on a orbital shaker for 10 min. Seal and store the plates upside down at 4°. 3. Aspirate the yellowish solution and replace with 100 ml of clean TBST. Shake for 10 min. Repeat this step. 4. Remove the washing solution and add 100 ml of BLOTTO to each container. Shake at the same speed for 1 hr. On a separate piece of nitrocellulose filter, spot 1.5, 0.15, and 0.015/zg of diluted antigen (the protein used in raising the antiserum) as positive controls and shake in BLOTTO together with the filters. 5. Add antiserum at a 1 : 200 to 1 : 1000 dilution in BLOTTO, depending on the titer of the antiserum (a specific dilution ratio for a certain screening can be empirically determined by a Western blot prior to the screening). Agitate at 40 rpm for at least 90 min but no more than 6 hr. 6. Save the diluted antiserum in BLOTTO for the secondary screening. It can be kept at 4° for a month. Wash the filters by agitating slowly three times, 10 min each, in 200 ml of fresh BLOTTO.
Identifying Specifically Bound Antibodies by Radiolabeled Antigen 1. After the final wash, add 100 ml of fresh BLOTTO to each container and make sure that the filters do not attach to one another. Add the radiolabeled antigen to each container at a final concentration of 3 × 105 cpm/ml. Shake at 40 rpm for at least 90 min but no more than 6 hr. 2. Save the radiolabeled antigen in BLOTTO at 4° for the secondary screening. Wash the filters three times with BLOTTO, 10 min each.
332
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[23]
3. Wash the filters briefly (1 min) in 200 ml PBS (pH 7.4) and place them on a sheet of clean filter paper to air dry with the face toward the plate facing up when drying. Filters must dry completely before autoradiography. 4. Cut Whatman 3MM filter paper to a size of 14 x 17 in. Place the dried filters on the paper, six filters per sheet, and tape the filters to the paper with three pieces of tape along the perimeter. The filters should be arranged in an asymmetrical manner so that alignment of the film images to the filters is possible. Again, the face toward the plate faces up. Wrap the whole assembly with plastic (Saran) wrap. 5. Sandwich an X-ray film between the wrapped filters and an intensifying screen in an X-ray film cassette. This step is carried out in a darkroom under safe light. 6. Place the film cassette(s) in a - 8 0 ° freezer and expose for 12 to 36 hr.
Secondary Screening After developing the primary screening films, align the images with the filters and mark on the film the positions of the holes punched in the plates. This is normally done on a light box with the film placed on top of the wrapped filters. Mark a 5-mm circle around each positive signal. Align the plates to the images with the hole l~ositions and use the rear end of sterile Pasteur pipettes to pick up agar plugs marked by the circles. Eject the agar plug picked in the Pasteur pipette into a 2-ml screw-cap tube containing 1 ml of SM buffer and 4 drops of chloroform. Cap the tube air tight and vortex at high speed for 20 sec. Leave at 4 ° overnight. Titer the lysates using 0.3 ml of Y1090, a t O D 6 0 0 n m - -0.1-0.2, and -<0.2 ml of phage. Serial dilutions are often necessary for titering the lysates from the primary screening, but the average titer is about 10 6 pfu/ml. Repeat the procedures described above, including plating, immobilizing proteins, washing, blocking, antibody reaction, and signal detection, with radiolabeled antigen using small plates, small filters, and scaled-down solution volumes. Keep the formula for phage adsorption unchanged, and use 2.5 ml top agarose in plating instead of 7.5 ml. Adjust the number of plaques on each plate for the secondary screening to 200-300, so that enough plaques can be screened and the majority of the plaques are separated from one another. The antiserum/BLOTTO and antigen/BLOTTO mixtures saved from the primary screening can be used two or three times without replenishment of antiserum or labeled antigen. They should be prewarmed to room temperature before use. After the X-ray films of the secondary screening are developed, pick
[23]
IMMUNOSCREENING WITH RADIOLABELED ANTIGEN
A
B
333
C
M.W. 200 K97 K68 K43 K25 K18K14K-
® ]
2
1
2
1
2
Fie. 2. Comparison of signal detection methods in Western blot analysis by labeled antigen (A), labeled secondary antibody (B), and labeled protein A (C). Samples were resolved by SDS-polyacrylamide gel electrophoresis and eletrotransferred to nitrocellulose membranes. The blotting procedures are similar to that described for screening, using rabbit anti-rat tissue kallikrein antiserum. Rat salivary gland extract (10 jxg, lane 1), rat tissue kallikrein (500 ng, lane 2). the positive plaques with the tips of Pasteur pipettes. Pick only those positive clones that are not in contact with any other clones. Eject each agar plug into 500/zl of SM buffer with 1 drop of chloroform, in a 2-ml screw-cap tube. The positive clones are now ready for titering and DNA preparation.
Western Blot Analysis of Recombinant Proteins Once a single clone or a group of clones is confirmed as positive by secondary screening and individual clones are isolated, the fusion proteins produced by the phage clones can be analyzed by Western blotting.7 Figure 2 shows the comparison of three signal detection methods, using labeled antigen, labeled secondary antibody, and labeled protein A, for the identification of a 38-kDa tissue kallikrein in rat submandibular gland extract resolved by sodium dodecylsulfate (SDS)-polyacrylamide gel electrophoresis. The results show that the identification of the bound antibody with radiolabeled antigen has the best specificity (Fig. 2A) while other methods exhibit nonspecific signals under the same conditions (Fig. 2B and C).
334
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
A
[23]
B
FIG. 3. Positive signals detected by radiolabeled antigen in the screening of a rat liver
cDNA library for rat kallikrein-binding protein cDNA clones. (A) Primary screening; (B) secondary screening. Purifiedrat kallikrein-binding protein: (1) 1.5 tzg; (2) 0.15/zg; (3) 0.015 p,g.
Isolation of cDNA Clones Encoding Rat Kallikrein-Binding Protein By screening a rat liver cDNA library constructed in hgt 11 vector using radiolabeled antigen, we have successfully isolated cDNA clones encoding rat kallikrein-binding protein (RKBP), 9 a serine protease inhibitor (serpin) and a 58-kDa acidic glycoprotein. The specificity of the antiserum against RKBP was first tested in a Western blot using an antigen overlay method similar to that described above. In the primary screening 12 plates, each with 30,000 independent clones, were lifted and processed, and a total of 8 positive clones were obtained. All were confirmed by secondary screening (Fig. 3A and B). In the secondary screening, each plate had approximately 300 plaques (Fig. 3B). When RKBP cDNA was used as the probe to rescreen the library, the number of positive clones from the same number of plaques screened in the immunoscreening was five- to sixfold higher. The increase in the number of positive clones can be explained by the fact that some cDNA inserts are cloned in the wrong orientation or incorrect reading frames relative to the promoter in the vector, and hence they do not produce the correct protein to be recognized by the antibody. But a cDNA probe is able to locate all these clones regardless of their orientation and reading frames. Sequence analysis of the cloned cDNAs was used to establish the identify of the cDNA that encodes RKBP. The translated amino acid sequence of the cDNA matches completely with the N-terminal amino acid sequence of the purified protein and confirms the identity of the cDNA clones encoding RKBP. 9
[24]
SCREENING RECOMBINANT pUC-LIKE PLASMIDS
335
Concluding Remarks Immunoscreening of expression cDNA libraries with radiolabeled antigens is a sensitive and specific method for identifying cDNA clones encoding the protein of interest. We have successfully used this method to isolate cDNA clones coding for rat a~-antitrypsin, 8 rat kallikrein-binding protein, 9 and human kininogen. However, screening expression cDNA libraries with immunological methods can detect only the fraction of cDNA inserts that produce proper protein products recognized by their specific antibodies. It is often necessary to use the isolated eDNA, or oligonucleotides derived from the clones, as probes for rescreening the library to obtain full-length cDNA clones. Nevertheless, the high degree of specificity of the immunoscreening method using antigen overlay makes it a valuable alternative to other screening methods, especially when nucleic acid probes are not available for the initial screening efforts. Acknowledgments This work was supported by Grants HL 29397 and HL 44083 from the National Institutes of Health.
[24] A l t e r n a t i v e s to X - G a l a c t o p y r a n o s i d e in S c r e e n i n g Recombinant Clones Based on pUC-Derived Plasmid Vectors B y PETR KARLOVSKY
Introduction
The standard repertoire of a molecular geneticist includes pUC plasmids as cloning vectors.l These plasmids allow detection of clones with inserts based on the color of colonies on plates containing X-Gal (5-bromo4-chloro-3-indolyl-/3-o-galactopyranoside) and IPTG (isopropyl-/3-D-thiogalactopyranoside). This color-based selection of recombinants proved so useful over the years that it was employed in the construction of the great majority of new vectors aimed to facilitate cloning, sequencing, mutagenesis, in vitro transcription, and other procedures of DNA analysis and manipulation. X-Galactopyranoside is too expensive for routine cloning experiments 1 C. Yanisch-Perron, J. Vieira, and J. Messing, Gene 33, 103 (1985).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
336
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[24]
and the plates cannot be stored for long. There are two alternatives: The use of MacConkey plates and the examination of colony size under conditions of lac induction. This chapter assesses the usefulness of these methods with 17 common cloning vectors.
Principle The principle of screening on X-Gal plates is the so-called a-complementation. A host strain carries the mutation lacZAMl5 in its/3-galactosidase gene, which is complemented by a small fragment of the lacZ product (o~ peptide) coded for by the plasmid vector. Inserting a DNA fragment into the polylinker disrupts the coding region for the a peptide and results in the loss of the /3-galactosidase activity, which can be monitored on indicator plates. Some host strains used for a complementation carry a superproducing allele of the lac repressor laclq. In these strains lacZAM 15 expression must be induced by the artificial inducer IPTG. A classical means for detecting fl-galactosidase, MacConkey/lactose plates, 2 was reported not to be sensitive enough in response to a weak activity resulting from a complementation.1 In spite of this, MacConkey plates were used for screening pUC clones in different laboratories over the years, but the method did not work every time. For this reason it was not published until a recent short note appeared. The publication did not specify the plasmid used. 3 However, this seems to be a critical point because we found that MacConkey plates work with some but not all pUC plasmids and related vectors. At least some of these differences are corroborated by a report that states that most commercially available pUC18 plasmids carry a mutation in the lacZa region that decreases the /3-galactosidase activity up to 50 times. 4 The last method for selection of recombinants does not use any flgalactosidase substrate at all. It is based on the observation that growth of E. coli colonies containing some pUC-related plasmids is inhibited under conditions of lac induction and that interrupting the lacZo~ frame by cloning DNA fragments into the polylinker counteracts this inhibition. 5 As a result, the colonies with inserts appear larger than the background colonies.
2 j. H. Miller, "Experiments in Molecular Genetics." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1972. M. P. Jennings and I. R. Beacham, BioTechniques 7, 1082 (1989). 4 y . Lobet, M. G. Peacock, and W. Cieplak, Nucleic Acids Res. 17, 4897 (1989). 5 p. Karlovsky, Nucleic Acids Res. 15, 6753 (1987),
[24]
SCREENING RECOMBINANT pUC-LIKE PLASMIDS
337
TABLE I COMPARISON OF DIFFERENT METHODS OF IDENTIFYING RECOMBINANT PLASMIDS ORIGINATING FROM pUC-L1KE VECTORS Colony size c Plasmid 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18.
)UGA ~UCI9 d 3UC18 d
3UC8 ~ ~UC9 e ~UCI2 e 9UC13 e ~UC8-1 f
X-Gal a W
MacConkey b
37°
42°
m
_
B B B B
+ -
+ -
+
+
+
-
B
-
-
B
+
+
(+)
Selected features (Control)
_
+ -+(+) + ~+
B
-
+
(+)
~UC8-2f
B
-
+
(+)
~UC9-1 f 3UC9-2 f
B
+
-
(+-)
B
-
-+
(-+)
~UCHinEcol ~
B
+
+
(+)
~KI8 h 3K19 h pBluescript g pGEM3Z j pWM528 k pWM529 k
B
+
-
(-)
B
+
-
(-)
B
+
+
-+
B
+
-+
+
B
+
+
+
B
+
+
+
)
Expression of cloned DNA in all possible reading frames from lac promoter Modified polylinker Kanamycin resistance for easy insert transfer All-purpose phagemid SP6/T7 promoters Totally synthetic plasmids
" Colonies on X-Gal plates: B, blue; W, white. ~' Suitability of the test on MacConkey plates at 37°: + , suitable (red colonies); - , unsuitable (white colonies). Suitability of the colony size test: + , suitable (distinct difference between plates with and without IPTG); - , method not applicable (no difference observed); ( ) , poor growth. J C. Yanisch-Perron, J. Vieira, and J. Messing, Gene 33, 103 (1985). J. Vieira and J. Messing, Gene 19, 259 (1982). t Z. Hanna, C. Fregeau, G. Prefontaine, and R. Brousseau, Gene 30, 247 (1984). H. J. Edenberg, L. G. Moss, and W. J. Rutter, Gene 58, 297 (1987). h R. D. Pridmore, Gene 56, 309 (1987). g pBluescript II exo/mung DNA sequencing system (Stratagene, La Jolla), 1989. J Promega Catalog and Reference Guide: Riboprobe Gemini System (Promega, Madison, WI), 1987. W. Mandecki, M. A. Hayden, M. A. Shallcross, and E. Stotland, Gene 94, 103 (1990).
Material and Reagents
Escherichia coli J M 1 0 9 [recA1 endA1 gyrA96 thi hsdR17 supEA4 relA1 ~ - A(lac-proAB), ( F ' traD36 p r o A B laclqZAM15) '] is u s e d t h r o u g h o u t t h e s t u d y . R e f e r e n c e s t o p l a s m i d s a r e l i s t e d i n T a b l e I. p U G A is c o n s t r u c t e d b y i n s e r t i n g a 4 5 - b p o l i g o n u c l e o t i d e c a r r y i n g U G A c o d o n s i n all t h r e e
338
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[24]
frames into the polylinker in pUC19.1 An IPTG 100× stock solution is made 0.1 M in water and stored at - 20°, and an X-Ga1500 × stock solution is made (20 mg/ml) in dimethylformamide and stored at 4 °. Both substances are added into an autoclaved L medium that has been cooled to 45-50 °. MacConkey agar is bought from Difco (Detroit, MI). Solid lactose is dissolved in the autoclaved MacConkey medium (45-60 °) to the concentration 10 g/liter. L medium contains 10 g tryptone (Difco), 5 g yeast extract (Difco), 5 g NaC1, and 15 g agar per liter. Ampicillin is used at a concentration of 50/xg/ml with all plasmids except pK18 and pK19, in which it was replaced by kanamycin at the same concentration. Method I Escherichia coli transformed with a ligation mixture is plated on MacConkey/lactose plates. Up to 300 colonies can be screened on one plate. After I day at 37° colonies of two types can be seen on the plates: dark red colonies contain the original vector and white colonies, sometimes with red centers, contain recombinant plasmids. Then either small liquid cultures are inoculated or colonies are streaked on plates with antibiotics in order to isolate plasmids. 6'7 Method II In the first variant, transformed bacteria are plated on IPTG plates in a dilution that ensures that not more than 50 colonies arise on 1 plate. The plates are incubated for 36-48 hr at 37°. Colonies containing recombinant plasmids are larger than colonies carrying the original vector; this difference becomes blurred at higher plating densities. In another variant, colonies are first plated on normal ampicillin plates without IPTG and then streaked onto IPTG plates on the second day. Heavily grown streaks are scraped with toothpicks and used to isolate plasmids by a minipreparation m e t h o d 6,7 Thinly grown streaks contain the vector without inserts. Simple L plates can be used instead of IPTG plates when working with a strain that does not overproduce lac repressor (HB101, DH1, etc.). Comparison of Both Methods with Different Plasmid Cloning Vectors To assess the practicability of both methods with various pUC-like vectors, we compared the colony phenotype of the standard laboratory 6 H. C. Birnboim, this series, Vol. 100, p. 243. 7 M. G. Riggs and A. McLachlan, BioTechniques 4, 310 (1986).
[24]
SCREENING RECOMBINANT pUC-LIKE PLASMIDS
339
strain E. coli JM109 ~transformed with 17 cloning vectors on MacConkey plates, X-Gal plates, and L plates with and without IPTG. Colony size on L plates without IPTG was used to imitate plating ofE. coli with plasmids harboring inserts on media containing IPTG because using one specific insert would hamper the generality of the results (see Concluding Remarks, below). These experiments were performed at two temperatures because the difference in colony size generally increases with temperature, but some strains grow poorly at 42 ° (unpublished observations). The results are shown in Table I. X-Galactopyranoside plates can be replaced by MacConkey plates when working with 12 plasmids. This property does not correlate with the inhibition of colony formation on lac induction, indicating that the cause of growth inhibition is not 3galactosidase activity. The best results regarding colony size selection were often obtained after 2 or 3 days, especially when working with vectors labeled as conditionally suitable (-+) in Table I. Concluding Remarks With many pUC-like plasmid vectors, X-gal plates can be substituted by the cheap and stable MacConkey medium. As an alternative, a method can be used that is based on the difference in colony size between strains carrying a plasmid with an insert and those containing only a vector. This latter method demands either the presence of IPTG in the medium or the use of strains without the laclq allele. Both methods are useful in reducing the number of clones screened in routine cloning experiments without extra effort and expense. Simple examination of colonies before plasmid isolation can give a clue regarding the plasmid content. The methods are limited to (nonidentical) subsets of vectors tested. Other limitations are cloning of short inserts functioning as open reading frames (which preclude X-Gal selection, too) and inserts that inhibit the growth of the host strain or express fl-galactosidase activity. Acknowledgment I wish to thank Howard J. Edenberg, RaymondD. Pridmore, and WlodekMandeckifor providing me with the plasmid vectors used in this study, as well as Margaret Nemec for correctingthe Englishmanuscript.The skillfultechnicalassistanceofJohannaAueris greatly appreciated. This work was supported by a grant from the Deutsche Forschungsgemeinschaft.
340
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[25] R a p i d C o l o n y H y b r i d i z a t i o n o n W h a t m a n Using Oligonucleotide Probes
[25]
541 P a p e r
B y GARY V. PADDOCK
Finding one desired gene in a mixture of many recombinant plasmids is a problem that must be solved often in molecular biology and can be accomplished by colony hybridization techniques using oligonucleotide probes. Utilization of the technique can vary from screening large numbers of bacterial colonies from a recombinant cDNA library using multiple degenerate probes, to finding one particular mutant among many potential variants, to the even more simple problem of checking the orientation of a DNA fragment inserted into a vector. All of these problems can be solved because the sensitivity of the colony hybridization technique is such that a single-base mismatch can be detected. The principles involved in colony hybridization are simple.l Colonies of bacteria are either grown directly on a filter placed on agar growth medium or are otherwise transferred by contact to a filter or membrane after growth on agar-supported medium and then lysed in situ with alkali, during which the DNA is also denatured and fixed to the filter. After neutralization and drying, the filter-bound DNA may be hybridized to a labeled oligonucleotide probe at a temperature designed to give the desired stringency. After subsequent washing and drying of the filters, they are autoradiographed by contact with X-ray film and the positions of colonies containing the desired genes thus determined. The desired colonies are then retrieved from a master plate for further analysis. Colony hybridization has been carried out using several types of supports. 2 Nylon membranes are the most durable with regard to resistance to damage and repetitive use but are also the most expensive and require many steps similar to those required for nitrocellulose. Nylon membranes from different manufacturers require different treatments and the instructions of the manufacturer must be followed closely for optimal results. Nitrocellulose, which traditionally has been the method of choice, 1-3 is less costly than nylon but can still be a considerable expense. Nitrocellulose is structurally poor. It distorts and cracks during drying; during handling, it 1 M. Grunstein and D. S. Hogness, Proc. Natl. Acad. Sci. U.S.A. 72, 3691 (1975). 2 j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989. 3 T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual." Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982.
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
[25]
COLONY HYBRIDIZATION ON PAPER
341
is subject to tearing when wet and chipping when dry. It can leave spurious spots due to possible poor wetting, retention of bacterial debris, or unincorporated label. Our preferred choice has been Whatman (Clifton, N J) 541 paper. 4'5 It is economical, sturdy when either wet or dry, and can be easily labeled with pen or pencil. In comparison to other hybridization supports, several steps such as baking in a vacuum oven, prehybridization, and some probe purification steps can be eliminated. Only simple buffered salts are required, yet background or dot noise is seldom evident. In our hands, 5 no special steps such as steam treatment 2'6'7 are required to obtain a hybridization signal equal to or better than that for nitrocellulose. Consequently, this method allows a low-budget laboratory to perform experiments with substantial reduction of cost and labor.
Materials Oligonucleotide probe A (5'-CACTATAACCCGTGC-3'), probe B (5'CACTATCACCCGTGC-3'), probe C (5'-AACAAGAGGAAGAGGAAGGTT-3'), probe D (5'-GAGGCTGTCAACAAGAGG-3'), and probe E (5'AGGAAGGTTAACTTCAAA-3') are synthesized using the Applied Biosystems (Foster City, CA) model 380B DNA synthesizer and washed with ethanol in accordance with the instructions of the manufacturer. No further purification is needed prior to labeling. [y-32P]ATP at 3000 Ci/mmol is obtained from New England Nuclear (Boston, MA). Polynucleotide kinase is from New England BioLabs (Beverly, MA) or Bethesda Research Laboratories (Gaithersburg, MD). Transfer RNA is from Bethesda Research Laboratories. Whatman 541 (W541) and 3MM filter paper, Difco growth media, and common chemicals are from Fisher Scientific (Norcross, GA). Note that precut 8-cm (#1541M080) and 132-ram (#1541M132) circular W541 filters are now available from Whatman. Ampicillin and Sephadex G-50 are from Sigma (St. Louis, MO). Escherichia coli RR1 contains plasmids pGEM-2 (Promega, Madison, WI), pBR322 (Bethesda Research Laboratories), pSP6/aa-ll5, pSP6/aa-44, pSP6/aa-44B, 8 or no plasmid. RepliPlates are from FMC (Marine Colloids Div., Rockland, ME). X-Omat XAR-5 X-ray film is from Kodak (Rochester, NY) and Cronex Hi-Plus intensifying screens are from Du Pont (Wilmington, DE). Hybrid4 j. p. Gergen, R. H. Stern, and P. 5 G. V. Paddock, BioTechniques 5, 6 R. Maas, Plasmid 10, 296 (1983). 7 W. E. Hill, W. L. Payne, G. Zon, (1985). 8 G. V. Paddock, BioTechniques 7,
C. Wensink, Nucleic" Acids Res. 7, 2115 (1979). 13 (1987). and S. L. Mosley, Appl. Environ. Microbiol. 50, 1187 856 (1989).
342
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
125]
FIG. 1. Autoradiography of colony hybridization filters. Left: pSP6/aa-115 filter with probe A exposed for 6 hr. Middle: pSP6/aa-115 filter with probe B exposed for 6 hr (note that this probe caused an increased but not relatively significant background noise. Even this level of background noise is highly unusual for this technique). Right: pGEM-2 filter with probe A exposed for 17 hr. Arrows on autoradiographs point to labeling of the filter with a Sharpie pen. TH = 41 °. [From G. V. Paddock, BioTechniques 5, 13 (1987) with permission.]
ization bag materials (2 mm thick) are Micro-Seal (8-in.-wide role) or Seala-Meal (10-in.-wide roll), both from Dazey (Industrial Airport, KS). Methods Plasmids are transformed into E. coli RRI as described by Coggins et al. 9 and spread onto L-Ap plates 5 containing 10 g Bacto-tryptone, 5 g Bacto yeast extract, 10 g NaCl, 0.8 g Dextrose, 2 ml I N NaOH, 14 g Bacto-agar, and 100 mg ampicillin per liter. Incubation is overnight at 37°. The colonies are then replicated onto additional L-Ap plates and incubated 8 hr at 37 ° (see Fig. 1). Because of the competition from satellite colonies characteristic of growth on ampicillin, 3 the growth rates for the bacterial colonies are not uniform. Colonies should not be allowed to grow beyond I to 2 ram. Alternatively, the colonies may be picked onto several L-Ap plates (see Fig. 2) in identical arrays. Replica plating may be carried out using FMC RepliPlates. Plates should be well dried before replication or liquid will be pressed out, causing the colonies to spread. If a long-term storage master plate is desired, the last plate in the replication series should contain 10% (v/v) glycerol. The long-term storage plate is incubated at 37 ° overnight (little actual growth will be visible) and then stored at - 70 °. The RepliPlate sponge device can also be stored at - 7 0 ° as it too will carry the pattern of colonies for a considerable time. Once the master and replicated plates are prepared, the following steps 9 L. W. Coggins, G. J. Grindlay, J. K. Vass, A. A. Slater, P. Montague, M. A. Stinson, and J. Paul, Nucleic Acids Res. 8, 3319 (1980).
[25]
COLONY HYBRIDIZATION ON PAPER
343
FIG. 2. Colony hybridization to find inserted sequence. Various colony isolates were picked onto L-Ap plates and the colonies screened with (left) probe C at TH = 53°, (middle) probe D at TH = 53°, or (right) probe E at TH = 43° in an attempt to isolate a recombinant with codons for basic amino acids (underlined) inserted into the HinclI site of pSP6/aa-44 in the proper orientation (5'-GAGGCTGTC/AACAAGAGGAAGAGGAAGGTT/AACTTCAAA-3'). A clone (arrows) that hybridized strongly to all three probes was arbitrarily chosen from several possibles and designated pSP6/c~a-44B.8pBR322 and pSP6/aa-44 negative controls were spotted in a right-hand vertical row (not visible). Heavy markings are the result of labeling the filter with a Sharpie pen.
m a y be used for filter preparation, probe preparation, and hybridization. Although seldom a p r o b l e m , filters should be p r e p a r e d in duplicate from identical plates to avoid spurious false positives. The amounts of wash solution given for filter washes are sufficient for batches of 10 to 20 filters.
Filter Preparation 1. UV-sterilized W541 filters labeled with a black Sharpie pen (Sanford, Bellwood, IL) are laid onto the plates in contact with the replicated colonies and incubated 2 hr at 37 °. A sterile needle is then used to punch orientation holes through the filter and into the agar. 2. The filters are then placed colony side down on L agar plates containing 150/~g/ml chloramphenical (L-C) and incubated overnight at 37 °. 3. T h e filters are then carefully peeled f r o m the plates with tweezers and are then w a s h e d batchwise with shaking (500 ml each wash) at r o o m t e m p e r a t u r e in a 21 x 31 x 6.5 c m plastic container (5 min each wash). The technique for the first wash is to set each filter on the liquid surface, colony side up, and let it sink or slide in gently. Subsequently, little care need be taken. All surface debri will be easily r e m o v e d in the first washes. W a s h twice with 500 ml 0.5 M N a O H , twice with 500 ml 0.5 M Tris-HC1, p H 7.4, twice with 500 ml 2 x SSC, p H 7.0 ( 2 0 x SSC is 3 M NaCl, 0.3 M sodium citrate), and once in 500 ml 95% (v/v) ethanol.
344
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[25]
4. The filters are then removed with tweezers and air dried, colony side up, on a sheet of Whatman 3MM paper. No baking is required.
Probe Preparation 1. The probes (100 to 330 ng) are labeled using [y-32p]ATP (100/zCi; New England Nuclear) and 10 units T4 polynucleotide kinase (Bethesda Research Laboratories or New England BioLabs) in 30/xl 50 mM TrisHC1 (pH 7.5), 10 mM MgCI2,5 mM dithiothreitol, 0.1 mM spermidine, 0.1 mM ethylenediaminetetraacetic acid (EDTA) and incubated at 37° for 20 rain. Ten additional units of enzyme is added for another 20 rain incubation period. 2. EDTA is then added to 10 mM and the reaction mix extracted once with phenol. 3. The labeled probe is then mixed with 100/~g tRNA and then purified free of precursors by chromatography through Sephadex G-50 (fine) in a 2-ml pipette (0.4 x 22 cm), using 10 mM Tris-HCl (pH 8.0), 1 mM EDTA (TE) and collecting 2-drop fractions. The column is prepared for use with a prerun of 100 ttg tRNA. Other optional purification procedures are discussed below. 4. Peak fractions are pooled and the specific activity calculated ( - 1-5 x 108 cpm//~g). 5. The probe (1-10 x 10 6 cpm to provide approximately 2 to 4 ng/ filter) is mixed with 10 mg tRNA in 1 ml 6 x SSC. 6. Just prior to use the probe mix is heated to 90 ° for 3 min and then quick cooled in ice water.
Hybridization 1. Each filter is wetted in 6 x SSC, briefly blotted on 3MM paper, and placed in a bag. Depending on filter size, the bags may be fashioned from roles of 2 mil thick plastic sealing pouch material (see Materials, above). Up to 10 filters may be placed in a bag. Alternatively, as many filters as required may be placed in a round plastic container that has a diameter only slightly larger than the filters. The container must have vertical rather than sloping sides so that the filters will not "ride up" the sides during shaking. 2. Two to 4 ml of 6 x NET (20 x NET is 3 M NaC1, 20 mM EDTA, 0.3 M Tris-HC1, pH 8.0) per filter is added to the bag. For plastic containers, the amount needed to cover the filters may vary somewhat depending on the vessel geometry. 3. Probe mix is heated and quick cooled and then added to the bag or other container.
[25]
COLONY HYBRIDIZATION ON PAPER
345
4. The bag is sealed with a heat sealer, removing as many air bubbles as possible in the process. Seal at least twice to prevent leakage. If a plastic container is used, simply cover with a tight fitting lid. 5. The filters are hybridized at the hybridization temperature (Tr0, derived from Tn = TD -- 5 °1° with gentle shaking overnight. In our experiments TH varies from 41 to 53° and the incubation is for 16 hr. The To is the temperature at which 50% of the duplexes are dissociated 11 and can be satisfactorily determined for these purposes by TD (°C) = (2 × number of AT base pairs) + (4 × number of GC base pairs).12 6. The bag is opened at one corner and the hybridization mix drained away. 7. The filters are removed from the bag or small container using tweezers and moved to a larger container and washed four times (batchwise) with 1 liter 6 × NET for 10 rain each at room temperature. Again it is important for the container to have vertical walls. 8. The filters are dried colony side up on Whatman 3MM paper. 9. The filters are then attached to a firm support (plastic sheet or glass plates), wrapped in plastic wrap, and autoradiographed by exposure to X-Omat XAR-5 film. The exposure time can be reduced by a factor of five by placing the film between the filters and Cronex Hi-Plus intensifying screens and exposing at - 7 0 °. 10. The probe can be removed 4 and the filters prepared for reuse by repeating the filter preparation washes described above (step 3 under Filter Preparation, above).
Discussion The procedures described above are based on the premise that simplicity is the best policy, at least when using Whatman 541 paper. Thus we have eliminated steps found elsewhere such as prehybridization, 13 filter steaming, 6'7 complex buffers using Denhardt's solution or sodium dodecyl sulfate ( S D S ) , 14 prepurification of the oligonucleotide before labeling, I° ~0 S. L. Berent, M. Mahmoudi, R. M. Torczynski, P. W. Bragg, and A. P. Bollon, BioTechniques 3, 208 (1985). N R. B. Wallace, J. Shaffer, R. F. Murphy, J. Bonner, T. Hirose, and K. Itakura, Nucleic Acids Res. 6, 3543 (1979). ~2 S. V. Suggs, T. Hirose, T. Miyake, E. H. Kawashima, M. J. Johnson, K. Itakura, and R. B. Wallace, in "Developmental Biology Using Purified Genes" (D. D. Brown, ed.), pp. 683-693. Academic Press, New York, 1981. 13 R. B. Wallace, M. J. Johnson, T. Hirose, T. Miyake, E. H. Kawashima, and K. Itakura, Nucleic Acids Res. 9, 879 (1981). ~4R. B. Wallace and C. G. Miyada, this series, Vol. 152, p. 432.
346
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[25]
and even postpurification of the oligonucleotide after labeling. 2 Chromatographic purification of the probe after labeling is actually no longer necessary for this purpose because a high percentage of the label will be incorporated into the oligonucleotide 2 using our conditions.5 [y_aEp]ATP label with higher specific activities of up to 7000 Ci/mmol is now commercially available, as are procedures for its u s e . 2'14 We have chosen to incorporate a higher percentage of label into a probe at a lower specific activity by using higher oligonucleotide concentrations, but the ratios of oligonucleotide and label can be varied considerably as required. 2 In fact, by using the labeling procedure described here, so much of the label is incorporated that postpurification of the probe can be eliminated altogether (M. Andrake, personal communication of unpublished observations, 1990). However, simple precipitation procedures using ethanol or cetylpyridinium bromide (depending on oligonucleotide length) are available 2 if needed. The formula 1°,12,14used here for the hybridization temperature seems to work well for oligomers containing from 15 to 21 nucleotides. Signals for a perfect match will be about l0 to 20 times stronger than those for a singlebase internal mismatch, 5,1° as seen in Fig. 1. When using mixed probes, calculating To for the probe with the highest AT content (i.e., TD min) and using a hybridization temperature of Tn = TD - 2 ° has been recommended.14 The use of such common conditions for mixed probes may lead to false positives,2 which can be discovered in part by raising the wash temperatures and comparing autoradiographs after washes at the different temperatures. 14False positives can, however, be more rigorously excluded by hybridization to a second pool of oligonucleotides with sequences predicted from a different region of the protein whose gene is desired. 2 We have satisfactorily stored colony replica masters for over 2½ years on the glycerol plates. One can replicate a new agar master using the FMC RepliPlate from either a plate still frozen (small yield) or a plate warmed and dried for 30 to 60 min. A problem with setting the plates out, however, is that condensation will develop and the colonies may spread. We have found, however, that one can store the original FMC RepliPlate, which will also maintain a colony master that can later be replicated onto new agar plates. In summary, the use of Whatman 541 filters for colony hybridization features simplicity, sensitivity, and economy, as well as the durability required for repeated use. Acknowledgments This research was supported in part by a Medical University of South Carolina Biomedical Research Support Grant. We are grateful to Mark Andrake for discussion of unpublished results and to Cheryl Alston for assistance on the manuscript.
[26]
LARGE INSERT
LINKING-CLONE
LIBRARIES
347
[26] L a r g e I n s e r t L i n k i n g - C l o n e L i b r a r i e s : Construction and Use B y A N N E M A R I E POUSTKA
Introduction
Linking clones are cloned fragments surrounding the restriction sites for a specific rare-cutting restriction enzyme. Linking-clone libraries therefore are natural complements to the rare-cutter jumping clone libraries. ~.2 Linking clones play a major role in physical mapping approaches, because they identify the position of the rare-cutter restriction site in a physical map, and inherently detect two fragments at the same time. In contrast to random probes, which have a correspondingly lower probability of identifying the shorter restriction fragments, linking clones are evenly distributed on restriction fragments of all size classes. The result is a low density of clones in regions of large fragments, and a high clone density in areas in which many rare-cutter sites occur, and therefore requiring more probes. Rare-cutter restriction sites in mammalian DNA are often part of CpG islands, found in association with promoters of genes. Linkingclone libraries from mammalian DNA therefore are enriched in genecontaining sequences) Because linking-clone libraries contain a subset of genomic library clones, similar protocols and vector-host combinations can be used for both library types. The exact protocol to be used for the construction of a linking-clone library can therefore be chosen, depending on the size of inserts needed, and the amount of DNA available. To allow the isolation of clones from a specific region of the genome, linking-clone libraries are often constructed from somatic cell hybrids, which contain the region of interest as, for example, the only human component in a hamster background. 4 Clones can then be plated, and screened by hybridization with labeled human repeat sequences to identify recombinants containing human DNA. To allow the identification of most or all human clones, linking clones constructed by this route should have t A. Poustka, this volume [27]. 2 A. Poustka and H. Lehrach, Trends Genet. 2, 174 (1986). 3 A. P. Bird, Nature (London) 321, 209 (1986). 4 T. M. Pohl, M. Zimmer, M. E. MacDonald, B. Smith, M. Bucan, A. Poustka, S. Volinia, S. Searle, G. Zehetner, J. J. Wasmuth, J. Gusella, H. Lehrach, and A.-M. Frischauf, Nucleic Acids Res. 16, 9185 (1988).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
348
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[26]
fairly large inserts, while the efficiency of library construction is less important. Other approaches can, however, be used to isolate region-specific linking clones, leading to the choice of different protocols for library construction. Examples are the use of fluorescence automated cell sorting (FACS) to isolate small amounts of DNA from specific chromosomes, 5 or the construction of linking clones from preexisting region-specific libraries .6 The protocols described here allow the construction of large insert linking-clone libraries, and can therefore be used to construct regional libraries based on somatic cell hybrids. In addition to considering the type of starting material, it is important to consider the effect of sequence differences and methylation pattern of the DNA used. To ensure that the linking and jumping libraries are complementary, or to allow the optimal identification of cleaved rarecutter sites in physical map construction, 7 it is advantageous to use the same DNA in linking-clone library construction that has been used for constructing complementary jumping libraries, or will be used in pulsedfield gel analysis. Because the methylation pattern of the DNA is lost during cloning, any linking-clone library constructed from precloned DNA 6 will contain additional clones containing rare-cutter sites, which are not cleaved in genomic DNA due to CpG methylation.
Principle of the Method Similar to the protocol for construction of rare-cutter jumping libraries, the protocol for constructing linking-clone libraries relies on a circularization procedure to clone fragments on both sites of a rare-cutter site (Fig. 1). DNA is cleaved partially with an enzyme cutting commonly in the genome (usually MboI or Sau3A) to a size range appropriate for either a h replacement vector or cosmid cloning, and circularized at low concentration. In analogy to the jumping library protocol, a tag sequence can be included at this step (Fig. IA), leading to the formation of a fraction of chimeric circles, containing both a DNA molecule and a tag. The ligation product is then treated with the appropriate rare-cutter enzyme (e.g., NotI) to linearize circles containing the corresponding sites, the linear DNA fragments are treated with alkaline phosphatase to block self-ligation, and 5 M. R. Wallace, J. W. Fountain, A. M. Brereton, and F. S. Collins, Nucleic Acids Res. 17, 1665 (1989). 6 K. Buiting, E. Passarge, and B. Horsthemke, Genomics 3, 143 (1988). 7 A. Poustka, Methods: Companion to Methods in Enzymology 1, 204 (1990).
[26]
LARGE INSERT LINKING-CLONE LIBRARIES
349
GENOMIC DNA PARTIALLY DIGESTED WITH MBO I R I
(A) PRESENCE
UGATEIN
(S) ABSENCE ~ ~
OF MARKERPLASMID (ApR SupF ) r~
R
RECLEAVEWITH RARE CUTTERENZYME(R) AND PHOSPHATASE R
1__1113. R I
I
l R I
R [
R
R I
R
R I
R
I
I
LIGATEINTOLAMBDA OR COSMIDVECTOR fir1
R I
R I
R I
R
SELECTFOR LAMBDA-SupF(MC!0611
LAMBDA-Spi" (NM 539I
COSM~D-ApR
COSMID-Km R
-Km x
FIG. 1. Schematic outline of large insert linking-library construction using h or cosmid vectors. Libraries can be c o n s t r u c t e d in the presence (A) or absence (B) of a selectable marker. Spi- (susceptible to P2 interference) refers to the genetic selection used in the E M B L vector s y s t e m to select for phages carrying inserts, t°
350
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[26]
the linearized DNA fragments are ligated with the h or cosmid vector arms cleaved at the corresponding rare-cutter restriction site. Because only a small fraction of the circles (depending on the enzyme used) will be cleaved by the rare-cutter enzyme, the vector ligation and packaging steps are simplified. If no tag has been used during library construction (Fig. 1B), by using standard selection for insert-containing clones (plating EMBL5 libraries on NM539, standard cosmid library cloning) the cloned population will contain a variable fraction of small rare-cutter fragments. If selection for a tag sequence is carried out [EMBL5 libraries plated on MC1061(P3), cosmids containing appropriate tags on selection plates], the tag will mark the junction between the sequences from the two sides of the rare-cutter site. Use of tags does, however, significantly reduce the overall cloning efficiency. DNA Concentration Circularization reactions must be carried out at sufficiently low DNA concentration to ensure that for each DNA molecule the local concentration of the other end of the same molecule will be much higher than the overall concentration of the ends of other molecules in the solution. Because it can be estimated, 2'8 that for a 50 kilobase (kb) molecule the probability of intra- and intermolecular ligation will be equal at a DNA concentration of approximately 10 tzg/ml, DNA concentrations of less than 1/zg/ml must be used during the construction of linking-clone libraries in cosmid vectors to ensure a background of less than 10% ofintermolecular ligation events. I f a tag sequence is used, this must be added at a molar concentration equivalent to the local concentrations of the ends in the circularization reaction (0.3 nM for circularizing a 50-kb molecule). The fragment size for construction of a h linking-clone library is less than half that for the cosmid linking-clone library construction, therefore slightly (square root of two-fold) higher DNA concentrations can be used in the circularization reaction. As described for jumping libraries, the tag concentration must be increased by the third power of the square root of two to have a high probability of forming chimeric circles containing both DNA fragment and the tag sequence. Materials In addition to the materials described in the chapter on construction and use of rare-cutter chromosome jumping libraries in this volume, l the following materials are used. 8 F. S. Collins and S. M. Weissman, Proc. Natl. Acad. Sci. U.S.A. 81, 6812 (1984).
[26]
LARGE INSERT LINKING-CLONE LIBRARIES
351
Tag Plasmid (Marker Plasmid) For linking-clone library construction in h vectors, plasmids containing bacterial suppressor genes 9 described in jumping library construction are used as tags. ~ Small plasmids or isolated antibiotic resistance tags can be used for the construction of linking libraries in cosmid vectors. The plasmid pUC8 (carrying an ampicillin resistance gene) can be used for the construction of a linking library in the vector Lawrist 7, carrying a kanamycin resistance gene. Because cosmid library construction is a factor of 10 less efficient than construction of a h library we usually do not use tag sequences in this protocol.
Vectors EMBL5 4 is a derivative of EMBL3,1° in which N o d sites replace the BamHI sites of the polylinker sequence. The cosmid vectors used for construction of linking-clone libraries are Lawrist7 (containing a N o d site) and Lawrist8 (containing an MluI site). Lawrist vectors are based on a cosmid vector containing a h replication origin and a kanamycin resistance gene constructed by P. de Jong (Lawrence Livermore Laboratories, Livermore, CA) and will be provided on request.
Bacterial Hosts NM538:ED8654 supF hsdR 1'~° NM539: NM538(P2cox3) l'l° MCI061(P3) ~ DH5a: fecAl (BRL)
Reagent Loening buffer (40x) 348 g Trizma base, 479.2 g NaH2PO4.2H20, 28.4 g ethylenediaminetetraacetic acid (EDTA); add H20 to 2 liters Linking Library Construction Two different protocols will be described, resulting in either h4 or cosmid (unpublished observations, 1992) linking-clone libraries. The vector EMBL5 can be used to construct NotI linking-clone libraries. Lawrist 7 and 8 cosmid vectors can be used for NotI, MluI, or BssHII library construction. 9 H. V. Huang, P. F. R. Little, and B. Seed, in (R. Rodriguez, ed.). Butterworths, London, 1987. i0 A.-M, Frischauf, H. Lehrach, A. Poustka, and N. Murray, J. Mol. Biol. 170, 827 (1983).
352
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[26]
If marker plasmids are used in library construction, follow the detailed protocol in construction of chromosome jumping libraries (procedures II-IV). i
Procedure I: Linearization of the Vector DNA EMBL5. Ten micrograms of EMBL5 is digested to completion in 50/xl of 1 x high buffer [10 mM Tris-HC1 (pH 7.6), 10 mM MgCI 2 , 1 mM dithiothreitol (DTT)] containing 10/zg bovine serum albumin (BSA) and 30 units NotI for 4 hr at 37°, and then transferred to ice. A 1-/~1 aliquot is heated for 3 min to 68 °, and electrophoresed on a 0.7% (w/v) TAE (50 x TAE: 242 g Trizma base, 57.1 ml glacial acetic acid, 100 ml 0.5 M EDTA, pH 8.0) agarose gel. If the digestion is complete, 10 units of EcoRI is added (to inactivate the middle fragment of the ~ vector) and the sample is incubated for 1 hr at 37°. EDTA is added to 12 mM, the DNA is phenol extracted, ethanol precipitated, and collected by a 10-rain spin in an Eppendorf centrifuge. The pellet is washed with 70% (w/v) ethanol, air dried, and dissolved to a concentration of 0.25/xg//zl in TE. Lawrist 7/8. Lawrist DNA (20 ~g) is digested to completion in 200/zl of 1 x high buffer containing 100/zg BSA and ScaI (2 U/~g). The mixture is incubated for 2 hr at 50 ° to linearize the vector. If digestion is complete, phosphatase treatment and control is performed as described for the tag plasmid in Ref. 1 (procedures III and IV). If phosphatase treatment has been successful the cloning site is cut to create vector arms. 1~ Digestion with NotI and phenol and ethanol precipitation are performed as described for EMBL5 and the sample is dissolved to a concentration of 0.25/zg//.d in TE. Procedure H: DNA Insert Preparation Construction of genomic libraries, and especially cosmid libraries, requires a high-quality DNA preparation with most fragments larger than a few hundred kilobases in length. 12To control the partial digest reactions, enzyme concentration or incubation time can be varied, or the partial digest can be controlled by using varying ratios of MboI and Dam methylase. 13 The following describes a protocol based on varying incubation time. Partial Digests: Analytical Scale (Varying Incubation Time). Thirty J1 A. Poustka, H. R. Rackwitz, A.-M. Frischauf, B. Hohn, and H. Lehrach, Proc. Natl. Acad. Sci. U.S.A. 81, 4129 (1984). 12 B. G. Herrmann and A.-M. Frischauf, this series, Vol. 152, p. 180. 13 j. D. Hoheisel, D. Nizetic, and H. Lehrach, Nucleic Acids Res. 17, 9571 (1989).
[26]
LARGE INSERT LINKING-CLONE LIBRARIES
353
microliters of reaction mixture contains 1/~g of DNA and 1 x high buffer. A 4-/-d sample is taken (0 time point) and 0.1 U MboI (3 U/~I; New England BioLabs, Beverly, MA) is added. Incubation is at 37°, and 5-t~l samples are taken at 10, 20, 30, and 40 rain into Eppendorf tubes containing 5 ~1 50 mM EDTA on ice. Samples are heated for 10 min at 68°, loading dye is added, and samples are analyzed by overnight electrophoresis through a 0.35% (w/v) agarose gel in Loening buffer at 1.5 V/cm. X ci857 DNA, uncut and cut with HindIII, is used as size marker. Partial Digests: Preparative Scale. Based on the results of the analytical digests, appropriate conditions for preparative digests are selected to give maximal amounts of DNA in the 50-kb range (usually between 20 and 30 rain for this protocol). It is important to choose conditions under which there is still some DNA in the zone of limiting mobility. In general, it is better to use digestion conditions that give slightly underdigested DNA samples. Partial digests prepared for cosmid library construction can also be used for )~ libraries (with a slight loss in efficiency). For preparative-scale partial digests, the same conditions as for the analytical reaction are used (10 p~g DNA in a volume of 300 ~1). A 4-~1 aliquot is taken before enzyme addition, and the mixture is warmed up to 37°. After adding 1 U MboI, incubation is started, and three time points are taken, determined from the analytical partial digest results (e.g., 70 ~1 at 15 rain, 150/~1 at 20 rain, and 70/~1 at 30 min). To each time point 20 mM EDTA is added immediately to stop the reaction. Samples are heated for 10 min to 68°, 5-/~1 aliquots are taken for gel analysis, and the samples are ethanol precipitated. Pellets are washed with 70% (v/v) ethanol, air dried, and taken up in TE to a concentration of 0.25/~g//~l. Based on the size distribution found in gel electrophoresis, appropriate samples are pooled for library construction.
Procedure III: Circularization Reaction Circularization reactions can be carried out either in the presence or in the absence of a tag plasmid. Selection for a tag plasmid reduces the overall efficiency of the process. However, it has the advantages of avoiding the background of short rare-cutter fragments in the genome and thus simplifies the localization of the junction point. Ligation without tag does give rise to higher overall efficiency of library construction, and is therefore preferable in the construction of linking libraries in cosmid vectors, or from very small amounts of DNA (e.g., sorted chromosomes). Ligation A (for X). Reactions contain the following in a total volume of 2 ml: I x ligase buffer, 1.25 ~g of DNA/ml, 1.25 /~g/ml of BamHIcleaved tag plasmid (for tag containing ligations), 50 t~g/ml BSA, 0.3 mM
354
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[26l
ATP, and 1000 U of ligase (New England Biolabs). Ligations are carried out overnight at 15°. As control for the ligation, 10 ~1 of the ligation mix containing 0.3/zg cleaved vector is incubated in parallel. After overnight incubation this sample is heated to 65 ° and analyzed by electrophoresis using a 0.7% (w/v) agarose gel in TAE. If the ligation reaction is complete, the ligase is inactivated by a 20-min incubation at 68 °. Ligation B (for Cosmids). Ligation and control is performed as described above with the exception that less insert DNA (0.8/zg/ml) is used. Because the efficiency of cloning into cosmid vectors is one order of magnitude below the efficiency of packaging X, the success of library construction depends on the extracts used. In our laboratory we use Gigapack Gold (Stratagene La Jolla, CA) with good results. Alternatively cosmid libraries can be started with more DNA (5-10/zg).
Procedure IV: Cleavage Reaction For cleavage of DNA circles, NaCI is added to 100 mM (for cleavage with NotI), 20 U NotI restriction enzyme is added per milliliter, and digestion is carried out for 4 hr at 37 °. As a control, 10/zl of the digest is taken after addition of the enzyme, and incubated with 200 ng of uncleaved vector (EMBL5). The control is analyzed by gel electrophoresis as described above. If digestion of the control DNA is complete, the reaction is stopped by adding EDTA to a concentration of 12 mM and 20/zg tRNA, which is added as carrier, and the sample is ethanol precipitated overnight at - 20°. The precipitated DNA is recovered by a 30-min centrifugation at I0,000 rpm in a Sorvall (Norwalk, CT) rotor, the pellet is washed with 70% (v/v) ethanol, air dried, and dissolved in 100/zl TE.
Procedure V: Phosphatase Treatment To a 100-~1 sample, 10/xl of medium buffer and 1 U of calf intestine alkaline phosphatase (CLAP) are added and the sample is incubated for 30 min at 37 °. Inactivation of the enzyme, phenol extraction, ethanol precipitation, and phosphatase control are as described in Ref. 1 (procedure X) The pellet is washed with 70% (v/v) ethanol, air dried, and dissolved in TE (final concentration, 100 ng//xl).
Procedure VI: Vector Ligation, Packaging, and Plating of h Library Ligation: Analytical Scale. To verify the success of the library construction, an analytical-scale vector ligation is carried out using 200 ng of insert D N A and 200 ng of vector in a volume of 10/xl, containing 1 x ligase buffer, 0.3 mM ATP, and 40 U ligase. In parallel, 1/zl of the cleaved vector DNA is ligated and the samples are incubated overnight at 15°.
[26l
LARGE INSERT LINKING-CLONE LIBRARIES
355
Packaging: Analytical Scale. One-microliter aliquots of EMBL5uncut, EMBL5-cut, EMBL5-religated DNA, and 2 ~1 of analytical reaction mixture are packaged in vitro using commercial packaging extracts. The reaction is stopped by adding 90/~1 h diluent to each reaction. Test Plating. Preparation of plating cells, phage adsorption, and plating are performed as described for jumping libraries. Dilutions plated are as follow: Ten microliters of 10 - 4 and 10 - 6 dilutions of uncut EMBL5 on NM538 Ten microliters of I0-4 and 10 - 6 dilutions of cut, religated EMBL5 on NM538 Ten microliters of undiluted, I0 -2, and 10 -4 dilutions of cut EMBL5 on NM538 Ten microliters of 10 - 4 and 10 - 6 dilutions of analytical ligation on NM538 Ten microliters of undiluted and 10 -2 dilution of uncut EMBL5 on NM539 and MCI061(P3) (if a tag plasmid was used) Twenty microliters of undiluted ligation mixture on NM539 and MC1061(P3) (if a tag plasmid was used) The expected number of plaques is 3 x 104-2 × 10 5 plaques//xg insert DNA on MC1061(P3) for tag-containing ligations. Ligations without tag give four times more plaques selected on NM539. Ligation and Packaging: Preparative Scale. Two micrograms of insert DNA and 2/zg of vector DNA are ligated in a volume of 50/zl using 1000 U of ligase (New England BioLabs) under the conditions described above. The whole sample or part of the sample can then be packaged with the commercial packaging extracts. Plating. To determine the precise number of plaques per microliter of packaging reaction, a test plating is carried out using 2 and 5 p~lof packaging mixture on the selective host [NM 539 or MC1061(P3)] and 10 /xl of 10 -2 and 10 -4 dilutions on NM538. For the preparative-scale plating the appropriate amount of packaged phage is mixed with 3 ml of an overnight culture of the selective host (check different batches to identify the batch with the highest plating efficiency) and incubated at 37 ° for 15 min. Then 30 ml of top layer agarose (agarose is better for filter lifts and for DNA preparations) is added, mixed carefully, poured onto prewarmed 22 × 22 cm Nunc (Roskilde, Denmark) screening plates containing BBL agar, and incubated until plaques are visible (8-10 hr at most, to keep plaques small). Filter Preparation. For filter screening, plates are cooled to 4° for 2 hr. Each plate is covered with a 22 x 22 cm nylon filter (Genescreen + or Hybond N +). The filters are marked with asymmetric needle holes (by sticking needles through the agar) and are left on plates for 3 min. The
356
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[26]
filters are peeled off carefully and placed, DNA side up, for 10 min on Whatman (Clifton, N J) 3MM paper moistened with denaturation solution (0.5 M NaOH, 1.5 M NaCI). They are then transferred onto neutralization solution [0.5 M Tris-HCl (pH 8.0), 1.5 M NaCI or 50 mM sodium phosphate (pH 6.5)] in a plastic box, floated for 2 min, and then submerged. Filters are air dried on Whatman 3MM paper, baked for 20 min in a vacuum oven, and treated under ultraviolet (UV) light.
Procedure VII: Vector Ligation, Packaging, and Plating of Cosmid Library Analytical Ligation and Packaging. Two hundred nanograms of insert DNA and 250 ng of cleaved vector DNA are ligated in a volume of 10/zl and incubated over night at 15°. Three microliters of ligation mixture, corresponding to 60 ng of insert DNA, and 1/xl of uncleaved vector DNA used as a control are packaged. After a 3-hr incubation at room temperature the samples are diluted with h diluent to give a volume of 60/zl. Cosmid Plating. Five and 10/zl of the packaged material (corresponding to 5 and 10 ng of insert DNA, respectively) are then incubated with 100 tzl of an overnight culture (prepared as described 1) of the bacterial host (DH5o0 for 15 min at 37 °. LB medium (600 /zl) is added and the sample is incubated for 1 hr at 37° with shaking to allow expression of the kanamycin resistance gene. The culture is centrifuged for 1 min in an Eppendorf centrifuge and each pellet is resuspended in 100/zl LB medium. Ceils are plated on LB plates containing kanamycin at 30 ~g/ml or, if an ampicillin-resistant plasmid (pUC8) is used as a marker, the plates contain both kanamycin and ampicillin at 30/zg/ml. Colonies are grown for 18-20 hr at 37°. Some 3 x 104-2 x 105 colonies are expected per microgram of insert DNA. In this laboratory, 8 x 103 to 3 x 10 4 colonies/ t~g are usually obtained using a tag plasmid. The preparative-scale ligation is carried out with a higher DNA concentration (2/.~g insert DNA and 2.5 tzg vector DNA in a volume of 30/.d). After packaging the titer must be determined again by test plating. In addition, different batches of plating cells should be tested at this point. Preparative-scale plating conditions are then adjusted to give the appropriate number of colonies per plate. Filter Lifts. For colony lifts we use the protocol described in Ref. 1. Note: If22 x 22 Nunc plates are used for filter lifts, plates must be poured on a level surface. Procedure VIII: Screening If a cell hybrid carrying human DNA on rodent background was used for library construction, single plaques or colonies will have to be picked
[26]
LARGE INSERT LINKING-CLONE LIBRARIES
357
after hybridization to, for example, total human DNA to isolate clones from the human component of the cell line. To be able to pick single plaques or colonies without the need to rescreen, not more than 2000 plaques or colonies should be plated on a 22 x 22 cm Nunc plate. This number can, however, be increased (to approximately 10,000 clones per 22 x 22 cm plate) if the background of plaques or colonies is made visible by including 35S-labeled vector into the probe. Because the 35S signal can be shielded by plastic (Saran) wrap, 32p and 35S signals can be easily distinguished, and plaques (colonies) with human DNA sequences can be recognized within the pattern of nonhybridizing plaques (colonies) identified by the 35S signal. If total human DNA is used as hybridization probe to identify human clones in a background of clones of rodent DNA, filters must be prehybridized with (unlabeled) sonicated (0.5- to 1.5-kb average size) hamster or mouse DNA, at a concentration of 200 ~g/ml hybridization solution for 5 hr or overnight. Discussion One of the major advantages of linking-clone library construction is the capability of this technique to focus on a small number of preferred sequences in the genome. These sequences can be identified by a number of different technical approaches [mapping by pulsed-field gel electrophoresis, construction of rare-cutter jumping and yeast artificial chromosome (YAC) clone libraries], or they can be distinguished by their unique biological properties (positions of CpG islands and therefore positions of genes). The sites selected during library construction can be quite rare, reducing the effort in library construction and clone analysis. For example, if we assume an average size of 600 kb for NotI fragments in the genome, 5000 linking clones would give a 1-fold coverage of the entire genome. A NotI linking-clone library of 20,000 clones will be likely to contain multiple clones for each NotI site in the genome. Correspondingly smaller libraries will be needed for shorter regions of the genome (entire chromosomes, subregions of chromosomes). Libraries constructed from DNA from cell hybrids containing, for example, a single human chromosome or chromosome fragment in a (diploid) hamster genome will, however, have to be twice as large to compensate for the ratio of hamster to human chromosomes. Therefore more than 10,000 NotI linking clones from such a hybrid will be needed to give a 1-fold coverage of the human segment, independent of the length of the human region. In combination with complementary jumping and/or rare-cutter YAC libraries, linking-clone libraries should therefore offer an efficient complementary approach to build ordered clone libraries over large regions of the
358
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[27]
mammalian genome. Similarly SplI, MluI, and NruI restriction enzymes, containing both CpG and A/T sequences in their recognition site, cut rarely in mammalian DNA and will give long-range maps or clone contiguous regions with a minimal number of clones.7'~4 Due to their A/T sequence in the recognition site, restriction sites for these enzymes will often occur outside of CpG island sequences. Linking-clone libraries constructed with these enzymes will therefore be especially useful to span CpG-rich regions with a minimal number of clones, but will be less useful in the identification of genes in a region of the genome. If the main goal of the linking-clone library construction is to focus on genes from an area enzymes like BssHII or SacII will be most useful, because these recognition sites are usually found in CpG islands and only rarely outside. Due to the larger number of sites for these enzymes, larger linking-clone libraries must be generated to cover a region of the genome. The use of highly methylated DNA sources will reduce the number of clones needed to span a region of the genome. ~4If the methylation pattern of the cell is used to reduce the number of clonable sites, it is important to choose DNA sources showing a homogeneous methylation pattern (i.e., recently recloned cell lines) because partially methylated sites will complicate the analysis and increase the size of the library needed. Linking clone libraries offer a number of advantages and they are relatively easy to construct. They can serve as flexible tools in any analysis of larger regions of mammalian genomes by a combination of genetic and physical mapping approaches, or for gene identification. ~4 A. Poustka, A. Dietrich, G. Langenstein, D. Toniolo, S. T. Warren, and H. Lehrach, Proc. Natl. Acad. Sci. U.S.A. 88, 8302 (1991).
[27] C o n s t r u c t i o n a n d U s e o f C h r o m o s o m e Jumping Libraries
By ANNEMARIE POUSTKA Introduction As an alternative to the direct cloning of large fragments in P1 ~or yeast artificial chromosome vectors, 2 the construction of chromosome jumping libraries relies on a series of steps carried out before cloning to reduce the I N. Sternberg, Proc. Natl. Acad. Sci. U.S.A. 87, 103 (1990). 2 D. T. Burke, G. F. Carle, and M. V. Olson, Science 236, 806 (1987).
METHODS IN ENZYMOLOGY.VOL. 217
Copyright © 1993 by Academic Press, Inc. All rightsof reproductionin any form reserved.
[27]
CHROMOSOME JUMPING LIBRARIES
359 Jumping Ubrary
Chromosome Linking Ubrary
FIG. 1. Directionaljumpingby alternatingbetweena rare-cutterjumpingand a rare-cutter linking library. size of large DNA fragments. This is done by introducing large internal deletions, followed by cloning the remaining fragments containing the ends of the original fragment in a h vector. Jumping libraries fall into two major categories: rare-cutter jumping libraries derived from DNA fragments created by complete or close to complete digestion with an enzyme cutting rarely in the genome (e.g., NotI, MluI, BssHII), 3 and common-cutter jumping libraries constructed from large DNA fragments generated by a very partial cleavage of genomic DNA with a restriction enzyme cutting often in the DNA used (e.g., MboI). 4 Additional types of libraries, based on DNA digested partially with E c o R I (a common cutter), and N o t I (an enzyme cutting rarely in the mammalian genome) have also been constructed 5 and can be used for special purposes. The following sections concentrate on the construction of rare-cutter jumping libraries, because these libraries in many respects are easier to construct and to use. They also offer more possibilities in combination with other techniques we have available for the analysis of large genomes (e.g., the physical mapping provided by pulsed-field gel analysis). Rare-cutter jumping libraries find a natural counterpart in linking clone libraries because linking clones inherently connect neighboring rare-cutter jumping clones constructed with the same enzyme (Fig. 1), forming the basis of directional chromosome jumping. 6 Principle of Method To be able to combine the goal of cloning the ends of fragments hundreds of kilobases in size with the limitations of the well-understood and 3 A. Poustka, T. M. Pohl, D. P. Barlow, A, Frischauf, and H. Lehrach, Nature (London)
325, 353 (1987). 4 F. S. Collins, M. L. Drumm, J. L. Cole, W. K. Lockwood,G. F. Vande Woude, and M. C. Iannuzzi, Science 235, 1046(1987). 5 A. Poustka and H. Lehrach, Genetic Eng. 10, 169 (1988). 6 A. Poustka and H. Lehrach, Trends Genet. 2, 174 (1986).
360
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[27]
HIGH MOLECULARWEIGHTDNA IN AGAROSE
C DIGEST COMPLETELYWITH RARE-CUI"IrERENZYME
MELT AGAROSE DILUTE AND UGATE IN PRESENCEOF SUP F PLASMID
~
DIGESTWITH COMMON CuTIrlNG ENZYME AND PHOSPHATASE
imal2m CLONE INTO AMBER MUTATEDPHAGEVECTOR 1151 ABS
PLATEON SUP" HOST MC1061
FIG. 2. Schematic outline of rare-cutter j u m p i n g library construction.
efficient h cloning systems, we must construct DNA fragments containing the two ends of the original fragments on a single DNA fragment. The fragments must be short enough to be cloned in a standard h vector system. This procedure is summarized in Fig. 2. DNA, prepared in agarose blocks to be as intact as possible, is cleaved completely with an enzyme such as NotI, MluI, or BssHII cutting rarely in the genome to generate fragments hundreds of kilobase pairs in length. The DNA is then diluted to a concentration low enough to reduce the likelihood of intermolecular ligation events to a low level (less than 10%). 6,7 After that the dilute DNA is ligated in the presence of a genetically selectable tag (a phosphatase7 F. S. Collins and S. M. W e i s s m a n , Proc. Natl. Acad. Sci. U.S.A. 81, 6812 (1984).
[27]
CHROMOSOME JUMPlNG LIBRARIES
361
treated plasmid carrying a suppressor gene as selectable marker),8 added at a molar concentration corresponding to the local concentration of one end of the molecule at the position of the other end. Because tag concentration and the concentration of the other end are similar, a major fraction of ligation events will lead to the formation of a large circular molecule, formed under uptake of a tag sequence. Although such a structure is too large to be easily cloned in Escherichia coli, it can be cleaved by a second restriction enzyme that does not have a site in the tag sequence (Table I). The generated fragments are treated with alkaline phosphatase to block further ligation of remaining unligated ends. They are then ligated into NM1151AamBamSam, a h cloning vector carrying multiple amber mutations, -~and therefore dependent on a suppressor gene to be able to grow. The ligation product is then packaged in vitro, and plated on a nonsuppressot-containing host to select clones of junction fragments containing the introduced suppressor gene.
DNA Concentrations To ensure the high circularization frequency required for the formation of correct jumping clones, and to reduce the frequency of intermolecular ligation events artifactually connecting ends of different DNA fragments, the circularization step must be carried out at a sufficiently low concentration. The ratio of intra- to intermolecular ligation events, reflected later in the frequency of randomly coligated clones in the library, depends on the ratio of the local concentration of one end of a long DNA molecule at the position of the other end, to the concentration of the ends of all other molecules in the solution. This level can be most easily calculated as the ratio of the actual DNA concentration to the concentration at which interand intramolecular ligations are equally likely. 6 Because this concentration (expressed in nucleotide molarities or weight per volume) varies inversely with the square root of the length of the molecule, circularization of longer molecules therefore must be carried out at correspondingly lower concentrations, with the DNA concentration expressed in mass units (micrograms per milliliter, or molar concentration of nucleotides) decreasing with the square root of the length of the molecule to be circularized.
Concentration of Marker Plasmid To optimize the formation of the "tagged" composite circles, formed by ligation of a tag molecule to one end of the long DNA chain, followed 8 B. Seed, Nucleic Acids Res. 11, 2424 (1983).
362
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
t~
g
2
"z ~.~
Z
~
o, -2~
X g., O Z 1--, rO a~ (-
0.2 " ~
O o:t O
[,h i
O
.a
,.,1 O
O
Z
Z <
o c¢
0
z z
o 0J
.>_ o.0 O
Z 0
q.
q-
q.
~"
eq t::[
e~
[27]
[27]
CHROMOSOME JUMPING LIBRARIES
363
by ring closure, the concentration of the tag molecules must be roughly equal to the local concentration of the other end of the same molecule. If the tag concentration is too high, a large fraction of the long DNA chains will ligate to tags at both ends, which, in the case of using dephosphorylated tag sequences, will block further circularization. Dephosphorylation of the plasmid DNA is used to suppress loss of tag sequences by selfcircularization. An alternative possibility 7 has been the use of the isolated suppressor gene sequence. In this case, phosphatase treatment of the ends is not required, because the suppressor gene sequence is too short to be able to circularize by itself. At low tag concentrations a large fraction of the molecules will circularize without prior ligation to a tag molecule, and will therefore not be recognized as junction fragment in the later selection step. For the libraries constructed by complete digestion with rare cutter enzymes, each plasmid concentration can be expected to lead to enhanced recovery of clones derived from DNA of a specific size range, with lower tag concentration favoring the recovery of clones corresponding to larger jumps. In general, such libraries are therefore constructed in different fractions, using tag concentrations differing by one to two orders of magnitude.
Materials
Tag Plasmids, ?t Vector To provide a genetically selectable tag sequence, small plasmids containing a bacterial suppressor gene 9 have been constructed 5 by introducing polylinkers carrying the appropriate rare cutter restriction sites, and deleting recognition sites for enzymes used in the recleavage reaction (Table I). NM115lABS is an insertion vector modified from NM1151~° by introducing three amber mutations in the A, B, and S genes. 5 Both tag plasmids and k vector will be provided on request or will be available through the American Type Culture Collection (ATCC; Rock° ville, MD).
9 H. V. Huang, P. F. R. Little, and B. Seed, in (R. Rodriguez, ed,). Butterworths, London, 1987. ~0 N. E, Murray, in "Lambda I I " (R. W. Hendrix, J. W. Roberts, F, Stahl, and R. A. Weisberg, eds.), p. 359, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1983.
364
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[27]
Bacterial Hosts
The following hosts are used: NM538:ED8654 supF hsdR, 11 derived from ED8654 lz NM539: NM538(P2cox3) l) MCI061: hsdR lacX7413 MC1061(P3): MC1061 containing plasmid P38 Strains will be available through the ATCC, or will be provided on request. Enzymes and Reagents
T4 DNA ligase (New England BioLabs, Beverly, MA): 400,000 units (U)/ml Restriction endonucleases (New England BioLabs or Boehringer Mannheim, Indianapolis, IN) Calf intestine alkaline phosphatase (CIAP) (Boehringer Mannheim): Molecular biology grade; stock at 1 U/tzl Agarase (Calbiochem, San Diego, CA): 5 U/~I dissolved in TE buffer (see below) Proteinase K (Boehringer Mannheim) Agarose (Sigma, St. Louis, MO) Low melting point agarose (Bethesda Research Laboratories, Gaithersburg, MD) Phenylmethylsulfonyl fluoride (PMSF) (Sigma): 40/zg//zl dissolved in 2-propanol Nitrocellulose filters (Schleicher & Schuell, Keene, NH) Hybond N + nylon filters (Amersham, Arlington Heights, IL) ATP (100 mM) (Boehringer Mannheim): Adjust to pH 8 with Tris base Bovine serum albumin (BSA): 5 mg/ml in H20 Nitrilotriacetic acid (100 mM): Adjust to pH 8 with acetic acid tRNA (yeast transfer RNA) (Boehringer Mannheim): 10 tzg/tzl Phenol (Merck, Rahway, NJ): Molecular biology grade; equilibrate with 1 M Tris-HCl, pH 8 Solutions
TE: 10 mM Tris-HCl (pH 8.0), 1 mM ethylenediaminetetraacetic acid (EDTA) TEE: 10 mM Tris-HC1 (pH 8.0), 10 mM EDTA 1~ A.-M. Frischauf, H. Lehrach, A. Poustka, and N. Murray, J. Mol. Biol. 170, 827 (1983). z2 K, Borck, J. D. Brammar, W. J. Hopkins, and N. E, Murray, Mol. Gen. Genet. 146, 199 (1976). 13 M. J. Casadaban and S. N. Cohen, J. Mol. Biol. 138, 179 (1980).
[27]
CHROMOSOME JUMPING LIBRARIES
365
TNE: TE + 100 mM NaC1 h diluent: 100 mM Tris-HCl (pH 7.5), 10 mM MgSO 4 , 1 mM EDTA, pH 8.0 Ligase buffer (10 x ): 400 mM Tris-HCl (pH 7.6), 100 mM MgCI 2 , 10 mM dithiothreitol (DTT) Phenol-chioroform-isoamyl alcohol: 25 : 24 : 1, saturated with TE Restriction enzyme buffers High (10 × ): 100 mM Tris-HCl (pH 7.6), 100 mM MgCI~, 10 mM DTT, 1000 mM NaCI Medium (10×): 100 mM Tris-HC1 (pH 7.6), 100 mM MgCI~, 10 mM DTT, 500 mM NaCI TAE (50x): 242 g Trizma base, 57,1 ml glacial acetic acid, 100 ml 0.5 M EDTA (pH 8.0); add H20 to 1 liter Buffer A: 20 mM Tris (pH 8), 3 mM MgCI 2, 10 mM ethanol, 1 mM EDTA Buffer M 1: add the following in order: 110/zl H20, 1 tzl 2-mercaptoethanol, 6 ~zl 0.5 M Tris (pH 7.4), 300/zl of 0.05 M spermidine, 0.1 M putrescine (adjusted to pH 7 with Tris), 9/zl 1 M MgCI~_, 75/zl 0.1 M ATP Denaturation solution: 0.5 M NaOH, 1.5 M NaCI Neutralization buffer: 50 mM NaP~, pH 6.5 Media and Plates
LB medium: 10 g Bacto-tryptone (0123-01; Difco, Detroit, MI), 5 g yeast extract (0127-01 ; Difco), and 10 g NaCI; add H20 to 1 liter, adjust pH to 7.5, and autoclave LB agar: LB medium plus 15 g agar (Difco); autoclave BBL agar: 10 g Trypticase (Baltimore Biological Laboratories), 5 g NaCI, 10 g agar (Difco); add H20 to 1 liter and autoclave BBL top agar: 10 g Trypticase (Baltimore Biological Laboratories), 5 g NaCl, 6.5 g agar (Difco); add H20 to 1 liter, autoclave, and add 10 ml of sterile 1 M MgSO 4
Construction of Rare-Cutter Jumping Libraries In the following protocol we will describe the construction of a N o d jumping library, using BamHI as recleavage enzyme. Differences in the construction between this and libraries constructed with other rare-cutter enzymes, as well as modifications using other enzymes in the recleavage step, are minor.
366
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[27]
Procedure I: Linearization of h Vector DNA NM115 lABS is a h insertion vector carrying three amber mutations in essential genes. The vector has unique sites for the enzymes BarnHI, EcoRI, HindlII, and XhoI and can therefore be used to construct libraries using these enzymes or enzymes generating complementary ends. The protocol will use BamHI as an example.
Preparative Digest 1. In preparative digests 100 tzg of NM 115 lABS is digested to completion with BamHI (2 U/txg), 1 x high buffer, and I00 t~g BSA in a volume of 500/xl. 2. Digests are incubated for 2 to 4 hr at 37° and then transferred to ice. 3. To check the digestion, 1 tzl of sample is removed, heated for 5 min to 65 ° , immediately transferred to ice to ensure dissociation of protruding ends before loading on a gel, and checked by electrophoresis on a 0.7% (w/v) agarose/TAE gel. 4. If digests have gone to completion, EDTA is added to 12 mM, the DNA is extracted with an equal volume of phenol-chloroform-isoamyl alcohol (25 : 24 : 1). After a 5-min centrifugation in an Eppendorf centrifuge the organic phase is reextracted with 200/~1 TE and the aqueous layers are pooled. 5. Sodium acetate is added to 0.3 M, and the DNA is precipitated by adding 3 vol of ethanol. The sample is incubated for 15 min in dry ice and centrifuged for 15 min. The pellet is washed with 70% (v/v) ethanol-water, air dried for 20 rain at room temperature, and dissolved to a concentration of 0.25 txg/tzl in TE.
Procedure H: Isolation of Tag Plasmid by Gel Electrophoresis 1. To isolate the tag plasmid free of the P3 plasmid (Ampam Tetam Kan) used to select for the suppressor gene, 20 txg of plasmid is loaded on a 10 x I0 cm low melting point agarose gel [1% (w/v) low melting point agarose in TAE buffer], and run for 4 hr at 2 V/cm. 2. Gels are stained in 0.3/zg/ml ethidium bromide for 20 min, the 1.9kb supercoiled plasmid is localized under a 360-nm ultraviolet (UV) light source, and excised in a minimal amount of agarose. 3. The gel slice is equilibrated for 10 min in 200/~1 TNE, melted by incubating for 10 min at 68 °. 4. After the agarose has melted completely, the sample is transferred to 37 ° to equilibrate at this temperature (5 rain), 3 tzl agarase is added (10 U//zl), and incubated for 4 hr at 37°. 5. The DNA is extracted once with prewarmed (37 °) phenol (preequili-
[27]
CHROMOSOME JUMPING LIBRARIES
367
brated with TE). Reextraction and ethanol precipitation are performed as described in procedure I. DNA is dissolved to a concentration of 0.25/xg/ /zl in TE. Procedure IlI: Linearization and Phosphatase Treatment of Plasmid DNA To linearize the tag plasmid, 10/.~g plasmid DNA is digested with 10 to 30 U of NotI (Boehringer Mannheim), 1 x high buffer, and 50/zg BSA in a 200-/zl reaction at 37° for 4 hr to overnight. An aliquot is checked for completeness of the digestion by gel electrophoresis on a 1% (w/v) agarose/TAE gel. If the digest is found to be complete, 4/xl (300 ng) is taken out for control ligation. The remaining 196/~1 is diluted with 200/zl of sterile water (phosphatase does not work well in high salt). DNA is dephosphorylated by incubating with 0.2 U of CIAP (Boehringer Mannheim, 1 U//xl) per microgram DNA for 30 min at 37°. The reaction is stopped by adding nitrilotriacetic acid, pH 8.0 (100 mM stock), to a concentration of 12 mM, followed by a 15-rain incubation at 68 °. Residual enzyme is removed by phenol extraction, and the DNA is collected by ethanol precipitation and dissolved in TE to a final concentration of 0.25/zg//xl. Procedure IV: Phosphatase Control To check the efficiency of the phosphatase treatment and the ligatability of the generated ends, 250-ng aliquots of the tag plasmid DNA taken before and after the phosphatase treatment are ligated in 10-/zl reactions. Ligation reaction: In a 10-/xl volume mix 200 ng linearized plasmid (before and after phosphatase treatment), 1/~1 10 × LB, 3/zl ATP (1 mM) and 40 U of ligase (400 U/~I; New England BioLabs). Ligations are incubated for 3 hr at room temperature. Samples before and after ligation are analyzed on a 1% (w/v) agarose gel. The nondephosphorylated sample should form oligomers, while the phosphatased sample should not. As an additional check for damage to the ends during the phosphatase step, an additional ligation of the phosphatased DNA can be carried out in the presence of a small amount of T4 DNA kinase, expected to result again in the formation of the oligomer pattern. Procedure V: Preparation of in Vitro Packaging Extracts In vitro packaging extracts of excellent quality can be purchased commercially (e.g., Stratagene, Foster City, CA). For the preparation of large
368
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[27]
chromosome jumping libraries the preparation of homemade extracts will, however, in many cases be the only option, because large amounts of packaging extract are needed, due to the fact that all DNA fragments generated must be ligated and packaged using genetic selection. This makes the use of commercial extracts too expensive. Extracts can be prepared in high quality and large amounts, using the following protocol modified from that of Scherer et al. 14 Freeze-Thaw Lysate. Single colonies of BHB2688 are streaked on two plates, and incubated at 30 and 42° to check for temperature sensitivity (indicating the presence of a prophage). Three 5-liter Erlenmeyer flasks, each containing l liter of LB medium, are inoculated with 5 ml of overnight culture and grown at 30° under vigorous aeration to OD 0.6 (600 nm). One liter of LB prewarmed to 65 ° is added, and the culture is shaken at 43 ° for 20 min and for another 3 hr at 37°. The flasks are cooled in ice-water and the cells are centrifuged for 20 min at 4° in l-liter bottles in a Beckman (Fullerton, CA) J6 centrifuge. Pellets are resuspended in the cold in 3 ml 10% (w/v) sucrose, 50 mM Tris-HCl (pH 7.4), and 1-ml aliquots of the resulting semiliquid paste are distributed into cold 10-ml Oak Ridge centrifuge tubes. To each aliquot 60/zl of 2-mg/ml lysozyme is added, mixed rapidly, and immediately frozen in liquid nitrogen. Tubes are thawed slowly on ice, until the paste looks semiliquid and viscous, and 250/zl M1 buffer is added. The paste is mixed gently, and centrifuged in a Ti 50 rotor at 4° for 30 min at 35,000 rpm in a Beckman ultracentrifuge. The supernatants are aliquoted in 20- and 500-/xl aliquots in cold Eppendorf tubes, frozen immediately in liquid nitrogen, and stored at - 70°. A 3-liter preparation will give 6-9 ml freeze-thaw lysate. Sonic Extract. Checked precultures of BHB2690 are prepared as described above, and used to inoculate 1 liter LB medium in a 5-liter Erlenmeyer flask. The culture is grown and induced as above. After induction the culture is grown under good aeration at 37° for another 3 hr, chilled in ice-water, and centrifuged for 20 min at 5000 rpm in l-liter bottles in a cold J-6 centrifuge. The pellet is resuspended in 15 ml buffer A and transferred to a 50-ml Falcon tube (Becton Dickinson Labware, Oxnard, CA). The tube is then put into a beaker with ice-salt water, and sonicated in bursts of 5 sec, until the suspension clears (it is essential to avoid foaming). The solution is then transferred to cold SS34 tubes, and centrifuged for 10 min at 6000 rpm at 4°. To the supernatant 2.4 ml M1 buffer is added, and the solution is distributed in aliquots of 20 and 200/xl in cold Eppendorf
14 G. Scherer, J. Telford, L. Baldari, and V. Pirrotta, J. Mol. Biol. 138, 179 (1981).
[27]
CHROMOSOME JUMPING LIBRARIES
369
tubes. The tubes are stored at - 7 0 ° until use. A l-liter preparation will give approximately 4 ml sonic extract.
Procedure VI: Preparation of High Molecular Weight DNA in Agarose Blocks Preparation of Single-Cell Suspension. Cells from many different sources can be used. Cells from adherent cell lines are converted into single-cell suspensions by trypsinization. Blood lymphocytes are isolated from total blood containing sodium citrate as described by Herrmann and Frischauf, 15 except that the cell pellet after lysis is suspended in 4.5 ml phosphate-buffered saline (PBS) per 10 ml blood. Cells are washed once by centrifugation (3 rain at 3000 rpm) and resuspended to a final cell density of 1 × 106 cells/40/A in PBS. DNA in Agarose Blocks. A solution of 1.2% (w/v) low melting point agarose in PBS is melted and kept at 42 °. The cell suspension (at room temperature) is then mixed with an equal volume of the 1.2% (w/v) agarose solution, and pipetted in 80-/zl aliquots into the slots of plastic slot formers, kept on a glass plate on ice. After 10 rain on the ice-cooled glass plate the adhesive tapes closing the bottom of the slots are removed, and the blocks formed by solidificiation of the agarose are expelled into 50-ml screwcapped tubes, and incubated in a solution containing 1% (v/v) sarkosyl, 0.5 M EDTA (pH 8.0), and 2 mg/ml proteinase K for at least 48 hr at 55°. After incubation the blocks are rinsed three times with TE by allowing the blocks to settle, carefully decanting the solution, and resuspending the blocks in 50 ml fresh TE. After these rinses, the blocks are resuspended in TE containing 40 tzg/ml PMSF, and incubated for 30 min at 55°. After repeating this step once, blocks are either used immediately, or stored for long periods in 0.5 M EDTA, pH 8.0. Procedure VII: Cleavage of Genomic DNA in Agarose Digestions are carried out by incubating each block (approximately 7 /~g DNA in 80/zl) with 20 U NotI in a 200-~1 reaction for 4-6 hr at 37° in 1 × high buffer. Blocks are washed twice for 10 min in I0 mM Tris-HCI, pH 8, 10 mM EDTA (TEE). To remove the enzyme, 200 tzl TEE plus 200 /zg//~l proteinase K are added, and the reaction is incubated for 40 rain at 37°. Blocks are again washed twice in TEE, melted for 15 rain at 68°, and 15 B. G. Herrmann and A.-M. Frischauf, this series, Vol. 152, p. 180.
370
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[27]
incubated for 10 min at 37 °. Then 200/zl TEE plus 0.4/zg/ml PMSF are added, and the solution is incubated for another 30 rain at 37°.
Procedure VIII: Circularization Ligation Ligations are carried out at different DNA concentrations and tag plasmid concentrations to create a more even representation of clones corresponding to jumps of different sizes. Concentrations depend on the size distribution generated by the enzyme used. The following conditions are used for NotI complete digest libraries of mammalian DNA, and must be modified appropriately for other enzymes and DNA sources. Two ligations are carried out: Ligation 1: Volume 3 ml, DNA concentration 300 ng/ml, plasmid concentration 100 ng/ml, BSA 50/zg/ml, ATP 0.3 mM, ligase 1000 U/ml (New England BioLabs) Ligation 2: Volume 15 ml, DNA concentration 150 ng/ml, plasmid concentration 10 ng/ml, BSA 50/xg/ml, ATP 0.3 mM, ligase 1000 U/ml (New England BioLabs). In the case of a NotI library this ligation will give more clones than ligation 1, aiming for longer jump fractions To assemble the circularization reactions, blocks containing digested DNA are melted at 65 ° (make sure the agarose is completely molten before proceeding), and the DNA is pipetted with a yellow pipette tip (the end cut off with a sterile razor blade) into I x ligation buffer prewarmed to 37° and mixed by carefully inverting the tube a few times. (At 7-8/zg DNA/ block in a 300-/xl volume, 8/xl will correspond to 200 ng of DNA.) Then the calculated amounts of digested tag plasmid, ATP, and ligase are added and ligations are carried out at 15° overnight. In parallel, 10/xl of the ligation mix is incubated overnight at 15° with 0.5/xg cleaved vector (BamHI-cut NM115lABS), heated at 65 ° for 5 min, and analyzed by electrophoresis on 0.7% (w/v) agarose gels (successful ligation is indicated by the ligation of the vector arms). If the control ligation was successful, the preparative ligation is stopped by inactivation of the ligase for 30 rain at 65 °.
Procedure IX: Recleavage of DNA Circles For the recleavage step, NaCI is added to 100 mM (for recleavage with BamHI), I0 U restriction enzyme is added per milliliter reaction, and digestions are carried out for 2 hr at 37°. In parallel, a 10-/xl aliquot of the reaction is incubated together with 0.3 p.g of uncleaved vector (e.g., NM 115 lABS), and the digest is analyzed
[2 7]
CHROMOSOME JUMPING LIBRARIES
371
by gel electrophoresis as above. If the added DNA has been completely digested, the recleavage reaction is likely to have succeeded. Reactions are stopped by adding EDTA to a final concentration of 12 mM, tRNA is added as carrier to 10 txg/ml, sodium acetate is added to 0.3 M, and the solution is precipitated with 2.2 vol of ethanol overnight at - 2 0 °' The precipitate is collected by centrifugation for 40 min at 16,000 rpm in a Sorvall (Norwalk, CT) centrifuge at 20°; pellets are washed with 70% ethanol, air dried, and dissolved in 200 txl TE. Comment. We usually perform ligation and recleavage reactions in Falcon tubes and then transfer the solution to Corex tubes for precipitation and centrifugation.
Procedure X: Phosphatase Treatment of Insert DNA To dephosphorylate unligated ends, 22 txl 10 x medium buffer and 2 U CIAP are added, and the reactions are incubated for 30 min at 37 °. The enzyme is inactivated as described above by adding nitrilotriacetic acid, followed by an incubation for 15 min at 68 °, the reaction is phenol extracted, and ethanol precipitated. The pellet is washed as described above and the DNA is dissolved in TE to a final concentration of 20 ng/txl.
Procedure XI: Vector Ligation and Packaging Reaction Analytical Ligation. For analytical ligations 2-/xl aliquots of insert DNA (40 ng) are taken before and after phosphatase treatment, mixed with 900 ng cleaved vector, and ligated overnight at 15° in 10-txl ligase reactions using 1 txl ligase diluted to 40 U/Ixl. In addition, a phosphatased sample is ligated to phosphatase-treated vector. Analytical Packaging. One-microliter aliquots of NM 115 lABS (uncut, cut, cut and religated), and 2 txl (8 ng insert, 180 ng vector) of the analytical ligation are mixed on ice with 2 /xl sonic extract and 4/xl freeze-thaw lysate, incubated for 2 hr at room temperature, and plated with MC1061/ P3 to determine plating efficiency, vector background, vector ligatability, and the frequency of junction fragments. Reactions are diluted with 90 Ixl of )t diluent, and plated as described in Test Plating (below). The expected titer on MC1061 is 1 x 104-3 x 105/ixg insert DNA, depending on DNA and plasmid concentrations. The expected titer with NM538 as ligation control is 1-5 x 108/txg vector DNA. Preparation of Plating Cells. Plating cells are prepared by inoculating 25 ml LB in a 125-ml Erlenmeyer flask with a colony taken from a fresh plate of the appropriate strain, and incubating overnight at 37°
372
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[27]
with shaking. Cells are collected in a 10-min spin at 3000 rpm and the pellet is resuspended in a one-half volume of sterile 10 mM M g S O 4. Cells can be stored at 4° for extended periods. Two to four different ON preparations are started from the selective host MC1061/P3. To make sure that the phage library can be transferred into colonies, MC1061/P3 must be grown on kanamycin-containing plates to ensure retention of the P3 plasmid. Test Plating. Packaged phage suspension (10/A) is added to 100/zl of plating cells, and incubated for 15 min at 37°; 3 ml melted top agar is added and distributed on prewarmed BBL plates. Dilutions plated are as follow: Ten microliters each of 10 -4 and 10 - 6 diluted uncut NM115lABS on NM538 Ten microliters each of 10 -4 and 10 -6 diluted religated NM115lABS on NM538 Ten microliters each of 10 -4 and 10 - 6 diluted ligation on NM538 Ten microliters of undiluted religated NM115 lABS on MC 1061 Twenty-five microliters of undiluted ligations on different preparations of MC1061 plating cells to determine which plating cell preparation gives the highest efficiency (40-400 plaques can be expected on the selective plates, depending on the efficiency of the packaging mix used, which needs to be at least 5 x 108//zg of uncut vector DNA)
Preparative Vector Ligation. Preparative ligations are carried out with the same vector:insert ratio and the same DNA concentrations as the analytical ligations. Preparative Packaging. The preparative packaging is carried out as for the analytical packaging, with a 3-hr incubation time. After packaging, jumping clones must be purified over a CsC1 step gradient, because large amounts of packaging mix reduce the plating efficiency. CsCl Step Gradients. Gradients are prepared in SW60 polyallomer tubes using 0.5 ml each of 54, 42, and 31% CsCI in h diluent (w/w; e.g., 5.4 g CsCI, 4.6 ml X diluent). Boundaries are marked with a felt pen, and the packaged library is layered on top and overlayed with h diluent. After a 3-hr spin in SW60 tubes at 35,000 rpm at 18°, fractions are taken from the top with a Pasteur pipette. The packaged phages will be underneath a white layer visible within the CsC1. Larger (I ml) fractions are taken from the top and smaller (200/A) fractions from the region of interest. The small fractions are then titrated on NM538; fractions containing the library (usually two to three fractions) are then pooled and dialyzed against X diluent. An unlimited amount of this clean
[27]
CHROMOSOME JUMPING LIBRARIES
373
material can now be plated with 1-2 ml of plating cells on a single plate without loss in efficiency. Procedure XII: Amplification as ~ Library The plating of the library is carried out as in the analytical plating protocols. The purified packaged phages are plated on MC1061(P3) at a density of up to 105 plaques per 22 x 22 cm Nunc (Roskilde, Denmark) screening plate. Jumping libraries can be stored in different forms: (1) Amplify the library as a phage library, make a plate lysate, and store as ~ lysate. (2) Transfer phage library into a high-density colony pattern: (a) scrape off colonies and freeze as a cell suspension (in freezing medium) or (b) make filter replicas from the primary library, freeze the master filter, and use the replica for colony lysis to prepare a screening filter for screening of the primary library. Procedure XIII: Replication into High-Density Colony Patterns Jumping clones grown as phage at 30° contain bacteria immune to superinfection, because the repressor will be active at this temperature, and will therefore silence the phage genome, as well as the genomes of any superinfecting phages. Although in this state phage replication is turned off, the clones are able to replicate off the plasmid origin of the tag plasmid. Due to the suppression of the amber mutations in the amp and tet genes carried by the P3 plasmid, bacteria containing jumping clones are resistant to ampicillin and tetracycline. This allows for the growth of immune, antibiotic-resistant bacteria from each plaque after transfer of a small amount of bacteria to antibiotic selection plates. To carry out this transfer, the plates are cooled to 4°, covered with nitrocellulose filters (nylon membranes do not work), left for 5 min, and the filters transferred to LB plates with plaques facing away from the plate. Plates are then incubated for 4 hr at 32°, and filters are transferred to LB plates containing 14/~g/ml tetracycline (again with colony side up). Colonies are grown 24-30 hr at 32°. Procedure XIV: Screening Jumping Libraries as Colonies Jumping libraries transferred into colonies are in general stored at - 70° as frozen, amplified aliquots, containing approximately 100,000 separate colonies per fraction. Plating the Fractions. Jumping clone-carrying bacteria (100,000) in !
374
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[27]
ml LB are plated on a 22 x 22 cm agar plate containing 14/zg/ml tetracycline and 30/xg/ml kanamycin. Bacteria are grown at 32° to a diameter of approximately 1 mm. Colony Replicas. To replicate this pattern a 22 x 22 cm nylon membrane (Hybond N) is layered on top of the colonies, and filters are marked at 10 asymmetrically distributed positions with needle holes. The filter is removed and put with the colony side up on a slightly damp Whatman (Clifton, NJ) 3MM filter on a 30 × 30 cm glass plate. A second membrane is moistened on an agarose plate, and put on top of the first filter. This sandwich is covered with a second sheet of Whatman 3MM and a second glass plate, and pressed together to transfer the colonies; the second membrane is marked with the pattern of needle holes. After transferring the filters back to LB plates (containing the antibiotics), the colonies on the filters are grown for 3-4 hr, and the replication step is repeated. The master filter is moistened with Hogness modified freezing medium, and put on a plastic plate of the same size and covered with a thin plastic foil carrying a graph paper pattern. After marking the position of the needle holes on the graph pattern, the membrane and the graph plastic foil are covered with a second plastic plate, clamped with eight small bulldog clamps, and stored at - 8 0 °. Colony Lysis. The remaining two filters carrying colonies are transferred to Whatman 3MM paper moistened in denaturation solution for 10 min, blotted dry on Whatman 3MM paper, and then floated (colony side up) on approximately 400 ml of neutralization buffer in a Nunc 22 x 22 cm plate for 2 min. The filters are transferred to a glass plate, colonies are wiped off with gauze tissue or Kleenex prewetted in neutralization solution, washed with another 300 ml of neutralization solution, and blotted dry between two sheets of Whatman 3MM paper. Filters are air dried, and marker holes are made with a soft pencil. Filters are baked for 20 min, and the DNA is cross-linked to the membrane by a 2-min UV exposure to 200/zW/cm 2. Clones present on both replicas after hybridization are identified on the stored frozen library, and the positive area is cut out as a small square (edge size, a few millimeters) using a heated scalpel. The excised filter fragment is transferred to a tube containing 1 ml LB plus antibiotic and the cells are well suspended. Ten microliters of the cell suspension is diluted into 1 ml of the same medium, and 1, 5, and 20/~1 are plated on 8-cm LB-Tet plates. Plates are incubated at 32°, and those containing 300 to 600 colonies are immediately used for rescreening. After transfer of the colonies to membranes, plates are incubated further to allow regrowth of the colonies. Regrowth sometimes looks poor but there is always enough material for further analysis. Filters are treated as described above.
[27]
CHROMOSOME JUMPING LIBRARIES
375
Procedure XV: Isolation of Jumping Clones DNA Preparation. For DNA preparation from plaques as well as for colonies the same phage minipreparation protocol is used (plasmid DNA preparations often contain phage DNA). A single fresh plaque or colony is inoculated in 2 ml LB containing 10 mM MgSO 4 and grown on a rotating wheel at 37 ° overnight. If the culture comes from a colony, 5 /.d of fresh plating cells is added to ensure a sufficient inoculum of nonlysogenized host cells. Cells are lysed by adding a drop of chloroform. After centrifugation 30 /~g of DNase is added to 900/zl of lysate and the sample is incubated for I hr at 37°. After adding 100/xl of 1 M Tris (pH 8.6), 3 M NaCI, 250 mM EDTA, and 1 mg/ml proteinase K, the sample is incubated for 3 hr at 37°, phenol extracted, and precipitated with 0.3 M sodium acetate, 0.6 vol 2-propanol; the pellet is then washed with 70% (v/v) ethanol and dissolved in 30/xl TE. This preparation yields 2/~g of well-digestable DNA made from plaques picked from the selective host, allowing its use for clones at early stages of purification. After further plaque purification, NM538 can be used for plating, resulting in higher DNA yields. Isolation of Fragment Ends. Fragment ends can be isolated from the tag plasmid by digestion of the DNA with the enzyme used in the first digestion step (NotI, MluI). If this site has been destroyed by ligation of different restriction sites with ligation-compatible ends (e.g., using an MluI-cleaved tag plasmid to construct a BssHII jumping library), restriction enzymes cleaving at flanking sites within the polylinker of the tag plasmid can be used (Table I). Isolation as Plasmid Subclones. The insert in jumping clones can be easily isolated as plasmids by excising the insert by the enzyme used in the recleavage step (e.g., BamHI for a NotI/BamHI library), followed by ligation at low DNA concentration (<5 /zg/ml of DNA insert) and transformation into a host allowing selection for the suppressor gene [e.g., MC1061(P3)]. Clones can be recovered by plating on selection plates containing 7.5/zg/ml tetracycline, and 15 tzg/ml ampicillin.
Discussion
Library Size Because rare-cutter jumping clones start and end at rare-cutter restriction sites, library sizes of a few times the number of a rare-cutter restriction site will cover the genome. If we assume the average size of a NotI
376
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[27]
fragment is approximately 600 kb, 16 1-fold genome coverage would require approximately 5000 clones. NotI jumping libraries of 15,000 to 30,000 clones will therefore correspond to three- to sixfold genome coverage, statistically more than sufficient to contain all sequences clonable by the particular system used. To be able to also isolate the fraction of rarecutter sites partially methylated in the genome, all our libraries have been constructed aiming for 10- to 20-fold genome coverage. Rare-cutter libraries constructed with BssHII, SaclI, or MluI should be approximately twofold larger to compensate for the smaller average size of the corresponding restriction fragments.
Problems The main theoretical difficulty associated with the construction of chromosome jumping libraries is due to the formation of chimeric clones, the product of a coligation between two different DNA molecules during library construction. As described before, the frequency of such coligation events can in theory be reduced to arbitrarily low levels by carrying out the ligation at increasingly low DNA concentrations. Practical limits do, however, exist, because lower DNA concentrations require larger volumes, more ligase, and lead to increased difficulties in recovering the very dilute DNAs after the recleavage step. In practice, therefore, ligations are carried out at concentrations expected to result in up to 10% of coligated clones [actually a level much lower than that found in many of the currently used yeast artificial chromosome (YAC) libraries]. Clones can be considered correct if a number of clones of the same structure have been isolated independently, or can be checked by hybridization with somatic cell hybrid panels (both ends map to the same chromosome or chromosome region) or pulsed-field gradient (PFG) gel analysis (both ends map to the same PFG fragment in a digest with the same enzyme also used to construct the library). In PFG analysis it is, however, important to consider that jumps to partially cleaved sites internal to visible fragments, as well as jumps beyond well-cleaved sites, can be observed. 3 This is especially the case if different DNA sources are being used in the PFG analysis and in library construction, due to potential differences in restriction sites or their methylation status. If no clones are found in the library for a particular jump, this can be due to a number of reasons. Points to check are whether the rare-cutter site next to the probe is cleaved in the genomic DNA used to construct the library, or if the fragment generated is within the range easily covered 16 A. P. Bird, Nature (London) 321, 209 (1986).
[27]
CHROMOSOME JUMPING LIBRARIES
377
by chromosome jumping (up to 700 kb). An additional complication is caused by the use of complete digestion with enzymes like EcoRI or BamHI during the recleavage reaction, combined with the use of a X insertion vector (NM115lABS) for cloning, because the size of the junction fragment formed (the sum of the two end fragments plus the tag plasmid) can exceed the capacity of the vector (0-12 kb). To reduce this problem, a family of libraries has been constructed, using the same rare cutter but different enzymes for the recleavage reaction. ~ Other libraries have been constructed using a mixture of two enzymes (e.g., EcoRI and Hindlll)] or partial digestion with a common cutting enzyme (e.g., Sau3A) in the recleavage reaction, at the cost of some loss in efficiency.
Alternative Approaches Many alternative approaches to the protocol described here have been considered, and in some cases tested. Useful modifications are the use of alternative selection systems for junction fragments, based on physical isolation of junction fragments, using, for example, biotinylated tag sequences, or the use of an inverse polymerase chain reaction (PCR) strategy to amplify a specific junction fragment selectively.
Use of Rare-Cutter Jumping Libraries Rare-cutter chromosome jumping libraries offer a number of features to simplify analysis and cloning of large regions of genomes. Chromosome jumping offers a direct route to the isolation of the ends of larger clones that can be isolated, even if sequence features within a fragment would make the intact fragment difficult or impossible to clone in other available systems. Rare-cutter jumping clones offer the advantage of easy characterization by PFG analysis. The inherent directionality allows repeated jumps in one or the other direction on the chromosome. Because clones start and end at the ends of rare-cutter fragments, jumping clones tend to start and end at the position of genes, due to the association of genes with CpG islands located at the position of rare-cutter sites. Due to the small size of the libraries needed, both jumping and linking clone libraries are easy to screen, and can serve as the basis of parallel mapping strategies, based on the identification of complementary jumping and linking clones (Fig. 1), while gaps too large to be bridged by chromosome jumping can be closed by the identification of bridging restriction fragments. 6 In rare-cutter chromosome jumping it is, however, required to isolate sequences located next to unmethylated rare-cutter sites, to be able to start the process. Techniques to isolate such probes have been discussed. 3'5"6
378
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[28]
Rare-cutter chromosome jumping has been used successfully in the isolation of a number of genes, and in combination with complementary (linking clones) and alternative (YAC clones) techniques is expected to play an essential role in the future in the analysis of large regions of chromosomes and genomes. Acknowledgments I wouldlike to thank Hans Lehrach and Anna Maria Frischaufin whose laboratorythese protocols were developed, for help and critical discussion of this manuscript. This work was supported by a grant from the Deutsche Forschungsgemeinschaft to A.P.
[28] C o s m i d C l o n i n g a n d W a l k i n g to M a p H u m a n C D 1 Leukocyte Differentiation Antigen Genes
By C. YUNG Yu, LAI-CHU Wu, LAKI B U L U W E L A , and CESAR MILSTEIN
Introduction CD1 antigens include the first human leukocyte antigen defined by monoclonal antibodies. The first human "cluster of differentiation" contains three related antigens, CDIa, CDlb, and CDlc, with molecular weights between 43,000 and 49,000. These antigens are expressed in a relatively restrictive manner on the cortical thymocytes, the Langerhans cells of the skin for CDla and CDlc, many T leukemic cell lines, and a large proportion of B cells of neonates and severe combined immunodeficient patients for CDIc. The biological function(s) of CD1 antigens is yet to be elucidated. The CD1 antigens associate with fl2-microglobulin (for a review, see Ref. 1). This unusual feature is shared by the class I molecules of the major histocompatibility complex (MHC). Molecular cloning of the complementary DNA for CDla and subsequent genetic analysis 2reveal some intriguing information about the evolutionary relationship of CD1 and MHC. The exon-intron structures of the CD1 genes are largely similar to those of the MHC class I and class II I F. Calabi, C. Y. Yu, C. A. G. Bilsland, and C. Milstein, in " I m m u n o g e n e t i c s of the Major Histocompatibility C o m p l e x " (R. Srivastava, B. P. R a m , and P. Tyle, eds.), p. 215. V C H Publ., N e w York, 1991. 2 F. Calabi and C. Milstein, Nature (London) 323, 540 (1986).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993by AcademicPress, Inc. All rights of reproduction in any form reserved.
[28]
COSMID CLONING AND WALKING
379
genes and the derived amino acid sequences for the a 3 domains for CD1 and MHC class I, and the/3z domains for class II molecules, share ~21% sequence identity. Five different human CD1 genes can be detected by a CD1 cDNA cross-hybridizing probe but none of these genes is located in the MHC locus in chromosome 6. The five CD1 genes, named CDIA to CD1E, were cloned from a h genomic library. 3'4 In addition to the three previously defined antigens, the antigen encoded by CD 1D has been identified. 5 Nucleotide sequence comparison of the five CD1 genes exhibited 79-93% identity in the highly conserved ct3 exons, and 47-67% identity in the leader sequence and cq and a 2 e x o n s . 2-4'6-8 Consequently, a cDNA probe FCB (CD1A) containing the o~3 sequence cross-hybridizes to all five CD1 genes. Each of the CD1 genes can be represented by an EcoRI restriction fragment of specific size in genomic Southern blot analysis: CDIA, 4.5 kb; CD1B, 0.9 kb; CD1C, 7.2 kb; CDID, 3.1 kb and CD1E, 2.6 kb. 3 On the other hand, there is negligible sequence similarity at the 3'-untranslated (UT) regions among these five genes and hence, their Y-UT regions are gene specific. The CD1D gene appears to be more similar to the two murine CD1 genes than to the other four human genes. Therefore, the CD1 genes are categorized into two classes, with human CD1A, CD1B, CD1C, and CD1E in one class, and human CD1D, murine CDI.1, and CD1.2 in another class. 6 The DNA inserts of the CD1 h clones ranged from about 13 to 20 kb in size. 3 Although each CD1 gene is only about 3-4 kb, none of the h clones contained more than one CD1 gene. Using DNA from human X mouse somatic cell hybrids and the FCB probe, the human CD1 genes were mapped to chromosome 1. 2 High-resolution in situ hybridization showed that the five genes were localized within a single band, or at most two bands, in the human chromosome lq22-23. 9 Application of pulsedfield gel electrophoresis (PFGE) to resolve restriction enzyme-digested genomic DNA fragments sized between 50 and I000 kb, followed by Southern blot analysis with CD1 gene-specific probes, established the physical linkage of the five CDI genes, and the size limit of the putative CD1 gene complex. This led to the construction and screening of cosmid 3 L. H. Martin, F. Calabi, and C. Milstein, Proc. Natl. Acad. Sci. U.S.A. 83, 9154 (1986). 4 L. H. Martin, F. Calabi, F.-A. Lefebvre, C. A. G. Bilsland, and C. Milstein, Proc. Natl. Acad. Sci. U.S.A. 84, 9189 (1987). 5 C. A. G. Bilsland and C. Milstein, Eur. J. lmmunol. 21, 71 (1991). 6 F. Calabi, J. M. Jarvis, L. Martin, and C. Milstein, Eur. J. lmmunol. 19, 285 (1989). 7 S. P. Balk, P. A. Bleicher, and C. Terhorst, Proc. Natl. Acad. Sci. U.S.A. 86, 252 (1989). 8 A. Aruffo and B. Seed, J. Immunol. 143, 1723 (1989). 9 D. G. Albertson, R. Fishpool, P. Sherrington, E. Nacheva, and C. Milstein, EMBO J, 7, 2801 (1988).
380
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[28]
libraries to isolate CD 1 clones with larger inserts and application of cosmid walking techniques to clone their intergenic regions. We thus cloned the entire CD1 gene complex by overlapping cosmids and elucidated their organization. ~0
Principles of Methods
Choice of Pulsed-Field Gel Electrophoresis In Southern's pulsed-field gel electrophoresis apparatus, the "waltzer, ''1~'12 a circular gel on a turntable rotates in two preset orientations in a uniform electric field at preset time intervals. The major advantage of this machine is that DNA molecules follow straight tracks and that the parameters for gel electrophoresis are simple. A detailed analysis of the conditions governing the mobility of large DNA molecules in this cross-field gel apparatus can be found in Ref. 12, (Our "waltzer" was constructed by the Medical Research Council Laboratory of Molecular Biology Mechanical Workshop.)
Choice of Cosmid Vector and Digests of Genomic DNA Cosmid vector and restriction enzymes chosen are important factors for successful cloning and walking experiments. We chose Lorist 6 as the cosmid vector. This vector has unique restriction sites for HindlII, BamHI, ScaI, SacI, and NotI at the cloning cassette. 13,14Lorist 6, which originates from Loric, ~5 contains several unique features. First, it has the kanamycin-resistant gene (neomycin) instead of the commonly used ampicillin-resistant gene. The antibiotic kanamycin is bacteriocidal instead of bacteriostatic, as in the case for ampicillin. Thus, growth of satellite colonies due to local exhaustion of the antibiotic in the agar plate by growing bacteria with recombinants is minimal. Second, Lorist 6 cosmids are relatively stabler in the host bacteria because they use the h origin for DNA replication instead of that from ColEI, as in most plasmid/cosmid vectors. Lorist 6 recombinants may have a higher and more constant copy number than do most ColEI replicon-based I0 C. Y. Yu and C. Milstein, EMBO J. 8, 3727 (1989). 11 R. Anand, Trends Genet. 2, 278 (1986). t2 E. M. Southern, R. Anand, W. R. A. Brown, and D. S. Fletcher, Nucleic Acids Res. 15, 5925 (1987). J3 T. J. Gibson, A. Rosenthal, and R. H. Waterson, Gene 53, 283 (1987). 14 T. J. Gibson, A. R. Coulson, J. E. Sulston, and P. F. R. Little, Gene 53, 275 (1987). i5 p. F. R. Little and S. H. Cross, Proc. Natl. Acad. Sci. U.S.A. 82, 3159 (1985).
[28]
COSMID CLONING AND WALKING
381
cosmids. 15,16 The cloning cassette of Lorist 6 vector is flanked by rhoindependent bacterial transcription terminator sequences. This was designed to insulate the vector genes from transcriptional interference from the cloned insert DNA. Overall, Lorist 6 bears little DNA sequence identity to the commonly used plasmid/cosmid vectors derived from pBR322/pUC/pBluescript. Therefore DNA probes originated from these vectors are less likely to cross-hybridize to the Lorist 6 sequence due to contamination or unavoidable inclusion of vector sequences (particularly the polylinker) during the manipulation processes. The result is a cleaner background during the screening process. Third, bacteriophage T7 and SP6 promoters flank the Lorist 6 cloning cassette. Therefore, single-stranded RNA probes near the termini of the DNA insert can be prepared to facilitate cosmid walking experiments. We isolated cosmid clones from three libraries with different restriction digests of genomic DNA. This was to bridge gaps in cosmid clones isolated from a single library due to over- or underrepresentation of cleavage sites for a particular restriction enzyme in some regions. The three libraries were made with DNAs partially digested by HindlII, BamHI, and MboI, respectively. Cosmid clones isolated from the HindlII and BamHI libraries are easier to map for the corresponding restriction sites because the vector fragment (5.16 kb) can be readily distinguished from those of the insert after restriction digest with the corresponding enzyme and agarose gel electrophoresis. Thus, limits of the insert DNA can be defined. The MboI library was constructed because MboI is a four-cutter that may generate a better representation of random DNA fragments for a library. The Mbol DNA fragments are compatible to BamHI-digested cosmid vector for sticky end ligation.
Materials and Reagents Escherichia coli 1046 [overnight culture grown in tryptone broth supplemented with 10 mM MgSO 4 and 0.2% (w/v) maltose in a 37 ° environmental shaker] Gigapack II Gold packaging extract (Stratagene, Foster City, CA) Hybond N hybridization membranes (Amersham, Arlington Heights, IL), disks (82- and 132-mm diameters), and rolls Low-gelling temperature (LGT) agarose (GIBCO-Bethesda Research Laboratories, Gaithersburg, MD) Multiprime labeling kit (Amersham)/oligolabeling kit (Pharmacia, Piscataway, N J) [~-32p]dCTP, 3000 Ci/mmol (Amersham) 16 S. H. C r o s s and P. F. R. Little, Gene 49, 9 (1986).
382
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[28]
Hybridization solution: 10% (v/v) dextran sulfate (Pharmacia), 50% (v/v) formamide (Fluka, Ronkonkoma, NY), 0.5% (w/v) sodium dodecyl sulfate (SDS), 1 M NaCI Lysis buffer for mammalian cells: 0.32 M sucrose, 10 mM Tris-HCl, 5 mM MgCI2, pH 7.4; autoclave and then supplement with Triton X-100 to 1% (v/v) NDS: 10 mM Tris-HC1, 0.5 M ethylenediaminetetraacetic acid (EDTA), 1% lauroylsarcosine, pH 9.5; autoclave Sucrose gradient solutions: 15, 25, 35, and 45% (w/v) sucrose in 1 M NaCI, 20 mM Tris, pH 8.0, 10 mM EDTA SET: 150 mM NaCI, 50 mM Tris-HC1, 1 mM EDTA, pH 8.0 SSC (2 x ): 300 mM NaC1, 30 mM sodium citrate, pH 7.0 SSPE (2 x ): 360 mM NaC1, 20 mM NazHPO4, 2 mM EDTA; adjust to pH 7.4 with NaOH TAE (0.5 ×): 20 mM Tris-acetate, 1 mM EDTA, pH 8.5 TBE (1 × ): 90 mM Tris, 90 mM boric acid, 2.5 mM EDTA, pH 8.3 Tryptone broth (per liter): 10 g tryptone, 5 g NaC1, pH 7.4; mix/stir well, aliquot, and autoclave LB-Kan plates (per liter): 10 g tryptone, 8 g NaCI, 5 g yeast extract, 15 g Bacto-agar (Difco, Detroit, MI) in distilled water; autoclave, supplement with 25 mg of kanamycin monosulfate prior to pouring LB-GIy plates (per liter): 10 g tryptone, 8 g NaCI, 5 g yeast extract, 15 g Bacto-Agar, 250 ml of glycerol, and distilled water up to 1 liter; autoclave TY broth (2 x ) (per liter): 15 g tryptone, 5 g NaCI, 10 g yeast extract, and distilled water, pH 7.4; autoclave Methods
Pulsed-Field Gel Electrophoresis Large molecular weight DNA from tissue culture cells embedded in LGT agarose is used for restriction enzyme digests. Rare cutters such as SalI, XhoI, and others with CG dinucleotide as part of the recognition sequences are used. To resolve DNA fragments between 50 and 400 kb, the 1.0% (w/v) agarose gel is electrophoresed in 0.5 × TAE at 150 V with a pulse time of 25 sec at 20 ° for 40 hr. To resolve DNA fragments between 150 and 1000 kb, the gel is electrophoresed with a pulse time of 65 sec under identical conditions. Southern blot analysis of MOLT 4 genomic DNA resolved by PFGE and application of CDI gene-specific probes indicates that the CD1 genes cluster in an XhoI fragment less than 260 kb in size, and that they can be
[")8]
COSMID CLONING AND WALKING
383
1oOkb I
I
Sf X S
II
jl
SfSfS
X
III
,I ,[ "",%
,/ oo,,/" .7
X
i
CD 1A
CD1 D
S
CD1 C "'-.., CD1 B X
I
I 25kb I
I
FIG. 1. A partial, long-range restriction map around the human CD1 gene complex deduced from PFGE data. The five CD1 genes cluster in an XhoI fragment about 260 kb long. They can be further divided into two groups by a SalI digest of genomic DNA and PFGE. S, Sale X, XhoI; Sf, Sill. (After Ref. 10.)
divided into two groups by a SalI digest: CD1A and CD1D in one group, and CDIB, CD1C, and CD1E in another (Fig. 1).
Preparation of Cosmid Libraries Isolation of Genomic DNA Approximately 1 × 108 culture cells (-105 cells/ml) are harvested by spinning in an IEC-7R centrifuge (International Equipment Company, Needham Heights, MA) at 2000 rpm (-800 g), 4°, for 10 min and washed with 20 ml cold phosphate-buffered saline (PBS). The cell pellet is loosened by vortexing, and then thoroughly resuspended in 40 ml of lysis buffer. The cell membrane is solubilized by the lysis buffer and the nuclei pelleted by spinning at 2000 rpm, 4°, 20 min. To ensure complete membrane lysis, the pellet is washed with 20 ml of lysis buffer. Ten milliliters of SET buffer with 0.5% SDS and proteinase K (50 ~g/ml) is added to the nuclei pellet. After overnight incubation at 37° , the nuclear proteins are digested and the long DNA fibrils released to the medium. Residual proteins are removed by sequential extractions with equal volume of phenol, phenol : chloroform, and chloroform. For each extraction, the aqueous and organic phases are mixed gently by inverting the sealed tube five times and then centrifuged at 2000 rpm, 4 ° for 15 min. The lower, organic phase is removed for the first two extractions. For the last extraction, the viscous aqueous phase is transferred gently to a fresh 50-ml tube using a 20-ml syringe fitted with an inverted, disposable, 1-ml plastic pipette tip (with part of the tip portion
384
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[28l
removed with a razor blade). The large DNA fibrils are then fished out using a sealed Pasteur pipette tip after mixing the aqueous phase with 25 ml of chilled ( - 20 °) 95% (v/v) ethanol. After rinsing with 70% ethanol and partial air drying, the DNA fibrils are dissolved in 300/xl of TE (I0 mM Tris-HCl, 1 mM EDTA, pH 7.4) at 4 ° overnight. The DNA is dialyzed twice with 500 ml TE to remove residual contaminants. The genomic DNAs for the BamHI library and the MboI library are prepared by this method. Alternatively, the 1 x 10 7 PBS-washed cells are resuspended in 1 ml of PBS mixed with an equal volume of molten, 1.5% (w/v) agarose equilibrated at 42 ° and cast to an agarose plug mold. After solidification on ice, the agarose plugs are digested with proteinase K (final concentration, 10 /zg/ml) in NDS at 37° overnight. These agarose plugs are opaque in color and float in the buffer initially, but turn transparent and sink to the bottom of the container after proteinase K digestion. They are stored in fresh NDS buffer at 4 °. The genomic DNA trapped in the LGT agarose plugs is digested by restriction enzymes. The DNA used for the HindlII library is prepared with this method. Both methods for isolation of genomic DNA are recommendable but the agarose plug method gives a better yield of DNA and may be more suitable if the quantity of cells is limiting.
Partial Digestion and Fractionation of Genomic DNA To determine the optimum conditions for best representation of fragments around 35-45 kb, we digest equal amounts of genomic DNAs with serially diluted restriction enzymes (e.g., BamHI or MboI), according to the protocol described by Maniatis et al. J7 We carry out eight preliminary reactions, each with 2/xg of DNA and from 0, 0.04, 0.08, 0 . 1 6 . . . to 2.4 units of enzyme in a final reaction volume of 15/xl at 37° for 1 hr, and the digests are analyzed by 0.4% (w/v) agarose gel electrophoresis. We use DNA digested with HindlII, with XhoI, and undigested k DNA as molecular weight markers for 23 kb, 15 and 35 kb, and 48 kb, respectively. Four preparative digestions are performed under conditions that give from slightly partial to almost complete digestion. Thus, we use 1.5, 5, 10, and 22 units of BamHI or MboI each for 75/xg of DNA in a reaction volume of 300/zl for 1 hr at 37 °. Enzyme reactions are stopped by adding EDTA to a final concentration of 10 mM. The DNA fragments are squentially purified with equal volumes of phenol, phenol:chloroform, and chloroform extractions. After alcohol precipitation, the DNA pellets are each resuspended in 100 /xl of TE, pooled, and loaded onto a sucrose step 17 T. Maniatis, E. F. Fritsch, and J. Sambrook, "Molecular Cloning: A Laboratory Manual," p. 282. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1982.
[28]
COSMID CLONING AND WALKING
385
gradient and centrifuged at 26,000 rpm at 20° for 20 hr with an SW28 (Beckman, Palo Alto, CA) rotor. The sucrose step gradient is made by carefully layering four sucrose solutions sequentially, that is, 15, 25, 35, and 45% sucrose in buffer (i.e., with the lowest concentration first and displaced with the higher concentration from the bottom). After centrifugation, the gradient is fractionated with a fraction collector and a peristaltic pump. The centrifuge tube is sealed with Parafilm at the top with a 20-txl capillary tube piercing through the seal and the gradient. Clean Teflon tubings connected the capillary tube to the peristaltic pump and the fraction collector. About 50 fractions (0.7 ml each) are collected. To ensure that the fractionation system is working properly, a mock fractionation test is performed to work out the exact conditions, such as the settings for the fractionator and the peristaltic pump. The size of DNA fragments from every two fractions is analyzed with a 0.4% (w/v) agarose gel (using 15 t~l from each fraction). Fractions containing DNA fragments between 35 and 50 kb are pooled. The sucrose in the solution is removed by dialysis (twice) against 500 ml of TE, 4 °. To ensure that DNA fragments less than 35 kb are present in minimal quantity, the pooled D N A fractions are subjected to another gradient centrifugation by loading to the 15-45% step gradient, and processed as before. Smaller DNA molecules compete with larger molecules for ligation with the vector but are inefficiently packaged. Moreover, smaller DNA fragments may self-ligate and then be efficiently packaged, resulting in artifactual linkage data. The dialyzed DNA fragments are further purified by alcohol precipitation and resuspended in TE at a concentration of 0.5 ~g//xl. We normally prepare 3-10/xg of genomic DNA fragments between 35 and 48 kb long to construct a cosmid library of high complexity. We used the sucrose gradient method to size fractionate DNA for the BamHI and the MboI libraries. On the other hand, the HindlII library is constructed from partially digested genomic DNA embedded in agarose plugs, which is resolved with PFGE, twice, to obtain DNA fragments between 35 and 50 kb in size. LGT agarose gel (1%, w/v) is used for PFGE. To isolate DNA from resolved LGT agarose gel, the agarose block containing the appropriate size molecules is excised from the gel, transferred to a 1.5-ml microcentrifuge vial, incubated at 65 ° for 15 min to melt the agarose thoroughly, and equilibrated at 37 ° for 5 min. The molten solution is extracted twice with TE-saturated phenol (do not use phenol:chloroform or chloroform for this extraction), three times with n-butanol, followed by standard alcohol precipitation. DNA fragments are resuspended in TE with a final concentration of 0.5/zg/tzl.
386
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[]28]
Preparation of Vector CsCl-purified Lorist 6 DNA (20/zg in 100 p.l) is digested with 50 U of appropriate restriction enzyme such as BamHI or HindlII. Completion of digest is examined by 0.8% (w/v) agarose gel electrophoresis using 5/zl of the reaction mixture. The linearized DNA appeared as a clean, single band in the gel. Otherwise additional enzyme and longer incubation time are required. The linearized vector band can also be isolated with LGT agarose electrophoresis. The completely linearized DNA is purified by alcohol precipitation and resuspended in 100/~1 of phosphatase buffer (50 mM Tris, 1 mM EDTA, pH 8.0). Five units of alkaline phosphatase (Boehringer Mannheim, Indianapolis, IN) is added and the mixture is incubated at 37° for 30 rain. To stop the reaction, 80 t~l of phenol:chloroform is added and the mixture vortexed continuously for 20 sec. After centrifugation the aqueous phase is purified with alcohol precipitation and the vector DNA pellet resuspended in TE with a final concentration of 100 ng//zl. The quality of the vector is tested with a simple cloning experiment. Briefly, 10 ng of the vector DNA is ligated at 15° overnight, with and without 10 ng of Sau3AI-digested h DNA (for the BamHI vector). The ligated mixture is used to transform competent cells, which are plated on LB-Kan agar plates. Results of the self-ligation experiment (i.e., vector only) give information on the efficiency of the phosphatase reaction. The result for the Sau3AI experiment reveals the quality of the vector and the efficiency of the ligation. Less than 100 colonies are expected for the former reaction and more than 3000 colonies for the latter.
Ligation and Packaging A series of ligation reactions are set up with molar ratios of vector to DNA insert ranging from 25:1 to 10: 1. In one experiment, we ligate 300-500 ng of vector DNA with 150-250 ng of insert DNA, with five reactions in total and with each reaction in a final volume of 10/zl. Also included in the ligation mixture are 1 mM rATP, 1 mM spermidine, 50 mM Tris (pH 7.5), 10 mM MgC12 , 10 mM dithiothreitol (DTT), 500 ng of BSA, and 1 /~1 of T4 DNA ligase (New England BioLabs, Beverly, MA). The ligation reaction is carried out at 15° for 2 hr and at 4° overnight. Afterward, the ligated mixtures are pooled together, alcohol precipitated, and resuspended in 5/zl of sterilized distilled water and packaged with Gigapack II Gold (Stratagene) according to the instructions of the manufacturer. Briefly, the ligated mix is transferred to a tube of freeze-thaw lysate, to which sonicated extract (15 /zl) is added. Packaging reactions are performed for 2 hr at 22 ° and terminated by addition of 500/zl h diluent and
[28]
COSMID CLONING AND WALKING
387
20 t~l of chloroform. Packaged cosmids are stored on ice or in a refrigerator, but never frozen. The mixture is then spun briefly in a microcentrifuge to sediment debris and then assayed for titer of recombinants with a overnight culture of E. coli strain 1046~8 as host bacteria for infection. To obtain a high efficiency of infection, the host bacteria are grown in tryptone broth supplemented with l0 mM MgSO 4 and 0.2% (w/v) maltose for 16-24 hr. To assay the titer of the cosmid clones, I-5/zl of the packaged product is mixed with 100/zl o f k diluent and 200/~1 of overnight E. coil 1046 bacteria. After incubation at 37° for 25 min 800/zl of 2 x TY broth is added and incubated at 37° for 40 min. Aliquots of these recovered bacteria are plated on LB-Kan plates. We plate l0 ~1 (with 90/~1 of 2 x TY broth), 50/xl, and 100/zl of the mixture on 9-cm diameter agar plates and incubate them at 37° overnight. Thus, the total number of the recombinants obtained in that particular packaging reaction can be calculated. Each of our libraries contains approximately 5 x 105 clones. Less than 1 x 105 clones would be considered a poorly represented library. The libraries are plated out for screening.
Plating out Cosmid Library Two days prior to plating out a cosmid library, 40 large (13.5-cm diameter) and 100 medium (9-cm diameter) LB-Kan plates are prepared and left at room temperature, and 15 large LB-GIy plates are made and kept at 4°. Other materials required include 20 sheets of sterile 18 x 18 cm Whatman (Maidstone, U.K.) 3MM paper (or velvet pads), a pack of 132-mm-diameter nitrocellulose membrane filters (BA 85; Schleicher & Schuell, Keene, NH), packs of 132- and 82-ram-diameter Hybond N hybridization membranes (Amersham), two 20 × 20 cm glass plates, India ink, and a 1-ml syringe with needle. Day I. Five 1.5-ml vials, each containing approximately 5 x 104 packaged cosmids in 100/zl of ~ diluent and 200/xl of "overnight E. coli 1046 bacteria," are incubated at 37° for 25 min. To allow expression of the kanamycin-resistant gene in the infected host, 800/xl of 2 x TY broth is added to each vial and incubated at 37° for 40 min. Infected bacteria (500 /xl) is spread onto each large LB-Kan plate and left at room temperature for 1 hr, and incubated at 37° for 12-16 hr. Ten large plates are processed this way. We never leave the plates longer than this time, so as to avoid the overgrowth of bacterial colonies. Each colony is -0.5-1 mm in diameter. Larger colonies would result in high background due to bacterial debris, and in uneven transfer of colonies to the nitrocellulose membranes. Day 2. Lifting of bacterial colonies and replica plating are carried out I8 B. Cami and P. Kourilsky, Nucleic Acids Res. 5, 2381 (1978).
388
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[28]
in a laminar flow hood or in a clean, undisturbed area. Bacterial colonies from each plate are transferred to a nitrocellulose membrane (after labeling with a permanent, black marker pen) by overlaying the dry membrane on top of the bacterial colonies and pressing gently with a bent Pasteur pipette. The membrane and the plate are marked by piercing holes through the membrane to the agar in an asymmetric manner, using a syringe needle filled with India ink. The nitrocellulose membrane with bacterial side up is laid on top of a sheet of sterilized Whatman 3 MM paper, placed on a clean glass plate. This is the master copy of the library. Labeled, prewet Hybond N membrane is overlaid on the master copy, which is backed with a piece of sterilized Whatman 3MM paper (or a velvet pad) and a clean glass plate. The set-up is evenly pressed with the palm of the hand. After removing the top glass plate and the velvet pad, pinholes on the master copy are precisely copied to the Hybond membrane with syringe needle and India ink. The replica is peeled apart and placed on a fresh LBKan plate with colony side facing up. Two replicas are made from each master copy. The bacterial colonies from the original plate are kept at room temperature overnight (16 hr) and then stored at 4° for 1-2 weeks. Each of the master copies is placed on a cold LB-GIy plate with colony side up and left at 4 ° for 2 hr. Afterward, they are transferred to a clean plastic petri dish with colony side up, sealed with Parafilm, put into a plastic freezer bag, and stored at - 7 0 °. The replicas in fresh LB-Kan plates are incubated at 37° for 3 hr and then at room temperature for 12-16 hr. The size of bacterial colonies is carefully controlled to avoid overgrowth. Days 3 and 4. The replica membranes with bacterial colonies are processed to lyse the bacteria and to denature and immobilize the DNA molecules on the membrane. The membranes with bacterial colony side up are laid on Whatman 3MM filter papers in four plastic trays, each soaked with the following four solutions, respectively: (1) 10% (w/v) SDS, (2) 0.5 M NaOH, 1.5 M NaCI, (3) 0.5 M Tris-HCl (pH 8.0), 1.5 M NaC1, and (4) 2 x SSPE; each reaction takes 3-5 min. Afterward, the membranes are placed on dry Whatman 3 MM paper and then air dried for 15 min, ultraviolet (UV) irradiated with a Stratalinker (Stratagene) (autocross-link mode) or with a UV germicidal lamp in a laminar flow hood for 5 min, and baked for 30 min in an 80° oven. To remove bacterial proteins and debris that may give high background, the membrane filters are washed with SET-0.1% (w/v) SDS (prewarmed to 42 °) for 30 min at room temperature (or 42 °) with agitation, and then transferred into a hybridization bag or tube for prehybridization and hybridization experiments. For 20 large filters we used - 5 0 ml of hybridization fluid enriched with
[28l
COSMID CLONING AND WALKING
389
denatured, sonicated salmon sperm DNA (concentration, 100 tzg/ml) for prehybridization at 42° for 3 hr with mild agitation. Afterward, denatured DNA probes [labeled with oligolabeling kit (Pharmacia) or multipriming kit (Amersham) and [a-32p]dCTP] are added to the hybridization fluid to a final activity of - 5 x 105 cpm/ml. After 16-40 hr, the radioactive hybridization fluid is transferred to a 50-ml tube and kept at 4 ° for further use. The hybridized filters are washed for 20 min twice at room temperature with 500 ml of 2 x SSC-0.1% (w/v) SDS on a rotary platform, for 20 min twice at 65 ° with 500 ml of 1 × SSC-0.5% (w/v) SDS, and sometimes for 20 min with 500 ml 0.1 x SSC-0.1% (w/v) SDS at room temperature. The hybridization membranes are left briefly on Whatman 3 MM paper, wrapped in Saran wrap while still damp, and exposed to Kodak (Rochester, NY) X-OMAT films with two intensifying screens and kept in a - 7 0 ° freezer for 16-40 hr. To key the X-ray film to the hybridization membrane, we put markers with asymmetric dots of radioactive ink or Glogos autoradiogram marker (Stratagene) at the corners. Day 5. After developing the films, labels and pinhole marks on hybridization membranes are copied to the films after careful alignment of the marks on the film and the cassettes by the radioactive ink or autoradiogram marker. A genuine positive clone should have signals on films from both replicas, although the signal from one of the replicas might be weaker. Positive clones can be picked from the stored original plates in the first 2 weeks as an agar plug, or from the master nitrocellulose membranes kept in the - 7 0 ° freezer by carving the appropriate region ( - 5 mm in diameter) of the filter with a clean scalpel blade, respectively. Once the "positives" are picked from the master, we move on to the rescreening process immediately because the relatively small population of the positive clones in the growth medium may die when stored, even in 20% (v/v) glycerol at - 20 °. The selected colonies are recovered in 500/xl of 2 x TY broth at 37° for 40 min and then titrated on LB-Kan plates. The aim of the first rescreening process is to recover the positive clones and therefore a relatively high density of 200-1000 colonies are spread on each plate. Again the size of each bacterial colony is not allowed to grow more than 1 mm in diameter. Afterward, the bacterial colonies are transferred to Hybond N membrane, keyed, and processed as previously described. Replicas are not necessary for rescreenings. The Hybond N membrane is not prewet to enable efficient transference of bacterial colonies. Further processing to lyse the bacteria, denature the DNA molecules, and UV irradiate the membranes is as before. The processed membranes are prehybridized and then exchanged with hybridization fluid containing the original, used probe that has been denatured by heating in a boiling water bath for 10 min and chilled on ice for 5 min. Prehybridization and hybridization are for 2 and 16 hr,
390
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[28]
respectively, both in a 42 ° incubator with agitation. Washes and exposure are as before. The plates from which bacterial colonies were transferred to membranes are incubated at 37° for 3 hr and then at room temperature overnight to allow residual bacterial colonies to recover. Thus "positives" of the first rescreening are picked from these "recovered" colonies. The second rescreening is largely identical to the first one, except that the emphasis is on plating out well-isolated single colonies (preferably 20-100 colonies for each plate). We normally perform two to three rounds of rescreenings to ensure single colonies of the positive clones. For storage, the cosmid clones are grown overnight in LB-Kan medium, centrifuged and resuspended in 2 x TY-20% (v/v) glycerol, and kept at - 20 or - 70°.
Restriction Analyses Cosmid DNAs from 10 ml of overnight cultures of all positive clones are prepared using standard alkaline lysis techniques and restricted with HindlII, BamH1, and EcoRI enzymes to examine if they are similar or identical clones. Southern Blot analysis of the restricted cosmid DNA with the original probe (FCB) establishes which are genuine. The probe hybridizes to restriction fragments identical in size to the ones obtained from genomic DNA. There are some exceptions, presumed to be fragments close to the cloning site. To prepare large amounts of cosmid DNA from selected positive clones, we normally grow 500 ml or 1 liter of bacterial culture when DNA is prepared by the LiCI precipitation or the CsCI centrifugation methods, respectively. Restriction maps for cosmid clones are constructed by three to four rounds of single- and double-restriction digests of cosmid DNAs and Southern blot analyses with various probes. We take advantage of existing information such as the limited DNA sequence data available, and also restriction sites mapped previously in the h clones. The first round involves single cosmid DNA digests with a battery of six cutters. The aim is to identify appropriate enzymes that will cleave the cosmid at fewer than five sites. The second and third rounds of digests are a combination of single- and double-restriction enzyme digests, with the enzymes that give a manageable number of fragments, and also with the enzymes flanking the cloning cassette of the cosmid vector. In general, for each reaction we use - 1 . 5 tzg of cosmid DNA in a final volume of 20/xl. Restriction digests are carried out for 5-8 hr and the digested DNAs are electrophoresed in a 0.8% (w/v), 18 x 20 cm agarose gel (with ethidium bromide) for - 1 6 hr with 1 x TBE buffer, until the bromphenol blue is - 1 cm from the end of the gel. Molecular weight markers such as the 1-kb ladder and h DNA digested with HindlII (both from GIBCO-Bethesda Research
[28]
COSMID CLONING AND WALKING
391
Laboratories) are loaded in the flanking lanes. A (UV fluorescent, preferably) ruler is placed next to the molecular weight marker when the gel is photographed. The gel is treated and DNA blotted to Hybond N membranes. Sometimes two copies of blots are obtained from a single gel: the first copy blotted for - 1 5 min and the second for 1-2 hr. These blots are used to identify the restriction fragments that hybridize to available probes, and the fragments that contain repetitive DNA. Sonicated, total human genomic DNA is labeled by standard techniques and used as a probe to detect repetitive DNA. The restriction fragments that do not hybridize to the total genomic DNA probe are used for cosmid walking experiments. In our experience, good quality and quantity of cosmid DNA are essential for complete digestion, and therefore unambiguous data, to facilitate the construction of a restriction map of a cosmid clone. For interpreting the band patterns of the ethidium bromide-stained gels, it is important to bear in mind that intensity of a band reflects the quantity of DNA present and therefore an intense band may reflect two components of identical size, while a faint band (with respect to nearby bands) may be a partial digestion product. New approaches have been developed to help speed up the restriction mapping process. One approach is to linearize the cosmid, generate a partial restriction digest, and use specific oligonucleotide probes for unidirectional mapping.
Linkage of CD1 Genes Specific probes for each of the five CD 1 genes were used to screen cosmid libraries. These probes were mostly derived from the 3'-UT regions of various cDNA clones such as CD1A, CD1B, and CD1D, or from 3' genomic regions. The first library we screened was an amplified library made with partially digested genomic DNA.~9 Cosmid clones for all five CD1 genes were isolated from this library. However, restriction analysis of the cosmid clones for CD1A revealed that they were all identical, and so were the clones for CD1C and CDID. A more diverse collection of CD1 cosmid clones was obtained from the two made of BamHI and MboI partially digested DNA from MOLT 4 and the lymphoblastoid line AD, respectively. Further clones were obtained with unique DNA probes isolated from existing cosmids. The linkage of the five CD 1 genes was established in three stages. Stage 1: Two Different CD1 Genes in Single Cosmids. The linkage of CD1E to CD1B, and the linkage of CDIC to CD1A, was made obvious by 19 L. Buluweta, D. G. Albertson, P. Sherrington, P. H. Rabbitts, N. Spurr, and T. H. Rabbitts, EMBO J. 7, 2003 (1988).
392
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES kb -23 -9.5 -6.6
[28]
1 2 3 4 5 (kb)
I IIII
I
r
-4.3
--2.3 2
CD1E
CD1B
R B RB
Sm
B
B
XXRR
Sm
I I II
I
I
I
IIII
II
I COS Y18A
2.6 kb
0.9-kb
Linkage of CD1E and CD1B 2 m
/
CD1A
CD1C
B SmSmBB BR
I I I II
R
II
I
Sm
I
II
COS Y49G
Sal
I
R
Sal RB
Sal RB
I
I II_
COS Y75A COS YM4
B BR
R
Sm
Xho Xho
Sal
R
I II
I
I
I I
I
I
4.5 kb
I
II
7.2 kb
Linkage of CD1A
and CD1C
3 FIG. 2. Cosmid cloning and walking to link the five CD1 genes. (1) Southern blot analysis of MOLT 4 genomic DNA digested with EcoRI and probed with the CD1 cross-hybridizing probe, FCB. Five different CD1 genes with specific EcoRI fragments were detected. (2 and 3) Restriction maps of cosmids to show the linkage of different CDI genes in single cosmids. The specific EcoRI fragments for each CDI genes are marked under the map by solid bars with sizes indicated. Arrows represent the directions ofgene transcription. Dotted lines show incomplete maps. B, BarnHI; R, EcoRI, Sal, Sail; Sm, SrnaI; Xho, XhoI. (4) Southern blot analysis of cosmid DNAs digested with EcoRI and probed with FCB probe. (5) Cosmid walking to link the CD1A and CD1D genes. W and Z are CD1D- and CDlA-specific probes, respectively. A nonrepetitive probe, Y, was isolated from cos Y49G and used for screening the BarnHI and the MboI cosmid libraries, which yielded YM84F1 and YA14F5, respectively. The small (1.4 and 1.5 kb) BarnHI fragments are marked as vertical strokes in the various cosmids in (5a). The 1.4-kb BarnHI fragments from Y33G were eluted, labeled, and used as a probe for Southern blot analysis of BamHI-restricted DNA from YA 14F5 and Y33G (5b). Hybridization of this probe to both cosmids at a specific fragment of identical size indicated that the two cosmids are linked. (Modified from Ref. 10.) (Fig. 2 continues.)
[28]
COSMID CLONING AND WALKING
393
(kb) CD1C 7.2 CD1A 4.5 CD1D 3.1 CD1E 2.6
CD1B 0.9
4
b '
5'
5 10 (kb) '
'
> >kb
CD1D YM1
ill
YM38
Y33G YA14F5
,,, - 1.4
YM84F1 Y49G CD1A Probes
D t W
~ l X
r~ t Y
n Z
Linkage of CD1D and CD1A 5 FIG. 2. (continued)
the presence of specific restriction fragments arising from the a3 exons of these genes in cos Y18A and cos YM4, respectively. As shown in Fig. 2, in Southern blot analysis of EcoRI-digested cosmid DNAs with the FCB cross-hybridizing probe, the CD1B-specific 0.9-kb fragment and the CDIEspecific 2.6-kb fragment were detected in cos 18A, while the CD1A-specific 4.5-kb fragment and the CD1C-specific 7.2-kb EcoRI fragment were detected in cos YM4 [Fig. 2 (4)]. Restriction analyses of these cosmid DNAs revealed that the CD1E and the CD1B genes were about 20 kb apart and arranged in a head-to-head orientation [Fig. 2 (2)]. The CD1A and the
394
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[28]
CD1C genes were 25 kb apart and arranged in the same transcriptional orientations [Fig. 2 (3)]. Stage 2: Overlapping Restriction Fragments in Two Cosmids Containing Different CD1 Genes. Cosmid clones containing CD1C (cos Y75A, cos YM5) and CD1B genes (cos Y l l L A and cos Y14C) had in common a number of restriction fragments that accounted for about 21 kb. In addition, Y11LA, which contained the whole of the CD1B gene, included a specific 0.8-kb HindIII fragment that hybridized to a 3'-end CDIC probe. Putting all this information together, it could be deduced that CD1B and CD1C genes were about 32 kb apart and arranged in a tail-to-tail orientation. Stage 3: Cosmid Walking. The analysis of the isolated cosmid clones established the linkage between CD1A, CD1C, CD1B, and CD1E genes. From the pulsed-field gel electrophoresis experiment we knew that the CD1D and CD1A genes were at most 160 kb apart, and separate from the other CD1 genes. We deduced that the CDID gene was located upstream of the CD1A gene. Nonrepetitive DNA restriction fragments from cos Y49G were identified by Southern blot analysis using a labeled, sonicated total human genomic DNA probe. We selected a 3.2-kb HindIII-ScaI fragment, located 25 kb 5' to the CD1A gene, to screen the cosmid libraries. Two different cosmids, YA14F5 and YM84F1, were obtained [Fig. 2 (5a)]. Cos YA14F5 shared a 1.4-kb BamHI restriction fragment with cos Y33G and an additional 1.5-kb BamHI fragment with cos YM1. To test whether these were overlapping fragments, the 1.4-kb BamHI fragments from both Y33G and cos YA14F5 were eluted after agarose gel electrophoresis and analyzed. They showed identical restriction patterns with frequent restriction enzyme cutters such as Hinfl, MboI, and AvaII. In addition, the radioactively labeled 1.4-kb probe isolated from cos Y33G also hybridized to the 1.4-kb BamHI fragment from cos YA14F5 [Fig. 2 (5b)]. Thus, it was concluded that cos YA14F5 linked the cosmid clones for CD1D and CD1A. Detailed analyses of the cosmids for these two genes revealed that they are located about 73 kb apart and that they are arranged in the same transcriptional orientation. Overall, the linkage of the five CD1 genes was established by 14 overlapping cosmid clones spanning -190 kb of DNA (Fig. 3). l° Discussion Preparation and screening of cosmid libraries is relatively more difficult than for ~ libraries. The quality of probes for screening of cosmid libraries is critical as common sequences in the probe and the cosmid cloning vector may cause high background. The choice of Lorist 6 vector for library
[28]
COSMID CLONING AND WALKING
I
Sal I
Xho I
I
s~.~ i
I
~mH, s=~
Ill II
I
I I I
III IIIII
I IIII
I
I
I
I
I
II
CD1A
[]
[]
i YM1 I YMS8 ,Y33G
II I
II
CD1D
cosmids
I
I
I
I I
I
II
I
395
I I
I
CDIB
CDIE
[]
[]
mm
=
= i
Y14C Y11LA
i I Y49G
I
~Y 7 5 A YM5
I
II
CD1C
= , = , YA14F5 IYM84F1
I I IIII
I I
=yllLB Y18A Y 19B i I
=
= I
| YM4
Ixo~s
tt
l
t
tt
t
t
tt
0
20
40
60
80
100
120
140
160
180
200
I
I
I
I
I
I
I
I
I
I
I
(kb)
FIG. 3. A physical map linking the five CD1 human thymocyte differentiation antigen genes. Horizontal arrows represent the transcriptional orientations. Vertical arrows show the corresponding position of probes used for screening and/or Southern blot analysis of cosmid DNAs. (After Ref. 10.)
construction largely circumvents this problem as there is little similarity in DNA sequence to the pUC or pBluescript vectors, from which most of the DNA probes are derived. When the cosmid clones are isolated, however, compared with k clones the follow-up work is simpler and easier to control. Cosmid DNA can be prepared following standard plasmid procedures with reasonably good quality and high yield (e.g., 100-500/zg of cosmid DNA from a 500-ml culture with chloramphenicol amplification). The inserts are at least twice larger in cosmid than in X clones, an obvious advantage in chromosomal walking experiments. Several simple precautions may increase the success rate for construction and screening of cosmid libraries. The efficiency of infection by packaged cosmids is a critical factor in maximizing the complexity of the cosmid library. In our hands host bacteria grown in yeast extract-containing media such as Luria broth or 2 × TY broth consistently give 3 to 10 times lower plating efficiency for cosmid and X clones than those grown in tryptone medium supplemented with 0.2% (w/v) maltose and I0 mM
396
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[28]
MgSO4 for 16-24 hr. It is better to concentrate the work only with colonies giving good positive signals from two replicas. When the positives are picked from the master filters, it is essential to move on to the rescreening procedures as soon as possible instead of storing them as glycerol stocks for future rescreening. A considerable proportion of bacteria in the glycerol stocks may be killed in the freeze-thaw procedure and thus the desired clones may be lost. The master filters should be kept at - 7 0 ° in a deep freezer for long-term storage and to avoid further freeze-thawing. The success rate for rescreening clones from filters stored at - 2 0 ° is significantly lower than those stored at - 7 0 °. The lysis of bacterial colonies for the rescreening of cosmid/plasmid clones can be simplified. 2° Briefly, the bacterial colonies are transferred to Hybond N membrane and then placed on a Whatman No. 1 filter paper presoaked with 2 x SSC-0.5% (w/v) SDS in a plastic or glass tray for 3 min. The tray with filters is then subjected for 3 min to the full power of a microwave oven equipped with a rotatory platform. This replaces the denaturation and the neutralization by chemicals and also the fixation steps. The prewash, prehybridization, and hybridization procedures are the same as before. Screening of amplified libraries, whether cDNA or genomic DNA, cosmid or X, homemade or commercially available, always suffers the same setback: the clones isolated with a given probe tend to be identical and probes generated from this new clone for further screenings of the same library may again result in isolation of clones with identical inserts. There are good theoretical and practical reasons why this should be so. Taking certain precautions in the library amplification procedure can help. It is preferable to plate out the primary library directly on several agar plates with selection media. The amplified clones from each plate can be collected using a cell scraper and homogeneously resuspended in 2 x TY broth supplemented with glycerol (final concentration, -25%). The bacteria are then pooled into three or more independent fractions, aliquoted, and stored at - 7 0 °. Thus clones isolated from different fractions of the amplified library are less likely to contain identical inserts and therefore a higher chance to cover upstream or downstream overlapping regions. In a walking experiment to physically link different genes with cosmid clones, knowledge of the limit of the gap to cover and direction of the next gene to reach is important. This information may be obtained by pulsedfield gel electrophoresis experiments. Modified techniques such as jumping libraries may be required if the gap between two genes is large and there is an urgent demand to reach the next gene, as was the case for cloning 20 L. Buluwela, A. Foster, T. B o e h m , and T. Rabbitts, Nucleic Acids Res. 17, 452 (1989).
[28]
COSMID CLONING AND WALKING
397
the cystic fibrosis gene. 21 When the gap is small (e.g., less than 30 kb) a judicious choice of new probes to screen cosmid and/or ?, DNA libraries generated with a different restriction enzymes may yield valuable clones to cover the gap, or at least generate new probes for further walking procedures. In our experiments to link the CD1D and CDIA genes, cos Y33G and cos Y49G (both isolated from a HindlII library) were separated by a gap of about 35 kb. Application of a novel 5' probe derived from cos Y49G to screen a BamHI library yielded cos YM84F, which almost touched cos Y33G. Application of the same 5' probe to screen an MboI library resulted in the isolation of a larger clone that overlapped to cos Y33G by 1.4 kb and established the final linkage. Construction of restriction maps for the CDI gene complex was achieved purely by a combination of single- and double-restriction digests and Southern blot analysis. This method is tedious. There are methods that may enhance the speed of the restriction mapping process. Cosmid DNA can be linearized by restriction digest with a rare cutter such as NotI, or by h-terminase 22 (Takara Biochemical, Berkeley, CA), which specifically recognizes the cos site of the vector and generates a 12-bp cohesive end that can be denatured by heating at 65 °. Through Southern blot analysis with a carefully chosen specific oligonucleotide probe and the linearized DNA that has been partially digested with a second restriction enzyme, the new restriction sites can be directionally mapped. In the autoradiograph the size of each band in the ladder defines the location of restriction sites. The oligonucleotide probe should be located between the site of linearization and the cloning site (or the first recognition site of the enzyme used for the partial digest). By means of two specific oligonucleotide probes flanking the two ends of the cloning sites or those complementary to the cohesive ends of the X cos site, a cosmid can be mapped from both directions. Conditions for agarose gel electrophoresis for directional mapping vary among cosmids as their restriction enzyme patterns vary. The size of the first restriction fragment next to the cloning site or the socalled end fragment is an important factor because it is the first band to be detected by the labeled oligonucleotide probe. A conventional 0.8% (w/v) agarose gel is ideal if the end fragment is less than 3 kb and if the restriction sites are evenly distributed. An end fragment of more than 5 kb may require a lower percentage gel and longer time for electrophoresis. Pulsed-field gel electrophoresis may be desirable to resolve band patterns 21 j. M. Rommens, M. C. Iannuzzi, B.-S. Kerem, M. L. Drumm, G. Melmer. M. Dean, R. Rozmahel, J. L. Cole, D. Kennedy, N. Hidaka, M. Zsiga, M. Buchwald, J. R. Riodan, L.-C. Tsui, and F. S. Collins, Science 245, 1059 (1989). 22 H. R. Rackwitz, G. Zehetner, H. Muliado, H. Delius, J. H. Chai, A. Poustka. and H. Lehrach, Gene 40, 259 (1985).
398
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[29]
greater than 10 kb. Data obtained from directional mapping are a useful guide for the correct array of the bands. However, accurate sites should be determined by standard single- and double-restriction digests. Acknowledgments We thank Dr. Terry Rabbitts for giving us the Colo HSR HindIII cosmid library, Dr. John Su|ston for a helpfuldiscussionon the methodfor platingof cosmid libraries. C.Y.Y. was supportedby researchgrantsfromthe Children'sHospitalFoundation,Columbus,Ohio (#020-832), the OSU-American Cancer Society (#IRG-16-30), and the Bremer Research Fund (#9114). L.C.W. was supported by the BremerResearch Fund (#9106) and the OSU Seed Grant (#221396). We are indebtedto Ms. BrendaCain and Judy Whybrowfor expert secretarial assistance.
[29] D e t e c t i o n o f D N A in S o u t h e r n B l o t s with Chemiluminescence By IRENA BRONSTEIN, JOHN C . VOYTA, O W E N J. M U R P H Y , and RICHARD L . CATE
RICHARD TIZARD, CHRISTIAN W . E H R E N F E L S ,
Introduction The analysis of DNA by membrane hybridization techniques is important in the characterization of cloned genes, investigation of genetic diseases, detection of pathogens, forensic determinations, as well as many other areas of biology. Membrane-based methodologies vary in the amount of information they provide, from simple detection by dot-blot analysis to nucleotide sequence determination with the genomic sequencing protocol of Church and Gilbert) Various types of probes can be used with these techniques, including synthetic oligonucleotides labeled with 32p using polynucleotide kinase or deoxynucleotidyl terminal transferase, longer DNA probes isotopically labeled by nick translation, random priming, or polymerase chain reaction (PCR), and RNA probes generated with SP6 polymerase. As an alternative to 32pisotope, a number of nonisotopic methods have been developed for DNA detection. The colorimetric substrate Nitro Blue Tetrazolium (NBT)/5-Bromo-4-Chloro-3-Indolyl Phosphate (BCIP) for alkaline phosphatase has been used to detect DNA, in combination with probes labeled with biotin or digoxigenin, via avidin-alkaline phosphatase I G. M. Church and W. Gilbert, Proc. Natl. A c a d . Sci. U.S.A. 81, 1991 (1984).
METHODSIN ENZYMOLOGY,VOL. 217
Copyright© 1993by AcademicPress, Inc. All rightsof reproductionin any formreserved.
[29]
CHEMILUMINESCENCE TO DETECTDNA
399
or digoxigenin antibody-alkaline phosphatase conjugates, respectively. 2'3 Chemiluminescence, the emission of light as a consequence of a chemical reaction, has also been used as an alternative detection methodology. 4-1° As discussed below, chemiluminescence offers a number of advantages over other methods of nonisotopic detection. Chemiluminescent organic reactions can be classified in several ways. The majority of these reactions require a critical step that involves oxidation of a substrate with molecular oxygen or its synthetic equivalent. The oxidation of luminol is a classic example of a chemiluminescent reaction in which the key oxidative step involves hydrogen peroxide and aminophthalhydrazide in the presence of suitable catalysts.ll Other important types of chemiluminescent organic reactions are electron transfer and fragmentation schemes, which occur in oxygenated species such as endoperoxides, 1,2-dioxetanes, dioxetanones, and trioxanes. 32 Simple dioxetanes, such as tetramethyldioxetane, are unstable and thermally decompose near or below room temperature to generate excited states of carbonyl products. 13 Our interest in 1,2-dioxetanes is based on the premise that these molecules, when suitably derivatized, have the potential to simplify the process of chemiluminescence greatly by eliminating the addition of the singlet oxygen step. Numerous dioxetanes and dioxetanones, once believed to be only fleeting transients, have now been synthesized, isolated, and studied. Various substituent groups have been shown to decrease the rates of decomposition of 1,2-dioxetanes. Perhaps the most dramatic example was reported by Wynberg and co-workers, TM who found that the half-life 2 j. j. Leary, D. J. J. Brigati, and D. C. Ward, Proc. Natl. Acad. Sci. U.S.A. 80, 4045 (1983). 3 S. Dooley, J. Radtke, N. Blin, and G. Uteregger, Nucleic Acids Res. 16, 11839 (1988). 4 1. Bronstein, J. C. Voyta, K. G. Lazzari, O. J. Murphy, B. Edwards, and L. J, Kricka, BioTechniques 8, 310 (1990). 5 j. j. Lanzillo, BioTechniques 8, 622 (1990). 6 C. M. Kreike, J. R. A. de Koning, and F. A. Krens, Plant Mol. Biol. Rep. 8, 172 (1990). 7 R. Tizard, R. L. Cate, K. L. Ramachandran, M. Wysk, J. C. Voyta, O. J. Murphy, and I. Bronstein, Proc. Natl. Acad. Sci. U.S.A 87, 4514 (1990). 8 R. L. Cate, C. W. Ehrenfels, M. Wysk, R. Tizard, J. C. Voyta, O. J. Murphy, and I. Bronstein, Genet. Anal. Tech. Appl. 8, 102 (1991). 9 D. Pollard-Knight, A. C. Simmonds, A. P. Schaap, H. Akhavan, and M. A. W. Brady, Anal. Biochem. 185, 353 (1990). ~0 C. Martin, L. Bresnick, R.-R. Juo, J. C. Voyta, and I. Bronstein, BioTechniques 11, 110 (1991). tl H. O. Albrecht, Z. Phys. Chem. 136, 321 (1928). t2 G. B. Schuster and S. P. Schmidt, Adv. Phys. Org. Chem. 18, 187 (1982). 13 N. J. Turro, P. Lechtken, N. E. Schore, G. Schuster, H.-C. Steinmetzer, and A. Yekta, Acc. Chem. Res. 7, 97 (1974). 14 j. H. Wieringa, J. Strating, and H. Wynberg, Tetrahedron Lett. 2, 169 (1972).
400
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[29]
ENERGY SOURCE
o[o
ELECTRON-RICH ALKOXY SUBSTITIJENT
~ STABILITY
"N ACTIVATION
EMISSION PROPERTIES
FIG. 1. Schematic structure of stable 1,2-dioxetane enzyme substrates. of a d a m a n t y l i d e n e a d a m a n t a n e - 1,2-dioxetane at 25 ° was 21 years. The low rate of d e c o m p o s i t i o n c o m p a r e d to other k n o w n dioxetanes was attributed to a steric effect.15 U n s y m m e t r i c a l l y substituted dioxetanes, which bear a single a d a m a n t y l group, d e c o m p o s e more rapidly than the bisadamantyl derivatives, but are sufficiently stable for practical applications. ~6 Activation of 1,2-dioxetanes (i.e., emission of light) can o c c u r in two ways. H u m m e l e n e t al.17 described a thermal method for activating adam a n t y l i d e n e a d a m a n t a n e - l , 2 - d i o x e t a n e . This dioxetane, when heated to 176 °, d e c o m p o s e s into two molecules of a d a m a n t a n o n e a c c o m p a n i e d b y a chemiluminescent signal. The second type of 1,2-dioxetane activation consists of the r e m o v a l of a p r o t o n or a substituent, which leads to electronic redistribution, followed b y a c o n c e r t e d dioxetane ring fragmentation with chemiluminescence. ~8 It is this m o d e of activation that has led to the synthesis of 1,2-dioxetanes that can be activated by e n z y m e s (i.e., by the r e m o v a l o f substituents). A schematic diagram of a 1,2-dioxetane substrate is shown in Fig. 1. In s u m m a r y , stable 1,2-dioxetane chemiluminescent substrates incorporate several important functions: an energy source of c h e m i l u m i n e s c e n c e in the p e r o x y bond, stability provided by the spiroadam a n t a n e group, light emission properties defined by the aryl substituent, and, finally, an activation site that consists o f an e n z y m e - c l e a v a b l e group. 19 15W. Adam, L. A. Arias Encarnacion, and K. Zinner, Chem. Ber. 116, 839 (1983). 16I. Bronstein and A. Sparks, in "Immunochemical Assays and Biosensor Technology for the 1990's" (R. M. Nakamura, Y. Kasahara, and G. A. Rechnitz, eds.), pp. 229-250. Am. Soc. Microbiol., Washington D.C. (1992). i7 j. C. Hummelen, T. M. Luider, and H. Wynberg, this series, Vol. 133, p. 531. 18C. Lee and L. A. Singer, J. Am. Chem. Soc. 102, 3823 (1980). 19I. Bronstein, B. Edwards, and J. C. Voyta, J. Biolumin. Chemilumin. 4, 99 (1989).
[29]
CHEMILUMINESCENCE
TO DETECTDNA
401
0-00CH3 OPO~F]o. 2. Chemical structure of AMPPD.
The enzyme-cleavable group acts as a protecting moiety that enables luminescence to occur only when it is cleaved by a suitable enzyme. An example of a direct chemiluminescent substrate is disodium 3(4-methoxyspiro[1,2-dioxetane-3,2-tricyclo[3-3-1-13,7] decan]-4-yl) phenyl phosphate (AMPPD) (Fig. 2), which in the presence of the enzyme alkaline phosphatase decomposes with light emission at 477 nm. This particular molecular structure was chosen based on the enhanced thermal stability of the compound, improved chemiluminescence yields, and ease of synthesis. The activation energy for AMPPD decomposition in HzO is 21.5 kcal/ mol. AMPPD is stable at 30°, at which its half-life for decomposition in carbonate buffer at pH 12 is 1.2 years. AMPPD is indefinitely stable in the solid form at 40.19 The K m of AMPPD is 0.2 mM, typical of other monophosphate esters that are substrates for alkaline phosphatase. 2° The mechanism leading to AMPPD luminescence in the presence of alkaline phosphatase involves two steps and is shown in Fig. 3. In the first step, dephosphorylation by alkaline phosphatase occurs, generating a moderately stable anion, AMP-D. The second step involves a further breakdown of A M P - D to adamantanone and the charge-transfer excited state of methyl m-oxybenzoate anion, which emits light. The half-life of decomposition of A M P - D in solution varies from 2 min to several hours, depending on its immediate environment. As a result, A M P - D concentration increases until the rate of its decomposition is equal to the rate of its production from AMPPD. The chemiluminescent light emission from AMPPD activated by alkaline phosphatase occurs in the form of a "glow" that persists for several hours in solution. On nylon, the kinetics are considerably slower, and the glow lasts for days. 7 This light emission profile is characteristic of a two-step kinetic process. In the following sections, we describe protocols employing AMPPD to detect DNA on Southern blots and to detect nucleotide sequence ladders. The protocols have been divided into two categories based on the use of biotinylated probes or probes directly conjugated to alkaline phosphatase. 20 R. B. McComb, G. N. Bowers, Jr., and S. Posen, "Alkaline Phosphatase," p. 245. Plenum, New York, 1979.
402
[29]
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
°-°
OIO o" HP04T
1
t~ FIG. 3. Mechanism of enzyme-catalyzed decomposition of AMPPD.
Principles of Method Chemiluminescence detection with AMPPD can be performed using various experimental formats, such as solution, bead, and membrane hybridizations. All of the DNA hybridization techniques described in this chapter involve the use of neutral nylon membranes as a solid support onto which the target DNA is immobilized. Subsequently, a complementary probe, labeled with alkaline phosphatase or biotin, is hybridized to the immobilized DNA on the membrane. The filter then undergoes a series of washes to remove excess and nonspecifically bound probe, prior to the incubations necessary for chemiluminescent detection. In the case of the biotinylated probe, the membrane undergoes an additional incubation with an avidin-alkaline phosphatase conjugate. Ultimately, the membranes are incubated in AMPPD for a short period and placed between two pieces of plastic (Saran) wrap, trapping a thin film of solution. Images are then obtained on X-ray film or Polaroid (Cambridge, MA) instant black and white film. The amount of light produced is directly proportional to the level of bound alkaline phosphatase.
Biotinylated Probes
Biotinylation of DNA and Oligonucleotide Probes DNA probes can be labeled with biotin for subsequent detection with streptavidin-labeled alkaline phosphatase by a number of enzymatic and chemical methods. Biotin can be incorporated into DNA probes enzymatically by replacing one nucleotide with a biotinylated nucleotide derivative. Biotinylation does not significantly affect the hybridization conditions
[29]
CHEMILUMINESCENCE
TO DETECTDNA
403
of the probe. Several biotinylated dUTP analogs and other biotinylated nucleotides are available from commercial suppliers. Synthetic oligonucleotide probes can be 3' end-labeled using terminal transferase, allowing one or more biotinylated nucleotides to be added. 21 We have found that optimum sensitivity is obtained when 10 or fewer biotinylated nucleotides, spaced with unlabeled nucleotides at a ratio of 1 : 3, are added to the 3' end of an oligonucleotide probe. Spacing of biotinylated nucleotides with unlabeled nucleotides permits more efficient binding of multiple streptavidin-labeled alkaline phosphatases to the hybridized probe. Chemical methods can be used to add biotin groups to the 5' end or at other positions of oligonucleotide probes. 22 To chemically biotinylate an oligonucleotide probe, an amino group must be incorporated into the probe first. This is most commonly performed by using the Aminolink reagent (Applied Biosystems, Foster City, CA) to add an amine at the 5' end of the synthetic oligonucleotide probe at the last step of probe synthesis. An amine-modified thymidine derivative is also available (Molecular Biosystems, Inc., San Diego, CA) for incorporation of an amine at an internal position. Reagents are also available for the incorporation of amines using other reagents. After cleavage and deprotection of the probe, the amine group can be biotinylated using N-hydroxysuccinimido (NHS)-biotin. Biotin-containing probes can also be directly synthesized with biotin phosphoramidites that are commercially available (Clontech Laboratories, Palo Alto, CA). Cloned DNA probes can be labeled with biotin by using biotinylated nucleotides in nick translation 2 and random hexamer priming 23 reactions. For both of these systems, we replace dTTP with biotin-ll-dUTP in standard labeling reactions. These labeling systems produce DNA probes with high levels of biotinylation that can be used in a variety of blot detection systems. One major advantage of biotinylated DNA probes over 32p-labeled DNA probes is their stability. Biotinylated probes are stable for 6 to 12 months; thus probes that are used routinely can be synthesized in large amounts and stored for future use. Recommended hybridization and chemiluminescent detection conditions for biotinylated probes are detailed below. These results clearly show the advantages of multiple biotin groups per probe. 2~ R. K. Moyzis, J. M. Buckingham, L. S. Cram, M. Dani, L. L. Deaven, M. D. Jones, J. Meyne, R. L. Ratliff, and J. R. Wu, Proc. Natl. Acad. Sci. U.S.A. 85, 6622 (1988). 2z A. Chollet and E. H. Kawashima, Nucleic Acids Res. 13, 1529 (1985). 23 D. Cherif, O. Bernard, and R. Berger, Hum. Genet. 81, 358 (1989).
404
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[29]
Hybridization with Biotinylated Oligonucleotide Probes Southern blots or dot blots should be prepared by standard protocols. 24'25 Optimum signal to noise is obtained with neutral nylon membranes (Tropilon-45; Tropix, Inc., Bedford, MA). The target DNA should be fixed to the membrane by ultraviolet (UV) fixation or by baking at 80 ° (less than 20 min). The membranes should then be wetted in 0.25 M disodium phosphate (pH 7.2 with H 3 P O 4 ) and prehybridized in hybridization buffer [7% (w/v) sodium dodecyl sulfate (SDS), I mM ethylenediaminetetraacetic acid (EDTA), 1% (w/v) 1-Block reagent (Tropix), 0.25 M disodium phosphate, (pH 7.2 with H3PO4)] for I hr at 55° (or the appropriate hybridization temperature for the probe). Hybridize the biotinylated oligonucleotide probe, diluted (0.1 to 5.0 pmol/ml) in fresh hybridization buffer, for 2 hr at the appropriate temperature. Next, wash the membrane as follows: twice (5 min each) at room temperature in 2 x SSC (1 x SSC: 0.15 M NaC1, 0.015 M sodium citrate), 1% (w/v) SDS; twice (15 min each) at the hybridization temperature in 1 x SSC, 1% (w/v) SDS; twice (5 min each) at room temperature in 1 x SSC. Then proceed to the section, Chemiluminescent Detection of Biotinylated Probes. Figure 4 shows an example of the results obtained using the above hybridization conditions. It gives a comparison of the hybridization of two terminal transferase-labeled oligonucleotide probes, one labeled with 1 biotin-11-dUTP per probe, and one with 10 biotin-11-dUTPs per probe spaced with dATPs.
Hybridization with Biotinylated DNA Probes Prepare membranes as described in the previous section. Wet the membrane with 5 x SSC. Prehybridize the membrane with hybridization buffer [0.5% (w/v) polyvinylpyrrolidone (PVP), 1 mM EDTA, 1 M NaCI, 5% (w/v) dextran sulfate, 0.2% (w/v) heparin, 4% (w/v) SDS, 50 mM Tris, pH 7.2]. Dilute the heat-denatured biotinylated DNA probe in hybridization buffer (1 to 20 fmol/ml), add to the membrane, and incubate overnight at 65 °. Then wash the membrane as follows: twice (5 min each) at room temperature with 2 × SSC, 1% (w/v) SDS; twice (15 min each) at 65° with 0.1 x SSC, 1% (w/v) SDS; twice (5 min each) at room temperature with 1 x SSC. Next, proceed to the section, Chemiluminescent Detection of Biotinylated Probes.
24 E. M. Southem, J. Mol. Biol. 98, 503 (1975). 25 p. A. Devlin, K. L. Ramachandran, and R. L. Cate, DNA 7, 499 (1988).
[29]
CHEMILUMINESCENCE TO DETECTDNA
A
405
B t
I
100 50 25 12.5 6.25 3.13 1.56 0.78 0.39
FIG. 4. Chemiluminescentdetection of pBR322 with a biotinylated oligonucleotideprobe. Dilutions of pBR322 plasmid were spotted onto Pall Biodyne A nylon membrane and detected by hybridization with an oligonucleotide probe (35-mer) from pBR322, biotinylated with terminal transferase. Membranes were hybridized to oligonucleotideprobes containing 1 (A) or 10 biotin-ll-dUTP (B). The membranes were subsequently blocked, incubated with streptavidin-alkaline phosphatase and AMPPD, and exposed to film as described in text.
Chemiluminescent Detection of Biotinylated Probes After the hybridization and stringency washes described above, the membranes can then be processed for chemiluminescent detection. This portion consists of three steps: blocking the membrane to prevent nonspecific binding of streptavidin-alkaline phosphatase, incubation with streptavidin-alkaline phosphatase, and incubation with chemiluminescent substrate. The following procedure is performed at room temperature. First, wash the membrane twice (5 min each) with blocking buffer [0.2% (w/v) I-Light blocking reagent (Tropix), 0.1% (v/v) T w e e n 20, in phosphatebuffered saline (PBS)] and then incubate the membrane for 30 min with the same buffer. Next, incubate the membrane for 30 min with Avidx-alkaline phosphatase (Tropix) (diluted 1 : 10,000 with blocking buffer minus Tween20). Wash the m e m b r a n e once for 5 min with blocking buffer, four times (5 rain each) with 0.3% (v/v) T w e e n 20 in PBS, and then twice (5 min each) with substrate buffer (0.1 M diethanolamine, 1 m M MgCI2, pH 10.0). The membrane is finally incubated for 5 min with 0.25 m M AMPPD in substrate buffer. Excess substrate is drained from the membrane, and the membrane is sealed in plastic (Saran wrap or heat-sealable bags), and exposed to film.
406
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[29]
An initial exposure of 10 to 20 min can be used to assess the signal intensity and background signal prior to performing the optimum exposure. Kodak (Rochester, NY) XAR-5 or Polaroid instant black and white film can be used. The combination of Polaroid instant black and white film and a camera luminometer is useful for imaging miniblots and dot or slot blots. A recently modified version of this protocol that leads to lower nonspecific background levels on various membranes, including positively charged nylon, has been developed (Martin et al., manuscript in preparation). The major modification of this procedure is in the blocking step, in which 0.5% (w/v) SDS is used in place of Tween 20 as a component of the blocking and washing buffers. In addition, 0.5% SDS is also included in the Avidx-alkaline phosphatase conjugate incubation step. Overall, these new protocol changes provide a significant advantage in the detection of nucleic acids on most commercially available membranes.
Troubleshooting The sensitivity of nonisotopic detection systems for alkaline phosphatase is limited by nonspecific background. In the biotin/streptavidin-alkaline phosphatase systems described above, most of the background is due to the nonspecific binding of the streptavidin-alkaline phosphatase conjugate to the membrane. The protocols described above have been optimized for the hybridization, blocking, and detection conditions that result in low levels of nonspecific background. The quality of water used to prepare buffers as well as the freshness of buffers are also critical. We have found that fresh high-performance liquid chromatography (HPLC)grade deionized water (Milli-Q; Millipore, Bedford, MA) works well for these systems. We also prepare all blocking and detection buffers fresh daily to limit alkaline phosphatase contamination due to bacterial growth. The fact that alkaline phosphatase is somewhat thermostable and difficult to denature and inhibit makes it important that no alkaline phosphatase is present as a contaminant in buffer preparations. There are several possible ways to improve sensitivity. Longer hybridization times or higher concentrations of labeled DNA in the hybridization buffer may increase specific signal. Higher concentrations of the streptavidin-alkaline phosphatase conjugate or longer incubations with the conjugate may increase signal. In some cases, increasing the probe or conjugate concentration will increase background. Low signal may also be due to improperly labeled or denatured DNA probe. Excess nonspecific background can be due to a number of factors. Bacterial contamination of buffers will result in high levels of background. A higher than expected or nonuniform background may be due to alkaline
[29]
CHEMILUMINESCENCE
TO DETECTDNA
407
phosphatase secreted into the water or buffer by contaminating bacteria. If high levels of bacteria are actually present in one of the buffers, they may become trapped in the pores of the membrane, resulting in a " spotty" background. It may be possible to lower a high background by incubating longer in blocking buffer (up to overnight at 4°), increasing the number of washes after conjugate addition, or increasing the dilution of the conjugate. Occasionally a spotty background may occur that is due to aggregation of the conjugate; aggregates can be eliminated by centrifugation of the conjugate prior to removing an aliquot for dilution. Some biotinylated probes show higher nonspecific binding to membrane than others. This may be reduced by lowering the concentration of probe used in the hybridization buffer, or by increasing the duration of the first two stringency washes. A spotty background due to labeled probe may be eliminated by ethanol precipitation of the probe. Alkaline Phosphatase-Conjugated Oligonucleotide Probes There are several limitations in the use of biotinylated DNA probes in hybridization assays. They include the additional step/time required to process the membrane after the hybridization and stringency wash steps, and the background due to the nonspecific binding of the streptavidin-alkaline phosphatase conjugate to the membrane surface. Both of these limitations can be overcome by using synthetic oligonucleotide probes that have been previously covalently labeled with alkaline phosphatase. These probes are hybridized using essentially the same conditions as 3zP-labeled probes and, because no enzyme-labeled protein is used to detect them, nonspecific backgrounds are very low. The application of these probes to genomic Southern blotting and DNA sequencing is described below. Conjugates can be made using the procedure described by Jablonski et al. 26 o r using kits available from Promega (Madison, WI) or Cambridge Research Biochemicals (Cheshire, England). Genomic Southern Analysis
Southern blots of human genomic DNA on Tropilon-45 nylon membranes are prepared as described z5 and DNA is cross-linked to the membrane by UV treatment. ~ Membranes are dried to completion prior to a 15- to 30-min prehybridization in 1% (w/v) crystalline-grade bovine serum albumin (BSA), 0.25 M disodium phosphate (pH 7.2), 7% (w/v) SDS at 45o. 1 Hybridization is performed for 2 hr at 45° in the same buffer with the 26 E. Jablonski, E. Moomaw, R. H. Tullis, and J. R. Ruth, Nucleic Acids Res. 14, 6115 (1986).
408
[29]
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
32p A 1 23
Chemiluminescence '
' 1
B 23
1
C 23
1
D 23
'
23.1 9.46.64.4-
2.3-2.01.3-
Incubation time
--
1 hr
4hr
16hr
Exposure time
7d
3hr
12hr
3hr
FIG. 5. Southern analysis of the tissue plasminogen activator (tPA) gene in human DNA with 32p_ and alkaline phosphatase-labeled probes. Two identical membranes containing human DNA (20 pg/lane) digested with PvulI (lanes 1), BglI (lane 2), and BgllI (lane 3) were hybridized with a tPA oligonucleotide probe (5'-CTGGTATATCATCTGCGTTTTTTC-Y) labeled with either 32p (A) or internally labeled at T14 with alkaline phosphatase (B-D). The final two stringency washes in 1 x SSC/I% (w/v) SDS were at 53 °. Various exposures were obtained after the 5-min incubation in AMPPD. The incubation time refers to the time lapsed between the AMPPD addition and the start of the X-ray exposure. The AP-conjugated probe was a gift of E. Jablonski (Molecular Biosystems).
alkaline phosphatase-conjugated probe (0.25 nM). After hybridization, the membranes are washed four times for 5 min at 45 ° with 5 x SSC, 1% (w/v) SDS and two times for 5 rain with 1 x SSC, 1% (w/v) SDS at the appropriate temperature. The membranes are then treated as described below in the section, Chemiluminescent Detection with Alkaline Phosphatase-Oligonucleotide Conjugates. Autoradiographs of identical Southern blots hybridized with an oligonucleotide probe labeled with either 32p o r alkaline phosphatase are shown in Fig. 5. The autoradiograph with the 32p-labeled probe required a 7-day exposure (Fig. 5A). Exposures B, C, and D were generated from the other membrane after hybridization with the probe conjugated to alkaline phosphatase. Various exposures were then obtained after the incubation in AMPPD. The increase in signal observed with longer incubation times is due to the kinetics of chemiluminescence. The chemiluminescent detec-
[29]
CHEMILUMINESCENCE
20
2
1
TO DETECTDNA
0.5
0.25
409
~g
FIG. 6. Level of detection with an alkaline phosphatase-conjugated probe and AMPPD. The amount of human genomic DNA digested with BglIl is indicated. The probe and hybridization conditions were the same as in Fig. 5. The incubation and exposure times were 15 rain and 14 hr, respectively.
tion method provides an increase in both the sensitivity (12-fold) and the speed of detection (40-fold) over 32p detection. The sensitivity of the alkaline phosphatase-conjugated probe (with AMPPD) is demonstrated in Fig. 6. Using the present protocol, it is possible to detect a unique gene in as little as 0.25/zg of human DNA (76,000 molecules).
Genomic Sequencing Sequence reactions and membrane preparations are performed essentially as described by Church and Gilbert. 1The chemical cleavages consist of the five originally described by Maxam and GilbertZV--G, AG, AC, TC, 27 A. M. Maxam and W. Gilbert, Proc. Natl. Acad. Sci. U.S.A. 74, 560 (1977). 28 C. M. Rubin and C. W. Sehmid, Nucleic Acids Res. 8, 4613 (1980).
410
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[29]
[29]
CHEMILUMINESCENCE TO DETECTDNA
411
and C - - a n d one other, T. ~8 DNA for each reaction consists of 1 /~g of plasmid DNA digested with restriction enzyme and Elutip (Schleicher & Schuell, Keene, NH) purified and, in addition, sonicated calf thymus DNA (4/zg). One-seventh of each reaction mixture is loaded per lane onto a 0.4mm TBE (90 mM Tris borate, 20 mM EDTA, pH 8.4) gradient sequencing gel (60 cm long).29 After 4 hr of electrophoresis, the DNA is electrotransferred to Tropilon-45 and UV treated.~ Membranes are dried to completion prior to a 5-min prehybridization in 1% (w/v) crystalline-grade BSA, 7% (w/v) SDS, 1 mM EDTA, 0.25 M disodium phosphate, pH 7.2 (adjusted with H 3 P O 4 ) . ! The hybridization with the enzyme-conjugated probe is performed for 2 hr at 45 ° in the same buffer. After hybridization, the membranes are washed four times for 5 min at 45 ° in 0.125 M NaC1, 1 mM EDTA, 1% (w/v) SDS, 0.04 M sodium phosphate, pH 7.2. t The membranes are then treated as described below under chemiluminescent detection. Figure 7 shows a DNA sequence detected with AMPPD and an alkaline phosphatase-conjugated probe. The amount of plasmid DNA loaded per lane (140 ng) is equivalent on a molar basis to the amount of individual plasmid DNA analyzed with the multiplex sequencing protocol. 3° If each band represents 1/300 of the total DNA treated then 0.14 fmol is present per band.
Chemiluminescent Detection with Alkaline Phosphatase-Oligonucleotide Conjugates Membranes are rinsed with Triton wash buffer [1% (v/v) Triton X-100, 125 mM NaC1, 50 mM Tris-HC1, pH 8.0] briefly, and washed for 20 min in the same buffer, followed by two l-rain rinses in 1 x SSC. Finally, there are two 1-min rinses in diethanolamine substrate buffer [0.1 M diethanolamine (pH 10), 1 mM MgCI2]. Membranes are incubated for 5 min in 0.4 mM AMPPD in the same buffer, sandwiched between two layers of Saran wrap, and placed in contact with Kodak XAR-film. .~9M. D. Biggin, T. J. Gibson, and G. F. Hong, Proc. Natl. Acad. Sci. U.S.A. 80, 3963 (1983). 30 G. M. Church and S. Kieffer-Higgins, Science 240, 185 (1988).
FIG. 7. Nucleotide sequence detected with AMPPD and an alkaline phosphataseconjugated probe. Plasmid pSQ214, containing a pBR322 insert cloned between two NotI sites, was digested with NotI and subjected to the genomic sequencing protocol. The nylon membrane was hybridized with an oligonucleotide probe (conjugated to alkaline phosphatase), which hybridizes via 20 nucleotides of homology between 1 NotI site and the insert. The incubation and exposure times were 5 and 30 rain, respectively.
412
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[29]
Troubleshooting The major limitation with alkaline phosphatase-conjugated oligonucleotide probes is their complicated synthesis. At present the only published method makes use of the homobifunctional reagent disuccinimidyl suberate to cross-link the enzyme and oligonucleotide; two column steps are then required to purify the conjugate. 26 Conjugates can be purchased directly from Molecular Biosystems and kits are available from Promega and Cambridge Research Biochemicals. For genomic Southern analysis, in which the stringency of the final wash is critical, it may be important to keep the GC content low enough and the probe length short enough so that a high temperature is not required for the final wash. A high-temperature wash could result in loss of alkaline phosphatase activity.
Discussion Chemiluminescent detection with AMPPD and DNA probes labeled with alkaline phosphatase (directly or indirectly via a conjugate) provides enhancement in both sensitivity and speed of detection. In direct comparisons with 32p-labeled probes, chemiluminescent detection can increase the speed of detection 40-fold and the sensitivity by 10-fold. The chemiluminescent blots can also be stripped using conditions similar to those for 32p-labeled probes. Chemiluminescent detection may offer an additional advantage over 32p autoradiography, because the signal intensity is high enough for direct electronic imaging with chargecoupled devices, silicon-intensified targets, photon-counting cameras, or other sensitive scanning devices, 31'32 that would eliminate the film copy. The assay limitations of using a streptavidin-alkaline phosphatase conjugate with biotinylated probes include nonspecific background of the conjugate and additional processing. These can be eliminated by the use of direct alkaline phosphatase-labeled probes. Alkaline phosphatase-labeled probes are hybridized essentially the same way as 32p-labeled probes and show little nonspecific binding. Biotinylated probes do have the advantage of being more widely available, being suitable for short and long probe labeling, and yielding two- to threefold higher chemiluminescent signals in a given exposure time. Because A M P - D is relatively long-lived, its diffusion could result in high background and blurred bands on membrane-based assays. However, 31 R. A. Wick, BioTechniques 7, 262 (1989). 32 y . Hiraoka, J. W. Sedat, and D. A. Agard, Science 238, 36 (1987).
[29]
CHEMILUMINESCENCE
TO DETECTDNA
413
the sharp images of DNA bands shown in the sequencing experiment indicate that diffusion of A M P - D is greatly restricted and suggest that the anion is complexed to the nylon. The effect of the nylon on the light emission characteristics of alkaline phosphatase-activated AMPPD is consistent with the anion residing in a hydrophobic environment. The nylon membrane causes a shift in the chemiluminescent spectrum of the activated AMPPD from the maximum of 477 nm in aqueous buffer solution to 460 nm, v similar to the shift observed for similar emitters in apolar solvents. 33'34The hydrophobic environment stabilizes the dioxetane anion A M P - D by complexing it in water-free domains. While the association of AMP D with the membrane results in the sharp images of DNA bands, it also causes the kinetics of light emission to slow considerably. The slower kinetics may result because the complexed A M P - D is tightly bound and its fragmentation is slower. Some hydrophobic polymers improve the overall chemiluminescence intensity of activated AMPPD in aqueous solution and on solid supports, acting as "enhancers" to increase sensitivity and the speed of detection. This enhancement is achieved either by increasing the yield of chemiexcitation or by improving the quantum yield of emission from the excited molecules, or both. A similar enhancement of chemiluminescent yields apparently occurs on nylon and not on other membranes, a conclusion based on the observation that addition of water-soluble polymeric enhancers does not significantly improve signals on nylon. In the future, it may be possible to design a new membrane superior to nylon and to generate the luminescent yields observed in nonaqueous solutions, which are increased by three orders of magnitude over the yields in aqueous solutions.
Summary
The chemiluminescent detection methods described in this chapter have been successfully applied to the detection of plasmid DNA and genomic DNA in Southern and sequencing protocols. The high sensitivity and the simplicity of AMPPD are instrumental in making the chemiluminescent detection of DNA successful in hybridization assays. This detection technique has also been used to detect DNA in dot b l o t s 35'36 and in situ hybridization experiments 35 as well as proteins 33 I. 34 I. 35 I. 36 I.
A. Klotz and A. R. Sloniewsky, Biochem. Biophys, Res. Commun. 31, 421 (1968). A. Klotz, G. P. Royer, and A. R. Sloniewsky, Biochemistry. 8, 4752 (1969). Bronstein, J. C. Voyta, and B. Edwards, Anal. Biochem. 180, 95 (1989). Bronstein and J. C. Voyta, Clin. Chem. 35, 1856 (1989).
414
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
in e n z y m e - l i n k e d blots.39, 4°
immunosorbent
assays
( E L I S A s ) 37,38 a n d
[30] Western
37 I. Bronstein, J. C. Voyta, G. H. G. Thorpe, L. J. Kricka, and G. Armstrong, Clin. Chem. 35, 1441 (1989). 38 G. H. G. Thorpe, I. Bronstein, L. J. Kricka, B. Edwards, and J. C. Voyta, Clin. Chem. 35, 2319 (1989). 39 p. G. Gillespie and A. J. Hudspeth, Proc. Natl. Acad. Sci. U.S.A. 88, 2563 (1991). 4o p. G. Gillespie and A. J. Hudspeth, J. Cell Biol. 112, 625 (1991).
[30] Picogram Detection of Stable D y e - D N A Intercalation Complexes with Two-Color Laser-Excited Confocal Fluorescence Gel Scanner B y HAYS S. R Y E , STEPHEN Y U E , MARK A . QUESADA, RICHARD P. H A U G L A N D , RICHARD A . M A T H I E S , a n d A L E X A N D E R N . GLAZER
Interest in the fundamentals of DNA-ligand interactions, as well as the search for better antitumor drugs, has led to the extensive study of molecules that form high-affinity intercalation complexes with DNA. 1.2 In particular, the dimeric analogs of a number of chromophores, including acridines, 3-5 7-hydropyridocarbazoles,6 and 3,8-diamino-6-phenylphenanthridinium, 7-9 demonstrate DNA-binding affinities several orders of magnitude higher than their corresponding monomers. Nielsen e t al. 1o showed with radiolabeled compounds that di-, tri-, tetra-, and hexaacridinylamines are so tightly associated with double-stranded DNA (dsDNA) that they J R. D. Sheardy, W. D. Wilson, and H. D. King, in "Chemistry and Physics of DNA-Ligand Interactions" (N. R. Kallenbach, ed.), p. 175. Adenine, New York, 1990. 2 L. P. G. Wakelin, Med. Res. Rev. 6, 275 (1986). 3 R. G. M. Wright, L. P. G. Wakelin, A. Fieldes, R. M. Acheson, and M. J. Waring, Biochemistry 19, 5825 (1980). 4 N. Assa-Munt, W. A. Denny, W. Leupin, and D. R. Kearns, Biochemistry 24, 1441 (1985). 5 N. Assa-Munt, W. Leupin, W. A. Denny, and D. R. Kearns, Biochemistry 24, 1449 (1985). 6 D. Delaprat, A. Delbarre, I. Le Guen, B. P. Roques, and J. B. Le Pecq, J. Med. Chem. 23, 1336 (1980). 7 B. Gaugain, J. Barbet, R. Oberlin, B. P. Roques, and J. B. Le Pecq, Biochemistry 17, 5071 (1978). s B. Gaugain, J. Berber, N. Capelle, B. P. Roques, J. B. Le Pecq, and M. Le Bret, Biochemistry 17, 5078 (1978). 9 j. Markovits, B. P. Roques, and J. B. Le Pecq, Anal. Biochem. 94, 259 (1979). l0 p. E. Nielsen, W. Zhen, U. Henriksen, and O. Buchardt, Biochemistry 27, 67 (1988).
METHODSIN ENZYMOLOGY,VOL. 217
Copyright © 1993by AcademicPress, Inc. All rights of reproductionin any formreserved.
[30]
415
STABLE D Y E - D N A INTERCALATION COMPLEXES
A ~
H3C"--~N +0
~+...-CH --3 iii
~
H
co N~ !
H2C\
CIH3
~H3
CH3
CH3
(4t-) ,CH2 CH2~CH 2
B H2N - ~ ~ ~
NH2
H
H2N - ~ ~ ~
NH2
H
FlG. 1. Structures of (A) thiazole orange homodimer (TOTO) and (B) ethidium homodimer (EthD).
are not removed during gel electrophoresis. Glazer e t a l . It exploited the stability of a tight complex between the highly fluorescent bisintercalator ethidium homodimer (EthD; Fig. 1) and dsDNA to detect picogram amounts of D N A on agarose gels with a laser-excited confocal fluorescence gel scanner.12 The tight binding of polyfunctional intercalating ligands offers both a number of advantages and fundamental new possibilities for the fluorescent staining and detection of DNA. First, because complexes between such molecules and D N A are extremely stable, they can be used to label u A. N. Glazer, K. Peck, and R. A. Mathies, Proc. Natl. Acad. Sci. U.S.A. 87, 3851 (1990). tz M. A. Quesada, H. S. Rye, J. C. Gingrich, A. N. Glazer, and R. A. Mathies, BioTechniques 10, 616 (1991).
416
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[30]
dsDNA prior to electrophoresis, eliminating the need for the large amounts of dye normally required for postelectrophoresis staining. This technique improves DNA detection by significantly lowering the background signal generated by residual free dye in the gel and obviates the need to work with large quantities of toxic compounds. Second, because a stable complex is formed between the DNA and the intercalating dye, this opens up the possibility of staining individual samples of dsDNA with dyes having distinctive spectroscopic properties that facilitate multiplex detection. Electrophoretic comparison of multiplexed prestained standard ladders and unknowns within a single gel lane would permit accurate determination of sizes of the unknown fragments and would provide a high density of information from a single gel. Studies of the stable EthD-dsDNA complex validated key aspects of such an approach.Ill3 The EthD-dsDNA complex was stable to electrophoresis and allowed detection and sizing of restriction fragments on agarose gels at picogram levels of DNA per band. Preliminary two-color experiments were performed with EthD and thiazole orange. 13 The fluorescence emission maxima of the dsDNA complexes of these two dyes lie at 620 nm 14and 530 nm, 15respectively. Thiazole orange has an affinity for DNA similar to that of ethidium bromide and does not form complexes stable to electrophoresis. ~3 Electrophoresis of EthD-dsDNA complexes on agarose gels in the presence of 1.65 × 10 - 7 M thiazole orange in the running buffer did not lead to any loss of the EthD label. At this thiazole orange concentration, with detection at 530 nm, dsDNA fragments could be readily detected at 20 pg/band. Two-color scanning of a mixture of linearized plasmids, unstained pBR322, and M13 prestained with EthD, after electrophoresis with thiazole orange in the running buffer, allowed sensitive detection of pBR322 in the 530-nm scan and of M13 in the 620nm scan. 13 The high sensitivity of detection of dsDNA with thiazole orange and the positive outcome of the multiplexing experiment prompted examination of a thiazole orange dimer (TOTO), the structure of which is given in Fig. 1. As illustrated below, TOTO forms complexes with DNA stable to electrophoresis, and there is minimal migration of dye from a preformed complex of TOTO with dsDNA to a 100-fold excess of unlabeled DNA. As anticipated from the earlier multiplexing experiments with EthD and thiazole orange, electrophoretic separation of preformed complexes of 13 H. S. Rye, M. A. Quesada, K. Peck, R. A. Mathies, and A. N. Glazer, Nucleic Acids Res. 19, 327 (1991). ~4R. P. Haugland, "Molecular Probes: Handbook of Fluorescent Probes and Research Chemicals," p. 129. Molecular Probes, Inc., Eugene, Oregon, 1989. i5 L. G. Lee, C. Chen, and L. A. Chiu, Cytometry 7, 508 (1986).
[30]
STABLE D Y E - D N A INTERCALATION COMPLEXES
417
DNA with EthD and with TOTO can be performed in the same lane and the two types of complexes detected by simultaneous two-color scanning. It must be noted that achieving optimal sensitivity and the best separations depends on the correct molar ratio of DNA to dye, and thus requires knowledge of DNA concentration prior to mixing. In addition, the sensitivity obtainable with the procedures detailed here is fully accessible only through the use of the laser-excited confocal scanner described below, or through an equivalent detection system. Methods
Instrumentation: Two-Color Confocal Fluorescence Imaging System The two-color confocal fluorescence laser scanner system is shown in Fig. 2. Light (488 nm, 18 mW at sample) from an argon ion laser (SpectraPhysics 165, Mountain View, CA) is reflected off a long-pass dichroic beam splitter (96% reflection for s polarization at 488 nm) (480 DMLP; Omega Optical, Brattleboro, VT) and directed through a x 40 N.A. 0.60 infinite conjugate objective (Achroplan 440864; Carl Zeiss LD, Thornwood, NY). The input beam diameter (1.25 mm) is selected to give a 17~m-diameter spot in the gel. The variable coverslip correction of the objective is set for 1.5 ram, so the laser is focused through a 1.5-ram glass plate covering the gel. The micrometer adjustment of the objective z position is used to center the focused beam 200 ~m below the bottom surface of the cover glass. For submarine gels, the focused laser beam is lowered 1.7 mm past the top surface of the gel prior to scanning. The fluorescence emission is collected by the objective and passed back through the first beam splitter ( - 9 2 % transmission) to a second beam splitter (98% reflection for 530 nm at 45 ° incidence and 92% transmission at 620 nm) (560 DMLP; Omega Optical) that separates the EthD and TOTO emissions (fluorescence emission peaks at 620 and 530 nm, respectively). The two resulting beams are separately focused with 100-ram focal length achromat lens (MeUes-Griot, Irvine, CA) through 400-~m-diameter spatial filters (Melles-Griot) to effect confocal detection. A bandpass discrimination filter with a transmission window of 530 -+ 30 nm (530DF60; Omega Optical) and a long-pass 495-nm sharp cutoff filter (GG-495; Schott, Dureya, PA) are placed in front of the photomultiplier (R666; Hamamatsu, Bridgewater, N J) dedicated to TOTO detection while two long-pass 610nm sharp cutoff filters (RG-610; Schott) are placed in front of the photomultiplier (R666; Hamamatsu) dedicated to EthD detection. The outputs of the cooled phototubes (TE177RF; Products for Research, Danvers, MA) are collected (1 MI~ terminated), amplified, and filtered [bandwidth, ap-
418
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[301
Preamplifier Computer
Dichroic Beam Splitter Mirror Dichroic Beam Splitter
FIG . 2 . Diagram of the two-color laser-excited confocal fluorescence gel scanner. Laser light is reflected from a long-pass dichroic beam splitter, passed through a microscope objective, and brought to a focus within the agarose gel. The resulting fluorescence is collected by the objective in an epiillumination format, passed back through the beam splitter, and directed at a long-pass dichroic beam splitter to achieve color separation between the EthD and TOTO channels . The fluorescence emissions from EthD and TOTO are subjected to spatial and spectral filtration and detected with a photomultiplier . A computer-controlled DC servo motor-driven XY translation stage is used to move the gel past the laser beam .
proximately direct current (DC) to 100 Hz] with a dual-channel low-pass filter-amplifier (SR640 ; Stanford Research Systems, Palo Alto, CA) and stored in a computer (PC-AT clone) after multiplexing and digitization with a 12-bit analog-to-digital converter (ADC) (DASH 16-17; Metra Byte, Taunton, MA). A computer-controlled DC servo motor-driven XYtranslation stage (MC7000 ; Daedal, Harrison City, PA) with a 12 x 12 in. travel length and 10-Am resolution is used to translate the gel past the laser beam . Scanning is done in a line-scan/step/line-scan sequence with a line-scan rate of 4 cm/sec, a step size of 160 Am, and a pixel size of 160 Am. With a sampling rate of 250 Hz, the fluorescence is sampled exactly once over the 160-Am pixel with the ADC. The computer is used to control the XY
[30]
STABLE D Y E - D N A INTERCALATION COMPLEXES
419
translation stage and to acquire and display images in a split screen format for the output of each detector. The fluorescence images are displayed in real time in pseudocolor and stored for processing.
Spectroscopic Properties of Ethidium Homodimer and Thiazole Orange Dimer Ethidium homodimer ('~492 = 8900M -1, Ref. 14; ~max v = 620 rim) shows a fluorescence quantum yield enhancement of 40-fold on binding to dsDNA. Thiazole orange dimer t°~cn3oH) v x = 530 nm) is ~e,507 = 131,700M-I; )kma a dimer of the highly fluorescent DNA-binding fluorophore thiazole orange (.~c~3om = 77,000 M - i ; hVmax= 530 nm, Refs. 13 and 15) that demonstrates ~502 a fluorescence enhancement of -3000-fold on binding to RNA and DNA. 15 The absorption and fluorescence emission spectra of EthD and TOTO, bound to DNA, are shown in Fig. 3.
Preparation and Storage of Dye Solutions Ethidium homodimer and TOTO (both from Molecular Probes, Eugene, OR) are stable when stored as dry powders in the dark. Ethidium homodimer (-> I. l mM) is dissolved in filtered, deionized water and kept for long periods (up to 1 year) at - 20°. Diluted working stocks of EthD in 40 mM Tris-acetate, 1 mM ethylenediaminetetraacetic acid (EDTA), pH 8.2 (TAE buffer) are stable in storage for up to 3 months at 4°. Thiazole orange dimer stocks (up to 12 mM) are prepared by first dissolving solid TOTO in dimethyl sulfoxide (DMSO). This solution is then separated into small volumes and stored under nitrogen at 4° . When stored in this manner, TOTO appears to remain stable for a number of months, although repeated thawing and use of the same DMSO stock eventually results in loss of TOTO fluorescence. Working stocks of TOTO are prepared fresh immediately prior to use by dilution into 4 mM TAE buffer, pH 8.2 (4 mM Tris-acetate, 0.1 mM EDTA). Diluted aqueous stocks of TOTO have an apparent half-life of 5 hr at 4°, and thus should be used immediately following dilution into aqueous media. All dye-containing solutions should be stored in the dark when possible, and working stocks should be kept on ice during use.
Staining of Double-Stranded DNA DNA sizing ladders are obtained from GIBCO-Bethesda Research Laboratories (Life Technologies, Gaithersburg, MD). Stock solutions of the h DNA/HindIII (621 /xg/ml) and ~X-174 DNA/HaeIII (714 /zg/ml) ladders are stored at - 2 0 °, and a stock solution of the high molecular
420
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
A
~ 1
m
O e-,
2
[30]
3
\\'I
~"''" m
ti-
o~
< m
m
400
350
450
500
550
600
n
I
650
700
750
Wavelength (nm)
B
1
2
3
/ 'I:; ",,, O
<
! 350
400
450
500
550
Wavelength (nm)
600
650
700
[30]
STABLE D Y E - D N A INTERCALATION COMPLEXES
421
weight DNA ladder (53/zg/ml) is stored at 4°. All ladder stocks are shipped and maintained in 10 mM Tris-HCl (pH 7.4), 5 mM NaCI, 0.1 mM EDTA. Complex formation prior to agarose gel electrophoresis is accomplished by simple mixing of the sample dsDNA with either EthD or TOTO. Both DNA and dye solutions should be diluted into 4 mM TAE buffer, pH 8.2, prior to use. Mixing is typically accomplished in a total volume of 75-150/zl in sterile plastic Eppendorf tubes. The order of mixing is important. The DNA solution should be added to the diluted dye solution. The D N A - d y e solution is well mixed by repipetting, and the samples incubated at room temperature for a minimum of 30 min in the dark. For two color applications, different DNA samples are initially labeled separately with EthD and TOTO as described above. Following an initial incubation, the different DNA samples are then mixed together and incubated in the dark at room temperature for an additional 30 min. Effective EthD staining of DNA with the detection system described above can be accomplished at absolute DNA concentrations between 50 pg//xl and 1.5 ng//zl at DNA base pairs (bp) : EthD molar ratios of up to 5 : 1. Complexes can be prepared at higher DNA concentrations (4 ng//zl) if the D N A : E t h D molar ratio is raised to 10 bp : 1 dye dimer. TOTO staining of DNA can be performed at DNA concentrations between 20 and 400 pg//zl at DNA : TOTO ratios of 5 : 1, and DNA concentrations as high as 2.4 ng//zl can be labeled if the DNA (bp) :TOTO ratio is raised to between 10:1 and 20: 1. Departure from the appropriate DNA : dye ratios and the concentration ranges specified above may result in the precipitation of DNA, severe streaking, and band splitting.
Final Sample Preparation and Agarose Gels Following final incubations, 15% (w/v) Ficoll (in deionized, filtered, sterile water) is mixed with the D N A - d y e solution to a final concentration of 3.75% (e.g., addition of 25/zl 15% Ficoil to 75/zl labeling mix). (Addition
FIG. 3. Absorption and fluorescence emission spectra of (A) EthD and (B) TOTO. In each instance, curve 1 represents the normalized absorption spectrum of the dye in 4 mM TAE buffer at pH 8.2. The spectra of EthD and TOTO bound to DNA (A and B, curves 2) were generated by incubating the dyes with calf thymus DNA in 4 mM TAE, pH 8.2 at room temperature for 30 min in the dark prior to the acquisition of the spectra. The final concentrations in each case were 9.4 x 10 -6 M dye and 9.4 × 10 -4 M DNA (bp), to give a molar ratio of DNA (bp) : dye of 100 : 1. Curves 3 show the fluorescence emission spectra of a 1 : 50 dilution of the calf thymus D N A - d y e mixtures described for curves 2, giving final concentrations for these spectra of 1.9 x 10 -7 M dye and 1.9 x 10 -5 M DNA (bp), respectively. Fluorescence excitation was at 488 nm.
422
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[30]
of typical tracking dyes, such as bromphenol blue and xylene cyanole, should be avoided because these substances are fluorescent and interfere with DNA detection.) This mixture is then immediately loaded onto an agarose gel. Agarose gel electrophoresis of the D N A - d y e samples can be conducted in either a vertical gel or in more traditional submarine formats. A Bio-Rad (Richmond, CA) Mini-Protean II gel apparatus is utilized to cast the vertical gels (gel dimensions: 6 cm long x 8 cm wide z 1 mm thick; 5-mm-wide wells). All gels are made in 40 mM TAE, pH 8.2, and electrophoresis is conducted in the same buffer.
Data Collection and Processing Following electrophoresis, gels are scanned with the two-color, confocal fluorescence gel imaging system. The resulting unprocessed binary data files are composed of 12-bit pixels arrayed in FTS file format with alternating pixels representing the TOTO and EthD channels. These IBM disk operating system (DOS) files are then separated into their respective arrays and converted to 8-bit Macintosh tagged image file format (TIFF) files. The resulting images are then processed with the National Institutes of Health (NIH) image processing program Image 1.29, on a Macintosh IIci computer. Density plots of the gel lanes are generated by averaging the pixel values across columns of a defined section of the image. These values are then plotted as a function of the average column position. Fluorescence intensity values for the detected bands are calculated by integrating the peaks generated in the density plots. Migration distances are measured to the peak center of the fluorescence intensity profiles of the density position plots. Results
Double-Stranded DNA Detection Sensitivity For the EthD-dsDNA complex, 60 pg of DNA could be readily detected per 5-mm-wide band on a 1-mm-thick vertical agarose gel. u Under the same conditions, as little as 4 pg of DNA per band of the TOTO-dsDNA complex can be detected (Fig. 4). The fluorescence of D N A - E t h D complexes has been shown to be insensitive to variation in DNA base composition 9 and the fluorescence intensity of D N A - E t h D fragments in agarose gels is directly proportional to the amount of DNA present over a range of DNA loads and sizes, from 200 to 800 pg and 2 to 23 kbp. u Likewise, the fluorescence intensity of DNA-TOTO fragments in agarose
[30]
STABLE D Y E - D N A INTERCALATION COMPLEXES
423
_= o
k~
0
50
I
I
I
100
150
200
250
Mobility FIG. 4. Detection of X DNA/HindlII-TOTO complexes. Inset: A portion of the fluorescence image of an agarose gel loaded with 200 pg (lane A) and 100 pg (lane B) of h DNA/ HindlII-TOTO complexes. For each lane, ~ DNA/HindlII [8.2 x 10-8 M DNA (bp) for lane A and 4.0 × 10-s M DNA (bp) for lane B] was incubated at room temperature for 30 min in the dark with TOTO (1.6 x 10-8 M for lane A and 8.2 x 10 -9 M for lane B) at a molar ratio of 5 bp/TOTO. All mixing was conducted in 4 mM TAE buffer, pH 8.2. A 25-tzl aliquot of 15% (w/v) Ficoll was then added to each 75-/xl sample, to give final concentrations of 6.3 × 10-8 M DNA (bp) and 1.3 × 10-8 MTOTO for lane A and 3.1 × 10-8 M DNA (bp) and 6.3 x 10 -9 M TOTO for lane B. Samples (5 txl) of these mixtures were then loaded onto a vertical, 0.9% (w/v) agarose gel in 40 mM TAE, pH 8.2 that had been preelectrophoresed for 2 hr at 10 V/cm. Electrophoresis of the DNA samples was conducted in the dark for 1 hr at 10 V/cm. The lowest band of the restriction pattern in lane B contains approximately 4 pg of DNA. The fluorescence intensity plot derived from lane B illustrates the detection of the TOTO-labeled DNA fragments.
gels is d i r e c t l y p r o p o r t i o n a l to the a m o u n t o f D N A p e r b a n d (Fig. 5). T h e l i n e a r c o r r e l a t i o n b e t w e e n E t h D a n d T O T O f l u o r e s c e n c e i n t e n s i t y and the q u a n t i t y o f D N A at c o n s t a n t D N A : d y e r a t i o s is s h o w n in Fig. 6. F o r b o t h T O T O and EthD, the fluorescence emission per intercalated dye molecule w a s s i m i l a r o v e r a r a n g e o f m o l a r d s D N A b p : d y e ratios f r o m 5 : 1 to 20 : l (see Fig. 6B and D).
Multicolor Detection and Sizing o f Double-Stranded D N A F r a g m e n t s T w o - c o l o r detection after electrophoresis of D N A fragments preincub a t e d s e p a r a t e l y w i t h E t h D and T O T O c a n b e u t i l i z e d to d e t e r m i n e a c c u -
424
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES A
/
/
.
t
[30]
800 pg
i
"
J
~
600pg
O
4O0 pg
0
"0 -II- . ~ - " . ........ ~'-- ~ / - - t , " ...... ,, 5 10 15 20 Size (kbp)
.. B
-'A 100pg , 25
30
• 23.1 kb
6 9.4 kb 6.6 kb -*""~ ~ ~
0
200
400
. . - × 4.3kb
600
800
1000
Load (pg) FIG. 5. Dependence of the fluorescence intensity of h D N A / H i n d l I I - T O T O complexes in agarose gels (A) on the size of the DNA fragments and (B) on the amount of sample loaded per lane. Curve fitting was performed by a least-squares analysis. All samples contained a molar ratio of 5 DNA bp per TOTO and were prepared by incubating h DNA/HindlII (4.1 x 10-7to4.1 x 1 0 - 8 M b p ) w i t h T O T O ( 8 . 4 x 10-8to8.4 x 10-9M) i n 4 m M T A E , pH 8.2 at room temperature for 30 min in the dark. A 25-/zl aliquot of 15% (w/v) Ficoll was then added to each 75-p.1 sample, resulting in final concentrations of 3.1 x 10 -7 to 3.1 x 10 -8 M DNA bp and 6.3 x 10 -8 to 6.3 x 10 - 9 M TOTO. Samples (5/zl) of these mixtures were subjected to electrophoresis as described in Fig. 4.
[30]
STABLE
DYE-DNA
A
INTERCALATION
COMPLEXES
425
B
5:1
-.o
~""
. -'-; "; ~
- .
~
=3, ~b
10:1
{J m
o=
.~
~ ~ ~
5
10
_ ~-
I
I
I
20
25
rr
I
I
I
I
I
5
10
15 Size (kbp)
20
25
25
y
~lt 23.1 kb
,w
" ' ~ 20:1 30:1
"I i
I 20
9.4 kb 6.6 kb 4.4 kb
i
10:1
"of / - /-" ..e / / -.----"" .,.... 1 -"~-- = - . _
I
l0 15 DNA/TOTO
D
4o
•
I
5
30
5:1
•
4.4 kb
"~
"* 20:1
15 Size (kbp)
C
=o
~
9.4 kb 6.6kb
I 30
0
5
I
I
10 15 DNA/EthD
I 20
25
FIG. 6. Dependence of the fluorescence intensity of h DNA/HindlII-TOTO and h DNA/ HindlII-EthD complexes on the DNA:dye ratio. (A, TOTO) and (C, EthD) illustrate the dependence of fluorescence intensity on the size of the DNA fragments in the h DNA/HindllI restriction pattern at given DNA : dye ratios. (B, TOTO) and (D, EthD) show the relative fluorescence intensities per mole of dye for each X DNA/HindlII fragment at various DNA bp:dye ratios. Curve fits for the data in (A) and (C) were determined by least-squares analysis, h DNA/HindlII (8.4 x 10-7M bp) was mixed with various amounts of either TOTO or EthD to generate the DNA : dye ratios indicated. All mixtures were made in 4 mM TAE buffer, pH 8.2. A 25-p,1 aliquot of 15% (w/v) Ficoll was then added to each 75-/A sample, resulting in a final DNA load concentration of 6.3 z 10 _7 M bp (2 ng DNA/lane). Samples of these mixtures (5/xl) were electrophoresed as described in Fig, 4.
rately f r a g m e n t sizes o v e r a 0.6- to 48-kbp range (Figs. 7 and 8). T h e p r o c e d u r e utilized for f r a g m e n t size d e t e r m i n a t i o n is illustrated in Fig. 7. Figure 7 A and B s h o w s the o u t p u t o f the 620-nm d e t e c t o r (recording the f l u o r e s c e n c e o f the E t h D - s t a i n e d l-kb ladder used as the standard) and the 530-nm d e t e c t o r (recording the f l u o r e s c e n c e o f the X D N A / H i n d l I I f r a g m e n t s u s e d as the u n k n o w n s ) . Figure 7C s h o w s f l u o r e s c e n c e intensity plots d e r i v e d f r o m lane 2 in Fig. 7 A and in Fig. 7B. T h e plot o f mobilities (peak positions) o f s t a n d a r d f r a g m e n t s plotted against 1/log (fragment size in base pairs) in Fig. 7D p r o v i d e s the calibration line for c o n v e r s i o n o f the mobilities o f u n k n o w n f r a g m e n t s to sizes. A c o m p a r i s o n o f the actual size o f s t a n d a r d D N A f r a g m e n t s ranging f r o m 603 to 23,130 bp with that
620 nm
530 nm
A
B
I
2
3
C e-
¢)
kb Ladder-EthD
100
~./HLudIII-TOTO I
I 200
]50
I 250
I 300
350
Mobility
D
°,..~
o
0.24
I
I
I
I
I
I
I
0.25
0.26
0.27
0.28
0.29
0.3
0.31
1/log(size)
0.32
[30]
STABLE DYE-DNA INTERCALATION COMPLEXES
427
calculated from two-color scans of multiplexed gel lanes shows excellent agreement between the two sets of values (Table I). The binding of EthD and TOTO reduces the mobility of DNA molecules in agarose gels to an extent that is proportional to the amount of dye bound. This shift is most significant for EthD, which shows DNA mobilities of 0.98, 0.97, and 0.95 for DNA (bp) : EthD ratios of 20 : 1, 10 : I, and 5 : 1, respectively (normalizing to the mobility of DNA fragments at 30 bp: 1 dye dimer; data not shown). For TOTO, the mobility shifts for DNA : dye ratios of 20 : 1, 10 : I, and 5 : 1 are 1.0, 0.99, and 0.97, respectively (again using 30:1 fragment mobilities for normalization; data not shown). Dye migration between DNA samples is also more extensive for EthD, which can transfer up to two-thirds of the bound dye in a sample of DNA at 5 bp/EthD to excess unlabeled DNA. 1~ However, this transfer is greatly decreased when the initial D N A : E t h D ratio is raised. 13 TOTO-DNA samples at 5 bp/dye transfer only 15-20% of the initially bound dye to unlabeled DNA. This result holds even if DNA-TOTO complexes are incubated for up to 10 hr with a 100-fold excess of uncomplexed dsDNA (results not shown). At the DNA : dye ratios employed in the multicolor experiments described here, the transfer of dye between DNA molecules
FIG. 7. Determination of fragment sizes of dsDNA by two-color detection of EthD and TOTO complexes. (A) and (B) show the fluorescence images of a vertical 0.9% (w/v) agarose gel at 620 and 530 nm, respectively. D N A : d y e ratios are given as moles bp per mole dye. Lanes 1 and 4, 8 ng of 1-kb ladder DNA-EthD complex (10 bp/EthD). Lane 3, 1 ng of h DNA/HindlII-TOTO (20 bp/TOTO). Lane 2, two-color sizing mixture containing 8 ng of lkb ladder D N A - E t h D complex (10 bp/EthD) and 1 ng of h DNA/HindlII-TOTO (20 bp/ TOTO). This mixture was generated in two stages as described in Methods by separately mixing l-kb ladder DNA (4.5 x 10 -6 M bp) with EthD (4.5 x 10 -6 M) and h DNA/HindlII (9.4 x 10 -7 M bp) with TOTO (4.7 x 10 -8 M). These samples were then mixed together to yield a 75-/zl solution containing 2.5 × 10 -6 M bp 1-kb ladder DNA, 2.5 x 10 -7 M EthD, 4.2 x 10 -7 M bp h DNA/HindlII, and 2.1 x 10 -8 MTOTO. The l-kb ladder sample in lanes 1 and 4 was a 75-p.1 mixture of l-kb ladder DNA (2.5 x 10 -6 M bp) with EthD (2.5 x 10 .-7 M). The h DNA/HindlII-TOTO sample in lane 3 was generated by diluting the initial ,~ DNA/HindlII-TOTO mix into a 75-tzl volume to yield a ~ DNA/HindlII concentration of 4.2 x 10 -7 M bp and a TOTO concentration of 2.1 x 10 -8 M. All mixtures and dilutions were in 4 mM TAE buffer, pH 8.2. Following final incubations, 25/zl of 15% (w/v) Ficoll was added to each 75-/xl mixture, and 5/zl of each resulting solution was then loaded onto an agarose gel made in 40 mM TAE buffer, pH 8.2. For electrophoresis conditions, see Fig. 4. (C) Fluorescence intensity plots derived from lane 2. The mobilities of the DNA-dye fragments derived from this graph are plotted in (D). The size calibration curve for the l-kb ladder DNA-EthD (A) is superimposed on the mobilities of the h DNA/HindlII-TOTO fragments (D). The actual and calculated sizes for the h DNA/HindlII-TOTO are shown in Table I. The gel was prepared in 40 mM TAE buffer, pH 8.2, and calibration curve fitting was accomplished through least-squares analysis.
428
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[30]
A aa
o
0.24
I
I
I
I
I
I
0.26
0.28
0.3
0.32
0.34
0.36
0.38
1/log(size)
B am
i
o
m
0.21
I
I
I
i
0.22
0.23
0.24
0.25
0.26
1/log(size) FIG. 8. Determination of fragment sizes of dsDNA by two-color detection of EthD and TOTO complexes. (A) shows qbX-174 D N A / H a e l I I - T O T O fragments (El) with a 1-kb ladder D N A - E t h D (A) as standard. (B) Size determination for the largest fragments of the h DNA/ HindlII restriction digest ([~) with a high molecular weight DNA calibration standard (A). The actual and calculated sizes of these fragments are shown in Table I. The experiment described in (A) was conducted in the manner described for the h DNA/HindlII-TOTO experiment in Fig. 7A-D, except that 1.5 ng of the ~X-174 D N A / H a e l I I - T O T O was used and electrophoresis was performed in a 1.5% (w/v) agarose gel. The high molecular weight fragment size determination (B) was conducted by the same basic strategy, except that a
[30]
STABLE D Y E - D N A INTERCALATION COMPLEXES
429
TABLE I Two-COLOR DNA SIZE DETERMINATION WITH ETHIDIUM HOMODIMER AND TH~AZOLE ORANGE DIMER Sizing (bp) Target DNA"
Sizing ladder
• X-174/HaeIII
1-kb ladder
MHindlll
l-kb ladder
High-molecular weight ladder
Band b
Actual"
Calculated
1 2 3 4 2 3 4 5 6 I
1,353 1,078 872 603 9,416 6,557 4,361 2,322 2.027 23,13(1
1,299 1,004 805 570 9,468 6,625 4,339 2,358 2,031 23,788
2
9,416
9,570
" DNA sizing ladders obtained from GIBCO-BRL (Life Technologies) and New England BioLabs (Beverly, MA). t' Fragments numbered from largest to smallest. c Based on literature from GIBCO-Bethesda Research Laboratories and New England BioLabs.
is not large and appears to compensate for the mobility shifts induced by the bound fluorophores. Summary
The stable complexes between highly fluorescent, polyfunctional intercalators and dsDNA can be used to detect dsDNA in agarose gels at picogram levels and for multicolor detection of multiplexed dsDNA
submarine gel (gel dimensions, 9 cm long × 6.5 cm-wide × 5 mm thick; well dimensions. 4 × 1.5 × 4 mm) was employed for a 0.4% agarose gel. This gel was loaded with 10-p.I aliquots of solutions similar to those described for the experiment in Fig. 7A-D, yielding loads of 16 ng high molecular weight ladder DNA-EthD and 4 ng ;~ DNA/HindIII-TOTO. This gel was preelectrophoresed for 3 hr at 10 V/cm. Electrophoresis of DNA samples was conducted in the dark at 6.7 V/cm for 5 rain and then for 18 hr at 1.4 V/cm. DNA : dye ratios for standard and target DNA samples were the same in all experiments in Figs. 7 and 8. The gels were made in 40 mM TAE buffer, pH 8.2, and calibration curve fitting was accomplished through least-squares analysis.
430
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[30]
fragments. Development of additional DNA-binding fluorophores with appropriate spectroscopic properties will expand the range of applications. In principle, the D N A - d y e intercalation complexes represent a more sensitive alternative to an established approach to fluorescent labeling and detection of restriction fragments by ligation to single-stranded short oligonucleotides labeled with different fluorochromes, followed by separation on denaturing polyacrylamide gels.16 The latter technique gives near single-base resolution up to 400 bases and the ability to quantitate fragment size up to 2000 bases, and has been successfully applied to cosmid mapping.16 Detection of DNA fragments as intercalation complexes requires that the separations be performed on agarose gels under nondenaturing conditions. Such conditions have been used for extensive mapping of yeast cosmids with postelectrophoresis staining with ethidium bromide. 17 For the patterns on agarose gels, the magnitude of the "error window," which specifies how similar two fragments must be before the corresponding fragments in different digests are paired, was reported to be strongly size dependent. The error window was expanded by a factor of 1.3 for fragments from 400 to 600 bp, 1.2 for fragments from 600 to 800 bp, and 1.1 for fragments from 800 to 1000 bp. Moreover, it was necessary to introduce corrections for systematic differences between size estimates taken from two different gels.17 For the multiplexing procedure described here, the size estimates for fragments from 600 bp to over 23 kbp were in close agreement with actual sizes as determined from DNA sequence (Table I), and certainly within the error windows given above. The multiplexing procedure should also minimize errors introduced by gel-to-gel variations in mobility, because the standard and unknowns are always run in the same lanes. Kohara et al. 18established a physical map of almost the entire Escherichia coli chromosome by analysis of a large genomic library. In this case, partial restriction digests were used to generate patterns of fragments and the mapping was performed by agarose gel electrophoresis. The disadvantage of this approach is that fewer fragments are generated. However, this is compensated for by the fact that partial digests reveal the order of the fragments produced and thus greatly increase the amount of information 16 A. V. Carrano, J. Lamerdin, L. K. Ashworth, B. Watkins, E. Branscomb, T. Slezak, M. Raft, P. J. DeJong, D. Keith, L. McBride, S. Meister, and M. Kronick, Genomics 4, 129 (1989). 17 G. T. Brodeur, C. Helms, M. Frank, M. MacCollin, R. Scheinman, and T. Frank, Proc. Natl. Acad. Sci. U.S.A. 83, 7826 (1986). 18 y . Kohara, K. Akiyama, and K. Isono, Cell 50, 495 (1987).
[31]
ALGINATE
AS MATRIX
SUPPORT
FOR YAC
CLONING
431
relevant to the question of overlap between different D N A fragments. ~9 Large d s D N A fragments can be detected with high sensitivity as intercalation complexes and such detection would be well suited to the mapping approach adopted by K o h a r a et al. 18 Whereas the detection technology dependent on stable fluorescent d s D N A - d y e intercalation complexes is still in its infancy, its promise appears bright. Acknowledgments H.S.R. was a recipient of a predoctoral fellowship from the Department of Health and Human Services Training Grant GM 07232. R.A.M. and A.N.G. are grateful for assistance with the scanner and probe development from the Lawrence Berkeley Laboratory Director's Opportunity Fund. This research was supported in part by the Director, Office of Energy Research, Office of Health and Environmental Research, Physical and Technological Research Division of the U.S. Department of Energy under Contract DE-FG-91ER61125 (to R.A.M. and A.N.G.) and by a grant from the Lucille P. Markey Charitable Trust (A.N.G.) E9E. Branscomb, T. Slezak, R. Pae, D. Galas, A. V. Carrano, and M. Waterman, Genomics 8, 351 (1990).
[3 1] A l g i n a t e a s M a t r i x S u p p o r t f o r Y e a s t A r t i f i c i a l Chromosome Cloning By CELESTE CANTRELL and ERIC LA1 The use of the yeast artificial c h r o m o s o m e (YAC) for cloning large fragments into yeast has greatly facilitated physical map constructions of large complex genomes. 1 The major advantage of the YAC vector over cosmid vectors [insert size of 35-40 kilobase pairs (kbp)] is that YAC vectors can incorporate inserts of heterologous D N A in the size range from 100 to 1000 kbp. The other advantage of the YAC system is that palindromic and repetitive D N A sequences are more stable in yeast than in Escherichia coli. Thus, YAC libraries might contain mammalian genomic D N A sequences that are underrepresented or absent in E. coli libraries. This has been supported by the finding that YAC clones can be used to close some of the gaps in the cosmid cloning of the Caenorhabditis elegans genome.2 To introduce foreign D N A into yeast cells, competent yeast cells must l D. T. Burke, G. F. Carle, and M. V. Olson, Science 236, 806 (1987). 2 A. Coulson, R. Waterston, J. Kiff, J. Sulston, and Y. Kahara, Nature (London) 335, 184 (1988).
METHODS IN ENZYMOLOGY. VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved,
432
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[31]
be prepared either by lithium acetate treatment 3 or by enzymatic conversion to spheroplasts.4 Because the transformation efficiency of yeast cells with large DNA fragments is relatively low (103 to 105 colonies per microgram of DNA), spheroplast procedures that yield a greater transformation efficiency are preferred over lithium acetate treatment. The use of spheroplast transformation results in the requirement for a solid matrix in which to embed the yeast cells for the regeneration of their cell wall. Agar is the most commonly used matrix for the regeneration step because of its low cost and low toxicity to the yeast cells. However, this results in the laborintensive process of manually picking colonies embedded in the agar layer. The colony-picking step is currently the most time-consuming and tedious procedure in the construction of YAC libraries. This is especially true in the construction of YAC libraries from hybrid cell lines in which the DNA of interest is represented in a small percentage of the clones. Abidi et al. 5 have designed a manifold containing 3000 stainless steel pins to facilitate the recovery of colonies embedded in agar. However, this method requires expensive equipment and low-density plating to ensure good recovery with minimum cross-contamination. W e 6 and others 7 have investigated the possibility of using alternative matrices in the cell wall regeneration process. Principle of Method There are a number of solid matrices that are compatible with the entrapment of microorganisms and cells. One of these matrices, alginic acid, produced by the brown algae of the P h a e o p h y c a s e , is especially well suited for the YAC cloning procedure because of its unique reversible interaction with multivalent ions. Solutions containing alginic acid will cross-link in the presence of most polyvalent ions (except magnesium). For example, with increasing concentrations of calcium, alginic acid, or sodium alginate solutions become viscous and solidify to form a translucent gel. The calcium alginate gel reliquefies in the presence of a suitable calcium-chelating agent such as ethylenediaminetetraacetic acid (EDTA). This reversible gelling-remelting behavior of alginate solutions is thus ideal for the entrapment of yeast spheroplasts after DNA transformation. 3 j. D. Begg, Nature (London) 275, 104 (1978). 4 p. M. J. Burgers and K. J. Percival, Anal. Biochem. 163, 391 (1987). 5 F. E. Abidi, M. Wada, R. D. Little, and D. Schlessinger, Genomics 7, 363 (1990). 6 E. Lai and C. Cantrell, Nucleic Acids Res. 17, 8008 (1989). 7 C. N. Traver, S. Klapholz, R. W. Hyman, and R. W. Davis, Proc. Natl. Acad. Sci. U.S.A. 86, 5898 (1989).
[31]
ALGINATE AS MATRIX SUPPORT FOR Y A C CLONING
433
To entrap yeast spheroplasts in an alginate gel, the cells are mixed with sodium alginate and plated onto a nylon membrane in an agar plate that contains the necessary nutrients, selection agents, and calcium ions. The sodium alginate solution will slowly absorb the calcium ions from the agar plate through the nylon membrane and solidify as a thin film on top of the membrane. After the appearance of yeast transformants, the alginate gel can be removed by transferring the nylon membrane to an agar plate containing EDTA. The EDTA-containing agar plate will slowly remove the calcium ions and the alginate gel will dissolve. Thus, the yeast colonies are transferred from the liquid alginate solution to the membrane and are ready for screening or duplication. Materials and Reagents
YAC Clone. The YAC clone used for the entrapment contains a 360kbp human insert from the T cell receptor locus. Sodium Alginate. The sodium alginate solid and solution are obtained from FMC BioProducts (Rockland, ME). The 1.25% (w/v) alginate solution is commercially available and is premade and ready to use. The 3% (w/v) alginate solution is prepared by dissolving 6 g of sodium alginate powder in 200 ml of 0.6 M KCI. It is necessary to stir the solution for several hours to dissolve the solids completely. The solution is then sterilized by placing in a boiling water bath for 20 min. Yeast Media. The YAC clone is grown in SD + cAA + A [SD: 0.67% (w/v) Bacto-yeast (Difco, Detroit, MI) nitrogen base with or without amino acids, 2% (w/v) dextrose; cAA: 5 g/liter final concentration of casamino acids; A: 10 mg/liter final concentration of adenine sulfate]. The YAC spheroplasts are plated on SORB plates [1 M sorbitol, 0.67% (w/v) Bactoyeast nitrogen base with or without amino acids, 8% (w/v) dextrose, 10 rag/liter final concentration adenine sulfate, 5 g/liter final concentration casamino acids and 20 mM CaCI:] using alginate or one of the alternative solid matrices (see below). All chemicals are from Sigma Chemical Co. (St. Louis, MO). Other Solid Matrices for Entrapment. The spheroplasts are suspended in three other supporting matrices for comparison: (1) TOP agar [1 M sorbitol, 0.67% (w/v) Bacto-yeast nitrogen base with or without amino acids, 8% (w/v) dextrose, 10 rag/liter final concentration of adenine sulfate, 5 g/liter final concentration casamino acids, and 2.5% (w/v) agar], (2) 1% (w/v) SeaKem LE agarose in 1 M sorbitol, and (3) 1% (w/v) SeaPlaque low melting point agarose in 1 M sorbitol. All agaroses are obtained from FMC BioProducts.
434
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[31]
Methods
Preparation of Spheroplasts Spheroplasts are prepared from an exponentially growing yeast culture at 3 x l 0 7 cells/ml (OD600 = 1) according to Burgers and Percival 4 with the following modifications: (1) Because the yeast used already contain YACs, they are grown in SD + cAA + A medium; (2) the zymolase reaction is incubated at 30 ° for 30 min; (3) no DNA is added to the spheroplasts, only an equivalent amount of TE (10 mM Tris, 1 mMEDTA); and (4) the SOS (1 M sorbitol, 0.25% yeast extract, 0.5% bactopeptone) medium contains no CaCl 2 .
Plating Yeast Spheroplasts with Alginate Solution The spheroplasts are mixed with 2 ml of either 1.25 or 3% (w/v) alginate solution (42 °) and plated onto an 82-mm nylon membrane contained in a SORB plate (87 mm) maintained at 37 °. These temperatures facilitate the even spreading of the alginate solutions. The alginate solution is spread evenly across the nylon membrane by gently tilting and rotating the plate. A thin film is formed over the nylon membrane and the alginate solution is then allowed to gel at room temperature for 30 min before incubation at 30° for 3-4 days with the plate inverted. For comparison of the efficiency of cell wall generation in other matrices, the spheroplasts are plated with either 6 ml of TOP agar (48°), 3 ml of 1% (w/v) SeaKem LE agarose, or 3 ml of 1% (w/v) SeaPlaque agarose and overlaid onto SORB plates.
Removal of Alginate Gel and Recovery of Yeast Cells Yeast cells can be observed in the alginate gel usually after 3 days of incubation. To remove the alginate gel, the nylon membrane is transferred to plates containing 0.125 M EDTA in 1% (w/v) SeaKem LE agarose. The EDTA plates are thoroughly dried in a 37° incubator or oven overnight. The alginate gel above the nylon membrane will slowly liquefy and the alginate solution will be absorbed by the EDTA plate, leaving the yeast cells on the nylon membrane. The alginate gel should disappear in less than 1 hr. If alginate gels are still present after 1 hr, the nylon membranes are transferred onto new EDTA plates.
Preparation of Screening Filters and Storage of Master Filters After the removal of the alginate gel, the nylon membranes containing the yeast cells are placed back on SEL [0.67% (w/v) Bacto-yeast nitrogen base with or without amino acids, 2% (w/v) dextrose, complete amino acids minus tryptophan, 2% (w/v) agar] plates and grown overnight at 30°.
[31]
ALGINATE AS MATRIX SUPPORT FOR Y A C CLONING
435
The following day, a replicate of the membranes can be made by placing a second nylon membrane onto the membrane containing the YAC clones. This is done by making a sandwich consisting of (from bottom to top) a flat table top, three pieces of dry Whatman (Clifton, N J) 3MM paper, the master nylon membrane with the colonies up, a nylon membrane prewetted on an SD + cAA + A plate, a dry piece of Whatman 3MM paper, and a piece of glass plate. Heavy hand pressure is applied briefly but evenly from the top and the stack is dismantled; the copy and the master membranes are then placed on SD + cAA + A plates. The copy is then grown at 30° for 20 hr (overnight). To prepare the membranes for hybridization, the membranes are placed on Whatman 3MM paper soaked in SOE [l M sorbitol, 20 mM EDTA, 10 mM Tris (pH 8), 0.8% (v/v) dithiothreitol (DTT) freshly added] briefly, followed by overnight incubation at 37 ° between 3MM papers soaked in lysis buffer [I M sorbitol, 20 mM EDTA, 10 mM Tris (pH 8), 1% (v/v) 2-mercaptoethanol, 1.5 mg/ml zymolyase 20T] in sealed bags. The membrane is then denatured in denaturation buffer (0.5 M NaOH, 1.5 M NaCI) for 5 rain, neutralized with 0.5 M Tris (pH 7), air dried, and either oven baked for 1 hr or UV-irradiated (120 mJ). The master nylon membrane should be kept on SD + cAA + A plates containing 20% (v/v) glycerol at - 7 0 °. Comparison o f Alginate and Other Matrices as Solid Support for Yeast Spheroplasts
There are a number of conflicting results concerning the efficiency of using alginate in yeast cell wall regeneration versus the standard agar or agarose. Abidi et al. 5 reported a 10-fold decrease in transformation efficiency when alginate was used, while Traver et al. v found no differences with either alginate or agar. Thus, we sought to compare the efficiency of alginate versus the other matrices. One thousand YAC spheroplasts were plated in either 1.25% (w/v) alginate, 3% (w/v) alginate, 2.5% (w/v) agar, 1% (w/v) SeaKem LE agarose, or 1% (w/v) SeaPlaque agarose. There seems to be little variation in the ability of the spheroplasts to regenerate the cell walls in the matrices tested (differences less than 30%). Thus, the use of alginate will facilitate the screening process without significant loss of cloning efficiency. Discussion The development of yeast artificial chromosome vectors is undoubtedly one of the major breakthroughs in genomic cloning in recent years.
436
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[32]
However, many of the procedures associated with YAC cloning are tedious and have not been optimized for general applications. The use of alginate as a solid support for YAC clone regeneration replaces the need to manually pick the YAC clones onto nylon membranes for hybridization and storage. A number of laboratories have used the alginate matrix for YAC cloning with mixed results. 5-7 This discrepancy might be related to the source of alginate solution used. Alginic acid can be purified from one of three alga species 8 and the resulting preparations can differ in their viscosity, gel strength, and, most importantly, the amount of endotoxins. Thus, one must use alginate preparations that are suitable for cell entrapments and YAC cloning. Svoboda and Ourednick 9 reported that the efficiency of cell wall regeneration is directly related to the alginate concentration, with higher efficiency observed at higher alginate concentration. We have demonstrated that similar efficiency can be obtained with either 1.25 or 3% (w/v) alginate solutions. However, we do not recommend the use of the 3% (w/v) alginate solution because of its high viscosity and lengthy remelting time. Acknowledgments This work was supported in part by a grant from the Elsa Pardee Foundation.E.L. is a Special Fellowof the LeukemiaSocietyof America. 8C. Bucke, this series, Vol. 135, p. 175. 9 A. Svobodaand P. Ourednicek, Curr. Microbiol. 20, 335 (1990).
[32] G e n o m e W a l k i n g b y S i n g l e Specific Primer-Polymerase Chain Reaction By V E N K A T A K R I S H N A S H Y A M A L A a n d G I O V A N N A F E R R O - L U Z Z I A M E S
Introduction Over the past few years the polymerase chain reaction (PCR) has become an indispensable technique in molecular biology. ~'2 The PCR technique is used for selective amplification of DNA fragments that can t T. J. White, N. A r n h e i m , and H. A. Erlich, Trends Genet. 5, 185 (1989). 2 T. D. K o c h e r and A. C. Wilson, in " E s s e n t i a l Molecular Biology: A Practical A p p r o a c h " (T. A. Brown, ed.), p. 187. I R L Press, Oxford, England, 1991.
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993by AcademicPress. Inc. All rights of reproduction in any form reserved.
[32]
GENOME WALKING BY SINGLE SPECIFIC PRIMER P C R
437
be used for various p u r p o s e s . 3'4 The only requirement for amplification is that the sequence information at the extremities of the DNA fragment to be amplified be known. However, this requirement poses a major limitation on the use of the PCR in the amplification of unknown regions. We have devised a strategy to overcome this limitation and amplify double-stranded DNA when the sequence information is available at one end only. 5 This modification, the single specific primer-PCR (SSP-PCR), extends the applicability of the PCR technique to genes for which only partial sequence information is available, and allows rapid unidirectional genome walking from known into unknown regions of the chromosome. The basic principle of the SSP-PCR procedure is schematically described in Fig. 1. (1) The DNA is digested, preferably using two restriction enzymes; (2) the unknown end of the DNA is ligated to a suitable oligomer of known sequence, long enough to be used as a primer for the PCR; (3) the ligation reaction mixture is subjected to PCR amplification using a specific primer annealing to the known sequence and a generic oligomer annealing to the unknown end. A variety of DNA fragments will be ligated to the generic oligomer and during amplification the generic primer will hybridize to all of these ends. However, specificity is imparted by the specific primer, which brings about exponential accumulation of only the specific fragment. We have used this method to answer a number of questions concerning the characterization of unknown Salmonella typhimurium DNA in the vicinity of DNA of known sequences, as schematically represented in Fig. 2: (1) genome walking beyond the histidine transport operon with available restriction informationS; (2) genome walking beyond the argA gene in the absence of any restriction informationS; and (3) characterization of the recombination event between a known site and a distant foreign gene in the analysis of genetic duplication mutations in the histidine biosynthetic operon. 6 The SSP-PCR technique has also been used successfully in eukaryotic systems. Examples include (!) the analysis of translocations in the human X chromosome 7 and (2) the isolation of tyrosine kinase genes (T. White, personal communications, 1992). Below we give the general set of conditions for the SSPPCR. 3 V. Shyamala and G. F.-L. Ames, J. Bacteriol. 171, 1602 (1989). 4 K. B, Mullis and F. A. Faloona, this series, Vol. 155, p. 335. 5 V. Shyamala and G. F.-L. Ames, Gene 84, 1 (1989). 6 V. Shyamala, E. Schneider, and G. F.-L. Ames, EMBO J. 9, 939 (1990). 7 S. E. Bodrug, J. J. A. Holden, P. N. Ray, and R. G. Worton, E M B O J . 10, 3931 (1991).
438
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[32]
I
(I)
Restricted and ligated to the generic olicjomer
mgmmmmiNmlllm~ mulmHmmmmmmmmmam~m m
u
=
~
I
(2)
First few Cycles of Amplification
Annealing and First copy ~r :_=
•~ - -
. . . . . . . . . . .
. . . . . . . . . . . . . . . . .
° ° - - -
. . . . . . . . . . . . . . . . .
"4
I
I
(3)
40 Cycles
I mm
Amplified Specific Fragment
Fro. 1. Schematic representation of the SSP-PCR technique. Shaded boxes, nonspecific DNA (essentially all genomic DNA) and the fragments derived by digestion; black boxes, generic oli8omer ligated to the unknown end of the DNA fragments; black bars, generic primer; open bar, fragment-specific primer; dashed arrows, amplified DNA. In step 1 the genomic DNA is digested with a combination of enzymes and the unknown end is ligated to an oligomer of known sequence. In steps 2 and 3 the ]igation reaction mixture is amplified with a primer specific for the known end of the fragment and a generic primer complementary to the oligomer. Although the generic primer anneals to the unknown ends of all fragments, the resulting products increase only linearly. The exponential amplification of the specific product is brought about by the simultaneous annealing of the fragment-specific primer and the generic primer to a given fragment.
[32]
GENOME WALKING BY SINGLE SPECIFIC PRIMER P C R
439
histldlne transport operon L~g~g~g~ Known DNA region
~ Known restriction sites arg A
his D
L
~
JRegion of interest of unknown sequence
"~'~-~ADistant DNA brought adjacent to known DNA by a recombination event
~ Duplication join-point FIG. 2. Schematic representation of situations examined by SSP-PCR in S. typhimurium. Top: Genome walking beyond the histidine transport operon with the availability of restriction information. Middle: Genome walking beyond the argA gene in the absence of any restriction information. Bottom: Characterization of the join point of duplication mutations with one end near the hisD gene.
Materials The following materials are used for our experiments. Alternative sources are also suitable. T4 DNA ligase, M13mpl8, M13mpl9, and all restriction enzymes are from Boehringer Mannheim (Indianapolis, IN). Taq polymerase is from Perkin-Elmer-Cetus (Norwalk, CT), SmaI-cut M 13mp 10 is from Amersham (Arlington Heights, IL). Lysozyme, pronase, RNase A, and RNase T1 are from Sigma (St. Louis, MO). All oligomers are synthesized on site using an Applied Biosystems (Foster City, CA) DNA synthesizer. Experimental
Isolation of Bacterial Chromosomal DNA Our experiments are performed on S. typhimurium LT2 for which the conditions are described. Any source of DNA is appropriate. Bacteria are grown overnight in 50 ml LB medium (10 g bactotryptone, 5 g yeast extract, 10 g NaCI dissolved in 1 liter of double-distilled water and pH adjusted to 7.0 prior to autoclaving), harvested by centrifugation, and washed in 10 ml of 0.1 M Tris-HC1 (pH 8.0), 0.1 M ethylenediaminetetraacetic acid (EDTA), 0.15 M NaCI. The washed cells are resuspended in 0.5 ml of 0.15 M NaCI, 0.1 M EDTA, treated for 20 min with 50/xl of
440
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[32]
freshly prepared lysozyme (20 mg/ml in 0.25 M Tris-HC1, pH 8.0), and incubated at 60 ° for 10 min. The cell lysate is treated with 0.5 ml of 20 mg/ml pronase that has been self-activated by incubating the 20-mg/ml solution at 37 ° for 2 hr. The DNA is phenol extracted, ethanol precipitated, dissolved in 5 ml of TE buffer [10 mM Tris-HC1 (pH 7.5), 1 mM EDTA] and treated with 100/~1 of heat-treated RNase A and RNase TI (1 mg/ml and 10,000 U/ml, respectively, in 0.1 M sodium acetate, pH 5.5) for 1 hr at 37 °. The DNA is ethanol precipitated and dissolved in 0.1 ml of TE buffer. The yield of DNA is in the range of 0.5 mg. 5
Restriction and Ligation of Chromosomal DNA Availability of restriction information in the region of unknown sequence within a reasonable distance from the known region is a great asset, because it defines the choice of the restriction enzyme. However, in most situations it is likely that restriction information will not be available and, to increase the odds of finding a restriction site in the vicinity of the known gene, digestion with several enzymes must be carried out. Chromosomal DNA sufficient for several reactions is initially digested with an enzyme that cuts in the region of known sequence. This site must be outside the gene-specific primer binding site. The digested DNA is phenol extracted, ethanol precipitated, and aliquoted for digestion with second enzymes that cut in the unknown region. Generic oligomers of at least 20 nucleotides are designed to complement and ligate to the unknown end. Alternatively, if a vector of known sequence is used for ligating to the unknown end, the vector DNA is digested with enzymes giving sites compatible for ligation to the unknown end of the DNA. Following restriction, the vector DNA is phenol extracted and ethanol precipitated. The doubly digested chromosomal DNA is diluted to a concentration of 1/~g/ ml and aliquots ranging in amounts from 1.0-6.0 ng are used for each ligation reaction with 2.0/.~g of digested vector in a final volume of 10/xl with 1.0/zl of 10 x ligation buffer (Boehringer Mannheim) and 1/zl (5.0 U) of T4 DNA ligase at 15° overnight. The final concentration of DNA for ligation appears to be less critical for the amplification of short fragments; however, we have observed that larger DNA fragments are generated only within a narrow range of DNA concentrations, which might vary in different experiments. For example, in the case of genome walking beyond the histidine transport operon a 550-bp product was produced at each of the three concentrations of DNA used (3.0-6.0 ng/10/zl of ligation reaction mixture), while a 950-bp product was produced only at a concentration of 3.0 ng/10/zl of ligation reaction mixture (Fig. 3). When a large number of DNA samples must be examined, restricted chromosomal DNA can be ligated at a single concentration of 3.0 ng/10/~1 ligation reaction to compati-
[32]
GENOME WALKING BY SINGLE SPECIFIC PRIMER P C R
a
b
c
d
e
f
g
h
i
j
441
M
950 bp 550 bp
FIG. 3. Genome walking beyond the histidine transport operon. Chromosomal DNA (2.0 /xg) from LT2 wild type was digested with Pstl, which cuts in the known region, and with AvaI or StuI, which cut in the unknown region. M13 mpl8 RF DNA (75/zg) was digested with Pstl and XmaI to ligate the AvaI-digested chromosomal DNA; alternatively Ml3mpl0 was digested with Srnal to ligate Stul-digested DNA. The restricted chromosomal DNA was diluted to a concentration of 60 tzg/ml. Five concentrations of chromosomal DNA, ranging from 0.6 to 6.0 ng, were ligated to restricted MI3 DNA (180/xg/ml) in a final volume of 10 /zl with 5 U of T4 DNA ligase at 15° overnight. A l-tzl aliquot of the ligation mix was used for the PCR in a total volume of 25/zl. The M13 reverse primer served as the vector-specific generic primer and the second primer was specific for the hisP gene of the histidine transport operon. To analyze the amplification products, 2 ~1 of the reaction mix was electrophoresed on 1% (w/v) agarose in TBE (0.1 M Tris-HCl, 0.1 M borate, 1 mM EDTA), and visualized with ethidium bromide. Lanes a-e: AvaI ligation; f-j: StuI ligation at DNA concentrations of 0.6, 1.5, 3.0, 4.5, and 6.0 ng, respectively. Lane M, 123-bp ladder marker. Based on the restriction information products of 500 and 900 bp were expected for Aval- and Stul-ligated products, respectively [F. Ardeshir, C. F. Higgins, and G. F.-L. Ames, J. Bacteriol. 147, 401 (1981)]. The specificity of the products was examined by Southern analysis using a ~-~Plabeled internal primer (data not shown)? b l y d i g e s t e d v e c t o r at a c o n c e n t r a t i o n o f 2.0 /xg/10 /~1.6 H o w e v e r , t h e concentration must be standardized for different situations and systems. The individual ligation reaction mixtures are saved and can be used again for each new gene walking step.
P o l y m e r a s e Chain R e a c t i o n A l-/zl a l i q u o t o f t h e l i g a t i o n r e a c t i o n m i x t u r e is u s e d f o r P C R in a t o t a l volume of 25/zl. The generic primer to be used depends on the vector or
442
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[32]
on the generic oligomer ligated to the unknown end. For example, if M13 is used as the vector DNA, M13 primer serves as the vector-specific generic primer. The second primer is always specific for the known sequence in the DNA to be analyzed. Amplification buffer consists of 67 mM Tris-HCl (pH 8.8 at 25°), 6.7 mM MgCI:, 16 mM ammonium sulfate, 0.5 mM concentrations of each of the four deoxynucleoside triphosphates, 1.0/xM primer, and 0.25 U of Taq polymerase. A drop of mineral oil is layered on top of the amplification reaction mixture. DNA is denatured at 94 ° for 1 min, annealed at 55 ° for 1 min, and extended at 72 ° for 2 min. The total number of cycles is about 40. To analyze the amplification products, 2/~1 of the reaction mixture is electrophoresed on 1% (w/v) agarose in TBE (0.1 M Tris-HC1, 0.1 M borate, I mM EDTA), and visualized with ethidium bromide.
Testing for Specificity of Amplification Product The specificity of the amplification products needs to be ascertained because the primers can anneal at sites with partial homologies and yield undesired products. When sufficient sequence information is available to design an internal oligomer Southern analysis can be performed. 5 Briefly, following visualization of the amplified products in an agarose gel, the DNA is denatured by treating the gel with 0.4 M NaOH, 0.8 M NaCI for 30 rain. The gel is dried onto Whatman (Clifton, NJ) 3MM paper using a regular gel drier. The dried gel is wetted with distilled water to remove the Whatman 3MM paper to prepare the gel for hybridization in 5 × SSPE [1 x SSPE is 10 mM sodium phosphate of (pH 7.0), 0.18 M NaCI, 1 mM EDTA], 0.3% (w/v) sodium dodecyl sulfate containing l0/xg/ml sonicated calf thymus DNA for 30 min at 50 °. Appropriate 32p end-labeled internal primer is added to the solution and incubation is continued for 4 hr. Hybridized gels are washed twice in 2 x SSPE, 0.1% (w/v) sodium dodecyl sulfate for 30 min at room temperature and twice in 5 x SSPE, 0.1% (w/v) sodium dodecyl sulfate at 52° (15 min). 8 When an internal primer cannot be designed for Southern analysis due to limited sequence information, specificity of the product can be ascertained as follows. 5 The amplification product visualized on an agarose gel with ethidium bromide is excised from the gel and placed in an Eppendorf tube. Depending on the intensity of the band, 100-500 p.l of TE is added to the agarose slice containing the DNA. A 2 to 3-min incubation of the Eppendorf tube in a boiling water bath is sufficient to melt the agarose. If the agarose solidifies due to the small volume of TE, the tube can be reheated just prior to use. 8 j. L. Bos, M. V. Vries, A. M. Jansen, G, H. Veeneman, J. H. Van Boon, and A. J. Van tier Eb, Nucleic Acids Res. 12, 9155 (1984).
[32]
GENOME WALKING BY SINGLE SPECIFIC PRIMER P C R
443
A 5-tA aliquot of this mixture is used for the amplification reaction in a final volume of 100 ~1. Three reactions are set up: one with the generic primer alone, one with the gene-specific primer alone, and one with both primers. If the amplified DNA is specific and derived by the participation of both primers, a product of the same size as the original product should be observed only when both primers are present. Occasionally, some products might be obtained in single-primer reactions, but the sizes of these products generally are different from that of the specific product. This test for specificity is a reliable alternative to Southern analysis with an internal primer.
Sequencing of Single Specific Primer-Polymerase Chain Reaction Products After ascertaining specificity, the SSP-PCR products can be sequenced either following asymmetric amplification or by cloning into M 13 or other vectors. For amplification products of a size less than 500 bp, direct sequencing following asymmetric amplification is possible. 3 Direct sequencing following asymmetric amplification minimizes the problem of visualizing misincorporation errors introduced by Taq polymerase. 3 The amplified product isolated from an agarose gel as described above is used as a template to carry out two asymmetric amplifications, using 1 tzM gene-specific primer and 0.01 tzM (limiting concentration) generic primer to sequence one strand, and the reverse combination to sequence the second strand in a final volume of 100 ~1. The amplification reagents and conditions are as described above, except that the extension time at 72 ° is reduced to 1 min, because the product is less than 500 bp. The amplification reaction is extracted with 300 txl of chloroform to remove the oil and the aqueous phase is passed through a 1.0-ml spin column of Sephacryl S-300 equilibrated with TE. The flow-through is ethanol precipitated and the DNA is sequenced using the limiting primer. For fragments larger than 500 bp the product must be cloned into a sequencing vector. 5'6 If the SSP-PCR product has been generated with a primer adjacent to a polycloning site, the product includes the adjacent restriction sites up to the cloning site. These are useful for cloning and, in cases in which restriction information is available, the DNA can be safely digested with an appropriate enzyme that does not cut within the amplified DNA. However, in the absence of restriction information bear in mind that these enzyme sites could be present in the unknown amplified DNA. If sequencing is done after subcloning of the amplified product, at least three individual subclones must be sequenced to ensure that base alterations are not the result of errors during amplification. Changes present in less than all
444
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[32]
three subclones are considered the result of errors incorporated by Taq polymerase during amplification. Features and Additional Applications of Single Specific Primer-Polymerase Chain Reaction While it is useful to have information regarding restriction sites in the unknown DNA, it is not a requirement for SSP-PCR. When the sites are unknown a series of enzyme combinations should be used. Usually one or more of the enzyme combinations yields an amplified product. The ligation reaction mixes are the equivalent of genomic libraries, because they can be used repeatedly. For each new step of gene walking, a new primer is designed on the basis of the newly obtained sequence information and it is used for amplification with the already existing restriction-ligation reaction mixtures. The ligation reaction mixture used for generating the fragment in the previous step is avoided for the next round of PCR because it will not provide any new sequence information; however, it should be included for the subsequent steps of PCR. Besides its use in unidirectional movement into unknown regions for routine cloning and sequencing purposes, the SSP-PCR technique is also ideal for cloning genes for which the existing sequence information cannot be utilized. For example, cloning of genes using the known restriction map of Escherichia coli K-129 is complicated when other E. coil strains or a different genus of a related organism, such as S. typhimurium, are used, because they have different restriction maps. Another use of the SSP-PCR technique is in the case of deletion and insertion mutations. For example, the sites of transposon or viral insertion can be identified by SSP-PCR, by using a primer specific for the transposon or virus of interest. The SSP-PCR procedure is also useful for amplification and sequencing of splice sites in the genomic DNA of eukaryotes. Although the PCR supports the amplification of products up to several kilobases, the largest product amplified by the SSP-PCR reported to date is 1.8 kb. 7 The absence of products with most combinations of restriction-ligation reaction mixtures indicates that either these enzyme sites are not within a reasonable distance from the specific primer that allows efficient amplification, or that the extension time of 2 min at 72 ° is too short for the rapid accumulation of the product. This is not a serious handicap because synthesis of several new primers would be required in any case for sequencing a 1.8-kb product and the same primers can be used for taking further gene walking steps. 9 y . Kohara, K. Akiyama, and K. Isono, Cell 50, 495 (1987).
[32]
GENOME WALKING BY SINGLE SPECIFIC PRIMER P C R
445
The S S P - P C R technique does not require a circular DNA template and therefore does not require ligation of both ends. The unknown DNA must be ligated to an oligomer of known sequence only at its unknown end, thus becoming contiguous with the generic primer-binding site. Although ligation following a single restriction enzyme digestion of both the test DNA and the vector is sufficient to generate amplification product, digestion of the vector with a second enzyme is desirable. This helps minimize vector-vector ligation, thus eliminating the formation of generic primerbinding sites at the two ends of the vector dimers. Therefore, even though the unknown DNA may receive digestion with only one enzyme when limited restriction information is available, it is preferable to digest the vector DNA with any uninterfering second enzyme. The SSP-PCR method also overcomes some of the problems encountered when using techniques that involve bacterial transformation. For example, the ligation o f A v a I CCCGAG-generated ends with X m a I CCCGGG-generated ends, which have a mismatch, results in ligated products that are not viable in vivo following transformation into bacterial cells. On the other hand, because the SSP-PCR does not involve any in vivomediated steps, the ligation reaction mixture can be amplified despite the mismatch? Successful SSP-PCR of blunt end restriction-ligation products has increased the choice of restriction enzymes to analyze unknown DNA. 5 One of the critical parameters in SSP-PCR is the ratio of vector DNA to test DNA during ligation. The ligation reaction should result in the joining of the monomeric form of the unknown test DNA fragment to the vector. The fragmented chromosomal DNA is used at low concentration to minimize ligation of restriction fragments to each other, which can compete with the vector DNA, thus inhibiting the generation of fragments appropriately ligated. The vector DNA is used at a high concentration to promote ligation to individual chromosomal DNA fragments. Multimeric forms of the vector DNA formed due to its high concentration with most double digests will not result in tail-to-tail ligation. Because only tail-totail ligation can provide binding sites for the generic primer on both strands of the vector DNA and lead to exponential accumulation of a nonspecific product, this is not a serious problem. In our studies we have made use of the concentrations suggested by Collins and Weissmanl°; however, these conditions may need to be standardized for specific experimental situations. M13 vectors are useful for the following reasons: (1) commercial availability of DNA and primers for amplification, (2) use of a single generic Io F. S. Collins and S. A. W e i s s m a n , Proc. Natl. Acad. Sci. U.S.A. 81, 6812 (1984).
446
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[33]
primer for all amplifications, (3) convenience of multiple cloning site for ligating a variety of ends, and (4) convenience for subcloning the generic primer product, which amplifies adjacent cloning sites, for sequencing and expression purposes. However, any vector with the above features (a variety of which are currently available, e.g., SK and pGem) should serve the purpose. A generic primer complementary to the sequence outside the polyclonal site would be most useful. Although theoretically any oligomer of sufficient length (20 nucleotides) and of known sequence and compatibility can be used for ligation to the unknown ends and meets the requirements of a primer for amplification, it necessitates the synthesis of generic oligomers compatible with each restriction fragment, which may not be cost effective. Acknowledgments W e t h a n k Anil Joshi for m a n y useful d i s c u s s i o n s throughout the d e v e l o p m e n t o f this idea. W e also t h a n k D. Irwin, M. Morgan, and Y. Y a n g for m a n y helpful discussions. This work was s u p p o r t e d by National Institutes of Health Grant D K 12121 and A m e r i c a n C a n c e r Society Grant MV-397 to G . F . - L . A . V . S . dedicates this publication to the m e m o r y o f Dr. H. W. Dickerman.
[33] M a p p i n g T r a n s c r i p t i o n S t a r t P o i n t s w i t h T4 DNA Polymerase
By MICKEY C-T. Hu and NORMAN DAVIDSON Introduction Two of the most popular techniques for determining transcription start points of genes on cloned genomic DNA involve the use of single-stranded DNA-specific endonuclease S I or exonuclease Exo VII to map RNA transcripts hybridized to well-characterized template DNA. ~Both of these mapping techniques involve hybridization of the RNA to be analyzed with a purified, radioactively labeled DNA probe. Hybridizations are performed in high concentrations of formamide at an optimal temperature to favor RNA : DNA over DNA : DNA duplex formation. Subsequently, the hybridization mixes are digested with endonuclease S1 or exonuclease Exo VII, and the nuclease-resistant RNA : DNA duplexes are resolved by denaturing polyacrylamide or agarose gel electrophoresis. The transcription start point is then deduced from the size of the protected DNA l A. J. Berk a n d P. A. Sharp, Proc. Natl. Acad. Sci. U.S.A. 75, 1274 (1978).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993by AcademicPress, Inc. All rights of reproduction in any form reserved.
[33]
MAPPING TRANSCRIPTION START POINTS
447
fragment. If the labeled end of the DNA restriction fragment is within 200 nucleotides of the 5' end of the RNA and within the first exon, highresolution mapping of the transcription start point can be obtained by S 1 mapping. In many cases, however, the first exon of a eukaryotic gene is quite short. It is then frequently difficult to find a convenient restriction endonuclease site within this exon for S 1 mapping. Although the Exo VII mapping technique can be used for mapping short exons in which restriction sites have not been mapped, 2 it is not accurate for determining the transcription start point of a gene that contains a large intron between the first and second exons, when the labeled site lies within the second exon. Both of these mapping techniques require some precise restriction maps. Significant inconveniences of both techniques have been the need to purify the end-labeled DNA probes and to determine optimal conditions for hybridization. Here, we describe a precise mapping technique for determining transcription start points on cloned genomic DNA using T4 DNA polymerase.~ This method uses single-stranded M13 DNA and, therefore, is unlike the S1 and Exo VII mapping methods, independent of the restriction sites present in the insert DNA. As illustrated in Fig. 1, essentially the protocol involves the following steps: (1) hybridizing an mRNA to a single-stranded M13 vector containing an antisense genomic DNA sequence spanning the presumptive transcription start point, (2) annealing a DNA primer to the M13 DNA at a site on this DNA upstream from the 5' end of the mRNA on the template DNA, and (3) extending the primer with T4 DNA polymerase. Because T4 DNA polymerase will not displace the mRNA : DNA hybrid, 4 synthesis is blocked at the 5' end of the mRNA molecule. The length of the extended DNA products can then be determined with single-nucleotide resolution on denaturing sequencing gels in parallel with a sequencing ladder. The sensitivity of the method makes possible precise mapping of moderately rare transcripts, when sufficient RNA is available. It is particularly valuable for mapping the transcription start points of genes that contain a large intron between the first and second exons. It also provides an alternative to the S 1 and Exo VII mapping methods. We have used this method to map the transcription start point of the mouse skeletal a-actin gene and others have successfully used this technique to map the transcription start points of the Drosophila ras2 gene 5 and the cysD gene ofEscherichia coli. 6 2 A. J. Berk and P. A. Sharp, Cell 14, 695 (1978). 3 M. C-T. Hu and N. Davidson, Gene 42, 21 (1986). Y. Masamune and C. C. Richardson, J. Biol. Chem. 246, 2692 (1971). 5 N. Cohen, A. Salzberg, and Z. Lev, Oncogene 3, 137 (1988). 6 M. S. Malo and R. E. Loughlin, Gene 87, 127 (1990).
448
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
5' m7G
[33]
Antisense genomicinsert @
(A)~
tsp PmRNA
3'
H
5
'
m7Gp
~ tsp
- ~
DNA sequencing pnmer
3'
~.,
~'p" (A)n
PP~ ~ 5 -
3'
P2P] 5"-'H3'
M13 vector
I
An_^_," ~ ~ T 4 DNA polymerase ~,,.~.t~ ~ (and four dNTP) /
m5~
..o,,~
v...
~Extend
37
~
5' ~
-,v~
1
Analyze thesizeof the extension product on sequencing gel FIG. 1. Protocol for mapping transcription start points on cloned genomic DNA. The solid bar represents the insert DNA, the hatched box represents 32p-labeledDNA primer, and the wavy line represents mRNA. Materials and Methods
Buffers, Solutions, and Reagents YT medium (2 ×) (per liter): 5 g of NaC1, 10 g of Bacto-yeast extract (Difco, Detroit, MI), 16 g of Bacto-tryptone (Difco), pH 7.0 TSE buffer: 20 mM Tris-HCl (pH 7.5), 10 mM NaCI, 0.1 mM ethylenediaminetetraacetic acid (EDTA) STEPK buffer: 0.1 M NaC1, 10 mM Tris-HC1 (pH 7.5), 1 mM EDTA, 300/~g/ml proteinase K
[33]
MAPPING TRANSCRIPTION START POINTS
449
Binding buffer for oligo(dT)-cellulose: 0.5 M NaC1, 10 mM Tris-HC1 (pH 7.5), 1 mM EDTA, 0.1% (w/v) sodium dodecyl sulfate (SDS) Wash buffer for oligo(dT)-cellulose: 0.1 M NaC1, 10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.1% (w/v) SDS Elution buffer for oligo(dT)-cellulose: 10 mM Tris-HCl (pH 7.5), 0.1 mM EDTA Hybridization buffer (9 x ): 3.6 M NaC1, 360 mM sodium piperazineN,N'-bis(2-ethanesulfonic acid) (PIPES) (pH 6.4), 9 mM EDTA T4 DNA polymerase buffer: 67 mM Tris-HCl (pH 8.8), 17 mM (NH4)2SO 4, 7 mM MgCI2, 7 I~M EDTA, 10 mM 2-mercaptoethanol. and 0.2 mg/ml acetylated bovine serum albumin (BSA) T4 DNA polymerase buffer (10 x ): 670 mM Tris-HCl (pH 8.8), 170 mM (NH4)2804, 70 mM MgC12, 70/xM EDTA, 100 mM 2-mercaptoethanol, and 2 mg/ml acetylated BSA Gel loading buffer: 90% (v/v) formamide, 10 mM EDTA, 10 mM NaOH, 0.2% (w/v) bromphenol blue, 0.2% (w/v) xylene cyanol TBE buffer: 90 mM Tris, 90 mM borate, 3 mM EDTA, pH 8.3 Acrylamide (40%) stock solution for gel electrophoresis: 38% (w/v) acrylamide and 2% (w/v) bisacrylamide in H20 T4 DNA polymerase and T4 polynucleotide kinase: obtain from Bethesda Research Laboratories (Gaithersberg, MD) or Boehringer Mannheim (Indianapolis, IN); Sequenase version 2.0 (T7 DNA polymerase) is from United States Biochemical (Cleveland, OH) [y-32p]ATP (-3000 Ci/mmol) and [o~-35S]dATP(1000 Ci/mmol): Obtain from Amersham (Arlington Heights, IL) Unlabeled nucleotides and oligo(dT)-cellulose (type 7): Obtain from Pharmacia-LKB Biotechnology (Piscataway, N J) Escherichia coli 16S and 23S ribosomal RNAs: Obtain from Boehringer Mannheim MI3 primers: Obtain from New England BioLabs (Beverly, MA) Custom oligodeoxynucleotide primers: Synthesize on an automated DNA synthesizer
Preparation of DNA Template It is imperative to have clean, single-stranded M13 DNAs if the protocol is to work well. In a 125-ml Erlenmeyer flask, 12 ml of 2 x YT medium is inoculated with 50/zl of a fresh overnight culture of E. coli JM109 or suitable alternate strain and grown for 1 hr at 37°, with shaking at 250 rpm. Then 50 ~1 of phage supernatant is added and grown for 12 hr. The culture is aliquoted (1.4 ml in each 1.5-ml Eppendorf tube) and centrifuged at 15,000 g at 4° for 5 min. From each the supernatant is collected and
450
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[33]
transferred to another Eppendorf tube and centrifuged again at 15,000 g at 4° for 5 rain. The 1.2-ml cleared supernatants are transferred to fresh Eppendorf tubes and 0.3 ml of a 20% (w/v) polyethylene glycol (PEG)/ 2.5 M NaC1 solution is added to each. The tubes are mixed by inversion several times and placed on ice for 30 min and then centrifuged at 15,000 g for 15 min at room temperature. The supernatant is removed and the tubes are centrifuged again for 2 min. The remaining supernatants are carefully removed. The phage precipitate in each tube is resuspended in 160 /zl of TSE buffer. The phage samples are extracted once with an equal volume of phenol (at 65°), extracted twice with an equal volume of phenol-chloroform (room temperature), and extracted once with an equal volume of chloroform. The DNA is precipitated by the addition of 0.5 vol of 7.5 M ammonium acetate and 2.5 vol of 100% ethanol at - 20 ° overnight. The DNA is then pelleted, dried, resuspended in 200/zl of 10 mM TrisHCI (pH 7.5), and precipitated again as described above. The DNA is then pelleted, washed once with 70% (v/v) ethanol, dried, and resuspended in 40/zl of 10 mM Tris-HCl (pH 7.5). The A260 is measured and the DNA concentration is determined. The anticipated yield is 2-4 /xg singlestranded DNA per milliliter of culture. It is crucial to use high-quality DNA template in the mapping method described here.
Preparation of mRNA Total cellular RNA is isolated from cells or tissue using the guanidinium thiocyanate-phenol-chloroform extraction procedure as described. 7 Poly(A) ÷ RNA is isolated from total cellular RNA using two cycles of oligo(dT)-cellulose chromatography. 8 Alternatively, poly(A) + RNA can be isolated directly from cells by using the following protocol. The cells ( - 1 x 108 cells) are washed once with phosphate-buffered saline (PBS) and resuspended thoroughly in 10 ml of STEPK buffer (at - 1 x 10 7 cells/ ml), 0.5 ml of 10% (w/v) SDS is added, and the cell suspension is mixed by swirling for 1 min. The lysate is then poured into an RNase-free 15-ml Dounce (Wheaton, Millville, N J) homogenizer at room temperature and homogenized with 10 up-and-down strokes. The lysate is passed twice through a sterile plastic syringe fitted with an 18-gauge needle to shear high molecular weight DNA. The lysate is incubated at 50° for 1 hr. The - 9 ml of clear lysate is mixed with 1 ml of 4 M NaC1 (make up the NaCI concentration of the lysate to 0.5 M). The lysate is added to the preequilibrated oligo(dT)-cellulose (typically - 2 0 0 mg at 0.5-ml packed volume) and rocked gently at room temperature for 1-2 hr. Oligo(dT)7 p. Chomczynski and N. Sacchi, Anal. Biochem. 162, 156 (1987). s H. Aviv and P. Leder, Proc. Natl. Acad. Sci. U.S.A. 69, 1408 (1972).
[33]
MAPPING TRANSCRIPTION START POINTS
451
cellulose is pelleted at room temperature at 5000 g for 5 min and resuspended in 5 ml binding buffer and transferred to a 10-ml RNase-free (i.e., alkali-treated) Econo-column (Bio-Rad, Richmond, CA). The oligo(dT)cellulose column is washed at least six times with 10 ml binding buffer and twice with 10 ml wash buffer. Poly(A) ÷ RNA is then eluted with 10 ml elution buffer into one RNase-free 45-ml centrifuge tube and eluted again with 10 ml elution buffer into another centrifuge tube. Poly(A) + RNA in each tube is precipitated by the addition of 1 ml of 3 M sodium acetate and 25 ml of 100% ethanol at - 2 0 ° overnight. Poly(A) + RNA is then pelleted, dried, and resuspended in 200/~1 of elution buffer. Note that all of the buffers used above should be RNase free.
Preparation of DNA Primers and Sequencing Ladders An aliquot (10 pmol) of M13 primer or synthetic oligodeoxynucleotide primer is 5' end labeled to a specific activity of - 1 x 108 cpm//.~g with polynucleotide kinase and [y-32P]ATP (-5000 Ci/mmol), and purified by chromatography through BioGel P-60 (Bio-Rad) by the standard procedures. 9 The single-stranded M13 DNA template (-1/zg) with insert DNA complementary to the 5' region of the mRNA of interest is sequenced by the dideoxy chain-termination procedure using [o~YS]dATP (1000 Ci/ mmol) and Sequenase version 2.0 United States Biochemical (Cleveland, OH) by the standard protocol 9 and used as sequencing ladders.
mRNA : DNA Template Hybridization All hybridization and subsequent extension reactions are carried out in capped 0.5-ml Eppendorf tubes. The RNA sample [10 or 5 /zg of poly(A) + RNA] is precipitated and dried as described above and dissolved in 2.2/zl diethyl pyrocarbonate-treated H20, heated to 65 ° for 5 min, and 2.8/zl of 9 x hybridization buffer is added. One microliter of M13 singlestranded DNA (0.1 or 0.05/zg/~l) with insert DNA complementary to the 5' region of the mRNA of interest and 20 /~1 of RNase-free deionized formamide are added to the RNA solution. The mixture is denatured by heating at 80° for 5 min and hybridized by incubation for 8-16 hr at 37 °. Nucleic acids are precipitated by the addition of 3 ~1 of 3 M sodium acetate and 75/zl of 100% ethanol. The precipitate is collected by centrifugation at room temperature for 30 min. The RNA : DNA samples are washed with 75% (v/v) ethanol and collected by centrifugation at 15,000 g at room temperature for 2 min and dried under vacuum. 9 j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989.
452
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[33]
Note that the RNA sample must be dissolved well in H20 before proceeding hybridization. The heating step at 65 ° should help dissolve the RNA sample in a small volume of H20. Alternatively, the dried RNA sample can be dissolved in 4.4/zl diethyl pyrocarbonate-treated H20 and double amounts of the other buffers and reagents (as described above) should be added. If the RNA sample cannot be dissolved well in a small volume of H20, it implies that the RNA sample is not clean (e.g., has a high salt content) or not pure [e.g., still too much ribosomal RNA in the poly(A) ÷ R N A sample]. Most problems encountered in the present method can be traced back to poor hybridization at this step, which can mostly be traced back to problems with the RNA or DNA sample. Primer Annealing and Extension The dried RNA : DNA pellet is suspended in 9/zl ofT4 DNA polymerase buffer. Note that the pellet should be dissolved directly in T4 DNA polymerase buffer rather than suspending in H20 and subsequently adding 10 x T4 DNA polymerase buffer. One microliter (2.5 ng/t~l) of the 32p_ labeled DNA primer ( - l x 108 cpm//zg) is added and the annealing mixture is heated to 65 ° for 1 min and incubated for 10 rain at 37°. The extension reaction is carried out by adding 0.5/xl of 10 x T4 DNA polymerase buffer, 2/~1 of diethyl pyrocarbonate-treated H20, 2/~1 of 2.5 mM dNTP (a mixture of equal volumes of 10 mM dATP, dCTP, dGTP, and dTTP), and 1 /xl of T4 DNA polymerase. Note that the polymerase should be added last to prevent the possibility of DNA degradation by the enzyme (see Conclusions and Discussion, below). The reaction mixture is incubated for 30 min at 37°. A time course study may be made. If the final product is small, a shorter incubation time may be adequate. The reaction is then terminated by addition of 35/zl of sterile H20 and 1/xl of 0.5 M EDTA (to a final concentration of 10 mM EDTA). The mixture is extracted once with 50/xl of phenol-chloroform and nucleic acids (50 ~1) are precipitated by the addition of 5 tzl of 3 M sodium acetate and 140/zl of 100% ethanol. After ethanol precipitation and drying under vacuum, the RNA : DNA pellet is suspended in 10/xl of gel loading buffer. The sample mixture is heated at 90 ° for 3 min just before electrophoresis, quenched on ice, and electrophoresed on a 40-cm 6% (w/v) polyacrylamide-8 M urea sequencing gel in 1 x TBE buffer in parallel with four dideoxy DNA-sequencing reactions as size markers. Following electrophoresis, the gel is immediately transferred to a sheet of Whatman (Clifton, N J) 3MM paper, covered with plastic wrap, and dried for 2 hr on a 40-cm gel dryer at 80°. The dried
[33]
MAPPING TRANSCRIPTION START POINTS
453
gel is autoradiographed with Kodak (Rochester, NY) XAR film at - 7 0 ° for 24-48 hr.
Sensitivity of Method To test the potential of the method, we carried out a reconstruction experiment using mouse BC3H-1 l° poly(A) + RNA diluted with excess heterologous RNA, that is, E. coli 16S and 23S ribosomal RNAs. In this experiment, we also titrated the amount of the single-stranded DNA template to reduce the background products due to the secondary structures in the DNA template. Figure 2 shows the pattern of the extension products from a serial dilution of poly(A) + RNA versus 0.l or 0.05 /zg DNA template, and of 10/xg of total BC3H-I RNA versus 0.1 /xg DNA template. Evidently, the intensity of the mRNA-specific signal (the bands labeled " c a p " site) increases corresponding to the amount of poly(A) + RNA used. As little as 0.1 /~g of poly(A) + RNA, versus 0.1 or 0.05/zg DNA template, can be detected with an exposure time of 48 hr without the aid of an intensifying screen using a 32p-labeled primer (16-mer) with a specific activity of 1 × 108 cpm//zg DNA. Skeletal c~-actin mRNA is thought to be an abundant transcript that is estimated to be present at 2 to 5% of the poly(A) + RNA from differentiated BC3H-1 cells. Thus, the detection of a band with 0.1/zg of BC3H-1 poly(A) + RNA diluted with 5 /zg of heterologous RNA corresponds to the detection of an RNA of 0.02 to 0.05% abundance in a sample. This calculation suggests that the method should be sufficiently sensitive to detect mRNA species present at levels of a few copies per cell. n It is recommended, however, that poly(A) + RNA be used rather than total RNA because of the higher background products in the latter case (as shown in lane l, Fig. 2).
Accuracy of Method As shown in Fig. 2, measurements indicate an apparent variability of one nucleotide in the T4 DNA polymerase stop position. The major band observed by us corresponds to a 5' skeletal a-actin mRNA sequence of m7G(5')ppp(5')ACAC. The minor band with a length one nucleotide less would correspond to a mRNA sequence of mVG(5')ppp(5')ACAC. We suggest that the former assignment is correct because of the greater intensity of this band, but we do not have decisive proof of this point. If this interpretation is correct, the observed termination of the l0 D. Schubert, A. J. Harris, C. E. Devine, and S. H e i n e m a n n , J. Cell Biol. 61, 398 (1974). II R. F. W e a v e r and C. W e i s s m a n n , Nucleic Acids Res. 7, 1175 (1979).
4.54
SCREENING LIBRARIES, I D E N T I F Y I N G A N D MAPPING GENES
0.1pg DNA template
0.05pg DNA template
tot~ Poly(A)* RN.~ A RNA" ~ TGC
Poly(A)+ RNA , ,
5 1 0.1.01 0 pg
10 0 0.1 1 5 10
"cap" site (tsp) ~ a m
m
m
.
123456789101112131415
] "TATA" box
[33]
[33]
MAPPING TRANSCRIPTION START POINTS
455
T4 D N A polymerase extension reaction to give a product one nucleotide shorter may be due to steric interference by the cap structure. We note that the conventional primer extension using RNA and S1 mapping methods usually shows several bands differing in length by one or more nucleotide, with corresponding uncertainties in the cap site. 11-14 As an additional control, the following experiment is performed to ensure that the observed extension products are not artifacts of the interaction of the long overhanging 3' portion of the bound RNA with the D N A template. The RNA : D N A hybridization is carried out as described above except that the antisense single-stranded D N A is from an M13 subclone with a shorter insert that still contains the predicted transcription start point of the mouse skeletal a-actin gene. Following hybridization, an aliquot of the mixture of the RNA : D N A hybrid is treated with RNases A and T1, under the conditions described by Melton et al., ~5 to cleave off the overhanging RNA tail. The 32p-labeled primer is annealed to the singlestranded D N A of either the intact or the RNase-treated RNA : D N A hybrid or the single-stranded D N A template alone (as a control), and then extended with T4 D N A polymerase. The experimental rationale is that if the primer extension reaction of the polymerase is indeed blocked specifically by the 5' end of the mRNA on the D N A template, the predigested RNA t2 D. S. Luse, J. R. Haynes, D. VanLeeuwen, E. A. Schon, M. L. Cleary, S. G. Shapiro, J. B. Lingrel, and R. G. Roeder, Nucleic Acids Res. 9, 4339 (1981). t3 T. A. Kost, N. Theodorakis, and S. H. Hughes, Nucleic Acids Res. 11, 8287 (1983). 14 A. Hanauer, M. Levin, R. Heilig, D. Daegelen, A. Kahn, and J. L. Mandel, Nucleic Acids Res. 11, 3503 (1983). t5 D. A. Melton, P. A. Krieg, M. R. Rebagliati, T. Maniatis, K. Zinn, and M. R. Green, Nucleic Acids Res. 12, 7035 (1984).
FIG. 2. Sensitivity test of the mapping method with T4 DNA polymerase. Equal amounts of RNA samples [BC3H-1 poly(A) ÷ RNA diluted with E. coli 16S and 23S ribosomal RNAs to make up a total of 5/.~g RNA] were hybridized to either 0.1 or 0.05/~g of M13 singlestranded DNA containing the antisense strand of the mouse skeletal a-actin genomic clone DNA. The amount of poly(A) ÷ RNA in each hybridization was as indicated above each lane [except that in lanes 1 and 6, 10/~g of total RNA and 10/zg of poly(A) ÷ RNA were used, respectively]. In each reaction, 2.5 ng of 32p-labeled DNA primer ( - 1 x 108 cpm/~g) was hybridized to the DNA template and extended with T4 DNA polymerase for 30 min at 37°. Following denaturation, equal amounts of radioactive counts of the primer extension samples were electrophoresed on a 6% (w/v) polyacrylamide-urea sequencing gel. Lanes 7 to 10 show sequencing ladders of the same DNA template in the absence of hybridized RNA. An autoradiographic exposure developed without the aid of an intensifying screen was used to map primer extension products. The transcription start point is denoted as the " c a p " site and TATA box is indicated on the right of the autoradiogram.
456
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[33]
molecule on the DNA template should have the same blocking effect on the extension of the polymerase as that of the intact RNA molecule on the template. Also, the extension products from different DNA templates, containing the same region of the RNA : DNA hybrid, should indicate the same transcription start point on the template. The results showed that the stop point for the polymerase extension reaction was not influenced by the RNA tail on the 3' side of the exon, nor by changes in the position of the initiating primer relative to the transcription start point on the DNA template.
Conclusions and Discussion We describe here a precise mapping technique for identifying transcription start points on cloned genomic DNA. This technique utilizes the features of T4 DNA polymerase that allow it to carry out primed DNA synthesis on a single-stranded DNA template but prevent it from carrying out a strand displacement reaction through an R N A : D N A duplex region. The present method has one significant advantage in addition to its apparent accuracy. In many eukaryotic genes, including the mouse skeletal ot-actin gene, the first exon is quite short. It is then frequently difficult to find a convenient restriction endonuclease site within this exon for S 1 mapping. It is also often the case that the first intron is rather long (longer than 1 kb), so that Exo VII mapping, using a restriction fragment labeled within the second exon, gives products that are too long to be measured with single-nucleotide accuracy. Another significant advantage of the present method is its ability to map precisely a bidirectional promoter 5'16 on cloned genomic DNA. For instance, the bidirectional transcription start points of the Drosophila ras2 gene were precisely determined by this method and found to be only 94 nucleotides apart. 5 The current method requires only that the insert, cloned in M13 or other vectors that give single-stranded DNAs, spans the transcription start point. It may be used to determine whether or not the transcription start point is contained in a given insert. If the available insert extends too far upstream for accurate length measurements using a primer that lies within the vector sequence, standard methods for reducing the insert size can be u s e d . 17'18 Alternatively, a special primer within the insert could be synthesized and used. 16 j. M. Grichnik, B. A. French, and R. J. Schwartz, Mol. Cell. Biol. 8, 4587 (1988). 17 S. Henikoff, Gene 28, 351 (1984). 18 R. M. K. Dale, B. A. McClure, and J. P. Houchins, Plasmid 13, 31 (1985).
[33]
MAPPING TRANSCRIPTION START POINTS
457
T4 DNA polymerase is a DNA-dependent DNA polymerase that catalyzes the polymerization of deoxynucleoside 5'-triphosphates (dNTPs) to the 3'-hydroxyl termini of primers on single-stranded DNA template. T4 DNA polymerase is uniquely suited to the current method because it cannot catalyze strand displacement synthesis. This polymerase does not contain any endonuclease or any 5'---~3'-exonuclease activity. However, it carries an active 3'---~5'-exonuclease activity that is blocked by 5'--~3' DNA polymerase activity in the presence of dNTPs. Thus, it should be noted that low levels of dNTPs should not be used for this kind of experiment, because once the dNTPs are exhausted the exonuclease activity will degrade the DNA. For this reason, incubation times longer than 60 min should not be used. Furthermore, linear single-stranded DNA [e.g., single-stranded DNA product produced by asymmetric polymerase chain reaction (PCR)] should not be used as a template for the current method because it might be degraded by the 3'-->5'-exonuclease activity of this polymerase. However, linear PCR products with phosphorothionate residues at the 3' ends may be used. In the conventional method of primer extension mapping of cap sites, using reverse transcriptase and mRNA as template, secondary structures in the 5' region of mRNA cause premature stops. Although secondary structures in the DNA sequence upstream from the transcription start point may cause similar problems using the present method, the lower thermal stability of DNA secondary structures compared to RNA secondary structures may provide some advantage for the present method. Previously, we anticipated that the present method might be improved by adding T4 bacteriophage gene 32 protein in the primer extension reactions with T4 DNA polymerase to stimulate this polymerase by removing inhibitory secondary structure from the template DNA3; however, the addition of T4 bacteriophage gene 32 protein could also facilitate strand displacement synthesis. 19'2° Therefore the addition of T4 bacteriophage gene 32 protein is not recommended in the present method. The sensitivity of the current method may mark the beginning of its application for a variety of studies. In the present application, we have mapped the transcription start point of an abundant transcript. The sensitivity test suggests that the experimental conditions used should work for a message present at only 0.02 to 0.05% of the poly(A) + RNA. Moreover, we believe that by using optimal ratios of template DNA to poly(A) ÷ RNA and by using a primer as close as possible to the presumptive transcription 19 B. Alberts and L. Frey, Nature (London) 227, 1313 (1970). 20 N. G. Nossal, J. Biol. Chem. 249, 5668 (1974).
458
SCREENING LIBRARIES, IDENTIFYING AND MAPPING GENES
[33]
start point, thus minimizing the number of secondary structure stops, considerably greater sensitivity can be achieved.
Acknowledgments We are grateful to Dr. Judith L. Campbell for technical advice. This work was supported by a research grant from the National Institutes of Health.
[34]
E L E C T R O P O R A T I O N IN R E C O M B I N A N T D N A
TECHNOLOGY
461
[34] A p p l i c a t i o n o f E l e c t r o p o r a t i o n in R e c o m b i n a n t DNA Technology
By
H U N T I N G T O N POTTER
Introduction The spectacular success of recombinant DNA technology rests on the foundation of three basic techniques--the ability to clone genes, the ability to manipulate the resulting nucleic acid sequences in vitro, and the ability to reintroduce the chimeric constructs into cells. Of the various techniques for introducing nucleic acid into living cells, electroporation is the most versatile. It has been successfully used in essentially all cell t y p e s - animal, plant, and microbial--and causes less perturbation of the target cells and transfected DNA than alternative approaches. In addition to yielding a high frequency of permanent or transient transfectants, electropotation is highly reproducible and also substantially easier to carry out than many alternative techniques. The first biological use of electroporation--the formation of holes or pores in the cell membrane by high-voltage electric shock--was to induce cells to fuse via their plasma membranes.~ It was then found that the electropores could be used to introduce macromolecules into cells. 2-5 The earlier studies used specially designed apparatus to carry out electroporation on a few cell lines. We were able to extend and modify electroporation to allow the introduction of exogenous DNA into a broad spectrum of cell types using a widely available electrophoresis power supply and easy-tomake electroporation cuvettes. 4 Since then, electroporation devices have become available from a number of manufacturers (see Instrumentation) and the technique has become the method of choice for gene transfer in many situations. 6 Although the most widespread application of electroporation has been for gene transfer, the technique also can be used to introduce proteins, metabolites, and other small molecules into recipient cells. For instance, E U. Zimmerman, F. Riemann, and G. Pilwat, Biochim. Biophys. Acta 436, 460 (1976). 2 E. Neumann, M. Schaefer-Ridder, Y. Wang, and P. H. Hofschneider, EMBO J. 1, 841 (1982). 3 T. K. Wong and E. Neumann, Biochem. Biophys. Res. Commun. 107, 584 (1982). 4 H. Potter, L. Weir, and P. Leder, Proc. Natl. Acad. Sci. U.S.A. 81, 7161 (1984). 5 G. A. Evans, H. A. Ingraham, K. Lewis, K. Cunningharn, T. Seki, T. Moriuchi, H. C. Chang, J. Silver, and R. Hyman, Proc. Natl. Acad. Sci. U.S.A. 82, 5824 (1984). 6 H. Potter, Anal. Biochem. 174, 361 (1988).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press. h~c. All rights of reproduction in any form reserved.
462
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[34]
actin filaments can be labeled in living carrot cells 7 and primary chick corneal fibroblasts (K. Daniels and E. D. Hay, personal communication, 1992) after electroporation in the presence of rhodaminyllysine phallotoxin. This has allowed the visualization of much finer actin filaments during all phases of the cell cycle than was previously possible with fixed cells. K. Daniels (personal communication, 1992) has also succeeded in electroporating neuronal cells in developing chick neural tube embedded in agar, a model for studies of primary tissue. Nucleoside triphosphates and other nucleoside analogs, 8,9 as well as inositol lipids, ~° can also be introduced into living cells, allowing a number of experiments on intracellular metabolism to be carded out more directly. Finally, various proteins, including antibodies, can be introduced into cells by electroporation, allowing specific intracellular proteins to be labeled and/or inactivated. 1~,~2 In essence, electroporation makes use of the fact that the cell membrane is an electrical capacitor that is unable (except through ion channels) to pass current. Subjecting membranes to a high-voltage electric field results in their temporary breakdown and the formation of pores that are large enough to allow macromolecules, as well as smaller molecules such as ATP, to enter or leave the cell. The precise mechanism and parameters governing pore formation and the transfer of molecules through the pores are matters of active research. (For a review of the biophysics of electroporation, see various articles in the books edited by Neumann et al. ~3and Chang et ai.14) Briefly, two parameters--the voltage and the duration of the current pulse--govern the effectiveness of the electroporation and are varied for different cell types. In general, the smaller the cell, the larger the electric field (voltage) necessary to induce pore formation. The reclosing of the membrane is a natural decay process that can be delayed by keeping the cells at 0 °. Following closure, the exogenous DNA appears to be free in the cell cytoplasm.~5 It can then enter the nucleus to be transcribed in 7 j. A. Traas, J. H. Doonan, D. J. Rawlins, P. J. Shaw, J. Watts, and C. W. Lloyd, J. Cell Biol. 105, 387 (1987). 8 j. A. Sokoloski, M. M. Jastreboff, J. R. Bertino, A. C. Sartorelli, and R. Narayanan, Anal. Biochem. 158, 272 (1986). 9 D. Knight and M. Scrutton, Biochem. J. 234, 497 (1986). I0 p. j. Van Haastert, M. J. De Vries, L. C. Penning, E. Roovers, J. Van der Kaay, C. Erneux, M. M. Van Lookeren Campagne, Biochem. J. 258, 577 (1989). 11 R. Chakrabarti, D. E. Wylie, and S. M. Schuster, J. Biol. Chem. 264, 15494 (1989). 12 D. L. Berglund and J. R. Starkey, J. Immunol. Methods 120, 79 (1989). 13 E. Neumann, A. E. Sowers, and C. A. Jordon (eds.), "Electroporation and Electrofusion in Cell Biology." Plenum, New York, 1989. 14 D. C. Chang, B. Chassy, J. A. Saunders, and A. E. Sowers (eds.), "Handbook of Electroporation and Electrofusion." Academic Press, San Diego, 1992. 15 W. Bertling, K. Hunger-Bertling, and M. J. Cline, J. Biochem. Biophys. Methods 14, 223 (1987).
[34]
ELECTROPORATION IN RECOMBINANT D N A TECHNOLOGY
463
a transient fashion and, at a lower frequency, become integrated into the host genome to generate a permanently transfected cell line. In summary, electroporation can be considered essentially as a massmicroinjection procedure. The amount of DNA that can be introduced into the nuclei of electroporated mammalian cells, for instance, is in the range of 0.5 pg, corresponding to 10 4 DNA molecules of 8% of total endogenous host DNA. ~5 The maximum size of the DNA molecules that can be introduced by electroporation is at least 150 kb.16 Electroporation is also sufficiently efficient to allow plasmid cDNA libraries to be transfected into mammalian host cells for selection (see, e.g., Ref. 17).
Comparison of Electroporation to Other Gene Transfer Methodologies. Several means exist for introducing macromolecules such as nucleic acids into cells, and some are uniquely suited to certain applications. For instance, retroviral vectors are able to introduce cloned genes into mammalian cells with efficiencies approaching 100%, 18while electroporation efficiency is generally less than 10% for permanent transfection (although new technology is increasing that efficiency, as discussed below). However, retroviral vectors require substantially more preparation before the actual gene transfection can take place, and they integrate only into the genomes of dividing cells (which is sometimes an advantage). Also, there is an 8-kb limit to the size of the nucleic acid sequence that can be incorporated into a retroviral vector, while electroporation can be used to introduce very large DNA molecules into cells. The main advantages of electroporation are that it is widely applicable and extremely easy to carry out. In addition, the DNA is introduced into the cell essentially naked, rather than being incorporated into phagocytic vesicles, as is the case of DNA taken up as CaPO4 or DEAE-dextran coprecipitates. 19,2° This may explain why electroporation can, in some cells, result in a lower level of mutation of transfected DNA when compared with most traditional gene transfer methods (compare, e.g., Refs. 15 and 21 with Refs. 22 and 23). Only microinjection results in a similarly low spontaneous mutation frequency of exogenously added DNA. 24 16 j. C. Knutson and D. Yee, Anal. Biochem. 164, 44 (1987). 17 E. C. B6ttger, BioTechniques 6, 878 (1988). 18 D. A. Williams, I. R. Lemischka, D. G. Nathan, and R. C. Mulligan, Nature (London) 310, 476 (1984). 19 L. F. Graham and A. Van der Eb, Virology 52, 456 (1973). 2o D. J. Sussman and G. Milman, Mol. Cell. Biol. 4, 1641 (1984). 21 N. R. Drinkwater and D. K. Klinedinst, Proc. Natl. Acad. Sci. U.S.A. 83, 3402 (1986). 22 M. P. Calos, H. S. Lebkowski, and M. R. Botchan, Proc. Natl. Acad. Sci. U.S.A. 80, 3015 (1983). 23 A. Razzaque, H. Mizusawa, and M. M. Seidman, Proc. Natl. Acad. Sci. U.S.A. 80, 3010 (1983). 24 K. R. Thomas and M. R. Capecchi, Cell 51, 503 (1987).
464
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[34]
Recently, two other approaches for introducing macromolecules into living cells have been developed--lipofectin 25 and high-velocity bead gunsfl 6 Lipofectin generates liposomes that can incorporate DNA, and when fused with target cells result in efficient transfection. It has the advantages of not requiring specialized equipment, but the disadvantage of being relatively expensive. The bead guns can be used for various cell types but are particularly useful for transfecting plant cells, because the cell wall does not have to be removed.
Illustrative Electroporation Methods Although electroporation is effective in a wide variety of cell types, each requires slightly different conditions, and a comprehensive description of all the methods and applications of electroporation is now far beyond the scope of this chapter. Therefore, I describe typical conditions of electroporation of various classes of target cell: mammalian, plant, bacteria, and yeast. Starting with these methods the researcher should quickly be able to optimize conditions for a particular cell line of interest. Also, the protocols presented here are intended for use with the most common type of electroporator, which uses a capacitor discharge method to generate the high-intensity electrical pulse (see Instrumentation, below). The electrical parameters for other instruments should be adjusted according to the instructions of the manufacturers. Instrumentation. The wide use of electroporation has been made possible in large part by the availability of commercial apparatus that are easy to use, extremely reproducible, and safe. The design of these machines varies substantially, but they fall into two basic categories: either they use a capacitor discharge system to generate an exponentially decaying current pulse, or they generate a true square wave, or an approximation thereof. The two types of machine use fundamentally different means of controlling the pulse duration, which, together with the voltage, are the two electrical parameters that govern pore formation. The capacitor discharge instruments charge their internal capacitor to a certain voltage and then discharge it through the celI-DNA suspension. Both the size of the capacitor and the voltage can be varied. Because the current pulse is an exponentially decaying function of (1) the initial voltage, (2) the capacitance setting of the instrument, and (3) the resistance of the circuit (including the sample), changing the capacitor size to allow more (or less) charge to be stored 25 p. L. Feigner, T. R. Gadek, M. Holm, R, Roman, H. W. Chan, M. Wenz, J. P. Northrop, G. M. Ringold, and M. Danielsen, Proc. Natl. Acad. Sci. U.S.A. 84, 7413 (1987). 26 T. M. Klein, E. D. Wolf, R. Wu, and J. C. Sanford, Nature (London) 327, 70 (1987).
[34]
ELECTROPORATIONIN RECOMBINANT
DNA
TECHNOLOGY
465
at the voltage will result in longer (or shorter) decay times and hence a different effective pulse duration. In contrast, square wave generators control both the voltage and pulse duration with solid-state switching devices. They also can produce rapidly repeating pulses. Most of our electroporation experiments have used the Bio-Rad (Richmond, CA) Gene Pulser, a capacitor discharge device. Capacitor discharge devices are also available from Bethesda Research Laboratories (Gaithersburg, MD), BTX (San Diego, CA), Hoeffer (San Francisco, CA), and IBI (New Haven, CT). These machines, either in a single unit or by addons, can deliver a variety of electroporation conditions suitable for most applications. Square wave generators are available from, for instance, BTX or Baekon (Saratoga, CA) and offer greater control over pulse width, allow multiple, rapid pulses, and can be more effective for cells that are very sensitive or otherwise difficult to transfect. These machines also carry a higher price tag. (For a fuller discussion of electroporation instruments, see Ref. 6). It has become apparent that alternating current pulses at - 100 kHz may be the most effective wave form for electroporation, and possible electrofusionfl 7-z9 However, dedicated electroporation devices utilizing such waves are not yet commercially available and must be constructed from components. The experimental protocols outlined below are designed for use with the Bio-Rad Gene Pulser, but will be directly applicable to other capacitor discharge devices and, with some adjustment, to square wave generators. Because all cell lines will need to be optimized for the particular machine, these protocols are meant primarily as starting guides to be adapted as needed according to the instructions of the manufacturer and the needs of the individual investigator.
Mammalian Cells
Electroporation Buffers Dulbecco's phosphate-buffered saline (without Ca z÷ or Mg 2÷) (PBS): 8 g NaC1, 0.2 g KC1, 0.2 g KH2PO 4 , 2.16 g Na2HPO 4 • 7H20 per liter, pH 7.3 HEPES-buffered saline (HEBS): 4.76 g N-2-hydroxyethylpiperazineN'-2-ethanesulfonic acid (HEPES), 8 g NaCI, 0.4 g KCI, 0.18 g NaeHPO 4 , 1.08 g glucose per liter, pH 7.05 Tissue culture medium (without fetal calf serum) 27 D. C. Chang, Biophys. J. 56, 641 (1989). 28 Q. Zheng and D. C. Chang, Biochim. Biophys. Acta 1008, 104 (1991). 29 E. Tekle, R. D. Astumian, and P. B. Chock, Proc. Natl. Acad. Sci. U.S.A. 88, 4230 (1991).
466
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[34]
Phosphate-buffered sucrose: 272 mM sucrose, 7 mM sodium phosphate (pH 7.4), 1 mM MgCI2
Electroporation Parameters and Choice of Electroporation Buffer
The voltage and capacitance settings must be optimized for each cell type, with the resistance of the electroporation buffer being critical for choosing the initial instrument settings. That is, for the low-resistance buffers (high salt) such as PBS, HEBS, or tissue culture medium, start with a capacitor setting of 25 tzF and a voltage of 1200 V for 0.4-cm cuvettes, then increase or decrease the voltage until optimal transfection is obtained (usually at about 40 to 70% cell viability). The choice between PBS, HEBS, and tissue culture medium for many cells is arbitrary. However, some cells are electroporated more effectively in one or another. Particularly sensitive ceils seem to prefer tissue culture medium, although it has been shown 2 that calcium and magnesium ions (which are present in tissue culture medium) lower electroporation efficiency. Phosphatebuffered sucrose has the advantage that it can be optimized at lower voltages (see below). Optimal permanent and transient transfections occur at about the same instrument settings, so transient expression can be used to optimize conditions for a new cell type. Some cells are easily killed and thus electroporate poorly at the high voltages needed for PBS or HEBS electroporation buffers. One solution is to use phosphate-buffered sucrose as elecroporation medium, because it can be optimized at voltages several hundred volts lower than can PBS or HEBS. Alternatively, Chu et al. 3° found many sensitive cells were electroporated more effectively in HEBS with a low-voltage, high capacitance setting that results in at least a 10-fold longer pulse duration. For these conditions, start at 250 V, 960 /zF, and change the voltage up to 350 V or down to 100 V in steps to determine optimal settings. Keeping cells at 0 ° often improves cell viability, and thus results in higher effective transfection frequency, especially at high power (½CV2), which can lead to heating. 4 However, Chu et al. 3° found that some cell lines electroporate with higher efficiency at room temperature when using low-voltage, high-capacitance conditions. Therefore, steps 4-8 below should be carried out separately at both temperatures to determine the optimum conditions for a new cell line. The efficiency with which electroporation generates permanently transfected cell lines ranges from 10 -2 to 10 - 6 per viable cell. 30 G. Chu, H. H a y a k a w a , and P. Berg, Nucleic Acids Res. 15, 1311 (1987).
[34]
ELECTROPORATION IN RECOMBINANT D N A TECHNOLOGY
467
Procedure: Suspension Cells 1. Grow cells to be transfected to mid- or late log phase in complete medium. Each permanent transfection will usually require 5 x 106 cells to yield a reasonable number of transfectants. Each transient expression may require 1 to 4 x 10 7 cells, depending on the promoter. 2. Harvest cells by centrifuging 5 min (600-1000 g), 4 °, and resuspend the cell pellet in half the original volume of ice-cold electroporation buffer (see discussion of temperature in Electroporation Parameters and Choice of Electroporation Buffer, above). 3. Harvest the cells by centrifuging 5 min as in step 2, and resuspend the cells at 1 x 107/ml in electroporation buffer at 0° for permanent transfection. Higher concentrations of cells (up to 8 x 107/ml) may be used for transient expression. The volume for each electroporation should be 0.5 ml. 4. Transfer aliquots of 0.5 ml of the cell suspension into the desired number of electroporation cuvettes at 0 ° (cuvettes with 0.4 cm electrode separation, from Bio-Rad). 5. Add DNA to the cell suspension in the cuvettes at 0°. For permanent transfection, the DNA should be linearized by cleavage with a restriction enzyme that cuts in a nonessential region and then purified by phenol extraction and ethanol precipitation. For transient expression, the DNA may be left supercoiled. In both cases, the DNA should have been purified through two preparative CsC1/ethidium bromide equilibrium gradients followed by phenol extraction and ethanol precipitation. For transient expression, 10 to 40 t~g of DNA is optimal. For permanent transfection, 1 to 10 Ixg is sufficient. For cotransfection (which we generally avoid), 1 tzg of DNA carrying the selectable marker and 10 txg of DNA containing the gene of interest are usually adequate. The DNA stock may be sterilized by one ethyl ether extraction: the (top) ether phase is removed and the DNA solution allowed to dry for a few minutes to evaporate any remaining ether. 6. Mix the DNA/cell suspension by holding the cuvette on the two "window sides" and flicking the bottom. 7. After 5 min at 0 °, place the cuvette in the chamber in the electroporation apparatus (at room temperature) and shock one or more times at the desired voltage and capacitance settings, according to the manufacturer's instructions for your instrument. The voltage and capacitance settings that should be used will vary, depending on the cell type and need to be optimized (see previous page). 8. After electroporation, return the cuvette containing cells and DNA to ice for 5 min.
468
M E T H O D S FOR T R A N S F O R M I N G A N I M A L A N D P L A N T CELLS
[34]
9, Dilute the transfected cells 20-fold in the nonselective complete medium and rinse the cuvette with the same medium to recover all the transfected cells. 10. Grow the cells for 48 hr (or about two generations) prior to selection with medium containing the appropriate antibiotic for permanent transformants or for 50 to 60 hr prior to harvesting for transient expression assays. 1la. Place cells to be selected for permanent transfectants in the antibiotic-containing medium. Selection conditions will vary with cell type. For example, neomycin selection generally requires -400 t~g/ml G418 in the medium. Escherichia coli guanine phosphoribosyltransferase (Eco-gpt) gene selection requires 1 /zg/ml mycophenolic acid, 250/~g/ml xanthine, and 15/zg/ml hypoxanthine in the medium. For permanent transfection, it is often convenient to plate out the cells at a limiting dilution immediately following the shock if they are adherent cells or at the time of antibiotic addition if they are suspension cells. 1lb. For transient expression, harvest the cells and assay for expression according to standard protocols. Procedure: Adherent Cells
Adherent cells may be transfected essentially as described above. 1. Trypsinize the cells from the plate surface [1 ml 0.05% (w/v) trypsin, 0.53 mM ethylenediaminetetraacetic acid (EDTA) per 100-mm plate]. 2. Inactivate the trypsin with serum-containing medium, and wash the cells by several centrifugations and resuspensions in electroporation buffer at 0 °. 3. Electroporate at settings appropriate for the electroporation buffer and optimized for each cell type. As discussed above for suspension cells, the high-salt electroporation buffers (PBS and HEBS) are used with highvoltage, low-capacitance settings. For instance, 1500 V, 25 ~F effectively electroporates many hardy cell types. However, if the cells are irreversibly damaged by the high voltages, tissue culture medium at power supply settings of 250 V, 960/zF should be tried as a starting place for optimization. 4. After 5 min at 0 °, plate cells at various dilutions for permanent or transient expression assays as described above for suspension assays. Procedure: Electroporation o f Adherent Cells on Microbead Carriers
Many situations exist where it would be advantageous to be able to introduce macromolecules into adherent cells still attached to their sub-
[34]
ELECTROPORATION IN RECOMBINANT D N A TECHNOLOGY
469
strate. For instance, many adherent cells, such as neurons or endothelial cells and even fibroblasts, have a unique morphology when attached to their substrates. In addition, they may show significantly different morphologies and behavior when attached to different kinds of substrates. For instance, neurons "growing" (sending out processes) on collagen or tissue culture plastic behave quite differently from neurons growing on laminin. There are several methods that have been used to electroporate adherent cells directly in their attached state, but these require special electroporation instruments not yet commercially available. 31~32An alternative approach to electroporating adherent cells attached to their substrates uses available methodology and instrumentation in a new way that will be easily adapted in laboratories already carrying out electroporation in the traditional manner. Specifically, it is possible to electroporate DNA into cells attached to the surface of microbeads in suspension (for further discussion, see Refs. 33 and 33a). The indication is that the electroporation efficiency is almost as high as for the same cells in suspension. Because plastic microbeads are easy to manipulate, come in various types applicable to almost all adherent cells, and can be kept in suspension for short periods of time, it is straightforward to wash a sample of microbeads carrying cells in appropriate electroporation buffer, introduce the beads at any desired concentration into the electroporation chamber in suspension, and carry out the electroporation in the same manner as for suspended cells alone. As long as the concentration of microbeads is not high, so that their contribution to the total volume remains small, drastic changes in electroporation parameters seem, by our preliminary experiments, not to be necessary. The procedure should in principle be applicable to any adherent cell type for both transient and stable expression. As with all electroporation experiments, however, optimization for each cell type and, in this case, probably for high concentrations of microbeads, would be advisable for obtaining high transfection efficiencies. To carry out electroporation of cells on microbeads, perform the following steps. 3~ S. Gallagher and D. C. Chang, in "Handbook of Electroporation and Electrofusion" (D, C. Chang, B. Chassy, J. A, Saunders, and A. E, Sowers, eds.). Academic Press, San Diego, 1991. 32 L. Raptis and K. L. Firth, D N A Cell Biol. 9, 615 (1990). 33 H. Potter and S. W. F. Cooke, in "Handbook of Electroporation and Electrofusion" (D. C. Chang, B, Chassy, J. A. Saunders, and A. E. Sowers, eds.). Academic Press, San Diego, 1992. 33a M. P. Rols, D. Coulet, and J. Teissi6, Eur. J. Biochem. (1992), in press.
470
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[34]
1. Prepare Cytodex 1 microbeads (Pharmacia, Piscataway, NJ) or the equivalent according to the instructions of the manufacturer. Briefly, define the beads by swelling them in Ca 2+ and Mg2 +-free phosphate-buffered saline, allowing them to settle, removing the supernatant, and resuspending them twice. Autoclave the washed microbeads in a 30- to 50-fold volume of buffer. 2. Just prior to use, place the desired volume of beads (approximately 1-5 mg/105 cells) into appropriate growth medium [for instance, Dulbecco's modified Eagle's medium (DMEM) with 10% fetal calf serum, glutamate and penicillin/streptomycin added] and wash once by allowing them to settle in the same medium. 3. Harvest cells growing in tissue culture dishes by standard procedures, add them to the resuspended microbeads, and place beads and cells together in a bacterial or tissue culture dish. Microscopic examination after several hours should indicate good adherence and appropriate morphology of the cells on the microbeads (stirred suspension cultures should also work). 4. The following day, remove the microbeads together with their medium from the petri dish and transfer them into electroporation buffer by repeatedly allowing the beads to settle and then resuspending them. 5. After removing the final wash, resuspend the beads with their cells in an appropriate volume of electroporation buffer (0.5 ml) and place them on ice for 3-5 rain in the electroporation cuvette. 6. Just prior to electroporation, add 2-5 ~g of DNA to the cuvette, resuspend the (by now) settled microbeads containing the cells, and carry out the electroporation as described above for suspension cells. Return the cuvette to ice for 3-5 min. 7. Remove the microbeads from the cuvette and place them in medium for recovery and growth. Transfected cells can be visualized by standard procedures. For instance, if the transfected DNA contains a fl-galactosidase gene, proceed as follows: 8. First fix the cells on the microbeads for 10 min in 4% (w/v) paraformaldehyde, 0.2% (w/v) glutaraldehyde, wash in PBS, and expose to 5-bromo-4-chloro-3-indolyl-fl-D-galactopyranoside (X-Gal) solution containing 5 mM KFeCN (ferric), 5 mM KFeCN (ferro), 2 mM MgC12 , 0.1% (w/v) X-Gal for 3-6 hr. Blue cells expressing fl-galactosidase are clearly visible on the surface of the microbeads, indicating successful transfection.
[34]
ELECTROPORATION IN RECOMBINANTDNA TECHNOLOGY
471
Electroporation into Plant Protoplasts Although whole plants or leaf tissue have been reported to be transfectable by electroporation34'35plant cells must generally be made into protoplasts before DNA can be easily introduced into them. The following basic protocol is adapted from that of Ou-Lee et al. 36 (see also the procedures of Fromm et al. 37'38and Sheenag'4°). The protoplast-generating procedure can be modified for different plant cell types. Also, like mammalian cells, plant protoplasts may be electroporated under a variety of electrical conditions, as will be discussed. Different investigators have used both high voltage with low capacitance (short pulse duration) or low voltage with high capacitance (long pulse duration) to achieve successful gene transfer. Electroporation Buffer
CaClz (5 raM) Mannitol (0.4 M) Make up solution in PBS or HEBS [Saunders et al. 41 reported that replacing 135 mM NaC1 with LiCI increases chloramphenicol acetyltransferase (CAT) transient gene expression in electroporated plant protoplasts 4- to 70-fold] Protoplast Solution
Cellulase (Yakult Biochemical, Hyogo, Japan), 2% (w/v) Macerozyme (Yakult Biochemical, Hyogo, Japan), 1% (w/v) Pectylase, 0.01% (w/v) Mannitol (0.4 M) CaCI2 (40 raM) (N-Morpholino)ethanesulfonic acid (MES), 10 mM, pH 5.5
34 H. Morikawa, A. Iida, C. Matsuri, M. Ikegami, and Y. Yamada, Gene 41, 121 (1986). 35 R. A. Dekeyser, B. Claes, R. M. U. De Rycke, M. E. Habets, M. C. Van Montagu, and A. B. Caplan, Plant Cell 2, 591 (1990). 36 T. M. Ou-Lee, R. Turgeon, and R. Wu, Proc. Natl. Acad. Sci. U.S.A. 83, 6815 (1986). 37 M. Fromm, L. P. Taylor, and V. Walbot, Proc. Natl. Acad. Sci. U.S.A. 82, 5824 (1985). 38 M. Fromm, J. Callis, L. P. Taylor, and V. Walbot, this series, Vol. 153, p. 351. 39 j. Sheen, Plant Cell 2, 1027 (1990). 4o j. Sheen, Plant Cell 3, 225 (1991). 41 j. A. Saunders, B. F. Matthews, and P. D. Miller, in "Electroporation and Electrofusion in Cell Biology" (E. Neumann, A. E. Sowers, and C. A. Jordon, eds.), p. 343. Plenum, New York, 1989.
472
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[34]
Procedure
1. Obtain protoplasts from carefully sliced 5-ram strips of sterile plant material (1 g dry weight) by incubating in 8 ml protoplast solution on a rotary shaker at 30° for 3 to 6 hr. 2. Remove debris by filtration through an 80-/zm mesh nylon screen. 3. Rinse the screen with 4 ml electroporation buffer. Combine protoplasts in a sterile 15-ml conical microcentrifuge tube. 4. Wash protoplasts twice: Centrifuge 5 min at 1000 rpm (300 g) 0 °, add 5 ml electroporation buffer, and collect by centrifuging. Repeat. Resuspend in electroporation buffer at 1.5 to 2 x 106/ml (determined by counting an aliquot in a hemacytometer using phase optics). 5. Carry out electroporation, as described for mammalian cells above, in 0.4-cm cuvettes. Use one or several shocks at ! to 2 kV with a 3- or 25/zF capacitance as a starting point for optimizing the system. Alternatively, use 200-300 V with 500-1000/~F if electroporation buffer is reduced to 10 mM phosphate. 6. Harvest cells after 48 hr of growth and assay for transient gene expression or select for permanent transfectants. Protoplasts can also be selected and grown into full transgenic plants. Discussion
Optimal parameters for plant electroporation differ depending on whether tissue culture cells or various parts of the whole plant are used as a source of protoplasts. In particular, S h e e n 39,4° found that the high salt in PBS is damaging to protoplasts freshly isolated from plant tissue. Instead, an electroporation buffer of 0.6 M (for leaf cells) or 0.7 M (for root and stem cells) mannitol and 25 mM KC1 (leaf) or 40 mM KCI (root or stem) with 4 mM MES (pH 5.7) and 1 mM 2-mercaptoethanol (2-ME) added for root and stem protoplasts, is recommended. Bovine serum albumin (BSA; 0.1%, w/v), 15 mM 2-ME, and 1 mM MgCI2 were added to the protoplast isolation buffer and the CaCl2 reduced to 1 raM. The lower salt concentration in the electroporation buffer reduced the optimal capacitance setting to 200/xF. Transformation of Bacteria by Electroporation Early studies of electroporation 4 indicated that bacteria could also be transformed with plasmid DNA by electroporation. However, it was not until the study by Dower et al. 42 that the efficiencies of transforma42 W. J. Dower, J. F. Miller, and C. W. Ragsdale, Nucleic Acids Res. 16, 6127 (1988).
[34]
ELECTROPORATION IN RECOMBINANT D N A TECHNOLOGY
473
tion by electroporation were increased to a much higher level than that obtainable by traditional and modified heat-shock procedures. It is now possible to transform a great many (perhaps all) gram-positive and gramnegative bacteria by electroporation. The efficiency of transformation in E. coli is routinely 109/~g of input plasmid DNA, and can reach as high as 10l°. Critical parameters in obtaining such high transformation frequencies are clean DNA, very well washed and fresh cells (although frozen cells work well too, at a somewhat lower efficiency), and, most important, keeping the cells at 0 ° during all stages of their preparation and electroporation. The procedure given below for E. coli is adapted from that of Dower et al., 42 as described by J. Sheen in the work by Ausubel et al. 43 Preparation o f Cells
1. Inoculate 2.5 ml of an overnight culture of E. coli in LB medium without sodium chloride [LBNS: 10 g Bacto-tryptone (Difco, Detroit, MI) 5 g yeast extract per liter) in a sterile 2-liter flask of LBNS. Grow at 37 ° with shaking (300 rpm) to an OD600 of - 0 . 5 to 0.6. 2. Chill the cells in an ice-water bath 10 to 15 min and transfer to prechilled centrifuge bottles. 3. Harvest the cells by centrifuging 20 rain at 2°. It is essential to keep the cells ice cold in this and all subsequent steps. 4. Pour off the supernatant and resuspend the pellet in 5 ml ice-cold, sterile, double-distilled or Milli-Q (Millipore, Bedford, MA)-deionized water. Add 500 ml ice-cold water and mix well. Harvest the cells by centrifugation. 5. Pour offthe supernatant immediately and resuspend the loose pellet in the remaining liquid. The pellet can be made tighter by substituting icecold HEPES (1 mM, pH 7.0) for the ice-cold water in step 4. Add another 500 ml of ice-cold water or HEPES, mix well, and centrifuge again. 6. Pour off the supernatant immediately and resuspend the pellet by swirling it in the remaining liquid. 7. If cells are to be used immediately for electroporation, place suspension in a prechilled, narrow bottom, 50-ml polypropylene tube, and spin 10 min at 3000 g, 2°. Estimate the pellet volume (usually about 500/zl from a 500-ml culture) and add an equal volume of ice-cold water (not HEPES) to resuspend the cells (on ice). Aliquot 50 to 300/zl of cells into prechilled microcentrifuge tubes. The cell density is about 2 × 1011/ml. 43 F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (eds.), "Current Protocols in Molecular Biology." Greene and Wiley (Interscience), New York, 1987.
474
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[34]
If cells are to be frozen for future electroporations, add 40 ml ice-cold 10% (v/v) glycerol to the cells from step 6 and mix well. Harvest by centrifugation and resuspend the pellet in an equal volume of ice-cold 10% (v/v) glycerol. Aliquot 50 to 300/xl of cells into prechilled microcentrifuge tubes and freeze on dry ice (not in liquid nitrogen). Store at - 8 0 °. Prolonged incubation of cells in ice-water at all stages can increase transformation efficiency of some strains--such as BW313/P3 and MC1061/ P3mmore than threefold.
Transformation of Cells After preparing SOC medium, perform the steps outlined below.
SOC Medium Yeast extract, 0.5% (w/v) Tryptone, 2% (w/v) NaC1 (10 mM) KCI (2.5 mM) MgCI 2 (10 mM) MgSO 4 (10 mM) Glucose (20 mM) I. Set the electroporation apparatus to 2.48 kV, 25/.~F. Set the pulse controller to 200 or 400 IL The pulse controller is necessary when highvoltage pulses are applied over short gaps in the high-resistance electroporation solution (H20) used for bacteria. Not only does it control the pulse width with an in-parallel resistor, but it contains an in-series resistor that protects the power supply from being burned out by the high current that occurs if the electric pulse arcs. 2. Add 5 pg to 0.5/xg plasmid DNA in 1/xl to tubes containing 50/.d fresh or thawed cells on ice (approximately 10 l° cells). Mix by tapping the tube or by swirling the cells with the pipettor. 3. Transfer the DNA and cells (total volume 50/zl) into a cuvette with electrodes 0.2 cm apart (Bio-Rad) that has been chilled 5 min on ice, shake slightly to settle the cells to the bottom, and wipe the ice and water from the cuvette with a Kimwipe. Avoid bubbles. The volume of DNA added to the cells should be kept small. Adding DNA up to one-tenth of the cell volume will decrease the transformation efficiency two- to three-fold. Also, because the resistance of the sample should be high, make sure that addition of the DNA to the cells does not increase the total salt concentration in the cuvette by more than 1 mM. 4. Place the cuvette into the sample chamber and apply the pulse. 5. Remove the cuvette. Immediately add 1 ml SOC medium [or LBNS
[34]
ELECTROPORATION IN RECOMBINANT D N A TECHNOLOGY
475
plus 20% (w/v) glucose] and transfer to a sterile culture tube with a Pasteur pipette. Incubate 30 to 60 rain with moderate shaking at 37°. 6. Place aliquots of the transformation culture on LB plates containing antibiotics.
Transformation of Yeast by Electroporation As with bacteria, the small size of yeast cells compared to mammalian cells requires higher field strengths for efficient electroporation. Nonetheless, the principle is the same, and allows transformation efficiencies with purified DNA of 3 × 105 transformants per microgram of DNA. This frequency compares favorably with other yeast transformation systems. For instance, yeast can be transformed after treatment with lithium acetate, to yield a transformation frequency of between 102 and 103 transformants per microgram of plasmid containing the yeast replication origin. The maximum transformation frequencies using spheroplasts (which take much longer to prepare) can reach 10 4 t o 10 5 transformants per microgram of replication-competent DNA. Thus, the transformation frequency for electroporation is comparable to that of the spheroplast procedure, but is substantially easier to carry out. The protocol described below is essentially that of Becker and Guarente 44,45 and has been shown to work for a number of Saccharomyces cerevisiae strains. It can be modified for electroporation of Schizosaccharomyces pombe by increasing the voltage to 2 kV.
Procedure 1. Grow yeast in YEPD broth (10 g yeast extract, 20 g Bacto-peptone, 20 g dextrose per liter) at 30° with good aeration to late logarithmic phase (ODr00 1.3-1.5; approximately 1 × 108 cells/ml). 2. Harvest and concentrate the cells by multiple centrifugations at 0°; centrifuge and resuspend pellet in 1 vol of sterile, ice-cold, double-distilled or Milli-Q (Millipore)-deionized H20; centrifuge and resuspend in 0.5 vol Milli-Q H20; centrifuge and resuspend in 1/20 original volume of electroporation buffer (1 M sorbitol in Milli-Q H20 ). 3. Incubate on ice for several minutes; harvest the cells by centrifugation; resuspend in 1/100 original volume of electroporation buffer. (The 44 D. M. 45 D. M. (D. C. Diego,
Becker and L. Gaurante, this series, Vol. 194, p. 182. Becker and L. Gaurante, in "Handbook of Electroporation and Electrofusion" Chang, B. Chassy, J. A. Saunders, and A. E. Sowers, eds.). Academic Press, San 1991.
476
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[34]
yeast can be rapidly frozen at this stage for later electroporation at reduced efficiency.) 4. Add -<100 ng plasmid DNA to 40/zl of cell suspension in less than 5/zl of TE (10 mM Tris-HCl, I mM EDTA, pH 8.0). 5. Incubate the cells and DNA on ice for 5 min. Transfer to ice-cold electroporation chambers (2-mm gap width). Electroporate at 1.5 kV, 25 tzF capacitance with the pulse controller set at 200 fL 6. Immediately, dilute electroporated cells with 0 ° sterile electroporation buffer and transfer to selective medium or agar plates containing 1 M Sorbitol. Application of Electroporation to Human Gene Therapy One long-term goal of recombinant DNA technology is to be able to apply our newfound knowledge to the treatment of human disease. As more and more genes become identified and ultimately cloned that, when mutant, result in a disease state, it seems possible that gene replacement therapy might be useful in some instances. However, there are several criteria that must be realized before such a goal can be practically achieved. First, a gene must be available that, when introduced into a relatively small number of cells of the individual, can result in improved health. Second, there must be a way to introduce the cloned gene into appropriate cells without damaging them and then reintroduce the cells into the individual such that they can make use of their newly engineered genotype. The first problem of finding appropriate genes is being solved rapidly and there already exist several candidates for such an application (for a discussion, see Ref. 46). The remaining problem is, therefore, that of introducing the genes into the appropriate cells and reintroducing those cells into the organism without adverse effects. Currently, there are essentially two preferred ways to introduce foreign genes into mammalian cells of a wide variety of tissue types. The first is electroporation, described here, and the second is the use ofretroviral vectors that have been designed to incorporate 7-8 kb of foreign DNA and then infect any human cell.~8 Although for many purposes in scientific research both electroporation and retroviral vectors are adequate for gene transfer, with certain advantages accruing to one or the other in different situations, gene therapy in humans poses special problems. Because of their high efficiency (approaching 100%), retroviral vectors have been the best means for transfecting DNA into primary cells prior to their reintroduction into the organism 46 I. M. Verma, Sci. Am. 263, 68 (1990).
[34]
ELECTROPORATION IN RECOMBINANT
DNA TECHNOLOGY
477
(for a discussion, see Ref. 47). Standard electroporation, in contrast, can usually transfect between 20 and 30% of the cells (for transient expression or permanent expression with vectors that can replicate in the recipient ce1148). Both methods can be used to tranfect bone marrow cells, which may then be reintroduced into a recipient animal.18'49 The demonstration of transfection of human hematopoietic stem cells by electroporation 5° is particularly encouraging. However, the mechanisms by which these two techniques work strongly favors electroporation as a long-term solution to gene therapy. When a retrovirus enters a target cell, it integrates essentially randomly in the genome and thus has potential for introducing mutational damage by the mere fact of its insertion. In addition, the transcriptional promoter within the long-terminal repeats (LTRs) of an integrating retrovirus can result in the expression of nearby genes. If the virus inserts adjacent to an oncogene, malignant transformation of the target cell can result. Finally, the retrovirus still retains the capability of excising from the genome and reintegrating or potentially even reinfecting other cells, provided it is supplied in trans with the appropriate proteins (as might occur if the cells are infected by a second retrovirus of a viable type). Thus, there is no guarantee that the retrovirus-transfected cells represent a safe and stable means of introducing an engineered gene into a living organism. An ideal gene transfer system would efficiently replace a mutant gene with the current wildtype sequence but without also introducing potentially dangerous retrovirus LTRs. Two advances in the use of electroporation have gone far to increase its potential application to gene therapy. First, as discussed above, rapid alternating (100 kHz) field pulses can (transiently) transfect cells with close to 100% efficiency and viability. 27-29 Second, there is good evidence that electroporated genes can recombine with their homologous host genefl 4'51'52 The resultant cell actually acquires the wild-type version in place of its mutant gene at the exact location in the chromosome that it normally should reside, thus reducing the potential mutagenetic effects of random insertion and obviating the need for LTRs. The successful use of standard electroporation to introduce genes into the germline of mice can result in 1 in 1000 cells acquiring the exogenous DNA by recombination47 T. Friedmann, Science 244, 1275 (1989). 48 B. Sugden, K. Marsh, and J. Yates, Mol. Cell. Biol. 5, 410 (1985). 49 F. Toneguzzo and A. Keating, Proc. Natl. Acad. Sci. U.S.A. 83, 3496 (1986). 5o F. Toneguzzo and A. Keating, Proc. Annu, Conf. IEEE Eng. Med. Biol. Soc., 9th p. 715 (1987). ~1 O. Smithies, R. G. Gregg, S. S. Boggs, M. A. Koralewski, and R. S. Kucherlapati, Nature (London) 317, 230 (1985). 52 M. J. Capecchi, Science 244, 1288 (1989).
478
M E T H O D S FOR T R A N S F O R M I N G A N I M A L A N D P L A N T CELLS
[35]
insertion.53 Radiofrequency electroporation should increase that efficiency even further. Such cells can be selected in vitro prior to their reintroduction into the recipient organism and should be essentially normal. Acknowledgments I am grateful for the assistance of Stefan Cooke in the preparation of this manuscript and for carrying out some of the experiments. L. Reid, D. Chang, E. Tekle, K. Daniels, and L. Guarante provided unpublished data. The research in my laboratory has been supported by grants from the National Institutes of Health (GM35967 and AG08084), the Alzheimer's Disease and Related Disorders Association, and the Freudenberger family. 53 L. Reid and O. Smithies, in "Handbook of Electroporation and Electrofusion" (D. C. Chang, B. Chassy, J. A. Saunders, and A. E. Sowers, eds.). Academic Press, San Diego, 1992.
[35] T r a n s f o r m a t i o n o f I n t a c t Y e a s t C e l l s b y E l e c t r o p o r a t i o n By JOHN R. SIMON Introduction The transformation of Saccharomyces cerevisiae is a relatively difficult process due in part to the chemical structure of the cell wall. Two methods for the transformation of S. cerevisiae are in general use today. The first involves the enzymatic digestion of the cell wall, producing spheroplasts, followed by the introduction of the transforming DNA into the cell in the presence of polyethylene glycol (PEG). ~The second entails the pretreatment of the cells with lithium acetate, which, followed by a brief heat pulse in the presence of PEG, may render the cells porous to DNA. 2 While each of these techniques is efficient in the transformation of S. cerevisiae, each is laborious and can show much variation in the transformation frequency, depending on factors such as the growth phase of the cell culture, and the individual batch of P E G ) The technique of electroporation has been described for the transformation of plant protoplasts 4 and bacteria: as well as for the transfection I A. Hinnen, J. B. Hicks, and G. R. Fink, Proc. Natl. Acad. Sci. U.S.A. 75, 1929 (1978). 2 H. Ito, Y. Fukada, K. Murata, and A. Kimura, J. Bacteriol. 153, 163 (1983). 3 R. J. Klebe, J. V. Harriss, S. D. Sharpe, and M. G. Douglas, Gene 25, 33 (1983). 4 M. Fromm, L. Taylor, and V. Wolbot, Proc. Natl. Acad. Sci. U.S.A. 82, 5824 (1985). 5 N. M. Calvin and P. C. Hanawalt, J. Bacteriol. 170, 2796 (1988).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
[35]
ELECTROPORATION OF YEAST
479
of mammalian cells. 6 The electroporation of S. cerevisiae has also been described. 7,8 The first reports of yeast electroporation indicated that extremely high voltages were required to attain rather low transformation frequencies 7 even though in one study yeast spheroplasts were used in the electroporation experiments. 8 More recently, there have been reports of the electroporation of yeast using commercially available systems.9-~ This chapter describes a rapid and efficient procedure for the transformation of S. cerevisiae by electroporation. Among the advantages of this system are its speed and simplicity, involving few manipulations of the cells following growth, and the finding that this procedure can be successfully performed with crude minipreparation DNA isolated from Escherichia coli or S. cerevisiae. Principle of Electroporation There are a number of commercially available systems that can be used for the electroporation of yeast. In each of these systems cells or protoplasts are placed between two electrodes in an electroporation chamber and are exposed to a transient electric field produced by a simple resistor-capacitor circuit. It is thought that this electric field, delivered as an exponentially decaying pulse, induces the formation of transient pores in the cell membrane through which the DNA molecules are able to enter the cell. The efficiency of transformation by electroporation is a function of the field strength, capacitance and resistance of the circuit, the cell type or strain, and the electroporation buffer being used. Materials and Reagents Yeast cultures for transformation by electroporation are grown in YEPD [2% (w/v) peptone, 1% (w/v) yeast extract, 2% (w/v) glucose]. The strains we routinely use in our laboratory are M12B (MAYa trpl-289 ura352 gal2), 12 JT-26A (MATa 1eu2-3,112 ura3-52 his3 trpl lys2), 13 SUB60 (MA Ta lys2-801 leu2-3,112 ura3-52 his3-h200 trpl-l ubi4A-2::LEU2), 14and 6 G. Chu, H. Hayakawa, H. Yamada, and P. Berg, Nucleic Acids Res. 15, 1311 (1987). 7 H. Hashimoto, H. Morikawa, Y. Yamada, and A. Kimura, Appl. Microbiol. Biotechnol. 21, 336 (1985). 8 I. Karube, E. Tamiya, and J. Matsuoka, FEBS Lett. 182, 90 (1985). 9 D. M. Becker and L. Guarante, this series, Vol. 195, p. 182. i0 E. Delorme, Appl. Environ. Microbiol. 55, 2242 (1989). ii j. R. Simon and K. McEntee, Biochem. Biophys. Res. Commun. 164, 1157 (1989). I-~T. McClanahan and K. McEntee, Mol. Cell. Biol. 4, 2356 (1984). t3 j. M. Treger and K. McEntee, Mol. Cell. Biol. 10, 3174 (1990). la D. Finley, E. Ozkaynak, and A. Varshavsky, Cell 48, 1035 (1987).
480
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[35]
AH22 (MATa 1eu2-3,112 his4-519 canl), 1 although this method should be equally successful with other laboratory strains. The electroporation method described here has been optimized for the Cell-Porator system equipped with microcuvettes (Bethesda Research Laboratories, Gaithersburg, MD). However, this methodology should be easily adapted for use with electroporation systems produced by other manufacturers. Electroporation of Saccharorayces cerevisiae 1. Inoculate 100 ml of YEPD in a 250-ml flask with an aliquot of an overnight liquid culture or with a single colony from an agar plate. Grow the culture at 30° with continuous shaking to an OD595 of 1.0-1.5 for optimal transformation efficiency. Denser stationary phase cultures can also be used, although the transformation frequency per microgram of DNA may be somewhat lower. 2. Harvest the cells by centrifugation at 2000 g at 4 ° for 5 min. Wash the cells once in 1/2 vol of sterile glass-distilled water or electroporation buffer and resuspend in 1/10 vol of electroporation buffer [0.3 mM NazHPO4, 0.2 mM KH2PO4, I0% (v/v) glycerol]. 3. Incubate the cells on ice for 5 min, centrifuge as above, and resuspend in 1/100 vol of electroporation buffer. Divide the cells into 100-/zl aliquots in Eppendorf centrifuge tubes. 4. Add autonomously replicating plasmid DNA to the cells at concentrations ranging from 100 to 400 ng/100/zl of cells. In these transformations, it is not necessary to add carrier DNA. For transformations with nonreplicating plasmid DNA or with linear DNA molecules, add up to 5 /zg of transforming DNA and an equal amount of carrier DNA to each 100-~1 aliquot of cells. For transformation with E. coli or S. cerevisiae minipreparation DNA the amount of DNA to be added should be determined experimentally. 5. Incubate the celI-DNA mixtures on ice for 20 min, transfer 25/zl of the cells to the microelectroporation chambers (following the instructions of the manufacturer), and pulse at settings of 400 V (the gap between the electrodes is 0.15 cm, such that the field strength is 2667 V), 10-/xF capacitance, and low resistance on the Cell-Porator system power supply. Note that longer incubations on ice of up to 60 min do not adversely affect the resulting transformation frequencies. It is important that microelectroporation chambers be used; transformation experiments using the standard electroporation chambers manufactured by Bethesda Research Laboratories have been unsuccessful. 6. Immediately remove the electroporated cells from the microelectroporation chamber, dilute in 100/zl of cold electroporation buffer or sterile
[35]
ELECTROPORATION OF YEAST 500'
481
A
200
"5
z
100 t
I
(
I
~ 600 500
Oq
~ 1 I °l 0,2
0,4
0.6
0.8
l,
~.0
1.2
DNA ( ~g )
FIG. 1. DNA dependence of transformation by electroporation in S. cerevisiae strain JT26A. Cultures of strain JT-26A were grown to midlogarithmic phase and electroporated as described. (A) Cells were electroporated with the indicated concentrations ofYEp24 plasmid DNA, selecting for Ura * transformants. (B) Cultures of strain JT-26A were transformed with the indicated concentrations of YEp24 by the method of Ito et al. 2 using lithium acetate and selecting for Ura + transformants. (Adapted from Ref. 11 with permission of Academic Press.)
glass-distilled water, and plate directly onto selective agar plates. Incubate the plates at 30° for 2-4 days, or until colonies appear. Using this method we routinely achieve transformation frequencies of up to 3 × 103 transformants per microgram of episomal plasmid DNA and 1-2 transformants per microgram of linear DNA. A comparison was made between the transformation of S. cerevisiae with the plasmid YEp24 ~5by electroporation and by the lithium acetate procedure over a range of DNA concentrations (Fig. 1). Data from an electroporation experiment (Fig. I A) shows a DNA-dependent increase in the transformation frequency up to 100 ng of DNA, at which point the number of transformants reaches a plateau value. Data from transformation experiments using the lithium acetate procedure (Fig. IB) show that little or no transformation is observed at DNA concentrations below approximately 50-250 ng, although at higher concentrations of DNA the transformation frequency is greater than that of electroporation. Table I summarizes the types of plasmids that have been used in our laboratory for the electroporation of S. cerevisiae. Although the episomal plasmids used range in size from 4.9 kb (YRp7),16 ~5D. Botstein, S, C. Falco, S. Stewart, M. Brennan, S. Scherer, D. T. Stinchcomb, K. Struhl, and R. W. Davis, Gene 8, 17 (1979). 16 D. T. Stinchcomb, K. Struhl, and R. W. Davis, Nature (London) 282, 1035 (1976).
482
M E T H O D SFOR TRANSFORMING ANIMAL AND PLANT CELLS
[35]
TABLE 1 Saccharomyces cerevisiae STRAINS AND EP1SOMALPLASMIDS USED FOR ELECTROPORATIONa
Strain
Transforming plasmid
Selectable marker
MI2B M12B M12B M12B JT-26A JT-26A JT-26A AH22 SUB60 SUB60
pCTA b YRp7 YCp50 ~ pMC1790 d YEp24 pMC1790 pSZ214 pSZ214 pMCCEN4 YCp50
URA3 TRP1 URA3 TRPI URA3 TRP1 LEU2 LEU2 TRP1 URA3
Adapted and reprinted with permission of Life Technologies (Gaithersburg, MD). b A. R. Buchman and R. D. Kornberg, Mol. Cell. Biol. 10, 887 (1990). c M. D. Rose, P. Novick, J. H. Thomas, D. Botstein, and G. R. Fink, Gene 60, 237 (1987). d M. J. Casadaban, A. Martinez-Arias, S. K. Shapira, and J. Chou, this series, Vol. 100, p. 293.
up to 20 kb (pSZ214), 17 little difference in the transformation frequencies obtained with each has been detected.
Concluding Remarks As stated above, using this method we typically achieve transformation frequencies as high as 3 × 10 3 transformants per microgram of episomal plasmid DNA. This method is most appropriate for rapid transformations using low concentrations of DNA when extremely high transformation frequencies are not required. This method may not be appropriate for those transformation experiments using high concentrations of DNA where very high numbers of transformants are desired, because, as noted above, the transformation frequency reaches a plateau value at approximately 100 ng of transforming DNA. However, it is remarkably versatile in that it can be used to transform yeast cells with CsCI density gradient-purified DNA, with linear DNA, and with crude minipreparation DNA prepared from E. 17 S. W. Ruby, J. W. Szostak, and A. W. Murray, this series, Vol. 101, p. 253.
[36]
OPTIMIZING THE BIOLISTIC PROCESS
483
coli as well as from S. cerevisiae. Due to the ease of this method, it should be possible to complete 20-25 transformations in 1 hr.
Acknowledgments I would like to thank the members of the McEntee laboratory for providing data used to compile Table I, and Kevin McEntee for critically reading the manuscript.
[36] O p t i m i z i n g the Biolistic P r o c e s s for D i f f e r e n t Biological Applications By J. C. SANFORD, F. D. SMIIH, and J. A. RUSSELL Introduction The biolistic process employs high-velocity microprojectiles to deliver nucleic acids and other substances into intact cells and tissues.l-4 This process has also been called the microprojectile bombardment method, the gene gun method, the particle acceleration method, and so on. Diverse applications for the biolistic process are rapidly being found for both basic research and genetic engineering. The biolistic process was originally developed as a means to deliver foreign genes into the nuclear genome of higher plants.l'2 This is where most efforts have been focused, resulting in successful biolistic transformation of a wide range of tissues in a wide range of plant species. 3-28 t j. C. Sanford, T. M. Klein, E. D. Wolf, and N. Allen, J. Part. Sci. Technol. 5, 27 (1987). 2 T. M. Klein, E. D. Wolf, R. Wu, and J. C. Sanford, Nature (London) 327, 70 (1987). 3 j. C. Sanford, Trends Biotechnol. 6, 229 (1988). 4 j. C. Sanford, in "Proceedings of the Biomedical Engineering Society" (D. C. Milulecky and A. M. Clarke, eds.), pp. 89-98. New York Univ. Press, New York, 1990. 5 T. M. Klein, M. Fromm, A. Weissinger, D. Tomes, S. Schaaf, M. Sletten, and J. C. Sanford, Proc. Natl. Acad. Sci. U.S.A. 85, 4305 (1988). T. M. Klein, T. Gradziel, M. E. Fromm, and J. C. Sanford, Bio/Teehnology 6, 559 (1988). 7 T. M. Klein, E. C. Harper, Z. Svab, J. C. Sanford, M. E. Fromm, and P. Maliga, Proc. Natl. Acad. Sci. U.S.A. 85, 8502 (1988). 8 y._c. Wang, T. M. Klein, M. Fromm, J. Cao, J. C. Sanford, and R. Wu, Plant Mol. Biol. 11, 433 (1988). 9 j. Cao, Y.-C. Wang, T. M. Klein, J. C. Sanford, and R. Wu, in "Plant Gene Transfer--1989 UCLA Symposium," (C. J. Lamb and R. N. Beachy, eds.) pp. 21-33. Liss, New York, 1990. l0 T. M. Klein, L. Kornstein, J. C. Sanford, and M. E. Fromm, Plant Physiol. 91, 440 (1989). tt p. Christou, D. E. McCabe, and W. F. Swain, Plant Physiol. 87, 671 (1988). 1,. D. E. McCabe, W. F. Swain, B. J. Martinell, and P. Christou, Bio/Technology 6, 923 (1988).
METHODS IN ENZYMOLOGY,VOL. 217
Copyright© 1993by AcademicPress, Inc. All rightsof reproductionin any formreserved.
484
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[36]
Transformed plant tissues include cell suspensions, calli, immature embryos, mature embryo parts, meristems, leaf pieces, microspores, and pollen. Transformed species include those that were otherwise impossible or very difficult to transform. 12-14 The biolistic process has proved to be effective even in very small cell types, and has therefore been useful in transforming diverse microbial species. These include microbial eukaryotes such as yeast and filamentous fungi 29and algae3°; prokaryotes such as Bacillus megaterium,31 Pseudomonas syringae, Agrobacterium tumefaciens, Erwinia amylovora, Erwinia stewartii, and Escherichia c01i32; and obligate fungal pathogens such as Uncinula necator. 33 The biolistic process first made possible the transformation oforganelle i3 M. E. Fromm, F. Morrish, C. Armstrong, R. Williams, J. Thomas, and T. M. Klein, Bio/ Technology 8, 833 (1990). 14 W. J. Gordon-Kamm, T. M. Spencer, M. Mangano, T. R. Adams, R. J. Daines, W. G. Start, J. V. O'Brien, S. A. Chambers, W. R. Adams, Jr., N. G. Willetts, T. B. Rice, C. J. Mackey, R. W. Krueger, A. P. Kausch, and P. G. Lemaux, Plant Cell2, 603 (1990). 15 H. Morikawa, A. Iida, and Y. Yamada, Appl. Microbiol. BiotechnoL 31, 320 (1989). 16 D. Twell, T. M. Klein, M. E. Fromm, and S. McCormick, Plant Physiol. 91, 1270 (1989). 17 T. M. Klein, B. A. Roth, and M. E. Fromm, Proc. Natl. Acad. Sci. U.S.A. 86, 6681 (1989). t8 j. H. Oard, D. F. Paige, J. A. Simmonds, and T, M. Gradziel, Plant Physiol. 92, 334 (1990). 19 j. A. Russell, M. K. Roy, and J. C. Sanford, Plant Physiol. 98, 1050 (1992). 20 M. M. Fitch, R. M. Manshardt, D. Gonsalves, J. L. Slightom, and J. C. Sanford, Plant Cell Rep. 9, 189 (1990). 2i R. R. Mendel, B. Miiller, J. Schulze, V. Kolesnikov, and A. Zelenin, Theor. Appl. Genet. 78, 31 (1989). 22 j. C. Sanford, Physiol. Plant. 79, 206 (1990). 23 p. Christou, W. F. Swain, N. S. Yang, and D. E. McCabe, Proc. Natl. Acad. Sci. U.S.A. 86, 7500 (1989). 24 R. R. Mendel, AgBiotech News Inf. 2(5), 643 (1990). 25 T. M. Klein, S. A. Goff, B. A. Roth, and M. E. Fromm, Proc. Int. Congr. Plant Tissue Cell Cult., 7th (1990). 26 j. j. Finer and M. D. McMullen, Plant Cell Rep. 8, 586 (1990). 27 D. T. Tomes, A. K. Weissinger, M. Ross, R. Higgins, B. J. Drummond, S. Schaaf, J. Malone-Schoneberg, M. Staebell, P. Flynn, J. Anderson, and J. Howard, Plant Mol. Biol. 14, 261 (1990). 28 K. K. Kartha, R. N. Chibbar, F. Georges, N. Leung, K. Caswell, E. Kendall, and J. Qureshi, Plant Cell Rep. 8, 429 (1989). 29 D. Armaleo, G. N. Ye, T. M. Klein, K. B. Shark, J. C. Sanford, and S. A. Johnston, Curr. Genet. 17, 97 (1990). 3o G. Zumbrunn, M. Schneider, and J.-D. Rochaix, Technique 1, 204 (1989). 31 K. B. Shark, F. D. Smith, P. R. Harpending, J. L. Rasmussen, and J. C. Sanford, Appl. Environ. Microbiol. 57, 480 (1991). 32 F. D. Smith, P. R. Harpending, and J. C. Sanford, J. Gen. Microbiol. 138, 239 (1992). 33 F. D. Smith, D. M. Gadoury, P. R. Harpending, and J. C. Sanford, manuscript in preparation (1992).
[36]
OPTIMIZING THE B1OLISTIC PROCESS
485
genomes. Chloroplasts of Chlamydomonas can now be routinely transformed, 34,35 yeast and Chlamydomonas mitochondria can be biolistically transformed, 36,37and higher plant chloroplasts can be either transiently38'39 or stably4° transformed using the biolistic process. Most recently, the biolistic process has proved useful in transforming animal cell lines, 41 primary animal cells, 42 and intact animals. 43'44 While the biolistic process clearly has value, we are still learning how to make the process optimally effective within its diverse fields of application. In the last 2 years we have learned a great deal about how to make the process more effective. This chapter is meant to communicate what we have learned, and to help elucidate for others how they might best go about optimizing the process for their own particular applications. The basic features that must be considered by anyone using the biolistic process are (1) particle accelerator parameters, (2) microprojectile parameters, (3) biological parameters, and (4) experimental design. Particle Accelerator Parameters There are several ways of accelerating microscopic particles to supersonic speeds, as is required by the biolistic process. These were outlined by Sanford et al. 1 Of these various acceleration methods, the only method that has proved to be of general value thus far is acceleration of microprojectiles on the face of a macroscopic carrier, or "macroprojectile." The macroprojectile is in all cases driven by a gas shock. The gas shock can be derived by use of a chemical explosion (gunpowder), ~ an electric explosion of a water droplet, n'~2 a discharge of compressed air, t5 or by a 34 j. E. Boynton, N. W. Gillham, E. H. Harris, J. P. Hosler, A. M. Johnson, A. R. Jones, B. L. Randolph-Anderson, D. Robertson, T. M. Klein, K. B. Shark, and J. C. Sanford, Science 240, 1534 (1988). 3.s A. D. Blowers, L. Bogorad, K. B. Shark, and J. C. Sanford, Plant Cell 1, 123 (1989). 36 S. A. Johnston, P. Q. Anziano, K. Shark, J. C. Sanford, and R. A. Butow, Science 240, 1538 (1988). 37 T. D. Fox, J. C. Sanford, and T. W. McMullin, Proc. Natl. Acad. Sci. U.S.A. 85, 7288 (1988). 38 H. Daniell, J. Vivekananda, B. L. Nielsen, G. N. Ye, K. K. Tewari, and J. C. Sanford, Proc. Natl. Acad. Sci. U.S.A. 87, 88 (1990). 39 G. N. Ye, H. Daniell, and J. C. Sanford, Plant Mol. Biol. 15, 809 (1990). 4o Z. Svab, P. Hajdukiewicz, and P. Maliga, Proc. Natl. Aead. Sci. U.S.A. 87, 8526 (1990). 41 A. V. Zelenin, A. V. Titomirov, and V. A. Kolesnikov, FEBS Lett. 244, 65 (1989). 42 R. S. Williams and S. A. Johnston, In Vitro Cell and Deo. Biol. 27P, 11-14 (1991). 43 N. S. Yang, J. Burkholder, B. Roberts, B. Martinell, and D. McCabe, Proc. Natl. Acad. Sci. U.S.A. 87, 9568 (1990). 44 R. S. Williams, S. A. Johnston, M. Riedy, M. J. DeVit, S. G. McElligott, and J. C. Sanford, Proc. Natl. Acad. Sci. U.S.A. 88, 2726 (1991).
486
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[36]
helium shock 45 generated by a rupture-membrane mechanism. The macro-
projectile may be any lightweight object that has a front surface that can carry microprojectiles, a back surface that can receive the energy of the gas shock, and sufficient cohesive integrity to withstand the gas shock, sudden acceleration, and violent deacceleration. While there are now numerous particle accelerator designs in use, we will limit our discussion to the gunpowder-driven PDS-1000 accelerator [previously distributed by Du Pont (Wilmington, DE)] and its helium shock driven retrofit (now distributed by Bio-Rad, Richmond, CA). This focus is due to our familiarity with these acceleration systems, both of which were developed in our laboratory. In addition they are the systems most widely used and are the only ones that are commercially available. Researchers using other accelerator designs can still benefit from the information gained through our experience with these types of devices. Some people may choose to continue to use the gunpowder-driven apparatus, so we include some discussion of it. However, as the new helium-driven apparatus is dramatically superior, 45 most of our discussion will relate to this improved biolistic system. Power Source
Gunpowder-driven designs employ standard nail-gun cartridges, as are used in the construction industry. Until now this has been the established biolistic power source, but it has the disadvantages of being somewhat dangerous, uncontrolled, and messy in terms of generating dirty gases and debris within the apparatus. The new helium-driven apparatus has the advantage that the power source is safer and cleaner, and the power output can be regulated. We have observed that helium is clearly superior to other gases such as compressed air or nitrogen. This was as we expected, because helium is a light gas and expands much faster than other conventional bottled gases, imparting higher velocities to lightweight macroprojectiles. We believe the velocities achieved by the gunpowder and helium power sources are not fundamentally different, based on depth of penetration studies. The gunpowder-driven system seems to have higher velocity in the "epicenter" of a target region, but this is usually associated with a zone of cell death roughly 1 cm in diameter.~9 The helium-driven system does not generally produce a zone of death, and apparently produces higher velocities over a wider target area combined with better dispersal of particles, resulting in a more uniform field of transformation. In all biological systems we 45 j. C. Sanford, M. J. DeVit, J. A. Russell, F. D. Smith, P. R. Harpending, M. K. Roy, and S. A. Johnston, Technique 3, 3 (1991).
[36]
OPa'IMIZING THE BIOLISTICPROCESS
487
have tested, the helium system has proved dramatically superior to the gunpowder system in effectiveness. 45 Macroprojectile The gunpowder system requires a cylindrically shaped, high-density polyethylene macroprojectile, a tight-fitting, relatively long, heavily-armored acceleration barrel, and a special Lexan (Dupont, Wilmington, DE) stopping plate with a very small central aperture. The helium system employs a 2.54-cm circular Kapton (Dupont) membrane (only 0.06 mm in thickness) as a macroprojectile, which has the following important benefits. Only a short flight distance is needed, as the membrane requires very little time to come up to speed. The less massive membrane can be stopped with a screen, rather than a Lexan disk. Therefore more particles can be delivered without any associated high-velocity "debris," which can be generated from the macroprojectile or stopping plate. In addition, the microprojectiles are accelerated in a dried-down form over a larger surface of the wider macroprojectile, and are subsequently dispersed much more widely and uniformly on impact against the stopping screen. Vacuum~Residual Gas Regardless of the apparatus used, the gas overlying the target sample usually must be modified. Most commonly, as much of the overlying air is removed with a vacuum pump as is practical, such that a standard vacuum gauge will read 28-29 in. Hg (about 710-740 mmHg). Higher vacuums are not generally practical because of residual water vapor pressure from the biological sample itself. The strength of the vacuum must be reduced for certain applications. For example, bombardment of mouse skin in situ requires a reduced vacuum of approximately 20 in. Hg (about 510 mmHg), or the suction on the tissue can damage cells and reduce expression levels.44 Likewise, mouse liver tissue will not tolerate a vacuum at any l e v e l . 44 The efficiency of transformation of certain biological targets can be enhanced by flushing the chamber with helium prior to pulling a vacuum, such that the residual gas is helium instead of air. This advantage is quite dramatic in microbial systems, and helium flush can increase bacterial transformation by five- to sixfold, 32 and yeast transformation fourfold (J. C. Sanford, unpublished observation, 1992). However, this advantage is not universal. In tobacco cell suspensions the benefit is small or absent (J. C. Sanford, unpublished observation, 1992). There are two reasons why the gas overlying the biological sample can
488
M E T H O D S FOR T R A N S F O R M I N G A N I M A L A N D P L A N T CELLS
[36]
affect biolistic transformtion. The principal reason is that microprojectiles are rapidly deaccelerated as they pass through any gas. By removing most of the overlying gas, the amount of deacceleration can be significantly reduced. Likewise, by using a light gas such as helium, the drag can also be reduced. The smaller the microprojectile, the more dramatic the deacceleration problem. Because bacterial transformation involves a subset of microprojectiles that are extremely small, a helium flush and a strong vacuum become especially important factors affecting biolistic efficiency. A second reason why the gas overlying the sample can be important is that this gas can transmit a potentially damaging shock wave. By reducing the density of the overlying gas, or by using a low molecular weight gas such as helium as an overlay, the severity of such a shock wave can be reduced.
Baffles~Meshes The acoustic shock/gas blast that is generated during the supersonic acceleration of the macroprojectile can kill cells, especially those cells that are multiply traumatized by also being penetrated by the microprojectiles, and which may also be exposed to a selective medium. Even when such shock is not lethal, it may impair subsequent cell division, growth, and regeneration. Modification of the overlying gas can reduce the intensity of this shock, but only slightly. We have, therefore, attempted to reduce the shock wave further. Very fine meshes placed between the microprojectile launch site and the biological sample have been reported to improve gunpowder-driven biolistic transformation dramatically. 14We have found that such meshes are indeed effective with gunpowder-driven systems, but are less critical with the helium system. We have also tested a single-aperture postlaunch baffle with the gunpowder system, and a prelaunch baffle with the helium system. 19To evaluate the severity of the shock to the sample, we developed a "shave cream" assay. This assay simply measures the degree to which a layer of shave cream is disrupted by bombardment. We find that the mesh is more effective than a prelaunch baffle, which in turn is more effective in reducing shock than a postlaunch baffle. In addition, a mesh plus a prelaunch baffle is better than either alone. We believe that the benefit of the mesh with the gunpowder system is in reducing shock-generated trauma to cells, in addition to improving disaggregation, as has been proposed previously. 14 While these results show that mechanical shock trauma to target samples can be reduced by meshes and baffles, biological experiments with the helium system show these devices generally have little or no benefit in terms of increasing the number of stable transformants. We conclude that when suitable settings
[36]
O P T I M I Z I N G T H E BIOLIST1C PROCESS
489
and distances are used with the helium system, shock injury to cells is not a principal limiting factor for transformation efficiency. This also supports our belief that the overlying gas is more important in maintaining microprojectile velocity than in reducing shock wave intensity.
Determinants of Velocity There are several particle gun parameters that affect velocity and that interact. These include power load (pressure), gap distance (distance from power source to macroprojectile), macroprojectile flight distance, and target distance (distance from microprojectile launch site to biological target). Obviously, higher power loads, shorter gap distances, and longer macroflight distances give higher launch velocities. Longer microflight distance reduces impact velocity, but improves particle dispersion and minimizes gas shock to cells. Use of smaller microprojectiles, reduced vacuum, or baffle/meshes also results in reduced impact velocity. The helium-driven system is functional from 600 to 2400 psi. We have observed that 600 psi is sufficient for some degree of biolistic transformation, but is suboptimal for most applications. For most applications, 1000 psi is optimal or nearly optimal. As pressure increases toward 2400 psi velocities also increase, but the higher pressures do not necessarily result in significantly higher transformation rates. There appear to be negative effects at higher pressures, largely balancing out the advantages of higher velocities. Our "shave cream" assay indicates that the gas shock impacting the biological target increases markedly as pressures increase above 1000 psi. In the helium system, we have tested gap distances ranging from 1 to 20 ram, and have found that shorter gap distances increase velocity, but also increase variability and off-centered macroprojectile flight. Generally, a 6- to 12-ram gap distance seems optimal in terms of effective energy transfer with minimal variability. We know that in the gunpowder system, shortening the barrel length (acceleration distance of the macroprojectile) reduces the final velocity of the macroprojectile. In the helium system, we have tested macroprojectile flight distances of 0-20 mm. As distance increases, velocity increases as expected; however, so does variability and off-centered hits. Generally a 10-ram flight distance gives near optimal velocities, without serious variation in flight orientation or transformation frequency. Distance to target is not very critical when using larger microprojectiles. However, when small microprojectiles are used, as is the case in bacterial transformation, 3~'32microprojectile flight distance is critical, and must be minimized to maintain adequate impact velocity.
490
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[36]
The factors that affect velocity interact. For example, an increase in power load can compensate for increased gap distance, decreased macroflight distance, or increased microflight distance. Introduction of a bafflemesh, or reduced vacuum, may need to be offset by shorter microflight distance or higher power load.
Safety People who choose to build their own biolistic devices should be aware of certain hazards, and should incorporate features into their devices that make them inherently safer. All devices that have electrical components should include a ground fault interrupter mechanism, because users typically are working, often with wet hands, in a metallic, grounded environment (a laminar flow hood)! The hazards associated with gunpowder charges include premature firing due to heat or impact, exploding acceleration barrels due to barrel blockage, and ejection of high-velocity macroprojectile, cartridge, or other debris from a system that has not been fully sealed before firing. High-pressure helium can be hazardous at the tank source, or from rupture of fittings or tubing. Firing of the rupture membrane of a helium system without the benefit of enclosure or vacuum is extremely loud. Such premature firing could conceivably generate small pieces of high-velocity membrane material, or cause injury to the hearing of the user. Microprojectile Parameters
Choice of Microprojectiles Tungsten. Tungsten particles can be obtained in various size ranges from Sylvania (Sylvania Chemicals/Metals, GTE Products Corp., Towanda, PAL These particles are extremely irregular in shape and heterogeneous in size. Although different mean sizes range from 0.5 to 2.0+ /zm, their distributions overlap extensively. The advantages of tungsten are that it is very inexpensive, it is available in numerous sizes, each size class represents a broad spectrum of particle diameters, it is easy to coat with DNA, and we have more experience with it than with other particle types. The disadvantages are that it is potentially toxic to certain cell types, it is subject to surface oxidation that can alter DNA binding, it catalytically degrades the DNA bound to it over time, and it is highly heterogeneous in shape and size, which prevents optimization of size for a particular cell type. Gold. Gold particles are available in a very limited range of sizes from
[36]
OPTIMIZING THE BIOLISTIC PROCESS
491
either Aesar (Johnson Matthey Aesar Group, Seabrook, NH), or from Bio-Rad. Aesar particles tend to be 2/xm or larger, while Bio-Rad particles are smaller. Currently available gold particles are much rounder and more uniform in size than tungsten. A principal advantage of gold particles is their uniformity, which allows for optimization of size relative to a given cell type--assuming one of the few available sizes happens to be optimal. An even more important advantage of gold is that it is biologically inert. Gold is not toxic to any cells we have tested, and is already approved by the Food and Drug Administration (FDA) as a human therapeutic agent. Unlike tungsten, gold does not catalytically attack DNA bound to it. A major disadvantage of gold is that it is relatively expensive. Surprisingly, gold is not stable in sterile aqueous suspensions, and over a period of time it agglomerates irreversibly; therefore it is best to prepare gold particles the day they are to be used. The uniformity of gold is undesirable in the sense that if the correct specific particle size for a certain cell type is not available, then transformation rates may approach zero. Last, while DNA can be bound to gold as well as to tungsten, from our experience gold coating is more subject to variation, associated with slight perturbations of precipitation conditions. Other Particles. We have tried other high-density particles for use as microprojectiles. In our hands, platinum and iridium particles both yield very poor results. We do not know if the problem is that these particles are suboptimal in terms of their diameter, or if they do not coat well with DNA. We have also tried lower density particles as microprojectiles. Glass needles ( - 1 mm in diameter, 3-30 mm long) can penetrate cell walls and enter into onion epidermal cells. Likewise, dried cells of E. coli and A. tumefaciens can be shot into living onion epidermal cells. While these lower density particles have the ability to penetrate cell walls, their reduced momentum dramatically reduces the efficiency (rate) of such penetration. While lower density particles do not penetrate cells efficiently, they provide intriguing possible advantages. For example, dried cells such as E. coli, A. tumefaciens, and yeast make ideal biological capsules, which should be capable of delivering plasmids or minichromosomes in a naturally encapsulated form. Such encapsulation could completely eliminate problems with particle size heterogeneity, irregular DNA coating, particle agglomeration, and shearing or abrasion of DNA. Experiments indicate that dried cells of E. coli harboring a plant expression vector can be used to bombard tobacco or maize cell suspension cells, resulting in /3-glucuronidase (GUS)-expressing tobacco c e U s . 46 Likewise, intact 46 j. L. Rasmussen, J. A. Russell, and J. C. Sanford, manuscript in preparation (1993).
492
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[36]
phage bearing a common yeast transformation vector in its "stuffer" region, used as projectiles to bombard yeast, yield moderate to good rates of yeast transformants. 47 Ideally, such biological capsules could be modified to increase their density so that they would penetrate the target cells more effectively. When cells that lack cell walls or other types of outer sheath material are used as targets (such as animal cell cultures), high rates of transformation can be obtained even when using low-density particles such as silica particles (GlassMilk; Bio 101, San Diego, CA) (J. L. Rasmussen and J. C. Sanford, unpublished observations). Particle Size. The size of the particles chosen for biolistic transformation is generally based on the size of the target cells. As a rule of thumb, particles should be roughly one-tenth the diameter of the cell. However, there are examples where this is not true. For example, for intact mouse epidermal transformation, surprisingly large particles (3.9/xm) are effective, for cells less than 20/zm in diameter. On the other hand, particles as small as 1.0/xm are very effective on primary cell cultures of myotubes (40 x 100 /~m in length). A summary of available particles and their attributes and uses is given in Table I.
Coating Particles Microprojectile coating is one of the most important sources of variation affecting biolistic efficiency. Apparently each time DNA is precipitated, its pattern of precipitation and aggregation is unique and nonreproducible. The precipitation occurs so rapidly that it is nearly impossible to obtain a uniform reaction mixtureMespecially because gold or tungsten particles are difficult to keep in suspension. Thus, even when we do our best to hold conditions constant we see important differences in transformation efficiency from one microcentrifuge tube (precipitation event) to another. Furthermore, we still experience fluctuations from day to day and month to month that we cannot explain (transformation rates seem to go down consistently in the summer, perhaps relating to humidity). Hopefully, superior and more reproducible coating procedures will be developed. Until then, users should strive to make the precipitation reaction mixture as homogeneous and reproducible as possible. Various DNA-coating protocols have been published, and the essential components of these protocols are given in Table II. Of these protocols, we can best describe and critically evaluate the protocol we currently use, which is distinctly superior to our previously published protocols. 47 j. L. Rasmussen and J. C. Sanford, manuscript in preparation (1993).
[36l
493
OPTIMIZING THE BIOLISTIC PROCESS TABLE I DIFFERENT PROJECTILES AND THEIR USES
Projectile
Diameter (p,m)
Attributes
M5 tungsten (Sylvania)
0.1-1,0
Size heterogeneity, irregular shapes
M10 tungsten (Sylvania)
0.2-1.5
Size heterogeneity, irregular shapes
1-/~m gold (BioRad)
-1
Uniform in size, round
1.7-/zm gold (BioRad) 1- to 3-/xm gold (Aesar) 2- to 5-~tm gold (Aesar) Dried Escherichia coli, bearing plant vectors h phage with markers Glass fragments
-1.7
Uniform in size, round
1-3
Fairly uniform in size, round Fairly uniform in size, round Very uniform in size, symmetrical
2-5 -1
-0.1 - 1 × 3-30
Very uniform in size, polyhedral Heterogeneous, glass crystals vary in length
Proven applications Bacteria, yeast, possibly meristems, with high velocities Chlamydomonas, yeast, plant cells, animal cell cultures Plant cells, animal cell cultures, yeast, approximately the same as MI0 Larger plant cells, mouse skin Larger plant cells, mouse skin Mouse liver, muscle, spleen, intestine Large plant cells
Yeast, plant cells Large plant cells
1. To begin, 60 mg of particles is weighed out, placed in a microcentrifuge tube, and vortexed vigorously in 1 ml 70 or 100% (v/v) ethanol. Surprisingly, the brand of microcentrifuge tube can be important. Tungsten and apparently DNA can stick to the surfaces of some types of tubes. "Treff" microcentrifuge tubes (Tekmar, Cincinnati, OH) work very well. Twice we have switched to less expensive brands, resulting in a dramatic loss in efficiency that was not diagnosed until many experiments were ruined. At room temperature the particles are then soaked in ethanol for 15 rain, pelleted by a 15-min centrifugation (15,000 rpm), decanted, washed three times with sterile distilled water, and brought up to a final volume of 1000 ~1 in a 50% (v/v) glycerol solution. These particles can be stored at room temperature for 1-2 weeks (prolonged storage can lead to oxidation of the surfaces of the particles). It was previously recommended that particles be extensively sonicated while in ethanol. We no longer feel this is beneficial, and under certain conditions can make particle agglomeration worse rather than better, especially when gold particles are used.
494
METHODS
FOR TRANSFORMING
ANIMAL
AND PLANT
CELLS
O~
<
Z
~
E ~
0
z
0
0
o
el) 0 Z
o
u~
o
0
(J o
o
<
Z
0 0
e 0 e~ -~
- ~
•
oo 0 0
0 ~
~
~
~
0
~
0
[36]
[36]
O P T I M I Z I N G T H E B1OLISTIC PROCESS
495
2. For convenience, sterile aliquots of 2.5 M CaCl 2 and 0.1 M spermidine (free-base) are stored at 4 and - 20°, respectively. Surprisingly, after several months the frozen spermidine goes bad in the freezer, which on several occasions has lead to a ruinous loss of transformation efficiency, which went undiagnosed for considerable periods of time. Therefore, frozen spermidine aliquots should be made fresh at least once a month. 3. We prepare DNA at a concentration of 1 /~g//zl. It appears that contaminating protein is a principal cause of particle agglomeration during coating, and has limited how much DNA can be used effectively. Ideally, DNA to be used for biolistic experiments should be put through several additional phenol extraction steps to remove all traces of protein. If the DNA is very pure and in abundant supply, the amount used for coating can be increased severalfold over what we otherwise recommend, increasing transformation rates. However, when transforming bacteria with M5 particles (effective particle size, -0.1/zm), we find DNA concentrations should be reduced fourfold to 0.25/xg//xl. 32 4. There are different views on how large an aliquot of particles should be coated at one time. For a long time, our laboratory only prepared aliquots large enough for three bombardments (see Table II). However, we now more typically use double aliquots (sufficient for six bombardments). Other laboratories seem to prepare enough particles in a single vessel for an entire experiment. It is not clear to us yet if larger aliquots yield a more or a less uniform reaction mixture. We describe our "traditional" small aliquot (three bombardment) procedure, which obviously can be increased for larger scale reactions. 5. We begin by aliquoting 25 ~1 of the tungsten suspension into microcentrifuge tubes. It is important to vortex continuously while removing aliquots of the tungsten suspension, to avoid nonuniform sampling. 6. We then add 2.5/zl of the DNA stock, 25/xl of CaCI 2 stock, and 10 ta,l of the spermidine stock, in that order, while the microcentrifuge tube is continuously being vortexed, Continuous vortexing is important to ensure a uniform reaction mixture. 7. The mixture should be allowed to react and to coat the particles for several minutes during continuous vortexing. The coated particles should then be gently pelleted by pulse centrifugation (early protocols called for hard pelleting, which leads to more agglomeration).
Loading Particles Once particles have been coated with DNA they should be used as soon as possible. This is particularly true when tungsten particles are used, because the tungsten can degrade the DNA. If a full day of bombardment
496
M E T H O D S FOR T R A N S F O R M I N G A N I M A L A N D P L A N T CELLS
[36]
is planned, we recommend coating particles as they are needed, two to four times during the day. For the gunpowder-driven system, 50 /zl of supernatant is then removed, leaving enough for three bombardments of 2/zl to be loaded onto each macroprojectile. Effort is made to divide the particles accurately-one-third per aliquot (which is difficult), and to place the aliquot in the exact center of the macroprojectile (which takes practice). For the helium-driven system, all of the supernatant is removed, and the pellet is washed in 70/A of 70% (v/v) ethanol. A second wash in 100% ethanol is optional. The particles are then gently pelleted and brought up in 24/zl of 100% ethanol. The resulting suspension is mixed by dipping the microcentrifuge tube in an ultrasonic cleaner (Branson 1200), and then aliquoted (6/zl) onto Kapton flying disks, again using care to take equal amounts of particles per aliquot, and to place the aliquot in the exact center of the disk. It is important that the disks have been washed in 70% ethanol before use, and are free from grease, fingerprints, and so on, to ensure uniform coating and drying. The suspension can be spread over an area 1 cm in diameter in the center of the disk, using the pipette tip. It is crucial that, immediately after loading, the disk be placed in a desiccator until thoroughly dry ( - 6 0 sec) and that it is kept there until immediately before use. Exposure to humidity during or after drying dramatically reduces transformation rates, apparently due to hygroscopic clumping and agglomeration. 32 For certain applications, the amount of particles loaded can be substantially increased. We believe that the coated particles are relatively stable while in ethanol (at least for halfa day), but that once dried they are unstable. Therefore, we dry particles onto disks as needed, and use them within 1-2 hr.
Biological Parameters There are several biological parameters that are important for successful biolistic transformation. First, one must have an appropriate gene construct with a promoter that is strong and that will express in desired target tissue. Second, the target cells must be in a state receptive to transformation. Third, there must be high rates of particle penetration and cell survival and growth after bombardment. A detailed discussion of the biological factors that have been important in optimizing biolistic transformation of various species in our laboratory is given below. Most of this information has come from our experiments with bacteria, yeast, and plant cell suspension cultures.
[36]
OPTIMIZING THE BIOLISTIC PROCESS
497
Vector Constructs
Obviously, it is important that appropriate vectors be utilized in biolistic experiments. The vectors must have appropriate reporter or selective genes with appropriate promoters, and may be either replicating or integrative. The size and form of the transforming DNA should also be considered. In plants, we routinely employ the/3-glucuronidase (GUS) gene 48 as a reporter gene for evaluating transient expression. Other laboratories use luciferase or anthocyanin genes as reporter genes. For determination of stable transformation rates we routinely use the neomycin phosphotransferase (NPTII) g e n e , 49 which confers resistance to kanamycin. Herbicide resistance genes can also be used as selective markers, t3'~4 For dicot plants we usually use the plasmid pBI426 (obtained from W. Crosby, Plant Biotechnology Institute, Saskatoon, Canada), which has a GUS-NPTII gene fusion, 5° driven by a double 35S cauliflower mosaic virus (CaMV) promoter plus a leader sequence from alfalfa mosaic virus. This plasmid yields 10- to 100-fold more transiently transformed tobacco cells than does pBI121 (Clonetech, Palo Alto, CA), which has a GUS gene driven by a single 35S promoter and the NPTII gene driven by the nopaline synthase promoter. In monocot species, constructs with the alcohol dehydrogenase promoter and intron 5 or the rice actin promoter 5~ yield much higher numbers of transformants than do constructs with weaker promoters such as the CaMV 35S promoter. In bacteria and yeast, we deliver autonomously replicating vectors routinely. However, autonomous replication is not essential in yeast, because very high rates of biolistic transformation are also achieved with integrative (nonreplicating) vectors. 29 Vectors bearing plant replicons are not expected to be stable, but may reasonably be expected to increase the probability of integrative events. Likewise, vectors bearing transposable elements might greatly increase the efficiency of integration] 2 which is a limiting factor in biolistic plant transformation. Vector size does not appear to be a limiting factor. Escherichia coli 48 R. A. Jefferson, T. A. Kavanagh, and M. W. Bevan, EMBO J. 6, 3901 (1987). 49 E. Beck, G. Ludwig, W. A. Awerswald, B. Reiss, and H. Schaller, Gene 19, 324 (1982). 50 R. S. S. Datla, J. K. Harnmerlindl, L. E. Pelcher, G. Selvaraj, and W. L. Crosby, J. Cell. Biochem. Suppl. 14E, 279 (1990). 51 D. McElroy, W. Zhang, J. Cao, and R. Wu, Plant Cell 2, 163 (1990). 52 j. Laufs, U. Wirtz, M. Kammann, V. Matzeit, S. Schaefer, J. Schell, A. P. Czernilofsky, B. Baker, and B. Gronenborn, Proc. Natl. Acad. Sci. U.S.A. 87, 7752 (1990).
498
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[36]
plasmid vectors are effective up to the normal size limits of such vectors (20-30 kb). ~, phage vectors (50 kb) can be bound to tungsten particles and can yield high transformation rates. 47 Likewise, intact cells (e.g., E. coli) can be delivered as biolistic projectiles, 46 indicating that entire chromosomes or genomes might be delivered by this process. Genes can be biolistically delivered as RNA 2 or DNA, in circular or linear 35 form, and as single-stranded 35 or double-stranded DNA.
Cell Age~Physiology In general, the optimum targets for biolistic transformation are healthy cells that are receptive to transformation and that can withstand the stresses of the bombardment process. This generally means that "young," actively dividing cells are the best. However, there are exceptions to this rule and the optimum cell age of each species must be determined empirically. When equal numbers of cells from early-log, mid- and late-log, and stationary cultures of B. megaterium strain 7A17 are transformed, cells from early-log phase are transformed most efficiently. 3t There is no difference in transformation efficiency between cells from midlog, late-log, and stationary cultures of E. coli JA221. 32 In the yeast Saccharomyces cerevisiae, cells from stationary cultures are most efficiently transformed.29 For tobacco NT 1 cell suspensions,S3 early log-phase cells, 4 days past subculturing, give the highest rates of transformation. Cells 6 days old (midlog phase) and older yield dramatically lower numbers of transformants. For 'Black Mexican Sweet' (BMS) corn cell suspension cultures, the frequency of cell subculturing can also affect transformability. BMS cell suspensions subcultured three times per week give higher numbers of transformants than cultures subcultured only once a week.
Cell Size Many organisms having different cell sizes and some cell organelles have been successfully transformed with the biolistic process. Successful organelle transformation include chloroplasts of the green alga Chlamydomonas reinhardtii (10 ~ m ) , 34'35 chloroplasts of tobacco (5 t~m)fl 8-4° and yeast mitochondria. 36 The bacteria B. megaterium (1.3 × 4.0 /xm), 31 E. coli (1.1-1.5 × 2.0-6.0 ~m), E. amylovora (0.5-1.0 × 1.0-3.0/xm), A. tumefaciens (0.6-1.0 × 1.5-3.0 ~m), and P. syringae pv. syringae (0.7-1.2 x 1.5/~m) 32 have all been transformed using M5 tungsten particles. A variety of plant cells of various shapes and sizes (20-100/xm) have 53 C. Paszty and P. F. Lurquin,
BioTechniques 5, 716 (1987).
[36]
OPTIMIZING THE BIOLISTIC PROCESS
499
also been transformed. Target cell size is a major consideration in selection of particle size and target distance (see Tables I and III). Cell Density Cell density is an important parameter for the transformation of both microbes and plant cell suspension cultures. Generally, a uniform lawn of cells one cell layer thick is optimal. This provides the greatest number of targets, without extraneous cells that can interfere with plating or selection. In bacterial systems, cells that are grown in liquid culture are prepared for bombardment by centrifugation, resuspension, and then spreading them evenly over the surface of the bombardment medium. The optimum cell number per 10-cm petri plate for E. coli JA221 and B. megaterium 7A17 is 2 x 10 9 and 1 x 108, respectively. More transformants per plate were produced when 3 x 10 9 E. coli cells per plate were bombarded rather than 2 x 10 9, but transformed colonies were too dense to count. For tobacco cell suspension cultures, we routinely collect 5 ml of suspension, which contains a 0.6-ml settled volume of cells, onto a 7-cm diameter filter paper. However, at this density the number of stable transformants can be difficult to count, and thus the cells are often diluted and replated after bombardment (see Cell Handling, Transfers, Selection below). Osmoticum The addition of an osmoticum (i.e., a supplemental agent increasing osmolarity) to the bombardment medium can dramatically increase the rates of transformation. We have found this to be true for all microbial species tested and for all plant cell suspension cultures, although the optimum concentration for each species varies. Elevated osmoticum concentrations may work by protecting the cells from leakage and bursting (lower turgor pressure) and may also improve particle penetration itself. The optimum osmotic concentration for B. megaterium 7A 17 is approximately 1.5 M (0.75 M sorbitol plus 0.75 M mannitol). The optimum for E. coli JA221 is approximately 0.6 M sorbitol. For bacteria, the optimum osmotic concentration is generally slightly below the toxic level for the species. One exception is E. amylovora, which can grow at 1.0 M sorbitol. This concentration of osmoticum, however, interferes with ampicillin selection for pUC118 transformation. In this case, a concentration of 0.05 M still significantly increases transformation efficiency while permitting selection for the ampicillin-resistant transformants. When selecting E. coli JA221 (AtrpES leu- hsdR- recA-)transformants on tryptophan dropout
500
[36]
METHODS FOR TRANSFORMING ANIMAL A N D PLANT CELLS
~0a
8
o
o
o
_
o
..o
.
.
.
.
.
o
~
Z
¢.1
~
Z
% ez
,-.t
e4
e.l
o;e,i
,d
o~
Z
xJ +N
+
lu~ ...
d~ e~
X
X
X
e
..
~ o ~
'
~
[36]
OPTIMIZING THE BIOLISTIC PROCESS
501
medium that had been transformed with plasmid pKRSI01 (Ap r, trpE), the optimum osmoticum was 0.6 M sorbitol. However, the cells grow slowly at 0.6 M sorbitol, which is not a problem with tryptophan selection, but can interfere with ampicillin selection because of formation of satellite colonies around the transformed colony. A lower concentration (0.2-0.4 M) of osmoticum still produces more transformants per plate than no osmoticum but also reduces the incubation time and formation of satellite s as compared to 0.6 M. In tobacco cell suspension cultures, 2- to 10-fold higher rates of both transient and stable transformants are obtained when at least 300-900 mOsm/kg H20 osmoticum is included in the bombardment medium. 55 in most of our experiments osmoticum has consisted of equal molarities of mannitol and sorbitol. Because commercial sources of mannitol may be contaminated with abscisic acid 54 we have also tested the use of raffinose as an osmoticum. Thus far, we have not seen a substantial benefit of raffinose over mannitol/sorbitol. Additionally, raffinose is more expensive and is difficult to keep in solution at high concentrations. Another benefit to using high osmotic conditions in plant cell suspension cultures is the reduction of background cell growth. If the starting osmoticum is inhibitory but not lethal, all cell growth is initially inhibited and then as the osmoticum concentration is lowered and the cells are placed on kanamycin medium, only the kanamycin-resistant colonies resume growth. For NT1 tobacco cell nuclear transformation a concentration of 0.2-0.4 M (i.e., 400-700 mOsm/kg H20) supplemental osmoticum appears to be optimal. For transient gene expression in tobacco chloroplasts a concentration of 0.55 M mannitol plus 0.55 M sorbitol is optimal. 39
Tungsten Toxicity In some cases tungsten microprojectiles are toxic to the target cells. Tungsten particles added to the medium of tobacco cell suspensions reduce cell growth, even at concentrations 10-20 times lower than that delivered to a bombarded plate. At higher concentrations, tungsten can cause extensive cell death, t9 Tungsten also dramatically acidifies the culture medium. This is not the cause for toxicity in tobacco cell suspensions, but medium acidification could be a significant problem in pH-sensitive cells. Tungsten does not appear to be toxic to all cell types (e.g., Bacillus). When tungsten toxicity is believed to be a problem, the best solution would be to use gold or another inert particle type, if the appropriate 54 .]. A. Russell, M. K. Roy, and J. C. Sanford, In Vitro Cell. Dev. Biol. 28P, 97 (1992). 55 H. Belefant and F. Fong, Plant Physiol. 91, 1467 (1989).
502
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[36]
size for a particular application is available. In tobacco cell suspension cultures, bombardment with 1-/~m gold instead of M10 tungsten particles increases the recovery of stable transformants. 19Where the use of gold is not possible, then reduced concentrations of tungsten in the DNA reaction mixture, or reduced loads on the macroprojectile, may be tried. Also, the tungsten concentration in the cell environment may be reduced by washing the cells/tissues soon after bombardment. For pH-sensitive cells, the bombardment medium can be buffered. Tungsten acidification of the medium of tobacco cell suspension cultures is effectively buffered by 10 mM 2-(Nmorpholino)ethane sulfonic acid (MES). 19
Cell Handling, Transfers, Selection Bacteria. We have developed a transfer system for bacteria that allows exposure to a high level of osmoticum during bombardment and then facilitates a gradual decrease in osmoticum and imparts selection for antibiotic resistance. 32 The transfer device is a thin agar medium layer (7 ml), which is pipetted onto a piece of supporting filter paper (8-cm diameter) with an extending tab for handling (paper + agar = "pagar"). Cells are spread onto the pagar, dried, bombarded, and then the pagar is transferred on top of a selective medium (21 ml). The selective medium includes enough antibiotic so that the final concentration following diffusion into the total 28-ml volume is correct. The pagar medium should contain the desired concentration of osmoticum. The osmoticum concentration for bombardment may be high enough to slow or actually prevent growth initially, but when the pagar is layered over the selective medium diffusion gradually and gently reduces the osmotic concentration while the antibiotic is diffusing upward. In all microbial systems tested, resuspended cells are slowly dried onto the surface of the medium shortly before bombardment. In cases in which bacteria are bombarded while the surface of the medium is still moist, transformation efficiency is reduced. Also, bombarding moist plates results in splattering of cells and medium during bombardment, and may contaminate the surfaces of the gun for other users. Plant Cell Suspension Cultures. To prepare plant cell suspension cultures for bombardment, the cells are collected onto 7-cm filter papers (#1; Whatman, Clifton, N J) using a B~chner funnel. The filter papers containing the cells are then placed over pagar supports in 100 x 15 mm petri plates. The pagar supports consist of a filter paper with attached tabs (for handling), covered with 10 ml of growth medium containing the desired osmoticum, and solidified with 0.25% (w/v) Gelrite (Kelco, San Diego, CA). The cells are allowed to equilibrate with the osmoticum for at least
[36]
OPTIMIZING THE BIOLISTIC PROCESS
503
1 hr before bombardment. During bombardment, the vacuum should not be pulled higher than 28 in. Hg (about 710 mmHg), or the pagar supports will sometimes flip out of the plates due to sudden degassing of the Gelrite. The bombarded plates are then placed in plastic boxes and are incubated in a culture room at 24° and with indirect light. On the day following bombardment, the osmoticum in the culture medium is reduced in two gentle steps. First, the tabs are used to remove from the old petri plate the pagar supports and cells, all of which is transferred to the new petri plates containing 10 ml of Gelrite-solidified growth medium without osmoticum. Eight to 10 hr later, the pagar support and cells are transferred to new petri plates containing 20 ml of Gelritesolidified growth medium without osmoticum. Two days after bombardment, either transient GUS assays are performed, or the cells are transferred to selective medium. For transient GUS assays, the filter papers containing the cells are transferred to new petri plates and 1 ml of 5-bromo-4-chloro-3-indolyl-/3-o-glucuronic acid, cyclohexyl ammonium salt (X-Gluc) staining solution 12 is pipetted under the filter paper so as not to disturb the cells. The cells are then incubated at 37° for 24 hr, and the number of GUS-expressing blue cells are counted. To select for kanamycin-resistant cells, the filter papers containing the cells are transferred to 100 x 15 mm petri plates containing 20 ml of NTI growth medium with 350 mg/liter kanamycin and 0.25% (w/v) Gelrite. Kanamycin-resistant colonies begin to appear in 4 weeks. One of the critical factors for colony growth in tobacco NTI cells is the gaseous environment. Wrapping the plates with Parafilm (American National Can, Greenwich, CT) delays the appearance of colonies and reduces the number of colonies recovered. 55 This is likely due to ethylene accumulation in the plates. As an alternative, wrapping the plates with venting tape (Scotch Brand #394; 3M Corporation, St. Paul, MN) gives better gas exchange yet still helps reduce entry of contaminants. With venting tape, however, desiccation of the plates occurs more rapidly. Thus, the cells must be transferred to fresh medium at least every 2 weeks. With our optimized NT1 protocol, typically 500 to 1500 kanamycinresistant colonies can be obtained from 1 bombarded plate. However, it is impossible to count all of these colonies if the cells are left on the original filter paper disks. Thus, the cells must be replated to a lower density. The method we use is to dilute the cells 2 days postbombardment at the time of transfer to kanamycin medium. First, the filter paper containing the cells is cut into four equal parts. Each filter paper section is then placed in a 150 x 15 mm petri dish containing 40 ml of NT1 medium with 350 mg/liter kanamycin and 0.25% (w/v) Gelrite. Subsequently, 3 ml of liquid medium is pipetted onto each plate and the plates are swirled to spread
504
M E T H O D SFOR TRANSFORMING ANIMAL AND PLANT CELLS
[36]
the cells uniformly. Because it is difficult to subsequently transfer the cells until colonies appear, the plates are wrapped with Parafilm to reduce desiccation.
Experimental Design Parameters When optimizing the biolistic process, each cell system requires special considerations. However, there are some features inherent in the process that create variation for all experiments. For example, there can be major variation between different tungsten-DNA coating events as measured by particle agglomeration and transformation efficiency. To minimize this problem, our experimental designs typically block DNA-precipitation aliquots (microcentrifuge tubes) across treatments, so that a "good" or " b a d " precipitation is not confounded with a treatment effect. In addition, we see significant fluctuations in agglomeration and transformation efficiency between days and over months. When applying the biolistic process to any species or cell type for the first time, certain basic parameters must be optimized empirically in an efficient and rational manner. In nonmicrobial systems, these parameters are best studied using a rapid series of transient gene expression experiments. In microbial systems, stable transformation experiments can be used for preliminary testing, because these can be scored very soon after bombardment. Because certain parameters naturally interact, it is logical to test such parameters using a fractional factorial design) 6 We use this design to optimize the physical parameters (power load, gap distance and target distance) of the helium gun for a new application. When we test 3 values of each of 3 parameters the fractional factorial design reduces treatment size from 27 to 13. The size of such factorial experiments is limited by how many samples can be bombarded in a single day, because we do not consider contrasts between different days to be valid. There are significant variations from shot to shot, with some shots being "failures," hence at least 3 replicates are needed per treatment (preferably 5 to 10). Using a factorial design, 13 treatments (with 5 replicates each) would require only 65 bombardments, which is a reasonable-sized experiment for a single day. The data from the fractional factorial-type experiments can be analyzed using the response surface analysis procedure of SAS (Statistical Analysis System; SAS Institute, Inc., Cary, NC). This analysis gives the combination of the three parameters that would give either a 56 O. Kempthorne, "The Design and Analysis of Experiments." Krieger, Malabar, Florida, 1983.
[36]
OPTIMIZING THE BIOLISTIC PROCESS
505
maximum or minimum response (number of transformants), Based on the results of the first experiment, a second fractional factorial experiment would follow, refining the optimum values for each parameter. The optimum conditions for the biolistic transformation of plants depends on the type of tissue to be bombarded. With intact tissues such as leaves, meristems, and cotyledons, particle penetration is often the most limiting factor and higher particle velocity may be required either by using higher power load, shorter gap distance, or shorter target distance. With cell cultures, however, cell injury is generally more limiting than particle penetration and more gentle treatments are needed. Furthermore, optimal bombardment conditions depend on whether the purpose of the experiment is for transient gene expression only (e.g., for testing promoter strength) or whether stable transformants are desired. The highest transient transformation rates are generally obtained with more violent treatments, which give better particle penetration. However, these treatments may injure cells in such a way that while they can still express the gene, they may have impaired cell division or growth. Therefore, optimal treatments for stable transformation will tend to be gentler than is optimal for transient expression studies. A general scheme for optimizing biolistic stable plant transformation is suggested below. With cell cultures, generally we screen for transient plant tranformation in our initial experiments to optimize biological parameters and then we screen stable transformation in later experiments. First, a plasmid with a strong promoter and a marker or reporter gene must be identified. We routinely use the GUS gene for transient assay experiments and the NPTII gene for selection of stable transformants. A plasmid such as p U C l l 8 without GUS or NPTII is used as a negative control. In all experimental designs, each microcentrifuge tube used for DNA-coating particles (precipitation event) should be treated as a block, and ideally the cells from different culture flasks should be randomly distributed or blocked among treatments as well. The size of an experiment that can be performed in 1 day depends on the time required for cell preparation. For example, with cell suspension cultures, 2 experienced people can bombard 100 plates in 1 day. A more comfortable experiment size is 60 plates/day. However, when cell preparation time is lengthy, such as with embryo dissection, the maximum experiment size may be only 20 plates. For the actual bombardment step, typically 15 to 30 plates can be done per hour (depending on the operator and the complexity of the experiment). In plant systems the state of the tissue and the osmoticum concentration in the bombardment medium are the two most important biological
506
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[36]
parameters to begin to optimize. Helium gun parameters that are already known to be optimum for a similar target should be used for initial experiments (see Table III).
Experiment 1 Purpose: To optimize cell type or cell stage for bombardment. 1. Prepare five to seven plates of each cell type or cell stage on appropriate medium. 2. Set helium gun parameters at 1000 psi, gap distance at 1.0 cm, target distance at 12.3 cm, and 1 cm flying disk flight distance. 3. Coat M10 particles with pBI505 plasmid (dicots) or pACGUS (monocots). 4. Bombard the plates and incubate under standard growth conditions for 2 days. 5. Stain the tissues by covering them with x-Gluc solution. The x-Gluc solution consists of 0.5 mg/ml x-Gluc dissolved in dimethyl sulfoxide (DMSO), 10 mM ethylenediaminetetraacetic acid, disodium salt (EDTA), 100 mM sodium phosphate, 0.5 mM potassium ferrocyanide, and 0.1% (v/v) Triton X-100.12 Incubate at 37 ° for 24 hr and count the number of blue expression units (blue-stained cell clusters) per bombardment.
Experiment 2 Purpose: To determine if osmoticum in the bombardment medium increases transient transformation rates. (Note: This will be further optimized in experiment 5). 1. Prepare bombardment medium with equal ratios of mannitol and sorbitol at a combined concentration of 0, 0.25, 0.5, 0.75, and 1.0 M. 2. Distribute the type of cells or tissues selected from experiment 1 onto the prepared plates. Use six plates (one unbombarded control) per treatment. Incubate for at least 1 hr. 3. Bombard and stain using the conditions described in experiment 1.
Experiment 3 Purpose: To determine optimal helium pressure and target distance for transient and stable gene transformation. (Note: For tissues with a lengthy preparation time, such as meristems, divide into two experiments, transient and stable). 1. Using the best cells or tissues and optimum osmotic treatments (determined in experiments 1 and 2), prepare 33 plates to be used for
[36]
OPTIMIZING THE BIOLISTIC PROCESS
507
transient assays and 33 plates to be used for stable selection. There will be five replicate plates per treatment plus three negative controls for both transient and stable assays. 2. Coat M10 particles with plasmid DNA containing the GUS and/or NPTII genes. 3. Bombard the plates using the gun set at three helium pressures (1000, 1300, and 1600 psi) and two target distances (5 and 12.3 cm). Incubate the plates for 2 days. 4. Stain the cells for transient assays with x-Gluc, and transfer cells for stable selection to medium with kanamycin. Determine the best treatments based on the number of blue expression units or kanamycin-resistant colonies/plants.
Experiment 4 Purpose: To determine the optimal combination of flying disk flight distance and helium pressure for transient and/or stable gene transfer. (Again, this experiment may be divided into two parts.) I. Using the best tissue and osmoticum concentration (determined in experiments 1 and 2), prepare 48 plates to be used for transient assays and 48 plates to be used for stable selection. There will be five replicate plates per treatment plus three negative controls for both transient and stable assays. 2. Coat M10 particles with plasmid DNA containing the GUS and/or NPTII genes. 3. Bombard the plates using three pressures (ranging from the best pressure determined inexperiment 3, up to 2000 psi), three flying disk flight distances (0, 1, and 2 cm) and the best target distance determined in experiment 3. Incubate the plates for 2 days, stain with x-Gluc or transfer to kanamycin medium, and count the number of blue expression units or kanamycin-resistant colonies/plants obtained.
Experiment 5 Purpose: To optimize the concentration of osmoticum in the bombardment medium for stable transformation. Experimental design will be the same as in experiment 2 but stable transformation will be evaluated. Experiment 6 Purpose: To determine the best particle type (tungsten or gold) for stable transformation.
508
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[36]
When attempting to biolistically transform a bacterium, osmoticum concentration is the most important biological parameter. Selecting the wrong osmoticum concentration for the initial experiments can mean the difference between 0 and 2000 transformants per plate. Begin by using physical gun parameters (power load, 1000 psi; gap distance, 1.0 cm; target distance, 6.0 cm) and biological parameters (growth phase, logarithmic; cell density, 2 x l 0 9 cfu/plate) that are already optimized for E. coli JA221. 32 In the first experiment determine the range of osmoticum that produces transformants. When we used this approach to transform E. amylovora, E. stewartii, P. syringae pv. syringae, and A. tumefaciens we were able to transform cells in our initial experiment and determine a range of osmoticum for successful transformation. 32 Biolistic transformation of bacteria differs from plant transformation in that M5 tungsten particles are used as well as a helium flush of the vacuum chamber. Prior to the first bombardment experiment, a method for selecting transformants must be chosen. Either direct selection (auxotrophic marker or antibiotic marker) or indirect selection (agar overlay containing antibiotic for antibiotic marker, or pagar for antibiotic markers) can be used. Also, an upper limit of osmotic concentration can be determined that allows growth of the recipient bacterium, narrowing the range of concentrations to be tested.
Bacterial Experiment 1 Purpose: To determine the approximate range of o smoticum necessary for transformation of the bacterium. 1. Prepare selective medium with 0 M osmoticum, three treatments of sorbitol, and three treatments of mannitol at concentrations between 0 M and a concentration close to the concentration that prevents growth. Use 3 plates and 1 control per treatment, a total of 28 plates. 2. Spread 1 x 10 9 cells/plate from a logarithmic growth culture and allow the plates to dry slowly before bombardment. 3. Control plates are prepared by mixing the DNA-coated tungsten with bacterial cells, which are then spread on the plate surface. The control plates are exposed to vacuum only and no helium blast. 4. Set the helium gun parameters: 1000 psi; gap distance, 1.0 cm; target distance, 6.0 cm. 5. Coat M5 tungsten particles with plasmid DNA. 6. Bombard plates, incubate at appropriate temperature, count putative transformants, and determine whether sorbitol or mannitol produces more transformants per plate and the approximate optimum concentration range.
[36]
OPTIMIZING THE BIOLISTIC PROCESS
509
7. Transformation can be confirmed by plasmid isolation, restriction digest, and visualization by agarose gel electrophoresis. Bacterial Experiment 2 Purpose: Optimize biolistic parameters. Prepare a fractional factorial design experiment to determine the optimum helium gun parameters. Test helium pressure (1000, 1300, and 1600 psi), target distance (6.0, 9.2, and 12.3 cm), and gap distance (low, middle, and high). Use medium that contains the osmoticum concentration determined in experiment 6a to give the greatest number of transformants per plate. Repeat using parameters suggested by the results of experiment 6b. Using the optimum parameters determined in experiments 6a and 6b, optimize the biological parameters in the following experiments. Bacterial Experiment 3 Purpose: Optimize the osmoticum concentration. Bacterial Experiment 4 Purpose: Optimize the culture growth phase (early, middle and late logarithmic, and stationary). Bacterial Experiment 5 Purpose: Optimize the cell density per plate. Summary The biolistic process is still rapidly evolving. We do not anticipate further major improvements in biolistic apparatus. There will probably still be further major improvements in particles, DNA coating, and vectors, as well as significant further advances in understanding of biological determinants of cell penetration and survival. The technology has currently reached the point at which it can be readily and reliably used for a wide range of applications. Given the information presented in this chapter, new applications can be optimized fairly readily. Acknowledgments This work was supported by a grant from Du Pont. J.A.R. was supported by the Cornell NSF Plant Science Center, a unit in the USDA-DOE-NSF Plant Science Centers Program and a unit of the Cornell Biotechnology Program, which is sponsored by the New York State Science and Technology Foundation, a consortium of industries, and the U.S. Army Research Office.
510
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[37] Chloroplast T r a n s f o r m a t i o n in
[37]
Chlamydomonas
By JOHN E. BOYNTON and NICHOLAS W. GILLHAM Introduction
Successful chloroplast transformation was first reported by Boynton and co-workers in 1988 ~ for the unicellular green alga, Chlamydomonas reinhardtff, using the biolistic method developed by J. Sanford and colleagues.2'3 This alga, which contains a single large, cup-shaped chloroplast with approximately 80 copies of its 196-kb circular genome, 4 proved to be an ideal model system for a number of reasons. Chloroplast gene mutations conferring resistance to antibacterial antibiotics are easily selected 5,6 and chloroplast mutations resulting in photosynthetic defects are readily isolated in C. reinhardtii as acetate-requiring strains. 7,s Nonphotosynthetic mutants resulting from deletions in the chloroplast atpB and psbA genes 9,1° proved to be excellent transformation recipients. They were nonreverting, allowed recovery of rare photosynthetically competent isolates on minimal medium, and permitted easy detection of integrated donor sequences. ~,ll The ability to recover rare transformants resulting unequivocally from stable integration of homologous donor sequences into the recipient chloroplast genome was a tremendous asset in overcoming the uncertainties I j. E. Boynton, N. W. Gillham, E. H. Harris, J. P. Hosler, A. M. Johnson, A. R. Jones, B. L. Randolph-Anderson, D. Robertson, T. M. Klein, K. B. Shark, and J, C. Sanford, Science 240, 1534 (1988). 2 T. M. Klein, E. D. Wolf, R. Wu, and J. C. Sanford, Nature (London) 327, 70 (1987). J. C. Sanford, T. M. Klein, E. D. Wolf, and N. Allen, Part. Sci. Technol. 5, 27 (1987). 4 E. H. Harris, "The Chlamydomonas Sourcebook." Academic Press, San Diego, 1989. 5 E. H. Harris, J. E. Boynton, and N. W. Gillham, in "Methods in Chloroplast Molecular Biology" (M. Edelman, R. B. Hallick, and N.-H. Chua, eds.), p. 3. Elsevier, Amsterdam, 1982. 6 E. A. Wurtz, B. B, Sears, D. K. Rabert, H. S. Shepherd, N. W. Gillham, and J. E. Boynton, Mol. Gen. Genet. 170~ 235 (1979). 7 p. Bennoun and P. Delepelaire, in "Methods in Chloroplast Molecular Biology" (M. Edelman, R. B. Hallick, and N.-H. Chua, eds.), p. 25. Elsevier, Amsterdam, 1982. 8 H. S. Shepherd, J. E. Boynton, and N. W. Gillham, Proc. Natl. Acad. Sci. U.S.A. 76, 1353 (1979). 9 A. M. Myers, E. H. Harris, N. W. Gillham, and J. E. Boynton, Curr. Genet. 8, 369 (1984). i0 j. D. Palmer, J. E. Boynton, N. W. Gillham, and E. H. Harris, in "The Molecular Biology of the Photosynthetic Apparatus," (K. E. Steinback, S. Bonitz, C. J. Arntzen and L. Bogorad, eds.) p. 269. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1985. il j. E. Boynton, N. W. Gillham, S. M. Newman, and E. H. Harris, Adv. Plant Gene Res. 6, 3 (1992).
METHODS IN ENZYMOLOGY,VOL. 217
Copyright © 1993by AcademicPress, Inc. All rightsof reproductionin any form reserved.
[3 7]
CHLOROPLAST TRANSFORMATION
51 1
that clouded previous attempts at chloroplast transformation in higher plants.12 These experiments had depended on introduction of a foreign drug resistance marker into wild-type cells by Ti-mediated transformation or by polyethylene glycol (PEG)-Mg z+ treatment of protoplasts. Expression of drug resistance was assessed initially in callus tissue and subsequently in regenerated plants. While nuclear gene transformants in higher plants have been obtained with considerable success over the past decade, using a variety of methods for introducing the donor DNA, chloroplast and mitochondrial transformation lagged far behind. Two problems unique to transformation of cellular organelles had to be resolved. First, methods for delivery of donor DNA across the double-membrane envelope separating the organelle from the cytoplasm had to be developed. Second, expression of rare introduced donor sequences in the highly polyploid background in chloroplasts of the recipient cells had to occur at an appreciable frequency. Approximately 80 chloroplast genomes are present in the single chloroplast of each Chlamydomonas cell, and a tobacco leaf cell may contain up to 100 chloroplast genomes in each of its approximately 100 chloroplasts, although marked deviations around these mean values probably occur in both cases. The biolistic particle delivery system, 2'3,13 in which DNA-coated microprojectiles were shot into recipient cells at high velocity circumvented both problems. 14Once appropriate particle size and propellant charge had been determined, this technique permitted delivery of DNA across both the cell and organelle membranes. Furthermore, because each particle carries multiple copies of the donor DNA, enough copies of the selectable marker gene can be introduced into the recipient cell to increase the probability of expressing that gene in a background of the many resident copies of the recipient genome. The ability to manipulate chloroplast genome number downward in Chlamydomonas by growing the cells in 5-fluorodeoxyuridine (FdUrd) 15further improves the chances of isolating transformants.16 Since the first report of chloroplast transformation in C. reinhardtii in 1988, a more than 15 papers using this technique with this alga will have been published by the end of 1991. At the October 1991 Congress of the International Society for Plant Molecular Biology, 19 abstracts involved i., M. A. Haring and M. De Block, Physiol. Plant. 79, 218 (1990). 13 j. C. Sanford, Physiol. Plant. 79, 206 (1990). 14 R. A. Butow and T. D. Fox, Trends Bioehem. Sci. 15, 465 (1990). It E. A. Wurtz, J. E. Boynton, and N. W. Gillham, Proc. Natl. Acad. Sci. U.S.A. 74, 4552 (1977). 16 j. E. Boynton, N. W. Gillham, E. H. Harris, S. M. Newman, B. L. Randolph-Anderson, A. M. Johnson, and A. R. Jones, in "Current Research in Photosynthesis" (M. Baltscheffsky, ed.), Vol. III, p. 509. Kluwer Academic, The Hague, The Netherlands, 1990.
512
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[37]
chloroplast transformation in this alga. Transformation technology has proved generally useful for studying the regulation of chloroplast gene expression, ~7-:9 chloroplast protein structure and function, 3°-44 processes involved in chloroplast gene recombination, 45-48 and for disrupting the function of specific chloroplast g e n e s . 46'49-56 Moreover, the biolistic methodology developed for stable chloroplast transformation in Chlamydomonas has been successfully adapted for transformation of the organelle in tobacco leaves, using similar antibiotic resistance chloroplast markers, to 17 A. D. Blowers, G. S. Ellmore, U. Klein, and L. Bogorad, Plant Cell 2, 1059 (1990). 18 F. DOrrenberger and J.-D. Rochaix, EMBO J. 10, 3495 (1991). 19 F. Dfirrenberger and J.-D. Rochaix, Int. Congr. Int. Soc. Plant Mol. Biol. 3rd abstr. 2000 (1991). 2o M. Goldschmidt-Clermont, Y. Choquet, J. Girard-Bascou, F. Michel, M. SchirmerRahire, and J.-D. Rochaix, Cell 65, 135 (1991). 21 M. Goldschmidt-Clermont, Y. Takahashi, and J.-D. Rochaix, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 1997 (1991). 22 C. R. Hauser, J. E. Boynton, and N. W. Gillham, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 1934 (1991). 23 J.-D. Rochaix, M. Goldschmidt-Clermont, Y. Choquet, Y. Takahashi, and J. GirardBascou, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 199 (1991). 24 W. Sakamoto, X. Chen, K. L. Kindle, and D. B. Stern, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 1941 (1991). 25 D. B. Stern, E. R. Radwanski, and K. L. Kindle, Plant Cell 3, 285 (1991). 26 D. B. Stern, H.-C. Chen, W. Sakamoto, X. Chen, Q. Chen, C. Adams, and K. Kindle, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 192 (1991). 27 A. J. Thompson and D. L. Herrin, Int. Congr. Int. Soc. Plant Mol. Biol., 3rdabstr. 219 (1991). 28 A. J. Thompson and D. L. Herrin, Nucleic Acids Res. 19, 6611 (1991). 29 U. Klein, J. D. De Camp, and L. Bogorad, Proc. Natl. Acad. Sci. U.S.A. 89, 3453 (1992). 30 A. Avni, J. D. Anderson, J.-D. Rochaix, and M. Edelman, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 195 (1991). 31 S. E. Bingham and A. N. Webber, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 2001 (1991). 32 V. A. Dahms, I. M. Baroli, and A. R. Crofts, Int. Congr. Int. Soc. PlantMol. Biol., 3rd abstr. 2028 (1991). 33 j. M. Erickson, A. Domain, and J. Whitelegge, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 180 (1991). 34 p. B. Gibbs, S. E. Bingham, and A. N. Webber, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 1872 (1991). 35 A. Lers, P. B. Heifetz, E. Gross, J. E. Boynton, N. W. Gillham, and B. Osmond, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 1861 (1991). 36 R. A. Roffey, J. H. Golbeck, C. R. Hille, and R. T. Sayre, Proc. Natl. Acad. Sci. U.S.A. 88, 9122 (1991). 37 j. Whitelegge, T. Maung, S. Tahtakran, and J. M. Erickson, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 1865 (1991). 38 G. F. Wildner, G. Zhu, R. G. Jensen, and R. B. Hallick, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 1998 (1991). 39 R. Xu, S. E. Bingham, and A. N. Webber, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 1961 (1991).
[37]
CHLOROPLAST TRANSFORMATION
513
produce transformed calli and ultimately whole plants. 57-61 Chloroplast transformation has also been reported in tobacco protoplasts following introduction of similar chloroplast antibiotic resistance markers by PEG fusion. 6z In addition, transient expression of foreign genes, such as the uidA gene encoding/3-glucuronidase (GUS) under the control of chloroplast promoters, has been described in tobacco cells, callus, and leaves using the biolistic delivery system by Daniell and colleagues. 63 Strategies for Chloroplast Transformation
Choice of Appropriate Donor Plasmids and Recipient Strains. Initially, most chloroplast transformation protocols have involved the use of combi40 E. Przibilla, S. Heiss, U. Johanningmeier, and A. Trebst, Plant Cell 3, 169 (1991). 4~ A. Lers, P. B. Heifetz, J. E. Boynton, N. W. GiUham, and C. B. Osmond, J. Biol. Chem. 267, 17494 (1992). 42 S. Schrader and U. Johanningmeier, Plant Mol. Biol. 19, 251 (1992). 43 S. E. Bingham, R. Xu, and A. N. Webber, FEBS Lett. 292, 137 (1991). 44 y . Chouquet, M. Rahire, J. Girard-Bascou, J. Erickson, and J.-D. Rochaix, EMBO J. 11, 1697 (1992), 45 S. M. Newman, J. E. Boynton, N. W. Gillham, B. L. Randolph-Anderson, A. M. Johnson, and E. H. Harris, Genetics 126, 875 (1990). *~ S. M. Newman, N. W. Gillham, E. H. Harris, A. M. Johnson, and J. E. Boynton, Mol. Gen. Genet. 230, 65 (1991). 4v S. M. Newman, E. H. Harris, A. M. Johnson, J. E. Boynton, and N. W. Gillham, Genetics 132, 413 (1992). 48 S. M. Newman, J. E. Boyton, E. H. Harris, and N. W. Gillham, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 2027 (1991). 49 M. Goldschmidt-Clermont, Nucleic Acids Res. 19, 4083 (1991). 50 K. L. Kindle, K. L. Richards, and D. B. Stern, Proc. Natl. Acad. Sci. U.S.A. 88, 1721 (1991). 51 y . Takahashi, M. Goldschmidt-Clermont, S.-Y. Soen, L. G. Franzen, and J.-D. Rochaix. EMBO J. 10, 2033 (1991). 52 j. y . Suzuki and C. E. Bauer, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 1999 (1991). 53 j. y . Suzuki, and C. E. Bauer, Plant Cell 4, 929 (1992). 54 S. Leu, J. Schlesinger, R. Motzery, A. Michaels, and N. Shavit, personal communication. 55 F.-A. Wollman, L. Bult6, O. Vallon, and R. Kuras, personal communication. 56 W. Sakamoto, N. Sturm, S. B0schlen, K. Kindle, F.-A. Wollman, and D. Stern, personal communication. 57 Z. Svab, P. Hajdukiewicz, and P. Maliga, Proc. Natl. Acad. Sci. U.S.A. 87, 8526 (1990). 58 p. Maliga, Trends Biotechnol. in press. 59 p. Maliga, J. Staub, H. Carrer, P. Hajukiewicz, R. Malone, and Z. Svab, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 200 (1991). 6o j. M. Staub and P. Maliga, Plant Cell 4, 39 (1992). 6L j. M. Staub and P. Maliga, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 1994 (1991). 62 G. V. Horvath, C. O'Neill, P. J. Dix, and P. Medgyesy, Int. Congr. Plant Mol, Biol., 3rd abstr. 1996 (1991). 63 H. Daniell, this volume [38].
514
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[37]
nations of homologous, selectable alleles in the donor and recipient DNAs from C. reinhardtii. In these cases, chloroplast transformation normally occurs by homologous gene replacement, apparently involving a doubleexchange event between the chloroplast sequences in the donor D N A and corresponding sequences in the recipient chloroplast genome, u,45,64 thus excluding plasmid sequences from integration. While any pBR- or pUCderived plasmid can serve as the vector, care should be taken to ensure that the selectable chloroplast marker carried by the donor D N A is flanked by regions of homology with the recipient chloroplast genome. The recipient strain for the initial chloroplast transformation experiments in Chlamydomonas was a nonphotosynthetic mutation, ac-u-c-2-21 (CC-373), with a 2.5-kb deletion affecting the 3' half of the chloroplast atpB gene and extending into the inverted repeat. J The donor D N A was a 7.6-kb chloroplast fragment cloned in pBR313 that carried the wild-type atpB gene and had homology to sequences located on either side of the deletion in the recipient genome. Transformants selected for restored photosynthesis were shown to have integrated the donor chloroplast D N A sequences correctly into the recipient chloroplast genome by homologous recombination. No evidence was found for integration of plasmid sequences or for nonhomologous (illegitimate) integration. Mutants with lesions in a number of chloroplast genes required for photosynthesis 1~(Table I) can serve as suitable recipient strains for chloro-
64 j. E. Boynton, N. W. Gillham, S. M. Newman, E. H. Harris, A. M. Johnson, and B. L. Randolph-Anderson, Int. Congr. Int. Soc. Plant Mol. Biol., 3rd abstr. 7 (1991). 65 C. Roitgrund and L. Mets, Curr. Genet. 17, 147 (1990). 66 j. Girard-Bascou, Y. Choquet, M. Delosme, and M. Dron, Curr. Genet. 12, 489 (1987). 67 M. Goldschmidt-Clermont, Y. Choquet, J. Girard-Bascou, M. Michel, M. SchirmerRahire, and J.-D. Rochaix, Cell 65, 135 (1991). 68 y. Choquet, M. Goldschmidt-Clermont, J. Girard-Bascou, U. K/ick, P. Bennoun, and J.-D. Rochaix, Cell 52, 903 (1988). 69 J.-D. Rochaix, M. Kuchka, S. Mayfield, M. Schirmer-Rahire, J. Girard-Bascou, and P. Bennoun, EMBO J. 8, 1013 (1989). 70 j. M. Erickson, M. Rahire, P. Malnoe, J, Girard-Bascou, Y. Pierre, P. Bennoun, and J.-D. Rochaix, EMBO J. 5, 1745 (1986). 71 D. Robertson, J. E. Boynton, and N. W. Gillham, Mol. Gen. Genet. 221, 155 (1990). 72 C. Lemaire and F.-A. Wollman, J. Biol. Chem. 264, 10235 (1989). r3 R. J. Spreitzer, M, Goldschmidt-Clermont, M. Rahire, and J.-D. Rochaix, Proc. Natl. Acad. Sci. U.S.A. 82, 5460 (1985). 74 X.-Q. Liu, N. W. Gillham, and J. E. Boynton, J. Biol. Chem. 264, 16100 (1989). 75 S. Leu, J. Schlesinger, A. Michaels, and N. Shavit, Plant Mol. Biol. 18, 613 (1992). 76 S. Biischlen, Y. Choquet, R. Kuras, and F.-A. Wollman, FEBS Lett. 284, 257 (1991). 77 C. R. Hauser, J. E. Boynton, and N. W. Gillham, unpublished observations (1992). 78 S. L. Baldauf and J. D. Palmer, Nature (London) 344, 262 (1990).
[371
CHLOROPLAST
TRANSFORMATION
5 15
ca
T
>,
<
z, r,
e.~
ca
o ca
==
_5 ka Z Z ©
eaO
•
~ ~ ~ ~
~-
©
ca~
a::
~= o o o o : ~
o o
o
o o oo
o o"~
©
o~
Z < ~1 ca
ca
~
~
~
~,
ca
~
ca
0
ca
•
0
{-
..~°°~~
oooo
ooca
cacaca
~
~
~caca
© 0 .d ~r
"~ o
o
~ZZZ~
o
~
oo
ZZ
o
z
o o o o
z z z z
.~
~
,.,,:
~
E
o 0
<
Z
q- ,-a ~ ¢4
<
•~ _m
ca ca
a:a
," o o = 0 "0
'7,
.g
&
516
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[37]
plast transformation. Cells expressing the complementing wild-type gene are easily selected by plating the population of transformed cells on minimal medium at high density ( - 5 × 106/plate). The nature of the genetic lesion in most of these photosynthetically defective mutants is known and the corresponding wild-type genes have been cloned. This repertoire of recipient strains with defined photosynthetic lesions will likely increase in the near future as null insertion and deletion mutations are created by targeted disruption of additional chloroplast genes. 46,49,51 Alternatively, wild-type recipient strains can be transformed with cloned chloroplast genes encoding antibiotic or herbicide resistance mutations. 11,16,40,45Transformants are readily selected by plating at high density on the appropriate medium.
Reduction of Chloroplast Genome Copy Number in Recipient Cells. In C. reinhardtff and closely related strains, growth of cells in the presence of 0.5 mM FdUrd appears to block chloroplast DNA replication selectively, resulting in up to a 10-fold reduction in the number of chloroplast genomes per cell over six to seven cell generations. 15 This substantial reduction in chloroplast ploidy has little effect on autotrophic growth or synthesis of specific chloroplast polypeptides. 79 However, the FdUrdinduced reduction in chloroplast genome number is accompanied by an increase in the frequency of certain classes of chloroplast transformants (i.e., those involving deletions and antibiotic or herbicide resistance). 16,45,46 While FdUrd also induces chloroplast mutations,6'8 one can show unequivocally using restriction fragment length polymorphism (RFLP) markers that these account for a very small fraction of the isolates selected following transformation. 45 A specific reduction in the level of chloroplast ploidy in a higher plant, Solanum nigrum, has also been achieved by growth of suspension cultures in the presence of the DNA gyrase inhibitors nalidixic acid and novobiocin, which selectively reduce chloroplast DNA content. 8° Whether these inhibitors can be used to increase frequencies of chloroplast transformants of higher plants remains to be established. Meristematic tissue containing proplastids or suspension cultures prepared from protoplasts may prove to be especially favorable material for chloroplast transformation, because both the number of plastids per cell and the number of genomes per plastid are reduced in these cells. 58,81'8z
79 j. p. Hosler, E. A. Wurtz, E. H. Harris, N. W. Gillham, and J. E. Boynton, Plant Physiol. 91, 648 (1989). 80 j. Ye and R. T. Sayer, Plant Physiol. 94, 1477 (1990). 81 R. M. Leech and K. A. Pyke, in "The Division and Segregation of Organelles" (S. A. Boffey and D. Lloyd, eds.), p. 39. Cambridge Univ. Press, Cambridge, England, 1988. 82 M. R. Thomas and R. J. Rose, Planta 158, 329 (1983).
[37]
CHLOROPLAST TRANSFORMATION
517
Use of Donor Plasmids and Recipient Strains with Chloroplast RFLP Markers. The chloroplast genomes of all mutant strains of C. reinhardtii derived from wild-type strain 137C4 [ e . g . , CC- 124 (rot ~) and CC- 125 (m t + )] are readily distinguishable based on RFLP markers from that of interfertile isolates containing the Chlamydomonas smithii chloroplast genome [CC1852 (mr-) and CC-1373 (mt÷)] and from several C. reinhardtii isolates obtained from the wild. 83 The well-characterized chloroplast genomes of C. reinhardtii and C. smithii are colinear and differ by RFLPs that are created by variation in the number of short dispersed repeat sequences found in most intergenic regions. 1°'~1'45When the recipient strain and the insert in the donor plasmid differ by such linked RFLPs, a putative transformant can be distinguished unequivocally from a new mutation using these physical markers. Introduction of new RFLP markers within the coding or flanking sequences of the donor DNA by site-directed mutagenesis is often possible without altering the function or expression of the gene in question. Such a multiply marked plasmid has been used effectively for studying the events accompanying integration of donor sequences during chloroplast transformation of tobacco. 6°'61 Selection and Identification of Transformants vs New Mutations. Because most existing nonphotosynthetic and all known antibiotic and herbicide resistance mutations result from single-base pair changes 11 (Table I), the problem of distinguishing reversions to photosynthetic competence or forward mutations to antibiotic resistance from bona fide transformants can become acute. In the case of point mutations affecting either photosynthetic function or causing resistance to antibiotics or herbicides, a linked RFLP marker on the donor fragment is required to discriminate between new mutations arising in the recipient and bona fide transformants. In certain cases, such as the DCMU4 mutation to herbicide resistance, 84 the base pair mutation itself creates a scoreable RFLP. Alternatively, use of wild-type recipient and donor strains, in which the gene in question is closely flanked by easily identified RFLP markers, can also eliminate ambiguity in distinguishing newly arising mutations from transformants. In the case of the antibiotic resistance markers in the chloroplast rRNA genes, simultaneous selection for two linked resistance markers on the donor plasmid effectively eliminates the problem of spontaneous resistance mutations with similar phenotypes because double mutations are vanishingly rare. 16,45If necessary, a single antibiotic resistance phenotype
83 E. H. Harris, J. E. Boynton, N. W. Gillham, B. D. Burkhart, and S. M. Newman, Arch. Protistenkd. 139, 183 (1991). 84 j. M. Erickson, M. Rahire, J.-D. Rochaix, and L. Mets, Science 228, 204 (1985).
518
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
13 7]
can be used for selection when the spontaneous mutation frequency is low, as in the case of spectinomycin resistance. 6,45 Homologous Gene Replacement, Cointegrate Formation, and Persistence o f Free Plasmid. As long as the donor DNA has regions homologous to the recipient chloroplast genome on either side of the selectable marker(s), integration during chloroplast transformation always appears to occur by homologous gene replacement. Integration events have been studied in detail using antibiotic resistance mutations in the chloroplast rRNA genes and linked R F L P markers in C. reinhardtii. 45 A strong bias was found for the exchange events to occur near the ends of the chloroplast donor insert, with about 90% of the events occurring within 850 bp of the vector-insert junctions. 45 Thus, the entire donor fragment, but none of the vector sequences, are integrated. Similar results have been observed for chloroplast transformants of tobacco. 6°'61 Whether integration actually involves two breakage and reunion events between the donor fragment and recipient genome, or whether it occurs by a unidirectional gene conversion mechanism, remains to be established. To date, vector sequence integration into the chloroplast genome has been observed in a single case, in which the chloroplast donor sequence had homology only to one side of the deletion mutation in the recipient. 1~.16 A model involving formation of a cointegrate resulting from a singleexchange event in the region of homology shared by the two circular DNAs best explains the observed DNA phenotype of the resulting transformants. The single region of homology between donor and recipient was duplicated in the process as predicted. These transformants, in which a psbA deletion mutation defective in photosynthesis (CC-744) was complemented with a cloned psbA gene from a herbicide resistance mutant, remained heteroplasmic for cointegrate and mutant recipient genomes over many generations when selected for photosynthetic competence. When selection on heteroplasmic isolates was relaxed by transfer to acetate medium in dim light, the cointegrate genomes were rapidly lost and isolates homoplasmic for the original psbA deletion mutation were recovered. However, prolonged subculturing under photosynthetic conditions resulted in certain homoplasmic lines that contained only chloroplast genomes with herbicide-resistant psbA genes. While the vector sequences were retained in these homoplasmic isolates, one copy of the region initially duplicated was excised. These results predict that integration of vector sequences adjacent to any chloroplast gene can be controlled by using a donor-recipient combination that shares a region of homology only at one end of the selectable marker. In the initial atpB transformation experiments] the donor pBR313 plasmid containing the chloroplast insert was observed to persist for many
[37]
CHLOROPLAST TRANSFORMATION
5 19
generations in rapidly dividing recipient cells grown in selective ( H S ) 4 liquid medium. These cells had also integrated wild-type atpB genes into their chloroplast genomes by homologous gene replacement. If the transformed cells were transferred to solid HS medium, the free plasmids were lost by the time sufficient cell divisions had occurred to permit DNA isolation, but the integrated atpB genes were retained. There is as yet no proof that the free plasmids that persisted in the transformed cells grown in liquid culture were localized in the chloroplast. However, one presumes that they may have replicated in the chloroplast using the pBR origin of replication, because the Barn HI chloroplast insert (Barn 10) in this plasmid does not contain either of the mapped origins of chloroplast DNA replication in Chlamydomonas. 85-87 If a foreign selectable marker, such as the bacterial aadA gene encoding an enzyme that detoxifies spectinomycin, 49 can be expressed in a pBR-derived plasmid lacking chloroplast DNA sequences, one suspects that suitable autonomously replicating vectors could be constructed without difficulty for Chlamydomonas. Materials
Available Recipient Strains and Donor Plasmids. Table I lists recipient mutant strains potentially useful for chloroplast transformation, their gene products, and selection methods. Virtually all of these recipient strains and many of the clones containing wild-type and mutant donor genes are available from the Chlamydomonas Genetics Center [Department of Botany, Duke University, Durham NC 27706; Dr. E. H. Harris, Director; telephone, (919) 684-5243; fax, (919) 684-5412; E-mail, Chlamy@ ACPBU.DUKE.EDU]. In addition, the protocols developed for targeted disruption of chloroplast genes encoding specific photosynthetic polypeptides (see below) should soon provide a collection of null mutations for these and other chloroplast genes involved in photosynthesis. In theory, these null mutants should prove to be equally suitable recipients for future chloroplast transformation experiments as the known deletion mutants and far more effective as recipients than most of the point mutations with defects in photosynthesis. Because "popout" of the disrupting sequence is exceedingly rare, 88 they are also nearly as stable as deletion mutations. For the purpose of homologous gene replacement any pBR-, pUC-, or pBluescript-derived plasmid containing the selectable marker of interest 85 j. Waddell, X.-M. Wang, and M. Wu, Nucleic Acids Res. 12, 3843 (1984). 86 X.-M. Wang, C. H. Chang, J. Waddell, and M. Wu, Nucleic Acids Res. 12, 3857 (1984). 87 M. Wu, J. K. Lou, D, Y. Chang, C. H. Chang, and Z. Q. Nie, Proc. Natl. Acad. Sci. U.S.A. 83, 6761 (1986). 88 S. M. Newman, J. E. Boynton, and N. W. Gillham, unpublished observations (1992).
520
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[37]
should suffice. Although inserts of - 1 0 kb can be integrated, these are often tedious to manipulate experimentally. Specialized vectors are presently necessary only for expression of foreign genes (see below) and for nonintegrative transformation. Delivery Systems. The biolistic particle gun designed by J. Sanford and colleagues at Cornell University 2'3 was used for the original chloroplast transformation experiments in Chlamydomonas j and tobacco. 57 The instrument was initially marketed by Du Pont (Biotechnology Systems Division, Wilmington, DE) as the PDS-1000 particle delivery system and was licensed to Bio-Rad (Richmond, CA) by the Du Pont Agricultural Products Division. The PDS-1000 was refitted with a helium acceleration system in the fall of 1990 to replace the 22-caliber blank gunpowder charges (PDS1000/He), and gold microcarriers were substituted for the original tungsten microprojectiles for DNA delivery. The design improvements, which circumvent potential toxicity problems of gunpowder and tungsten residues on the shot plates, generally increase the transformation frequencies for chloroplast genes. Other biolistic particle delivery systems of differing design have been developed for transformation in various laboratories. For example, the instrument constructed by J.-D. Rochaix and colleagues in Geneva 89 has been used successfully by that group for chloroplast transformation over the past several years. Technology under development for chloroplast transformation in Chlamydomonas includes aerosol beam microinjection, 9° an air gun, 28 and an ultraviolet (UV) laser microbeam. 91 Chloroplast transformation in Chlamydomonas has also been achieved by agitating wall-deficient cells with 0.4- to 0.5-mm glass beads in the presence of donor DNA, 5° a method that is highly effective for nuclear gene transformation. 92 This procedure involves vortexing 4 × 10 7 cells in 0.4 ml of HSA culture medium 4 with 300 mg of 0.4- to 0.5-mm glass beads and 1-20/zg donor plasmid DNA for 15-30 sec at top speed. Recipient cells were either a cell wall-deficient mutant (e.g., cw-15, CC-400, or CC406), or wild type stripped of vegetative walls using an autolysin preparation made from mating gametes. 4 In spite of the ease and simplicity of this method, the frequency of chloroplast transformants obtained is substantially lower and less reproducible than that routinely observed using the biolistic method. Attempts by C. Hauser in our laboratory to use electroporation to 89 G. Zumbrunn, M. Schneider, and J.-D. Rochaix, Technique 1, 204 (1989). 9o L. Mets, manuscript in preparation. 91 G. Weber, S. Monajembashi, K.-O. Greulich, and J. Wolfrum, Eur. J. Cell Biol. 49, 73 (1989). 95 K. L. Kindle, Proc. Natl. Acad. Sci. U.S.A, 87, 1228 (1990).
[37]
CHLOROPLASTTRANSFORMATION
521
transform an atpB deletion mutant of Chlamydomonas (ac-u-c-2-21, CC373), grown in the presence of FdUrd, to photosynthetic competence with the cloned wild-type gene have yielded equivocal results. Using the BioRad gene pulsar system, 400/xl of cells at 1 × 108/ml in EP buffer [10 mM Tris, pH 8, 50 mM NaCI, 1 mM ethylenediaminetetraacetic acid (EDTA), 5 mM CaClz, 0.2 M mannitol] were singly and doubly pulsed in the presence of 20/xg/ml of the cloned wild-type atpB gene (0.3 to 0.8 kV at 960 tzF). After 1 week, numerous small, pale green colonies appeared on minimal medium, but these failed to grow on transfer to fresh minimal medium, suggesting transient complementation of the nonphotosynthetic phenotype. When colonies were cultured in permissive acetate-containing medium, no integration of donor sequences could be detected by polymerase chain reaction (PCR) using primers flanking the deletion in the recipient strain. Media for Growth and Selection of Transformants. Formulations of all solid and liquid media for Chlamydomonas have been described by Harris. 4 Wild-type, photosynthetically competent cells of Chlamydomonas are usually grown in liquid cultures of minimal (HS) medium provided with high light [-400 /xmol photons/m 2 per second photosynthetically active radiation (PAR)] and 5% (v/v) CO2. Mutants deficient in photosynthesis, which must be supplied with sodium acetate as a reduced carbon source, are grown on HSA or TAP medium 4 in dim light (3/xmol photons/ m 2 per second PAR). Photosynthetically competent transformants of nonphotosynthetic mutants are selected by plating the cells on HS minimal medium in moderate light (80/xmol photons/m 2 per second PAR). Wildtype cells transformed with the DCMU4 herbicide resistance marker in the psbA gene are selected on HS plates containing 1.5 txM 3-(3,4-dichlorophenyl)-l,l-dimethylurea (DCMU) under moderate light. Wild-type cells transformed to antibiotic resistance are generally selected o n H S H A 4 plates containing 100/xg/ml spectinomycin, 100/xg/ml streptomycin, or 200/xg/ml erythromycin singly or in combination, depending on the particular resistance markers in the donor DNA. All plates used for selection of transformants also contain 50/xg/ml ampicillin to reduce the prospects of bacterial contamination. These plates can be incubated in either moderate or dim light. Methods for Biolistic Transformation
Growth and Preparation of Recipient Cells. The standard protocol for chloroplast transformation in our laboratory utilizes recipient cells grown to midlog phase (2-4 x 10 6 cells/ml) in 300-ml liquid shake cultures (HS medium plus 5% CO2 or H S H A plus air in bright light for wild type;
522
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[37]
H S H A or TAP medium plus air in dim light for mutations impaired in photosynthesis). When cells are grown in 0.5 mM FdUrd-containing medium to reduce the number of copies of their chloroplast genomes, 6,15 the cultures are inoculated at - 5 x 104 cells/ml and grown to late log phase ( ~ 5 - 1 0 × 10 6 cells/ml). Cells are pelleted by centrifugation (16,300 g) at 20° for 8 min and resuspended to a density of 1.14 × 108/ml in HSHA medium, 1-ml aliquots are diluted 1 : 1 with 0.2% Difco (Detroit, MI) agar in HS medium at 42 °, and two 0.7-ml aliquots containing 4 × 10 7 cells each are dispersed on the surfaces of 10-cm diameter petri plates of solid H S H A medium that are relatively dry, having stood for at least 3 days at room temperature prior to plating. 45Chlamydomonas will withstand 42 ° for only I to 2 min, so one must work rapidly after adding the cell suspension to the warm agar. Petri plates are gently swirled on the bench surface to disperse top agar evenly and then covered with aluminum foil for 2-3 hr to prevent the cells from swimming toward the light while the agar solidifies and the plates dry, This procedure yields a uniform monolayer of cells embedded in 0.1% (w/v) top agar on the surface of the HSHA medium. One to 3 hr after bombardment, the cells are resuspended by adding 1.5 ml of HS medium and loosening them from the top agar by rubbing the surface of the plate with a glass spreader. The cells are then respread on two plates of selective media containing ampicillin (HS for recipients with impaired photosynthesis, H S H A plus antibiotics for rRNA transformants, and HS plus DCMU for herbicide resistance). Several alternative methods have been used by other laboratories for preparing C. reinhardtii cells for transformation: (1) Cells of a nonphotosynthetic mutant were grown in liquid medium to midlog phase, concentrated to 10 7 in 0.3 ml, plated directly on 5.5-cm petri plates of TAP medium, and incubated in dim light (200-300 lux) for 16-48 hr to obtain a dense confluent layer. 2°'49 After bombardment, the plates were held for 4-20 hr under dim light (300 lux) and then replated on selective HSM medium in bright light (3000 lux). (2) Wild-type cells were grown on TAP plates in bright light (3000 lux), bombarded with plasmids containing a selectable foreign gene (aadA) conferring spectinomycin resistance, and incubated for several hours under dim light (300 lux) before replating on selective medium containing spectinomycin. 5~ (3) Wild-type cells were grown in liquid H S H A medium to midlog phase, concentrated by centrifugation, and 1-2 x 10 7 cells were plated on 5.5-cm plates of H S H A medium and incubated in darkness overnight prior to bombardment. 4° After bombardment, the plates were again incubated in darkness for 18-24 hr and then replated on HS medium containing the selective herbicide. (4) Cells of a mutant defective in photosynthesis grown for about six generations in HSA medium containing 0.5 mM FdUrd were spread on selective HS
[37]
CHLOROPLASTTRANSFORMATION
523
medium at 1-5 x 107 cells/petri plate and bombarded with no subsequent replating. 25,5° Preparation ofPlasmid DNA. Cloned chloroplast DNA fragments isolated as the covalently closed circular band from cesium chloride gradients 93 are routinely used for chloroplast transformation in our laboratory. The effectiveness of linearized duplex plasmid DNA for chloroplast transformation appears to depend on the position of the donor gene relative to the ends of the linearized plasmid v e c t o r 11'88'94In the case of transformation of the atpB deletion mutant ac-u-c-2-21, single-stranded circular DNA of a given donor plasmid was only 25 to 50% as effective as the doublestranded DNA of that plasmid. 94
Preparation of Microprojectiles, DNA Coating, and Bombardment. Tungsten microprojectiles (Bio-Rad) are prepared fresh for each chloroplast transformation experiment as described by Newman et al. 45 Sixty milligrams of M10 microprojectiles (-1.2-/xm diameter) is resuspended in 1 ml of 95% ethanol in a 1.5-ml microfuge tube, vortexed for 2 min to deglomerate the microprojectiles, and pelleted for 2 rain in a microfuge. The microprojectiles are washed two times by carefully removing all but 80 to 100/xl of the residual supernatant and resuspending them in 1 ml of sterile deionized water with vigorous vortexing. Twenty-five microliters of resuspended tungsten microprojectiles is aliquoted to each of a series of 1.5-ml microfuge tubes (one tube per three bombardments), immediately followed by the addition of 2.5/~1 of the donor plasmid DNA at 1 /xg//zl, 25/zl of 2.5 M CaCI2, and 10 tzl of 0.1 M spermidine (free base). Tubes are finger flicked 8 to 10 times to mix, allowed to sit at room temperature for 8-12 min, spun 30 sec in the microfuge, and 50 /xl of supernatant discarded. The DNA-coated particles are resuspended in the remaining solution by vortexing vigorously, 2 ~1 immediately loaded per macroprojectile, and bombardment effected using 22-caliber blank charges (gray, industry standard label power level #1) as accelerators in the PDS-1000 particle delivery system. The 1.0-/xm diameter gold particles (Bio-Rad) used with the PDS-1000/ He are prepared as follows: A 60-mg aliquot is added to a 1.5-ml microfuge tube with 100/A absolute ethanol and vortexed for 1 to 2 min, spun in a microfuge for 1 min, and the pellet washed twice with 1 ml sterile deionized water. The pellet is uniformly resuspended in 1 ml sterile water, and 50/~1 aliquots removed to individual 1.5-ml microfuge tubes. To each tube, 5 txl donor DNA at 1 /zg//~l, 50 /zl 2.5 M CaCI 2, and 20 /xl of 0.1 M 93 j. Sambrook, E. F. Fritsch, and T. Maniatis, "Molecular Cloning: A Laboratory Manual," 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989. 94 A. D. Blowers, L. Bogorad, K. B. Shark, and J. C. Sanford, Plant Cell 1, 123 (1989).
524
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[37]
spermidine free base are added in sequence. The tubes are vortexed for 3 min, spun in the microfuge for 10 sec, and as much supernatant as possible removed. The pelleted particles are washed with 250/zl of absolute ethanol, vortexed briefly, spun again, and the pellet resuspended in 60/zl of absolute ethanol. A ten microliter aliquot of the resuspended particles is pipetted onto the center of each macrocarrier and allowed to dry before use. For bombardment with the original PDS-1000 the stopping plate is located in the top slot of the chamber and the sample petri dish is placed in the fourth slot. For the PDS-1000/He, the macrocarrier launch assembly and the sample petri dish are placed in the second and fourth positions from the top of the chamber, respectively. The macrocarrier launch assembly includes two spacer rings (for short macrocarrier travel distance) and its cover lid is located 1/8 in. under the rupture disk retaining cap. We use a 1300-psi rupture disk that is dipped in isopropanol and immediately installed in the retaining cup, following which the retaining ring is securely tightened. In both cases a vacuum of - 2 9 in. Hg is pulled prior to bombardment. Selection for Expression of Introduced Genes. Theoretically, there is a rather low probability of any donor gene that enters a recipient chloroplast being expressed against the background of the many resident copies of that gene. However, the biolistic delivery system serves to alleviate this problem by delivering microprojectiles coated with - 2 0 to 50 copies of the donor plasmid DNA. 1 Furthermore, reduction of the number of copies of the chloroplast genome in recipient cells by growing them for several generations in FdUrd ~5A6 can result in a 10- to 20-fold increase in the transformation frequency of certain recipient strains, probably because the ratio of donor to recipient molecules is shifted further in favor of the donor. When an introduced gene is dominant and strong selection can be applied, the problem of expression is obviously less severe. However, transformation of missense mutations that are impaired in photosynthesis because they make defective polypeptides with a donor fragment containing the wild-type gene has proved to be difficult, because the defective mutant polypeptides appear to interfere with formation of the wild-type multimeric photosynthetic complexes.16 We have found that allowing time for segregation and expression of the introduced donor DNA to occur before selection does not appear to enhance the frequency of transformants obtained. The frequency of transformation for the atpB and rRNA genes remained the same or actually decreased when the data were corrected for division of the recipient cells during the period of expression prior to selection. 16 Hence for most homologous donor/recipient combinations, there appears to be little if any benefit from allowing time for expression prior to selection. Early
[37]
CHLOROPLASTTRANSFORMATION
525
experiments showed that either the gunpowder residue or the accumulated tungsten particles strongly reduced the recovery of transformants bombarded directly on selective media. Experiments using the PDS-1000/ He and gold microprojectiles, which would be expected to obviate both problems, also yield higher frequencies of transformants when the cells are respread. Identification of Transformants. Putative transformants identified on the basis of their ability to form colonies on selective medium are generally replated to obtain single colonies or restreaked on selective medium prior to DNA analysis. Total cell DNA can be rapidly prepared from 1-cm-' patches of Chlamydomonas cells grown on agar medium 45 or from 50- to 100-ml liquid cultures. 95 In certain cases, entire colonies present on the initial selective plates can be cut out in agar blocks, transferred to small tubes of liquid medium, and the cells grown up for DNA preparation. Qualitative analysis of the chloroplast DNA to verify the presence of the donor fragment can be done by standard methods involving digestion with appropriate restriction enzymes, agarose gel electrophoresis, and Southern blotting using cloned probes or by PCR using appropriate primers followed by restriction analysis. Chloroplast DNA from selected transformants can also be prepared by sodium iodide density gradient centrifugation 96 and restriction digests of purified chloroplast DNA analyzed by gel electrophoresis. ~,~6The latter method allows one to examine the entire chloroplast genome of individual transformants for restriction fragment alterations and to assess the stoichiometry of the introduced fragment relative to the remaining fragments in the genome. Calculation of Tranaformation Frequencies. While the amount of DNA used to coat the microprojectiles is known in the case of biolistic transformation using the PDS-1000 delivery system, only those recipient ceils within the area of the petri plate bombarded are likely to come in contact with the DNA-coated microprojectiles. Our laboratory routinely plates a uniform monolayer of 4 × 107 recipient cells in 0. I% (w/v) top agar on each 10-cm plate of H S H A medium. An estimated 14% of the plate area (5.7 × 10 6 cells) is included in the spray pattern of the microprojectiles in the PDS-1000 using a standard distance of 9 cm between the stopping plate and the bottom of the petri dish on which the cells are spread, as Calculations of the frequency of transformants assume that the area of the plate bombarded and the number of cells in this area remain constant between experiments. These frequencies are corrected by a constant 25% recovery rate determined empirically for wild-type cells bombarded using 95 N. W. Gillham, J. E. Boynton, and E. H. Harris, Curr. Genet. 12, 41 (1987). % D. M. Grant, N. W. Gillham, and J. E. Boynton, Proc. Natl. Acad. Sci. U.S.A. 77, 6067 (1980).
526
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[37]
the PDS-1000 by resuspending and replating them in a dilution series following bombardment. Initially, transformation frequencies of 2-4 × 10 - 6 w e r e obtained for the atpB deletion mutant ac-u-c-2-21 (CC-373). 1 By improving the methods used to prepare and coat the microprojectiles, and reducing the number of copies of the chloroplast genome by growing recipient cells in FdUrd prior to bombardment, the frequencies have gradually increased to - 1 x 10 -4 for this mutant.11'16 These values probably underestimate the true efficiency of the transformation process because many of the recipient cells in the spray pattern are likely missed by the DNA-coated microprojectiles. Specific Considerations
Use of Missense Mutations Defective in Photosynthesis as Transformation Recipients. Experiments done to date suggest that missense mutations in genes encoding polypeptides that are parts of multimeric chloroplast complexes yield lower transformation frequencies than deletion mutations in these same genes. The reason may be that the defective polypeptides encoded by the missense mutant recipients compete with the wild-type polypeptides encoded by the donor gene in the initially heteroplasmic transformants. For example, the 4- to 15-fold lower frequency of photosynthetically competent transformants of atpB missense mutations obtained in comparison to atpB deletion mutations may result from the defective/3 subunit of the CF0/CF 1ATP synthase complex synthesized by the missense recipient strain.16,97 We have tested the hypothesis that a reduction in the level of chloroplast protein synthesis in the missense recipient may increase the frequency of atpB transformants using a strain, CC-707, that contains an atpB missense mutation (ac-u-c-2-9) and a chloroplast rRNA mutation to spectinomycin resistance (spr-u-l-27-3). Growth of the spectinomycin-resistant mutant on acetate plus spectinomycin results in the specific inhibition of photosynthetic polypeptides synthesized in the chloroplast. 98 A 2.6-fold increase in the transformation frequency of the CC-707 strain was observed when it was grown for six or seven generations in the presence of spectinomycin to reduce the amount of chloroplast synthesized proteins, including the defective /3 subunit of CFt. 16The transformation frequency of this strain was elevated even more dramatically (-14-fold) when it was grown in spectinomycin plus FdUrd to reduce chloroplast genome copy number, while growth in FdUrd alone 97 D. Robertson, J. P. Woessner, N. W. Gillham, and J. E. Boynton, J. Biol. Chem. 264, 2331 (1989). 98 X.-Q. Liu, J. P. Hosler, J. E. Boynton, and N. W. Gillham, Plant Mol. Biol. 12, 385 (1989).
[37]
CHLOROPLASTTRANSFORMATION
527
had no effect. 16 This synergistic response can be explained by assuming that once synthesis of the defective/3 subunit is suppressed, the missense mutant responds to the FdUrd-induced reduction of chloroplast genome number in the same way as the atpB deletion mutation.
Transformation of Genes in the Inverted Repeat Region and Copy Correction. Donor sequences integrated by transformation into the psbA gene or the 16S and 23S rRNA genes located in the inverted repeat region of the chloroplast genome undergo copy correction such that transformants have identical sequences in both repeats. 11,16.45This is readily demonstrated for the 16S and 23S rRNA genes using donor and recipient combinations that contain selectable antibiotic resistance markers flanked by easily scorable RFLPs. By the time of DNA analysis, most antibiotic-resistant transformants isolated are already homoplasmic for one or more RFLP markers from the donor, indicating that both copy correction and segregation to homoplasmicity have occurred. Those few transformants that appeared to be heteroplasmic for particular donor and recipient forms of RFLPs proved to be mixed colonies of homoplasmic cells based on RFLP analysis of subclones, indicating that copy correction and segregation had occurred. Similar results have been obtained for homoplasmic transformants of the psbA gene using two different approaches. ~1.99First, a nonphotosynthetic recipient strain having both copies of the psbA gene deleted (CC-744) was transformed with a large donor fragment carrying a wildtype psbA gene from the erythromycin-resistant strain CC-64, which overlapped both ends of the deletion, and photosynthetically competent colonies were selected. Second, a wild-type recipient strain (CC-1852) having R F L P markers flanking the psbA gene and within the gene itself (created by the fusion of exons 3 and 4) was transformed with a donor plasmid carrying a psbA gene with the DCMU4 mutation and herbicide-resistant transformants selected. In both instances, the transformants were homoplasmic for the psbA donor sequences in the two copies of their inverted repeats. The deletion mutant ac-u-c-2-43 (CC-I015) lacking the entire singlecopy atpB gene and the adjacent inverted repeat sequences encoding the 16S, 23S, and 5S rRNA genes has been transformed with a donor fragment containing a wild-type atpB gene and extending - 9 0 0 bp into the inverted repeat. 1~A high frequency of photosynthetically competent transformants with both the missing atpB and rRNA genes restored was observed. In this case the donor fragment is thought to integrate by illegitimate pairing and recombination between short dispersed repeat elements downstream of the donor atpB gene with similar sequences in the recipient genome 99 A. Lers, P, B. Heifetz, J. E. Boynton, and N. W. Gillham, unpublished observations (1992).
528
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[3 7]
downstream of the 5S rRNA gene. The transformation intermediate having the end of the inverted repeat downstream of atpB restored would then copy the missing rRNA genes from the opposite inverted repeat. In all cases involving transformation of genes in the inverted repeat, one presumes that the donor sequences integrate initially into only one copy of the repeat and that the resultant hemizygous molecule undergoes copy correction, to produce genomes with two copies of either the donor or recipient sequences of the gene in question. Thus, copy correction might be expected to reduce the transformation frequency of genes in the inverted repeat by 50% compared to single-copy genes. However, detecting differences of this magnitude is probably not possible with the precision and reproducibility of the present transformation technology. Use o f RFLP Markers to Ascertain Exchange Points for Integration o f Donor Sequences. Naturally occurring RFLP variation between the chloroplast genomes of C. reinhardtii and closely related interfertile strains 1°'83(see below) or induced restriction site changes flanking specific chloroplast genes of interest in t o b a c c o 6°'61 have proved useful in ascertaining exchange points between donor and recipient molecules in transformation. 45'6°'6~ In both C. reinhardtii and tobacco, a strong bias exists for exchange events to occur near the vector-insert junction, resulting in integration of virtually the entire donor fragment. In C. reinhardtii, a 500bp region upstream of the 16S rRNA gene containing the promoter of the rRNA operon, and a region spanning the 3' end of the psbA gene, both function as internal hot spots for integration events to OCCUr. 45-47 Other internal regions of the chloroplast donor fragment are far less recombinationally active than predicted per kilobase. Whether other chloroplast promoter regions will also show preferential activity as sites of integration remains to be established. The possibility of utilizing the hot spot downstream of the psbA gene to promote integration events elsewhere in the chloroplast genome is now being tested, and the recombinogenic features of this hot spot are being analyzed. Cotransformation Using Chloroplast Genes on Separate Donor Plasraids. Bombardment of Chlamydomonas cells having reduced chloroplast DNA content with microprojectiles containing a mixture of two separate plasmids with different chloroplast inserts results in an unexpectedly high percentage (25-50%) of the transformants selected for antibiotic resistance also carrying copies of the unselected photosynthetic donor gene. 11,41,46,47,50 DNA analysis of these cotransformants shows that the majority are homoplasmic for the selected donor gene and heteroplasmic for the second unselected gene, both of which are inserted by homologous gene replacement. Single-cell cloning of these heteroplasmic isolates results in colonies homoplasmic for both donor sequences. A small and variable number of
[37]
CHLOROPLASTTRANSFORMATION
529
the selected transformants (0-10%) are initially homoplasmic for both donor sequences. This technique is extremely useful for both targeted disruption and site-directed mutagenesis of specific chloroplast genes (see below). Integration and Expression of Foreign Gene Sequences. Foreign gene sequences (aadA, uidA, and nptH) have been stably incorporated into the chloroplast genome of C. reinhardtii in a noncoding region of the inverted repeat immediately downstream of the single-copy atpB gene. 17'94 The same is true for the Chlamydomonas nuclear gene encoding arylsulfatase (ARS).l~,~°° In certain instances, the foreign sequences undergo copy correction. In each case, the donor construct used to complement a nonphotosynthetic recipient strain carried an atpB deletion mutation. Normal transcription of uidA coding sequences was observed when they were fused to the endogenous atpB or rbcL promoters 17 while small amounts of unexpectedly large transcripts were seen for the nptH gene fused to the maize rbcL promoter. 94 In neither case was a protein product detected. Deletion analysis of the atpB or 16S rRNA promoters fused to the uidA coding sequence revealed structural differences in the two promoters when transcription of the chimeric deletion constructs was examined in stable chloroplast transformants, 29 Goldschmidt-Clermont 49 demonstrated convincingly that the bacterial aadA gene encoding aminoglycoside 3"-adenyl transferase fused to the chloroplast atpA promoter and rbcL 3' untranslated sequences from C. reinhardtii is expressed when integrated downstream of the chloroplast tscA gene, resulting in spectinomycin- and streptomycin-resistant transformants. This construct has been used successfully as a selectable heterologous marker for targeted disruption of chloroplast genes (see below). Targeted Disruption of Chloroplast Genes. The fact that chloroplast transformation normally occurs by homologous gene replacement makes the targeted disruption of chloroplast genes possible. Success has been obtained by cotransforming wild-type cells with separate plasmids containing the disrupted gene and a homologous selectable marker (see above) IL46'5° or with a single construct have a selectable foreign marker inserted in the gene to be disrupted 2°,21,23,49,51 (see above). In both cases the recipient cells were grown in FdUrd to reduce their chloroplast genome number prior to transformation. Cloned atpB and rbcL genes were disrupted by insertion of a 480-bp PstI fragment from the yeast plasmid YEp24 at unique PstI sites within their coding regions. 46 These constructs were introduced together with a second plasmid carrying selectable spectinomycin and streptomycin t00 N. W. Gillham, B, L. Randolph-Anderson, and J. E. Boynton, unpublished observations (1992).
530
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[37]
resistance markers in the 16S rRNA gene and an erythromycin resistance marker in the 23S rRNA gene. Alternatively, a 200-bp SnaBI fragment was deleted from the coding region of the cloned rbcL gene and this construct was cotransformed together with the plasmid carrying selectable 16S rRNA markers. About half of the antibiotic-resistant rRNA transformants selected under conditions permissive for survival of nonphotosynthetic mutations (dim light plus acetate) are initially heteroplasmic for the unselected disrupted rbcL or atpB genes, 46 and isolates homoplasmic for the disrupted genes are readily obtained after one round of single-cell cloning. These isolates lack the proteins encoded by the disrupted genes. Single-cell clones should be made as soon as possible after the antibioticresistant transformants are selected, because segregation for the disrupted gene occurs quickly even under permissive conditions and photosynthetically competent segregants rapidly overgrow the nonphotosynthetic disruption segregants. A small and variable fraction (0-10%) of the cotransformants is initially homoplasmic for both the selected and unselected disrupted markers when isolated. Cotransformation has been employed by Suzuki and Bauer n,53 to disrupt a chloroplast open reading frame (ORF) in C. reinhardtii with homology to the frxC ORF from the Marchantia chloroplast genome and the bchL gene of Rhodobacter, which encodes a subunit of the protochlorophyllide reductase. In this case, 90% of the antibiotic-resistant transformants were reported to be cotransformed for the disruptedfrxC ORF and about 50% were initially homoplasmic for the disruption. The alternative strategy used by Goldschmidt-Clermont and colleagues 2°,21,23,49'51 involves insertion of the selectable bacterial aadA gene encoding spectinomycin and streptomycin resistance within the cloned chloroplast gene to be disrupted and direct selection for drug resistance under conditions permissive for survival of nonphotosynthetic mutations. Isolates homoplasmic for disrupted psaC and tscA genes were obtained after three rounds of single-cell cloning, whereas cells containing a disruption of ORF 472 remained heteroplasmic on antibiotic-containing medium. Goldschmidt-Clermont 49 hypothesized that ORF 472 is an essential gene for survival of C. reinhardtii and that segregants homoplasmic for the disrupted form of this gene die. The aadA coding sequence flanked by 5' atpA and 3' rbcL regulatory sequences has been engineered as a convenient expression cassette with a set of unique restriction sites at each end. 49 Both methods are useful for gene disruption and should permit isolation of null mutations in many genes encoding proteins essential for photosynthesis. While they offer slighly different advantages and disadvantages, neither method requires that the introduced mutations be functional. Co-
[37]
CHLOROPLAST TRANSFORMATION
531
transformation allows introduction of deletion mutations and site-directed changes into genes of interest without requiring that they function. However, most of the antibiotic-resistant transformants selected are initially heteroplasmic for the disrupted gene. Therefore, DNA analysis usually must be performed to identify the heteroplasmic transformants that must then be subcloned to obtain isolates homoplasmic for the gene disruption. Also, the resistance mutations chosen may themselves have phenotypic effects (see below). In contrast, the insertional inactivation method allows direct selection for isolates homoplasmic for the disrupted gene. However, to use the method for introduction of deletion mutations or site-directed changes, the aadA expression cassette must be inserted immediately upstream or downstream of the gene of interest in the donor construct. When using this approach to obtain site-directed mutations, one must be certain that insertion of the aadA construct itself does not affect expression of the gene in question. Nonetheless, the aadA expression cassette has been successfully used to introduce site-directed changes in the chloroplast psaC gene. '°~
Strategies for Site-Directed Mutagenesis and Problems of lsogenicity. Precise evaluation of the effects of specific site-directed changes in a given chloroplast protein on normal chloroplast function requires an isogenic background between transformants and the standard wild-type strain except for the specific amino acid substitutions under study. Maintaining isogenicity places severe constraints on the recipient strains and donor plasmids that can be used for transformation. A review of the strategies we and others have employed for site-directed mutagenesis of the chloroplast psbA gene, which encodes the D1 reaction center protein of Photosystem II (PSII), illustrates the types of problems one can encounter in this regard. The psbA gene, which is located in the inverted repeat of the chloroplast genome of C. reinhardtii, is one of the best characterized photosynthetic genes in terms of both naturally occurring and site-directed mutations, including many that result in herbicide resistance. Availability of nonphotosynthetic psbA deletion mutations in C. reinhardtii that can be used as recipient strains together with cloned mutant psbA genes encoding herbicide-resistant D 1 proteins has made possible direct selection of transformants carrying the site-directed changes in this gene. Initial experiments, in which the donor fragment carrying a herbicide-resistant psbA gene only had homology to the recipient deletion strain upstream of the coding region, resulted in integration of both the donor insert and vector sequences as well as duplication of the region of homology in the recipient genome'"'6 (see above). Although these transformants were photosynthet~0~ M. Goldschmidt-Clermont, manuscript in preparation.
532
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[37]
ically competent and herbicide resistant, most remained heteroplasmic for the psbA deletion and the introduced psbA gene under restrictive growth conditions, probably because duplication of the recipient sequences during integration of the donor fragment interfered with expression of some function required for cell survival. Use of a larger donor fragment containing a wild-type psbA gene and having homology at both ends of the deletion recipient genome yields stable psbA transformants lacking vector sequences. In this case, the introduced psbA gene is copy corrected and segregates to homoplasmicity. 99 However, the C. reinhardtiipsbA gene is very large (five exons and four introns, totaling - 8 kb) and most psbA deletion mutations are even larger ( - 9 kb), making construction of complementing donor plasmids difficult. Thus, to use this approach for site-directed mutagenesis of the psbA gene the large donor fragment must be dismantled and reassembled prior to transformation. Furthermore, transformants with site-directed changes that impair D1 function cannot be isolated, because selection for the psbA transformants is based on restoration of photosynthetic competence of the recipient strain. One must also ensure that nonphotosynthetic strains containing psbA deletion mutations are otherwise isogenic with standard wild-type strains. This is best illustrated by our finding that transformants of a psbA deletion recipient strain designated ac-u-[3 (CC744) that were homoplasmic for a wild-type psbA gene integrated at its normal position nevertheless had subnormal photosynthetic performance compared to the standard wild-type strain CC-125.1°2 This difference is probably explained by the origin of the ac-u-fl psbA deletion mutation from diploid wild-type cells grown in FdUrd, subjected to X-ray mutagenesis, and backcrossed once to a standard wild-type strain to yield CC-744. 9 Hence this strain may very well be aneuploid and contain other X-rayinduced mutations affecting photosynthetic performance as well. Nevertheless, one could arbitrarily accept a photosynthetically competent transformant of CC-744 with reduced rates of 02 evolution as the standard strain to which all transformants of CC-744 carrying site-directed mutations in the psbA gene are compared, However, more promising alternative strategies for psbA transformation are now available. Null mutations can now be made in chloroplast genes encoding photosynthetic proteins by targeted gene disruption. 46'49'51 Similar disruptions to produce null mutations in the wild-type psbA gene should be possible and these mutant strains could then be used as transformation recipients. Complementation
~0~p. B. Heifetz, A. Lers, E. Gross, J. E. Boynton, N. W. Gillham, and C. B. Osmond, J. Phycol., Suppl. 27, 30 (1991).
[371
CHLOROPLASTTRANSFORMATION
533
of such nonphotosynthetic recipient strains would still require that any site-directed mutations affecting the D1 protein not block its function. Direct selection for herbicide-resistant transformants of a wild-type strain using a 1.1-kb donor fragment carrying a Ser-264-~Ala mutation (DCMU4) in the psbA exon 5 has been used successfully to study the effects of two secondary mutations on the spectrum of herbicide crossresistance of the original resistance mutation. 4° To make certain that the herbicide-resistant colonies selected are bona fide transformants rather than new mutations, one or more R F L P markers should be used to distinguish the donor and recipient psbA sequences. The base pair change resulting in the Ile-259--~Ser secondary mutation created a new HindIII site that was easily scored. While direct selection for herbicide-resistant transformants is well suited for studying secondary mutations affecting herbicide cross-resistance, this approach has several problems when used for testing the effects of other D 1 mutations on photosynthetic function. First, a large donor fragment may have to be used if the new mutation is in a different exon from the herbicide resistance mutation used for selection. Second, many of the herbicide-resistant psbA mutations in cyanobacteria, Chlamydomonas, and land plants are known to reduce photosynthetic performance under certain environmental conditions.t°3-~°5 Hence, herbicide-resistant transformants carrying secondary psbA mutations must be compared to otherwise isogenic transformants carrying the herbicide-resistant psbA mutation and not to the original wild-type strains. Furthermore, there is no direct way to separate possible interactions between the herbicide resistance mutation and site-directed changes resulting in amino acid substitutions elsewhere in the D1 protein from the direct effects of the second site mutations themselves. Interpretation of the photosynthetic performance of transformants carrying a mutation that removes the Cterminal extension of the Dl protein is complicated because cells with the stop codon mutation near the end ofpsbA exon 5 were selected for herbicide resistance mutations also present in the same exon/2 Cotransformation of a standard wild-type strain using a plasmid carrying selectable antibiotic resistance mutations in the rRNA genes and a separate plasmid containing the mutagenized psbA gene segment provides a feasible alternative for introducing site directed changes in the psbA gene without eliminating the requirement that the cotransformants produce a functional D1 protein. However, such site-directed alterations must be I03 j. Brusslan and R. Haselkorn, EMBO J. 8, 1237 (1989). t04 j. M. Erickson, K. Pfister, M. Rahire, R. K. Togasaki, L. Mets, and J.-D. Rochaix, Phmt Cell 1, 361 (1989). 105j. j. Hart and A. Sternler, Plant Physiol. 94, 1295 (1990).
534
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[37]
accompanied by a scorable RFLP marker within the donor fragment, either resulting from the site-directed mutation or closely linked to it, in order to isolate lines homoplasmic for the introduced psbA change. As long as selection for transformants is done under conditions permissive for survival of nonphotosynthetic mutations (acetate medium in dim light), one should be able to recover isolates homoplasmic for mutations that partially or totally disrupt psbA function. However, these psbA transformants also carry the rRNA antibiotic resistance marker(s) used for selection. The proper isogenic control is a wild-type transformant containing the selectable rRNA marker alone. Our laboratory has successfully used a spectinomycin-resistant 16S rRNA marker for the selection of transformants carrying stop codon mutations in psbA exon 5 at the processing site for the C-terminal extension. 4~Analysis of the photosynthetic performance of these transformants homoplasmic for the psbA preprocessed mutation was not complicated by the presence of the spectinomycin resistance marker spr-u-l-6-2, which has little if any effect on photosynthetic efficiency or photoautotrophic growth rate. 35 In contrast, we have found that transformants carrying both spectinomycin and streptomycin resistance markers in the 16S rRNA genes have substantially reduced photosynthetic performance under high light intensity compared to the wild-type strain from which they were derived.~°z The reduced photosynthetic capacity in these doubly antibiotic-resistant transformants may be accounted for by less efficient chloroplast protein synthesis. Transformants carrying either the sr-u-2-60 streptomycin resistant mutation or the spr-u-l-6-2 spectinomycin resistance mutation alone are not substantially impaired in either photosynthesis or chloroplast protein synthesis. ~°6 This suggests that the two mutations in the 16S rRNA interact negatively in the sr/spr transformants to reduce the capacity for chloroplast protein synthesis and hence the photosynthetic efficiency. While the double selection for streptomycin and spectinomycin resistance virtually assures that all isolates obtained are bona fide transformants, selection for spectinomycin resistance alone is probably the preferred alternativea~,45.46 because the frequency of spontaneous spectinomycin resistance mutations is very l o w . 6 Induction of New Mutations Using Biolistic Transformation. Newman et al. 45 found that bombardment of cells with tungsten microprojectiles using the PDS-1000 biolistic delivery system is potentially mutagenic. A large increase in the frequency of nuclear mutations to streptomycin resistance and more modest increases in chloroplast mutations resistant to streptomycin, spectinomycin, and erythromycin were seen in C. reinx06 p. B. Heifetz, A. Lers, J. E. B o y n t o n , and N. W. Gillham, unpublished observations (1992).
[37]
CHLOROPLASTTRANSFORMATION
535
hardtii cells bombarded with tungsten particles devoid of donor DNA. Whether this is also true of the modified system utilizing the helium propellant and gold microprojectiles remains to be established. Another question that needs further investigation is whether chloroplast DNA sequences become integrated into the nuclear genome as a consequence of chloroplast transformation. Integration of donor genes appears to occur randomly in nuclear transformants of C. reinhardtii when cells are transformed with either high-velocity microprojectiles or vortexed glass b e a d s . 92A°7 Consequently, there is no reason why chloroplast DNA sequences should not occasionally be integrated into the nuclear genome following transformation, creating new insertion mutations. By the same token, development of a transformation protocol for inducing nuclear mutations by tagging with a foreign donor sequence should also be possible. A nonphotosynthetic insertion mutant in the nuclear gene encoding the 7 subunit of the chloroplast ATP synthase was isolated following PEGmediated transformation of Chlamydomonas with exogenous DNA.108
Concluding Remarks Chloroplast transformation provides the technology for dissecting the function of specific chloroplast regulatory sequences and probing structure/function relationships of individual chloroplast-encoded proteins by examining in vivo the consequences of in vitro mutations. This methodology also offers the opportunity for ascertaining the functions encoded by chloroplast ORF sequences. Such investigations are already providing new approaches to the study of gene regulation and protein function, because the mutations created can be evaluated in vivo in their normal location in the chloroplast genome without complications resulting from position effects, which can arise in the case of nonhomologous recombination. Studies are now possible in which constructs with altered regulatory sequences in proper juxtaposition to their native coding sequences are introduced by chloroplast transformation for functional study in oivo. Similarly, regulatory sequences for different classes of genes (e.g., those encoding ribosomal and photosynthetic proteins) are being exchanged and the effects examined. Results of such studies now underway are just beginning to appear in press, but many more mutations will have to be examined before definitive conclusions concerning chloroplast gene expression and function can be drawn. As with any generally useful new technology, we may expect in the next few years an explosion of interest107 K. L. Kindle, R. A. Schnell, E. Fernandez, and P. A. Lefebvre, J. Cell Biol. 109, 2589 (1989). 108 E. J. Smart and B. R. Selman, Mol. Cell. Biol. U , 5053 (1991).
536
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[38]
ing results that depend on the use of chloroplast transformation. In the meantime ever more sophisticated adaptations of the original technology will become available. Successful transformation of higher plant chloroplasts brings with it the hope that these organelles may eventually be engineered for practical purposes, such as is currently being done with nuclear genes in important crop plants. Acknowledgments We wish to acknowledge the fundamental contributions made to the development of the chloroplast transformation system by J. Sanford, T. Klein, and K. Shark of Cornell, who introduced us to the biolistic technology and collaborated with us on the first successful chloroplast transformation experiments. Chloroplast transformation would not have become a reality were it not for the hard work of many researchers in our own laboratory over the past two decades, who have isolated and characterized many of the chloroplast mutations we have used as recipients or donors. Those who have participated in developing and refining chloroplast transformation technology include E. H. Harris, C. R. Hauser, P. B. Heifetz, J. P. Hosler, A. M. Johnson, A. R. Jones, A. Lers, S. M. Newman, B. L. RandolphAnderson, and D. Robertson. This research was supported by NIH Grant GM19427 and DOE Grant DE-FG05-89ER-14005 and North Carolina Biotechnology Center Grant 9107PIG-7001.
[38] F o r e i g n G e n e E x p r e s s i o n in Chloroplasts of H i g h e r Plants M e d i a t e d b y T u n g s t e n Particle B o m b a r d m e n t B y HENRY DANIELL
Introduction Several approaches have been used in the past to manipulate genes in chloroplasts, that is, generation of chloroplast mutants, protoplast fusion, organelle inactivation, and chloroplast recombination. Daniell and McFadden ~ reported the uptake and expression of bacterial and cyanobacterial genes by isolated chloroplasts. Reports of the introduction of chloroplasts into albino protoplasts and the observation of variegated progeny with the transfer of only two chloroplasts 2 opens up the possibility of introduction of transformed chloroplasts into recipient protoplasts. Sanford and coworkers 3 have developed a transformation technique that relies on bornI H. Daniell and B. A. McFadden, Proc. Natl. Acad. Sci. U.S.A. 84, 6349 (1987). 2 L. Eigel, R. Oelmuller, and M. O. Koop, Mol. Gen. Genet. 227, 446 (1991). 3 j. C. Sanford, Physiol. Plant. 79, 206 (1990).
METHODS IN ENZYMOLOGY.VOL. 217
Copyright© 1993by AcademicPress, Inc. All rightsof reproductionin any formreserved.
[38]
CHLOROPLAST TRANSFORMATION IN HIGHER PLANTS
537
bardment of recipient cells with high-velocity tungsten microprojectiles coated with foreign DNA. Using this DNA delivery system, several groups 4-8 have demonstrated stable complementation of chloroplasts of C h l a m y d o m o n a s reinhardtii. Daniell et al. 9 demonstrated the first transient expression of foreign
genes in plastids of higher plants using the chloramphenicol acetyltransferase (cat) gene and the biolistic device. Most recently Ye et al. ~° have reported conditions for optimal DNA delivery into plastids of cultured tobacco cells, using an improved biolistic device. Daniell et al. 11 have also reported transient expression of/~-glucuronidase (GUS) in different cellular compartments following biolistic delivery of chloroplast or nuclear vectors into wheat leaves and calli derived from anther culture or immature embryos. Stable complementation of tobacco chloroplasts using a modified chloroplast 16S rDNA gene conferring antibiotic resistance has also been accomplished using the biolistic device. 12'~3The biolistic device is the only reliable and reproducible method to date for delivering foreign DNA into chloroplasts of higher plants. A g r o b a c t e r i u m - m e d i a t e d chloroplast transformation TM has met with limited success; polyethylene glycol (PEG)mediated chloroplast transformation 13bis in disagreement with other laboratories, l0 Principle
In the standard gunpowder-driven PDS-1000 biolistic device (Du Pont, Wilmington, DE) a gunpowder charge is used to drive a plastic plunger (macroprojectile) down a barrel to accelerate DNA-coated tungsten particles (microprojectiles). The macroprojectile hits a stopping plate, letting 4 j. D. Boynton, N. W. Gillham, E. H. Harris, J. P. Hosler, A. M. Johnson, A. R. Jones, B. L. Randolph-Anderson, D, Robertson, T. M. Klein, K. B. Shark, and J. C. Sanford, Science 240, 1534 (1988). A. D. Blowers, L. Bogorad, K. B. Shark, and J. C. Sanford, Plant Cell 1, 123 (1989). 6 A. D. Blowers, G. S. Ellmore, U. Klein, and L. Bogorad, Plant Cell 2, 1059 (1990). 7 K. L. Kindle, K. C. Richards, and D. B. Stern, Proc. Natl. Acad. Sci. U.S.A. 88, 1721 (1991). 8 S. M. Newman, J. E. Boynton, N. W. Gillham, B. L. Randolf-Anderson, A. M. Johnson, and E. H, Harris, Genetics 126, 875 (1990). H. Daniell, J, Vivekananda, B. L. Nielsen, G. N. Ye, K. K. Tewari, and J. C, Sanford, Proc. Natl. Acad. Sci. U.S.A. 87, 88 (1990). l0 G. N. Ye, H, Daniell, and J. C. Sanford, Plant Mol. Biol. 15, 809 (1990). if H. Daniell, M. Krishnan, and B. A. McFadden, Plant Cell Rep. 9, 615 (1991). L' Z. Svab, P. Hajdukiewiez, and P. Maliga, Proc. Natl. Acad. Sci. U.S.A. 87, 8526 (1990). f3 j. M. Staub and P. Maliga, Plant Cell 4, 39 (1992). f3a M. De Block, J. Schell, and M. Van Montagu, EMBO J. 4, 1367 (1985). f3h B. Sporlein, M. Streubel, G. Dahlfield, P. Westhoff, and H. U. Koop, Theor. Appl. Genet. 82, 717 (1991).
538
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[38]
the microprojectiles continue to travel into a partially evacuated chamber. Microprojectiles traveling at high speed forcefully enter the target cells or tissues, which are placed at a given height inside the bombardment chamber. The gas and debris from the gunpowder charge is vented into a filter housing unit and are eventually trapped in the vacuum oil. Du Pont has developed a retrofit kit for the PDS-1000, providing the user with a gas-driven particle delivery system, the PDS-1000/He. The PDS-1000/He uses high-pressure helium instead of gunpowder as the driving force for the macrocarriers. In this method, a small chamber is sealed at one end with rupturable membrane(s) and filled with helium to high pressure. A solenoid-driven lance then ruptures the membrane, releasing a shock wave, which enters the launch assembly device that accommodates a removable sleeve. There are removable rings inside the sleeve to facilitate launching of microprojectiles. A nylon mesh is locked in place across the axis of the sleeve; DNA-coated microprojectiles are loaded directly onto the center of the mesh. The helium shock wave atomizes and accelerates the microprojectiles as it passes through the mesh. In yet another modification called the flying disk method, a plastic membrane is loosely held in the same position as the nylon mesh. Particles are dried on its surface. The disk is accelerated down the sleeve 1 cm, on firing, where it impacts against a stopping screen and releases microprojectiles to hit the target cells or tissues.
Methods Materials and Stock Solutions Bottle top filters (I00 ml) (Cat. No. 8310, 0.2/zm; Costar, Cambridge, MA) Sterile disposable pipettes Autoclaved filter paper disks (55 mm in diameter, Cat. No. 1001, 055, VWR No. 28450-047; Whatman, Clifton, NJ): Autoclave the filter disks in a glass petri dish, covered with aluminum foil Sterile 60 x 15 mm petri plates Tweezers: Autoclave; flame before each use Ethanol: 95 and 70% (v/v) Pipetman (Gilson, France) and disposable, autoclaved tips (low binding) Sterile plant cell culture media (see below) Kimwipes: Wrap in aluminum foil and autoclave Three- to 4-day-old cultured plant cells Sterile macroprojectiles: Wash in 100% ethanol in microtiter plates Sterile stopping plates: Wash in 100% ethanol
[38]
CHLOROPLAST TRANSFORMATION IN HIGHER PLANTS
539
Gun cleaning patches (autoclave) Gun cleaning rod Calcium chloride (2.5 M): Weigh 1.84 g of CaC1z and dissolve in 5 ml of water (make fresh just before use and filter sterilize; may be stored at 4° for short periods; do not freeze) Sterile tungsten particles Sterile Eppendorf tubes (low binding) Sterile 1 M spermidine free base: Take a 1-g unopened bottle of spermidine stored at 4° and add 6.8 ml of sterile water and filter sterilize; store as 25-/~1 aliquots at - 2 0 ° (highly hygroscopic) Plant Cell Culture Media and Subculture Conditions Sugar Beet (SB-18-1R) Sterile sugarbeet medium (100 ml of 10 x medium): Water, 70 ml (autoclaved); MS salts, 4.3 g (4°); i-inositol, I00 mg (room temperature); pyridoxine HC1, 5 mg (room temperature); nicotinic acid, 5 mg (room temperature); sucrose, 30 g (molecular biology grade; protease, nuclease free); thiamine hydrochloride, I mg (room temperature) (100 /~1 from stock of 10 mg/ml; store at - 2 0 °) Make up the medium to 100 ml and freeze at - 2 0 °. To make the 1 x medium: 1. Thaw 10 x stock and dilute to 1 x using autoclaved double-distilled H20. 2. Adjust the pH to 5.8 with KOH (initial pH will be about 4.4). 3. Autoclave for 20 min. Tobacco (NT1) NT1 medium (100 ml of 10× medium): Water, 70 ml (autoclaved); MS salts, 4.3 g; i-inositol, 100 mR; KH2PO4, 100 mR; sucrose, 30 g (molecular biology grade); thiamine hydrochloride, 1 mg (use 100/~1 of 10-mg/ml stock); 2,4-dichlorophenoxyacetic acid, 0.2 mg (use 200 /~l from 1-mg/ml in 50% ethanol) Store the medium in the freezer at - 2 0 °. To make 1 × medium: 1. Thaw l0 x stock medium and dilute to 1 x . 2. Adjust the pH to 5.8 with KOH. 3. Autoclave for 20 min.
540
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[38]
After washing the glassware in chromic acid, autoclave it separately before using to prepare medium. Autoclave flasks and caps separately. After the medium has cooled to room temperature, add 3 ml of suspension culture (6- to 7-day-old cells) to 12 ml of sterile 1 x medium. Grow the cells at 26 ° under continuous shaking (150 rpm) in the light. Sieve the cultures using 500-/zm mesh for every two subcultures to get rid of cell clumps or regenerated calli. Subculture the cells every week and maintain at least three batches of each culture. Always check cultures for contamination by streaking the cells on LB-agar plates and incubating at 37° until the next subculture.
Solid Culture For long-term storage of cultured plant cells solid cultures are ideal. Strictly follow sterile conditions during the transfer of cells or calli. I. 2. 3. 4. 5. 6. 7.
8. 9. 10.
Make 1 x medium by diluting the 10x stock. Adjust pH to 5.8 using KOH. Add 1.5 g ofphytagar (Sigma, St. Louis, MO) to 100 ml of medium. Autoclave for 20 min. Pour medium either into petri plates or culture dishes and let it solidify in the hood. After solidification, streak a few drops of the cells (NT1 or SB) on their respective media and cover. Sugar beet cells should have foil wrapped around the plate to prevent differentiation, while tobacco cells can be left in the light. Both cultures should be kept in the growth chamber (26°). Transfer the calli to fresh petri plates or culture dishes once a month. Divide into two batches of three plates each and do the transfer once every month. Remember to check for bacterial or fungal contamination by streaking cells on LB plates.
Generation of Tissues for Bombardment For bombardment of tissues, plants should be grown aseptically from seeds on MS medium supplemented with 2% (w/v) sucrose and solidified with 0.8% (w/v) agar. In our experiments on bombardment of wheat leaves or calli, we use plants that are regenerated from anther culture or immature embryos. When the plants are at the two- to three-leaf stage, they are transplanted aseptically into test tubes containing half-strength MS medium supplemented with 2% (w/v) sucrose and solidified with 0.8% (w/v) agar. Calli are generated from immature embryos by a modified method
[38l
CHLOROPLAST TRANSFORMATION IN HIGHER PLANTS
541
described by Sears and Deckard. ~4 The 10- to 12-day-old immature embryos of wheat are placed on basal MS medium containing only half the amount of 2,4-dichlorophenoxyacetic acid (2,4-D; 1 mg/ml); the calli are left in this medium until hard white embryonic tissue develops. This tissue usually starts forming after 2 months when the calli are transferred to fresh medium every 3-4 weeks. CaUi rich in this embryonic tissue are transferred to fresh medium and used for bombardment.
Preparation for Bombardment Plant Material 1. Spray the hood with 70% (v/v) ethanol and wipe with sterile wipes. 2. Turn on the ultraviolet (UV) light in the hood for a few minutes. 3. After the UV light has been turned off, place the culture flasks in the hood and spray ethanol over the flasks. 4. Wear gloves and spray ethanol over gloved hands. 5. Label the flasks with the date, strain, type of medium, and the initials of the user. 6. Flame the neck of the flask and inoculate 5 ml of the desired plant cells (to be bombarded) into 20 mi of fresh medium, using a sterile pipette. 7. Take 100/~1 of the medium from the mother and daughter cultures and streak on an LB plate (which is already partitioned and numbered at the bottom). 8. Place the streaked LB plates at 37° and the culture flasks at 26° in the shaker. Leave the caps loose enough to facilitate aeration while flasks are on the shaker. Grow the cells for 4 days.
Microprojectile s The preparation of microprojectiles should be done the day before bombardment. 1. Place 60 mg of tungsten (M-10, 0.7/zm; 75053, DuPont, Wilmington, DE) particles into an Eppendorf tube. 2. Add 1 ml of 100% ethanol and vortex vigorously for 2 rain. 3. Let this tube sit at room temperature overnight. 4. Spin the Eppendorf tube for 2.5 min at maximum speed in a microcentrifuge kept in the hood and remove the supernatant. 5. Wash three times with sterile water. Finger vortex between each wash. When washing with water the tungsten particles will be very 14 R. G. Sears and E. L. Deckard, Crop Sci. 22, 546 (1982).
542
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[38]
loose; it is all right to leave some water in the first two washes, but during the third wash try to aspirate off as much water as possible. 6. Add I ml of 50% (v/v) glycerol (sterile) and leave at room temperature. 7. This can be stored up to 1 week; longer storage may result in oxidation of the metal. Bombardment o f Cells or Tissues
I. Keep a stand in the hood and affix a bottle to which the Costar sterile filter unit is tightly screwed. Place a 5.5-cm sterile filter paper disk and soak in 4 ml of the growth medium. 2. In a 5.5-cm plastic petri dish place two 5.5-cm filter disks and add 1 ml of the growth medium. 3. Add 2 ml of culture and filter out the growth medium by applying mild suction. 4. Scrape and weigh the cells. Use a microscale balance and a weighing boat to weigh the cells. Discard these cells after determining the fresh weight because they are no longer sterile. 5. Add 4 ml of the growth medium to the Costar filter unit. Add enough culture volume to obtain 300 mg of cells, using a sterile pipette. 6. Using the same pipette disperse the cells uniformly on the filter paper. 7. Apply a gentle vacuum until all the medium is drained off. 8. Using a small tweezer transfer the filter disk containing cells to a petri plate that has two 5.5-cm filter disks moistened with the growth medium. 9. To bind DNA to microprojectiles, add the following: Washed particles, 25/zl DNA [1/xg//.d in TE buffer (10 mM Tris-HC1, 1 mM EDTA, pH 8.0)], 5/zl CaCI 2 (2.5 m), 25/~1 (prepared fresh) Spermidine (I M), 5/zl (stored at - 2 0 °) Vortex by hand after each addition, afterward allowing the tube to sit for 10 min. Spin down in an Eppendorf centrifuge for 10 sec, using the pulse button, and discard 40 ~zl of the supernatant. 10. Vortex vigorously for 1 min. Take out a macroprojectile from the microtiter plate, using the pin loader. Load 5/zl of the DNA-tungsten mixture onto the macroprojectile. Push the macroprojectile, using the pin loader, into the barrel, with the DNA-tungsten mixture pointing downward toward the sample. Even if mixed thor-
[38]
CHLOROPLAST TRANSFORMATION IN HIGHER PLANTS
543
oughly the third aliquot may not contain the same amount of tungsten particles as the first two. Therefore use this sample to load in an agarose gel to check the binding efficiency of DNA onto the tungsten particles. At the time of loading the sample on the macroprojectile, vortex and immediately load the sample on the macroprojectile. The bombardment chamber should be sprayed with 70% (v/v) ethanol and wiped with sterile tissue after each bombardment. The barrel should be cleaned using gun cleaning patches and the rod. Keeping the sample in a petri plate (cells on filter paper or tissues on agar plates) at the fourth level, bombard under partial vacuum (0.07-0.1 arm). Each sample may be bombarded twice. Bombard at least three plates for each treatment or plasmid. After bombardment, add 1 ml of the culture medium to each plate. Foreign gene expression studies are usually done 36, 48, or 72 hr after bombardment. Grow the cells after bombardment in the light at 26 ° in the growth chamber. Precautions
Strictly follow the order of additions for coating tungsten particles with DNA; any change would result in a decrease in DNA binding. Make sure the stopping plate is kept in place and the vacuum is at least 28 in. Hg. Spray the gun chamber with 70% (v/v) ethanol and wipe it with sterile tissue after every bombardment. Do not force the bullet into the barrel. DNA should be free of protein; otherwise it would form clumps with tungsten particles. DNA free of proteins could be obtained by repeated phenol-chloroform extractions or proteinase treatment followed by ethanol precipitation. Methods of bombardment using the PDS-1000/He system are slightly different. After 10 min of incubation of the DNA-tungsten suspension, the particles pelleted down by a pulse contrifugation in a microfuge should be washed once with 70/zl of 100% ethanol. Resuspend the pellet in 30/zl of 100% ethanol. Spread 8 tzl of the tungsten/DNA suspension to dry on the center of a 1-in. disk (25 ram) made of 2-mil (50-mm) plastic membrane (for the flying disk method) or on a 1-in. disk of 94-/zm nylon mesh (for the helium entrainment method). Load the flying disk into a brass launch ring that is then screwed into a sleeve with a metal screen on a retainer ring 1.3 cm below the brass launch ring. For the helium entrainment method, place the nylon mesh between two brass rings and screw them into the sleeve. Place the sleeve into the sleeve holder at the desired height. Seal the rupture end of the pressure chamber with an appropriate
544
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[38]
number of 2-propanol-soaked 2-mm plastic rupture disks (three layers for 900 psi, four for 1200 psi, and five for 1500 psi). Load the target sample at a chosen platform in the sample chamber and bombard under partial vacuum (0.3 atm).
Assays for Foreign Gene Expression Chloramphenicol Acetyltransferase Transfer bombarded cells to Corex tubes and wash once with 10 ml of TE buffer (250 mM Tris-HCl, 10 mM EDTA, pH 7.8). Pellet cells at 8000 g for 10 min at 4 ° and transfer the pellet to 2-ml Eppendorf tubes and resuspend in 1 ml of TE buffer containing 2 mM phenylmethylsulfonyl fluoride. Sonicate cells twice for 20 sec, using a probe sonicator. After a 15-rain centrifugation at 4 °, transfer the supernatant to a new Eppendorf tube and assay for chloramphenicol acetyltransferase (CAT) activity. To 500/zl of extract add 20/xl of D-threO [dichloro-acetyl- 1-14C]chloramphenicol (1.85 MBq/mmol, 0.5/zCi) and acetyl-CoA (0.5 mM). After incubation for 30 min at 37 °, add 1 ml of ethyl acetate, vortex vigorously, and spin briefly to separate the aqueous phase from the organic phase. Transfer the organic phase to a new tube and evaporate in a speed vacuum concentrator. Dissolve the acetylated products in 25/.d of ethyl acetate, spot the extract on silica gel thin-layer plates, and separate in chloroform-methanol (95 : 5, ascending). After autoradiography, scrape the acetylated forms of chloramphenicol and count in a suitable scintillant.
~-Glucuronidase GUS buffer (final concentrations given in parentheses): NaH2PO4 (100 raM), 1.38 g; EDTA (10 mM), 372 rag; K4Fe(CN) 6 (0.5 mM), 21 mg Make up the volume to 100 ml (use autoclaved HzO), adjust the pH to 7.0 with NaOH, filter sterilize, and store at 4°. Substrate solution for the reaction (for 10 plates): Dissolve 5 mg of X-Gluc (5-bromo-4-chloro-3-indolyl-fl-D-glucuronic acid, 0.5/~g/ml) in 100/xl of dimethyl sulfoxide (DMSO) and then add to 10 ml of GUS buffer. Add 10/zl of 100% Triton X-100 (0.1%, v/v). Filter sterilize the solution. Add 0.5 ml to each plate containing the bombarded sample, preferably on the callus or the leaf or the cells in the bombarded area. Keep all stock solutions and containers sterile to avoid contamination. Incubate at 37° overnight.
[38]
CHLOROPLAST TRANSFORMATION IN HIGHER PLANTS
545
Vectors Selection of Suitable Chloroplast Promoter
Work in this laboratory for the past several years has involved construction of chloroplast expression vectors either for stable integration of foreign genes into the chloroplast genome or for transient/stable expression and autonomous replication of introduced plasmids inside chloroplasts or mitochondria. As a first step toward achieving this, a series of chloroplast expression vectors have been constructed using the promoter selection vector pKK232-8 (Pharmacia, Piscataway, NJ), which is a pBR322 derivative containing a promoterless cat gene. A multiple cloning site (MCS) has been placed 5'-proximal to the cat gene to facilitate insertion and analysis of promoter fragments. Transcription/translation of cat can be used to quantify the strength of promoters inserted into the MCS of pKK232-8. The plasmid contains the ribosomal RNA Tl and T2 terminators distal to the cat gene to allow cloning of strong promoters and three stop codons between the MCS and the AUG of the cat gene to prohibit translational read-through into the cat gene. Restriction fragments of chloroplast DNA containing the entire promoter region and 5'-untranslated region of the psbA gene from spinach (pMP450; courtesy of Dr. W. Gruissem, University of California-Berkeley) pHD306 or pea (pPPBXI0218; courtesy of Dr. J. Mullet, Texas A&M University) pHD312, or, alternatively, the rbcL and atpB promoter region from maize (pPBI443; courtesy of Dr. A. Gatenby, DuPont Company) pHDI03, have been individually inserted into the MCS site; colonies have been screened on LB plates containing chloramphenicol. Plasmids containing chloroplast promoter fragments have been investigated by analyzing transient expression of cat in cucumber etioplasts using the methodology of Daniell and McFadden.l The spinach or pea psbA promoter has been found to be the strongest among the promoters tested. The chloroplast expression vector pHD203 (Fig. 1A) contains a double psbA promoter fragment, in opposite orientation to facilitate insertion of additional genes. While one psbA promoter region would drive the cat gene, the second promoter fragment is placed upstream of a multiple cloning site (MCS) containing sites for AvaI, XmaI, BamHI, BgllI, SalI, Sinai, HinclI, PstI, and HindlII. There is a ribosomal RNA T~ terminator distal to the MCS that would facilitate subcloning genes driven by strong promoters. There are convenient EcoRI and PstI sites within cat and/3lactamase genes, respectively, to screen for partial digestion of pHD203. The Escherichia coli uidA gene, coding for/3-glucuronidase (GUS), t5 has i_s R. A. Jefferson, S. M. Burgess, and D. Hirsch, Proc. Natl. Acad. Sci. U.S.A. 83, 8447 (1986).
546
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[38l
"1"1 AvaI/XmaI
A
P v u l ~ . ~
NdeI.~ Tthfff- 1 " ~
nHngnR-AI I~ i ~-PstI " . . . . . . . . . )J/psbA
\ x~.x)~ \ ~_qPAT ~¢//psbA
promoter
_ _
promoter
'2T ~ H i n d ] I I q "1"2 Ncol FIG. 1. (A) The chloroplast expression vector pHD203-GUS contains two psbA promoter fragments inserted in opposite orientations to facilitate simultaneous transcription of two promoterless marker genes. Escherichia coli uidA coding for GUS has been inserted into the MCS at P s t I - S m a I sites. The restriction sites shown on the map are unique for pHD203GUS. [Reprinted from G. N. Ye, H. Daniell, and J. C. Sanford, (1990)Plant Mol. Biol. 15, 809-820.] (B) The plasmid pHD407 carries a 4.1-kbp SmaI fragment containing the origin of replication (D loop) from pea chloroplast DNA inserted into pHD312. The plasmid pHD312 contains the entire promoter and 5'-untranslated region of the pea psbA gene inserted 5'proximal to the promoterless cat gene present in the promoter selection vector pKK232-8. For more details, see Vectors. [Reprinted from H. Daniell, J. Vivekananda, B. L. Nielsen, G. N. Ye, K. K. Tewari, and J. C. Sanford, (1990) Proc, Natl. Acad. Sci. U.S.A. 87, 88-92.]
been inserted into the MCS of pHD203 at PstI-SmaI sites as described in detail by Ye et al. 1o Insertion o f Chloroplast Origin o f Replication into Chloroplast Expression Vectors
To increase the copy number of the introduced plasmid, origin of replication sequences from plastid genomes may be included in chloroplast vectors. Several pea chloroplast DNA fragments ~6A7containing replication origins identified as displacement loops (D loops) have been tested for in vitro DNA replication, using a replication fraction isolated from pea chloroplasts containing RNA polymerase, DNA polymerase, DNA primase, and topoisomerase I activities. A well-defined chloroplast replicon has been inserted into the chloroplast expression vector pHD312, which contains the pea psbA promoter 5'-proximal to the promoterless cat gene, resulting in the construction of pHD407 (Fig. 1B). Analysis of in vitro DNA synthesis revealed the presence of single-stranded DNA molecules 16 B. L. Nielsen and K. K. Tewari, Plant Mol. Biol. 11, 3 (1988). 17R. Meeker, B. L. Nielsen, and K. K. Tewari, Mol. Cell. Biol. 8, 1216 (1988).
[38]
CHLOROPLAST TRANSFORMATION IN HIGHER PLANTS
547
Sma It BarnH !
B
pHD 407 (9919 bp)
/ Eeor I FIG. 1. (continued)
of about 9.9 kbp, corresponding to the full length of pHD407. Restriction digests of in vitro replication products showed that fragments of the expected sizes were labeled in pHD407. 9 Nuclear Expression Vectors The nuclear expression vector pPBI121 carries a uidA gene driven by a cauliflower mosaic virus (CaMV) 35S promoter and flanked at the 3' end by a polyadenylation signal from the nopaline synthase gene of the Agrobacterium tumefaciens Ti plasmid.~8 For negative controls, pUC 19 DNA or appropriate vector DNA should be used in all bombardments. The nuclear expression vector pUC8 CaMV CATA N is a 4.2-kbp plasmid carrying a cat gene driven by a 35S CaMV promoter, flanked by a 3' nopaline synthase PstI poly(A) fragment. 18 R. A. Jefferson, Plant Mol. Biol. Rep. 5, 387 (1987).
548
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[,38]
Evaluation of Results
~-Glucuronidase Expression in Anther-Derived Albino Plants It was of interest to study GUS expression in anther-derived albino plants. Certainly, it was anticipated that the blue GUS product might be especially easy to visualize. Figure 2A shows the expression of GUS in albino leaf bombarded with pHD203-GUS (left) but not in that bombarded with control pUC 19 (right). The product of the uidA gene,/3-glucuronidase, when present, cleaves glucuronic acid from the substrate X-Gluc to produce an insoluble indigo dye following oxidative dimerization. Even though some of the earlier investigations on pollen-derived albino rice plants indicated lack of ribosomes in albino plastids as the cause of albinism, subsequent studies in other laboratories suggested that a major cause was alterations of the albino plastid genome (for a detailed discussion, see Ref. 11). Expression of GUS in albino leaves bombarded with pHD203GUS (Fig. 2A) suggests the presence of a functional protein synthetic machinery in albino plastids. Chloroplast-specific expression of GUS by pHD203-GUS is discussed in the next section.
Compartmentalized ~-Glucuronidase Expression Green plants derived from anther culture were preferred for studies on gene expression because the results were comparable to field-grown plants but at the same time plants were free of bacteria because they have been grown under totally sterile conditions. Although the tungsten particles were seen in samples bombarded with pUC19, no GUS expression was observed. On the other hand, it was evident from samples that had been bombarded with pPBII21 and pHD203-GUS that/3-glucuronidase, when present, cleaved glucuronic acid from the substrate X-Gluc to produce an insoluble indigo dye. To locate the compartment in which gene products from pPBI121 or pHD203-GUS function, bombarded leaves from antherderived green plants were examined under the microscope. It is evident from Fig. 2B that the/3-glucuronidase-derived product was present evenly throughout the cytosol when the nuclear expression vector pPBII21 had been used to bombard wheat leaves. On the other hand, when chloroplast expression vector pHD203-GUS was used for bombardments the indigo dye was subcellularly localized within wheat cells (Fig. 2C and D). Chloroplasts noticeably lost their green color after the addition of GUS substrate, probably because the substrate contained organic solvents and detergents that could destabilize pigment protein complexes. Thus, GUS was localized within chloroplasts as has been shown in bombardments of tobacco %1° and sugar beet cells (Daniell et al., unpublished observations, 1992). These
c~
2 E
× C~
r~
v
~,×
~~
o
[38]
CHLOROPLAST TRANSFORMATION IN HIGHER PLANTS
549
results show that a dicot chloroplast promoter (pea psbA) can indeed function efficiently in a monocot chloroplast. For a critical discussion on the ability of the psbA promoter to function in the chloroplast, but not in the nuclear compartment, see General Comments, below. fl-Glucuronidase Expression in Callus Derived from Immature Embryos While anther-derived albino and green plants are ideal to study transient expression of foreign genes, regeneration of wheat plants from bombarded tissues may be a formidable challenge. Therefore, calli rich in embryonic tissue were generated from immature embryos of wheat. Figure 2E shows the expression of GUS in regenerable calli derived from immature embryos. When bombarded with foreign DNA, callus clumps were shattered on impact of tungsten particles; however, this did not affect their subsequent gene expression. No background indigo dye was detected in negative controls, bombarded with pUC19, after incubation with the GUS substrate (Fig. 2F). A number of blue areas may be seen in the callus bombarded with pHD203-GUS (Fig. 2E), indicating that chloroplasts in a number of targeted cells have been transformed. [The data in Fig. 2 have been reprinted from Daniell et al. (1991) Plant Cell Rep. 9, 615.] Expression of cat in Cultured Tobacco Cells Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407 (chloroplast expression vector with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms (Fig. 3A). Nuclear expression of cat was maximal 72 hr after bombardment. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. An increase in the expression of cat was observed at 72 hr in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. Although the expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. It is known that electroporation of protoplasts results in DNA delivery into the cytosol and not inside the organelles. While the nuclear expression vector, 35S-CAT, showed expression of cat, no activity was observed with any other plasmid or chloroplast vector. 9 These observations were subsequently confirmed by investigations
550
METHODSFOR TRANSFORMINGANIMAL AND PLANT CELLS A
35S-CAT DHD407 NUC ' CHL-CAT
pUC118 II
II
I
48 hr
35S-CAT NUC
pUC118 If
nHD407 " CHL-CAT II
I
72 hr
35S-CAT DHD407 NUC - CHL-CAT ~f Ir 1
pUC118
96 hr
pUC118 l
120hr
35S-CAT NUC
=l
ir
pHD407 CHL-CAT I
[38]
[38]
551
CHLOROPLAST TRANSFORMATIONIN HIGHER PLANTS
B
psbA-CAT psbA-CAT no replicon pea replicon
pUC 118 I
I
w
I
I
I
35S-CAT nuclear I
I
¢-
0
o9
'-
a
D I
, •
eO I
I
<
O~
eO I
I
o
~ It
o
Io
0 0 tl""
~-
I I
~-
II ....
I
FIG. 3. (A) Analysis of cat expression in tobacco NTI suspension cells bombarded with pUC118 (negative control), 35S-CAT (nuclear expression vector), and pHD407 (chloroplast expression vector containingchloroplast replicon). CAT was assayed by thin-layer chromatography of [14C]chloramphenicol and its faster migrating acetylated products. Average protein concentration in 500 txl of the sample assayed were as follows. 48 hr: pUC118,900 /xg; 35S-CAT, 476/zg; pHD407, 870 ~g; 72 hr: pUCI18, 787/zg; 35S-CAT, 590/xg; pHD407, 710/zg; 96 hr: pUC118, 1360/zg; 35S-CAT, 147/zg; pHIM07, 48/zg; 120 hr: pUC118,523/s,g; 35S-CAT, 91 tzg; pHD407, 99/xg. (B) Analysis of cat expression in tobacco NT1 suspension
552
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[38]
using similar chloroplast expression vectors provided by Prof. L. Bogorad (Harvard University). Expression of cat was studied in NT1 cells bombarded with vectors containing replicon inserts from tobacco and maize chloroplast genomes (Fig. 3B). The tobacco B a m l V chloroplast DNA fragment was cloned into pGV825 (a Ti plasmid intermediate vector) by A. Blowers (Harvard University) (pACpl8); this fragment cloned into pUC supported DNA synthesis in vitro using the replication system described by Carrillo and Bogorad. 19The maize B a m X fragment was cloned into pGV825 by A. Blowers (pACpl9); this fragment cloned into pBR322 was not especially active in the in vitro DNA synthesis assay of Tewari and co-workers 2° but functioned as an autonomously replicating sequence in yeast (when cloned into YIp5). The repliconless vector showed 0.74 x 10 3 cpm CAT activity per microgram of protein in a sonic extract of cells 72 hr after bombardment; vectors containing replicon fragments from tobacco and maize showed 1.03 and 1.45 x 10 3 cpm//zg of protein, respectively. In all of these constructs, the bacterial cat gene was under the control of an rbcL promoter region from maize. Several factors might have contributed to the continued maintenance of high levels of expression of cat in cells bombarded with autonomously replicating chloroplast expression vectors. Replication of chloroplast expression vectors should have resulted in increased copy number, thereby increasing cat expression. It has been reported that, in cultured tobacco cells, copy number of plastid DNA per cell increases 11-fold within 1 day after the addition of fresh medium; replication of plastids was most frequently observed on the second day. 21'z2Therefore, an addition of fresh medium to bombarded cells should have further enhanced replication of the foreign plasmid inside the chloroplasts. It is also known that essentially 19 N. Carrillo and L. Bogorad, Nucleic Acids Res. 16, 5603 (1988). 2o B. Gold, N. Carrillo, K. K. Tewari, and L. Bogorad, Proc. Natl. Acad. Sci. U.S.A. 84, 194 (1987). 2I T. Yasuda, T. Kuroiwa, and T. Nagata, Planta 174, 235 (1988). 22 y . Takeda, H. Hirokawa, and T. Nagata, Mol. Gen. Genet. 232, 191 (1992).
cells bombarded with chloroplast expression vectors containing various replicon fragments and promoters. Protein concentration in samples assayed (72 hr after bombardment) were as follows. Top: pUC 118,856 and 1008 p.g; pHD312 (repliconless), 802 and 1075/zg; pHD407 (pea replicon), 1075 and 488/xg; 35S-CAT, 1160 and 1102/xg. The film was exposed to the TLC plates for 8 hr. Bottom: pUCII8, 65 ~g; pHD 312, 40 and 46/zg; pHD407, 32 and 26 /zg; 35S-CA T, 39 and 38/xg; rbcL-CAT(tobacco replicon), 276/zg; rbcL-CAT(maize replicon), 275 ~g; rbcL-CAT (no replicon), 248 p.g. The film was exposed to the TLC plate for 4 days due to the low number of bombarded cells. [Reprinted from H. Daniell, J. Vivekananda, B. L. Nielsen, G. N. Ye, K. K. Tewari, and J. C. Sanford, (1990) Proc. Natl. Acad. Sci. U.S.A. 87, 88-92.]
[38]
C H L O R O P L A STRANSFORMATION T IN HIGHER PLANTS
553
all chloroplast genomes replicate in a cell cycle in cultured plant cells and that there is no unreplicated organellar DNA. 23 Our observations indicate that foreign plasmids containing appropriate replicons when introduced into cultured sugar beet cells using the gene gun enter mitochondria and replicate in vivo (Daniell et al., unpublished observations). Optimization of Foreign Gene Expression in Chloroplasts We have reported an efficient and highly reproducible delivery system, using an improved biolistic device, that facilitates expression of foreign genes in chloroplasts of cultured plant cells.~° Tobacco cells bombarded with nuclear expression vector (pPBI505) showed high levels of GUS expression, with blue color being distributed evenly throughout the cytosol. On the other hand, when the chloroplast expression vector pHD203GUS was bombarded, the indigo dye was subcellularly localized. Compartmentalized expression of GUS by these vectors was further confirmed by introducing them into tobacco protoplasts by polyethylene glycol (PEG)mediated transformation followed by GUS assays. While the nuclear expression vector (pPBI505) showed a high level of GUS expression, no GUS activity was observed for pUCll8 or pHD203-GUS. ~° Chloroplast transformation efficiencies increased dramatically (about 200-fold) using an improved helium-driven biolistic device as compared to the more commonly used gunpowder charge-driven device. Using uidA as a reporter gene and the improved biolistic device, optimal bombardment conditions were established, consistently producing several hundred transformants per petri plate. Chloroplast transformation efficiency was found to be increased further (20-fold) with supplemental osmoticum in the bombardment and incubation media. General Comments Transient expression of foreign genes (cat, uidA) in chloroplasts of tobacco, sugar beet, and wheat cells, and in leaves or calli has been observed. It is clear that chloroplast promoters are interchangeable among monocots and dicots; the cat gene driven by the maize rbcL promoter functions in tobacco chloroplasts 9 and the uidA gene driven by the pea psbA promoter functions in wheat chloroplasts.ll Almost all of these chloroplast vectors have been tested for their transient expression in isolated plastids, 9 using the method of Daniell and McFadden. In addition, chloroplast vectors introduced into isolated protoplasts by :3 H. Diogenes-Infante and A. Weissbach, Plant Mol. Biol. 14, 891 (1990).
554
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[38]
electroporation9 or PEG-mediated DNA uptake 1° do not express foreign genes in the nuclear compartment. The psbA promoter, when fused to nptlI or bar-coding sequences and introduced into tobacco by Agrobacterium mediated transfer, resulted in transcriptional activity that was too low to produce any detectable mRNA; attempts to induce the tobacco psbA promoter to function in the nuclear compartment revealed the absolute need to insert 35S promoter-enhancer elements 5' proximal to the psbA promoter region. 24 Bogorad and co-workers 25 have demonstrated that chloroplast genes from maize and Amaranthus hybridus are not transcribed from their own promoters when placed in the nuclei of transgenic tobacco plants. Furthermore, the kinetics of foreign gene expression in chloroplasts is distinctly different from that of the nucleus; foreign gene expression has been observed in chloroplasts several days after nuclear expression. 9'1° This may be due to the delay in the entry of foreign DNA and/or diffusion of substrates (e.g., X-Gluc) across the double plastid membrane. Despite several successful reports of transient foreign gene expression in chloroplasts of higher plants, stable integration and expression of foreign genes have not yet been accomplished. Demonstration of stable genetic complementation of the tobacco plastid genome, using a mutant 16S rDNA gene,12'13 established conditions for plastid selection but failed to integrate any foreign DNA. Chloroplast transformation has been pointed out to be as efficient as nuclear transformation in Chlamydomonas.12 In tobacco, transformation of plastids has been reported to be 100-fold less efficient than transformation of the nucleus12; however, in this report leaves have been bombarded as opposed to cultured cells in other studies, where higher efficiencies have been reported; larger tungsten particles (I/zm) have also been used in this study as opposed to smaller particles (<0.7 /xm) in other studies on chloroplast transformation.9-11 Furthermore, 3 chloroplast transgenic clones were recovered from a sample of 56, of which 53 were scored as spontaneous mutants, thereby underestimating the actual number of transformants (due to loss of flanking markers by copy correction). An accurate comparison of the efficiency of chloroplast vs nuclear transformation, in progress in our laboratory, is overcoming these aforementioned problems. We have bombarded a chloroplast-specific marker gene (EPSPS, which functions in the chloroplast but is not a chloroplast gene, thereby eliminating spontaneous mutations) in cultured plant cells. Selection and regeneration of transgenic plants are in progress. Parallel progress has been made in the transformation of chloroplasts 24 M. Corneilsen and M. Vandew[ele, Nucleic Acids Res. 17, 19 (1989). 25 A. Y. Cheung, L. Bogorad, M. Van Montagu, and J. Schell, Proc. Natl. Acad. Sci. U.S.A. 85, 391 (1988).
[38]
C H L O R O P L A STRANSFORMATION T IN HIGHER PLANTS
555
in Chlamydomonas and higher plants. Daniell and McFadden I demonstrated the expression of foreign genes (cat, rbcS) in chloroplasts of higher plants in 1987; expression of foreign genes in chloroplasts of Chlamydomonas has also been accomplished recently. 26 Stable complementation of deletions in the chloroplast genome of Chlamydomonas reported by Boynton e t al., in 19884 has been accomplished recently in tobacco. 12'13Complete nucleotide sequences of higher plant chloroplast genomes are available in the literature; this has greatly facilitated the studies of chloroplast transformation. However, complete nucleotide sequence of the Chlamydomonas chloroplast genome has not yet been determined. Chlamydomonas provides a single large chloroplast ideal for bombardment studies and a large number of mutants that are amenable to genetic analyses. However, higher plants have a large number of chloroplasts in each cell making transformation studies more difficult. On the other hand, a large number of commonly used reporter genes (e.g., cat, uidA, nptlI, etc.) can be readily expressed in higher plant chloroplasts but not in Chlamydomonas; because of this fundamental difference in the protein synthetic machinery, observations made in Chlamydomonas can not be extrapolated to higher plants. Rapid progress has been made by using both systems as useful tools. A workable system for gene introduction or replacement in chloroplasts has great merit as a tool for the study of their function and regulated gene expression. One of the important goals of these studies is to introduce economically important traits in agricultural crops; genes of economic importance should therefore be engineered via organelle genomes in order to utilize the potential advantages of the organelle transformation system. For example, one of the major hurdles in engineering insect resistant plants has been the low level of expression of Bacillus thuringiensis (B.t) toxin genes; increase in B.t. toxin gene expression of up to 500-fold has been achieved through specific modification of B.t. coding sequence from prokaryotic composition to suit the eukaryotic nature of plant nuclei. 27 It is also known that chloroplast genes transferred to the nuclear genome have adjusted to nuclear base composition and codon usage. 28 Therefore, the problem of insufficient expression of foreign genes, especially if the foreign gene is of bacterial origin, could be overcome by engineering those genes via organelle genomes. It is also possible to introduce multiple copies of foreign genes via organelle genomes as opposed to a few functional copies 26 M. Goldschmidt-Clermont, Nucleic Acids Res. 19, 4083 (1991). 27 F. J. Perlak, R.-L. Fuchs, D. A. Dean, S. L. McPherson, and D. A. FischRoff, Proc. Natl. Acad. Sci. U.S.A., 88, 3324 (1991). 28 j. C. Oliver, A. Marin, and J. M. Martinez-Zapater, Nucleic" Acids Res. 18, 65 (1990).
556
M E T H O D SFOR TRANSFORMING ANIMAL AND PLANT CELLS
[381
via the nuclear genome4-8; whether this would result in increased foreign gene products remains an open question, at this point. Engineering the chloroplast genome would also be useful in identifying a large number of chloroplast genes whose functions are still unknown. For example, successful introduction of D N A into chloroplasts and its stable integration by homologous recombination would open the way for selective inactivation of chloroplast genes and subsequent restoration of their functions. Targeted disruption of known chloroplast genes [e.g., atpB, rbcL, 29 psaC 3°] has been recently accomplished in Chlamydomonas but not subsequent restoration o f their functions; disruption of ORF472 h o w e v e r remained heteroplasmic.26 Analysis of the complete nucleotide sequences of the chloroplast genomes of a liverwort (Marchantia polymorpha,) and higher plants (tobacco, rice) has resulted in the identification of a number of open reading frames (ORFs) which are likely to represent additional, previously unrecognized chloroplast genes. By D N A or protein sequence homology and transcript analyses a few of these ORFs have been identified. 31 Identification of products of the ORFs and their functions in chloroplasts is the next major challenge to chloroplast molecular biologists. The sexual transfer of genes from crop plants to weedy species to create more persistent weeds is probably the greatest environmental risk of genetic engineering crops for herbicide resistance. Escape of engineered foreign genes via pollen grain has indeed been documented recently. 32 Barring a few exceptions, uniparental-maternal inheritance of cytoplasmic organelles is a widespread p h e n o m e n o n in the plant kingdom. Therefore, an introduced foreign gene is likely to be contained within the transgenic plants; engineering foreign genes via organelle genomes may be used as an alternative transformation system for those plants that exhibit a high f r e q u e n c y o f outcross.3~
Acknowledgments The author is grateful to the followingfor their experimental contributions: G. N. Ye, M. Krishnan, I. M. Holme, J. Vivekananda, C. Paszty, and S. B. Kaliappan. The author also acknowledges fruitful collaborations with Drs. L. Bogorad, J. C. Sanford, B. A. McFadden, K. K. Tewari, and B. L. Nielsen. The results presented here were supported by the following grants to H.D.: NSF Grant RII-8902065, SBOE Grants 88-022, 89-022, and 89-010, and WTC Grant 312-206 to H.D. and B.A.McFadden. 29S. M. Newman, N. W. Gillham, E. H. Harris, A. M. Johnson, and J. E. Boynton, Mol. Gen. Genet. 230, 65 (1991). 30y. Takahashi, M. Goldschmidt-Clermont, S. Y. Soen, L. G. Franzen, and J. D. Rochaix, EMBO J. 10, 2033 (1991). 31 K. Ohyama, T. Kohchi, T. Sato, and Y. Yamada, Trends Biochem. Sci. 13, 19 (1988). 32 N. C. Ellstrand and C. A. Hoffman, BioScience 40, 438 (1990).
[39]
RECOMBINANT
VACCINIA VIRUS
557
[39] Generation and Analysis of Vaccinia Virus Recombinants B y G A l L P. MAZZARA, A N T O N I A DESTREE, a n d A N N A M A H R
Introduction
Vaccinia virus has become one of the most widely used vectors for the expression of heterologous genes in mammalian cells. The widespread use of vaccinia as a vector system is due in part to the ease with which recombinant vaccinia viruses containing large insertions of foreign DNA can be generated and the authenticity of expression of foreign polypeptides during viral replication. ~ Vaccinia virus has the capacity for at least 25 kilobases (kb) of foreign DNA. 2 Recombinant vaccinia viruses expressing a wide variety of heterologous genes have been used for a number of applications, including (1) analyzing gene regulation, 3'4 (2) producing biologically active molecules in tissue culture, 5 (3) immunizing animals for antibody production, 6 (4) creating live recombinant vaccines, 7-13 and (5) elucidating the role of specific antigens in inducing defined immune re-
I D. E. Hruby, Clin. Microbiol, Rev. 3, 153 (1990). 2 G. L. Smith and B. Moss, Gene 25, 21 (1983). 3 D. E. Hruby, G. T. Thomas, E. Herbert, and C. A. Franke, this series, Vol. 124, p. 295. 4 D. Ansardi, C. Porter, and C. D. Morrow, J. Virol. 65, 2088 (1991). 5 A. Pavirani, P. Meulien, H. Harrer, K. Dott, F. Mischief, M.-L. Wiesel, C. Mazurier, and J.-P. Lecocq, Biochem. Biophys. Res. Commun. 145, 234 (1987). 6 K. Kent, L. Gritz, H. Cranage, P. Silvera, T. Corcoran, and J. Stott, Int. Conf. AIDS. 6th abstr. Th.A. 298 (1990). 7 B. Moss, G. L. Smith, J. L. Gerin, and R. Purcell, Nature (London) 311, 67 (1984). 8 T. J. Wiktor, R. I. MacFarlan, K. J. Reagan, B. Dietzschold, P. J. Curtis, W. H. Wunner, M. Kieny, R. Lathe, J. Lecocq, M. Mackett, B. Moss, and H. Koprowski, Proc. Natl. Acad. Sei. U.S.A. 81, 7194 (1984). 9 D. Zagury, J. Bernard, R. Cheynier, I. Desportes, R. Leonard, M. Fouchard, B. Reveil, D. Ittele, Z. Lurhuma, K. Mbayo, J. Wane, J. Salaun, B. Goussard, L. Dechazal. A. Burny, P. Nara, and R. Gallo, Nature (London) 332, 728 (1988). ~0V. A. Fischetti, W. M. Hodges, and D. E. Hruby, Science 244, 1487 (1989). i1 B. E. H. Coupar, M. E. Andrew, D. B. Boyle, and R. V. Blanden, Proc. Natl. Acad. S c i U.S.A. 83, 7879 (1986). t2 D. D. Auperin, J. J. Esposito, J. V. Lange, S. P. Bauer, J. Knight, D. R. Sasso, and J. B. McCormick, Virus Res. 9, 233 (1988). ~3 E. M. Cantin, R. Eberle, J. L. Baldick, B. Moss, D. E. Willey, A. L. Notkins, and H. Openshaw, Proc. Natl. Acad. Sci. U.S.A. 84, 5908 (1987).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
558
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[39]
sponses. 14-18This last application includes generating targets for cytotoxic T cells. 19In this chapter, methods for the generation and analysis of recombinant vaccinia viruses are presented.
Biology of Vaccinia Virus Appreciation of the unique features of vaccinia virus as an expression vector requires an understanding of certain features of the biology of the virus. Vaccinia virus is a member of the poxvirus family, which comprises a group of complex animal viruses whose replication is confined to the cytoplasm of the infected cell. Vaccinia virus, the prototype orthopoxvirus, contains a linear, double-stranded DNA genome of 191.6 kb with 198 major open reading frames. 2° This DNA contains hairpin loops at the ends, and extending from these loops are inverted terminal repeats of approximately l0 k b . 2°'21 The DNA is packaged within the virus core, which also contains a complete transcription system that includes capping, methylating, and polyadenylating enzymes as well as a viral RNA polymera s e . 22 The viral RNA polymerase recognizes only vaccinia (or other poxvirus) transcriptional regulatory sequences, which differ from eukaryotic or prokaryotic promoter consensus sequences. 23-26 The enzymes located in the virus core, together with those synthesized during the course of virus infection, permit replication of vaccinia virus independent of nuclear host cell functions involved in DNA replication and transcription, thus allowing 14 R. A. Koup, J. L. Sullivan, P. H. Levine, D. Brettler, A. Mahr, G. Mazzara, S. McKenzie, and D. Panicali, Blood 73, 1909 (1989). 15 j. M. Zarling, W. Morton, P. A. Moran, J. McClure, S. G. Kosowski, and S. L. Hu, Nature (London) 323, 344 (1986). 16 L. Shen, Z. Shen, W. Chen, M. D. Miller, V. Stallard, G. P. Mazzara, D. L. Panicali, and N. L. Letvin, Science 252, 440 (1991). 17 C. J. Langford, S. J. Edwards, G. L. Smith, G. F. Mitchell, B. Moss, D. J. Kemp, and R. F. Anders, Mol. Cell. Biol. 6, 3191 (1986). z8 W. Keil and R. R. Wagner, Virology 170, 392 (1989). 19 R. A. Koup, J. L. Sullivan, P. H. Levine, F. Brewster, A. Mahr, G. Mazzara, S. McKenzie, and D. Panicali, J. Virol. 63, 584 (1989). 2o S. J. Goebel, G. P. Johnson, M. E. Perkus, S. W. Davis, J. P. Winslow, and E. Paoletti, Virology 179, 247 (1990). 21 p. Geshelin and K. I. Berns, J. Mol. Biol. 88, 785 (1974). 22 B. MOSS, in "Virology" (B. Fields, D. M. Knipe, R. M. Chanock, J. L. Melnick, B. Roizman, and R. E. Shope, eds.), p. 2079. Raven, New York, 1990. 23 S. Venkatesan and B. Moss, J. Virol. 37, 738 (1981). 24 C. Bertholet, R. Drillien, and R. Wittek, Proc. Natl. Acad. Sci. U.S.A. 82, 2096 (1985). 25 A. J. Davison and B. Moss, J. Mol. Biol. 210, 749 (1989). 26 A. J. Davison and B. Moss, J. Mol. Biol. 210, 771 (1989).
[39]
RECOMBINANT VACCINIA VIRUS
559
cytoplasmic replication of the virus. 27 The core enzymes are essential for infectivity, as demonstrated by the finding that deproteinized genomic DNA is noninfectious. On infection of susceptible cells by vaccinia virus, the transcription system in the virus core is activated, and a first round of RNA synthesis occurs. 28 The resulting early mRNAs are then translated to yield early proteins, among which are a DNA polymerase 29and other enzymes needed for replication of the viral genome. DNA replication, which begins within a few hours of infection, marks the beginning of late gene expression as well as the end of early transcription. The polypeptides synthesized late in infection include most of the structural proteins and many of the enzymes found in the mature virus. 24,3° These proteins are assembled into virus particles in the cytoplasm. The majority of the infectious virus remains cell associated; however, some of these mature virions gain an additional lipid envelope derived from the Golgi membrane before exiting through the plasma membrane. 31 The temporal regulation of gene expression is controlled primarily at the transcriptional level. Genes expressed at early or late times, defined as the periods preceding and following the onset of DNA replication, have different transcriptional regulatory sequences (promoters) and utilize different transcription f a c t o r s . 25'26'32 A subset of genes are expressed throughout the vaccinia replication cycle, and these genes contain separate, tandemly arranged early and late promoter sequences.3S The mRNAs synthesized at early and late times differ in structure. Like eukaryotic mRNAs, early mRNAs have methylated c a p s 34 and poly(A) tails, 35 and are of discrete length, with transcription termination occurring 50-70 bp beyond the conserved termination sequence TTTTTNT. 36.37By contrast, late mRNAs contain capped poly(A) sequences at the 5' termini 3s'39 and, because transcription termination signals are apparently lacking, the 3' 27 F. Fenner, R. Wittek, and K. R. Dumbell, "The Orthopoxviruses." Academic Press, San Diego, 1989. 28 j. R. Kates and B. R. McAuslan, Proc. Natl. Acad. Sci. U.S.A. 58, 134 (1967). .,9 p. Traktman, R. Sridhar, R. C. Condit, and B. Roberts, J. Virol. 49, 125 (1984). 30 R. Wittek, M. Hanggi, and G. Hiller, J. Virol. 49, 371 (1984). 31 L. Payne and K. Kristensson, J. Virol. 32, 614 (1979). s2 L. Yuen, A. J. Davison, and B. Moss, Proc. Natl. Acad. Sci. U.S.A. 84, 6069 (1987). 33 M. Mackett, G. L. Smith, and B. Moss, J. Virol. 49, 857 (1984). 34 C. M. Wei and B. Moss, Proc. Natl. Acad. Sci. U.S.A. 72, 318 (1975). 35 j. R. Kates and J. Beeson, J. Mol. Biol. 50, 1 (1970). 36 L. Yuen and B. Moss, J. Virol. 60, 320 (1986). 37 G. Rohrmann, L. Yuen, and B. Moss, Cell 46, 1029 (1986). 38 B.-Y. Ahn and B. Moss, J. Virol. 63, 226 (1989). 39 B. Schwer, P. Visca, J. C. Vos, and H. G. Stunnenberg, Cell 50, 163 (1987).
560
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[39]
ends are extremely heterogeneous in length. 4°'41 Vaccinia RNA is colinear with the genomic DNA, and no splicing of RNA has been observed. Vaccinia virus has a broad host range in vivo and can productively infect a large number of mammalian and avian cell lines. 27 Infection is followed by rapid and complete inhibition of host nucleic acid and protein synthesis. 2z As a result, the host translational machinery synthesizes exclusively viral proteins. Cytopathic effects are first observed a few hours after infection; within 20-40 hr after infection, infectious viral progeny are produced, followed by cell death. Generation of Recombinant Viruses The generation of recombinant vaccinia viruses is accomplished via homologous recombination in vivo between vaccinia DNA and plasmid vectors that contain the heterologous sequences to be inserted. 33'42-45The plasmid vectors contain one or more chimeric genes, each comprising a poxvirus promoter linked to a protein-coding sequence, flanked by viral sequences from a nonessential region of the vaccinia genome. As diagrammed in Fig. 1, the plasmid is transfected into cells infected with the parental vaccinia virus, and recombination between vaccinia sequences on the plasmid and the corresponding DNA in the viral genome results in the insertion into the viral genome of the chimeric genes on the plasmid. Infectious virus containing a recombinant genome comprise approximately 0.01-0.05% of the viable progeny virus; consequently, a variety of procedures have been developed for their identification or selection. Once identified, the recombinant virus Can be purified by repeated plaque isolation. For many laboratory studies, the neurotropic WR strain of vaccinia [ # V R l l 9 ; American Type Culture Collection (ATCC), Rockville, MD] has been used as the parental virus for the generation of recombinants. However, other strains may be preferable for specific applications. For example, a primary consideration in the use of live recombinant virus for immunoprophylaxis is safety. Consequently, vaccine strains of virus, including the Wyeth (New York City Board of Health, ATCC #VR325) and Elstree (ATCC #VR862) strains have been increasingly used for the generation of recombinants. Derivatives of any of these wild-type strains 4o j. A. Cooper, R. Wittek, and B. Moss, J. Virol. 39, 733 (1981). 41 A. Mahr and B. Roberts, J. Virol. 49, 510 (1984). 42 E. Nakano, D. Panicali, and E. Paoletti, Proc. Natl. Acad. Sci. U.S.A. 79, 1593 (1982). 43 M. Mackett, G. L. Smith, and B. Moss, Proc. Natl. Acad. Sci. U.S.A. 79, 7415 (1982). E. Paoletti, B. R. Lipinskas, C. Samsonoff, S. Mercer, and D. Panicali, Proc. Natl. Acad. Sci. U.S.A. 81, 193 (1984). 45 D. Panicali and E. Paoletti, Proc. Natl. Acad. Sci. U.S.A. 79, 4927 (1982).
[39]
RECOMBINANTVACCINIAVIRUS
561
Vacclnla Virus Recombinant
-1
Parental Virus
I
Recombination
Purification and Growth
;IIIIII~II/IIIIIIIII/IIIIIIIIIllI~
ii
Genomlc Analysis
iii
Expression Analysis il Expression Plasmld Baalc
Vaccines
Research
Protein Expression FIG, 1. Generation and analysis of recombinant vaccinia virus.
that contain mutations useful for the identification of recombinant viruses may also be used. 46'47 In these strains, formation of a recombinant results in the restoration of a selectable, wild-type phenotype. For example, Smith et al. 48 have described the use of a parental virus, designated vAbT 33, which contains a mutation in K1L, a host range gene; this mutation prevents virus growth on certain cells, most notably the RK-13 cell line derived from rabbit kidney. The plasmid vectors used for in vivo recombination with this virus simultaneously insert the foreign gene of interest and restore host range function. Consequently, recombinants can be selected by virtue of their ability to grow on the restrictive cell line. A number of general plasmid vectors for the introduction of foreign genetic elements into the vaccinia genome have been described. 33,44.47'49,5° 46 j. F. Rodriguez and M. Esteban, J. Virol. 63, 997 (1989). 47 M. E. Perkus, K. Limbach, and E. Paoletti, J. Virol. 63, 3829 (1989). 48 K. A. Smith, V. Stallard, J. M. Roos, C. Hart, N. Cormier, L. Cohen, B. E. Roberts, and L. G. Payne, Vaccine, in press. 49 F. G. Falkner, T. R. Fuerst, and B. Moss, Virology 164, 450 (1988). 50 S. Chakrabarti, K. Brechling, and B. Moss, Mol. Cell. Biol. 5, 3403 (1985).
562
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[39] ¢1, EcORI
hoI, Sphl , Sin.I, Kpnl
FIG. 2. Structures of two plasmid vectors for insertion and expression of foreign genes in vaccinia virus. Vector pAbT4586 is designed to permit the simultaneous insertion of the E. coli lacZ gene together with two additional foreign genes of interest, each under the direction of a vaccinia promoter, into the TK locus of the vaccinia genome. Plasmid vector vAbT4587 is used for the insertion of a single foreign gene into a host range mutant in the vaccinia HindlII M region. Unique restriction sites for insertion of foreign DNA fragments are indicated.
Minimally, these vectors contain one or more vaccinia promoters adjacent to unique restriction sites for insertion of foreign coding sequences, vaccinia sequences that direct insertion of these sequences into homologous regions of the virus genome, and a bacterial origin of replication and antibiotic resistance marker to permit amplification of the plasmid in prokaryotic cells. Many of these vectors also incorporate elements that facilitate the identification and purification of recombinant viruses. Structures of two representative vectors are shown in Fig. 2. Promoters. Because cellular and other viral promoters are not recognized by the vaccinia transcriptional apparatus, natural or synthetic vaccinia (or other poxvirus) promoters must be used to direct the expression of foreign genes. 25,26'51'52 The use of vaccinia promoters in an insertion vector requires knowledge of the promoter sequence and of the transcriptional start site of the vaccinia gene. Ideally, the promoters used in these vectors lack the endogenous translational start site. This permits insertion of the intact foreign coding sequence immediately downstream of the vaccinia RNA start site to allow initiation of transcription here and translation of the resulting mRNA into the authentic foreign protein. A number of vaccinia virus promoters, defined by transcriptional map51 C. Puckett and B. Moss, Cell 35, 441 (1983). 52 D. D. Patel, C. A. Ray, R. P. Drucker, and D. J. Pickup, Proc. Natl. Acad. Sci. U.S.A. 85, 9431 (1988).
[39]
RECOMBINANT VACCINIA VIRUS
563
ping and DNA sequence analysis, have been used for the expression of foreign genes. The choice of promoter dictates the timing and level of gene expression, and is dependent on the specific application. For example, it has been reported that foreign proteins expressed late in the vaccinia replication cycle may be ineffective for priming cytotoxic T cell responses in vivo and for generating target cells for recognition by specific cytotoxic T cells in vitro. 53 Consequently, vaccinia recombinants intended for vaccine use should be constructed using early or constitutive early/late promoters to express the foreign gene of interest if a cell-mediated immune response is desired. The 7 . 5 K 33 and 4 0 K 47'54'55 promoters, ideal for early expression, are also active during late infection. For maximum early expression, any cryptic vaccinia transcription termination sequences (TTTTTNT) present in the coding sequence of the foreign gene should be altered by mutagenesis to permit expression of full-length early mRNA, ultimately enhancing protein expression, and improving the immunogenicity of the resulting recombinant. 56 For high-level expression of foreign gene products, strong late promoters from genes encoding the major virus structural proteins are preferred. Widespread use is made of the strong late I l K promoter. 24 Based on analysis of such strong late promoters, Davison and M o s s 57 have also designed a synthetic promoter that is stronger than any of the natural late promoters currently used in expression vectors, and have used this promoter to direct the expression of several herpesvirus proteins. An alternate method for expressing high levels of foreign protein in the vaccinia system utilizes the bacteriophage T7 promoter and RNA polymerase. 58 Two vaccinia recombinants are made: one contains a vaccinia promoter driving the expression of the T7 RNA polymerase, and the second virus contains the foreign gene to be expressed under the control of the T7 promoter and termination sequences. Cells are then simultaneously infected with both recombinants. An improvement of this system makes use of the encephalomyocarditis virus 5'-untranslated sequence to confer cap-independent translation of mRNA, thereby increasing protein yields. 59 A final consideration in the choice of a vaccinia promoter for use at a 53 B. E. Coupar, M. E. Andrew, G. W. Bothe, and D. B. Boyle, Eur. J. Immunol. 16, 1479 (1986). 54 j. Lyons, C. Sinos, A. Destree, T. Caiazzo, K. Havican, S. McKenzie, D. Panicali, and A. Mahr, Infect. Imrnun. 58, 4089 (1990). 55 j. Taylor, R. Weinberg, B. Languet, P. Desmettre, and E. Paoletti, Vaccine 6, 497 (1988). 56 p. A. Earl, A. W. Hugin, and B. Moss, J. Virol. 64, 2448 (1990). 57 A. J. Davison and B. Moss, Nucleic Acids Res. 18~ 4285 (1990). 58 T. R. Fuerst, P. L. Earl, and B. Moss, Mol. Cell. Biol. 7, 2538 (1987). 59 O. Elroy-Stein, T. R. Fuerst, and B. Moss, Proc. Natl. Acad. Sci. U.S.A. 86, 6126 (1989).
564
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[39]
particular insertion site is the issue of vaccinia sequence duplications that result from the introduction of a second copy of a vaccinia promoter into the genome. Sequence duplications in vaccinia, whether introduced by single cross-over recombination forming gene repeats or by the insertion of vaccinia promoters adjacent to foreign genes, are inherently unstable due to the relatively high frequency of intramolecular recombination. 6° This frequency will be affected by the size of the repeats and the distance separating them. Thus, ectopic insertion of a vaccinia promoter close to its native site will result in deletion or inversion of intervening sequences, depending on whether a direct or inverted duplication is produced. The consequence of such genomic rearrangement depends on whether the inversion or deletion is deleterious to viral growth. Such instability can be minimized by using short natural or synthetic promoter sequences; by using promoters isolated from other poxviruses; by using the native promoter of a nonessential gene, at its natural position in the viral genome, to direct foreign gene expression; and/or by increasing the distance between duplicated promoter sequences. Selectable Marker Genes. To facilitate identification of recombinant viruses, plasmid vectors may contain a marker gene under the direction of a vaccinia promoter, which is inserted into the vaccinia genome along with the foreign DNA of interest. Thus, the recombinants produced after in vivo recombination with such a vector simultaneously express both the marker gene and the desired foreign gene or genes. For example, plasmid vectors that contain the Escherichia coli fl-galactosidase gene give rise to recombinant viruses that can be identified by blue plaque formation in the presence of the appropriate indicator. 6~ Enrichment for recombinant viruses has been obtained via coexpression of guanine phosphoribosyltransferase (gpt), 62 neomycin phosphotransferase, 63 or the herpesvirus thymidine kinase (TK). 45 Insertion Site. To generate infectious recombinant vaccinia viruses, the site selected for insertion of foreign DNA must be in a region of the genome nonessential for virus growth in tissue culture. Several such regions have been identified, including the TK, 43 hemagglutinin (HA), 64 and ribonucleotide reductase 65 genes. Other nonessential sites include a site within the HindIII F fragment of the WR strain of vaccinia virus, 44 a 6o D. Spyropoulos, B. E. Roberts, D. L. Panicali, and L. K. Cohen, J. Virol. 62, 1046 (1988). 61 D. Panicali, A. Grzelecki, and C. Huang, Gene 47, 193 (1986). 62 F. G. Falkner and B. Moss, J. Virol. 62, 1849 (1988). 63 C. A. Franke, C. M. Rice, J. H. Strauss, and D. E. Hruby, Mol. Cell. Biol. 5, 1918 (1985). 64 H. Shida, T. Tochikura, T. Sato, T. Konno, K. Hirayoshi, M. Seki, Y. Ito, M. Hatanaka, Y. Hinuma, M. Sugimoto, F. Takahashi-Nishimaki, T. Maruyama, K. Miki, K. Suzuki, M. Morita, H. Sashiyama, and M. Hayami, EMBO J. 6, 3379 (1987). 65 S. Child, G. J. Palumbo, R. M. L. Buller, and D. E. Hruby, Virology 174, 625 (1990).
[39]
RECOMBINANT VACCINIA VIRUS
565
region at the left end of the genome that is deleted in some mutants, 66 and a region within the HindlII M fragment of the NYCBH strain of vaccinia virus. 47'48 Although any nonessential site may be used in the construction of recombinant viruses, certain sites, such as the HA or TK genes, are favored because they permit identification and/or selection of recombinants. The most commonly used site for insertion into the vaccinia genome is within the TK gene. Disruption of the TK gene coding sequences by insertion of foreign DNA results in the formation of T K - recombinant viruses, which can be selected by plaquing on a TK cell line in the presence of 5-bromodeoxyuridine (BUdR). However, not all BUdR-resistant plaques will be recombinants, because spontaneous T K - mutants arise at a frequency of 10 -4. The proportion of recombinant T K - virus thus depends on the efficiency of DNA transfection and recombination during recombinant generation. However, disruption of the gene may result in marked attenuation of virus growth in uiuo. 67 The use of the host range mutant vAbT 33 as the parental virus for in vivo recombination permits the insertion of foreign genetic material at a nonessential site in the vaccinia HindlII M region without a significant change in the in vivo growth characteristic of the resulting recombinant. 48 The plasmid vectors for in vivo recombination with this virus are designed such that insertion of foreign DNA by homologous recombination simultaneously regenerates the K I L host range gene. This permits selection of recombinant viruses by virtue of their growth on the restrictive cell line. The use of this insertion site for the generation and selection of recombinants has some significant advantages over other methods. First, the method allows the rapid isolation of recombinant viruses occurring at a frequency as low as 10 -4. It does not require the use of drugs or mutagens for selection, nor is there a need for the use of marker genes, such as the E. coli lacZ gene, for recombinant identification. Finally, insertion in this region can be accomplished without the loss of any vaccinia gene functions by introducing foreign DNA into noncoding sequences of the host range gene. Growth and Titration of Vaccinia Virus Safety Considerations
Handling of both recombinant and nonrecombinant vaccinia virus should be in accordance with National Institutes of Health (NIH) and 66 D. Panicali, S. W. Davis, S. R. Mercer, and E. Paoletti, J. Virol. 37, 1000 (1981). 67 R. M. L. Buller, G. L. Smith, K. Cremer, A. L. Notkins, and B. Moss, Nature (London) 317, 813 (1985).
566
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[39]
Center for Disease Control (CDC) guidelines. 68 All activities involving the use and manipulation of vaccinia virus should be done in accordance with Biosafety level 2 regulations. All personnel in laboratory or animal care areas where vaccinia is utilized should have documented evidence of vaccination within the preceding 3 years. Persons for whom vaccination is contraindicated, such as those with altered immune status or eczema, should not handle vaccinia virus. Vaccinia recombinants should be handled in accordance with NIH guidelines pertaining to recombinant organisms. Host Cells The broad host range of vaccinia virus allows the use of a number of different cell lines for the preparation of virus stocks, plaque formation, and transfection. BS-C-4069cells work well for transfections, plaque purification, amplification, and for titering virus. CV-1 (ATCC #CCL70) or BS-C-1 (ATCC #CCL26) cells can be substituted for BS-C-40 cells. The human cell line, 143hTK- (ATCC #CRL8303), is used for selection of T K - recombinants. RK-13 cells (ATCC #CCL37) are preferred for preparation of high-titer virus stocks because of the higher viral yields; they are required for host range selection based on the K1L host range gene. A 15cm plate of confluent cells contains approximately 3 x 107 RK-13 cells or 2.0-2.5 × 107 BS-C-40 cells. All these cell lines are grown at 37° with 5% CO2 in Dulbecco's modified Eagle's medium (DMEM) supplemented with 5% (v/v) fetal calf serum (FCS). Vaccinia Virus Growth Virus stocks may be prepared from a plaque isolate or from a virus stock of known titer. Amplification of a plaque isolate requires infection of successively increasing numbers of cells. The following protocols are generally applicable for infection of cell monolayers in 6- and 15-cm plates. When using virus, thaw them quickly at 37 °, keep on ice, and vortex well before using. Reagents Confluent monolayers of RK-13 or BS-C-40 cells in 6-cm tissue culture plates Confluent monolayers of RK-13 or B S-C-40 cells in 15-cm tissue culture plates 6s U.S. Department of Health and Human Services, "Biosafety in Microbiology and Biomedical Laboratories," p. 78. U.S. Government Printing Office, Washington, D.C., 1988. 69 W. W. Brockman and D. Nathans, Proc. Natl. A c a d . Sci. U.S.A. 71, 942 (1974).
[39]
RECOMBINANT VACCINIA VIRUS
567
DMEM supplemented with 2% (v/v) FCS DMEM supplemented with 5% (v/v) FCS Tris-HCl (1 mM), pH 9.0 Sucrose (36% w/v) in 1 mM Tris-HCl, pH 9.0
Procedure: Initial Amplification of Plaque Isolate 1. Prepare confluent monolayers of RK-13 cells in 6-cm plates. BS-C-40 cells can be used but will result in a lower yield of virus. 2. Aspirate the medium from cells, add virus, and allow to adsorb for 30 min at 37°. The virus plaque, which normally contains approximately 300-800 plaque-forming units (pfu), is originally resuspended in 2 ml of DMEM supplemented with 2% (v/v) FCS. For virus plaques grown on BS-C-40 cells, use 1 ml of virus. If grown on RK-13 cells, use 0.3 ml of virus. 3. Add 4 ml DMEM supplemented with 2% (v/v) FCS and incubate at 37 ° until 100% of the cells display a cytopathic effect (CPE). This is typically seen at 1-5 days. Do not allow the infection to proceed for longer than 5 days. 4. Scrape the cells into medium and harvest by centrifugation at 3000 rpm for 10 min at 4 °. Resuspend the cell pellet in 2 ml of ! mM Tris-HC1, pH 9.0, for each 6-cm plate or 5 ml of 1 mM Tris-HCl, pH 9.0, for each 15-cm plate. Alternatively, remove the medium, add the 1 mM Tris-HCl, pH 9.0, before scraping the cells and then transfer to a tube. 5. To release virus from cells, freeze and thaw three times, vortexing between each cycle. Store at - 80°. The resulting virus stock can be titered or further amplified on a 15-cm plate of cells.
Procedure: Secondary Amplification of Plaque Isolate~Preparation of Stock from Virus of Known Titer 1. Prepare confluent monolayers of RK-13 cells in 15-cm plates. 2. Remove the medium from cells and add 4.5 ml fresh DMEM supplemented with 2% (v/v) FCS. 3. Add 0.2 ml of virus from the primary amplification or virus from a titered stock to give a multiplicity of infection (MOI) of 0.1 pfu/cell. Adsorb virus for 30 min at 37°. 4. Add 15 ml DMEM supplemented with 2% (v/v) FCS and incubate at 37°. The infected cells should be observed daily to monitor CPE; 100% CPE is typically seen in 2 days. 5. When cells display 100% CPE, harvest and store in 5 ml of 1 mM Tris-HC1, pH 9.0, per 15-cm plate as described in steps 4 and 5 above under Initial Amplification. One plate yields approximately 0.2-5 x l 0 9 pfu/ml.
568
M E T H O D S FOR T R A N S F O R M I N G A N I M A L A N D P L A N T CELLS
[39]
Procedure: Virus Purification
If desired, virus may be concentrated and purified by centrifugation through a sucrose cushion. Purified virus is used for immunization studies. I. Layer virus on 15 ml of 36% (w/v) sucrose in 1 mM Tris-HC1, pH 9, in a 40-ml Beckman (Fullerton, CA) ultracentrifuge tube for the SW28 rotor. 2. Centrifuge for 1 hr at 20,000 rpm at 4 ° to pellet virus. 3. Remove the sucrose and resuspend the viral pellet in 1 mM TrisHC1, pH 9 (1-2 ml/15-cm dish), Virus Titration Reagents
Confluent monolayers of BS-C-40 cells in 6-cm tissue culture plates DMEM supplemented with 2% (v/v) FCS Crystal violet (0.1%, w/v) in 20% (v/v) ethanol Procedure
1. Prepare confluent monolayers of BS-C-40 cells in 6-cm dishes. 2. Make 1-2 ml of 10-fold serial dilutions (10 -4 through 10- ~0dilutions) of the virus stock in DMEM supplemented with 2% (v/v) FCS. To avoid aggregation of virus, vortex each dilution well. 3. Remove the medium from cells and place 0.4 ml of the desired dilutions onto duplicate plates. Adsorb virus for 30 rain in a 37° incubator, rocking the plates every l0 min to ensure an even distribution of virus over the monolayer. 4. Remove inoculum and add 5 ml in DMEM supplemented with 2% (v/v) FCS. Incubate at 37° for 2 days. 5. Remove the medium. Add 3-4 ml of 0.1% (w/v) crystal violet in 20% (v/v) ethanol. Leave at room temperature for 5-10 min. Remove the crystal violet solution, rinse with water, and count the plaques after the plates are dry. Generation of Recombinants In Vivo Recombination
Generation of vaccinia recombinants in vivo requires the transfection of plasmid vectors into vaccinia-infected cells. Several variations of the calcium phosphate precipitation method for transfecting DNA have been used successfully. A basic protocol is presented here.
[39]
R E C O M B I N A N T V A C C I N I A VIRUS
569
Reagents Confluent monolayers of BS-C-40 or RK-13 cells in 6-cm tissue culture dishes N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES)-buffeted saline (HBS): 137 mM NaC1, 5 mM KC1, 0.7 mM Na2HPO 4, 6 mM dextrose, 20 mM HEPES, pH 7.1 CaCIz (2 M) Tris-HC! (1 mM), pH 9.0
Procedure 1. Infect cells with vaccinia virus at an MOI of 0.1 pfu/cell. Use BS-C-40 cells for BUdR selection, and RK- 13 cells for host range selection. Incubate at 37 ° for 30 min. 2. Prepare DNA precipitated with calcium phosphate as follows: mix 20/zg plasmid DNA in 500/xl HBS. Add 31/~1 of 2 M CaCI 2 and mix gently by pipetting. Let stand at room temperature 30-45 min. A negative control with no DNA should also be run in parallel. 3. After removing viral inoculum from plate, add 4 ml DMEM supplemented with 2% (v/v) FCS and return the plate to the incubator for 30 min. 4. Add precipitated DNA to the plate and incubate at 37 ° until 100% of the cells display CPE. This will be 24 hr for BS-C-40 cells and 48 hr for RK-13 cells. 5. Scrape the cells into medium and harvest by centrifugation at 3000 rpm for 10 min at 4 °. Alternatively, remove the medium, scrape cells into 1 mM Tris-HCl, pH 9.0 and pellet as described. Resuspend the pellet in 2 ml of 1 mM Tris-HC1, pH 9, and freeze/thaw three times to release virus. 6. Store at - 80°.
Selection of Recombinants A number of methods have been developed for the selection and screening of recombinant viruses. In the following section, the fl-galactosidase screening method and the T K - and K1L host range selection procedures will be described. A negative control of the parental virus with no added plasmid should be performed in parallel.
Reagents For/3-galactosidase screening Confluent monolayers of BS-C-40 or RK-13 cells in 6-cm plates Agarose overlay (made by mixing 1.2% (w/v) agarose with an equal volume of 2 x DMEM supplemented with 5% (v/v) FCS)
570
M E T H O D S FOR T R A N S F O R M I N G A N I M A L A N D P L A N T CELLS
[39]
Agarose overlay containing 0.4 mg/ml Bluogal (Bethesda Research Laboratories, Gaithersburg, MD) For T K - selection Confluent monolayers of 143hTK - cells in 6-cm plates Agarose overlay Agarose overlay containing 25/xg/ml BUdR For host range selection Confluent monolayers of RK-13 cells in 6-cm plates Agarose overlay Procedures
1. Prepare 10-fold serial dilutions of in vivo recombination (IVR)-generated virus in DMEM supplemented with 2% (v/v) FCS. 2. Remove the medium from cells and add 400/zl of each dilution to duplicate plates as follows: a. For fl-galactosidase screening: Plate 10 -2 tO 10 -6 dilutions on BS-C-40 cells. b. For TK selection: Plate l0 -4 to 10 - 6 dilutions on one set of 143hTK- cells (for total virus yield); plate 10 -2 to 10 -4 dilutions on a second set of 143hTK- cells (for recombinant selection). c. For host range selection: Plate 10 -~ to 10 -4 dilutions on RK-13 cells. 3. After incubating for 30 min at 37 °, remove viral inoculum and add 3-5 ml of appropriate overlay mixture: a. For fl-galactosidase screening: Agarose overlay. b. For TK selection: Agarose overlay (for l0 -4 to 10 - 6 dilutions) and agarose overlay containing 25/.~g/ml BUdR (for 10 -2 to 10 -4 dilutions). c. For host range selection: Agarose overlay. Overlay is made by mixing 2 × medium kept at 42-45°C with melted 1.2% (w/v) agarose cooled to the same temperature. Allow to solidify at room temperature and then return to a 37° incubator. 4. To screen for fl-galactosidase activity, remove plates from the incubator 2 days postinfection, and add 3 ml of agarose overlay containing 0.4 mg/ml Bluogal over the existing overlay. Let solidify at room temperature and return to the 37 ° incubator. Plaques typically turn blue 2-3 days after Bluogal addition. Recombination frequency can be calculated by determining the ratio of blue to white plaques. Pick well-isolated blue plaques into 2 ml DMEM supplemented with 2% (v/v) FCS for additional rounds of plaque purification. If it is necessary to obtain additional plaques for purification, replate the
[39]
RECOMBINANTVACCINIAVIRUS
571
IVR on BS-C-40 cells in the presence of Bluogal to give approximately 100 plaques/6-cm plate. 5. For TK selection, pick isolated plaques from the BUdR-treated plates into 2 ml DMEM supplemented with 2% (v/v) FCS. Recombination frequency can be calculated by comparing the number of plaques obtained in the presence and absence of BUDR. Purification will generally require at least two additional rounds of plaque isolation on 143hTK - cells in the presence of BUdR. 6. For host range selection, pick plaques formed on RK-13 cells into 2 ml DMEM supplemented with 2% (v/v) FCS and purify by replaquing on RK-13 cells. A pure isolate is generally obtained after the second round of plaque isolation.
Screening for Expression of Foreign Genes A number of methods for the identification of recombinant viruses based on the presence or expression of the foreign gene of interest have been described. These include methods based on DNA hybridization, mRNA analysis, and immunological detection. In addition to immunoassays performed either in situ on viral plaques or on infected cell lysates, this section describes a simple nucleic acid screen, useful when immunological reagents for the expressed proteins are not available. These assays can be performed at the early stages of recombinant virus purification to confirm the presence of recombinant virus in initial plaque isolates. When performing any of these assays, the parental virus should always be included as a negative control. If possible, a positive control should also be run in parallel.
R N A Dot Blot Reagents
Confluent monolayers of BS-C-40 cells in 6-cm plates Phosphate-buffered saline (PBS): 136 mM NaCI, 2.7 mM KC1, 8.1 mM Na2HPO 4 , 1.5 mM KHzPO4, 9.1 mM CaC12, 4.9 mM MgCI 2 , pH 7.2 Guanidinium thiocyanate solution (GTC): 4 M guanidinium thiocyanate, 25 mM sodium citrate (pH 7), 0.5% (w/v) laurylsarcosine, 0.1 M 2-mercaptoethanol Dimethyl sulfoxide (DMSO) Lysis buffer: Mix equal volumes of GTC plus DMSO
572
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[39]
Procedure 1. Remove the medium from plates. 2. Infect the cells with virus as follows: (a) infect at an MOI of 5-10 pfu/cell when using a virus with known titer; (b) infect with 0.2-0.4 ml for a plaque picked from RK-13 cells and resuspended in 2 ml medium; (c) infect with 1.0 ml for a plaque picked from BS-C-40 or 143hTK- cells and resuspended in 2 ml medium. 3. Adsorb virus for 30 min at 37° in a total volume of 1.0 ml DMEM supplemented with 2% (v/v) FCS. 4. Add 4 ml DMEM supplemented with 2% (v/v) FCS. 5. Incubate at 37 ° until CPE is observed in all cells (approximately 16-24 hr). 6. Remove the medium and wash cells twice with PBS. 7. Add 0.6-1.0 ml of freshly prepared lysis buffer to the plate and incubate at 37 ° for 30 min. 8. Scrape lysed cells into an Eppendorf tube. Samples can be frozen at this point, or spotted onto nitrocellulose or nylon filters and hybridized with appropriate nucleic acid probes according to standard procedures. Use 100/zl/sample.
Black Plaque Assay The black plaque assay is an in situ enzyme-linked immunosorbent assay (ELISA), 54'7° using specific primary and secondary antibodies and performed on an infected cell monolayer. The primary antibody may be a monoclonal antibody, polyclonal antibody, or whole-serum preparation reactive with the protein of interest. The secondary antibody is conjugated to alkaline phosphatase; thus, positive plaques can be identified by virtue of their blue-black color after reaction with the chromogenic indicator. The assay may be performed on fixed or live infected cells. The fixed assay is used to demonstrate foreign protein expression during the course of plaque purification and to determine the purity of plaque isolates. The live assay can be used as a means of plaque purification. The black plaque assay requires high-affinity antibodies, typically diluted 1 : 100 to 1 : 500.
Reagents Confluent monolayers of BS-C-40 or RK-13 cells in six-well (35-mm) tissue culture plates For fixed black plaque v0 M. Mackett and J. R. Arrand, EMBO J. 4, 3229 (1985).
[39]
RECOMBINANT VACCINIA VIRUS
573
PBS Tris-buffered saline (TBS): 20 mM Tris-HC1 (pH 7.6), 150 mM NaC1 High-salt wash buffer: 20 mM Tris-HCl (pH 8.4), 1 M NaCI, 0.05% (v/v) Tween 80 Formaldehyde, 3.7% (v/v) in PBS Normal goat serum (NGS) Appropriate primary and alkaline phosphatase-labeled secondary antibodies BCIP kit (Kirkegaard and Perry Laboratories, Gaithersburg, MD) For live black plaque PBS Bovine serum albumin (BSA), 3% (w/v) in PBS TBS Appropriate primary and alkaline phosphatase-labeled secondary antibodies BCIP/NBT phosphatase substrate Procedure
1. Infect cells in six-well (35-mm) tissue culture plates with approximately 50 pfu of virus per well. If using RK-13 cells, an agarose overlay must be applied after infection. 2. Two days postinfection, aspirate the medium or carefully remove the agarose overlay without disturbing the monolayer, and wash cells gently with PBS. 3. For black plaque with fixed cells, add 3.7% (v/v) formaldehyde in PBS and incubate for 20 rain at room temperature. Aspirate the formaldehyde solution and wash the monolayer three times with PBS. Then incubate with 0.5-1.0 ml primary antibody (diluted in NGS) for 1 hr at room temperature at 37° or overnight at 4 ° . 4. For live black plaque, add 1.0-2.0 ml of primary antibody diluted in sterile 3% (v/v) BSA. Incubate at room temperature for 60 min. 5. For both live and fixed samples, remove primary antibody and wash gently three times with PBS. 6. Incubate at room temperature for 1 hr with secondary antibody diluted 1 : 500-1 : 1000. For fixed samples, the secondary antibody is diluted in 10% (v/v) NGS; for live black plaques, it is diluted in 3% (w/v) BSA. Remove secondary antibody from the monolayer and wash twice with high-salt wash buffer (fixed samples) or PBS (live samples), and once with TBS. Develop color using the BCIP/NBT phosphatase substrate according to the instructions of the manufacturer. After color development, which may take up to 60 min, stop the reaction by removing chromagen and rinsing with water.
574
M E T H O D S FOR T R A N S F O R M I N G A N I M A L A N D P L A N T CELLS
[39]
7. For the live black plaque samples, pick positive plaques with sterile Pasteur pipettes into 2 ml DMEM supplemented with 2% (v/v) FCS.
Immunoblot Assay In this assay, crude lysates of infected cells are spotted onto nitrocellulose and reacted with antibody specific for the expressed proteins. Confluent monolayers of cells in 24-well tissue culture plates (1.5 cm/well) are infected as described for RNA dot-blot assay and harvested when 100% CPE is observed. The infected cell pellet is resuspended in 0.5-1.0 ml PBS and subjected to three rounds of freeze/thaw. Lysate (100-500 /zl) is spotted onto nitrocellulose and reacted with primary and secondary antibodies according to standard techniques. Note that if the expressed protein is secreted, the culture medium can be directly analyzed after application to nitrocellulose filters to detect the presence of extracellular protein. Phenylmethylsulfonyl fluoride (PMSF) can be added to 1 mM if the medium or cell lysate will be stored at - 8 0 ° prior to analysis.
Characterization of Recombinant Vaccinia Viruses Once a recombinant vaccinia virus has been isolated and amplified, it can be analyzed both for genomic structure, to verify correct insertion of foreign DNA, and for protein expression by a variety of immunological methods, including radioimmunoprecipitation analysis (RIPA), Western blot, and immunofluorescence. This section will describe the preparation of vaccinia genomic DNA for Southern blot analysis, radiolabeling of vaccinia-infected cells for RIPA of expressed proteins, and preparation of samples from vaccinia-infected cells for Western blot.
Preparation of Vaccinia Genomic DNA Analysis of the genomic DNA of recombinant viruses by restriction enzyme digestion and hybridization should be routinely performed to verify the proper insertion of foreign genes and to demonstrate genetic homogeneity in the virus stock. In addition to the genomic DNA of the recombinant virus, it is useful to analyze, in parallel, genomic DNA from the parental vaccinia virus and the donor plasmid DNA. The restriction pattern can be visualized by ethidium bromide staining prior to Southern transfer and hybridization. Filters should be hybridized with both vaccinia DNA corresponding to the site of insertion and with DNA representing the inserted foreign genes. An example of Southern hybridization to show
[39]
RECOMBINANT VACCINIA VIRUS
575
insertion of foreign DNA into the vaccinia HindIII M site is shown in Fig. 3.
Reagents Confluent monolayers of BS-C-40 or RK-13 cells in 15-cm tissue culture plates PBS Hypotonic solution: 10 mM Tris-HCl (pH 8), 5 mM ethylenediaminetetraacetic acid (EDTA), 10 mM KCl 2-Mercaptoethanol Triton X-100, 10% (v/v) Proteinase K (20 mg/ml in water) NaCI (5 M) Sodium dodecyl sulfate (SDS), 10% (w/v) Sodium acetate (3 M), pH 5.2 Ethanol, 100% Ethanol, 70% (v/v) TE: 10 mM Tris-HC1 (pH 8.0), 1 mM EDTA; containing 0.5 mg/ml RNase A Phenol : chloroform (1 : I) Chloroform
Procedure This is a rapid method for the preparation of vaccinia genomic DNA that is pure enough for Southern blot analysis or cloning. The yield of DNA per 15-cm tissue culture plate is sufficient for 5-10 digestions, and is dependent on both multiplicity and length of infection. 1. Infect cells with the recombinant virus at an MOI of 2-10 pfu/cell. The virus is adsorbed for 30 rain at 37° in 5 ml DMEM supplemented with 2% (v/v) FCS. After adsorption, 15 ml of DMEM supplemented with 2% (v/v) FCS is added. 2. After CPE is observed in all cells, remove the medium and wash the monolayer twice with PBS. Scrape the cells into PBS and transfer to a centrifuge tube. Pellet the cells at 3000 rpm for 10 min at 4 °. 3. Discard the supernatant and resuspend the pellet in 1.8 ml of hypotonic solution. Add 1/.d 2-mercaptoethanol and 200/~l of 10% (v/v) Triton X-100. Incubate on ice for 10 rain with intermittent vortexing. 4. Centrifuge twice for 10 min at 2000 rpm at 4° to pellet nuclei. 5. To the supernatant, add 1/~l of 2-mercaptoethanol, 10/~l of proteinase K (20 mg/ml in water), 40/.d 5 M NaCl, and 100/.d 10% (w/v) SDS. Incubate for 1 hr at 37 °.
1.5
kb
2.9 2.5
H
E
H
t
t
t
kb
kb
E
H
t
t
P30K t o o .
.._
I
N
I
M
141 -
HIV envelope
I
M
_
.
-
K
1 2 3 4 5
23.1 9.4 6.6 4.3
2.3 2.0
i
! i
i¸
?
FXG. 3. Genomic structure and Southern blot analysis of a recombinant vaccinia virus. The structure of this recombinant, which contains the HIV-1 BH10 env gene inserted downstream of the 30K promoter in the H i n d l I I M fragment, is indicated above; Southern blot hybridization analysis is shown below. DNA was digested with E c o R I (lanes 1 and 2) or H i n d l I I (lanes 3 to 5), fractionated by electrophoresis through an agarose gel, and transferred to a nitrocellulose filter for hybridization with a 32p-labeled DNA fragment corresponding to the HIV env gene. Lanes 1 and 3 contain restriction digests of the parental plasmid used for in vivo recombination; lanes 2 and 4 contain genomic DNA from the recombinant; lane 5 contains genomic DNA from the wild-type NYCBH strain of vaccinia virus. Molecular weight markers in kilobase pairs (kb) are shown to the left.
[39]
RECOMBINANT VACCINIA VIRUS
577
6. Extract twice with phenol: chloroform (1 : 1) and once with chloroform. Then add 1/10 vol of 3 M sodium acetate, pH 5.2, and 2 vol of 100% ethanol and place at - 2 0 ° to precipitate DNA. 7. Pellet the DNA by centrifugation at 4° for 10 min at 12,000 rpm in a Sorvall (Norwalk, CT) SS-34 rotor. Rinse the pellet once with 70% (v/v) ethanol, drain, and allow the pellet to air dry. Do not desiccate. 8. Resuspend the pellet in 200/~1 of TE containing 0.5 mg/ml RNase A. Alternatively, the addition of RNase can be delayed and done concurrently with the digestion of the DNA. Store the DNA at 4°. 9. Approximately 20-50/zl of the DNA should be used for each digestion.
Protein Expression Analysis There are several immunoassays that can be used to analyze the products of foreign gene expression by a vaccinia virus recombinant. Following are protocols for the preparation of samples for Western blot analysis and for radioimmunoprecipitation analysis (RIPA). In the Western blot assay, lysates of infected cells are fractionated on SDS-polyacrylamide g e l s 71 and then transferred to nitrocellulose and reacted with monoclonal or polyclonal antibodies to determine the molecular weights and relative expression levels of the proteins of interest. RIPA provides similar information with regard to polypeptide size and yield. In addition, when the appropriate radiolabeled substrate is used in the culture medium, RIPA can also be used to detect modifications such as glycosylation, myristylation, and phosphorylation of the expressed proteins. Figure 4 shows an example of protein expression analysis using RIPA. In this experiment, both the infected cell lysate and the culture medium were analyzed for the presence of the human immunodeficiency virus type 1 (HIV-1) e n v encoded polypeptides expressed by a recombinant vaccinia virus. The amount of foreign protein expressed is dependent on the promoter used to direct its expression as well as on culture conditions (e.g., host cells, multiplicity of infection, and time of infection). For example, approximately 30/xg of HIV-1 envelope glycoprotein was produced per l08 Vero cells over a period of 4 days by a recombinant vaccinia virus that contained the HIV e n v gene under the control of the vaccinia 7.5K promoter. When the T7 system was used, expression levels were 7.5-fold higher. 72 71 U. K. Laemmli, Nature (London) 227, 680 (1970). 72 F. Dorner and N. Barrett, in "AIDS Vaccine Research and Clinical Trials" (S. D. Putney and D. P. Bolognesi, eds.), p. 219. Dekker, New York, 1990.
578
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
1
gp160 gp120
[39]
2
"~ "~
FIG. 4. Radioimmunoprecipitationanalysis of HIV-1polypeptidesproduced by a recombinant vaccinia virus that expresses the HIV-1 env gene. Infected BC-C-40cells were radiolabeled with [~SS]methioninefor 24 hr and the cell lysate and clarified culture medium were prepared as described in text. Both fractions were subjected to RIPA using antiserum from HIV-infected individuals. The positions of HIV polypeptides are indicated to the left.
Western Blot Analysis Reagents Confluent monolayers of BS-C-40 cells in 6-cm tissue culture plates H y p o t o n i c solution: 10 m M Tris-HCl (pH 8.0), 5 m M E D T A , 10 m M KC1 PBS P M S F (0.1 M in ethanol) Laemmli sample buffer ( 5 × ) : 0.31 M Tris-HCl (pH 6.8), 10% (w/v) SDS, 50% (v/v) glycerol, 0.5 M dithiothreitol (DTT), 0.25% (w/v) bromphenol blue 71
[39]
R E C O M B I N A N T V A C C I N I A VIRUS
579
Procedure 1. Infect cells with the recombinant virus at an MOI of 2 pfu/cell in 0.5 ml DMEM supplemented with 2% (v/v) FCS. 2. Let virus adsorb for 30 min at 37°. 3. Add 4.5 ml DMEM supplemented with 2% (v/v) FCS. 4. Allow infection to proceed for 16-24 hr at 37 ° until there is total CPE. 5. Remove the medium, which can be analyzed for secreted protein, and wash the plates twice with PBS. 6. Scrape the cells into 1.0 ml of hypotonic solution containing a final concentration of 1 mM PMSF and transfer to Eppendorf tube. Other protease inhibitors that can be included are 0.2 mM leupeptine, 2 mM pepstatin, and/or 1 mM iodoacetic acid. 7. Either sonicate three times for 5 sec each or freeze/thaw three times. Use sonicator settings that will break open cells, while allowing samples to remain cold. 8. Spin for 30 min and transfer the supernatant to a new tube. 9. Freeze the supernatant at - 8 0 °. 10. Use 20-200 ~1 for each analysis. Samples are mixed with one-fifth volume of 5 × Laemmli sample buffer and boiled for 3 min before loading on a gel.
Radioimmunoprecipitation Analysis Reagents Confluent monolayers of BS-C-40 cells in 10-cm tissue culture dishes Labeling medium For [35S]methionine labeling: Methionine-free DMEM supplemented with 4% (v/v) FCS, 0.4 mM L-glutamine, and 20/zCi/ml [35S]methionine (> 1000 Ci/mmol) For [3H]leucine labeling: Glutamine-, leucine-free DMEM supplemented with 4% (v/v) FCS, 4 mM u-glutamine, 25 mM o-glucose, and 20/xCi/ml [3H]leucine (> 140 Ci/mmol) For [3H]glucosamine labeling: Glutamine-, leucine-free DMEM supplemented with 4% (v/v) FCS, 4 mM L-glutamine, 0.8 mM L-leucine, 25 mM o-glucose, and 20/zCi/ml [3H]glucosamine (30-60 Ci/ mmol) PBS RIPA buffer: 1% (v/v) Triton X-100, 1% (v/v) sodium deoxycholate, 0.1% (w/v) SDS, 10 mM Tris-HCl (pH 7.5), 0.1-0.5 M NaCI, 5 mM EDTA
580
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[39]
Protein A-Sepharose: Prepare by swelling 1 g overnight at 4 ° in 10-15 ml RIPA buffer, washing twice, and finally resuspending 1 : 1 in RIPA buffer Laemmli sample buffer (1 x ): Dilute from 5 x Laemmli sample buffer Procedure
1. Remove the medium from cells and add virus at an MOI of 2 pfu/cell in 2 ml DMEM supplemented with 2% (v/v) FCS. Incubate for 30-60 min at 37 °. 2. Prepare 2-3.5 ml labeling medium for each plate. 3. Aspirate off virus inoculum and add 5-6 ml of labeling medium per plate. For overnight labeling, add 1 ml of DMEM per 100 ml of labeling medium. 4, Harvest the cells when total CPE is observed (approximately 16-24 hr). 5. If medium is to be analyzed, spin it twice at 1000 rpm in a clinical centrifuge to remove cellular debris. 6. Wash the cells once with PBS. 7. Add 1 ml RIPA buffer to the plates, scrape cells, and transfer to 6-ml tubes. Leave on ice for 10 min. The protease inhibitors described under the Western protocol can be included if desired. 8. Sonicate the tubes three times for 5 sec each. 9. Transfer to Eppendorf tubes, spin for 10 min at full speed, and decant supernatants to new tubes. 10. Incubate an appropriate amount of lysate with the antibody at 4 ° overnight. One 10-cm plate should yield enough sample for 10 analyses. 1 I. For precipitation of the antigen/antibody complex, add 50/zl protein A-Sepharose and mix gently for 90 min at room temperature. 12. Pellet the protein A-Sepharose for 30 sec to 4 min in a microfuge and wash the pellets three or four times with 1 ml RIPA buffer. 13. Air dry the pellets, then resuspend in 1 x Laemmli sample buffer. Store frozen at -80°; boil the samples for 3 min prior to loading on a gel.
Vaccination of Animals To monitor immunogenicity of recombinant vaccinia viruses, laboratory animals can be vaccinated with the desired strain by the intraperitoneal, intranasal, intradermal, or subcutaneous routes. The immune response to a given dose of a particular recombinant is dependent in part on
[40]
RETROVIRAL
VECTORS
581
the route of immunization.72'73The dose used is dependent on the species, the route of inoculation, and the virulence of the test virus. For example, mice can be vaccinated intraperitoneally with 10 7 pfu when the test virus contains an insertion into the HindlII M fragment that inactivates the gene encoding the 30K protein, but with 108 pfu of a T K - recombinant. Blood from immunized mice can be collected 4-6 weeks later for serum analysis. Concluding Remarks Vaccinia virus is an extremely versatile virus expression system that can be easily manipulated in the laboratory. Recombinant viruses may be used to study gene expression, to dissect the immune response to specific antigens, to manufacture large quantities of biologically active material, and to produce live vectored vaccines for immunization against a variety of diseases. As additional viral vector improvements are made, the potential of vaccinia as a tool for biological research, as a protein production system and as an immunoprophylactic will continue to increase. Acknowledgments The authors wish to thank Nancy Cormier, Eric Day, and Virginia Stallard for their contributions to the development of methods described; Nancy Cormier and Janet Lyons for providing the data illustrated; and David Hill and Ruth Emyanitoff for critical reading of this manuscript. We also gratefully acknowledge the advice and support of Dennis Panicali, under whose overall direction much of this work was accomplished. 73 M. E. Andrew, B. E. H. Coupar, and D. B. Boyle, Irnrnunol. Cell Biol. 67, 331 (1989).
[40] U s e o f R e t r o v i r a l V e c t o r s for G e n e T r a n s f e r and Expression
By A. DUSTY MILLER, DANIEL G. MILLER, J. VICTOR GARCIA, and CARMEL M. L Y N C H Retroviruses have evolved a highly efficient gene transfer capability that provides the basis for one of the most effective gene transfer systems available to date. Indeed, the retroviral vector system has proved useful for the transfer of genes into many cell types, such as hematopoietic cells and other primary cells, ~ that are difficult to transduce by using other I A. D. Miller, Blood 76, 271 (1990).
METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
582
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[40]
methods. In addition, the precise integration of retroviral vectors into the genome of an infected cell provides a powerful genetic tool. Many elegant applications of the retroviral vector system have been developed based on these properties, such as promoter trap vectors for the analysis of cellular promoters and their regulation and the use of retroviral vectors to study immunoglobulin rearrangement. 2 It is possible to add genes to a retrovirus while maintaining the ability of the virus to replicate and transfer the genes to other ceils, but such vector designs are limited by constraints on the size of the retroviral genome and the difficulty of ensuring transcription of the viral as well as the introduced genes. Replication-defective vectors can be made based on deletion of most or all of the viral protein coding regions, and offer much more flexibility regarding sequences that can be inserted. In early experiments, replication-defective vectors were produced in a mixture with replication-competent "helper" virus. Although gene transfer could be achieved, the transduced cells were also infected with the helper virus, resulting in continued potential for spread of the vector and other unwanted properties associated with viral protein synthesis. The solution to these problems came in 1983 with the development of retrovirus-packaging cell lines that allowed the production of replication-defective retroviral vectors in the absence of helper v i r u s ) : Another important advance came in 1986 with the development of vectors that could be produced at high titer [107 colony-forming units (cfu)/ml or more], due to better definition of the complete retroviral packaging s i g n a l ) : The focus of this chapter is on the use of a set of such high-titer retroviral vectors that was developed in this laboratory for the transfer and expression of cDNAs. Principle of Method The retroviral vector system for gene transfer that will bc described here can be divided into two components, the retroviral vector and the packaging cells. The retroviral vector is manipulated in its DNA form as part of a bacterial plasmid. The vector does not encode viral proteins but serves as a vehicle for the genes to be transferred. The retrovirus-packaging cells provide all of the viral proteins necessary for encapsidation of 2 A. D. Miller, Curr. Top. Microbiol. Immunol. 158, 1 (1992). 3 R. Mann, R. C. Mulligan, and D. Baltimore, Cell 33, 153 (1983). 4 S. Watanabe and H. M. Temin, Mol. Cell. Biol. 3, 2241 (1983). 5 D. Armentano, S. F. Yu, P. W. Kantoff, T. von Ruden, W. F. Anderson, and E. Gilboa, J. Virol. 61, 1647 (1987). 6 M. A. Bender, T. D. Palmer, R. E. Gelinas, and A. D. Miller, J. Virol. 61, 1639 (1987). 7 M. A. Adam and A. D. Miller, J. Virol. 62, 3802 (1988).
[40]
RETROVIRALVECTORS
583
vector RNA into virions and for subsequent infection, reverse transcription, and integration of the vector into the genomic DNA of cells. Figure 1 depicts a set of retroviral vectors that contain selectable markers and unique cloning sites for insertion of cDNAs. 8'9 The vectors are named according to the order of genetic elements in the vector: L, long terminal repeat (LTR); N, neo; S, simian virus 40 (SV40) early promoter; C, human cytomegalovirus (CMV) immediate early promoter; HD, hisD; H, hph; and X, cloning site. With the exception of LN, the vectors contain two promoters, one driving expression of the selectable marker and the other driving expression of the inserted DNA. Transcription of the inserted cDNAs is driven by strong viral promoters, either the retroviral LTR (LXSN, LXSHD, and LXSH), an immediate early promoter from human cytomegalovirus (LNCX, LHDCX), or the SV40 early promoter (LNSX). In general we find the LTR and CMV promoters to be strong promoters, while the SV40 promoter is somewhat weaker. Vectors with three different dominant selectable markers are shown. Selection for each of the markers is independent of the presence or absence of the other markers, allowing sequential use of vectors carrying different selectable markers to transfer multiple genes into cells. The design of retrovirus-packaging cell lines has evolved to address the problem of spontaneous helper virus production encountered with early designs. 1° Early packaging cells (type A, Fig. 2) contained replication-competent retroviral genomes from which the packaging signal of the virus, between the 5' LTR and the gag coding region, had been deleted. These deleted viruses produced all of the retroviral proteins, but genomic RNA was poorly encapsidated into virions and the virus spread very slowly. However, a single recombination event between this deleted retrovirus and a retroviral vector introduced into the packaging cells could result in the production of wild-type virus (Fig. 2), which spreads very efficiently. Further modifications of the viral genome contained in packaging cell lines (type B, Fig. 2) significantly reduced the potential for helper virus production, and two recombination events are required to yield wildtype virus. The most recent designs involve the separation of the gag-pol and eno viral protein-coding regions on separate expression plasmids that are independently transfected into the packaging cells (type C, Fig. 2), such that three recombination events are necessary for wild-type virus production. Note also that reduced overlap between vector and helper 8 A. D. Miller and G. J. Rosman, BioTechniques 7, 980 (1989). 9 M. A. R. Stockschlaeder, R. Storb, W. R. A. Osborne, and A. D. Miller, Hum. Gene Ther. 2, 33 (1991). l0 A. D. Miller, Hum. Gene Ther. 1, 5 (1990).
584
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
LN
F~
ul+
LNSX ~
[40]
neo . p p A ]1~\\\\\\\\\'~ LTR I
~/+
neo
r -~
pA
(BamHI) Stul Avrll Hindlll Clal neo ~ pA
LNCX ~
~'+ II~,\\\\\\\\'~lJC M ~
(BamHI) Hindlll Hpal Clal
~+
LXSN
i-% neo
pA
I sv I~,,\\\\\\\\'~l
LIFt
II
EcoRI Hpal Xhol BarnHI
u/+
LHDCX
(BamHI)
(BamHI)
Hindlll
LXSHD EcoRI Hpal Xhol BamHI
r" "p" LXSH
~
-
I svlV///////////~
p,A H LTR I
/1"-.,,
Hpal Xhol BamHI
I
1 kb
I
FIG. l. Retroviral vectors. Retroviral vectors containing the neomycin phosphotransferase (neo), histidinol dehydrogenase (hisD), or hygromycin phosphotransferase (hph) selectable markers are shown. The coding regions of these genes are shaded. Internal promoters consist of the SV40 early promoter (SV) and a human cytomegalovirus immediate early promoter (CMV). LTR indicates the retroviral long terminal repeat, connecting lines indicate other viral sequences, arrows indicate the cap sites of promoters and the direction of
[40]
RETROVIRAL VECTORS
585
virus sequences reduces the possibility of helper virus production. Indeed, the vector and packaging cell line combinations used in this chapter have no overlap at their 3' ends (except LXSH, which has only 11 bp of overlap), and helper virus production has not been detected by using sensitive assays. A summary of the available packaging lines in these different classes is presented in Table I. 3'4'8'11-25"25a A primary consideration in the selection of an appropriate packaging cell line is the host range of vectors produced by the cells, which is determined by the particular retrovirus used in the construction of the packaging cells. This range has been constantly expanding with the development of new packaging lines. The host range of characteristic cell lines from each host range class is shown in Table II. The most useful host range for mammalian cells is amphotropic, which allows infection of cells from most species of experimental interest. These host range classes should be used only as a general guide, because there are exceptions to these rules. For example, some sublines of Chinese hamster ovary (CHO) 11 R. D. Cone and R. C. Mulligan, Proc. Natl. Atcad. Sci. U.S.A. 81, 6349 (1984). l-~ A. D. Miller, M. F. Law, and I. M. Verma, Mol. Cell. Biol. 5,431 (1985). ts R. A Bosselman, R.-Y. Hsu, J. Bruszewski, F. Hu, F. Martin. and M. Nicolson, Mol. Cell. Biol. 7, 1797 (1987). 14 A. W. Stoker and M. J. Bissell, J. Virol. 62, 1008 (1988). 15 L. R. Boone, C. L. Innes, P. L. Glover, and E. Linney, J. Virol. 63, 2592 (1989). E6j. Sorge, D. Wright, V. D. Erdman, and A. E. Cutting, Mol. Cell. Biol. 4, 1730 (1984). 17 A. D. Miller and C. Buttimore, Mol. Cell. Biol. 6, 2895 (1986). ~8 p. Savatier, C. Bagnis, P. Thoraval, D. Poncet, M. Belakebi, F. Mallet, C. Legras, F. L. Cosset, J. L. Thomas, Y. Chebloune, C. Faure, G. Verdier, J. Samarut, and V. Nigon. J. Virol. 63, 513 (1989). 19 O. Danos and R. C. Mulligan, Proc. Natl. Acad. Sci. U.S.A. 85, 6460 (1988). 20 D. Markowitz, S. Goff, and A. Bank, J. Virol. 62, 1120 (1988). 21 D. Markowitz, S. Goff, and A. Bank, Virology 167, 400 (1988). 2: j. p. Dougherty, R. Wisniewski, S. Yang, B. W. Rhode, and H. M. Temin, J. Virol. 63, 3209 (1989). 23 j. p. Morgenstern and H. Land, Nucleic Acids Res. 18, 3587 (1990). 24 F.-L. Cosset, C. Legras, Y. Chebloune, P. Savatier, P. Thoraval, J. L. Thomas, J. Samarut. V. M. Nigon, and G. Verdier, J. Virol. 64, 1070 (1990). 25 A. D. Miller, J. V. Garcia, N. von Suhr, C. M. Lynch, C. Wilson, and M. V. Eiden, J. Virol. 65, 2220 (1991). 25~ D. G. Miller and A. D. Miller, J. Virol. 66, 78 (1992).
transcription, pA indicates polyadenylation signals, and ~* indicates the extended retroviral packaging signal. Restriction sites for cDNA insertion are indicated. Restriction sites in parentheses are discussed in the text. The vectors carrying neo and hisD have been described, 8'9 and LXSH was made from LXSN by replacement of the neo insert with hph (M. E. Emerman and J. V. Garcia, unpublished results). Complete vector sequences are available from GenBank.
0
,..
;>
~=~.o_~
E*-'o
-~
~'~. =~:
I
,.o.~
I
Z Z
,..1
0
z
~z 0
n.
,...I W
,...I
n.
~m
¢1. _1
o
0
~
~
W
Z
0 o ,...1
0
;> ~
0
[40]
RETROVIRAL VECTORS
587
TABLE I RETROVIRUS-PACKAGING CELL LINES
Type ~
Name
Host range b
A
~-2 C3A2 ~O-AM PAl2 Clone 32 Q2bn, Q4dh N-Pac T19-14X VT19-17-H2 PA317 PE501 pHF-g PM571 tbCRE ~CRIP GP + E-86 GP + e n v A m l 2 DSN DAN I~E Isolde PG13 PG53
Ecotropic REV Amphotropic Amphotropic Ecotropic Avian N-Ecotropic Amphotropic Amphotropic Amphotropic Ecotropic Avian Polytropic Ecotropic Amphotropic Ecotropic Amphotropic REV Amphotropic Ecotropic Avian GALV GALV
B
C
Maximum titer c
Drug resistance gene(s) d
Ref.
107 107 × 105 × 106 x 104 × 105 106 103 103 × 107 107 × 104 x 105 106 106 × 106 106 × 105 × 104 (high) 105 × 106 105
gpt neo gpt tk neo hph hph neo gpt tk tk hph tk hph, gpt hph, gpt gpt hph, gpt neo neo gpt hph, ble tk, dhfr* tk, hph
Mann et al. (1983)3 Watanabe and Temin (1983)4 Cone and Mulligan (1984) H Miller et al. (1985) 12 Bosselman et al. (1987) j3 Stoker and Bissell (1988) t4 Boone et al. (1989) t5 Sorge et al. (1984) 16 Sorge et al. (1984) 16 Miller and Buttimore (1986) t7 Miller and Rosman (1989)8 Savatier et al. (1989) L8 Miller and Miller (1992)25~ Danos and Mulligan (1988) ~9 Danos and Mulligan ( 1 9 8 8 ) t9 Markowitz et al. (1988)2o Markowitz et al, (1988) -'l Dougherty et al. (1989) 22 Dougherty et al. (1989)22 Morgenstern and Land (1990)-'3 Cosset et al. (1990) -'4 Miller et al. (1991) -'5 Miller et al. (1991)25
2 2 4 3 3
4 2 7
4 7 4 ? 3
×
" Packaging cell type based on type of deleted helper virus (Fig. 2). b Abbreviations: G A L V , Gibbon ape leukemia virus; REV, avian reticuloendotheliosis virus; N-Ecotropic, Ntype mouse cell-restricted ecotropic host range. c Highest reported titers. In some cases this value is from papers published after the initial report describing the cell line. d Drug resistance gene(s) that are already present in the packaging cells due to their use for DNA transfer during cotransfection of defective helper virus constructs. Selection for vectors carrying these markers cannot be performed in these packaging cells, gpt, Xanthine-guanine phosphoribosyltransferase; tk, herpes simplex virus thymidine kinase gene; hph, hygromycin phosphotransferase; dhfr*, a mutant dihydrofolate reductase gene; ble, a bacterial gene that confers resistance to bleomycin and phleomycin in mammalian cells; neo, neomycin phosphotransferase.
cells are infectable by using amphotropic vectors, but most are completely resistant and also show partial resistance to infection by vectors with a Gibbon ape leukemia virus (GALV) host range. 25 Similarly, amphotropic vectors can infect some bovine and chicken cells, but not others. These examples are denoted by -+ in Table II, but other exceptions also exist. The procedure for generating stable vector-producing cell lines has been described, 26 and involves calcium phosphate-mediated transfection of one packaging cell line, harvest of virus produced transiently 2 days 26 A. D. Miller, D. R. Trauber, and C. Buttimore, Somatic Cell Mol. Genet. 12, 175 (1986).
588
METHODS
FOR TRANSFORMING
ANIMAL
TABLE
AND PLANT
[40]
CELLS
II
HOST RANGE OF SELECTED PACKAGING CELLS Target
PE501
PA317
PG13
DSN
Isolde
PM571
cells
(ecotropic)
(amphotropic)
(GALV)
REV
(avian)
(polytropic)
Mouse
+
+
-
---
-
+
Rat
+
+
+
+
-
+
Hamster
-
---
+
Rabbit
-
+
+
Mink
-
+
+
Cow
-
-+
+
Cat
-
+
+
-+
Dog
-
+
+
+
Monkey
-
+
+
+
Human
-
+
+
+
-
Chicken
-
-
+
+
+
Quail
-
+
after transfection, and the use of the virus to infect another packaging cell line with a different host range (Fig. 3). Vector-infected clones are isolated and screened for the presence of an unrearranged vector, high-titer vector production, the absence of helper virus, and for expression of the inserted gene. The reason for this procedure rather than direct isolation of vectortransfected clones is that the resultant clones generally produce higher titer virus and contain only one vector integrant, allowing its structure to be confirmed unambiguously. The rationale for using packaging cells with different host ranges in the procedure for making stable vector-producing cell lines is based on the following. Retroviral envelope proteins produced by packaging cells bind to cell surface receptors that are required for retrovirus infection and thus block infection by other retroviruses that use the same receptor for entry. Thus, vectors produced by a given packaging cell line do not easily infect the same packaging cells or other packaging cells with the same host range. 26 However, retroviruses that use different receptors for entry are unaffected by this block.26 For example, ecotropic pseudotype virus generated by PE501 cells can readily infect amphotropic PA317 cells or GALVbased PG13 cells. Any two packaging lines can be used in this procedure as long as their host ranges are not the same and the virus generated from the transfected packaging cells is capable of infecting the recipient packaging cells. Virus from PGI3 cells cannot infect mouse cells (Table II), so virus from this packaging cell line cannot infect PA317 or PE501 packaging cells.
[40]
RETROVIRAL VECTORS
RETROVIRUS PACKAGING CELLS (PE501 OR PA317) TRANSFECT CELLS L
589
PLASMID CONTAINING SELECTABLE RETROVIRAL VECTOR
/
I
2 DAYS
HARVEST VIRUS AND INFECT PACKAGING CELLS HAVING A DIFFERENT HOST RANGE (PE501.--~.PA317, PA317.-~PE501, PA317 OR PE501--~PGI3) ~
,
~
CLONEVECTOR-INFECTED CELLS IN SELECTIVE MEDIUM
VECTOR-PRODUCING CLONAL CELL LINES TEST CLONES FOR: 1. UNREARRANGED VECTOR 2. VECTOR TITER 3. ABSENCE OF HELPER VIRUS 4. EXPRESSION OF INSERTED GENE FIG. 3. Methodfor generationof stable vector-producingcell lines.
Materials and Reagents Retroviral vectors and packaging cell lines can be obtained from the laboratories in which they were developed. The wide host range packaging cell lines used here can be obtained from the American Type Culture Collection (ATCC; Rockville, MD): PA31717 (ATCC CRL 9078) and PG1325 (ATCC CRL 10,686). PE5018 ecotropic packaging cells are used here, but other generally available ecotropic packaging cells can be substituted. Cells are grown in Dulbecco's modified Eagle medium with high glucose (4.5 g/liter) supplemented with 10% (v/v) fetal bovine serum (Hyclone, Logan, UT). The packaging cells can be adapted to grow in iron-supplemented bovine calf serum (Hyclone) by growing them for 2 days at moderate density in a 50:50 mixture of fetal and calf serum followed by growing the cells in calf serum for about 1 week. The PA317, PGI3, and PE501 cells were derived from NIH 3T3 thymidine kinase-
590
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[40]
negative (tk-) cells, and the N I H 3T3 tk- cells are also used as targets for infection. All cells are grown at 37° in a humidified incubator in an atmosphere of 10% COJair. Cell clones are isolated by using glass cloning rings (cloning cylinders; Bellco, Vineland, NJ). Colonies of cells are stained for enumeration by using Coomassie Brilliant Blue G stain (Sigma, St. Louis, MO) (1 g/liter in 40% methanol-10% acetic acid, v/v) after removal of the culture medium and a single wash with Dulbecco's phosphate-buffered saline containing calcium and magnesium (GIBCO, Grand Island, NY). Methods
Gene Insertion into Retroviral Vectors Figure 1 shows several retroviral vectors and available cloning sites for cDNA insertion. Sequences surrounding the retroviral vector were derived from pBR322 and contain the ampicillin resistance gene, allowing manipulation of the vectors as plasmids in bacteria. It is also possible to remove the internal promoters used for cDNA expression in LNSX, LNCX, or L H D C X and replace these with alternative promoters for cDNA expression by using the BamHI site in these vectors between the selectable marker and the internal promoter. The BamHI site is unique in LNSX and LNCX, but there are two BamHI sites in L H D C X (Fig. 1). The inserted cDNAs should not contain polyadenylation signals as these will cause premature termination of transcription and reduce the levels of full-length vector RNA. If the sequences to be inserted contain elements that cause R N A instability, such as the sequences located in the Y-nontranslated regions of hematopoietic growth factor genes, 27 these should also be removed if possible. While sequences that reduce the amount of full-length vector RNA can be included in retroviral vectors, these sequences will reduce the titer of virus produced by packaging cells containing the vector, and may lead to frequent deletion of the inserted sequences because there is a strong selection for recombinant vectors that lack the offending sequences.
Virus Production by Transient Transfection of Packaging Cells Virus can be generated from the plasmid forms of retroviral vectors by transient transfection of packaging cells. This procedure is useful for rapid generation of virus from vector DNA constructs or as a first step in generating stable vector-producing cell lines (see below). We use calcium 27 G. Shaw and R. Kamen, Cell 46, 659 (1986).
[40]
RETROVIRALVECTORS
591
phosphate coprecipitation for introduction of vector DNA into cells because of its simplicity and reliability, but many other methods for DNA introduction also work. Plasmid DNA should be purified before use by centrifugation in a cesium chloride gradient containing ethidium bromide. While other methods may yield suitable DNA for transfection, it is important that the DNA be relatively pure and free of salts. Vector titers obtained by using this method range from 10 3 to over 105 cfu/ml.
Day 1: Seed the retrovirus-packaging cells (PE501, PA317, or PG13) at 5 × 105 cells/6-cm dish. Day 2: Replace the culture medium with 4 ml fresh medium and transfect the cells with vector plasmid DNA by using the calcium phosphate precipitation procedure. All reagents should be sterilized before use by filtration through 0.22-/xm sterile filters. For each plasmid sample, prepare a DNA-CaCI 2 solution by mixing 25/~1 2.0 M CaCI 2 , 10 p,g plasmid DNA (in 10 mM Tris-HCl, pH 7.5), and water to make 200 ~1 total. Prepare fresh precipitation buffer by mixing 100/A 500 mM N-2-hydroxyethylpiperazineN'-2-ethanesulfonic acid ( H E P E S ) - N a O H (pH 7.1), 125/xl 2.0 M NaCI, 10/.d 150 mM Na2HPO4-NaH2PO 4 (pH 7.0), and water to make 1 ml total. Add the 200/xl DNA-CaC12 solution dropwise with constant agitation to 200/~1 precipitation buffer in a clear 12 x 75 mm polystyrene tube [Falcon 2054 (Becton Dickinson, Oxnard, CA) or equivalent]. A faint cloudiness in the solution should be immediately apparent. If the mixture remains clear or a precipitate consisting of large clumps develops, something is wrong. After 30 min at room temperature, add the resultant fine precipitate to a dish of cells and swirl the dish to distribute the precipitate. Day 3: Aspirate the medium and add 4 ml fresh medium. Day 4: Remove the virus-containing medium and centrifuge the medium at 3000 g for 5 rain at 4° to remove cells and debris. The viruscontaining medium can be used immediately to infect recipient cells or it can be frozen at - 7 0 ° for later use. Virus frozen at - 7 0 ° is stable for years. Generation of Stable Vector-Producing Cell Lines Stable virus-producing cell lines are generated as previously described z6 (outlined in Fig. 3). This is the method of choice for most purposes. The virus produced is relatively homogeneous because the virion RNA is transcribed from a single integrated provirus, as opposed to virus produced by direct transfection techniques, in which multiple copies with various arrangements may be present. The vector is produced at high titer, and because the cells are relatively unaffected by vector secretion and can be frozen for storage, this technique provides a practically limitless supply
592
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[40]
of a retroviral vector. While various combinations of packaging lines having different host ranges can be used in this technique, the procedure for generating stable lines with an amphotropic host range is described below since this host range is in general the most useful.
Day 1: Seed PE501 retrovirus-packaging cells at 5 x 105 cells/6-cm dish. Day 2: Replace the culture medium with 4 ml fresh medium and transfect the cells with vector plasmid DNA as described above. Day 3: Aspirate the medium from the transfected PE501 cells and add 4 ml fresh medium. Seed PA317 cells at 105 cells/6-cm dish, two dishes for each dish of transfected PE501 cells. Day 4: Replace the medium on the PA317 cells with medium containing 4 ~g/ml Polybrene (Sigma). Remove 3 ml of virus-containing medium from each dish of transfected PE501 cells (leave I ml to keep the cells from drying out until they are trypsinized; see below) and centrifuge the medium at 3000 g for 5 min at 4 ° to remove cells and debris. From each dish of transfected PE501 cells, use 1 ml of virus-containing medium to infect one dish of PA317 cells, and add 10/zl to another dish of PA317 cells. Trypsinize and seed the PE501 cells at a 1 : 20 dilution into 6-cm dishes containing medium with 0.75 mg/ml G418 (active concentration), 4 mM histidinol, or 0.4 mg/ml hygromycin B, depending on the selectable marker in the vector. These dishes are stained and evaluated for colony formation after 5 days of selection as a measure of the efficiency of DNA transfection. A transfection efficiency of about I000 colonies//zg plasmid DNA is typical. Day 5: Trypsinize the infected PA317 cells and seed the cells at 9:10 and 1 : 10 dilutions into 10-cm dishes containing 10 ml medium plus the appropriate drug for selection (see Day 4, above). The 9:10 and 1 : 10 dilutions of PA317 cells infected with 1 ml or 10/zl of virus results in a 4log range of dilutions, some of which should yield appropriate numbers of colonies for isolation of clonal cell lines. After drug-resistant colony formation (5 to 10 days of selection), isolate clones from dishes containing small numbers of colonies by using cloning rings. To prepare the cloning rings for use, spread a thin coating of silicone grease [Dow Coming (Midland, MI) high-vacuum grease or equivalent] on the bottom plate of a 10cm glass petri dish, place the rings in the dish so that the grease coats one open end, and autoclave the dish to sterilize. To isolate clones, locate colonies and draw a circle around each colony on the bottom of the dish with a felt-tip pen. Colonies can be most easily visualized by holding the dish up to the light, taking care not to spill the medium. We find it useful to turn off the airflow in the laminar airflow hood to avoid desiccation of the colonies during placement of cloning rings. Aspirate the medium and
[40l
RETROVIRAL VECTORS
593
place cloning rings over colonies to be isolated and press down with tweezers. Add a drop of trypsin/ethylenediaminetetraacetic acid (EDTA) to each cylinder, and monitor the extent of trypsinization microscopically. When the cells have rounded up, add medium to each ring (one at a time) and fairly vigorously force the medium in and out of a pipette to dislodge the cells. We typically isolate about 10 colonies for analysis. After expansion, assay the clonal lines for an intact vector structure by Southern analysis, for the production of high vector titer, for the presence of helper virus (see Marker Rescue Assay for Helper Virus, below), and for expression of the inserted gene.
Virus Harvest and Assay To prepare virus, replace the medium on confluent culture~ of vectorproducing cells, collect the medium 12 to 24 hr later, and centrifuge the medium at 3000 g for 5 min at 4° to remove cells and debris. This process can be repeated three or four times at 12-hr intervals from the same dish of cells. The virus-containing medium can be used immediately to infect recipient cells or frozen at - 7 0 ° for later use. Vector titer is determined as follows.
Day 1: Seed recipient cells (NIH 3T3, HeLa, etc.) at 5 x 105 cells/ 6-cm dish. Day 2: Change the medium to medium containing 4 t~g/ml Polybrene (Sigma) and add various dilutions of test virus. Day 3: Trypsinize and dilute the cells 1 : 20 into medium containing 0.75 mg/ml G418 (active concentration) for vectors carrying the neo gene, 4 mM histidinol for vectors carrying the hisD gene, and 0.4 mg/ml hygromycin B for vectors carrying the hph gene. These concentrations may need adjustment depending on the cell line. Days 8-10: Stain and count colonies. Virus titer in colony-forming units per milliliter (cfu/ml) is calculated by dividing the number of colonies by the volume (in milliliters) of virus used for infection and multiplying by 20 to correct for the 1 : 20 cell dilution. Marker Rescue Assay for Helper Virus The marker rescue assay for helper virus detection measures the ability of a virus sample to rescue or mobilize a retroviral vector from cells that contain but do not produce a vector. It should be remembered that the ability of this assay to detect a given helper virus depends on whether the helper virus can infect the cells used in the assay. For example, ecotropic helper virus cannot be detected by using human cells. Thus the assay cells
594
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[40]
should be chosen to match the expected helper viruses (for an example, see Ref. 28). While this assay is somewhat tedious and slow, it is sensitive and measures the property of helper viruses that is most important in the context of retroviral vector design, the ability to mobilize vectors. To make cells that harbor but do not release a vector, infect NIH 3T3 or H e L a cells with a helper-free vector carrying a selectable marker [we use LN virus (Fig. 1) that carries the neo gene] and select the cells for the presence of the selectable gene (G418 for neo). This virus can be obtained from a packaging line that produces any high-titer vector. Passage the cells for 2 weeks to allow potential helper virus (which should not be present) to spread, and assay the cells for vector production by using NIH 3T3 or HeLa cells as indicator cells for virus production, respectively. Cells that do not produce the vector (nonproducer cells) should be preserved for use in the marker rescue assay described below. Day 1: Seed nonproducer cells containing a neo vector (NIH 3T3 or HeLa) at 5 × 105 cells/6-cm dish. Day 2: Infect nonproducer cells by adding 1 ml test virus (centrifuged at 3000 g for 5 min at 4° to remove cells and debris), 3 ml regular medium, and 4 /xg/ml Polybrene. Control-positive dishes can be infected with a small amount of amphotropic helper virus (e.g., 1 /zl or less of virus produced by N I H 3T3 cells transfected with pAM-MLV 17 plasmid and passaged for 2 weeks to allow complete infection of the cells) or other helper virus capable of replicating in the nonproducer cells. Day 3: Passage cells for 2 weeks to allow helper virus spread. Take care not to cross-contaminate the cultures, some of which may begin to make helper virus at high titer. Trypsinize the cells two to three times a week and replate the cells at 1 : 10 to 1 : 40 dilutions. The cells should be kept at relatively high density to facilitate virus spread. Day 16: Plate naive NIH 3T3 or HeLa cells (same cell type as nonproducer cell line used) at 105 cells/6-cm dish. Feed confluent dishes of "nonproducer" cells (which now may be "producing" virus). Day 17: Harvest medium from the nonproducer cells and use 1-ml samples to infect the naive NIH 3T3 or HeLa cells in the presence of 4 /~g/ml Polybrene. Centrifuge the medium at 3000 g for 5 min at 4 ° to remove cells and debris. Any live cells that are transferred along with the medium will be drug resistant and could give a false-positive result. Day 18: Replace the medium on the newly infected cells with medium containing G418 [0.75 mg/ml (active concentration) for N I H 3T3, 1.0 mg/ ml (active concentration) for HeLa]. 28 M. Kaleko, J. V. Garcia, W. R. A. O s b o r n e , and A. D. Miller, Blood 75, 1733 (1990).
[40]
RETROVIRAL VECTORS
595
Day 23: Stain and count colonies. The presence of colonies indicates that the neo vector was rescued by helper virus in the test sample. Usually this is obvious, and positive dishes are covered with drug-resistant colonies. Infection of Cells Many cell types can be infected by direct exposure to virus. The addition of 4 /~g/ml Polybrene or protamine sulfate 29 during infection facilitates infection. These compounds are positively charged (polycationic), and presumably act by neutralizing negative charges present on the surface of cells and virions to allow better binding. Always centrifuge or filter virus before use to avoid contamination of the target cells with packaging cells that may be present in vector-containing medium. Cells that are difficult to infect can often be infected at higher rates by direct cocultivation with vector-producing cells in the presence of 4/zg/ ml Polybrene for up to several days. This technique is particularly useful for cells that grow in suspension, including hematopoietic stem cells from animals and otherwise difficult to infect hematopoietic or lymphoid cell lines, and after cocultivation the cells are washed from the dish. Because of the apparent need for cell division during retrovirus infection, 3° cells should be plated at low enough density to allow cell division during infection. Plating at low density also helps to reduce cell fusion that can occur in cultures exposed to large amounts of virus. For example, 1 ml of virus from a higher-titer packaging cell line can induce dramatic fusion when added to a confluent 6-cm dish of NIH 3T3 cells in the presence of Polybrene. Cell fusion is presumably due to the entry of a single virion into two cells at the same time, producing a connection between the cells.
Infection of Chinese Hamster Ovary Cells Surprisingly, Chinese hamster ovary cells are resistant to infection by vectors having envelope proteins from any of the major classes of murine retroviruses. This resistance has precluded the use of retroviral vectors in this well-developed genetic system. Although vectors made by using GALV-packaging cells will infect CHO cells, z5the infection rate is variable in different substrains of these cells. We have found that treatment of CHO cells with the glycosylation inhibitor tunicamycin renders these 29 K. Cornetta and W. F. Anderson, J. Virol. Methods 23, 186 (1988). 30 D. G. Miller, M. A. Adam, and A. D. Miller, Mol. Cell. Biol. 10, 4239 (1990).
596
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[40]
TABLE III TUNICAMYCIN TREATMENT ALLOWS INFECTION OF CHINESE HAMSTER OVARY CELLSa Virus titer (cfu/ml) on indicated target cells CHO-KI cells Vector-host range
Vector-producting cell line
- Tun
+ Tun
Susceptible cells
Susceptible cell type
Ecotropic Amphotropic GALV
PE501/LNL6 c3 PA317/LN c l l PG13/LN c8
<1 <1 3 × 103
5 X 10 4 2 x 103 1 x 105
1 × 106 6 X 10 6 6 × 105
NIH 3T3 NIH 3T3 HeLa
a Virus was harvested from the indicated vector-producing cell line and was used to infect cells known to be susceptible to the particular virus, or CHO-K1 cells that had (+ Tun) or had not ( - T u n ) been pretreated with tunicamycin. The LNL6 vector6 is similar to the LN vector and also carries the neo gene. Recipient cells were seeded at 105 cells/ 6-cm dish the day before infection and, where indicated, 0.2 mg/ml tunicamycin was added to the cells 2 hr after seeding. Twenty-four hours after infection, the medium in all dishes was replaced with growth medium containing 0.5 mg/ml G418 (active concentration), and colonies were counted 5 days later.
cells susceptible to infection with ecotropic and amphotropic vectors, and improves the infection rate of vectors having a GALV host range 25a(Table III). The infection protocol is described below.
Day 1: Seed CHO cells at 105 cells/6-cm dish. Four hours later (after the cells become adherent) add tunicamycin at 0.15 to 0.2/xg/ml. Tunicamycin is toxic to the cells, and the concentration may need adjustment depending on the batch of tunicamycin. Day 2: Remove the medium 19 hr after tunicamycin addition and replace with fresh medium containing 4/zg Polybrene and virus.
Concluding Remarks We and others have used the vectors and techniques described here to make packaging cell lines that produce vectors expressing a variety of cDNAs, including cDNAs encoding MyoD, 31adenosine deaminase, 32clot31 H. Weintraub, S. J. Tapscott, R. L. Davis, M. J. Thayer, M. A. Adam, A. B. Lassar, and A. D. Miller, Proc. Natl. Acad. Sci. U.S.A. 86, 5434 (1989). 32 R. A. Hock, A. D. Miller, and W. R. A. Osborne, Blood 74, 876 (1989).
[40]
RETROVIRAL VECTORS
597
ring factor IX, 33purine nucleoside phosphorylase,34 the retinoic acid receptor, 35 the insulin-like growth factor I receptor, 36 tyrosine kinase L c k , 37 human immunodeficiency virus (HIV) Nef, 38and C D 4 . 39 Most attempts to make virus from a particular vector have been straightforward, resulting in high-titer virus carrying the unrearranged vector. We have been successful in generating high-titer vectors carrying large cDNAs, such as the insulin-like growth factor I receptor cDNA (4.4 kb), 36 and vectors carrying cDNAs up to about 7 kb should also be possible. We have not found helper virus production in any of the many vector-producing cell lines generated by using PA317 cells and the vectors described here, and we have begun to assume that the lines are helper virus free unless a definitive answer is necessary for the interpretation of an experimental result. We have specified centrifugation to remove cells and debris from viruscontaining medium in the procedures above. Virus-containing medium can also be filtered through 0.45-/zm filters to achieve the same goal; however, all filters are treated with a surfactant to allow wetting of the filter membrane, and this detergent can reduce virus titers, especially if the volume filtered is small. It is important to choose filters with low protein-binding properties and to realize that different lots of filters may contain different amounts and types of surfactants. In some cases, it has proved difficult to generate high-titer virus from vectors carrying specific genes or cDNAs. For example, the second intron of the/3-globin gene is required for proper/3-globin expression, necessitating a reverse orientation of the gene within the retroviral vector to prevent intron deletion. However, the presence of the intron in reverse orientation resulted in aberrant vector transcription and low vector titers. 4° We have also observed low vector titers from a vector carrying a factor VIII cDNA of about 4.5 kb (shortened to remove nonessential sequences) that apparently destabilizes mRNAs that contain these sequences (C. M. Lynch and A. D. Miller, unpublished observations, 1989). In both cases we have been able to produce low-titer unrearranged virus from the vectors, but needed to screen many more packaging cell clones than usual to find clones that 33 T. D. Palmer, A. R. Thompson, and A. D. Miller, Blood 73, 438 (1989). 34 W. R. A. Osborne and A. D. Miller, Proc. Natl. Acad. Sci. U.S.A. 85, 6851 (1988). 35 S. J. Collins, K. A. Robertson, and L. Mueller, Mol. Cell. Biol. 10, 2154 (1990). 36 M. Kaleko, W. J. Runer, and A. D. Miller, Mol. Cell. Biol. 10, 464 (1990). 37 N. Abraham, M. C. Miceli, J. R. Parnes, and A. Veillette, Nature (London) 350, 62 (1991). 38 j. V. Garcia and A. D. Miller, Nature (London) 350, 508 (1991). 39 A. Veillette and M. Fournel, Oncogene 5, 1455 (1990). 4o A. D. Miller, M. A. Bender, E. A. S. Harris, M. Kaleko, and R. E. Gelinas, J. Virol. 62, 4337 (1988).
598
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[40]
produced unrearranged vectors. The other clones in general produced higher titer virus that had lost part or all of the inserted sequences. Some reports suggest that the titer of retroviral vectors can be dramatically increased by cocultivation of a vector-producing cell line with a packaging cell line having a different host range. In this situation, the vector can move back and forth between packaging cells and cause an increase in the number of vector copies per cell. However, we have found no more than a 2- to 10-fold increase in titer by using this method, with the disadvantages of increased probability of helper virus generation and vector rearrangement. 41 Because retroviral vectors made by using amphotropic and GALVbased packaging cells can infect human cells, the question arises concerning the safety of investigators handling these materials. While there can be no guarantee that these materials are safe, several arguments suggest that the dangers are minimal. Because retroviruses are surrounded by a lipid membrane derived from the virus-producing cell, they are sensitive to desiccation and are readily inactivated by detergents or ethanol. Second, human complement is known to inactivate murine retroviruses, including amphotropic virus, and GALV, by direct lysis of virions in an antibodyindependent manner. 42-44This is in contrast to the inability of human serum to inactivate retroviruses that cause disease in humans, human T cell leukemia/lymphoma virus (HTLV-1) 45 and H I V . 46 The site of complement action is the viral envelope protein. 47 This activity should reduce the possibility of viral infection or virus spread in vivo. Third, these retroviral vectors are made in the absence of helper virus, thus preventing their further spread after initial infection. Presumably there would be little consequence of infection of a few somatic cells with a retroviral vector encoding a selectable marker or a normal cellular gene. Retroviral vectors carrying oncogenes present a different concern in that infection of one cell in a person with such a virus might theoretically lead to neoplastic growth of that cell. Thus, much greater care should be exercised with oncogenic retroviruses, especially those having an ampho41 C. M. Lynch and A. D. Miller, J. Virol. 65, 3887 (1991). 42 R. M. Welsh, Jr., N. R. Cooper, F. C. Jensen, and M. B. Oldstone, Nature (London) 257, 612 (1975). 43 R. M. Welsh, Jr., F. C. Jensen, N. R. Cooper, and M. B. Oldstone, Virology 74, 432 (1976). 44 N. R. Cooper, F. C. Jensen, R. M. Welsh, Jr., and M. B. Oldstone, J. Exp. Med. 144, 970 (1976). 45 H. Hoshino, H. Tanaka, M. Miwa, and H. Okada, Nature (London) 310, 324 (1984). 46 B. Banapour, J. Sernatinger, and J. A. Levy, Virology 152, 268 (1986). 47 R. M. Bartholomew, A. F. Esser, and H. J. Muller-Eberhard, J. Exp. Med. 147, 844 (1978).
[41]
GENE TRANSFER USING LIPOPOLYAMINE-COATED
DNA
599
tropic or GALV coat, to prevent contact with virus-containing medium or production of virus-containing aerosols. Potentially oncogenic viruses should be produced in ecotropic packaging cell lines if possible, because ecotropic virus does not infect human cells. It is important to realize that even if an oncogenic virus that is helper free is used to infect target cells, there is no guarantee that the target cells do not already release helper virus that could rescue the oncogenic retroviral vector. For example, if an oncogene-containing vector produced by using ecotropic packaging cells is used to infect mouse cells, one might be tempted to assume that the resultant cells are safe because helper virus was not present in the vector preparation used to infect the cells, and even if it was it would not be able to infect human cells. However, if the target cells already produce xenotropic or amphotropic virus, the oncogenic virus will be shed from the cells with a host range appropriate for infection of human cells. An interesting feature of the GALV-based packaging line PG13 is that virus generated by this line cannot reinfect the same cells, because GALV does not infect mouse cells. The same is not true of other packaging lines, which can be reinfected with vectors that they produce, although at lower frequency than naive cells would be infected. 26 The lack of vector spread in PGI3 cells should reduce the possibility of vector rearrangement and would be useful in mutation rate studies to look at single rounds of vector replication. Acknowledgments We thank Theo Palmer for helpful comments on this manuscript. This work was supported by grants from the National Heart, Lung and Blood Institute and the National Institute of Allergy and Infectious Diseases of the National Institutes of Health.
[41] G e n e T r a n s f e r into P r i m a r y a n d E s t a b l i s h e d Mammalian Cell Lines with Lipopolyamine-Coated DNA
By
JEAN-PHILIPPE LOEFFLER a n d JEAN-PAUL BEHR
Lipopolyamine-mediated transfection is a simple, powerful, and generally applicable technique that was designed in our laboratories chiefly to manipulate, at the genomic level, fragile postmitotic cells that are not easily amenable to genetic studies. Indeed, the various techniques that are based on viral or liposomal vectors, DNA coprecipitation with calcium phosphate or cationic polymers, membrane weakening by chemical means METHODS IN ENZYMOLOGY, VOL. 217
Copyright © 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.
600
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[41]
(solvents, detergents, amphiphilic polymers, or enzymes) or physical means (electric, osmotic or thermic shocks, or particle bombardment) suffer either from cytotoxicity or from variable efficiency, or require special equipment. The prerequisites for a long (typically of micrometer size) and polyanionic DNA molecule to somehow cross an intact cytoplasmic membrane are compaction and masking of the negative charges. (Subsequent gene expression requires additional nuclear membrane crossing, and autonomous replication or genomic integration for stable expression.) Both of these functions may be achieved with polyamines,1 the natural counterions of nucleic acids in vivo, provided they are chemically linked to a lipid that reinforces their individual effects. 2-4 Two such lipospermines [dioctadecylamidoglycylspermine (DOGS) and dipalmitoylphosphatidylethanolamylspermine (DPPES); Fig. 1] have been designed and synthesized through metabolizable peptide linkages, leading to molecules of reduced cytotoxicity. In aqueous solution they spontaneously form cationic liposomes that, on simple mixing with a diluted plasmid DNA solution, condense the nucleic acid into much smaller multimolecular particles coated with a cationic lipid bilayer (Fig. 2). Like viruses, these particles "find" and bind to the cells through nonspecific electrostatic attraction (which is the longest range intermolecular force known). Finally, the nucleic acid eventually enters the cell by lipid/membrane fusion or more probably by endocytosis. Thus, lipospermine-mediated gene transfer is straightforward (simple mixing of the components), of general applicability because it is driven by unspecific interaction with the cell, and of low toxicity due to a biodegradable vector. Although we shall focus here mostly on transient expression in primary cells, this technique has now been successfully used in many laboratories to transfect some 40 established cell lines or primary tumor cells (e.g., human prolactinoma, meningioma, astrocytoma, and glioma) either transiently or permanently. Experiments on cells of different embryological origin will be described, and finally we shall illustrate the optimization of this technique on a permanent cell line. An example of applications relevant to cell biology and improvements still in progress will also be given. i j._p. Behr, in " L e s Polyamines: Chimie, Biologie, M6decine." Flammarion, Paris, 1991. 2 j..p. Behr, Tetrahedron Lett. 27, 5861 (1986). 3 j._p. Behr, B. Demeneix, J.-P. Loeffler, and J. Perez-Mutul, Proc, Natl. Acad. Sci. U.S.A. 86, 6982 (1989). 4 Although originally described as a liposomal technique, another procedure based on a quaternary ammonium salt probably mediates transfection with a similar mechanism [P. L. Felgner, T. R. Gadek, M. Holm, R. Roman, H. W. Chan, M. Wenz, J. P. Northrop, G. M. Ringold, and M. Danielsen, Proc. Natl. Acad. Sci. U.S.A. 84, 7413 (1987)].
[41]
GENE TRANSFER USING LIPOPOLYAMINE-COATED D N A
O
601
NH:
NH3 ÷
~
~
~ ~ ~-~/~CO2X
DPPES
0 2-
NH+
O ~H2+ NH3 +
FIG. 1. Structure of the lipospermines DOGS and DPPES.
Fro. 2. Mixing of anionic D N A with e x c e s s cationic lipospermine liposomes leads to cationic lipid-coated plasmids.
602
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
NH2
Nit
NH
~
NH2
l~,~u~ysl
[CH3(CH2)IT] 2NH CbzGlypNP NEta,CH2CI2 "
NBoc ~
NH
[41]
Boc4SperCOaH
NH
NBoc
NH2
NHBoc
H2Pd~ [CH3(CH2)I7]2NCOCH2NHCOOCH2C6H~CFI2~2,EtOH
Boc4SperCO2H CF3CO2H [CH3(CH2)lV]2NCOCH2NH2
DCC,CH2CI2
~
B.
DOGS
O ~NOH Boc4SperCO2H
O DCC,CH2C12,q,HF~
O ~ Boc4SperCO_ ~ - "
DPPE,NEt 3 CHCla/EtOH, 40° ,,
CF3CO2H ~, DPPES
O FXG.3. Synthesis of a functional spermine molecule and its covalent binding to lipids. Synthesis of Lipopolyamines The synthetic scheme is outlined in Fig. 3. All chemicals are supplied by Fluka AG (Buchs, Switzerland). Dimethylformamide is dried over potassium hydroxyde and distilled in v a c u o ; dichloromethane is distilled over calcium hydride. DOGS (Transfectam®) is commercially available from Promega (Madison, WI) or from SepracorIBF (Villeneuve-la-Garenne, France). T e t r a - t e r t - b u t o x y c a r b o n y l s p e r m i n e - 5 - c a r b o x y l i c a c i d (Boc4SperCO2H) 5
Acrylonitrile (3 ml) is added at once to 18 ml of a molar solution of the tetramethylammonium salt of L-ornithine in dry dimethylformamide. After 5 j..p. Behr, J. Chem. Soc., Chem. Commun. p. 101 (1989).
[41]
GENE TRANSFER USING LIPOPOLYAMINE-COATED D N A
603
stirring for 1 hr at room temperature, the solvent is removed, giving essentially the desired compound [<5% N,N-biscyanoethylated compounds as judged by IH nuclear magnetic resonance (NMR)] in crystalline form. This dinitrile is dissolved into 20 ml of a 0.5 M solution of potassium hydroxide in ethanol and hydrogenated at atmospheric pressure in the presence of 1 g of Raney nickel. The reaction is followed by NMR and goes to completion after - 2 4 hr. The pyrophoretic catalyst is carefully filtered off under nitrogen and solvent removal yields the crude spermine 5-carboxylate as a white solid. This compound is dissolved together with 12.2 g of Boc-ON in 40 ml of tetrahydrofuran and 10 ml water. After stirring for 3 days the mixture is taken to dryness and redissolved in 100 ml of chloroform; the organic layer is washed twice with 1 M sodium hydroxide, then with water followed by 5% (w/v) citric acid and finally with water again. The chloroform solution is dried and evaporated, leading to the crude protected spermine. Purification is performed by silica gel chromatography with chloroform/methanol mixtures as eluent, giving 5.4 g of tetra-tert-butoxycarbonylspermine-5-carboxylic acid (78% overall yield). Spermine-5-carboxyglycinedioctadecylamide (DOGS) A mixture of 0.52 g of recrystallized dioctadecylamine, 0.37 g of benzyloxycarbonylglycine p-nitrophenyl ester, and 0.18 ml of triethylamine in 5 ml of dry dichloromethane is stirred at room temperature for 36 hr. The organic solution is extracted three times with 0.5 M cold sodium carbonate, then successively with water, 1 M hydrochloric acid, and with water again. The dichloromethane layer is dried and evaporated in vacuo, giving 0.65 g (91%) of benzyloxycarbonylglycinedioctadecylamide.This compound is hydrogenated for 1 hr in 8 ml of dichloromethane/ethanol (1/1, v/v) with 0.1 g of 10% (w/v) palladium over charcoal. The mixture is filtered and taken to dryness, giving 0.5 g (96%) of glycinedioctadecylamide. This compound and 0.55 g of tetra-tert-butoxycarbonylspermine-5-carboxylic acid are dissolved in 3 ml of dry dichloromethane and a solution of 0.18 g dicyclohexylcarbodiimide in 0.5 ml of dichloromethane is added dropwise. After 12 hr, the solution is filtered and evaporated in vacuo. The protected lipospermine is purified by silica gel chromatography with dichloromethane/ethanol mixtures. The desired compound is then deprotected in 3 ml of trifluoroacetic acid for 10 min at room temperature. Removal of the acid under vacuum gives 0.96 g (90%) of spermine-5-carboxyglycinedioctadecylamide tetratrifluoroacetic acid salt. 1H NMR spectrum in deuteromethanoi, 8 (ppm): 0.9 [t, (CH3)2] , 1.3 [m, 2 x (CH2)15], 1.4-1.7 (m, 2 x
604
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[41]
CH2CH2NCO), 1.8-2.2 (m, 4 x CH2CH2N+), 3.0-3.2 (m, 5 x CH2N+), 3.35 (t, 2 × CH2NCO), 4.0 (t, CHN+), 4.15 (s, COCH2ND). Dipalmitoylphosphatidylethanolamidospermine (DPPES) Sixty milligrams of Boc4SperCO2 H in 0.9 ml of dichloromethane and 11 mg of N-hydroxysuccinimide in 0.5 ml of tetrahydrofuran/dichloromethane (1/1, v/v) are treated with 19 mg of dicyclohexylcarbodiimide in 0.5 ml of dichloromethane for 12 hr at room temperature. The reaction mixture is cooled to 0°, filtered, and solvents are removed in vacuo. The residue is taken up in 1 ml of dry chloroform, and 62 mg of dipalmitoylphosphatidylethanolamine and 14 mg triethylamine are added. The clear solution is left at 40 ° for 6 hr, then cooled to room temperature and diluted with 4 m| of dichloromethane. This solution is extracted with 4 ml of 0.5 M sodium carbonate followed by 4 ml of 5% (w/v) citric acid and evaporated to dryness. Silica gel chromatography [0-10% (v/v) methanol in dichloromethane] yields 70 mg (60%) of a glassy compound. Quantitative deprotection is performed in 1 ml of trifluoroacetic acid/dichloromethane (1/1, v/v) for 5 min at room temperature, giving the desired lipospermine as the tetratrifluoroacetate. The ~H NMR spectrum in deuterochloroform/ deuteromethanol (1/1, v/v) 8 (ppm): 0.85 [t, (CH3)2], 1.3 [m, 2 × (CH2)I2], 1.5-1.65 (m, 2 × CH2CO2), 1.8-2.1 (m, 4 × CH2CH2N+), 2.3 (tt, 2 × C H 2 C H z C O 2 ) , 2.9-3.1 (m, 5 × CHzN+), 3.2 (bm, CHzNDCO), 3.75-4.05 (m, CHN +, 2 × CH2OP), 4.15-4.40 (2 × dd, CO2CH2), 5.20 (OCH). Gene Transfer Applied to Endocrinology The transfer of chimeric genes containing a reporter gene coupled to given promoter sequences is a powerful tool to use in studying the activity of regulatory DNA sequences. The transcriptional activity of such elements is dependent on their physiological environment. It is therefore of prime importance for endocrinologists and neurobiologists to be able to study gene expression in normal primary cells. One possible reporter gene is the gene encoding bacterial chloramphenicol acetyltransferase (CAT), which has been used in the present studies. This enzyme is easily detectable, the assay is sensitive, and the results reflecting transcriptional activity can be quantified. Chloramphenicol Acetyltransferase Measurements Chloramphenicol acetyltransferase activity is determined by the method of Gorman et al. 6 Cells are suspended in 100/zl of 200 mM Tris6 C. M. G o r m a n , L. M. Moffat, and B. H. Howard, Mol. Cell. Biol. 2, 1044 (1982).
[41]
GENE TRANSFER USING LIPOPOLYAMINE-COATED D N A
605
TABLE I CELL CULTURE MEDIA
Medium Locke's
Dissociation medium 1: for 20 ml of Locke's medium
Dissociation medium 2: for 100 ml of PBS
Components
Concentration
pH
NaCI KCI NaHCO3 HEPES Glucose CollagenaseIV (Sigma) Dispase(Boeringer Mannheim) Hyaluronidase (Sigma) Bovine serum albumin (Sigma) Glucose Penicillin streptomycin Trypsin (Sigma) Bovine serum albumin
154 mM 5.6 mM 3.6 mM 5 mM 5.6 mM 10 mg 20 mg 5 mg 100 mg 36 mg 50/zg/ml 50 mg 100 mg
7.4
7.4
--
HC1 (pH 7.4). After several f r e e z e - t h a w cycles, the extract is heated (65 °) for 10 min, centrifuged (10,000 rpm, 5 min), and 80 t~l of the supernatant is added to 40 t~l of Tris-HCl containing [14C]chloramphenicol (0.1 /~Ci; specific activity of 47 t~Ci/mmol). After 5 min at 37 ° the reaction is initiated by adding 40 p~l of 4 m M acetyl-CoA. The mixture is kept at 37 ° for 2 hr and then extracted with 0.5 ml of ethyl acetate. After separation by silica gel thin-layer chromatography (chloroform/methanol, 95%/5%), the acetylated and unreacted forms of chloramphenicol are located by autoradiography, cut out, and counted. With a constant initial amount of substrate, CAT activity can be quantitated as a percentage of chloramphenicol converted to acetylated forms. The total protein content in each reaction is measured by the method of Bradford (kit from Bio-Rad, Richmond, CA). More important, transfection efficiency stays remarkably constant, making internal controls (e.g., cotransfection of a fl-galactosidase expression vector) unnecessary.
Gene Transfer into Primary Porcine Melanotrope Cells Isolation and Culture of Cells. Porcine pituitaries are obtained from the local abattoir and collected in L o c k e ' s medium (Table I). After three washes with L o c k e ' s medium, the pituitaries are dissected into neurointermediate lobes (NILs) and anterior pituitaries. After several rinses to remove blood cells and debris, the N I L s are placed in the first dissociation medium (Table I) and kept at 37 ° for 30 rain. After centrifugation (1500 rpm, 5 min) and rinsing with L o c k e ' s medium, a second dissociation
606
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[41]
medium (Table I) is used for 15 min at 37°. The NILs and dissociated cells are collected by centrifugation, rinsed twice with a culture medium composed of 50% Ham's and 50% Dulbecco's modified Eagle's medium (DMEM) (GIBCO-Bethesda Research Laboratories, Gaithersburg, MD) and then filtered through a 48-/~m nylon mesh to eliminate coarse tissue debris. The cell suspension is generally purified on a Percoll gradient (Pharmacia, Piscataway, N J: 50% in Locke's solution) to eliminate red blood cells and debris. Alternatively, a BSA gradient [10% (v/v) bovine serum albumin in Locke's solution; Sigma, St. Louis, MO] is used. Cells are collected, rinsed with the Ham's-DMEM mixture, and resuspended in culture medium containing 65% DMEM, 25% Ham's, and 10% fetal calf serum. For transfection studies on attached cells, cells are counted and the cell suspension is diluted to a final concentration of approximately 2 × 105 cells/ml. Then cells are plated in 35-mm culture dishes (Costar, Cambridge, MA) and grown in a humidified atmosphere (95% air and 5% CO2 at 37°). The culture medium is changed every 72 hr. Intermediate lobe cells thus prepared can be maintained in culture for 2 weeks. For cell transfection in suspension, cells are kept in serum-free DMEM after dissociation and the DNA-lipid complex is added immediately (see the next section). Transfection of Primary Melanotrope Cells in Suspension. After enzymatic dispersal, intermediate lobe cells are resuspended in DMEM ( - 1 0 6 cells/500/xl). The lipopolyamine stock solution (2 mM, 2.5 mg DOGS/ml) is prepared either in ethanol or in a 10% ethanol aqueous solution obtained by 10-fold dilution of a 20 mM ethanolic solution with sterile distilled water. The DNA-lipid complex, freshly obtained by mixing separately diluted DNA (X/xg in 250 /zl DMEM; X, 1-5 /zg) and lipopolyamine (1.5 × X/zl stock solution in 250/.d DMEM) solutions, is added to the cell suspension for increasing contact times (see also Recent Improvements and Transfection of Other Cells, below). Except for the 24- and 48-hr treatments, in which cells are plated, cells are kept in suspension (in 1.5ml Eppendorf tubes) in a humidified 95% 02/5% CO2 incubator at 37°. After the transfection period, cells are washed with phosphate-buffered saline (PBS; GIBCO, Grand Island, NY) and CAT activity is determined after 48 hr. This transfection protocol in suspension should be useful for cells that attach slowly or not at all in culture (Fig. 4). Transfection of Attached Melanotrope Cells. After enzymatic dispersal of the tissue, membrane receptors are often destroyed and full regeneration often takes several days in culture. Thus if one addresses the problem of receptor-regulated gene expression, cells must be transfected after an initial culture period of several days. After enzymatic digestion of NILs, cells are plated at a density of 5 ×
[41]
GENE TRANSFERUSINGLIPOPOLYAMINE-COATEDDNA 10O,
~,
#
G
.7
607
:3
E
50
Ct 5 10 60 l~ g$
ct
S 10
io
30 rain
-
; I
i. ~
~ hr
g8 *
time of transfection
FIG. 4. The time course of the transfection efficiency was studied using 2 × 105 cells incubated with 5/xg of D N A - D O G S complex with an excess (3 × ) of cationic charges (see Recent Improvements and Transfection of Other Cells). The plasmid TRE/tK-CA T contains four copies of the canonical tetradecanoylphorbol acetate responsive element (core sequence TGACTCA) fused to the thymidine kinase of herpes simplex minimal promoter and the CAT sequence; ct, control.
105 cells/well on Costar dishes (3 cm) and kept for 2 to 3 days in DMEM supplemented with 10% (v/v) fetal calf serum. After this period, attached cells are washed twice with DMEM (no serum) and the transfection medium, made of 2/xg DNA in 500 jzl DMEM plus 4/.tl of a 2 mM DOGS stock solution in 500/zl DMEM, is applied overnight (see also Recent Improvements and Transfection of Other Cells, below). The medium is then changed (DMEM) and 12 hr later the appropriate drugs are added for another 12 hr. Chloramphenicol acetyltransferase activity is then determined as described. Figure 5 shows that transcription from chimeric genes bearing cAMP-responsive elements 7 (CRE) or the protooncogene c-fos promoter s can be stimulated by neurotransmitters and second messengers.
Gene Transfer into Chrornaffin Cells to Study Transcriptional Regulation of Peptide Synthesis Adult bovine chromaffin cells express the preproenkephalin gene
(PENK) and synthesize and secrete the opioid peptides [Met]- and [Leu]enkephalin. These cells are stimulated by acetylcholine and histamine via nicotinic and Hrhistaminergic receptors. To investigate whether these stimuli modulate proenkephalin synthesis at the transcriptional level, we transfected chimeric genes bearing the PENK promoter coupled to the 7 j. F. Habener, Mol. Endocrinol. 4, 1087 (1990). 8 p. Sassone-Corsi, J. C. Sisson, and I. Verma, Nature (London) 334, 314 (1988).
608
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[41]
A.
CRE/tk-CAT
-109
+57
FC4
human c-fos
promoter
I
I -300
-60
V
+42
-404 DSE
AP1
CRE TATA
B.
CRE/tK-CAT
FC4 I
I
Ct
FK
CRF
I
I
Ct
FK
CRF
FIG. 5. cAMP and corticotropin-releasing factor (CRF) stimulate cAMP-responsive genes and protooncogene c-fos in primary melanotropes. Induction was triggered by forskolin (FK) (5 × 10 -6 M) or CRF (10 -8 M) and compared to untreated cells (Ct).
CAT gene and evaluated the transcriptional activity in cells stimulated by drugs acting on these two membrane receptors. Chromaffin Cell Culture. Isolated adrenal medullary cells are obtained by enzymatic digestion as described previously. 9 Briefly, after collagenase digestion in situ, medullas are dissected out, minced, and subjected to 9 N. Kley, J. P. Loeffler, C. W. Pittius, and V. H611t, EMBO J. 5, 967 (1986).
[41]
GENE TRANSFER USING LIPOPOLYAMINE-COATED D N A
609
further trypsin digestion. Isolated cells are further purified on a Percoll gradient, washed twice with DMEM, and plated in Costar wells (3 cm) at a density of 5 × 105 cells/well. Cells are allowed to attach for 48 hr in DMEM supplemented with 10% (v/v) fetal calf serum, glutamine (0.2 g/ liter), glucose (1.8 g/liter, sodium bicarbonate (2 g/liter), streptomycin (1 /xg/ml), penicillin (1 /xg/ml), and antimitotics [cytosine arabinoside (10 /~M) and 5-fluorodeoxyuridine (10/zM)] while maintained at 37° in a humidified atmosphere containing 5% CO2. After that period, cells are switched to a defined serum-free medium (Bottenstein and Sato) with antibiotics and antimitotics as above. Transfection and Drug Treatment. After 1 or 2 days in serum-free medium, cells are washed with DMEM prior to addition of the transfection medium. The transfection medium is obtained by mixing (per well) extemporaneously 500 ~1 DMEM containing 2 tzg PENKAT-12 plasmid 1° (Fig. 6) and 500/zl DMEM containing 4/zl of a 2 mM ethanolic DOGS solution (see also Recent Improvements and Transfection of Other Cells, below). The transfection step lasts 12 hr and cells are then put back in defined Bottenstein and Sato medium. After 12 hr, cells are stimulated for 24 hr by adding the drugs directly to the medium and CAT activity is determined. Figure 6 illustrates that under these transfection conditions and cell treatments, transcription from the proenkephalin promoter is efficiently stimulated by nicotinic and histaminergic receptor agonists. Central Nervous System in Gene Transfer Studies A wide range of nerve cell types of different anatomical origin, either central (cortex, striatum, septum hypocampus, hypothalamus, or cerebellum ll) or peripheral (dorsal root ganglia), have been successfully transfected with DOGS. Immunochemical studies with antibodies directed against CAT or fl-galactosidase, or global measurement (CAT activity) of purified subpopulations of brain cells (neurons or astrocytes), show that foreign DNA is efficiently expressed in primary neuronal or nonneuronal cells maintained in vitro. In this chapter we will focus on experiments performed on primary cerebellar neurons, which can be obtained as a >95% pure neuronal culture.
Preparation and Culture of Cerebellar Granular Cells Cerebelli are dissected out from 6-day-old albino rats. Tissue is kept in imidazole-sodium hydroxide-buffered DMEM medium (pH 7.5). After to M. Comb, N. Mermod, S. E. Hyman, J. Pearlberg, M. E. Ross, and M. Goodman, EMBO J. 7, 3793 (1988). H j. p. Loeffler, F. Barthel, P. Feltz, J.-P. Behr, P. Sassone-Corsi, and A. Feltz, J. Neurochem. 54, 1812 (1990).
610
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[41]
A.
pENKAT-12
-120 I
I ENKrF-1
I
i~,=~,~,~~,
+1 ~ car
B.
pENKAT-12 I
l
Ot
N
H
Fro. 6. Transcriptional regulation of proenkephalin in primary chromaffin cells. (A) pENKAT-12 construct used in this study; the main regulatory elements in the 5' regulatory sequence of the P E N K promoter are depicted. (B) Autoradiogram obtained from chromaffin cells untreated (Ct) or treated with 5 x 10 - 6 M nicotine (N) or 5 x 10-6 M histamine (H).
mechanical dispersal, the cells are suspended in DMEM supplemented with high K + (25 mM), gentamicin, insulin (5 × 10 - 7 M ) and 10% (v/v) decomplemented horse serum. Cells are plated at a density of about 5 × 105 cells/dish on polyornithine (500 ~g/ml, 10 min)-coated Costar dishes (3.5 cm). This results in a nearly pure (>95%) culture of differentiated (neurite extending) neurons within 3 days (Fig. 7).
Transfection Prior to transfection, cells are washed with DMEM. The transfection mix is prepared as described for chromaffin cells [2/zg DNA (TRE/tkCAT) and 1 ml/dish]. The transfection step lasted for 5 hr. Then cells are
[41]
GENE TRANSFER USING LIPOPOLYAMINE-COATEDD N A
611
B
A
a
b
FIG, 7. Transfection of differentiated neurons. (A) Cerebellar neurons (b) are transfected without noticeable morphological change (a). Bar: 100/zm. (B) Autoradiogram of the CAT activities corresponding to (a): TRE/tk-CAT-DOGS transfection prior to plating, and (b): control. w a s h e d twice and cultured in serum-free medium for 48 hr and C A T activity is determined. This t r e a t m e n t results in efficient C A T activity and is not toxic b e c a u s e overall cell survival (trypan blue exclusion test) is not affected in transfected neurons as c o m p a r e d to untreated cells (Fig. 7). Optimal transfection conditions are then determined by varying the lipopolyamine ( D O G S and D P P E S ) - t o - D N A ratio. Figure 8 shows that a i
100]
0
DOGS
'~
DPPES
E o
>-
50.
io < t-< (.I
0
0.1
I
3
5
10
DNA (2pg) ; LIPID RATIO
FIG. 8. CAT activity in lipospermines [DOGS ((3) and DPPES (V)] transfected granular neurons increases sharply when the compacted complex bears a net positive charge (abscissa, ratio of lipid to nucleic acid charges). Inset: Autoradiogram obtained with D O G S - T R E / t k CA T.
612
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[41]
sharp increase in transfection efficiency occurs around neutrality of the lipid-DNA complex as was noticed previously with melanotrope cells3; furthermore, both lipospermines show similar transfection efficiency. Gene Transfer in a Permanent Pituitary Cell Line
AtT20 Cell Culture AtT20 cells are corticotrophic cells derived from a mouse anterior pituitary tumor. (The AtT20/D-16 V subclone was obtained from J.-L. Roberts, New York). Cells are propagated in DMEM supplemented with 10% (v/v) fetal calf serum, glutamine (286 rag/liter), penicillin (50/zg/ml), streptomycin (50/zg/ml), and kanamycin (50 ~g/ml). Cells are plated on Costar dishes (3.5 cm) and cultured at 37° in 95% 02/5% COz. They are generally used at 30 to 50% confluency for transfection studies.
Optimization of Method for AtT20 Cells Because initially the method showed variable efficiency in different hands, a careful search was undertaken to optimize and describe it unambiguously. Preparation of the Lipospermine/Plasmid Complex. DNA condensation by polyamines is known to be dependent on concentrations of reactants, on ionic strength, as well as on the presence of other polycations. A similar conclusion was reached for condensation by lipopolyamines, and in addition to the observation that DOGS slowly precipitated out of DMEM (but not out of water or sodium chloride solutions), this may be the clue to why the preparation of the complex could influence transfection. Optimal and nearly time-independent conditions for association were found in - 1 5 0 mM sodium chloride or in alkaline-earth cation-depressed DMEM (see Recent Improvements and Transfection of Other Cells, below) in the 10/zM base pair (or less) range of DNA concentration. The amount of lipospermine necessary for strong CAT activity (2-4/zl of a 2 mM solution per microgram plasmid) agreed with the general observation of a threshold level around charge neutrality of the complex. Optimal Transfection Time. Variation of CAT activity with transfection time, that is, with the time after which cells were washed and serum supplemented, showed a plateau after - 1 5 hr. Thus attached AtT20 cells take much longer to transfect than nonattached primary melanotrope cells (Fig. 4): there is, for instance, a residual 30% CAT activity increase between 8 and 15 hr of incubation (which may in part be accounted for by the cell population increase). Finally, the following procedure was taken
[41]
GENE TRANSFERUSINGLIPOPOLYAMINE-COATEDDNA
613
for subsequent studies: 1 /xg of plasmid is diluted into 500 /xl DMEM in which the concentration of divalent cation is depressed (see Recent Improvements and Transfection of Other Cells, below); 2/A of a 2 mM DOGS solution [in ethanol or 10% (v/v) ethanol in distilled water] is diluted into another 500/xl of DMEM; these solutions are mixed and poured after a few minutes onto the cells kept in a small volume of serum-free DMEM; after 10-12 hr the transfection medium is removed.
Lipopolyamine-Based Gene Transfer to Study Second Messengers: Protein Kinase A Pathway In mammalian cells, extracellular signals (neurotransmitters and hormones) can modulate gene expression by stimulating cAMP formation in response to ligand-receptor interaction on the external side of the cell membrane. The intracellular effects of cAMP, including regulation of gene expression, are mediated by protein kinase A [PKA; ATP : protein phosphostransferase (EC 2.7.1.37)]. At low cAMP levels, PKA is an inactive tetramer of two catalytic subunits and two regulatory subunits. The biological effects of PKA are mediated by phosphorylation of specific substrates of the catalytic subunits. At the nuclear level, activation of gene transcription by cAMP is mediated in many cases by the trans-acting factor CREB (cAMP response element-binding protein), a phosphorylation substrate of PKA. Point mutations in the regulatory subunit of PKA can suppress the binding sites for cAMP. Introduction of such mutated regulating subunits (by gene transfer) inactivates PKA because these mutated regulatory subunits are no longer released when the cAMP level increases. Inactivation of PKA by this approach indeed blocks cAMP-induced gene expression. 12,13 Taking advantage of the optimized protocol described above, we used this approach in AtT20 cells to study cAMP-mediated gene control. Figure 9 shows that chimeric genes bearing a canonical cAMP-responsive consensus sequence (TGACGTCA) are efficiently stimulated by forskolin, a drug that stimulates adenylate cyclase directly and increases cAMP levels. Cotransfection of this reporter gene (CAT) with a mutated regulatory subunit of PKA suppresses induction by forskolin. This experiment shows that lipopolyamine-mediated gene transfer can be used in AtT20 cells as an efficient tool for introduction of specific biochemical modifications in regulatory pathways. We are now using this approach to study the regulat2 G. S. McKnight, G. G. Cadd, C. H. Clegg, A. D. Otten, and L. A. Correll, Cold Spring Harbor Syrup. Quant. Biol. 53, 111 (1988). 13 p. L. Mellon, C. H. Clegg, L. A. Correll, and G. S. McKnight, Proc. Natl. Acad. Sci. U.S.A. 86, 4887 (1989).
614
METHODSFOR TRANSFORMING ANIMAL AND PLANT CELLS
[41]
CRE/tk-CAT
Mt-REVAB
hGH poly (A) R1 cDNA
CRE/tk-CAT
CRE/tk-CAT +Mt-REVA8
+ PCH 110
I
I
Ct
FK
I
// Ct
I
FK
FIG. 9. Mutated regulatory PKA subunits abolish cAMP-dependent induction of CREcontaining genes. AtT20 cells were simultaneously cotransfected with a CRE-containing gene (CRE/tK-CAT) (1/zg/well) and an expression vector (2 p.g/well) coding for a mutated regulatory PKA subunit (lacking cAMP-binding sites) (Mt-REVAB)or with a control plasmid (2 /xg/well) (PCHII0, an expression vector coding for/3-galactosidase, or pUC18). The transfection step lasted 10 hr, after which cells were switched to serum-free DMEM for 24 hr and then stimulated with forskolin (FK, 5 x 10 -6 M) for 10 hr. CAT activity was determined and taken as an index of CRE/tK-CAT transcription. Induction of CRE/tK-CAT transcription by FK was completely abolished in AtT20 cells cotransfected with Mt-REVAB, in contrast to cells cotransfected with PCHll0 or pUC18. tory mechanism of neurotransmitters. For example, preliminary experim e n t s s h o w t h a t in A t T 2 0 cells c o r t i c o t r o p i n - r e l e a s i n g f a c t o r ( C R F ) c a n s t i m u l a t e c h i m e r i c g e n e s b e a r i n g c A M P - r e s p o n s i v e e l e m e n t s , an e f f e c t t h a t is s u p p r e s s e d b y i n t r o d u c t i o n o f m u t a t e d r e g u l a t i n g s u b u n i t s o f P K A , i n d i c a t i n g t h a t this s t r a t e g y c a n b e u s e d to i n v e s t i g a t e i n t r a c e l l u l a r r e g u l a t o r y p a t h w a y s l i n k e d to g i v e n r e c e p t o r s . S i m i l a r d a t a h a v e b e e n o b t a i n e d on the complete promoter sequence (rather than the isolated regulatory consensus sequence) of the proopiomelanocortin (POMC) gene, a cAMP-
[41]
GENE TRANSFERUSINGLIPOPOLYAMINE-COATEDDNA
615
inducible gene that lacks the classical cAMP-responsive motif. Thus, specific inactivation of regulatory pathways by lipopolyamine-mediated gene transfer can be used for investigation of more complex regulatory sequences. Furthermore, because high DNA transfer is also achieved in neurons and endocrine cells, similar competition experiments with mutated kinase subunits may be used to investigate peptide gene expression (POMC and proenkephalin) in these primary culture models. Recent Improvements and Transfection of Other Cells Transfection efficiency depends on multiple factors. The best approach for achieving a reasonable and reproducible gene transfer protocol is to work in a defined medium, to follow rigorously a known transfection procedure, and to adapt it by optimizing a few crucial parameters. Obviously the cell type, but also the level of confluence and even the pretransfection conditions (serum growth factors), will have an influence on the cell surface properties, on the rate of endocytosis, or on the cell cycle. Hence there is variable" competence" for accepting and expressing (stably or not) an exogene. Among important and easy-to-adapt parameters are those governing the DNA-lipospermine association (range and ratio of concentrations, nature of the medium) and the coated DNA-ceU surface interaction (transfection medium and time). Condensation of nucleic acids by polyamines is known to be competitively inhibited by other cations in the expected order: Mg2+, Ca 2+ >~ Na +, K+; polyanions [e.g., phosphate, heparin, albumin, and ethylenediaminetetraacetic acid (EDTA)] also may interfere. Thus, the size of compacted lipospermine-coated particles (see Fig. 2) is not only dependent on the initial lipid and DNA concentrations, but also on medium composition and ionic strength. On the other hand, unless there is an optimal size for endocytosis small particles should transfect better, so both partners should be highly diluted before being allowed to encounter. Variations along these lines led in practice to separate dilution of the plasmid (1-5/zg) and the lipid to 100-500/zl before mixing. As compacting medium, pure water and high ionic strength were found to be less effective than 150 mM NaCI or DMEM. However, alkaline-earth cations present at millimolar concentration in DMEM severely depress transfection; they may be removed by a freeze-thaw cycle o f a 2 × DMEM solution followed by quick filtration of the insoluble MgHPO 4 and CaHPO4. As to the charge ratio of lipopolyamine to nucleic acid, experiments with endocrine cells, 3 cerebellar neurons (Fig. 8), or AtT20 cells (see Optimization of Method for AtT20 Cells, above) demonstrate that transfection is efficient only when the complex bears a strong net positive charge,
616
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[41]
irrespective of the valence of the lipocation.3 The upper limit to the excess cationic charge may be toxicity, especially for quaternary ammonium salts that are used in other "cationic liposome"-based transfection techniques and are not easily handled by the cell. Charge ratios are calculated on the following basis: 1 /xg DNA contains 3.07 nmol of phosphate anionic charges (assuming a mean molecular weight of 325 for a nucleotide sodium salt); 1/xl of a 2 mM (2.5 mg/ml DOGS tetratrifluoroacetate, Mr 1263; or 2.7 mg/ml DPPES tetratrifluoroacetate, Mr 1331) lipospermine solution contains at least 6 nmol of ammonium cationic charges at neutral pH. The net charge requirement of the complex reflects a necessary electrostatic interaction with the cell membrane, so cells that are refractory to net cationic conditions may be checked for transfection by compacted net anionic complexes obtained with default lipopolyamine charges. Other variables affect the coated DNA-cell surface interaction directly. Transfection media seem less critical than the DNA coating medium, yet trypsin (used to detach cells) and competing polyions (especially macromolecules present in serum) should be absent; also, the total volume over the cells should be kept minimal to favor fast encounter. Serum should be added only if needed because it may affect transfection efficiency and also gene expression in an unpredictable way. Optimal transfection times may be highly variable, ranging from <30 min for nonattached melanotrope cells (Fig. 4) to about 12 hr for AtT20 and most attached cells (see Optimization of Method for AtT20 Cells, above) Moreover, they may be conversely related to the net charge of the complex due to the interdependency of variables. When performed in the culture medium, extended transfection times should not be problematic because lipopolyamines are usually of low toxicity. Finally, once the transfection procedure has been optimized, it may be wise to dilute the plasmid to be expressed into carrier DNA to check for a possible cell saturation phenomenon. In summary, in the absence of a more specific start-up procedure the following recipe may be used: add 5/zg plasmid to 500/xl of serum-free DMEM in which the divalent cation level has been depressed (see above) and vortex; add I0 ~1 of a 2 mM DOGS solution [in ethanol or 10% (v/v) ethanol in distilled water] to another 500/.d of this DMEM, and vortex; mix the two solutions and pour onto ~106 cells at 30-50% confluence. Alternatively, or if the cells require a special medium, add 1/xg plasmid to 50/xl of 150 mM NaC1 and vortex; add 2/zl of a 2 mM DOGS solution [in ethanol or 10% (v/v) ethanol in distilled water] to another 50 ~1 of 150 mM NaCI and vortex; mix the solutions and vortex. After 10 min, pour onto 105-106 cells (well below confluence) kept in 1 ml of serum-free culture medium and mix gently; leave in contact for - I 0 hr before adding
[41]
GENE TRANSFERUSINGLIPOPOLYAMINE-COATEDDNA
617
serum. Optimization may be achieved by variation of the DOGS : DNA ratio and of the transfection time. If the results obtained are poor, other modifications should be made, taking into consideration the above-mentioned sources of interference. To date, over 40 cell lines have been transfected successfully, allowing the following general statements to emerge: 1. The lipospermine-coated method is simple, fast, and in general more efficient than classical coprecipitation methods. 2. Due to compaction, there should be no upper limit to DNA size. 3. The technique shows excellent reproducibility, making cotransfection of an internal reference unnecessary. 4. The transfection seems uniform among cells, as seen indirectly by immunohistochemistry; however, direct detection after transient transfection with a/3-galactosidase reporter gene showed 15% blue cells as compared to <5% with Calcium phosphate. 5. In all but a few cases, no cytotoxicity was noticed even at high DOGS levels, nor was there any interference with physiological regulations. If necessary, DPPES may be substituted for DOGS (Fig. 1), which is as efficient (Fig. 8) but shows much faster breakdown to endogenouslike molecules. 6. In contrast to viruses and physical techniques like electroporation or particle guns, lipopolyamines should be ineffective on intact cells having an external cytoskeleton like yeast, plant cells, and bacteria. Recently, however, plant protoplasts were stably transformed with high yield. Moreover, lipospermines may be utilized as adjuvant to the aforementioned techniques, for instance to extend the host range of viruses, ~4'15 or to compact DNA with an adjustable net charge prior to electroporation, or to wrap the nucleic acid around DOGS-presoaked hydrophobic metal particles. Interestingly, efficient gene transfer has also been obtained by pretreating cells with lipospermine and then adding the naked plasmid. Besides straightforward gene transfer into cells in vitro, lipopolyamines should also deliver DNA in vivo and mediate transfer of other nucleic acids, that is, mRNA or oligonucleotides, either single stranded (as antimessenger or triple helix-forming compounds at the genome level) or double stranded (for titration of gene expression-regulating proteins).
~4 See the DEAE-dextran method in the chapter by W. A. Kleown, C. R. Campbell, and R. S. Kucherlapati, this series, Vol. 185, p. 527. t5 p. Roux, P. Jeanteur, and M. Piechaczyk, Proc. Natl. Acad. Sci. U.S.A. 86, 9079 (1989).
618
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[42]
Acknowledgments We thank Jean-Marie Lehn for interest in this work, P. Feltz for encouragement, F. Barthel and J. S. Remy for recent contributions, and A. L. Boutillier, P. Brochard, B. Demeneix, and B. Kieffer for unpublished data. We are indebted to S. McKnight (Seattle), I. Verma (San Diego), P. Sassone-Corsi (Strasbourg), and M. Comb (Boston) for the gift of plasmids. AtT20 cells were generously provided by J.-L. Roberts (New York). This work was supported by grants from the Centre National de la Recherche Scientifique (CNRS), Institut National de la Sant6 et de la Recherche M6dicale (INSERM), and Association pour la Recherche sur le Cancer (ARC).
[42] R e c e p t o r - M e d i a t e d Transport of D N A into
Eukaryotic Cells B y M A T T H E W GOTTEN, ERNST W A G N E R , a n d M A X L . BIRNSTIEL
General Introduction
DNA-mediated gene transfer into eukaryotic cells has proved to be a powerful approach for the analysis of the molecular and cellular biology of cell differentiation, growth, and carcinogenic transformation. Many techniques have been developed for the introduction of genes: calcium phosphate precipitation, ~'2 electroporation, 3,4 liposome packaging of DNA, 5-7 with 8-~° or without specific targeting of the liposomes, DOTMAmediated lipofection,ll'12 microinjection,13 the use of polycations such as
l A. Loyter, G. A. Scangos, and F. H. Ruddle, Proc. Natl. Acad. Sci. U.S.A. 79, 422 (1982). 2 C. A. Chen and H. Okayama, BioTechniques 6, 632 (1988). 3 E. Neumann, M. Schaefer, Y. Wang, and P. H. Hofschneider, EMBO J. 1, 841 (1982). 4 K. Ohtani, M. Nakamura, S. Saito, K. Nagata, T. Sugamura, and Y. Hinuma, Nucleic Acids Res. 17, 1589 (1989). 5 R. Fraley and D. Papahadjopoulus, Curr. Top. Microbiol. lmmunol. 96, 171 (1982). 6 C. Nicolau, A. T. Legrand, and E. Grosse, this series, Vol. 152, p. 157. 7 R. J. Mannino and S. Gould-Fogerite, BioTechniques 6, 682 (1988). 8 C.-Y. Wang and L. Huang, Proc. Natl. Acad. Sci. U.S.A. 84, 7851 (1987d). 9 p. Machy, F. Lewis, L. McMillan, and Z. L. Jonak, Proc. Natl. Acad. Sci. U.S.A. 85, 8027 (1988). I0 y . Kanedi, K. Iwai, and T. Uchida, Science 243, 375 (1989). H p. L. Feigner, T. R. Gadek, M. Holm, R. Roman, H. W. Chan, M. Wenz, J. P. Northrop, G. M. Ringold, and M. Danielsen, Proc. Natl. Acad. Sci. U.S.A. 84, 7413 (1987). 12 C. E. Holt, N. Garlick, and E. Cornel, Neuron 4, 203 (1990). 13 M. Graessmann and A. Graessmann, in "Microinjection and Organelle Transplantation Techniques" (J. E. Celis, A. Graessmann, and A. Loyter, eds.), pp. 3-13. Academia, London, 1986.
METHODS IN ENZYMOLOGY.VOL. 217
Copyright © 1993by AcademicPress, Inc. All rightsof reproductionin any form reserved.
[42]
RECEPTOR-MEDIATED TRANSFEROF DNA
619
Polybrene] 4 DEAE-dextran, 15-17 lipopolyamine] 8 and polyornithine 19 as well as asbestos-mediated 2° or direct transfer of genes from bacteria to eukaryotic cells 21 or direct microinjection of tissue.22'23 Genes have also been transferred by particle bombardment. 24In none of these procedures has the mechanism of DNA uptake into the nucleus been thoroughly investigated. There are two basic natural mechanisms for the uptake of substances in the eukaryotic cell. Small molecules such as amino acids, monosaccharides, and most ions are transported directly across the plasma membrane into the cytoplasm. Macromolecules such as peptides and proteins are taken up by the process of receptor-mediated endocytosis. This uptake is made possible by macromolecule-specific receptors that are found on the surface of the cell membrane. Once the macromolecules are bound, ligands and receptors are clustered and reach the coated pits on which the clathrinassociated membrane is pinched off as a coated vesicle. After removal of the clathrin the vesicles fuse with and become part of the acidic endosomes. Ligand and receptors can have different fates. They can either be destroyed in a degradative pathway, or brought back to the cell surface in a recycling pathway. Receptors include, among many others, those targeted to low-density lipoprotein (LDL), 25 transferrin, z6,27 asialoglycoproteins, 28 gpl20 envelope protein of the human immunodeficiency virus (HIV), 29-31 and diphtheria toxin. 32'33 14 S. Kawai and M. Nishizawa, Mol. Cell. Biol. 4, 1172 (1984). ~5 F. L. Graham and A. J. van der Eb, Virology 52, 456 (1973). 16 j. McCutchan and J. S. Pagano, J. Natl. Cancer Inst. 41, 351 (1968). 17 O.-R. B. Choi and J. B. Engel, Cell 55, 17 (1988). 18 j..p. Behr, B. Demeneix, J.-P. Loeffler, and J. P. Perez-Mutul, Proc. Natl. Acad. Sci. U.S.A. 86, 6982 (1989). 19 F. F. Farber, J. L. Melnick, and J. S. Butch, Biochim. Biophys. Acta 420, 298 (1975). 20 j. D. Appel, T. M. Fasy, D. S. Kohtz, J. D. Kohtz, and E. M. Johnson, Proc. Natl. Acad. Sci. U.S.A. 85, 7670 (1988). 21 W. Schaffner, Proc. Natl. Acad. Sci. U.S.A. 77, 2163 (1980). 22 j. Wolff, R. Malone, P. Williams, W. Chong, G. Acsadi, A. Jani, and P. Feigner, Science 247, 1456 (1990). 23 G. Acsadi, S. Jiao, A. Jani, D. Duke, P. Williams, W. Chong, and J. Wolff, New Biologist 3, 71 (1991). 24 N.-S. Yang, J. Burkholder, B. Roberts, B. Martinell, and D. McCabe, Proc. Natl. Acad. Sci. U.S.A. 87, 9568 (1990). 25 j. L. Goldstein, M. S. Brown, R. G. W. Anderson, D. W. Russell, and W. J. Schneider, Annu. Reu. Cell Biol. 1, 1 (1985). 26 W. S. May and P. Quatrecasas, J. Mernbr. Biol. 88, 205 (1985). 27 H. A. Huebers and C. A. Finch, Physiol. Rev. 67, 520 (1987). 28 M. Spiess, Biochemistry 29, 10009 (1990). 29 T. Kieber-Emmons, B. A. Jameson, and W. J. W. Morrow, Biochim. Biophys. Acta 989, 281 (1989).
620
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[42]
Because of the trafficking of the receptors, their internalization :7,28,34 occurs frequently. Because there are several hundred thousand receptors per cell, at least for some ligands, this rapid trafficking leads to high turnover numbers per cell. Thus, it has been calculated that each of the 100,000 to 500,000 asialoglycoprotein receptors on hepatocytes transports and internalizes as many as 200 ligand molecules per day. z8 Similarly, the iron ion-transporting transferrin has high turnover numbers, with an estimated 2 × l 0 4 iron ions transported across the plasma membrane per minute. 35 The basic principle of all receptor-mediated transport systems for cloned DNA is to subvert the efficient cellular mechanisms of receptormediated internalization of proteins in such a way that ligands bound up with DNA are recognized by the receptors and are carried swiftly and efficiently across the plasma membrane into the cell.
Principle of Method Transferrinfection is the process by which DNA is transferred into cells by transferrin-polycation conjugates based on transferrin-dependent receptor-mediated endocytosis. 36-38 For this, the human iron-transport protein transferrin, or the chicken homolog conalbumin, was covalently linked to DNA-binding protamines or to DNA-binding polylysines of various degrees of polymerization (90 to 450 lysine residues). Receptor-Mediated Entry of DNA into Cells. When the plasmid DNA in the transferrin-polylysine conjugate (TfpL) complex containing the luciferase gene is supplied to eukaryotic cells, moderate to high levels of expression of the luciferase gene occurs in some cell types, while others
3o L. A. Lasky, G. Nakamura, D. H. Smith, C. Fennie, C. Shimasaki, E. Patzer, P. Berman, T. Gregory, and D. J. Capon, Cell 50, 975 (1987). 3t C.-F. Perno, M. W. Baseler, S. Broder, and R. Yarchoan, J. Exp, Med. 171, 1043 (1990). 32 R. E. Morris, A. S. Gerstein, P. F. Bonventre, and C. B. Saelinger, Infect. Immun. 50, 721 (1985). 33 j. M. Rolf, H. M. Gaudin, and L. Eidels, J. Biol. Chem. 265, 7331 (1990). 34 j. Maddon, J. S. McDougal, P. R. Clapham, A. G. Dalgleish, S. Jamal, R. A. Weiss, and R. Axel, Cell 54, 865 (1988). 35 L. Stryer, "Biochemistry," 3rd Ed. Freeman, New York, 1988. 36 E. Wagner, M. Zenke, M. Cotten, H. Beug, and M. L. Birnstiel, Proc. Natl. Acad. Sci. U.S.A. 87, 3410 (1990). 37 M. Zenke, P. Steinlein, E. Wagner, M. Cotten, H. Beug, and M. L. Birnstiel, Proc. Natl. Acad. Sci. U.S.A. 87, 3655 (1990). 3s M. Cotten, F. L/ingle-Rouault, H. Kirlappos, E. Wagner, K. Mechtler, M. Zenke, H. Beug, and M. L. Birnstiel, Proc. Natl. Acad. Sci. U.S.A. 87, 4033 (1990).
[42]
RECEPTOR-MEDIATED TRANSFER OF DNA
621
Trensferrin
Condensed D N A DONUT coated with Translerrin Extended DNA
Binds to receptor
recept°r T Transterrin
T
~
~
Internalized
Cytoplasm
1
°
Lysosome ~ ?7
Nucleus FIG. 1. Diagram summarizing the general principle of transferrinfection. A transferrinpolycation conjugate is prepared. DNA, when incubated with this conjugate, undergoes a polycation-induced condensation to produce a transferrin-coated DNA doughnut. This structure is then supplied to transferrin-receptor cells. Transferrin-receptor interactions result in the internalization of the complex by receptor-mediated endocytosis. By an unknown mechanism, the DNA finds its way to the nucleus, where subsequent expression of genes contained on the DNA ensues.
a p p e a r to be refractory (see Table I). The general principle of this method is s u m m a r i z e d in Fig. 1. Several lines of evidence suggest that in K562 cells or chicken HD3 cells r e c e p t o r - m e d i a t e d endocytosis of the D N A is involved. Transferrinfection is c o m p e t e d by addition of iron-loaded transferrin in the cell medium. 37 F o r K562 cells or HD3 cells polylysine alone is a p o o r carrier for D N A transfer into the ceUs. 37'39 Only when linked to the transferrin 39E. Wagner, M. Cotten, R. Foisner, and M. L. Birnstiel, Prec. Natl. Acad. Sci. U.S.A. 88, 4255 (1991).
622
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[42]
moiety does transferrinfection ensue. That the binding of the iron-containing transferrin to its receptor is a crucial step in transferrinfection is further supported by our finding that protocols that increase the number of transferrin receptors 38in K562 cells (as determined by Scatchard analysis 4° and our unpublished observations, 1990) also increase transferrinfection. The binding of transferrin-polylysine and transferrin-polylysine-DNA to cell surface receptors was measured with tritiated compounds whereas the internalization was followed using fluoresceinated transferrin-polylysine-DNA complexes. Binding of the complexes to viable HD3 cells was saturable. The apparent binding constants were similar for transferrin and transferrin-polylysine, suggesting that the polylysine moiety did not severely impede receptor recognition. Finally, fluoresceinlabeled transferrin-polylysine-DNA complexes appeared rapidly in numerous small fluorescent vesicles in >95% of the cells, suggesting that the DNA complexes were now in the vesicular (endosomal?) system of the c e l l . 37
We observe that, at least for some cell types, transferrinfection is very much enhanced by the addition of chloroquine during the 4-hr duration of transferrinfection, but this requirement appears to vary in a highly idiosyncratic and unpredictable manner from cell type to cell type. We presume that where chloroquine is beneficial, as is the case for K562 cells, this lysosomatropic drug increases the pH in the endosomal and the lysosomal compartments and thus prevents degradation of the reporter D N A during passage from endosomes to the nuclear compartment. But the action of chloroquine is not fully understood and other mechanisms of action are not excluded. Other lysosomatropic substances added with or instead of chloroquine, such as monensin, do not facilitate transferrinfection, but actually interfere with it. NH4C1 and methylamine are ineffective. An alternative, and often superior, protocol that allows high-level expression involves treating transferrinfected cells with a defective adenovirus. In cells that can bind and internalize adenovirus (most human and many mouse cell types) the entry of adenovirus involves a membrane disruption as the pH drops in the endosome. We have found that treatment of cells supplied with various ligand-polycation DNAs (e.g., transferrin-polylysine, gpl20-polylysine, antibody-polylysine) in the presence of the replication-defective adenovirus di312 allows enhanced gene expression in the absence of chloroquine (see note added in proof). Ligands Other Than Transferrin. DNA can be targeted to other receptors by choosing different ligand-receptor systems. Thus, it has been 40 E. Mattia, K. Rao, D. Shapiro, H. Sussman, and R. Klausner, J. Biol. Chem. 259, 2689 (1984).
[42]
RECEPTOR-MEDIATED TRANSFEROF DNA
623
possible to target the cell membrane protein CD4 in CD4-positive lines with conjugates formed between polylysine and anti-CD4 monoclonal antibodies or polylysine and recombinant gp 120 (the envelope protein of HIV; a kind gift of Genentech, South San Francisco, CA). Other receptors were targeted with anti-CD7 monoclonal antibodies and asialofetuin (unpublished observations, 1992). A related procedure using asialoorosomucoid-polylysine conjugates has been successfully used to deliver DNA, via the asialoglycoprotein receptor, to hepatocytes, both in tissue culture and in r a t s . 41'42 Quantitative Aspects. High DNA concentrations during transferrinfection are desirable but the DNA concentration in stock solutions cannot exceed 20-30/xg/ml because of the limited solubility of the T f p L - D N A complexes. We find that plasmids of 13 kb work as well as plasmids of 6 kb. We are currently testing alternate DNA packaging schemes to increase the size of plasmid that can be reliably transfected. (See note added in proof. 5) Quantitative Southern analysis revealed that initially, after a few hours of incubation, on the order of 5000 ("episomal") DNA plasmids per cell became associated with K562 cells. One or 2 weeks later the number of DNA molecules was reduced by a factor of about 1000. In the case of K562 cells, virtually all cells take up DNA (see above) and close to 100% of the cells express the reporter gene (see Ref. 37 and below). Especially where chloroquine is not required, there is no cell death during transferrinfection. This means that the procedure can be repeated several times on the same cell culture and in this way the amount of DNA that is transferred into the cells can be increased. 37 Where there is no selection for the transferred gene, expression after transferrinfection is transient. Expression of the Rous sarcoma virus long terminal repeat (LTR)-driven luciferase expression plasmid (pRSVL) in K562 cells, after reaching a maximum of expression around 18 to 24 hr, decays with a half-life of days when measured in the cell culture as a whole. When the pRSVL construct is presented to K562 cells in the context of a dominant control region of the globin gene cluster, 43 expression is maximal after day 2 and a high level persists in the cell culture as a whole for about 2 to 3 weeks. This protracted expression may render the establishment of stable cell lines unnecessary in some distances. When transfection of a selectable marker (e.g., neomycin phosphotransferase)
4t C. Wu, J. Wilson, and G. Wu, J, Biol. Chem. 2,64, 16985 (1989). 42 G. Y. Wl.l and C. H. Wu, J. Biol. Chem. 263, 14621 (1988). 43 p. Collis, M. Antoniou, and F. Grosveld, EMBO J. 9, 233 (1990).
624
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[42]
is performed on K562 cells about 0.5 to 1% of the cells form colonies of stable transformants.
Methods
Synthesis of Transferrin-Polylysine Conjugates The initial conjugate synthesis 36'39 involved the modification of one to two amino groups on the transferrin molecule with the reactive bifunctional reagent N-succinimidyl-3-(2-pyridyldithio)propionate (SPDP), followed by the ligation to the similarily modified polycations (polylysine or protamine) through the formation of disulfide bonds (see Conjugation Method 1, below). We have also synthesized transferrin-polylysine conjugates that contain a specific ligation through modification of the transferrin carbohydrate moiety. 44 The two terminal exocyclic carbon atoms of the sialic acids within the carbohydrate chains of human transferrin are selectively removed by periodate oxidation. 45 The oxidized aldehyde-containing form of transferrin was used for coupling to the amino groups of polylysine. The junction that results from aldimine formation was stabilized by reduction with sodium cyanoborohydride to the corresponding amine linkage (see Conjugation Method 2, below). There are a number of advantages of the carbohydrate linkage procedure compared to the SPDP procedure. The carbohydrate method has the advantage of being less time consuming. It is useful for scaling up for the preparation of large quantities of conjugates and it generates conjugates having defined polycation-transferrin ligation sites with "nature-derived" carbohydrate spacers.
Preparation of Conjugates General Procedures Quantitative Assays. The polylysine content of fractions was estimated spectrophotometrically by the ninhydrin assay and, in the case of fluorescein isothiocyanate (FITC)-labeled polylysine, by absorption at 495 nm. The amount of dithiopyridine linkers in modified transferrin was determined, after reduction of an aliquot with dithiothreitol, by an absorption measurement of released pyridine-2-thione at 340 nm. The amount of free 44 E. W a g n e r , M. Cotten, K. Mechtler, H. Kirlappos, and M. L. Birnstiel, Bioconjugate Chem. 2, 226 (1991). 45 T. K i s h i m o t o and M. Tavassoli, Anal. Biochem. 153, 324 (1986).
[42]
RECEPTOR-MEDIATED TRANSFEROF DNA
625
mercapto groups was determined using Ellman's reagent 46 and measurement at 412 nm. Transferrin content of the fractions was determined by ultraviolet (UV) measurement at 280 nm and correction (where necessary) of the value by subtraction of the corresponding UV absorption of FITC, dithiopyridine, or buffer at 280 nm.
Conjugation Method 1: Transferrin-Polylysine Conjugate Synthesis through Disulfide Linkages Conjugation method 1 has been used for the preparation of conjugates of transferrin or conalbumin with various poly(L-lysines), 36poly(D-lysine), poly(L-arginine) (unpublished observations, 1990), salmon sperm protamine, 36 and a synthetic protamine analog39; conjugates of poly(L-lysines) with rgpl2047'48 have been synthesized (unpublished observations, 1990), as well as poly(L-lysine)-antibody conjugates [with anti-CD4, anti-CD7 (unpublished observations, 1990)] and with asialofetuin (unpublished observations, 1990). A related procedure for the synthesis of asialoorosomucoid poly(L-lysine) conjugates has been described by Wu and Wu. 42 Transferrin-poly(L-lysine) conjugates with polylysines of an average chain length of 200 or 450 lysine monomers (pL200, pL450) have been synthesized as described36'~9: coupling of transferrin to polylysine was performed by ligation via disulfide bonds after modification with the bifunctional reagent succinimidyl-3-(2-pyridyldithio)proprionate (SPDP; Pharmacia, Piscataway, N J). 3-(2-Pyridyldithio)propionate-Modified Transferrin. A solution of 100 mg (1.25 /zmol) of human transferrin (iron free, Sigma, St Louis, MO) in 3 ml of 100 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) buffer, pH 7.9, was subjected to gel filtration on a Sephadex G25 column. To the resulting 5-ml solution, 260/~1 of a 10 mM ethanolic solution of SPDP (2.6/zmol) was added with vigorous mixing. After 1 hr at room temperature, purification was performed by a further Sephadex G-25 gel filtration to give 6 ml of a solution of 1.1/~mol transferrin modified with 2.1 /~mol dithiopyridine linker. 3-Mercaptopropionate-Modified Polylysine. Poly(L-lysine) of different molecular weights was used, namely those with an average chain length of 200 or 450 lysine monomers (PL200 or pL450 hydrobromide; Sigma). Both unlabeled and fluorescent-labeled polylysines were used; fluorescent labeling with FITC (Sigma) was performed in sodium bicarbonate buffer, 46 G. L. Ellman, Arch. Biochem. Biophys. 82, 70 (1959). 47 L. Lasky, J. Groopman, C. Fennie, P. Benz, D. Capon, D. Dowbenko, G. Nakamura, W. Nunes, M. Renz, and P. Berman, Science 233, 209 (1987). 48 L. Lasky, G. Nakamura, D. Smith, C. Fennie, C. Shimasaki, E. Patzer, P. Berman, T. Gregory, and D. Capon, Cell 50, 975 (1987).
626
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[42]
pH 9, for 3 hr. A gel-filtered solution of 0.57/xmol pL200 (FITC labeled) in 3 ml 20 mM sodium acetate buffer was brought to pH 7.9 by the addition of 300/~l of 1 M HEPES buffer and 204/.tl of a 10 mM ethanolic solution of SPDP (2.04/.tmol) was added with vigorous mixing. One hour later 500 /zl of 1 M sodium acetate, pH 5, was added; after gel filtration with 20 mM sodium acetate the solution contained 0.54/xmol PL200 with 1.86/zmol of dithiopyridine linker. The solution was brought to pH 7 by addition of HEPES buffer, and 36 mg dithiothreitol (DTT) was added. The solution was kept under argon at pH 7.5 for 1 hr. The pH was adjusted to 5.2 by addition of 400/xl 3 M sodium acetate buffer. After gel filtration (Sephadex G-25, 14 x 180 mm column, 15 mM sodium acetate, pH 5.0) a solution of 0.50 ~mol PL20o, which was modified with 1.84/~mol mercaptopropionate linker, was obtained. Following the same procedure, modification of 0.20 /zmol PL450 with 0.70/zmol SPDP gave a product of 0.18/.~mol PL450 with 0.57/zmol dithiopyridine groups; treatment with DTT and isolation gave 0.175/zmol PL450 modified with 0.56/zmol mercapto groups. Conjugation of Transferrin with Polylysine. TfPL200 conjugates were prepared by mixing 1.06/xmol modified transferrin (see 3-(2-Pyridyldithio)propionate-Modified Transferrin, above) in 100 mM HEPES buffer, pH 7.9, with 0.20/xmol modified pLz00 (see previous section) in sodium acetate buffer under an argon atmosphere. The reaction mixture was kept for 18 hr at room temperature. TfPL450 conjugates were prepared in a similar manner starting with 0.61/xmol modified transferrin and 0.12/zmol mercapto-modified pL450. Both TfPL200 and TfPL450 were isolated from the reaction mixture by cation-exchange chromatography [Pharmacia Mono S column HR 10/10; gradient elution, buffer A: 50 mM HEPES (pH 7.9) and buffer B: buffer A plus 3 M sodium chloride]; it was essential for the recovery of the polycation conjugates to add sodium chloride to the reaction mixture (final concentration, 0.6 Min case ofTfpL200 or 1 Min case of TfpL4s0 conjugates) before loading the column and to start the gradient at this salt concentration. The excess of uncoupled transferrin was eluted first. The product fractions were eluted at salt concentrations around 1.4 M with TfpL200 or around 2 M salt with TfpL450 . The TfpLz0o product fractions were pooled into three conjugate fractions, A-C, with increasing polylysine:transfen-in ratio. The TfpL450 conjugates were separated into four fractions, A-D. After dialysis against HBS [20 mM HEPES (pH 7.4), 150 mM NaC1], conjugate fractions were obtained with overall yields of 80% (TfpL200, containing 39 mg conjugated transferrin) or 64% (TfpL450, containing 20 mg conjugated transferrin). The yields are based on equivalents oftransferrin in the product relative to equivalents ofmercapto groups in the modified polylysine starting material.
[42]
RECEPTOR-MEDIATED TRANSFEROF DNA
627
Conjugation Method 2: Transferrin-Polylysine Conjugate Synthesis through Carbohydrate Modification Conjugation method 2 has been applied to the synthesis of transferrin-polylysine conjugates, 44 for the conjugation of rgpl20 to polylysine (unpublished observations, 1992), and for the conjugation of transferrin to a synthetic protamine analog or to the DNA intercalator ethidium homodimer. 44 However, the method could not be used for the preparation of conalbumin-polylysine conjugates, 36'44 probably due to the absence of sialic acid residues in the conalbumin carbohydrate. 49 A solution of 102 mg (1.28 /xmol) of transferrin (human, iron-free; Sigma) in 3 ml of a 30 mM sodium acetate buffer (pH 5) was subjected to gel filtration on a Sephadex G-25 (Pharmacia) column. This gelfiltration step serves to remove low molecular weight contaminants that interfere with the modification steps. The resulting 3.8-ml solution was cooled to 0° and 80 /zl of a 30 mM sodium acetate buffer (pH 5) containing 4 mg (19/zmol) of sodium periodate was added. The mixture was kept in an ice bath in the dark for 90 min. For removal of the low molecular weight products, a further gel filtration (Sephadex G-25, 30 mM sodium acetate buffer, pH 5) was performed and yielded a solution containing about 82 mg (1.03/xmol) of oxidized transferrin {monitoring: UV absorption at 280 nm and ninhydrin assay; the oxidized form that contains aldehydes in contrast to unmodified transferrin, gives a color reaction on staining with anisaldehyde reagent [a sample is dropped on a silica gel thin-layer plate, dried, immersed into p-anisaldehyde/sulfuric acid/ethanol (1/1/18, v/v/v) and followed by drying and heating]}. The transferrin solution was added to a solution containing 0.50 /zmol of fluorescently labeled poly(L-lysine) with an average chain length of 300 lysine monomers [derived from 34 mg hydrobromide salt (Sigma) after labeling with 130/xg of fluorescein isothiocyanate in sodium bicarbonate buffer (pH 9) for 3 hr and subsequent gel filtration] in 4.5 ml of 100 mM sodium acetate (pH 5) with vigorous mixing at room temperature. The pH of the solution was brought to 7.5 by addition of 1 M sodium bicarbonate after 20 min; to the mixture, four portions of 9.5 mg (150 /xmol) of sodium cyanoborohydride were added at 1-hr intervals. Purification proceeded in the same fashion as described in conjugation method 1: after 18 hr of reduction, 1.9 ml of 5 M sodium chloride was added to bring the solution to an overall salt concentration of about 0.75 M. The reaction mixture was loaded on a cation-exchange column (Pharmacia Mono S HR 10/10) and was fractionated with a sodium chloride gradient from 0.75 to 2.5 M with a constant content of 25 mM 49j. Williams,Biochem.J. 108, 57 (1968).
628
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[42]
HEPES (pH 7.3). Some transferrin protein (about 30%) together with a weak fluorescence activity eluted in the flow-through; the major amount of fluorescent conjugate eluted between 1.35 and 1.9 M salt and was pooled into three fractions. After dialysis twice against 2 liters of 25 mM HEPES (pH 7.3), these yielded (in order of elution) fraction A, containing 19 mg (0.24 /~mol) of transferrin modified with 80 nmol of polylysine; fraction B, containing 27 mg (0.34 /xmol) of transferrin modified with 150 nmol of polylysine; and fraction C, containing 5 mg (62 nmol) of transferrin modified with 80 nmol of polylysine. The overall yield of these conjugates based on transferrin was 50%, based on polylysine (62%).
Storage of Conjugates and Iron Incorporation for Transferrin Ligands Transferrin conjugates, unless used immediately, can be stored after shock-freezing (liquid nitrogen) at - 2 0 ° for up to 12 months in the ironfree form. Before iron incorporation, samples (about 0.5 to 1.5 mg) are brought to physiological salt concentration (150 mM) by the addition of sodium chloride; the iron incorporation is performed by the addition of 4 to 8/zl of 10 mM iron(III)-citrate buffer (containing 200 mM citrate and adjusted to pH 7.8 by sodium bicarbonate addition) per milligram transferrin content. The iron-loaded conjugates are used for DNA complex formationas described (see Conjugate DNA-ComplexFormation). To limit the deterioration of the conjugates that often occurs on several freeze-thaw cycles, the conjugates are divided into convenient small aliquots, shockfrozen, and kept at - 2 0 °. In general, iron-incorporated samples maintain their transfection activity for 2-3 months if repeated freeze-thaw cycles are avoided.
Application of Conjugates Choice of Cells We have tested a variety of cells for their ability to be transfected with transferrin-polycation conjugates. These results are summarized in Table I. The cell types fall into three categories based on the luciferase activity obtained. Luciferase expression appears to be a good general indicator of gene expression. We have tested other parameters of gene transfer such as RNA production by both class II and class III polymerase, generation of/3-galactosidase protein, generation of tat trans-activation with an HIV LTR system, and generation of stable cell lines expressing neomycin phosphotransferase. The values obtained are consistent with luciferase values.
[42]
RECEPTOR-MEDIATED TRANSFEROF DNA
629
TABLE I TRANSFERRINFECTIONWITHVARIOUSCELLTYPES Cell type
Efficiency of transfection"
Cells that work well (> 105 light units/106 cells) Human K562 cells Human Ewing's sarcoma EW-2 cells Chicken HD3 erythroblasts Chicken REV-NPB4 lymphoblasts Cells that work moderately well (5 x 103 to 105 light units/106 cells) Human HeLa cells Human HepG2 cells Human H9 cells Hamster CHO cells Mouse Ehrlich ascites Monkey COS cells Rat H4IIEC3 cells Rat 1A cells Chicken EGFR-myb erythroblasts Chicken normal bone marrow cells Cells that work poorly (<103 light units/106 cells) Human primary lymphocytes Human U937 cells Human Kurkatt cells Human CCRF CEM cells " +, Works only with chloroquine; - , works without or with chloroquine. Also indicated in Table I is the requirement of each cell type for chloroquine (100/zM) during the 4-hr transfection period.
Preparation of Cells, Treatment to Enhance Transferrin Receptor Levels Transfection of Suspension Cultures. In general, exponentially growing suspension cultures are collected by centrifugation and suspended in fresh medium (with or without serum; see below) at one-third to one half of their saturating density. For example, K562 cells are grown in suspension in R P M I 1640 medium [Cat. No. 079-03018P ( G I B C O - - B e t h e s d a Research Laboratories, Gaithersburg, MD), plus 2 g sodium bicarbonate per liter] plus 10% (v/v) fetal calf serum (FCS) 100 units/ml penicillin, 100/zg/ml streptomycin, and 2 m M glutamine, reach a density of 500,000 cells/ml. At 12-20 hr before transfection, the cells are placed in fresh medium containing 50/xM desferrioxamine [D 9533 (Sigma); stock solution is dis-
630
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[42]
solved in water at 100 mM, and stored in aliquots at -20°]. The morning of the transfection, the cells are collected, resuspended in fresh medium containing 10% (v/v) FCS (plus 50 tzM desferrioxamine) at 250,000 cells/ ml, and placed in a 24-well dish at 2 ml/weU. The desferrioxamine pretreatment serves to raise the transferrin receptor levels approximately fivefold, resulting in an increase in DNA delivery.38 With some cell types, such as chicken HD3 cells, exponential growth alone produces high transferrin receptor levels that cannot be further elevated by desferrioxamine treatment. An enhancement of gene delivery is observed in HD3 cells only when stationary cultures are treated with desferrioxamine. This parameter should be evaluated when testing a new cell type. Transfection of Adherent Cells. In general, cells are transfected at 50-60% confluence to ensure that a large proportion of cells are dividing and will continue to divide during the experiment. The cells [e.g., HeLa, Chinese hamster ovary (CHO), HepG2] are plated on day I (300,000-600,000 cells/T-25 flask, having an approximately 25-cm 2 surface area) and transfected on either day 2 or day 3. On the morning of the day of transfection, the cells are placed in 5 ml of fresh medium per T-25 flask. Application of the Transferrin-Polylysine-DNA Complex. Transferrin-polylysine-DNA complexes are prepared as described below. Normally 6-10/zg of DNA is used for a sample of 500,000 K562 cells, or a sample of I million HeLa cells. Just prior to transfection, chloroquine, when required, is added so that the final concentration in the cell suspension plus the DNA solution is I00/xM. [Chloroquine is obtained from Sigma (C-6628); a stock solution of 100 mM water is stored in aliquots at - 2 0 ° in the dark]. Transferrin-polylysine-DNA complex (in 500/zl) is then added for a 4-hr incubation at 37°. The DNA-containing medium is then removed, the cells are washed once with 3 ml warmed medium, and then 10 ml of warmed medium is added to the cells. When chloroquine is not required, the cells are simply incubated in the presence of the DNA complex until harvest (additional medium or serum may be added if necessary). Normally the cells are harvested (see Harvesting Cells, below) 18-48 hr later and processed for the luciferase (or other) assay.
DNA Preparation, Precautions, and Quantitation DNA quality is an important parameter. We normally purify the DNA by two CsCI gradients followed by an RNase and a proteinase K digestion, phenol-chloroform extraction, and ethanol precipitation. Probably the critical parameter is the quantitation of the DNA. The transfection efficiency varies strongly with the DNA: TfpL ratio, therefore errors in DNA quantitation can influence the transfection. RNA can also bind the
[42]
RECEPTOR-MEDIATED TRANSFEROF DNA
631
polylysine and compete for DNA binding, as well as contribute to the absorbance at 260 nm. It seems important to have a reliable DNA quantitation in the absence of RNA for good transfections. Plasmid DNA is isolated from the appropriate bacterial strains using a Triton/lysozyme lysis method. The bacterial pellet from a l-liter overnight culture is suspended in 10 ml of 20% (w/v) sucrose, 50 mM Tris, 10 mM ethylenediaminetetraacetic acid (EDTA), pH 7.5 (solution 1) and placed on ice for 10 min. Then 2.2 ml of freshly made 10-mg/ml lysozyme in solution 1 is added to the sample, and the samples are vortexed and incubated for 10 min on ice. Five milliliters of 0.2 M EDTA, pH 7.0, is added to the sample, and the sample is again vortexed and incubated on ice for 10 min. Ten milliliters of 2% (v/v) Triton X-100, 40 mM Tris, 60 mM EDTA, pH 7.5 is added to the sample; the sample is mixed thoroughly and incubated for 15-30 min on ice. The sample is then centrifuged [45 min, 17,000 rpm, Sorvall (Norwalk, CT) SS-34 rotor, 4°]. To the supernatant (26 ml) is added 28.5 g of CsC1 and 0.5 ml of a 10-mg/ml solution of ethidium bromide and the sample is centrifuged for 16 hr at 49,000 rpm at 20° in a Beckman (Fullerton, CA) VTi50 rotor. The supercoiled plasmid band (the lower band) is removed from the gradient with a syringe and needle, transferred to a VTi65 tube, and centrifuged for 4 hr at 65,000 rpm at 20° in a Beckman VTi65 rotor. The plasmid band is recovered from the tube, extracted with CsCl-saturated 2-propanol until the pink color vanishes, and dialyzed overnight against a 1000-fold excess of 10 mM Tris, 1 mM EDTA, pH 7.4 (TE). The DNA is then recovered by ethanol precipitation, treated with 0.2 mg/ml RNase A (37 °, 30 min) followed by 0.2 mg/ml proteinase K (56°, 30 min). Following a phenol-chloroform and then chloroform extraction, the DNA is again recovered by ethanol precipitation, dissolved in TE, and quantitated by triplicate absorbance readings at 260 nm. An absorbance at 260 nm of 1 is taken to be 0.05 mg/ml. To test the requirement for the CsC1 purification steps, parallel samples of DNA were prepared. One set was carried through both CsC1 gradients, the second set, after bacterial lysis, was purified by two phenol-chloroform and one chloroform extraction, precipitated at room temperature with 0.54 vol 2-propanol (to remove a large portion of the RNA), and then subjected to the RNase A and proteinase K steps (referred to hereafter as quick DNA). Analysis of the DNA samples by gel electrophoresis revealed no detectable differences in DNA quality between the CsCl-purified DNA and the quick DNA. The two sets of DNA samples were then transferrinfected into K562 cells and the subsequent luciferase activity was assayed 20 hr later (Fig. 2; methods described below). We find large differences in the luciferase activity obtained. With the plasmid pRSVL (the Rous sarcoma virus long terminal repeat driving the luciferase gene), the CsC1-
632
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
Plasmid Preparation
[42]
Light Units
pRSVL
Quick
I z/~ 17ezos
pRSVL
.c,
2 I
pCMVL
Quick
3 ~
pCMVL
CsCl
4
2502480 15456605
10 5
10 6
10 7
10 8
FIG. 2. Influence of DNA quality on transferrinfection. Plasmid DNA was prepared using either a quick lysis technique or by two CsCl density gradients as described in text. Aliquots of 6/xg DNA were transferrinfected into 5 x 105 K562 cells (desferrioxamine treated) in the presence of 100/zM chloroquine and harvested for luciferase analysis 20 hr later. The results (plotted as total luciferase light units obtained from each transfected culture) were obtained with either the Rous sarcoma virus LTR-driven luciferase expression plasmid, pRSVL [J. R. de Wet, K. V. Wood, M. DeLuca, D. R. Helinski, and S. Subramani, Mol. Cell. Biol. 7, 725 (1987)], or a plasmid containing luciferase driven by the cytomegalovirus immediate early promoter (pCMVL).
purified DNA gives a 31-fold increase in activity; with pCMVL (the cytomegalovirus promoter driving the luciferase gene) there is a sixfold increase in expression with the CsCI purification.
Conjugate-DNA Complex Formation Formation of DNA Complexes. Because of its cationic properties, the transferrin-polylysine (or the transferrin-protamine) conjugate binds DNA avidly. In band-shift experiments it has been demonstrated that the transferrin-polylysine conjugates (TfpL) band-shift linear or covalently circular DNA without size discrimination. 36 For each TfpL preparation, one can calculate the mass ratios at which the DNA-transferrin-polylysine mixture reaches electroneutrality. Consistent with this calculation one finds nearly complete gel-mobility retardation of the DNA complex as well as optimal DNA expression for a reporter gene at these ratios (see Ref. 36). The formation of complexes of transferrin-polycation with DNA is performed by mixing diluted solutions of DNA (30/~g/ml or less) with the transferrin-polycation conjugates. Normally we dilute the DNA (as a 0.5 to 1.5-mg/ml solution in TE) into HBS, with a resulting volume of 330/zl. The dilution of DNA at room temperature and the absence of phosphate in the buffer are essential to avoid precipitation problems. In a second tube, TfpL is diluted into HBS (final volume, 170/zl). The 170-/xl TfpL
[42]
RECEPTOR-MEDIATED TRANSFEROF DNA
633
sample is then rapidly mixed with the 330-/zl DNA sample to generate the D N A - T f p L complex ready to add to the cells. The optimum weight ratio of TfpL (as transferrin) to DNA is normally determined in titration experiments in which a constant amount of DNA encoding a reporter gene, 6 /zg, is complexed with 12-24 /zg of TfpL and tested for transfection efficiency. Investigations have shown that the polycation-polylysine in the transferrin-polycation conjugates not only serves to attach transferrin to DNA, but also plays a pivotal role in condensing the DNA to toroid-like structures with a diameter of about 80-100 nm, 39 a dimension that resembles the diameter of the coated pits. We have investigated the role of DNA condensation in transferrinfection efficiency in K562 cells using the luciferase gene (pRSVL; size: 6.2 kb) as a reporter gene. We find that although authentic or synthetic protamines conjugated to Tf bind DNA and function in DNA delivery, no condensed toroid structures can be found by inspection in the electron microscope. Consistent with this lack of DNA condensation we find that the gene transfer is down by at least a factor of 10 as compared to the TfpL system. Polylysine by itself condenses DNA to doughnut-like structures, a finding first reported for h DNA by Laemmli, 5° but no DNA transfer is observed in K562 c e l l s . 37'39 The ratio of transferrin to polylysine in the conjugate also influences the efficiency of transferrinfection. After conjugation, fractions with differing transferrin : polylysine ratios can be isolated by chromatography on Pharmacia Mono S columns 39 and their efficiency of transferrinfection tested. Using the luciferase gene as a reporter gene it emerges that conjugation of 1 transferrin per approximately 100 lysine moieties yields optimal compounds for gene transfer experiments.
Conjugate-Free Polycation-DNA Ternary Complexes With conditions that maximize transferrinfection, a calculated 120 transferrin molecules are associated with each 6 kb of plasmid DNA. We have noted that a large fraction, up to 90% of the TfpL, can be replaced by polylysine or the metabolically stable poly(D-lysine) without impeding doughnut formation or transferrinfection. However, if the number of transferrin molecules per doughnut falls below 10-15, targeting of the complexes to the receptors is apparently no longer possible and transferrinfection is abolished. Condensation of the DNA, with various degrees of success, can be brought about by cations such as histones and protamines, but not with spermidine or spermine (at physiological ionic strength). 5o U. K. Laemmli, Proc. Natl. Acad. Sci. U.S.A. 72, 4288 (1975).
634
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[42]
With the exception of histone H4, a strong correlation between DNA condensation and transferrinfection efficiency has been found. 39
Transfection, Troubleshooting, Initial Parameters to Vary The presence or absence of fetal calf serum (FCS) in the transfection medium may have an effect on the transferrinfection efficiency. Depending on a particular batch of FCS (different quality and origin), with K562 cells we sometimes find a higher initial transfection rate (day 1) if we omit serum from the medium during the first 4 hr of transferrinfection. However, cells suffer considerably from this serum-free period in the presence of chloroquine. In contrast, more than 99% of cells stay viable when both FCS and chloroquine are included in the transfection experiments; consequently at a later time point (day 2) the gene expression of the whole culture is higher. There are a number of other parameters that can be varied to improve the transfection efficiency. However, the initial parameters that we test when evaluating a new cell type are the use of 100/zM chloroquine and the presence of serum during the 4-hr DNA exposure. In general we use a human transferrin in our conjugates, so that competition with bovine transferrin (in the fetal calf serum) is generally not a problem when transfecting human cells. However, the competition effect may be stronger when the human transferrin conjugate is used to transfect mouse cells, rat cells, or cells of other species. Although it should not influence the DNA delivery, the promoter used to drive the indicator gene plays an important role. If the promoter driving the indicator gene has weak activity in the cell type being tested, it will obviously influence the resulting gene expression.
Standard Transfection Protocol for K562 Cells K562 cells are prepared for transfection (as described in ReceptorMediated Entry of DNA into Cells, above) at 250,000 cells/ml, and placed in a 24-well dish at 2 ml/well. Six micrograms DNA in 330/zl HBS (150 mM NaC1, 20 mM HEPES, pH 7.3) is mixed with TfpL conjugate (optimum, e.g., 18/zg in the case of TfpL300B) in 170/zl HBS, and after 15 to 30 min at room temperature the mixture is added to K562 cells. Chloroquine is added to the 2-ml cell sample just before adding the 500-/~1 DNA-conjugate sample (I00/zM final concentration; 25/zl of a 10 mM chloroquine solution is added), After a 4-hr incubation at 37°, the cells are washed in prewarmed, fresh medium (no chloroquine) and incubated at 37 °. (Normally this is done by gently removing 90% of the medium and replacing it with fresh medium, followed by a repetition after waiting an hour to let the cells resettle.) An analysis of the optimum time for exposure of K562 cells to
[42]
RECEPTOR-MEDIATED TRANSFEROF DNA Incubation Lime
Light Units 0
2xlO 5 4xlO 5 i
0.5 hour
635
I
L
I
I
6xlO 5 8xl I
i
I
1200
900 1 hour
26000
14400 2 hours
3
9tO00
hours
4 hours
FIG. 3. DNA delivery as a function of the time of exposure to transferrin-potylysin-DNA complexes. Transferrinfection was performed with 6 tzg pRSVL and 5 × 105 K562 cells (desferrioxamine treated) in the presence of 100/zM chloroquine. The cells were exposed to the DNA for the indicated times, washed with flesh medium, and assayed for luciferase activity 20 hr later.
T f p L - D N A complexes in the presence of 100/zM chloroquine is shown in Fig. 3. K562 cells were incubated with 6 tzg pRSVL as a complex with 18 /zg of TfpL, in 100 /zM chloroquine. After the indicated times, the cells were washed into fresh medium lacking chloroquine. The cells were harvested 20 hr later, and extracts were prepared and analyzed for luciferase activity. We find that the highest levels of expression are obtained when the cells are exposed to the DNA complexes for 4 hr (Fig. 3). Subsequent experiments indicate a decline in cell viability after 5 hr (probably due to the toxicity of the chloroquine) so that in general, when chloroquine is required, the incubation time is limited to 4 hr. In cells where chloroquine is not required (chicken HD3, some HeLa lines) the cells can be kept in constant exposure to T f p L - D N A complexes with no apparent change in cell viability.
Haroesting Cells The cells are normally harvested for luciferase assay 16 to 20 hr after transfection (see below and Assays for Transfection Efficiency). However, the timing of harvest is an important variable and should be optimized in initial experiments. In general, harvest at 24-48 hr after transfection gives a good yield of activity.
636
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
. s,rurn[]]
l
~
I06
[42]
l
I
t1[. I 24 hours
48 hours 72 hours
FIG. 4. Luciferase activity as a function of the time of harvest. Transferrinfection was performed with 6/xg pRSVL and 5 × 105 K562 cells (desferrioxamine treated) in the presence of 100/zM chloroquine and in either the presence or absence of 10% (v/v) fetal calf serum. After a 4-hr exposure to DNA, the cells were washed with complete medium and harvested either 24, 48, or 72 hr later. The graph indicates the resulting luciferase activity (in light units).
An analysis of the optimum harvest time for assaying luciferase expression in K562 cells is shown in Fig. 4. K562 cells were transferrinfected with 6/xg of pRSVL in either the presence or absence of 10% (v/v) fetal calf serum. Cells were harvested at various times after transfection, and extracts were made, standardized for protein content, and assayed for luciferase activity (Fig. 4). When transfected in the absence of serum, the yield of luciferase activity peaks at 24 hr and declines by a factor of approximately 10 over the next 72 hr (Fig. 4). The expression pattern obtained when the transfection is performed in the presence of serum is slightly altered, with activity peaking at 48 hr posttransfection (Fig. 4). Note that the plasmid used here, pRSVL has no replication signal. Strikingly different results are obtained when a plasmid with the capacity to replicate, such as an episome, is used [see Fig. 5, fluorescence-activated cell sorting (FACS) analysis].
Assays for Transfection Efficiency Luciferase Assay Suspension Cultures. Transfected cell cultures (2-5 ml, 500,000 to 2 million cells) are transferred to 15-ml conical tubes, harvested by centrifugation (1500 rpm, Heraeus minifuge, Kalkberg, Germany), resuspended in 10 ml of phosphate-buffered saline (PBS), again centrifuged, and the cell pellet is transferred to a 1.5-ml Eppendorf tube with 1 ml of PBS. The cells are centrifuged in the Eppendorf5415 centrifuge (14,000 rpm, 20 sec); the resulting cell pellet is resuspended in 100 ~1 0.25 M Tris, pH 7.5.
[42]
RECEPTOR-MEDIATED TRANSFEROF DNA
637
trol
0
, 200
, ~0
, ~ll
7--, Im 1~0
z~ Oxe 1~ 1~ 1~ 1~ 140Control l A Transfected
o
Fluorescence FIG. 5. FACS analysis to determine the proportion of the transfection population that expresses a transfected lacZ gene. Transferrinfection was performed with desferrioxaminetreated K562 cells using (per 5 × l05 cells) 8 /xg of pNEBO.LTRlacZ [containing the Epstein-Barr virus (EBV) EBNA1 gene and oriP sequence plus the lacZ gene driven by the HIV LTR] and 2/xg pCMVTat (containing the HIV tat gene driven by the CMV immediate early promoter; both plasmids supplied by Genentech). The transferrinfection was performed for 4 hr in RPMI containing 10% (v/v) FCS, 100/xM chloroquine, and 50/~M desferrioxamine. Cells were harvested at (A) 24 hr, (B) 48 hr, and (C) 1 week posttransfection, loaded with the fluorescent/3-galactosidase substrate FDG, and analyzed by FACS.
A d h e r e n t Cultures. The medium is removed from the culture (approximately 2 million cells, T-25 flask) and the cells are washed once with 5 ml of PBS. A l-ml aliquot of PBS is then added to the flask, and the cells are removed from the plastic by gentle scraping with a rubber policeman and transferred to a 15-ml conical centrifuge tube. The flask is washed/scraped
638
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[42]
once tion, after Tris,
more with a 1-ml aliquot of PBS. The cells are collected by centrifugaresuspended in 1 ml of PBS, and transferred to an Eppendorf tube; centrifugation the resulting pellet is resuspended in 100/xl of 0.25 M pH 7.5. Extract Preparation. The cells (suspended in 0.25 M Tris) are subjected to three freeze-thaw cycles (3 min in liquid nitrogen or a dry ice-ethanol bath, 3 min in a 37° heating block). The sample is then centrifuged for 5 min at 15,000 rpm in an Eppendorf 5415 centrifuge and the supernatant (containing the luciferase activity) is carefully removed to a fresh centrifuge tube. Such extracts can be flash frozen with liquid nitrogen and stored at - 20° or used immediately for luciferase activity determination. There are reports in the literature that a Triton lysis method can be used to generate luciferase extracts. 5~ When we have compared the two methods (freeze-thaw versus Triton) we have found no great difference in the yield of extracted luciferase with K562 cells. However, other cell types may show differences in luciferase extractability. Determining Luciferase Activity. The luciferase activity in cell extracts is assayed using a Berthold CliniLumat instrument (LB 9502, Wildbad, Germany) as follows: 1. Prepare an assay buffer: Assay buffer (for 10 ml): 6.85 ml water, 2.5 ml 0. I M glycylglycine (pH 7.8), 0.5 ml 0.1 M ATP, 0.15 ml 1.0 M MgSO 4 This buffer is prepared fresh on the day of assay to avoid deterioration of the ATP. 2. Prepare an injection buffer: Injection buffer (10 ml): 6.0 ml water, 2.0 ml 1 mM luciferin (in water), 2.0 ml 0.1 M glycylglycine (pH 7.8) The ATP is from Boehringer Mannheim (Mannheim, Germany; #519 979, M r 605.2) and a 0.1 M solution is obtained by dissolving 605 mg in I0 ml water. This is stored in aliquots at - 2 0 °. Luciferin is from Sigma (D-luciferin, sodium salt; #L-6882, M r 302.3). A 1 mM solution is prepared by dissolving 10 mg luciferin in 33 ml water. This is stored in aliquots at - 2 0 °. A luciferase enzyme standard is prepared from luciferase (Sigma, # L 5256) dissolved at 1 mg/ml in 0.1 M glycylglycine, pH 7.8, and stored at - 2 0 °. Various dilutions of the enzyme are prepared in 100 mM sodium phosphate (pH 7.5), 10 mM KCI, 1 mM MgCI 2 , 1 mM DTT containing 20 /zg/ml bovine serum albumin (BSA) and are stable at 4° for 1-2 weeks. 51 O. Schwartz, J. Virelizier, L. Montagnier, and U. H a z a n , Gene 88, 197 (1990).
[42]
RECEPTOR-MEDIATED TRANSFEROF DNA
639
The luciferase assay is performed by adding 1-50/~1 of cell extract to 350 txl of assay buffer. The sample is gently mixed (avoid vortexing, which may generate a static charge on the tube) and placed in the CliniLumat instrument. The instrument automatically injects 300 ~1 of the injection buffer into the sample, measures the light emission, and displays an integrated value for the first 30 sec of light production. In general, 1/.d of 1 /zg/ml luciferase gives approximately 10 million light units with these assay conditions. ~-Galactosidase Assay We have tested three different/3-galactosidase assay systems. The in situ assay procedure, using the chromogenic substrate X-Gal, has proved to be an insensitive, unreliable indicator of total cell expression with even clonal lacZ expressing lines staining in a chimeric pattern (see also Ref. 52). Therefore we describe here a solution assay for lacZ activity, useful for determining total population activity, and a FACS assay that is useful for determining what proportion of a transfected population expresses the introduced DNA. Analysis of Cell Extracts. Extracts are prepared as described (see above) and/3-galactosidase activity was assayed as described by Herbomel et al. 53 One milliliter of a solution containing 60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCI, 1 mM MgCI2, and 50 mM 2-mercaptoethanol, and 0.2 ml of o-nitrophenyl-/3-o-galactopyranoside [ONPG (Sigma), 2 mg/ml in 60 mM Na2HPO4, 40 mM NaH2PO4] were added to 30 /zl of cell extract. The mixture was kept at 37° for 20 min to 1 hr, until a yellow shade was obvious (for the extracts with /3-galactosidase activity). The reaction was stopped by adding 0.5 ml of 1 M sodium bicarbonate. /3-Galactosidase activity was determined by measuring the absorbance at 420 nm. Fluorescence-Activated Cell Sorter Analysis. Living cells were loaded with FDG (fluorescein di-/3-o-galactopyranoside) by osmotic shock, diluted in staining medium, and processed by FACScan (Becton Dickinson, Paramus, NJ) as described. 54 Suspension cell cultures (2-5 ml, 1 million cells) are transferred to 15ml conical tubes, harvested by centrifugation (1500 rpm, 10 min, Heraeus minifuge), and resuspended in 100 /~1 of SM buffer [PBS plus I0 mM 52 G. MacGregor, A. Mogg, J. Burke, and C. Caskey, Somatic Cell Mol. Genet. 13, 253 (1987). 53 p. Herbomel, B. Bourachot, and M. Yaniv, Cell 39, 653 (1984). 54 G. P. Nolan, S. Fiering, J. F. Nicolas, and L. A. Herzenberg, Proc. Natl. Acad. Sci. U.S.A. 85, 2603 (1988).
640
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[42]
HEPES (pH 7.3), and 4% (v/v) FCS]. The samples are transferred into FACS tubes and placed in a 37° water bath; I0 min later 100/zl of prewarmed 2 mM FDG [Molecular Probes, Eugene, OR; stock solution of 5 mg FDG in 38 t~l dimethyl sulfoxide (DMSO)/water (1/1, v/v)] in water is added with mixing and the samples are kept at 37° for exactly 1 min. The FDG loading is stopped by adding 2 ml of ice-cold SM buffer, and 2 t~l of propidium iodide (1 mg/ml) is then added. The samples are kept on ice until FACS analysis; analysis is done with a Becton Dickinson FACScan at a fluorescence of 520 nm with live gating. An analysis of the transfection efficiency of K562 cells using this method is shown in Fig. 5. K562 cells were transfected with a plasmid encoding the lacZ gene driven by the HIV LTR mixed with a second plasmid encoding the trans-activator Tat driven by the CMV promoter. This plasmid contains, in addition, the oriP region and the EBNA1 gene, which allow episomal replication of the plasmid. The FACS analysis of these transfected cells indicates a moderate expression of lacZ at 24 hr posttransfection (with 20-30% of the cells expressing detectable levels of the enzyme; Fig. 5A) and high expression (70-100% of the cells) at both 48 hr and 7 days posttransfection (Fig. 5B and C). Note that this experiment was performed in the absence of selection; when the same cell population was assayed at 2 weeks posttransfection the cells displayed only background fluorescence, indicating that either the nonepisomal Tat plasmid or the episomal fl-Gal plasmid (or both) were lost. The FACS analysis also demonstrated that greater than 95% of the transfected cell population was viable at all times after transfection.
Isolation of Stable Transformants The isolation of clones from adherent cultures is performed using standard techniques that need not be described here. The determination and isolation of stable transformants of suspension cultures is performed using a methylcellulose cloning procedure. Two to 3 days after transfecting the cells with DNA containing an appropriate selectable marker (e.g., neomycin phosphotransferase), aliquots of the cells are plated in a semisolid growth medium containing, in addition to their normal requirements, 0.5-1 mg/ml G418 and 20 mg/ml methylcellulose (see the next section). Approximately 14 days later (depending on the cell type) colonies of G418resistant cells can be picked and transferred to suspension culture. The normal cloning efficiency of K652 cells using this procedure, in the absence of selection, is approximately 60-70% (i.e., when 100 cells are plated, 60-70 G418-resistant colonies are obtained). Preparation of Methylcellulose Medium. In a 2-liter Erlenmeyer flask (sterile, preweighed) is placed a sterile magnetic stir bar and 460 ml of
[42]
RECEPTOR-MEDIATED TRANSFEROF DNA
641
sterile water. The water is heated until boiling and then 20 g of methylcellulose (#64630; Fluka, Buchs, Switzerland) is added. The mixture is stirred for an additional 3 min and then cooled to room temperature. Powdered medium, sufficient for 1 liter, is placed in a 500-ml graduated cylinder along with the appropriate quantities of sodium bicarbonate, penicillin/streptomycin, and other components. The pH is checked, the volume is adjusted to 500 ml, and this 2 x medium is filter sterilized. The 2 × medium is then mixed with the cooled methylcellulose solution, the volume is adjusted to 1 liter, and the medium is stirred at 4° overnight. The final medium should not be cloudy. This material is stored in 50-ml aliquots at - 20°. To prepare medium for cloning use, a 50-ml aliquot of the medium is thawed (normally the medium is removed to 37° the night before it is needed), mixed with 10 ml of serum, and the volume adjusted to 100 ml with complete medium lacking serum. The selective agent (e.g., G418) is added at this step. The material is quite viscous and the most efficient method of mixing is multiple inversions of a capped tube (10-15 complete inversions are sufficient for full dispersion of a dye marker). Plating Cells in Methylcellulose. A 2.5-ml aliquot of the methylcellulose medium is placed in a 5-ml disposable culture tube (measurement is by comparison to an identical tube containing a measured 2.5-ml volume). A 50- to 100-/xl aliquot of cells is added to the tube, which is then inverted 15 times to disperse the cells. The contents of the tube are then poured, in two nearly equal aliquots, into 2.5-cm culture dishes, of approximately 1 ml/dish. It is nearly impossible to pour the final 0.5 ml of the viscous mixture, and this value is taken into consideration when aliquoting the cells. The culture dishes are then placed inside a large, 25 x 25 cm culture plate that contains, in addition, several open dishes of sterile water that help maintain the humidity during incubation. The entire assembly is then placed in a 37°/CO2 incubator. The methylcellulose culture does not immediately attain its full viscosity, so it is important that the cultures be allowed to " r e s t " for at least 2 days after plating before they are moved. After that they can be carefully examined at 1- or 2-day intervals. Because of the spatially constrained nature of the cell growth, approximately twofold higher levels of G418 are required compared to suspension cultures. At 2-3 weeks after plating, colonies can be harvested with a normal 20-/zl Pipetman and transferred to suspension culture (normally into 100/xl medium in a 96well dish). With transferrinfection into K562 cells, approximately 0.5-1% of the transfected cells can be obtained as stable colonies. In other words, if 10,000 cells are plated at 3 days posttransfection, 2 weeks later 50-100 colonies are obtained.
642
M E T H O D S FOR T R A N S F O R M I N G A N I M A L A N D P L A N T CELLS
[42]
Concluding Remarks We describe here the methods for preparing and using transferrin-polycation and other ligand-polycation conjugates for receptor-mediated D N A transfer. This method, termed transferrinfection, is particularly effective with cell lines derived from the erythroid lineage (e.g., K562 and HD3 cells), most likely due to the high level of cycling transferrin receptor on these cells. In other established cell lines such as H e L a , CHO, Cos, and HepG2, this m e t h o d works with efficiencies comparable to other transfection techniques. In certain cell types the method works poorly, or not at all. We are currently examining these cells to determine if the problem can be remedied. In the cells where transferrinfection functions well, the method has the following advantages o v e r other transfection methods: 1. The m e t h o d is simple to use, once the ligand-polycation conjugates are obtained. Unlike retroviral methods, this technique does not require the generation of special viral constructs. 2. The method can be used with many D N A molecules. We have transfected D N A molecules from 3.5 to 15 kb with great success. 3. The method works with high efficiency. We can demonstrate that, with K562 cells, 70-100% of the transfected cell population both takes up D N A and transiently expresses a marker gene contained on the DNA. We routinely obtain 0.5-1% stable G418-resistant colony formation when transfecting K562 cells. 4. The m e t h o d is particularly gentle, involving a transferrin-polycation conjugate that the cell binds with nearly the same avidity as unmodified transferrin. FACS analyses of transfected cell populations demonstrate > 9 5 % viability at 24 hr, 48 hr, and 7 days posttransfection. This may partly account for the high efficiencies obtained.
Acknowledgments We thank Martin Zenke, Hartmut Beug, and Peter Steinlein for their contributions to the development of this technique. We are especially grateful to Peter Steinlein for help with the FACS analysis. We thank Fran~oise L/ingle-Rouaultand Thomas yon Ruden for their advice on methyicellulosecloning. We appreciate the technical assistance of Helen Kirlappos, Karin Kos, and Karl Mechtler. Note added in proof." Since submission of this paper there have been major developments in our understanding of the molecular mechanisms and in the procedures of transferrinfection. It is now suggested that the degree of gene transfer into cells is critically dependent on the liberation, and exit into the cytoplasm, of DNA molecules trapped in the endosomal compartment. The exceptional efficiency of gene transfer in K562 cells is
[42]
RECEPTOR-MEDIATED TRANSFER OF D N A
643
suggested to result from the extremely low endosomal pH in these cells which in turn is caused by a lesion in the Na +, K+-ATP regulation of endosomal acidification) In these endosomes, the weak base chloroquine is thought to accumulate to such an extent that it becomes osmotically active leading to disruption of the endosome and liberation of DNA into the cytoplasm. ~ Adenoviruses escape destruction in the lysosomal compartment because they have developed molecular skills to disrupt the endosome and to gain access to the cytoplasm through which they reach the nuclear compartment. Addition of adenovirus to the DNApolylysine-transferrin conjugates presumably leads to co-localization of both compounds in the endosome and this results in an at least 1000-fold stimulation of gene transfer and expression in HeLa cells 2 which are relatively poor candidates for the classical transferrinfection even in presence of chloroquine. Most cell lines tested respond to the addition of adenovirus, as long as they contain cell surface receptors for both the virus and for the transferrin. Where adenovirus receptors are lacking, cells can still be transfected at very high levels after chemical coupling of the adenovirus with the polylysine. Such coupling can be brought about either by reacting the adenovirus with polylysine in the presence of transglutaminase or by biotinylation of the virus and streptavidinylation of the polylysine. ~.3 DNA is then added to the adenovirus-polylysine conjugate and reacted (condensed) by addition of polylysine-transferrin conjugate. In this way ternary complexes arise in which the DNA becomes ionically linked to both adenovirus-polylysine and transferrin-polylysine. These conjugates have a very high capacity for transfering DNA into cells even at low concentration) In this composition DNA is transferred into the ceils either via the transferrin or the adenovirus receptor thus extending the application of the technique to a great many cell types. An alternative linkage protocol is to prepare polylysine linked to an antibody directed against the adenovirus. 4 Since in all of these ternary viral-DNApolylysine complexes the transfected DNA is on the outside of the adenovirus, very large gene constructs can be transfected. 4'5 Even where the replication deficient adenovirus d1312 is employed, the use of this virus in human or murine cells leads to a noticeable toxicity 5 which can be recognized by cells rounding off and detaching from the petri dish surface. This is the reason for our lack of success in recording high levels of stably transformed cells using the adenovirus supported transfection procedure. Toxicity can be abolished in one of several ways. First, Ad5 d1312 can be replaced by the chicken CELO adenovirus which is as endosomolytic as Ad5 (unpublished results). Second, it is possible to UV or psoralen inactivate the adenovirus genome. 5 Such inactivated viruses are active in gene transfer and represent a considerable safety feature for biological (and medical) application. Third, endosomolytic synthetic peptides gleaned off the influenza virus
r E. Wagner, K. Zatloukai, M. Cotten, H. Kirlappos, K. Mechtler, D, T. Curiel, and M. L. Birnstiel, Proc. Natl. Acad. Sci. U.S.A. 89, 6099-6103 (1992). 2 D. T. Curiel, S. Agarwal, E. Wagner, and M. Cotten, Proc. Natl. Acad. Sci. U.S.A. 88, 8850-8854 (1991). 3 K. Zatloukal, E. Wagner, M. Cotten, St. Phillips, Ch. Plank, P. Steinlein, D. Curiel, and M. L. Birnstiel, Annals o f the New York Academy o f Sciences (1992), in press. 4 D. T. Curiel, E. Wagner, M. Cotten, M. L. Birnstiel, Ch. Li, St. Loechel, S. Agarwal, and P. Hu, Human Gene Therapy 3, 147-154 (1992). 5 M. Cotten, E. Wagner, K. Zatloukal, St. Philipps, D. T. Curiel and M. L. Birnstiel, Proc. Natl. Acad. Sci. U.S.A. 89, 6094-6098 (1992).
644
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[43]
hemagglutinin can be incorporated into DNA-polylysine-transferrin complexes.6 Such complexes represent virus-free, but virus-like entry vehicles, which work at high efficiency in gene transfer in a number of cells tested in our laboratory, although the efficiency of these vectors is not as yet as high as that obtained with complete adenovirus. 6 E. Wagner, Ch. Plank, K. Zatloukal, M. Cotten and M. L. Birnstiel, Proc. Natl. Acad. Sci. U.S.A. 89, 7934-7938 (1992).
[43] C a t i o n i c L i p o s o m e - M e d i a t e d
RNA Transfection
By V. J. DWARKI, ROBERT W. MALONE, and INDEg M. VEgMA Introduction A major interest in modern biology is understanding the function of genes. There are two ways to achieve this: one requires "knocking out" the function of the gene from the cell and the other involves introduction of the gene into the cell. While rapid advances are being made to debilitate the gene selectively in its own chromosomal milieu by homologous recombination, much of our knowledge of eukaryotic gene regulation has been due to its ability to introduce the foreign genetic material into cells. A wide variety of methods are available to introduce genetic material into cells. These include simple manipulations such as mixing high molecular weight DNA with calcium phosphate, DEAE-dextran, polylysine, or polyornithine. Other methods involve microinjection, electroporation, protoplast fusion, liposomes, reconstituted viral envelopes, and viral vectors. In nearly all cases DNA has been introduced into cells because of its inherent stability and eventual integration in the host genome. Progress in the field o f R N A transfection has been slow and restricted to a few cases. 1-4 Inability to obtain sufficient amounts of intact RNA and its rapid degradation have been a major impediment in the past. The limitation of obtaining sufficient quantities of RNA can now be alleviated by synthesizing large amounts of RNA in vitro, using bacteriophage RNA polymerases. 5 The development of a reliable method to introduce RNAs into cells I B. Flanegan, R. F. Pettersen, V. Ambros, M. J. Hewlett, and D. Baltimore, Proc. Natl. Acad. Sci. U.S.A. 74, 961 (1977). 2 p. Alquist, R. French, M. Janda, and L. S. Loesch-Fries, Proc. Natl. Acad. Sci, U.S.A. 81, 7066 (1984). 3 S. van der Werf, J. Bradley, E. Wimmer, F. W. Studier, and J. J. Dunn, Proc. Natl. Acad. Sci. U.S.A. 83, 2330 (1986). 4 S. Mizutani and R. J. Colonno, J. Virol. 56, 628 (1985). 5 F. W. Studier and B. A. Moffatt, J. Mol. Biol. 189, 113 (1986).
METHODS IN ENZYMOLOGY,VOL. 217
Copyright© 1993by AcademicPress, Inc. All rightsof reproductionin any formreserved.
[43]
RNA LIPOFECTION
645
efficiently will allow the study of eukaryotic regulatory factors influencing both the translational efficiency and the stability of eukaryotic mRNAs. It will also offer the opportunity to use RNA directly for therapeutic purposes, mRNA transfection is inherently more attractive than DNA transfection for gene expression because it bypasses the complex issues of transcriptional regulation and requires only that the polynucleotide reach the cytoplasm and be translated. Cationic liposomes have been used to introduce both DNA and RNA into cells with considerable s u c c e s s . 6-1° This technique is highly reproducible for expressing exogenous proteins in a wide range of cultured cells, whole organs and, with minor modifications, this technology can also be adapted for expression of protein in embryos. N The basic rationale for using cationic lipids as carriers of nucleic acids has emerged from the realization that cells growing in culture have a net negative charge. Therefore, positively charged lipid vesicles containing high molecular weight macromolecules would be expected to interact spontaneously with these surfaces and deliver their payload. The prototype of this approach consists of polycationic liposomes composed of novel, positively charged lipid, DOTMA {N-[1-(2,3-dioleyloxy)propyl]N,N,N-trimethylammonium}, 12that can form liposomes that interact spontaneously with nucleic acids. Below we describe an experimental protocol by which, using cationic lipids, in vitro-synthesized RNAs are introduced into cells. We have used luciferase RNA as the reporter to study various parameters of this technique. RNA Synthesis T7 RNA polymerase transcription templates, as well as various mRNAs produced from them, are outlined in Fig. 1. Xenopus laevis/3globin sequences were derived from the plasmid pSP64 T, 13 with the/3globin 5' sequences obtained as the HindIII/BglII fragment and the/3globin 3' sequences obtained as the BglII/EcoRI fragment. These 3' sequences include a terminal polynucleotide tract of A23C30. The Photinus P. L. Feigner, T. R. Gadek, M. Holm, R. Roman, H. W. Chan, M. Wenz, J. P. Northrop. G. M. Ringold, and M. Danielsen, Proc. Natl. Acad. Sci. U.S.A. 84, 7413 (1987). 7 R. W. Malone, P. L. Feigner, and I. M. Verma, Proc. Natl. Acad. Sei. U.S.A. 86, 6077 (1989). 8 B. Weiss, H. Nitschko, I. Ghattas, R. Wright, and S. Schlesinger, J. Virol. 63, 5310 (1989). 9 p. L. Feigner and G. M. Ringold, Nature (London) 337, 387 (1989). i0 R. W. Malone, Focus U , 4 (1989). tt C. E. Holt, N. Garlick, and E. Cornel, Neuron 4, 203 (1990). 12 p. L. Feigner, Adv. Drug. Del. Rev. 5, 163 (1990). 13 p. A. Kreig and D. A. Melton, Nucleic Acids Res. 12, 7057 (1984).
646
[43]
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
~
<,: I
<-I
~1
N
0
<1
J
I
a>
"
a:).. 2
<<=_ -/oi; I
~°
~
-=I
D
/
o
I.,
0
°°
~a <'~ Z.~
~
_
N
~"
±
fl
I ~ 'i o. ~<,
vvJ.
~L
C
"N C
~~ ~
.
~~"~
[43]
RNA LIPOFECTION
647
pyralis luciferase sequences were obtained as the HindlII/BamHI fragment of pJD206,14 and they include 22 bases of luciferase cDNA sequence preceding the open reading frame, as well as 45 bases of cDNA sequence downstream of the termination codon, but they are devoid of the luciferase polyadenylation signal. The 30-nucleotide poly(A) tail of the plasmid Luc An was obtained from pSP64 An. All transcripts were generated from the T7 R N A polymerase promoter. DNA templates were linearized downstream of the sequences to be transcribed using a fivefold excess of the appropriate restriction endonuclease. The digests were extracted two times with phenol-chloroform and two times with chloroform, followed by precipitation with 0.3 M sodium acetate and 2 vol of ethanol. The DNA was then dissolved at approximately 1 mg/ml in diethyl pyrocarbonate (DEPC)-treated water, and the ratio of absorbance at 260 and 280 nm was determined. Preparations with a ratio of less than 1.7 were found to give reduced quality and yield of RNA transcripts in many cases. The capped RNAs were transcribed from a linearized plasmid DNA in the reaction mixture containing 40 mM TrisHCI at pH 8.0, 8 mM MgCI2,5 mM dithiothreitol (DTT), 4 mM spermidine, 1 mM ATP, 1 mM UTP, 1 mM CTP, 0.5 mM GTP, 0.5 mM mVG(5')ppp(5')G (New England BioLabs, Beverly, MA), T7 RNA polymerase (New England Biolabs, Beverly, MA), at 4000 units/ml, RNasin (Pharmacia, Piscataway, NJ) at 2000 units/ml, and linearized DNA template at 0.5 mg/ml for 60 rain at 37°. The transcription reaction mixture was treated with RQ1 DNase (2 units//xg of template; Pharmacia) for 15 rain at 37° and, after extraction with phenol-chloroform, the samples were precipitated with ethanol-sodium acetate, dissolved in DEPC-treated water, and purified over a Sephadex G-50 spin column. Sample purity was evaluated using the A26o/A28o ratio (typically between 2.0 and 2.1), and degradation was assessed by electrophoresis in a 1% (w/v) agarose minigel containing 0.25 /zg of ethidium bromide per milliliter agarose. Uncapped samples were prepared in a similar fashion, except the m7G(5')ppp(5')G was omitted and the GTP concentration was raised to 1 mM. Radioactive RNA was prepared without capping as described above by adding 4 txCi (1 Ci = 37 GBq) of [32p]UTP per microgram of template DNA. In general, RNA transcripts were prepared in bulk, using reactions yielding 0.1-1 mg of purified RNA. RNA Transfection DOTMA was incorporated into liposomes with dioleylphosphatidylethanolamine (DOPE) as described by Feigner and colleagues. 6 The formulat4 j. R. de Wet, K, V. Wood, M. DeLuca, D. R. Helinski, and S. Subramani, Mol. Cell. Biol. 7, 725 (1987).
648
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[43]
tion of D O T M A - D O P E is available from Bethesda Research Laboratories (Gaithersburg, MD) under the trade name of Lipofectin reagent. Plates (10 cm) of rapidly dividing adherent cells near confluence or 1 x 10 7 suspension cells were transfected as follows. Cells were washed once with OptiMEMI reduced serum medium (Cibco, Gaithesburg, MD) then returned to the incubator and covered with the medium during the preparation of the liposome-polynucleotide complexes. Aliquots (4 ml) of Opti-MEM I medium were placed in 12 x 75 mm polystyrene snap-cap tubes, and 50 /~g of lipofectin reagent was added. A mixture of capped mRNA and uncapped carrier RNA (transcribed from EcoRV-linearized plBI 31) was then added to the media-lipid mixture for a total of 20 /zg of RNA. The mixture was immediately vortexed, and the Opti-MEM-lipid-RNA mixture was added. Cells were returned to the incubator for the desired period before harvesting. After lipofection for the indicated amount of time, cells were washed two times in 1 ml of 0.1 M potassium phosphate (pH 7.8), I mM DTT (lysis buffer) and scraped off the plate or otherwise resuspended in 1 ml of lysis buffer and placed in a microcentrifuge tube. Cells were centrifuged at 4 ° for 5 min at 16,000 g. Cell pellets were resuspended in 100/zl oflysis buffer, frozen in liquid nitrogen, and thawed at 37°. Three such freeze-thaw cycles were used to lyse the cells, after which the debris was pelleted as above and the supernatant harvested and frozen at - 2 ° until assayed. Total protein concentration of the lysates was determined by the method of Bradford and 30/zg of total protein assayed for luciferase activity. Luciferase assays were performed using a Monolight 2001 luminometer (Analytical Luminescence Laboratory, San Diego, CA) with automatic injection of substrate and integration of counts over a 30-sec interval. Mock transfections were performed with carrier RNA, lipofectin, and Opti-MEMI and were analyzed in parallel with corresponding experimental samples. Results are expressed as the difference of experimental and mock-transfected cell light emission specific activity (60-sec light emission counts/30/zg of total extract protein). Optimization of Transfection: Lipofectin: RNA Ratio Because loading cells with DOTMA, a positively charged lipid, is associated with cytotoxicity, ~5 optimization of the lipofectin : RNA ratio was performed for N I H 3T3 cells by varying the amount oflipofectin used to transfect 20/zg of RNA (15/xg of carrier plus 5/xg of capped fig Luc fig An runoff mRNA; see Fig. 1) and assayed for luciferase-specific activity 15 G. W. Both, Y. Furuichi, S. M u t h u k r i s h e n e n , and A. J. Shatkin, J. Mol. Biol. 104, 637 (1976).
[43]
RNA LIPOFECTION
649
80 C'3 Q
60 tO
t._o ¢0 .~_ E ¢,,,.
40
2O
._~ O
c
0
1o
25
50
1oo
micrograms Lipofectin
FIG. 2. Transfection efficiency varies with the ratio of RNA to lipofectin. Subconfluent 10-cm plates of NIH 3T3 cells were transfected with 20/zg of RNA (5/zg of Cap-/3g Luc/3g An plus 15 tzg of carrier) complexed with various quantities of lipofectin liposomes. Thirty micrograms of total cellular lysate protein from each transfection was then analyzed for luciferase light emission with integration over a 30-sec counting interval. Data shown represent the average specific activity of two transfections after correction for background.
after 8 hr of transfection. The results shown in Fig. 2 indicate that the specific activity of luciferase protein is optimized at 50/zg of lipofectin under these conditions. This ratio (2.5/xg of lipofectin to 1 txg of RNA) appears to be most efficient in our hands. H o w e v e r , a more careful analysis of the optimization of transfection by D O T M A is needed. Kinetics of m R N A Transfection To investigate the relationship between the quantity of m R N A transfected and the resulting protein translation, a total of 20 ~g of R N A containing various amounts of Cap-fig Luc fig An m R N A was used to transfect N I H 3T3 cells. After transfection for 8 hr, a linear relationship was observed between the specific activity of luciferase (within twofold experimental variation) and the quantity of transfected m R N A (Fig. 3). It is worth noting that the assay is sensitive enough to detect protein synthesized after transfection of as little as 10 ng of RNA. In contrast, cells transfected with R N A containing 20 t~g of Cap-/3g Luc/3g An m R N A by using the D E A E - d e x t r a n procedure for 8 hr showed barely detectable levels of luciferase activity (0.01 pg of luciferase corn-
650
METHODS
FOR
TRANSFORMING
ANIMAL
AND
PLANT
CELLS
[43]
200
3 ' O
2
[]
cO t-
[]
8 .o_ ._.
= 101,
e-
0
=r-
'
1 I
'
2 I
3 4 mRNA(p,g) "
I
'
I
'
5 I
'
6
FIG. 3. Kinetics ofmRNA transfection. Subconfluent 10-cmdishes of NIH 3T3 cells were transfected with various quantities of mRNA (Cap-BgLuc Bg An) with the addition of carrier RNA to a total of 20 ~g/transfection under the standard conditions. Lysates were prepared 8 hr after addition of RNA-lipofectin complex to cells and analyzed for luciferase specific activity as described. Inset: Data near the origin shown with expanded scales. All transfections were performed in duplicate as shown. pared to 122 pg o f luciferase with RNA-lipofectin). Our conservative estimate is that the R N A - l i p o f e c t i n procedure is at least 100- to 1000fold more efficient than the conventional D E A E - d e x t r a n method of R N A transfection. If cells are transfected with the same m R N A in the absence of carrier an initial lag phase o f about 30 min after transfection is observed. The synthesis of luciferase protein increases with time and is linear for about 240 min. 7 Addition of carrier R N A enhances protein production following R N A transfection, presumably by competing with the m R N A for cytoplasmic RNase activity. Efficiency of RNA Transfection To determine how efficiently the D O T M A - R N A complex associates with cells, labeled R N A was prepared without capping or polyadenylation from EcoRV-linearized pIBI 31 (2 x 105 cpm//zg of RNA). About 106 cpm was transfected into N I H 3T3 cells and analyzed for association with the cells. Results summarized in Table I indicate that within 1 hr at least 60% o f the labeled R N A was tightly associated with cells, and at least 20-30% o f the radioactive material was RNase resistant. Moreover, this association appears to be v e r y rapid, consistent with an ionic interaction between cell membrane and the D O T M A / R N A complex.
[43]
RNA LIPOFECTION
651
TABLE I EFFICIENCY OF RNA TRANSFECTIONa
Time after transfection (hr)
RNA adherent to cells (%)
RNase-resistant RNA (%)
0 1.0 2.0 5.0 8.2 9.0 15
-71 75 60 ND 57 ND
3.5 32 18 ND 23 ND 37
a NIH 3T3 cells were transfected with 5 fig of 32p_ radiolabeled RNA for the indicated period of time, and then the fraction of 32p that was tightly cell associated (adherent) or refractory to RNase release (RNase resistant) was determined. The 0 time point indicates the treatment of lipofectin-RNA complex with RNase before addition to the cells. ND, Not determined.
RNA Transfection in Various Cell Types To extend the utility of RNA transfection by lipofectin, a wide variety of cell types were transfected with 20/zg of Cap-/3g Luc/3g An RNA and 50/zg of lipofectin in 4 ml of Opti-MEM (optimal for NIH 3T3 cells; see Fig. 2) and incubated for 8 hr. Figure 4 shows that nearly all cell types exhibited luciferase activity. The various efficiencies of RNA transfection in different cell types could be due to differential transfectability, suboptimal lipofectin : RNA ratios, translational efficiency, or stability of mRNA. It is recommended that investigators optimize the conditions for the specific cell types and the nucleic acids. Although this chapter deals with the lipofection procedure as used in cultured cells, several investigators have attempted to inject DNA mixed with lipofectin directly into embryos and organs. Expression of the reporter plasmid chloramphenicol acetyltransferase (cat) gene was obtained for up to 6 days in lungs if mice were injected intravenously or intratracheally with 15 to 30/zg ofpSV2cat plasmid complexed with lipofectin, t6 Direct injection of cat and luciferase DNA and RNA in X. laevis embryos also resulted in CAT activity, only in the presence of DOTMA. ~° 16 K. L. Brigham, B. Meyrick, B. Christman, M. Magnuson, G. King, and L. C. Berry, Jr., A m . J. Med. Sci. 298, 278 (1989).
652
M E T H O D S FOR T R A N S F O R M I N G A N I M A L A N D P L A N T CELLS
[43]
10 8
10 7 ¢0 0
._o .on •E
10 6
105
.C::
._~
¢n
0 ¢.D
104
10 3
cell line
FIG. 4. RNA transfection in a variety of cell types. Fifty micrograms of lipofectin liposomes was used to transfect various cell lines either with ( + ) or without ( - ) 20/xgof mRNA (Cap-fig Luc fig An). Lysates were prepared 8 hr after addition of lipofectin and were analyzed for luciferase specific activity as before.
Example of Utility of Lipofection The R N A transfection technique can be used to investigate various parameters influencing the translational efficiency of mRNAs by directly transfecting m R N A transcripts generated in vitro from DNA constructs containing specific sequences (Fig. 1). About 0.2, I, 2.5, or 5 p~g of each m R N A (shown in Fig. 1) was transfected in a total of 20 tzg of RNA (with appropriate amounts of carrier RNA) into NIH 3T3 cells for 8 hr under the optimal conditions and analyzed for luciferase specific activity. Figure 5 shows that maximal protein synthesis was obtained with the m R N A transcript that contains the cap and both the 5'- and 3'-untranslated regions of/~-globin. Results obtained with all six transcripts were analyzed by linear regression and tabulated. The data indicate that the capped m R N A is nearly 40-fold more efficiently translated than the uncapped identical mRNA. The data in Fig. 5 also show that the 5'-untranslated region of/3globin m R N A imparts a nearly ninefold greater translational efficiency. Finally, the presence of a/3-globin 3'-untranslated region plus an A23C30 polynucleotide tract confers at least a sixfold advantage over the transcripts containing only a poly(A) stretch of 30 residues. As a control for the integrity of the T7 polymerase-transcribed mRNAs,
[43]
RNA LIPOFECTION
653
250 200
8 g
~
150
o
lOO so
o
0
1
2
3
4
5
6
m R N A (lag)
FIG. 5. Comparison of mRNA translations. The various RNA preparations seen in Fig. 1 were transfected into NIH 3T3 cells and analyzed for luciferase-specific activity 8 hr after RNA/liposome complex addition. A total of 20 tzg of RNA was used for each transfection, and the specific activity is indicated as a function of the mass of mRNA transfected. Regression lines were plotted by using the Cricket graph software package (Cricket Software, Malvern, PA). (3, Cap-13gLuc/3g An; ~1,,/3gLuc/3g An; II, Cap-Luc/~g An; <>, Luc/3g An; O, Cap-Luc An; Z], Luc An.
we p e r f o r m e d in vitro translation in rabbit reticulocyte extracts. W h e n the m R N A transcripts used for transfection were translated in vitro in a rabbit reticulocyte cell extract, they w e r e all translated efficiently (within twoto threefold) regardless of the p r e s e n c e of the cap or 5'- for 3'-untranslated sequences. 7 Thus the properties of R N A in vivo are quite different from those manifested in in vitro assays. H o w e v e r , the amount of luciferase synthesized in an in vitro translation s y s t e m is at least 1000-fold greater (e.g., 7 ng in reticulocyte lysates per 2/zg of template as c o m p a r e d to 7.7 pg for 2 / z g of transfected m R N A ) than w h e n using R N A - l i p o f e c t i n . Concluding R e m a r k s We report the d e v e l o p m e n t of a high-efficiency R N A transfection syst e m using D O T M A - c o n t a i n i n g liposomes (lipofectin), which was previously used to transfect D N A into cells. 6 The procedure is simple, reliable, and at least 100- to 1000-fold m o r e efficient than the presently
654
METHODS FOR TRANSFORMING ANIMAL AND PLANT CELLS
[43]
available DEAE-dextran method. 1-4 Furthermore, we show that the translation of in vitro synthesized mRNA in NIH 3T3 cells continues for at least 5 hr. 6 It is thus feasible to study the parameters of translation machinery by direct RNA transfection, rather than by introducing DNA constructs. Using this method, we find that 70% of the transfected RNA is associated with the cells, and a large fraction of this RNA is taken up into the cells as judged by RNase resistance (Table I). In many instances, transient expression of an exogenous protein may be all that is necessary to answer the question at hand. In these cases, it may be worthwhile for the researcher to consider the mRNA transfection approach because of the relative efficiency of the system. A particular attractive feature of the RNA-lipofectin procedure is the ability to transfect a wide variety of cell types. For example, conventional DNA transfection protocols have generally resulted in rather low levels of expression in hematopoietic cell lines such as U937, but the procedure described here using RNA is efficient (Fig. 4). Furthermore, RNA can be transfected into human, mouse, rat, Xenopus, and Drosophila cells, thus enlarging the scope of this method. It has also been shown that Sindbis virion RNA and in vitro-transcribed infectious RNA have been transfected using cationic lipids, resulting in active virus particles. 8 However, one limitation of the lipofectin procedure is the toxicity associated with the positively charged lipids. For this reason it is prudent to establish the optimal RNA : lipofectin ratio for the desired cell type. The RNA-lipofectin procedure can also be used to study the effect of various sequence elements on mRNA stability. The technology developed here may eventually be extended to introduce antisense RNA into cells, including modified oligonucleotides containing methyl phosphonate or thiolated nucleotides, particularly to study the role of protooncogenes such as fos or myc, transcripts which have a short half-life of 30-60 rain. The RNA-lipofectin method can be used to introduce RNA directly into whole tissues and embryos, 1°'11 raising the possibility that liposome-mediated mRNA transfection might offer yet another option in the growing technology of eukaryotic gene delivery, one based on the concept of using RNA as a drug.
AUTHOR
INDEX
655
AUTHORINDEX Numbers in parentheses are footnote reference numbers and indicate that an author's work is referred to although the name is not cited in the text.
A Abate, C., 277 Abelson, J., 173 Abidi, 432, 435(5), 436(5) Abraham, N., 597 Aburatni, H., 294 Acheson, R. M., 414 Acsadi, G., 619 Adachi, T., 24, 25(6), 27 Adam, M. A., 582, 595,596 Adam, W., 400 Adams, C., 512 Adams, S. P., 67 Adams, T. R., 484, 488(14), 494(14), 497(14) Adams, W. R., Jr., 484, 488(14), 494(14), 497(14) Adesnik, M., 219 Agard, D. A., 412 Agarwal, S., 643 Ahn, B.-Y., 559 Ahn, M.-H., 77 Aiba, S., 23 Akhavan, H., 399 Akiyama, K., 430, 444 Alakhov, Y. B., 123, 128(9), 131(9), 142 Albers, M. W., 88 Alberts, B., 457 Albertson, D. G., 379, 391 Albrecht, H. O., 399 Alexander, W. A., 49 Allan, R., 204 Allen, N., 483,485(1), 510, 511(3), 520(3) Allet, B., 5 Alquist, P., 644 Ambros, V., 644 Ames, G. F.-L., 437, 440(5, 6), 441(5), 442(5), 443(3, 5, 6), 445(5) Amman, E., 82, 91(19)
Anand, R., 380 Anders, R. F., 558 Anderson, C. W., 123, 127(7) Anderson, J., 484 Anderson, L. E., 253 Anderson, R. G. W., 619 Anderson, W. E., 126 Anderson, W. F., 582, 595 Anderson, W. R., 37, 39(17) Andreasen, P. A., 325 Andrew, M. E., 557, 563 Ansardi, D., 557 Anson, J. G., 21 Anthony-Cahill, S. J., 142 Antoniou, M., 623 Anziano, P. Q., 485,494(36) Appel, J. D., 619 Arias Encarnacion, L. A., 400 Armaleo, D., 484, 494(29), 497(29), 498(29), 500(29) Armentano, D., 582 Armstrong, C., 484, 497(13) Armstrong, G., 414 Anaheim, N., 79, 99, 103, 173,218,436 Arnold, W., 64 Arrand, J. R., 572 Aruffo, A., 233,379 AshweU, G., 36, 39(11), 44(11) Ashworth, L. K., 430 Assa-Munt, N., 414 Astumian, R. D., 465,477(29) Auerswald, E.-A., 314 Auperin, D. D., 557 Ausubel, F. M., 3,473 Avaron, B., 190 Aviv, H., 450 Awerswald, W. A., 497 Axel, R., 620 Azubaalis, D. A., 303 Azuma, C., 152
656
AUTHOR INDEX /3
Baccanari, D. P., 136 Bachman, B., 6 Backendorf, C., 48 Bagnis, C., 585, 587(18) Baker, B., 497, 500(52) Baker, C. H., 101 Baldari, L., 368 Baldauf, S. L., 516 Baldick, J. L., 537 Balk, S. P., 379 Baltimore, D., 37, 582, 585(3), 586(3), 587(3), 644 Banapour, B., 598 Banerjee, A. K., 143 Bank, A., 585, 587(20, 21) Baranov, V. I., 123, 128(9), 131(9), 132, 133 Barbas, C. F., 231,232, 257(12) Barbet, J., 414 Barlow, D. P., 359, 377(3) Barnes, M. H., 101 Barnett, R. S., 242 Baroli, I. M., 512 Barrett, N., 577, 581(72) Barrett, R. W., 228, 231,233(5), 245(5) Barthel, F., 609 Bartholomeusz, A., 10 Bartholomew, R. M., 598 Baseler, M. W., 620 Bass, S., 231,232, 248(11), 256(11) Bateman, J. F., 287, 293 Batt, C. A., 174, 281,282(5), 285 Bauer, C. E., 513,515(52, 53), 530(52, 53) Bauer, S. P., 557 Beacham, I. R., 336 Bear, D. G., 81, 82(11) Beaucage, S. L., 197 Beaudet, A. L., 113 Beck, E., 314, 497 Becker, D. M., 302, 475,479 Beckwith, J. R., 12 Beckwith, J., 321 Bedbrook, J. R., 71 Bedouelle, H., 174, 204, 258, 259(2), 261, 262(2) Beechey, R. B., 10 Beeson, J., 559 Begg, J. D., 432 Behr, J.-P., 600,602, 609, 612(3), 615(3), 619
Belakebi, M., 585, 587(18) Belefant, H., 501 Belkin, S., 97 Bellini, A. V., 173 Belt, P. B. G. M., 48 Bender, M. A., 582, 597 Benfey, P. N., 67 Benkovic, S. J., 231,232, 257(12) Benkovic, S., 219 Benne, R., 126 Bennoun, P., 510, 514, 515(68, 69, 70) Bentley, D. R., 287 Benventre, P. F., 620 Benz, P., 625 Berber, J., 414 Berchtold, M. W., 103, 105, 113, 118(18), 120 Berchtold, M., 103 Berent, S. L., 345, 346(10) Berg, C. M., 321 Berg, D. E., 314, 315, 321 Berg, P., 61, 78,466, 479 Berger, M. C., 103 Berger, R., 403 Berger, S. L., 157 Berglund, D. L., 462 Bergstedt-Lundquist, S., 152 Berhtold, M. W., 103 Berk, A. J., 446 Berkhout, B., 277 Berman, M. L., 233 Berman, P., 620, 625 Bernard, H.-U., 4 Bernard, J., 557 Bernard, O., 403 Berninger, M., 182 Berns, K. I., 558 Bernstein, K. E., 49 Berrettini, M., 326 Berry, L. C., Jr., 651 Bertholet, C., 558, 559(24), 563(24) Bertino, J. R., 462 Bertling, W., 462, 463(15) Besnard, F., 77 Betlach, M. C., 302 Beug, H., 620, 621(37), 622(37, 38), 624(36), 625(36), 627(36), 632(36), 633(36) Bevan, M. W., 497 Bevan, M., 66 Bhave, N., 210
AUTHOR INDEX Biggin, M. D., 411 Bilsland, C. A. G., 378, 379 Bingham, S. E., 512, 513,515(43) Bird, A. P., 376 Birkenmeier, C. S., 157 Birnboim, H. C., 19, 27, 126, 338 Birnstiel, M. L., 620, 621,622(37, 38), 624, 625(36, 39), 627(36, 44), 632(36), 633(36, 39), 643,644 Bissell, M. J., 585,587(14) Bittner, M. L., 67 Blacklow, S. C., 190 Blanck, G., 173 Blanden, R. V., 557 Bleicher, P. A., 379 31in, N., 399 Bloch, W., 79, 96(7), 98(7) Blochlinger, K., 61 Bloom, K., 311 Blowers, A. D., 485,494(35), 498(35), 512, 523, 528(17, 94), 537, 556(5, 6) Blumenberg, M., 173 Blute, L., 513,515(55) Bodrug, 437,444(7) Boehm, T., 396 Boeke, J. D., 303,306(9) Boggs, S. S., 477 Bogorad, L., 485, 494(35), 498(35), 512, 528(17, 29), 537, 552, 554, 556(5, 6) Bolivar, F., 302 Bollon, A. P., 345, 346(10) Bonner, J., 345 Bonventre, P. F., 620 Boone, L. R., 585, 587(15) Borck, K., 364 Borer, P. N., 284 Bos, J. L., 442 Bosselman, R. A., 585,587(13) Botchan, M. R., 463 Both, G. W., 648 Bothe, G. W., 563 Botstein, D., 219, 280, 304, 305, 308, 309, 310, 311,481,482 Botterman, J., 73 B6ttger, E. C., 463 Bounton, J. E., 514, 515(71) Bourachot, B., 639 Bowers, G. N., Jr., 401 Boyd, D., 321 Boyer, H. W., 302
657
Boyer, H., 261 Boyle, D. B., 557, 563 Boynton, J. D., 537, 555(4), 556(4, 8) Boynton, J. E., 485,494(34), 510, 511,512, 513,514,515(1, 11, 16, 45, 74), 516,517, 518(1, 6, 11, 16, 45), 520(1), 522(6, 15), 523(11, 45), 524(1, 16), 525, 526, 527, 528(41, 46), 529, 532, 534, 556 Bradley, J., 644 Brady, M. A. W., 399 Bragg, P. W., 345, 346(10) Brammar, J. D., 364 Brammer, W. J., 12 Brand, L. A., 67 Branscomb, E., 430, 431 Brechling, K., 561 Breitling, F., 231,232,248(10) Brennan, M., 481 Brenner, M., 77 Brent, R., 473 Brereton, A. M., 348 Bresnick, L., 399 Brettler, D., 558 Breut, R., 3 Brewster, F., 558 Brigati, D. J. J., 399, 403(2) Brigham, K. L., 651 Broach, J. R., 302 Brockman, W. W., 566 Broder, S., 620 Brodeur, G. T., 430 Bronstein, I., 399,400, 401(19), 402(7), 413, 414 Brosius, J., 82, 91 Brousseau, R., 337 Brown, M. S., 619 Brown, N. C., 101 Brown, W. R. A., 380 Brown-Luedi, M., 68, 70(22) Bruggemann, E. P., 46, 47 Brusslan, J., 533 Bruszewski, J., 585,587(13) Bucan, M., 347 Buchardt, O., 414 Buchman, A. R., 78, 482 Bucke, C., 436 Buckingham, J. M., 403 Bugg, T. D. H., 101 Buhler, J., 310 Buiting, K., 348
658
AUTHOR INDEX
Buller, L., 564 Buller, R. M. L., 565 Bult6, L., 513 Buluwela, L., 391,396 Burgers, P. M. J., 432, 434(4) Burgess, S. M., 545 Burke, D. T., 358, 431 Burke, J. F., 178 Burke, J., 639 Burkhardt, B. D., 517 Burkholder, B., 534 Burkholder, J., 485,619 Burnstiel, M. L., 643 Burny, A., 557 B0schlen, S., 513, 515(56), 516 Butch, J. S., 619 Butler, E. T., 143 Butow, R. A., 485,494(36), 511 Buttimore, C., 585, 587, 588(26), 599(26) Bycroft, M., 190
C Cadd, G. G., 613 Cahan, A., 67 Cai, Z., 271,272(3), 273(3) Caiazzo, T., 563,572(54) Calabi, F., 378,379 Callis, J., 471 Calos, M. P., 463 Calvin, N. M., 478 Camaschella, C., 287, 294 Cami, B., 387 Campbell, C. R., 617 Campbell, D. R., 286, 287 Cane, D. E., 88 Cantin, E. M., 557 CantreU, C., 432, 436(6) Cao, J., 497 Capecchi, M. J., 477 Capecchi, M. R., 463,477(24) Capelle, N., 414 Caplan, A. B., 471 Capon, D. J., 620 Capon, D., 625 Carabon, J., 77, 302 CardareUi, C., 35, 45(7) Carillo, N., 552 Carle, G. F., 315, 358,431
Carrano, A. V., 430, 431 Carrer, H., 513 Carter, P., 174, 189, 204, 258, 259(2), 261, 262(2) Casabo, L., 253 Casadaban, M. J., 364, 482 Caskey, C. T., 287 Caskey, C., 639 Caswell, K., 484 Cate, R. L., 399, 402(7), 404, 407(25) Chai, J. H., 397 Chai, K. X., 326, 334(9), 335(8, 9) Chakrabarti, R., 462 Chakrabarti, S., 561 Chamberlin, M. J., 143 Chambers, S. A., 484, 488(14), 494(14), 497(14) Chambliss, G. H., 127 Chan, D., 287 Chart, H. W., 464, 600, 618, 619(11), 645, 653(6), 654(6) Chan, K., 291 Chan, V.-L., 258 Chandrasegaran, S., 79 Chang, C. H., 519 Chang, D. C., 462, 465,469, 477(27, 28) Chang, D. Y., 519 Chang, G.-J. J., 173, 181(9) Chang, H. C., 461 Chang, W., 88, 89(29), 96(29), 101 Chang, Y. N., 151 Chao, J., 326, 329, 333(7), 334(9), 335(8, 9) Chao, L., 326, 333(7), 334(9), 335(8, 9) Cbao, S., 326, 333(7), 334(9), 335(8, 9) Chapman, N. M., 146 Chassy, B., 462 Chatoo, B. B., 303 Chattopadhyay, D., 143 Chaudhary, V., 47 Chebloune, Y., 585, 587(18, 24) Chemeris, V. V., 142 Chen, C. A., 618 Chen, C. M., 88 Chen, C., 416, 419(15) Chen, C.-J., 34, 38, 45 Chert, H.-C., 512 Chen, H.-Z., 123, 127(8) Chen, L., 88, 89(29), 96(29), 101, 326, 334(9), 335(9) Chen, Q., 512
AUTHOR INDEX Chen, S., 173 Chen, W., 558 Chen, X., 512 Cherif, D., 403 Chernov, B. K., 142 Cheung, A. Y., 554 Cheynier, R., 557 Chibbar, R. N., 484 Child, S., 564 Chilton, M.-D., 66 Chin, J. E., 34 Chin, K.-V., 35, 37, 39(19) Chiswell, D. J., 248,251(25), 257(25) Chiu, L. A., 416, 419(15) Chizzonite, R. A., 253 Chock, P. B., 465,477(29) Choi, K., 38 Choi, O.-R. B., 619 Chollet, A., 403 Chomczynski, P., 109, 450 Chong, W., 619 Choquet, Y., 512, 513, 514,515(44, 66, 67), 516, 522(20), 528(20, 23), 530(20, 23) Chou, J., 482 Christman, B., 651 Christou, P., 483,484, 485(11, 12), 494(11), 503(12), 506(12) Chu, G., 466,479 Chua, N.-H., 67, 78 Chung, C. T., 204 Church, G. M., 398,407(1), 409(1), 411 Cianzani, I., 287 Cieplak, W., 336 Clackson, T., 189 Claes, B., 471 Clancy, M., 67, 77(14) Clapham, P. R., 620 Clark, D. P., 45 Clark, D,, 34 Clark, J. M., 99, 105 Clarke, L., 302 Cleary, M. L., 455 Clegg, C. H., 613 Clements, M., 315 Cline, M. J., 462,463(15) Cobianchi, F., 297 Coffin, J. M., 160 Coggins, L. W., 342, 343(8) Cohen, C., 8 Cohen, D. 1., 168
659
Cohen, L. K., 564 Cohen, L. W., 173,209 Cohen, L., 561,565(48) Cohen, N., 447, 456(5) Cohen, S. N., 364 Cole, J. L., 359 Cole, W. G., 287 Coleclough, C., 153, 158(6), 167, 168(20) Collins, F. S., 105,348, 350, 359, 360,445 Collins, S. J., 597 Collis, P., 623 Colonno, R. J., 644 Comb, M., 609 Comstock, L. J., 82, 91(18) Condit, R. C., 559 Cone, R. D., 585,587(11) Cooke, S. W. F., 469 Cooper, J. A., 560 Cooper, N. R., 598 Corcoran, T., 557 Cormier, N., 561,565(48) Corneilsen, M., 554 Cornel, E., 618, 619(12), 645, 654(11) Cornetta, K., 595 Cornwell, M. M., 47 Correll, L. A., 613 Cortes, P., 77 Cortopassi, G., 99, 173 Cossart, P., 314 Cosset, F. L., 585,587(18, 24) Cosstick, R., 190, 193(16), 198,258,281 Cotten, M., 620, 621, 622(37, 38), 624, 625(36, 39), 627(36, 44), 632(36), 633(36, 39), 643,644 Cotton, R. G, H., 286, 287, 288, 292, 293, 294 Coulet, D., 469 Coulson, A. R., 95, 380 Coulson, A., 431 Coupar, B. E., 563 Cox, S., 150 Cram, L. S., 403 Cranage, H., 557 Cremer, K., 565 Crofts, A. R., 512 Croop, J. M., 35 Croop, J., 34, 44(3) Crosby, W. L., 497 Cross, E., 532, 534(35, 102) Cross, S. H., 380, 381
660
AUTHORINDEX
Crothers, D. M., 284 Cullen, B. R., 253 Cunningham, K., 461 Curiel, D. T., 643 Curiel, D., 643 Curran, T., 264, 277 Currier, S. J., 46 Curtis, P. J., 557 Cutting, A. E., 585, 587(16) Cwirla, S. E., 228, 231,233(5), 245(5) Czernilosky, A. P., 497, 500(52)
D
Daegelen, D., 455 Dahl, H.-H. M., 287, 293 Dahlquist, F. W., 101 Dahms, V. A., 512 Daines, R. J., 484, 488(14), 494(14), 497(14) Dalbadie-McFarland, G., 173, 209 Dale, R. M. K., 456 Dalgleish, A. G., 620 Daly, M., 67 Dang, M. N., 102 Danho, W., 253 Dani, M., 403 Daniell, H., 485, 494(38, 39), 500(39), 501(39), 536, 545(1), 553(1, 11), 554(1, 11), 555(1), 537, 546(10), 547(9), 548(9, 10), 549(9), 552, 553(9, 10), 554(9, 10) Danielsen, M., 600, 618, 619(11), 645, 653(6), 654(6) Dano, K., 325 Danos, O., 585, 587(19) Darlfeld, G., 537 Das, A., 82 Das, H. K., 4 Dasgupta, R., 144 Dasmahapatra, B., 144, 145(11), 150 Date, T., 173 Datla, R. S. S., 497 Davanloo, P., 49 Davidson, A. J., 558, 559, 562(25, 26), 563 Davidson, J. N., 242 Davidson, N., 447 Davies, C., 65 Davies, M. D., 141 Davis, M. A,, 233
Davis, M., 168 Davis, R. L., 596 Davis, R. W., 152, 302, 325, 432, 435(7), 436(7), 481 Davis, S. W., 558, 565 Day, L. A., 238 De Block, M., 66, 73,511 De Boer, H. A., 4 de Boer, H., 82, 91(18) De Camp, J., 512, 528(29) de Crombrugghe, B., 45 de Ferra, F., 173 de Koning, J. R. A., 399 De Rycke, R. M. U., 471 De Vries, M. J., 462 de Wet, J. R., 58, 632,647 Dean, D. A., 555 Dean, M., 164 Deaven, L. L., 403 Debouck, C., 5 Deckard, E. L., 541 Deen, K. C., 182 DeJong, P. J., 430 Dekeyser, R. A., 67,471 Del Sal, G., 95 Delaprat, D., 414 Delbarre, A., 414 Delepelaire, P., 510 Delius, H., 397 deLorenzo, V., 321 Delorme, E., 479 Delosme, M., 514, 515(66) DeLuca, M., 58, 632, 647 Demeneix, B., 600, 612(3), 615(3), 619 den Hertog, T. J. A., 126 Dengler, B. D., 284 Denny, W. A., 414 Depicker, A. G., 67 Deschazal, L., 557 Desmettre, P., 563 Desportes, I., 557 Destree, A., 563,572(54) Devereux, J., 92 Devine, C. E., 453 DeVit, M. J., 485,486, 487(44, 45), 500(44) Devlin, J. J., 228, 231 Devlin, P. A., 404, 407(25) Devlin, P. E., 228, 231 Devos, R., 5
AUTHOR INDEX Dianzani, I., 287, 294 Dietrich, A., 358 Dietzschold, B., 557 Diggelmann, H., 61 DiMaio, D., 48 Dingwall, C., 220 Diogenes-lnfante, H., 553 Dix, P. J., 513 Djavadi-Ohaniance, L., 142 Dockx, J., 73 Dodd, J., 310 Dolgikh, D. A., 142 Doly, J., 27 Domain, A., 512 Donadio, P. E., 253 Dong, D. L. Y., 151 Dooley, S., 399 Doonan, J. H., 462 Dorit, R. L., 103 Dorner, F., 577, 581(72) Dott, K., 557 Dougherty, J. P., 585, 587(22) Douglas, M. G., 478 Dowbenko, D., 625 Dower, W. J., 228,231,233(5), 237, 245(5), 251,283,472, 473(42) Drillien, R., 558, 559(24), 563(24) Drinkwater, N. R., 463 Drohan, W., 48 Dron, M., 514, 515(66) Drucker, R. P., 562 Drumm, M. L., 359 Drumm, M., 105 Drummonds, B. J., 484 Drutsa, V., 73, 188, 258 Dubel, S., 231, 232, 248(10) Dubendorff, J. W., 105, 114(17), 115(17), 116(17), 118(17) Dudock, B. S., 123, 127(7) Duke, D., 619 Duke, G. M., 143 Dull, T. J., 91 Dumbell, K. R., 559 Dunn, J. J., 49, 81, 105, 114(17), 115(17), 116(17), 118(17), 644 Dupret, J. M., 101 Durbin, R. K., 81 Durrenberger, F., 512 Dush, M. K., 103
661
E Earl, P. A., 563 Earl, P. L., 563 Eberle, R., 557 Eckert, K. A., 277 Eckstein, F., 173, 190, 193, 198, 199,202(8, 9), 203(9), 205(10), 209(10), 215(8, 10), 216(10), 217, 258, 281 Edelman, M., 512 Edenberg, H. J., 337 Eder, J. H., 326 Edgell, M. H., 259 Edwards, B., 399,400, 401(19), 413,414 Edwards, S. J., 558 Efron, D., 123 Egan, W., 197 Eglitis, M. A., 37, 39(17) Ehrenels, C. W., 399 Eidels, L., 620 Eiden, M. V., 585, 587(25), 595(25) Eigel, L., 536 Elder, J. T., 48 Ellenberger, T., 90 Ellman, G. L., 625 Ellmore, G. S., 512, 528(17), 537, 556(6) Ellstrand, N. C., 556 Elroy-Stein, O., 49, 563 Elson, H. F., 39 Ely, B. K., 173, 174(4) Emerson, S. U., 102 Engel, J. B., 619 Enger-Valk, B. E., 12 Engler, M., 285 Enquist, L., 153 Epstein, P., 113 Erdmann, V. D., 585, 587(16) Erickson, J. M., 512, 514, 515(70), 517,533 Erickson, J., 513, 515(44) Erlich, H. A., 79, 83, 103,218,436 Erlich, H., 83 Erlitz, L., 153 Erneux, C., 462 Esaki, N., 173 Esposito, J. J., 557 Esser, A. F., 598 Esteban, M., 561 Evans, G. A., 89, 105,461 Ezaz-Nikpay, K., 88, 89(29), 96(29), 101
662
AUTHORINDEX F
Falco, S. C., 481 Falkner, F. G., 561,564 Faloona, F. A., 437 Faloona, F., 79, 83, 103, 218, 271 Falvey, A. K., 126 Familletti, P. C., 253 Fang, R.-X., 67 Farber, F. F., 619 Fasy, T. M., 619 Faure, C., 585, 587(18) Fedorov, A. N., 142 Feigner, P. L., 464 Feinberg, A. P., l l l , 113(23) Feinstone, S. M., 102 Feigner, P. L., 600, 618, 619, 645, 650(7), 653(6, 7) Feltz, A., 609 Feltz, P., 609 Fenner, F., 559 Fennie, C., 620, 625 Feramisco, J. R., 325 Ferl, R. J., 67, 77(14) Fernandez, E., 535 Fersht, A. R., 190 Fiddes, J. C., 325 Fieldes, A., 414 Fiering, S., 639 Fiers, W., 4, 5, 258 Figuet, B., 142 Filipowicz, W., 78 Fillmore, G. C., 278 Finch, C. A., 619, 620(27) Finer, J. J., 484 Fink, C. L., 67 Fink, G. R., 303, 306(9), 478, 480(1), 482 Finkelstein, A. V., 142 Finley, D., 479 Firth, K. L., 469 Fischroff, D. A., 555 Fishel, R. A., 183 Fishpool, R., 379 Fitch, M. M., 484 Fitts, R., 48 Fjellstedt, T. A., 303 Flanegan, B., 644 Flavell, R. B., 66 Fletcher, D. S., 380 Flick, J. S., 67
Flicke, P., 285 Flint, J., 77 Flynn, P., 484 Foisner, R., 621,624(39), 625(39), 633(39) Fojo, A. T., 39 Fong, F., 501 Fordis, C. M., 36 Forrest, S. M., 287,293, 294 Forster, A. C., 65, 159 Foss, K., 173 Foster, A., 396 Fouchard, M., 557 Fountain, J. W., 348 Fournel, M., 597 Fox, T. D., 485, 494(37), 511 Fraley, R. T., 67 Fraley, R., 618,619(5) Franceschini, T., 173 Francklyn, C., 101 Frank, M., 430 Frank, T., 430 Franke, C. A., 557, 564 Franklin, N., 4 Franzen, L. G., 556 Fraser, M. J., 48 Frazen, L. G., 513, 515(51), 516(51), 522(51), 530(51), 532(51) Freese, E., 77 Fregeau, C., 337 French, B. A., 456 French, R., 644 Frey, L., 457 Fried, M., 279 Friedman, S. M., 237 Friedmann, T., 477 Friesen, P. D., 151 Frischauf, A., 359 Frischauf, A.-M., 347, 351, 352, 364, 369, 377(3) Fritsch, E. F., 3, 6(1), 18, 27, 29(13), 68, 105, 109(19), 110(19), 113(19), 114(19), 116(19), 117(19), 144, 148(12), 156, 204, 222, 223(18), 224(18), 235, 236(19), 237(19), 279, 283, 290, 340, 341(2), 342(3), 346(2), 384, 451,523 Fritz, H., 73 Fritz, H.-J., 174, 176, 182, 183(20), 188, 189, 258 Frohman, M. A., 103 Fromm, M. E., 484, 497(13)
AUTHOR INDEX Fromm, M., 67,471,478,483,494(6), 497(5) Frommer, W.-B., 75 Froshauer, S., 321 Fry, J. S., 67 Fuchs, R.-L., 555 Fuerst, T. R., 48, 49, 561,563 Fukada, Y., 478,481(2) Fuller, R. S., 315 Fung, M., 173 Funkuda, Y., 302 Furuichi, Y., 648
G Gadek, T. R., 464, 600, 618, 619(11), 645, 653(6), 654(6) Gadoury, D. M., 484, 489(32), 494(32, 33), 495(32), 496(32), 498(32), 500(33), 502(32), 508(32) Gal, S., 36, 39(10) Galas, D. J., 99, 173 Galas, D., 431 Galat, A., 101 Gallagher, S., 469 Gallie, D. R., 67, 141 Galski, H., 35 Galuppi, G. R., 67 Garcia, J. V., 585,587(25), 594, 595(25) Gardner, R. C., 68, 70(22) Garlick, N., 618, 619(12), 645,654(11) Garling, D. J., 278 Gasser, F., 314 Gatignol, A., 277 Gaudin, H. M., 620 Gaugain, B., 414 Gaurante, L., 475 Gautxch, J. W., 326 Geehrter, T. D., 325 Gehrke, L., 67, 141 Geisselsoder, J., 176, 260 Gelfand, D. H., 90, 92(36), 98(36), 103,218 Gelfand, D., 79 Gelinas, R. E., 582, 597 Georges, F., 484 Gergen, J. P., 341 Gerin, J. L., 557 Germann, U. A., 37, 39(19), 46 Gerstein, A. S., 620 Gething, M.-J., 47, 48
663
Geysen, H. M., 251,253 Ghattas, I., 645,654(8) Ghosh, A., 144 Ghosh, B., 82 Giannelli, F,, 287 Gibbs, P. B., 512 Gibson, T. J., 261,380, 411 Giebel, L. B., 227 Gilbert, H. J., 21 Gilbert, W., 103, 143, 398, 407(1), 409, 411(1) Gilboa, E., 582 Gill, D. S., 143 Gillespie, P. G., 414 Gillham, N. W., 485,494(34), 510, 511,512, 513, 514, 515(1, 11, 16, 45, 46, 47, 71, 74), 516, 517, 518(1, 6, 11, 16, 45), 520(1), 522(6, 15), 523(11, 45), 524(1, 16), 525, 526, 527, 528(41, 46), 529, 530(46), 532, 534, 537, 555(4), 556(4), 556 Gingrich, J. C., 415,416(12) Ginsburg, D., 325 Girard-'Bascou, J., 513, 515(44) Girard-Bascou, J., 512, 514, 515(66, 67, 68, 69, 70), 522(20), 528(20, 23), 530(20, 23) Giraud, E., 314 Gissmann, L., 10 Glazer, A. N., 415,416,422(I 1), 427(11, 13) Glover, P. L., 585,587(15) Godall, G. J., 78 Godson, G. N., 259 Goebel, S. J., 558 Goeddel, D. V., 4, 82, 87(24), 91(24) Goff, S. A., 484 Goff, S., 585,587(20, 21) Gogos, J. A., 294 Golbeck, J. H., 512 Gold, B., 552 Gold, L. M., 123, 127(2) Gold, L., 81 Goldberg, M. E., 142 Goldberg, S. B., 67 Goldschmidt-Clermont, M., 512, 513, 514, 515(49, 51, 67, 68, 73), 516(49), 519(49), 522(20, 49), 528(20, 21, 23, 49), 530(20, 21, 23, 49), 531,532(49), 555, 556 Goldstein, J. L., 619 Golinelli-Pimpaneau, B., 79 Golomb, M., 253
664
AUTHOR INDEX
Gonsalves, D., 484 Goodman, M., 609 Gordon, J., 122 Gordon-Kamm, W. J., 484,488(14), 494(14), 497(14) Gorman, C. M., 42, 604 Gorman, C., 55, 222 Gossel6, V., 73 Gossels, S. D., 48 Goto, T., 310 Gottardi, E., 294 Gottesman, M. M., 34, 35, 36, 37, 38, 39, 43(15), 44(5), 45, 46, 47 Gould-Fogerite, S., 618, 619(7) Goulian, M., 260 Goussard, B., 557 Gradziel, T. M., 484 Gradziel, T., 483,494(6) Graessmann, M., 618, 619(13) Graham, F. L., 42, 54,619 Graham, L. F., 463 Graham, M. W., 105 Gralla, J,, 284 Grandi, G., 173 Grannemann, R., 53 Grant, D. M., 101,525 Grant, S., 67, 75(12), 77(12), 78(12) Gray, J. V., 79 Green, G. N., 321 Green, M. R., 143,455 Green, P. M., 287 Greenberg, H. B., 102 Greenberg, J. R., 157 Greene, P. J., 302 Greene, R., 231,232, 248(11), 256(11) Greene, W. C., 253 Greenwood, J., 231,232, 233(13) Gregg, R. G., 477 Gregory, T., 620, 625 Greshelin, P., 558 Greulich, K.-O., 520 Grichnik, J. M., 456 Griffin, B. E., 53, 64, 187 Griffin, J. H., 326 Griffith, M. C., 142 Griffiths, A. D., 248, 251(25), 257(25) Grindlay, G. J., 342 Grisai, P., 219 Gritz, L., 557 Groeneveld, H., 48
Groisman, E. A., 321 Grompe, M., 287 Gronenborn, B., 67, 71,220, 497, 500(52) Groopman, J., 625 Gros, P,, 34, 35, 37, 44(3) Gross, E., 512 Grosse, E., 618, 619(6) Grosveld, F., 623 Grunstein, M., 340 Gruss, P., 48 Grzelecki, A., 564 Gu, X. R., 79 Guarante, L., 479 Guarente, L., 302 Gudkov, A. T., 134 Guild, B. C., 37 Gurevitch, 170 Gusella, J., 347 Gyllenstein, U. B., 113
H Ha, I., 77 Habener, J. F., 607 Habets, M. E., 471 Haeberli, P., 92 Hahn, P., 68, 70(22) Hahn, W. E., 160 Haikimi, J., 253 Hajdukiewicz, P., 485, 513, 520(57), 537, 554(12), 555(12) Hajukiewicz, P., 513 Hallick, R. B., 512 Hamada, H., 46, 47 Hamer, D., 48 Hammerlindl, J. K., 497 Hammond, R. A., 101 Han, M., 287 Hanahan, D., 6, 18, 95, 109, 176, 204, 268 Hanauer, A., 455 Hanawalt, P. C., 478 Hanggi, M., 559 Hanna, Z., 337 Hannah, C., 67, 77(14) Hanover, J. A., 36, 39(11), 44(11) Haring, M. A., 511 Haroz, R. K., 160 Harpending, P. R., 484, 486, 487(32, 45), 489(31, 32), 494(32, 33), 495(32),
AUTHOR INDEX 496(32), 498(32), 500(31, 32, 33), 502(32), 508(32) Harper, E. C., 483 Harrer, H., 557 Harris, A. J., 453 Harris, E. A. S., 597 Harris, E. H., 485, 494(34), 510, 511, 513, 514,515(1, 11, 16, 45, 46, 47), 516, 517, 518(1, 11, 16), 520(1,4), 521(4), 523(11), 524(1, 16), 525,526(11, 16), 527(11, 16, 45), 528(46, 47), 530(46), 532(9, 46), 534(46), 537, 555(4), 556 Harrison, B., 161 Harriss, J. V., 478 Hart, A. M., 150 Hart, C., 561,565(48) Hart, J. J., 533 Harvey, R., 173, 174(4) Haselkorn, R., 533 Hashimoto, H., 479 Hatanaka, M., 564 Hattori, M., 184 Haugland, R. P., 416 Hauser, C. R., 512, 516 Hauser, H., 53 Havican, K., 563, 572(54) Hayakawa, H., 466, 479 Hayakawa, S., 24 Hayami, M., 564 Hayden, M. A., 337 Haynes, J. R., 455 Hayward, D., 151 Hayward, G. S., 151 Hazan, U., 638 He, M., 10 Healey, A., 295 Hedrick, S. M., 168 Heifetz, P. B., 512, 513, 527, 528(41), 532, 534(35, 41, 102) Heilig, R., 455 Heinemann, S., 453 Heiss, S., 513,515(40), 522(40), 533(40) Heizmann, C. W., 113, 120 Helfman, D. M., 325 Helinski, D. R., 4, 58, 632, 647 Helms, C., 430 Hemsley, A., 99, 173 Henikoff, S., 218,456 Henkin, T. M., 127 Henriksen, U., 414
665
Henshaw, E. C., 123 Herbert, E., 557 Herbomet, P., 639 Hering, S., 53, 64 Herman, L. M. F., 67 Hermes, J. D., 190 Hernalsteens, J.-P., 66 Herrera-Estrella, L.. 66 Herrero, M., 321 Herrin, D. L., 512, 520(28) Herrmann, B. G., 352, 369 Herrmann, G., 54, 56(31), 64 Hershield, M. V., 4 Herzenberg, L. A., 639 Hewlett, M. J., 644 Heynecker, H. L., 302 Heywood, S. M., 123 Hicks, J. B., 478, 480(1) Higa, A., 6 Higgins, D. R., 311 Higgins, R., 484 Higuchi, R., 173,218, 219, 279 Hill, W. E., 341, 345(7) HiUe, C. R., 512 Hiller, G., 559 Himeno, T., 23 Hinnen, A., 478, 480(1) Hinuma, Y., 564, 618 Hiraoka, Y., 412 Hirayoshi, K., 564 Hirokawa, H., 552 Hirose, S., 174 Hirose, T., 174, 345, 346(12) Hirsch, D., 545 Ho, S. N., 220, 271, 272(3), 273(3), 274(1), 276(2), 277(1, 2), 279(1) Hock, J., 325 Hock, R. A., 596 Hodges, R., 48 Hodges, W. M., 137 Hofer, B., 173, 175, 178, 180, 189 Hoffman, C. A., 556 Hoffmann, N. L., 67 Hofmann, W., 8, 10 Hofschneider, P. H., 618 Hogness, D. S., 340 Hoheisel, J. D., 352 Hohn, B., 352 Hohn, T., 67 Hollenberg, S. M., 173
666
AUTHOR INDEX
HoUt, V., 608 Holm, C., 310 Holm, M., 464, 600, 618, 619(11), 645, 653(6), 654(6) Holmes, D. S., 178 Holt, C. E., 618, 619(12), 645, 650(7), 654(1 l) Holton, T. A., 105 Holy, A., 91 Hong, G. F., 411 Honjo, T., 152 Hoopes, B. C., 164 Hopkins, J. D., 315 Hopkins, W. J., 364 Hod, H., 174 Horikoshi, M., 77 Horinouchi, S., 25 Horn, G. T., 79, 83, 103,218 Horn, G., 83 Horovitz, A., 190 Horsch, R. B., 67 Horsthemke, B., 348 Horton, R. M., 220, 271, 272(3), 273(3), 274(1), 276(2), 277, 279(1) Horvath, G. V., 513 Hoschneider, P. H., 461,466(2) Hoshino, H., 598 Hoshino, T., 25 Hosler, J. P., 485, 494(34), 510, 511(1), 514(1), 515(1), 516, 518(1), 520(1), 524(1), 525(1), 526, 537, 555(4), 556(4) Houdebine, L.-M., 109 Houhins, J. P., 456 Housman, D. E., 35, 37 Housman, D., 34, 44(3) Howard, B. H., 42, 222, 277, 604 Howard, B., 38, 55 Howard, J., 484 Howarth, A. J., 68, 70(22) Howell, S. H., 67 Howells, D. W., 287 Howley, P. M., 48 Hruby, D. E., 137, 557, 564 Hsiung, N., 48 Hsu, R.-Y., 585,587(13) Hu, F., 585,587(13) Hu, M. C.-T., 447 Hu, P., 643 Hu, S. L., 558 Huang, C., 564
Huang, H. V., 351,363 Huang, L., 618,619(8) Huber, H., 197 Hudspeth, A. J., 414 Huebers, H. A., 619, 620(27) Huffaker, T. C., 305, 310(14) Hughes, C., 5 Hughes, S. H., 325, 455 Hugin, A. W., 563 Hui, A. S., 4 Hummelen, J. C., 400 Hunger-Bertling, K., 462, 463(15) Hunt, D., 220 Hunt, H. D., 271, 274(1), 276(2), 277(1, 2), 279(1) Hurwitz, D. R., 48 Hutchison, C. A., III, 259 Hutton, C. J., 174, 281,282(5) Huynh, T. V., 152, 325, 432, 435(7), 436(7) Hyman, S. E., 609 I
Iannuzzi, M. C., 359, 397 Ichikawa, Y., 101 Iida, A., 471,484, 485(15) Ikegami, M., 471 Imanaka, T., 23 Inayama, S., 174 Ingelbrecht, I. L. W., 67 Ingraham, H. A., 461 Innes, C. L., 585,587(15) Innis, M. A., 90, 92(36), 98(36), 103 Inouye, S., 173 Isberg, R. R., 314, 315 Ish-Horowicz, D., 178 Isono, K., 430, 444 Istock, N. L., 204 Itakura, K., 173, 209, 345, 346(12) Ito, H., 302, 478, 481(2) Ito, Y., 564 Ittele, D., 557 Iwai, K., 618, 619(10) Iyer, R. P., 197
J Jabonski, E., 407, 412(26) Jack, W. E., 88
AUTHORINDEX
667
515(1, 16), 516(16), 517(16), 518(1, 16), Jacobs, J. D., 67 520(1), 524(1, 16), 525(1, 16), 526(1, 16), Jacobsen, H., 260 527(16), 537, 555(4), 556(4) Jakubzik, U., 321 Jones, D. H., 277 Jamal, S., 620 Jones, J., 253 Jameson, B. A., 619 Jones, M. D., 403 Janda, K. D., 231,232, 257(12) Jones, P. T., 258, 265(4), 270(4) Janda, M., 644 Jordon, C. A., 462 Jang, S. K., 141 Jorgensen, E. D., 81 Jani, A., 619 Jorgensen, R. A., 314 Jannasch, H. W., 97 Joyner, S. S., 136 Jansen, A. M., 442 Jung, V., 99, 105 Jansen, H. W., 258 Juo, R.-R., 399 Jansen, H.-W., 73, 188 Jarvis, J. M., 379 Jastreboff, M. M., 462 K Jeang, K.-T., 277 Jeanteur, P., 617 Kaarem, B.-S., 397 Jeffers, J., 5 Kaderbhai, M. A., 10 Jefferson, R. A., 73, 497, 545,547 Kaderbhai, N., 10 Jeffries, A. C., 65 Kadowaki, H., 219 Jennings, M. P., 336 Kadowaki, K., 23, 32 Jensen, F. C., 598 Kadowaki, T., 219 Jensen, R. G., 512 Kaesberg, P., 126, 144 Jenson, J. C., 253 Kafatos, F. C., 294 Jiao, S., 619 Kahara, Y., 431 Jilk, R., 321 Kahn, A., 455 Jin, M., 101 Kain, K. C., 102 Jobling, S. A., 67, 141 Kakinuma, A., 32 Jochmus, I., 10 Johanningmeier, U., 513, 515(40), 522(40), Kaleko, M., 594, 597 533(40, 42) Kamen, R., 590 Kammann, M., 220,497, 500(52) Johnson, A. D., 101 Johnson, A. M., 485,494(34), 510, 511,513, Kan, N. C., 259 514, 515(1, 16, 45, 46, 47), 516(16, 46), Kane, S. E., 34, 35, 36, 39(10), 44(5) 517(16, 45), 518(1, 16, 45), 520(1), Kane, S., 38 522(45), 523(45), 524(1, 16, 45), 525(1), Kanedi, Y., 618, 619(10) 526(1, 16), 527(16, 45), 528(46, 47), Kang, A. S., 231,232, 257(12) 532(46), 534(45, 46), 537, 555(4), 556 Kantoff, P. W., 37, 39(17), 582 Johnson, B. J. B., 173, 181(9) Karayiogou, M., 294 Johnson, D. A., 326 Karlovsky, P., 336 Johnson, E. M., 619 Kartha, K. K., 484 Johnson, G. P., 558 Karube, I., 479 Johnson, M. J., 345, 346(12) Kasai, Y., 77 Johnson, P. F., 173 Kaslow, D. C., 296 Johnson, R. C., 314, 315 Kates, J. R., 559 Johnston, S. A., 484,485,485,486, 487(44, Katz, W., 310 45), 494(29, 36), 497(29), 498(29), Kaufman, D. L., 89, 105 500(29, 42, 44) Kaufman, R. J., 48, 141 Jonak, Z. L., 618, 619(9) Kausch, A. P., 484,488(14), 494(14), 497(14) Jones, A. R., 485,494(34), 510, 511,514(1), Kavaler, J., 168
668
AUTHOR INDEX
Kavanagh, T. A., 497 Kawai, S., 619 Kawasaki, E. S., 103 Kawashima, E. H., 345, 346(12), 403 Kay, R. M., 48 Kay, R., 67 Kazuyuki, T., 174 Kearns, D. R., 414 Keating, A., 477 Keil, W., 558 Keith, B., 78 Keith, D., 430 Kelley, D. E., 157 Kemp, D. J., 558 Kemper, B., 232 Kempthorne, O., 504 Kendall, E., 484 Kent, K., 557 Kettman, J., 167 Khoury, G., 48 Kieber-Emmons, T., 619 Kieffer-Higgins, S., 411 Kieny, M., 557 Kiessling, U., 47, 49, 51(23), 54(23) Kiff, J., 431 Kimura, A., 302, 478,479,481(2) Kinashi, T., 152 Kindle, K. L., 512, 513, 515(50), 520, 523(25, 50), 528(50), 535, 537, 556(7) Kindle, K., 512, 513,515(56) King, G., 651 King, H. D., 414 Kingston, R. E., 3,473 Kirlappos, H., 620, 622(38), 624, 627(44), 643 Kirpichnikov, M. P., 142 Kishimoto, T., 624 Klapholz, S., 432,435(7), 436(7) Klausner, R., 622 Klebe, R. J., 478 Kleckner, N., 233 Klein, T. M., 464, 483, 484, 485, 494(2, 6, 29, 34), 497(5, 13, 29), 498(29), 500(29), 510, 511(1, 2, 3), 514(1), 515(1), 518(1), 520(1, 2, 3), 524(1), 526(1), 537, 555(4), 556(4) Klein, U., 512, 528(17, 29) Klein, Uwe., 537, 556(6) Klenow, H., 260 Kleown, W. A., 617
Klewinghaus, I., 231,232, 248(10) Kley, N., 608 Kline, B. K., 277 Klinedinst, D. K., 463 Klotz, I. A., 413 Knight, D., 462 Knight, J., 557 Knowles, J. R., 79, 190 Knutson, J. C., 463 Knutson, V. P., 253 Kocher, T. D., 436 Koehler, K. A., 157 Koester, H., 190 Koeuth, T., 287 Kohara, Y., 430, 444 Kohchi, T., 556 Kohtz, D. S., 619 Kohtz, J. D., 619 Kolb, J. M., 310 Kolesnikov, V. A., 485,500(41) Kolesnikov, V., 484 Kolodner, R., 183 Konarska, M. M., 146 Konig, R., 36, 39(11), 44(11) Konishi, H., 23 Konno, T., 564 Koop, H. V., 537 Koop, M. O., 536 Koprowski, H., 557 Koralewski, M. A., 477 Korflhage, C., 67, 75(12), 77(12), 78(12) Kornberg, A., 260, 315 Kornberg, R. D., 482 Kornstein, L., 483 Kosowski, S. G., 558 Kost, T. A., 455 Kotzorek, G., 190, 199 Koup, R. A., 558 Kourilsky, P., 387 Kozak, M., 68, 143, 151 Kramer, B., 73, 176, 188,258 Kramer, W., 73, 174, 176, 182, 183(20), 188, 258 Krammer, W., 189 Krausslich, H. G., 150 Krebs, M. P., 315, 316, 317(11), 318(11) Kreig, P. A., 645 Kreike, C. M., 399 Krekel, 199 Krens, F. A., 399
AUTHOR INDEX Kricka, L. J., 399, 414 Krieg, P. A., 127, 143,455 Kriegler, M., 38 Krippl, B., 49 Krishnan, M., 537, 553(11), 554(11) Kristensson, K., 559 Kronick, M., 430 Krueger, R. W., 484, 488(14), 494(14), 497(14) Krummel, B., 173,219, 279 Kucherlapati, R. S., 477, 617 Kuchka, M., 514, 515(69) Kuck, U., 514, 515(68) Kuenzle, C. C., 103 Kiihlein, B., 173, 175, 180 Kuhn, L., 167, 168(20) Kumar, A., 173 Kunkel, T. A., 189, 197, 258, 277, 281 Kuras, R., 513,515(55), 516 Kuroiwa, T., 552
L La Torre, J., 157 Laemmli, U. K., 9, 47, 131, 149, 577, 578(71), 633 Lai, E., 432,436(6) Lai, J. S., 173 Lamande, S. R., 287, 293 Lamerdin, J., 430 Lammle, B., 326 Lanar, D. E., 102 Land, H., 585, 587(23) Landers, T. A., 182 Lane, W. S., 101 Lange, J. V., 557 Langenstein, G., 358 Langford, C. J., 558 Langle-Rouault, F., 620, 622(38) Languet, B., 563 Lanzillo, J. J., 399 Larsen, G. R., 48 Larson, C. J., 88, 89(29), 96(29), 101 Laskey, R. A., 220 Lasky, L. A., 620 Lasky, L., 625 Lassar, A. B., 596 Lathe, R., 557 Latt, S. A., 48
669
Lau, Y. F., 291 Laufs, J., 67, 75(12), 77(12), 78(12), 220. 497, 500(52) Lautenberger, J. A., 259 Law, M. F., 585, 587(12) Law, M.-F., 37, 48 Lazaar, A. L., 314 Lazzari, K. G., 399 Le Bret, M., 414 Le Guen, I., 414 Le Pecq, J. B., 414,422(9) Leary, J. J., 399, 403(2) Lebel, S., 173 Lebkowski, H. S., 463 Lebo, R. V., 325 Lechner, R., 285 Lechtken, P., 399 LeClair, K., 101 LeClerc, J. E., 204 Lecocq, J., 557 Lecocq, J.-P., 557 Leder, P., 153,450, 461,466(4), 472(4) Lee, C., 400 Lee, K. Y., 71 Lee, L. G., 416, 419(t5) Leech, R. M., 516 Leemans, J., 73 Lefebvre, F.-A., 379 Lefebvre, P. A., 535 Legrand, A. T., 618, 619(6) Legras, C., 585,587(18, 24) Lehrach, H., 347,350(2), 351,352,358, 359, 361(5, 6), 363(5), 364, 377(3, 5, 6), 397 Lekovits, I., 167, 168(20) Lemaire, C., 514, 515(72) Lemaux, P. G., 484, 488(14), 494(14), 497(14) Lemischka, I. R., 463,476(18), 477(18) Leonard, R., 557 Leonard, W. J., 253 Lerner, R. A., 231,232, 257(12) Lets, A., 512,513,527,528(41), 532,534(35, 41, 102) Letvin, N. L., 558 Leu, S., 513,514, 515(54, 75) Leu, T. M. J., 103 Leung, N., 484 Leupin, W., 414 Lev, Z., 447, 456(5) Leventhal, J. M., 127
670
AUTHOR INDEX
Levin, M., 455 Levine, M. D., 284 Levine, P. H., 558 Levy, J. A., 598 Lewin, B., 89 Lewis, E. D., 173 Lewis, F., 618, 619(9) Lewis, K., 461 Li, Ch., 643 Li, W.-H., 4 Lieb, M., 4 Lieber, A., 49, 50, 51(23), 54, 56(31), 58, 62(36), 64 Lienhard, G. E., 157 Limbach, K., 561,563(47), 565(47) Lin, P., 253 Lindberg, A. M., 146, 150(14) Lindquist, R. N., 157 Lingrel, J. B., 455 Linney, E., 585, 587(15) Lipinskas, B. R., 560, 564(44) Lis, J., 156 Little, M., 231,232, 248(10) Little, P. F. R., 351,363,380, 381 Liu, H. L., 146 Liu, J., 88, 101 Liu, X.-Q., 514, 515(74), 526 Lloyd, C. W., 462 Lobet, Y., 336 Lockwood, W. K., 359 Lodish, H., 143 Loeb, L. A., 219 Loechel, St., 643 Loeftter, J. P., 608, 609 Loeflter, J.-P., 600, 612(3), 615(3), 619 Loesch-Fries, L. S., 644 Long, G. L., 173,227 Longworth, J., 151 Lorz, H., 75 Lou, J. K., 519 Loughlin, R. E., 447 Lovelace, E., 37, 39(15), 43(15) Loyter, A., 618 Lu, H. S., 326, 334(9), 335(9) Lubbe, L., 53 Lucas, Z. J., 260 Luckow, V. A., 48 Ludwig, G., 314, 497 Ludwig, J., 193 Luhrs, R., 75
Luider, T. M., 400 Lupski, J. R., 287 Lurhuma, Z., 557 Lurquin, P. F., 498 Luse, D. S., 455 Luthman, S., 209 Lynch, C. M., 585, 587(25), 595(25), 598 Lyons, J., 563,572(54) Lyons, L. B., 233
M Maas, C., 67, 75, 77(12), 78(12) Maas, R., 341,345(6) Mac Collin, M., 430 MacConnel, W. P., 264 MacDonald, M. E., 347 MacFarlan, R. I., 557 MacFerrin, K. D., 79, 80(2), 84(2), 86(2), 89(2), 92(2), 93(2), 101 MacGregor, G., 639 Machy, P., 618, 619(9) Mack, S. L., 101 Mackett, M., 48, 557, 559, 560, 561(33), 563(33), 564(43), 572 Mackey, C. J., 484, 488(14), 494(14), 497(14) Mackow, E. R., 102 MacMillan, A. M., 101 Maddon, J., 620 Maeda, K., 8, 10 Magnuson, M., 651 Magnusson, G., 209 Mahmoudi, M., 345,346(10) Mahr, A., 558, 560, 563,572(54) Maizels, N., 4 Makris, J. C., 315, 318, 319 Malcolm, A. D. B., 210 Maldonado, E., 77 Maliga, P., 483, 485, 513, 516(58), 517(60, 61), 518(60, 61), 520(57), 528(60, 61), 537, 554(12, 13), 555(12, 13) Mallet, F., 585,587(18) Malnoe, P., 514, 515(70) Malo, M. S., 447 Malone, R. W., 645,651(10), 653(7), 654(10) Malone, R., 513,619 Malone-Schoneberg, J., 484 Mandecki, W., 173, 337 Mandel, J. L., 455
AUTHOR INDEX Mandel, M., 6 Manfioletti, G., 95 Mangano, M., 484, 488(14), 494(14), 497(14) Maniatis, T., 3, 6(1), 18, 27, 29(13), 68, 105, 109(19), 110(19), 113(19), 114(19), 116(19), 117(19), 127, 143, 144, 148(12), 156, 204, 222, 223(18), 224(18), 235, 236(19), 237(19), 279, 283, 290, 340, 341(2), 342(3), 346(2), 384,451,455,523 Manley, J. L., 56, 173 Mann, R., 37, 582, 585(3), 586(3), 587(3) Mannino, R. J., 618, 619(7) Manshardt, R. M., 484 Marchuk, D., 105 Marcus, A., 123 Margoius, H. S., 329 Marin, A., 555 Mark, R., 564 Markhan, A. F., 173, 174(4) Markovits, J., 414, 422(9) Markowitz, D., 585, 587(20,21) Markus, M. A., 91 Marmenout, A., 258 Marsh, K., 477 Marston, F. A. O., 100 Martin, C., 399 Martin, F., 585,587(13) Martin, G. R., 103 Martin, L. H., 379 Martin, L., 379 Martinell, B. J., 483, 484(12), 485(12), 503(12), 506(12) Martinell, B., 619 Martinez-Arias, A., 482 Martinez-Lapater, J. M., 555 Maruyama, T., 564 Masamune, Y., 447 Mascara, T., 287 Mason, T. J., 253 Mathies, R. A., 415, 416, 422(11), 427(11, 13) Matsuda, F., 152 Matsuoka, J., 479 Matsuri, C., 471 Matthews, B. F., 471 Mattia, E., 622 Matzeit, V., 67, 68, 71,497, 500(52) Maung, T., 512 Maxam, A. M., 409 May, W. S., 619
671
Mayfield, S., 514, 515(69) Mazodier, P., 314 Mazurier, C., 557 Mazzara, G. P,, 558 Mazzara, G., 558 Mbayo, K., 557 McAllister, W. T., 81 McAusln, B. R., 559 McBride, L., 430 McCabe, D. E., 483, 484, 485, 494(11), 503(12), 506(12) McCabe, D., 619 McCafferty, J., 248, 251(25), 257(25) McClain, W. H., 173 McClanahan, T., 479 McClelland, M., 281 McClure, B. A., 456 McClure, J., 558 McClure, W. R., 81, 82(12), 164 McComb, R. B., 401 McCormick, J. B., 557 McCormick, S., 484 McCutchan, J., 619 McDougal, J. S., 620 McElligott, S. G., 485,487(44), 500(44) McElroy, D., 497 McEntee, K., 479, 481(11) McFadden, B. A., 536, 537, 545(1), 553(1, 11), 554(1, 11), 555(1) McGovern, K., 321 Mclnnes, J. L., 159 McKenney, K., 5 McKenzie, S., 558,563,572(54) McKenzie, T., 25 McKeon, F. D., 101 McKnight, G. S., 613 McLachlan, A., 338 McLachlin, J. R., 37, 39(17) McMillan, L., 618, 619(9) McMullen, M. D., 484 McMullin, T. W., 485, 494(37) McPherson, J., 67 McPherson, S. L., 555 McSwiggen, J. A., 81, 82(11) Mead, D. A., 232 Means, A. R., 113 Mechtler, K., 620, 622(38), 624, 627(44), 643 Meckish, G., 35 Medgyesy, P., 513 Meeker, R., 546
672
AUTHOR INDEX
Mege, E., 219 Mehnert, D., 303 Meissner, P. S., 233 Meister, S., 430 Melgon, D. A., 645 Mellon, P. L., 613 Melnick, J. L., 619 Melton, D. A., 127, 143,455 Mendel, R. R., 484 Menetret, J.-F., 8, 10 Mercer, S. R., 565 Mercer, S., 560 Merlino, G. T., 35, 42 Merlino, G., 45, 222 Mermod, N., 609 Merrick, W. C., 123 Messens, E., 66 Messing, J., 68, 70, 73(23), 82, 174,190, 193, 205(14, 22), 261,302, 335, 336(1), 337 Mets, J., 520 Mets, L., 514, 515(65), 517, 533 Meulien, P., 557 Meyer, F., 219 Meyne, J., 403 Meyrick, B., 651 Miceli, M. C., 597 Michaels, A., 513,514, 515(54, 75) Michel, M., 514, 515(67), 522(20), 528(20), 530(20) Mickley, L. A., 39 Miki, K., 564 Miller, A. D., 37, 581, 582, 583, 585, 587, 588(26), 594, 595,596, 597,598, 599(26) Miller, D. G., 595, 596 Miller, J. F., 237, 472, 473(42) Miller, J. H., 317, 320(12), 336 Miller, J., 283 Miller, M. D., 558 Miller, P. D., 471 Miller, R. H., 204 Milman, G., 463 Milne, A., 48 Milstein, C., 378, 379, 383(10), 392(10), 394(10), 395(10) Minton, N. P., 21 Mischler, F., 557 Mitchell, G. F., 558 Mitchener, J. A., 101 Miwa, M., 598 Miyada, C. G., 345, 346(13)
Miyake, T., 345, 346(12) Miyauchi, A., 32 Mizukami, T., 49 Mizusawa, H., 463 Mizutani, S., 644 Model, P., 229 Modich, P., 88 Modrich, P., 259 Moffat, B. A., 49, 82 Moffat, L. F., 55 Moffat, L. M., 604 Moffatt, B. A., 11,644 Mogg, A., 639 Monajembashi, S., 520 Montagnier, L., 638 Montague, P., 342 Montandon, A. J., 287 Moomaw, E., 407,412(26) Moore, C. A., 277 Moore, D. D., 3,473 Moran, P. A., 558 Morelle, G., 183 Morgan, W. D., 81, 82(11) Morgenstern, J. P., 585, 587(23) Morikawa, H., 471,479, 484, 485(15) Morin, C., 173,209 Morinag, Y., 173 Morioka, T., 32 Morisato, D., 233 Morita, M., 564 Moriuchi, T., 461 Morozov, I. Y., 133 Morris, R. E., 620 Morrish, F., 484, 497(13) Morrow, C. D., 557 Morrow, W. J. W., 619 Morton, W., 558 Mosley, S. L., 341,345(7) Moss, B., 48, 49, 557, 558, 559, 560, 561, 562, 563,564, 565 Moss, L. G., 337 Motzery, R., 513,515(54) Mount, D. W., 10 Moyzis, R. K., 403 Mueller, L., 597 Mueller, W., 219 Mui, F., 261 Muliado, H., 397 Mfiller, B., 484 Mtiller, R., 264
AUTHOR INDEX Muller-Eberhard, H. J., 598 Muller-Esterl, W., 325 Mulligan, R. C., 37, 463, 476(18), 477(18), 582, 585,586(3), 587(3, 11, 19) Mullis, K. B., 79, 103,218, 437 Mullis, K., 83,271,302,478,481(2) Murphy, O. J., 399, 402(7) Murphy, R. F., 345 Murray, A. W., 482 Murray, N. E., 363,364 Murray, N., 351,364 Murzina, N. V., 134 Muthukrishenen, S., 648 Muzny, C. T., 287 Muzyczka, N., 209 Myers, A. M., 510, 532(9) Myers, L. C., 91 Myers, L., 88
N Nacheva, E., 379 Nagamine, C. M., 291 Nagarajan, V., 31 Nagata, K., 618 Nagata, T., 552 Nagy, F., 67 Naito, T., 152 Nakagawa, K., 25, 32 Nakamaye, K. L., 190, 199, 202(8), 215(8), 281 Nakamura, G., 620, 625 Nakamura, M., 618 Nakano, E., 560 Nakatani, Y., 77 Nara, P., 557 Narayanan, R., 462 Nash, H. M., 91 Nathan, D. G., 463,476(18), 477(18) Nathans, D., 209, 219, 566 Natsoulis, G., 303, 306(9) Neff, N. F., 305, 311 Neidhardt, F. C., 79 Nelson, D. L., 253 Nelson, F. K., 237 Nelson, M., 281 Nelson, R. M,, 173, 227 Neriah, Y. B., 35 Neumann, E., 461,462,466(2), 618
673
Neuner, A., 97 Newman, S. M., 510,511,513,514, 515(11, 16, 45, 46, 47), 516(11, 16, 45, 46), 517, 518(11, 16, 45), 519, 522(45), 523(11, 45), 524(16), 525(16, 45), 526(11, 16), 527(11, 16, 45), 528(46, 47), 530(46L 532(46), 534(45, 46), 537, 556 Nicklen, S., 95 Nickolson, M., 585, 587(13) Nicolas, J. F., 639 Nicolau, C., 618, 619(6) Nie, Z. Q., 519 Nielsen, B. L., 485, 494(38), 537, 546, 547(9), 548(9), 549(9), 552, 553(9), 554(9) Nielsen, E. A., 168 Nielsen, L., 325 Nielsen, P. E., 414 Niemela, S. L., 204 Nienhucs, A. W., 126 Nigon, V., 585,587(18) Niles, E. G., 49 Nilsson, S. V., 209 Nirenberg, M. W., 123 Nishizawa, M., 619 Nitschko, H., 645, 654(8) Nizetic, D., 352 Nokins, A. L., 565 Nolan, G. P., 639 Noller, H. F., 91 Noma, Y., 152 Nomura, M., 310 Nordmann, P. L., 315,318, 319 Noren, C. J., 142 Northrop, J. P., 464, 600, 618,619(11), 645, 653(6), 654(6) Nossal, N~ G., 182,260, 457 Notkins, A. L., 557 Novick, P., 304, 310(12), 482 Nunes, W., 625
O O'Brien, J. V., 484,488(14), 494(14), 497(14) O'Neill, C., 513 Oard, J. H., 484 Oberlin, R., 414 OdeU, J. T., 67 Oelmuller, R., 536
674
AUTHOR INDEX
Ogren, W. L., I0, 11 Ogur, M., 303 Ohasa, O., 103 Ohmayer, A., 182 Ohtani, K., 618 Ohyama, K., 556 Okada, H., 598 Okayama, H., 618 Okruszek, A., 190, 193(16), 198, 258, 281 Oldstone, M. B., 598 Oliver, D. B., 321 Oliver, J. C., 555 Olsen, D. B., 173, 190, 198, 199, 205(10), 209(10), 215(10), 216(10), 258 Olson, M. V., 358, 431 Oostra, B. A., 173, 174(4) Openshaw, H., 557 Oram, J. O., 21 Oren, P., 285 Orlandi, P. A., 102 Orozco, E. M., 10, 11 Orr-Weaver, T. L., 303 Ortlepp, S. A., 132, 133 Orum, H., 13, 14(4), 21(4) Osborne, W. R. A., 583, 585(9), 594, 596, 597 Osmond, B., 512 Osmond, C. B., 513, 528(41), 532, 534(35, 41, 102) Osterlund, M., 209 Ott, J., 190, 258 Otten, A. D., 613 Ou-Lee, T. M., 471 Ourednicek, 436 Overgaard-Hansen, K., 260 Ovodov, S. Y., 123, 128(9), 131(9) Ow, D. W., 67 Ozkaynak, E., 479
P Paddock, G. V., 341,342, 346(5) Padgett, R. A., 146 Padmanabhan, R., 38, 224 Pae, R., 431 Pagano, J. S., 619 Paige, D. F., 484 Palmenberg, A. C., 143, 150 Palmer, J. D., 510, 516, 517(10)
Palmer, T. D., 582,597 Palumbo, G. J., 564 Pan, Y. E., 253 Panganiban, L. C., 228, 231 Panicali, D. L., 558, 564 Panicali, D., 558, 560, 560, 563, 564, 565, 572(54) Panicalli, D., 48 Panniers, R., 123 Paoletti, E., 48, 558, 560, 561,563, 564(44, 45), 565 Papahadjopoulus, D., 618, 619(5) Parekh, S. M., 190 Parker, R. C., 209, 219 Parks, G. D., 143 Parmley, S. F., 228, 245(2), 251(2) Parnes, J. R., 597 Parry, D. A. D., 8 Parsons, J. T., 160 Passarge, E., 348 Pastan, I. H., 37, 39(17) Pastan, I., 34, 35, 36, 37, 38, 39(10, 15, 19), 42, 43(15), 44(5), 45, 46, 47, 222 Paszty, C., 498 Patel, D. D., 562 Patel, L., 277 Patterson, T. A., 164 Patzer, E., 620, 625 Paul, J., 342 Pavirani, A., 557 Pavlakis, G. N., 48 Payne, L. G., 561,565(48) Payne, L., 559 Payne, M. E., 113 Payne, W. L., 341,345(7) Peacock, M. G., 336 Pearlberg, J., 609 Pease, L. R., 220, 271, 272(3), 273(3), 274(1), 276(2), 277, 279(1) Peck, K., 415,416, 422(11), 427(11, 13) Pelcher, L. E., 497 Penning, L. C., 462 Percival, K. J., 432, 434(4) Perez-Mutul, J. P., 619 Perez-Mutul, J., 600, 612(3), 615(3) Perham, R. N., 231,232,233(13) Perkins, A., 253 Perkus, M. E., 558,561,563(47), 565(47) Perlak, F. J., 555 Perno, C.-F., 620
AUTHOR INDEX Perry, R. P., 157 Pestka, S. B., 99, 105 Pestka, S., 105 Peters, E. A., 228, 231,233(5), 245(5) Pettersen, R. F., 644 Pettersson, U., 146, 150(14) Pflugfelder, M., 73, 188 Pfordt, M., 10 Phillips, C. L., 101 Phillips, L. R., 197 Phillips, St., 643 Pickup, D. J., 562 Piecchaczyk, M., 617 Pierre, Y., 514, 515(70) Pietrzak, M., 67 Pilus, L., 308 Pilwat, G., 461 Pirrotta, V., 368 Pister, K., 533 Pittius, C. W., 608 Plank, Ch., 643,644 Platzer, M., 47 Plugfelder, M., 258 Podlaski, F. J., 253 Pohl, A. P., 347 Pohl, H. E. W., 325 Pohl, T. M., 359, 377(3) Pollack, R. E., 173 Pollard-Knight, D., 399 Poncet, D., 585,587(18) Ponzone, A., 287 Porter, C., 557 Posen, S., 401 Postle, K., 314 Potter, B. V. L., 217 Potter, H., 461,466(4), 469, 472(4) Poulsen, L. K., 13, 14(4), 21(4) Poustka, A., 347, 348, 350(2), 351, 352, 354(1), 355(1), 356(1), 358, 359, 361(5, 6), 363(5), 364, 377(3, 5, 6), 397 Pouwels, P. H., 12 Pratt, D., 239 Prefontaine, G., 337 Prenger, J., 253 Price, E. R., 101 Prodmore, R. D., 337 Prols, M., 71, 73(26), 75(25) PrzibiUa, E., 513,515(40), 522(40), 533(40) Ptashne, M., 82, 91(19) Ptitsyn, O. B., 142
675
Puckett, C., 562 Puissant, C., 109 Pullen, J. K., 220, 271,274(1), 276(2), 277(1, 2), 279(1) Purcell, R., 557 Pyke, K. A., 516 Q Quatrecasas, P., 619 Quesada, M. A., 415,416, 427(13) Quigley, M., 178 Qureshi, J., 484
R Rabbitts, P. H., 391 Rabbitts, T. H., 391 Rabbitts, T., 396 Rabert, D. K., 510, 516(6), 518(6), 522(6), 534(6) Rabson, A. B., 277 Rackwitz, H. R., 352, 397 Radtke, J., 399 Radwanski, E. R., 512, 523(25) Raft, M., 430 Rafferty, U. M., 325 Ragsdale, C. W., 237, 283,472,473(42) Rahire, M., 513, 514, 515(44, 70, 73), 517, 533 Ramachandran, K. L., 399, 402(7), 404, 407(25), 413(7) Randolph-Anderson, B. L., 485, 494(34), 510, 511, 513, 514, 515(1, 16, 45), 516(16, 45), 517(16, 45), 518(1, 16, 45), 520(1), 522(45), 523(45), 524(1, 16), 525(1, 16, 45), 526(1, 16), 527(16, 45), 529, 534(45, 46), 537, 555(4), 556(4, 8) Rao Movva, N., 73 Rao, K., 622 Raptis, L., 469 Rasmussen, J. L., 484,489(31), 491,494(31), 498(46, 47), 500(31) Ratliff, R. L., 403 Rauscher, F. J., III, 277 Rawlings, D. J., 296 Rawlins, D. J., 462 Rawlins, D. R., 209
676
AUTHOR INDEX
Ray, C. A., 562 Razzaque, A., 463 Reagan, K. J., 557 Rebagliati, M. R., 127, 143,455 Regan, J. B., 197 Reid, L., 478 Reimann, F., 461 Reinberg, D., 77 Reinhard, D. H., 36 Reis, A., 219 Reiss, B., 314, 497 Remaut, E., 4, 5,258 Renz, M., 625 Resnick, M. A., 311 Reveil, B., 557 Reznikoff, W. S., 314, 315, 316, 317(11), 318, 319 Rhode, B. W., 585, 587(22) Riccio, A., 5 Rice, C. M., 564 Rice, T. B., 484, 488(14), 494(14), 497(14) Richards, J. H., 173,209 Richards, K. C., 537,556(7) Richards, K. L., 513, 515(50), 520(50), 523(50), 528(50) Richardson, C. C., 82, 87(21), 184, 185(38), 197, 250, 260, 285, 447 Richert, N. D., 47 Riedy, M., 485,487(44), 500(44) Riggs, A. D., 56, 173, 209 Riggs, M. G., 338 Ringold, G. M., 464, 600, 618,619(11), 645, 653(6), 654(6) Risman, S. S., 81 Roberts, B. E., 561,564, 565(48) Roberts, B., 559, 560, 619 Roberts, D. E., 233 Roberts, J. D., 189, 258,281 Robertson, D., 485, 494(34), 510, 511(1), 514, 515(1, 71), 518(1), 520(1), 524(1), 525(I), 526, 537, 555(4), 556(4) Robertson, K. A., 597 Rochaix, J. D., 556 Rochaix, J.-D., 484, 494(30), 512, 513, 514, 515(44, 67, 68, 69, 70, 73), 517, 520, 522(20), 528(21, 23), 530(21, 20, 23), 533 Rodda, S. M., 253 Rodrigues, N. R., 286 Rodriguez, J. F., 561 Rodriguez, R. L., 302
Roeder, R. G., 455 Roeder, R., 77 Roffey, R. A., 512 Rogarad, L., 523,528(94) Rogers, S. G., 67, 202, 203(29) Rohrmann, G., 559 Roitgrund, C., 514, 515(65) Rolf, J. M., 620 Rols, M. P., 469 Roman, R., 464, 600, 618, 619(11), 645, 653(6), 654(6) Rommens, J. M., 397 Roninson, I. B., 34, 38, 45 Roovers, E., 462 Roques, B. P., 414, 422(9) Rose, M. D., 482 Rose, R. J., 516 Rosenberg, A. H., 49, 105, 114(17), 115(17), 116(17), 118(17) Rosenberg, M., 5 Rosenthal, A., 380 Rosman, G. J., 583, 585(8), 587(8) Ross, J., 105 Ross, M. E., Ross, M., 484 Roth, B. A., 484 Roth, J., 277 Rothstein, R. J., 303 Rothstein, R., 308 Rothstein, S. J., 314 Rourke, A. W., 123 Roux, P., 617 Roy, M. K., 484, 486, 487(45), 488(19), 494(19), 501,502(19), 503(55) Royer, G. P., 413 Royhudhury, R., 159 Rozhon, E. J., 144, 145(11), 150 Rubin, C. M., 409, 411(28) Rubin, L. A., 253 Ruby, S. W., 482 Ruddle, F. H., 618 Rudolph, R., 8 Rueckert, P. R., 151 Russel, M., 229 Russell, D. W., 619 Russell, J. A., 484, 486, 487(45), 488(19), 491,492, 494(19), 498(46), 501,502(19), 503(55) Ruth, J. R., 407, 412(26) Rutherford, A. V., 37, 39(15), 43(15)
AUTHOR INDEX Rutter, W. J., 337, 597 Ryabova, L. A., 123, 128(9), 131(9), 132 Rye, H. S., 415,416, 427(13) Rymo, L., 160 S Sacchi, N., 450 Sacci, N., 109 Saelinger, C. B., 620 Saglio, G., 287 Saiki, R. K., 79, 103, 173, 218,219, 279 Saiki, R., 83 Saito, S., 618 Sakaki, Y., 184 Sakamoto, W., 512, 513,515(56) Salaun, J., 557 Saleeba, J. A., 292 Salminen, A., 39 Salzberg, A., 447,456(5) Samarut, J., 585,587(18, 24) Sambrook, J., 3, 6(1), 18, 27, 29(13), 47, 48, 68, 105, 109(19), 110(19), 113(19), 114(19), 116(19), 117(19), 144, 148(12), 156, 204, 222, 223(18), 224(18), 235, 236(19), 237(19), 279, 283, 290, 340, 341(2), 342(3), 346(2), 384, 451,523 Samsonoff, C., 560, 564(44) Sanders, P. R., 67 Sandhu, G. S., 277 Sandig, V., 50, 58, 62(36), 66 Sanford, J. C., 464, 483, 484, 485, 486, 487(32, 44, 45), 488(19), 489(31, 32), 491,492, 494(2, 6, 19, 32, 33, 34, 35, 37, 38, 39), 495(32), 496(32), 497(5), 498(32, 35, 46, 47), 500(31, 32, 33, 39, 44), 501(39), 502(32, 19), 503(55), 508(32), 510, 511, 514(1), 515(1), 518(1), 520(1, 2), 523, 524(1), 525(1), 526(1), 528(94), 536, 537, 546(10), 547(9), 548(9, 10), 549(9), 552, 553(9, 10), 554(9), 555(4), 556(4, 5) Sanger, F., 95 Santi, D. V., 79 Saran, B. R., 204 Sarkar, G., 277 Sartorelli, A. C., 462 Sarver, N., 48 Sasakawa, C., 315
677
Sasaki, T., 24, 25(6) Sashiyma, H., 564 Sasso, D. R., 557 Sassone-Corsi, P., 607, 609 Sato, T., 23,556, 564 Saulino, A., 105 Saunders, J. A., 462, 471 Savatier, P., 585,587(18, 24) Savtchenko, E. S., 173 Sayer, R. T., 516 Sayers, J. R., 190, 193, 198, 199, 202(9), 203(9), 258 Sayre, R. T., 512 Scangos, G. A., 618 Schaaf, S., 483,484, 497(5) Schaal, S., 75 Schaap, A. P., 399 Schaeer-Ridder, M., 461,466(2) Schaefer, M., 618 Schaefer, S., 497, 500(52) Schaller, H., 314, 497 Scharf, S. J., 87, 218 Scharf, S., 79, 83, 103 Schatz, P. J., 308, 309 Schein, C. H., 100 Scheinman, R., 430 Schell, J. J., 220 Schell, J., 66, 71, 73, 75(25), 497, 500(52), 554 Scherer, G., 368 Scherer, S., 302, 481 Schimmel, P., 101 Schirmer-Rahire, M., 514, 515(67), 515(69), 522(20), 528(20), 530(20) Schlesinger, J., 513,514, 515(54, 75) Schlesinger, S., 645,654(8) Schlumperli, D., 5 Schmid, C. W., 409, 411(28) Schmidt, S. P., 399 Schmidt, W., 190, 193(16), 198, 199, 202, 258, 281 Schneider, C., 95 Schneider, E., 437, 440(6), 443(6) Schneider, M., 484,494(30), 520 Schneider, T. D., 81 Schneider, W. J., 619 Schnell, R. A., 535 Schold, M., 173 Schon, E. A., 455 Schore, N. E., 399
678
AUTHORINDEX
Schrader, S., 513,533(42) Schreiber, S. L., 79, 80(2), 84(2), 86(2), 88, 89(2), 92(2), 93(2), 101 Schubert, D., 453 Schughart, K., 258 Schuldiner, A. R., 277 Schulga, A. A., 142 Schultz, P. G., 142 Schulze, J., 484 Schuster, G. B., 399 Schuster, G., 399 Schwartz, J., 144, 145(11), 150 Schwartz, O., 638 Schwartz, R. J., 456 Schweiger, M., 123, 127(2) Schwer, B., 559 Scott, J. K., 228 Scott, K., 230 Scott, L. A., 105,277 Scrutton, M., 462 Sczakiel, G., 4, 8, 10 Seals, C., 253 Searle, S., 347 Sears, B. B., 510, 516(6), 518(6), 522(6), 534(6) Sears, R. G., 541 Secemski, I. I., 157 Sedat, J. W., 412 Seed, B., 233,351,361,363, 379 Seehaus, T., 231,232, 248(10) Seidman, J. G., 3,473 Seidman, M. M., 463 Seki, M., 564 Seki, T., 461 Selman, B. R., 535 Selvaraj, G., 497 Sentenac, A., 310 Sernatinger, J., 598 Serrano, L., 190 Severinson, E., 152 Shaffer, J., 345 Shallcross, M. A., 337 Shapira, S. K., 482 Shapiro, D., 622 Shapiro, S. G., 455 Shark, K. B., 484, 485, 489(31), 494(29, 31, 34, 35), 497(29), 498(29, 35), 500(29, 31), 510, 511(1), 514(1), 515(1), 518(1), 520(I), 523, 524(1), 525(1), 526(1), 528(94), 537, 555(4), 556(4, 5)
Shark, K., 485, 494(36) Sharp, P. A., 48, 146 Sharp, P. M., 4 Sharpe, S. D., 478 Shatkin, A. J., 151,648 Shavit, N., 513,514, 515(54, 75) Shaw, G., 590 Shaw, J., 4 Shaw, P. J., 462 Sheardy, R. D., 414 Sheen, J., 471,472(39, 40) Sheldon, C. C., 65 Shell, J., 67 Shen, G.-J., 101 Shen, J. B., 10, 11 Shen, L., 558 Shen, S.-H., 173 Shen, W., 262, 270(28) Shen, W.-Y., 262 Shen, Z., 558 Shepherd, H. S., 510, 516(6, 8), 518(6), 522(6), 534(6) Shepherd, R., 68, 70(22) Sherman, F., 303 Sherrington, P., 379, 391 Shewchuk, L., 94 Shida, H., 564 Shillito, R. D., 67 Shimamoto, K., 329 Shimasaki, C., 620, 625 Shortle, D., 209, 219, 280, 304, 310(12) Shreiber, S. L., 91 Shuldiner, A. R., 105 Shuster, S. M., 462 Shyamala, V., 437, 440(5, 6), 441(5), 442(5), 443(3, 5, 6), 445(5) Sideras, P., 152 Siegel, E. C., 183 Silhavy, T. J., 12 Silver, J., 102 Silvera, P., 557 Simmonds, A. C., 399 Simmonds, J. A., 484 Simon, J. R., 479, 481(11) Simons, G., 5 Simpson, L., 4 Singer, L. A., 400 Singer-Sam, J., 56 Sinos, C., 563,572(54) Sisk, W. P., 233
AUTHOR INDEX
679
Spiess, M., 143,619, 620(28) Sisson, J. C., 607 Spiliotes, A. J., 48 Sivasubramaniam, S., 67 Spirin, A. S,, 123, 128(9), 131(9), 133 Sive, H. L., 159 Spoasman, J. D.~ 326 Skingle, D. C., 159 Sporlein, B., 537 Skoglund, C. M., 79 Spreitzer, R. J., 514, 515(73) Slater, A. A., 342 Spritz, R. A., 48,227 Sleat, D. E., 67, 141 Spun', N., 391 Sieeter, D. D., 91 Spyropoulos, D., 564 Sletten, M., 483,497(5) Sridhar, R., 559 Slezak, T., 430, 431 St. John, T., 159 Slighton, J. L., 484 Staden, R., 259 Slilaty, S. N., 173 Staebell, M,, 484 Sloniewsky, A. R., 413 Staehehn, T., 122 Smart, E. J., 535 Stahl, F. W., 153 Smith, A. E., 173, 174(4) Sta|handske, P. K., 146, 150(14) Smith, B., 347 Stallard, V., 558,561,565(48) Smith, D. H., 620 Standaert, R. F., 101 Smith, D., 625 Smith, F. D., 484, 486, 487(32, 45), 489(31), Stanssens, P., 4, 5 494(31, 32), 495(32), 496(32), 498(32), Starkey, J. R., 462 Starlinger, P., 75 500(31, 32), 502(32), 508(32) Start, W. G., 484, 488(14), 494(14), 497(14) Smith, G. E., 48 Smith, G. L., 48,557,558,559,560, 561(33), Staub, J. M., 537, 554(13), 55503) Staub, J., 513, 517(60, 61), 518(60, 61), 563(33), 564(43), 565 528(60, 61) Smith, G. P., 228,229,230,231,237,245(2), Steinbiss, H.-H., 67, 71, 73, 75(25) 251(2) Steinlein, P., 620, 621(37), 622(37), 643 Smith, H. O., 79 Smith, J. A., 3,473 Steinmetzer, H.-C., 399 Smith, K. A., 561,565(48) Stemler, A., 533 Smith, K. B., 484, 489(32), 494(32, 33), Stern, D. B., 512, 513, 515(50), 520(50), 495(32), 496(32), 498(32), 500(33) 523(25, 50), 528(50), 537, 556(7) Stern, D., 513,515(56) Smith, M., 189, 219, 258 Smithies, O., 92,477,478 Stern, R. H., 341 Sninsky, J. J., 79, 103 Sternberg, N., 358 Soda, K., 173 Sternberg, P. W., 287 Soen, S. Y., 556 Stetter, K. O., 97 Soen, S.-Y., 513, 515(51), 516(51), 522(51), Stewart, S., 481 530(51), 532(51) Stiegler, P., 187 Stinchcomb, D. T., 302,481 Sokoloski, J. A., 462 Solomon, F., 308, 309, 310 Stinson, M. A., 342 Sommer, S. S., 277 Stofel, S., 218 Stoker, A. W., 585,587(14) Sommer, W., 50 Stokschlaeder, M. A. R., 583, 585(9) Sorge, J., 585,587(16) Storb, R., 583,585(9) Sotti, P., 151 Stormo, G. D., 81 Southern, E. M., 45, 380, 404 Stotland, E., 337 Southern, P. J., 61 Stott, J., 557 Sowers, A. E., 462 Sparks, A., 400 Strathern, J. N., 311 Spencer, T. M., 484, 488(14), 494(14), Strating, J., 399 Straus, J. W., 123, 127(7) 497(14)
680
AUTHOR INDEX
Strauss, J. H., 564 Strauss, M., 47, 49, 51(23), 53, 54, 56(31), 58, 62(36), 64, 66, 187 Streubel, M., 537 Streuli, C. H., 187 Struhl, K., 3, 302,473,481 Stryer, L., 620 Stubbs, J. D., 126 Studier, F. W., 11, 49, 82, 105, 114(17), 115(17), 116(17), 118(17), 644 Studier, W. F., 81 Stunnenberg, H, G., 559 Sturm, N., 513, 515(56) Subramani, S., 58, 632, 647 Sueoka, N., 25 Sugamura, T., 618 Sugden, B., 477 Suggs, S. V., 345, 346(12) Sugimoto, M., 173,564 Sullivan, F. X., 101 Sullivan, J. L., 558 Sullivan, M., 35 Sulston, J. E., 380 Sulston, J., 431 Summers, M. D., 48, 101 Sunjevaric, I., 173 Sussman, D. J., 463 Sussman, H., 622 Suzuki, J. Y., 513,515(52, 53), 530(52, 53) Suzuki, K., 564 Suzuki, Y., 32, 174 Svab, Z., 483, 485, 513, 520(57), 537, 554(12), 555(12) Svetlik, P., 253 Svoboda, 436 Swain, W. F., 483,484,485(11, 12), 494(11), 503(12), 506(12) Symons, R. H., 65, 159 Syvanen, M., 314, 315 Szostak, J. W., 303,482
T Tabor, S., 82, 87(21), 99, 184, 185(38), 197, 250, 260 Tahtakran, S., 512 Takagi, H., 23, 32 Takahashi, W., 25, 29 Takahashi, Y., 512, 513, 515(51), 516(51),
522(51), 528(21, 23), 530(21, 23, 51), 532(51), 556 Takahashi-Nishimaki, F., 564 Takao, M., 24, 25(6), 32 Takeda, Y., 552 Taketo, A., 204 Talmadge, K., 143 Tamiya, E., 479 Tanabe, T., 152 Tanaka, H., 173,598 Tanaka, S., 46, 173 Tanaka, T., 25 Tanguay, R. L., 56 Tanner, K., 277 Tapscott, S. J., 596 Tavassoli, M., 624 Taylor, J. W., 19, 190, 193(16), 198,258,281 Taylor, J., 563 Taylor, L. P., 471 Taylor, L., 478 Taylor, S. I., 219 Teissie, J., 469 Tekle, E., 465, 477(29) Telford J., 368 Temin, H. M., 582, 585,587(4, 22) Teppke, M., 54, 56(31) Terhorst, C., 379 Terranova, M. P., 79, 80(2), 84(2), 86(2), 88, 89(2, 29), 91, 92(2), 93(2), 96(29) Terry, B. J., 88 Teubel, W. J., 48 Tewari K. K., 485, 494(38), 537, 546, 547(9), 548(9), 549(9), 552, 553(9), 554(9) Theodorakis, N., 455 Thiebaut, F., 47 Thoen, C., 73 Thomas G. P., 325 Thomas G. T., 557 Thomas J. H., 305, 310(14), 311,482 Thomas J. L., 585, 587(18, 24) Thomas J., 484, 497(13) Thomas K. R., 463,477(24) Thomas M. R., 516 Thomas P. S., 45 Thompson, A. J., 512, 520(28) Thompson, A. R., 597 Thompson, C., 73 Thoraval, P., 585, 587(18, 24) Thorpe, G. H. G., 414
AUTHOR INDEX Thyer, M. J., 596 Tiemeier, D., 153 Timmis, K. N., 321 Tinoco, I., 284 Titomirov, A. V., 485,500(41) Tizard, R., 399,402(7) Tochikura, T., 564 Togasaki, R. K., 533 Tomes, D. T., 484 Tomes, D., 483,497(5) Tomic, M., 173 Toneguzzo, F., 477 Toney, M. D., 99, 173 Toniolo, D., 358 T6pfer, R., 67, 71, 73, 75(25) Torczynski, R. M., 345,346(10) Towbin, H., 122 Townsend, J., 71 Traas, J. A., 462 Tracy, S., 146, 150 Traktman, P., 559 Trauber, D. R., 587,588(26), 599(26) Traver, C. N., 432, 435(7), 436(7) Trebst, A., 513,515(40), 522(40), 533(40) Treger, J. M., 479 Treiger, B. F., 253 Treissman, R., 126 Trent, D. W., 173, 181(9) Troen, B. R., 36, 39(10) Trueheart, J., 303, 306(9) Tsien, W., 253 Tsuboi, A., 24, 25(6) Tsuboi, S., 24 Tsukagoshi, N., 23, 24, 25, 27, 29, 32 Tsuruo, T., 38, 46, 47 Tucker, J., 4, 5 Tullis, R. H., 407, 412(26) Turgeon, R., 471 Turner, P. C., 67, 141 Turro, N. J., 399 Twell, D., 484 Tyagi, J. S., 45 Tzagoloff, H., 239
U Uchida, T., 618, 619(10) Uchihi, R., 24 Udaka, S , 23, 24, 25, 27, 29, 32
681
Ueda, K., 34, 35, 36, 37, 39(10, 15, 17), 43(15), 45, 46 Uhlenbeck, O. C., 284 Ukada, S., 32 Uno, Y., 315 Upcroft, P., 295 Uteregger, G., 399
V Vallette, F,, 219 Vallon, O., 513,515(55) Van Boom, J. H., 442 Van Boom, J., 258 van de Putte, P., 48 van den Elzen, P. J. M,, 71 van der Eb, A, J., 42, 619 Van der Eb, A., 54, 463 Van der Kaay, J., 462 van der Weft, S., 644 Van Haastert, P. J., 462 Van Lookeren Campagne, M. M., 462 Van Montagu, M. C., 67, 471 Van Montagu, M., 66, 73,554 Van Ness, J., 160 Van Straaten, F., 264 Van Veveren, C., 264 Vande Woude, G. F., 359 Vandewiele, M., 73,554 Vandeyar, M. A., 174, 281,282(5) VanLeeuwen, D., 455 Varshavsky, A., 479 Vasil, I. K., 67, 77(14) Vasil, V., 67, 77(14) Vass, ,I. K., 342 Vasser, M., 82, 91(18) Veeneman, G. H., 442 Veillette, A., 597 Velten, J., 71 Venkatesan, S., 558 Verdier, G., 585,587(18) Verdine, G. L., 79, 80(2), 84(2), 86(2), 88, 89(2, 29), 91, 92(2), 93(2), 96(29), 101 Verhoeyen, M. E., 258, 265(4), 270(4) Verma, I. M., 37, 264, 476, 585, 587(12), 645,650(7), 653(7) Verma, I., 607 Versalovic, J., 287 Vershon, A. K., 101
682
AUTHOR INDEX
Vieira, J., 70, 73(23), 82, 190, 205(14), 302, 335, 336(1), 337 Vinograd, J., 209, 219 Virelizier, J., 638 Visca, P., 559 Vivekananda, J., 485, 494(38), 537, 547(9), 548(9), 549(9), 552, 553(9), 554(9) Volgelstein, B., 111, 113(23) Volinia, S., 347 von Hippel, P. H., 81, 82(11) yon Ruden, T., 582 yon Suhr, N., 585, 587(25), 595(25) Voorma, H. O., 126 Vos, J. C., 559 Voyta, J. C., 399, 400, 401(19), 402(7), 413, 414 Vries, M. V., 442 Vu, L., 310 W Waddell, J., 519 Wagner, E., 620, 621, 622(37, 38), 624, 625(36, 39), 627(36, 44), 632(36), 633(36, 39), 643, 644 Wagner, R. R., 558 Wakelin, L. P. G., 414 Walbot, V., 67, 471 Wallace, M. R., 348 Wallace, R. B., 173,345, 346(12, 13) Walsh, C. T., 88, 101 Wane, J., 557 Wang, A. M., 103 Wang, C.-Y., 618, 619(8) Wang, J. C., 310 Wang, L., 326, 334(9), 335(9) Wang, X.-M., 519 Wang, Y., 461,466(2), 618 Wang, Y.-C., 483 Ward, D. C., 399, 403(2) Waring, M. J., 414 Warren, S. T., 358 Wasley, L. C., 48 Wasmuth, J. J., 347 Watanabe, S., 582, 585(4), 587(4) Waterman, M., 431 Waterson, R. H., 380 Waterson, R., 431 Watkins, B., 430
Watson, R. M., 209, 219 Watts, J. W., 67, 141 Watts, J., 462 Way, J. C., 233 Waye, M. M. Y., 258, 261, 262, 265(4), 270(4, 28) Weaver, R. F., 453,455(11) Webb, J., 285 Webb, N. R., 101 Webber, A. N., 512, 513, 515(43) Weber, G., 520 Weber, H., 219 Weeks, D., 123 Wefel, R., 189 Wei, C. M., 559 Weickmann, J. L., 173 Weinberg, R., 563 Weiner, A. M., 4 Weiner, M. P., 174, 281,282(5) Weinreich, M., 315, 319, 320(16) Weinstein, B., 310 Weinstock, G. M., 12 Weintraub, H., 596 Weir, L., 461,466(4), 472(4) Weisblum, B., 25 Weiss, B., 202, 203(29), 645, 654(8) Weiss, R. A., 620 Weissbach, A., 553 Weissinger, A. K., 484 Weissinger, A., 483,497(5) Weissman, C., 160 Weissman, S. A., 445 Weissman, S. M., 48, 350, 360 Weissmann, C., 219, 453,455(11) Wells, J. A., 231,232, 248(11), 256(11) Welsh, R. M., Jr., 598 Wendler, A., 199 Wensink, P. C., 341 Wenz, M., 464, 600, 618, 619(11), 645, 653(6), 654(6) Wen', W., 67, 75, 77(12), 78(12) Westhoft, P., 537 Westmorelnd, J., 311 Westphal, H., 49 Whalen, W., 82 White, T. J., 103,436 Whitelegge, J., 512 Wick, R. A., 412 Wiegand, T., 318 Wieringa, J. H., 399
AUTHOR INDEX Wieslander, L., 179 Wiessel, M.-L., 557 Wiktor, T. J., 557 Wildner, G. F., 512 Wilis, A. E., 232 Willetts, N. G., 484, 488(14), 494(14), 497(14) Willey, D. E., 557 Williams, D. A., 463,476(18), 477(18) Williams, J., 627 Williams, P., 619 Williams, R. S., 485, 500(42) Williams, R., 484, 487(44), 497(13) Willingham, M. C., 35, 37, 39(15), 42, 43(15), 47 Willingham, M., 38, 222 Willis, A. E., 231,233(13) Wilson, A. C., 436 Wilson, C., 585,587(25), 595(25) Wilson, J., 623 Wilson, K. J., 120 Wilson, S. H., 297 Wilson, S., 48 Wilson, T. M. A., 67, 141 Wilson, W. D., 414 Wimmer, E., 141, 150, 644 Winger, G., 261 Winslow, J. P., 558 Winter, G., 174, 189, 204, 248, 251(25), 257(25), 258, 259(2), 262(2), 265(4), 270(4) Wirth, M., 53 Wirtz, U., 497, 500(52) Wisniewski, R., 585, 587(22) Witney, F., 176, 260 Wittek, R., 558, 559, 560, 563(24) Wittekind, M., 310 Wittinghofer, A., 4, 8, 10 Wittwer, C. T., 278 Woessner, J. P., 526 Wolber, V., 8 Wolbot, V., 478 Wolf, E. D., 464, 483, 485(1), 494(2), 510, 511(2, 3), 520(2, 3) Wolff, J., 619 Wolfrum, J., 520 Wollman, F.-A., 513, 514, 515(55, 56, 72), 516 Wondisford, F. E., 219 Wong, C.-H., 101
683
Wong, K., 261 Wong, T. K., 461 Woo, S. C., 67 Wood, K. V., 58, 632, 647 Wood, W. B., 233 Woodhead, J. L., 210 Woodley-Miller, C., 326, 334(9), 335(9) Wright, D., 585, 587(16) Wright, P. J., 10, 287 Wright, R. G. M., 414 Wright, R., 645,654(8) Wu, C. H., 623,625(42) Wu, C., 623 Wu, G. Y., 623,625(42) Wu, G., 623 Wu, J. R., 403 Wu, M., 519 Wu, R., 159, 464, 471,483, 494(2), 497, 510, 511(2), 520(2) Wunner, W. H., 557 Wurtz, E. A., 510, 511, 516, 518(6), 522(6, 15), 524(15), 534(6) Wychowski, C., 102 Wylie, D. E., 462 Wynberg, H., 399, 400 Wysk, M., 399,402(7), 413(7)
X Xiong, W., 326, 334(9), 335(9) Xu, R., 513, 515(43) Y Yamada, H., 23,479 Yamada, Y., 471,479, 484,485(15), 556 Yamagata, H., 23, 24, 25, 27, 29, 32 Yamaguchi, K., 25, 29 Yamamoto, T., 77 Yamanaka, M. Y., 102 Yamgata, H., 32 Yang, A. Y., 325 Yang, N. S., 484, 485 Yang, N.-S., 619 Yang, S., 585,587(22) Yanisch-Perron, C., 70, 73(23), 82,302, 335, 336(1), 337 Yaniv, M., 639
684
AUTHOR INDEX
Yanowsky, C., 4 Yaoita, Y., 152 Yarchoan, R., 620 Yashikawa, M., 315 Yasuda, T., 552 Yates, J., 477 Ye, G. N., 484,485,494(29, 38, 39), 497(29), 498(29), 500(29, 39), 501(39), 537, 546(10), 547(9), 548(9, 10), 549(9), 552, 553(9, 10), 554(9, 10) Ye, J., 516 Yee, D., 463 Yekta, A., 399 Yeun, L., 559 Yin, J. C.-P., 314, 315 Yon, J., 279 Young, R. A., 152, 325 Yu, C. Y., 378, 380, 383(10), 392(10), 394(10), 395(10) Yu, S. F., 582 Yuan, R., 259 Yuckenberg, P., 176, 260
Z Zagury, D., 557 Zakour, A., 281
Zakour, R. A., 189, 219, 258 Zarling, J. M., 558 Zatloukai, K., 643,644 Zawadske, L. E., 101 Zeheb, R., 325 Zehetner, G., 347, 397 Zelenin, A. V., 485, 500(41) Zelenin, A., 484 Zenke, M., 620, 621(37), 622(38), 624(36), 625(36), 627(36), 632(36), 633(36) Zhang, W., 497 Zhao, L.-J., 224 Zhen, W., 414 Zheng, Q., 465, 477(28) Zhu, G., 512 Zimmer, M., 347 Zimmerman, S. B., 161 Zimmerman, U., 461 Zin, K., 143 Zinder, N. D., 233 Zinn, K., 127, 455 Zinner, K., 400 Zoller, M. J., 189 Zon, G., 341,345(7) Zu, R., 512 Zubay, G., 123, 127(8) Zuker, M., 187 Zumbrunn, G., 484, 494(30), 520 Zydowski, L. D., 101
SUBJECT INDEX
685
Subject Index A aadA expression cassette, 529, 531 Acridines, DNA-binding affinity, 414 a-Actin gene, mouse skeletal, transcription start point of, mapping, 447 Adamantylideneadamantane-1,2-dioxetane half-life, 400 thermal method for activating, 400 Adenovirus d1312, toxicity, 643 abolishing, 643-644 AdPol, analysis of nuclear localization signal domain in, 220 Aerosol beam microinjection, 520 Affinity purification methods, 249 of phage from epitope library, 245-249 Affinity-purified phage, analysis of, 249255 Agarose gel electrophoresis of pUC19 plasmid mutagenesis intermediates, 208 of single-stranded DNA mutagenesis intermediates, 196 verification of gapped circle formation by, 180 Agrobacterium tumefaciens, 484 cell size, 498 dried cells (microprojectile), 491 Ti plasmids, genes from T-DNA region, 66 Air guns, 520 AiT20 cells culture, 612 transfection in, lipopolyamine-mediated, 615-616 applications of, 613-614 optimal time, 612-613 optimization of, 612-613 preparation of lipospermine/plasmid complex for, 612 o-Alanine ligases Ddla and Ddlb, E. coli, overproduction of, 101 Albino plants, anther-derived,/3-glucuronidase expression in, 548
Alcohol dehydrogenase promoter and intron, 497 Algae, 484 Alginate (alginic acid) as matrix support for YAC cloning. 431436 preparations, 436 solutions, reversible gelling-remelting behavior of, 432 Alkaline phosphatase, secondary antibody conjugated to, 325 Alkaline phosphatase-conjugated oligonucleotide probes, 407-412 chemiluminescent detection with, 411 troubleshooting, 412 nucleotide sequence detected with. 410411 Amicon 8MC microultrafiltration system. 124-125 Amicon YMI00 ultrafiltration membrane, 140 a-Aminoadipate, 303 Amplification product, specificity of, testing for, 442-443 AMPPD, 401 chemiluminescence of, mechanism leading to, 401-402 chemiluminescent detection with, 412413 applications of, 413-414 level of, 409 principles of, 402 enzyme-catalyzed decomposition of, mechanism of, 401 nucleotide sequence detected with, 410411 structure of, 401 a-Amylase B. stearothermophilus, production by B. brevis, 32 human salivary gland, production by B. brevis, 32 ANALYSEQ (computer program), 259 Animals, vaccination of, 580-581
686
SUBJECT INDEX
Anther-derived albino plants,/3-glucuronidase expression in, 548 Anthocyanin gene, 497 Antibody biotinylated, followed by avidin-conjugated horseradish peroxidase, 325 secondary, conjugated to alkaline phosphatase, 325 tagged with radiolabeled protein A, 325 Antigen(s) radiolabeled immunoscreening with, 325-335 signal detection in Western blot analysis by, 333 radiolabeling of, 329 Antisense RNA overexpression of, MDR1 system for, 39-40 synthesis of, 64-65 application T7 expression system to, 64-65 Arylamine N-acetyltransferases NATI and NAT2, human, overproduction of, 101 Asbestos-mediated gene transfer, 619 atpB deletion mutant, electroporation of, 520 atpB deletion mutations, 526 atpB missense mutations, 526 Avidin-peroxidase complex, recipe, 234
B Bacillus breois cell wall proteins, 23 as expression system, 23 advantages of, 23 heterologous protein production by, 2333 construction of expression-secretion vectors for, 27-29, 33 examples of, 31-32 host bacterium, 24 media for, 24 plasmids for, 25 problems with, 32-33 procedure, 31 reagents for, 24 mutagenesis, with N-methyl-N'-nitro-Nnitrosognanidine, 32-33 plasmid DNA, preparation of, 27
preservation of, 25 transformation of electroporation, 30-31 Tris-polyethylene glycol method, 2930 Bacillus megaterium, 484 7A17 strain biolistic transformation of, 498 optimum osmotic concentration, 499 cell size, 498 Bacillus subtilis DNA polymerase III, overproduction of, 101 as expression system, 23 Bacillus thuriengiensis toxin expression, 555 Bacteria chromosomal DNA, isolation of, 439440 electroporation of, 472-475 preparation of cells for, 473-474 transformation of cells, 474-475 optimum osmotic concentration, 499 transfer system for, for bombardment, 502 Bacteriophage. See also Fusion phage affinity purification of, from epitope library, 245-249 affinity-purified, analysis of, 249-255 summary of results, 252-255 filamentous, libraries of peptides and proteins displayed by, 228-257 partial purification of, for ELISA, 240 Bacteriophage-antibody libraries, 228-229, 257 Bacteriophage h, with markers (microprojectile), 491-493 Bacteriophage h vector(s), 498. See also Vector(s), h phage for construction of rare-cutter jumping library, 363 design, 152-153 linearization, 366 preparative digest for, 366 positive-selection cell-free expression of large collections of cDNA clones with, 152170 cDNA fractionation by subtractive hybridization, 159-160 cDNA preparation for, 158-159
SUBJECT INDEX expanding sectors and clones, 163164 forming sectored library, 163 insertion of cDNA into vector molecules, 160-163 mRNA isolation for, 156-158 observations and technical modifications, 168-170 preparing DNA for cell-free expression, 164-165 transcription, 165-166 translation, 166 two-dimensional gel analysis of translation products, 167-169 vector preparation for, 155-156 preparation of, 155-156 primer-restriction end (PRE) adapters for, 153-155 Bacteriophage SP6, RNA polymerase, 135-136 continuous-flow cell-free (CFCF) transcription-translation systems with, gene expression procedures and results, 134-137 RNA probes generated with, 398 Bacteriophage T4, gene 32 protein, in mapping transcription start points with T4 DNA polymerase, 457 Bacteriophage T7, 49 promoter adsorption to nuclear proteins, 56-57 modification, 50 mutagenesis, oligonucleotide synthesis for, 57 mutant cloning, 57-58 properties of, 58-59 in pGEM, 49-50 RNA polymerase, 135-136 binding of oligonucleotides to, 57 cell clones carrying, selection of, 5860 continuous-flow cell-free (CFCF) transcription-translationsystems with, gene expression procedures and results, 134-137 expression of bi- and polycistronic mRNA by, 63-64 high-level gene expression by, 49-66 advantages of, 65-66 alternative strategies for, 60-61
687
applications of, 61-66 cell lines used, 50-51 cellular expression assay, 58 equipment for, 53 experimental procedures, 56-61 expression of chimeric immunoglobulins, 64 gene transfer and selection of clones, 57-61 levels of expression achieved with, 65 materials for, 50-53 methods, 53-55 oligonucleotides, 51-53 principle of, 49-50 promoter used for, 65-66 purification of plasmids for transfection, 53-54 reagents for, 53 reporter gene assays, 55 stable expression of genomic human growth hormone gene, 61-62 stable expression of tissue plasminogen activator cDNA, 63 synthesis of antisense RNA and ribozymes, 64-65 transcription in vitro, 57-58 transfection procedures, 54-55 vectors, 51-53 nuclear localization of, 49 Baculovirus, 48 transcription vectors for expression in, 48 BAL 31 nuclease deletion mutagenesis, 218 BamdlII library, construction of, 385 Barley protoplasts, chloramphenicol acetyltransferase assay of, 75-77 Bead guns, high-velocity, 464 Bicistronic mRNA, expression of, by phage T7 RNA polymerase, 63-64 Binding assays, 250-251 kinetics of, 255-256 Binding protein(s) FK506 FKBP-12, overproduction of, 101 FKBP-13, overproduction of, 101 ligands for, 256 Biolistic devices. See also Particle accelerators
688
SUBJECT INDEX
particle delivery systems, 520 particle gun, 520 principle, 537-538 Biolistic process, 483,619 applications, 483-485 biological parameters, 485, 496-504 cell age/physiology, 498 cell density, 499 cell handling, transfers, selection, 502-504 cell size, 498-499 most important to begin to optimize, 505-506 osmoticum, 499-501,508 vector constructs, 497-498 experiments, 506-508 bacterial, 508-509 design, 485 design parameters, 504-509 features, 485 induction of new mutations with, 534535 methods, 521-526 microprojectile parameters, 485,490-496 optimizing, 483-509 general scheme for, 505-508 parameters, 500 particle accelerator parameters, 485-490 shave cream assay, 488-489 Biolistic transformation. See Biolistic process Biopanning, 245-248, 255-256 results of, 254 Bio-Rad Gene Pulser, 465 Bioreactor(s), 124-125 for translation based on Amicon 8MC microultrafiltration system, 125 for translation based on upflow ultrafiltration column system, 126 Biotinylated antibody, followed by avidinconjugated horseradish peroxidase, 325 Biotinylated probes, 402-407 advantages of, 403 chemiluminescent detection of, 405-406 troubleshooting, 406-407 hybridization with, 404 Biotinylation, 239-240 Black beetle virus signal. See Insect virus translational initiation signal
Black Mexican Sweet corn cell suspensions biolistic transformation of, 498 cultures, 498 Black plaque assay, 572-574 procedure, 573-574 reagents, 572-573 BL 21 (DE3) pLYS E, 115 Blocking solution, recipe, 234 Blunt end restriction-ligation products, single specific primer-PCR of, 445 Bovine papillomavirus, 48 Bovine serum albumin, recipes, 234 Brome mosaic virus coat protein synthesis, in wheat germ CFCF translation system, 131 kinetics of, 133 5-Bromo-4-chloro-3-indolyl-/3-D-galactopyranoside. See X-Galactopyranoside BS 1-BS III, PCR point mutagenesis of, 221 BssHII
cleavage of plFF8 vector, 15-16, 21-22 digestion patterns of, 13-14
C Caenorhabditis elegans, cosmid cloning of,
431 Calcium phosphate precipitation, 618, 644 Callus, derived from immature embryos, /3-glucuronidase expression in, 549 cAMP-mediated gene control, study of, 612-613 Capacitor discharge devices, 465 Cassette approach to cloning, 277 cat expression, in cultured tobacco cells, 549-553 analysis of, 550-552 Cauliflower mosaic virus (CaMV), 35S RNA promoter, 67 use in monocots, 73-75 Cauliflower mosaic virus 35S promoter, 497 CCM. See Chemical cleavage of mismatch CD1 antigen, 378 and major histocompatibility complex, evolutionary relationship of, 378379
SUBJECT INDEX CD4 antigen inter alia, domains of, overproduction of, 101 PCR synthesis of, using various donors, 86 CD1 genes, 378-379 categorization of, 379 CDI.I, 379 CD1.2, 379 CD1A, 379 and CDID, cosmid walking to link, 392-393 CD1B, 379 CDIC, 379 CD1D, 379 and CD1A, linkage experiments, 397 CD1E, 379 different in single cosmids, linkage of, 391-394 two cosmids containing, overlapping restriction fragments in, 394 linkage of, 391-394 with cosmid clones, walking experiment for, 396-397 by cosmid cloning and walking, 392394 stage 1,391-394 stage 2, 394 stage 3,394 long-range restriction map around, 383 mapping of, 379 by cosmid cloning and walking, 378398 choice of cosmid vector and digests of genomic DNA for, 380-381 choice of pulsed-field gel electrophoresis for, 380 materials and reagents, 381-382 methods, 382-394 preparation of cosmid libraries, 383390 principles of methods, 380-382 pulsed-field gel electrophoresis, 382-383 physical map linking, 395 restriction maps for, construction of, 397-398 Cell culture media, 605 Cell extracts, preparation of, materials and reagents for, 127
689
Cell-free expression of large collections of cDNA clones, with positive-selection ~. phage vectors, 152-170 preparing DNA for, 164-165 Cell-free protein synthesis, from pC 1B 1 and pC11B9, SDS-PAGE analysis of, 149 Cell-free systems continuous-flow. See Continuous-flow cell-free systems preparative-scale gene expression in, 123-142 transcription-translation, 123 translation, 123 Cell-free transcription, of plasmid DNAs, 146-148 protocol for, 146-148 Cell-free translation, of in vitro synthesized RNA, 148 protocol for, 148 Cell-free translation products, two-dimensional gel analysis of, 167-169 Cell-free vector(s), insect virus translational initiation signal, 143-151 Cellular expression assay, 58 Central nervous system, in gene transfer studies, 609-612 Cerebellar granular cells preparation and culture of, 609-611 transfection in, 610-612 efficiency of, 611-612 lipopolyamine-mediated, 615-616 c-fos DNA insert, coning into M13 pingpong vector M 13B 119, 263-264 Chemical cleavage of mismatch, 286-295 applications of, 286-287 hybond method, 294 materials and reagents, 289-290 methods, 290-294 autoradiography, 292 DNA-DNA duplex formation, 291 electrophoresis, 292 gel purification for probe preparation. 290 general, 290-292 hydroxylamine modification, 291 osmium tetroxide modification, 291 variations of, 292-294 32p mode, 292-293
690
SUBJECT I N D E X
principle of, 287-290 problems, 294-295 screening of DNA-RNA duplexes by, 293-294 35S mode, 292 unlabeled mode, 292-293 Chemiluminescence classification of, 399 detection of DNA with, 398-414 advantages of, 399 with alkaline phosphatase-conjugated oligonucleotide probes, 407-412 with alkaline phosphatase-oligonucleotide conjugates, 411 with AMPPD, 412-413 applications of, 413-414 level of, 409 principles of method, 402 applications of, 413-414 with biotinylated probes, 402-407 with DNA probes, 412-413 principles of method, 402 Chimeric immunoglobulins, expression of, 64 Chinese hamster ovary cells, 585-587 retroviral infection of method, 595-596 tunicamycin treatment allowing, 596 Chlamydomonas, 555 CC-64 strain, 527 CC-373 strain, 526 electroporation of, 520-521 CC-707 strain, 526 transformation frequency of, 526-527 CC-744 strain, 527, 532 CC-1015 strain, chloroplast transformation of, 527-528 CC-1852 strain, 527 chloroplast transformation in, 510-536 delivery systems for, 520 recipient cells for, growth and preparation of, 521-523 recipient strains for available, 517 choice of, 513-516 reduction of chloroplast genome copy number in, 516 use of, with chloroplast RFLP markers, 517
growth of, 522-523 media for, 521 inverted repeat region, chloroplast transformation in, and copy correction, 527-528 nuclear gene encoding arylsulfatase, incorporation of foreign gene sequences into, 529 preparation of, for chloroplast transformation, 522-523 selection of, 521 Chlamydomonas Genetics Center, 527
Chlamydomonas reinhardtii chloroplasts cell size, 498 genomes, 517 incorporation of foreign gene sequences into, 529 stable complementation of, 537 transformation in, 510 growth and preparation for, 522523 psbA gene, site-directed mutagenesis of, strategies for, 531-534 Chlamydomonas smithii, chloroplast genomes of, 517 Chloramphenicol acetyltransferase, 604 assay, 55, 544 of tobacco and barley protoplasts, 7577 measurements of, 604-605 synthesis in rabbit reticulocyte CFCF transcription-translation system with phage SP6 RNA polymerase, 137 kinetics of, 139 Chloroplast cotransformation, with chloroplast genes on separate donor plasraids, 528-529 Chloroplast expression vectors, 545-546, 553-554. See also Vector(s), chloroplast expression insertion of chloroplast origin of replication into, 546-547 Chloroplast genes chloroplast cotransformation with, on separate donor plasmids, 528-529 disruption of study of, 512
SUBJECT INDEX
targeted, 529-531 insertional activation method, 530531 recombination, study of, 512 regulation of expression, study of, 512 Chloroplast protein, structure and function of, study of, 512 Chloroplast RFLP markers use of, to ascertain exchange points for integration of donor sequences, 517 use of donor plasmids and recipient strains with, 517 Chloroplasts foreign gene expression in, 553-556 optimization of, 553 promoters, selection of, 545-546 Chloroplast transformants growth and selection of, media for, 521 herbicide-resistant, direct selection for, 533 identification of, 517-518, 525 selection of, 517-518 Chloroplast transformation Agrobacterium-mediated, 536 approaches, 536 in Chlamydomonas, 510-536 applications, 512-513, 535-536 available recipient strains and donor plasmids for, 519-520 choice of donor plasmids and recipient strains for, 513-516 considerations, 526-535 delivery systems for, 520 genes for, 515 growth and preparation of recipient cells, 521-523 history of, 510-512 homologous gene replacement, cointegrate formation, and persistence of free plasmid, 518-519 materials, 519-521 methods, 521-526 preparation of microprojectiles, DNA coating, and bombardment for, 523-524 preparation of plasmid DNA for, 523 reduction of chloroplast genome copy number in recipient cells, 516
691
selection for expression of introduced genes, 524-525 strategies, 513-519, 531-534 use of donor plasmids and recipient strains with chloroplast RFLP markers, 517 use of missense mutations defective in photosynthesis as transformation recipients in, 526-527 frequencies, calculation of, 525-526 of genes in inverted repeat region, and copy correction, 527-528 in higher plants, 536-556 assays for foreign gene expression, 544 bombardment of cells or tissues, 542543 precautions, 543-544 evaluation of results, 548-553 generation of tissues for bombardment, 540-541 materials and stock solutions, 538-539 methods, 538-544 plant cell culture media and subculture conditions, 539-540 preparation for bombardment, 541-542 solid culture, 540 vectors for, 545-547 PEG-mediated, 536 problems, 511 Chromaffin cells gene transfer into cell culture for, 608-609 and drug treatment, 609 to study transcriptional regulation of peptide synthesis, 607-609 transcriptional regulation of proenkephalin in, 610 Chromosomal DNA bacterial, isolation of, 439-440 restriction and ligation of, 440-441 Chromosomal mutations, generation by integration, 303-306 Chromosome jumping libraries, 358-378. See also Rare-cutter jumping libraries common-cutter, 359 construction of, 358-359 suppressor-containing plasmids and their polylinkers modified for, 362
692
SUBJECT INDEX
Circularization ligation, procedure, 353354, 370 Clones, with correct sequence, effect of EcoK or EcoB selection on, 266 Cloning cassette approach, 277 cDNA, by polymerase chain reaction, 102-122 cosmid, 378-398 of C. elegans, 431 with E. coli K-12 restriction map, 444 of foreign sequences, into plasmid pSK1.MDR, 40 in-frame, in plFF8 vector, 17-18 preparation for, 15-17 mutant bacteriophage T7 promoter, 5758 OE sequence variants modified C o l E I : : T n 5 0 R F lac for, 319 modified T n 5 0 R F lac for, 319 plasmid vectors for, screening recombinant pUC-like plasmids with, comparison of methods, 338-339 with polymerase chain reaction products, 103-105 ligation and transfection for, 114 materials and reagents for, 108-109 procedure, 113-114 strategy, 106 structured protein domains, 256-257 yeast artificial chromosome, with alginate matrix support, 431-436 CMP-NeuAc synthetase, E. coli, overproduction of, 101 Cointegrate formation, 518-519 Colchicine, in MDRl-based selection experiments, 36, 38, 44 determination of dose, 40-42 ColE1 ::Trt5 ORF lac, modified for cloning OE sequence variants, 319 Colony hybridization filters autoradiography of, 342 preparation of, 343-344 to find inserted sequence, 343 on paper, 340-346 filter preparation for, 343-344 hybridization, 344-345 materials for, 341-342
methods, 342-345 probe preparation for, 343-344 principles of, 340 supports for, 340-341 temperature, formula for, 346 Compaction, 600 Complementary DNA clones cell-free expressions of large collections of, with positive-selection h phage vectors, 152-170 encoding rat kallikrein-binding protein, isolation of, 334 cloning, by polymerase chain reaction, 102-122 fractionation by subtractive hybridization, 159-160 generation of, 109-114 experimental procedure, 109-114 insertion into *jac, flow chart for, 156 insertion into vector molecules, 160-163 preparation of, 158-159 tissue plasminogen activator, stable expression of, 63 Complementary DNA library plating, for primary screening, 329-330 rat liver, screening with radiolabeled antigen for rat kallikrein-binding protein cDNA clones, positive signals detected by, 334 screening of applications, 325 methods for, 325 with radiolabeled antigen, 325-335 c~-Complementation, 336 Continuous-flow cell-free (CFCF) systems, 123-142 advantages of, 138-139 applications of, 142 composition of incubation mixtures and feeding solutions for, 130-131 features of, 139-140 membranes, parameters, and yields in, 134 perspectives on, 141-142 problems and limitations of, 140-141 transcription-translation with endogenous RNA polymerase, gene expression procedures and results, 133-134
SUBJECT INDEX with phage SP6 RNA polymerase, gene expression procedures and results, 134-137 with phage T7 RNA polymerase, gene expression procedures and results, 134-137 translation, gene expression procedures and results, 127-132 Continuous-flow principle, 123 Cosmid(s) clones rescreening of, lysis of bacterial colonies for, 396 restriction analyses of, 390-392 cloning, 378-398 of C. elegans, 431 and walking, to link CDI genes, 392394 for cloning and walking, 380-381 Lawrist 7, 351 linearization of, 352 Lawrist 8, 351 linearization of, 352 for linking-clone libraries, 351 Lorist 6, 380-381, 394-395 walking, 394 to link CD1 genes, 392-394 Cosmid DNA, digested with EcoRI and probed with FCB probe, Southern blot analysis of, 392-393 Cosmid library construction and screening of, precautions, 395-398 ligation and packaging of, 386-387 linking-clone construction of, 349, 351 ligation of analytical, 356 procedure, 354 packaging of, analytical, 356 plating of, 356 filter lifts for, 356 plating out, 387-390 preparation of for cloning and walking, 383-390 isolation of genomic DNA, 383384 partial digestion and fractionation of genomic DNA, 384-385 preparation of vector for, 386
693
Coupled primer approaches to mutagenesis, 189 Coupled transcription-translation systems, cell-free, 123 Coxsackievirus 3C protease expression of, analysis of, 149-150 native and mutant, construction of plasmid DNAs expressing, 146 CpC islands, positions of, 357 CRE-containing genes, cAMP-dependent induction of, effect of mutated regulatory PKA subunits on, 613 Cyclic deletion, with double primers and MI3B119 vector DNA sequence of selection primers 1 and 2 used for, 264 strategy, 263 Cyclic selection, 258 Cyclophilin A, overproduction of, 101 Cyclophilin B, overproduction of, 101 cysD gene, E. coli, transcription start point of, mapping, 447 Cysteine handles, 102 D
[32]p dCTP-labeled probe, mutation detection by chemical cleavage with, 293 DEAE-dextran-mediated gene transfer, 619,644 Deletion(s) atpB mutant, 526 electroporation of, 520 cyclic, with double primers and M13B119 vector DNA sequence of selection primers 1 and 2 for, 264 strategy, 263 mutagenesis with T4 DNA polymerase, 258 mutations, 444 study of, with Tn5 ORF lag 321-322 Dengue virus, type 2, nonstructural protein, expression in E. coli using pPLEX, 10 Deoxycytidine 5'-O-(1-thiotriphosphateL Sp-diastereomer of, structure of, 191 Deoxyterminal transferase, 398 3,8-Diamino-6-phenylphenanthridinium, DNA-binding affinity, 414
694
SUBJECT INDEX
Dicotyledonous plants, gene expression in, nonisotopic methods, 398-399 66-68 fragments vector cassettes for, 68-73 amplification of Dihydrofolate reductase synthesis PCR for, 436-437 in E. coli CFCF system with endogerequirements for, 437 nous RNA polymerase, 133-134 cloning, in plasmid pIFF8, 17-18 kinetics of, 135 hemimethylated, 258 in E. coli CFCF system with phage SP6 high molecular weight, in agarose RNA polymerase, 136 blocks, preparation of, 369 kinetics of, 137 inserts in wheat germ CFCF system with phage phosphatase treatment of, 371 SP6 RNA polymerase, 136 preparation of kinetics of, 138 for linking-clone library construcDioctadecylamidoglycylspermine, 600, tion, 352-353 603-604 varying incubation time protocol, CAT activity in, 611 352-353 structure of, 601 liposome packaging of, 618 Dioxetanes, 400 mutated, transformation of E. coli with, 1,2-Dioxetanes, 399-400 procedure, 205 activation of, methods for, 400 phosphorothioate-containing, restriction enzyme substrates, stable, structure of, endonucleases unable to hydrolyze, 400 198 that can be activated by enzymes, synphosphorothioate-modified, 258 thesis of, 400 plasmid Dioxetanones, 399 B. breois, preparation of, 27 Dipaimitoylphosphatidylethanolamylspermine, cell-free transcription of, 146-148 600 expressing native and mutant 3C CAT activity in, 611 protease of coxsackievirus, constructure of, 601 struction of, 146 Disulfide linkages, transferrin-polylysine linearization and phosphatase treatment of, 367 conjugate synthesis through, 625-626 nicking procedure, 210 DNA. See also Complementary DNA; preparation of Double-stranded DNA; Genomic DNA; Single-stranded DNA for chloroplast transformation, 523 chromosomal for mutagenesis, 208 bacterial, isolation of, 439-440 preparation of restriction and ligation of, 440-441 for cell-free expression, 164-165 cloning, in plFF8 vector for cloning in pIFF8 vector, 17 direct in-frame, 17-18 indirect in-frame, 17-18 receptor-mediated entry into cells, 620complexes, formation of, 632-633 622 cosmid, digested with EcoRI and probed size determination of, two-color, with with FCB probe, Southern blot ethidium homodimer and thiazole analysis of, 392-393 orange dimer, 429 cytosine 5-methyltransferase M.HaelII, template, preparation for mapping tranH. aegyptus, overproduction of, 101 scription start points, 449-450 wild-type, strand-selective hydrolysis of, detection of with chemiluminescence, 398-414 214-215 membrane hybridization techniques, DNA circles, recleavage of, procedure, 398 370-371
SUBJECT INDEX DNA coating of microprojectiles, 523-524 protocols, 492-495 DNA detection, of multidrug resistance gene, 45 DNA-DNA duplex formation, method, 291 DNA-dye intercalation complexes, 430. See also Stable dye-DNA intercalation complexes h D N A / H i n d l I I - T O T O complexes detection of, 423 fluorescence intensity of, 424 picogram detection of, with two-color laser-excited confocal fluorescence gel scanner, 424 DNA ligase, T4, 261 DNA-mediated gene transfer into eukaryotic cells, 618 techniques, 618-619 of multidrug resistance gene, in mammalian expression vectors, 40 DNA plasmids. See Double-stranded DNA plasmids DNA polymerase misincorporation of nucleotides or a-thionucleotide, 219 phage T4, 258, 261,457 deletion mutagenesis with, 258 effect on frequency of mutation, 267 mapping transcription start points with, 446-458 properties, 260 site-directed mutagenesis with, 258259, 270 phage T7, 285 selection of, 285 Sequenase, 258, 261 effect on frequency of mutation, 267 properties, 260 site-directed mutagenesis with, 260 test of, 265-266 Taq, 286 thermophilic, that possess proofreading activity and thermal stability, 97 DNA polymerase I, E. coli, Klenow fragment of. See pollk DNA polymerase III, B. subtilis, overproduction of, 101
695
DNA probes biotinylated advantages of, 403 chemiluminescent detection of, 4054O6 hybridization with, 404 biotinylation of, 402-403 clones, biotinylation of, 403 DNA repair proteins Ada, AIkA, Fpg, E. coli, overproduction of, 101 DNA-RNA duplexes, screening of, by chemical cleavage of mismatch, 293294 DOGS. See Dioctadecylamidoglycylspermine Donor, 83 DOTMA-containing liposomes. See Lipofectin Double primers, and M13B119 vector, cyclic deletion with DNA sequence of selection primers 1 and 2 used for, 264 strategy, 263 Double-stranded DNA. See also Heteroduplex DNA; Homoduplex DNA amplification of, single specific primerPCR, 437 fragments detection of, multicolor, 423429 large, detection of, 431 sizing of, multicolor, 423-429 with EthD and TOTO complexes, 426-429 phosphorothioate-based mutagenesis of, 189-217 trouble-shooting, 216-217 sequencing, 184-185 procedure, 184-185 staining of, 419-421 Double-stranded DNA plasmids introducing restriction sites into, 295301 materials, reagents, and their use, 297-299 method, 299 principle of method, 295-299 recombination efficiency obtained using different lengths of oligonucleotides, 300
696
SUBJECT INDEX
introduction of single-stranded oligonucleotide into, 296 Drosophila ras2 gene, transcription start point of, mapping, 447 dU-containing linear plasmid(s), preparation of, 178-179 procedure, 178-179 Dye-DNA intercalation complexes. See Stable dye-DNA intercalation complexes
E EcoK/EcoB selection, 258-259 effect on clones with correct sequence, 266 effect on frequency of hybridization positives, 266 ECPCR. See Expression-cassette polymerase chain reaction Electrophoresis, of polymerase chain reaction products, on polyacrylamide gels, 224 Electroporation, 237, 302, 618, 644 of adherent cells, 468 on microbead carriers, 468-470 advances in, 477-478 advantages of, 463-464 applications of, 461-462 of atpB deletion mutant of Chlarnydomonas, 520 ofB. brevis, 30-31 of bacteria, 472-475 biophysics of, 462-463 buffers, 465-466, 471 choice of, 466 comparison to other gene transfer methodologies, 463-464 efficiency of, 463,477 in human gene therapy, 476-478 instrumentation, 464-465 of mammalian cells, 465-470 methods, 464-465 parameters, 462,466 into plant protoplasts, 471-472 principle of, 479 procedure, 463 radiofrequency, 478 in recombinant DNA technology, 461478
suspension cells, 467-468 of yeast, 475-476 Element-encoded functions, analysis of, with T n 5 0 R F lac, 317-319 End clamp, 84 Endocrine cells, lipopolyamine-mediated gene transfer in, 604-609, 615-616 Endonuclease S1, mapping transcription start points with, 446-447 Enrichment, quantifying, 248-249 Enzyme-linked immunosorbent assay, 250251 partial purification of phage for, 240 Epidermal growth factor, human, production by B. brevis, 32 Epitope library affinity purification of phage from, 245249 construction of, 228 Epstein-Barr virus, 48 Erwinia amylovora, 484 cell size, 498 optimum osmotic concentration, 499 Erwinia stewartfi, 484 Escherichia coli, 484 AC2522 strain, 261 D-alanine ligases Ddla and Ddlb, overproduction of, 101 cell size, 498 CMP-NeuAc synthetase, overproduction of, 101 cyclophilin A, overproduction of, 101 cysD gene, transcription start point of, mapping, 447 DNA polymerase I, Klenow fragment of. See pollk DNA repair proteins Ada, AIkA, Fpg, overproduction of, 101 dried cells (microprojectile), 491 bearing plant vectors, 491,493 expression plasmid pPLEX, 3-11 expression products, analysis of, 7-8 hill promoter, 4 induction of, 6-7, I0-11 sequence elements, sources of, 5 structure of, 4-5 use of, 8-10 critical parameters for, 10-11 for expression of heterologous sequences, 8, 10
SUBJECT INDEX for expression of rabbit fast skeletal muscle light meromyosin, 89 troubleshooting, 11 expression systems, 3 continuous-flow cell-free, MS2 coat protein synthesis in incubation procedure, 128-132 kinetics of, 132 stock solutions for, 128 continuous-flow cell-free with endogenous RNA polymerase dihydrofolate reductase synthesis in, 133-134 /3-1actamase synthesis in, 133-134 continuous-flow cell-free with phage SP6 RNA polymerase, dihydrofolate reductase synthesis in, 136 kinetics of, 137 necessary elements, 3-4 troubleshooting, 11 histidine-tRNA synthetase, overproduction of, 101 JA221 strain biolistic transformation of, 498 optimum osmotic concentration, 499501 JM101 strain, 261 JMI09 strain, 115 K-12, restriction map of, cloning of genes with, 444 mapping of, 430-431 mcrAB- mutant, 281 overproducing. See also Overproducer(s) construction problems, 79 plasmid vectors, 497-498 pPLEX-derived constructs, cloning, 6 proteins soluble in 8 M urea, analysis of, 8 SDS-soluble proteins, analysis of, 7-8 soluble protein fraction, analysis of, 7 strains, for expression of nonfusion polypeptides with pPLEX, 4-6 TGl strain, 261 transformation of, with mutated DNA, procedure, 205 Ethidium bromide, nicking of plasmid with extraction and spin dialysis procedure, 211
697
procedure, 210 site-specific, 209-211 Ethidium homodimer absorption and fluorescence emission spectra of, 420-421 complexes, two-color detection of, 426429 preparation and storage of, 419 spectroscopic properties of, 419 structure of, 415 two-color DNA size determination with. 429 Ethidium homodimer-dsDNA complex~ 416 Eukaryotic cells gene transfer into DNA-mediated, 618 techniques, 618-619 receptor-mediated, 618-644 mechanisms for uptake of substances in, 619 splice sites in genomic DNA, amplification and sequencing of, 444 Exonuclease digestion of mutant heteroduplex wildtype strand, 215-217 gapping procedure, 215-216 preparation of mutant homoduplex for, 216-217 phage T7, gapping with, procedure, 202203 Exonuclease Ili deletion mutagenesis with, 218 gapping with, procedure, 202-203 Exonuclease VII, mapping transcription start points with, 446-447 Expression cassette(s), 83 aadA, 529, 531 CD4, PCR synthesis of, using various donors, 86 structure of, 85 Expression-cassette polymerase chain reaction, 83-85, 100-102 advantages of, 100-101 amplification, 92-93, 98 digestion, 93-95, 98-99 DNA components of, structure of, 85 induction procedure, 96-97 insoluble proteins with, 100 leapfrog, 102
698
SUBJECT INDEX
ligation, 93-95, 99 loss of overproduction with, 99-100 low-melting-point agarose method, 94 materials and methods for, 90-97 enzymes/reagents, 91-92 oligonucleotides, 90-91 overexpression system, 91 software, 92 template DNA, 91 thermal cycler, 92 mutations with, 97 overproducer construction using, 82-84 overproduction of proteins using, 79-102 poor levels of expression with, 100 primers. See also Primer(s) coding and anticoding sequences in, 89-90 proteins overproduced with, 101 purification on ceramic beads, ligation in solution method, 94-95 selectable, 101-102 transformation with, 95-96, 99-100 troubleshooting, 98-100 Extension, 262 overlap, gene splicing by, 270-279 test of temperature, 265-268
F Filamentous phage, libraries of peptides and proteins displayed by, 228-257 Fluorescence-activated cell sorting analysis, 348, 639-640 to determine proportion of transfection population expressing transfected lacZ gene, 637 for P-glycoprotein, 45-46 Fluorescence automated cell sorting. See Fluorescence-activated cell sorting analysis Fluorescence gel scanner, two-color laserexcited confocal, picogram detection of stable dye-DNA intercalation complexes with, 414-431 5-Fluoroorotic acid, 303 Fold and Squiggles (GCG) program, 89 Foreign gene(s), engineered, escape via pollen grain, 556
Foreign gene expression. See also Bacillus brevis, heterologous protein production by; Bacteriophage T7, RNA polymerase, high-level gene expression by; specific gene assays, 544 in chloroplasts, 529, 553-556 optimization of, 553 in chloroplasts of higher plants history, 536 mediated by tungsten particle bombardment, 536-556 levels of, 48 screening for, 571-574 selection for multidrug resistance in, 3540 systems for, 47-49 vectors for, 47-48 Freeze-thaw lysate, preparation for preparation of chromosome jumping libraries, 368 Fungus, filamentous, 484 Fusion gene, with MDR1 and adenosine deaminase coding sequences, 37 Fusion phage, 228 constructs, 230 filamentous, libraries of peptides and proteins displayed by, 228-257 vectors, 230. See also Vector(s), fusion phage design of, 229-233 Fusion protein complex, construction by splicing, 275276 expression in E. coli, 3 multidrug resistance gene, 37-38
G fl-Galactosidase, 321 /3-Galactosidase assay, 639-640 of cell extracts, 639 fluorescence-activated cell sorter, 637, 639-640 in situ, 639 Gap, single-stranded, to which mutant oligonucleotide can anneal, preparation for plasmid mutagenesis, 211-212
SUBJECT INDEX Gapped circle(s) conversion into covalently closed heteroduplex circle, 182 formation of, 179-181 procedure, 181 verification by AGE, 180 preparation of, 178-182 undesired, cleavage and separation of, 181-182 Gapped circle method, 173-189 limitations and modifications of, 185-186 materials and reagents, 176-178 buffers and solutions, 177 enzymes, 177 media, 176-177 oligonucleotides, 177 strains, 176 oligonucleotide-directed mutagenesis, 182-183 preparation of gapped circle for, 178-182 preparation of plasmid substrate for, 175 principle of, 174-176 screening for and analysis of mutants, 183-185 unintentional mutations with, 186-189 Gapped duplex mutagenesis, 189 Gapping with exonuclease III, 202-203 with exonuclease T7, 202-203 of nicked mutant heteroduplex, 215-216 Gas shock, 485-486 Gel analysis, two-dimensional, of cell-free translation products, 167-169 Gel electrophoresis agarose of pUC19 plasmid mutagenesis intermediates, 208 of single-stranded DNA mutagenesis intermediates, 196 verification of gapped circle formation by, 180 pulsed-field, 357 in cosmid cloning and walking, 380, 382-383 of tag plasmid, 366-367 Gel purification, for probe preparation, method, 290 Gels, sequencing, pouring and running, 241-243
699
Gel scanner, two-color laser-excited confocal fluorescence, picogram detection of stable dye-DNA intercalation complexes with, 414-431 Gene fusion. See also Fusion gene in-frame, 12-22 applications, 22 limitations of, 22 materials, 13 principle of method, 13-15 transformation and selection of recombinants, 18-19 verification of selected clones, 19-21 selection, 12 Gene gun method. See Biolistic process GeneJockey (computer program), 259 Gene replacement homologous, 518-519 available donor plasmids for, 519-520 therapy criteria for, 476 preferred ways, 476 problems, 476 Gene splicing, by overlap extension, 270279 example, 273-275 Genome walking beyond histidine transport operon, 441 by single specific primer-PCR, 436-446 Genomic DNA in agarose, cleavage of, 369-370 digests of, choice of, for cosmid cloning and walking, 380-381 MOLT 4, digested with EcoRI and probed with FCB, Southern blot analysis of, 392 partial digestion and fractionation of, 384-385 vaccinia, preparation of, 574-577 Genomic sequencing, with alkaline phosphatase-conjugated oligonucleotide probes, 409-411 Glass beads, agitating wall-deficient cells with, 520 Glass microprojectiles, 491,493 Globin synthesis, in rabbit reticulocyte CFCF translation system, 132 /3-Glucuronidase assay, 544
700
SUBJECT INDEX
expression in anther-derived albino plants, 548 in callus derived from immature embryos, 549 compartmentalized, 548-549 transient, 513 gene, 497 /3-Glucuronidase--expressing tobacco cells, 491 P-Glycoprotein, 35 analysis of, 45-47 fluorescence-activated cell analysis of, 45-46 immunofluorescence of, 45-46 immunoprecipitation of, 45-47 Gold microprojectiles, 490-491 l-/zm, 493 1.7-/zm, 493 preparation of, 523-524 1- to 3-/xm, 493 2- to 5-/xm, 493 Growth hormone detection of, 55 human expression by T7 RNA polymerase system, 49 gene, high-level expression by T7 RNA polymerase, 61-62 mRNA, construction of ribozyme directed to, application T7 expression system to, 64-65 Gunpowder-driven accelerators, 486. See also Particle accelerators determinants of velocity, 489 macroprojectile, 487 power source, 486 shave cream assay of, 488
H Haemophilus aegyptus, DNA cytosine 5methyltransferase M.HaelII, overpro-
duction of, 101 HeLa cells, nuclear extracts, 56 Helium-driven accelerators, 486. See also Particle accelerators determinants of velocity, 489 macroprojectile, 487
power source, 486-487 shave cream assay of, 489 Helper virus, marker rescue assay for, method, 593-595 Hemimethylated DNA, 258 Herbicide resistance genes, 497 Herbicide-resistant chloroplast transformants, direct selection for, 533 Heteroduplex circle, covalently closed, conversion of gapped circle into, 182 Heteroduplex DNA mutant nicked, gapping procedure, 215-216 preparation for plasmid mutagenesis, 209-214 procedure, 214 wild-type strand, exonuclease digestion of, 215-217 restriction endonuclease nicking of, 201 High molecular weight DNA, in agarose blocks, preparation of, 369 High-velocity bead guns, 464 HindIII library, construction of, 385 his3, 302 Histidine transport operon, genome walking beyond, 441 Histidine-tRNA synthetase, E. coli, overproduction of, 101 HIV-1 polypeptides, produced by recombinant vaccinia virus that expresses HIV-1 env gene, radioimmunoprecipitation analysis of, 578 Homoduplex DNA, mutant, preparation for plasmid mutagenesis, 214-217 procedure, 216-217 Horseradish peroxidase avidin-conjugated, biotinylated antibody followed by, 325 secondary antibody conjugated to, 325 Host functions, analysis of, with Tn50RF lac, 319-321 Host mutant, that enhances transposition, isolation of, 320 Human growth hormone gene, genomic, stable expression of, 61-62 Human papilloma virus type 16, E7 protein, expression in E. coli using pPLEX, 10 type 18, E7 protein, expression in E. coli using pPLEX, 10
SUBJECT INDEX Hybond method, of chemical cleavage of mismatch, 294 Hybridization positives, frequency of, effect of E c o K or EcoB selection on, 266 7-Hydropyridocarbazoles, DNA-binding affinity, 414 Hydroxylamine modification, method, 291
I Immunoblot assay, 574 Immunofluorescence, of P-glycoprotein, 45 -46 lmmunoglobulin(s), chimeric, expression of, 64 by T7 RNA polymerase, 63-64 lmmunoprecipitation, of P-glycoprotein, 45 -47 Immunoscreening, with radiolabeled antigen, 325-335 In-frame cloning direct, in plFF8 vector, 17-18 indirect, in plFF8 vector, 17-18 preparation of ORF vector plFF8 for, 15-17 Insect virus translational initiation signal, 143-151 in vitro gene expression with analysis of coxsackievirus 3C protease expression, 149-150 bacterial strains, 144 cell-free transcription of plasmid DNAs, 146-148 cell-free translation of in vitro synthesized RNA, 148 construction of plasmid DNAs expressing native and mutant 3C protease of coxsackie virus, 146 enzymes, plasmids, and radiochemicals for, 144 materials and methods, 144-150 results, 150-151 Insert DNA, phosphatase treatment of, 371 Insertion(s) mutations, 444 unintentional, 188-189 sequence, 312 colony hybridization to find, 343
701
Insulin, results of biopanning with, 254255 Integration comparison with plasmid shuffle, 309312 detecting spurious mutations with, 310311 generation of chromosomal mutations by, 303-306 example, 305-306 principles of method, 303-305 isolation of conditional-lethal TUB2 alleles by, 305-306 of mutant alleles, 304, 309-310 Inter alia human CD4, domains of, overproduction of, 101 Interleukin 2, production by Bacillus brevis, 32 Interleukin-2Ra, results of biopanning with, 254-255 Intracellular adhesion molecule (ICAM)-I, domains of, homeodomain of, 101 In vitro gene expression, with insect virus translational initiation signal, 143-151 In vitro packaging extracts, preparation procedure, 367-369 In vitro transcription, 57-58 IPTG. See lsopropyl-fl-D-thiogalactopyranoside Isogenicity, problems of, chloroplast transformation strategies for, 531-534 I sopropyl-fl-D-thiogalactopyranoside plates, screening recombinant pUClike plasmids on, 335,337, 339 method, 338 IS50 transposition. See Tn5 transposition
J hjac recombinant, structure of, 162 Jumping libraries. See Chromosome jumping libraries
K Kanamycin-resistant cells, selection for. 503 K562 cells transfection protocol for, 634-635 transferrinfection in, efficiency, 642-643
702
SUBJECT INDEX L
lac induction, examination of colony size under conditions of, 336 fl-Lactamase, synthesis in E. coli CFCF system with endogenous RNA polymerase, 133-134 kinetics of, 135 lacZ fluorescence-activated cell sorting analysis of, 637, 639-640 solution assay of, 639 translation site, translation initiation at, distinguished from translation initiated within insert, 20-21 LacZ ÷ fusions, 322 k phage vector(s). See Bacteriophage vector(s) Laser scanner system, two-color confocal fluorescence, 417-419 detection of double-stranded DNA by, 423-429 sensitivity of, 422-423 detection of stable dye-DNA intercalation complexes by, 414-431 sizing of double-stranded DNA by, 423429 LEU2, 482 leu2, 302 Library amplified, screening of, 396 cDNA, immunoscreeningof with radiolabeled antigen, 325-335 chromosome jumping, 358-378 cosmid, preparation for cosmid cloning and walking, 383-390 epitope affinity purification of phage from, 245-249 construction of, 228 expanding, 163-164 linking-clone, large insert, 347-358 of peptides and proteins displayed by filamentous phage, 228-257 bacterial strains for, 233-236 recipes, 234-236 construction of, 243-245 general procedures for, 236-243 making, 243-245 design of degenerate oligonucleotide insert, 243
phenol extraction, chloroform extraction, and ethanol precipitation from sodium acetate solution for, 236-243 phage-antibody, 228-229 phage-antibody, 257 sectored, forming, 163 Ligand (term), 229 Ligands, 256 Ligate (term), 229 Light meromyosin, rabbit fast skeletal muscle, expression of, using pPLEX, 8-10 Linearization of cosmid vector Lawrist7, 352 of cosmid vector Lawrist8, 352 of h vector DNA, procedure, 366 of h vector EMBL5, 352 of plasmid DNA, procedure, 367 of vector DNA, procedure, 352 with wild-type DNA, procedure, 214215 Linear plasmid(s), dU-containing, preparation of, for site-specific mutagenesis, 178-179 Linking clone(s), 347 construction of, from preexisting regionspecific libraries, 348 large insert, 347-348 region-specific, 348 Linking-clone library, 347 advantages of, 358 construction of, 347-348 advantages of, 357 protocols for, 348 large insert, 347-358 construction of, 348 bacterial hosts for, 351 circularization reaction procedure, 353-354 cleavage reaction procedure, 354 DNA concentration for, 350 DNA insert preparation procedure, 352-353 linearization of vector DNA procedure, 352 materials for, 350-351 phosphatase treatment procedure, 354 principle of method, 348-350 protocols for, 348, 351-357
SUBJECT INDEX reagent for, 351 screening procedure, 356-357 tag plasmid for, 351 vector ligation, packaging and plating of cosmid library procedure, 356 and plating of h library procedure, 354-356 vectors for, 351 h Linking-clone library construction of, 349, 351 DNA concentration for, 350 materials for, 350-351 principle of method, 348-350 ligation of analytical-scale, 354-355 preparative-scale, 355 procedure, 353-354 packaging of analytical-scale, 355 preparative-scale, 355 plating of, 355 filter preparation for, 355-356 test plating of, 355 Lipid-coated plasmids, cationic, 600-601 Lipofectin, 464 RNA transfection with, 644-654 Lipofectin:RNA ratio optimization of, 648-649 transfection efficiency and, 649 Lipofection. See also RNA lipofection DOTMA-mediated, 618 Lipopolyamine(s), synthesis of, 602-604 Lipopolyamine-based gene transfer. See Lipopolyamine-coated DNA, gene transfer with Lipopolyamine-coated DNA, gene transfer with, 599-619 in AiT20 cells, 615-616 applications of, 613-614 optimal time, 612-613 optimization of, 612-613 preparation of lipospermine/plasmid complex for, 612 cell lines transfected successfully by, 615-617 in cerebellar granular cells, 615-616 efficiency factors, 615 in endocrine cells, 604-609, 615-616 optimal times, 616 optimization of, 617
703
protein kinase A pathway, 613-615 recent improvements, 615-617 recipe for, 616-617 to study second messengers, 613-615 variables that affect, 616 Lipopolyamine-mediated gene transfer. See Lipopolyamine-coated DNA, gene transfer with Liposomes, 644 cationic mixing of anionic DNA with, 600-601 RNA transfection mediated by, 644654 DOTMA-containing. See Lipofectin packaging of DNA, 618 Lipospermine(s), 600 CAT activity in, 611 cationic, mixing of anionic DNA with. 600-601 Lipospermine-mediated gene transfer, 600 Lipospermine/plasmid complex, preparation of, 612 Lithium acetate, 478 transformation, 302 L plates, with and without IPTG, screening recombinant pUC-like plasmids on, 337, 339 Luciferase activity of, as function of time of harvest, 636 assay of, 55, 636-639 adherent cultures for, 637-638 extract preparation for, 638 harvesting cells for, 635-636 suspension cultures for, 636 gene, 497 lys2, 302 negative selection of, 303
M MacConkey/lactose plates, screening recombinant pUC-like plasmids on, 336-337,339 method, 338 principle of, 336 Macroprojectiles, 485-487,537 Magnetic activated cell sorting, selection procedure, for cells expressing MDRI gene product, 38-39
704
SUBJECT INDEX
Major histocompatibility complex, and CDI, evolutionary relationship of, 378-379 Mammalian cells electroporation of, 465-470 adherent cells, 468 electroporation on microbead carriers, 468-470 buffers, 465-466 choice of, 466 parameters, 466 suspension cells, 467-468 primary and established lines, gene transfer with lipopolyamine-coated DNA into, 599-618 Mannitol, 501 Marker plasmid. See Tag plasmid Marker rescue assay, for helper virus, method, 593-595 MbodlII library, construction of, 385 MboI, 381 MDR1. See Multidrug resistance gene Melanotrope cells, primary porcine, gene transfer into, 605-607 of attached cells, 606-608 of cells in suspension, 606-607 isolation and culture of cells for, 605606 Membrane hybridization techniques analysis of DNA by, 398 probes for, 398 Membrane protein topology, study of, with T n 5 0 R F lac, 321 3-Mercaptopropionate-modified polylysine, 625-626 Messenger RNA bi- and polycistronic, expression by T7 RNA polymerase, 63-64 human growth hormone, construction of ribozyme directed to, application T7 expression system to, 6465 isolation of, 156-158 preparation of for mapping transcription start points, 450-451 materials and reagents for, 126-127 template, primer extension mapping of cap sites with, 457 in vitro synthesized, 646
Messenger RNA:DNA template, in mapping transcription start points, 451452 Messenger RNA transfection, liposomemediated comparison of translations, 653 efficiency of, 654 kinetics of, 649-650 Methylcellulose plating cells in, 641 preparation of medium, 640-641 N-M ethyl- N'-nitro- N-nitrosoguani dine , Bacillus breois mutagenesis with, 32-
33 Microbead carriers, electroporation of adherent cells on, procedure, 468-470 Microinjection, 463, 618, 644 direct, 619 Micropanning, 251-252 Microprojectiles, 490-496, 537 bombardment method. See Biolistic process choice of, 490-492 coating particles, 492-495 protocols for, 492-495 dried E. coil, bearing plant vectors, 493 glass fragments, 493 1-/~m gold, 493 1.7-/xm gold, 493 high-density, 491 phage with markers, 493 loading particles, 495-496 lower density, 491 M5 tungsten, 493 M10 tungsten, 493 particle size, 492 preparation of for bombardment, 541-542 for chloroplast transformation, 523524 1- to 3-/.~mgold, 493 2- to 5-/zm gold, 493 uses, 493 Microultrafiltration system, Amicon 8MC, 124-125 Mimotopes, 253 Mini-kan hopper element, 233 Mismatch, chemical cleavage of, 286-295 Mismatch oligonucleotide(s), phosphorylation of, procedure, 197
SUBJECT INDEX Mispriming, 271 Missense mutations atpB, 526 defective in photosynthesis, as chloroplast transformation recipients, 526527 Mitochondrial transformation, problems, 511 Mlul, 358 Monoclonal antibody 3-4B, 253 results of biopanning with, 253-254 C219, 46 MRK-16, 46 Monocotyledonous plants, gene expression in, vectors for, 73-78 construction of, 75 expression studies of, 75-78 M13 ping-pong vector(s). See also Vector(s), MI3 ping-pong with EcoK/EcoB selection markers, 261 features of, 445-446 in site-directed mutagenesis, 258-260, 269-270 MS2 coat protein synthesis, in E. coli CFCF translation system incubation procedure, 128-132 kinetics of, 132 stock solutions for, 128 Multidrug resistance amplification to high-level gene expression, 38-39, 44 as dominant selectable marker, 34-35 expression, analysis of, 44-45 selection for, 38-39 applications to foreign gene expression, 35-40 techniques, 35 Multidrug resistance gene and adenosine deaminase, fusion gene with, 37 coamplification, 36 in cotransfections, 36 DNA detection, 45 fusion proteins, 37-38 in mammalian expression vectors, 34-47 cells used with, 39 colchicine selection and amplification, 44 colchicine dose for, 40-42
705
DNA transfer, 40 methods for, 40-47 transfection and initial selection, 4243 transfection methods, 3%40 retroviral transfer of, 36-38, 43-44 RNA detection, 45 as selectable marker in retroviral vector system, 36-37 in tissue culture transfection experiments, 36 Multidrug transporter, 35. See also PGlycoprotein Mutagenesis coupled primer approaches, 189 deletion methods, 218 with T4 DNA polymerase, 258 efficiency of difference obtained at different temperatures of incubation, 267 methods of improving, 258 gapped duplex, 189 insertion method, 219 unintentional mutations, 188-189 oligodeoxynucleotide-directed, M13 ping-pong vectors and T4 DNA polymerase in, 258-270 oligonucleotide-directed, 219 method, 182-183 by overlap extension, 274 phosphorothioate-based, of singlestranded and double-stranded DNA, 189-217 ping-pong, 258-270 point methods, 219 polymerase chain reaction-based protocol, 218-227 site-directed applications of, 280 chloroplast transformation strategies for, 531-534 gapped circle method, 173-189 high-efficiency, 189-217 M13 vectors for, 258-270 oligonucleotide-mediated, method, 282-284 principle of, 280-281
706
SUBJECT INDEX
by overlap extension, 273-274 phosphorothioate approach, 189-217 ofpsbA gene, strategies for, 531-534 template, uracil-containing, 189 Mutagenic oligonucleotides phosphorylation procedure, 182 primers, kinasing of, 281 Mutagenic primers, sequences and frequencies for, 284 Mutagenized genes, expression in yeast, 301-312 Mutant(s) alleles integration of, 304, 309-3130 obtaining, with plasmid shuffle, 309310 heteroduplex nicked, gapping procedure, 215-216 preparation of for plasmid mutagenesis, 209-214 procedure, 214 wild-type strand, exonuclease digestion of, 215-217 homoduplex formation of, procedure, 203 preparation of for phosphorothioate-based mutagenesis with single-stranded DNA vectors, 201-203 for plasmid mutagenesis, 214-217 oligonucleotides, 196-197 annealing of, 212-213 preparation of single-stranded gap for, 211-212 to single-stranded region of plasmid, procedure, 212-213 screening for and analysis of, 183-185 double-stranded DNA sequencing, 184-185 isolation of plasmids, 183-184 transformation of E. coli with, procedure, 205 transposition, isolation and analysis of, 312-322 Mutation(s) chromosomal, generation by integration, 303-306 detection by chemical cleavage of mismatch, 286-295
frequency of, effect of using different enzymes on, 267 new induction of, with biolistic transformation, 534-535 selection and identification of, 517-518 plasmid-borne, generation by plasmid shuffle, 306-309 spurious, detecting, with plasmid shuffle and integration, 310-311 unintentional, 186-188 with gapped circle method, 186-189 in insertions, 188-189 MI3 vector(s), with EcoK/EcoB selection markers, 261 B-Myosin, human cardiac, heavy chain, expression in E. coli using pPLEX, 10
N Negative charges, masking of, 600 Neomycin phosphotransferase gene, 497 Nick translation, DNA probes isotopically labeled by, 398 Nitro Blue Tetrazolium/BCIP, 398-399 Nitrocellulose, 340-341 Nitrocellulose filtration, removal of wildtype single-stranded DNA by, 200-201 procedure, 200-201 Nonsense codons, 258 NruI, 358 NTG. See N-Methyl-N'-nitro-N-nitrosoguanidine Nuclear expression vectors, 547. See also Vector(s), nuclear expression Nuclease digestion, restriction and, removal of parental strand by, 283 Nucleotides analogs, enzymatic incorporation of, 219 misincorporation of, by DNA polymerases, 219 Nylon membranes, 340
O OE sequence variants, cloning modified ColEI::Tn50RF lac for, 319 modified Tn5 ORF lac for, 319 Oligo (computer program), 259
SUBJECT INDEX Oligodeoxynucleotide-directed mutagenesis, MI3 ping-pong vectors and T4 DNA polymerase in, 258-270 Oligodeoxynucleotide-directed mutants, selection of, 280-286 approaches for, 281 Oligonucleotide(s) binding to phage T7 RNA polymerase, 57 for constructing vector MI3B119, 264 degenerate, as insert, design of, 243 for expression-cassette polymerase chain reaction, 90-91 for high-level gene expression by phage T7 RNA polymerase, 51-53 lengths of, different, recombination efficiency obtained with, 300 mismatch, phosphorylation of, procedure, 197 mutagenic phosphorylation of, procedure, 182 primers, kinasing of, 281 mutant, 196-197 annealing of, 212-213 preparation of single-stranded gap for, 211-212 to single-stranded region of plasmid, procedure, 212-213 primers, 281 design of, 259 mutagenic, kinasing of, 281 single-stranded, introduction into double-stranded plasmid, 296(s) for site-specific mutagenesis in plasmids, 177 synthesis of, for phage T7 promoter mutagenesis, 57 synthetic, s2p-labeled, 398 Oligonucleotide-directed mutagenesis, sitedirected, method, removal or parental strand by restriction and nuclease digestion, 283 Oligonucleotide-directed mutants, 280286 Oligonucleotide-mediated mutagenesis, 182-183,219 conversion of gapped circle into covalently closed heteroduplex circle, 182
707
phosphorylation of mutagenic oligonucleotides, 182 of plasmids, method, 206-207 site-directed, 280-286 materials and reagents, 281 method, 282-284 annealing primer to template, 282 kinasing of mutagenic oligonucleotide primer, 282 principle, 280-281 second-strand synthesis, 283 transformation, 283 results, 283-284 transformations, 182-183 Oligonucleotide probes alkaline phosphatase-conjugated, 407412 genomic sequencing with, 409-411 genomic Southern analysis with, 407409 level of detection with, 409 biotinylated chemiluminescent detection of, 405406 hybridization with, 404 biotinylation of, 402-403 preparation of, 344 rapid colony hybridization on paper with, 340-346 materials for, 341-342 methods, 342-345 Oncogenes, retrovirus carrying, safety considerations, 598-599 Open reading frame chloroplast, 556 targeted disruption of, 530 selection, in DNA/cDNA, 21-22 Open reading frame vectors, 12. See a/so Vector(s), open reading frame Osmium tetroxide modification, 291 Overexpression system, for expressioncassette polymerase chain reaction, 90-91 Overlap extension general concept, 272 gene splicing by, 270-279 example, 273-275 protocol for, 278-279
708
SUBJECT INDEX
mutagenesis by, 274 site-directed, 273-274 primers used in, examples of, 274 Overproducer(s) architecture of, 80-82 construction of, using expression-cassette polymerase chain reaction, 8284 promoter, 81-82 ribosome-binding site of, 81 transcription terminator, 82 Oxirane acrylic particles, for affinity purifying phage, 248 P P170, 35. See also P-Glycoprotein Packaging extracts, in vitro, preparation procedure, 367-369 Paper, colony hybridization on, 340-346 Papillation assay, advantages of, 320 T n 5 0 R F lac, 318 Parental strand, removal by restriction and nuclease digestion, 283 Partial digests analytical-scale, 352-353 preparative-scale, 353 Particle acceleration method. See Biolistic process Particle accelerators, 485-490 baffles/meshes, 488-489 designs, 486 determinants of velocity, 489-490 macroprojectiles, 485-487 PDS-1000, 520, 534 bombardment with, 524 gunpowder-driven, 486 helium shock driven retrofit, 486 PDS-1000/He, 520, 538 bombardment with, 524 preparation of gold particles for use with, 523-524 power source, 486-487 safety, 490 shave cream assay of, 488-489 vacuum/residual gas, 487-488 Particle bombardment, 619. See also Biolistic process Particle delivery systems, 520
Particle gun, 520 Pepsinogen, swine, production by Bacillus brevis, 32 Peptide(s) displayed by phage, libraries of, 228-257 sequences GDWVFI, 255 PWflWLX, 255 synthesis, gene transfer into chromaffin cells to study transcriptional regulation of, 607-609 tags, 102 Phagemid(s), 232 phGH-M13gllI, 230, 232 Phosphatase control ligation reaction in, 367 procedure, 367 Phosphatase treatment of insert DNA, 371 of plasmid DNA, 367 Phosphorothioate-based mutagenesis, 189217 of plasmids preparation of mutant heteroduplex, 209-214 annealing of mutant oligonucleotide, 212-213 polymerization reaction, 213-214 preparation of single-stranded gap to which mutant oligonucleotide can anneal, 211-212 site-specific restriction endonuclease/ethidium bromide nicking of plasmid, 209-214 preparation of mutant homoduplex, 214-217 exonuclease digestion of mutant heteroduplex wild-type strand, 215-217 strand-selective hydrolysis of wildtype DNA, 214-215 preparation of plasmid DNA, 208 principle of method, 205 strategy, 207-208 transformation of competent cells, 217 procedure, 217 troubleshooting, 216-217 of single-stranded D N A experimental procedure, 192-193 materials and enzymes for, 192-193
SUBJECT INDEX media for, 192 reagents for, 192 preparation of template DNA for, 193-196 principle of, 190-191 procedure, 191 with single-stranded DNA vectors, 196205 phosphorylation of mismatch oligonucleotide, procedure, 197 preparation of mutant homoduplex, 201-203 preparation of RFIV heteroduplex DNA annealing, 199 polymerization, 199-200 removal of wild-type single-stranded DNA, 200-201 transformation of competent cells, 203-205 preparation of competent cells, 204 transformation of E. coil with mutated DNA, 205 with single-stranded vectors, 196-205 Phosphorothioate-containing DNA, restriction endonucleases unable to hydrolyze, 198 Phosphorothioate-modified DNA, 258 Phosphorylation of mismatch oligonucleotide, procedure, 197 of mutagenic oligonucleotides, procedure, 182 Photosynthesis, missense mutations defective in, as chloroplast transformation recipients, 526-527 Picogram detection, with two-color laserexcited confocal fluorescence gel scanner, of stable dye-DNA intercalation complexes, 414-431 Ping-pong mutagenesis, 258-270. See also M13 ping-pong vector(s) coning of c-fos DNA insert into vector M13B119,263-264 experimental details, 261-262 bacterial strains and vectors, 261-262 enzymes, 261 extension/ligation, 262 hybridization, 262 materials and methods, 261-268
709
principles of method, 259-260 removal of first intron, 264 removal of second intron, 265 removal of third intron, 264 results of experiment, 262-268 schemes. 268 test of different DNA polymerases and temperature of extension/ligation, 265 -268 troubleshooting, 268-269 Piperidine cleavage, method, 291-292 Pituitary cell line, permanent, gene transfer in, 612-615 Plant cell suspension cultures bombardment of, handling, transfer, and selection in, 503 preparation of, for bombardment, 502503 Plant material, preparation for bombardment, 541 Plant protoplasts, electroporation into, 471-472 buffer, 471 procedure, 472 protoplast solution, 471 Plasmid(s). See also Phagemid(s); Vector(s) carrying gene for T7 RNA polymerase, 51 clones, rescreening of, lysis of bacterial colonies for, 396 donor available for chloroplast transformation, 519-521 for chloroplast transformation choice of, 513-516 separate, cotransformation with chloroplast genes on, 528-529 use with chloroplast RFLP markers, 517 double-stranded DNA introducing restriction sites into, 295301 introduction of single-stranded oligonucleotide into, 296 free, persistence of, 518-519 isolation of, 183-184 procedure, 184 linear, dU-containing, preparation of, 178-179
710
SUBJECT INDEX
lipid-coated, cationic, 600-601 M6SVT7N, 51, 53 necessary elements of, 3-4 pACpl8, 552 pACpl9, 552 pBD7, 144-145 pBI121, 497 pBI426, 497 pBluescript, recombinant clones based on, comparison of methods of identifying, 337 pBR322, chemiluminescent detection of, 405 pBR-AN3, 28-29 pBR322/pUC-derived, 295 pC1B1 cell-free protein synthesis from, SDSPAGE analysis of, 149 construction of, 146-147 pCl 1B9 cell-free protein synthesis from, SDSPAGE analysis of, 149 construction of, 146 pCBII1 35, 146-147 pCBAK8, 230 pCMVTTN, 51, 53 pCTA, 482 pDH51, 67 pEI94, 25 pGEM, 51-52, 135 T7 promoter in, 49-50 pGEMEX-2, 114-115 pGEMEX-PV, expression of recombinant rat parvalbumin in, 119 pGEM3Z, recombinant clones based on, comparison of methods of identifying, 337 ~HaMDR, 36, 38, 43 ~HaMDR/A, 36-37 ~HD103, 545 ~HD203, 545-546 ~HD306, 545 ~HD312, 545-546, 549 ~HD407, 546, 549 ~HD203-GUS, 546-547 pHNlf, physical map and polylinker sequence of, 87 pHWl, 25 pHY481, 25 plFF5, 14-15, 21
plFF8, 14-15, 21 applications of, 22 BssHII cleavage, 15-16, 21-22 calf intestinal phosphatase treatment, 16 cloning of DNA fragments in, 17-18 filling-in reaction with Klenow polymerase and dNTPs, 16-17 limitations of, 22 preparation of, for in-frame cloning, 15-17 preparation of DNA fragments for cloning in, 17-18 pkl8, recombinant clones based on, comparison of methods of identifying, 337 pkl9, recombinant clones based on, comparison of methods of identifying, 337 ~KfdH, 230 ~KK232-8, 545 3MC1790, 482 ~MCCEN4, 482 ~MLS-MIu-Not, 362 ~MON316, 67 ~MP450, 545 9MTT7N, 51-53 ,NU210, 26-28 ~PBI121, 547 ,PBI443, 545 ,PLEX, 3-11. See also Escherichia coli, expression plasmid pPLEX pPLEX19, 11 pPPBX10218, 545 productively gapped using exonuclease III, 213 pRT55, 73-74 pRT66, 73-74 pRT77, 73-74 pRT88, 73-74 pRT99, 73-74 pRT100, 67-69, 72 pRTI01, 68-69, 72 polylinker sequence, 69-70 pRT102, 68-69, 72 polylinker sequence, 69-70 pRT103, 68-69, 72 polylinker sequence, 69-70 pRTI04, 68-69, 72 polylinker sequence, 69-70
SUBJECT INDEX
pRTI05, 68-69, 72 polylinker sequence, 69-70 pRTI06, 68-69, 72 polylinker sequence, 69-70 pRT107, 68-69, 72 polylinker sequence, 69-70 pRT108, 68-69, 72 polylinker sequence, 69-70 pRTlOlcat, 76-77 pRT-ex/s-int/s-cat, 78 pRT 100-pRT 108 construction of, 68-72 general properties of, 68 vectors based on, 72 pRU 100, 25 pSac, 362 pSD-MluI, 362 pSEX, 230 pSKI.MDR, 36, 38, 40 cloning foreign sequences into, 40 structure of, 40-41 pSP65, 135 pSP73, 135 pSZ214, 482 pTi, A. tumerfaciens, T-DNA region genes, 66 pT7Ig, 63-64 pT7mhGH, 52 pT7mluc, 52 pT7neo, 51-52 pUB110, 25 pUC8, 351 recombinant clones based on, comparison of methods of identifying, 337 pUC8-1, recombinant clones based on, comparison of methods of identifying, 337 pUC8-2, recombinant clones based on, comparison of methods of identifying, 337 pUC9, recombinant clones based on, comparison of methods of identifying, 337 pUC9-1, recombinant clones based on, comparison of methods of identifying, 337 pUC9-2, recombinant clones based on, comparison of methods of identifying, 337
711
pUCI2, recombinant clones based on, comparison of methods of identifying, 337 pUCI3, recombinant clones based on. comparison of methods of identifying, 337 pUC18, 336 pUC19, 546 pUC8 CaMV CATA N, 546 pUC-derived, screening recombinant clones based on, 335-339 pUCl8-derived, screening recombinant clones based on comparison of methods, 337 methods for, 336 principle of, 336 pUCHinEcol, recombinant clones based on, comparison of methods of identifying, 337 pUCI9 mutagenesis intermediates, analysis by agarose gel electrophoresis, 208 pUGA, recombinant clones based on, comparison of methods of identifying, 337 purification of, for transfection, 53-54 pWM528, recombinant clones based on, comparison of methods of identifying, 337 pWM529, recombinant clones based on, comparison of methods of identifying, 337 pWT481, 25 single-stranded region, annealing of mutant oligonucleotides to, procedure, 212-213 site-specific mutagenesis in, gapped circle method, 173-189 site-specific restriction endonuclease/ ethidium bromide nicking of. 209211 suppressor-containing, and polylinkers, modified for construction of jumping libraries, 362 synthetic. See Cosmid(s) tag isolation of, by gel electrophoresis, 366-367 for large insert linking-clone library construction, 351,353
712
SUBJECT INDEX
yeast, 302 2/zm circle, 302 YCp, 302 YCp50, 482 YEp, 302 YEp24, 482 YIp, 302-303 YRp7, 482 Plasmid-borne mutations, generation by plasmid shuffle, 306-309 Plasmid DNA B. brevis, preparation of, 27 cell-free transcription of, 146-148 expressing native and mutant 3C protease of coxsackievirus, construction of, 146 isolation of, materials and reagents for, 126 linearization and phosphatase treatment of, 367 nicking procedure, 210 preparation of for chloroplast transformation, 523 for mutagenesis, 208 Plasmid mutagenesis, phosphorothioatebased oligonucleotide-directed method, 206207 preparation of mutant heteroduplex, 209-214 preparation of plasmid DNA, 208 principle of method, 205 strategy, 207-208 transformation of competent cells, 217 troubleshooting, 216-217 Plasmid shuffle comparison with integration, 309-312 detecting spurious mutations with, 310311 generation of plasmid-borne mutations by, 306-309 example, 308-309 principles of method, 306-308 isolation of conditional-lethal TUB1 alleles by, 308-309 obtaining mutant alleles with, 309-310 Point mutagenesis methods, 219 polymerase chain reaction-based protocol, 218-227
pollk, 259 effect on frequency of mutation, 267 properties, 260 Polyacrylamide gel electrophoresis, of polymerase chain reaction products, 224 Polyamines, condensation of nucleic acids by, inhibition of, 615 Polybrene-mediated gene transfer, 619 Polycations, use of, 618 Polycistronic mRNA, expression of, by phage T7 RNA polymerase, 63-64 Polyethylene glycol, 478 Polyethylene glycol-mediated chloroplast transformation, 536 Polylysine, 3-mercaptopropionate-modifled, 625-626 Polylysine-mediated gene transfer, 644 Polymerase chain reaction, 103,441-442 amplification of DNA fragments by, 436-437 applications of, 436-437 to isolate specific cDNA, 103-105 cDNA cloning by, 102-122 expression of cloned PCR products, protein quantitation, and isolation, 114-122 generation of cDNA for, 109-114 materials and reagents for, 107-109, 116-117 DNA probes isotopically labeled by, 398 experimental procedure, 111-113 expression-cassette, overproduction of proteins with, 79-102 internal, experimental procedure, 111 materials and reagents for, 108 3'-directed, 103-105 experimental procedure, 111 general strategy for, 104 5'-directed, 103-105 experimental procedure, 111 general strategy for, 104 primer, single specific, genome walking by, 436-446 Polymerase chain reaction-based point mutagenesis, 218-227 applications, 220 of BS I-BS III, 221 materials and reagents, 222
SUBJECT INDEX
method, 222-224 principle of, 220-222 two-step experimental conditions for, 225 first-step PCR, 222-223 frequency and number of point mutations accumulated with, 226 second-step PCR, 223-224 strategy, 221 Polymerase chain reaction-generated mutations, 97 Polymerase chain reaction products analysis of, 112-113 by electrophoresis on polyacrylamide gels, 224 cloned, expression of, 114 host strains for, 115-116 cloning of, 103-105 ligation and transfection for, 114 materials and reagents for, 108-109 procedure for, 113-114 strategy for, 106 expression of experimental procedure for, 117-118 materials and reagents for, 116 isolation of, experimental procedure for, 118-122 quantitation of experimental procedure for, 118 materials and reagents for, 116-117 Polymerization reaction, 213-214 preparation of mutant heteroduplex for, 214 Polynucleotide kinase, 398 Polyornithine-mediated gene transfer, 619, 644 Porcine melanotrope cells, primary, gene transfer into, 605-607 Preparative-scale gene expression, 123-142 materials and reagents for, 126-127 perspectives on, 141-142 procedures and results, 127-137 reactors for, 124-125 Primer(s). See also Single specific primerPCR 3', design of, 89 5', design of, 84-89 annealing and extension of in mapping transcription start points, 452-453
713
to template, 281 design of, 84-90 DNA, preparation of, for mapping transcription start points, 451 double, and M13B119 vector, cyclic deletion with DNA sequence of selection primers 1 and 2 used for, 264 strategy, 263 expression-cassette polymerase chain reaction, coding and anticoding sequences in, 89-90 mutagenic, sequences and frequencies for, 284 oligonucleotide, 281 mutagenic, kinasing of, 281 for overlap extension, examples, 274 sequence XIHI01N, 285 Primer Designer (computer program), 259 Primer-restriction end (PRE) adapters, 153-155 for use with hjac and hecc, 155 Priming random, DNA probes isotopically labeled by, 398 single, 258 Proenkephalin, transcriptional regulation of, in chromaffin cells, 610 Promoter selection vectors. See Vector(s), promoter selection Protease, coxsackievirus 3C, native and mutant, construction of plasmid DNAs expressing, 146 Protein(s). See also Fusion protein binding, ligands for, 256 displayed by phage, libraries of, 228-257 domains, structured, cloning, 256-257 expression of, experimental procedure for, 117-118 insoluble, 100 mammalian, production by B. brevis. 32 overproduction of, using ECPCR, 79102 production of heterologous, by B. brevis, 23-33 in vitro, methods for, 102 recombinant color-based selection of, 335 isolation of, materials and reagents for, 117
714
SUBJECT INDEX
quantitation of, experimental procedure for, 118 Western blot analysis of, 333 synthesis, cell-free, from pCIB1 and pCl 1B9, SDS-PAGE analysis of, 149 T4 bacteriophage gene 32, in mapping transcription start points with T4 DNA polymerase, 457 Protein A, radiolabeled antibodies tagged with, 325 signal detection in Western blot analysis by, 333 Protein expression analysis, by vaccinia virus recombinant, 577-580 Protein kinase A pathway for lipopolyamine-based gene transfer, 613-615 subunits, mutated, effect on cAMPdependent induction of CRE-containing genes, 613 Protoplast fusion, 644 psbA gene, site-directed mutagenesis of, strategies for, 531-534 Pseudomonas syringae, 484 cell size, 498 PstI nicking, of wild-type DNA, procedure, 214-215 Pulsed-field gel electrophoresis, 357 in cosmid cloning and walking, 380, 382-383 3-(2-Pyridyldithio)propionate-modified transferrin, 625 R Rabbit reticulocyte continuous-flow cellfree (CFCF) system with phage SP6 RNA polymerase, chloramphenicol acetyltransferase synthesis in, kinetics of, 139 transcription-translation, chloramphenicol acetyltransferase synthesis in, 137 translation, globin synthesis in, 132 Radiofrequency electroporation, 478 Radioimmunoprecipitation analysis of HIV-1 polypeptides produced by recombinant vaccinia virus that expresses HIV-1 eno gene, 578
procedure, 580 reagents, 579-580 Radiolabeled antigen immunoscreening of cDNA library with, 325-335 apparatus for, 328-329 applications, 325-326 flow chart for, 327 materials and reagents, 326-329 methods, 329-334 binding specific antibodies to immobilized protein, 331 identifying specifically bound antibodies by radiolabeled antigen, 331-332 isolation of cDNA clones encoding rat kallikrein-binding protein, 334 plating cDNA library for primary screening, 329-330 radiolabeling antigens for, 329 transferring recombinant polypeptides to nitrocellulose filters, 330-331 Western blot analysis of recombinant proteins, 333 primary, 334 principle of, 326 secondary, 332-334 time considerations, 329 signal detection in Western blot analysis by, 333 Raffinose, 501 Random priming, DNA probes isotopically labeled by, 398 Rare-cutter jumping clones fragment ends, isolation of, 375 isolation of DNA preparation for, 375 as plasmid subclones, 375 procedure, 375 Rare-cutter jumping colony lysis, 374 replicas, 374 Rare-cutter jumping libraries, 347, 359 construction of, 348, 357, 365-375 alternative approaches, 377 amplification as ), library procedure, 373 bacterial hosts for, 364
SUBJECT INDEX
circularization ligation procedure, 370 cleavage of genomic DNA in agarose procedure, 369-370 DNA concentrations for, 361 enzymes and reagents for, 364 isolation of jumping clones procedure, 375 isolation of tag plasmid by gel electrophoresis procedure, 366-367 h vector for, 363 linearization and phosphatase treatment of plasmid DNA procedure, 367 linearization of k vector DNA procedure, 366 marker plasmid concentrations for, 361-363 materials for, 363-365 media and plates for, 365 phosphatase control procedure, 367 phosphatase treatment of insert D N A procedure, 371 preparation of high molecular weight DNA in agarose blocks procedure, 369 preparation of in oitro packaging extracts procedure, 367-369 principle of method, 359-363 problems, 376-377 procedure, 360-361 recleavage of DNA circles procedure, 370-371 replication into high-density colony patterns procedure, 373 screening jumping libraries as colonies procedure, 373-374 solutions for, 364-365 tag plasmids for, 363 vector ligation and packaging reaction procedure, 371-373 CsCI step gradients, 372-373 ligation of analytical, 371 preparative, 372 packaging of analytical, 371 preparative, 372 plating cells, preparation of, 371-372 screening as colonies, 373-374 plating fractions for, 373-374
715
size, 375-376 test plating of, 372 use of, 377-378 Rat kallikrein-binding protein cDNA clones isolation of, 334 screening of rat liver cDNA library for, positive signals detected by radiolabeled antigen in, 334 Rat liver cDNA library, screening with radiolabeled antigen for rat kallikreinbinding protein cDNA clones, positive signals detected by, 334 RBS. See Ribosome-binding site Receptor-mediated transfer into eukaryotic cells, 618-644 with ligands other than transferrin, 622623 method(s), 624-641 principle of, 620-624 recent developments, 641-644 systems, principle of, 620 Recleavage, of DNA circles, procedure. 370-371 Recombinant DNA technology, 461 electroporation in, 461-478 Recombinant protein(s) color-based selection of, 335 isolation of, materials and reagents for, 117 quantitation of, experimental procedure for, 118 Western blot analysis of, 333 Recombinant pUC-like plasmid(s), screening, 335-339 comparison of methods, 337 with different plasmid cloning vectors, 338-339 limitations, 339 materials and reagents, 337-338 method I, 338 method II, 338 principle, 336 Recombinant rat parvalbumin expression in pGEMEX-PV, 119 quantitation of, 120 purification of, 121 Recombinant vaccinia virus, 557-581 Repolymerization, 203 Reporter gene assays, 55
716
SUBJECT INDEX
a2 repressor, S. cerevisiae, homeodomain of, overproduction of, 101 Restriction, and nuclease digestion, removal of parental strand by, 283 Restriction endonuclease(s) nicking of heteroduplex DNA, 201 nicking of plasmid extraction and spin dialysis procedure, 211 site-specific, 209-211 nicking of plasmid DNA, procedure, 210 unable to hydrolyze phosphorothioatecontaining DNA, 198 Restriction enzyme(s) BssHII cleavage of pIFF8 vector, 15-16, 2122 digestion patterns of, 13-14 MluI, 358 NruI, 358 SplI, 358 Restriction-ligation products, blunt end, single specific primer-PCR of, 445 Restriction maps for CDI genes, 397-398 for cosmid clones, 390-391 E. coli K-12, cloning with, 444 Restriction sites, introduction of into double-stranded plasmid DNA, 295301 rapid, 295-301 Retroviral vector(s), 35,463,476-477, 581-599. See also Vector(s), retroviral carrying oncogenes, safety considerations, 598-599 efficiency, 476 gene insertion into, method, 590 gene transfer with materials and reagents, 589-590 method(s), 590-596 principle of, 582-588 infection of cells by, method, 595 infection of chinese hamster ovary cells by method, 595-596 tunicamycin treatment allowing, 596 for transfer of MDR1, 36-38, 43-44 Retroviral vector-producing cell lines, stable, generation of method, 589, 591-593 procedure, 587-588
Retrovirus harvest and assay of, method, 593 high-titer, generation of, difficulties, 597-598 production of, by transient transfection of packaging cells, method, 590-591 safety considerations, 598 titer of, increasing, 598 Retrovirus-containing medium, filtration of, 597 Retrovirus-packaging cells, 582-583 generation of, 596-597 strategies for, 586 host range of, 588 lines, 587, 589 GALV-based PG13, 599 selection of, 585-587 transient transfection of, virus production by, method, 590-591 Reverse transcriptase, primer extension mapping of cap sites with, 457 Reverse transcription experimental procedure, 110-111 materials and reagents for, 107-108 Ribosome-binding site, 81 design of, 81 Ribozymes, synthesis of, 64-65 application T7 expression system to, 6465 Rice actin promoter, 497 RNA. See also Messenger RNA antisense overexpression of, MDR1 system for, 39-40 synthesis of, 64-65 isolation of experimental procedure, 109-110 materials and reagents for, 107 synthesis of, 645-647 in vitro synthesized, cell-free translation of, 148 protocol for, 148 RNA detection, of multidrug resistance gene, 45 RNA dot blot, 571-572 procedure, 572 reagents, 571 RNA lipofection, 644-654 applications, 652-654 efficiency of, 649-651,653-654 features of, 654
SUBJECT INDEX
limitations, 654 optimization of, 648-649 in various cell types, 651-652 RNA polymerase endogenous, continuous-flow cell-free (CFCF) transcription-translation systems with, gene expression procedures and results, 133-134 phage SP6, 135-136 continuous-flow cell-free (CFCF) transcription-translation systems with, gene expression procedures and results, 134-137 RNA probes generated with, 398 phage T7, 135-136 cell clones carrying, selection of, 5860 continuous-flow cell-free (CFCF) transcription-translation systems with, gene expression procedures and results, 134-137 expression of bi- and polycistronic mRNA by, 63-64 high-level gene expression by, 49-66 nuclear localization of, 49 oligonucleotide binding to, 57 stable expression of tPA cDNA by, 63 RNA transfection, 644-645,647-648 cationic liposome-mediated, 644-654 with lipofectin. See RNA lipofection S Saccharomyces cerevisiae. See also Yeast AH22 strain, 482 biolistic transformation of, 498 JT-26A strain, 482 electroporation of, DNA dependence of transformation by, 481 MI2B strain, 482 a2 repressor homeodomain, overproduction of, 101 strains, for electroporation, 482 SUB60 strain, 482 Salmonella typhimurium, single specific primer-PCR in, 438 situations examined by, 439 Secondary antibody conjugated to alkaline phosphatase or horseradish peroxidase, 325 gold-labeled, 325
717
radiolabeled, 325 signal detection in Western blot analysis by, 333 Second-strand synthesis, 283 Sequenase, 258, 261 effect on frequency of mutation, 267 properties, 260 Sequencing, 240-241,249-250 gels, pouring and running, 241-243 ladders, preparation for mapping transcription start points, 451 template, 240 Shave cream assay, 488-489 Shine-Dalgarno sequence, 81 Simian virus 40, 48 Single-cell suspension, preparation of, 369 Single priming, 258 Single specific primer-PCR applications of, 444-446 basic principle, 437-438 of blunt end restriction-ligation products, 445 critical parameters in, 445 experimental, 439-444 isolation of bacterial chromosomal DNA, 439-440 polymerase chain reaction, 441-442 restriction and ligation of chromosomal DNA, 440-441 sequencing of products, 443-444 testing for specificity of amplification product, 442-443 features of, 444-446 genome walking by, 436-446 materials, 439 products largest, 444 sequencing of, 443-444 in S. typhimurium, situations examined by, 439 vectors for, 446 Single-stranded DNA phosphorothioate-based mutagenesis of. 189-217 analysis of intermediates, by agarose gel electrophoresis, 196 trouble-shooting, 216-217 self-priming test for, procedure, 195-196 template annealing of primer to, 199 procedure, 199
718
SUBJECT INDEX
preparation for phosphorothioatebased mutagenesis, 193-195 vectors, phosphorothioate-based mutagenesis with, 196-205 wild-type, removal of, by nitrocellulose filtration, 200-201 Single-stranded gap, to which mutant oligonucleotide can anneal, preparation for plasmid mutagenesis, 211-212 Single-stranded oligonucleotide(s), introduction into double-stranded plasmid, 296 Site-directed mutagenesis applications of, 280 chloroplast transformation strategies for, 531-534 gapped circle method, 173-189 high-efficiency, 189-217 methods for, 189 materials and reagents bacterial strains, 281 enzymes, 281 primers, 281 methods, 286 MI3 vectors for, 258-270 oligonucleotide-mediated, 280-286 method, 282-284 principle, 280-281 by overlap extension, 273-274 phosphorothioate approach, 189-217 ofpsbA gene, strategies for, 531-534 Small cultures, processing, 240 Sodium alginate, 433 Sodium bisulfite mutagenesis, 219 SOE. See Splicing by overlap extension Software ANALYSEQ, 259 for expression-cassette polymerase chain reaction, 92 Fold and Squiggles program, 89 GeneJockey, 259 Oligo, 259 Primer Designer, 259 Sonic extract, preparation for preparation of chromosome jumping libraries, 368369 Sorbitol, 501 SOS response, and transposition, study of, 320-321
Southern blot analysis with alkaline phosphatase-conjugated oligonucleotide probes, 407-409 level of detection, 409 with chemiluminescence, 398-414 of cosmid DNAs digested with EcoRI and probed with FCB probe, 392393 of genomic DNA MOLT 4 digested with EcoRI and probed with FCB, 392 with 32p. and alkaline phosphataselabeled probes, 408 of recombinant vaccinia virus, 576 Spermine-5-carboxyglycinediotadecylamide, 603-604 Spermine synthesis, 602 Spheroplast transformation, 432 Spinach, Rubisco (ribulose-bisphosphate carboxylase) activase isoforms, expression in E. coli using pPLEX, 10 SplI, 358 Splicing by overlap extension, 270-279 constructing complex fusion protein by, strategy for, 275-276 examples, 273-275 general concept, 272 general considerations, 275-277 method, 271-272 protocols for, 277-279 polymerase chain reaction conditions, 278 solutions and reagents, 277 Square wave generators, 465 SSP-PCR. See Single specific primer-PCR Stable dye-DNA intercalation complexes advantages of, for fluorescent staining and detection of DNA, 415-416 picogram detection of, with two-color laser-excited confocal fluorescence gel scanner, 414-431 data collection and processing, 422 final sample preparation and agarose gels, 421-422 instrumentation, 417-419 methods, 417-422 preparation and storage of dye solutions, 419 results, 422-429 staining of double-stranded DNA, 419-421
SUBJECT INDEX Starved cells, 239 Subtractive hybridization, cDNA fractionation by, 159-160 Sugar beet, cell culture media and subculture conditions, 539 Supernatant, removal of, 236-237
T Tag plasmid gel electrophoresis of, 366-367 for large insert linking-clone library construction, 351,353 Temperature, of extension/ligation, test of, 265-268 Template DNA for ECPCR, 91 preparation of for mapping transcription start points, 449-450 for phosphorothioate-based mutagenesis of single-stranded DNA, 193195 self-priming test, 195-196 Template mutagenesis, uracil-containing, 189 Tetramethyldioxetane, 399 Tetra-tert-butoxycarbonylspermine-5carboxylic acid (Boc4SperCO2H), 602603 Thermal cycler, for expression-cassette polymerase chain reaction, 92 Thiazole orange dimer preparation and storage of, 419 spectroscopic properties of, 419 two-color DNA size determination with, 429 Thiazole orange homodimer, 416-417 absorption and fluorescence emission spectra of, 420-421 complexes, two-color detection of, 426429 structure of, 415 c~-Thionucleotide, misincorporation of, by DNA polymerases, 219 Tissue plasminogen activation gene, Southern analysis of, with 32p. and alkaline phosphatase-labeled probes, 408
719
Tissue plasminogen activator cDNA, stable expression by T7 RNA polymerase, 63 detection of, 55 Titering transducing units, 239 Tn5,314-316, 321 Tn5 lac translation fusion element, 312322 Tn5 ORF lac, 316-317,319, 321-322 analysis of element-encoded functions with, 317-319 analysis of host functions with, 319321 applications of, 317-322 characteristics of, 322 modified for cloning OE sequence variants, 319 Tn5 ORF lac papillation, 318 Tn5 transposition, 315 host functions in, 315 Tobacco cells culture media and subculture conditions. 539-540 NT1 suspensions biolistic transformation of, 498 cat expression in, 549-553 analysis of, 550-552 colony growth, critical factors, 503 culture osmoticum, 501 protoplasts chloramphenicol acetyltransferase assay of, 75-77 chloroplast transformation in, 513 size, 498 stable complementation of, 537 Tobacco leaf organelles, transformation of, 512-513 Transcription, 165-166 cell-free, of plasmid DNAs, 146-148 protocol for, 146-148 reverse experimental procedure, l lO-111 materials and reagents for, 107108 terminator, 82 vectors, 83 for expression in baculovirus, 48 in vitro, 57-58 Transcription factor KBFI, human, overproduction of, 101
720
SUBJECT INDEX
Transcription start points, mapping with reverse transcriptase and mRNA template (conventional method), 457 with T4 DNA polymerase, 446-458 accuracy of, 453-456 advantages of, 456 applications, 447, 457 buffers, solutions, and reagents, 448449 materials and methods, 448-456 mRNA:DNA template hybridization in, 451-452 preparation of DNA primers and sequencing ladders for, 451 preparation of DNA template for, 449-450 preparation of mRNA for, 450-451 primer annealing and extension in, 452-453 protocol for, 447-448 requirements for, 456 sensitivity of, 447, 453,457-458 sensitivity test for, 454-455, 457 techniques for, 446-447 Transcription-translationsystems, cellfree, 123 with endogenous RNA polymerase, gene expression procedures and results, 133-134 with phage SP6 RNA polymerase, gene expression procedures and results, 134-137 with phage T7 RNA polymerase, gene expression procedures and results, 134-137 Transducing units, titering, 239 Transferrin conjugation with polylysine, 626 ligands, iron incorporation for, 628 3-(2-pyridyldithio)propionate-modified, 625 receptor levels, treatment to enhance, 629-630 Transferrinfection, 620-622, 642 adenovirus-supported, 643 of adherent cells, 630 advantages of, 642 application of conjugates, 628-636 assays, 636-641 fluorescence-activated cell sorting analysis, 637
choice of cells for, 628-629 DNA delivery as function of time of exposure to transferrin-polylysinDNA complexes, 635 harvesting cells after, 635-636 influence of DNA quality on, 632 initial parameters to vary, 634 isolation of stable transformants, 640641 in K562 cells efficiency, 642-643 standard protocol, 634-635 method(s), 624-641 precautions, 630-632 preparation of cells, 629 preparation of conjugates, 624-628 preparation of DNA, 630-632 principle of, 620-624 quantitation of, 630-632 quantitative aspects, 623-624 recent developments, 642-644 of suspension cultures, 629-630 synthesis of conjugates, 624 transfection, 634 troubleshooting, 634 with various cell types, 629 Transferrin-polycation-DNAcomplex, 633-634 formation of, 632-633 Transferrin-polylysineconjugates application of, 628-636 preparation of, 624-628 general procedures for, 624-625 quantitative assays of, 624-625 storage of, 628 synthesis of, 624 through carbohydrate modification, 627-628 through disulfide linkages, 625-626 Transferrin-polylysine-DNAcomplex application of, 630 DNA delivery as function of time of exposure to, 635 formation of, 632-633 Transgenic mice, multidrug resistance gene in, 35 Translation, 166 cell-free systems, 123 continuous-flow, gene expression procedures and results, 127-132
SUBJECT INDEX of in vitro synthesized RNA, 148 protocol for, 148 Translation products, two-dimensional gel analysis of, 167-168 Transposable element, 312-313 end sequences, defining, 314 Transposase, defining, 314 Transposition conservative, 313 factors involved in, 313 host mutant that enhances, isolation of, 320 IS50. See Transposition, Tn5 SOS response and, study of, 320-321 Tn5, 315 host functions in, 315 Transposition mutants, isolation and analysis of, 312-322 Transposon, 312 insertion sites, identification of, 444 Trioxanes, 399 Trioxetanes, 399 TRP1, 482 trpl, 302 Trypanosoma cruzi, trypanothione reductase, overproduction of, 101 Trypanothione reductase, T. cruzi, overproduction of, 101 TUB1, conditional-lethal alleles, isolation of, 308-309 TUB2, conditional-lethal alleles, isolation of, 305-306 TUB3, 308-309 Tungsten microprojectiles, 490 bombardment of cells with, 534 M5,493 M10,493 preparation of, 523 toxicity, 501-502 Tungsten particle bombardment, foreign gene expression in chloroplasts of higher plants mediated by, 536556 Two-color confocal fluorescence imaging system, 417-419 picogram detection of stable dye-DNA intercalation complexes with, 414431 Two-dimensional gel analysis, of cell-free translation products, 167-169
721 U
Ultrafiltration Amicon YM100 membrane, 140 upflow column systems, 125-126 Ultraviolet laser microbeams, 520 Uncinula necator, 484 Unintentional mutations, 186-188 with gapped circle method, 186-189 in insertions, 188-189 URA3, 482 ura3, 302 negative selection of, 303 Uracil-containing parental template, inactivated by uracil N-glycosylase, 258 Uracil-containing template mutagenesis. 189 V Vaccination, of animals, 580-581 Vaccinia genomic DNA, preparation of, 574-577 procedure, 575-577 reagents for, 575 Vaccinia virus, 48, 581 biology of, 558-560 Elstree strain, 560 growth of, 566-568 initial amplification of plaque isolates procedure, 567 reagents for, 566-567 secondary amplification of plaque isolate/preparation of stock from virus of known titer procedure, 567 handling of, safety considerations, 565566 preparation of, host cells for, 566 purification procedure, 567 recombinant, 557-581 applications, 557-558, 581 characterization of, 574-577 expressing HIV-1 env gene, HIV-I polypeptides produced by, radioimmunoprecipitation analysis of, 578 generation of, 560-565, 568-571 insertion site for, 564-565 plasmid vectors for, 561-562 promoters for, 562-564
722
SUBJECT INDEX
selectable marker genes for, 564 strains for, 560-561 in vivo, 568-569 procedure, 569 reagents, 569 genomic structure and Southern blot analysis of, 576 protein expression analysis by, 577580 screening for foreign gene expression in, 571-574 selection of, 569-571 procedures, 570-571 reagents for, 569-570 titration of procedure, 568 reagents for, 568 WR strain, 560 Wyeth strain, 560 Vector(s), 237. See also Cosmid(s); Plasmid(s) based on vector cassettes pRTI00pRT108, 72 beating plant replicons, 497 beating transposable elements, 497 for biolistic process, 497-498 cell-free, insect virus translational initiation signal, 143-151 chloroplast expression, 545-547, 553554 pHD103, 545 pHD203, 545-546 pHD306, 545 pHD312, 545-546, 549 pHD407, 546, 549 pHD203-GUS, 546-547 cloning, plasmid, screening recombinant pUC-like plasmids with, comparison of methods, 338-339 E. coli, 497-498 for foreign gene expression, 47-48 fusion phage, 230 design of, 229-233 fAFF1, 230 fdH, 230 fUSE5, 230 pCBAK8, 230 phGH-Ml3glII, 230, 232 pKfdH, 230 pSEX, 230
for gene expression by phage T7 RNA polymerase, 51-53 for gene expression in dicots, 66-68 for gene expression in monocots, 73-78 for generation of recombinant vaccinia virus, 561-562 ~. phage, 152-170, 498 for construction of rare-cutter jumping library, 363 design of, 152-153 EMBL5, 351 linearization of, 352 hecc, 153 PRE adapters for, 155 preparation of, 155 structure of, 154 hjac, 153 flow chart for inserting cDNA into, 156 PRE adapters for, 155 preparation of, 155 structure of, 154 linearization of, 366 positive-selection, cell-free expression of large collections of cDNA clones with, 152-170 PRE adapters for, 153-155 for large insert linking-clone library construction, 351 linearization of, procedure, 352 MI3 ping-pong with EcoK/EcoB selection markers, 261 features of, 445-446 M13B18, 261 MI3BI9, 261 M13Bl19, 258, 261,266 coning of c-fos DNA insert into, 263-264 and double primers, cyclic deletion with DNA sequence of selection primers 1 and 2 used for, 264 strategy, 263 oligonucleotide used for constructing, 264 polylinker region of, DNA sequence of, 265 M13B119W, 261 M13Kll, 261
SUBJECT INDEX
M13K18, 261 M13K19, 261 MI3K119, 261 M13KI 1RX, 261 MI3KI19W, 258,261,265 M13LP67, 230 use in site-directed mutagenesis, 258260,269-270 nuclear expression, 547 pPBI121, 547 pPBI443, 545 pUC8 CaMV CATA N, 546 open reading frame (ORF), 12 pIFF5, 14-15, 21 pIFF8, 14-15, 21 applications of, 22 BssHII cleavage, 15-16, 21-22 calf intestinal phosphatase treatment, 16 cloning of DNA fragments in, 17-18 filling-in reaction with Klenow polymerase and dNTPs, 16-17 limitations of, 22 preparation for in-frame cloning, 15-17 preparation of DNA fragments for cloning in, 17-18 for selection of open reading frames in DNA/cDNA, 21-22 plant expression, 71-73 preparation for cosmid cloning and walking, 386 promoter selection, pKK232-8, 545 retroviral, 463,476-477,581-599 LHDCX, 583-585 LN, 583-585 LNCX, 583-585 LNSX, 583-585 LXSH, 583-585 LXSHD, 583-585 LXSN, 583-585 for transfer of M D R I , 36-38, 43-44 for single specific primer-PCR, 446 single-stranded, phosphorothioate-based mutagenesis with, 196-205 transcription, 83 for expression in baculovirns, 48 virus-based systems, 34, 47-48,644. See also Bovine papillomavirus; Retrovirus; Vaccinia virus
723
YAC, advantages of, 431 Vector cassettes for gene expression in dicotyledonous plants, 68-73 general properties of, 68 suitable for transcriptional fusions, 68 suitable for translational fusions, 68 Viral envelopes, reconstituted, 644 Viral insertion sites, identification of, 444 Virions, large-scale purification of, 237239 Virus-based vector systems, 34, 47-48, 644. See also Bovine papillomavirus: Retrovirus; Vaccinia virus Virus-like entry vehicles, virus-free, 644
W Western blot analysis procedure, 579 reagents for, 578 of recombinant proteins, 333 signal detection methods by labeled antigen, 333 by labeled protein A, 333 by labeled secondary antibody, 333 Whatman 541 filters, 341,345-346 colony hybridization on, 340-346 Wheat biolistic delivery of chloroplast into, transient expression of/3-glucuronidase after, 537 immature embryos, callus derived from, ¢-glucuronidase expression in, 549 Rubisco (ribulose-bisphosphate carboxylase) small subunit, expression in E. coli using pPLEX, 10 Wheat germ continuous-flow cell-free (CFCF) system with phage SP6 RNA polymerase, synthesis of dihydrofolate reductase in. 136 kinetics of, 138 translation, brome mosaic virus coat protein synthesis in, 131 kinetics of, 133 Wild-type DNA hydrolytic digestion of, by exonuclease digestion, 202
724
SUBJECT INDEX
strand-selective hydrolysis of, 201,214215 PstI nicking and linearization procedure, 214-215 X X-Galactopyranoside plates, screening recombinant pUC-like plasmids on, 335, 337, 339 alternative to, 335-339 principle of, 336 Y Yeast, 484 dried cells (microprojectile), 491 electroporation of, 475-476, 478-483 advantages of, 479 applications, 482-483 DNA dependence of transformation by, 481 materials and reagents, 479-480 method, 480-482 principle of, 479 procedure, 475-476 results, 482-483 strains and episomal plasmids for, 482 expression of mutagenized genes in, 301-312 chromosomal vs plasmid location, 311-312 comparisons of methods, 309-312 by integration, 303-306 materials, 302-303 by plasmid shuffle, 306-309 mitochondria, cell size, 498 plasmid(s), 302 episomal, for electroporation, 482
2/.~m circle, 302 YEp, 302 YIp, 302-303 YIp5, 302 spheroplasts, 478 plating with alginate solution, 434 preparation of, 434 solid support for, matrix, 433 comparison of alginate and, 435 transformation of. See also Yeast, electroporation of methods, 478 TUB1, conditional-lethal alleles, isolation of, 308-309 TUB2, conditional-lethal alleles, isolation of, 305-306 TUB3, 308-309 Yeast artificial chromosome, 433 advantages of, 431 cloning, with alginate matrix support, 431-436 efficiency, 436 materials and reagents, 433 methods, 434-435 plating yeast spheroplasts with alginate solution in, 434 preparation of screening filters and storage of master filters in, 434435 preparation of spheroplasts for, 434 principle of method, 432-433 removal of alginate gel and recovery of yeast cells in, 434 results, 436 libraries, 431 construction of, 357 colony-picking step, 432 media for, 433
Preface Recombinant DNA methods are powerful, revolutionary techniques for at least two reasons. First, they allow the isolation of single genes in large amounts from a pool of thousands or millions of genes. Second, the isolated genes from any source or their regulatory regions can be modified at will and reintroduced into a wide variety of cells by transformation. The cells expressing the introduced gene can be measured at the RNA level or protein level. These advantages allow us to solve complex biological problems, including medical and genetic problems, and to gain deeper understandings at the molecular level. In addition, new recombinant DNA methods are essential tools in the production of novel or better products in the areas of health, agriculture, and industry. The new Volumes 216, 217, and 218 supplement Volumes 153, 154, and 155 of Methods in Enzymology. During the past few years, many new or improved recombinant DNA methods have appeared, and a number of them are included in these new volumes. Volume 216 covers methods related to isolation and detection of DNA and RNA, enzymes for manipulating DNA, reporter genes, and new vectors for cloning genes. Volume 217 includes vectors for expressing cloned genes, mutagenesis, identifying and mapping genes, and methods for transforming animal and plant cells. Volume 218 includes methods for sequencing DNA, PCR for amplifying and manipulating DNA, methods for detecting DNA-protein interactions, and other useful methods. Areas or specific topics covered extensively in the following recent volumes of Methods in Enzymology are not included in these three volumes: "Guide to Protein Purification," Volume 182, edited by M. P. Deutscher; "Gene Expression Technology," Volume 185, edited by D. V. Goeddel; and "Guide to Yeast Genetics and Molecular Biology," Volume 194, edited by C. Guthrie and G. R. Fink. RAY Wu
XV