Pediatric Bone, Second Edition: Biology & Diseases

PEDIATRIC BONE BIOLOGY & DISEASES SECOND EDITION Edited by

FRANCIS H. GLORIEUX Genetics Unit, Shriners Hospital, McGill University, Montreal, Quebec, Canada

JOHN M. PETTIFOR Mineral Metabolism Research Unit. Department of Pediatrics, Chris Hani Baragwanath Hospital, Soweto, Johannesburg, South Africa

HARALD JU¨PPNER Endocrine Unit, Department of Medical and Pediatrics, Massachusetts General Hospital, and Harvard Medical School, Boston, Massachusetts, USA

AMSTERDAM • BOSTON • HEIDELBERG • LONDON NEW YORK • OXFORD • PARIS • SAN DIEGO SAN FRANCISCO • SINGAPORE • SYDNEY • TOKYO Academic Press is an imprint of Elsevier

Academic Press is an imprint of Elsevier 32 Jamestown Road, London NW1 7BY, UK 225 Wyman Street, Waltham, MA 02451, USA 525 B Street, Suite 1800, San Diego, CA 92101-4495, USA First Edition 2003 Second Edition 2012 Copyright Ó 2012, 2003 Elsevier Inc. All rights reserved. No part of this publication may be reproduced, stored in a retrieval system or transmitted in any form or by any means electronic, mechanical, photocopying, recording or otherwise without the prior written permission of the publisher Permissions may be sought directly from Elsevier’s Science & Technology Rights Department in Oxford, UK: phone (+44) (0) 1865 843830; fax (+44) (0) 1865 853333; email: [email protected]. Alternatively, visit the Science and Technology Books website at www.elsevierdirect.com/rights for further information Notice No responsibility is assumed by the publisher for any injury and/or damage to persons or property as a matter of products liability, negligence or otherwise, or from any use or operation of any methods, products, instructions or ideas contained in the material herein. Because of rapid advances in the medical sciences, in particular, independent verification of diagnoses and drug dosages should be made Medicine is an ever-changing field. Standard safety precautions must be followed, but as new research and clinical experience broaden our knowledge, changes in treatment and drug therapy may become necessary or appropriate. Readers are advised to check the most current product information provided by the manufacturer of each drug to be administered to verify the recommended dose, the method and duration of administrations, and contraindications. It is the responsibility of the treating physician, relying on experience and knowledge of the patient, to determine dosages and the best treatment for each individual patient. Neither the publisher nor the authors assume any liability for any injury and/or damage to persons or property arising from this publication British Library Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library Library of Congress Cataloging-in-Publication Data A catalog record for this book is available from the Library of Congress ISBN : 978-0-12-382040-2 For information on all Academic Press publications visit our website at www.elsevierdirect.com Typeset by TNQ Books and Journals Pvt. Ltd. Printed and bound in United States of America 12 13 14 15 10 9 8 7 6 5 4 3 2 1

Preface to the Second Edition

The first edition of this book, published in 2003, was sufficiently well received that we find it timely to publish a second edition 8 years later. A great deal of new knowledge has enriched the field of pediatric bone health and diseases during this period. We have kept in this second edition the same overall organization set in the first one. There have been changes in the list of contributors with a few declining and new ones embarking with enthusiasm. The first part of the book deals with basic information on the major systems controlling the development, structure and homeostasis of bone tissue, with one chapter added on dental development and maturation. The second part describes the tools and techniques validated for the evaluation of bone development and its abnormalities. To follow suggestions received, a new chapter on radiographic imaging completes this section. The third part deals with specific disorders or groups of disorders with emphasis where appropriate on basic aberrations and their clinical expression. As was requested by several readers, we have tried to provide more information on management of the various diseases. We hope that the new edition will be well received, as pediatricians and researchers working in the field of pediatric bone diseases see the need for such a textbook. The realm of pediatric bone diseases continues to rapidly expand and we hope that the book will be useful

to those interested in it, to the scientists at the bench to understand the clinical expression of the biological pathways and functions they study in the laboratory, and to the clinicians who wish to connect their observations with complex biological mechanisms and to the underlying genetic defects as they evaluate their patients’ response to established or new therapies. We wish to express our gratitude to Mara Conner and Megan Wickline at Elsevier/Academic Press for their understanding, patience and support. We also extend our appreciation to all the contributors to this large effort. In the preface of the first edition we expressed the hope that the content of the book would give substance to the recognition that “pediatric osteology” had come of age as a medical specialty, which has frequently provide substantial new insights into biology by the fact that an increasing number of these pediatric diseases has now been defined at the molecular level and thus may have significant implications also for the understanding of adult bone diseases. Although those who have invested their professional life into it come from a spectrum of different backgrounds, they now identify themselves more clearly with this emerging field. May the book be of help in that effort, and also entice younger colleagues to join in an exciting journey.

ix

List of Contributors

Judith E. Adams MBBS, FRCR, FRCP, FBIR Consultant Radiologist, Manchester Royal Infirmary & Professor of Diagnostic Radiology, University of Manchester, UK

John Damilakis Associate Professor, University of Crete, Faculty of Medicine, Department of Medical Physics, Iraklion, Crete, Greece

Laura K. Bachrach MD Professor of Pediatrics, Department of Pediatrics, Stanford University School of Medicine, Palo Alto, CA, USA

Marie B. Demay MD Endocrine Unit, Massachusetts General Hospital, Harvard Medical School, Boston, MA, USA

Murat Bastepe MD, PhD Assistant Professor of Medicine, Endocrine Unit, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, MA, USA

Michael J. Econs MD Professor of Medicine, Indiana University School of Medicine, Indianapolis, IN, USA Serge Ferrari MD Division of Bone Diseases, University Hospitals and Medical Faculty of Geneva, Switzerland

Clemens Bergwitz MD Assistant Professor of Medicine, Massachusetts General Hospital, Department of Medicine, Division Endocrinology, Massachusetts General Hospital, Boston, MA, USA

Mary Fewtrell Reader in Childhood Nutrition, Honorary Consultant Paediatrician, Childhood Nutrition Research Centre, UCL Institute of Child Health, London, UK

Maria Luisa Bianchi MD Bone Metabolism Unit, Istituto Auxologico Italiano IRCCS, Milan, Italy

Thomas J. Gardella PhD Associate Professor of Medicine, Massachusetts General Hospital, Department of Medicine, Division of Endocrinology, Massachusetts General Hospital, Endocrine Unit, Boston, MA, USA

Paolo Bianco MD Professor of Pathology, Sapienza University of Rome, Director, Anatomic Pathology, Umberto I University Hospital, Rome, Italy

Francis H. Glorieux OC, MD, PhD Professor of Surgery, Pediatrics and Human Genetics, McGill University, Adjunct Professor of Pediatrics, University of Montre´al, Director of Research, Shriners Hospital for Children, Montreal, Canada

Nick Bishop MD Head, Academic Unit of Child Health, Professor of Paediatric Bone Disease, University of Sheffield, Sheffield Children’s Hospital, Sheffield, UK Lynda F. Bonewald PhD Vice Chancellor for Research Interim, Curator’s Professor, Lee M and William Lefkowitz Professor, Director, Bone Biology Research Program Director, UMKC Center of Excellence in Mineralized Tissues University of Missouri at Kansas City School of Dentistry, Department of Oral Biology, Kansas City, MO, USA

Michel Goldberg DDS Professeur e´merite, UMR-S 747INSERM Universite´ Paris Descartes Nick Harvey MD Lecturer and Honorary Consultant in Rheumatology, The MRC Lifecourse Epidemiology Unit, University of Southampton, Southampton General Hospital, Southampton, UK

Jean-Philippe Bonjour MD Division of Bone Diseases, University Hospitals and Medical Faculty of Geneva, Switzerland

Priv.Dozent Dr Wolfgang Ho¨gler Consultant Paediatric Endocrinologist, Birmingham Children’s Hospital, Honorary Senior Lecturer, University of Birmingham, UK

Noe¨l Cameron Professor of Human Biology, Centre for Global Health and Human Development, Loughborough University, Loughborough, Leicestershire, UK

Ingrid A. Holm MD, MPH Division of Genetics, Program in Genomics, and the Manton Center for Orphan Disease Research, Children’s Hospital Boston and Harvard Medical School, Boston, MA, USA

Thomas O. Carpenter MD Departments of Pediatrics (Endocrinology) and Orthopaedics and Rehabilitation, Yale University School of Medicine, New Haven, CT, USA

Katharina Ja¨hn PhD University of Missouri-Kansas City, School of Dentistry, Kansas City, MO, USA

Thierry Chevalley MD Division of Bone Diseases, University Hospitals and Medical Faculty of Geneva, Switzerland

Harald Ju¨ppner MD Professor of Pediatrics, Endocrine Unit and Pediatric Nephrology Unit, Department of Medicine and Pediatrics, Massachusetts General Hospital and Harvard Medical School, Boston, MA, USA

William G. Cole MD, PhD Chief of Pediatric Surgery, University of Alberta, Canada

xi

xii

LIST OF CONTRIBUTORS

Frederick S. Kaplan MD Departments of Orthopedic Surgery, Medicine, and the Center for Research in FOP and Related Disorders, University of Pennsylvania School of Medicine, Philadelphia, PA, USA Christopher S. Kovacs MD, FRCPC, FACP Professor of Medicine (Endocrinology and Metabolism), Obstetrics & Gynecology, and BioMedical Sciences, Memorial University of Newfoundland, Attending and Consultant Specialist (Endocrinology and Metabolism), Health Sciences Centre and Eastern Health Corporation, St. John’s, Newfoundland, Canada Henry M. Kronenberg MD, PhD Endocrine Unit, Massachusetts General Hospital and Harvard Medical School, Boston, MA, USA Mary B. Leonard MD, MSCE Associate Professor of Pediatrics & Epidemiology, The Children’s Hospital of Philadelphia, Department of Pediatrics, Department of Biostatistics and Epidemiology, University of Pennsylvania School of Medicine, Philadelphia, PA, USA Fanxin Long PhD Associate Professor of Medicine, and Associate Professor of Developmental Biology, Division of Endocrinology, Metabolism and Lipid Research, Department of Medicine, Washington University in St Louis, MO, USA Christa Maes PhD Laboratory of Experimental Medicine and Endocrinology (LEGENDO), Katholieke Universiteit Leuven, Belgium

John M. Pettifor MBBCh, PhD Mineral Metabolism Research Unit, Department of Paediatrics, University of the Witwatersrand and Chris Hani Baragwanath, South Africa Anthony A. Portale MD Professor of Pediatrics, University of California San Francisco, San Francisco, CA, USA John T. Potts MD Endocrine Unit, Department of Medicine, The Massachusetts General Hospital and Harvard Medical School, Boston, MA, USA Ann Prentice PhD Director, MRC Human Nutrition Research, Elsie Widdowson Laboratory, Fulbourn Road, Cambridge, UK Frank Rauch MD Associate Professor, Genetics Unit, Shriners Hospital for Children, Montreal, Canada Jean-Marc Retrouvey Division of Orthodontics, McGill University, Montreal, Quebec, Canada David L. Rimoin MD, PhD Medical Genetics Birth Defects Center, Cedars-Sinai Health System and Department of Pediatrics and Medicine, UCLA School of Medicine, Los Angeles, CA, USA Rene Rizzoli MD Division of Bone Diseases, University Hospitals and Medical Faculty of Geneva, Switzerland David Rowe Department of Genetics and Developmental Biology, University of Connecticut Health Center, Farmington, CT, USA Isidro B. Salusky MD Professor of Pediatrics, Division of Pediatric Nephrology, Director, Pediatric Dialysis Program, Director, General Clinical Research Center, David Geffen School of Medicine at UCLA, Los Angeles, CA, USA

Daniella Magen MD Division of Pediatric Nephrology, Meyer Children’s Hospital, Rambam Health Care Campus and Laboratory of Molecular Medicine, Rappaport Faculty of Medicine and Research Institute Technion e Israel Institute of Technology, Haifa, Israel

Ste´phane Schwartz DDS Assistant Director, Dental Clinic Montreal Children’s Hospital MUHC (McGill University Health Center) Associate Professor, McGill University

David D. Martin MD Paediatric Endocrinology and Diabetology, University Children’s Hospital, Tu¨bingen University, Tu¨bingen, Germany

Nick Shaw MD Consultant Paediatric Endocrinologist, Birmingham Children’s Hospital, Honorary Senior Lecturer, University of Birmingham, UK

Marc D. McKee PhD Professor, Faculty of Dentistry, Department of Anatomy & Cell Biology and Faculty of Medicine, McGill University, Montreal, Quebec, Canada

Eileen M. Shore PhD Departments of Orthopedic Surgery, Genetics, and the Center for Research in FOP and Related Disorders, University of Pennsylvania School of Medicine, Philadelphia, PA, USA

Walter L. Miller MD Distinguished Professor of Pediatrics, University of California San Francisco, San Francisco, CA, USA Geert Mortier MD Department of Medical Genetics, University of Antwerp, Antwerp, Belgium Zulf Mughal Consultant in Paediatric Bone Disorders & Honorary Senior Lecturer in Child Health, Royal Manchester Children’s Hospital, Central Manchester University Hospitals NHS Foundation Trust, Manchester, UK Amaka C. Offiah HEFCE Clinical Senior Lecturer, Academic Unit of Child Health, Sheffield Children’s NHS Foundation Trust, Sheffield, UK Bram Perdu MD Department of Medical University of Antwerp, Antwerp, Belgium

Genetics,

Farzana Perwad MD Assistant Professor of Pediatrics, University of California San Francisco, San Francisco, CA, USA

Rene´ St-Arnaud PhD Genetics Unit, Shriners Hospital for Children, Montre´al (Que´bec) and Departments of Surgery and Human Genetics, McGill University, Montre´al (Que´bec), Canada Andrea Superti-Furga Professor, University of Lausanne, Division of Pediatrics, Centre Hospitalier Universitaire Vaudois, Lausanne, Switzerland Rajesh V. Thakker MD, ScD, FRCP, FRCPath, FMedSci Professor of Medicine, Academic Endocrine Unit, Nuffield Department of Medicine, Oxford Centre for Diabetes, Endocrinology and Metabolism (OCDEM), Churchill Hospital, Headington, Oxford, UK Sheila Unger MD, FRCP University of Lausanne, Service of Medical Genetics, Centre Hospitalier Universitaire Vaudois, Lausanne, Switzerland Filip Vanhoenacker MD Department of University Hospital of Antwerp, Belgium

Radiology,

LIST OF CONTRIBUTORS

Wim Van Hul MD Department of Medical Genetics, University and University Hospital Antwerp, Belgium Katherine Wesseling Perry MD David Geffen School of Medicine at University of California, Los Angeles, CA, USA Michael P. Whyte MD Medical-Scientific Director, Center for Metabolic Bone Disease and Molecular Research, Shriners Hospital for Children, Professor of Medicine, Pediatrics, and Genetics, Washington University School of Medicine, St. Louis, MO, USA

xiii

Shlomo Wientroub MD Department of Pediatric Orthopedic Surgery, Dana Children’s Hospital, Tel Aviv Medical School, Tel Aviv, Israel Israel Zelikovic MD Division of Pediatric Nephrology, Meyer Children’s Hospital, Rambam Health Care Campus, and Laboratory of Developmental Nephrology, Department of Physiology and Biophysics, Rappaport Faculty of Medicine and Research Institute, Technion e Israel Institute of Technology, Haifa, Israel

C H A P T E R

1

Bone Cell Biology: Osteoclasts, Osteoblasts, Osteocytes K. Ja¨hn, L.F. Bonewald University of Missouri-Kansas City, School of Dentistry, 650 E 25th Street, Kansas City, MO 64108, USA

INTRODUCTION TO BONE

RANKL, ephrins, and sclerostin as described in this chapter. Moreover, the extracellular matrix (ECM) on which osteoblasts and osteoclasts attach and in which osteocytes reside, influences the function of these cells. Although previously viewed as mainly a support structure for bone cells, it is now clear that the bone ECM controls and directs bone cell function. This chapter will provide an overview of how bone cells coordinate their actions to generate, maintain and remove bone mass.

Depending upon field of study, bone is described very differently. From a material, biochemical, or physical point of view, bone is described as a composite material that is made up of an organic component consisting of collagenous and non-collagenous proteins and a mineral phase consisting of calcium and phosphate [1]. Often bone is viewed as a dead, hard material with only a structural purpose, to hold the body in place, to protect internal organs, and to serve as attachment sites for skeletal muscles to achieve movement. Yet bone is far from being either dead or static. From a biological point of view, bone is a complex living tissue in which this composite material of organic and mineral components is created and maintained by at least three major cell types, namely osteoblasts, osteocytes and osteoclasts (see schematic bone remodeling unit in Figure 1.1) [2]. In the first and second decades of human life, bone is constantly growing. Towards the end of the second and into the third decades, dynamic remodeling takes place to maintain the skeleton with the potential for increasing bone mass. After the third decade, bone mass starts its inevitable decline. Considering this simplified time course of human bone development, it is obvious that bone is dynamically controlled and remodeled. As a dynamic connective tissue, bone is constantly responding to external forces such as loading of the skeleton and to internal and external signals such as cytokines, growth factors and hormones. Several hormones have been shown to play important roles in the skeleton such as the estrogens and androgens, parathyroid hormone (PTH) and 1,25-dihydroxyvitamin vitamin D3 (1,25,D3). In addition to these external signals, bone cells are in constant communication with each other and cells of the immune and hematopoietic systems, through factors such as osteoprotogerin,

Pediatric Bone, Second Edition DOI: 10.1016/B978-0-12-382040-2.10001-2

OSTEOCLASTS The cells that resorb the mineralized ECM of bone are called osteoclasts. They arise from hematopoietic progenitors that also give rise to macrophages. The osteoclast precursor cells are recruited to the bone surface where they fuse to form multinucleated cells [3] (see schematic image in Figure 1.2). The co-stimulating molecule RANKL (RANK ligand), which is expressed by osteoblasts, stromal cells and osteocytes, is the most commonly known cellular activation pathway of osteoclast-precursors and the osteoclastogenic cascade of transcription factors [3,4]. Osteoclasts are very rare in bone, only two to three cells per mm3 bone can be found [5]. The active form of these multinucleated giant cells is present in specialized cavities on the bone surface, known as Howship’s lacunae. Osteoclasts show a high level of polarization when attached to the bone surface. The most characteristic feature in this state is the ruffled border, which consists of finger-like cytoplasmic projections [6] and is turned towards the bone surface. The osteoclast seals the cavity around its ruffled border and then secretes protons and a variety of proteolytic enzymes, i.e. collagenases, gelatinases, into the cavity, to carry out the organic breakdown of the bone ECM [7].

1

Copyright Ó 2012 Elsevier Inc. All rights reserved.

2

1. BONE CELL BIOLOGY: OSTEOCLASTS, OSTEOBLASTS, OSTEOCYTES

FIGURE 1.1

The bone remodeling unit. This drawing of a bone remodeling unit depicts an active osteoclast sitting in its Howship’s lacunae releasing protons and enzymes into a sealed zone to degrade and digest the mineralized bone matrix. Cuboidal-shaped osteoblasts are positioned behind the osteoclasts secreting type I collagen and other non-collagenous proteins to form the osteoid e the newly deposited, unmineralized bone matrix. Several differentiation stages of the osteoblast phenotype are illustrated. The spindle-shaped bone lining cells are covering all inactive bone surfaces, as well as the bone remodeling unit to create a micromilieu where theoretically cross-talk takes place between osteoclasts and osteoblasts. Transition stages from the osteoblast to the osteocyte are shown including the early osteoid osteocyte to the mature embedded osteocyte. The role of the osteocyte to create a communication network between practically all cells on the bone surface is demonstrated by the extensive cell processes connecting osteocytes, osteoblasts, bone lining cells and osteoclasts.

The sole function of the osteoclast is to resorb bone. The mature osteoclast is described histologically as a multinucleated, tartrate resistant, acid phosphatase positive cell. However, macrophage polykaryons can have these same characteristics; so the “gold standard” for identifying an osteoclast is the formation of resorption lacunae or “pits” on a mineralized surface (see histological image in Figure 1.2). Other characteristics of the osteoclast include the expression of calcitonin receptors, enzymes such as cathepsin K and matrix metalloprotein-9 (MMP-9) that play a role in matrix degradation, and the vacuolar proton pump for the transport of protons to the resorption lacunae. For the osteoclast to resorb, it must form a “sealing zone” around the periphery of its attached area to concentrate not only proteases but also protons into this limited area. Underneath the cell, within the ruffled border, the pH is reduced to approximately 2e3 which enhances the degradation of mineralized matrix [8]. As osteoclast precursors are derived from hematopoietic precursors, the same stem cells that become granulocytes and monocytes/macrophages, cell lines such as RAW 267.4 and MOPC-5, are available that represent osteoclast precursors for experimental studies. These

cells can form TRAP positive multinucleated cells that resorb bone and form resorption lacunae on dentin [9]. It has been well known for the last 10e15 years in the bone field that osteoclast precursors require supporting cells for osteoclast formation. The importance of factors produced by supporting cells such as macrophage colony stimulating factor (M-CSF) to induce proliferation of osteoclast precursors has been validated [10]. Critical factors and cell surface molecules involved in osteoclast formation have only recently been elucidated with the discovery of RANK ligand (RANKL) and osteoprotogerin (OPG) [11,12]. The osteoclast precursor expresses a receptor known as RANK (receptor activator of NFkB) that signals through the NF-kB pathway. The binding of the cell membrane bound ligand, RANKL, activates RANK receptor. However, the soluble factor, OPG, acting as a “decoy” receptor can bind to RANKL, preventing osteoclast formation. The expression of RANKL on the surface of supporting cells occurs when these cells are exposed to bone resorbing cytokines, hormones, and factors such as interleukins 1, 6, 11, PTH, PTH-related protein (PTHrp), oncostatin M, leukemia inhibitory factor, prostaglandin E2, or 1,25 D3 [13]. These factors upregulate RANKL to a level

PEDIATRIC BONE

THE OSTEOBLAST CELL LINEAGE

FIGURE 1.2 Osteoclast differentiation and activity. The activation of osteoclast precursors to fuse and form active osteoclasts is shown in the schematic image (upper panel). Arising from a hematopoietic precursor that is activated by M-CSF and RANKL, the pre-osteoclast is formed and fuses with others to produce multinucleated TRAP positive cells, which finally form a sealing zone to attach to the bone matrix to form the bone resorption cavity underneath a ruffled border. Active, TRAP positive stained osteoclasts (red) can be seen on the histological image taken from the distal region of a mouse femur. Methyl green was used as counterstaining to label all cell nuclei. (See color plate section.)

capable of overcoming the effects of circulating OPG, thereby resulting in osteoclast formation. Efforts to generate osteoclasts without supporting cells have only recently been accomplished in vitro by using an artificial, soluble form of RANKL [14]. A new therapeutic called Denosumab which is an anti-RANKL antibody has been approved for the treatment of osteoporosis [15,16].

THE OSTEOBLAST CELL LINEAGE Osteoblasts are known as the cells that form bone, characterized by their unique ability to secrete a type I collagen-rich ECM that eventually mineralizes.

3

Osteoblasts were first named by Gegenbaur in 1864 [17], and since then their function as the major proteinexpressing cells in bone has been widely studied. All of the cells and stages of differentiation with the osteoblast lineage are often quickly summarized as “the osteoblast”. However, at least four to five major maturation stages of the osteoblast cell lineage are commonly accepted, the immature osteoblast referred to as preosteoblasts, mature osteoblasts, osteoid ostecytes, early osteocyte, and mature osteocytes as terminally differentiated osteoblasts embedded in the bone matrix [18]. Franz-Odendaal et al. in 2006 postulated a total of eight different maturation stages for the transition of osteoblasts to osteocytes based on morphological features as well as expression profiles of the cells [19]. The recent classification of osteoblast-lineage clearly distinguishes between active surface osteoblasts that secrete the ECM and several maturation stages of osteoid osteoblasts and young osteocytes to mature and deeply embedded osteocytes. Lining cells on the bone surface are thought also to be terminally differentiated osteoblasts on the bone surface, but the lineage of these cells has not been completely validated (a short summary of osteoblast maturation stages and markers can be found in Figure 1.3). Osteoblasts arise from multipotent progenitor cells of mesenchyme origin, mesenchymal stem cells. Friedenstein and co-workers were the first to characterize these clonogenic cells by their adherence to tissue culture plastic surfaces, and discovered that this isolated population is able to differentiate into a variety of mature cell types ranging from osteoblasts, to chondrocytes or adipocytes, under the appropriate conditions [20,21]. The niche for osteoprogenitors in bone is the periosteum, the endosteum, and the marrow stroma [22,23]. With bone trauma, fracture, or other conditions requiring bone repair, mesenchymal progenitor cells serve as a stem cell reservoir that are recruited to the injury site. However, unlike the hematopoietic stem cell, the identification of mesenchymal stem cells has not been as thoroughly characterized. One can identify single hematopoietic stem cells, but this has not been accomplished for mesenchymal stem cells. At present, a population of cells with a series and panel of markers has been identified with the capacity to differentiate into osteoblasts [24]. Chemotactic molecules such as osteopontin [25] and various members of the transforming growth factor-b family [26,27], which are stored in great amounts in the bone ECM, when released attract progenitor cells to the injured site or to a previously resorbed, remodeling site. These progenitors differentiate into matrix-producing osteoblasts. A “master control gene” necessary for progenitor cells to differentiate into osteoblasts is the transcription factor Runx2 (Runt-related transcription factor-2; also

PEDIATRIC BONE

4

1. BONE CELL BIOLOGY: OSTEOCLASTS, OSTEOBLASTS, OSTEOCYTES

FIGURE 1.3 The osteoblast lineage. The upper panel represents the differentiation of a pre-osteoblast into an osteocyte. While the preosteoblast descended from the mesenchymal progenitor cell is mainly but not entirely expressing type I collagen, the mature osteoblast also expresses a variety of non-collagenous proteins for ECM synthesis, including bone sialoprotein and osteocalcin, a bone specific marker. During the differentiation into mature osteocytes, several proteins are upregulated such as E11/gp38, a marker for embedding and early osteocytes and sclerostin a marker for late, mature osteocytes. The histological image from the distal region of a mouse femur (stained with hematoxylin and eosin) shows an active cuboidal osteoblast on the bone surface (purple arrow), an early osteocyte (blue arrow) and a mature, stellar-shaped osteocyte deeply embedded in the bone matrix (green arrow). (See color plate section.)

named Cbfa1, Osf2, Pebp2a1, or Aml3) [28,29]. Runx2 is of crucial importance during osteoblast differentiation. This was dramatically demonstrated by deleting or “knocking-out” the gene in mice. Newborn mice possessed a cartilagenous, but non-mineralized skeleton and died upon birth due to inability to breathe. The importance of this “master control gene” was highlighted in 1997, when a total of five papers were

published in Cell describing the role of Runx2 during osteoblast differentiation and the dramatic effects of its targeted deletion in mice models leading to the complete absence of bone formation [28,30e33]. Runx2 was the first true osteoblast-specific transcription factor identified through its binding site within the promotor of the osteocalcin gene [34]. Runx2 is known to control osteoblast differentiation by subsequently activating the expression of osteoblast phenotype-specific genes such as type I collagen and osteocalcin [34,35]. While Runx2 is the earliest and most specific marker of osteogenesis identified to date [36], several homeodomain transcription factors, such as Msx2, Dlx5, Bapx1, and Hoxa-2 have been suggested to regulate Runx2 expression. A second crucial transcription factor required for osteoblast differentiation during development that acts downstream of Runx2 is osterix (Osx) [35]. Mice lacking Osx have a similar phenotype to those lacking Runx2. Nakashima et al. demonstrated that osterix-null mice do not show signs of intramembranous or endochondral bone formation with the absence of bone markers such as osteocalcin, osteopontin, or osteonectin [35]. The active, mature osteoblasts exhibit a cuboidal or polygonal cell shape. As these cells are responsible for the secretion of the bone matrix or osteoid, osteoblasts contain abundant endoplasmatic reticula and enlarged Golgi apparatus [37]. The major protein secreted by osteoblasts is type I collagen, a fibrillar extracellular matrix protein that determines the tensile strength of bone. Type I collagen is not exclusively found within bone, it is in fact one of the most abundant proteins in vertebrates and is present in skin, tendons and ligaments. Each type I collagen molecule is composed of three polypeptide chains (one a2 and two a1 chains) that are organized as a right-handed triple helix [38e40]. Osteoblasts further express a variety of so-called non-collagenous proteins to form the unmineralized matrix in the osteoid seam [41,42]. The specific function of most of these proteins is still not completely understood. Osteocalcin (OCN) is one of the most prominent non-collagenous proteins that is bone-specific in expression. This small 49 amino acid protein contains, in most species, uncommon post-transcriptional modification, gammacarboxylation, of three glutamic acids (Gla). These calcium-binding residues lead to the formation of “Gla”-helices which bind to hydroxyapatite (the inorganic component of the ECM of bone) [38]. OCN is expressed during the late stage of osteoblast differentiation in vitro [43]. Moreover, in embryonic bone, it is upregulated with the early onset of hydroxyapatite crystal formation [40]. Therefore, OCN has been suggested to be one of the main regulators of bone turnover, and mineralization [44]. Recent findings also imply a role for this calcium-binding protein in its undercarboxylated form in the hormonal regulation of glucose

PEDIATRIC BONE

THE OSTEOCYTE

and fat metabolism [45]. This has opened a whole new area of investigation and supports the novel hypothesis that bone can function as an endocrine organ. Other cells derived from the osteoblastic-lineage are bone lining cells. This origin of lining cells has been very controversial. Bone lining cells are thought to be resting osteoblasts, pre-osteoblasts or post-osteoblasts. We know that these cells cover almost all surfaces in adult bone to build a connective tissue barrier. More recently, bone lining cells were acknowledged as active cells that participate in bone resorption and formation. Moreover, these cells appear to be involved in homeostatic processes as they are in communication with the osteocyte network and are an element of the strain sensing network [37]. Bone lining cells may also be one of the major sources for active osteoblasts and could be seen as a reservoir for pre-osteoblasts if subjected to the right stimulus. This theory was proposed by Dobnig et al., where intermittent treatment of adult rats with PTH led to a reactivation of bone lining cells to bone forming osteoblasts that led to increased bone formation [46].

THE OSTEOCYTE The mature differentiated stage of the osteoblast lineage becomes apparent when osteoblasts are surrounded by the ECM of bone. Osteoblasts then undergo morphological changes; they develop long slender-like cell processes, lose many of their cytoplasmic organelles and develop into stellar-shaped cells [18]. This very distinctive osteoblast maturation stage is then called an osteocyte. Osteocytes possess a very unique location in bone, being trapped within lacunae similar to small “caves” inside the bone matrix, where these cells form a connective network by sending their dendritic processes through small “tunnels”, called canaliculi, that connect and span throughout the whole bone volume. It is unclear why, considering that osteocytes are also the most abundant cell type found in bone [47], their specific role within bone biology was overlooked for decades. This is thought to be due to the difficulty of isolating and removing mature osteocytes from the mineralized matrix. The proposed main function of osteocytes was to sense distribution and amount of mechanical strain that is applied to the bone [48,49]. A key factor that led to the discovery of this particular function of osteocytes is their location within the load-bearing ECM of bone [50]. Moreover, the importance of the integrity of the osteocytic network is highlighted in aging or microdamaged bone or with certain treatments, i.e. glucocorticoids, where the loss of viable osteocytes causes bone

5

tissue to become a truly inactive, dead tissue [51,52]. The transfer of the strain information between osteocytes is realized through their long slender-like processes e the most dramatic morphological feature of osteocytes. Whereas numerous osteoblast cell lines have been generated for experimental studies, only one osteocyte cell line has been generated to date, the MLO-Y4 cell that possesses dendritic processes and early markers for osteocytes. This cell line has been and is being used extensively to elucidate osteocyte function [53e59]. Gap junctions at the end of these processes enable the osteocytes to communicate. Gap junctions are specialized cellecell contact points which are formed by members of the connexin protein family [60,61]. Six of these transmembrane proteins are joined across the extracellular gap between two adjacent cells to form a channel structure allowing the passage of small metabolites, ions and intracellular signaling molecules below a size of 1 kDa. But what causes this form of intracellular signaling due to mechanical stimulation? In theory, there are at least three different forms of mechanical strain on bone cells e hydrostatic pressure, direct cell strain and fluid flow-induced shear stress. The most commonly accepted theory is load-induced fluid flow [48,49,60]. Interstitial fluid is squeezed through the porous ECM and through the lacunarecanaliculi system in response to bone deformations by physiological loading and the shear stresses then act directly on the outer cellular structures of the osteocytes [62]. The most prominent molecules that have been involved in mechanotransduction in bone are nitric oxide [63], adenosine triphosphate (ATP) [64,65], prostaglandin (PGE2) [49,66] and calcium [67]. Osteocytes have recently come into the spotlight as they appear to be multifunctional [68]. One function is to contribute to the regulation of mineral homeostasis. It has been shown that osteocytes can regulate calcium availability by removing and replacing their mineralized matrix under normal, healthy conditions such as lactation [68,69]. In addition to the regulation of calcium, osteocytes have a major role in the regulation of phosphate homeostasis. Osteocytes regulate both biomineralization and phosphate through molecules such as phosphate regulating factor with homologies to endopeptidase on chromosome X (Phex), dentin matrix protein-1 (Dmp1), and fibroblast growth factor (FGF23), all expressed by osteocytes [70e73]. Both Dmp1 and Phex appear to downregulate the expression of FGF-23, which allows more efficient reabsorption of phosphate by the kidney thereby maintaining sufficient circulating phosphate to maintain normal bone mineral content. Dmp1 null mice have a similar phenotype to hyp mice carrying a Phex mutation, that of osteomalacia and rickets due to elevated FGF-23 levels in osteocytes

PEDIATRIC BONE

6

1. BONE CELL BIOLOGY: OSTEOCLASTS, OSTEOBLASTS, OSTEOCYTES

[73,74]. While autosomal dominant hypophosphatemic rickets in patients is due to mutations in Phex [75], autosomal recessive hypophosphatemic rickets is due to mutations in Dmp1 [74] and both show elevation of FGF-23 in osteocytes. Based on these observations, we proposed that the osteocyte lacunocanalicular network can function as an endocrine system, targeting distant organs such as kidney [74]. Another function of osteocytes is to act as orchestrators of both bone formation and bone resorption. Osteocytes produce a factor, sclerostin, which inhibits osteoblastic bone formation [76,77]. This molecule is now the target of therapeutics as an antibody to sclerostin has been shown to enhance bone mass and promote bone healing [78e81]. Conversely, osteocytes can support osteoclast formation, especially in their dying or apoptotic state [82,83]. Osteocytes appear to express both RANKL and OPG [84]. What is not clear is how factors produced by osteocytes can reach the bone surface, but Dallas and co-workers have shown by dynamic imaging that osteocytes can extend their dendritic processes into marrow and vascular spaces suggesting a mean for the delivery of factors [85,86].

CONCLUSION Not only are bone cells in constant communication with each other, but the ECM can also influence the function of bone cells. Bone is a reservoir of factors ready to be released during resorption that can modify the bone coupling process or provide circulating growth factors. A number of transcription factors as described above have been identified that are specific for bone induction and development. Clearly, these growth factors and transcription factors are regulated by a number of circulating hormones such as parathyroid hormone, estrogen, and 1,25(OH)2D3. As outlined in this chapter, another layer of complexity is added due to the fact that bone structure is also regulated by mechanical load or lack of mechanical loading. Understanding the normal physiology of bone and its diseases has led to the generation of therapeutics important in the prevention and treatment of bone disease and acceleration and initiation of bone repair. Studies are also underway to identify means to treat or reverse abnormal bone development based on studies of bone cell origin, function, and their regulation.

References [1] Cowin SC. Bone Mechanics Handbook. New York: CRC Press; 2001. [2] Bilezikian JP, Lawrence GR, Rodan GA. Principles of Bone Biology. Academic Press; 2002.

[3] Takahashi N, Udagawa N, Takami M, Suda T. Cells of bone: osteoclast generation. In: Bilezikian JP, Raisz LG, Rodan GA, editors. Principles of Bone Biology. Academic Press; 2002. p. 109e26. [4] Matsuo K, Irie N. Osteoclast-osteoblast communication. Arch Biochem Biophys 2008;473:201e9. [5] Meunier PJ, Coindre JM, Edouard CM, Arlot ME. Bone histomorphometry in Paget’s disease. Quantitative and dynamic analysis of pagetic and nonpagetic bone tissue. Arthritis Rheum 1980;23:1095e103. [6] Roodman GD. Advances in bone biology: the osteoclast. Endocr Rev 1996;17:308e32. [7] Hill PA. Bone remodelling. Br J Orthod 1998;25:101e7. [8] Roodman GD. Advances in bone biology: The osteoclast. Endocr Rev 1996;17:308e32. [9] Chen W, Li YP. Generation of mouse osteoclastogenic cell lines immortalized with SV40 large T antigen. J Bone Miner Res 1998;13:1112e23. [10] Kodama H, Nose M, Niida S, Yamasaki A. Essential role of macrophage colony-stimulating factor in the osteoclast differentiation supported by stromal cells. J Exp Med 1991;173:1291e4. [11] Yoshizawa T, Handa Y, Uematsu Y, et al. Mice lacking the vitamin D receptor exhibit impaired bone formation, uterine hypoplasia and growth retardation after weaning. Nat Genet 1997;16:391e6. [12] Simonet WS, Lacey DL, Dunstan CR, et al. Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell 1997;89:309e19. [13] Aubin JE, Bonnelye E. Osteoprotegerin and its ligand: A new paradigm for regulation of osteoclastogenesis and bone resorption. Medscape Womens Health 2000;5:5. [14] Quinn JM, Elliott J, Gillespie MT, Martin TJ. A combination of osteoclast differentiation factor and macrophage-colony stimulating factor is sufficient for both human and mouse osteoclast formation in vitro. Endocrinology 1998;139:4424e7. [15] Bekker PJHD, Rasmussen AS, Murphy R, et al. A single-dose placebo-controlled study of AMG 162, a fully human monoclonal antibody to RANKL, in postmenopausal women. J Bone Miner Res 2004;19:1059e66. [16] Rizzoli RYU, Kirkpatrick P. Denosumab. Nat Rev Drug Discov 2010;9:591e2. ¨ ber die Bildung des Knochengewebes. Natur[17] Gegenbaur C. U wissenschaften 1864. [18] Aubin JE, Liu F. The osteoblast lineage. In: Bilezikian JP, Raisz LG, Rodan GA, editors. Principles in Bone Biology. Academic Press; 1996. p. 51e67. [19] Franz-Odendaal TA, Hall BK, Witten PE. Buried alive: how osteoblasts become osteocytes. Dev Dyn 2006;235:176e90. [20] Friedenstein AY, Lalykina KS. Lymphoid cell populations are competent systems for induced osteogenesis. Calcif Tiss Res 1970;(Suppl):105e6. [21] Friedenstein AJ, Chailakhyan RK, Gerasimov UV. Bone marrow osteogenic stem cells: in vitro cultivation and transplantation in diffusion chambers. Cell Tiss Kinet 1987;20:263e72. [22] Burger EH, Boonekamp PM, Nijweide PJ. Osteoblast and osteoclast precursors in primary cultures of calvarial bone cells. Anat Rec 1986;214:32e40. [23] Aubin JE, Triffitt JT. Mesenchymal stem cells and osteoblast differentiation. In: Bilezikian JP, Raisz LG, Rodan GA, editors. Principles of Bone Biology. Academic Press; 2002. p. 59e82. [24] Dominici M, Le Blanc K, Mueller I, et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006;8:315e7.

PEDIATRIC BONE

REFERENCES

[25] Forquer Raheja L, Geneto DC, Yellowley CE. Hypoxic osteocytes recruit human MSCs through an OPN/CD44-mediated pathway. Biochem Biophys Res Commun 2008;366:393e403. [26] Postlethwaite AE, Seyer JM. Identification of a chemotactic epitope in human transforming growth factor-beta 1 spanning amino acid residues 368-374. J Cell Physiol 1995;164:587e92. [27] Cho TJ, Gerstenfeld LC, Einhorn TA. Differential temporal expression of members of the transforming growth factor beta superfamily during murine fracture healing. J Bone Miner Res 2002;17:513e20. [28] Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. Osf2/ Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89:747e54. [29] Schinke T, Karsenty G. Transcriptional control of osteoblast differentiation and function. In: Bilezikian JP, Raisz LG, Rodan GA, editors. Principles of Bone Biology. Academic Press; 2002. p. 83e91. [30] Komori T, Yagi H, Nomura S, et al. Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 1997;89:755e64. [31] Mundlos S, Otto F, Mundlos C, et al. Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell 1997;89:773e9. [32] Otto F, Thornell AP, Crompton T, et al. Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 1997;89:765e71. [33] Rodan GA, Harada S. The missing bone. Cell 1997;89:677e80. [34] Ducy P. Cbfa1: a molecular switch in osteoblast biology. Dev Dyn 2000;219:461e71. [35] Nakashima K, Zhou X, Kunkel G, et al. The novel zinc fingercontaining transcription factor osterix is required for osteoblast differentiation and bone formation. Cell 2002;108:17e29. [36] Karsenty G. How many factors are required to remodel bone? Nat Med 2000;6:970e1. [37] Majeska RJ. Cell biology of bone. In: Cowin SC, editor. Bone Mechanics Handbook. CRC Press; 2001. p. 1e24. [38] Calvo MS, Eyre DR, Gundberg CM. Molecular basis and clinical application of biological markers of bone turnover. Endocr Rev 1996;17:333e68. [39] Prockop DJ. Mutations that alter the primary structure of type I collagen. The perils of a system for generating large structures by the principle of nucleated growth. J Biol Chem 1990;265:15349e52. [40] Rossert J, de Crombrugghe B. Type I collagen. In: Bilezikian JP, Raisz LG, Rodan GA, editors. Principles in Bone Biology. Academic Press; 2002. p. 189e210. [41] Hauschka PV, Lian JB, Cole DE, Gundberg CM. Osteocalcin and matrix Gla protein: vitamin K-dependent proteins in bone. Physiol Rev 1989;69:990e1047. [42] Oldberg A, Franzen A, Heinegard D. Cloning and sequence analysis of rat bone sialoprotein (osteopontin) cDNA reveals an Arg-Gly-Asp cell-binding sequence. Proc Natl Acad Sci USA 1986;83:8819e23. [43] Lian JB, Stein GS. Concepts of osteoblast growth and differentiation: basis for modulation of bone cell development and tissue formation. Crit Rev Oral Biol Med 1992;3:269e305. [44] Ivaska KK, Hentunen TA, Vaaraniemi J, Ylipahkala H, Pettersson K, Vaananen HK. Release of intact and fragmented osteocalcin molecules from bone matrix during bone resorption in vitro. J Biol Chem 2004;279:18361e9. [45] Ferron M, Hinoi E, Karsenty G, Ducy P. Osteocalcin differentially regulates beta cell and adipocyte gene expression and affects the development of metabolic diseases in wild-type mice. Proc Natl Acad Sci USA 2008;105:5266e70.

7

[46] Dobnig H, Turner RT. Evidence that intermittent treatment with parathyroid hormone increases bone formation in adult rats by activation of bone lining cells. Endocrinology 1995;136:3632e8. [47] Parfitt AM. The cellular basis of bone turnover and bone loss: a rebuttal of the osteocytic resorption-bone flow theory. Clin Orthop Relat Res 1977;127:236e47. [48] Knothe Tate ML. Whither flows the fluid in bone? An osteocyte’s perspective. J Biomech 2003;36:1409e24. [49] Klein-Nulend J, van der PA, Semeins CM, et al. Sensitivity of osteocytes to biomechanical stress in vitro. FASEB J 1995;9:441e5. [50] Lanyon LE. Osteocytes, strain detection, bone modeling and remodeling. Calcif Tissue Int 1993;53(Suppl.1):S102e6. [51] Dunstan CR, Somers NM, Evans RA. Osteocyte death and hip fracture. Calcif Tissue Int 1993;53(Suppl.1):S113e6. [52] Frost HM. In vivo osteocyte death. J Bone Joint Surg Am 1960;42-A:138e43. [53] Kato Y, Windle JJ, Koop BA, Mundy GR, Bonewald LF. Establishment of an osteocyte-like cell line, MLO-Y4. J Bone Miner Res 1997;12:2014e23. [54] Bonewald L. Establishment and characterization of an osteocyte-like cell line, MLO-Y4. J Bone Miner Metab 1999;17:61e5. [55] Cheng BZ, Luo J, Sprague E, Bonewald LF, Jiang JX. Expression of functional gap junctions and regulation by fluid flow in osteocyte-like MLO-Y4 cells. J Bone Miner Res 2001;16:249e59. [56] Plotkin LI, Bellido T. Glucocorticoids induce osteocyte apoptosis by blocking focal adhesion kinase-mediated survival. Evidence for inside-out signaling leading to anoikis. J Biol Chem 2007;282:24120e30. [57] Kogianni GMV, Noble BS. Apoptotic bodies convey activity capable of initiating osteoclastogenesis and localized bone destruction. J Bone Miner Res 2008;23:915e27. [58] Bakker ADSV, Krishnan R, Bacabac RG, et al. Tumor necrosis factor alpha and interleukin-1beta modulate calcium and nitric oxide signaling in mechanically stimulated osteocytes. Arthritis Rheum 2009;60:3336e45. [59] Guo DKA, Guthrie J, Veno PA, Harris SE, Bonewald LF. Identification of osteocyte-selective proteins. Proteomics 2010;10:3688e98. [60] Cherian PP, Cheng B, Gu S, Sprague E, Bonewald LF, Jiang JX. Effects of mechanical strain on the function of Gap junctions in osteocytes are mediated through the prostaglandin EP2 receptor. J Biol Chem 2003;278:43146e56. [61] Jiang JX, Siller-Jackson AJ, Burra S. Roles of gap junctions and hemichannels in bone cell functions and in signal transmission of mechanical stress. Front Biosci 2007;12:1450e62. [62] Weinbaum S, Cowin SC, Zeng Y. A model for the excitation of osteocytes by mechanical loading-induced bone fluid shear stresses. J Biomech 1994;27:339e60. [63] Vatsa A, Mizuno D, Smit TH, Schmidt CF, MacKintosh FC, Klein-Nulend J. Bioimaging of intracellular NO production in single bone cells after mechanical stimulation. J Bone Miner Res 2006;21:1722e8. [64] Jørgensen NRGS, Civitelli R, Steinberg TH. ATP- and gap junction-dependent intercellular calcium signaling in osteoblastic cells. J Cell Biol 1997;139:497e506. [65] Genetos DCKC, Zhang Y, Yellowley CE, Donahue HJ. Oscillating fluid flow activation of gap junction hemichannels induces ATP release from MLO-Y4 osteocytes. J Cell Physiol 2007;212:207e14. [66] Robinson JA, Chatterjee-Kishore M, Yaworsky PJ, et al. Wnt/ beta-catenin signaling is a normal physiological response to mechanical loading in bone. J Biol Chem 2006;281:31720e8.

PEDIATRIC BONE

8

1. BONE CELL BIOLOGY: OSTEOCLASTS, OSTEOBLASTS, OSTEOCYTES

[67] Hung CT, Pollack SR, Reilly TM, Brighton CT. Real-time calcium response of cultured bone cells to fluid flow. Clin Orthop Relat Res 1995:256e69. [68] Bonewald LF. The amazing osteocyte. J Bone Miner Res 2011;26:229e38. [69] Qing H, Bonewald LF. Osteocyte remodeling of the perilacunar and pericanalicular matrix. Int J Oral Sci 2009;1:59e65. [70] Bonewald LF. Osteocytes as dynamic, multifunctional cells. Ann NY Acad Sci 2007;1116:281e90. [71] Thompson DL, Sabbagh Y, Tenenhouse HS, et al. Ontogeny of Phex/PHEX protein expression in mouse embryo and subcellular localization in osteoblasts. J Bone Miner Res 2002;17: 311e20. [72] Nampei A, Hashimoto J, Hayashida K, et al. Matrix extracellular phosphoglycoprotein (MEPE) is highly expressed in osteocytes in human bone. J Bone Miner Metab 2004;22: 176e84. [73] Liu S, Zhou J, Tang W, Jiang X, Rowe DW, Quarles LD. Pathogenic role of Fgf23 in Hyp mice. Am J Physiol 2006;291:E38e49. [74] Feng JQ, Ward LM, Liu S, et al. Loss of DMP1 causes rickets and osteomalacia and identifies a role for osteocytes in mineral metabolism. Nat Genet 2006;38:1310e5. [75] Autosomal dominant hypophosphataemic rickets is associated with mutations in FGF23. Nat Genet 2000;26:345e8. [76] Winkler DGSM, Geoghegan JC, Yu C, et al. Osteocyte control of bone formation via sclerostin, a novel BMP antagonist. EMBO J 2003;22:6267e76. [77] Beighton P. Sclerosteosis. J Med Genet 1988;25:200e3. [78] Li X OM, Warmington KS, Morony S, et al. Sclerostin antibody treatment increases bone formation, bone mass, and bone strength in a rat model of postmenopausal osteoporosis. J Bone Miner Res 2009;24:578e88.

[79] Li X WK, Niu QT, Asuncion FJ, et al. Inhibition of sclerostin by monoclonal antibody increases bone formation, bone mass and bone strength in aged male rats. J Bone Miner Res 2010 Jul [Epub ahead of print]. [80] Tian XJW, Li X, Paszty C, Ke HZ. Sclerostin antibody increases bone mass by stimulating bone formation and inhibiting bone resorption in a hindlimb-immobilization rat model. Bone 2010 Sep; [Epub ahead of print]. [81] Agholme FLX, Isaksson H, Ke HZ, Aspenberg P. Sclerostin antibody treatment enhances metaphyseal bone healing in rats. J Bone Miner Res 2010;25:2412e8. [82] Noble BS, Peet N, Stevens HY, et al. Mechanical loading: biphasic osteocyte survival and targeting of osteoclasts for bone destruction in rat cortical bone. Am J Physiol Cell Physiol 2003;284; C934eC43. [83] Tatsumi SIK, Amizuka N, Li M, et al. Targeted ablation of osteocytes induces osteoporosis with defective mechanotransduction. Cell Metab 2007;5:464e75. [84] Kramer IHC, Keller H, Pegurri M, et al. Osteocyte Wnt/betacatenin signaling is required for normal bone homeostasis. Mol Cell Biol 2010;30:3071e85. [85] Kamel SAVP, Jiang J, Bonewald LF, Dallas SL. Comprehensive imaging of osteocytes and their dendrites in situ using widefield fluorescence, confocal microscopy and time lapse imaging. 31st Annual Meeting of the American Society for Bone and Mineral Research (abstract) 2009 Sep. [86] Veno PALY, Kamel SA, Feng JQ, Bonewald LF, Dallas SL. A membrane-targeted GFP selectively expressed in osteocytes reveals cell and membrane dynamics in living osteocytes. 32nd Annual Meeting of the American Society for Bone and Mineral Research (abstract) 2010 October 16.

PEDIATRIC BONE

C H A P T E R

2

Bone Matrix and Mineralization Marc D. McKee 1, William G. Cole 2 1

Faculty of Dentistry, and Department of Anatomy and Cell Biology, McGill University, Montreal, Quebec, Canada 2 Divisions of Orthopaedics and Pediatric Surgery, The Stollery Children’s Hospital, and University of Alberta, Edmonton, Alberta, Canada

STRUCTURAL HIERARCHY IN BONE

intimate intercalation of nanocrystals of mineral with the organic scaffolding extracellular matrix [1]. In fact, it is precisely this nanoscale deposition of trillions of inorganic, tiny plate-like crystallites within a softer organic matrix that provides for the inherent flexibility of bones that allows them to be deformed during mechanical challenge, but then return to their original organization characteristic of any given skeletal element. Beyond the macroscale, bone tissue is largely organized as a mosaic of different connected geometric subunits. These are generally referred to as cylindrical osteons (Haversian systems), half-cylindrical hemiosteons, or generally as irregularly disposed intervening bone tissue having a variety of forms related to the forces placed upon it. These subunits are constructed together either loosely as cancellous (spongy) trabecular bone, or densely as compact, generally cortical bone. Collectively, these osseous subunits are “welded” together at their adhesive interfaces by so-called cement lines (really cement planes) [4]. The organic and inorganic components of cement lines likely ensure molecular bonding across this adhesive interface, safeguarding tissue cohesion during bone remodeling as defective, fatigued (microfractured) bone is resorbed, and new bone is deposited to fill the resorption site leaving an intervening cement line at this temporospatially distinct boundary [5]. The cell teams responsible for these alternating cycles of bone resorption followed by formation are called bone multicellular/metabolic units (BMUs) and consist of osteoblasts, osteocytes and osteoclasts that leave behind nascent bone packets bonded to the residual bone [6]. Collectively, this cellular activity e together with the abundant mineralized matrix e creates the necessary physiologic and functional properties of bone, and allow for its carefully orchestrated removal and replacement otherwise know as bone turnover. Figure 2.1 presents a montage of light and transmission

Remarkable in its structural complexity and function, bone tissue serves multiple purposes depending on its anatomic location and on its surrounding and attached tissues. Indeed, hierarchical organization of bone extending from the macroscale to the nanoscale provides for a variety of functions and biomechanical properties that result entirely from its basic structural elements and how they are assembled and interact with one another [1]. Bone tissue is a hard, tough and durable material, able to withstand substantial loads and impacts, and able to respond dynamically e through the actions of cells e to a variety of mechanical challenges. In doing so, the skeleton ultimately repairs and replaces itself throughout the lifespan. Further to this, bone tissue also serves as an important vital ion reservoir, harboring abundant quantities of key mineral ions such as calcium and phosphate which can be mobilized upon demand and released for systemic use by cells throughout the body, and for something no less important than providing nutrient mineral ions to breastfeeding infants during lactation [2]. Bone’s hardness and toughness come from the fact that it is a composite material, consisting primarily of a protein-rich, interconnected organic matrix network whose macromolecular assemblies are interwoven in a way that provides a scaffold for mineral deposition [1]. Mineralization of this extracellular matrix by calcium and phosphate complexation to form crystalline salts that harden bones (and teeth) is not haphazard, but in fact occurs in a way that is almost unimaginably controlled at the molecular level e indeed, like most cellular processes. The inorganic phase (mostly crystalline, as a substituted form of hydroxyapatite [3]) that forms in the skeleton provides exactly the required hardness, while at the same time ensuring requisite toughness by

Pediatric Bone, Second Edition DOI: 10.1016/B978-0-12-382040-2.10002-4

9

Copyright Ó 2012 Elsevier Inc. All rights reserved.

10

2. BONE MATRIX AND MINERALIZATION

(A)

(C)

(B)

(E)

(D)

FIGURE 2.1 Light (A) and transmission electron (BeE) micrographs showing osteoblast-lineage bone cells (osteoblasts, Ob; osteocytes, Oc), unmineralized bone extracellular matrix (Osteoid), and the mineralized matrix (MM) of bone. (A) Cuboidal osteoblasts align at forming bone surfaces, with some becoming incorporated into the bone as osteocytes. (B, C) Osteoblasts secrete a collagen fibril-rich layer of extracellular matrix known as the osteoid which in its deeper regions show patches of mineralized matrix. Mineralization becomes more confluent at the mineralization front where it permeates throughout the fibrillar and interfibrillar matrix compartments. (D, E) Some osteoblasts become trapped within the extracellular matrix eventually to become embedded within mineralized bone as osteocytes. Osteocyte cell processes extend into the mineralized bone matrix within small channels termed canaliculi (arrows).

electron micrographs illustrating the cells, matrix and mineral of bone, and their relationships at the ultrastructural level. The subsequent sections of this chapter provide details on the composition of the extracellular matrix of bone, with a section at the end providing a discussion of matrix mineralization, and how proteins in the matrix are thought to regulate this process.

ORGANIC MATRIX OF BONE This section focuses on the organic matrix which constitutes approximately 20e30% by weight of bone [7]. The organic matrix contains approximately 90% collagen (by weight) and 10% non-collagenous proteins, proteoglycans, and lipids; although on a molar basis,

the latter category roughly equals collagen. Plasma proteins are also present in the organic matrix. Many plasma proteins permeate bone deriving from its rich vasculature, but have little or no affinity for bone, whereas others such as a2-HS glycoprotein (fetuin A) have a higher affinity for the matrix and/or mineral of bone [7]. A description of the primary structure, synthesis, and assembly of the major macromolecules of bone follows. Major bone collagens are described first, followed by the small, leucine-rich, interstitial proteoglycans (SLRPs), and then by non-collagenous proteins of bone. Some macromolecules are not discussed, including the microfibrillar proteins, such as type VI collagen and the fibrillins, as well as the lipoproteins. Details concerning the latter macromolecules as well as other macromolecules of the extracellular matrix and further details about the

PEDIATRIC BONE

ORGANIC MATRIX OF BONE

described macromolecules can be found online at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/), National Library of Medicine, National Institutes of Health.

Type I Collagen Type I collagen e the most abundant protein of bone e is also present in periosteum, perichondrium, ligaments, tendons, annulus fibrosus, menisci, dermis, sclera, dentin, fascia, and the adventitial layers of viscera [8,9]. It is one of the fibrillar collagens. The characteristic feature of the fibrillar collagens is that they contain a long, continuous triple helix that assembles into highly organized collagen fibrils [10]. The fibrils have high tensile strength, which is critical for the function of bone and other tissues. Each molecule of type I collagen is composed of two a1(I) chains and one a2(I) chain [10]. A small number of molecules contain three a1(I) chains. The importance of type I collagen in normal development is highlighted by the phenotypes that result from the homozygous or heterozygous loss of the a1(I) chains. Homozygous loss in the Mov 13 mouse, in which the a1(I) gene is inactivated by insertional mutagenesis, results in a prenatal lethal phenotype because of the lack of type I collagen in the tissues [11]. Heterozygous loss of one a1(I) allele, either in the Mov 13 mouse or in humans, yields the osteogenesis imperfecta type IA phenotype [12]. The a1(I) and a2(I) chains are encoded by the COL1A1 and COL1A2 genes, respectively. The COL1A1 gene is located on chromosome 17q21.3-q22 and the COL1A2 gene on chromosome 7q21.3-q22 [13,14]. Both genes have a similar structure, but because exons 33 and 34 are fused in COL1A1, the COL1A1 gene contains 51 exons, whereas the COL1A2 gene contains 52 exons [15,16]. The differences of 18 kb for COL1A1 and 38 kb for COL1A2 are attributable to differences in the sizes of their introns. For the pre-pro-a2(I) chain, the signal peptide is encoded by part of exon 1; the N-propeptide is encoded by part of exon 1, exons 2e5, and part of the junctional exon 6; the N-telopeptide is encoded by part of exon 6; the triple helix is encoded by part of exon 6, exons 7e48, and part of the junctional exon 49; the Ctelopeptide is encoded by part of exon 49; the C-propeptide is encoded by part of exon 49 and exons 50e52 [10,15]. The same arrangement exists for the pre-proa1(I) chain, except that the exon numbering is reduced by one beyond exons 33 and 34, which are fused in COL1A1 [10]. The exons encoding the main triple helix of the two chains have similar sizes [14]. Each exon encodes complete GlyeXeY triplets, where X and Y are often proline so that they commence with a codon for Gly

11

and end with a codon for Y. All exons encoding the triple-helical domain are 45, 54, 99, 108, or 162, base pairs (bps). It is likely that 54 bp was the ancestral exon size. The 108- and 162-bp exons arise from loss of introns. The 45- and 99-bp exons result from recombinations between two 54-bp exons [17]. The pre-pro-a1(I) chain contains 1464 amino acid residues [10,15]. It contains a signal peptide of 22 residues, an N-propeptide of 139 residues, an N-non-helical telopeptide of 17 residues, a main triple helix of 1014 residues, a C-non-helical telopeptide of 26 residues, and a C-propeptide of 246 residues. The mature tissue form of the a1(I) chain contains 1057 residues, including the main triple helix and the N- and C-telopeptides. The N-propeptide begins with a globular domain of 86 residues, including a von Willebrand type C repeat and 10 cysteine residues. It is followed by a triple-helical domain of 48 amino acids and a short globular domain. The procollagen N-proteinase cleavage site is at the Pro161eGln162 bond, numbered from the start of the signal peptide. Allysine cross-linking sites are located at residues 170 and 1208. There are two hydroxylysines that can be glycosylated at residues 265 and 1108. The mammalian collagenase cleavage site is at the Gly953e Ile954 bond. Proline residue 1164 may be 3-hydroxylated. There are two potential RGD (Arg-Gly-Asp) cell attachment sites at residues 745e747 and 1093e1095. Procollagen C-proteinase cleaves at Ala1218eAsp1219. The globular C-propeptide contains four cysteine residues at positions 1259, 1265, 1282, and 1291 that are involved in interchain disulfide bonding [18]. It also contains cysteine residues that are involved in intrachain disulfide bonding between residues 1299 and 1462 and between residues 1370 and 1415. There is also a putative Asn1365 site for attachment of an N-linked oligosaccharide. The pre-pro-a2(I) chain is shorter than the prepro-a1(I) chain, although the main triple-helical domains are the same size [16,19]. The pre-pro-a2(I) chain has a signal peptide of 22 amino acid residues, an N-propeptide of 57 residues, an N-non-helical telopeptide of 11 residues, a main helical domain of 1014 residues, a C-terminal non-helical telopeptide of 15 residues, and a globular C-propeptide of 247 residues. The very short globular domain of the N-propeptide contains only two cysteine residues. It is followed by a triple-helical domain of 42 residues and a second short globular domain. Procollagen N-proteinase cleaves at the Asn79eGln80 bond. Lysine residues 177 and 1023 are potential sites for hydroxylation and glycosylation. There are potential cell attachment sites at RGD sequences at positions 777e779, 822e824, and 1005e1007. The procollagen C-proteinase cleavage site is at the Ala1119eAsp1120 bond. Three sites for interchain disulfide bonds are at residues 1163, 1186, and 1195.

PEDIATRIC BONE

12

2. BONE MATRIX AND MINERALIZATION

Intrachain disulfide bonds may form between cysteine residues at positions 1203 and 1364 and between cysteine residues at positions 1272 and 1317. There is a potential N-linked oligosaccharide attachment site at Asn1267. The structures of the C-propeptide of human type III procollagen and the C-telopeptides of type I collagen have been described [20,21]. The structures of the Cpropeptides of types I and III procollagen are likely homologous. In contrast to the elongated structure of the C-terminal triple-helical region and the Ctelopeptide, the C-propeptide has a low-resolution structure composed of three large lobes and one small lobe [21]. This structure is readily interpretable in terms of the subunit composition and known positions of inter- and intrachain disulfide bonds. Among the eight cysteines found in the C-propeptide domains of type III procollagen, cysteines 1e4 are involved in interchain disulfide bonding, whereas cysteines 5e8 form intrachain disulfide bonds [22]. Consequently, it is likely that the three large lobes correspond to the intrachain disulfide-bonded region of each of the three polypeptide chains, whereas the small lobe corresponds to the junction region containing the interchain disulfide bonds and linking to the rest of the procollagen chain. Such an arrangement would place the chain-recognition region at the core of the structure, well positioned to determine the specificity of chainechain interactions [21]. The C-telopeptide of type I collagen had a hairpin conformation, with the C terminus folded back onto the triple helix [20]. After being transcribed, the pre-mRNA for the prepro-a1(I) and pre-pro-a2(I) chains undergoes exon splicing, capping, and the addition of a polyA tail, which gives rise to mature mRNAs. The mRNAs are translated in polysomes bound to the rough endoplasmic reticulum [23]. Formation of the triple-helical heterotrimeric type I procollagen molecule requires the synthesis of the constituent pro-a1(I) and pro-a2(I) chains from their distinct mRNAs. Transfer to the Golgi apparatus and movement into the secretory pathway require completion of both post-translational modifications and triple helix formation. The [pro-a1(I)]2[proa2(I)] heterotrimer is the major product, whereas stable [pro-a1(I)]3 homotrimer is formed in only small amounts. A [pro-a1(I)][pro-a2(I)]2 heterotrimer or a [pro-a2(I)]3 homotrimer have not been detected in cell cultures or tissues. Efficient type I procollagen heterotrimeric assembly appears to require that the elongating nascent pro-a1(I) and pro-a2(I) chains be inserted into the same compartments of the rough endoplasmic reticulum and that a mechanism for chain selection be operational within the compartment. Coordinated expression of the COL1A1 and COL1A2 genes is one way of ensuring

that the appropriate 2:1 ratios of the protein chains are available for the assembly of heterotrimers [24e26]. However, the ratios of the pro-a1(I):pro-a2(I) mRNAs vary widely, even though the resultant heterotrimers maintain the protein chain ratio of 2:1 [27]. Consequently, chain selection probably plays an important role in molecular assembly [28]. In support of the latter proposal, distinct chain recognition sequences of 15 amino acid residues have been identified within the Cpropeptides of the type I procollagen chains [29]. The interactions between the C-propeptides that lead to registration of nascent pro-a1(I) chains occur while the chains are still associated with polysomes [30e32]. Nascent collagen chains are translated on complex polyribosomal aggregates associated with more than one strand of mRNA. Consequently, it is likely that the organization of the mRNA translocons is a critical factor in molecular assembly [23]. Elongation pauses are also a prominent feature of synthesis of pro-a1(I) and proa2(I) chains [33]. There also appears to be an interaction between the translation complexes for the synthesis of the two chain types [28]. These interactions may serve two purposes: to bring the translation complexes to the same regions of the endoplasmic reticular membrane to ensure the co-localization of the nascent chains for interaction and to regulate or coordinate the rates of synthesis of the two pro-a chains. In many systems producing type I collagen, the pro-a1(I):pro-a2(I) ratio is greater than 2:1 [34]. In such situations, it is likely that all of the pro-a2(I) mRNA is engaged in heterotrimer synthesis, whereas the excess pro-a1(I) chains may either produce [pro-a1(I)]3 trimer or be degraded [35]. The signal peptides are removed as the nascent chains enter the rough endoplasmic reticulum. Both procollagen chains undergo hydroxylation and glycosylation of specific residues as a prerequisite for the formation of a stable triple-helical heterotrimer. Many of these enzymatic modifications occur as co-translational events. Approximately 100 proline residues in the Y position of GlyeXeY repeats undergo 4-hydroxylation by prolyl 4-hydroxylase. A single proline residue in the X position undergoes 3-hydroxylation by prolyl 3hydroxylase. A variable number of lysine residues, also in the Y position, may undergo lysyl hydroxylation by lysyl hydroxylase. Hydroxylation of proline residues to hydroxyproline is critical for the formation of a stable triple helix. The hydroxylases require the procollagen chains to be in a nascent state and various co-factors need to be present, such as ferrous ions, molecular oxygen, a-ketoglutarate, and ascorbate [36]. Prolyly 4-hydroxylase, also called procollagen proline 2 oxoglutarate 4-dioxygenase, is a tetramer consisting of two a and two b subunits with a molecular weight of 240 kDa. The b subunit is also known as protein

PEDIATRIC BONE

ORGANIC MATRIX OF BONE

disulfide isomerase. The gene for the b subunit, P4HB, is located on chromosome 17q25 [37]. The gene is expressed ubiquitously. There are two a subunits whose genes are named P4HA1 and P4HA2 [38]. The P4HA1 gene is located on chromosome 10q21.3-23.1 [39], and the P4HA2 gene is located on chromosome 5q31 [38]. The mRNAs encoded by P4HA1 and P4HA2 are expressed ubiquitously, although the ratios of the mRNAs vary between tissues. There are two a (I) subunit mRNA isoforms that result from mutually exclusive alternative splicing of exons 9 or 10 of P4HA1 [40]. Tetramers containing either two a (I)/two b subunits or two a1(II)/two b subunits have similar enzyme activities [38]. Co-expression of recombinant P4HA1, P4HA2, and P4HB in insect cells did not show any tetramers that contained both P4HA1 and P4HA2 protein chains [41]. Proline 986 of the triple helical region of pro a1(I) chain is the single proline residue that undergoes 3hydroxylation. Cartilage-associated protein (CRTAP), encoded by CRTAP, forms a complex with prolyl-3hydroxylase-1 (P3H1), encoded by LEPRE1 and the prolyl cis-trans isomerase cyclophilin B (CyPB), encoded by PPIB that is required for type I collagen 3-prolyl hydroxylation [42]. There appear to be at least four lysyl hydroxylases. The enzyme is also called procollagen-lysine 2 oxoglutarate 5-dioxygenease. Lysyl hydroxylase 1, an 85-kDa membrane-bound homodimeric protein, is localized to the cisternae of the rough endoplasmic reticulum [43]. It hydroxylates specific lysine residues in XeLyseGly sequences. Its gene, PLOD1, is located on chromosome 1p36.3-p36.2 [43]. It is expressed in the skeleton and in many other tissues. Lysyl hydroxylase 2 is encoded by PLOD2, which is located on chromosome 3q23-q24 [44]. It also forms homodimers. It is highly expressed in non-skeletal tissues as well as in bone [45]. Lysyl hydroxylase 2 modifies lysyl residues in the telopeptides of type I collagen involved in intermolecular cross-link formation. Lysyl hydroxylase 3 is encoded by PLOD3, which is located on chromosome 7q36 [46,47]. It is also expressed mostly in non-skeletal tissues. There is also a putative telopeptide lysyl hydroxylase that is specific for bone. The gene called either BRKS or TLH1 was predicted from linkage studies of patients with Bruck syndrome type I to be located on chromosome 17p12 [48]. Recently, FKBP10, which encodes FKBP65, which has prolyl cis-trans isomerase activity, was identified as a possible cause of some cases of Bruck syndrome type I e the gene is located on chromosome 17q21.2 [49]. When lysyl residues become hydroxylated, they may serve as a substrate for a glycosyltransferase and for a galactosyltransferase, which add glucose and galactose, respectively, to the hydroxyl group. These modifications also require the chains to be in the nascent

13

state. Increased levels of glycosylation tend to reduce the size of the collagen fibrils presumably caused by interference with packing of the molecules. A mannose-rich oligosaccharide may also attach to an asparagine residue in the C-propeptide. Chaperones play an important role in the assembly of procollagens in the rough endoplasmic reticulum. Protein disulfide isomerase, which has both enzymatic and chaperone functions, interacts transiently with procollagen chains early in the procollagen assembly pathway [50,51]. Release of prolyl 4-hydroxylase, including its b-subunit protein disulfide isomerase, from the triple-helical domain coincides with the assembly of thermally stable triple-helical molecules. However, if triple helix formation is prevented, prolyl 4-hydroxylase remains associated with the triple-helical domain, suggesting a role for the enzyme in preventing aggregation of this domain. Protein disulfide isomerase is also able to associate independently with the C-propeptide of monomeric procollagen chains prior to trimer formation, indicating a role for this isomerease in coordinating the assembly of heterotrimeric molecules [50]. It is also able to catalyze disulfide bond formation within and between the C-propeptides. HSP47, also called collagen-binding protein 2, is a heat shock protein that resides in the endoplasmic reticulum [52]. It interacts transiently with procollagen during its folding, assembly, and transport from the endoplasmic reticulum of mammalian cells. It has been suggested to carry out a diverse range of functions, such as acting as a molecular chaperone facilitating the folding and assembly of procollagen molecules, retaining unfolded molecules within the endoplasmic reticulum, and assisting the transport of correctly folded molecules from the endoplamic reticulum to the Golgi apparatus. The association of HSP47 with procollagen coincides with the formation of a collagen triple helix. HSP47 may form a chaperone complex with FK506binding protein 10 (FKBP10) that interacts with procollagen [49]. The importance of HSP47 in normal type I collagen biosynthesis is highlighted by the phenotype of mice lacking the heat shock protein [52]. The homozygous mice did not live longer than 11.5 days, and their tissues were deficient in collagen fibrils. The findings indicated that type I collagen was unable to form a rigid triple-helical structure without the assistance of HSP47 and that HSP47 was essential for normal development. HSP47 is encoded by SERPINH1 which is located on chromosome 11q13.5 [53]. The C-propeptides undergo registration and stabilization by the formation of interchain and intrachain disulfide bonds in the rough endoplasmic reticulum. The formation of the disulfide bonds is catalyzed by the enzyme protein disulfide isomerase, which is also the b-subunit of prolyl 4-hydroxylase. This process

PEDIATRIC BONE

14

2. BONE MATRIX AND MINERALIZATION

is critical for the correct alignment of the main triplehelical domain because the helix winds up from the C terminus. Triple helix formation is initiated in the rough endoplasmic reticulum immediately after the synthesis of the pro-a chains and after the formation of the interchain disulfide bonds within the C-propeptide [54,55]. It is likely that formation of the triple helix is a posttranslational event because the production of triplehelical molecules requires approximately 8 or 9 minutes after completion of the synthesis of the pro-a chains. The helix propagates from a single C-terminal nucleation site toward the N terminus and is interrupted by the random occurrence of peptide bonds in the cis configuration. The C-propeptide and C-telopeptide do not appear to play a role in nucleation of triple helix formation [56]. However, a minimum of two hydroxyproline-containing GlyeXeY triplets at the C-terminal end of the triple helix are required for nucleation to occur [56]. Direct nuclear magnetic resonance measurements of chick calvarial collagen showed that approximately 16% of the XePro and 8% of XeHyp bonds were cis in the unfolded collagen [57]. Many studies have shown that the rate-limiting step in the zipper-like propagation of the helix is the process of cis-trans isomerization [54,55,57,58]. Peptidyl prolyl cis-trans isomerase catalyzes the cis-trans isomerization of XePro peptide bonds in collagen [59]. FKBP65, encoded by FKBP10, also has prolyl cis-trans isomerase activity [60]. Protein disulfide isomerase is also present in the rough endoplasmic reticulum. However, protein disulfide isomerase does not appear to act as a cisetrans isomerase [59]. Full hydroxylation of proline residues in the Y position of GlyeXeY triplets also enhances the rate of propagation of the triple helix from the site of nucleation to the N terminus [61]. Biophysical studies using model collagen peptides have also shown that the folding of GlyeXeY peptides is best described as an all-or-none, third-order reaction [62e64]. The formation of the triple helix occurs in the rough endoplasmic reticulum. The type I procollagen molecules move to the Golgi apparatus, where oligosaccharides may be added to a C-propeptide asparagine residue. The molecules are secreted from the cell, during which (or soon after) the N- and C-propeptides are rapidly cleaved. The N-propeptide is specifically cleaved by procollagen 1 N-endoproteinase. The enzyme is encoded by the ADAMTS2 gene, which is an abbreviation for a disintegrin-like and metalloproteinase with thrombospondin type I motif [65]. The enzyme exists in a long and a short form as a result of alternative splicing [66]. The C-propeptide is cleaved by procollagen C-endoproteinase, which is the same as bone morphogenetic protein-1 (BMP-1) [67]. The gene is located on chromosome 8q21 [68]. Procollagen C-endoproteinase is a secreted, neutral zinc metalloproteinase. The Drosophila equivalent gene

is called tolloid (TLD). There are two isoforms of the human enzyme as a result of alternative splicing [69]. The long form appears to be an inactive proenzyme that can be activated by removal of the pro-domain. There are four mammalian BMP-1/TLD-like proteases [70]. One of them, tolloid-like-1 (TLL1), is also an astracin-like metalloproteinase. Its gene, TLL1, is located on chromosome 4q32-q33 [70]. The activity of procollagen C-endoproteinase is enhanced by procollagen C-endopeptidase enhancer, which is a glycoprotein that binds to the C-propeptide and enhances the activity of the Cproteinase enzyme [71]. Its gene, PCOLCE, is located on chromosome 7q21.3-q22 approximately 6 Mb from the COL1A2 gene that encodes pro-a2(I) chains of type I procollagen [72]. A second procollagen C-endopeptidase enhancer has been isolated. Its gene, PCOLCE2, is located on chromosome 3q21-q24 [73]. A number of functions have been proposed for the released a1(I) N-propeptide, including prevention of premature intracellular molecular association, facilitation of transcellular transport and secretion, regulation of extracellular fibrillogenesis, and feedback regulation of procollagen synthesis [74]. However, there is little evidence to support these proposals. For example, deletion of exon 2 of COL1A1 in mice, which deleted the 65-amino acid cysteine-rich globular domain of the N-propeptide of pro-a1(I) chains, did not produce any demonstrable anomalies in type I collagen biosynthesis, collagen cross-linking, or collagen fibrillogenesis [74]. Following removal of the N- and C-propeptides, the type I collagen molecules can self-assemble, cross-link, undergo further growth, and pack into thick collagen fibers. The nucleation steps that initiate the formation of collagen fibrils may commence within crypts on cell surfaces [75,76]. Various biophysical studies as well as rotary shadowing electron microscopy have shown that type I collagen monomers are rod-like structures with a length of approximately 300 nm and a diameter of approximately 1.4 nm. The overall helical symmetry is left-handed, with 10 residues in three turns and a pitch of approximately 3 nm. The three helical chains are further coiled about a central axis to form a right-handed helix with a repeat distance of approximately 10 nm [77,78]. The high content of glycine and its occurrence in every third residue of the triple-helical domain give rise to a polymer of tripeptide units with the formula (eGlyeXeYe)n. Glycine is the smallest amino acid; as such, it is the only amino acid that can pack tightly at the center of the triple-stranded collagen fibril monomers. The side chains of amino acids in the remaining eXe and eYe positions protrude from the chain, and this arrangement allows a variety of amino acid residues to be accommodated in the molecule. The high imino acid content, particularly the high 4-hydroxyproline

PEDIATRIC BONE

ORGANIC MATRIX OF BONE

content, has a stabilizing effect on the triple-helical structure. In type I collagen, the triple-helical configuration occurs throughout 95% of the rod-like monomer. The N- and C-telopeptides do not contain glycine residues at every third position. The long triple-helical domain not only provides the molecule with the stability required for its biomechanical functions but also makes it resistant to enzymatic cleavage apart from specific peptide bonds that can be cleaved by mammalian collagenases. The collagen monomers are able to undergo spontaneous self-assembly into fibrils. The fibrils are crossstriated as a result of the assembly of molecules in a parallel array but with a stagger of approximately one-quarter of their length. The periodicity of the cross-striated fibril is a result of each monomer having five highly charged regions at approximately 67-nm intervals. The repeat period e called a D period e is approximately 67 nm in length and contains 234 amino acids. The overall length of the collagen fibril monomer is 4.4 D units, which also corresponds to 300 nm. Because of the non-integral length of the monomers, overlapping by D divides the fibril into overlap zones that include the N- and C-termini of the molecules and gap zones that do not. The quarter-stagger arrangement of the collagen molecules provides the appropriate substrate conformation for the action of lysyl oxidase. The enzyme, which is a copper-dependent amine oxidase, requires molecular oxygen for activity. It acts on specific lysine and hydroxylysine residues to produce the corresponding aldehydes that are required for the formation of covalent collagen cross-linkages. The enzyme, which is also called protein-lysine 6-oxidase, is encoded by LOX, which is located on chromosome 5q23.3-q31.2 [79]. Alternative splicing produces three mRNA isoforms [79]. There are also four lysyl oxidase-like loci. LOXL1 is located on chromosome 15q22, LOXL2 on chromosome 8p21-p21.2, LOXL3 on chromosome 2p13.3, and LOXL4 on chromosome 10q24 [80,81]. The lysine aldehyde pathway occurs primarily in adult dermis, cornea, and sclera, whereas the hydroxylysine aldehyde pathway predominates in bone, ligaments, tendons, and embyronic dermis. The first step in both pathways is the oxidative deamination of the 3-amino group in telopeptide lysine and hydroxylysine residues to form their corresponding aldehydes, called allysine and hydroxyallysine, respectively. In the lysine aldehyde pathway, two allysines may condense to form the aldol condensation product, which forms intramolecular bonds. Aldimine cross-links are formed when allysine in the telopeptides reacts with lysine or hydroxylysine residues in adjacent helices to provide covalent intermolecular cross-linkages. In the hydroxylsine aldehyde pathway, hydroxyallysine can condense with

15

a hydroxylysine residue to form a reducible cross-link that can undergo an Amadori rearrangement to form hydroxylysino-5-oxo-norleucine. The hydroxylysinederived aldimine cross-links can also occur as galactosyl or glucosylgalactosyl derivatives. In the hydroxylysine aldehyde pathway, the major mature cross-link is based on trivalent 3-hydroxypyrididinium residues [82]. It includes hydroxylysylpyridinoline, derived from three hydroxylysine residues, and lysylpyridinoline, derived from two hydroxylysine residues and one lysine residue. These two cross-links are naturally fluorescent and can be assayed directly in tissue hydrosylates as well as in blood and urine. Insights into the importance of posttranslational modifications and preferred intermolecular binding partners for telopeptide and helical cross-linking domains in regulating cross-link type and placement are being obtained using ion-trap mass spectrometry and peptide-specific antibodies [83]. The formation of collagen fibrils has been studied extensively. Of particular interest are in vitro studies that use intact procollagen as well as procollagen lacking either the N-propeptide (pC) or C-propeptide (pN) with fibril formation initiated by the addition of specific Nand C-proteases [84,85]. This approach leads to the formation of fibril-like structures with the characteristic collagen D-periodic banding pattern but with a distinctive, bipolar needle-like morphology that is different from that of fibrils isolated from native tissue [76,85]. These fibril structures show a single polarity reversal where the orientation of the collagen is reversed with amino termini at both ends of the fibrils [85]. Newly formed fibrils with characteristic D periodicity have been isolated from various embyronic tissues [86]. These fibrils also frequently show a single polarity reversal [87]. Fibrils may increase in size by the fusion of small (1e10 mm) segments, and the lateral association of long or short fibrils may lead to thicker fibrils [86,88]. The growth of type I collagen fibrils appears to be partly regulated by other collagen molecules that are included within the heterotypic fibers [89]. For example, other collagens in the heterotypic type I collagen fibrils of dermis include types III, V, XII, and possibly XIV collagen [90]. In bone, the other collagens are type V and type V/XI hybrid molecules [91]. It is likely in these various types of heterotypic type I collagen fibrils that the N-propeptides that remain attached to the collagens, other than type I collagen, play a role in regulating the growth of the fibrils [90]. A number of other molecules, including the small leucine-rich proteoglycans such as decorin, fibromodulin, lumican, as well as hyaluronan, also appear to regulate the growth of fibrils [92]. The molecular packing of collagen fibrils has been determined mainly in tissues such as tendon. X-ray diffraction studies indicate the presence of three-

PEDIATRIC BONE

16

2. BONE MATRIX AND MINERALIZATION

dimensional crystallinity admixed with liquid-like lateral order [93,94]. The lateral unit cell, which contains five molecules in cross-section, gives rise to row lines with a maximum spacing of 3.8 nm. Electron microscopy of a transverse section of tendon fibrils reveals a similar periodicity (z4 nm) orientated radially with respect to the fibril center. A feature of the model is that molecules are tilted obliquely in a plane oriented 30
to the fibril surface [94], which results in the helicoidal organization of collagen fibrils. An additional feature of the model is that the fibril surface is coated in molecular ends, which has important consequences for fibril growth. For example, the persistence of the N-propeptides of types III, V, or XI collagen might prevent their incorporation into the center of the fibril, thereby forcing all N termini to the surface of the fibril, with prevention of further accretion and limiting fibril diameter [93]. An alternative molecular packing model is the fivestranded Smith microfibril [94]. The microfibril, with a diameter of approximately 4 nm, is the minimum filamentous structure that possesses an axial D repeat. Although their existence is still debated, evidence indicates that they do exist [93]. Three-dimensional image reconstructions of 25-nm diameter collagen fibrils show evidence of a 4-nm repeat in transverse section, which might correspond to ordered arrays of microfibrils, particularly at the level of gapeoverlap junctions. Bone and other connective tissues have distinctive collagen fiber sizes and distinctive suprafibrillar architectures, as seen by polarized light microscopy [95]. In woven bone, the collagen fibrils are generally randomly distributed. Lamellar bone contains collagen fibrils that are arranged in parallel layers or sheets running in different directions. Bone osteons have a lamellar structure in which the lamellae are arranged in concentric cylinders.

Type V Collagen Type V collagen was first identified in human placenta and dermis, but later studies showed that it is widely expressed in type I collagen-containing tissues including bone [96,97]. The type V collagen molecules exist as heterotrimers a1(V)2a2(V) a1(V) a2(V) a3(V) and as homotrimers a1(V)3 [98,99]. An apparently distinct a4(V) chain is synthesized by Schwann cells [100]. Type V collagen chains also form heterotypic molecules with type XI collagen chains. For example, the highly homologous a1(V) and a1(XI) chains may yield an a1(V) a1(XI) a2(V) trimer in bone and cartilage [91]. The following description of type V collagen is limited to the a1(V) and a2(V) chains because the a3(V) and a4(V) genes are not expressed in bone, although the a3(V) gene is expressed in ligament attachments to bone [101].

The gene for the a1(V) chain, COL5A1, is located on chromosome 9q34.2-q34.3 [102]. The gene has 66 exons, more than the number of exons in type I and II collagens. Exon 1 encodes the signal peptide of 36 amino acid residues and one base of the N-propeptide. Exons 2e14 encode the remainder of the N-propeptide, with exon 14 being a junctional exon that encodes the end of the N-propeptide and the beginning of the triple-helical domain. The N-propeptide contains 505 amino acid residues and the N-telopeptide contains 17 residues. The pro-a1(V) N-propeptide is similar in size and domain structure to the N-propeptides of the proa1(XI) and pro-a2(XI) chains [103e105]. The Npropeptides of the latter three chains all contain a very large globular domain, immediately downstream of the signal peptide, that is much larger than, and has no apparent homology to, the cysteine-rich globular domains of type IeIII collagens. The globular domains of the pro-a1(V), pro-a1(XI), and pro-a2(XI) chains are bisected by a cluster of two cysteines into a basic Nterminal subdomain and a C-terminal subdomain rich in acidic residues and tyrosines [103e106]. The latter region contains 27 tyrosine residues and 73% of the total number of tyrosine residues in the pre-pro-a1(V) chain. Approximately 40% of the N-propeptide tyrosine residues are sulfated [107]. The N-terminal subdomain is analogous to the thrombospondin 1 motif and is identical to the proline- and arginine-rich peptide (PARP) motif [108]. The derived three-dimensional structure of PARP suggests a conserved nine b-stranded structure [109,110]. The PARP motif is also present in the N-propeptides of the pro-a1(XI) and pro-a2(XI) chains but not in the pro-a2(V) chains. The globular domain of the N-propeptide of the pro-a1(V) chain is followed by an interrupted triple-helical domain of 25 GlyeXeY repeats and then another short non-collagenous region prior to the main triple-helical domain. Pro-a1(V), proa1(XI), and pro-a2(XI) sequences share similarities in all subdomains of their N-propeptides, with the exception of the acidic globular variable region [104]. There is no evidence of alternative splicing in the Npropeptide of pro-a1(V) chains, although it occurs in the pro-a1(XI) and pro-a2(XI) N-propeptides [103]. There are two hypothetical N-proteinase cleavage sites (Ala-Gln) at positions 541e542 and 546e547. The main triple-helical domain of a1(V) chains is similar to those of type IeIII collagens in that each non-junctional exon begins with a complete codon for glycine and ends with a complete codon for a residue in the Y position of GlyeXeY triplets [102,111]. The codons are commonly 45 or 54 bps. The main triplehelical domain is encoded by exons 14e62 [102]. These exons encode a main triple-helical domain of 1014 amino acid residues. Lysine residues at positions 642 and 1482, which are important for intermolecular

PEDIATRIC BONE

ORGANIC MATRIX OF BONE

cross-linkages, are preserved. The helical domain lacks the Gly-Ile/Leu mammalian cleavage site at position 775e776 of type IeIII collagens [112]. The absence of this sequence explains the lack of cleavage of the a1(V) chains by mammalian collagenase. Carboxyl terminal of the main triple helix is the C-telopeptide of 33 amino acid residues and the Cpropeptide of 233 residues. They are encoded by exons 62e66. The putative C-proteinase cleavage site is located at position 1605e1606 (AlaeAsp). The C-propeptide has a high homology with the same region of pro-a1(XI) chains. Seven cysteine residues and their vicinities are conserved. The pro-a chains that can form homotrimers or both homo- and heterotrimers of pro-a chains have eight cysteine residues, but the pro-a chains that form heterotrimers only have seven cysteine residues [17]. The C-propeptide of pro-a1(V) chains has eight cysteine residues, whereas the C-propeptide of the pro-a1(XI) chains has seven cysteine residues [113]. The pro-a1(V) chain contains numerous sites for potential attachment of N-linked oligosaccharides. It has a heparin binding site at residues 897e929 [114]. Heparin binding sites are also present in a1(XI) and a2(XI) chains but not a2(V) chains [115]. Binding of extracellular chondroitin sulfate E to type V collagen may facilitate cell binding and matrix assembly [116]. There are RGD cell attachment sites at positions 645e647 and 663e665. The gene for the a2(V) chain, COL5A2, resides on chromosome 2q14-q32 [117,118]. The gene, which spans approximately 67 kb, is located in a tail-to-tail orientation with the COL3A1 gene. The intergenic distance is approximately 22 kb. The two genes contain 51 exons and share almost identical structures. COL5A2 encodes a pre-pro-a2(V) chain of 1496 amino acid residues [119,120], and it includes a signal peptide of 26 residues. The pro-a2(V) N-propeptide is encoded by four complete exons and partially by the junctional exon. The N-propeptide of 167 residues includes an aminoterminal globular subdomain of 82 residues, in which there is a von Willibrand type C-like repeat. This subdomain contains a central cluster of 10 cysteine residues flanked on both sides by short, hydrophilic sequences. It is similar to the equivalent subdomain of the Npropeptide of pro-a1(I) chains but dissimilar to the equivalent subdomain of the pro-a1(V) chain [111,121]. The N-propeptide also includes an interrupted helical subdomain of 78 residues and a non-helical subdomain of seven residues. The N-proteinase cleavage site is at the AsneGln bond at position 193e194 of the full-length chain. The N-telopeptide contains 15 residues, including the lysine cross-linking site at residue 175. The main triple-helical domain contains 1017 residues and is followed by a C-telopeptide of 26 residues and a Cpropeptide of 246 residues. The C-proteinase cleavage

17

site is located at the GlyeAsp bond at position 1250e1251. There are seven RGD sequences that are potential cell binding sites. There are several sites for the attachment of N-linked oligosaccharides. Also, there are three cysteine residues, at positions 1293, 1299, and 1325, for intermolecular cross-linking and sites for intrachain disulfide cross-links at positions 1333e1494 and 1402e1447. In contrast to type I procollagen processing, in which the N- and C-propeptides are rapidly cleaved following secretion, type V procollagen molecules retain their Npropeptides. A variety of type V collagen molecules retaining all or parts of the N-propeptides have been extracted from tissues and from tissue culture medium [109,122,123]. Rotary shadowing confirmed the retention of the N-propeptides on some of the type V collagen molecules extracted from tissues [124]. Nonetheless, within pro-a1(V)2pro-a2(V) heterotrimers, some proa1(V) N-propeptides and pro-a2(V) C-propeptides are enzymatically removed by bone morphogenetic protein-1-like enzymes. Pro-a1(V) C-propeptides are processed by furin-like proprotein convertases in vivo [125]. When type V collagen epitopes are unmasked in tissues, this collagen is found to co-localize with type I collagen [126]. The exact spatial relationship between these collagens in the type I collagen fibrils is unclear. However, co-polymeric assembly is likely because cross-linkages between types I and V collagens have been isolated from bone [127]. It is also likely that type V collagen regulates the formation of the type I collagen fibrils [128]. Type V collagen molecules are capable of forming homotypic fibrils in vitro with or without an apparent 67-nm cross-striation pattern [129]. Increasing the quantity of type V collagen relative to type I collagen decreased the final fibril diameter [130]. It has been proposed that the retained N-propeptides of type V collagen molecules protrude from the surface of the type I collagen fibrils, where they regulate the growth of the fibrils [89,130]. Confirmation of the importance of the amino-terminal extension of the a2(V) chain was provided by the phenotype of mice in which the COL5A2 gene was engineered to lack exon 6, which normally encodes the N-telopeptide of a2(V) chains. The mice showed abnormal type I collagen fibrillogenesis in the dermis [131]. Although type V collagen, with the exception of its N-propeptides, is buried within the type I collagen fibrils, its main triple-helical domain is known to bind to thrombospondin, heparin, heparan sulfate, decorin, and biglycan [114,132e135]. Type V collagen contains seven RGD sequences on the a2(V) and two on the a1(V) chains that may enable type V collagen to attach to various cell types. These interactions may involve the a1b1 and a2b1 integrins [136].

PEDIATRIC BONE

18

2. BONE MATRIX AND MINERALIZATION

Small, Leucine-rich Interstitial Proteoglycans The small, leucine-rich interstitial proteoglycans (SLRPs) are a large family of extracellular matrix glycoproteins/proteoglycans that share a leucine-rich repeating structural motif [137]. Many of the family members bind to various collagens and to growth factors such as TGF-b1 [138]. The gene family can be divided into subfamilies based on similarities in amino acid sequences and gene organization. The type I subfamily includes decorin and biglycan, which contains an N-terminal domain substituted with chondroitin or dermatan sulfate chains. These proteoglycans show 57% protein sequence identity and are encoded by genes composed of eight exons with exon/intron junctions in conserved positions [139,140]. Fibromodulin and lumican constitute the type II subfamily and exhibit 48% protein sequence identity. Their genes are composed of three exons with conserved exon/intron junctions [141,142]. Other members of the latter family include the proline- and arginine-rich and leucine-rich repeat protein (PRELP) and osteomodulin. The class III SLRP expressed in cartilage is epiphycan, also called PG-Lb [143]. Chondroadherin represents its own subfamily, with a different gene organization and a different amino acid composition [144]. The leucine-rich repeating extracellular glycoproteins/proteoglycans have core proteins of 32e42 kDa [145]. The protein chains can be divided into N-terminal, central, and C-terminal domains. The N-terminal domains are least conserved, but in all members of the family they contain four Cys residues, which form intrachain disulfide bonds. The glycosaminoglycan chains in decorin and biglycan are O-glycosidically linked to Ser residues in the N-terminal region, providing polyanionic properties to the proteoglycans. In contrast, the N-terminal domains of fibromodulin and lumican carry clusters of negatively charged Tyr sulfate residues. The different leucine-rich repeat proteoglycans and glycoproteins have similar C-terminal domains, which contain approximately 50 amino acid residues. This domain contains two Cys residues involved in an intrachain disulfide bond, leading to the formation of a 34- to 41-residue loop. The common central domain constitutes approximately 60e80% of the total protein. In most of the members of the family, it contains 10 or 11 repeats of a 20- to 25-residue-long leucine-rich motif, with Asn and Leu residues in conserved positions. Each leucine-rich repeat contains the motif LXXLXLXXNXL, with each motif being separated by nine to 18 amino acids. Up to 30 adjacent leucine-rich repeats have been described in some leucine-rich repeat proteins. The leucine residues in the motif may be replaced by alanine, valine, isoleucine, phenylalanine, tyrosine, or methionine. The asparagine

residue at position 9 may be replaced by cysteine or threonine. There are consensus site Asn residues in the central repeat domain for substitution with carbohydrates. For example, the latter Asn sites are partially substituted with keratan sulfate in fibromodulin and lumican. The three-dimensional structure of one member of the family, ribonuclease inhibitor, showed that the leucinerich repeats form a horseshoe-shaped coil of parallel, alternating a-helices and b-sheets stabilized by interchain hydrogen bonds [146]. Results of structural studies of decorin and biglycan are in accordance with the latter x-ray crystallographic findings [147]. Decorin, fibromodulin, and lumican bind to fibrillar collagens in vitro, leading to delayed fibril formation and the formation of thinner fibrils [148]. These changes are likely attributable to binding of the leucine-rich repeat glycoproteins/proteoglycans to the surface of the axially growing fibril, which inhibits the incorporation of additional triple-helical collagen monomers [85]. Binding of the leucine-rich repeat proteoglycan to collagen alters the surface properties of the fibrils and may affect the interactions between individual collagen fibrils as well as between the fibrils and the matrix. Competitive binding and displacement of proteoglycans may regulate the growth of collagen fibrils during skeletal development [149]. Decorin and fibromodulin bind to distinct and apparently separate sites in the gap region of the D period of the collagen fibril in vivo [150,151]. Decorin has been shown to bind to a small region of the C-terminus of the triple-helical domain of a1(I) chains, close to one of the intermolecular crosslinking sites [152]. This region corresponds to the c1 band of the collagen fibril D period. Proteoglycan core proteins of decorin, biglycan, and fibromodulin, prepared as fusion proteins, each bound TGF-b1 [153]. There was negligible binding to several other growth factors. Intact decorin, biglycan, and fibromodulin, isolated from bovine tissues, competed with the fusion proteins for TGF-b1 binding. Affinity measurements suggest a two-site binding model with KD values ranging from 1 to 20 nM for the high-affinity binding site and from 50 to 200 nM for the low-affinity binding site. Stoichiometry indicated that the highaffinity binding site was present in one of 10 proteoglycan core molecules and that each molecule contained a low-affinity binding site. Tissue-derived biglycan and decorin were less effective competitors for TGF-b binding than fibromodulin or the non-glycosylated fusion proteins. Removal of the chondroitin/dermatan sulfate chains of decorin and biglycan (fibromodulin is a keratan sulfate proteoglycan) increased the activities of decorin and biglycan, suggesting that the glycosaminoglycan chains may hinder the interaction of the core proteins with TGF-b. The fusion proteins competed for the binding of radiolabeled TGF-b to Mv1Lu cells and

PEDIATRIC BONE

ORGANIC MATRIX OF BONE

endothelial cells. Affinity labeling showed that the binding of TGF-b to betaglycan and the type-I receptors in Mv1Lu cells and to endoglin in endothelial cells was reduced, but the binding to the type II receptors was unaffected. Latent recombinant TGF-b1 precursor bound slightly to fibromodulin and not at all to decorin and biglycan. These findings indicate that the three decorin-type proteoglycans each bind TGF-b isoforms and that slight differences exist in their binding properties. They, and possibly other members of this family of proteoglycans, may regulate TGF-b activities by sequestering TGF-b in the extracellular matrix. Representative members of the subfamilies of small, leucine-rich interstitial proteoglycans are described next. Decorin and Biglycan The decorin gene, DCN, and the biglycan gene, BGN, are located on chromosomes 12ql3.2 and Xq28, respectively [154]. Both genes have a similar eight exon gene structure. The decorin gene is approximately 45 kbs, whereas the biglycan gene is approximately 8 kbs. Exon 1 of decorin, which encodes the 50 untranslated region, exists as exon 1a and exon 1b, which undergo alternative splicing [140]. The decorin transcript can also undergo additional alternative splicing to yield five isoforms, AeE. Isoform A, which contains the full amino acid coding sequence, is the product of transcript variants Al from exon 1a and A2 from exon 2b. Isoform B lacks the exons 3 and 4 sequence, isoform C lacks the exons 3e5 sequence, isoform D lacks the exons 4e7 sequence, and isoform E lacks the exons 3e7 sequence. There are several polyadenylation sites, of which two account for the 1.6- and 1.9-kb mRNAs isolated from various connective tissues and cultured cells [140]. The biglycan mRNA sizes, also related to the use of different polyadenylation sites, are 2.1 and 2.6 kbs [139]. The BGN gene is subject to X inactivation because there is no homologous gene on the Y chromosome. However, the pseudoautosomal expression of BGN probably results from the regulation of the BGN gene by a gene or genes that escape X inactivation [155]. Preprodecorin contains 359 amino acid residues [156]. It includes a signal peptide of 16 residues, an Npropeptide of 14 residues, and a mature chain of 329 residues. Intrachain disulfide bonds are present between Cys54 and Cys67 as well as between Cys313 and Cys346. Twelve leucine-rich repeats are present in the central domain between residues 73 and 359. The O-linked chondroitin sulfate or dermatan sulfate attachment site is at residue 34. Residues 211, 262, and 303 provide potential N-linked oligosaccharide attachment sites. The core protein of 359 amino acid residues has a predicted molecular weight of 39 kDa, whereas the protein extracted from tissues has a molecular weight of

19

approximately 130 kDa, of which the chondroitin sulfate chain contributes approximately 40 kDa [157]. Preprobiglycan contains 368 amino acid residues [139]. It contains a signal peptide of 16 residues, a propeptide of 21 residues, and a mature protein of 331 residues. A region of proteoglycan N-terminal homology is present from residues 57 to 81 of the full-length protein. Ten leucine-rich repeats are located between residues 91 and 315. Residues 316e368 contain a domain with proteoglycan C-terminal homology. Residues 42, 47, 180, and 198 are potential chondroitin sulfate or dermatan sulfate attachment sites. Biglycan contains two substituted sites, whereas decorin contains only one. Asn residues 270 and 311 are possible sites for N-linked oligosaccharides. The secreted core protein has a predicted molecular weight of 38 kDa, whereas the intact tissue protein has a molecular weight of approximately 270 kDa, with the two chondroitin sulfate chains contributing 40 kDa [158]. BMP-1 cleaves probiglycan at a single site, removing the propeptide and producing a biglycan molecule with an N-terminus identical to that of the mature form found in tissues [159]. The BMP-1-related proteases, mammalian Tolloid and mammalian Tolloidlike 1 (mTLL-1), have low levels of probiglycan-cleaving activity. Wild-type mouse embryo fibroblasts produce only fully processed biglycan, whereas the fibroblasts derived from embryos homozygous null for the Bmp1 gene, which encodes both BMP-1 and mammalian Tolloid, produce predominantly unprocessed probiglycan, and fibroblasts homozygous null for both the Bmp1 gene and the mTLL-1 gene produce only unprocessed probiglycan. Consequently, all detectable probiglycanprocessing activity in the mouse embyronic fibroblasts is accounted for by the products of these two genes. The importance of decorin and biglycan in the formation of the connective tissues is demonstrated by the anomalies observed in mice that fail to express these genes. In decorin-deficient mice, the mice have fragile skin attributable to coarse and irregular collagen fibrils, confirming the importance of decorin in normal collagen fibrillogenesis [160]. Biglycan-deficient mice show reduced longitudinal growth and decreased bone mass, indicating an important role for biglycan in bone health [161]. Mice lacking both decorin and biglycan have more profound osteopenia compared to mice deficient in only one of these SLRPs [162]. Fibromodulin and Related Small Proteoglycans Representative members of the fibromodulin subfamily also include lumican, PRELP, and osteomodulin, also known as osteoadherin. They are found in most connective tissues but in greatest abundance in cartilage, tendon, and ligament [163]. The following descriptions will be restricted to fibromodulin and osteomodulin which are both present in bone.

PEDIATRIC BONE

20

2. BONE MATRIX AND MINERALIZATION

The fibromodulin gene, FMOD, is approximately 8.5 kbs and is located on chromosome 1q32 [164]. The gene contains three exons with conserved exon/intron junctions. Exon 1 encodes the 50 untranslated region, exon 2 contains 983 bps and encodes the major part of the translated region, and exon 3 encodes the last 50 nucleotides of the translated region as well as the 30 untranslated region. The fibromodulin mRNA is approximately 3 kbs. The highest expression of the gene is in hyaline cartilages, tendon, and ligament, whereas lower levels of expression occur in most other connective tissues [163]. Fibromodulin is a 59-kDa protein [163]. The fulllength protein contains 376 amino acid residues, including a signal peptide of 18 amino acid residues and a mature protein of 358 amino acid residues. The mature protein is composed of a central region containing leucine-rich repeats with up to four keratan sulfate chains flanked by disulfide-bonded terminal domains. The amino-terminal domain contains 10 tryosine residues that are partially sulfated [141]. The keratan sulfate chains are attached by N-glycosidic linkages from Nacetylglucosamine to asparagine residues in the central domain of the molecule [165]. In contrast to other SLRPs, fibromodulin does not contain glycosaminoglycan chains in the amino-terminal domain and does not contain chondroitin/dermatan sulfate in any domain. Mice lacking fibromodulin showed altered tendon structure because of the high proportion of thin, irregular collagen fibrils [145]. These relatively mild changes confirmed the important role of fibromodulin in regulating collagen fibrillogenesis in vivo. The gene for osteomodulin (also known as osteoadherin), OMD, is located on chromosome 9q22.31. The full-length human protein contains 421 amino acid residues. The primary structure of bovine osteomodulin was obtained by nucleotide sequencing of a cDNA clone from a primary bovine osteoblast expression library [166,167]. The entire translated primary sequence corresponds to a 49,116-Da protein with a calculated isoelectric point for the mature protein of 5.2. The dominating feature is a central region consisting of 11 leucinerich repeats ranging in length from 20 to 30 residues. The full, primary sequence contains four putative sites for tyrosine sulfation, three of which are at the N-terminal end of the molecule. There are six potential sites for Nlinked glycosylation, some of which are substituted with keratan sulfate chains. Osteomodulin shows 42% sequence identity to bovine keratocan and 38% identity to bovine fibromodulin, lumican, and human PRELP. Unique to osteomodulin is the presence of a large and very acidic C-terminal domain. The distribution of cysteine residues resembles that of other leucine-rich repeat proteins except for two centrally located cysteines. Northern blot analysis of RNA samples from various

bovine tissues showed a 4.5-kilobase pair mRNA for osteomodulin to be expressed in bone only. Osteomodulin mRNA was detected by in situ hybridization in mature osteoblasts located superficially on trabecular bone. Osteomodulin binds to hydroxyapatite and cells. Cell binding is mediated by integrin avb3 [167].

Thrombospondins The five members of the thrombospondin family are designated thrombospondin-1 to thrombospondin-5 [168]. Thrombospondin-5 is also known as cartilage oligomeric matrix protein (COMP). The thrombospondins are multimeric, multidomain glycoproteins that function at cell surfaces and in the extracellular matrix. The latter functions are also referred to as matricellular functions. The thrombospondin-1 gene, THBS1, is located on chromosome 15ql5 [169]. The full-length protein monomer contains 1170 amino acids, including a signal peptide of 31 amino acids. The thrombospondin-2 gene, THBS2, is located on chromosome 6q27 [170]. The full-length protein contains 1172 amino acids, including a signal peptide of 18 amino acid residues. The thrombospondin-3 gene, THBS3, on chromosome 1q21 encodes a protein monomer of 956 amino acids, including a signal peptide of 36 amino acid residues [171]. The thrombospondin-4 gene, THBS4, on chromosome 5ql3 encodes a full-length protein monomer of 961 amino acid residues, including a signal peptide of 21 residues [172]. Finally, the thrombospondin-5 gene, COMP, located on chromosome 19pl3.1 encodes a fulllength monomer of 757 amino acids, including a signal peptide of 20 amino acid residues [173]. Each thrombospondin is expressed in multiple tissues, particularly during fetal life. Similarly, most tissues express multiple members of the thrombospondin family [174]. Consequently, most of the thrombospondins are expressed in bone and cartilage during embryogenesis [175]. COMP is the most abundant form in postnatal growth plates [176]. Thrombospondin-2 and COMP are also present in postnatal bone and bone marrow stromal cells [176]. The thrombospondins are divided into subfamily A and subfamily B [174]. Thrombospondin-1 and thrombospondin-2 monomers, the members of subfamily A, share a complex modular structure and can assemble into disulfide-linked trimers. The modules from the amino terminus include the N-terminal domain, the oligomerization sequence, the procollagen homology region, three type 1, three type 2, and seven type 3 repeating units, and a globular C-terminal domain. Thrombospondins-3e5 are in subfamily B. They have unique N-terminal regions and lack the procollagen homology domain and type 1 repeats, but they contain

PEDIATRIC BONE

ORGANIC MATRIX OF BONE

four copies of the type 2 repeat and are assembled as pentamers. The globular amino- and carboxyl-terminal domains are connected to the remainder of the monomers by thin, flexible stalk regions [177]. The conformations of the stalk regions and the termini are determined, at least in part, by the calcium ion concentration [178]. The oligomerization motifs in all the thrombospondins are likely to be in a coiled-coil conformation, giving rise in subfamily A to trimers and in subfamily B to pentamers [179]. The procollagen homology region of thrombospondin-1 also folds into a stable, compact, and disulfide-bonded monomer. Isolated type 3 repeats of COMP produce a 14.2-nm rod-like structure [180]. The C-terminal domain and the adjoining type 3 repeats may fold together, in the presence of calcium, to form a C-terminal globular structure [180]. Thrombospondin-1 and thrombospondin-2 can form homotrimers and heterotrimers [181]. Thrombospondin trimers and pentamers are stabilized by the formation of interchain disulfide bonds between their corresponding oligomerization domains. Pentamerization of COMP involves the formation of interchain disulfide bonds between cysteine residues 68 and 71 [182]. Intrachain disulfide bonds are also present in the type 3 repeats. There are also specific sites for the addition of N- and O-linked sugars and for the C-mannosylation of tryptophan [183]. In the extracellular matrix, the thrombospondins bind to other macromolecules as well as to cell surface receptors. Many of the interactions involve specific domains within the monomers. Some of the interactions are sequence specific, but many are also dependent on the ionic environment and the conformation of the monomers. Each thrombospondin-1 monomer can bind approximately 35 calcium ions, whereas subfamily B thrombospondins, such as COMP, are expected to bind almost double that number of calcium ions [184]. Major changes in conformation of the type 3 repeats and the molecule follow the binding of calcium ions. Binding sites are also present for heparin and heparan sulfate proteoglycan, decorin, various integrins, as well as a wide range of proteases, cytokines, and growth factors [183]. The binding sites and the consequences of the interactions have been most thoroughly studied for thrombospondin-1 and thrombospondin-2. For example, the activities of thrombin, plasmin, neutrophil cathepsin G, elastase, urokinase plasminogen activator, plasminogen activator inhibitor, and MMP-2 are modified following binding to the latter thrombospondins [185]. The small latent TGF-b1 complex with the latencyassociated peptide binds to the WSIIWSPW motif in the second type 1 repeat of thrombospondin-1 [186]. An intermolecular activation effect of the KRFK motif

21

in the first type 1 repeat of thrombospondin-1 releases mature, active TGF-b1. Thrombospondin-2, which lacks the KRFK motif, can bind the latent TGF-b1 complex but cannot activate it [186]. Thrombospondin-4 and COMP bind to type I and II collagens [187]. COMP also binds type IX collagen and MMP-19 and -20, whereas thrombospondin-4 also binds to laminin, fibronectin, and matrilin-2 [187]. Cell surface interactions with thrombospondin-1 have been studied in detail [174]. The amino-terminal domain, type 1 repeats, type 3 repeats, and the Cterminal domain all interact with the cell surface. Each region appears to act via different cell surface receptors. The interactions are calcium-dependent and appear to be important for the maintenance of cell adhesion, spreading, migration, and shape. Cell attachment activity also appears to be important for thrombospondins-2 and -4 and COMP [188]. The C-terminal domains of thrombospondin-4 and COMP bind types I, II, and IX collagens in a zinc iondependent manner [187,189]. The binding of the latter thrombospondins is to the amino and carboxyl propeptides and two triple-helical sites of these collagens. The pentameric structure of thrombospondin-4 and COMP favors the use of multiple sites of interaction, which are likely to stabilize the extracellular matrix. Further insights into the functions of thrombospondin (TSP)-1, -2, -3 and -5 have been obtained from murine gene knockout studies. Mice lacking thrombospondin-1 show decreased embryonic viability, early onset pneumonia, increased circulating monocytes, and reduced TGF-b1 activation in the inflamed lungs and pancreas [190]. TSP1-deficient mice have no reported appendicular skeletal defects but have craniofacial dysmorphism, that is more pronounced in compound TSP1/2-deficient mice, spinal lordosis and altered rates of wound healing and tissue remodeling in various injury models. Mice lacking thrombospondin-2 have increased thickness and density of the longbone cortices, attributed to increased bone formation [191]. The TSP2-deficient mice also show resistance to ovariectomy-induced bone loss, differential surface responsiveness to mechanical loading, increased bone formation and reduced chondrogenesis in response to fracture, and altered bone mass and geometry associated with aging [168]. The TSP2-deficient mice have fragile skin, lax tendons, abnormal fibrillar collagen organization, increased vascular density, prolonged bleeding time, and accelerated skin wound healing [191]. The changes in the skin and tendons indicate that thrombospondin-2 normally plays an important role in collagen fibrillogenesis. Abnormal fibroblast interactions with the extracellular matrix and increased production of active MMP-2 were also identified in cell cultures from TSP2-deficient mice.

PEDIATRIC BONE

22

2. BONE MATRIX AND MINERALIZATION

In the TSP3-deficient mice, skeletal development was initially normal but, by 9 weeks of age, there was accelerated ossification of the secondary ossification centers of the femoral heads [192]. The TSP3-null mice also had an increased femoral cortical bone periosteal circumference and parameters of mechanical strength. The phenotype of TSP4-deficient mice has not been reported to date. However, the C-terminal domain of TSP4 binds to collagens I, II, III and V, as well as laminin, fibronectin and matrilin-2 [174]. TSP5-deficient mice have a mild skeletal phenotype with growth plate disorganization and mild exercise-induced articular cartilage flattening [193]. These skeletal changes are worse in compound TSP1/5 and TSP3/5-deficient mice [193]. Missense mutations of THBS5, particularly those that affect calcium binding and protein folding, are associated with the pseudoachondroplasia and multiple epiphyseal dysplasia phenotypes in mice and humans [194].

Osteonectin Osteonectin, initially isolated from demineralized bone matrix, was named according to its ability to bind to calcium, hydroxyapatite, and collagen, and to nucleate hydroxyapatite deposition [195,196]. The protein has also been called secreted protein, acidic and rich in cysteine (SPARC), basement membrane 40, or “culture shock” protein [197]. Osteonectin is an antiadhesive protein because it inhibits cell spreading, induces rounding of cells, and disassembles focal adhesions [198]. Other activities of osteonectin include calcium-dependent binding to collagens and thrombospondin, binding to platelet-derived growth factor-AB and -BB, and regulation of cell proliferation and MMP expression [199]. The gene SPARC or ON, which contains 10 exons, is located on chromosome 5q31.3-q32 [200]. The gene is expressed at high levels in tissues undergoing morphogenesis, remodeling, and wound repair. It is also made by cells of osteoblastic lineage and the hypertrophic chondrocytes of the growth plate [201]. The SPARC gene is also expressed in several postnatal non-skeletal tissues, including salivary and renal tubular epithelium [202]. Osteonectin is the most abundant non-collagenous protein in mineralized bone matrix in some species [196]. The SPARC gene encodes a full-length protein of 303 amino acids, including the signal peptide of 17 amino acid residues. The core molecular weight is 33 kDa [203]. The protein extracted from bone has an apparent molecular weight of 43 kDa attributable to post-translational modifications such as glycosylation. The mature human protein consists of 286 amino acid residues divided into three domains [204]. An aminoterminal acidic segment (residues 1e52) binds five to eight calcium ions with low affinity and mediates

interactions with hydroxyapatite. A follistatin-like domain (residues 53e137) contains five disulfides and an N-linked oligosaccharide at Asn [99]. Finally, an ahelical domain contains two EF hand, high-affinity, extracellular calcium binding sites (EC domain, residues 138e286). Crystal structure analysis showed that the follistatin and extracellular calcium domains interact through a small interface that involves the EF hand pair of the extracellular domain [205]. The elongated follistatin domain is structurally related to serine protease inhibitors of the Kazal family. Residues implicated in cell binding, inhibition of cell spreading, and disassembly of focal adhesions cluster on one side of osteonectin opposite the binding epitope for collagens and the Nlinked oligosaccharide. Crystal structure analysis also has shown that the collagen-binding epitope in the helix aA is partially masked by helix aC [205]. Deletion of helix aC produced a 10-fold increase in collagen affinity, similar to that seen after proteolytic cleavage of this helix [206]. Five residues were crucial for collagen binding: R149 and N156 in helix aA and L242, M245, and E246 in a loop region connecting the two EF hands of osteonectin. These residues were spatially close and formed ˚ , which matches the diameter of a flat ring of 15 A a triple-helical collagen domain. Nearly identical binding characteristics were displayed by type I and IV collagens. The absence of Sparc in transgenic mice gives rise to aberrations in the structure and composition of the extracellular matrix that result in cataracts, severe osteopenia, and impaired wound healing [207e209]. Sparcnull mice have decreased trabecular bone volume and fail to demonstrate an increase in bone mineral density in response to a bone-anabolic parathyroid hormone treatment regimen [209,210]. By 6 months of age, the mice develop severe eye pathology [207]. Sparc-null mice have greater deposits of subcutaneous fat and larger epididymal fat pads in comparison with wildtype mice. The dermis and fat pads of the SPARCdeficient mice contain less collagen I and the fibers are of smaller diameter than in controls [211e213].

Osteocalcin Osteocalcin is a small protein that accounts for approximately 10% of the non-collagenous protein of bone [214]. It is also called bone g-carboxyglutamate or bone Gla protein. It is one of several Gla proteins found in the skeleton. Other Gla proteins, such as protein S, are made elsewhere and are deposited in the bone matrix from the circulation [215]. The Gla proteins have in common the presence of glutamic acid residues that have been g-carboxylated by a specific g-carboxylase that requires vitamin K as a co-factor [216]. These

PEDIATRIC BONE

ORGANIC MATRIX OF BONE

g-carboxyglutamate residues have a high affinity for mineral ions such as Ca2þ and for hydroxyapatite crystals. The osteocalcin gene, BGLAP, is located on chromosome 1q25-q31 [217,218]. The gene is very small (<1 kb) and contains only four exons [219]. Exons 1e3 code for the preproosteocalcin, whereas exon 4 codes for the mature protein. The gene is specifically expressed by osteoblasts and is consequently limited to bone, specifically to regions destined for mineralization [220]. Mice lacking osteocalcin develop a phenotype marked by higher bone mass and bones of improved functional quality [221]. Histomorphometric studies performed before and after ovariectomy showed that the absence of osteocalcin leads to an increase in bone formation without impairing bone resorption. These findings, as well as those from detailed studies of bone mineralization in osteocalcin-deficient mice, provide evidence that osteocalcin is a determinant of bone formation and that it is also needed to stimulate bone mineral maturation [221,222]. Cloning of the mouse osteocalcin gene has shown that the gene structure is complex. It consists of three genes, all transcribed in the same direction, within a 23-kb region of genomic DNA [223]. The genes were named osteocalcin gene 1, osteocalcin gene 2, and osteocalcinrelated gene from the 50 end of the osteocalcin cluster. The osteocalcin 1 and osteocalcin 2 genes each contain four exons, whereas the osteocalcin-related gene contains, in addition to the four exons typical of osteocalcin, exon 1 that is not translated. Each of these genes can be transcribed. The osteocalcin 1 and osteocalcin 2 genes are expressed only in bone, whereas osteocalcinrelated gene is expressed in kidney but not in bone. The protein encoded by the osteocalcin-related gene is the same as nephrocalcin, a calcium-binding protein of the kidney [224]. The osteocalcin promoter has been studied in detail. Responsive elements for 1,25-dihydroxyvitamin D3, glucocorticoids, and tumor necrosis factor-a have been identified [225e227]. Other transcriptional regulatory sites such as one that binds MSX1 and MSX2, two homeodomain-containing proteins, have also been identified [228]. Two osteoblast-specific elements, OSE1 and OSE2, are present in the mouse osteocalcin gene. OSE2, which is upstream of OSE1, appears to regulate the expression of the osteocalcin gene by mature and immature osteoblasts, whereas OSE1 appears to regulate expression of the gene by immature osteoblasts. The full-length protein contains 100 amino acid residues [219]. There is a signal peptide of 23 amino acid residues and a propeptide of 28 residues. The mature protein contains 49 amino acid residues. In humans, the protein contains two rather than three Gla residues seen in other species [229]. The predicted structure of

23

the protein consists of two antiparallel a-helical domains connected by a b-turn [230]. A disulfide bond between cysteines 23 and 29 stabilizes the structure. The x-ray crystal structure of porcine osteocalcin at 2.0-angstrom resolution, revealed a negatively charged protein surface that coordinates five calcium ions in a spatial orientation that is complementary to calcium ions in a hydroxyapatite crystal lattice [231]. The Gla residues have affinity for free Ca2þ and Ca2þ-containing proteins. Calcium binds to the carboxyl groups of the Gla residues and to the opposing carboxyl groups of aspartic and glutamic acid residues in the two helical domains of osteocalcin [232]. Since 2007, osteocalcin has been identified as playing an important role in a reciprocal relationship between bones and energy metabolism [233]. This relationship involves the effects of leptin on osteoblast function and bone remodeling and osteocalcin in turn influencing energy metabolism apparently through the levels of uncarboxylated and undercarboxylated osteocalcin in the circulation [233,234]. Not all of the three glutamic acid residues in osteocalcin are fully carboxylated and bind to hydroxyapatite crystals. Uncarboxylated or undercarboxylated glutamic acid residues make osteocalcin susceptible to release from osteoblasts into the circulation [234]. Leptin may regulate the levels of gcarboxylation via regulating the levels of expression of Esp by osteoblasts [235]. The Esp gene, which encodes osteotesticular protein tyrosine phosphatase (OST-PTP), may contribute to the g-carboxylation of osteocalcin.

Small, Integrin-binding Ligand N-linked Glycoproteins This class of glycoproteins, also called SIBLINGs [236], includes a family of five proteins encoded by identically orientated tandem genes clustered within a 375 kb region on chromosome 4 [237]. The genes in order are dentin sialophosphoprotein (DSPP), dentin matrix acidic phosphoprotein 1 (DMP1), bone sialoprotein (IBSP), matrix extracellular phosphoglycoprotein (MEPE), and secreted phosphoprotein 1 (SPP1, also called osteopontin, OPN). Except for an apparent pseudogene between MEPE and SPP1 in humans, there are no other significant open reading frames in this region of chromosome 4 [237]. These genes have similar structures with either six or seven exons. It is likely that they arose by early gene duplication and subsequent divergence. The three-dimensional structures of bone sialoprotein and osteopontin, as determined by NMR analysis, shows that the proteins have an extended and flexible structure in solution [237]. The latter structure would be expected to facilitate binding to, and bridging between, multiple partners; for example, RGD and non-RGD integrins, other cell surface proteins,

PEDIATRIC BONE

24

2. BONE MATRIX AND MINERALIZATION

matrix metalloproteinases and complement factor H [237]. The extended structure could also be important for increasing binding to different crystallographic faces of bone mineral, and to different mineral phases [238]. The following sections will describe the members of the SIBLING family with the exception of DSPP which is present primarily in dentin rather than in bone. Bone Sialoprotein Bone integrin-binding sialoprotein, usually referred to as bone sialoprotein (BSP), is the second major sialoprotein of bone [7]. It constitutes approximately 12% of the non-collagenous protein of human bone. It binds to calcium and hydroxyapatite, cells, and collagens. The gene for bone integrin-binding sialoprotein, IBSP is located on chromosome 4q21-q25 between the DMP1 and MEPE genes [237]. The gene of about 15 kb includes seven exons and the promoter contains motifs that determine developmental regulation and tissue-specific expression [239]. As with the other members of the SIBLING family, exon 1 is non-coding while exon 2 includes the signal peptide and the first two codons of the mature protein. Exons 3 and 5 contain serine phosphorylation consensus sequences while exon 4 is proline rich. Exon 6 contains a glycosaminoglycan attachment site and a specific protease cleavage site. Exon 7 contains an RGD motif. Gene expression is more limited than that for osteopontin [240]. The IBSP gene is expressed by hypertrophic chondrocytes in the growth plate, in a subset of osteoblasts at the onset of matrix mineralization, and in osteoclasts [241]. Outside of the skeleton, IBSP is expressed in tooth odontoblasts and cementoblasts, and in trophoblasts of the placenta. The IBSP mRNA encodes a full-length protein of 317 amino acid residues and a signal peptide of 16 amino acid residues. The mature protein has a deduced core molecular weight of 33 600 [242]. Bone sialoprotein also contains stretches of polyglutamic acid as opposed to polyaspartic acid as found in osteopontin. The stretches of up to 10 glutamic acid residues provide high-affinity binding to Ca2þ. This characteristic is likely important in the role of integrin-binding sialoprotein in matrix mineralization. Bone sialoprotein, purified from bovine bone, has a molecular weight of 59 kDa due to its high content of carbohydrate. Bovine bone sialoprotein contains 5.8 phosphates that are added by casein kinase II to serine residues [243]. Mass spectrometry, combined with deglycosylation procedures, showed that bone sialoprotein contains 33.8% oligosaccharides, with 12.3% being N-linked and 21.5% O-linked [244,245]. An RGD sequence is located at the C-terminus of bone sialoprotein, in contrast to the more central location in osteopontin. It enables bone sialoprotein to bind to cells via an integrin receptor of the vitronectin

type (avb3). The RGD sequence is surrounded by tyrosine sulfation consensus sequences, although it is unclear whether sulfation affects the kinetics of binding. Bone cells attach to intact bone sialoprotein in an RGDdependent manner, but fragments of bone sialoprotein can bind to cells in an RGD-independent manner. BSP knockout mice have a higher bone mass than wild-type littermates, with very low bone formation activity and reduced osteoclast surfaces and numbers [246]. BSP/ preosteoclast cultures display impaired proliferation and enhanced apoptosis. The expression of osteoclast-associated genes is markedly altered in BSP/ osteoclasts, with reduced expression of cell adhesion and migration genes (aV integrin chain and OPN) and increased expression of resorptive enzymes (TRACP and cathepsin K) [247]. Despite the low basal turnover, both catabolic (ovariectomy) and anabolic (intermittent PTH) challenges increased bone formation and resorption in BSP/ mice, suggesting that compensatory pathways are operative in the skeleton of BSP-deficient mice [248]. Cortical bone repair and mineralization are also impaired by the absence of BSP [247,249]. Dentin Matrix Acidic Phosphoprotein-1 Dentin matrix acidic phosphoprotein-1 (DMP1) was first isolated by cDNA cloning using a rat odontoblast mRNA library [250]. It was initially postulated to be specific to dentin but later was detected in calvaria and long bones [251]. The gene encoding dentin matrix acidic phosphoprotein-1, DMP1, is located between DSPP and IBSP in the SIBLING gene cluster on chromosome 4q21 [237]. The gene contains six exons [252]. Exons 1e5 are similar in size to those of IBSP and SPP1. Exon 1 is non-coding, while exon 2 encodes the signal peptide and first two amino acids of the mature protein chain. Exons 3 and 5 contain serine phosphorylation sequences and exon 4 is proline rich. Exon 5 can be alternatively spliced. Exon 6, which encodes most of the protein, is equivalent to exons 6 and 7 of SPP1 and IBSP. Exon 6 of DMP1 contains a glycosaminoglycan attachment site, a specific protease cleavage site, and a more distal RGD motif. The mouse gene encodes a protein chain of 513 amino acids, including a signal peptide [253]. The amino acid sequence is highly acidic and serine rich. Phosphate analysis indicates that the NH2-terminal 37-kDa region contains 12 phosphates/mol, while the COOH-terminal 57-kDa region contains 41 [254]. The phosphates may serve as sequestering groups for recruiting calcium ions [255], or for binding to mineral. The cDNAdeduced amino acid sequence indicates that full-length rat DMP1 has three putative AsneXe-Ser/Thr N-linked glycosylation sites that are located within the 57-kDa

PEDIATRIC BONE

ORGANIC MATRIX OF BONE

proteolytic fragment, COOH-terminal to the RGD motif [250]. Full-length DMP1 is an inactive precursor which is proteolytically cleaved into two fragments. Extracts of bone and dentin contain two proteolytic fragments of DMP1 e an NH2-terminal 37-kDa fragment and a COOH-terminal 57-kDa fragment [254]. Sequence analysis revealed that DMP1 is proteolytically cleaved at four bonds: Phe173eAsp174, Ser180eAsp181, Ser217e Asp218, and Gln221eAsp222. BMP-1/Tolloid-like proteinase and the PHEX protein (phosphate-regulating gene with homologies to endopeptidases on the X chromosome) are candidate enzymes responsible for the proteolytic processing of DMP1 [254,256]. DMP1-null mice and humans with autosomal recessive hypophosphatasia manifest rickets and osteomalacia with isolated renal phosphate wasting associated with elevated serum fibroblast growth factor 23 (FGF23) levels and normocalciuria [257,258]. Osteopontin Osteopontin, also known as secreted phosphoprotein 1, is a secreted glycoprotein with the characteristics of a matricellular protein [259]. It was named osteopontin because it was proposed to act as a “bone bridge” from bone cells to hydroxyapatite [260]. It is highly expressed by bone cells but also by many other cell types, including hypertrophic chondrocytes, odontoblasts, cementoblasts, macrophages, as well as endothelial, smooth muscle, and epithelial cells [157,261]. Osteopontin is involved in a diverse range of biological processes, including biomineralization, cell attachment and cell signaling, cell migration, inflammation, and leukocyte recruitment. Osteopontin is a potent inhibitor of apatite formation and growth [262]; the inhibition is dose dependent and is abolished when phosphate groups were removed from osteopontin [262e265]. The osteopontin gene, SPP1 (secreted phosphoprotein 1), maps to chromosome 4q21-q25 and is located at the end of the cluster of the five genes of the SIBLING family [266]. It contains seven exons spanning approximately 9 kbs [267,268]. Exon 1 is non-coding while exon 2 encodes the signal peptide and the first two amino acids of the mature protein. Exons 3 and 5 contain phosphorylation sequences while exon 3 also contains a glycosaminoglycan attachment site. Exons 3 and 5 can be alternatively spliced. Exon 4 is proline rich. Exon 6 contains an RGD site and a specific proteolytic site [237]. Differential RNA splicing involving 42 nucleotides of exon 5 generates two alternatively spliced products in humans [266]. Mouse Spp1 mRNA contains two translational start sites which can produce a fulllength protein of 75 kDa and a 70 kDa short form that lacks the signal peptide [269].

25

Specific sequences in the 50 region of the SPP1 gene have been found to be regulated by hormones and growth factors associated with bone formation and bone remodeling. Some of the regulatory factors include TGF-b1, TGF-b2, retinoic acid, PTH, endothelin, proinflammatory cytokines, some BMPs, and 1,25-dihydroxyvitamin D3 [270e275]. Bone cells are a major site of synthesis and secretion of phosphorylated osteopontin [276]. In bone, osteopontin has been localized to osteoblasts, bone-lining cells, osteocytes, and cells with fibroblastic morphology associated with the periosteum [5,277,278]. In addition to being found throughout the bone matrix, osteopontin accumulates at various cellematrix interfaces (as a lamina limitans) and at matrixematrix interfaces (as a cement line) [1,4]. This protein is also synthesized by hypertrophic chondrocytes [276]. The full-length human osteopontin protein contains 300 amino acid residues, including a signal peptide of 16 amino acid residues [279]. The protein is acidic, can be highly phosphorylated [280], and is rich in sialic acid [274]. Phosphorylation of osteopontin occurs mainly on serine residues and is principally catalyzed by casein kinases [281]. Rat bone osteopontin has an average of 12 phosphoserine and one phosphothreonine residues, with considerable heterogeneity [282e284]. The variable level of phosphorylation of osteopontin observed in transformed osteogenic cells was probably attributable to modulation by 1,25-dihydroxyvitamin D3 [285]. In rat bone osteopontin, a single N-linked and 5-6 O-linked oligosaccharides have been identified, representing about 16.6% of the protein weight [282]. Three regions of the protein are highly conserved, including the N-terminal one-fourth of the chain, a segment around the RGD integrin-binding sequence, and the extreme C-terminus [279]. Four of the nine or 10 residues in the poly-Asp region (residues 70e80) are strictly conserved. In addition to the phosphate groups, this sequence may be involved in the attachment of the protein to mineral and in the regulation of growth of the bone crystals [263]. Osteopontin has an RGD cell-binding site, calciumbinding sites, and two heparin-binding domains [286]. The RGD domain (residues 128e130) interacts with cell surface integrins avb3, avb1, and avb5 to regulate cell attachment and spreading, intracellular signaling, and cell migration [287,288]. A cryptic SVVYGLR-containing domain interacts with a9b1 integrins after thrombin cleavage at residues 137 and 138 [289]. Osteopontin does not bind the standard form of CD44 (hyaluronic acid receptor) but may bind various isoforms of CD44 [290]. Osteopontin contains two conserved amino-terminal domains with heparin-binding homology that are likely to regulate its binding to the extracellular matrix.

PEDIATRIC BONE

26

2. BONE MATRIX AND MINERALIZATION

Osteopontin also binds directly to fibronectin, collagen, and osteocalcin [259]. Extracted osteopontin peptides from bone show that the protein exists as a heterogeneous mixture of molecules that differ in their extent of post-translational modification [283]. In particular, bone contains osteopontin molecules that differ widely in the extent of serine and threonine phosphorylation. Similar findings have been observed for osteopontin produced by cultured osteoblasts. In one study, a 55-kDa form, produced by immature osteoblasts, was less phosphorylated and sulfated than a 44-kDa form produced by more mature osteoblasts [291]. The 55-kDa form may have a localized function because it was secreted into cement lines, whereas the 44-kDa form may have a more widespread role in the regulation of mineralization throughout the bone. Glutamines at positions 34 and 36 are substrates for transglutaminase enzymes [292]. Transglutaminasepromoted cross-linking may account for the highermolecular-weight aggregates of osteopontin found in bone extracts [293e295]. Mice that lack osteopontin show no evidence of skeletal developmental anomalies in the neonatal period [296]. However, spleen cells from the deficient mice were better able to form osteoclasts than wild-type spleen cells. The phenotype became more pronounced with age. At 4e6 months of age, the osteopontin-deficient mice had two times the trabecular bone volume and three times the number of osteoclasts than wildtype mice [297]. The osteopontin-deficient mice were also resistant to ovariectomy-induced bone resorption, although the osteoclast numbers were not significantly different than those in sham-operated wild-type mice. This finding supports the proposal that osteopontin is an important regulator of osteoclast activity [297].

Matrix, Extracellular Phosphoglycoprotein Matrix, extracellular phosphoglycoprotein, MEPE, was first identified using expression screening of cDNA libraries prepared from tumors removed from patients with oncogenic hypophosphatemic osteomalacia [298]. The MEPE gene is located between IBSP and SPP1 in the SIBLING domain of chromosome 4q21.1 [237]. MEPE contains five exons. Exon 1 is noncoding while exon 2 encodes the signal peptide and the first two amino acids of the main protein. Exons 3 and 4 are similar to the equivalent exons of SPP1, IBSP and DMP1. Exon 5 of SPP1, IBSP and DMP1 is absent in MEPE. Exon 5 of MEPE encodes most of the protein. A 2-kb MEPE transcipt was detected in oncogenic hypophosphatemic osteomalacia tumors [299]. The predicted MEPE protein contains 525 amino acids, including

a signal peptide, and has two N-glycosylation motifs, phosphorylation and glycosaminoglycan attachment sites, an RGD motif and a specific protease cleavage site [298]. Mouse Mepe, also called osteoblast/osteocyte factor 45 (OF45), contains three methionine translational start codons. The first of them predicts a protein containing 441 amino acids. Northern and Western blot analyses confirmed expression in mouse bone [299]. The expression of Mepe was increased during mineralization in osteoblast cultures and in osteocytes. MEPE (and other SIBLING proteins) contains a conserved amino acid sequence called the ASARM peptide (acidic, serineand aspartate-rich motif) with potent mineralization inhibition properties [300e302]. ASARM interactions with (or cleavage by) PHEX can release this mineralization inhibition [300,303]. Patients with inactivating mutations of PHEX develop osteomalacia (hypomineralization, osteoidosis) as part of X-linked hyphosphatemia in the absence of functional PHEX [304]. Mice lacking one or two alleles of Mepe had increased bone mass [299]. The Mepe-null mice were resistant to bone loss during aging. Increased bone mass appeared to be attributable to increased osteoblast numbers and activity while osteoclast number and bone resorption surface area were unchanged. These findings suggested that Mepe normally plays an inhibitory role in bone formation in mice [299].

MINERALIZATION OF BONE The mineralization of vertebrate bone is a remarkable melding of geological and biological processes. Not surprisingly, Nature makes good use of terrestrial elements for tissue hardening and combines them in such a way to form generally insoluble (at physiologic neutral pH) calciumephosphate salts whose nanocrystals solidify bone, cartilage and tooth extracellular matrices. Particularly intriguing is the biological scaling down of geological, rock-forming processes such that bone nano-“biorocks” are single crystals that attain a remarkable regularity in size, shape, orientation and number within the extracellular matrix. The location of mineral within bone extracellular matrix clearly resides both within, and between, the collagen fibrils [1,305,306]. These distinct ultrastructural compartments for the mineral phase invariably provide different spatial and chemical environments for crystal growth, affecting crystal size and orientation. Whereas a reasonable amount of published information exists on how crystal growth e once initiated e is regulated in bone, there is a relative paucity of information on the nucleation process by which clusters of mineral ions reach a critical, stable nucleus size to

PEDIATRIC BONE

MINERALIZATION OF BONE

impart the crystalline, long-range order characteristic of mature bone mineral crystals. Indeed, precursor phases e such as amorphous calcium phosphate, and octacalcium phosphate e have long been proposed to exist prior to mineral maturation to form the crystalline apatitic phase, but compelling evidence for this remains scant [3]. Regardless of this mineral progression, key early facilitators of bone matrix mineralization have recently been identified, largely revolving around the handling and processing of the potent mineralization inhibitor pyrophosphate. Pyrophosphate (P2O7) is a ubiquitous metabolic byproduct of many intracellular processes found in most cells, and it also can be produced extracellularly [307]. Tissue fluid pyrophosphate found throughout the body prevents mineral deposition by binding either ionic or crystalline (in lattice) calcium such that mineralization is prevented. Tissue-non-specific alkaline phosphatase (ALPL, TNAP; the bone/kidney/liver isoform of alkaline phosphatase) [308] is an enzyme highly expressed by mineralized tissue cells, where it enzymatically degrades inhibitory pyrophosphate to promote mineralization, and where the resultant two orthophosphate ions produced by the hydrolysis might additionally promote mineralization by elevating local phosphate concentrations. Such an elegant, relatively simple way of initiating mineralization in bones and teeth (via high cellular ALPL expression to remove pyrophosphate), while preventing mineralization in soft tissues (low, or absent, ALPL expression resulting in persistent pyrophosphate), is supported by recent compelling mouse genetics studies [309]. Transgenic mice deficient in either ENPP1 (ectonucleotide pyrophosphatase phosphodiesterase 1; also called PC1, plasma cell membrane glycoprotein 1) that produces pyrophosphate directly extracellularly from nucleotides such as ATP, or ANK (ankylosis protein) which transports pyrophosphate out of the cell and into the extracellular compartment, both show decreased extracellular pyrophosphate and abundant ectopic calcification [310,311]. Overexpression of ALPL in the dermis of the skin in transgenic mice intentionally to remove pyrophosphate from a soft connective tissue results in dermal collagen mineralization [312]. Importantly, inactivating mutations in the ALPL gene e where ALPL enzymatic activity is reduced and extracellular inhibitory pyrophosphate levels are thus elevated e causes hypophosphatasia with characteristic osteomalacia (hypomineralization of bone, osteoidosis) [313]. Equally important effectors of bone mineralization are serum and tissue fluid levels of calcium and phosphate. The endocrinology underlying mineral ion homeostasis is both critical and complex, and essential for maintaining circulating and tissuespecific levels of mineral ions appropriate for extracellular matrix mineralization [314]. Probably the single

27

biggest advance in these combined fields is the realization that phosphate plays a far more critical role in physiologic and pathologic calcification than ever imagined (whereas previously the emphasis was on calcium), and that the phosphate:pyrophosphate ratio (modulated in large measure by the actions of ALPL) provides key molecular regulation maintaining the equilibrium between early promoters and inhibitors necessary for the initiation of normal bone matrix mineralization [315]. Superimposed on these determinants are the matrix vesicles released by osteoblasts (and maybe osteocytes) into the extracellular matrix [316]. Matrix vesicles contain much of the molecular machinery for initiation of mineralization as described above e within a shed, membrane-circumscribed “cytoplasmic droplet” e while additionally having a concentrated phospholipid-rich membrane component from which enzymatically released phosphate (by PHOSPHO1) [317] may likewise be a critical factor regulating the phosphate:pyrophosphate balance within and immediately surrounding matrix vesicles. Once matrix vesicle integrity is lost by rupture of the vesicles, molecular determinants within the extracellular milieu, as described above and below, take further control of the mineralization process. Beyond the initiation of mineralization in bone, crystal growth is regulated by a subcategory of the secreted, calcium-binding phosphoprotein (SCPP) family [318] called the small, integrin-binding ligand, N-linked glycoproteins (SIBLINGs) that includes OPN, MEPE, BSP, DMP1 and DSPP [236]. Details for most of these proteins have already been provided in the preceding sections, and here we focus on a broader discussion of the role bone matrix proteins in general, and their peptides, in the regulation of bone mineralization. The larger family of SCPPs are calcium-binding proteins secreted into tissue fluids where calcium is particularly abundant (e.g. milk and saliva) where they are thought to bind and transport calcium while preventing crystal formation [318]. They are also prominent proteins in skeletal and dental mineralized tissues where they regulate crystal growth e again, usually as inhibitors of mineralization [236]. The need for crystal growth inhibitors in tissues destined for mineralization may not at first glance be readily apparent, but the massive mineralization events that occur in bones and teeth e induced by the processes described above e require a significant level of SIBLING protein regulation at the organiceinorganic interface as crystals must attain tissue-specific size, shape and orientation with the extracellular matrix [1]. For bone extracellular matrix, crystal growth regulation occurs in two ultrastructurally distinct compartments e within collagen fibrils, and between collagen fibrils. While biochemically and structurally distinct,

PEDIATRIC BONE

28

2. BONE MATRIX AND MINERALIZATION

each becomes fully calcified such that mineralization ultimately permeates and extends throughout the entire volume of assembled matrix. Early mineralization events occur as small calcification foci in the generally unmineralized, preassembled matrix termed the osteoid, although it is not unambiguously clear where the initial mineralization occurs, be it in matrix vesicles, within collagen fibrils or between collagen fibrils. Beyond the osteoid deeper in the matrix, there is a massive propagation of crystal growth at a planar zone called the mineralization front; here, bone matrix incorporates its major hardening event forming the mineralized matrix proper of bone which, over time, undergoes a slower maturation gradually to become even more mineralized [319]. Figure 2.1 illustrates generally locations of mineralization within bone extracellular matrix, and ultrastructural matrixemineral relationships within the collagenous matrix. Closely correlated with mineralization are osteoblast and osteocyte expression of tissue-non-specific alkaline phosphatase and SIBLING proteins, all of which initiate and regulate this key extracellular event. The SIBLING proteins have common features that include their being highly negatively charged (important in calcium binding) and extensively post-translationally modified, particularly by heavy phosphorylation in bone [284] which, in turn, adds additional negative charge to the proteins. Specific peptide motifs within the SIBLING proteins have been identified as being particularly effective in inhibiting crystal growth [320e322], and enzymatic processing of parent SIBLING proteins releasing smaller, highly active inhibitory peptides is thought to be an important step in how these proteins regulate mineralization [302,303]. In turn, enzymatic degradation of the inhibitory peptides releases crystals from growth inhibition [300,321]. Such a proteolytic processing cascade involved in the direct regulation of bone mineralization and acting locally at the level of the extracellular matrix (as compared to circulating factors modulating mineral ion homeostasis systemically) is perhaps best exemplified by work done on the ASARM peptide which is highly conserved among the SIBLING proteins [303]. Accumulating evidence for the mineralization-inhibiting ASARM peptide (from MEPE and OPN) [300,302,321] shows that it is a binding partner and substrate for PHEX e an enzyme whose inactivating mutations lead to X-linked hypophosphatemia (XLH) showing hallmark osteomalacia. In the absence of PHEX, renal phosphate wasting and accumulated ASARM peptides residing in the bone matrix likely act together in preventing adequate skeletal mineralization in XLH. In summary, bone extracellular matrix mineralization occurs as the net result of both systemic circulating factors regulating mineral ion homeostasis in blood

plasma and bone tissue fluids, together with local factors acting at the organiceinorganic interface [323]. Collectively, these determinants of mineralization induce and control crystal growth, and ultimately terminate the mineralization process, in a manner appropriate for the biomechanical demands placed on the skeleton.

References [1] McKee MD, Addison WN, Kaartinen MT. Hierarchies of extracellular matrix and mineral organization in bone of the craniofacial complex and skeleton. Cells Tissues Organs 2005;181: 176e88. [2] Wysolmerski JJ. Interactions between breast, bone, and brain regulate mineral and skeletal metabolism during lactation. Ann NY Acad Sci 2010;1192:161e9. [3] Rey C, Combes C, Drouet C, Glimcher M. Bone mineral: update on chemical composition and structure. Osteoporos Int 2009;20: 1013e21. [4] McKee MD, Nanci A. Osteopontin: an interfacial extracellular matrix protein in mineralized tissues. Connect Tissue Res 1996;35:197e205. [5] McKee MD, Nanci A. Osteopontin at mineralized tissue interfaces in bone, teeth, and osseointegrated implants: ultrastructural distribution and implications for mineralized tissue formation, turnover, and repair. Microsc Res Tech 1996;33:141e64. [6] Parfitt AM. Targeted and nontargeted bone remodeling: relationship to basic multicellular unit origination and progression. Bone 2002;30:5e7. [7] Herring G, editor. The Organic Matrix of Bone. New York: Academic Press; 1972. [8] Click EM, Bornstein P. Isolation and characterization of the cyanogen bromide peptides from the alpha 1 and alpha 2 chains of human skin collagen. Biochemistry 1970;9:4699e706. [9] Fietzek PP, Furthmayr H, Kuhn K. Comparative sequence studies on alpha2-CB2 from calf, human, rabbit and pig-skin collagen. Eur J Biochem 1974;47:257e61. [10] Bernard MP, Chu ML, Myers JC, Ramirez F, Eikenberry EF, Prockop DJ. Nucleotide sequences of complementary deoxyribonucleic acids for the pro alpha 1 chain of human type I procollagen. Statistical evaluation of structures that are conserved during evolution. Biochemistry 1983;22:5213e23. [11] Hartung S, Jaenisch R, Breindl M. Retrovirus insertion inactivates mouse alpha 1(I) collagen gene by blocking initiation of transcription. Nature 1986;320:365e7. [12] Bonadio J, Jepsen KJ, Mansoura MK, Jaenisch R, Kuhn JL, Goldstein SA. A murine skeletal adaptation that significantly increases cortical bone mechanical properties. Implications for human skeletal fragility. J Clin Invest 1993;92:1697e705. [13] Retief E, Parker MI, Retief AE. Regional chromosome mapping of human collagen genes alpha 2(I) and alpha 1(I) (COLIA2 and COLIA1). Hum Genet 1985;69:304e8. [14] de Wet W, Bernard M, Benson-Chanda V, et al. Organization of the human pro-alpha 2(I) collagen gene. J Biol Chem 1987;262: 16032e6. [15] Tromp G, Kuivaniemi H, Stacey A, et al. Structure of a fulllength cDNA clone for the prepro alpha 1(I) chain of human type I procollagen. Biochem J 1988;253:919e22. [16] Kuivaniemi H, Tromp G, Chu ML, Prockop DJ. Structure of a full-length cDNA clone for the prepro alpha 2(I) chain of human type I procollagen. Comparison with the chicken gene confirms unusual patterns of gene conservation. Biochem J 1988;252:633e40.

PEDIATRIC BONE

29

REFERENCES

[17] Vuorio E, de Crombrugghe B. The family of collagen genes. Annu Rev Biochem 1990;59:837e72. [18] Makela JK, Raassina M, Virta A, Vuorio E. Human pro alpha 1(I) collagen: cDNA sequence for the C-propeptide domain. Nucleic Acids Res 1988;16:349. [19] Bernard MP, Myers JC, Chu ML, Ramirez F, Eikenberry EF, Prockop DJ. Structure of a cDNA for the pro alpha 2 chain of human type I procollagen. Comparison with chick cDNA for pro alpha 2(I) identifies structurally conserved features of the protein and the gene. Biochemistry 1983;22:1139e45. [20] Orgel JP, Wess TJ, Miller A. The in situ conformation and axial location of the intermolecular cross-linked non-helical telopeptides of type I collagen. Structure Fold Des 2000;8:137e42. [21] Bernocco S, Finet S, Ebel C, et al. Biophysical characterization of the C-propeptide trimer from human procollagen III reveals a tri-lobed structure. J Biol Chem 2001;276:48930e6. [22] Lees JF, Bulleid NJ. The role of cysteine residues in the folding and association of the COOH-terminal propeptide of types I and III procollagen. J Biol Chem 1994;269:24354e60. [23] Veis A, Leibovich SJ, Evans J, Kirk TZ. Supramolecular assemblies of mRNA direct the coordinated synthesis of type I procollagen chains. Proc Natl Acad Sci USA 1985;82:3693e7. [24] Vuust J. Procollagen biosynthesis by embryonic-chick-bone polysomes. Estimation of the relative numbers of active proalpha1 and proalpha2 messenger ribonucleic acids. Eur J Biochem 1975;60:41e50. [25] Vuust J, Piez KA. A kinetic study of collagen biosynthesis. J Biol Chem 1972;247:856e62. [26] Vuust J, Sobel ME, Martin GR. Regulation of type I collagen synthesis. Total pro alpha 1(I) and pro alpha 2(I) mRNAs are maintained in a 2:1 ratio under varying rates of collagen synthesis. Eur J Biochem 1985;151:449e53. [27] Olsen AS, Prockop DJ. Transcription of human type I collagen genes. Variation in the relative rates of transcription of the pro alpha 1 and pro alpha 2 genes. Matrix 1989;9:73e81. [28] Hu G, Tylzanowski P, Inoue H, Veis A. Relationships between translation of pro alpha1(I) and pro alpha2(I) mRNAs during synthesis of the type I procollagen heterotrimer. J Cell Biochem 1995;59:214e34. [29] Lees JF, Tasab M, Bulleid NJ. Identification of the molecular recognition sequence which determines the type-specific assembly of procollagen. Embo J 1997;16:908e16. [30] Veis A, Brownell AG. Triple-helix formation on ribosome-bound nascent chains of procollagen: deuterium-hydrogen exchange studies. Proc Natl Acad Sci USA 1977;74:902e5. [31] Brownell AG, Veis A. Intracellular location of triple helix formation of collagen. Enzyme probe studies. J Biol Chem 1976;251:7137e43. [32] Brownell AG, Veis A. The intracellular location of the glycosylation of hydroxylysine of collagen. Biochem Biophys Res Commun 1975;63:371e7. [33] Veis A, Kirk TZ. The coordinate synthesis and cotranslational assembly of type I procollagen. J Biol Chem 1989;264:3884e9. [34] Kosher RA, Kulyk WM, Gay SW. Collagen gene expression during limb cartilage differentiation. J Cell Biol 1986;102:1151e6. [35] Bienkowski RS, Baum BJ, Crystal RG. Fibroblasts degrade newly synthesised collagen within the cell before secretion. Nature 1978;276:413e6. [36] Prockop DJ, Kivirikko KI. Heritable diseases of collagen. N Engl J Med 1984;311:376e86. [37] Popescu NC, Cheng SY, Pastan I. Chromosomal localization of the gene for a human thyroid hormone-binding protein. Am J Hum Genet 1988;42:560e4. [38] Helaakoski T, Annunen P, Vuori K, MacNeil IA, Pihlajaniemi T, Kivirikko KI. Cloning, baculovirus expression, and

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

[54]

characterization of a second mouse prolyl 4-hydroxylase alphasubunit isoform: formation of an alpha 2 beta 2 tetramer with the protein disulfide-isomerase/beta subunit. Proc Natl Acad Sci USA 1995;92:4427e31. Pajunen L, Jones TA, Helaakoski T, et al. Assignment of the gene coding for the alpha-subunit of prolyl 4-hydroxylase to human chromosome region 10q21.3-23.1. Am J Hum Genet 1989;45: 829e34. Helaakoski T, Veijola J, Vuori K, et al. Structure and expression of the human gene for the alpha subunit of prolyl 4-hydroxylase. The two alternatively spliced types of mRNA correspond to two homologous exons the sequences of which are expressed in a variety of tissues. J Biol Chem 1994;269:27847e54. Annunen P, Helaakoski T, Myllyharju J, Veijola J, Pihlajaniemi T, Kivirikko KI. Cloning of the human prolyl 4-hydroxylase alpha subunit isoform alpha(II) and characterization of the type II enzyme tetramer. The alpha(I) and alpha(II) subunits do not form a mixed alpha(I)alpha(II)beta2 tetramer. J Biol Chem 1997;272:17342e8. Ishikawa Y, Wirz J, Vranka JA, Nagata K, Bachinger HP. Biochemical characterization of the prolyl 3-hydroxylase 1.cartilage-associated protein.cyclophilin B complex. J Biol Chem 2009;284:17641e7. Hautala T, Byers MG, Eddy RL, Shows TB, Kivirikko KI, Myllyla R. Cloning of human lysyl hydroxylase: complete cDNA-derived amino acid sequence and assignment of the gene (PLOD) to chromosome 1p36.3ep36.2. Genomics 1992;13:62e9. Szpirer C, Szpirer J, Riviere M, Vanvooren P, Valtavaara M, Myllyla R. Localization of the gene encoding a novel isoform of lysyl hydroxylase. Mamm Genome 1997;8:707e8. Valtavaara M, Papponen H, Pirttila AM, Hiltunen K, Helander H, Myllyla R. Cloning and characterization of a novel human lysyl hydroxylase isoform highly expressed in pancreas and muscle. J Biol Chem 1997;272:6831e4. Passoja K, Rautavuoma K, Ala-Kokko L, Kosonen T, Kivirikko KI. Cloning and characterization of a third human lysyl hydroxylase isoform. Proc Natl Acad Sci USA 1998;95:10482e6. Valtavaara M, Szpirer C, Szpirer J, Myllyla R. Primary structure, tissue distribution, and chromosomal localization of a novel isoform of lysyl hydroxylase (lysyl hydroxylase 3). J Biol Chem 1998;273:12881e6. Breslau-Siderius EJ, Engelbert RH, Pals G, van der Sluijs JA. Bruck syndrome: a rare combination of bone fragility and multiple congenital joint contractures. J Pediatr Orthop B 1998;7: 35e8. Kelley BP, Malfait F, Bonafe L, et al. Mutations in FKBP10 cause recessive osteogenesis imperfecta and Bruck syndrome. J Bone Miner Res 2010;26:666e72. Bottomley MJ, Batten MR, Lumb RA, Bulleid NJ. Quality control in the endoplasmic reticulum: PDI mediates the ER retention of unassembled procollagen C-propeptides. Curr Biol 2001;11: 1114e8. Wilson R, Lees JF, Bulleid NJ. Protein disulfide isomerase acts as a molecular chaperone during the assembly of procollagen. J Biol Chem 1998;273:9637e43. Nagai N, Hosokawa M, Itohara S, et al. Embryonic lethality of molecular chaperone hsp47 knockout mice is associated with defects in collagen biosynthesis. J Cell Biol 2000;150:1499e506. Ikegawa S, Sudo K, Okui K, Nakamura Y. Isolation, characterization and chromosomal assignment of human colligin-2 gene (CBP2). Cytogenet Cell Genet 1995;71:182e6. Bruckner P, Eikenberry EF. Formation of the triple helix of type I procollagen in cellulo. Temperature-dependent kinetics support a model based on cis in equilibrium trans isomerization of peptide bonds. Eur J Biochem 1984;140:391e5.

PEDIATRIC BONE

30

2. BONE MATRIX AND MINERALIZATION

[55] Bruckner P, Eikenberry EF, Prockop DJ. Formation of the triple helix of type I procollagen in cellulo. A kinetic model based on cis-trans isomerization of peptide bonds. Eur J Biochem 1981;118:607e13. [56] Bulleid NJ, Dalley JA, Lees JF. The C-propeptide domain of procollagen can be replaced with a transmembrane domain without affecting trimer formation or collagen triple helix folding during biosynthesis. Embo J 1997;16:6694e701. [57] Sarkar SK, Young PE, Sullivan CE, Torchia DA. Detection of cis and trans X-Pro peptide bonds in proteins by 13C NMR: application to collagen. Proc Natl Acad Sci USA 1984;81:4800e3. [58] Buevich AV, Dai QH, Liu X, Brodsky B, Baum J. Site-specific NMR monitoring of cis-trans isomerization in the folding of the proline-rich collagen triple helix. Biochemistry 2000;39:4299e308. [59] Lang K, Schmid FX. Protein-disulphide isomerase and prolyl isomerase act differently and independently as catalysts of protein folding. Nature 1988;331:453e5. [60] Alanay Y, Avaygan H, Camacho N, et al. Mutations in the gene encoding the RER protein FKBP65 cause autosomal-recessive osteogenesis imperfecta. Am J Hum Genet 2010;86:551e9. [61] Perret S, Merle C, Bernocco S, et al. Unhydroxylated triple helical collagen I produced in transgenic plants provides new clues on the role of hydroxyproline in collagen folding and fibril formation. J Biol Chem 2001;276:43693e8. [62] Xu Y, Bhate M, Brodsky B. Characterization of the nucleation step and folding of a collagen triple-helix peptide. Biochemistry 2002;41:8143e51. [63] Boudko S, Frank S, Kammerer RA, et al. Nucleation and propagation of the collagen triple helix in single-chain and trimerized peptides: transition from third to first order kinetics. J Mol Biol 2002;317:459e70. [64] Persikov AV, Ramshaw JA, Kirkpatrick A, Brodsky B. Peptide investigations of pairwise interactions in the collagen triplehelix. J Mol Biol 2002;316:385e94. [65] Hurskainen TL, Hirohata S, Seldin MF, Apte SS. ADAM-TS5, ADAM-TS6, and ADAM-TS7, novel members of a new family of zinc metalloproteases. General features and genomic distribution of the ADAM-TS family. J Biol Chem 1999;274:25555e63. [66] Colige A, Sieron AL, Li SW, et al. Human Ehlers-Danlos syndrome type VII C and bovine dermatosparaxis are caused by mutations in the procollagen I N-proteinase gene. Am J Hum Genet 1999;65:308e17. [67] Kessler E, Takahara K, Biniaminov L, Brusel M, Greenspan DS. Bone morphogenetic protein-1: the type I procollagen Cproteinase. Science 1996;271:360e2. [68] Yoshiura K, Tamura T, Hong HS, et al. Mapping of the bone morphogenetic protein 1 gene (BMP1) to 8p21: removal of BMP1 from candidacy for the bone disorder in Langer-Giedion syndrome. Cytogenet Cell Genet 1993;64:208e9. [69] Sieron AL, Tretiakova A, Jameson BA, et al. Structure and function of procollagen C-proteinase (mTolloid) domains determined by protease digestion, circular dichroism, binding to procollagen type I, and computer modeling. Biochemistry 2000;39:3231e9. [70] Scott IC, Clark TG, Takahara K, et al. Assignment of TLL1 and TLL2, which encode human BMP-1/Tolloid-related metalloproteases, to chromosomes 4q32e>q33 and 10q23e>q24 and assignment of murine Tll2 to chromosome 19. Cytogenet Cell Genet 1999;86:64e5. [71] Scott IC, Clark TG, Takahara K, Hoffman GG, Greenspan DS. Structural organization and expression patterns of the human and mouse genes for the type I procollagen COOH-terminal proteinase enhancer protein. Genomics 1999;55:229e34. [72] Takahara K, Osborne L, Elliott RW, Tsui LC, Scherer SW, Greenspan DS. Fine mapping of the human and mouse genes

[73]

[74]

[75]

[76]

[77] [78] [79]

[80]

[81]

[82]

[83] [84]

[85] [86]

[87]

[88]

[89]

[90]

[91]

for the type I procollagen COOH-terminal proteinase enhancer protein. Genomics 1996;31:253e6. Xu H, Acott TS, Wirtz MK. Identification and expression of a novel type I procollagen C-proteinase enhancer protein gene from the glaucoma candidate region on 3q21-q24. Genomics 2000;66:264e73. Bornstein P, Walsh V, Tullis J, Stainbrook E, Bateman JF, Hormuzdi SG. The globular domain of the proalpha 1(I) Npropeptide is not required for secretion, processing by procollagen N-proteinase, or fibrillogenesis of type I collagen in mice. J Biol Chem 2002;277:2605e13. Birk DE, Trelstad RL. Extracellular compartments in matrix morphogenesis: collagen fibril, bundle, and lamellar formation by corneal fibroblasts. J Cell Biol 1984;99:2024e33. Silver D, Miller J, Harrison R, Prockop DJ. Helical model of nucleation and propagation to account for the growth of type I collagen fibrils from symmetrical pointed tips: a special example of self-assembly of rod-like monomers. Proc Natl Acad Sci USA 1992;89:9860e4. Ramachandran G, Kartha G. Structure of collagen. Nature 1954;174:269e70. Rich A, Crick F. The structure of collagen. Nature 1955;176: 915e6. Mariani TJ, Trackman PC, Kagan HM, et al. The complete derived amino acid sequence of human lysyl oxidase and assignment of the gene to chromosome 5 (extensive sequence homology with the murine ras recision gene). Matrix 1992;12:242e8. Kenyon K, Modi WS, Contente S, Friedman RM. A novel human cDNA with a predicted protein similar to lysyl oxidase maps to chromosome 15q24-q25. J Biol Chem 1993;268:18435e7. Jourdan-Le Saux C, Le Saux O, Donlon T, Boyd CD, Csiszar K. The human lysyl oxidase-related gene (LOXL2) maps between markers D8S280 and D8S278 on chromosome 8p21.2-p21.3. Genomics 1998;51:305e7. Eyre DR, Oguchi H. The hydroxypyridinium crosslinks of skeletal collagens: their measurement, properties and a proposed pathway of formation. Biochem Biophys Res Commun 1980;92:403e10. Eyre DR, Weis MA, Wu JJ. Advances in collagen cross-link analysis. Methods 2008;45:65e74. Miyahara M, Hayashi K, Berger J, et al. Formation of collagen fibrils by enzymic cleavage of precursors of type I collagen in vitro. J Biol Chem 1984;259:9891e8. Kadler KE, Holmes DF, Trotter JA, Chapman JA. Collagen fibril formation. Biochem J 1996;316:1e11. Birk DE, Nurminskaya MV, Zycband EI. Collagen fibrillogenesis in situ: fibril segments undergo post-depositional modifications resulting in linear and lateral growth during matrix development. Dev Dyn 1995;202:229e43. Holmes DF, Lowe MP, Chapman JA. Vertebrate (chick) collagen fibrils formed in vivo can exhibit a reversal in molecular polarity. J Mol Biol 1994;235:80e3. Parkinson J, Kadler KE, Brass A. Self-assembly of rodlike particles in two dimensions: A simple model for collagen fibrillogenesis. Physical Review E Stat Phys Plasmas Fluids Relat Interdisciplinary Top 1994;50:2963e6. Birk DE. Type V collagen: heterotypic type I/V collagen interactions in the regulation of fibril assembly. Micron 2001;32: 223e37. White JF, Werkmeister JA, Darby IA, Bisucci T, Birk DE, Ramshaw JA. Collagen fibril formation in a wound healing model. J Struct Biol 2002;137:23e30. Niyibizi C, Eyre DR. Identification of the cartilage alpha 1(XI) chain in type V collagen from bovine bone. FEBS Lett 1989;242: 314e8.

PEDIATRIC BONE

REFERENCES

[92] Scott JE, Parry DA. Control of collagen fibril diameters in tissues. Int J Biol Macromol 1992;14:292e3. [93] Hulmes DJ. Building collagen molecules, fibrils, and suprafibrillar structures. J Struct Biol 2002;137:2e10. [94] Orgel JP, Miller A, Irving TC, Fischetti RF, Hammersley AP, Wess TJ. The in situ supermolecular structure of type I collagen. Structure (Camb) 2001;9:1061e9. [95] Giraud-Guille MM. Twisted liquid crystalline supramolecular arrangements in morphogenesis. Int Rev Cytol 1996;166:59e101. [96] Chung E, Rhodes K, Miller EJ. Isolation of three collagenous components of probable basement membrane origin from several tissues. Biochem Biophys Res Commun 1976;71: 1167e74. [97] Rhodes RK, Miller EJ. Physicochemical characterization and molecular organization of the collagen A and B chains. Biochemistry 1978;17:3442e8. [98] Fessler LI, Robinson WJ, Fessler JH. Biosynthesis of procollagen [(pro alpha 1 V)2 (pro alpha 2 V)] by chick tendon fibroblasts and procollagen (pro alpha 1 V)3 by hamster lung cell cultures. J Biol Chem 1981;256:9646e51. [99] Morris NP, Watt SL, Davis JM, Bachinger HP. Unfolding intermediates in the triple helix to coil transition of bovine type XI collagen and human type V collagens alpha 1(2) alpha 2 and alpha 1 alpha 2 alpha 3. J Biol Chem 1990;265:10081e7. [100] Chernousov MA, Rothblum K, Tyler WA, Stahl RC, Carey DJ. Schwann cells synthesize type V collagen that contains a novel alpha 4 chain. Molecular cloning, biochemical characterization, and high affinity heparin binding of alpha 4(V) collagen. J Biol Chem 2000;275:28208e15. [101] Imamura Y, Scott IC, Greenspan DS. The pro-alpha3(V) collagen chain. Complete primary structure, expression domains in adult and developing tissues, and comparison to the structures and expression domains of the other types V and XI procollagen chains. J Biol Chem 2000;275:8749e59. [102] Takahara K, Hoffman GG, Greenspan DS. Complete structural organization of the human alpha 1 (V) collagen gene (COL5A1): divergence from the conserved organization of other characterized fibrillar collagen genes. Genomics 1995;29:588e97. [103] Greenspan DS, Cheng W, Hoffman GG. The pro-alpha 1(V) collagen chain. Complete primary structure, distribution of expression, and comparison with the pro-alpha 1(XI) collagen chain. J Biol Chem 1991;266:24727e33. [104] Zhidkova NI, Brewton RG, Mayne R. Molecular cloning of PARP (proline/arginine-rich protein) from human cartilage and subsequent demonstration that PARP is a fragment of the NH2terminal domain of the collagen alpha 2(XI) chain. FEBS Lett 1993;326:25e8. [105] Tsumaki N, Kimura T. Differential expression of an acidic domain in the amino-terminal propeptide of mouse pro-alpha 2(XI) collagen by complex alternative splicing. J Biol Chem 1995;270:2372e8. [106] Yoshioka H, Ramirez F. Pro-alpha 1(XI) collagen. Structure of the amino-terminal propeptide and expression of the gene in tumor cell lines. J Biol Chem 1990;265:6423e6. [107] Fessler LI, Chapin S, Brosh S, Fessler JH. Intracellular transport and tyrosine sulfation of procollagens V. Eur J Biochem 1986;158:511e8. [108] Neame PJ, Young CN, Treep JT. Isolation and primary structure of PARP, a 24-kDa proline- and arginine-rich protein from bovine cartilage closely related to the NH2-terminal domain in collagen alpha 1 (XI). J Biol Chem 1990;265:20401e8. [109] Moradi-Ameli M, Rousseau JC, Kleman JP, Champliaud MF, Boutillon MM, Bernillon J, et al. Diversity in the processing events at the N-terminus of type-V collagen. Eur J Biochem 1994;221:987e95.

31

[110] Moradi-Ameli M, Deleage G, Geourjon C, van der Rest M. Common topology within a non-collagenous domain of several different collagen types. Matrix Biol 1994;14:233e9. [111] Takahara K, Sato Y, Okazawa K, et al. Complete primary structure of human collagen alpha 1 (V) chain. J Biol Chem 1991;266:13124e9. [112] Fields GB, Van Wart HE, Birkedal-Hansen H. Sequence specificity of human skin fibroblast collagenase. Evidence for the role of collagen structure in determining the collagenase cleavage site. J Biol Chem 1987;262:6221e6. [113] Bernard M, Yoshioka H, Rodriguez E, et al. Cloning and sequencing of pro-alpha 1 (XI) collagen cDNA demonstrates that type XI belongs to the fibrillar class of collagens and reveals that the expression of the gene is not restricted to cartilagenous tissue. J Biol Chem 1988;263:17159e66. [114] Yaoi Y, Hashimoto K, Koitabashi H, Takahara K, Ito M, Kato I. Primary structure of the heparin-binding site of type V collagen. Biochim Biophys Acta 1990;1035:139e45. [115] Fichard A, Kleman JP, Ruggiero F. Another look at collagen V and XI molecules. Matrix Biol 1995;14:515e31. [116] Takagaki K, Munakata H, Kakizaki I, Iwafune M, Itabashi T, Endo M. Domain structure of chondroitin sulfate E octasaccharides binding to type V collagen. J Biol Chem 2002;277: 8882e9. [117] Weil D, Bernard M, Gargano S, Ramirez F. The pro alpha 2(V) collagen gene is evolutionarily related to the major fibrillarforming collagens. Nucleic Acids Res 1987;15:181e98. [118] Emanuel BS, Cannizzaro LA, Seyer JM, Myers JC. Human alpha 1(III) and alpha 2(V) procollagen genes are located on the long arm of chromosome 2. Proc Natl Acad Sci USA 1985;82:3385e9. [119] Myers JC, Loidl HR, Seyer JM, Dion AS. Complete primary structure of the human alpha 2 type V procollagen COOHterminal propeptide. J Biol Chem 1985;260:11216e22. [120] Valkkila M, Melkoniemi M, Kvist L, Kuivaniemi H, Tromp G, Ala-Kokko L. Genomic organization of the human COL3A1 and COL5A2 genes: COL5A2 has evolved differently than the other minor fibrillar collagen genes. Matrix Biol 2001;20:357e66. [121] Woodbury D, Benson-Chanda V, Ramirez F. Amino-terminal propeptide of human pro-alpha 2(V) collagen conforms to the structural criteria of a fibrillar procollagen molecule. J Biol Chem 1989;264:2735e8. [122] Niyibizi C, Eyre DR. Structural analysis of the extension peptides on matrix forms of type V collagen in fetal calf bone and skin. Biochim Biophys Acta 1993;1203:304e9. [123] Fichard A, Tillet E, Delacoux F, Garrone R, Ruggiero F. Human recombinant alpha1(V) collagen chain. Homotrimeric assembly and subsequent processing. J Biol Chem 1997;272:30083e7. [124] Bachinger HP, Doege KJ, Petschek JP, Fessler LI, Fessler JH. Structural implications from an electronmicroscopic comparison of procollagen V with procollagen I, pC-collagen I, procollagen IV, and a Drosophila procollagen. J Biol Chem 1982;257:14590e2. [125] Unsold C, Pappano WN, Imamura Y, Steiglitz BM, Greenspan DS. Biosynthetic processing of the pro-alpha 1(V) 2pro-alpha 2(V) collagen heterotrimer by bone morphogenetic protein-1 and furin-like proprotein convertases. J Biol Chem 2002;277:5596e602. [126] Fitch JM, Gross J, Mayne R, Johnson-Wint B, Linsenmayer TF. Organization of collagen types I and V in the embryonic chicken cornea: monoclonal antibody studies. Proc Natl Acad Sci USA 1984;81:2791e5. [127] Niyibizi C, Eyre DR. Structural characteristics of cross-linking sites in type V collagen of bone. Chain specificities and heterotypic links to type I collagen. Eur J Biochem 1994;224:943e50. [128] Kypreos KE, Birk D, Trinkaus-Randall V, Hartmann DJ, Sonenshein GE. Type V collagen regulates the assembly of

PEDIATRIC BONE

32

[129]

[130]

[131]

[132]

[133]

[134]

[135] [136]

[137]

[138]

[139]

[140]

[141]

[142]

[143]

[144]

[145]

[146]

[147]

2. BONE MATRIX AND MINERALIZATION

collagen fibrils in cultures of bovine vascular smooth muscle cells. J Cell Biochem 2000;80:146e55. Adachi E, Hayashi T, Hashimoto PH. Immunoelectron microscopical evidence that type V collagen is a fibrillar collagen: importance for an aggregating capability of the preparation for reconstituting banding fibrils. Matrix 1989;9:232e7. Birk DE, Fitch JM, Babiarz JP, Doane KJ, Linsenmayer TF. Collagen fibrillogenesis in vitro: interaction of types I and V collagen regulates fibril diameter. J Cell Sci 1990;95:649e57. Andrikopoulos K, Liu X, Keene DR, Jaenisch R, Ramirez F. Targeted mutation in the col5a2 gene reveals a regulatory role for type V collagen during matrix assembly. Nat Genet 1995;9: 31e6. Mumby SM, Raugi GJ, Bornstein P. Interactions of thrombospondin with extracellular matrix proteins: selective binding to type V collagen. J Cell Biol 1984;98:646e52. Koda JE, Rapraeger A, Bernfield M. Heparan sulfate proteoglycans from mouse mammary epithelial cells. Cell surface proteoglycan as a receptor for interstitial collagens. J Biol Chem 1985;260:8157e62. Whinna HC, Choi HU, Rosenberg LC, Church FC. Interaction of heparin cofactor II with biglycan and decorin. J Biol Chem 1993;268:3920e4. Aho S, Uitto J. Two-hybrid analysis reveals multiple direct interactions for thrombospondin 1. Matrix Biol 1998;17:401e12. Ruggiero F, Champliaud MF, Garrone R, Aumailley M. Interactions between cells and collagen V molecules or single chains involve distinct mechanisms. Exp Cell Res 1994;210:215e23. Iozzo RV. The family of the small leucine-rich proteoglycans: key regulators of matrix assembly and cellular growth. Crit Rev Biochem Mol Biol 1997;32:141e74. Fleischmajer R, Fisher LW, MacDonald ED, Jacobs Jr L, Perlish JS, Termine JD. Decorin interacts with fibrillar collagen of embryonic and adult human skin. J Struct Biol 1991;106: 82e90. Fisher LW, Heegaard AM, Vetter U, et al. Human biglycan gene. Putative promoter, intron-exon junctions, and chromosomal localization. J Biol Chem 1991;266:14371e7. Danielson KG, Fazzio A, Cohen I, Cannizzaro LA, Eichstetter I, Iozzo RV. The human decorin gene: intron-exon organization, discovery of two alternatively spliced exons in the 50 untranslated region, and mapping of the gene to chromosome 12q23. Genomics 1993;15:146e60. Antonsson P, Heinegard D, Oldberg A. Structure and deduced amino acid sequence of the human fibromodulin gene. Biochim Biophys Acta 1993;1174:204e6. Grover J, Chen XN, Korenberg JR, Roughley PJ. The human lumican gene. Organization, chromosomal location, and expression in articular cartilage. J Biol Chem 1995;270:21942e9. Johnson HJ, Rosenberg L, Choi HU, Garza S, Hook M, Neame PJ. Characterization of epiphycan, a small proteoglycan with a leucine-rich repeat core protein. J Biol Chem 1997;272: 18709e17. Grover J, Chen XN, Korenberg JR, Roughley PJ. The structure and chromosome location of the human chondroadherin gene (CHAD). Genomics 1997;45:379e85. Svensson L, Aszodi A, Reinholt FP, Fassler R, Heinegard D, Oldberg A. Fibromodulin-null mice have abnormal collagen fibrils, tissue organization, and altered lumican deposition in tendon. J Biol Chem 1999;274:9636e47. Kobe B, Deisenhofer J. Crystal structure of porcine ribonuclease inhibitor, a protein with leucine-rich repeats. Nature 1993;366: 751e6. Krishnan P, Hocking AM, Scholtz JM, Pace CN, Holik KK, McQuillan DJ. Distinct secondary structures of the leucine-rich

[148]

[149]

[150]

[151]

[152] [153]

[154]

[155]

[156]

[157]

[158]

[159] [160]

[161]

[162]

[163]

[164]

[165]

repeat proteoglycans decorin and biglycan. Glycosylationdependent conformational stability. J Biol Chem 1999;274: 10945e50. Vogel KG, Trotter JA. The effect of proteoglycans on the morphology of collagen fibrils formed in vitro. Coll Relat Res 1987;7:105e14. Scott JE, Haigh M. Identification of specific binding sites for keratan sulphate proteoglycans and chondroitin-dermatan sulphate proteoglycans on collagen fibrils in cornea by the use of cupromeronic blue in ’critical-electrolyte-concentration’ techniques. Biochem J 1988;253:607e10. Pringle GA, Dodd CM. Immunoelectron microscopic localization of the core protein of decorin near the d and e bands of tendon collagen fibrils by use of monoclonal antibodies. J Histochem Cytochem 1990;38:1405e11. Hedlund H, Mengarelli-Widholm S, Heinegard D, Reinholt FP, Svensson O. Fibromodulin distribution and association with collagen. Matrix Biol 1994;14:227e32. Keene DR, San Antonio JD, Mayne R, et al. Decorin binds near the C terminus of type I collagen. J Biol Chem 2000;275:21801e4. Hildebrand A, Romaris M, Rasmussen LM, et al. Interaction of the small interstitial proteoglycans biglycan, decorin and fibromodulin with transforming growth factor beta. Biochem J 1994;302:527e34. McBride OW, Fisher LW, Young MF. Localization of PGI (biglycan, BGN) and PGII (decorin, DCN, PG-40) genes on human chromosomes Xq13-qter and 12q, respectively. Genomics 1990;6(2):219e25. Geerkens C, Vetter U, Just W, et al. The X-chromosomal human biglycan gene BGN is subject to X inactivation but is transcribed like an X-Y homologous gene. Hum Genet 1995;96:44e52. Krusius T, Ruoslahti E. Primary structure of an extracellular matrix proteoglycan core protein deduced from cloned cDNA. Proc Natl Acad Sci USA 1986;83:7683e7. Fisher LW, Hawkins GR, Tuross N, Termine JD. Purification and partial characterization of small proteoglycans I and II, bone sialoproteins I and II, and osteonectin from the mineral compartment of developing human bone. J Biol Chem 1987;262:9702e8. Roughley PJ, White RJ. Dermatan sulphate proteoglycans of human articular cartilage. The properties of dermatan sulphate proteoglycans I and II. Biochem J 1989;262:823e7. Scott IC, Imamura Y, Pappano WN, et al. Bone morphogenetic protein-1 processes probiglycan. J Biol Chem 2000;275:30504e11. Danielson KG, Baribault H, Holmes DF, Graham H, Kadler KE, Iozzo RV. Targeted disruption of decorin leads to abnormal collagen fibril morphology and skin fragility. J Cell Biol 1997;136:729e43. Xu T, Bianco P, Fisher LW, et al. Targeted disruption of the biglycan gene leads to an osteoporosis-like phenotype in mice. Nat Genet 1998;20:78e82. Corsi A, Xu T, Chen XD, et al. Phenotypic effects of biglycan deficiency are linked to collagen fibril abnormalities, are synergized by decorin deficiency, and mimic Ehlers-Danlos-like changes in bone and other connective tissues. J Bone Miner Res 2002;17:1180e9. Heinegard D, Larsson T, Sommarin Y, Franzen A, Paulsson M, Hedbom E. Two novel matrix proteins isolated from articular cartilage show wide distributions among connective tissues. J Biol Chem 1986;261:13866e72. Sztrolovics R, Chen XN, Grover J, Roughley PJ, Korenberg JR. Localization of the human fibromodulin gene (FMOD) to chromosome 1q32 and completion of the cDNA sequence. Genomics 1994;23:715e7. Antonsson P, Heinegard D, Oldberg A. Posttranslational modifications of fibromodulin. J Biol Chem 1991;266:16859e61.

PEDIATRIC BONE

REFERENCES

[166] Sommarin Y, Wendel M, Shen Z, Hellman U, Heinegard D. Osteoadherin, a cell-binding keratan sulfate proteoglycan in bone, belongs to the family of leucine-rich repeat proteins of the extracellular matrix. J Biol Chem 1998;273:16723e9. [167] Wendel M, Sommarin Y, Heinegard D. Bone matrix proteins: isolation and characterization of a novel cell-binding keratan sulfate proteoglycan (osteoadherin) from bovine bone. J Cell Biol 1998;141:839e47. [168] Hankenson KD, Sweetwyne MT, Shitaye H, Posey KL. Thrombospondins and novel TSR-containing proteins, R-spondins, regulate bone formation and remodeling. Curr Osteoporos Rep 2010;8:68e76. [169] Dixit VM, Hennessy SW, Grant GA, Rotwein P, Frazier WA. Characterization of a cDNA encoding the heparin and collagen binding domains of human thrombospondin. Proc Natl Acad Sci USA 1986;83:5449e53. [170] LaBell TL, Milewicz DJ, Disteche CM, Byers PH. Thrombospondin II: partial cDNA sequence, chromosome location, and expression of a second member of the thrombospondin gene family in humans. Genomics 1992;12:421e9. [171] Adolph KW, Long GL, Winfield S, Ginns EI, Bornstein P. Structure and organization of the human thrombospondin 3 gene (THBS3). Genomics 1995;27:329e36. [172] Newton G, Weremowicz S, Morton CC, et al. The thrombospondin-4 gene. Mamm Genome 1999;10:1010e6. [173] Newton G, Weremowicz S, Morton CC, et al. Characterization of human and mouse cartilage oligomeric matrix protein. Genomics 1994;24:435e9. [174] Adams JC. Thrombospondins: multifunctional regulators of cell interactions. Annu Rev Cell Dev Biol 2001;17:25e51. [175] Di Cesare PE, Fang C, Leslie MP, Tulli H, Perris R, Carlson CS. Expression of cartilage oligomeric matrix protein (COMP) by embryonic and adult osteoblasts. J Orthop Res 2000;18:713e20. [176] Carron JA, Bowler WB, Wagstaff SC, Gallagher JA. Expression of members of the thrombospondin family by human skeletal tissues and cultured cells. Biochem Biophys Res Commun 1999;263:389e91. [177] Morgelin M, Heinegard D, Engel J, Paulsson M. Electron microscopy of native cartilage oligomeric matrix protein purified from the Swarm rat chondrosarcoma reveals a five-armed structure. J Biol Chem 1992;267:6137e41. [178] Lawler J, Derick LH, Connolly JE, Chen JH, Chao FC. The structure of human platelet thrombospondin. J Biol Chem 1985;260:3762e72. [179] Misenheimer TM, Huwiler KG, Annis DS, Mosher DF. Physical characterization of the procollagen module of human thrombospondin 1 expressed in insect cells. J Biol Chem 2000;275: 40938e45. [180] Maddox BK, Mokashi A, Keene DR, Bachinger HP. A cartilage oligomeric matrix protein mutation associated with pseudoachondroplasia changes the structural and functional properties of the type 3 domain. J Biol Chem 2000;275:11412e7. [181] O’Rourke KM, Laherty CD, Dixit VM. Thrombospondin 1 and thrombospondin 2 are expressed as both homo- and heterotrimers. J Biol Chem 1992;267:24921e4. [182] Efimov VP, Lustig A, Engel J. The thrombospondin-like chains of cartilage oligomeric matrix protein are assembled by a fivestranded alpha-helical bundle between residues 20 and 83. FEBS Lett 1994;341:54e8. [183] Hofsteenge J, Huwiler KG, Macek B, et al. C-mannosylation and O-fucosylation of the thrombospondin type 1 module. J Biol Chem 2001;276:6485e98. [184] Misenheimer TM, Mosher DF. Calcium ion binding to thrombospondin 1. J Biol Chem 1995;270:1729e33.

33

[185] Hogg PJ. Thrombospondin 1 as an enzyme inhibitor. Thromb Haemostat 1994;72:787e92. [186] Schultz-Cherry S, Chen H, Mosher DF, et al. Regulation of transforming growth factor-beta activation by discrete sequences of thrombospondin 1. J Biol Chem 1995;270:7304e10. [187] Narouz-Ott L, Maurer P, Nitsche DP, Smyth N, Paulsson M. Thrombospondin-4 binds specifically to both collagenous and non-collagenous extracellular matrix proteins via its C-terminal domains. J Biol Chem 2000;275:37110e7. [188] DiCesare PE, Morgelin M, Mann K, Paulsson M. Cartilage oligomeric matrix protein and thrombospondin 1. Purification from articular cartilage, electron microscopic structure, and chondrocyte binding. Eur J Biochem 1994;223:927e37. [189] Rosenberg K, Olsson H, Morgelin M, Heinegard D. Cartilage oligomeric matrix protein shows high affinity zinc-dependent interaction with triple helical collagen. J Biol Chem 1998;273: 20397e403. [190] Lawler J, Sunday M, Thibert V, et al. Thrombospondin-1 is required for normal murine pulmonary homeostasis and its absence causes pneumonia. J Clin Invest 1998;101:982e92. [191] Kyriakides TR, Zhu YH, Smith LT, et al. Mice that lack thrombospondin 2 display connective tissue abnormalities that are associated with disordered collagen fibrillogenesis, an increased vascular density, and a bleeding diathesis. J Cell Biol 1998;140: 419e30. [192] Hankenson KD, Hormuzdi SG, Meganck JA, Bornstein P. Mice with a disruption of the thrombospondin 3 gene differ in geometric and biomechanical properties of bone and have accelerated development of the femoral head. Mol Cell Biol 2005;25:5599e606. [193] Posey KL, Hankenson K, Veerisetty AC, Bornstein P, Lawler J, Hecht JT. Skeletal abnormalities in mice lacking extracellular matrix proteins, thrombospondin-1, thrombospondin-3, thrombospondin-5, and type IX collagen. Am J Pathol 2008;172: 1664e74. [194] Hecht JT, Hayes E, Haynes R, Cole WG. COMP mutations, chondrocyte function and cartilage matrix. Matrix Biol 2005;23: 525e33. [195] Romberg RW, Werness PG, Lollar P, Riggs BL, Mann KG. Isolation and characterization of native adult osteonectin. J Biol Chem 1985;260:2728e36. [196] Termine JD, Kleinman HK, Whitson SW, Conn KM, McGarvey ML, Martin GR. Osteonectin, a bone-specific protein linking mineral to collagen. Cell 1981;26:99e105. [197] Sage H, Tupper J, Bramson R. Endothelial cell injury in vitro is associated with increased secretion of an Mr 43,000 glycoprotein ligand. J Cell Physiol 1986;127:373e87. [198] Workman G, Sage EH. Identification of a sequence in the matricellular protein sparc that interacts with the scavenger receptor stabilin-1. J Cell Biochem 2011;112:1003e8. [199] Clark CJ, Sage EH. A prototypic matricellular protein in the tumor microenvironmentewhere there’s SPARC, there’s fire. J Cell Biochem 2008;104:721e32. [200] Swaroop A, Hogan BL, Francke U. Molecular analysis of the cDNA for human SPARC/osteonectin/BM-40: sequence, expression, and localization of the gene to chromosome 5q31q33. Genomics 1988;2:37e47. [201] Metsaranta M, Young MF, Sandberg M, Termine J, Vuorio E. Localization of osteonectin expression in human fetal skeletal tissues by in situ hybridization. Calcif Tissue Int 1989;45:146e52. [202] Young MF, Day AA, Dominquez P, McQuillan CI, Fisher LW, Termine JD. Structure and expression of osteonectin mRNA in human tissue. Connect Tissue Res 1990;24:17e28. [203] Bolander ME, Young MF, Fisher LW, Yamada Y, Termine JD. Osteonectin cDNA sequence reveals potential binding regions

PEDIATRIC BONE

34

[204]

[205]

[206]

[207]

[208]

[209]

[210]

[211]

[212]

[213]

[214] [215]

[216] [217]

[218]

[219]

[220]

[221]

2. BONE MATRIX AND MINERALIZATION

for calcium and hydroxyapatite and shows homologies with both a basement membrane protein (SPARC) and a serine proteinase inhibitor (ovomucoid). Proc Natl Acad Sci USA 1988;85:2919e23. Hohenester E, Maurer P, Hohenadl C, Timpl R, Jansonius JN, Engel J. Structure of a novel extracellular Ca(2þ)-binding module in BM-40. Nat Struct Biol 1996;3:67e73. Sasaki T, Hohenester E, Gohring W, Timpl R. Crystal structure and mapping by site-directed mutagenesis of the collagenbinding epitope of an activated form of BM-40/SPARC/osteonectin. Embo J 1998;17:1625e34. Sasaki T, Gohring W, Mann K, et al. Limited cleavage of extracellular matrix protein BM-40 by matrix metalloproteinases increases its affinity for collagens. J Biol Chem 1997;272:9237e43. Gilmour DT, Lyon GJ, Carlton MB, et al. Mice deficient for the secreted glycoprotein SPARC/osteonectin/BM40 develop normally but show severe age-onset cataract formation and disruption of the lens. Embo J 1998;17:1860e70. Basu A, Kligman LH, Samulewicz SJ, Howe CC. Impaired wound healing in mice deficient in a matricellular protein SPARC (osteonectin, BM-40). BMC Cell Biol 2001;2:15. Boskey AL, Moore DJ, Amling M, Canalis E, Delany AM. Infrared analysis of the mineral and matrix in bones of osteonectin-null mice and their wildtype controls. J Bone Miner Res 2003;18:1005e11. Delany AM, Hankenson KD. Thrombospondin-2 and SPARC/ osteonectin are critical regulators of bone remodeling. J Cell Commun Signal 2009;3:227e38. Bradshaw AD, Graves DC, Motamed K, Sage EH. SPARC-null mice exhibit increased adiposity without significant differences in overall body weight. Proc Natl Acad Sci USA 2003;100: 6045e50. Bradshaw AD, Puolakkainen P, Dasgupta J, Davidson JM, Wight TN. Helene Sage E. SPARC-null mice display abnormalities in the dermis characterized by decreased collagen fibril diameter and reduced tensile strength. J Invest Dermatol 2003;120:949e55. Puolakkainen P, Bradshaw AD, Kyriakides TR, et al. Compromised production of extracellular matrix in mice lacking secreted protein, acidic and rich in cysteine (SPARC) leads to a reduced foreign body reaction to implanted biomaterials. Am J Pathol 2003;162:627e35. Gallop PM, Lian JB, Hauschka PV. Carboxylated calciumbinding proteins and vitamin K. N Engl J Med 1980;302:1460e6. Maillard C, Berruyer M, Serre CM, Dechavanne M, Delmas PD. Protein-S, a vitamin K-dependent protein, is a bone matrix component synthesized and secreted by osteoblasts. Endocrinology 1992;130:1599e604. Suttie JW. Vitamin K-dependent carboxylase. Annu Rev Biochem 1985;54:459e77. Puchacz E, Lian JB, Stein GS, Wozney J, Huebner K, Croce C. Chromosomal localization of the human osteocalcin gene. Endocrinology 1989;124:2648e50. Cancela L, Hsieh CL, Francke U, Price PA. Molecular structure, chromosome assignment, and promoter organization of the human matrix Gla protein gene. J Biol Chem 1990;265:15040e8. Celeste AJ, Rosen V, Buecker JL, Kriz R, Wang EA, Wozney JM. Isolation of the human gene for bone gla protein utilizing mouse and rat cDNA clones. Embo J 1986;5:1885e90. Bronckers AL, Gay S, Finkelman RD, Butler WT. Developmental appearance of Gla proteins (osteocalcin) and alkaline phosphatase in tooth germs and bones of the rat. Bone Miner 1987;2: 361e73. Ducy P, Desbois C, Boyce B, et al. Increased bone formation in osteocalcin-deficient mice. Nature 1996;382:448e52.

[222] Boskey AL, Gadaleta S, Gundberg C, Doty SB, Ducy P, Karsenty G. Fourier transform infrared microspectroscopic analysis of bones of osteocalcin-deficient mice provides insight into the function of osteocalcin. Bone 1998;23:187e96. [223] Desbois C, Hogue DA, Karsenty G. The mouse osteocalcin gene cluster contains three genes with two separate spatial and temporal patterns of expression. J Biol Chem 1994;269:1183e90. [224] Deyl Z, Vancikova C, Macek K. gamma-Carboxyglutamic acidcontaining protein of rat kidney cortex. Changes with high fat diet, and molecular parameters. Hoppe Seylers Z Physiol Chem 1980;361:1767e72. [225] Yu VC, Delsert C, Andersen B, et al. RXR beta: a coregulator that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their cognate response elements. Cell 1991;67:1251e66. [226] Morrison NA, Shine J, Fragonas JC, Verkest V, McMenemy ML, Eisman JA. 1,25-dihydroxyvitamin D-responsive element and glucocorticoid repression in the osteocalcin gene. Science 1989;246:1158e61. [227] Li YP, Stashenko P. Characterization of a tumor necrosis factorresponsive element which down-regulates the human osteocalcin gene. Mol Cell Biol 1993;13:3714e21. [228] Hoffmann HM, Catron KM, van Wijnen AJ, et al. Transcriptional control of the tissue-specific, developmentally regulated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins. Proc Natl Acad Sci USA 1994;91: 12887e91. [229] Poser JW, Esch FS, Ling NC, Price PA. Isolation and sequence of the vitamin K-dependent protein from human bone. Undercarboxylation of the first glutamic acid residue. J Biol Chem 1980;255:8685e91. [230] Hauschka PV, Lian JB, Cole DE, Gundberg CM. Osteocalcin and matrix Gla protein: vitamin K-dependent proteins in bone. Physiol Rev 1989;69:990e1047. [231] Hoang QQ, Sicheri F, Howard AJ, Yang DS. Bone recognition mechanism of porcine osteocalcin from crystal structure. Nature 2003;425:977e80. [232] Hauschka PV, Carr SA. Calcium-dependent alpha-helical structure in osteocalcin. Biochemistry 1982;21:2538e47. [233] Lee NK, Sowa H, Hinoi E, et al. Endocrine regulation of energy metabolism by the skeleton. Cell 2007;130:456e69. [234] Berkner KL. The vitamin K-dependent carboxylase. Annu Rev Nutr 2005;25:127e49. [235] Hinoi E, Gao N, Jung DY, et al. The sympathetic tone mediates leptin’s inhibition of insulin secretion by modulating osteocalcin bioactivity. J Cell Biol 2008;183:1235e42. [236] Fisher LW, Fedarko NS. Six genes expressed in bones and teeth encode the current members of the SIBLING family of proteins. Connect Tissue Res 2003;44:33e40. [237] Bellahcene A, Castronovo V, Ogbureke KU, Fisher LW, Fedarko NS. Small integrin-binding ligand N-linked glycoproteins (SIBLINGs): multifunctional proteins in cancer. Nat Rev Cancer 2008;8:212e26. [238] Hunter GK, O’Young J, Grohe B, Karttunen M, Goldberg HA. The flexible polyelectrolyte hypothesis of protein-biomineral interaction. Langmuir 2010;26:18639e46. [239] Kim RH, Shapiro HS, Li JJ, Wrana JL, Sodek J. Characterization of the human bone sialoprotein (BSP) gene and its promoter sequence. Matrix Biol 1994;14:31e40. [240] Heinegard D, Oldberg A. Structure and biology of cartilage and bone matrix noncollagenous macromolecules. Faseb J 1989;3: 2042e51. [241] Bianco P, Fisher LW, Young MF, Termine JD, Robey PG. Expression of bone sialoprotein (BSP) in developing human tissues. Calcif Tissue Int 1991;49:421e6.

PEDIATRIC BONE

REFERENCES

[242] Fisher LW, McBride OW, Termine JD, Young MF. Human bone sialoprotein. Deduced protein sequence and chromosomal localization. J Biol Chem 1990;265:2347e51. [243] Salih E. In vivo and in vitro phosphorylation regions of bone sialoprotein. Connect Tissue Res 2003;44:223e9. [244] Zaia J, Boynton R, Heinegard D, Barry F. Posttranslational modifications to human bone sialoprotein determined by mass spectrometry. Biochemistry 2001;40:12983e91. [245] Wuttke M, Muller S, Nitsche DP, Paulsson M, Hanisch FG, Maurer P. Structural characterization of human recombinant and bone-derived bone sialoprotein. Functional implications for cell attachment and hydroxyapatite binding. J Biol Chem 2001;276:36839e48. [246] Malaval L, Wade-Gueye NM, Boudiffa M, et al. Bone sialoprotein plays a functional role in bone formation and osteoclastogenesis. J Exp Med 2008;205:1145e53. [247] Boudiffa M, Wade-Gueye NM, Guignandon A, et al. Bone sialoprotein deficiency impairs osteoclastogenesis and mineral resorption in vitro. J Bone Miner Res 2010;25:2393e403. [248] Wade-Gueye NM, Boudiffa M, Laroche N, et al. Mice lacking bone sialoprotein (BSP) lose bone after ovariectomy and display skeletal site-specific response to intermittent PTH treatment. Endocrinology 2010;151:5103e13. [249] Malaval L, Monfoulet L, Fabre T, et al. Absence of bone sialoprotein (BSP) impairs cortical defect repair in mouse long bone. Bone 2009;45:853e61. [250] George A, Sabsay B, Simonian PA, Veis A. Characterization of a novel dentin matrix acidic phosphoprotein. Implications for induction of biomineralization. J Biol Chem 1993;268:12624e30. [251] MacDougall M, Gu TT, Luan X, Simmons D, Chen J. Identification of a novel isoform of mouse dentin matrix protein 1: spatial expression in mineralized tissues. J Bone Miner Res 1998;13:422e31. [252] Qin C, Brunn JC, Jones J, et al. A comparative study of sialic acid-rich proteins in rat bone and dentin. Eur J Oral Sci 2001;109: 133e41. [253] Hirst KL, Simmons D, Feng J, Aplin H, Dixon MJ, MacDougall M. Elucidation of the sequence and the genomic organization of the human dentin matrix acidic phosphoprotein 1 (DMP1) gene: exclusion of the locus from a causative role in the pathogenesis of dentinogenesis imperfecta type II. Genomics 1997;42:38e45. [254] Qin C, Brunn JC, Cook RG, et al. Evidence for the proteolytic processing of dentin matrix protein 1. Identification and characterization of processed fragments and cleavage sites. J Biol Chem 2003;278:34700e8. [255] Qin C, Baba O, Butler WT. Post-translational modifications of sibling proteins and their roles in osteogenesis and dentinogenesis. Crit Rev Oral Biol Med 2004;15:126e36. [256] Steiglitz BM, Ayala M, Narayanan K, George A, Greenspan DS. Bone morphogenetic protein-1/Tolloid-like proteinases process dentin matrix protein-1. J Biol Chem 2004;279:980e6. [257] Ling Y, Rios HF, Myers ER, Lu Y, Feng JQ, Boskey AL. DMP1 depletion decreases bone mineralization in vivo: an FTIR imaging analysis. J Bone Miner Res 2005;20:2169e77. [258] Feng JQ, Ward LM, Liu S, et al. Loss of DMP1 causes rickets and osteomalacia and identifies a role for osteocytes in mineral metabolism. Nat Genet 2006;38:1310e5. [259] Giachelli CM, Steitz S. Osteopontin: a versatile regulator of inflammation and biomineralization. Matrix Biol 2000;19: 615e22. [260] Oldberg A, Franzen A, Heinegard D. Cloning and sequence analysis of rat bone sialoprotein (osteopontin) cDNA reveals an Arg-Gly-Asp cell-binding sequence. Proc Natl Acad Sci USA 1986;83:8819e23.

35

[261] O’Brien ER, Garvin MR, Stewart DK, et al. Osteopontin is synthesized by macrophage, smooth muscle, and endothelial cells in primary and restenotic human coronary atherosclerotic plaques. Arterioscler Thromb 1994;14:1648e56. [262] Boskey AL, Maresca M, Ullrich W, Doty SB, Butler WT, Prince CW. Osteopontin-hydroxyapatite interactions in vitro: inhibition of hydroxyapatite formation and growth in a gelatingel. Bone Miner 1993;22:147e59. [263] Hunter GK, Kyle CL, Goldberg HA. Modulation of crystal formation by bone phosphoproteins: structural specificity of the osteopontin-mediated inhibition of hydroxyapatite formation. Biochem J 1994;300:723e8. [264] Addison WN, Azari F, Sorensen ES, Kaartinen MT, McKee MD. Pyrophosphate inhibits mineralization of osteoblast cultures by binding to mineral, up-regulating osteopontin, and inhibiting alkaline phosphatase activity. J Biol Chem 2007;282:15872e83. [265] Jono S, Peinado C, Giachelli CM. Phosphorylation of osteopontin is required for inhibition of vascular smooth muscle cell calcification. J Biol Chem 2000;275:20197e203. [266] Young MF, Kerr JM, Termine JD, et al. cDNA cloning, mRNA distribution and heterogeneity, chromosomal location, and RFLP analysis of human osteopontin (OPN). Genomics 1990;7: 491e502. [267] Hijiya N, Setoguchi M, Matsuura K, Higuchi Y, Akizuki S, Yamamoto S. Cloning and characterization of the human osteopontin gene and its promoter. Biochem J 1994;303:255e62. [268] Crosby AH, Lyu MS, Lin K, et al. Mapping of the human and mouse bone sialoprotein and osteopontin loci. Mamm Genome 1996;7:149e51. [269] Inoue M, Shinohara ML. Intracellular osteopontin (iOPN) and immunity. Immunol Res 2011;49:160e72. [270] Kaji H, Sugimoto T, Kanatani M, Fukase M, Kumegawa M, Chihara K. Retinoic acid induces osteoclast-like cell formation by directly acting on hemopoietic blast cells and stimulates osteopontin mRNA expression in isolated osteoclasts. Life Sci 1995;56:1903e13. [271] Kubota T, Zhang Q, Wrana JL, et al. Multiple forms of SppI (secreted phosphoprotein, osteopontin) synthesized by normal and transformed rat bone cell populations: regulation by TGFbeta. Biochem Biophys Res Commun 1989;162:1453e9. [272] Noda M, Rodan GA. Transcriptional regulation of osteopontin production in rat osteoblast-like cells by parathyroid hormone. J Cell Biol 1989;108:713e8. [273] Noda M, Rodan GA. Type beta transforming growth factor regulates expression of genes encoding bone matrix proteins. Connect Tissue Res 1989;21:71e5. [274] Prince CW, Butler WT. 1,25-Dihydroxyvitamin D3 regulates the biosynthesis of osteopontin, a bone-derived cell attachment protein, in clonal osteoblast-like osteosarcoma cells. Coll Relat Res 1987;7:305e13. [275] Shioide M, Noda M. Endothelin modulates osteopontin and osteocalcin messenger ribonucleic acid expression in rat osteoblastic osteosarcoma cells. J Cell Biochem 1993;53:176e80. [276] Mark MP, Butler WT, Prince CW, Finkelman RD, Ruch JV. Developmental expression of 44-kDa bone phosphoprotein (osteopontin) and bone gamma-carboxyglutamic acid (Gla)containing protein (osteocalcin) in calcifying tissues of rat. Differentiation 1988;37:123e36. [277] Chen J, Singh K, Mukherjee BB, Sodek J. Developmental expression of osteopontin (OPN) mRNA in rat tissues: evidence for a role for OPN in bone formation and resorption. Matrix 1993;13:113e23. [278] Chen J, Zhang Q, McCulloch CA, Sodek J. Immunohistochemical localization of bone sialoprotein in foetal porcine bone tissues: comparisons with secreted phosphoprotein 1 (SPP-1,

PEDIATRIC BONE

36

[279]

[280]

[281]

[282]

[283] [284]

[285]

[286]

[287]

[288]

[289]

[290]

[291] [292]

[293]

[294]

[295] [296]

[297]

2. BONE MATRIX AND MINERALIZATION

osteopontin) and SPARC (osteonectin). Histochem J 1991;23: 281e9. Kiefer MC, Bauer DM, Barr PJ. The cDNA and derived amino acid sequence for human osteopontin. Nucleic Acids Res 1989;17:3306. Christensen B, Nielsen MS, Haselmann KF, Petersen TE, Sorensen ES. Post-translationally modified residues of native human osteopontin are located in clusters: identification of 36 phosphorylation and five O-glycosylation sites and their biological implications. Biochem J 2005;390:285e92. Lasa M, Chang PL, Prince CW, Pinna LA. Phosphorylation of osteopontin by Golgi apparatus casein kinase. Biochem Biophys Res Commun 1997;240:602e5. Prince CW, Oosawa T, Butler WT, et al. Isolation, characterization, and biosynthesis of a phosphorylated glycoprotein from rat bone. J Biol Chem 1987;262:2900e7. Neame PJ, Butler WT. Posttranslational modification in rat bone osteopontin. Connect Tissue Res 1996;35:145e50. Keykhosravani M, Doherty-Kirby A, Zhang C, et al. Comprehensive identification of post-translational modifications of rat bone osteopontin by mass spectrometry. Biochemistry 2005;44: 6990e7003. Safran JB, Butler WT, Farach-Carson MC. Modulation of osteopontin post-translational state by 1,25-(OH)2-vitamin D3. Dependence on Ca2þ influx. J Biol Chem 1998;273:29935e41. Mazzali M, Kipari T, Ophascharoensuk V, Wesson JA, Johnson R, Hughes J. Osteopontin e a molecule for all seasons. Q J Med 2002;95:3e13. Liaw L, Lindner V, Schwartz SM, Chambers AF, Giachelli CM. Osteopontin and beta 3 integrin are coordinately expressed in regenerating endothelium in vivo and stimulate Arg-Gly-Aspdependent endothelial migration in vitro. Circ Res 1995;77: 665e72. Liaw L, Skinner MP, Raines EW, et al. The adhesive and migratory effects of osteopontin are mediated via distinct cell surface integrins. Role of alpha v beta 3 in smooth muscle cell migration to osteopontin in vitro. J Clin Invest 1995;95:713e24. Smith LL, Cheung HK, Ling LE, et al. Osteopontin N-terminal domain contains a cryptic adhesive sequence recognized by alpha9beta1 integrin. J Biol Chem 1996;271:28485e91. Weber GF, Ashkar S, Glimcher MJ, Cantor H. Receptor-ligand interaction between CD44 and osteopontin (Eta-1). Science 1996;271:509e12. Sodek J, Chen J, Nagata T, et al. Regulation of osteopontin expression in osteoblasts. Ann NY Acad Sci 1995;760:223e41. Prince CW, Dickie D, Krumdieck CL. Osteopontin, a substrate for transglutaminase and factor XIII activity. Biochem Biophys Res Commun 1991;177:1205e10. Sorensen ES, Rasmussen LK, Moller L, Jensen PH, Hojrup P, Petersen TE. Localization of transglutaminase-reactive glutamine residues in bovine osteopontin. Biochem J 1994;304:13e6. Kaartinen MT, El-Maadawy S, Rasanen NH, McKee MD. Tissue transglutaminase and its substrates in bone. J Bone Miner Res 2002;17:2161e73. Nurminskaya M, Kaartinen MT. Transglutaminases in mineralized tissues. Front Biosci 2006;11:1591e606. Rittling SR, Matsumoto HN, McKee MD, et al. Mice lacking osteopontin show normal development and bone structure but display altered osteoclast formation in vitro. J Bone Miner Res 1998;13:1101e11. Yoshitake H, Rittling SR, Denhardt DT, Noda M. Osteopontindeficient mice are resistant to ovariectomy-induced bone resorption. Proc Natl Acad Sci USA 1999;96:8156e60.

[298] Rowe PS, de Zoysa PA, Dong R, et al. MEPE, a new gene expressed in bone marrow and tumors causing osteomalacia. Genomics 2000;67:54e68. [299] Gowen LC, Petersen DN, Mansolf AL, et al. Targeted disruption of the osteoblast/osteocyte factor 45 gene (OF45) results in increased bone formation and bone mass. J Biol Chem 2003;278: 1998e2007. [300] Addison WN, Nakano Y, Loisel T, Crine P, McKee MD. MEPEASARM peptides control extracellular matrix mineralization by binding to hydroxyapatite: an inhibition regulated by PHEX cleavage of ASARM. J Bone Miner Res 2008;23:1638e49. [301] Boskey AL, Chiang P, Fermanis A, et al. MEPE’s diverse effects on mineralization. Calcif Tissue Int 2010;86:42e6. [302] Martin A, David V, Laurence JS, et al. Degradation of MEPE, DMP1, and release of SIBLING ASARM-peptides (minhibins): ASARM-peptide(s) are directly responsible for defective mineralization in HYP. Endocrinology 2008;149:1757e72. [303] David V, Martin A, Hedge AM, Drezner MK, Rowe PS. ASARM peptides: PHEX-dependent and -independent regulation of serum phosphate. Am J Physiol Renal Physiol 2011;300: F783e91. [304] Drezner MK. PHEX gene and hypophosphatemia. Kidney Int 2000;57:9e18. [305] Su X, Sun K, Cui FZ, Landis WJ. Organization of apatite crystals in human woven bone. Bone 2003;32:150e62. [306] Rubin MA, Jasiuk I, Taylor J, Rubin J, Ganey T, Apkarian RP. TEM analysis of the nanostructure of normal and osteoporotic human trabecular bone. Bone 2003;33:270e82. [307] Russell RG, Fleisch H. Pyrophosphate and diphosphonates in skeletal metabolism. Physiological, clinical and therapeutic aspects. Clin Orthop Relat Res 1975;108:241e63. [308] Millan JL. Alkaline phosphatases: structure, substrate specificity and functional relatedness to other members of a large superfamily of enzymes. Purinergic Signal 2006;2:335e41. [309] Narisawa S, Frohlander N, Millan JL. Inactivation of two mouse alkaline phosphatase genes and establishment of a model of infantile hypophosphatasia. Dev Dyn 1997;208:432e46. [310] Gurley KA, Chen H, Guenther C, et al. Mineral formation in joints caused by complete or joint-specific loss of ANK function. J Bone Miner Res 2006;21:1238e47. [311] Hessle L, Johnson KA, Anderson HC, et al. Tissue-nonspecific alkaline phosphatase and plasma cell membrane glycoprotein-1 are central antagonistic regulators of bone mineralization. Proc Natl Acad Sci USA 2002;99:9445e9. [312] Murshed M, Harmey D, Millan JL, McKee MD, Karsenty G. Unique coexpression in osteoblasts of broadly expressed genes accounts for the spatial restriction of ECM mineralization to bone. Genes Dev 2005;19:1093e104. [313] Whyte MP. Physiological role of alkaline phosphatase explored in hypophosphatasia. Ann NY Acad Sci. 2010;1192:190e200. [314] Quarles LD. Endocrine functions of bone in mineral metabolism regulation. J Clin Invest 2008;118:3820e8. [315] Murshed M, McKee MD. Molecular determinants of extracellular matrix mineralization in bone and blood vessels. Curr Opin Nephrol Hypertens 2010;19:359e65. [316] Anderson HC. Matrix vesicles and calcification. Curr Rheumatol Rep 2003;5:222e6. [317] Roberts S, Narisawa S, Harmey D, Millan JL, Farquharson C. Functional involvement of PHOSPHO1 in matrix vesicle-mediated skeletal mineralization. J Bone Miner Res 2007;22:617e27. [318] Kawasaki K, Weiss KM. Evolutionary genetics of vertebrate tissue mineralization: the origin and evolution of the secretory calcium-binding phosphoprotein family. J Exp Zool B Mol Dev Evol 2006;306:295e316.

PEDIATRIC BONE

REFERENCES

[319] Roschger P, Paschalis EP, Fratzl P, Klaushofer K. Bone mineralization density distribution in health and disease. Bone 2008;42:456e66. [320] Bresler D, Bruder J, Mohnike K, Fraser WD, Rowe PS. Serum MEPE-ASARM-peptides are elevated in X-linked rickets (HYP): implications for phosphaturia and rickets. J Endocrinol 2004;183:R1e9. [321] Addison WN, Masica DL, Gray JJ, McKee MD. Phosphorylation-dependent inhibition of mineralization by osteopontin

37

ASARM peptides is regulated by PHEX cleavage. J Bone Miner Res 2010;25:695e705. [322] Pampena DA, Robertson KA, Litvinova O, Lajoie G, Goldberg HA, Hunter GK. Inhibition of hydroxyapatite formation by osteopontin phosphopeptides. Biochem J 2004;378: 1083e7. [323] Addison WN, McKee MD. ASARM mineralization hypothesis: a bridge to progress. J Bone Miner Res. 2010;25: 1191e2.

PEDIATRIC BONE

C H A P T E R

3

Prenatal Bone Development Fanxin Long Department of Medicine, Department of Developmental Biology, Washington University School of Medicine, Washington University in St Louis, Missouri, USA

Intramembranous Ossification

Proper formation of the skeleton requires precise control of both skeletal patterning and skeletal cell differentiation. Skeletal patterning usually refers to the specification of position, number, and shape of the skeletal elements, parameters believed to be determined before the appearance of skeletal cell types. This very important aspect was dealt with extensively in the previous edition of this chapter by St.-Jacques and Helms, but will not be discussed here. Instead, this update will focus on the more recent findings, especially those from mouse genetic studies, regarding the molecules that control the formation of chondrocytes and osteoblasts. Before this discussion, however, the chapter will briefly reiterate the different modes and the time line of bone formation in the human embryo, largely based on the previous edition of the chapter by St.-Jacques and Helms.

Intramembranous ossification begins toward the end of the second month of gestation in humans. The process has been most extensively studied in the developing cranium, where it is often preceded by a cellular proliferation at specific sites in the mesenchyme, and becomes histologically evident when a cluster of pale-staining stellate cells aggregate and take on a rounded basophilic appearance [3]. The aggregated mesenchymal cells gradually differentiate into mature secretory osteoblasts that actively produce the collagen I-rich extracellular matrix that is characteristic of bone. This differentiation process occurs in a small number of sites within the territory of each intramembranous bone, and these sites are called ossification centers. It is important to note that, although the initial condensation occurs in an avascular milieu, the differentiation of osteoblasts and the onset of mineralization are intimately related to blood vessel invasion, first in the surrounding mesenchyme and ultimately in the bone rudiment [4]. The inital bone tissue (spicule) is irregularly shaped and completely surrounded by the osteoblasts that secreted it. Some of the osteoblasts soon become encased in the matrix and become known as osteocytes. Each osteocyte is enclosed in its own lacuna but extends projections through small channels called canaliculi to maintain contact with neighboring osteocytes and intercellular fluids outside of the ossification center. Less differentiated osteoprogenitor cells present at the periphery proliferate and eventually differentiate into new osteoblasts, which continue to add bone to form a well-defined longer structure called a trabecula (beam). Multiple trabeculae soon connect and form a scaffolding characteristic of cancellous (or spongy) bone [3]. The first bone formed in the embryo is of an immature type, displaying relatively high cellularity and an almost random orientation of collagen fibers [5]. At approximately the time of birth,

MODES OF BONE FORMATION Most skeletal elements of modern vertebrates can be traced to the endoskeleton (skeleton formed inside the body) found in primitive vertebrates [1]. Vestiges of the exoskeleton (skeleton formed outside the body), however, are present in the skull and pectoral girdle. Although such exoskeletal derivatives have become thoroughly integrated with elements of the endoskeleton, they still form differently from the endoskeleton during embryogenesis. These bones, termed dermal because of their historical association with the skin, form by direct differentiation of mesenchymal cells into osteoblasts through intramembranous ossification. On the other hand, bones derived from the primitive endoskeleton develop first into cartilage templates but are subsequently replaced by bone through endochondral ossification [2].

Pediatric Bone, Second Edition DOI: 10.1016/B978-0-12-382040-2.10003-6

39

Copyright Ó 2012 Elsevier Inc. All rights reserved.

40

3. PRENATAL BONE DEVELOPMENT

this woven bone is gradually replaced by the more mature lamellar bone characterized by successive layers of uniformly oriented collagen fibers.

Endochondral Ossification This process also initiates with the aggregation of undifferentiated mesenchymal cells to form condensations (Fig. 3.1). However, unlike in intramembranous ossification, cellular proliferation does not appear to play an important part in this process, as these condensations are the result of an increase in cell packing mediated by changes in the extracellular matrix and cellecell adhesion molecules [6]. By their positions, shapes, and sizes, these prechondrogenic condensations prefigure the different skeletal elements [7]. As in intramembranous ossification, the initial condensation forms in an avascular environment, but here it remains avascular. In the core of these condensations, cells differentiate into chondrocytes that secrete a cartilage matrix characterized by the presence of types II, IX, and XI collagen and specific proteoglycans such as aggrecan. At the periphery of the condensation, cells surrounding the cartilage core flatten and form a thin membrane of stacked cells called the perichondrium, which insulates the cartilage from the surrounding mesenchyme [8]. Perichondrial cells retain chondrogenic potential and probably contribute to the radial expansion of the cartilage by appositional growth. Initially, the chondrocytes and perichondrial cells proliferate rapidly, and this proliferation together with the deposition of new matrix drives the growth of the elements. At a certain stage specific for each element, chondrocytes in the center E10.5

E12.5

E14.5

E15.5 – 18.5

FIGURE 3.1 Endochondral bone formation. Time line is based on mouse embryonic days, and the events are depicted for the tibia. The timing of events may differ in other skeletal elements. Cartilage initially develops from mesenchymal condensation within an avascular environment. Vascularization occurs following the hypertrophy of cartilage. (Courtesy of Dr Matthew Hilton.)

undergo progressive maturation. They acquire a flattened appearance and become organized in columns along the longitudinal axis of the developing skeletal element. Columns are separated by relatively thick lateral partitions of extracellular matrix, the longitudinal septa, whereas chondrocytes within a column are separated by thin transverse septa. Further maturation of these cells leads to hypertrophy characterized by cell enlargement, cessation of proliferation, and secretion of a distinct extracellular matrix rich in type X collagen that becomes progressively calcified [9]. These changes are accompanied by vascular invasion of the hypertrophic cartilage, and by differentiation of the inner perichondrium cells into osteoblasts, which secrete a layer of primary bone to form the bone collar [8]. At this stage, the thin layer of tissue covering the newly formed bone becomes known as the periosteum and continues to supply osteoblasts that produce the bone matrix of the diaphysis. Changes in the composition and properties of the cartilage matrix in the hypertrophic zone, including calcification of the longitudinal septa and the release of angiogenic factors, trigger its invasion by capillaries [10]. This results in the death of the terminally differentiated hypertrophic chondrocytes and degradation of the uncalcified transverse cartilage septa by invading “chondroclasts”, a cell type of ill-defined origin associated with the invading capillary sprouts. The invading blood vessels are believed to carry in osteoprogenitors that eventually differentiate into osteoblasts. Remnants of the calcified longitudinal septa act as templates on which the osteoblasts secrete bone matrix and establish the primary ossification center. Osteoclasts, which are bone-resorbing cells of hematopoietic origin, also appear within the ossifcation center, contributing to the formation of the marrow cavity. The synchronous maturation and columnar organization of the chondrocytes result in a characteristic histological structure known as the embryonic growth plate in which zones of proliferation, maturation, hypertrophy, and bone formation can be identified, linearly progressing from the articular ends (epiphysis) towards the midshaft (diaphysis) of the element. Continued proliferation of the less mature chondrocytes at the epiphysis, followed by their hypertrophy and their eventual replacement by trabecular bone near the diaphysis results in a distal displacement of the growth plate and longitudinal growth of the skeletal element. In a typical long bone, this growth is accompanied by resorption of the older trabeculae by osteoclasts, thus leaving significant trabecular bone only at the region immediately adjacent to the growth plate (metaphysis). Continued deposition of cortical bone by the periosteum (subperiosteal bone) leads to radial growth. Eventually, a secondary ossification center forms at the center of the epiphysis distal to the growth plate, from which

PEDIATRIC BONE

MOLECULAR REGULATION OF SKELETAL DEVELOPMENT

ossification proceeds radially in all directions. Formation of the secondary ossification center does not modify the general organization of the growth plate, which remains active until cessation of growth after puberty. In the long bones of humans, the growth plate eventually disappears with the only cartilage remaining at the articular surface. As in intramembranous ossification, the first bone tissue produced in the trabeculae and the diaphysis of the long bones is of a woven type. Remodeling of this immature bone following its resorption by osteoclasts leads progressively to replacement by mature lamellar bone.

TIMING AND SEQUENCE OF BONE FORMATION IN HUMANS All skeletal elements do not form simultaneously in the embryo. Generally, chondrification (cartilage formation) proceeds in a rostralecaudal (head-to-tail) fashion in the axial skeleton and in a proximaledistal (shoulderto-fingertip) fashion in the limb skeleton. This is a direct consequence of the developmental origin of the different elements from the progressively forming somites and the outwardly elongating limb buds, respectively. The chondrification sequence is rapid, and early in the seventh gestational week the cartilage primordia of all the elements of the axial and appendicular skeleton are present [11]. In the cephalic region, cartilage formation proceeds in a caudal-to-rostral direction. It starts at the beginning of week 7 and continues well into week 8 [12]. Thus, the appearance of the cartilage primordia of the skull base occurs after that of most axial and appendicular elements, but it precedes ossification of the membranous bones of the skull vault. Almost all primary ossification centers appear between weeks 7 and 12 of embryonic life in humans. In contrast, the secondary ossification centers such as those in the epiphyses appear over a long period, from late fetal life until puberty. The clavicle is the first bone in the body to ossify, with the mandible and maxilla following almost immediately. Generally, the facial and calvarial centers appear before the basicranial centers, followed by the hyoid centers [13]. More than 100 centers of ossification appear during human skull formation, but extensive fusion takes place between many of them, reducing the number to 45 by the time of birth [14]. In the axial skeleton, the costal centers appear first, followed by the primary vertebral centers and the sternal centers. The second to 11th rib centers appear at approximately the same time. The centers in the first and 12th ribs appear later in that order. The vertebrae ossify from three primary centers, one for the body and one for each neural arch. In the spine, as in the

41

thoracic cage, the sequence is not strictly cephalocaudal because ossification of the vertebral body starts first in the lower thoracic and upper lumbar regions and propagates in both directions from this area. Some delay is observed before the first cervical and the last two sacral centers appear. Ossification centers in the neural arches appear in a cephalocaudal sequence except in the atlas and axis, in which ossification is slightly delayed [13]. The sternum arises as a pair of cartilaginous bands that fuse along the midline as the ventral body wall develops. This fused cartilage precursor subsequently subdivides into craniocaudal elements, most of which will fuse again and will ossify after the fifth month to form the body of the sternum [15]. The primary ossification centers of the pectoral girdle appear before those of the pelvis in the following order: clavicle, scapula, ilium, ischium, and pubis. The centers in the humerus, femur, and then radius, ulna, and tibia appear at approximately the same time. The fibula differentiates slightly later. The bones of the hand invariably appear before their counterparts in the foot. These differ in that centers in the distal phalanges of the hand appear before those of the metacarpals, whereas the distal phalanges centers of the foot appear after the metatarsal centers [13]. The proximal and middle phalanges ossify last. Of the tarsal and carpal bones, only the talus and calcaneous generally begin to ossify before birth, with the cuboid sometimes and the lateral cuneiform rarely ossifying before birth [3].

MOLECULAR REGULATION OF SKELETAL DEVELOPMENT EpithelialeMesenchymal Interaction The requirement for an early tissue interaction to induce mesenchymal condensation is best demonstrated by tissue dissociationerecombination experiments with craniofacial tissues. Embryonic mandibular mesenchyme can be separated from the mandibular epithelium and cultured in vitro. Mesenchyme isolated before migration or at an early stage after migration of mesenchymal cells to the final site of bone formation fails to form bone in culture. However, if early mesenchyme is combined in vitro with mandibular epithelium or if mesenchyme is isolated at a late stage, then osteogenesis takes place, indicating a requirement for epithelialemesenchymal contact [16]. The signal from the epithelium appears to be permissive in nature. First, mandibular mesenchyme forms bone in culture when recombined with epithelia from other regions of the embryo as well, provided that they are of the correct age. Furthermore, the shape of the bone

PEDIATRIC BONE

42

3. PRENATAL BONE DEVELOPMENT

produced is independent of the source of epithelium but is dictated by the nature of the mesenchyme [16]. Finally, an epithelium such as the mandibular is incapable of inducing bone formation in a mesenchyme that is normally non-osteogenic. Such interactions have been studied in detail mostly in craniofacial structures and have been shown to be essential to induce formation of scierai ossicles and scierai cartilage, mandible and Meckel’s cartilage, maxilla, palatine bone, otic vesicle, and calvarial bones, and also clavicle and limb cartilage [17,18]. The molecular nature of the epithelial signal(s) is unclear but probably involves in many cases the bone morphogenic proteins (BMPs), which form a subfamily of secreted proteins among the TGF-b superfamily. Members of this group are characterized by a conserved C-terminal domain with several cysteine residues and undergo cellular processing by cleavage of an inactivating N-terminal domain. They act as dimers to bind a type II transmembrane receptor and induce recruitment and phosphorylation of the cytoplasmic tail of one of the type I receptors. Phosphorylation of the type I receptor initiates signal transduction through various pathways, including the SMAD family of intracellular signaling molecules. At least 20 different BMPs and the related growth and differentiation factors (GDFs) have been identified in vertebrates [19]. Members of this family of growth factors were first identified as proteins present in demineralized bone matrix, which has the remarkable capacity to induce ectopic bone formation in subcutaneous implants [20,21]. Purified recombinant BMPs share this capacity and are able to potentiate chondrocyte and osteoblast differentiation of cells in vitro [22]. Consequently, BMPs have long been considered in vivo “bone inducers”. However, BMPs induce ectopic bone by recapitulating the events occurring during endochondral bone formation [23], and therefore may not act by inducing ossification (production of bone matrix) per se. Instead, the bone-forming ability of BMPs probably reflects their role in the induction of mesenchymal condensations [24]. Several BMPs known to have cartilage/boneinducing potential accumulate in the extracellular material (ECM), including epithelial basal lamina [25,26]. In the case of the mandible, an epithelialemesenchymal interaction involving BMP signaling has been documented. BMPs-2, -4, and -7 are found in the distal mandibular epithelium whereas the homeobox-containing transcription factor Msx1 is present in the mandibular mesenchyme. Msx1 function in the mesenchyme was demonstrated by Msx1 knockout mice, which exhibited mandibular defects [27]. Expression of Msx1 requires mandibular epithelium [28] and can be induced by ectopic BMPs [29], thus implicating these molecules

in the early epithelialemesenchymal required for mandible formation.

interaction

Condensation Skeletal condensations have been studied most intensely in the developing limb in vivo and by means of micromass cultures of limb mesenchyme in vitro. The condensation stage is a very transient phase, rapidly followed by differentiation of the aggregated cells. At the histological level, it is characterized by a significant increase in cell-packing density in specific areas of the mesenchyme. Cells of the precartilaginous condensations can be visualized by their affinity for the lectin peanut agglutinin (PNA) and their transient upregulation of a number of markers, including versican, tenascin, syndecan, N-CAM, N-cadherin, thrombospondin-4, type I collagen, and heparan and chondroitin sulfate proteoglycans [30]. Cell proliferation plays a role in condensation of the calvarial, scierai, and mandibular primordia but not in the precartilaginous condensations of the limb, where cell movements appear to be more important [7]. Regardless of the mechanism, the high cell density generated in the condensations leads to increased cellecell contact as well as the formation of gap junctions facilitating intercellular communication [31,32]. These appear to be essential for differentiation to take place, and the extent of cellular condensation correlates with the level of subsequent chondrogenesis [33]. Two cell adhesion molecules implicated in the condensation process are N-cadherin and N-CAM. Ncadherin belongs to a group of calcium-dependent transmembrane glycoproteins that mediate cellecell adhesion by homotypic interactions through their extracellular domains. The protein cytoplasmic domain interacts with the actin cytoskeleton via the catenin molecules. N-CAM is a member of the large immunoglobulin superfamily of membrane glycoproteins and also mediates cellecell adhesion via homotypic interactions but in a calcium-independent manner. These molecules are expressed at high levels in condensing mesenchyme but disappear in differentiating cartilage and can be detected later only in the perichondrium. Much evidence shows that perturbing the functions of N-cadherin and N-CAM causes reduction or alteration of chondrogenesis both in vitro and in vivo [33]. Conversely, overexpression of N-cadherin and N-CAM in micromass cultures stimulates chondrogenesis [34,35]. Cellecell adhesion in the digit condensations was also shown to depend on Epheephrins interactions. The Eph receptors belong to the family of receptor tyrosine kinases. They are characterized by a unique cysteine-rich motif in their extracellular domain, followed by two fibronectin type III motifs. They interact with a family of at least eight ephrin ligands associated

PEDIATRIC BONE

MOLECULAR REGULATION OF SKELETAL DEVELOPMENT

with the cell membranes via a transmembrane domain or a GPI anchor [36]. EphrineEph signaling has been implicated in the sorting and adhesion of mesenchymal cells in both mouse and chicken [37e39]. Interestingly, in Hoxa13 mutant mice, expression of EphA7 was reduced in mesenchymal condensations correlating with altered adhesiveness, poorly resolved condensations, and defective chondrogenesis [38], whereas misexpression of Hoxd11 or Hoxa13 in the developing chick limb affected condensation size and cell adhesiveness [40,41]. Thus, Hox transcription factors may control skeletal patterning via the regulation of ephrineEph signaling, at the condensation stage. Interactions between cells and the ECM also significantly affect condensation. Prior to condensation, mesenchymal cells secrete an ECM rich in hyaluronan (HA) that facilitates cell movement but prevents close cellecell interactions. As condensation begins, a transient increase in hyaluronidase activity leads to controlled hydrolysis of HA and reduced intercellular space, thus favoring cellecell interactions [42,43]. Condensation also coincides with upregulation of a number of ECM proteins, including type I collagen, fibronectin, and various proteoglycans [33]. Syndecan-3 is an integral membrane protein that is also a heparan sulfate proteoglycan that interacts with ECM components and heparin-binding growth factors [44]. It is transiently expressed at high levels during formation of the precartilage condensations and downregulated (except in the perichondrium) after chondrocyte differentiation. Antibodies against syndecan-3 impair the formation of precartilaginous condensations in micromass cultures of chick limb mesenchyme [45]. Fibronectin is a dimeric proteoglycan present in the ECM of many tissues and plays an important role in cell migration and differentiation. Fibronectin interaction with the cellular integrin receptors can activate signaling through the focal adhesion kinase and the integrin-linked kinase pathways. Prior to condensation, fibronection is distributed throughout the intercellular space of the mesenchyme, but it accumulates in the condensations and reaches its maximal level of expression just prior to overt chondrogenesis [46]. Interaction between extracellular fibronectin and heparin-like molecules of the mesenchymal cell surface is crucial for the formation of precartilage condensations [47,48]. Antibodies specific to a certain isoform of fibronectin also perturbed chondrogenesis [49]. Expression of the aforementioned cellecell and cellematrix adhesion molecules is modulated by signaling factors. For instance, treatment of pluripotential cells or limb bud mesenchyme with TGF-b stimulated expression of fibronectin, N-CAM, N-cadherin, and tenascin [50,51]. Exposure of limb bud mesenchymal cells to certain BMPs also correlated with an increase in N-cadherin and N-CAM expression and

43

stimulates chondrogenesis [33]. Functionally, BMP/ GDF gain-of-function experiments in chick [52,53] and mouse embryos [54,55] led to hyperplasia and, in some cases, fusion of limb cartilage elements. Conversely, broad repression of BMP signaling inhibited cartilage development [54,56]. The important role of BMP signaling in chondrogenesis has been further demonstrated by genetic experiments in the mouse. Earlier gene deletion studies of BMPs in the mouse have been complicated by either early lethality or functional redundancy among the family members. For instance, null mutations in Bmp-2 or -4, as well as in the BMP receptor type 1A gene (Bmp-r1A), lead to early embryonic lethality [57e59], whereas mice null for Bmp-3 or Bmp-3b (also known as Gdf10) display no obvious embryonic phenotype in the skeleton [60,61]. However, by using the Cre-loxP technology, simultaneous deletion of Bmp2 and Bmp4 in the prechondrogenic limb mesenchyme with Prx1-Cre led to the failure of the formation of certain chondrogenic condensations [62]. These results indicate that a threshold of Bmp signaling is necessary for chondrogenesis. The fact that all chondrogenic condensations were not equally affected by the loss of Bmp2 and Bmp4 suggests that the less affected skeletal element may require a different set of Bmp family members. As in the mouse, mutations affecting BMP signaling in humans also lead to defects in skeletal elements. For instance, mutations in GDF5 have been found to cause brachypodism (bp) in the mouse, and HuntereThompson acromesomelic dysplasia as well as Grebe syndrome in humans [63]. Moreover, mutations in the gene encoding the BMP antagonist Noggin (NOG) also cause two autosomal dominant disorders e proximal symphalangism (SYM1) and multiple synostose syndrome (SYNS1), both characterized by multiple joint fusions [64]. Although the precise function of BMP signaling during mesenchymal condensation remains to be fully elucidated, studies have suggested that BMP/GDF signaling controls recruitment of cells into the early condensations [52,55]. Consistent with this view, genetic deletion of noggin, an extracellular antagonist of BMP proteins, resulted in enlarged cartilage elements and the lack of joints in the mouse [65]. Analyses of chondrogenesis in micromass cultures of limb bud mesenchyme established that BMP signaling is indeed required for formation of prechondrogenic condensations but also for differentiation of mesenchymal cells into chondrocytes [66,67]. More recently, by using an imaging system that dynamically visualizes limb mesenchymal cells undergoing successive phases of cartilage formation in vitro, Barna and Niswander found that BMP signaling was required for the “compaction” event that coalesces the small cellular aggregates into a round cluster of tightly associated cells with a distinct outer boundary,

PEDIATRIC BONE

44

3. PRENATAL BONE DEVELOPMENT

a prerequisite for chondrogenic differentiation [68]. Importantly, the compaction event appeared to be independent of Sox9 function, as Sox9-null cells exhibited no defect up to this point, although they subsequently became segregated from the chondrogenic mesenchymal condensations and adopted a “fibroblastoid” morphology distinct from the round morphology typical of the cells that remained within the condensation. Thus, BMP signaling appears to play a critical role in the formation of mesenchymal condensation before Sox9 becomes important. The molecular nature for this early requirement of BMP however, is not known at present. Interactions of the mesenchymal cells with other cell types also affect condensation. For instance, in the developing limb, there is an inverse relationship between condensations and blood vessel distribution. Vessels are initially present throughout the limb mesenchyme but undergo local regression from sites at which precartilaginous condensations will form shortly thereafter. It was shown that this vascular regression is essential for the condensation step and subsequent chondrogenesis in the developing limb of chick embryos, although the molecular mechanism was unclear. Interestingly, a more recent study showed that the chondrogenic primordia played a role in patterning the limb vasculature through the expression of vascular endothelial growth factor (VEGF) [69]. Thus, early chondrogenic events may trigger the vascular regression, which may in turn reinforce chondrogenesis.

Chondrocyte Differentiation The overt differentiation of condensed mesenchymal cells into chondrocytes is characterized by a shift in production of ECM and adhesion molecules. Whereas N-CAM, N-cadherin, and type I collagen are downregulated, collagen types II, IX, and XI, as well as the large proteoglycan aggrecan, are upregulated. Sox9, an HMG domain DNA-binding protein, is a key transcription factor regulating chondrocyte differentiation. Mutations in this gene cause the rare and severe dwarfism campomelic dysplasia in humans [70]. During embryogenesis, Sox9 is expressed in all prechondrogenic condensations, where it precedes the expression of the Col2a1 gene, which encodes the major cartilage matrix protein type II collagen. Because Sox9þ/ males were sterile, the function of Sox9 in chondrogenesis was initially studied by analyzing the fate of Sox9/ ES cells in chimeric mouse embryos. It was shown that the mutant cells were excluded from prechondrogenic condensations and failed to express any chondrocytespecific markers [71]. Interestingly, a more recent study, by applying live imaging techniques to limb mesenchymal condensations in vitro, demonstrated that the Sox9/ cells participated in the initial mesenchymal

condensations normally, but later segregated from the prechondrogenic clusters [68]. Tissue-specific knockout of Sox9 by the Cre-loxP technology confirmed that Sox9 is indispensable for chondrogenesis [72]. Sox9 likely performs multiple functions during chondrocyte development. Live imaging of mesenchymal condensation in vitro with Sox9/ cells indicated that Sox9 was required not for the initial mesenchymal condensation, but rather performed a subsequent role in maintaining the round morphology typical of the prechondrogenic cells [68]. Because Col2a1, one of the best known target genes of Sox9, was not yet activated in a majority of the prechondrogenic cells, the function of Sox9 at this stage was likely to be independent of type II collagen. Thus, in addition to activating chondrocyte-specific genes, Sox9 appears to play an earlier role that remains to be elucidated. Two other members of the Sox family, L-Sox5 and Sox6, interact with the same sequences and together with Sox9 activate transcription of the Col2a1 and aggrecan genes. L-Sox5 and Sox6 have partly redundant functions and single mutants displayed limited skeletal abnormalities, but the Sox5/Sox6 double mutants showed severe generalized chondrodysplasia characterized by poor differentiation of chondrocytes [73]. Thus, L-Sox5 and Sox6 are potent enhancers of chondrocyte differentiation. In addition to its role in mesenchymal condensation as discussed above, BMP signaling also stimulates chondrocyte differentiation after the condensation stage. BMPs transduce signals by binding to complexes of type I and II serine/threonine kinase receptors. In the most extensively studied mechanism, known as the “canonical” pathway, ligand binding induces phosphorylation of the receptors which, in turn, phosphorylates and activates receptor Smads (R-Smads) 1, 5 and 8 [74]. The activated R-Smads then complex with Smad4 to enter the nucleus, eventually regulating gene expression. Simultaneous deletion of the type I receptors Bmpr1a and Bmpr1b in the chondrogenic lineage with Col2-Cre resulted in a severe form of general chondrodysplasia where a majority of the cartilage promodia that prefigure the endochondral bones were absent [75]. Moreover, simultaneous removal of Smad1 and Smad5 in chondrogenic cells, regardless the status of Smad8, essentially abolished cartilage formation [76]. These findings therefore establish that canonical BMP signaling through R-Smads is indispensable for the formation of cartilage following the activation of the Col2a1 gene. Interestingly, deletion of Smad4, the binding partner for Smad1, 5 or 8, with a similar Col2Cre line, did not severely affect cartilage formation [77]. The discrepancy between the R-Smad- and Smad4-deficient mice raises the possibility that BMPSmad1/5/8 signaling may control cartilage development in a Smad4-independent manner. Indeed, BMPs

PEDIATRIC BONE

MOLECULAR REGULATION OF SKELETAL DEVELOPMENT

were shown to induce R-Smad nuclear localization in Smad4-null colon cancer cells [78], but whether this occurs during cartilage development is currently unknown. In contrast to BMP, some members of the Wnt family inhibit chondrocyte differentiation. The Wnt genes encode a large family (19 members in mouse and humans) of cysteine-rich secreted glycoproteins sharing homology with the Drosophila signaling factor wingless. Wnt proteins control morphogenesis and tissue patterning in a wide variety of organs [79]. Depending on the cell context, Wnt ligands interact with several types of membrane receptors including those of the Frizzled (Fz) family and the low-density lipoprotein receptor related proteins Lrp5 and 6 to activate a variety of intracellular signaling cascades. Among the most extensively studied is the b-catenin-dependent, canonical pathway. In this mechanism, binding of Wnt ligands stabilizes bcatenin, which enters the nucleus to interact with the LEF/TCF family of transcription factors, resulting in transcriptional activation of downstream target genes. Other b-catenin-independent pathways include those mediated by PKC or the Rho family of small GTPases, although the latter was recently shown also to participate in b-catenin signaling [80]. Studies in chick embryonic limbs or limb bud micromass cultures showed that ectopic expression of Wnt1 or Wnt7a inhibited chondrocyte differentiation [81,82]. Consistent with the view that the antichondrogenic role of Wnt proteins is mediated through b-catenin, overexpression of a stabilized form of b-catenin in embryonic limb mesenchyme resulted in a near complete loss of all limb cartilage elements in the mouse, due to an early differentiation defect reflected by the loss of Sox9 expression in the limb mesenchyme [83]. In addition, canonical Wnt signaling also plays further inhibitory roles at subsequent stages after Col2a1 expression is activated, as conditional overexpression of the stabilized b-catenin by Col2-Cre led to severe achondrodysplasia [84]. Similar to canonical Wnt signaling, Notch signaling also suppresses chondrogenesis. Notch signaling mediates communication between neighboring cells to control cell fate decisions in all metazoans [85,86]. The mammalian genome encodes four Notch receptors (Notch1e4) and at least five ligands (Jagged1, 2 and Delta-like 1, 3, 4). In the canonical Notch pathway, binding of the ligands to the Notch receptors present on the neighboring cell surface triggers two successive intramembrane proteolytic cleavages of the receptors mediated by the g-secretase complex and resulting in the release of the Notch intracellular domain (NICD) [87e89]. Upon its release from the plasma membrane, NICD translocates to the nucleus where it interacts with a transcription factor of the CSL family (RBPJk/ CBF-1 in mammals) to activate transcription of target

45

genes [90]. Expression studies revealed that multiple ligands and receptors are expressed in the prechondrogenic mesenchyme. Abolition of Notch signaling in the embryonic limb mesenchyme by the removal of either the g-secretase activity or the transcriptional effector RBPjk resulted in an acceleration of chondrocyte differentiation [91]. Conversely, forced expression of the constitutively active NICD in the limb mesenchyme completely abolished chondrogenesis. Importantly, the antichondrogenic effect of NICD was dependent on RBPjk, as simultaneous removal of the latter fully rescued the chondrogenic defect caused by NICD overexpression [91]. In addition to the direct suppressive role in chondrogenesis, Notch signaling is also known to control axial skeletal patterning through the regulation of somitogenesis. This was evidenced by the findings that Delta-like 3 (Dll3) [92], presenilin 1 (PS1) [93,94], a catalytic subunit of the g-secretase complex, or lunatic fringe, a glycosyltransferase that modifies Notch proteins [95] exhibited defects in the axial skeleton. Consistent with the mouse studies, human mutations in Dll3 [96] were found to cause spondylocostal dysostosis. Retinoid signaling via the retinoic acid receptor a (RARa) also acts to inhibit early chondrocyte differentiation [67,97]. In these studies, transgenic mice were generated to express a constitutively active RARa in the limb mesenchyme. Cells expressing the transgene did participate in mesenchymal condensations in vivo and in vitro but failed to differentiate into chondroblasts and maintained instead a prechondrogenic phenotype. In contrast, the addition of an RARa-selective antagonist to cultures of these cells was sufficient to stimulate chondroblast differentiation and cartilage formation, even when BMP signaling was repressed. Furthermore, inhibition of RAR activity correlated with PKA activation, increased Sox9 expression, and enhanced Sox9 transcriptional activity [67]. In the developing mandibular process, Sox9 and the homeobox transcription factor Msx2 are induced by BMP-4, and the relative amount of these two factors appears to determine where chondrogenesis takes place [98]. These two factors are also expressed in a subpopulation of cranial neural crests cells that will populate the mandibular area. In this population, Msx2 represses chondrogenic differentiation until cell migration is completed within the mandibular primordium [99]. It is not known whether the antagonistic interaction between Sox9 and Msx2 is direct or mediated by other factors.

Chondrocyte Proliferation and Maturation PTHrP (parathyroid hormone-related peptide) is a paracrine factor that shares homology with PTH (parathyroid hormone) in its N-terminal domain and binds

PEDIATRIC BONE

46

3. PRENATAL BONE DEVELOPMENT

a common receptor, the PTH/PTHrP receptor 1 (PTHR1). In developing long bones in rodents, Pthrp is expressed at highest levels by cells of the periarticular perichondrium, and at lower levels by the proliferating chondrocytes near the articular surface [100]. The Pth-r1 gene is expressed at low levels by proliferating chondrocytes and at high levels by the maturing chondrocytes adjacent to the Ihh-secreting cells, as well as osteoblastic cells in the perichondrium [101,102]. Targeting inactivation of the gene encoding either PTHrP or its receptor in the mouse resulted in neonatal lethality due to severe skeletal dysplasia in which premature maturation of chondrocytes led to short-limb dwarfism and excessive bone formation at birth [103]. Moreover, Pthr1/ chondrocytes present in the growth plate of chimeric mouse embryos developed from both Pthr1/eand wild-type ES cells underwent hypertrophy prematurely in a cell autonomous manner [104]. These studies identified a primary function for PTH signaling in the growth plate, which is to suppress the rate of chondrocyte hypertrophy. PTHrP acts by activating cAMP-dependent signaling pathways, in part by increasing PKA-dependent phosphorylation and transcriptional activity of Sox9 [105,106]. In keeping with the negative role of PTHrP in hypertrophy, misexpression of PTHrP in chondrocytes through a transgene markedly delayed chondrocyte maturation and bone formation, resulting in a completely cartilaginous endochondral skeleton at birth [107]. In humans, inactivating mutations in PTH-R1 cause Blomstrand chondrodysplasia characterized by advanced skeletal maturation with shortness of long bones and increased bone density [108e110]. Conversely, gain-of-function mutations in PTH-R1 cause Jansen metaphyseal chondrodysplasia [111,112], which was recapitulated in mice overexpressing such a mutant receptor [113]. Yet another activating mutation in PTH-R1 was identified in some enchondromatosis, a condition characterized by the presence of benign cartilage tumors adjoining the growth plate [114]. However, another research group could not confirm these findings [115], while others identified additional novel PTH-R1 mutations [116]. The expression of Pthrp in the periarticular region is strictly dependent on Indian hedgehog (Ihh), a member of the Hh family that includes additionally Sonic hedgehog (Shh) and Desert hedgehog (Dhh) in mammals. The Hedgehog (Hh) family of proteins plays fundamental roles in animal development conserved from flies to humans [117e119]. Smoothened (Smo), a seven-pass transmembrane protein is indispensable for transducing the Hh signal. Hh signaling ultimately controls the processing and subcellular localization of the Gli transcription factors (Gli1e3) that regulate expression of downstream target genes. In the developing cartilage, Ihh is primarily expressed by

prehypertrophic chondrocytes (chondrocytes immediately prior to hypertrophy) and early hypertrophic chondrocytes; Ihh signals to both immature chondrocytes and the overlying perichondrial cells [101,102]. Definitive evidence for the physiological function of Ihh signaling came from mouse genetic knockout studies. Ihh/ embryos exhibited multiple defects in the developing cartilage of the endochondral skeleton, these including a 50% reduction in chondrocyte proliferation and premature hypertrophy of chondrocytes [101, 120]. Subsequent genetic studies of Smo, revealed that whereas direct Ihh input was required for proper proliferation of chondrocytes [120,121], it did not appear to be critical for the regulation of chondrocyte hypertrophy, which instead depended primarily on PTHrP whose expression was induced by Ihh [101,120,122]. Later experiments however, did reveal that direct Ihh signaling does play a role within the proliferating population, in controlling the formation of the columnar from the round chondrocytes [123,124]. The control of PTHrP by Ihh appears to be through direct Hh signaling in the target cells, as localized removal of Smo led to a corresponding loss of PTHrP expression within the periarticular region [123]. Finally, the role of Ihh in chondrocyte proliferation and PTHrP expression is mainly mediated through the derepression of Gli3 repressor function, as simultaneous deleleton of both Gli3 and Ihh restored normal proliferation and hypertrophy [125,126]. Overall, these studies have led to a model in which Ihh and PTHrP jointly regulate chondrocyte proliferation and maturation. The insulin-like growth factors 1 and 2 (IGF-1 and IGF-2) are general growth-promoting factors that also directly regulate chondrocytes. These factors and their receptor (IGF-1R) are closely related to insulin and the insulin receptor (IR), respectively. IR and IGF-1R are tyrosine kinase receptors, activated as heterotetrameric complexes, which act via the docking protein insulin receptor substrate 1 (IRS-1) to initiate signal transduction by the mitogen-activated protein kinase or the phosphatidyl-inositol 3 kinase pathways [127]. IGF-2 (and to a lesser degree IGF-1) also interacts with a second receptor, the mannose-6-phosphate/IGF-2 receptor (IGF-2R). This is a monomeric receptor devoid of a signaling domain. It essentially acts as a scavenger to prevent accumulation of toxic levels of IGF-2 (and possibly IGF-1). These receptors are ubiquitously expressed, indicating the wide spectrum of cell types that insulin/IGF signaling acts on. IGF-1 and -2 are both locally produced by chondrocytes, in addition to the circulating IGF-1 produced in the liver that acts as an endocrine factor. Gene inactivation studies in the mouse have confirmed the essential role of the IGF signaling pathway in overall growth of the mouse embryo development, primarily through the control of cell proliferation [128e130]. Genetic experiments with

PEDIATRIC BONE

MOLECULAR REGULATION OF SKELETAL DEVELOPMENT

single and compound mutant embryos in IGF and Ihh signaling indicated that the two signaling pathways appear to stimulate chondrocyte proliferation in parallel mechanisms [131]. Fibroblast growth factor (FGF) signaling is also recognized as an essential component of the control of chondrocyte proliferation [132]. FGFs are polypeptide growth factors with diverse biological functions [133]. The human and mouse genomes contain 22 FGF and four FGFR genes. Most FGFs function by binding to and activating cell surface tyrosine kinase FGF receptors (FGFR). FGFs also bind to heparin or heparan sulfate proteoglycans that facilitate the FGF-binding and activation of FGFRs. Signaling via FGFRs is propagated through recruitment and phosphorylation of a variety of signaling proteins, that is triggered by the autophosphorylation of the activated receptors and tyrosinephosphorylation of the closely linked docking proteins [134]. As a result, multiple signaling modules including MAPK, PI3K, STAT1 and PKC are activated. Activating mutations in the transmembrane domain of the receptor FGFR-3 cause a spectrum of chondrodysplasia including hypochondroplasia, achondroplasia and thanatophoric dysplasia, depending on the degree of activation of the receptor [132,135,136]. Similarly, mouse models harboring the activating mutations in FGFR3 phenocopied many aspects of these diseases and revealed that reduced chondrocyte proliferation was the main cellular defect [137,138]. Conversely, FGFR3 deletion in the mouse led to increased proliferation and postnatal skeletal overgrowth [139,140]. Thus, FGFR-3 signaling normally suppresses chondrocyte proliferation in the growth plate. FGFR-3 signaling in chondrocytes is likely to be activated by FGF-18, as FGF-18/ embryos exhibited a similar overproliferation phenotype in chondrocytes [141,142]. The intracellular signaling may involve the signal transducer and activator of transcription (STAT) family of transcription factors [143,144]. Others have shown that FGFs activated the MAPK pathway to upregulate Sox9 expression and activity during chondrogenesis [145].

Osteoblast Differentiation Regardless of their origin from either the intramembranous or the endochondral process, osteoblast differentiation requires the same key transcription factors. One such factor is Runt domain factor 2/core binding factor a1 (Runx2/Cbfa1). Runx2 is a transcription factor isolated by virtue of its binding to cis-regulatory elements of the gene encoding osteocalcin, an osteoblast-specific protein. Runx2 is first expressed in cells of the mesenchymal condensations believed to contain common osteochondroprogenitor cells. With development, its expression progressively increases in

47

preosteoblasts and then in mature osteoblasts but is downregulated in chondrocytes except for the hypertrophic chondrocytes where Runx2 is expressed. Runx2/ Cbfa1 is indispensable for osteoblast differentiation, as demonstrated by knockout studies in the mouse. The skeleton of Runx2/ mice, which die at birth, is completely devoid of osteoblasts due to a differentiation arrest [146,147]. Runx2 is also required for osteoblast function beyond differentiation [148]. However, ectopic expression of Runx2 was not sufficient to induce osteoblast differentiation in the limb mesenchyme [149], and overexpression in osteoblasts caused osteopenia due to a blockage in osteoblast maturation [150]. Consistent with the fundamental importance of Runx2 in osteoblast differentiation and function, haploinsufficiency of Runx2 in humans causes cleidocranial dysplasia (CCD), an autosomal dominant disorder characterized primarily by a delay in closure of cranial sutures, reduced or absent clavicle, and dental anomalies [151]. Osterix (Osx, Sp7) is another transcription factor essential for osteoblast differentiation. Osx was discovered as upregulated in C2C12 cells by BMP during osteoblast differentiation [152]. Genetic deletion of Osx led to a complete lack of osteoblasts in the mouse embryo. The relatively normal Runx2 expression in the Osx/ embryos indicates that Osx functions in osteoblast differentiation downstream of Runx2. Furthermore, in the long bones of these mutant embryos, some cells normally destined to become osteoblasts adopted the chondrocyte phenotype, indicating that the Runx2-positive cells are bipotential and can differentiate into chondrocytes as opposed to osteoblasts in the absence of Osx. ATF4, a member of the basic leucine zipper family of transcription factors, plays an important role at a later stage than Runx2 and Osx during osteoblast differentiation [153]. Atf4/ embryos exhibited a severe deficit in the formation of mature osteoblasts even though Runx2 and Osx were expressed. In addition to its role in directly regulating the transcription of the mature osteoblast marker osteocalcin, Atf4 also controls the osteoblast phenotype by stimulating amino acid import to ensure a high level of protein translation of type I collagen, the main constituent of the bone matrix. Besides transcription factors, a number of developmental signals have been identified to control osteoblast differentiation in the embryo [154] (Fig. 3.2). Deletion of Ihh in the mice caused profound defects not only in chondrocytes, as discussed earlier, but also in osteoblast development in the endochondral skeleton [101,120]. In particular, loss of Ihh arrested osteoblast development at a primitive stage prior to expression of the earliest known markers including Cola1(I), AP and Runx2, and before the activation of canonical Wnt signaling in the lineage [155]. Thus, Ihh functions genetically upstream of canonical Wnt signaling during osteoblast

PEDIATRIC BONE

48

3. PRENATAL BONE DEVELOPMENT

Fgf, Bmp Hh

MSC

Wnt, Fgf

Runx2+

Wnt, Bmp

Osx+

OB

Notch

FIGURE 3.2 Multiple developmental signals control osteoblast

differentiation. Y: stimulation; t: inhibition. MSC: mesenchymal stem cells; OB: mature osteoblasts. (Figure modified from [154].)

development. Through genetic deletion of Smo to cellautonomously remove Hh responsiveness, it was shown that direct Ihh input was required in the perichondrial osteoprogenitors for development of the osteoblast lineage [120,121]. The control of Ihh over osteoblast differentiation requires both derepression of Gli3 repressor and activation of the Gli2 activator [156,157]. The importance of Gli2 activity is consistent with the finding that Gli2-null embryos (lethal at birth) showed impaired osteoblast formation [158]. The importance of canonical Wnt signaling in osteoblast differentiation during embryogenesis was suggested by genetic deletion of b-catenin from early osteogenic progenitors in the mouse [83,155,159,160]. These studies demonstrated that b-catenin is required for the progression both from Runx2- to Osterix-positive stage [155], and from Osx-positive cells to mature osteoblasts [160]. However, b-catenin appears to be dispensable in mature osteoblasts, as its deletion by Col1-Cre or OC-Cre did not affect osteoblasts per se, but instead decreased the expression of Opg by osteoblasts, and therefore indirectly enhanced osteoclast formation [161,162]. Additionally, non-canonical Wnt signaling mechanisms have also been shown to stimulate osteoblast differentiation [163,164]. Mouse genetic studies have also demonstrated the importance of BMP signaling in bone formation. A critical threshold level of BMP2/4 signaling was shown to be required for trabecular bone formation in the long bones, and specifically that the BMP signal controlled the progression from Runx2- to Osterix-positive cells [62]. Contrary to BMP2 and 4, BMP3 is a negative regulator of bone mass, as BMP3-null mice contained twice as much trabecular bone volume than the control littermates at 5e6 weeks of age [60]. It is possible that BMP3 inhibits osteoblastogenesis by counteracting BMP2, as suggested by in vitro studies [60]. Besides its role in osteoblast differentiation, BMP signaling was also shown to regulate the function of mature osteoblasts. Most notably, genetic deletion of BMPR1A using Og2-Cre (osteocalcin2-Cre) decreased osteoblast function

without an obvious effect on osteoblast numbers [165]. Similarly, overexpression of noggin, a secreted inhibitor for BMPs, under the osteocalcin promoter caused a reduction in osteoblast function and a lower bone mass in postnatal mice [166]. Mouse genetic studies have also revealed important roles for FGF signaling in the osteoblast lineage. Mice lacking the mesenchymal splice form of FGFR-2 exhibited a defect in osteoblast differentiation due to a partial loss of Runx2 [167]. Conversely, mice harboring a gain-of-function mutation in FGFR-2 showed an increase in osteoblast numbers associated with an increase in Runx2 expression and osteoblast differention [168]. Likewise, a gain-of-function mutation of FGFR-1 stimulated Runx2 expression and enhanced osteoblast differentiation in the calvaria, although the status of the long bones was not reported [169]. Tissue-specific deletion of FGFR-1 revealed that FGFR-1 signaling in osteoprogenitors promotes osteoblast differentiation without affecting Runx2 expression, whereas FGFR-1 signaling in mature osteoblasts inhibits the cells’ mineralization activity [170]. In contrast, mice lacking FGFR-3 showed a decrease in bone mineral density due to defects in mineralization, even though the number of osteoblasts was increased [171]. Finally, FGF-18-null embryos exhibited defects in the formation of mature osteoblasts despite normal Runx2 expression [141,142]. Thus, Fgf signaling likely promotes osteoblast differentiation, as well as proliferation and mineralization of mature osteoblasts. In contrast to the signals discussed above, Notch normally inhibits osteoblast differentiation. Genetic removal of either the g-secretase activity, or Notch recptors in the embryonic limb mesenchyme caused excessive bone formation that began in the embryo and culminated in adolescent mice [156]. The phenotype was due to increased osteoblast differentiation from the osteogenic precursors. Consistent with the negative role of Notch in osteoblast differentiation, forced-expression of NICD in osteoblastic precursors reduced osteoblast numbers and caused osteopenia [172]. Interestingly, forced-expression of NICD at a later stage of the osteoblast lineage led to sclerosis owing to excessive proliferation of the immature osteoblasts, highlighting stagespecific functions of constitutive Notch activation in the osteoblast lineage [173,174]. In humans, Notch1 haploinsufficiency caused ectopic osteoblast differentiation and calcification in the aortic valves [175,176].

References [1] Carroll RL. Vertebrate Paleontology and Evolution. New York: Freeman; 1988. [2] Patterson C. Cartilage bones, dermal bones, and membrane bones, or the exoskeleton versus the endoskeleton. In: Andrews S, Miles R, Walker A, editors. Problems in Vertebrate Evolution. London: Academic Press; 1977. p. 77e121.

PEDIATRIC BONE

REFERENCES

[3] Gardner E. Osteogenesis in the human embryo and fetus. In: Bourne GH, editor. The Biochemistry and Physiology of Bone. New York: Academic Press; 1971. p. 77e118. [4] Thompson TJ, Owens PD, Wilson DJ. Intramembranous osteogenesis and angiogenesis in the chick embryo. J Anat 1989;166: 55e65. [5] Pritchard JJ. General histology of bone. In: Bourne GH, editor. The Biochemistry and Physiology of Bone. New York: Academic Press; 1972. p. 1e20. [6] Thorogood PV, Hinchliffe JR. An analysis of the condensation process during chondrogenesis in the embryonic chick hind limb. J Embryol Exp Morphol 1975;33:581e606. [7] Ede DA. Cellular condensations and chondrogenesis. In: Hall BK, editor. Cartilage Development, Differentiation and Growth. New York: Academic Press; 1983. p. 143e85. [8] Caplan AI, Pechak DG. The cellular and molecular embryology of bone formation. In: Peck WA, editor. Bone and Mineral Research. New York: Elsevier; 1987. p. 117e83. [9] Poole AR. The growth plate: Cellular physiology, cartilage assembly and mineralization. In: Hall BK, editor. Cartilage: Molecular Aspects. Boca Raton: CRC Press; 1991. p. 179e211. [10] Vu TH, Shipley JM, Bergers G, et al. MMP-9/gelatinase B is a key regulator of growth plate angiogenesis and apoptosis of hypertrophic chondrocytes. Cell 1998;93:411e22. [11] Sadler TW. Longman’s Medical Embryology. Philadelphia: Lippincott Williams & Wilkins; 2000. [12] Lemire RJ. Embryology of the skull. In: Cohen Jr MM, MacLean RE, editors. Craniosynostosis: Diagnosis, Evaluation, and Management. Oxford: Oxford University Press; 2000. p. 24e34. [13] Noback CR, Robertson GG. Sequences of appearance of ossification centers in the human skeleton during the first five prenatal months. Am J Anat 1951;89:1e28. [14] Dixon AD. Prenatal development of the facial skeleton. In: Dixon AD, Hoyte DAN, Ronning O, editors. Fundamentals of Craniofacial Growth. Boca Raton: CRC Press; 1997. p. 59e97. [15] Carlson BM. Human Embryology and Developmental Biology. St Louis: Mosby; 1999. [16] Hall BK. Embryonic bone formation with special reference to epithelialemesenchymal interactions and growth factors. In: Hall BK, editor. Bone: Mechanisms of Bone Development and Growth. Boca Raton: CRC Press; 1994. p. 137e92. [17] Hall BK, editor. Tissue interactions and chondrogenesis. In: Cartilage; Development, Differentiation, and Growth. New York: Academic Press; 1983. p. 187e222. [18] Thorogood P. Morphogenesis of cartilage. In: Hall BK, editor. Cartilage: Development, Differentiation, and Growth. New York: Academic Press; 1983. p. 223e54. [19] Kawabata M, Miyazomo K. Bone morphogenic proteins. In: Canalis E, editor. Skeletal Growth Factors. Philadelphia: Lippincott Williams & Wilkins; 2000. p. 269e90. [20] Sampath TK, Reddi AH. Dissociative extraction and reconstitution of extracellular matrix components involved in local bone differentiation. Proc Natl Acad Sci USA 1981;78:7599e603. [21] Urist MR, Mikulski A, Lietze A. Solubilized and insolubilized bone morphogenetic protein. Proc Natl Acad Sci USA 1979;76: 1828e32. [22] Rosen V, Cox K, Hattersley G. Bone morphogenic proteins. In: Bilezikian JP, Raisz LG, Rodan GA, editors. Principles of Bone Biology. New York: Academic Press; 1996. p. 661e71. [23] Reddi AH. Role of morphogenetic proteins in skeletal tissue engineering and regeneration. Nat Biotechnol 1998;16:247e52. [24] Karsenty G, Wagner EF. Reaching a genetic and molecular understanding of skeletal development. Dev Cell 2002;2: 389e406.

49

[25] Paralkar VM, Nandedkar AK, Pointer RH, Kleinman HK, Reddi AH. Interaction of osteogenin, a heparin binding bone morphogenetic protein, with type IV collagen. J Biol Chem 1990;265:17281e4. [26] Zhu Y, Oganesian A, Keene DR, Sandell LJ. Type IIA procollagen containing the cysteine-rich amino propeptide is deposited in the extracellular matrix of prechondrogenic tissue and binds to TGF-beta1 and BMP-2. J Cell Biol 1999;144:1069e80. [27] Satokata I, Maas R. Msx1 deficient mice exhibit cleft palate and abnormalities of craniofacial and tooth development. Nat Genet 1994;6:348e56. [28] Takahashi Y, Bontoux M, Le Douarin NM. Epithelioe mesenchymal interactions are critical for Quox 7 expression and membrane bone differentiation in the neural crest derived mandibular mesenchyme. Embo J 1991;10:2387e93. [29] Barlow AJ, Francis-West PH. Ectopic application of recombinant BMP-2 and BMP-4 can change patterning of developing chick facial primordia. Development 1997;124:391e8. [30] Hall BK, Miyake T. All for one and one for all: condensations and the initiation of skeletal development. Bioessays 2000;22: 138e47. [31] Coelho CN, Kosher RA. Gap junctional communication during limb cartilage differentiation. Dev Biol 1991;144:47e53. [32] Zimmermann B. Assembly and disassembly of gap junctions during mesenchymal cell condensation and early chondrogenesis in limb buds of mouse embryos. J Anat 1984;138:351e63. [33] DeLise AM, Fischer L, Tuan RS. Cellular interactions and signaling in cartilage development. Osteoarthr Cart 2000;8:309e34. [34] Haas AR, Tuan RS. Chondrogenic differentiation of murine C3H10T1/2 multipotential mesenchymal cells: II. Stimulation by bone morphogenetic protein-2 requires modulation of N-cadherin expression and function. Differentiation 1999;64: 77e89. [35] Widelitz RB, Jiang TX, Murray BA, Chuong CM. Adhesion molecules in skeletogenesis: II. Neural cell adhesion molecules mediate precartilaginous mesenchymal condensations and enhance chondrogenesis. J Cell Physiol 1993;156:399e411. [36] Flanagan JG, Vanderhaeghen P. The ephrins and Eph receptors in neural development. Annu Rev Neurosci 1998;21:309e45. [37] Davy A, Bush JO, Soriano P. Inhibition of gap junction communication at ectopic Eph/ephrin boundaries underlies craniofrontonasal syndrome. PLoS Biol 2006;4:e315. [38] Stadler HS, Higgins KM, Capecchi MR. Loss of Eph-receptor expression correlates with loss of cell adhesion and chondrogenic capacity in Hoxa13 mutant limbs. Development 2001;128: 4177e88. [39] Wada N, Kimura I, Tanaka H, Ide H, Nohno T. Glycosylphosphatidylinositol-anchored cell surface proteins regulate position-specific cell affinity in the limb bud. Dev Biol 1998;202: 244e52. [40] Goff DJ, Tabin CJ. Analysis of Hoxd-13 and Hoxd-11 misexpression in chick limb buds reveals that Hox genes affect both bone condensation and growth. Development 1997;124:627e36. [41] Yokouchi Y, Nakazato S, Yamamoto M, et al. Misexpression of Hoxa-13 induces cartilage homeotic transformation and changes cell adhesiveness in chick limb buds. Genes Dev 1995;9: 2509e22. [42] Knudson CB, Toole BP. Hyaluronate-cell interactions during differentiation of chick embryo limb mesoderm. Dev Biol 1987;124:82e90. [43] Toole BP, Jackson G, Gross J. Hyaluronate in morphogenesis: inhibition of chondrogenesis in vitro. Proc Natl Acad Sci USA 1972;69:1384e6. [44] Kosher RA. Syndecan-3 in limb skeletal development. Microsc Res Tech 1998;43:123e30.

PEDIATRIC BONE

50

3. PRENATAL BONE DEVELOPMENT

[45] Seghatoleslami MR, Kosher RA. Inhibition of in vitro limb cartilage differentiation by syndecan-3 antibodies. Dev Dyn 1996;207:114e9. [46] Kulyk WM, Upholt WB, Kosher RA. Fibronectin gene expression during limb cartilage differentiation. Development 1989;106:449e55. [47] Frenz DA, Akiyama SK, Paulsen DF, Newman SA. Latex beads as probes of cell surface-extracellular matrix interactions during chondrogenesis: evidence for a role for amino-terminal heparinbinding domain of fibronectin. Dev Biol 1989;136:87e96. [48] Frenz DA, Jaikaria NS, Newman SA. The mechanism of precartilage mesenchymal condensation: a major role for interaction of the cell surface with the amino-terminal heparin-binding domain of fibronectin. Dev Biol 1989;136:97e103. [49] Gehris AL, Stringa E, Spina J, Desmond ME, Tuan RS, Bennett VD. The region encoded by the alternatively spliced exon IIIA in mesenchymal fibronectin appears essential for chondrogenesis at the level of cellular condensation. Dev Biol 1997;190:191e205. [50] Chimal-Monroy J, Diaz de Leon L. Expression of N-cadherin, NCAM, fibronectin and tenascin is stimulated by TGF-beta1, beta2, beta3 and beta5 during the formation of precartilage condensations. Int J Dev Biol 1999;43:59e67. [51] Leonard CM, Fuld HM, Frenz DA, Downie SA, Massague J, Newman SA. Role of transforming growth factor-beta in chondrogenic pattern formation in the embryonic limb: stimulation of mesenchymal condensation and fibronectin gene expression by exogenenous TGF-beta and evidence for endogenous TGFbeta-like activity. Dev Biol 1991;145:99e109. [52] Francis-West PH, Abdelfattah A, Chen P, et al. Mechanisms of GDF-5 action during skeletal development. Development 1999;126:1305e15. [53] Zou H, Wieser R, Massague J, Niswander L. Distinct roles of type I bone morphogenetic protein receptors in the formation and differentiation of cartilage. Genes Dev 1997;11:2191e203. [54] Tsumaki N, Nakase T, Miyaji T, et al. Bone morphogenetic protein signals are required for cartilage formation and differently regulate joint development during skeletogenesis. J Bone Miner Res 2002;17:898e906. [55] Tsumaki N, Tanaka K, Arikawa-Hirasawa E, et al. Role of CDMP-1 in skeletal morphogenesis: promotion of mesenchymal cell recruitment and chondrocyte differentiation. J Cell Biol 1999;144:161e73. [56] Merino R, Ganan Y, Macias D, Economides AN, Sampath KT, Hurle JM. Morphogenesis of digits in the avian limb is controlled by FGFs, TGFbetas, and noggin through BMP signaling. Dev Biol 1998;200:35e45. [57] Mishina Y, Suzuki A, Ueno N, Behringer RR. Bmpr encodes a type I bone morphogenetic protein receptor that is essential for gastrulation during mouse embryogenesis. Genes Dev 1995;9:3027e37. [58] Winnier G, Blessing M, Labosky PA, Hogan BL. Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev 1995;9:2105e16. [59] Zhang H, Bradley A. Mice deficient for BMP2 are nonviable and have defects in amnion/chorion and cardiac development. Development 1996;122:2977e86. [60] Daluiski A, Engstrand T, Bahamonde ME, et al. Bone morphogenetic protein-3 is a negative regulator of bone density. Nat Genet 2001;27:84e8. [61] Zhao R, Lawler AM, Lee SJ. Characterization of GDF-10 expression patterns and null mice. Dev Biol 1999;212:68e79. [62] Bandyopadhyay A, Tsuji K, Cox K, Harfe BD, Rosen V, Tabin CJ. Genetic analysis of the roles of BMP2, BMP4, and BMP7 in limb patterning and skeletogenesis. PLoS Genet 2006;2:e216.

[63] Luyten FP, Kaplan FS, Shore EM. Clinical disorders associated with bone morphogenic proteins. In: Canalis E, editor. Skeletal Growth Factors. Philadelphia: Lippincott Williams & Wilkins; 2000. p. 323e34. [64] Gong Y, Krakow D, Marcelino J, et al. Heterozygous mutations in the gene encoding noggin affect human joint morphogenesis. Nat Genet 1999;21:302e4. [65] Brunet LJ, McMahon JA, McMahon AP, Harland RM. Noggin, cartilage morphogenesis, and joint formation in the mammalian skeleton. Science 1998;280:1455e7. [66] Pizette S, Niswander L. BMPs are required at two steps of limb chondrogenesis: formation of prechondrogenic condensations and their differentiation into chondrocytes. Dev Biol 2000;219: 237e49. [67] Weston AD, Rosen V, Chandraratna RA, Underhill TM. Regulation of skeletal progenitor differentiation by the BMP and retinoid signaling pathways. J Cell Biol 2000;148:679e90. [68] Barna M, Niswander L. Visualization of cartilage formation: insight into cellular properties of skeletal progenitors and chondrodysplasia syndromes. Dev Cell 2007;12:931e41. [69] Eshkar-Oren I, Viukov SV, Salameh S, et al. The forming limb skeleton serves as a signaling center for limb vasculature patterning via regulation of Vegf. Development 2009;136: 1263e72. [70] Foster JW, Dominguez-Steglich MA, Guioli S, et al. Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene. Nature 1994;372:525e30. [71] Bi W, Deng JM, Zhang Z, Behringer RR, de Crombrugghe B. Sox9 is required for cartilage formation. Nat Genet 1999;22:85e9. [72] Mori-Akiyama Y, Akiyama H, Rowitch DH, de Crombrugghe B. Sox9 is required for determination of the chondrogenic cell lineage in the cranial neural crest. Proc Natl Acad Sci USA 2003;100:9360e5. [73] Smits P, Li P, Mandel J, et al. The transcription factors L-Sox5 and Sox6 are essential for cartilage formation. Dev Cell 2001;1: 277e90. [74] Massague J, Seoane J, Wotton D. Smad transcription factors. Genes Dev 2005;19:2783e810. [75] Yoon BS, Ovchinnikov DA, Yoshii I, Mishina Y, Behringer RR, Lyons KM. Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo. Proc Natl Acad Sci USA 2005;102:5062e7. [76] Retting KN, Song B, Yoon BS, Lyons KM. BMP canonical Smad signaling through Smad1 and Smad5 is required for endochondral bone formation. Development 2009;136:1093e104. [77] Zhang J, Tan X, Li W, et al. Smad4 is required for the normal organization of the cartilage growth plate. Dev Biol 2005;284: 311e22. [78] Liu F, Pouponno C, Massague J. Dual role of the Smad4/DPC4 tumor suppressor in TGFbeta-inducible transcriptional complexes. Genes Dev 1997;11:3157e67. [79] Wodarz A, Nusse R. Mechanisms of Wnt signaling in development. Annu Rev Cell Dev Biol 1998;14:59e88. [80] Wu X, Tu X, Joeng KS, Hilton MJ, Williams DA, Long F. Rac1 activation controls nuclear localization of beta-catenin during canonical Wnt signaling. Cell 2008;133:340e53. [81] Rudnicki JA, Brown AM. Inhibition of chondrogenesis by Wnt gene expression in vivo and in vitro. Dev Biol 1997;185:104e18. [82] Stott NS, Jiang TX, Chuong CM. Successive formative stages of precartilaginous mesenchymal condensations in vitro: modulation of cell adhesion by Wnt-7A and BMP-2. J Cell Physiol 1999;180:314e24. [83] Hill TP, Spater D, Taketo MM, Birchmeier W, Hartmann C. Canonical Wnt/beta-catenin signaling prevents osteoblasts from differentiating into chondrocytes. Dev Cell 2005;8:727e38.

PEDIATRIC BONE

51

REFERENCES

[84] Akiyama H, Lyons JP, Mori-Akiyama Y, et al. Interactions between Sox9 and beta-catenin control chondrocyte differentiation. Genes Dev 2004;18:1072e87. [85] Artavanis-Tsakonas S, Rand MD, Lake RJ. Notch signaling: cell fate control and signal integration in development. Science 1999;284:770e6. [86] Chiba S. Notch signaling in stem cell systems. Stem Cells 2006;24:2437e47. [87] Kopan R, Goate A. A common enzyme connects notch signaling and Alzheimer’s disease. Genes Dev 2000;14:2799e806. [88] Kopan R, Ilagan MX. The canonical Notch signaling pathway: unfolding the activation mechanism. Cell 2009;137:216e33. [89] Schroeter EH, Kisslinger JA, Kopan R. Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Nature 1998;393:382e6. [90] Honjo T. The shortest path from the surface to the nucleus: RBPJ kappa/Su(H) transcription factor. Genes Cells 1996;1:1e9. [91] Dong Y, Jesse AM, Kohn A, et al. RBPjkappa-dependent Notch signaling regulates mesenchymal progenitor cell proliferation and differentiation during skeletal development. Development 2010;137:1461e71. [92] Dunwoodie SL, Clements M, Sparrow DB, Sa X, Conlon RA, Beddington RS. Axial skeletal defects caused by mutation in the spondylocostal dysplasia/pudgy gene Dll3 are associated with disruption of the segmentation clock within the presomitic mesoderm. Development 2002;129:1795e806. [93] Shen J, Bronson RT, Chen DF, Xia W, Selkoe DJ, Tonegawa S. Skeletal and CNS defects in Presenilin-1-deficient mice. Cell 1997;89:629e39. [94] Wong PC, Zheng H, Chen H, et al. Presenilin 1 is required for Notch1 and DII1 expression in the paraxial mesoderm. Nature 1997;387:288e92. [95] Zhang N, Gridley T. Defects in somite formation in lunatic fringe-deficient mice. Nature 1998;394:374e7. [96] Bulman MP, Kusumi K, Frayling TM, et al. Mutations in the human delta homologue, DLL3, cause axial skeletal defects in spondylocostal dysostosis. Nat Genet 2000;24:438e41. [97] Cash DE, Bock CB, Schughart K, Linney E, Underhill TM. Retinoic acid receptor alpha function in vertebrate limb skeletogenesis: a modulator of chondrogenesis. J Cell Biol 1997;136: 445e57. [98] Semba I, Nonaka K, Takahashi I, et al. Positionally-dependent chondrogenesis induced by BMP4 is co-regulated by Sox9 and Msx2. Dev Dyn 2000;217:401e14. [99] Takahashi K, Nuckolls GH, Takahashi I, et al. Msx2 is a repressor of chondrogenic differentiation in migratory cranial neural crest cells. Dev Dyn 2001;222:252e62. [100] Lee K, Deeds JD, Segre GV. Expression of parathyroid hormonerelated peptide and its receptor messenger ribonucleic acids during fetal development of rats. Endocrinology 1995;136: 453e63. [101] St-Jacques B, Hammerschmidt M, McMahon AP. Indian hedgehog signaling regulates proliferation and differentiation of chondrocytes and is essential for bone formation. Genes Dev 1999;13:2072e86. [102] Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM, Tabin CJ. Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science 1996;273:613e22. [103] Karaplis AC, Luz A, Glowacki J, et al. Lethal skeletal dysplasia from targeted disruption of the parathyroid hormone-related peptide gene. Genes Dev 1994;8:277e89. [104] Chung UI, Lanske B, Lee K, Li E, Kronenberg H. The parathyroid hormone/parathyroid hormone-related peptide receptor coordinates endochondral bone development by directly controlling

[105]

[106]

[107]

[108]

[109]

[110]

[111]

[112]

[113]

[114] [115]

[116]

[117]

[118]

[119]

[120]

[121]

[122]

chondrocyte differentiation. Proc Natl Acad Sci USA 1998;95: 13030e5. Guo J, Chung UI, Kondo H, Bringhurst FR, Kronenberg HM. The PTH/PTHrP receptor can delay chondrocyte hypertrophy in vivo without activating phospholipase C. Dev Cell 2002;3:183e94. Huang W, Chung UI, Kronenberg HM, de Crombrugghe B. The chondrogenic transcription factor Sox9 is a target of signaling by the parathyroid hormone-related peptide in the growth plate of endochondral bones. Proc Natl Acad Sci USA 2001;98:160e5. Weir EC, Philbrick WM, Amling M, Neff LA, Baron R, Broadus AE. Targeted overexpression of parathyroid hormonerelated peptide in chondrocytes causes chondrodysplasia and delayed endochondral bone formation. Proc Natl Acad Sci USA 1996;93:10240e5. Jobert AS, Zhang P, Couvineau A, et al. Absence of functional receptors for parathyroid hormone and parathyroid hormonerelated peptide in Blomstrand chondrodysplasia. J Clin Invest 1998;102:34e40. Karaplis AC, He B, Nguyen MT, et al. Inactivating mutation in the human parathyroid hormone receptor type 1 gene in Blomstrand chondrodysplasia. Endocrinology 1998;139:5255e8. Karperien M, van der Harten HJ, van Schooten R, et al. A frameshift mutation in the type I parathyroid hormone (PTH)/PTHrelated peptide receptor causing Blomstrand lethal osteochondrodysplasia. J Clin Endocrinol Metab 1999;84:3713e20. Schipani E, Kruse K, Juppner H. A constitutively active mutant PTH-PTHrP receptor in Jansen-type metaphyseal chondrodysplasia. Science 1995;268:98e100. Schipani E, Langman CB, Parfitt AM, et al. Constitutively activated receptors for parathyroid hormone and parathyroid hormone-related peptide in Jansen’s metaphyseal chondrodysplasia. N Engl J Med 1996;335:708e14. Schipani E, Lanske B, Hunzelman J, et al. Targeted expression of constitutively active receptors for parathyroid hormone and parathyroid hormone-related peptide delays endochondral bone formation and rescues mice that lack parathyroid hormonerelated peptide. Proc Natl Acad Sci USA 1997;94:13689e94. Hopyan S, Gokgoz N, Poon R, et al. A mutant PTH/PTHrP type I receptor in enchondromatosis. Nat Genet 2002;30:306e10. Rozeman LB, Sansgiorgi L, Inge H, et al. Enchondromatosis (Ollier disease, Maffucci syndrome) is not caused by the PTHR1 mutation p.R150C. Hum Mutat 2004;24:466e73. Couvineau A, Wouters V, Bertand G, et al. PTHR1 mutations associated with Ollier disease result in receptor loss of function. Hum Molec Genet 2008;17:2766e75. Huangfu D, Anderson KV. Signaling from Smo to Ci/Gli: conservation and divergence of Hedgehog pathways from Drosophila to vertebrates. Development 2006;133:3e14. Ingham PW, McMahon AP. Hedgehog signaling in animal development: paradigms and principles. Genes Dev 2001;15: 3059e87. McMahon AP, Ingham PW, Tabin CJ. Developmental roles and clinical significance of hedgehog signaling. Curr Top Dev Biol 2003;53:1e114. Long F, Zhang XM, Karp S, Yang Y, McMahon AP. Genetic manipulation of hedgehog signaling in the endochondral skeleton reveals a direct role in the regulation of chondrocyte proliferation. Development 2001;128:5099e6108. Long F, Chung UI, Ohba S, McMahon J, Kronenberg HM, McMahon AP. Ihh signaling is directly required for the osteoblast lineage in the endochondral skeleton. Development 2004;131:1309e18. Karp SJ, Schipani E, St-Jacques B, Hunzelman J, Kronenberg H, McMahon AP. Indian hedgehog coordinates endochondral bone growth and morphogenesis via parathyroid hormone

PEDIATRIC BONE

52

[123]

[124]

[125]

[126]

[127]

[128]

[129]

[130]

[131]

[132]

[133] [134]

[135]

[136]

[137]

[138]

[139]

[140]

[141]

3. PRENATAL BONE DEVELOPMENT

related-protein-dependent and -independent pathways. Development 2000;127:543e8. Hilton MJ, Tu X, Long F. Tamixofen-inducible gene deletion reveals a distinct population of osteoblast-lineage cells, and direct regulation of PTHrP expression and chondrocyte morphology by Ihh. 2006;Submitted. Kobayashi T, Soegiarto DW, Yang Y, et al. Indian hedgehog stimulates periarticular chondrocyte differentiation to regulate growth plate length independently of PTHrP. J Clin Invest 2005;115:1734e42. Hilton MJ, Tu X, Cook J, Hu H, Long F. Ihh controls cartilage development by antagonizing Gli3, but requires additional effectors to regulate osteoblast and vascular development. Development 2005;132:4339e51. Koziel L, Wuelling M, Schneider S, Vortkamp A. Gli3 acts as a repressor downstream of Ihh in regulating two distinct steps of chondrocyte differentiation. Development 2005;132:5249e60. Clemmons DR. Insulin-like growth factors. In: Canalis E, editor. Skeletal Growth Factors. Philadelphia: Lippincott Williams & Wilkins; 2000. p. 79e99. Baker J, Liu JP, Robertson EJ, Efstratiadis A. Role of insulin-like growth factors in embryonic and postnatal growth. Cell 1993;75: 73e82. DeChiara TM, Efstratiadis A, Robertson EJ. A growth-deficiency phenotype in heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting. Nature 1990;345:78e80. Liu JP, Baker J, Perkins AS, Robertson EJ, Efstratiadis A. Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 1993;75:59e72. Long F, Joeng KS, Xuan S, Efstratiadis A, McMahon AP. Independent regulation of skeletal growth by Ihh and IGF signaling. Dev Biol 2006;298:327e33. Ornitz DM, Marie PJ. FGF signaling pathways in endochondral and intramembranous bone development and human genetic disease. Genes Dev 2002;16:1446e65. Itoh N, Ornitz DM. Functional evolutionary history of the mouse Fgf gene family. Dev Dyn 2008;237:18e27. Eswarakumar VP, Lax I, Schlessinger J. Cellular signaling by fibroblast growth factor receptors. Cytokine Growth Factor Rev 2005;16:139e49. Rousseau F, Bonaventure J, Legeai-Mallet L, et al. Mutations in the gene encoding fibroblast growth factor receptor-3 in achondroplasia. Nature 1994;371:252e4. Shiang R, Thompson LM, Zhu YZ, et al. Mutations in the transmembrane domain of FGFR3 cause the most common genetic form of dwarfism, achondroplasia. Cell 1994;78:335e42. Chen L, Adar R, Yang X, et al. Gly369Cys mutation in mouse FGFR3 causes achondroplasia by affecting both chondrogenesis and osteogenesis. J Clin Invest 1999;104:1517e25. Naski MC, Colvin JS, Coffin JD, Ornitz DM. Repression of hedgehog signaling and BMP4 expression in growth plate cartilage by fibroblast growth factor receptor 3. Development 1998;125:4977e88. Colvin JS, Bohne BA, Harding GW, McEwen DG, Ornitz DM. Skeletal overgrowth and deafness in mice lacking fibroblast growth factor receptor 3. Nat Genet 1996;12:390e7. Deng C, Wynshaw-Boris A, Zhou F, Kuo A, Leder P. Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell 1996;84:911e21. Liu Z, Xu J, Colvin JS, Ornitz DM. Coordination of chondrogenesis and osteogenesis by fibroblast growth factor 18. Genes Dev 2002;16:859e69.

[142] Ohbayashi N, Shibayama M, Kurotaki Y, et al. FGF18 is required for normal cell proliferation and differentiation during osteogenesis and chondrogenesis. Genes Dev 2002;16:870e9. [143] Sahni M, Ambrosetti DC, Mansukhani A, Gertner R, Levy D, Basilico C. FGF signaling inhibits chondrocyte proliferation and regulates bone development through the STAT-1 pathway. Genes Dev 1999;13:1361e6. [144] Su WC, Kitagawa M, Xue N, et al. Activation of Stat1 by mutant fibroblast growth-factor receptor in thanatophoric dysplasia type II dwarfism. Nature 1997;386:288e92. [145] Murakami S, Kan M, McKeehan WL, de Crombrugghe B. Upregulation of the chondrogenic Sox9 gene by fibroblast growth factors is mediated by the mitogen-activated protein kinase pathway. Proc Natl Acad Sci USA 2000;97:1113e8. [146] Komori T, Yagi H, Nomura S, et al. Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 1997;89:755e64. [147] Otto F, Thornell AP, Crompton T, et al. Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 1997;89:765e71. [148] Ducy P, Starbuck M, Priemel M, et al. A Cbfa1-dependent genetic pathway controls bone formation beyond embryonic development. Genes Dev 1999;13:1025e36. [149] Stricker S, Fundele R, Vortkamp A, Mundlos S. Role of Runx genes in chondrocyte differentiation. Dev Biol 2002;245:95e108. [150] Liu W, Toyosawa S, Furuichi T, et al. Overexpression of Cbfa1 in osteoblasts inhibits osteoblast maturation and causes osteopenia with multiple fractures. J Cell Biol 2001;155:157e66. [151] Mundlos S, Otto F, Mundlos C, et al. Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell 1997;89:773e9. [152] Nakashima K, Zhou X, Kunkel G, et al. The novel zinc fingercontaining transcription factor osterix is required for osteoblast differentiation and bone formation. Cell 2002;108:17e29. [153] Yang X, Matsuda K, Bialek P, et al. ATF4 is a substrate of RSK2 and an essential regulator of osteoblast biology; implication for Coffin-Lowry Syndrome. Cell 2004;117:387e98. [154] Long F. Targeting intercellular signals for bone regeneration from bone marrow mesenchymal progenitors. Cell Cycle 2008;7: 2106e11. [155] Hu H, Hilton MJ, Tu X, Yu K, Ornitz DM, Long, F. Sequential roles of Hedgehog and Wnt signaling in osteoblast development. Development 2005;132:49e60. [156] Hilton MJ, Tu X, Wu X, et al. Notch signaling maintains bone marrow mesenchymal progenitors by suppressing osteoblast differentiation. Nat Med 2008;14:306e14. [157] Joeng KS, Long F. The Gli2 transcriptional activator is a crucial effector for Ihh signaling in osteoblast development and cartilage vascularization. Development 2009;136:4177e85. [158] Miao D, Liu H, Plut P, et al. Impaired endochondral bone development and osteopenia in Gli2-deficient mice. Exp Cell Res 2004;294:210e22. [159] Day TF, Guo X, Garrett-Beal L, Yang Y. Wnt/beta-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Dev Cell 2005;8:739e50. [160] Rodda SJ, McMahon AP. Distinct roles for Hedgehog and canonical Wnt signaling in specification, differentiation and maintenance of osteoblast progenitors. Development 2006;133: 3231e44. [161] Glass 2nd DA, Bialek P, Ahn JD, et al. Canonical Wnt signaling in differentiated osteoblasts controls osteoclast differentiation. Dev Cell 2005;8:751e64.

PEDIATRIC BONE

REFERENCES

[162] Holmen SL, Zylstra CR, Mukherjee A, et al. Essential role of beta-catenin in postnatal bone acquisition. J Biol Chem 2005;280: 21162e8. [163] Takada I, Mihara M, Suzawa M, et al. A histone lysine methyltransferase activated by non-canonical Wnt signalling suppresses PPAR-gamma transactivation. Nat Cell Biol 2007;9: 1273e85. [164] Tu X, Joeng KS, Nakayama KI, et al. Noncanonical Wnt signaling through G protein-linked PKCdelta activation promotes bone formation. Dev Cell 2007;12:113e27. [165] Mishina Y, Starbuck MW, Gentile MA, et al. Bone morphogenetic protein type IA receptor signaling regulates postnatal osteoblast function and bone remodeling. J Biol Chem 2004;279: 27560e6. [166] Devlin RD, Du Z, Pereira RC, et al. Skeletal overexpression of noggin results in osteopenia and reduced bone formation. Endocrinology 2003;144:1972e8. [167] Eswarakumar VP, Monsonego-Ornan E, Pines M, Antonopoulou I, Morriss-Kay GM, Lonai P. The IIIc alternative of Fgfr2 is a positive regulator of bone formation. Development 2002;129:3783e93. [168] Eswarakumar VP, Horowitz MC, Locklin R, Morriss-Kay GM, Lonai P. A gain-of-function mutation of Fgfr2c demonstrates the roles of this receptor variant in osteogenesis. Proc Natl Acad Sci USA 2004;101:12555e60.

53

[169] Zhou YX, Xu X, Chen L, Li C, Brodie SG, Deng CX. A Pro250Arg substitution in mouse Fgfr1 causes increased expression of Cbfa1 and premature fusion of calvarial sutures. Hum Mol Genet 2000;9:2001e8. [170] Jacob AL, Smith C, Partanen J, Ornitz DM. Fibroblast growth factor receptor 1 signaling in the osteo-chondrogenic cell lineage regulates sequential steps of osteoblast maturation. Dev Biol 2006;296:315e28. [171] Valverde-Franco G, Liu H, Davidson D, et al. Defective bone mineralization and osteopenia in young adult FGFR3/ mice. Hum Mol Genet 2004;13:271e84. [172] Zanotti S, Smerdel-Ramoya A, Stadmeyer L, Durant D, Radtke F, Canalis E. Notch inhibits osteoblast differentiation and causes osteopenia. Endocrinology 2008;149:3890e9. [173] Engin F, Yao Z, Yang T, et al. Dimorphic effects of Notch signaling in bone homeostasis. Nat Med 2008;14:299e305. [174] Tao J, Chen S, Yang T, et al. Osteosclerosis owing to Notch gain of function is solely Rbpj-dependent. J Bone Miner Res 2010;25: 2175e83. [175] Garg V, Muth AN, Ransom JF, et al. Mutations in NOTCH1 cause aortic valve disease. Nature 2005;437:270e4. [176] Mohamed SA, Aherrahrou Z, Liptau H, et al. Novel missense mutations (p.T596M and p.P1797H) in NOTCH1 in patients with bicuspid aortic valve. Biochem Biophys Res Commun 2006;345:1460e5.

PEDIATRIC BONE

C H A P T E R

4

Postnatal Bone Growth: Growth Plate Biology, Bone Formation, and Remodeling Christa Maes 1, Henry M. Kronenberg 2 1

Assistant Professor, Katholieke Universiteit Leuven, Laboratory of Experimental Medicine and Endocrinology, Gasthuisberg O&N I, Leuven, Belgium 2 Professor of Medicine, Harvard Medical School; Chief, Endocrine Unit, Massachusetts General Hospital, Boston, Massachusetts, USA

ENDOCHONDRAL AND INTRAMEMBRANOUS BONE FORMATION

The precise arrangement of the individual anatomic elements of the skeleton involves actions and crosstalk of several morphogens including fibroblast growth factors (FGFs), sonic hedgehog (Shh), bone morphogenetic proteins (BMPs) and Wnts during fetal development [1]. These mechanisms underlying the early condensation, segmentation, differentiation and patterning events are reviewed in Chapter 3. The initial cartilage mold forms when mesenchymal cells condense and then differentiate into chondrocytes, under the direction of transcription factors including Sox-9 [2]. The chondrocytes synthesize a characteristic extracellular matrix (ECM) rich in collagens II, IX, and XI and aggrecan, among other matrix molecules. As such, a cartilaginous model or anlage is established that prefigures the future bone. The cartilage mold enlarges both through proliferation along the entire length of the mold and through matrix production. In the center of the mold, chondrocytes stop proliferating, enlarge (hypertrophy), and change the constituents of the matrix to include, for example, type X collagen. The matrix is subsequently mineralized, specialized osteoclasts called chondroclasts invade the region of hypertrophic chondrocytes along with blood vessels and preosteoblasts, and the hypertrophic chondrocytes undergo apoptosis. The invading cells come from the connective tissues surrounding the cartilage mold called the perichondrium. Perichondrial cells carry out a distinct genetic program that partly regulates the cartilage mold via the secretion of signaling molecules that regulate chondrocyte proliferation and differentiation, such as BMPs and parathyroid hormone-related peptide (PTHrP). In turn, the perichondrium is regulated by the cartilage. Perichondrial cells adjacent to prehypertrophic/

Intramembranous ossification is responsible primarily for the formation of most of the craniofacial elements, as will be discussed below. In contrast, all the long bones of the axial skeleton (vertebrae and ribs) and the appendicular skeleton (limbs) develop and grow through endochondral ossification (Fig. 4.1). This process encompasses the deposition of true bone matrix on top of scaffolding cartilaginous anlagen, and is controlled by a series of distinct cell types. The dramatic, asymmetric lengthening of the appendicular long bones is driven to a large extent by the proliferation, differentiation and matrix deposition of chondrocytes that form and make up cartilage, and of osteoblasts that build mineralized bone. Osteoclasts, giant multinuclear cells that break down (“resorb”) bone, contribute to the further modeling and remodeling of the deposited bone. In this lifelong process, packets of bone are constantly being removed and replaced to ensure an adequate shape, position, density and functionality of the mineralized bone framework. Bone growth is absolutely dependent on angiogenesis, putting vascular endothelial cells in the picture as another crucial cell type in bone. Over the last decades, intensive research has focused on the cellular and molecular control of bone development, growth and remodeling. In vitro cell systems have been extremely instructive, but insights derived from genetically altered mice and lessons from human inherited disorders have advanced the field tremendously, as reviewed in this chapter.

Pediatric Bone, Second Edition DOI: 10.1016/B978-0-12-382040-2.10004-8

55

Copyright Ó 2012 Elsevier Inc. All rights reserved.

56

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

FIGURE 4.1 Stepwise schematic diagram of long bone development through endochondral ossification. Around embryonic day 12 (E12) in mice, mesenchymal progenitor cells condense and differentiate into chondrocytes to form the cartilage anlagen that prefigures future long bones. Chondrocytes in the center become hypertrophic, while cells in the surrounding perichondrium differentiate into osteoblasts forming a bone collar, the provisional cortical bone. The hypertrophic cartilage core is subsequently invaded by blood vessels, eroded and replaced by bone and marrow (“primary ossification center”, POC). In the metaphysis, hypertrophic cartilage of the growth cartilage is continually replaced with trabecular bone, a process that relies on metaphyseal vascularization and mediates longitudinal bone growth. Around postnatal day 5 (P5), epiphyseal vessels invade the avascular cartilage and initiate a secondary center of ossification (SOC). Discrete layers of residual chondrocytes form growth plates between the epiphyseal and metaphyseal bone centers to support further postnatal longitudinal bone growth. Ultimately, (in humans) the growth plates close and growth stops. A detailed view of the perinatal bone structure (boxed area) is provided in Figure 4.2.

hypertrophic chondrocytes respond to Indian hedgehog (Ihh) and other signals from the chondrocytes to become pre-osteoblasts [3]. Some of these pre-osteoblasts differentiate into mature osteoblasts that lay down and mineralize a collagen I-containing matrix, the “bone collar”, around the cartilage mold. This bone collar forms the initiation site of the cortical bone, the dense outer envelope of compact, lamellar bone that provides the long bone with most of its strength and rigidity (see Fig. 4.1). The cortical bone grows by its remodeling by endosteal osteoclastic bone resorption and periosteal new bone formation, as pre-osteoblastic cells proliferate and differentiate. In humans, the cortical bone further enlarges by the formation of Haversian systems around central blood vessels. Other pre-osteoblasts formed in the perichondrium invade the developing bone along with the blood vessels and chondroclasts that accumulated in the region just prior to the cartilage invasion and erosion, and become true osteoblasts inside the new cavity [4]. These osteoblasts lay down bone matrix dominated by collagen type I on top of the calcified matrix left behind by the hypertrophic chondrocytes. This is the primary spongiosa, which is subsequently remodeled by further waves of osteoclasts and osteoblasts to form the secondary spongiosa, the forerunner of mature

trabecular bone. The marrow space is enlarged by continual osteoclast activity, and hematopoietic precursors migrate from the fetal liver to establish marrowbased hematopoiesis. Near the ends of the bone, the same cellular sequence of chondrocyte hypertrophy, vascular invasion, and bone formation subsequently occurs at so-called secondary ossification centers. The remaining discrete layers of residual growth cartilage between the expanding bone in the primary and secondary ossification centers at the opposing ends of the long bone are then called the growth plates [5]. The chondrocytes of the growth plates provide the prime engine for further postnatal longitudinal bone growth. This process is typified by precise temporal and spatial regulation of chondrocyte proliferation and differentiation. In fetal life, all non-hypertrophic chondrocytes vigorously proliferate. As a formal growth plate forms, however, the chondrocytes near the top of the growth plate slow down their rate of proliferation dramatically and are thought of as “reserve” or “resting” cells that may serve as stem cells for all other chondrocytes. Under controls that are poorly understood, resting cells periodically become proliferating chondrocytes that undergo several rounds of proliferation. These proliferating cells flatten out, with their short axis parallel to the long axis of the long bone, and form

PEDIATRIC BONE

CELLULAR AND MOLECULAR CONTROL OF SKELETAL GROWTH

columns of stacked proliferating chondrocytes, with each column representing descendants of a distinct clone of cells. The lengthening of the bone derives primarily from the large number of proliferating chondrocytes and the matrix secreted by all of the chondrocytes, and from the substantial enlargement that each chondrocyte undergoes when it hypertrophies. Because the chondrocytes and their matrix ultimately disappear, however, normal osteoblast function in the primary spongiosa and in the area adjacent to the growth plate is also essential to allow the expansion of the bone length generated by chondrocyte activity to be translated into permanent lengthening. This fact is illustrated, for example, by the short bones of mice in which the essential transcription factor Runx2 was inactivated in osteoblasts [6,7]. Another absolute requirement for endochondral bone growth to proceed is the progressive neovascularization of the region where cartilage becomes replaced by primary spongiosa. Early studies revealed that blocking of the bone’s blood supply in vivo resulted in reduced longitudinal growth [8,9]. Molecularly, this process strongly depends on vascular endothelial growth factor (VEGF) signaling, as shown first by experiments inhibiting VEGF action in juvenile mice by administration of a soluble VEGF receptor chimeric protein (sFlt-1) [10]. These mice showed impaired vascular invasion of the growth plate and, concomitantly, trabecular bone formation and bone growth were reduced while the hypertrophic cartilage zone became enlarged. Thus, endochondral bone growth involves rigorous coupling of maturation and activity of chondrocytes, osteoclasts and osteoblasts, and vascular invasion. Ultimately, at least in humans, the growth plates completely disappear or “close” during puberty, in a process that actively requires the action of estradiol acting on estrogen receptor a (ERa) in both boys and girls (see below), and longitudinal bone growth stops. Remodeling of existing bone, replacing the primary spongiosa by lamellar bone in the secondary spongiosa and renewing the cortical bone, takes place throughout adult life, ensuring optimal mechanical properties of the skeleton and contributing to mineral ion homeostasis. This continual bone turnover is accomplished through the balanced action of osteoclasts and osteoblasts (see below) and results in a dynamic organization of honeycomb plate-like structures or trabeculae in the interior of the bone that are surrounded by blood vessels and bone marrow and housed within the cortical bone. Different from the endochondral ossification process outlined above, a small number of bones, primarily the flat bones of the skull, form without a cartilage mold by a mechanism termed intramembranous bone formation [11]. The development of these bones also starts with mesenchymal progenitor cells forming

57

condensations at the sites where the bones will be formed [12]. Yet, in the mesenchymal condensations of intramembranous bones, cells do not differentiate into chondrocytes but instead differentiate directly into pre-osteoblasts and then osteoblasts that deposit “osteoid” or bone matrix rich in type I collagen. As the osteoblasts mature further, the bone matrix becomes progressively mineralized. The growth of these bones occurs by waves of proliferation and differentiation of pre-osteoblasts at the perimeter of the growing bones. As the perimeters of adjacent bones approach each other, a specialized structure, the suture, forms. At the suture, proliferating mesenchymal cells differentiate into osteoblasts. Normal development of the cranium requires that the skull expands in close coordination with the growth of the underlying brain; sutures normally do not close completely until brain expansion ceases [11,13e15]. Bone growth is regulated by a large variety of transcriptional, paracrine and endocrine signaling systems. In this chapter, we focus on a few such systems, chosen because of their established importance in normal human physiology and disease. The cellular and molecular control of skeletal development and growth is first considered, followed by a discussion of some of the prime endocrine controlled regulatory systems of bone growth and remodeling.

CELLULAR AND MOLECULAR CONTROL OF SKELETAL GROWTH Spontaneous mutations in humans and mice and experimental manipulation of genes, either deletions or overexpression (causing loss- or gain-of-function) have identified many growth and transcription factors and signaling cascades involved in skeletal development and growth by regulating the coordinated differentiation and/or actions of the various cell types of bone, namely chondrocytes, vascular endothelial cells, osteoblasts and osteoclasts.

Growth Plate Biology: Chondrocyte Proliferation and Differentiation In endochondral bones, the initial conversion of progenitor cells in the mesenchymal condensations into chondrocytes is determined by the expression of the key transcription factor Sox9, whereas the combined action of Sox9, 5 and 6 is required to direct the subsequent differentiation of chondrocytes throughout all phases of the chondrocyte lineage [16,17]. These phases encompass the round upper or “reserve” chondrocytes, the flattened, columnar proliferating chondrocytes, the

PEDIATRIC BONE

58

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

FIGURE 4.2 Schematic view of the cellular structure of developing long bones. The epiphysis is composed of chondrocytes, organized in layers of proliferation (round periarticular and flat columnar proliferating cells), progressive differentiation towards the metaphysis (prehypertrophic and hypertrophic chondrocytes), and cell death (apoptosis). The avascular cartilage is supplied by the epiphyseal blood vessel network that overlays its surface. In the metaphysis, blood vessels invading the terminal hypertrophic chondrocytes, osteoclasts resorbing the cartilage, and osteoblasts building bone on the cartilage remnants, all act coordinately to replace the cartilage anlagen with bone and marrow.

pre-hypertrophic, and the hypertrophic chondrocytes, characteristically organized as stratified layers in the growth cartilage (Fig. 4.2). The progression of the chondrocytes through these stages is the driving force of actual bone lengthening and is tightly controlled by a myriad of local signaling molecules. Some of the best-characterized ones are the pathway governed by PTHrP and Ihh, and the FGFs; their importance is reflected by the fact that mutations in their signaling receptors are causal to a number of severe human dwarfing conditions. Mutations in the PTH/PTHrP receptor cause Jansen and Blomstrand chondrodysplasia [18,19], and constitutive activation of FGF receptor (FGFR)3 leads to human achondroplasia and thanatophoric dysplasia [20e23]. We will therefore briefly review the basic mechanisms by which these signaling

systems control the pace of proliferation and differentiation of growth chondrocytes. The PTHrP/Ihh pathway provides a major regulatory system in growth chondrocytes. Ihh, a member of the conserved family of hedgehog proteins, is produced by the pre-hypertrophic and early hypertrophic chondrocytes of the growth cartilage. By as yet not fully clarified mechanisms involving signaling through the receptor Patched (Ptc), Ihh acts directly on cells expressing PTHrP to stimulate the expression of PTHrP in chondrocytes located near the periarticular ends of the bone. PTHrP in turn signals back to its receptor (the PTH/ PTHrP receptor that also responds to PTH in osteoblasts and kidney) that is expressed at low levels by proliferating chondrocytes and strongly by pre-hypertrophic cells. The result of this PTHrP signaling is that the further chondrocyte differentiation to hypertrophy is slowed down and chondrocytes are kept in the proliferative state, thereby maintaining the adequate length of columns. By preventing premature hypertrophic differentiation, the generation of cells that can produce Ihh is consequently slowed down and, therefore, the production of PTHrP is lowered. Thus, PTHrP and Ihh regulate each other via a negative feedback signaling pathway that controls the pace of chondrocyte differentiation in the growth plate [24e26]. In addition, mutant mouse models revealed that Ihh regulates endochondral bone growth through PTHrP-independent mechanisms as well. These include a direct role of Ihh signaling in the regulation of chondrocyte proliferation and accelerated conversion of round to columnar cells, and Ihhinduced direct actions on the perichondrium controlling bone collar formation [27e30]. Perichondrial cells are driven into the osteoblast lineage under the influence of Ihh stimulating the expression of Runx2, an essential transcription factor in osteoblast development (see below). Conversely, Runx2 also regulates Ihh expression and hypertrophic differentiation [24,30,31]. Also beyond development, Ihh continues to be essential in regulating and maintaining the growth plate and sustaining postnatal bone growth, as shown by inducible mutagenesis in mice [32]. The FGF pathway involves multiple ligands and receptors that regulate cell proliferation, differentiation, and/or apoptosis in several processes, including skeletal patterning and bone growth. FGFs are involved in skeletogenesis at virtually every step from the initial outgrowth of the limb to postnatal lengthening of the long bones and formation of the intramembranous bones of the skull [33]. A total of 22 different FGFs have been identified in humans and mice. Expression of FGF-7, -8, -17, and -18 occurs in the perichondrium surrounding the growth plate, whereas FGF-2 is expressed in the periosteum of bone. FGF-2 and -9 are both expressed by

PEDIATRIC BONE

CELLULAR AND MOLECULAR CONTROL OF SKELETAL GROWTH

chondrocytes, whereas FGF-2 is also expressed by osteoblasts. In the growing skull, FGF-2, -4, and -9 are expressed in the mesenchyme of the suture, whereas FGF-18 and -20 are expressed by differentiating osteoblasts [33]. Four genes encode receptors for the FGF family (called FGF receptors 1 to 4 [FGFR1e4]), although the actual number of receptors is larger because of splice variants of these genes. Each encodes a transmembrane protein with tyrosine kinase activity that is triggered by ligand binding at the plasma membrane. The extracellular domain contains three immunoglobulin domains that contribute to ligand-binding specificity and affinity. In the endochondral bones, FGFR3 is expressed by proliferating chondrocytes, FGFR1 is expressed by prehypertrophic and hypertrophic chondrocytes, and FGFR2 is expressed by perichondrial cells. In the sutures of the growing intramembranous bones of the skull, FGFR1 is found in the mesenchyme, whereas both FGFR1 and FGFR2 are expressed in the differentiating osteoblasts of sutures. FGFR3 is expressed late at the osteoblastic front of sutures [33]. A series of inherited human diseases and mutations in mice have demonstrated the importance of individual components of this complicated network of ligands and receptors in bone development. First, activating mutations in FGFR3 result in chondrodysplasias and dwarfism. Genetic analysis of the role of FGF signaling in the growth plate has, however, been complicated by the multiple roles of FGF signaling during early stages of development. Secondly, mutations in FGFR1 or 2 cause craniosynostosis, which results in skeletal dysplasias characterized by premature fusion of one or more cranial sutures, such as occur in Apert, Crouzon, and other syndromes [34]. The molecular mechanisms that contribute to these FGFR gain-of-functions mutations are complex and include constitutive (ligand-independent) or ligand-dependent FGFR activity [34]. The current insights in the FGF/FGFR signaling functions in these two settings, endochondral and intramembranous ossification, are briefly discussed here and further (see below), respectively. Humans with constitutively active FGFR3, due to point mutations such as a glycine-to-arginine mutation at residue 380 in the receptor’s transmembrane domain, have a form of dominantly inherited short-limbed dwarfism called achondroplasia. Both milder and more severe chondrodysplasias are caused by other activating mutations of FGFR3 [23]. Corresponding transgenic animal models have helped clarify the mechanisms whereby activation of FGFR3 leads to dwarfism. Activation of FGFR3 in humans and mice or overexpression of FGF-2 in transgenic mice lead to a decrease in chondrocyte proliferation in the growth plate and increased apoptosis. Conversely, mice missing the

59

FGFR3 gene, normally expressed in proliferative chondrocyte columns, have elongated columns and longer bones than normal [33,35,36]. These findings were surprising since activation of FGF receptor tyrosine kinases typically leads to a positive effect on cellular proliferation in most tissues. Substantial evidence, however, suggests that FGFR3 activation in chondrocytes leads to activation of STAT1, which activates the cell cycle inhibitor p21Waf1/Cip1 and thereby decreases chondrocyte proliferation; the decrease in chondrocyte proliferation caused by FGF signaling in vivo and in vitro is blocked in chondrocytes from STAT1
/
mice [37e39]. In addition, in transgenic mice, activation of FGFR3 leads to a decrease in expression of Ihh and its receptor and downstream target Ptc, whereas in mice lacking FGFR3, Ihh and Ptc expression are upregulated [40e42]. Since Ihh stimulates chondrocyte proliferation, this provides a further, indirect mechanism supporting the decrease in chondrocyte proliferation after activation of FGFR3. Besides modulating proliferation, FGFR3 signaling in vivo also appears to affect chondrocyte differentiation, as mouse models of achondroplasia and thanatophoric dysplasia show delayed hypertrophic differentiation of chondrocytes [42e44]. During chondrocyte differentiation, the FGF and BMP pathways appear generally to antagonize each other [45]. Moreover, BMP-4 expression is altered in FGFR3 mutant mouse models, and both FGF signaling and BMP signaling regulate Ihh production. Thus, each of these pathways has multiple mechanisms for communicating with each other as they regulate chondrocyte proliferation and differentiation. Due to the plethora of FGFs expressed in the skeleton and the many actions of FGFs early in development, it remains difficult to identify the specific FGF ligands that normally activate FGFR3 in the growth plate. FGF18 [46e48] and FGF-9 [49] appear to be the most important FGF ligands in regulating chondrogenesis identified so far. These ligands activate FGFR3 expressed on proliferating chondrocytes. In this context, the observation that mice missing FGF-18 have a growth plate phenotype that closely resembles that of the FGFR3 knockout mouse is interesting, since it suggests that FGF-18, synthesized in the perichondrium surrounding the growth plate, is the primary activator of FGFR3 in chondrocytes [46e48]. This phenotype thus highlights the importance of interactions between cells in the perichondrium and chondrocytes in the growth plate [3]. Besides the abovementioned growth factors, chondrogenesis is also affected by several other growth factor and hormones, including BMPs, growth hormone (GH) and insulin-like growth factors (IGFs), thyroid hormone, estrogen, androgen, 1a,25-dihydroxyvitamin D3 (1,25(OH)2D3), glucocorticoids, as discussed below and/or in other chapters.

PEDIATRIC BONE

60

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

Blood Vessel Invasion of Cartilage and Bone Vascularization A crucial aspect of bone growth is the vascularization of the expanding bone center. This is particularly evident during endochondral ossification: the cartilage intermediate of the long bones represents a unique mesenchymal tissue in that it is itself avascular, while fully differentiated hypertrophic cartilage undergoes angiogenic invasion, a process that is associated with the decay of the terminal cartilage and its replacement by bone. The replacement of the initially avascular cartilage template by highly vascularized bone and marrow tissue occurs through three consecutive vascularization events (see Fig. 4.1). First, the initial vascular invasion of the cartilage anlagen during embryonic development (sometimes called quiescent angiogenesis) involves endothelial cells invading from the perichondrial tissues and organizing into immature blood vessels in the primary center of ossification. Second, capillary invasion at the metaphyseal border of the growth cartilage mediates rapid bone lengthening. Third, vascularization of the cartilage ends initiates the formation of secondary ossification centers (see Fig. 4.1). Vascularization is an absolute requirement for endochondral bone development and growth to proceed, as a physical blockage of blood vessel invasion into cartilaginous fetal skeletal explants completely halted their development [50], and blocking of the bone’s blood supply in vivo resulted in reduced longitudinal growth [8,9]. In fact, as a rule, any type of bone formation occurs in close spatial and temporal association with vascularization of the ossified tissue, a concept termed angiogeniceosteogenic coupling [51,52]. The reasons that the vascular system is crucial for bone growth, homeostasis and repair obviously include its intrinsic function to supply oxygen, nutrients and growth factors/hormones to the bone cells as required for their specified activities. On top of that, the blood vessels are thought also to serve to bring in (precursors of) osteoclasts that will degrade the cartilage or bone extracellular matrix, to remove end products of the resorption processes, and to bring in progenitors of osteoblasts that will deposit bone [4,53,54]. Here, we will briefly review the basic molecular players currently known to govern the survival of the avascular cartilage, its invasion by blood vessels and the vascularization of bone. Endochondral cartilaginous condensations typically develop for a prolonged period of time as an avascular tissue. Immature chondrocytes are resistant to vascular invasion due to the production of angiogenic inhibitors [55,56]. As the fetal growth plates expand in the absence of blood vessels during development, chondrocytes in the center of the cartilage consequently face the challenge of hypoxia [57,58]. The main mediator of the

cellular responses to hypoxia is the transcription factor hypoxia-inducible factor (HIF)-1. HIF-1 is a heterodimer of two proteins, HIF-1a and HIF-1b; HIF-1b is constitutively expressed, whereas HIF-1a is the hypoxia-responsive component of the complex [59]. Particularly the stability of the HIF-1a protein is hypoxia sensitive, through oxygen-dependent hydroxylation of specific residues within its amino acid sequence. In non-hypoxic conditions, a family of HIF prolyl 4-hydroxylases is responsible for the hydroxylation of two proline residues (P402 and P564) in the oxygen dependent degradation domain (ODDD) of HIF-1a. The E3 ubiquitin ligase Von Hippel-Lindau (VHL) binds to the hydroxylated HIF-1a, and targets it to the proteasome for degradation [60,61]. In hypoxic conditions, this hydroxylation of HIF1a does not occur, and HIF-1a is stabilized and able to translocate to the nucleus, heterodimerize with the b-subunit, and initiate its transcriptional program along with other co-factors. As a result, a variety of pathways involved in the cellular adaptation to hypoxia are activated, including key regulators of glucose utilization and cell metabolism (stimulating anaerobic glycolysis), angiogenesis, and erythropoiesis [62]. In the last years, studies using genetically modified mice have shed light on how the genetic program controlled by hypoxia modulates endochondral bone development, by establishing the essential and nonredundant role of HIF-1a in chondrogenesis in vivo [57,58,63,64]. Conditional deletion of HIF-1a in limb bud mesenchyme or in chondrocytes, achieved by the use of the Cre-loxP strategy, caused massive cell death of the inner chondrocytes in the developing growth plate. This cell death region corresponds to the central hypoxic region area of the fetal growth plate [58,65]. Thus, HIF-1a is required for survival of the hypoxic chondrocytes located in the center of the growth cartilage, furthest from blood vessels. The precise mechanisms by which HIF-1a prevents chondrocyte death have yet to be fully explained. Likely, the transcriptional activity of HIF-1a is, on the one hand, required for turning on vital oxygen-sparing metabolic pathways that allow chondrocytes to survive and differentiate in their hypoxic environment. Activation of anaerobic glycolysis in mammalian hypoxic cells is HIF-1a-dependent [66]. During skeletogenesis, phosphoglycerate-kinase1 (PGK), a key enzyme of anaerobic glycolysis, was found to be strikingly stronger expressed in developing cartilage than in the surrounding tissues; HIF-1a-deficient chondrocytes, however, failed to upregulate PGK expression [58]. On the other hand, HIF-1a may additionally provide an indirect survival effect by inducing the expression of its downstream target VEGF, a principal regulator of blood vessel formation [67]. Deletion of VEGF from cartilage causes a cell death phenotype in the center of the fetal growth plate that closely mimics

PEDIATRIC BONE

CELLULAR AND MOLECULAR CONTROL OF SKELETAL GROWTH

what is observed in HIF-1a deficient growth plates [65,68]. Moreover, hypoxia increases VEGF accumulation in chondrocytes in vitro in an HIF-1a-dependent manner [69,70]. Thus, HIF-1a-mediated upregulation of VEGF and induction of angiogenesis in the perichondrial tissues surrounding the avascular cartilage is likely one of the mechanisms by which chondrocytes survive hypoxia. In addition to the low level of expression of VEGF noted in the central, hypoxic immature chondrocytes of the growth cartilage [65,68], VEGF is at all times expressed abundantly by late hypertrophic chondrocytes, where it is critical for blood vessel invasion and replacement of cartilage by bone [10,71e73]. Inhibition of VEGF action in juvenile mice by administration of a soluble VEGF receptor chimeric protein (sFlt-1) impaired vascular invasion of the growth plate; concomitantly, trabecular bone formation and bone growth were reduced and the hypertrophic cartilage zone became enlarged likely due to reduced osteoclast-mediated resorption [10]. Further mouse genetic studies univocally established that VEGF is an essential physiological mediator of all three key vascularization stages of endochondral bone development (see above and Fig. 4.1). These mouse models include the Cre/LoxP-mediated conditional inactivation of the VEGF gene in chondrocytes, and genetically engineered mice expressing only one of the three major VEGF isoforms [65,68,72e75]. Altogether, these models have exposed multiple essential roles of VEGF and its isoforms in endochondral ossification, not only as a key inducer of vascularization but also as a direct modulator of bone development by affecting the various cell types involved. Perichondrial cells, osteoblasts and osteoclasts are all well documented to express several of the VEGF receptors and to respond to VEGF signaling by enhanced recruitment, differentiation, activity and/or survival (reviewed in [71,76,77]. The current model is that VEGF is produced at high levels by hypertrophic chondrocytes and is partly sequestered in the cartilage matrix upon its secretion. Trapped VEGF can be released from the matrix by proteases such as matrix metalloproteinase (MMP) 9 secreted by osteoclasts/chondroclasts during cartilage resorption. VEGF can then bind to its receptors on endothelial cells and stimulate the guided attraction of blood vessels to invade the terminal cartilage [78]. Osteoblasts and osteoclasts, or precursors thereof, associated with the newly vascularized bone region may at the same time be affected by the VEGF signaling in their recruitment, proliferation, differentiation and function. These pleiotrophic actions of VEGF on the various cells in the bone environment may contribute to the tight coordination of vascularization, ossification, and matrix resorption that is characteristically seen in endochondral bone development and growth [71,77].

61

Since the loss-of-function models pointed out that VEGF is a positive regulator of bone development, skeletal growth and fracture repair [10,72,73,79,80], VEGF appears as an interesting target for stimulating fracture healing [81]. While it is being currently tested in preclinical models as a potential bone regeneration therapy, data using mice overexpressing VEGF temporally in the skeleton suggest that increasing the tightly coupled processes of angiogenesis and osteogenesis might be associated with potential side effects including disturbances in hematopoiesis [82]. In general, the actions of VEGF are highly dose dependent, and its physiological levels must be under very strict control mechanisms. Although the regulation of VEGF expression in the skeleton is still largely unresolved and may vary depending on the developmental stage and specific location and cell type, several mechanisms have been implicated to date. Hypoxia is a crucial trigger of VEGF expression in chondrocytes, osteoblasts, and possibly osteoclasts, through mechanisms that at least in part involve HIF [69,70,83e85]. During early bone development, Runx2 may be an important inducer of VEGF expression and blood vessel invasion into cartilage [86]. In addition, several hormones (including PTH, GH, 1,25(OH)2D3) and locally produced growth factors (e.g. FGFs, transforming growth factor-b [TGFb], BMPs, IGFs, plateletderived growth factor [PDGF]) have been demonstrated to be involved, at least in vitro, in the regulation of VEGF expression (see [76]).

Ossification: Osteoblast Differentiation and Activity Osteoblasts are highly specialized cells able to deposit and mineralize large amounts of matrix rich in type I collagen. Like chondrocytes, osteoblasts are cells of mesenchymal origin; they are thought to descend from mesenchymal stem cells that are pluripotent and have the capacity to differentiate into a variety of cell types, including adipocytes, chondrocytes and osteoblasts [87e89]. The prime transcription factors required to directing the cells into the osteoblastic lineage are b-catenin, Runx2 (previously termed Cbfa1), and Osterix, as discussed below [90,91]. Once committed, pre-osteoblasts further differentiate into mature osteoblasts secreting type I collagen and other bone matrix components, together called osteoid. Subsequently, osteoblasts direct the mineralization of the osteoid in a process that requires active alkaline phosphatase (ALP), expressed on the osteoblast membrane. These mature osteoblasts express characteristic genes including the gene encoding osteocalcin. Ultimately, the cells die through apoptosis, are converted to bone lining cells or become embedded within the bone matrix as osteocytes. Osteocytes are the most abundant

PEDIATRIC BONE

62

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

cell type in postnatal bone, playing roles in the sensing of mechanical forces, the regulation of bone formation and resorption, and the control of phosphate homeostasis [92,93] (see further). Here, we will discuss a number of crucial transcription factors and extracellular signaling molecules that have been shown to control various aspects of osteoblast biology, including Wnt/b-catenin signaling, Runx2 and Osx, and actions elicited by BMPs, hedgehogs (Hh), and FGFs. At least some of these are currently known to play a role in inherited human bone diseases. Wnt/b-catenin Signaling Wnts (wingless-type MMTV integration site) are a large family of secreted growth factors (19 different members in the mouse and human genomes) that play essential roles in multiple developmental processes. Wnts are also required for adult tissue maintenance, and perturbations in Wnt signaling can lead to tumor formation and other diseases [94,95]. In the skeletal system, mutations in Wnt signaling components lead to skeletal malformations and diseases such as osteoporosis-pseudoglioma and osteoarthritis (see below). Wnt pathway modulation, particularly neutralizing inhibitors of Wnt signaling, has emerged as a promising strategy to improve bone mass. These drugs are exciting breakthroughs but are not without risks; the challenges include tissue-specific targeting and consequently, long-term safety [96e98]. Wnts can transduce their signals through several different downstream signaling pathways. The best understood pathway is the canonical or Wnt/b-catenin pathway. Central to this pathway is the regulation of the protein stability of b-catenin, which acts as a transcription factor in the canonical Wnt pathway and is also involved in cell adhesion by binding to membranous cadherins. In the absence of Wnts, cytoplasmic b-catenin is constitutively degraded through its phosphorylation by glycogen synthase kinase 3-b (GSK3-b) that targets it to the ubiquitineproteasome pathway. Upon signaling by Wnts, b-catenin is stabilized and translocates to the nucleus, where it interacts with T-cell factor (TCF)/lymphoid enhancer factor (LEF) family transcription factors to regulate the expression of its target genes. In addition, other pathways affecting GSK3-b (e.g. phosphatidyl inositol 3 [PI3]-kinase pathways) can also modulate b-catenin transcriptional activity [94,95,99,100]. The importance of b-catenin in skeletal biology was proven by conditional b-catenin loss- and gain-offunction mouse models elucidating its role as a crucial transcription factor in (i) determining osteoblast lineage commitment of early osteo-chondroprogenitors [101e104] and (ii) coupling osteoblast to osteoclast activity [105]. The first set of studies provided evidence

that, in mesenchymal progenitor cells in the perichondrium and calvarium where cells are destined to become osteoblasts, Wnt signaling is high, leading to high levels of b-catenin inducing the expression of genes that mediate osteoblast differentiation (such as Runx2) while inhibiting transcription of genes required for chondrocyte differentiation (such as Sox9). In the absence of b-catenin, these cells become chondrocytes instead of osteoblasts, as revealed via genetic modifications in mice. Conversely, in the inner region of the condensations, Wnt signaling must be low, as these cells become chondrocytes (see [100]). Secondly, inactivation of bcatenin in differentiated osteoblasts [105] or osteocytes [106] revealed that its transcriptional activity is important for stimulating osteoblastic production of osteoprotegerin (OPG or TNFRSF11B, see below), an inhibitor of osteoclast formation. As such, b-catenin plays a role in the coupling between osteoblast and osteoclast activity, the central principle of bone remodeling and maintenance of bone mass (see below). Upon Wnt stimulation, the ligands bind to two synergistically acting families of Wnt (co)-receptors, the Frizzled (Fzd) receptor family members (10 known) and low-density lipoprotein receptor-related proteins (LRP5 or LRP6). This leads to the recruitment of axin to LRP5/6 in the plasma membrane. The sequestering of axin at the plasma membrane on its turn likely leads to the disassembly of the b-catenin destruction complex, thus mediating the stabilization and transcriptional activity of b-catenin. Activation of the pathway is normally constrained by the expression of secreted Wnt inhibitors such as Dickkopfs (Dkks), sclerostin, and secreted frizzled-related proteins (Sfrps). Members of the Dkk family and sclerostin bind to LRP5/6, and thereby block the ability of Wnt ligands to interact with these co-receptors. Proteins of the Sfrp family can directly bind to Wnt ligands, offering another way to inhibit activation of the pathway [94,95,98,107]. Mutations in the Wnt receptor complexes and Wnt antagonists have been clinically associated with changes in bone mineral density and fractures. Loss-of-function mutations in the LRP5 co-receptor cause the autosomal recessive disorder osteoporosis-pseudoglioma syndrome (OPPG), which is characterized by low bone mass, ocular defects, and a predisposition to fractures [108]. These findings were recapitulated in germline LRP5 knockout mice, which developed a low bone mass phenotype similar to patients with OPPG due to decreased osteoblast proliferation [109]. Conversely, gain-of-function mutations in the same group that render LRP5 with reduced affinities for the secreted antagonists Dkk1 and sclerostin result in high bone mass phenotypes [110e113]. There is debate as to whether these actions of LRP5 are direct or indirect actions on bone; argumentation to the latter is the

PEDIATRIC BONE

CELLULAR AND MOLECULAR CONTROL OF SKELETAL GROWTH

finding that activation of LRP5 in the duodenum, rather than in osteoblasts, increased osteoblast proliferation by suppressing serotonin secretion; the lower blood levels of gut-derived serotonin lead to an increase in bone mass through less serotonin binding to its osteoblast receptor, 5-hydroxytryptamine (Htr1b), and activation of the cAMP responsive element binding protein (CREB) transcription factor [114]. Mutations in SOST have also been identified in patients, namely those diagnosed with van Buchem disease and sclerosteosis, diseases associated with high bone mass [115,116]. Altogether, these findings over the last decade highlighted the important role of canonical Wnt signaling in regulating human bone mass. Extensive research is therefore being conducted in this area based on the prospect that it can possibly lead to pharmacological intervention useful in the management of osteoporosis. Among the candidate therapeutics are small molecule inhibitors of GSK3b, neutralizing antibodies to Dkk1, secreted Frizzled-related protein 1, and sclerostin. Since osteocytes are the major producer of sclerostin, inhibition of this Wnt antagonist appears as a particularly promising strategy to prevent bone loss without causing adverse side effects, such as related to the tumorigenicity and toxicity to other tissues of activated Wnt signaling [96e98]. Runx2 and Osterix: Essential Transcription Factors in Osteoblastogenesis Runx2 (runt related transcriptional factor 2, previously known as core-binding factor a1 [Cbfa1], Osf2, or AML3) and Sp7/Osterix determine the osteoblast lineage from mesenchymal stem cells along with canonical Wnt signaling. In the process of osteoblast differentiation, these factors and canonical Wnt signaling molecules inhibit mesenchymal cells from differentiating into chondrocytes and adipocytes. Runx2, a transcription factor of the ancient runt family, is the earliest known marker essential for the production of the osteoblast lineage. Functional studies have demonstrated that it is a central regulator of osteoblast differentiation and function, and absolutely essential for the induction of osteoblasts and the formation of endochondral and intramembranous bone. The dominant role of Runx2 is illustrated by the fact that Runx2-deficient mice completely lack osteoblasts and do not form bone at all e instead a completely cartilaginous skeleton develops without any true bone matrix [7,117]. In heterozygous (haploinsufficient) Runx2 mutant mice, the defect in osteoblast differentiation is limited to intramembranous bones [117]. The resulting phenotype in these mice closely resembles the cleidocranial dysplasia (CCD) syndrome in humans, a dominantly inherited developmental disorder of bone, and RUNX2 is mutated in most CCD patients [118,119]. Consistent with its function as an early transcriptional regulator of osteoblast

63

differentiation, Runx2 is also an early molecular marker of the osteoblast lineage, being highly expressed in perichondrial mesenchyme and in all osteoblasts. Pre-hypertrophic chondrocytes also express Runx2, and Runx2 plays important roles in cartilage biology as well. Runx2 can be sufficient to induce differentiation of mesenchymal cells into osteoblasts: its ectopic expression in non-osteoblastic cells leads to the expression of osteoblast-specific genes in vitro and in vivo [6]. Runx2 binds to an osteoblast-specific cis-acting DNA element present in the promoter of most genes expressed in osteoblasts; as such, Runx2 mediates osteoblast differentiation by inducing ALP activity, and regulating the expression of a variety of bone matrix protein genes, including the Col1a1, osteopontin, osteonectin, bone sialoprotein, and osteocalcin genes and Runx2 itself [120,121]. The regulation of different stages of osteoblast differentiation by Runx2 is, however, very complex; Runx2 transcriptional regulation involves interactions with a myriad of transcriptional activators and repressors and other co-regulatory proteins that are under continued investigation. The current model is that Runx2 triggers the expression of major bone matrix protein genes and the acquisition of an osteoblastic phenotype at an early stage of osteoblast differentiation, while inhibiting the late osteoblast maturation stages and the transition into osteocytes. As such, Runx2 may play an important role in maintaining a supply of immature osteoblasts. Runx2 must thus be suppressed for immature osteoblasts to become fully mature osteoblasts, which form mature bone with regularly and densely packed collagen fibrils and high mineralization [120,121]. Furthermore, Runx2 regulates the expression of RANKL and OPG in osteoblasts, thus affecting osteoclast differentiation (see below). Runx2 is also required for the expression of Osterix (encoded by the Osx or Sp7 gene), an SP family transcription factor with three zinc finger motifs. Osterix is expressed in osteoblast progenitors, osteoblasts, and at a lower level also in pre-hypertrophic chondrocytes [4,122]. Like Runx2-deficient mice, mice lacking Osterix showed complete lack of osteoblasts and absence of both intramembranous and endochondral bone formation [122]. Thus, Osterix is a third transcription factor that is essential for osteoblast differentiation. Since Runx2 is expressed in the mesenchymal cells of Osx-null mice but Osterix is not expressed in Runx2-null mice, it can be concluded that Osterix acts downstream of Runx2 [122]. Furthermore, the Osx gene contains a consensus Runx2-binding site in its promoter region, suggesting that Osterix might be a direct target of Runx2 [123]. The transcriptional activity of Osterix involves its interaction with NFATc1 cooperatively forming a complex that binds to DNA and induces the expression of Col1a1 [124]. The subtleties of how Osterix regulates

PEDIATRIC BONE

64

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

osteoblast differentiation and function, and which osteoblastic genes are directly regulated by Osterix are as yet to be elucidated. Expression of genes characteristic of mature osteoblasts (such as those encoding bone sialoprotein, osteopontin, osteonectin, osteocalcin) was absent in cells surrounding chondrocytes in Osx-null mice, and instead these cells express genes characteristic of chondrocytes (Sox9, Sox5, Col2a1) [122]. Osterix has also been reported to inhibit chondrogenesis in vitro [125,126]. Thus, Osterix may be important for directing precursor cells away from the chondrocyte lineage and toward the osteoblast lineage. Besides b-catenin, Runx2, and Osterix, various other (non-bone-specific) transcription factors are also involved in the genetic control of osteoblast differentiation and function, albeit not to a similar critical extent as their inactivation does not completely abrogate bone formation. These include ATF4, Msx1 and Msx2, Dlx5, Dlx6 and Dlx3, Twist, activator protein-1 (AP1) and its related molecules (Fos/Jun), and Schnurri-2 and -3 (for reviews and references therein, see [91,120,127,128]). Secreted Local Signaling Molecules Involved in Osteoblastogenesis A myriad of morphogens and signaling molecules control the activity of the transcription factors just described. These molecules include Wnts, as discussed before, as well as locally produced BMPs and TGF-b, Hedgehogs (particularly Ihh), FGFs, Notch ligands, IGFs, PDGF, and systemic factors like PTH, GH, prostaglandins, estrogens, androgens, 1,25(OH)2D3 and glucocorticoids. The roles of the signaling pathways involving BMPs, Ihh, and FGFs in osteoblastogenesis and bone formation are briefly reviewed here; the endocrine control of bone growth and remodeling is provided further (see below and other chapters). The family of growth factors that has received a tremendous amount of attention is that of the BMPs. These are members of the transforming growth factorb superfamily of growth factors that can, when applied locally, induce de novo bone formation; some BMPs, including BMP-2 and BMP-7, are therefore clinically used in orthopedics [129,130]. BMPs transduce signals through serine/threonine kinase receptors, composed of type I and II subtypes, activating intracellular Smads that relay the BMP signal to target genes in the nucleus [131, 132]. The analysis of their functions in vivo has relied mostly on gene deletion experiments. Although several BMPs affect skeletal patterning and joint formation, it has proved difficult using this approach to elucidate how they affect osteoblast differentiation. BMPs are crucial for regulating development in almost all the principal organs and tissues [131,133]. In the morphogenesis of the skeleton, BMPs have been

implicated in early limb patterning, mediating the correct formation, size or shape of the mesenchymal condensations, as well as converting the condensing mesenchymal cells into chondrocytes [134e136]. Their functions in osteogenesis during development, postnatal bone formation and remodeling, and fracture repair have therefore been hard to document in vivo because, in some cases, the inactivation of specific BMPs led to severe early defects and lethality (e.g. BMP-2, -4), precluding investigation of the later stages. In other cases, removal of individual family members (such as BMP-7) displayed no defects in skeletogenesis, presumably due to functional redundancy between the various BMP ligands and receptors [137]; around 20 BMP family members have been identified to date, and perichondrial cells, osteoblasts, and chondrocytes express multiple BMPs, BMP receptors, and BMP antagonists. Recent and ongoing studies therefore employ conditional (site-specific) and/or combined (multiple targets) mutagenesis strategies. As such, the double knockout of BMP-2 and BMP-4 in the limb completely disrupted osteoblast differentiation, demonstrating the crucial roles of these two BMPs in osteoblast differentiation [138]. Effects of BMP signaling in later stages of the osteoblast differentiation are suggested by studies using BMP antagonists. Targeting noggin overexpression to differentiated osteoblasts by the osteocalcin promoter results in osteopenia by 8 months of age [139]. Likewise, overexpression of gremlin, another BMP antagonist, in differentiated osteoblasts results in reduced bone mineral density and fractures [140]. On the other hand, a recent report using an osteoblast-targeted deletion of BMP receptor signaling indicated that BMP signaling in osteoblasts physiologically induces bone resorption by enhancing osteoclastogenesis via the RANKL-OPG pathway, thereby reducing bone mass [141]. Overall, signaling by BMPs plays an important role in a variety of cell types in bone such as osteoblasts, chondrocytes, and osteoclasts, and the precise mechanisms underlying their actions during bone growth have not yet been fully elucidated due to the considerable complexity and involvement of a myriad of interacting pathways. Nevertheless, particularly BMP-2 has been shown to play a critical role in osteogenic differentiation: it promotes the commitment of pluripotent mesenchymal cells to the osteoblast lineage [142,143] and has been demonstrated to induce the expression of both Runx2 and Osx during osteoblastogenesis [144e147]. The activity of BMP-2 as a potent inducer of bone formation is being applied to repair bone defects in humans [129,130,148]. Moreover, a human genetic study indicated that polymorphisms of BMP-2 gene expression are linked to a high risk for osteoporosis [149].

PEDIATRIC BONE

CELLULAR AND MOLECULAR CONTROL OF SKELETAL GROWTH

The Hedgehog family member Ihh is required for endochondral but not for intramembranous bone formation, by controlling osteoblast differentiation in the perichondrium of long bones. This statement is based on the finding that Ihh-deficient mice have disorganized growth plates, as expected (see above), but also completely lack osteoblasts in bone formed through endochondral ossification; however, these do appear to be present in the skull, the mandibles, and the clavicles e bones that form by intramembranous ossification [30,150]. In these mice, Runx2 is expressed in chondrocytes but not in perichondrial cells. As well, nuclear b-catenin is absent in the perichondrial cells of Ihh-deficient mice [103]. Thus, Ihh is required for inducing the initial activity of Runx2 and b-catenin in perichondrial cells and triggering them to become endochondral osteoblasts, thereby coupling chondrocyte maturation to osteoblast differentiation during endochondral ossification. Chondrocyte-derived Ihh remains crucial for sustaining trabecular bone also in the postnatal skeleton [32]. Skeletal abnormalities have been described in mutant mice lacking some of the intracellular mediators of Ihh signaling termed Gli proteins (three related transcription factors Gli1, Gli2 and Gli3); Gli2 mediates Ihh-induced osteoblast differentiation in mesenchymal cell lines by associating with Runx2 and stimulating its expression and function, as well as inducing BMP-2 expression [151,152]. FGF signaling has also been implicated in the proliferation of immature osteoblasts and the anabolic function of mature osteoblasts in vivo [46,48,153e155]. Whether and how osteoblast differentiation per se is affected by FGFs is currently elusive, but evidence indicates that FGF signaling induces BMP-2 expression and stimulates the expression and transcriptional activities of Runx2 [156e158]. Conversely, Runx2 has been demonstrated to form a complex with Lef1 or TCF that binds to the promoter region of the gene encoding FGF18, inducing its expression [159]. These findings underscore once more how the various pathways that are essential for endochondral and intramembranous bone development physically and functionally converge. Moreover, the ultimate outcome relies on the complex integration of both stimulatory and inhibitory signaling. In any case, FGFs and their receptors have important roles in the growth of intramembranous bones and the bone adjacent to growth plates in endochondral bone growth. In the cranial vault, inappropriately rapid differentiation of osteoblasts at the sutures, when combined with normal or increased cell proliferation, can lead to craniosynostosis, the premature fusion of sutures. This is a serious condition because it does not allow the normal growth of the brain and neural structures. As noted earlier, FGFs and their receptors are expressed in sutures. Activating mutations of FGFR1 or 2 in humans

65

can cause craniosynostosis [34]. The ligands most crucial for activating FGF receptors in sutures and osteoblasts of the limb are uncertain. However, genetic evidence in mice established that both FGF-2 and FGF-18 are important [46e48,158]. Thus, multiple FGFs and FGF receptors are needed for normal osteoblast production and differentiation.

Bone (Re)Modeling: Osteoclastogenesis, Bone Resorption, and the Coupling Principle The Role of Osteoclasts in Bone Modeling and Remodeling Osteoclasts are giant multinucleated cells that have the unique capacity to efficiently degrade calcified tissues. During development and growth of the endochondral bones, the main tissue to be resorbed is the calcified cartilage matrix produced by hypertrophic chondrocytes. Coinciding in time and place with the vascular invasion of the terminally differentiated chondrocytes, the calcified cartilage is co-invaded by osteoclasts, or a postulated related cell type termed “chondroclasts” [160]. Osteoclasts are not strictly essential for the excavation of the marrow space and its colonization by blood vessels and bone-forming osteoblast lineage cells to replace the hypertrophic chondrocytes during endochondral bone development [4,161]. However, the degradation, digestion and removal of the septa of calcified cartilage does require osteoclasts, as mice lacking osteoclasts, such as in the case of receptor activator of nuclear factor-kB (RANK)-deficiency (see below), display poorly remodeled osteocartilaginous structures instead of normal trabecular bone [4,161]. Moreover, such mice present with disorganized growth plates and impaired longitudinal bone growth, leading to a small body size and short limbs [161]. Not surprisingly, antiresorptive drugs such as bisphosphonates can interfere with bone modeling (shaping) during growth [162,163]. Bone, like many other organs in the body, goes through a tremendous amount of destruction and growth during childhood. Bisphosphonates potently decrease the activity of osteoclasts, which can lead to the accumulation of growth plate residues within trabecular bone tissue. Calcified cartilage has a high mineral density and therefore contributes to increase densitometric results, but is less resistant to fractures than is normal bone. Low remodeling activity might also delay bone healing after injury. This is of clinical interest, for instance in the treatment of juvenile osteoporosis during growth and of osteogenesis imperfecta (OI). OI is a genetic disease characterized by increased bone fragility and low bone mass due to the synthesis and secretion of defective type I collagen

PEDIATRIC BONE

66

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

molecules by the osteoblasts [164]. In the majority of OI patients, the disease is inherited in an autosomal dominant manner and can be linked to mutations in one of the two genes encoding collagen type I a chains (COL1A1 and COL1A2). This can be viewed as a near complete arrest of the normal osteoblast function in the most severe forms. Human OI patients exhibit characteristic short stature, which has been attributed to increased incidence of bone fractures, defective bone matrix production, and poor mineralization [165], hence illustrating the critical role played by the osteoblasts in the control of longitudinal growth. Disrupted growth plate structure was observed in severe OI patients and in various mutant mouse strains modeling the disease [165,166]. Pamidronate, a nitrogen-containing bisphosphonate that interferes with osteoclast activity, is now used worldwide to treat children and adolescents with moderate to severe forms of OI [167,168]. The hypothesis initially underlying the use of an anti-osteoclast medication in an osteoblast disorder such as OI was that a decrease in the activity of the bone resorbing system might compensate for the inadequate functioning of the bone-forming cells. This treatment has been reported to increase lumbar spine bone mineral density and metacarpal cortical width, to decrease fracture rate, and to improve mobility. These results are very encouraging, but the fact that bisphosphonates so effectively inhibit osteoclastic action raises concern that this form of treatment could further compromise longitudinal bone growth in OI children; therefore, treatment with bisphosphonates during growth is mainly reserved for patients with significant clinical problems [164,167,168]. Throughout further postnatal life, osteoclasts primarily act to degrade mineralized bone during the constant process of bone remodeling. Indeed, bone is continuously renewed via a process of self-destruction followed by a regeneration process. Its purposes are to repair damaged bone, remove old bone, and facilitate skeletal responses to changes in loading requirements and physiologic needs in ensuring mineral homeostasis. This dynamic nature of the skeleton is achieved by the coordinated actions of osteoclasts, osteoblasts, osteocytes within the bone matrix and osteoblast-derived lining cells that cover the surface of bone. In short, remodeling initiates with signals that stimulate osteoclast formation, followed by osteoclast-mediated bone resorption, a reversal period, and then a long period of bone matrix formation and mineralization mediated by osteoblasts [169,170] (Fig. 4.3). Packets of the existing trabecular and cortical mineralized bone tissue that are renewed during remodeling are called bone remodeling units (BRUs) or bone multicellular units (BMUs) [169]. The bone in an activated BRU is first removed by osteoclastic bone resorption in a process that takes a few weeks (see Fig. 4.3). During

FIGURE 4.3 Three-phase model of bone remodeling. The skeleton is a metabolically active organ that undergoes continuous remodeling throughout life. Bone remodeling involves the removal of mineralized bone by osteoclasts followed by the formation and subsequent mineralization of bone matrix by osteoblasts. Initiation starts with recruitment of hematopoietic precursors and their differentiation to osteoclasts, induced by osteoblast lineage cells that express osteoclastogenic ligands such as RANKL. Osteoclasts become multinucleated and resorb bone. Transition is marked by switching from bone resorption to formation via coupling factors, possibly including diffusible factors (e.g. hormones), membrane-bound molecules (e.g. ephrins), and factors embedded in bone matrix that become released upon osteoclastic bone resorption and can stimulate osteoblast recruitment, differentiation and/or activity. During the termination phase, the resorbed lacuna is refilled through bone formation by osteoblasts that later flatten to form a layer of lining cells on the bone surface or become osteocytes connected by canaliculi within the bone.

the time lag that occurs between the end of resorption and the beginning of formation, called the reversal phase, osteoblastic cells differentiate on the bone surface and deposit the organized matrix that then becomes mineralized. Hence, the lost bone is replaced by osteoblastic bone formation, lasting 3e4 months for one packet. This discrepancy in the kinetics of bone resorption and formation partly explains how increased resorption, even when accompanied by coupled increased formation, can cause bone loss, for example, in estrogen deficiency or hyperparathyroidism [169]. Excessive osteoclast activity can be the basis of several pathological conditions including osteoporosis, a common low bone mass disorder typically prevalent in postmenopausal women, but also periodontal disease, rheumatoid arthritis, multiple myeloma, Paget’s disease and metastatic cancer. On the other hand, impaired osteoclast differentiation and/or function leads to osteopetrosis, a rare human disease characterized by increased bone mass and obliteration of the bone marrow cavity. Many efforts have been made to dissect the regulatory pathways controlling osteoclast differentiation and function; the most important of those are reviewed here.

PEDIATRIC BONE

CELLULAR AND MOLECULAR CONTROL OF SKELETAL GROWTH

Osteoclastogenesis Osteoclasts derive from hematopoietic precursor cells of the myelomonocytic lineage and share a common precursor with macrophages. The early differentiation of the bipotential macrophage/osteoclast precursor cells is regulated by PU.1, a versatile hematopoietic cellspecific transcriptional regulator of the ETS-family. Particularly, the commitment to macrophages/osteoclasts is dependent on high level/activity of PU.1; consequently, PU.1 null mice lack both macrophages and osteoclasts, and are osteopetrotic [171,172]. This is a cell autonomous defect that can be corrected by bone marrow transplantation [172]. PU.1 regulates the lineage fate decision of the early progenitors by directly controlling expression of the c-Fms gene that is a key determinant of differentiation into the macrophage/osteoclast lineage (see below) [173]. PU.1 also regulates the transcription of another key osteoclastogenesis control gene, receptor activator of nuclear factor-kB (RANK) (see below) in myeloid progenitors [174]. Although mature macrophages and osteoclasts have some cell surface markers in common, the latter express high levels of tartrate-resistant acid phosphatase (TRAP), cathepsin K, vitronectin, calcitonin receptor and avb3 integrin, that typify the osteoclast lineage (see below). PU.1 is the earliest marker of osteoclast differentiation; yet, the signals that induce its expression and that of other cell-specific transcription factors involved in osteoclastogenesis are as yet unresolved. Among the other transcription factors that control osteoclast differentiation and function is NF-kB, which appears to play a role early during osteoclast differentiation. NF-kB is formed as a dimer composed of various combinations of proteins: p50, p52, p65, c-Rel, RelA and RelB [175]. Mice deficient in both p50 and p52 harbor an osteopetrosis phenotype due to an arrest of osteoclast differentiation; the presence of a large number of macrophages in these mice places NF-kB downstream of PU.1 in the genetic pathway controlling osteoclast differentiation [176,177]. NF-kB increases the expression of another transcription factor, c-Fos, which is the cellular homolog of the v-Fos oncogene and a major component of the activator protein (AP)-1 transcriptional complex [178]. The deletion of c-Fos in mice caused an early arrest of osteoclast differentiation leading to osteopetrosis, while again macrophage numbers were enhanced [179,180]. c-Fos interacts with the master transcription factor for osteoclastogenesis, nuclear factor of activated T cells c1 (NFATc1), to induce osteoclast-specific genes such as those encoding TRAP and calcitonin receptor (see below) [181,182]. After the precursor cells have committed to the osteoclast lineage, they become subjected to a complex multistep process culminating in the generation of

67

mature, multinuclear activated osteoclasts; these steps include proliferation, maturation and fusion of differentiating precursor cells, and finally activation of resorption. Several secreted molecules and signaling proteins control the process of osteoclast differentiation and function. The requirement for secreted molecules to control osteoclastogenesis was first documented with the genetic elucidation of a classical mouse mutation called op/op [183]. Mice homozygous for this recessive mutation lack osteoclasts and macrophages. The osteopetrotic phenotype of op/op mice is not cured by bone marrow transplantation, indicating that it is non-cell-autonomous defect [116,183]. The gene mutated in op/op mice encodes the growth factor macrophage colony-stimulating factor (M-CSF) [183]. The second critical cytokine essential for osteoclastogenesis is receptor activator of nuclear factor-kB ligand (RANKL) (also known previously as osteoprotegerin ligand [OPGL], osteoclast differentiation factor [ODF], or tumor necrosis factor [TNF]-related activationinduced cytokine [TRANCE]). As M-CSF, this signaling molecule is also strongly expressed by bone marrow stromal cells (i.e. osteoblast progenitors) and osteoblasts; M-CSF is produced in both a soluble and a membrane-bound form, while RANKL is made exclusively as a membrane protein by osteoblasts. The process of osteoclastogenesis requires direct cell-to-cell interaction between stromal/osteoblastic cells and osteoclast precursors presumably because of these key membrane-bound ligands. Both PTH and 1,25(OH)2vitaminD3 as well as several other osteotropic factors stimulating resorption increase the expression of RANKL on stromal/osteoblastic cells. Furthermore, not only osteoblasts but also chondrocytes and T cells synthesize and secrete RANKL and are able to support osteoclastogenesis. This may be important physiologically during osteoclast differentiation and invasion at the hypertrophic cartilage during endochondral bone development and growth, and definitely plays a major role pathologically. For instance, production of RANKL by T cells has been implicated as an activator of osteoclastic resorption in inflammatory-mediated bone and cartilage destruction such as seen in several autoimmune disorders including rheumatoid arthritis, likely working synergistically with TNF-a (for reviews, see [181,182,184e186]. M-CSF and RANKL affect several steps of the osteoclastogenesis cascade by binding to their respective receptors, c-Fms and RANK, that are expressed by osteoclast progenitors and osteoclasts at all stages of differentiation. M-CSF signaling is essential early on in the lineage for proliferation, differentiation and survival of the osteoclast/macrophage precursors. RANKL is an essential inducer of multiple aspects of osteoclastogenesis, including osteoclast differentiation, fusion, activation of

PEDIATRIC BONE

68

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

mature osteoclasts to resorb mineralized bone, and cell survival [181,182,184e186]. Through these actions, RANKL potently stimulates bone resorption. RANKL acts via binding to its signal transducing receptor RANK, a member of the TNF receptor family present on pre-osteoclasts and mature osteoclasts. Consistent herewith, an activating mutation of the human RANK gene was found in patients with familial expansile osteolysis, a disease of excess bone resorption [187]. Recent genetic and cell biological studies have begun to elucidate the complex signaling cascade downstream of RANK/ RANKL (reviewed by [181,182,186]). Briefly stated and oversimplified, the binding of RANKL to RANK on the surface of osteoclast precursors recruits the adaptor protein TNF receptor-associated factor (TRAF) 6 to the cytoplasmic domain of RANK, leading to activation of NF-kB and its translocation to the nucleus, and the actions of c-Fos and NFATc1 as outlined above. The actions of RANKL are negatively regulated by a secreted soluble decoy receptor termed osteoprotegerin (OPG) (previously also known as osteoclastogenesis inhibitory factor [OCIF]), also a member of the TNF receptor superfamily. OPG sequesters RANKL molecules and thereby blocks their binding to RANK. As such, OPG protects bone from excessive resorption; this conclusion is supported by the finding that certain homozygous deletions of OPG in humans can cause juvenile Paget’s disease, a disorder characterized by increased bone remodeling, osteopenia, and fractures [188]. The relative concentration of RANKL and OPG in bone is thus a major determinant of bone mass and strength. OPG is widely expressed; not surprisingly, its expression by osteoblasts and stromal cells is positively regulated by bone anabolic or antiresorptive factors, such as estrogen and calcitonin (see [184,186]). The essence of the RANK/RANKL/OPG cascade was clarified by mouse genetic studies. Mice lacking RANKL or RANK and mice with increased circulating OPG by transgenic overexpression were severely osteopetrotic due to a block in osteoclastogenesis. Conversely, targeted mutagenesis of OPG, overexpression of an sRANKL transgene, and administration of RANKL in mice, all led to increased osteoclast formation, activation and/or survival and resulted in an osteoporotic phenotype (see [184,186]). In summary, RANKL and OPG act in an antagonistic fashion to regulate bone resorption and their respective expression levels are under the control of pro- and antiresorptive factors including several hormones, cytokines and growth factors. Other regulatory molecules have been implicated in the late stages of osteoclast differentiation, the fusion process and activation of resorption. Co-stimulatory molecules acting in concert with M-CSF and RANKL to complete osteoclastogenesis include proteins containing an immunoreceptor tyrosine-based activation motif

(ITAM) domain that is critical for the activation of calcium signaling and found in adapter molecules like DNAX-activating protein (DAP)12 and the Fc receptor g (FcRg) [189]. The resultant increase in intracellular calcium is required for activation of NFATc1. The fusion of mononuclear osteoclast precursor cells into mature multinucleated osteoclasts is regulated by a membrane protein called dendritic cell-specific transmembrane protein (DC-STAMP). DC-STAMP-deficient cells failed to fuse, and these mononuclear osteoclasts had reduced resorptive efficiency in vitro. Consequently, DCSTAMP-deficient mice exhibited increased bone mass [190]. Further studies on the regulatory components of osteoclastogenesis will not only expand our basic understanding of the molecular mechanisms of osteoclast differentiation during bone development and remodeling, but also increasingly offer opportunities to develop therapeutic means of intervention in osteoclast-related diseases [191,192]. OPG, as well as soluble recombinant RANK, suppresses osteoclastogenesis, while antibodies to RANK can stimulate osteoclast formation. From the clinical point of view, the RANKL signaling pathway thus holds great promise as a strategy for suppressing excessive osteoclast formation in variety of bone diseases including osteoporosis, autoimmune arthritis, periodontitis, Paget’s disease, and bone tumors/metastases. One drug that has been developed to target RANKL signaling for the treatment or prevention of bone disease is denosumab, a human monoclonal antibody that binds to RANKL and prevents RANKL interaction with RANK [193]. Bone Resorption Bone resorption involves both dissolution of bone mineral as well as degradation of organic bone matrix. Osteoclasts are highly specialized to perform both of these functions. Upon activation of the mature multinucleated osteoclasts, the cells attach themselves firmly to the bone surface, using specialized actin-rich podosomes (actin ring), through cytoskeleton reorganization and cellular polarization [194]. Within these tightly sealed zones of adhesion to the mineralized matrix, the osteoclasts form convoluted, villous-like membranes called “ruffled borders” that drastically increase the surface area of the cell membrane facing the resorption lacuna. Via these ruffled membranes the osteoclasts secrete abundant hydrochloric acid (involving the vacuolar Hþ-ATPase proton pump) mediating acidification of the compartment between the cell and the bone surface, as well as a myriad of enzymes such as lysosomal cathepsins, the phosphatase TRAP, and proteolytic MMPs. The acidity of the environment leads to dissolution of the mineral phase (crystalline hydroxyapatite), activation of the lytic enzymes, and digestion of

PEDIATRIC BONE

CELLULAR AND MOLECULAR CONTROL OF SKELETAL GROWTH

organic matrix compounds. The sealing mechanism allows the localized dissolving and degrading of the mineralized bone matrix, while simultaneously protecting neighboring cells from harm. During the resorption process, dissolution of hydroxyapatite releases large amounts of soluble calcium, phosphate and bicarbonate [195,196]. These complex processes of osteoclast recruitment, polarization on the bone surface, and export of acid and enzymes are orchestrated by many factors, including RANKL, as well as integrin-mediated signaling from bone matrix itself. Particularly the avb3 integrin appeared important for osteoclast functioning based on the finding that inhibition of signaling through this avb3 integrin inhibited osteoclast-mediated bone resorption in vitro and in animal models of osteoporosis and malignant osteolysis [197]. Among the many other molecules that are important for the functional activity of osteoclasts, such as c-Src, cathepsin K, carbonic anhydrase II, TRAP, and several ion channel proteins, many have been found to cause an osteopetrotic phenotype when deleted in mice or altered in humans. The absence of these genes does not affect the differentiation into morphologically normal osteoclasts; however, the osteoclasts are not functional and fail to resorb bone effectively (reviewed in [78,195,196]. For instance, cathepsin K, the key enzyme in the digestion of bone matrix by its activity in degrading type I collagen, is highly expressed by activated osteoclasts and secreted in the resorption lacuna [198,199]. Its deletion in mice led to osteopetrosis, and mutations in the human cathepsin K gene cause pycnodysostosis. Highly selective and potent cathepsin K inhibitors have been shown useful as antiresorptive agents to treat osteoporosis, as well as being promising therapeutic tools to reduce breast cancerinduced osteolysis and skeletal tumor burden [200,201]. Besides cathepsin K, several proteolytic enzyme groups are involved in the degradation of organic components (collagens and proteoglycans) of bone and cartilage matrices after the mineral is dissolved. One of these is the MMP family, which constitutes over 25 members, including secreted collagenases, stromelysins, gelatinases and membrane-type (MT)-MMPs. Several MMPs including MMP9 and MMP14 (also known as MT1-MMP) are highly expressed in osteoclasts/chondroclasts. MMPs are synthesized as latent pro-enzymes that, upon proteolytic activation, can degrade numerous extracellular matrix components. As such, they are involved in development, growth and repair of tissues, but also in pathological conditions associated with excessive matrix degradation such as rheumatoid arthritis, osteoarthritis and tumor metastasis [202e204]. The Coupling Principle in Bone Remodeling Bone remodeling must be tightly controlled to maintain the normal bone homeostasis, but the molecular

69

mechanisms that control its initiation, progression, and cessation at any given site remain poorly understood. However, failure of this normal skeletal functioning is one of the most common early manifestations of aging, for example in osteoporosis and osteoarthritis. These and a variety of other pathologic conditions affecting the skeleton (e.g. rheumatoid arthritis, periodontitis, Paget’s disease, and bone tumors) lead to perturbations in the bone remodeling process, predominantly shifting the balance towards more degradation of bone due to local and/or systemic alterations in the levels of hormones or proinflammatory cytokines that stimulate bone resorption [170,205,206]. In normal conditions of development, growth, and bone health, the osteoclast is thought to die via apoptosis after a limited period of resorptive activity [207] and the resorbed area of cartilage or bone is efficiently replaced by newly formed bone through the action of osteoblasts. Hence, skeletal homeostasis remains intact as long as the activities of both osteoclasts and osteoblasts are balanced (“coupled”) and the net bone mass is maintained. This balance implies the existence of mechanisms tightly coordinating the differentiation of osteoblasts and osteoclasts as well as their migration to locations where they function. One prime aspect of the coupling principle is provided by the direct control of osteoclastogenesis by cells of the osteoblast lineage through their expression of M-CSF and RANKL. Conversely, osteoclasts may reciprocally stimulate osteoblast differentiation and function to initiate the anabolic arm of the remodeling process. Osteoclastic bone resorption may well locally release the myriad of growth factors, like for example TGFb, that are stored in the bone matrix, which can subsequently act to attract and stimulate osteoblasts [208]. Direct signaling by osteoclasts to cells of the osteoblast lineage has recently been demonstrated and may participate in coupled osteoblastogenesis and bone formation. For instance, the ephrin/Eph receptor system allows bidirectional signaling between osteoclasts and osteoblasts; osteoclasts express ephrin B2 and osteoblasts express its EphB4 receptor, both membrane-bound proteins [209]. Signaling through EphB4 into osteoblasts (“forward signaling”) enhances osteogenic differentiation in vitro, whereas signaling through ephrin B2 into osteoclast precursors (“reverse signaling”) suppresses osteoclast differentiation [209]. The overall outcome of such interaction thus is predicted to favor bone formation [210]. It has also been reported that the v-ATPase V0 subunit D2 is not only involved in osteoclast fusion but also regulates the secretion by osteoclasts of still unidentified factors that inhibit the differentiation of osteoblast precursors into mature cells [211]. Other cytokines involved in the coupling, such as interleukin-1 (IL-1), IL-2, IL-6, and oncostatin M, transduce their signals

PEDIATRIC BONE

70

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

through the gp130 protein and play an important role in osteoclast and osteoblast physiology [212].

Osteocytes and Mechanosensing Mechanical loading of the skeleton is essential for the development, growth, and maintenance of strong, weight-bearing bones. Altered growth and subsequent deformity resulting from abnormal mechanical loading is often referred to as mechanical modulation of bone growth. This phenomenon has key implications in the progression of infant and juvenile musculoskeletal deformities, such as adolescent idiopathic scoliosis, hyperkyphosis, genu valgum and tibia bowing. Clinical management of these deformities is often directed at modifying the mechanical environment of affected bones. However, there is limited understanding of how bone growth is regulated in response to mechanical loading with respect to growth plate chondrocytes [213]. Better characterized is the concept that mechanical loading improves bone strength particularly by inducing osteoblastic bone formation in regions of high strain energy. In order to withstand loading in the most efficient way (maximal strength for minimal material), the skeleton constantly adjusts its bone mass and architecture in response to load through bone remodeling. It has indeed long been recognized that mechanical stress induced by weight-bearing exercise increases osteoblast activity and induces bone formation. Bone tissue thus has a mechanosensing apparatus that directs osteogenesis to where it is most needed to increase bone strength. The most likely sensors of mechanical loading are the osteocytes, which sense variations in mechanical forces acting on bone and respond to this by signaling via sclerostin secretion and other mechanisms (see below), to coordinate osteogenesis [214,215]. Osteocytes represent the quantitatively dominant cell type in adult bone. Osteocytes, derived from osteoblasts, are buried within the mineralized bone matrix. They are connected to each other and to cells on the bone surface via numerous dendritic processes that run inside lacunar cannaliculi. These processes are thought to allow osteocytes to communicate with other cells including other osteocytes, and osteoblasts and osteoclasts on the bone surface, thereby playing roles in the regulation of bone formation and resorption [92,93,216]. They also allow the osteocytes to sense and respond to mechanical forces, and to secrete proteins involved in systemic phosphate homeostasis (see Chapter 7) including dentin matrix protein (DMP)-1, matrix extracellular phosphoglycoprotein (MEPE) and FGF-23 [92,217]. The importance of viable osteocytes in the maintenance of bone tissue health was shown by experimental destruction of osteocytes in murine bone: activation of the diphtheria toxin receptor, expressed

under the control of the osteocyte-specific DMP-1 promoter, quickly led to targeted ablation of osteocytes through necrosis, and was associated with a large-scale increase in bone resorption, decreased bone formation, and trabecular bone loss. Concomitantly, these mice were resistant to unloading-induced bone loss, indicating the requirement for osteocytes in the response to mechanical signals [218]. Osteocytes have been demonstrated to stimulate bone resorption in vitro and in vivo [219,220]. This modulation of bone remodeling may be elicited by osteocyte apoptosis, which can be consequential to unloading [221]. Conversely, mechanical stimulation is capable of maintaining osteocyte viability [222]. The recent deletion of b-catenin in osteocytes, using a DMP-1-Cre conditional knockout approach, indicated that b-catenin is necessary for normal osteocyte viability and function, and for the maintenance of normal bone. Indeed, these conditional knockout mice had bones with pronounced porosity and fragility due to increased osteoclast number and activity, most likely owing to reduced expression of OPG and an increase in RANKL, both found to be expressed in osteocytes [106]. The mechanisms by which a mechanical stimulus is transduced into biochemical signals in osteocytes and osteoblasts and the means whereby these cells then modulate bone remodeling have not been clearly identified. Influences that have been implicated are shearing forces produced by fluid movement (e.g. in the canaliculi surrounding the osteocytic dendrites) and a variety of membrane proteins, including integrins, connexins and stretch-sensitive ion channels [92,93]. It also has been proposed that the osteocyte senses load through cilia, single flagellar-like structures found on every cell [223]. When Pkd1, the gene encoding the large transmembrane protein polycystin-1 (PC-1) located at the primary cilia, was conditionally deleted in osteocytes using DMP-1-Cre mice, the bone anabolic response to loading was recently found to be dramatically decreased [224]. Osteocytes respond in vitro and in vivo to increased load by altering their signaling. For example, in response to loading, osteocytes upregulate nitric oxide production, release prostaglandin PGE-2 and IGF-1, and decrease glutamate transporter expression [92,93]. DMP-1 expression is also robustly increased upon mechanical stimulation [225]. DMP-1 inactivation in mice is associated with a hypomineralized phenotype linked with elevated FGF-23 expression and defective osteocyte lacuna/canalicular network formation [226]. Of great interest is the recent observation that mechanical loading suppresses the expression of SOST in osteocytes, resulting in a rapid decrease of sclerostin production [215]. As mentioned (see above), the osteocyte-specific protein sclerostin inhibits Wnt signaling

PEDIATRIC BONE

ENDOCRINE CONTROL OF POSTNATAL BONE GROWTH

through binding to LRP5/6. Consequently, SOST null mice have a very high bone mass [227] whereas, conversely, transgenic mice overexpressing sclerostin in osteocytes suffer severe bone loss [228]. Osteocytes thus appear to use the Wnt/beta-catenin pathway to transmit signals of mechanical loading to cells on the bone surface [92,106].

ENDOCRINE CONTROL OF POSTNATAL BONE GROWTH Several systemic factors are known to profoundly influence postnatal bone growth as well as bone remodeling. These include the principal regulators of mineral homeostasis, such as PTH and 1,25(OH)2 vitamin D that maintain calcium homeostasis by regulating osteoclastic resorption, the actions of which are discussed in detail in other chapters of this book. Here, we will briefly summarize the influences on bone growth and remodeling by the growth hormone /insulin-like growth factor-1 axis, sex steroids, thyroid hormones, and glucocorticoids.

Growth Hormone and Insulin-like Growth Factor-1 Growth hormone (GH) and insulin-like growth factor-1 (IGF-1) are central to the achievement of normal longitudinal bone growth and the acquisition of bone mass during the prepubertal period, and remain important regulators of bone homeostasis throughout life. Although GH may act directly on skeletal cells, most of its effects are mediated by IGF-1, which is present in the systemic circulation and is synthesized by peripheral tissues. Both systemic and local skeletal IGF-1 play a role in bone formation and the maintenance of bone mass [229,230]. GH is a single-chain peptide of 191 amino acids, synthesized and released from the anterior pituitary gland. Its receptor is highly expressed in the liver, adipose tissue, heart, kidneys, intestine, lung, pancreas, cartilage and skeletal muscle where it induces the synthesis of IGF-1, a member of the insulin family of growth factors [229,230]. Systemic IGF-1 is synthesized primarily in the liver and circulates bound by IGFbinding proteins (IGFBPs) that regulate its availability. The triple inactivation of IGFBP-3, -4 and -5 demonstrated that IGFBPs are necessary to maintain appropriate levels of systemic IGF-1 and adequate postnatal growth [231]. IGF-2 shares biochemical and biological properties with IGF-1; it is synthesized by skeletal cells, independent of GH, and is important in skeletal development, but its function in the adult skeleton is not proven [229,230].

71

During embryonic development, IGF-1 and IGF-2 are key determinants of growth. IGF-1 deficiency retards both pre- and postnatal growth, and IGF-1 receptor (IGF-1R) null mice, exhibiting a more severe growth deficiency, die shortly after birth [232e235]. In this context, prenatally, IGF-1 signaling is considered to be GH independent, whereas postnatally, IGF-1 is partly or fully GH dependent with phosphorylation of STAT5b having an intermediary role [236]. Knockout of the IGF-2 gene leads to decreased fetal growth in analogous fashion to knockout of the IGF-1 gene [237]. Because of the additional action of IGF-2 on the insulin receptor, knockout of IGF-2 and IGF-1R results in a more severe growth abnormality than knockout of IGF-1R alone [238]. Since IGF-2 acts predominantly in fetal life and GH acts on growth postnatally, there are no expected interactions between IGF-2 and GH in mice. Postnatally and throughout puberty, GH and IGF-1 play a critical role in determining longitudinal skeletal growth. Mice missing both the GH receptor and IGF-1 are only 17% of normal size [235]. These dramatic quantitative effects show that GH and IGF-1 importantly control bone growth in mammals. The crucial role of GH in controlling bone growth dates from the isolation of GH and the evidence that GH administration corrects the growth defects in patients with genetic or acquired GH deficiency (GHD) who display short stature. Patients and mice with mutations in the GH receptor gene (Laron dwarfism) have a similar defect in bone growth [235,239,240]. Studies of mice missing the GH receptor show that the mice, like people with Laron dwarfism, are of normal size at birth but have defective postnatal growth. In mice, the defect is detected days 10e40 after birth [235]. These mice have growth plates with short proliferative columns with fewer chondrocytes than normal, a slower rate of proliferation, and smaller hypertrophic chondrocytes than normal [235]. Thus, these mice display defects both in the proliferation and in the differentiation of chondrocytes. Clear demonstration of the physiologic importance of IGF-1 in bone growth awaited gene ablation studies [233,234,241]; subsequently, one human with IGF-1 gene mutation and a phenotype analogous to that of the knockout mice was reported [232]. Unlike the fairly normal prenatal phenotype of mice missing the GH receptor, mice missing the IGF-1 gene are only 60% of normal weight at birth and have a high perinatal mortality, which varies depending on the genetic background of the particular mouse strain. These mice, like the GH receptor knockout mice, have small hypertrophic chondrocytes [235,242]. Wang et al. [242] found that proliferative columns are of normal size and that the chondrocytes proliferate at a normal rate, whereas Lupu et al. [235] found that the proliferative columns

PEDIATRIC BONE

72

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

are short, with a low rate of proliferation. Although the studies differ in several respects, probably the most important difference that might explain the varying results is that the mice have distinct genetic backgrounds. As noted earlier, the observation that GH stimulates the production of IGF-1 in many cell types and the partial overlap in actions of these two factors has led to the hypothesis that many of the growth-promoting actions of GH on chondrocytes are mediated by IGF-1. The small size of the IGF-1 knockout mice, despite their high GH levels, is consistent with this idea. Nevertheless, the finding that mice missing both the GH receptor and IGF-1 genes have a greater growth defect than either individual knockout mouse is strong genetic evidence that the actions of GH and IGF-1 on growth are predominantly independent and additive [235]. Moreover, the traditional concept that GH primarily acts through stimulation of the IGF-1 production in the liver and increased circulating IGF-1 levels, was contested by mouse genetic studies. Indeed, when the IGF-1 gene was ablated specifically from liver in vivo using the Cre-Lox approach, circulating levels of IGF-1 decreased to approximately 20% of baseline, but the animals grew normally [243,244]. Although these studies demonstrate that a large fraction of circulating IGF-1 derives from the liver, they also suggest that IGF-1 made by the liver may not be vitally important for bone growth. The actions of IGF-1, whether produced locally or systemically, are via the IGF-1 receptor (IGF-1R) expressed on the cell surface of the chondrocytes of the growth plate. The type-2 IGF-1R is expressed equally throughout all maturational zones of the growth plate, whereas the type-1 receptor is more highly expressed by proliferating chondrocytes [245]. These data are consistent with the concept that IGF-1 has regulatory actions on all chondrocytes of the growth plate. Moreover, recently generated cartilage-specific IGF-1R knockout mice, constitutive as well as tamoxifeninducible models, indicate that the IGF-1R in chondrocytes controls cell growth, survival, and differentiation in embryonic and postnatal growth plates in part by suppression of PTHrP expression [246]. Thus, although the functional relationships between GH and IGF-1 actions on the growth plate remain unsettled, it is clear that the IGF-1 signaling pathway has a central function in modulating endochondral bone growth and regulates a number of key chondrocyte physiological processes such as chondrocyte proliferation, matrix synthesis, differentiation, hypertrophy and survival [229,230,235,246]. In addition to the effects on longitudinal growth, GH and IGF-1 are anabolic hormones and have the potential to regulate bone modeling and remodeling. During adolescence, the anabolic effects of GH and IGF-1 in

bone are important for the acquisition of bone mass. Late adolescence and early adulthood are critical periods for the acquisition of bone mass, and the achievement of peak bone mass. This is a critical determinant of future risk of osteoporosis. Adult GHD causes low bone turnover osteoporosis with high risk of vertebral and non-vertebral fractures, and the low bone mass can be partially reversed by GH replacement [230]. IGF1 mediates most of the effects of GH on skeletal metabolism. IGF-1 may reduce osteoblast apoptosis and promote osteoblastogenesis by stabilizing b-catenin, enhancing Wnt-dependent activity. This effect, associated with modest mitogenic properties, causes an increase in the number of osteoblasts, and an increase in osteoblastic function and bone formation [247,248]. Diseases affecting the GH/IGF-1 axis are frequently associated with significant alterations in bone metabolism that often lead to bone loss [229,230].

Sex Steroids: Estrogen and Androgen The effects of sex hormones on growth appear to be very species specific, so lessons from rodents cannot be easily applied to humans. In humans, in association with the increase in sex hormones in boys and girls at the time of puberty, linear bone growth accelerates, followed by the disappearance of the growth plate and permanent lack of further growth. Remarkably, several patients with defective estrogen receptor a (ERa) [249] or defective aromatase (the enzyme that converts testosterone to estradiol) [250,251] have been identified. These patients continued to grow into adulthood owing to a lack of epiphyseal fusion in the long bones, which resulted in increased adult height. Two girls without aromatase presented with signs of androgen excess but lack of a clear pubertal growth spurt until they were treated with estrogen [252]. While estrogen therapy resulted in rapid growth plate closure in patients with aromatase deficiency, it did not in the man with a mutation in the ERa gene [249e251]. In rodents, the growth plates do not fuse directly after sexual maturation, but high-dose estradiol treatment results in a clear reduction of the growth plate height [253]. A mouse model with cartilage-specific inactivation of ERa, the main ER regulating skeletal growth, was recently generated. During sexual maturation, the skeletal growth of these mice was normal, but they continued to grow after 4 months of age, resulting in increased bone length at the age of 1 year. High-dose estradiol treatment of adult mice reduced the growth plate height as a consequence of attenuated proliferation of growth plate chondrocytes in control mice but not in cartilage-specific ERa knockout mice [254]. Sex steroids also have a pronounced influence on the process of bone modeling, remodeling and homeostasis,

PEDIATRIC BONE

ENDOCRINE CONTROL OF POSTNATAL BONE GROWTH

essential for maintenance of the adult skeleton. The precise time of the attainment of peak bone mass is not certain, and it is skeletal-site dependent. The increase in gonadal steroid synthesis at the time of puberty is an important hormonal regulator of bone accretion. Boys with constitutionally delayed puberty achieve lower peak bone mass than normal boys [255]. Androgens are important not only as a source of estrogen, through the action of aromatase, but also for their direct effect in stimulating bone formation [256]. Testosterone, responsible for the male phenotype characterized by a larger skeleton, has complex effects on bone metabolism. As an anabolic steroid, it stimulates bone formation in both male and females. In addition, testosterone can inhibit bone resorption directly, acting through the androgen receptor as well as through conversion by aromatase to estrogens (see below). Androgens also increase periosteal bone formation, leading to larger and therefore stronger bones. Loss of androgens in males from chemical or surgical castration or an ageassociated decline of androgen levels has the same adverse effect on the skeleton as estrogen loss in women, albeit the loss of testosterone in aging men is not as universal or as abrupt as the loss of estrogen at the time of menopause in women [256,257]. Indeed, particularly postmenopausal women suffer from osteoporosis, characterized by low bone mass and high risk of debilitating fractures of the vertebrae and long bones. This disease afflicts millions of people, and becomes increasingly prevalent with the aging of the general population. Skeletal preservation by estrogen in females may be evolutionarily related to the need of calcium stores for embryonic skeletal development. In mammalian adult males and females, including humans, estrogen has been identified as the major inhibitor of bone resorption by reducing osteoclast number [257,258]. Estrogen deficiency increases both the number of sites at which remodeling is initiated, and the extent of resorption at a given site. Increased bone resorption is accompanied by increased bone formation as a result of coupling. However, the increase in bone formation is not sufficient to maintain bone balance and prevent bone loss. The reason for this “skeletal insufficiency” in osteoporosis is not known; it could be due to lack of estrogen or other hormones, such as androgens, required for fully effective bone formation, and is partly due to the above-mentioned kinetic imbalance. In cancellous bone, the loss results in thinner trabeculae, which become rod-shaped rather than plates, and in trabecular discontinuity, which deprives them of mechanical function. In cortical bone, endosteal bone resorption causes thinning of the cortex and sometimes “trabecularization” of the endosteal surface. Enhanced resorption increases the size of haversian canals and the porosity of the cortical bone. The result of these changes is significant

73

weakening of the respective bones and increased fracture risk. Treatment of women with hormone replacement therapy (either estrogen alone or estrogen plus progesterone) has been shown to prevent this bone loss [259]. Recent studies have shed light on the mechanism of estrogen action on osteoclasts: osteoclasts express estrogen receptors (ERa and ERb) and estrogen acts directly on osteoclasts to increase apoptosis [260,261]. The regulation of osteoclast life span by estrogen involves induction of the Fas/FasL system causing apoptosis, a pathway that may be involved both in osteoclast cell-autonomous effects [261], as well as in indirect mechanisms mediated via the osteoblast [262]. Furthermore, estrogen can have non-genomic effects, or rapid signaling effects, inducing the phosphorylation of components of various signaling pathways (e.g. the MAPK pathway) or calcium regulation. Such effects may contribute to the induction of osteoclast apoptosis by estrogen without the need for direct binding of ERa to DNA [262,263]. The DNA-binding function of ERa was recently shown to be dispensable also for the effects of estrogen on osteoblastogenesis and on decreasing the prevalence of mature osteoblast apoptosis [264]. In fact, Manolagas and co-workers propose that the protective effects of estrogens on bone result from their ability to attenuate oxidative stress in bone and bone marrow; estrogens diminish the generation of reactive oxygen species (ROS), stimulate the activity of glutathione reductase, and decrease the phosphorylation of p66shc, an adapter protein that serves as a key component of a signaling cascade that is activated by ROS and influences apoptosis and lifespan in invertebrates and mammals. Hence, loss of estrogens may accelerate the effects of aging on bone by decreasing the defense against oxidative stress [264,265]. A variety of other mechanisms contribute to the beneficial effects of estrogen on bone. Estrogen was reported to decrease the responsiveness of osteoclast progenitor cells to RANKL, thereby reducing osteoclastogenesis [266]. Estrogen also regulates a variety of cytokines, indirectly leading to changes in osteoclast number: estrogen suppresses the production of osteoclastogenic cytokines such as IL-1, IL-6, IL-7 and TNF-a in T cells and osteoblasts [267,268]. As well, part of the effects ascribed to estrogen deficiency were suggested to be in fact mediated by the resultant increase in pituitary gland derived follicle stimulating hormone (FSH), acting on osteoclasts [269].

Thyroid Hormones The hypothalamicepituitaryethyroid axis plays a key role in skeletal development, acquisition of peak bone mass and regulation of adult bone turnover. Euthyroid status is essential for maintenance of optimal bone mineralization and strength. In population studies,

PEDIATRIC BONE

74

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

hypothyroidism and hyperthyroidism have both been associated with an increased risk of fracture. In children, thyrotoxicosis advances bone age and accelerates postnatal skeletal development resulting in early cessation of growth and short stature due to premature fusion of the growth plates. Conversely, children and rodents with hypothyroidism have decreased rates of bone lengthening [270]. Although some of this decrease in growth plate function may be caused by associated decreases in GH levels, GH cannot fully correct abnormalities seen in rats and mice with hypothyroidism. These abnormalities include both shortened proliferative layers of chondrocytes and decreased numbers of hypertrophic chondrocytes [271]. At least some of the effects of thyroid hormone are likely to be direct effects on chondrocytes that express thyroid hormone receptors [272] because both growth plates and isolated chondrocytes respond to T3 in vitro by increasing the conversion of proliferating to hypertrophic chondrocytes [273,274]. Genetically engineered mice missing all transcripts from both the thyroid hormone receptor a and b loci have a delay in development of secondary ossification centers, a decrease in the proliferative layer of chondrocytes, and a particularly dramatic decrease in hypertrophic chondrocytes [275]. This phenotype is not as severe as that in mice with congenital absence of thyroid glands, or as in mice missing the pax8 gene encoding an essential transcription factor required for thyroid follicular cell development [276]. These comparisons, as well as comparisons with mice missing selected transcripts from the complicated thyroid hormone receptor loci, suggest that non-ligand-binding variants of these receptors function in the absence of thyroid hormone to generate a growth plate phenotype more severe than that in mice missing all transcripts from these loci [270,275,277,278]. Both receptor loci contribute to growth plate function. Some children with thyroid hormone resistance due to dominant negative mutations in the thyroid hormone receptor b gene have short stature, presumably partly through blockade of receptor action in the growth plate [279].

Glucocorticoids In contrast to sex steroids, glucocorticoid excess is catabolic to bone, as illustrated by glucocorticoidinduced osteoporosis, a devastating consequence of long-term use of glucocorticoids [280]. The mechanisms for glucocorticoid-induced bone loss are complex, including suppression of renal calcium reabsorption, reduction in intestinal calcium absorption, and hypogonadism, all of which lead to increased bone resorption and bone turnover. Perhaps more importantly, glucocorticoids also have direct effects on the skeleton [280]. Glucocorticoids impair the replication, differentiation

and function of osteoblasts and induce the apoptosis of mature osteoblasts and osteocytes, leading to a dramatic suppression of bone formation [281,282]. As well, glucocorticoids act directly on osteoclasts and prolong their life span; in addition, glucocorticoids may sensitize bone cells to regulators of bone remodeling and favor osteoclastogenesis, thus overall leading to increased bone resorption [283,284]. Glucocorticoids are widely used as anti-inflammatory and immunosuppressive drugs in children. Long-term, high-dose glucocorticoid treatment often leads to growth failure. Similarly, systemic administration of glucocorticoid in mice, rats, and rabbits decreases the rate of longitudinal bone growth, likely by inhibiting growth plate chondrocyte proliferation [285,286] and by stimulating chondrocyte apoptosis [287]. Glucocorticoid inhibits longitudinal bone growth, in part, through a direct effect on growth plate chondrocytes that exress glucocorticoid receptor [286]. In addition to its direct action on the growth plate, glucocorticoid may also suppress longitudinal bone growth through an indirect action, mediated, in part, by changes in the GH/IGF-1 axis [285,288]. Discontinuation of glucocorticoid treatment is followed by catch-up growth. Catch-up growth may occur because the decreased cell proliferation during glucocorticoid treatment conserves the proliferative capacity of the chondrocytes, thus slowing growth plate senescence. Following discontinuation of the glucocorticoid treatment, the growth plates are less senescent than normal, and hence show a greater growth rate and grow for a longer time than expected for age, resulting in catch-up growth [285]. Despite catch-up growth, prolonged glucocorticoid administration in children can result in some residual permanent growth deficit.

CONCLUDING REMARKS As outlined above, postnatal bone growth involves a complex spatiotemporal coordination of the proliferation, differentiation, and activity of multiple cell types building the multicomponent skeletal tissue. A myriad of transcription factors, local signaling molecules, endocrine, mechanical and central signals have been implicated in the regulation of bone growth and remodeling. Precise control is mandatory to build and maintain a skeleton that is fully able to fulfill its major functions, including mechanical support and mineral homeostasis. Moreover, a number of recent breakthroughs have shown that bone cells are not merely involved in the acquisition and maintenance of the bone mass, but also execute a number of critical functions that extend beyond the bone tissue proper. Among these are roles of osteoblasts and osteoclasts in the

PEDIATRIC BONE

REFERENCES

interplay between skeletal functioning and the regulation of immunology and inflammation [289,290], hematopoiesis and stem cell biology [291e294], the central and sympathetic nervous system [295e297] and energy metabolism [296,298e300]. Further advances in the molecular and genetic understanding of skeletal biology, including these novel integrative communication pathways with other tissues and organ systems, may offer new insights as well as potential therapeutic options to treat various pediatric bone diseases presented further in this book.

References [1] Tabin C, Wolpert L. Rethinking the proximodistal axis of the vertebrate limb in the molecular era. Genes Dev 2007;21: 1433e42. [2] Bi W, Deng JM, Zhang Z, Behringer RR, de Crombrugghe B. Sox9 is required for cartilage formation. Nat Genet 1999;22: 85e9. [3] Kronenberg HM. The role of the perichondrium in fetal bone development. Ann NY Acad Sci 2007;1116:59e64. [4] Maes C, Kobayashi T, Selig MK, et al. Osteoblast precursors, but not mature osteoblasts, move into developing and fractured bones along with invading blood vessels. Dev Cell 2010;19: 329e44. [5] Kronenberg HM. Developmental regulation of the growth plate. Nature 2003;423:332e6. [6] Ducy P, Zhang R, Geoffroy V, Ridall A, Karsenty G. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997;89:747e54. [7] Komori T, Yagi H, Nomura S, et al. Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 1997;89:755e64. [8] Trueta J, Morgan JD. The vascular contribution to osteogenesis. I. Studies by the injection method. J Bone Joint Surg Br 1960;42-B:97e109. [9] Brashear Jr HR. Epiphyseal avascular necrosis and its relation to longitudinal bone growth. J Bone Joint Surg Am 1963;45: 1423e38. [10] Gerber HP, Vu TH, Ryan AM, Kowalski J, Werb Z, Ferrara N. VEGF couples hypertrophic cartilage remodeling, ossification and angiogenesis during endochondral bone formation. Nat Med 1999;5:623e8. [11] Opperman LA. Cranial sutures as intramembranous bone growth sites. Dev Dyn 2000;219:472e85. [12] Hall BK, Miyake T. All for one and one for all: condensations and the initiation of skeletal development. Bioessays 2000;22: 138e47. [13] Morriss-Kay GM, Wilkie AO. Growth of the normal skull vault and its alteration in craniosynostosis: insights from human genetics and experimental studies. J Anat 2005;207:637e53. [14] Wilkie AO, Morriss-Kay GM. Genetics of craniofacial development and malformation. Nat Rev Genet 2001;2:458e68. [15] Helms JA, Cordero D, Tapadia MD. New insights into craniofacial morphogenesis. Development 2005;132:851e61. [16] Akiyama H, Chaboissier MC, Martin JF, Schedl A, de Crombrugghe B. The transcription factor Sox9 has essential roles in successive steps of the chondrocyte differentiation pathway and is required for expression of Sox5 and Sox6. Genes Dev 2002;16:2813e28.

75

[17] Smits P, Li P, Mandel J, et al. The transcription factors L-Sox5 and Sox6 are essential for cartilage formation. Dev Cell 2001;1: 277e90. [18] Karaplis AC, He B, Nguyen MT, et al. Inactivating mutation in the human parathyroid hormone receptor type 1 gene in Blomstrand chondrodysplasia. Endocrinology 1998;139:5255e8. [19] Schipani E, Kruse K, Juppner H. A constitutively active mutant PTH-PTHrP receptor in Jansen-type metaphyseal chondrodysplasia. Science 1995;268:98e100. [20] Bellus GA, McIntosh I, Smith EA, et al. A recurrent mutation in the tyrosine kinase domain of fibroblast growth factor receptor 3 causes hypochondroplasia. Nat Genet 1995;10:357e9. [21] Naski MC, Wang Q, Xu J, Ornitz DM. Graded activation of fibroblast growth factor receptor 3 by mutations causing achondroplasia and thanatophoric dysplasia. Nat Genet 1996;13: 233e7. [22] Shiang R, Thompson LM, Zhu YZ, et al. Mutations in the transmembrane domain of FGFR3 cause the most common genetic form of dwarfism, achondroplasia. Cell 1994;78:335e42. [23] Vajo Z, Francomano CA, Wilkin DJ. The molecular and genetic basis of fibroblast growth factor receptor 3 disorders: the achondroplasia family of skeletal dysplasias, Muenke craniosynostosis, and Crouzon syndrome with acanthosis nigricans. Endocr Rev 2000;21:23e39. [24] Kronenberg HM. PTHrP and skeletal development. Ann NY Acad Sci 2006;1068:1e13. [25] Lanske B, Karaplis AC, Lee K, et al. PTH/PTHrP receptor in early development and Indian hedgehog-regulated bone growth. Science 1996;273:663e6. [26] Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM, Tabin CJ. Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science 1996;273:613e22. [27] Chung UI, Schipani E, McMahon AP, Kronenberg HM. Indian hedgehog couples chondrogenesis to osteogenesis in endochondral bone development. J Clin Invest 2001;107:295e304. [28] Karp SJ, Schipani E, St Jacques B, Hunzelman J, Kronenberg H, McMahon AP. Indian hedgehog coordinates endochondral bone growth and morphogenesis via parathyroid hormone relatedprotein-dependent and -independent pathways. Development 2000;127:543e8. [29] Kobayashi T, Soegiarto DW, Yang Y, et al. Indian hedgehog stimulates periarticular chondrocyte differentiation to regulate growth plate length independently of PTHrP. J Clin Invest 2005;115:1734e42. [30] St Jacques B, Hammerschmidt M, McMahon AP. Indian hedgehog signaling regulates proliferation and differentiation of chondrocytes and is essential for bone formation. Genes Dev 1999;13:2072e86. [31] Kim IS, Otto F, Zabel B, Mundlos S. Regulation of chondrocyte differentiation by Cbfa1. Mech Dev 1999;80:159e70. [32] Maeda Y, Nakamura E, Nguyen MT, et al. Indian Hedgehog produced by postnatal chondrocytes is essential for maintaining a growth plate and trabecular bone. Proc Natl Acad Sci USA 2007;104:6382e7. [33] Ornitz D. FGF Signaling in the developing endochondral skeleton. Cytokine Growth Factor Rev 2005;16:205e13. [34] Miraoui H, Marie PJ. Fibroblast growth factor receptor signaling crosstalk in skeletogenesis. Sci Signal 2010;3:re9. [35] Colvin JS, Bohne BA, Harding GW, McEwen DG, Ornitz DM. Skeletal overgrowth and deafness in mice lacking fibroblast growth factor receptor 3. Nat Genet 1996;12:390e7. [36] Deng C, Wynshaw-Boris A, Zhou F, Kuo A, Leder P. Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell 1996;84:911e21.

PEDIATRIC BONE

76

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

[37] Legeai-Mallet L, Benoist-Lasselin C, Munnich A, Bonaventure J. Overexpression of FGFR3, Stat1, Stat5 and p21Cip1 correlates with phenotypic severity and defective chondrocyte differentiation in FGFR3-related chondrodysplasias. Bone 2004;34:26e36. [38] Sahni M, Ambrosetti DC, Mansukhani A, Gertner R, Levy D, Basilico C. FGF signaling inhibits chondrocyte proliferation and regulates bone development through the STAT-1 pathway. Genes Dev 1999;13:1361e6. [39] Su WC, Kitagawa M, Xue N, et al. Activation of Stat1 by mutant fibroblast growth-factor receptor in thanatophoric dysplasia type II dwarfism. Nature 1997;386:288e92. [40] Chen L, Li C, Qiao W, Xu X, Deng C. A Ser(365) Cys mutation of fibroblast growth factor receptor 3 in mouse downregulates Ihh/PTHrP signals and causes severe achondroplasia. Hum Mol Genet 2001;10:457e65. [41] Li C, Chen L, Iwata T, Kitagawa M, Fu XY, Deng CX. A Lys644Glu substitution in fibroblast growth factor receptor 3 (FGFR3) causes dwarfism in mice by activation of STATs and ink4 cell cycle inhibitors. Hum Mol Genet 1999;8:35e44. [42] Naski MC, Colvin JS, Coffin JD, Ornitz DM. Repression of hedgehog signaling and BMP4 expression in growth plate cartilage by fibroblast growth factor receptor 3. Development 1998;125:4977e88. [43] Iwata T, Chen L, Li C, et al. A neonatal lethal mutation in FGFR3 uncouples proliferation and differentiation of growth plate chondrocytes in embryos. Hum Mol Genet 2000;9:1603e13. [44] Segev O, Chumakov I, Nevo Z, et al. Restrained chondrocyte proliferation and maturation with abnormal growth plate vascularization and ossification in human FGFR-3(G380R) transgenic mice. Hum Mol Genet 2000;9:249e58. [45] Yoon BS, Pogue R, Ovchinnikov DA, et al. BMPs regulate multiple aspects of growth-plate chondrogenesis through opposing actions on FGF pathways. Development 2006;133: 4667e78. [46] Liu Z, Xu J, Colvin JS, Ornitz DM. Coordination of chondrogenesis and osteogenesis by fibroblast growth factor 18. Genes Dev 2002;16:859e69. [47] Liu Z, Lavine K, Hung I, Ornitz D. FGF18 is required for early chondrocyte proliferation, hypertrophy and vascular invasion of the growth plate. Dev Biol 2007;302:80e91. [48] Ohbayashi N, Shibayama M, Kurotaki Y, et al. FGF18 is required for normal cell proliferation and differentiation during osteogenesis and chondrogenesis. Genes Dev 2002;16:870e9. [49] Hung IH, Yu K, Lavine KJ, Ornitz DM. FGF9 regulates early hypertrophic chondrocyte differentiation and skeletal vascularization in the developing stylopod. Dev Biol 2007;307:300e13. [50] Colnot C, Lu C, Hu D, Helms JA. Distinguishing the contributions of the perichondrium, cartilage, and vascular endothelium to skeletal development. Dev Biol 2004;269:55e69. [51] Schipani E, Maes C, Carmeliet G, Semenza GL. Regulation of osteogenesis-angiogenesis coupling by HIFs and VEGF. J Bone Miner Res 2009;24:1347e53. [52] Wan C, Shao J, Gilbert SR, et al. Role of HIF-1alpha in skeletal development. Ann NY Acad Sci 2010;1192:322e6. [53] Karsenty G. The complexities of skeletal biology. Nature 2003;423:316e8. [54] Brandi ML, Collin-Osdoby P. Vascular biology and the skeleton. J Bone Miner Res 2006;21:183e92. [55] Hiraki Y, Shukunami C. Angiogenesis inhibitors localized in hypovascular mesenchymal tissues: chondromodulin-I and tenomodulin. Connect Tissue Res 2005;46:3e11. [56] Moses MA, Wiederschain D, Wu I, et al. Troponin I is present in human cartilage and inhibits angiogenesis. Proc Natl Acad Sci USA 1999;96:2645e50.

[57] Araldi E, Schipani E. Hypoxia, HIFs and bone development. Bone 2010;47:190e6. [58] Schipani E, Ryan HE, Didrickson S, Kobayashi T, Knight M, Johnson RS. Hypoxia in cartilage: HIF-1alpha is essential for chondrocyte growth arrest and survival. Genes Dev 2001;15: 2865e76. [59] Semenza GL. Regulation of cancer cell metabolism by hypoxiainducible factor 1. Semin Cancer Biol 2009;19:12e6. [60] Ivan M, Kondo K, Yang H, et al. HIFalpha targeted for VHLmediated destruction by proline hydroxylation: implications for O2 sensing. Science 2001;292:464e8. [61] Jaakkola P, Mole D, Tian Y, et al. Targeting of HIF-alpha to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science 2001;292:468e72. [62] Simon MC, Keith B. The role of oxygen availability in embryonic development and stem cell function. Nat Rev 2008;9:285e96. [63] Amarilio R, Viukov S, Sharir A, Eshkar-Oren I, Johnson R, Zelzer E. Hif1alpha regulation of Sox9 is necessary to maintain differentiation of hypoxic prechondrogenic cells during early chondrogenesis. Development 2007;134:3917e28. [64] Provot S, Zinyk D, Gunes Y, et al. Hif-1alpha regulates differentiation of limb bud mesenchyme and joint development. J Cell Biol 2007;177:451e64. [65] Maes C, Stockmans I, Moermans K, et al. Soluble VEGF isoforms are essential for establishing epiphyseal vascularization and regulating chondrocyte development and survival. J Clin Invest 2004;113:188e99. [66] Seagroves T, Ryan H, Lu H, et al. Transcription factor HIF-1 is necessary mediator of the pasteur effect in mammalian cells. Mol Cell Biol 2001;21:3436e44. [67] Ferrara N. Vascular endothelial growth factor: basic science and clinical progress. Endocr Rev 2004;25:581e611. [68] Zelzer E, Mamluk R, Ferrara N, Johnson R, Schipani E, Olsen B. VEGFA is necessary for chondrocyte survival during bone development. Development 2004;131:2161e71. [69] Cramer T, Schipani E, Johnson RS, Swoboda B, Pfander D. Expression of VEGF isoforms by epiphyseal chondrocytes during low-oxygen tension is HIF-1 alpha dependent. Osteoarthrit Cart 2004;12:433e9. [70] Lin C, McGough R, Aswad B, Block JA, Terek R. Hypoxia induces HIF-1alpha and VEGF expression in chondrosarcoma cells and chondrocytes. J Orthop Res 2004;22:1175e81. [71] Maes C, Carmeliet G. Vascular and nonvascular roles of VEGF in bone development. In: Ruhrberg C, editor. VEGF in Development. Austin: Springer; 2008. p. 79e90. [72] Maes C, Carmeliet P, Moermans K, et al. Impaired angiogenesis and endochondral bone formation in mice lacking the vascular endothelial growth factor isoforms VEGF164 and VEGF188. Mech Dev 2002;111:61e73. [73] Zelzer E, McLean W, Ng YS, et al. Skeletal defects in VEGF(120/ 120) mice reveal multiple roles for VEGF in skeletogenesis. Development 2002;129:1893e904. [74] Haigh J, Gerber H, Ferrara N, Wagner E. Conditional inactivation of VEGF-A in areas of collagen2a1 expression results in embryonic lethality in the heterozygous state. Development 2000;127:1445e53. [75] Eshkar-Oren I, Viukov SV, Salameh S, et al. The forming limb skeleton serves as a signaling center for limb vasculature patterning via regulation of Vegf. Development 2009;136: 1263e72. [76] Dai J, Rabie AB. VEGF: an essential mediator of both angiogenesis and endochondral ossification. J Dent Res 2007;86: 937e50.

PEDIATRIC BONE

77

REFERENCES

[77] Zelzer E, Olsen B. Multiple roles of vascular endothelial growth factor (VEGF) in skeletal development, growth and repair. Curr Top Dev Biol 2005;65:169e87. [78] Karsenty G, Wagner EF. Reaching a genetic and molecular understanding of skeletal development. Dev Cell 2002;2: 389e406. [79] Jacobsen KA, Al Aql ZS, Wan C, et al. Bone formation during distraction osteogenesis is dependent on both VEGFR1 and VEGFR2 signaling. J Bone Miner Res 2008;23:596e609. [80] Street J, Bao M, deGuzman L, et al. Vascular endothelial growth factor stimulates bone repair by promoting angiogenesis and bone turnover. Proc Natl Acad Sci USA 2002;99:9656e61. [81] Carano RA, Filvaroff EH. Angiogenesis and bone repair. Drug Discov Today 2003;8:980e9. [82] Maes C, Goossens S, Bartunkova S, et al. Increased skeletal VEGF enhances beta-catenin activity and results in excessively ossified bones. EMBO J 2010;29:424e41. [83] Kim HH, Lee SE, Chung WJ, et al. Stabilization of hypoxiainducible factor-1alpha is involved in the hypoxic stimuliinduced expression of vascular endothelial growth factor in osteoblastic cells. Cytokine 2002;17:14e27. [84] Knowles HJ, Athanasou NA. Hypoxia-inducible factor is expressed in giant cell tumour of bone and mediates paracrine effects of hypoxia on monocyte-osteoclast differentiation via induction of VEGF. J Pathol 2008;215:56e66. [85] Wang Y, Wan C, Deng L, et al. The hypoxia-inducible factor alpha pathway couples angiogenesis to osteogenesis during skeletal development. J Clin Invest 2007;117:1616e26. [86] Zelzer E, Glotzer D, Hartmann C, et al. Tissue specific regulation of VEGF expression during bone development requires Cbfa1/Runx2. Mech Dev 2001;106:97e106. [87] Chen Y, Shao JZ, Xiang LX, Dong XJ, Zhang GR. Mesenchymal stem cells: a promising candidate in regenerative medicine. Int J Biochem Cell Biol 2008;40:815e20. [88] Nishimura R, Hata K, Ikeda F, et al. Signal transduction and transcriptional regulation during mesenchymal cell differentiation. J Bone Miner Metab 2008;26:203e12. [89] Mendez-Ferrer S, Michurina TV, Ferraro F, et al. Mesenchymal and haematopoietic stem cells form a unique bone marrow niche. Nature 2010;466:829e34. [90] Harada S, Rodan GA. Control of osteoblast function and regulation of bone mass. Nature 2003;423:349e55. [91] Karsenty G. Transcriptional control of skeletogenesis. Annu Rev Genomics Hum Genet 2008;9:183e96. [92] Bonewald LF. The amazing osteocyte. J Bone Miner Res 2011;26: 229e38. [93] Noble BS. The osteocyte lineage. Arch Biochem Biophys 2008;473:106e11. [94] Clevers H. Wnt/beta-catenin signaling in development and disease. Cell 2006;127:469e80. [95] Klaus A, Birchmeier W. Wnt signalling and its impact on development and cancer. Nat Rev Cancer 2008;8:387e98. [96] Baron R, Rawadi G. Targeting the Wnt/beta-catenin pathway to regulate bone formation in the adult skeleton. Endocrinology 2007;148:2635e43. [97] Hoeppner LH, Secreto FJ, Westendorf JJ. Wnt signaling as a therapeutic target for bone diseases. Expert Opin Ther Targets 2009;13:485e96. [98] Kubota T, Michigami T, Ozono K. Wnt signaling in bone metabolism. J Bone Miner Metab 2009;27:265e71. [99] Jin T, George FI, Sun J. Wnt and beyond Wnt: multiple mechanisms control the transcriptional property of beta-catenin. Cell Signal 2008;20:1697e704. [100] Grigoryan T, Wend P, Klaus A, Birchmeier W. Deciphering the function of canonical Wnt signals in development and disease:

[101]

[102]

[103]

[104]

[105]

[106]

[107] [108]

[109]

[110]

[111]

[112]

[113]

[114]

[115]

[116]

[117]

[118]

[119]

[120]

conditional loss- and gain-of-function mutations of beta-catenin in mice. Genes Dev 2008;22:2308e41. Day T, Guo X, Garrett-Beal L, Yang Y. Wnt/beta-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Dev Cell 2005;8:739e50. Hill T, Spater D, Taketo M, Birchmeier W, Hartmann C. Canonical wnt/betacatenin signaling prevents osteoblasts from differentiating into chondrocytes. Dev Cell 2005;8:727e38. Hu H, Hilton MJ, Tu X, Yu K, Ornitz DM, Long F. Sequential roles of Hedgehog and Wnt signaling in osteoblast development. Development 2005;132:49e60. Rodda SJ, McMahon AP. Distinct roles for Hedgehog and canonical Wnt signaling in specification, differentiation and maintenance of osteoblast progenitors. Development 2006;133: 3231e44. Glass DA, Bialek P, Ahn JD, et al. Canonical Wnt signaling in differentiated osteoblasts controls osteoclast differentiation. Dev Cell 2005;8:751e64. Kramer I, Halleux C, Keller H, et al. Osteocyte Wnt/beta-catenin signaling is required for normal bone homeostasis. Mol Cell Biol 2010;30:3071e85. Baron R, Rawadi G, Roman-Roman S. Wnt signaling: a key regulator of bone mass. Curr Top Dev Biol 2006;76:103e27. Gong Y, Slee RB, Fukai N, et al. LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development. Cell 2001;107: 513e23. Kato M, Patel MS, Levasseur R, et al. Cbfa1-independent decrease in osteoblast proliferation, osteopenia, and persistent embryonic eye vascularization in mice deficient in Lrp5, a Wnt coreceptor. J Cell Biol 2002;157:303e14. Little RD, Carulli JP, Del Mastro RG, et al. A mutation in the LDL receptor-related protein 5 gene results in the autosomal dominant high-bone-mass trait. Am J Hum Genet 2002;70:11e9. Balemans W, Devogelaer JP, Cleiren E, Piters E, Caussin E, Van Hul W. Novel LRP5 missense mutation in a patient with a high bone mass phenotype results in decreased DKK1-mediated inhibition of Wnt signaling. J Bone Miner Res 2007;22:708e16. Boyden LM, Mao J, Belsky J, et al. High bone density due to a mutation in LDL-receptor-related protein 5. N Engl J Med 2002;346:1513e21. Semenov MV, He X. LRP5 mutations linked to high bone mass diseases cause reduced LRP5 binding and inhibition by SOST. J Biol Chem 2006;281:38276e84. Yadav VK, Ryu JH, Suda N, et al. Lrp5 controls bone formation by inhibiting serotonin synthesis in the duodenum. Cell 2008;135:825e37. Balemans W, Patel N, Ebeling M, et al. Identification of a 52 kb deletion downstream of the SOST gene in patients with van Buchem disease. J Med Genet 2002;39:91e7. Balemans W, Van Hul W. Identification of the disease-causing gene in sclerosteosis e discovery of a novel bone anabolic target? J Musculoskelet Neuronal Interact 2004;4:139e42. Otto F, Thornell AP, Crompton T, et al. Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 1997;89:765e71. Lee B, Thirunavukkarasu K, Zhou L, et al. Missense mutations abolishing DNA binding of the osteoblast-specific transcription factor OSF2/CBFA1 in cleidocranial dysplasia. Nat Genet 1997;16:307e10. Mundlos S, Otto F, Mundlos C, et al. Mutations involving the transcription factor CBFA1 cause cleidocranial dysplasia. Cell 1997;89:773e9. Franceschi RT, Ge C, Xiao G, Roca H, Jiang D. Transcriptional regulation of osteoblasts. Ann NY Acad Sci 2007;1116:196e207.

PEDIATRIC BONE

78

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

[121] Komori T. Regulation of bone development and extracellular matrix protein genes by RUNX2. Cell Tissue Res 2010;339: 189e95. [122] Nakashima K, Zhou X, Kunkel G, et al. The novel zinc fingercontaining transcription factor osterix is required for osteoblast differentiation and bone formation. Cell 2002;108:17e29. [123] Nishio Y, Dong Y, Paris M, O’Keefe RJ, Schwarz EM, Drissi H. Runx2-mediated regulation of the zinc finger Osterix/Sp7 gene. Gene 2006;372:62e70. [124] Koga T, Matsui Y, Asagiri M, et al. NFAT and Osterix cooperatively regulate bone formation. Nat Med 2005;11:880e5. [125] Kaback LA, Soung dY, Naik A, et al. Osterix/Sp7 regulates mesenchymal stem cell mediated endochondral ossification. J Cell Physiol 2008;214:173e82. [126] Tominaga H, Maeda S, Miyoshi H, Miyazono K, Komiya S, Imamura T. Expression of osterix inhibits bone morphogenetic protein-induced chondrogenic differentiation of mesenchymal progenitor cells. J Bone Miner Metab 2008. [127] Komori T. Regulation of osteoblast differentiation by transcription factors. J Cell Biochem 2006;99:1233e9. [128] Marie PJ. Transcription factors controlling osteoblastogenesis. Arch Biochem Biophys 2008;473:98e105. [129] Kirker-Head CA, Boudrieau RJ, Kraus KH. Use of bone morphogenetic proteins for augmentation of bone regeneration. J Am Vet Med Assoc 2007;231:1039e55. [130] Leboy PS. Regulating bone growth and development with bone morphogenetic proteins. Ann NY Acad Sci 2006;1068:14e8. [131] Chen D, Zhao M, Mundy GR. Bone morphogenetic proteins. Growth Factors 2004;22:233e41. [132] Shi Y, Massague J. Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 2003;113:685e700. [133] Hogan BL. Bone morphogenetic proteins: multifunctional regulators of vertebrate development. Genes Dev 1996;10: 1580e94. [134] Pizette S, Niswander L. BMPs are required at two steps of limb chondrogenesis: formation of prechondrogenic condensations and their differentiation into chondrocytes. Dev Biol 2000;219: 237e49. [135] Tsumaki N, Nakase T, Miyaji T, et al. Bone morphogenetic protein signals are required for cartilage formation and differently regulate joint development during skeletogenesis. J Bone Miner Res 2002;17:898e906. [136] Yoon BS, Ovchinnikov DA, Yoshii I, Mishina Y, Behringer RR, Lyons KM. Bmpr1a and Bmpr1b have overlapping functions and are essential for chondrogenesis in vivo. Proc Natl Acad Sci USA 2005;102:5062e7. [137] Tsuji K, Cox K, Gamer L, Graf D, Economides A, Rosen V. Conditional deletion of BMP7 from the limb skeleton does not affect bone formation or fracture repair. J Orthop Res 2010;28: 384e9. [138] Bandyopadhyay A, Tsuji K, Cox K, Harfe BD, Rosen V, Tabin CJ. Genetic analysis of the roles of BMP2, BMP4, and BMP7 in limb patterning and skeletogenesis. PLoSGenet 2006;2:e216. [139] Wu XB, Li Y, Schneider A, et al. Impaired osteoblastic differentiation, reduced bone formation, and severe osteoporosis in noggin-overexpressing mice. J Clin Invest 2003;112:924e34. [140] Gazzerro E, Pereira RC, Jorgetti V, Olson S, Economides AN, Canalis E. Skeletal overexpression of gremlin impairs bone formation and causes osteopenia. Endocrinology 2005;146: 655e65. [141] Kamiya N, Ye L, Kobayashi T, et al. Disruption of BMP signaling in osteoblasts through type IA receptor (BMPRIA) increases bone mass. J Bone Miner Res 2008;23:2007e17. [142] Katagiri T, Yamaguchi A, Komaki M, et al. Bone morphogenetic protein-2 converts the differentiation pathway of C2C12

[143]

[144]

[145]

[146]

[147]

[148]

[149]

[150]

[151]

[152]

[153]

[154]

[155]

[156]

[157]

[158]

[159]

myoblasts into the osteoblast lineage. J Cell Biol 1994;127: 1755e66. Ryoo HM, Lee MH, Kim YJ. Critical molecular switches involved in BMP-2-induced osteogenic differentiation of mesenchymal cells. Gene 2006;366:51e7. Celil AB, Campbell PG. BMP-2 and insulin-like growth factor-I mediate Osterix (Osx) expression in human mesenchymal stem cells via the MAPK and protein kinase D signaling pathways. J Biol Chem 2005;280:31353e9. Javed A, Bae JS, Afzal F, et al. Structural coupling of Smad and Runx2 for execution of the BMP2 osteogenic signal. J Biol Chem 2008;283:8412e22. Lee KS, Kim HJ, Li QL, et al. Runx2 is a common target of transforming growth factor beta1 and bone morphogenetic protein 2, and cooperation between Runx2 and Smad5 induces osteoblast-specific gene expression in the pluripotent mesenchymal precursor cell line C2C12. Mol Cell Biol 2000;20: 8783e92. Lee MH, Kwon TG, Park HS, Wozney JM, Ryoo HM. BMP-2induced Osterix expression is mediated by Dlx5 but is independent of Runx2. Biochem Biophys Res Commun 2003;309: 689e94. Govender S, Csimma C, Genant HK, et al. Recombinant human bone morphogenetic protein-2 for treatment of open tibial fractures: a prospective, controlled, randomized study of four hundred and fifty patients. J Bone Joint Surg Am 2002;84-A: 2123e34. Styrkarsdottir U, Cazier JB, Kong A, et al. Linkage of osteoporosis to chromosome 20p12 and association to BMP2. PLoSBiol 2003;1:E69. Long F, Chung UI, Ohba S, McMahon J, Kronenberg HM, McMahon AP. Ihh signaling is directly required for the osteoblast lineage in the endochondral skeleton. Development 2004;131:1309e18. Shimoyama A, Wada M, Ikeda F, et al. Ihh/Gli2 signaling promotes osteoblast differentiation by regulating Runx2 expression and function. Mol Biol Cell 2007;18:2411e8. Zhao M, Qiao M, Harris SE, Chen D, Oyajobi BO, Mundy GR. The zinc finger transcription factor Gli2 mediates bone morphogenetic protein 2 expression in osteoblasts in response to hedgehog signaling. Mol Cell Biol 2006;26:6197e208. Eswarakumar VP, Horowitz MC, Locklin R, Morriss-Kay GM, Lonai P. A gain-of-function mutation of Fgfr2c demonstrates the roles of this receptor variant in osteogenesis. Proc Natl Acad Sci USA 2004;101:12555e60. Jacob AL, Smith C, Partanen J, Ornitz DM. Fibroblast growth factor receptor 1 signaling in the osteo-chondrogenic cell lineage regulates sequential steps of osteoblast maturation. Dev Biol 2006;296:315e28. Yu K, Xu J, Liu Z, et al. Conditional inactivation of FGF receptor 2 reveals an essential role for FGF signaling in the regulation of osteoblast function and bone growth. Development 2003;130: 3063e74. Choi KY, Kim HJ, Lee MH, et al. Runx2 regulates FGF2-induced Bmp2 expression during cranial bone development. Dev Dyn 2005;233:115e21. Kim BG, Kim HJ, Park HJ, et al. Runx2 phosphorylation induced by fibroblast growth factor-2/protein kinase C pathways. Proteomics 2006;6:1166e74. Naganawa T, Xiao L, Coffin JD, et al. Reduced expression and function of bone morphogenetic protein-2 in bones of Fgf2 null mice. J Cell Biochem 2008;103:1975e88. Reinhold MI, Naski MC. Direct interactions of Runx2 and canonical Wnt signaling induce FGF18. J Biol Chem 2007;282: 3653e63.

PEDIATRIC BONE

REFERENCES

[160] Vu TH, Shipley JM, Bergers G, et al. MMP-9/gelatinase B is a key regulator of growth plate angiogenesis and apoptosis of hypertrophic chondrocytes. Cell 1998;93:411e22. [161] Dougall WC, Glaccum M, Charrier K, et al. RANK is essential for osteoclast and lymph node development. Genes Dev 1999;13:2412e24. [162] Rauch F, Cornibert S, Cheung M, Glorieux FH. Long-bone changes after pamidronate discontinuation in children and adolescents with osteogenesis imperfecta. Bone 2007;40:821e7. [163] Rauch F, Plotkin H, Zeitlin L, Glorieux FH. Bone mass, size, and density in children and adolescents with osteogenesis imperfecta: effect of intravenous pamidronate therapy. J Bone Miner Res 2003;18:610e4. [164] Rauch F, Glorieux FH. Osteogenesis imperfecta, current and future medical treatment. Am J Med Genet C Semin Med Genet 2005;139C:31e7. [165] Sanguinetti C, Greco F, De Palma L, Specchia N, Falciglia F. Morphological changes in growth-plate cartilage in osteogenesis imperfecta. J Bone Joint Surg Br 1990;72:475e9. [166] Evans KD, Lau ST, Oberbauer AM, Martin RB. Alendronate affects long bone length and growth plate morphology in the oim mouse model for osteogenesis imperfecta. Bone 2003;32: 268e74. [167] Glorieux FH, Bishop NJ, Plotkin H, Chabot G, Lanoue G, Travers R. Cyclic administration of pamidronate in children with severe osteogenesis imperfecta. N Engl J Med 1998;339: 947e52. [168] Glorieux FH, Rauch F, Shapiro JR. Bisphosphonates in children with bone diseases. N Engl J Med 2003;349:2068e71. author reply 71. [169] Martin TJ, Seeman E. Bone remodelling: its local regulation and the emergence of bone fragility. Best Pract Res Clin Endocrinol Metab 2008;22:701e22. [170] Sims NA, Gooi JH. Bone remodeling: multiple cellular interactions required for coupling of bone formation and resorption. Semin Cell Dev Biol 2008;19:444e51. [171] DeKoter RP, Singh H. Regulation of B lymphocyte and macrophage development by graded expression of PU.1. Science 2000;288:1439e41. [172] Tondravi M, McKercher S, Anderson K, et al. Osteopetrosis in mice lacking haematopoietic transcription factor PU.1. Nature 1997;386:81e4. [173] Zhang DE, Hetherington CJ, Chen HM, Tenen DG. The macrophage transcription factor PU.1 directs tissue-specific expression of the macrophage colony-stimulating factor receptor. Mol Cell Biol 1994;14:373e81. [174] Kwon OH, Lee CK, Lee YI, Paik SG, Lee HJ. The hematopoietic transcription factor PU.1 regulates RANK gene expression in myeloid progenitors. Biochem Biophys Res Commun 2005;335: 437e46. [175] Boyce BF, Yao Z, Xing L. Functions of nuclear factor kappaB in bone. Ann NY Acad Sci 2010;1192:367e75. [176] Iotsova V, Caamano J, Loy J, Yang Y, Lewin A, Bravo R. Osteopetrosis in mice lacking NF-kappaB1 and NF-kappaB2. Nat Med 1997;3:1285e9. [177] Franzoso G, Carlson L, Xing L, et al. Requirement for NF-kappaB in osteoclast and B-cell development. Genes Dev 1997;11: 3482e96. [178] Wagner EF, Eferl R. Fos/AP-1 proteins in bone and the immune system. Immunol Rev 2005;208:126e40. [179] Johnson RS, Spiegelman BM, Papaioannou V. Pleiotropic effects of a null mutation in the c-fos proto-oncogene. Cell 1992;71: 577e86.

79

[180] Wang ZQ, Ovitt C, Grigoriadis AE, Mohle-Steinlein U, Ruther U, Wagner EF. Bone and haematopoietic defects in mice lacking c-fos. Nature 1992;360:741e5. [181] Asagiri M, Takayanagi H. The molecular understanding of osteoclast differentiation. Bone 2007;40:251e64. [182] Takayanagi H. Mechanistic insight into osteoclast differentiation in osteoimmunology. J Mol Med 2005;83:170e9. [183] Yoshida H, Hayashi S, Kunisada T, et al. The murine mutation osteopetrosis is in the coding region of the macrophage colony stimulating factor gene. Nature 1990;345:442e4. [184] Boyce BF, Xing L. Functions of RANKL/RANK/OPG in bone modeling and remodeling. Arch Biochem Biophys 2008;473: 139e46. [185] Leibbrandt A, Penninger JM. RANK/RANKL: regulators of immune responses and bone physiology. Ann NY Acad Sci 2008;1143:123e50. [186] Boyle WJ, Simonet WS, Lacey DL. Osteoclast differentiation and activation. Nature 2003;423:337e42. [187] Hughes A, Ralston S, Marken J, et al. Mutations in TNFRSF11A, affecting the signal peptide of RANK, cause familial expansile osteolysis. Nat Genet 2000:45e8. [188] Whyte MP, Obrecht SE, Finnegan PM, et al. Osteoprotegerin deficiency and juvenile Paget’s disease. N Engl J Med 2002;347: 175e84. [189] Koga T, Inui M, Inoue K, et al. Costimulatory signals mediated by the ITAM motif cooperate with RANKL for bone homeostasis. Nature 2004;428:758e63. [190] Yagi M, Miyamoto T, Sawatani Y, Iwamoto K, Hosogane N, Fujita N, et al. DC-STAMP is essential for cell-cell fusion in osteoclasts and foreign body giant cells. J Exp Med 2005;202: 345e51. [191] Anandarajah AP, Schwarz EM. Anti-RANKL therapy for inflammatory bone disorders: Mechanisms and potential clinical applications. J Cell Biochem 2006;97:226e32. [192] Stolina M, Kostenuik PJ, Dougall WC, Fitzpatrick LA, Zack DJ. RANKL inhibition: from mice to men (and women). Adv Exp Med Biol 2007;602:143e50. [193] Burkiewicz JS, Scarpace SL, Bruce SP. Denosumab in osteoporosis and oncology. Ann Pharmacother 2009;43:1445e55. [194] Luxenburg C, Geblinger D, Klein E, et al. The architecture of the adhesive apparatus of cultured osteoclasts: from podosome formation to sealing zone assembly. PLoSONE 2007;2:e179. [195] Teitelbaum SL. Osteoclasts: what do they do and how do they do it? Am J Pathol 2007;170:427e35. [196] Vaananen HK, Laitala-Leinonen T. Osteoclast lineage and function. Arch Biochem Biophys 2008;473:132e8. [197] Rodan GA, Martin TJ. Therapeutic approaches to bone diseases. Science 2000;289:1508e14. [198] Gowen M, Lazner F, Dodds R, et al. Cathepsin K knockout mice develop osteopetrosis due to a deficit in matrix degradation but not demineralization. J Bone Miner Res 1999;14:1654e63. [199] Johnson MR, Polymeropoulos MH, Vos HL, Ortiz de Luna RI, Francomano CA. A nonsense mutation in the cathepsin K gene observed in a family with pycnodysostosis. Genome Res 1996;6: 1050e5. [200] Le Gall C, Bonnelye E, Clezardin P. Cathepsin K inhibitors as treatment of bone metastasis. Curr Opin Support Palliat Care 2008;2:218e22. [201] Stoch SA, Wagner JA. Cathepsin K inhibitors: a novel target for osteoporosis therapy. Clin Pharmacol Ther 2008;83:172e6. [202] Delaisse JM, Andersen TL, Engsig MT, Henriksen K, Troen T, Blavier L. Matrix metalloproteinases (MMP) and cathepsin K contribute differently to osteoclastic activities. Microsc Res Tech 2003;61:504e13.

PEDIATRIC BONE

80

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

[203] Krane SM, Inada M. Matrix metalloproteinases and bone. Bone 2008;43:7e18. [204] Sternlicht MD, Werb Z. How matrix metalloproteinases regulate cell behavior. Annu Rev Cell Dev Biol 2001;17:463e516. [205] Martin T, Gooi JH, Sims NA. Molecular mechanisms in coupling of bone formation to resorption. Crit Rev Eukaryot Gene Express 2009;19:73e88. [206] Matsuo K, Irie N. Osteoclast-osteoblast communication. Arch Biochem Biophys 2008;473:201e9. [207] Manolagas SC. Birth and death of bone cells: basic regulatory mechanisms and implications for the pathogenesis and treatment of osteoporosis. Endocr Rev 2000;21:115e37. [208] Tang Y, Wu X, Lei W, et al. TGF-beta1-induced migration of bone mesenchymal stem cells couples bone resorption with formation. Nat Med 2009;15:757e65. [209] Zhao C, Irie N, Takada Y, et al. Bidirectional ephrinB2-EphB4 signaling controls bone homeostasis. Cell Metab 2006;4:111e21. [210] Edwards CM, Mundy GR. Eph receptors and ephrin signaling pathways: a role in bone homeostasis. Int J Med Sci 2008;5: 263e72. [211] Lee SH, Rho J, Jeong D, et al. v-ATPase V0 subunit d2-deficient mice exhibit impaired osteoclast fusion and increased bone formation. Nat Med 2006;12:1403e9. [212] Sims NA. gp130 signaling in bone cell biology: multiple roles revealed by analysis of genetically altered mice. Mol Cell Endocrinol 2009;310:30e9. [213] Villemure I, Stokes IA. Growth plate mechanics and mechanobiology. A survey of present understanding. J Biomech 2009;42:1793e803. [214] Bonewald LF, Johnson ML. Osteocytes, mechanosensing and Wnt signaling. Bone 2008;42:606e15. [215] Robling AG, Niziolek PJ, Baldridge LA, et al. Mechanical stimulation of bone in vivo reduces osteocyte expression of Sost/sclerostin. J Biol Chem 2008;283:5866e75. [216] Han Y, Cowin SC, Schaffler MB, Weinbaum S. Mechanotransduction and strain amplification in osteocyte cell processes. Proc Natl Acad Sci USA 2004;101:16689e94. [217] Strom TM, Juppner H. PHEX, FGF23, DMP1 and beyond. Curr Opin Nephrol Hypertens 2008;17:357e62. [218] Tatsumi S, Ishii K, Amizuka N, et al. Targeted ablation of osteocytes induces osteoporosis with defective mechanotransduction. Cell Metab 2007;5:464e75. [219] Kogianni G, Mann V, Noble BS. Apoptotic bodies convey activity capable of initiating osteoclastogenesis and localized bone destruction. J Bone Miner Res 2008;23:915e27. [220] Zhao S, Zhang YK, Harris S, Ahuja SS, Bonewald LF. MLO-Y4 osteocyte-like cells support osteoclast formation and activation. J Bone Miner Res 2002;17:2068e79. [221] Aguirre JI, Plotkin LI, Stewart SA, et al. Osteocyte apoptosis is induced by weightlessness in mice and precedes osteoclast recruitment and bone loss. J Bone Miner Res 2006;21:605e15. [222] Noble BS, Peet N, Stevens HY, et al. Mechanical loading: biphasic osteocyte survival and targeting of osteoclasts for bone destruction in rat cortical bone. Am J Physiol Cell Physiol 2003;284. C934-C43. [223] Xiao Z, Zhang S, Mahlios J, et al. Cilia-like structures and polycystin-1 in osteoblasts/osteocytes and associated abnormalities in skeletogenesis and Runx2 expression. J Biol Chem 2006;281:30884e95. [224] Xiao Z, Dallas M, Qiu N, et al. Conditional deletion of Pkd1 in osteocytes disrupts skeletal mechanosensing in mice. Faseb J 2011. [225] Yang W, Lu Y, Kalajzic I, et al. Dentin matrix protein 1 gene cisregulation: use in osteocytes to characterize local responses to

[226]

[227]

[228]

[229]

[230]

[231]

[232]

[233]

[234]

[235]

[236]

[237]

[238]

[239]

[240]

[241]

[242]

[243]

[244]

mechanical loading in vitro and in vivo. J Biol Chem 2005;280: 20680e90. Feng JQ, Ward LM, Liu S, et al. Loss of DMP1 causes rickets and osteomalacia and identifies a role for osteocytes in mineral metabolism. Nat Genet 2006;38:1310e5. Li X, Ominsky MS, Niu QT, et al. Targeted deletion of the sclerostin gene in mice results in increased bone formation and bone strength. J Bone Miner Res 2008;23:860e9. Winkler DG, Sutherland MK, Geoghegan JC, et al. Osteocyte control of bone formation via sclerostin, a novel BMP antagonist. EMBO J 2003;22:6267e76. Ahmed SF, Farquharson C. The effect of GH and IGF1 on linear growth and skeletal development and their modulation by SOCS proteins. J Endocrinol 2010;206:249e59. Giustina A, Mazziotti G, Canalis E. Growth hormone, insulinlike growth factors, and the skeleton. Endocr Rev 2008;29: 535e59. Ning Y, Schuller AG, Bradshaw S, et al. Diminished growth and enhanced glucose metabolism in triple knockout mice containing mutations of insulin-like growth factor binding protein-3, -4, and -5. Mol Endocrinol 2006;20:2173e86. Woods KA, Camacho-Hubner C, Savage MO, Clark AJ. Intrauterine growth retardation and postnatal growth failure associated with deletion of the insulin-like growth factor I gene. N Engl J Med 1996;335:1363e7. Baker J, Liu JP, Robertson EJ, Efstratiadis A. Role of insulin-like growth factors in embryonic and postnatal growth. Cell 1993;75: 73e82. Liu J, Baker J, Perkins A, Robertson E, Efstradiatis A. Mice carrying null mutations of the genes encoding insulin-like growth factor I (Igf-1) and type 1 IGF receptor (Igf1r). Cell 1993;75:59e72. Lupu F, Terwilliger JD, Lee K, Segre GV, Efstratiadis A. Roles of growth hormone and insulin-like growth factor 1 in mouse postnatal growth. Dev Biol 2001;229:141e62. Woelfle J, Chia DJ, Rotwein P. Mechanisms of growth hormone (GH) action. Identification of conserved Stat5 binding sites that mediate GH-induced insulin-like growth factor-I gene activation. J Biol Chem 2003;278:51261e6. DeChiara T, Efstradiatis A, Robertson E. A growth-deficient phenotype in heterozygous mice carrying an insulin-like growth factor II gene disrupted by targeting. Nature 1990;345:78e80. Louvi A, Accili D, Efstratiadis A. Growth-promoting interaction of IGF-II with the insulin receptor during mouse embryonic development. Dev Biol 1997;189:33e48. Amselem S, Sobrier ML, Duquesnoy P, et al. Recurrent nonsense mutations in the growth hormone receptor from patients with Laron dwarfism. J Clin Invest 1991;87:1098e102. Zhou Y, Xu BC, Maheshwari HG, et al. A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse). Proc Natl Acad Sci USA 1997;94:13215e20. Powell-Braxton L, Hollingshead P, Warburton C, et al. IGF-I is required for normal embryonic growth in mice. Genes Dev 1993;7:2609e17. Wang J, Zhou J, Bondy CA. Igf1 promotes longitudinal bone growth by insulin-like actions augmenting chondrocyte hypertrophy. Faseb J 1999;13:1985e90. Sjogren K, Liu JL, Blad K, et al. Liver-derived insulin-like growth factor I (IGF-I) is the principal source of IGF-I in blood but is not required for postnatal body growth in mice. Proc Natl Acad Sci USA 1999;96:7088e92. Yakar S, Liu JL, Stannard B, et al. Normal growth and development in the absence of hepatic insulin-like growth factor I. Proc Natl Acad Sci USA 1999;96:7324e9.

PEDIATRIC BONE

81

REFERENCES

[245] Parker EA, Hegde A, Buckley M, Barnes KM, Baron J, Nilsson O. Spatial and temporal regulation of GH-IGF-related gene expression in growth plate cartilage. J Endocrinol 2007;194: 31e40. [246] Wang Y, Cheng Z, Elalieh HZ, et al. IGF-1R Signaling in chondrocytes modulates growth plate development by interacting with the PTHrP/Ihh pathway. J Bone Miner Res 2011. [247] DiGirolamo DJ, Mukherjee A, Fulzele K, et al. Mode of growth hormone action in osteoblasts. J Biol Chem 2007;282:31666e74. [248] Playford MP, Bicknell D, Bodmer WF, Macaulay VM. Insulinlike growth factor 1 regulates the location, stability, and transcriptional activity of beta-catenin. Proc Natl Acad Sci USA 2000;97:12103e8. [249] Smith EP, Boyd J, Frank GR, et al. Estrogen resistance caused by a mutation in the estrogen-receptor gene in a man. N Engl J Med 1994;331:1056e61. [250] Carani C, Qin K, Simoni M, et al. Effect of testosterone and estradiol in a man with aromatase deficiency. N Engl J Med 1997;337:91e5. [251] Bilezikian JP, Morishima A, Bell J, Grumbach MM. Increased bone mass as a result of estrogen therapy in a man with aromatase deficiency. N Engl J Med 1998;339:599e603. [252] Grumbach MM, Auchus RJ. Estrogen: consequences and implications of human mutations in synthesis and action. J Clin Endocrinol Metab 1999;84:4677e94. [253] Vanderschueren D, Boonen S, Ederveen AG, et al. Skeletal effects of estrogen deficiency as induced by an aromatase inhibitor in an aged male rat model. Bone 2000;27:611e7. [254] Borjesson AE, Lagerquist MK, Liu C, et al. The role of estrogen receptor alpha in growth plate cartilage for longitudinal bone growth. J Bone Miner Res 2010;25:2414e24. [255] Finkelstein JS, Neer RM, Biller BM, Crawford JD, Klibanski A. Osteopenia in men with a history of delayed puberty. N Engl J Med 1992;326:600e4. [256] Vanderschueren D, Gaytant J, Boonen S, Venken K. Androgens and bone. Curr Opin Endocrinol Diabetes Obes 2008;15:250e4. [257] Manolagas SC, Kousteni S, Jilka RL. Sex steroids and bone. Recent Prog Horm Res 2002;57:385e409. [258] Novack DV. Estrogen and bone: osteoclasts take center stage. Cell Metab 2007;6:254e6. [259] Rossouw JE, Anderson GL, Prentice RL, et al. Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the Women’s Health Initiative randomized controlled trial. J Am Med Assoc 2002;288:321e33. [260] Kameda T, Mano H, Yuasa T, et al. Estrogen inhibits bone resorption by directly inducing apoptosis of the bone-resorbing osteoclasts. J Exp Med 1997;186:489e95. [261] Nakamura T, Imai Y, Matsumoto T, et al. Estrogen prevents bone loss via estrogen receptor alpha and induction of Fas ligand in osteoclasts 1. Cell 2007;130:811e23. [262] Krum SA, Miranda-Carboni GA, Hauschka PV, et al. Estrogen protects bone by inducing Fas ligand in osteoblasts to regulate osteoclast survival. EMBO J 2008;27:535e45. [263] Kousteni S, Chen JR, Bellido T, et al. Reversal of bone loss in mice by nongenotropic signaling of sex steroids. Science 2002;298:843e6. [264] Almeida M, Martin-Millan M, Ambrogini E, et al. Estrogens attenuate oxidative stress and the differentiation and apoptosis of osteoblasts by DNA-binding-independent actions of the ERalpha. J Bone Miner Res 2010;25:769e81. [265] Manolagas SC. From estrogen-centric to aging and oxidative stress: a revised perspective of the pathogenesis of osteoporosis. Endocr Rev 2010;31:266e300. [266] Srivastava S, Toraldo G, Weitzmann MN, Cenci S, Ross FP, Pacifici R. Estrogen decreases osteoclast formation by down-

[267] [268] [269] [270] [271]

[272]

[273]

[274]

[275]

[276]

[277]

[278]

[279]

[280]

[281]

[282]

[283]

[284]

[285]

[286]

regulating receptor activator of NF-kappa B ligand (RANKL)induced JNK activation. J Biol Chem 2001;276:8836e40. Pacifici R. Estrogen deficiency, T cells and bone loss. Cell Immunol 2008;252:68e80. Weitzmann MN, Pacifici R. Estrogen deficiency and bone loss: an inflammatory tale. J Clin Invest 2006;116:1186e94. Sun L, Peng Y, Sharrow AC, et al. FSH directly regulates bone mass. Cell 2006;125:247e60. Gogakos AI, Duncan Bassett JH, Williams GR. Thyroid and bone. Arch Biochem Biophys 2010;503:129e36. Stevens DA, Hasserjian RP, Robson H, Siebler T, Shalet SM, Williams GR. Thyroid hormones regulate hypertrophic chondrocyte differentiation and expression of parathyroid hormonerelated peptide and its receptor during endochondral bone formation. J Bone Miner Res 2000;15:2431e42. Ballock R, Mita BC, Zhou X, Chen DH, Mink LM. Expression of thyroid hormone receptor isoforms in rat growth plate cartilage in vivo. J Bone Miner Res 1999;14:1550e6. Miura M, Tanaka K, Komatsu Y, et al. Thyroid hormones promote chondrocyte differentiation in mouse ATDC5 cells and stimulate endochondral ossification in fetal mouse tibias through iodothyronine deiodinases in the growth plate. J Bone Miner Res 2002;17:443e54. Robson H, Siebler T, Stevens DA, Shalet SM, Williams GR. Thyroid hormone acts directly on growth plate chondrocytes to promote hypertrophic differentiation and inhibit clonal expansion and cell proliferation. Endocrinology 2000;141:3887e97. Gauthier K, Plateroti M, Harvey CB, et al. Genetic analysis reveals different functions for the products of the thyroid hormone receptor alpha locus. Mol Cell Biol 2001;21:4748e60. Harvey CB, O’Shea PJ, Scott AJ, et al. Molecular mechanisms of thyroid hormone effects on bone growth and function. Mol Genet Metab 2002;75:17e30. Bassett JH, O’Shea PJ, Chassande O, et al. Analysis of skeletal phenotypes in thyroid hormone receptor mutant mice. Scanning 2006;28:91e3. Bassett JH, Williams AJ, Murphy E, et al. A lack of thyroid hormones rather than excess thyrotropin causes abnormal skeletal development in hypothyroidism. Mol Endocrinol 2008;22:501e12. Weiss RE, Refetoff S. Effect of thyroid hormone on growth. Lessons from the syndrome of resistance to thyroid hormone. Endocrinol Metab Clin North Am 1996;25:719e30. Canalis E, Mazziotti G, Giustina A, Bilezikian JP. Glucocorticoid-induced osteoporosis: pathophysiology and therapy. Osteoporos Int 2007;18:1319e28. O’Brien CA, Jia D, Plotkin LI, et al. Glucocorticoids act directly on osteoblasts and osteocytes to induce their apoptosis and reduce bone formation and strength. Endocrinology 2004;145: 1835e41. Yun SI, Yoon HY, Jeong SY, Chung YS. Glucocorticoid induces apoptosis of osteoblast cells through the activation of glycogen synthase kinase 3beta. J Bone Miner Metab 2008. Jia D, O’Brien CA, Stewart SA, Manolagas SC, Weinstein RS. Glucocorticoids act directly on osteoclasts to increase their life span and reduce bone density. Endocrinology 2006;147:5592e9. Kim HJ, Zhao H, Kitaura H, et al. Glucocorticoids suppress bone formation via the osteoclast. J Clin Invest 2006;116: 2152e60. Marino R, Hegde A, Barnes KM, et al. Catch-up growth after hypothyroidism is caused by delayed growth plate senescence. Endocrinology 2008;149:1820e8. Silvestrini G, Ballanti P, Patacchioli FR, et al. Evaluation of apoptosis and the glucocorticoid receptor in the cartilage growth plate and metaphyseal bone cells of rats after high-dose treatment with corticosterone. Bone 2000;26:33e42.

PEDIATRIC BONE

82

4. POSTNATAL BONE GROWTH: GROWTH PLATE BIOLOGY, BONE FORMATION, AND REMODELING

[287] Chrysis D, Ritzen EM, Savendahl L. Growth retardation induced by dexamethasone is associated with increased apoptosis of the growth plate chondrocytes. J Endocrinol 2003;176:331e7. [288] Nilsson O, Marino R, De Luca F, Phillip M, Baron J. Endocrine regulation of the growth plate. Horm Res 2005;64:157e65. [289] Lorenzo J, Horowitz M, Choi Y. Osteoimmunology: interactions of the bone and immune system. Endocr Rev 2008;29:403e40. [290] Takayanagi H. Osteoimmunology: shared mechanisms and crosstalk between the immune and bone systems. Nat Rev Immunol 2007;7:292e304. [291] Calvi LM, Adams GB, Weibrecht KW, et al. Osteoblastic cells regulate the haematopoietic stem cell niche. Nature 2003;425: 841e6. [292] Lo Celso C, Fleming HE, Wu JW, et al. Live-animal tracking of individual haematopoietic stem/progenitor cells in their niche. Nature 2009;457:92e6. [293] Lymperi S, Ferraro F, Scadden DT. The HSC niche concept has turned 31. Has our knowledge matured? Ann NY Acad Sci 2010;1192:12e8.

[294] Wu JY, Scadden DT, Kronenberg HM. Role of the osteoblast lineage in the bone marrow hematopoietic niches. J Bone Miner Res 2009;24:759e64. [295] Franquinho F, Liz MA, Nunes AF, Neto E, Lamghari M, Sousa MM. Neuropeptide Y and osteoblast differentiation e the balance between the neuro-osteogenic network and local control. FEBS J 2010;277:3664e74. [296] Karsenty G, Oury F. The central regulation of bone mass, the first link between bone remodeling and energy metabolism. J Clin Endocrinol Metab 2010;95:4795e801. [297] Takeda S, Karsenty G. Molecular bases of the sympathetic regulation of bone mass. Bone 2008;42:837e40. [298] Ferron M, Wei J, Yoshizawa T, et al. Insulin signaling in osteoblasts integrates bone remodeling and energy metabolism. Cell 2010;142:296e308. [299] Clemens TL, Karsenty G. The osteoblast: An insulin target cell controlling glucose homeostasis. J Bone Miner Res 2011;26: 677e80. [300] Lee NK, Karsenty G. Reciprocal regulation of bone and energy metabolism. Trends Endocrinol Metab 2008;19:161e6.

PEDIATRIC BONE

C H A P T E R

5

Dental Development and Maturation, from the Dental Crypt to the Final Occlusion Jean-Marc Retrouvey 1, Michel Goldberg 2, Ste´phane Schwartz 3 1

Division of Orthodontics, McGill University, Montreal, Quebec, Canada, 2 UMR-S 747-INSERM, Universite´ Paris Descartes, 3 Dental Clinic, Montreal Children’s Hospital, MUHC (McGill University Health Center), and McGill University

The formation and maturation of dental tissues constitute an important process in craniofacial development. Genes coding the expression of growth factors, transcription factors and extracellular matrix molecules regulate this process. The interactions between the mesoderm and the ectoderm are crucial during the initial steps of tooth germ development, morphogenesis and cell differentiation, leading to crown and later to root formation. These processes are associated with the formation of alveolar bone around the dental follicle and tooth eruption in the oral cavity. Disruption of the normal developmental pattern may be due to gene mutations or to defective expression of intracellular or extracellular structural molecules. The development of the dentition is also a great contributor to the development of the lower face height by enlargement of the dento-alveolar processes. As gene mutations, epigenetic alterations or influenced by post-genomic factors, individual defects can be identified. In such cases, the mutations listed in this review are invariably associated with oral development manifestations. As a more complex phenomenon, the close association of multiple defects interacting closely may produce multifaceted syndromes.

the expression of growth factors and transcription pathways regulate these events. Any mutation in these genes is susceptible to induce morphologic and/or functional alterations in any tooth developmental process. We review here the major events that influence early tooth formation that may shed light on major tooth abnormality such as amelogenesis imperfecta and dentinogenesis imperfecta, which may or may not be associated with major craniofacial alterations or defective mineralization syndromes [2,3]. Within the first branchial arch for all the teeth, and the nasofrontal bud for the maxillary incisors, all tooth buds result from the interactions of the oral ectoderm lining the stomodeal cavity, in specific areas spatially limited as oral placodes, and the dental mesenchyme containing cells derived from the neural crest. Initial Phase In the epithelial cells expressing Otlx2/Pitx2, two families of growth factors (bone morphogenetic proteins [BMPs], fibroblast growth factors [FGFs]) are activated. The epithelial placode then becomes thicker and up to day 11 of gestation is under the influence of Left in the mouse. This leads to the formation of a dental lamina. BMP, FGF, sonic hedgehog (Shh) and Wnt are expressed in the epithelial compartment, whereas the expression of Lhx6-7, Barx1, Msx 1-2, and Pax9 is increased in the odontogenic mesenchyme. The proliferating neural crest-derived cells condense in the dental mesenchyme and express Msx1, Pax9, Left and Cbfa1 (Runx2). This implies that any alteration of the genes coding for these molecules leads to severe alteration or even the lack of tooth formation (anodontia).

THE TOOTH BUD Embryology of the Tooth Three successive steps lead to the formation of a tooth: (1) the initiation of the process, (2) the morphogenesis of the tooth, and (3) the terminal differentiation of two layers of epithelial and mesenchymal cells acquiring their terminal phenotype [1]. Several genes activating

Pediatric Bone, Second Edition DOI: 10.1016/B978-0-12-382040-2.10005-X

83

Copyright Ó 2012 Elsevier Inc. All rights reserved.

84

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

Morphogenesis of the Tooth Depending on the position of the germ in the branchial arch, a different type of tooth will be produced. This is related either to a possible gradient of “morphogens”, or to the concomitant burst of cell clones predetermined to form incisors, canines, premolars and molars. The epithelial buds located along the dental lamina proliferate, become caps and later reach the bell stage. During early morphogenesis, three series of events are implicated in the shaping of the tooth crown. Initially, a semi-permeable basement membrane (BM) [4] regulates the diffusion of molecules between the enamel organ and the embryonic pulp compartments. The BM triggers the terminal differentiation of preodontoblasts into polarized secretory odontoblasts. The preameloblasts become differentiated secretory ameloblasts. Metalloproteases and other degradative enzymes trapped in the BM network are shaping the future dentino-enamel junction [5]. Following this initial step, neural crest-derived cells migrate and colonize the dental mesenchyme. Later, they slide toward the periphery of the embryonic pulp and undergo a series of cell divisions. One less division occurs in the inner enamel epithelium compared with the odontoblast layer. This induces a substantial length difference between the two compartments, hence to the folding of the cell layers and consequently to cusp formation. Finally, at an early bell stage, a niche of cells named the “enamel knot” is found in the central part of the tooth. They express the gene Msx2. This group of cells is not proliferative, in contrast with the cells located in the lateral parts of the germ. The central part stays in a fixed position whereas the rest of the enamel organ expands and, because of space limitations, contributes also to the formation of folds and consequently, cusps. The enamel knot expresses Shh, Bmp-2, Bmp-4, Bmp-7, Fgf-4 and Fgf-9 [6]. Terminal Differentiation Post-mitotic polarizing ameloblasts elongate. Intercellular junctions start to develop and the polarized young ameloblasts become functional and implicated in the synthesis and secretion of enamel proteins. Pre-odontoblasts originally bear a fibroblastic appearance. They migrate from the central part of the dental pulp to the periphery and become post-mitotic polarizing odontoblasts. Long protracted processes, characteristic of polarized odontoblasts, emerge from cell bodies associated into a palisade-like structure. They are implicated in the synthesis of collagen and non-collagenous proteins, whereas secretion and re-internalization of fragmented peptides or signal peptides occur along the cell processes, in the predentin and in dentin respectively. In the distal

part of the cell bodies, desmosomes and gap junctions form terminal junctional complexes. Root Formation/Eruption During the pre-eruptive phase, once the crown is formed, at the cervical margin of the enamel organ, epithelial cells proliferate and initiate the formation of the Hertwig’s epithelial root sheath. In the inner part of the sheath, epithelial cells promote the recruitment and cytodifferentiation of pulp progenitors. The outer layer is implicated in the recruitment of cementoblasts that cross the disaggregating intercellular Hertwig’s root sheath. The Hertwig’s root sheath is involved in the recruitment of cells of the periodontal ligament and the construction of the bony crypt [7]. The pulp progenitors migrate toward the inner surface of the Hertwig’s sheath. They become odontoblasts, organized as a palisade-like structure, forming the root dentin. The forming part of the tooth germ keeps its original position during these early stages of root formation. Gradually, the root(s) elongate(s) and the tooth erupts in the oral cavity. This is referred to as the eruptive prefunctional stage. Three possible origins have been reported for the cementoblasts: • during the early stages of formation of the root, epithelial cells of the Hertwig’s root sheath interconvert, become mesenchymal cells and ultimately acquire the cementoblast phenotype • afterwards, during root lengthening, the dissociation in the cervical area of the Hertwig’s root sheath allows some fibroblast-like cells issued from the dental follicle to migrate through these fenestrations and become cementoblasts • later, the tooth comes into contact with its antagonistic teeth, and the late steps of eruption/root formation are referred to as the functional stage. Then progenitors located in the periodontal ligament proliferate under the influence of cementum growth factor, and differentiate into cementoblasts. After stimulation of the cementum adhesion protein, cementoblast progenitors adhere to the cementum surface and contribute to the thickening of the forming cementum. Although the mechanisms implicated in the eruption are not fully elucidated, it is clear that a series of growth and transcription factors intervene in the formation of the bony socket. Colony-stimulating factor-1 (CSF-1), epithelial growth factor (EGF), transforming growth factor (TGF)1, interleukin 1a (Il-1a), receptor activator ligand of the nuclear factor-kappa B (RANKL), c-Fos, osteoprotegerin, parathyroid hormone-related protein, Cbfa1, tumor necrosis factor (TNF), vascular endothelial

PEDIATRIC BONE

THE TOOTH BUD

growth factor (VEGF) and bone morphogenetic protein2 (BMP-2) have all been implicated. These factors, together with a series of metalloproteases and disintegrins, contribute to the root lengthening, eruption and functional adaptation [7].

Histology of Dental Tissues Enamel, dentin and cementum constitute the three mineralized dental tissues, whereas the dental pulp is a unique non-mineralized tissue. Enamel The composition of enamel is shown in Table 5.1. ENAMEL STRUCTURE

The interacting presecretory ameloblast and odontoblast layers form distinct compartments on either side of the BM. The BM is then enzymatically degraded, and short ameloblast processes protrude toward the forming dentin, leading to the formation of a scalloped dentino-enamel junction (DEJ). Ameloblasts initiate the formation of the prismatic enamel made by rods (or prisms) and interrods (interprismatic enamel). Tightly packed hexagonal ˚ ngstro¨ms (A ˚ ) in enamel crystallites are about 700
300 A ˚ in cross-section, and vary between 2000 and 10 000 A height. Prisms (rods and interrods), Hunter-Schreger bands and Retzius lines constitute the three characteristic anatomic structures found in enamel (Fig. 5.1). Near the DEJ, in humans, between 10 and 20 prisms are seen bending alternatively to the right or to the left contributing to the formation of Hunter-Schreger’s bands. In transverse sections, Retzius lines appear as continuous lines forming concentric circles, and each enamel segment comprised between two Retzius lines, about 25 mm thick, constitutes a mineralization modulus [8]. This organization allows occlusal forces to be dissipated away from the pressure area. This type of architecture reinforces the mechanical properties of enamel.

85

diffuse in the outer layer forming predentin/dentin. The first enamel layer is aprismatic. Accumulation of degraded matrix components contributes to the formation of Tomes’ process. The formation of interrod enamel then starts around the processes, developing a continuous honeycomb structure. The thickness of the forming enamel is gradually increased. In humans, the aprismatic outer enamel layer is about 30 mm. Calcium deficiencies lead to the emergence of structural defects mostly in the outer enamel (hypoplasia). Post-secretory ameloblasts are implicated in enamel maturation. Proteases such as kallikrein-4 (KLK-4) contribute to the hydrolysis of amelogenin. Amelogenin proteins represent the predominate subfamily of gene products found in developing mammalian enamel, and are implicated in the formation of the largest hydroxyapatite crystals in the vertebrate body. Maturation (or postsecretory) ameloblasts appear as ruffle-ended cells, bearing some similarities with the osteoclasts, although some segments display a smooth appearance. The organic matrix expelled from maturing enamel is pushed in deep recesses and internalized into lysosomes. Lysosomal acid phosphatase and other catalytic enzymes contribute to the degradation of this temporary organic matrix, especially amelogenin. Post-secretory ameloblasts allow calcium and phosphate ions to diffuse and contribute to the thickening and lengthening of enamel crystallites. As an enzymatic inhibitor, fluoride alters

ENAMEL FORMATION

Enamel formation results from the secretion of an extracellular matrix (ECM) by secretory ameloblasts and its eventual mineralization. Some enamel proteins TABLE 5.1

Global Composition of Enamel In weight (%)

In volume (%)

Mineral phase

96

87

Organic phase

0.6e1

2

Water

3.4e4 1% free water 2.4% bound water

FIGURE 5.1 Human dental enamel, internal zone. Groups of rods 7e11

cut longitudinally (parazones) alternate with group of rods in crosssection (diazones) at right angles from the parazones. Scanning electron microscope (SEM) preparation.

PEDIATRIC BONE

86

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

these processes leading to mild to severe fluorosis. Defective enamel mineralization is also specifically due to the defective activity of maturation ameloblasts ENAMEL COMPOSITION

The mineral phase of enamel results in the formation of hydroxyapatite (HAp). In addition to calcium and phosphate, HAp composition also includes carbonate, magnesium, fluoride, sodium and many trace elements that are either mineral-associated or enzyme co-factors. Amelogenins constitute the bulk of the forming enamel matrix, while only a residual amount persists in the mature enamel. They are secreted as 28e25 kDa molecules, but are rapidly degraded into 21 kDa or less. They are presumably implicated in the nucleation and orientation of the crystallites. During enamel formation, proteases including enamelysine (MMP20) and other non-specific MMPs are implicated in the degradation of the molecule into small fragments that disappear during enamel maturation. KLK-4 also contributes to restriction of the organic content of mature enamel (0.4e0.6% w/v). Isoforms and spliced forms of amelogenins have been identified. Mutations of amelogenins result in different forms of amelogenesis imperfecta (AI) (Fig. 5.2). Enamelin forms about 5% of the enamel matrix, and the molecule seems to be implicated in nucleation and lengthening of crystallites and also in some forms of AI.

Ameloblastin (or amelin or shethlin) is synthesized by odontoblasts and ameloblasts, and it appears to be an adhesion molecule inhibiting cell proliferation and maintaining cell differentiation. A series of minor molecules are also present in enamel: amelotin, proteins issued from the serum, lipids and/or phospholipids, and calcium-binding proteins. Several enzymes such as MMPs, serine protease (KLK-4), acid and alkaline phosphatases are expressed during enamel formation and maturation. When these molecules are defective, due either to genetic mutations or to impaired enamel protein degradation, structural defects are detectable [9,10]. Dentin The composition of dentin is shown in Table 5.2. DIFFERENT TYPES OF DENTIN [11] OUTER PERIPHERAL DENTIN IN THE CROWN AND ROOT In the crown, odontoblasts at an early stage of

differentiation are implicated in the formation of a thin outer layer, the mantle dentin. Located beneath the dentino-enamel junction, dentin tubules are lacking or only some bended minute tubules are present. Its thickness varies between 15 and 30 mm. This layer displays specific elastic properties because it is less mineralized than the subjacent circumpulpal dentin [12] (Fig. 5.3). The proteins present in this thin layer are not phosphorylated, and a close relation has been established between

FIGURE 5.2 Human tooth displaying an amelogenesis imperfecta (AI). Left: enamel surface observed with the SEM. Hypoplastic enamel is seen, the outer part being missing. Center: longitudinal section of an AI affected tooth. Part of the outer enamel is missing. Right: the entire unsectioned tooth.

PEDIATRIC BONE

THE TOOTH BUD

TABLE 5.2 Global Composition of Dentin In weight (%)

In volume (%)

Mineral phase

70

50

Organic phase

20

30

Water

10e11

20

the degree of phosphorylation of the extracellular matrix molecules and their contribution to dentin or bone mineralization [14]. The same process occurs in the root where two distinct superficial layers have been identified for a total thickness of about 30 mm. The Hopewell-Smith hyaline layer and the granular Tomes’ layer are the first outer structures formed by root odontoblasts after their differentiation from the Hertwig’s root sheath. Cell interconnections and the general orientation of dentinal canaliculi along the long axis of the root suggest that these structures are implicated in the shaping and in the gradual reduction in the diameter of the root. As is

87

the case in the crown, these peripheral layers are hypomineralized and there is a general increase of mineralization some distance away from the cemento-dentinal junction. CIRCUMPULPAL DENTIN Dentin is produced continuously in adults (4 mm/day) formed by regularly spaced Von Ebner lines appearing as incremental lines, and every 20e24 mm an Owen line is more prominent, implicating the dentin that includes four to six Von Ebner lines. This appearance is related to circadian and other rhythms. The primary dentin is formed until the moment the tooth becomes functional. Then the formation of secondary dentin starts and will continue for the lifetime of the tooth. Apart from the decreasing number of dentinal tubules, there is no structural or chemical difference between primary and secondary dentins. The number of tubules is about 20 000 tubules/mm2. Circumpulpal dentin includes the intertubular and peritubular dentins (Fig. 5.4). Intertubular dentin results from the transformation of predentin into dentin. It forms the bulk of dentin, whereas peritubular dentin is more variable, according to species, and location examined.

FIGURE 5.3 Upper part of the panel: normal dentin. Upper left: SEM of a tooth collected from a patient displaying an X-linked hypophosphatemia. Lower part, left: under the dentino-enamel junction, the outer mantle dentin is unaffected by the disease, whereas in the circumpulpal dentin, empty interglobular spaces are clearly seen between calcospherites. The dentino-enamel junction and the mantle dentin (md) appear to be normal, whereas the circumpulpal dentin interglobular spaces are filled with extracellular matrix partially degraded remnants accumulating between unmerged globular structures. Apparently the mantle dentin is not influenced by phosphorus homeostasis, as seen in X-linked hypophosphatemia [13].

PEDIATRIC BONE

88

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

FIGURE 5.4

The peritubular dentin surrounds the lumen of the tubules. Intertubular dentin forms a continuous collagen-rich network. Left: horse’s dentin observed with the SEM. Right: human dentin observed with the transmission electron microscope (TEM).

Intertubular dentin is a type I collagen-rich structure. Collagen fibrils display a 100e120 nm diameter. Noncollagenous extracellular matrix proteins will be detailed in the paragraph related to the dentin composition. Some of them are phosphorylated and associated with the mineralization process either as promoters or inhibitors. Dentin crystallites appear as needle-like structures 3e4 nm thick and 60 nm long. They are located either along the surface of the collagen fibrils, in association with the so-called “holes” due to the quarter-staggered fibril structure, or filling the empty intercollagen spaces. In contrast, peritubular dentin is formed within the lumen of the tubules independently from the predentin transformation. It does not contain collagen fibrils, but is formed by a network of amorphous non-collagenous proteins, similar to those found in the intertubular dentin. In humans, the surface occupied by peritubular dentin is no more than 10% of the whole dentin volume. This distribution is related to the resistance to abrasion, intertubular dentin being elastic and easily abraded, whereas peritubular dentin is more resistant to attrition. Peritubular dentin has a higher carbonate and magnesium content than the intertubular dentin, and consequently is more soluble in acidic or in chelating solutions. The pathologic dentin defects related to specific gene mutations will be reviewed later in this chapter. They include formation of globular and interglobular

structures, defective dentin formation and altered root length. CELL AND TISSUE ORGANIZATION CELLULAR COMPARTMENT The odontoblasts are implicated in the synthesis of ECM molecules. These cells compose an individual compartment distinct from the pulp. The cells actively secrete predentin which is further transformed into mineralized dentin. THE PREDENTIN COMPARTMENT Another compartment comprises odontoblastic processes and predentin. Secretory vesicles are transferred along the processes and the larger part is secreted in the proximal predentin. Collagen fibrils start to aggregate at the site where they are secreted. The native fibrils elongate by end-to-end self-aggregation of the telopeptides and the diameter is increased by lateral aggregation of subunits. Proteoglycans such as fibromodulin and biglycan are also secreted in the proximal predentin and control collagen fibrillation. THE DENTIN COMPARTMENT The dentin compartment is a mineralized continuous structure starting at the metadentin border at the dentin edge and extending up to the dentino-enamel junction. Odontoblast processes are located within tubules (about 20 000/mm2).

PEDIATRIC BONE

89

THE TOOTH BUD

A second group of non-collagenous proteins (NCPs) are secreted along the process, diffusing throughout the porous intertubular dentin and also contributing to the formation of peritubular dentin. DENTIN EXTRACELLULAR MATRIX COMPOSITION

Normal dentin extracellular matrix composition is shown in Table 5.3. Alterations of some small integrin-binding ligand N-linked glycoproteins (SIBLINGs) are related to some dentin pathologies such as dentinogenesis imperfecta or dentin dysplasia. DMP-1, PHEX and FGF-23 mutations are implicated in hyper- or hypophosphatemia. Cement/Cementogenesis [15,16] Cementum global composition in weight of mineral 65%, organic 23%, water 12%. TABLE 5.3

STRUCTURAL DIFFERENCES BETWEEN THE DIFFERENT TYPES OF CEMENT

The formation of cement, the layer that covers the root of the teeth, starts with an acellular afibrillar thin band located at the cervical junction between dentin and enamel (coronal cement). It is regulated by osteopontin [17]. Once the acellular band is completed, the formation of acellular cement begins and includes extrinsic fibrils found on the mid-root cement. The lower part of the root (apical cement) is covered by cellular and acellular cement, which includes intrinsic and/or extrinsic fibrils (Sharpey’s fibers from the periodontal ligament). Cementoblasts are either trapped in cementum, to form cellular cementum, or they slide away from the cementum surface, giving rise to acellular cementum. In the apical part, mixed cement appears as a multilayered structure that includes cellular and acellular successive layers.

Normal Dentin Extracellular Matrix Composition

Collagens 90% Non-collagenous proteins 10%

Phosphorylated proteins

Nonphosphorylated proteins

Type I collagen (89%) þ type I trimer (11%)

þ 1e3% Type III and V collagens

SIBLINGs Genes coding: in human chromosome 4 in rodent chromosome 5 Locus 4q21 Implicated in Dentinogenesis imperfecta and dentin dysplasia

DSPP (between 155 and 95 kDa) cleaved into: >DSP (N-terminal- proteoglycan forming dimers): 100e280 kDa >DPP (C-terminal) 94 kDa DMP-1: 61 kDa (proteoglycan) nucleator BSP: 95 kDa (proteoglycan) nucleation þ crystallite growth OPN: 44 kDa, glycoprotein, mineralization inhibitor MEPE: 66 kDa glycoprotein

Amelogenin

Spliced forms: Aþ 4: 8.1 kDa A-4: 6.9 kDa

Others enamel molecules

Ameloblastine

Osteocalcine DPG : dentin gla-protein (acidic g carboxyglutamic) Matrix Gla protein (MGP)

>5.7 kDa >mineralization inhibitor >14 kDa, not inhibitor of mineralization

Osteonectin- SPARC

43 kDa

Serum proteins

Albumin a2-HS glycoprotein

Small leucine-rich proteoglycans (SLRPS)

CS/DS PGs: decorine, biglycan 42 kDa KS PGs: lumican, fibromoduline, osteoadherine 50 kDa

Growth factors

FGF2, TGFb1, BMPs, ILGF I & II, PDGF

Enzymes

Alkaline and acidic phosphatase, serine proteases, MMPs: collagenases: MMP-1, 8, 13 gelatinases A (MMP-2), and B (MMP9) Stromelysine 1: MMP-3 MT1-MMP, enamelysine: MMP-20 ADAMs et ADAMTS

Proteolipids

ECM Phospholipids

PEDIATRIC BONE

90

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

COMPOSITION OF THE ORGANIC PHASE OF CEMENTUM

(A)

The bulk of the organic fraction is formed by type I collagen (90% of the ECM) and type III collagen (z5%). The rest is formed by proteoglycans (namely decorine, biglycan, and lumican). Phosphorylated proteins such as BSP and osteopontin are implicated in cementum mineralization. Osteonectin, a nonphosphorylated glycoprotein, may also be present. Growth factors such as FGF-2, the cementum-derived growth factor (CDGF) and the cementum attachment protein (CAP) [18] play specific roles in cementum formation. CDGF is thought to be implicated in the recruitment and differentiation of cementoblasts, whereas CAP promotes the adhesion of cementoblasts on the dentin/cementum surface. Dlx-2 and Runx2/ Cbfa 1 regulate the initial cement formation and, consequently, any defective expression of these molecules induces cement alteration. Finally, alkaline phosphatase activity impairment interferes with cement formation.

(B)

MECHANISM OF SINGLE TOOTH ERUPTION Introduction The eruptive path of the dentition has been extensively studied and theories on tooth eruption have been proposed since as early as the 18th century. Teeth are unique specialized structures that develop from discrete invaginations of the oral ectoderm. These structures then invade the mesenchyme of the jaws [19]. The dental follicle, which includes the tooth bud, has to travel through alveolar bone to erupt into the oral cavity. Once the crown of the tooth is close to the gingival tissue, the oral tissues merge with the epithelium of the follicle to form the gingival and periodontal ligament. Specific steps are necessary for a specific tooth to reach and maintain its position on the occlusal plane: following intrabony development, the tooth bud migrates, and erupts in the oral cavity. Once in the oral cavity, the tooth continues its migration until contact is established with the opposing teeth and an occlusal table is established (Fig. 5.5).

Mechanism of Tooth Eruption The formation of the eruption pathway is independent of root formation. This was demonstrated by placing transmandibular wires over premolars in dogs prior to the onset of eruption. An eruption pathway caused by bone resorption formed in the alveolar bone despite the fact that the premolars were maintained stationary. As soon as the wires were removed, the teeth quickly erupted through the formed eruption pathway [7].

FIGURE 5.5 Active eruption of an upper right permanent canine. (A) The tooth is erupting through the gingival tissue slightly buccally. (B) The tooth is now in contact with the mandibular canine. All teeth in the upper quadrant have now at least one point of contact with their mandibular opposing tooth.

Role of the Dental Follicle in Tooth Eruption At the beginning of active tooth eruption (16 weeks postnatal), the dental follicle consists of a well vascularized, discrete connective tissue layer surrounding the tooth [20]. Its importance in tooth eruption was demonstrated by Cahill and Marks in 1980 [21]. They showed that tooth eruption could be interrupted if the dental follicle was removed prior to the onset of eruption. The role of the forming tooth in the formation of the eruptive pathway was also negated when they replaced the developing tooth in the dental follicle by inert (resin or metal) material. This material erupted in the same way as the tooth would have, showing that the presence of a tooth was not necessary for tooth eruption [22]. The dental follicle therefore must possess all, or the majority, of the molecules needed in the normal eruption pattern [7]. Colony stimulating factor 1 (CSF-1) is an essential factor for normal osteoclast differentiation and bone remodeling in mammals. Toothless rats show a severely reduced number of osteoclasts as may be seen in osteopetrosis [23]. Marks et al. have shown that the administration of CSF-1 to the toothless rat has a positive effect

PEDIATRIC BONE

MECHANISM OF SINGLE TOOTH ERUPTION

91

on tooth eruption, demonstrating the importance of CSF-1 and subsequently proper osteoclast activity on normal tooth eruption pattern [24]. Speed of Intraosseous Eruption The speed of intraosseous eruption depends on several factors. Each group of teeth is programmed to erupt at a different and specific time. However, the speed of intraosseous eruption is slow in relation to intraoral eruption and requires several years to complete. Tooth buds of the majority of permanent teeth are present in the infant, but will go through the gingival tissue only in the preadolescent years. Active eruption will begin after the crown of the tooth is fully completed [25] and will continue until the root is fully formed and the tooth is in contact with the opposing tooth on the occlusal plane Mechanisms of Intraosseous Tooth Eruption Tooth eruption is a complex event that involves many types of tissues. It is the only instance where a developing organ (the tooth) must exit the confines of its bony crypt [7]. To that effect, bone remodeling via osteoblasts and osteoclasts strategically positioned around the dental follicle must take place in order to ensure a normal eruption pattern. The eruption pathway must also continuously compensate for the increase in volume of the dento-alveolar process taking place simultaneously [7]. The dental crypt must resorb bone over the dental follicle by concentrating osteoclasts on its superior border at a specific time in the process of active eruption. Osteoblasts are more concentrated and abundant at the base of the dental follicle to produce alveolar bone. The combination of bone resorption and bone apposition, if properly balanced, will result in active intraosseous eruption [26e28]. The gubernacular canal, first mentioned by Hunter in 1778 [29] and in 1909 by James, is described as an eruption pathway used by the permanent tooth to replace the primary tooth. The gubernacular canals are too small to accommodate the crowns of permanent teeth, but are considerably enlarged by osteoclastic activity during the period of intraosseous tooth eruption [30]. The primary dentition mechanism of eruption via bone resorption is slightly different (Fig. 5.6). Osteoclastic activity is high, even if the tooth is stationary [20] and takes place on the superior aspect of the dental crypt. The gubernacular canal is enlarged and the tooth uses it as a pathway of eruption [31]. Primary teeth are very close to the surface [32] and a true intraosseous eruption pattern does not take place because the tooth buds are never totally covered with dense alveolar bone [33]. The crucial role of active bone resorption by osteoclasts in tooth eruption is demonstrated in osteopetrosis [34]. The teeth of osteopetrotic patients develop to their normal length, but fail to erupt into the oral cavity due to lack of osteoclastic activity, resulting in severe dental impactions.

FIGURE 5.6 Premolar tooth buds developing under primary molars. Note that the permanent molar does not replace a primary tooth but erupts distal to the primary dentition.

Genetic Control of Tooth Eruption According to the Tooth and Craniofacial Development Group of the University of Helsinki (www.bite-it.fi), a large number of genes is involved in the mechanism of tooth development and tooth eruption. Over 300 genes have been sequenced that involve several types of tissue [35]. Pelsmaekers [36] confirmed the genetic control of dental maturation in a study involving monozygotic twins. He showed that twins developed their dentition at the same time and at the same rate, regardless of the environment. It is of no surprise that a large number of heritable syndromes have a large dento-alveolar component and result in significant facial deformities by alteration of the pattern of tooth formation and tooth eruption [37,38]. Hypodontia, a condition in which some teeth fail to develop, is often associated with several syndromes, but it can also be found in the absence of other skeletal or ectodermal anomalies, suggesting the role of specific genes in the formation of the exact number of teeth and their proper positioning on the arch [39]. Mechanisms of Intraoral Tooth Eruption Multiple factors contribute to the onset of tooth eruption. Growth factors, such as insulin-like growth factor-1 (IGF-1), VEGF, tumor necrosis factor a (TNFa), are implicated in the transformation of monocytes into osteoclasts. Colony stimulating factor 1 (CSF-1) and monocyte chemotactic protein-1 (MCF-1) act in synergy with osteoprotegerin (acting as an inhibitor) and the overexpressed RANKL to influence osteoclastogenesis [40]. Four other factors, PTH [41], retarded protein interleukin-1alpha, Cbfa1/Runx2 (transcription factor) and the presence of osteoblasts also play a role. Interactions between growth factors,

PEDIATRIC BONE

92

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

transcription factors and hormones are responsible for the differentiation of mesenchymal cells into osteoblasts at the base of the crypt and osteoclasts at the superior aspect of the dental crypt. These changes are observed during the active part of tooth eruption, and result in the tooth bud erupting through the oral mucosa. Important Factors Contributing to Lack of Tooth Eruption The best model to study proper eruption sequence is a condition that has been termed “primary failure of eruption” [42]. It is a multifactorial event where teeth develop normally but fail to erupt in the oral cavity and remain impacted. Dento-alveolar development continues around these teeth and a normal dento-alveolar height is achieved by periosteal growth of the bone formed around the adjacent teeth. This condition can affect all teeth but is more prevalent in the posterior segment. This phenomenon is also observed in osteogenesis imperfecta types III and IV patients who develop severe lateral open bites during growth (Fig. 5.7 ). The dento-alveolar process fails to develop normally in the area of the non-erupting tooth (Fig. 5.8). Severe occlusal anomalies are observed, such as posterior open bites while adjacent teeth tip into the space of the non-erupting tooth contributing to the creation of a severe malocclusion. The tooth is usually ankylosed and will not respond to orthodontic traction suggesting that the eruptive processes are absent and that the periodontal ligament’s response to mechanical traction does not result in the typical bone remodeling

FIGURE 5.8 Multiple impacted teeth of non-syndromic origin. A 16-year-old patient with only eight permanent teeth erupted, residual primary molars and 21 permanent teeth impacted. Note the lack of development of the maxillary anterior dento-alveolar process.

process observed in normal tooth eruption or orthodontic traction. Ankylosis occurs when cementum from the root of the tooth fuses with the dento-alveolar process. It may either be complete or partial ankylosis as when only some parts of the root fuse with the alveolar process. Bone remodeling stops in the affected area of ankylosis and the tooth fails to erupt. Lack or severely reduced dento-alveolar development is associated with this condition. Orthodontic traction is useless and the tooth either stays impacted or does not totally reach the occlusal plane [42]. True impaction may also occur when the tooth deviates from its normal path of eruption, totally forms in the bone and fails to erupt. Maxillary canines have the highest incidence of impaction, probably due to their complex path of eruption (Fig. 5.9). Once uncovered and provided that adequate space is created on the arch, these impacted teeth can be brought into proper position with orthodontic traction [43].

DEVELOPMENT OF THE DENTAL OCCLUSION Dental occlusion may be static or dynamic. The static phase refers to the stage when the mandibular teeth are brought into light contact with the maxillary teeth by the closing motion of the mandible. Dynamic occlusion occurs when teeth come in contact during chewing, speaking or swallowing.

Timing of Eruption FIGURE 5.7

Dentition of 12-year-old type III osteogenesis imperfecta patient showing bilateral posterior open bites. Permanent molars have erupted several years ago but have failed to come in contact, probably due to lack of growth of the dento-alveolar process. The dento-alveolar process fails to develop normally in the area of the non-erupting tooth.

Modern mammals have a diphyodont teeth arrangement, that is a deciduous and a permanent dentition in succession over their lifespan [44]. In humans, the primary dentition is made up of 20 teeth including incisors, canines and primary molars. Active intraosseous eruption of primary teeth occurs in the first and second

PEDIATRIC BONE

DEVELOPMENT OF THE DENTAL OCCLUSION

93

FIGURE 5.10 Panoramic radiograph demonstrating a normal sequence of eruption in a 9-year-old patient. First permanent molars and upper and lower incisors are present in the mouth. Canines and premolars are resorbing the primary canines and molars.

FIGURE 5.9

Impacted upper right maxillary canine. The tooth has deviated from its normal path of eruption and is now resorbing the maxillary lateral incisor. The lower left second premolar is also impacted and poorly angulated as the lower left second primary molar has failed to resorb.

year of life and by 29 to 30 months, all 20 primary teeth are in place [45]. From the 30th month of life until the late teens, the permanent dentition develops, first with a path of intraosseous eruption followed by intraoral eruption. These movements are of large amplitude in relation to tooth size, occur in the three planes of space and must adjust to the continuous development of the dento-alveolar processes during growth [46]. Once teeth reach the occlusal plane, they continue to adjust with minute movements to stay in proper contact mesiodistally as well as occlusally. As the dental crypt moves toward the oral cavity, bone resorption takes place on the occlusal aspect of the crypt and bone apposition occurs at the base. At the same time, bone formation also increases the size of the dento-alveolar process. Complete remodeling of the alveolar bone occurs when deciduous teeth are replaced by succedaneous teeth. The alveolar bone associated with the primary tooth is completely resorbed together with the roots of the tooth while new alveolar bone is formed to support the newly erupted tooth [47]. The eruption sequence normally follows a path from the anterior to the posterior aspect of the mouth and is always constant during a normal eruption pattern (Fig. 5.10). Factors such as osteoprotegerin, RANKL, CSF-1 and VEGF control the path and sequence of eruption but their interactivity is still a subject of debate [24,48].

Intraosseous eruption of the lower incisors results in the eruption of the lower central incisors at 6 years of age, the first succedaneous teeth to erupt. Continuous eruption of succedaneous teeth occurs in the anterior part of the oral cavity until the age of 12e13 when the upper canines erupt [49]. The dental follicles of the permanent incisors, canines and premolars actively resorb bone and the primary tooth root structure, in order to appear in the oral cavity [50]. Odontoclasts, cells which are very close to osteoclasts, are actively involved in this process [51] and are linked to an increased expression of RANKL and to a decrease in osteoprotegerin (OPG) [52e54]. The absence of activity of odontoclasts results in non-resorption of primary teeth [55]. The succedaneous dentition continues to develop but the lack of resorption of the primary dentition creates an obstacle to eruption, resulting in an alteration of the path of eruption of the tooth buds, and severe impaction [56]. An example of this situation is the dentition of osteogenesis imperfecta types III and IV patients who show multiple impacted teeth caused by an alteration in osteoclastic activity leading to an absence of resorption of the primary dentition (Fig. 5.11) [57e59]. During the replacement of the primary dentition, intraosseous eruption takes place in the distal aspect of the primary dentition where the permanent molars

FIGURE 5.11 Impaction and malformation of premolars in an osteogenesis imperfecta type III patient. The crowns and the roots are no longer aligned as the primary tooth lack of resorption does not allow normal development of the premolar.

PEDIATRIC BONE

94

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

erupt. A large amount of growth in the three planes of space associated with remodeling of the alveolar process and of the anterior aspect of the ramus must take place as the dental arches have to increase their size significantly to allow the eruption of these large teeth. The first molars will normally erupt between the ages of 6 and 8 years while the second ones appear around the age of 12 years. There is considerable variation in the timing of eruption between individuals. However, the sequence has to be consistent to avoid impaction and ectopic eruption of some teeth. The third molars or wisdom teeth are normally programmed to erupt around the age of 18 years but will fail to erupt and remain impacted in about 75% of the population. This is probably due to the lack of sufficient growth of the tuberosity and ramus in modern humans, resulting in a space deficiency to allow a normal eruption pattern for these teeth. The pattern of tooth eruption is an organized bilateral event where pairs of teeth from the right and left part of the jaws will erupt at about the same time [59]. Any significant change in this sequence will compromise the eruption pattern or sequence. Teeth may become impacted if primary teeth are lost prematurely and space becomes inadequate.

Pattern of Tooth Eruption Teeth are genetically designed [60] to erupt in sequence, and position themselves in an orderly manner in the plane of occlusion. The movement of eruption takes place in the three planes of space with vertical (pure eruption), labiolingual (transverse) and mesiodistal (drift) movements [31]. Tooth buds can also rotate during the intraosseous eruption phase. Each tooth shows an individualized pattern of eruption until it reaches its final position on the occlusal plane. The best example is the maxillary canine which tends to erupt in a mesial direction until it reaches the lateral incisor roots. It then turns to follow a more vertical path and may sometimes adopt a more mesial path of eruption [61]. Once in the oral cavity but still away from the occlusal plane, eruption is rapid until the tooth reaches the occlusal plane [62]. Final occlusal positioning is genetically programmed but is very dependent on the functional envelope of muscles and tissues surrounding the alveolar process. Moss [63,64] has described how the dento-alveolar process responds to alterations in the functional matrix, the development of which is guided by the patients’ vital functions such as breathing and feeding. During sleep apnea episodes, patients are unable to breathe through their nose and keep their mouth constantly open. This altered mandibular position results in a potential opening of the gonial angle (the angle formed by the junction of the ramus and the body of

the mandibular bone) and a vertical descent of the upper molars (Fig. 5.12). Constricted maxillary arches, severe crowding and anterior open bite may result from the disturbance in the proper breathing mechanism. Harvold has shown that forcing mouth breathing in monkeys resulted in the development of severe malocclusions [65]. The changes are severe enough to alter the facial appearance and modify mandibular growth [66].

Speed of Eruption While the intraosseous rate of eruption is fairly slow (1e10 mm/day) [62], once in the oral cavity, the speed of eruption is faster until teeth reach the occlusal plane. Proffitt reported a mean daily eruption rate of 25 to 75 microns for premolars out of occlusion [62]. The entire amount of eruption took place at night. Once in contact with the opposing dentition, active eruption stops but drift continues to take place via remodeling of the alveolar bone by the periodontal ligament (PDL) cells to ensure constant contacts in occlusion [67]. The speed of tooth eruption presents several characteristics. First, eruption itself has to proceed at a certain rate to ensure that the eruption sequence is respected and that the dentition develops in an orderly manner. Prolonged delays may prevent eruption and result in ankylosis of tooth to bone. Second, the eruption speed is not uniform. Erupting teeth move at different speeds at different times. Initially, eruption speed is slow within bone; it increases thereafter and becomes very slow as

FIGURE 5.12 Cephalometric radiograph of a 12-year-old male patient diagnosed with moderate to severe sleep apnea. The gonial angle of the mandible is opened and the anterior teeth are not in contact resulting in an anterior open bite.

PEDIATRIC BONE

DENTAL DEFECTS AND SYNDROMES

the tooth approaches the occlusal plane. These remarkable shifts in speed are also seen in root formation which is fast at first, slows as the apical foramen closes and is very slow thereafter. Third, this range of velocities implies that bone resorption and formation, like root growth, must occur at variable speeds depending upon the stage of eruption. Fourth, during intraosseous eruption, the rate of bone (and root) resorption determines the rate of eruption [25,68]. Continued Tooth Eruption Throughout Life Once the tooth is in occlusion, minute movements in the three dimensions of space will take place to compensate for secondary growth, and abrasion of occlusal and interproximal dental surfaces. Tooth movement takes place more as a displacement caused by dento-alveolar remodeling than tooth eruption. This stage cannot be described as active tooth eruption but as an occlusal compensation to changing conditions in the oral cavity. If an opposing tooth is lost or not present, active tooth eruption may resume with the erupting tooth elevating itself above the plane of occlusion. The dento-alveolar process will follow the erupting tooth and elongate. Tooth movement is present throughout lifetime. Changes in functional factors, such as sleep apnea, periodontal disease or tooth loss will all result in alteration of the occlusion through tooth movement and dentoalveolar remodeling [68].

MATURATION OF THE PERIODONTAL LIGAMENT The Periodontal Ligament: Role and Development of the Dento-Alveolar Complex The development of the periodontal ligament is derived from the inner layer of the dental follicle shortly after initiation of root development [69] and begins with root formation prior to tooth eruption [70]. The developing ligament contains undifferentiated cells capable of differentiating into osteoblasts, osteoclasts and fibroblasts. This combination of cells is responsible for a continuous remodeling of the alveolar bone. Dento-alveolar development from the PDL cells will compensate for the constant change in position of the tooth [68,70]. The periodontal ligament development is a highly organized process [71]. The PDL is a highly vascular and cellular connective tissue situated between the tooth and the alveolar bone. It provides supportive attachment and sensory functions [68]. Cells, vascular elements and an extracellular compartment of matrix proteins and glycosaminoglycans provide unique biophysical functions that enable mammalian teeth to adjust their position while

95

remaining attached to the bony socket. Fibroblasts are the predominant cells of the periodontal ligament and have important roles in the development, structure and function of the tooth [72].

The Periodontium The periodontium, which is composed of the root cementum, the dento-alveolar process and the periodontal ligament is a unique structure with a variety of functions [73]. The main one is to provide mastication control and feedback and the second is to ensure optimum positioning of the teeth on the occlusal table. The ligament presents a high cellular turnover rate and Constant remodeling takes place as teeth being subject to masticatory forces and migrate in the dento-alveolar process. During the formation of the orofacial complex, the immature periodontal ligament around the dental follicle participates in the dental eruption and dentoalveolar process development. The maturing fibrils of the periodontal ligament shrink which may contribute to tooth eruption [74,75]. At the end of the intraosseous eruption process, the nascent periodontal ligament fuses with the oral epithelium and forms the periodontium. The ligament is responsible for the intraoral eruption stage of development and guides the tooth into its proper position on the dental arch. Once in position, the PDL will maintain the dental alignment and interdigitation position in relation to the other teeth for the life of the patient by constant remodeling of the dentoalveolar processes [68].

DENTO-ALVEOLAR GROWTH AND DISPLACEMENT OF BONE STRUCTURES Alveolar bone undergoes continuous remodeling due to tooth movement, masticatory forces and dental migration [47]. The periodontal ligament will also constantly remodel the alveolar bone, first rapidly during the period of active eruption and then more slowly once the teeth are in occlusal contact.

DENTAL DEFECTS AND SYNDROMES 1. Dental agenesis and hyperdontia 2. Dental defects • Shape defects • Enamel defects • Dentin defects

Dental Agenesis Tooth formation and morphogenesis are under strict genetic control [76]. Crucial molecules involved in tooth

PEDIATRIC BONE

96

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

formation include RUNX2. In humans, heterozygous loss of function of MSK1 or PAX9 causes oligodontia [76,77]. Agenesis of a single tooth or teeth is a frequent anomaly in human dental development [60]. Oligodontia, hypodontia and anodontia are interchangeable names for this anomaly (Fig. 5.13). Familial tooth agenesis (FTA) is a well known condition in which the most commonly missing permanent teeth are the third molars (20% of the population), followed by the maxillary lateral incisors, the mandibular second bicuspids and the mandibular central incisors respectively [78,79]. Diseases such as scarlet fever or nutritional problems during pregnancy can result in dental agenesis. However, agenesis of several teeth is usually associated with heritable syndromes such as ectodermal dysplasias which constitute a wide and complex group of diseases. Ectodermal Dysplasia The most representative example of this group of conditions is anhydric ectodermal dysplasia with an incidence of between 1/10 000 and 1/100 000 live births. The defective gene is ED1 in humans, and Ta in the mouse [4]. It is X-linked and hemizygotes lack most of their dentition. Dental agenesis is strongly correlated to the absence or severe lack of dento-alveolar bone development as tooth eruption is largely responsible for the increase in volume of the dento-alveolar process. Thus, children affected by ectodermal dysplasia present with no or only a few teeth of conical shape and are deprived of the corresponding alveolar bone development (Fig. 5.14). Vertical face height development is stunted. The upper jaw also exhibits reduced length with a small palate and a correspondingly reduced cranial base width [80]. These patients look older than

FIGURE 5.13

Hypodontia. Very few permanent teeth are present but the ones present are normally shaped. This patient has only the upper central incisor in the maxilla and no lower incisors. Several permanent posterior teeth are also congenitally absent. The dentoalveolar process in the areas of anodontia is not severely reduced in size.

FIGURE 5.14 Ectodermal dysplasia. Hypodontia, abnormally shaped teeth such as conical crowns and short roots, and lack of development of the dento-alveolar processes are common findings in this syndrome.

their age due to sparse scalp hair, pursed lips and depressed nose base. Sofaer [81] found that 1 in 500 females with hypodontia in the permanent dentition and 1 in 50 with hypodontia in the primary dentition may be carriers for anhydric ectodermal dysplasia, suggesting a gene dose effect in ED1 mutations. Incontinentia Pigmenti-Williams syndrome Incontinentia pigmenti (BlocheSulzberger syndrome) is a syndrome similar to ectodermal dysplasia. It is also X-linked and often lethal in males. Its incidence reaches 1/40 000 in females. It affects both the primary and the permanent dentition, and 90% of patients show oral changes such as missing or conical teeth. There is a typical alopecia at the crown of the head, and the eyes are affected [82]. Ocular changes may be serious, such as severe myopia, retinal detachment or optic atrophy. Problems in mental development are found in 15% of the cases. Axelsson [83] examined 62 individuals with Williams syndrome and found that 40.5% of them lacked one or more permanent teeth while 11.6% of them lacked six or more permanent teeth. This appears to be linked to a contiguous gene deletion at chromosome 7 (7q11.23). Cherubism Cherubism is a rare neoplastic disease affecting particularly the jaw bones (Fig. 5.15). Multilocular fibrous dysplasia of both the maxilla and the mandible result in painless enlargement of these craniofacial bones. The dentition is affected by hypodontia and severe malocclusion [84]. The name cherubism comes from the fact that the face becomes deformed and almost circular due to fibrous proliferation. This condition affects mainly growing children and has been shown to regress in adulthood. Long bones are unaffected by the condition [85].

PEDIATRIC BONE

DENTAL DEFECTS AND SYNDROMES

97

FIGURE 5.15 Cherubism. Multilocular and radiolucent aspect of the maxillary and mandibular bones. Hypodontia, malformed teeth and severe malocclusion can be observed in this panoramic radiograph.

Cleft and Lip Palate Children born with unilateral or bilateral lip/palate clefts or palatal cleft alone present a high incidence of hypodontia (Figs 5.16 and 5.17) [86]. Lack of fusion between the maxillary and the medial nasal process explains the interruption or fragmentation of the dental lamina causing the agenesis of the lateral incisor on the cleft side. In a 2003 study, 49.8% of the cleft lip/palate children were missing this particular lateral tooth [87]. What is more intriguing is the dental agenesis of the teeth outside the cleft area, where 10.9% of patients lack the contralateral tooth [60]. The second most commonly missing permanent teeth are the maxillary second bicuspids, followed by the mandibular second bicuspids, and finally the first bicuspids [60]. Children with isolated cleft palate also have a high incidence of hypodontia (31.5%). Even in the absence of an alveolar cleft the teeth most frequently absent are the maxillary laterals

FIGURE 5.16 Occlusal view of a unilateral cleft palate. Collapse of the arch on the affected side, maxillary midline deviation and asymetry. The upper left lateral incisor is misshapen. The upper left canine is impacted.

FIGURE 5.17 Bilateral cleft lip and palate. Premaxilla is formed and includes the two central incisors. The clefts extend from the palate, the dento-alveolar process to the lip. Partial anodontia (absence of the permanent canines) and poorly shaped teeth in the area of the cleft are present.

followed by the second bicuspids. The more severe the palatal cleft, the more severe the hypodontia [88]. Down Syndrome The prevalence of tooth agenesis in Down syndrome is high. It is about 10% higher than in the general population and affects predominantly the mandibular permanent incisors [89].

Hyperdontia Hyperdontia (supernumerary teeth) is rarer than oligodontia. In the primary dentition, the maxillary lateral incisor is the only supernumerary tooth (0.10%) [90]. One to 3% of the general population will exhibit hyperdontia in the permanent dentition [91] and the supernumerary tooth is generally the maxillary lateral incisor. A Hong Kong study indicated a 2.7% rate for males and a 6.5% rate for females [104]. There is a higher incidence in Black (6%) than in Caucasian (0.64%) populations. Black children have more supernumerary teeth in the molar and bicuspid areas [92]. Some supernumerary teeth are distorted, conical and small. The most common is the mesiodens, a small conical tooth that is found between the permanent maxillary central incisors (Figs 5.18 and 5.19). If the abnormal tooth appears in the molar area, it is called a paramolar, and if located distal to the third molar, it becomes a supplemental tooth. The last category of non-syndromic hyperdontia is the odontoma. It is considered a hamartomatous

PEDIATRIC BONE

98

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

FIGURE 5.18 The mesiodens is a small tooth usually located between the two upper central incisors and inverted (crown facing the nasal floor).

malformation. The odontoma can be complex (made of dental tissue totally disorganized) or compound (when it bears resemblance with a normal tooth). A supernumerary tooth is the primary cause of the lack of eruption of the maxillary permanent incisor [92]. The presence of multiple supernumerary teeth is often indicative of a syndrome, such as cleidocranial dysplasia [93]. Cleidocranial Dysplasia Cleidocranial dysplasia (CCD) is the best example of a syndrome associated with multiple supernumerary unerupted teeth (Fig. 5.20). Its incidence is about 1/ 1 000 000 with no preference for gender or race [94]. It is an autosomal dominant condition, characterized by delayed closure of the fontanels, brachycephalic skull, hypoplastic or aplastic clavicles and numerous dental anomalies. Multiple supernumerary teeth are part of the syndrome, as are retained primary teeth, and unerupted permanent teeth. Mutations in CBFA1 (RUNX2), mapped to chromosome 6p21, have been identified as

FIGURE 5.19 A rare view of a mesiodens that has erupted in the mouth on the labial aspect of the central incisors.

FIGURE 5.20 Cleidocranial dysplasia. A defect in the dental lamina results in a large number of supernumary teeth. These teeth usually stay impacted and are often misshapen. Primary teeth also fail to resorb especially in the posterior segments.

responsible for CCD [76,93]. CBFA1 is a transcription factor acting as a major controller of osteogenesis. Variable loss of function of CBFA1 may give rise to clinical variability, including classic CCD, mild CCD, and isolated primary dental anomalies. Ooshima et al. [95] reported genotypeephenotype associations such as “the more supernumerary teeth, the shorter the individual”. Mundlos [96] reported that lack of remodeling leads to persistence of the dental lamina, resulting in the formation of multiple supernumerary teeth at the same time that the crowns of the permanent teeth are formed, creating a third dentition [97]. Actually, it is the same type of bone dysplasia that links the supernumerary teeth to the persistence of the primary teeth in the mouth and to the delay, or non-eruption, of the permanent teeth.

Dental Defects Size and Shape Teeth can be abnormally small (microdontia), abnormally large (macrodontia), or misshaped. A study of tooth size in 43 parental pairs and their 100 offspring supported the hypothesis that tooth size is a sex-linked trait [98]. Microdontia is the most common developmental abnormality after hypodontia (Fig. 5.21). There is a significant association with hypodontia, and the more severe the hypodontia, the greater the possibility of microdontia [99]. A strong association was also found between agenesis of the second premolar and the pegged maxillary incisor [79]. Environmental conditions also contribute to variation in human tooth size [100]. In pregnant women affected with hypothyroidism, diabetes or hypertension, odontometric analyses in the offspring showed that maternal hypothyroidism and diabetes resulted in an increase in tooth size, while hypertension was associated with decreased tooth size.

PEDIATRIC BONE

DENTAL DEFECTS AND SYNDROMES

FIGURE 5.21 Non-syndromic 18-year-old female patient presenting with hypodontia, several severely misshapen and smaller than normal teeth not associated with a syndrome. Lateral and anterior open bite, anterior crossbite are also part of the malocclusion.

Chemotherapy and radiotherapy in infants, babies and young children contribute to changes in both primary and permanent dentition. The defects usually appear as hypodontia, microdontia, enamel hypoplasia and stunted roots. All these defects were present in the dentition of 52 surviving children afflicted by malignant diseases, even though none of them had received radiotherapy to their facial structures. Microdontia was present in 20% of this group, significantly above the 2.5% average for the normal population [101]. Severe and generalized microdontia is associated with several syndromes. Rieger syndrome, an autosomal dominant genetic defect, whose main features are ocular (microphthalmia), craniofacial (hypoplastic alae nasi) and hypospadia, presents with, in addition to hypodontia, an anterior mandibular tooth of smaller size and tapered in shape [102]. Identical dental findings are found in Williams syndrome, where teeth are tapered or incisors are screwdriver-shaped [83]. In Turner syndrome, there is a reduction of the dental crown’s height [103]. Several root anomalies were also reported. Trisomy 21 individuals also have a permanent dentition of reduced size [104]. The opposite was true for the deciduous dentition [104]. The authors hypothesized that, while the decreased mitotic activity of cells could logically explain the general reduction in the permanent teeth size, the phenomenon did not take place at the time of deciduous teeth mineralization (8e10 weeks of gestation) when the fetus experiences a burst of cellular activity. The result of this increased activity would be larger than normal deciduous teeth. Macrodontia is a defect rarely found in the normally developing child. However, there is a positive correlation with body stature and tooth size [100]. In subjects with a 47 XYY phenotype, the extra Y chromosome appears linked to larger teeth, probably because it

99

provided a stronger and longer mitotic cell activity during the individual’s prenatal and early postnatal periods [105]. The KBG syndrome is an autosomal dominant trait characterized by short stature, facial anomalies (telecanthus, wide eyebrows, brachycephaly), mental retardation, skeletal anomalies (abnormal vertebrae, short metacarpals, short femoral necks) and macrodontia (mostly large upper incisors) [106]. Dental root anomalies are not frequent, and mostly limited to a reduction in size (short root anomaly). Normal dental roots are approximately twice the length of their corresponding crowns. A ratio of one to one or less defines a short root anomaly. Anomalies often associated with short roots are hypodontia, peg-shaped teeth, dens invaginatus and taurodontism. Short root anomalies may be limited to a few teeth (usually maxillary permanent laterals) or may affect the whole dentition. Chemotherapy, radiotherapy and total body irradiation can be devastating for the permanent dental root development in the pediatric community. A study mentioned earlier found abnormal permanent root development in long-term survivors of malignant diseases, with the root disturbance corresponding to the duration of treatment and dose of irradiation [101]. The addition of chemotherapy treatment further disturbs tooth formation. The extent of the damage seems to depend upon the stage of histodifferentiation of the tooth and the amount of rads administered. Any dose higher than 2000 rads produced serious dental defects, regardless of the child’s age. The authors described a case of a boy who had received 4050 rads to the right middle ear (rhabdomyosarcoma) and to the right cervical lymph nodes when he was 2 years old; the rads were supplemented with vincristine, actinomycin D and cyclophosphamide. At age 13, his panoramic radiograph revealed that his permanent teeth were present in the oral cavity but no root formation was noted on the first molars and several teeth such as the second premolars and molars were not developing normally (Fig. 5.22). Hultta¨ et al. reviewed the radiographs of 52 children who had received stem cell transplantation before the age of 10. The children were treated with anticancer therapy for acute lymphomatic leukemia, acute monocytic leukemia and non-Hodgkin lymphomas. A postoperative assessment took place at an average age of 7.2 years, and 945 teeth were examined. All patients presented with severe disturbances in the root development of the permanent teeth. The most severely affected teeth were found in patients who were 3.1 to 5.0 years at the time of the transplantation. Taurodontism is a dental root anomaly found in 2.5% of the Caucasian population. It is caused by the apical enlargement of the body of the tooth (or coronal part)

PEDIATRIC BONE

100

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

FIGURE 5.22 Rhabdomyosarcoma patient having received radiotherapy at a young age. Note the total absence of development of the roots of the first molars, Conical root shape and malformed second molars and premolars. Lower left second molar is not developing as well as the third molars.

at the expense of the root length. Therefore, the roots appear much shorter. Simultaneously, the classic cemento-enamel constriction lessens or disappears. Taurodontism is often found in individuals with aneuploidy of the X chromosome [107]. Enamel Defects Enamel is a unique, highly mineralized tissue. Its protein constituents, amelogenin (80e90%), ameloblastin (5e10%), enamelin (3e5%) and enamelysin (1%) are produced by ameloblasts. They are responsible for enamel maturation. Deleterious effects of environmental and systemic factors during enamel formation are often traceable when the tooth emerges into the oral cavity. Defects in any of the above proteins can trigger enamel defects without affecting other parts of the structure [108]. Enamel defects are also part of syndromes that are hereafter mentioned. Each group of teeth has a unique anatomy and is easily recognizable. Each crown of a particular tooth may show specific alterations that may or may not endanger its integrity. For example, “dens in dente” or “dens invaginatus” is a developmental anomaly where the enamel of the maxillary incisors enfolds itself on the lingual pits and penetrates into the pulpal space. The “dens in dente” is a structure with its own inner enamel, dentin and blood supply (Fig. 5.23) [109]. As its name implies, it looks like a tooth within a tooth. If the opening is not protected and sealed in time, the invagination may communicate with the pulpal space which may become contaminated by oral bacterial flora. A pulpal infection ensues, requiring endodontic therapy. The incidence of pulpal necrosis is between 0.25 and 9.66%. “Dens evaginatus” or “tubercle shaped cusp” is the opposite of dens in dente. The enamel folds itself outwardly and resembles an extra cusp near the central

FIGURE 5.23 Dens in dente. The dental papilla is forming a second tooth inside the normally developed tooth.

groove of the tooth [110]. This event takes place in the early stage of odontogenesis. Posterior permanent teeth, notably bicuspids, most frequently present with this type of enamel defect. During active intraoral tooth eruption, the opposite tooth will eventually occlude into the central groove and fracture the little tubercle. The dentin and the minuscule pulpal tissue are then exposed, and the tooth becomes infected. This anomaly is frequent in subjects with Asian ethnic background but is also found in other races [111]. The “talon cusp”, which resembles the “dens evaginatus”, limits itself to maxillary incisors (Fig. 5.24). It favors deciduous teeth, but may be found on permanent teeth as well. It can interfere with the patient’s occlusion and presents both an esthetic and a treatment challenge [112]. Enamel defects are also associated with nutritional deficiencies. They appear as linear or irregular spots on the teeth, usually on the edge of the permanent incisors and on the superior third surfaces of the first permanent molars. These surfaces undergo their odontogenesis during the neonatal period and during the first year of life. Vitamin D, calcium and phosphorus deficiencies as well as any severe nutritional deficiency will trigger such defects. Other disturbances may also cause enamel defects. A low calcium concentration during enamel formation is a specific determinant of enamel hypoplasia [113].

PEDIATRIC BONE

DENTAL DEFECTS AND SYNDROMES

101

FIGURE 5.25 Hypoplastic phase of enamelogenesis imperfecta FIGURE 5.24 Talon cusp that does not allow for proper tooth positioning as it interferes with arch alignment.

Enamel mineralization defects or amelogenesis imperfecta (AI) [108] may take place at different stages of odontogenesis. When the damage occurs during the secretory time (hypoplastic defect), the enamel is of good quality, but of insufficient quantity, sometimes practically nonexistent. When the damage occurs during the mineralization time (hypomineralized defect), the enamel is of normal thickness but poor quality. When it takes place during maturation time (protein processing and crystallite maturation defect), the enamel retains its normal thickness but quality is even poorer. Most enamel defects have a dominant inheritance. Enamelin (ENAM 4q21) is the main gene involved. A classification of AI was proposed by Witkop in 1988 [108]. He stated that AI, a developmental intrinsic defect in enamel formation, can be classified into four different types: 1. Hypoplastic defect, where the enamel does not develop to its normal thickness (Fig. 5.25) 2. Hypomaturation defects, where the enamel is of normal thickness but of mottled appearance 3. Hypocalcification defects, where the enamel is of normal thickness but friable and yellowish-brown in color 4. Hypomaturationehypoplastic defects associated with taurodontism (hypoplastic and hypocalcified enamel in teeth with atypically enlarged pulp chambers). The complexity and the high intrafamilial variability, together with the difficulties in diagnosing the precise type of AI (such as hypocalcification versus hypomaturation), make it difficult to identify the precise gene defect. Teeth with AI are difficult to maintain, resulting in a high proportion of edentulism among family members. Syndromes associated with AI are rare. In

(see also Fig. 5.2). The enamel is normal but in very small quantity. Notice that the enamel is already fracturing at the incisal edges and is very translucent.

mucopolysaccharidoses (MPS) enamel can be specifically targeted. MPS is a family of metabolic disorders (lysosomal enzyme deficiencies) that share an autosomal recessive inheritance (except for MPS II which is sexlinked). They are all affected with “dysostosis multiplex”. Yet only one MPS, the Morquio syndrome (MPS IVB), is associated with enamel defects, even though the affected individuals show milder phenotypes than their counterparts with MPS IVA. The enamel is yellow, brittle and weak [114]. The tricho-dento-osseous syndrome (TDO), an autosomal dominant trait, is caused by a mutation in DLX3, mapped to 17q21. It presents with a combination of amelogenesis imperfecta (pitted thin and discolored enamel) and taurodontism. The taurodontic tooth is characterized by an abnormally large pulpal space and absence of the constriction between the crown and the root (cemento-enamel junction). TDO individuals have kinky hair (curly at birth), thick dense bones and brittle nails. The dental phenotype is present in all cases [115]. Focal dermal hypoplasia (FDH) or GoltzeGorlin syndrome presents with severe dental defects: the enamel is irregular and misshaped and covers small misaligned teeth. Hypodontia is present as well. It is transmitted as a sex-linked trait on the short arm of the X chromosome [116]. Dentine Defects In dentine, collagen (mostly collagen type I) serves as a network for the forming carbonate apatite. Dentine matrix protein (DMP1), dentin sialoprotein (DSP) and the dentin phosphoprotein (DPP) are the noncollagenous components that regulate dentinogenesis. The most important dentinal defect is dentinogenesis imperfecta (DGI), an autosomal dominant trait (Figs 5.26 and 5.27). In 1973, Shields et al. divided DGI into

PEDIATRIC BONE

102

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

FIGURE 5.26 Dentinogenesis imperfecta. Teeth are brownish in color, fracture easily and are very difficult to restore. Enamel fractures easily as the dentineeenamel bond is weak.

three subgroups [117]. All of them are linked to chromosome 4q21, and result from mutations in DSP [108]. The first group, or DGI type I, is linked to osteogenesis imperfecta (OI); the second group, DGI type II, presents with almost the same clinical picture but with no other systemic involvement; the third type, DGI type III, is a rare isolated disorder known as the “Brandywine isolate”. Two more dentinal defects, dentin dysplasia I [101], an exceedingly rare condition and dentin dysplasia II (DDII) which bares close resemblance with DGI II, complete the list [117]. Dentinogenesis imperfecta type II is one of the most common dominantly inherited disorders. Its incidence is around 1/8000 and its penetrance is high [118].

FIGURE 5.27 Dentinogenesis imperfecta in the mixed dentition. Severe wear and attrition are visible. Permanent molars have a blueish coloration.

In 2003, Sreenath et al. [119] studied the role of the Dspp gene in tooth mineralization in Dspp-null mice and concluded that it regulated proteoglycan synthesis during dentinogenesis. Beattie et al. performed linkage and mutation analysis in studying phenotypic variation in dentinogenesis imperfecta/dentin dysplasia (DDII) linked to 4q21 in a large pedigree spread over four generations. The related individuals all displayed dentin defects associated with DGI and DDII. The pattern of inheritance was autosomal dominant with complete penetrance. They concluded that type II dentin dysplasia and DGI type II as well as DGI type III were non-syndromic heritable dentin defects and should be put in one single category and classified by their respective severities [120]. DSPP is expressed in bone as well as in dentin. However, bone is not involved in DGI type II [3]. It is thus possible that other molecules in bone exert redundancy. DGI is easily recognizable. The teeth are opalescent, with a color varying from gray to yellow. They are fragile and the enamel chips off easily because its poor adhesion to dentin and the dentin itself is defective. Dental fractures can be severe because the circumpulpal dentin (deeper dentin) is weak and does not resist stress. On radiographs, the crowns appear bulbous, the roots are slender and short and the pulp spaces are obliterated by irregular dentin. Dentinogenesis imperfecta type I is associated with the osteogenesis imperfecta syndrome (OI) [58,121] (see Chapter 18). In this heritable disorder, bone brittleness is associated with a decreased bone mass. The syndrome is associated with other anomalies, such as blue sclerae, hearing loss and joint hypermobility [57]. Most patients harbor a mutation in one of the two genes encoding type I collagen [122]. Sillence has proposed a classification into four types which is still frequently used [123]. Type I is the mildest form, type II is lethal, type III is the most severe one compatible with life (Fig. 5.28) and type IV, a heterogeneous group with variable severity. Glorieux and his group were able to describe three more types (V, VI and VII) [122]. When OI is caused by a mutation in a protein other than collagen type I, DI is not present. In the past, OI linked to collagen I defect was further classified as having DI or not. However careful examination of apparently normal dentitions may show subtle signs of DI [124]. Deciduous teeth are more affected than the permanent ones. Other problems are failure of eruption, tooth impaction and severe malocclusion. The most common type of malocclusion in the OI patient is the class III malocclusion. A lack of anteroposterior development associated with a larger mandible results in anterior crossbites. Lack of dentodevelopment, especially in the posterior region, leads to the development of lateral open bites (Figs 5.29 and 5.30) [58]. The latter may occur

PEDIATRIC BONE

DENTAL DEFECTS AND SYNDROMES

FIGURE 5.28 Osteogenesis imperfecta type III patient presenting

103

FIGURE 5.29 Lateral cephalometric radiograph of an osteogenesis imperfecta type III patient presenting the typical lack of anterior projection of the maxilla and lateral posterior open bites.

with dentinogenesis imperfecta. Anterior crossbite is observed.

even in forms of OI not linked to type I collagen abnormalities [3,124]. X-linked hypophosphatemia (XLH), is a heritable disease caused by impaired renal phosphate transport (see Chapter 26) (Figs 5.31 and 5.32). It is linked to mutations in the PHEX gene. It results in rickets, osteomalacia, growth retardation and dentin defects [125, 126]. The latter trigger spontaneous dental abscesses on teeth that appear intact and devoid of carious lesions. Schwartz et al. examined 14 patients with XLH and found a high percentage of these particular abscesses. The teeth showed impaired dentin mineralization that allowed elongated pulp horns to reach the cementoenamel junction and, through minor enamel abrasions, be exposed to the oral bacteria [127]. Shields et al. measured the pulp profile area of the hypophosphatemic teeth on radiographs as a measure of secondary dentin development [125]. The large pulp size, the lack of secondary dentin and the globoid dentin explained

FIGURE 5.30 Intraoral pictures of an osteogenesis imperfecta type III malocclusion in the mixed dentition characterized by an anterior crossbite and lateral open bites. Dentinogenesis imperfecta is also associated with osteogenesis imperfecta in this patient.

FIGURE 5.31

Bite-wing type dental radiograph of a hypophosphatemia patient. The pulp chambers are enlarged. No protective dentin is present leading to spontaneous pulpal necrosis and dental abscesses.

PEDIATRIC BONE

104

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

FIGURE 5.32 Periapical radiograph of a hypophosphatemia patient. Periapical radiolucency is detected on a routine radiograph. No evidence of dental decay or periodontal involvement is present.

the occurrence of dental abscesses. Chaussain-Miller et al. stated that early treatment of XLH with the association of the 1-hydroxylated form of vitamin D and phosphates was beneficial with definite improvement of the dentin tissue [121].

FIGURE 5.34 Periapical radiograph of the anterior aspect of the maxilla of an osteopetrotic patient showing lack of dental eruption, poorly formed teeth and increased density of the alveolar bone.

Osteopetrosis, also known as Albers-Scho¨nberg disease, is characterized by a defect in the differentiation and/or function of osteoclasts [128,129]. The most severe forms tend to have an autosomal recessive inheritance (1 in 250 000 births) while the milder forms have an autosomal dominant inheritance (1 in 20 000 births). Marks [130] demonstrated that tooth eruption was dependent on bone resorption in osteopetrotic rats. When teeth cannot erupt, they change their shape and become dilacerated. In the most severe form of osteopetrosis, called malignant osteopetrosis, the dental findings include delayed tooth eruption, impaction and severe root and crown malformation (Figs 5.33e5.35) [129].

CONCLUSION

FIGURE 5.33 Osteopetrosis in a 6-year-old patient. Extremely dense bone, multiple unerupted and malformed teeth are present. No osteoclastic activity is present to counterbalance the osteoblastic proliferation. Dental eruption patterns are completely disturbed.

Tooth eruption through the dental follicle is a complex phenomenon. It involves osteoblastic and osteoclastic activity that contributes to form dento-alveolar bone. This bone formation and the development of dental occlusion, first for the deciduous, then for the succedaneous dentition, will have a profound impact on the

PEDIATRIC BONE

REFERENCES

FIGURE 5.35 Intraoral occlusal picture of an osteopetrotic patient. No bone remodeling is present. Dental eruption is incomplete. Proliferation of bone around the dental follicle without bone resorption and remodeling does not allow for normal tooth eruption.

development of the lower part of the face. If teeth are missing or fail to erupt in the proper position, dentoalveolar development will be stunted and the alveolar ridge will either not form or be severely reduced in size. In severe cases of hypodontia, very little dentoalveolar volume is present, resulting in a collapsed lower face height. The mode of tooth eruption, guided by precise genetic control, is also largely influenced by its neuromuscular environment and the response of the periodontal ligaments to the environment. Tooth positioning may be altered by functional imbalance, as the periodontal ligament will respond to forces and rapidly remodel the dento-alveolar complex in order to maintain the necessary physiological distance between the alveolar wall and the dental root. Dentofacial development is intimately linked to proper dento-alveolar development that is itself dependent on a properly developing sequence of dental eruption and PDL influence. The study of heritable conditions has helped to explain why and how dental defects take place. It has also allowed delineation of specific syndromes. As it is the case in other disciplines, a thorough oral examination together with a comprehensive medical history will continue to contribute to further our knowledge of the complex mechanisms underlying dental maturation.

References [1] Vaahtokari A, Vainio S, Jowett A. Molecular mechanisms of cell and tissue interactions during early tooth development. Anat Rec Part A 1996;245:151e61. [2] Wright J. Consequences of amelogenin mutations: implications in amelogenesis imperfecta Amelogenins: multifaceted proteins for dental and bone formation and repair. Benham 2010;88e98.

105

[3] Kim J, Simmer J. Hereditary dentin defects. J Dent Res. 2007;86:392. [4] Monreal A, Ferguson BM, Headon DJ, Street SL, Overbeek PA, Zonana J. Mutations in the human homologue of mouse dl cause autosomal recessive and dominant hypohidrotic ectodermal dysplasia. Nat Genet. 1999;22:366e9. [5] Rush J-V. Determinisms of odontogenesis. Cell Biol Rev. 1987;14:86. [6] MacKenzie AM, Ferguson B, Sharpe P. Expression patterns of the homeobox gene, Hox-8, in the mouse embryo suggest a role in specifying tooth initiation and shape. Development 1992;115:403e20. [7] Wise GE, Frazier-Bowers S, D’Souza RN. Cellular, molecular, and genetic determinants of tooth eruption. Crit Rev Oral Biol Med 2002;13:323e35. [8] Sasaki ST, Goldberg M, Takuma S, Garant P. Cell biology of tooth enamel formation. Monographs in Oral Science. Karger Basel 1999. p. 1e204. [9] Snead ML, Newcomb CJ, Payne ML, et al. Cell to matrix interactions suggests a pathway for enamel regeneration using artificial matrices. Goldberg M Bentham; 2010. [10] Chun YHP, Hu JC-C, Simmer JP. The non-amelogenins: ameloblastin and enamelin in Amelogenins: multifaceted proteins for dental and bone formation and repair. M. Goldberg Bentham; 2010. p. 42e55. [11] Goldberg M, Marian KA, Young M, Boskey A. Dentin: structure, composition and mineralization. The role of dentin ECM in dentin formation and mineralization. Fronters Bioscience E3 January 1, 2011;711e35. [12] Wang R, Weiner S. Strain-structure relations in human teeth using Moire fringes. J Biomech 1997;31:135e41. [13] Boukpessi T, Septier D, Bagga S, et al. Dentin alteration of deciduous teeth in human hypophosphatemic rickets. Calcif Tissue Intern 2006;79:294e300. [14] Gericke A, Qin C, Spevak L, et al. Importance of phosphorylation for osteopontin regulation of biomineralization. Calcif Tissue Int 2005;77:45e54. [15] Schroeder H. Biological problems of regenerative cementogenesis: synthesis and attachment of collagenous matrices on growing and established root surfaces. Int Rev Cytol 1992;142:1e60. [16] Bosshardt D, Schroeder H. Cementogenesis reviewed: a comparison between human premolars and rodent molars. Anatomy 1996;245:267e92. [17] VandenBos T, Bronckers AL, Goldberg HA, Beertsen W. Blood circulation as source for osteopontin in acellular extrinsic fiber cementum and other mineralizing tissues. J Dent Res. 1999;78:1688. [18] Slomka MJ, Coward VJ, Banks J, et al. Identification of sensitive and specific avian influenza polymerase chain reaction methods through blind ring trials organized in the European Union. Avian Dis 2007;51(Suppl):227e34. [19] Marks Jr S, Schroeder H. Tooth eruption: theories and facts. Anat Rec 1996;245:374e93. [20] Wise G, Marks Jr S, Cahill D. Ultrastructural features of the dental follicle associated with formation of the tooth eruption pathway in the dog. J Oral Pathol Med 1985;14:15e26. [21] Cahill D, Marks Jr S. Tooth eruption: evidence for the central role of the dental follicle. J Oral Pathol Med 1980;9:189e200. [22] Marks Jr S, Cahill D. Experimental study in the dog of the nonactive role of the tooth in the eruptive process. Arch Oral Biol. 1984;29:311e22. [23] Schneider GBG, Marks Jr SC. The diagnosis and cure of neonatal osteopetrosis: Experimental evidence from congenitally osteopetrotic (ia) rats. Metab Bone Dis Rel Res. 1979;1:335e9.

PEDIATRIC BONE

106

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

[24] Wesenbeeck LV, Odgrerl PR, Mackay CA, et al. The osteopetrotic mutation toothless (tl) is a loss-of-function frameshift mutation in the rat Csf1 gene: Evidence of a crucial role for CSF-1 in osteoclastogenesis and endochondral ossification. Proc Natl Acad Sci USA 2002;99:14303e98. [25] Marks S. The basic and applied biology of tooth eruption. Connect Tissue Res. 1995;32:149e57. [26] Cahill D. Eruption pathway formation in the presence of experimental tooth impaction in puppies. Anat Rec 1969;164:67e77. [27] Marks Jr S, Cahill D, Wise G. The cytology of the dental follicle and adjacent alveolar bone during tooth eruption in the dog. Am J Anat 1983;168:277e89. [28] Marks Jr S, Gorski J, Wise G. The mechanisms and mediators of tooth eruption emodels for developmental biologists. Int J Dev BioI 1995;39:223e30. [29] Hunter J. The Natural History of Human Teeth. 1778 [30] Cahill D. Histological changes in the bony crypt and gubernacular canal of erupting permanent premolars during deciduous premolar exfoliation in beagles. J Dent Res. 1974;53:786. [31] Gorski JP, Marks SC, Cahill DR, Wise GE. Developmental changes in the extracellular matrix of the dental follicle during tooth eruption. Connect Tissue Res. 1988;18:175e90. [32] Proffit W, Vig K. Primary failure of eruption: a possible cause of posterior open-bite. Am J Orthodont 1981;80:173e90. [33] McCall JO. Clinical Dental Roentgenology. W. B. Saunders Company; 1957. [34] Marks Jr S. Pathogenesis of osteopetrosis in the ia rat: Reduced bone resorption due to reduced osteoclast function. Am J Anat 1973;138:165e89. [35] Frazier-Bowers SA, Simmons D, Koehler K, Zhou J. Genetic analysis of familial non syndromic primary failure of eruption. Orthodont Craniofacial Res. 2009;12:74e81. [36] Pelsmaekers B, Loos R, Carles C, Derom C, Viletinck R. The genetic contribution to dental maturation. J Dent Res. 1997;76: 1337. [37] Wise G, Frazier-Bowers S, D’Souza R. Cellular, molecular, and genetic determinants of tooth eruption. Crit Rev Oral Biol Med 2002;13:323. [38] Lokesh Suri B, Gagari E, Vastardis H. Delayed tooth eruption: pathogenesis, diagnosis, and treatment. A literature review. Am J Orthodont Dentofacial Orthoped 2004;126:4. [39] McCollum MS. Evolution and development of teeth. J Anat. 2001;199:153e9. [40] Heinrich J, Bsoul S, Barnes J, Woodruff K, Abboud S. CSF-1, RANKL and OPG regulate osteoclastogenesis during murine tooth eruption. Arch Oral Biol. 2005;50:897e908. [41] Philbrick Willam M, Dreyer Barbara E, Nakchbandi Innaam A, Karaplis Andrew C. Parathyroid hormone-related protein is required for tooth eruption. Proc Natl Acad Sci USA 1998; 95:11846. [42] Bowers S Frazier, Koehler K, Akerman J, Proffit W. Primary failure of eruption: further characterization of a rare eruption disorder. Am J Orthodont Dentofacial Orthoped 2007;131:578. [43] Ericson S, Kurol J. Radiographic examination of ectopically erupting maxillary canines. Am J Orthodont Dentofacial Orthoped 1987;91:483e92. [44] Lee C, Proffit W. The daily rhythm of tooth eruption. Am J Orthodont Dentofacial Orthoped 1995;107:38e47. [45] Moorree C. Normal variation in dental development determined with reference to tooth eruption status. J Dent 1965;44:161. [46] Trentini C, Proffit W. High-resolution observations of human premolar eruption. Arch Oral Biol. 1996;41:63e8.

[47] Sodek J, McKee M. Molecular and cellular biology of alveolar bone. Periodontology. 200;24:99-126. [48] Dobbins DE, Sood R, Hshiramoto A, et al. Mutation of macrophage colony stimulating factor (Csf1) causes osteopetrosis in the tl rat. Biochem Biophys Res Commun 2002;294:1114e20. [49] Smith B, Garn S. Polymorphisms in eruption sequence of permanent teeth in American children. Am J Phys Anthropol 1987;74:289e303. [50] Harokopakis-Hajishengallis E. Physiologic root resorption in primary teeth: molecular and histological events. J Oral Sci. 2007;49:1e12. [51] Sahara N, Okafuji N, Toyoki A, et al. Odontoclastic resorption of the superficial nonmineralized layer of predentine in the shedding of human deciduous teeth. Cell Tissue Res. 1994;277: 19e26. [52] Fukushima H, Kajiya H, Takada K, Okamoto F. Expression and role of RANKL in periodontal ligament cells during physiological root resorption in human deciduous teeth. Eur J Oral Sci. 2003;111:346e52. [53] Bille M, Kvetny M, Kjaer I. A possible association between early apical resorption of primary teeth and ectodermal characteristics of the permanent dentition. Eur J Orthodont 2008;30:346. [54] Oshiro T, Shibasaki Y, Yoda S, et al. Immunolocalization of vacuolar type Hþ ATPase, cathepsin K, matrix metalloproteinase 9, and receptor activator of NFkB ligand in odontoclasts during physiological root resorption of human deciduous teeth. Anat Rec 2001;264:305e11. [55] Yoda S, Suda N, Kitahara Y, Komori T, Onyama K. Delayed tooth eruption and suppressed osteoclast number in the eruption pathway of heterozygous Runx2/Cbfa1 knockout mice. Arch Oral Biol 2004;49:435e42. [56] Iizuka T, Cielinski M, Aukerman SL, Marks Jr SC. The effects of colony-stimulating factor-1 on tooth eruption in the toothless (osteopetrotic) rat in relation to the critical periods for bone resorption during tooth eruption. Arch Oral Biol. 1992;37:629e36. [57] O’Connell A, Marini J. Evaluation of oral problems in an osteogenesis imperfecta population. Oral Surg Oral Med Oral Path Oral Radiol Endodontol 1999;87:189e96. [58] Schwartz S, Tsipouras P. Oral findings in osteogenesis imperfecta* 1. Oral Surg Oral Med Oral Pathol 1984;57:161e7. [59] Mossey P. The heritability of malocclusion: part 2. The influence of genetics in malocclusion. J Orthodont 1999;26:195. [60] Vastardis H. The genetics of human tooth agenesis: new discoveries for understanding dental anomalies. Am J Orthodont Dentofacial Orthoped 2000;117:650e6. [61] Ericson S, Kurol J. Resorption of maxillary lateral incisors caused by ectopic eruption of the canines: a clinical and radiographic analysis of predisposing factors. Am J Orthodont Dentofacial Orthoped 1988;94:503e13. [62] Proffit WR, Prewitt JR, Baik HS, Lee CF. Video microscope observations of human premolar eruption. J Dent Res. 1991; 70:15. [63] Moss M, Salentijn L. The primary role of functional matrices in facial growth* 1. Am J Orthodont 1969;55:566e77. [64] Moss M, Young R. A functional approach to craniology. Am J Physl Anthropol 1960;18:281e92. [65] Harvold EP, Tomer BS, Vargervik K, Chierici G. Primate experiments on oral respiration* 1. Am J Orthodont 1981;79: 359e72. [66] Vargervik K, Miller AJ, Chierici G, Harvold E, Tomer BS. Morphologic response to changes in neuromuscular patterns experimentally induced by altered modes of respiration* 1. Am J Orthodont 1984;85:115e24.

PEDIATRIC BONE

REFERENCES

[67] Saffar JL, Cherruau M. Alveolar bone and the alveolar process: the socket that is never stable. Periodontology 2000;1997(13):76e90. [68] McCulloch C, Lekic P, McKee M. Role of physical forces in regulating the form and function of the periodontal ligament. Periodontology 2000;2000(24):56e72. [69] Ten Cate A. The role of epithelium in the development, structure and function of the tissues of tooth support. Oral Dis 1996;2:55e62. [70] Cho M, Garant PR. Development and general structure of the periodontium. Periodontology 2000;2000(24):9e27. [71] Barrett A, Reade P. The relationship between degree of development of tooth isografts and the subsequent formation of bone and periodontal ligament. Periodont Res. 1981;16:456e65. [72] Lekic P, McCulloch C. Periodontal ligament cell populations: the central role of fibroblasts in creating a unique tissue. Anat Rec 1996;245:327e41. [73] Ten Cate A, Mills C. The development of the periodontium: the origin of alveolar bone. Anat Rec 1972;173:69e77. [74] Bellows C, Melcher A, Aubin J. Contraction and organization of collagen gels by cells cultured from periodontal ligament, gingiva and bone suggest functional differences between cell types. J Cell Sci. 1981;50:299. [75] Beertsen W, Everts V, Van den Hooff A. Fine structure of fibroblasts in the periodontal ligament of the rat incisor and their possible role in tooth eruption. Arch Oral Biol. 1974;19:1087e92. [76] Thesleff I. The genetic basis of tooth development and dental defects. Am J Med Genet A 2006;140:2530e5. [77] Aberg T, Cavender A, Gaikwad JS, et al. Phenotypic changes in dentition of Runx2 homozygote-null mutant mice. J Histochem Cytochem 2004;52:131. [78] Altug-Atac A, Erdem D. Prevalence and distribution of dental anomalies in orthodontic patients. Am J Orthodont Dentofacial Orthoped 2007;131:510e4. [79] Garib D, Peck S, Gomes S. Increased occurrence of dental anomalies associated with second-premolar agenesis. J Inform 2009;79:3. [80] Gorlin RG, Hennekam RCM. Syndromes of the Head and Neck. Oxford University Press; 2001. [81] Sofaer J. A dental approach to carrier screening in X linked hypohidrotic ectodermal dysplasia. J Med Genet. 1981;18:459. [82] Holmstrom G, Thoren K. Ocular manifestations of incontinentia pigmenti. Acta Ophthalmol Scand 2000;78:348e53. [83] Axelsson S. Variability of the cranial and dental phenotype in Williams syndrome. Swed Dent J Suppl. 2005;170:3. [84] Kozakiewicz M, Perczynska Partyka W, Kobos J. Cherubism e clinical picture and treatment. Oral Dis 2001;7:123e30. [85] Jones W, Gerrie J, Pritchard J. Cherubism e A familial fibrous dysplasia of the jaws* 1. Oral Surg Oral Med Oral Pathol 1952;5:292e305. [86] Lourenc¸o Ribeiro L, et al. Dental anomalies of the permanent lateral incisors and prevalence of hypodontia outside the cleft area in complete unilateral cleft lip and palate. Cleft Palate Craniofacial J 2003;40:172e5. [87] Tsai TP, Huang CS, Huang CC, See LC. Distribution patterns of primary and permanent dentition in children with unilateral complete cleft lip and palate. Cleft Palate Craniofacial J 1998; 35:154e60. [88] Ranta R, Stegars T, Rintala A. Correlations of hypodontia in children with isolated cleft palate. Cleft Palate J 1983;20:163e5. [89] Russell BG. Tooth agenesis in Down syndrome. Am J Med Genet. 1995;55:466e71. [90] Skrinjari IB- F. Anomalies of deciduous teeth and findings in permanent dentition. Acta Stomatol Croat 1991;25:151.

107

[91] Davis P. Hypodontia and hyperdontia of permanent teeth in Hong Kong schoolchildren. Commun Dent Oral Epidemiol 1987;15:218e20. [92] Harris E, Clark L. An epidemiological study of hyperdontia in American blacks and whites. J Inform 2008;78:3. [93] Garvey MT. Supernumerary teeth e an overview of classification, diagnostic and management. J Can Dent Assoc. 1999;65:612e6. [94] Baumert U, Golan I, Redlich M, Aknin JJ, Muessig D. Cleidocranial dysplasia: molecular genetic analysis and phenotypic based description of a Middle European patient group. Am J Med Genet A 2005;139:78e85. [95] Ooshima T, Mishima IR. Sobue s K. The prevalence of developmental anomalies of teeth and their association with tooth size in the primary and permanent dentitions of 1650 Japanese children. Int J Paediatr Dent 1996;6:87e94. [96] Mundlos S. Cleidocranial dysplasia: clinical and molecular genetics. J Med Genet. 1999;36:177. [97] Jensen B, Kreiborg S. Development of the dentition in cleidocranial dysplasia. J Oral Pathol Med 1990;19:89e93. [98] Lewis D, Grainger R. Sex-linked inheritance of tooth size: a family study. Arch Oral Biol. 1967;12:539e44. [99] Brook AH. A unifying aetiological explanation for anomalies of human tooth number and size. Arch Oral Biol. 1984;29:373e8. [100] Garn Sm, Osborne RH, Alvesalo L, Horowitz SL. Maternal and gestational influences on deciduous and permanent tooth size. J Dent Res. 1980;59:142e3. [101] Maguire A, Evans RG, Amineddine H, et al. The long-term effects of treatment on the dental condition of children surviving malignant disease. Cancer 1987;60:2570e5. [102] Jorgenson RJ, Levin LS, Cross HE, et al. The Rieger syndrome. Am J Med Genet. 1978;2:307e18. [103] Midtbø M, Halse A. Root length, crown height, and root morphology in Turner syndrome. Acta Odontol 1994;52:303e14. [104] Peretz B, Shapira J, Farbstein H, Arieli E, Smith P. Modification of tooth size and shape in Down’s syndrome. J Anat 1996; 188:167. [105] Alvesalo L, Osborne R, Kari M. The 47, XYY male, Y chromosome, and tooth size. Am J Hum Genet. 1975;27:53. [106] Herrmann J, Pallister PD, Tiddy W, Opitz JM. The KBG syndrome e a syndrome of short stature, characteristic facies, mental retardation, macrodontia and skeletal anomalies. Birth Defect Orig Art Ser 1975;11:7. [107] Jaspers M, Witkop Jr C. Taurodontism, an isolated trait associated with syndromes and X-chromosomal aneuploidy. Am J Hum Genet. 1980;32:396. [108] Witkop Jr C. Amelogenesis imperfecta, dentinogenesis imperfecta and dentin dysplasia revisited: problems in classification. J Oral Pathol Med 1988;17:547e53. [109] Vajrabhaya L. Nonsurgical endodontic treatment of a tooth with double dens in dente. J Endodont 1989;15:323e5. [110] Stewart R, Dixon G, Graber R. Dens evaginatus (tuberculated cusps): genetic and treatment considerations. Oral Surg Oral Med Oral Pathol 1978;46:831e6. [111] Mellor J, Ripa L. Talon cusp: a clinically significant anomaly. Oral Surg Oral Med Oral Pathol 1970;29:225e8. [112] Bailleul-Forestier I, et al. The genetic basis of inherited anomalies of the teeth. Part 2: Syndromes with significant dental involvement. Eur J Med Genet. 2008;51:383e408. [113] Nikiforuk G, Fraser D. The etiology of enamel hypoplasia: A unifying concept. J Pediatr 1981;98:888e93. [114] Gorlin RG, Hennekam RCM. Syndromes of the Head and Neck. Oxford University Press; 2001.

PEDIATRIC BONE

108

5. DENTAL DEVELOPMENT AND MATURATION, FROM THE DENTAL CRYPT TO THE FINAL OCCLUSION

[115] Price JA, Wright JT, Walker SJ, et al. Tricho-dento-osseous syndrome and amelogenesis imperfecta with taurodontism are genetically distinct conditions. Clin Genet. 1999;56:35e40. [116] Al Ghamdi K, Crawford P. Focal dermal hypoplasia e oral and dental findings. Int J Paediatr Dent 2003;13:121e6. [117] Shields E, Bixler D, El-Kafrawy A. A proposed classification for heritable human dentine defects with a description of a new entity. Arch Oral Biol. 1973;18:543e53. [118] Malmgren B, Lindskog S, Elgadi A, Norgen S. Clinical, histopathologic, and genetic investigation in two large families with dentinogenesis imperfecta type II. Hum Genet. 2004;114:491e8. [119] Sreenath T, Thyagarajan T, Hall B, et al. Dentin sialophosphoprotein knockout mouse teeth display widened predentin zone and develop defective dentin mineralization similar to human dentinogenesis imperfecta type III. J Biol Chem. 2003;278:24874. [120] Beattie ML, Kim JW, Gong SG, et al. Phenotypic variation in dentinogenesis imperfecta/dentin dysplasia linked to 4q21. J Dent Res. 2006;85:329. [121] Chaussain-Miller C, Sinding C, Septier D, et al. Dentin structure in familial hypophosphatemic rickets: benefits of vitamin D and phosphate treatment. Oral Dis 2007;13:482e9. [122] Rauch F, Glorieux F. Osteogenesis imperfecta. Lancet 2004;363:1377e85.

[123] Sillence D, Senn A, Danks D. Genetic heterogeneity in osteogenesis imperfecta. Br Med J 1979;16:101. [124] Lygidakis N, Smith R, Oulis C. Scanning electron microscopy of teeth in osteogenesis imperfecta type I. Oral Surg Oral Med Oral Pathol Oral Radiol Endodontol 1996;81:567e72. [125] Shields Ed, Scriver CR, Reade T, et al. X-linked hypophosphatemia: the mutant gene is expressed in teeth as well as in kidney. Am J Hum Genet. 1990;46:434. [126] Murayama T, Iwatsubo R, Akiyama S, Amano A, Morisaki I. Familial hypophosphatemic vitamin D-resistant rickets: dental findings and histologic study of teeth. Oral Surg Oral Med Oral Pathol Oral Radiol Endodont 2000;90:310e6. [127] Schwartz S, Scriver CR, Reade TM, Shields ED. Oral findings in patients with autosomal dominant hypophosphatemic bone disease and X-linked hypophosphatemia: further evidence that they are different diseases. Oral Surg Oral Med Oral Pathol 1988;66:310. [128] Stark Z. Osteopetrosis. Orphanet J Rare Dis 2009;4:1e10. [129] Moghadam MI, Nemati S, Johan M. Dental radiographic findings of malignant osteopetrosis: report of four cases. Iran J Radiol 2009;6:141e5. [130] Marks Jr S. Tooth eruption depends in bone resorption: experimental evidence from osteoetpotrotic (ia) rats. Metab Bone Dis Relat Res. 1981;3:107e15.

PEDIATRIC BONE

C H A P T E R

6

Parathyroid Hormone and Calcium Homeostasis John T. Potts, Thomas J. Gardella Endocrine Unit, Department of Medicine, The Massachusetts General Hospital and Harvard Medical School Boston, MA, USA

INTRODUCTION Parathyroid hormone (PTH) and PTH-related peptide (PTHrP), along with other calciotropic hormones, play critical roles in calcium homeostasis and bone biology. In contrast to PTH, which is produced by discrete endocrine glands, PTHrP is produced as a paracrine/ autocrine factor in many different adult and fetal tissues and has, unlike PTH, multiple functions (Fig. 6.1). First discovered as a calcium-regulating hormone in the 1920s [1e3], PTH is secreted by the parathyroid glands and is the critical regulator of blood calcium concentration in all terrestrial vertebrate species. PTHrP,

FIGURE 6.1 Biology of the PTH/PTHrP receptor. The PTH/ PTHrP receptor interacts with two ligands, PTH and PTHrP, and can activate several second-messenger signaling pathways, including the cAMP/protein kinase A (PKA) and Ca2þ/inositol 1,4,5-triphosphate/ PKC pathways. The receptor is abundantly expressed in bone and kidney, where it mediates the endocrine actions of PTH, and in the metaphyseal growth plate and numerous other tissues, where it mediates the autocrine/paracrine actions of PTHrP.

Pediatric Bone, Second Edition DOI: 10.1016/B978-0-12-382040-2.10006-1

a slightly larger molecule than PTH, was discovered more recently through efforts to identify the factor that causes, when produced in excess by certain tumors, the humoral hypercalcemia of malignancy syndrome [4e6]. PTH and PTHrP most likely evolved from a common ancestral precursor, as discussed further below. The polypeptides share only limited overall amino acid sequence identity, yet at least their N-terminal regions are sufficiently homologous to enable them to bind to and activate a common G protein-coupled receptor, the PTH/PTHrP receptor (also referred to as PTH1R) [7e9]. This receptor mediates the most important biologic actions of both peptides: PTH-dependent regulation of calcium homeostasis and PTHrP-dependent regulation of endochondral bone formation [10e14]. This chapter reviews (1) the comparative chemistry of PTH and PTHrP, their genes, and their interactions with PTH1R; (2) the current molecular models of interactions between the two ligands and their common receptor; and (3) the different biologic roles of both peptides on target tissues, such as the role of PTH in calcium homeostasis and bone turnover and the role of PTHrP in bone and cartilage development, as well as the functional characteristics of two novel, closely related receptors and the pharmacologic and physiochemical evidence for several additional, still incompletely characterized receptors for PTH and PTHrP.

PHYSIOLOGICAL ROLE OF PTH To ensure a multitude of essential cellular functions, the extracellular concentration of calcium (Ca2þo) is maintained within narrow limits [15,16]. In terrestrial

109

Copyright Ó 2012 Elsevier Inc. All rights reserved.

110

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

vertebrates, calcium is necessary for adequate mineralization of the skeleton, which provides mechanical support and protection for internal organs and acts as levers for the various muscle groups involved in locomotion. Because of its high calcium content, 99% of the body’s supply, the skeleton also serves as the most important reservoir from which calcium can be rapidly mobilized. Because food intake and thus the nutritional supply of calcium are usually discontinuous, intestinal calcium absorption occurs only intermittently. Maintenance of a constant blood calcium concentration thus constitutes a major homeostatic challenge which, during evolution, led to the development of highly efficient mechanisms to increase intestinal calcium absorption, reduce urinary calcium losses, and facilitate, if necessary, rapid mobilization of calcium from the skeletal reservoir [16]. In contrast to these environmental challenges of most terrestrial vertebrates, marine animals, which are usually exposed to the high environmental calcium concentration of seawater (10 mM) had to adopt mechanisms by which extracellular calcium could be reduced [17,18]. Unlike the diet of terrestrial animals, seawater provides only a very limited supply of phosphate, and this environmental deficiency resulted in the development of mechanisms to conserve phosphate. It thus, appears plausible that the efficient intestinal absorption of phosphate and the impressive capacity of the mammalian kidney to retain phosphate [15,19] are remnants of earlier evolutionary adaptations to life in the low phosphate environment of the oceans (see Chapter 7 for discussion of phosphate homeostasis). PTH and the active form of vitamin D, 1,25-dihydroxyvitamin D3 (1,25(OH)2D3), are the principal physiologic regulators of calcium homeostasis in humans and all terrestrial vertebrates [11,20,21]. Synthesis and secretion of PTH are stimulated by any decrease in blood calcium, and conversely, secretion of the hormone is inhibited by an increase in blood calcium [22,23]. This rapid negative feedback regulation of PTH production, along with the biologic actions of the hormone on different target tissues, represents the most important homeostatic mechanism for minute-to-minute control of calcium concentration in the extracellular fluid (ECF) [24e26]. In contrast to the rapid actions of PTH, 1,25(OH)2D3 is of critical importance for long-term, day-to-day, and week-to-week calcium balance. The actions of both hormones are coordinated, and each influences the synthesis and secretion of the other. At least three distinct, but coordinated, actions of PTH increase the flow of calcium into the ECF and thus increase the concentration of blood calcium [27e29]. Through its rapid actions on the kidney and bone, which are all mediated through the PTH/PTHrP receptor and subsequent secondary messages in specific

and highly specialized cells, PTH increases the release of calcium from bone, reduces the renal clearance of calcium, and stimulates the production of 1,25(OH)2D3 by activating the gene encoding 25-hydroxyvitamin D-1a-hydroxylase (1a-hydroxylase) in the kidney. The relative importance of the first two actions of PTH on the rapid, minute-to-minute regulation of calcium is not definitively resolved, but most physiologists have stressed the importance of the effects of PTH on bone in maintaining hour-to-hour calcium homeostasis in the ECF. Several lines of evidence, such as that provided by calcium kinetic analysis, indicate a transfer between ECF and bone of as much as 500 mg calcium daily, which is equivalent to one-fourth to one-half the total ECF calcium content [15]. Besides regulating this transfer of calcium from bone through direct breakdown of bone tissue (mineral and matrix), PTH influences the rates of exchange of calcium adsorbed to the surface of bone; this exchangeable calcium pool can be stimulated to provide a rapid and substantial rate of entry of calcium into blood. In addition to these actions of PTH on bone, actions of PTH on the kidney may also be extremely important in the precise hourly regulation of ECF calcium. The third action of PTH on calcium homeostasis e namely, enhancement of intestinal calcium absorption e is indirect and involves the synthesis of 1,25(OH)2D3 from the biologically inactive precursor 25(OH)D3. It is difficult, however, to analyze quantitatively or to contrast proportionately the relative physiologic importance of the direct and indirect actions of PTH on the three principal target tissues: kidney, bone, and intestine. The complexity of bone as a tissue and the many detectable rates of exchange of calcium between the skeleton and the ECF have made the action of PTH on the skeleton difficult to analyze. The state of calcium in blood is complex; much of the calcium is present as chelates or is bound to plasma proteins. Because actual filtered loads depend on the ratio of free and bound forms of calcium, it is difficult to calculate renal calcium clearance accurately. The different PTH-dependent actions to promote calcium entry into the ECF are most clearly defined in conditions of deficiency or excess of PTH, such as during experiments in animals or during controlled observations in patients with disorders of parathyroid gland function. The experimental data in these extremes abundantly affirm the crucial calcium homeostatic role of PTH. However, because of continuous and rapid adjustments in mineral ion concentration, it can be difficult to observe the consequences of hormone action under normal physiologic conditions. For example, the rate of PTH secretion changes continually and rapidly so that the controlled variable, calcium, remains constant, and it may, therefore, be difficult experimentally to detect small corrective changes.

PEDIATRIC BONE

PHYSIOLOGICAL ROLE OF PTH

Teleologically, the action of PTH on the regulation of blood phosphate concentration in terrestrial species is best understood as a secondary, rather than a homeostatic, action. Phosphate is abundant in the food chain in terrestrial existence. Phosphate deficiency, unlike calcium deficiency, in the absence of specific organ dysfunction is, therefore, an unlikely environmental challenge (see Chapter 7 for detailed review of the regulation of phosphate homeostasis). To correct a deficiency in calcium, calcium phosphate stores in bone can be rapidly dissolved; such activity results, however, in the simultaneous liberation of ionic calcium and phosphate. Because a high blood phosphate level tends to lower the calcium concentration through multiple mechanisms, the rise in blood calcium that occurs after bone dissolution (desirable homeostatically) is, therefore, beneficial only if the concomitant increase in blood phosphate concentration (undesirable) can be rapidly corrected. To maximize the control of calcium homeostasis, PTH thus has divergent actions on renal tubular handling of the two mineral ions: it increases the retention of calcium and, at the same time, diminishes reabsorption of phosphate. Through these mechanisms, namely, increased renal phosphate clearance to prevent hyperphosphatemia and increased tubular calcium reabsorption, PTH guarantees that an elevation in blood calcium results from the increased release of calcium from bone. The renal action of PTH on phosphate homeostasis is biologically predominant over the increased phosphate flux from bone. Consequently, parathyroidectomy (experimentally in animals) or renal resistance to PTH, as in patients with pseudohypoparathyroidism or renal failure, leads not only to hypocalcemia but also to an increase in blood phosphate and a marked reduction in urinary phosphate excretion. This finding demonstrates the importance of the PTHdependent action on phosphate homeostasis in the kidney, which becomes particularly important in disease states when high bone turnover is the result of dietary calcium deficiency or lack of biologically active vitamin D [30,31].

Chemistry The first extracts from bovine parathyroid glands were described in 1925, and the content of biologically active PTH was assessed by their hypercalcemic and phosphaturic properties [1,2]. However, it was not until 1959, when Aurbach [32] and Rasmussen and Craig [33] developed improved extraction procedures, that it became possible to isolate and purify sufficient quantities to determine the primary structure of bovine, porcine, and human PTH through the protein sequence determination methods [34e39]. Two groups independently determined the sequences of human and bovine

111

hormones [34e39]. Shown in Figure 6.2 are the sequences of the bovine, porcine, and human hormones determined by one group [35,36,38,39]. Discordant sequences for the human PTH polypeptide, and in one position for the bovine hormone, published by another group [34,37] are not shown in Figure 6.2, since nucleotide sequence analysis of genomic and complementary DNA confirmed the amino acid sequences of the first group (the only exception was residue 76 in human PTH, which was determined to be glutamine instead of glutamic acid) [35,36,39]. Based on these amino acid sequences, the PTH(1e34) fragments of the different species were synthesized, and their biologic activities were compared in vitro and in vivo with those of highly purified intact PTH from the same species. Molecular cloning techniques then led to the deduction of the amino acid sequences of rat, chicken and dog PTHs [40e43], followed more recently by the identification of PTH molecules in other mammals and fish, discussed below. The synthetic peptides used in parathyroid hormone research today are based largely on the (1e34) regions of the mammalian hormone sequences shown in Figure 6.2 [44,45]. Extensive sequence homology is present in the mammalian PTH species; these molecules consist of a single-chain polypeptide with 84 amino acids and a molecular weight of approximately 9400 Daltons (that of human PTH[1e84] is 9425 Daltons). The N-terminal region of PTH, which is necessary and sufficient for the regulation of mineral ion homeostasis, shows high sequence conservation among all the vertebrate species (see Fig. 6.2). The middle portions of the different molecules exhibit the most structural variation, which could suggest that this region of PTH is only of limited functional importance. The non-mammalian PTH homologs of chicken [41,42] and fish species Danio rerio (zebrafish) [46] and Takifugu ruberipes (puffer fish) [47,48] diverge considerably from the mammalian hormones C-terminal of amino acid residue His32. Interestingly, both fish species have two distinct genes encoding two separate PTH molecules, called PTH1 and PTH2 [46,47]. The zebrafish peptides are considerably shorter than mammalian PTH (67 and 68 residues), while fugu PTH1 is predicted to be 81 residues in length and fugu PTH2 is predicted to be 63 residues [47]. After the original work establishing that the first 34 amino acids of mammalian PTH were sufficient to produce a fully active synthetic peptide [44,45], much work has centered on defining the minimum pharmacophore essential for biologic activity. We describe below how sites of ligand interaction with the PTH/PTHrP receptor were defined by performing assays with products of various combinations of shortened and modified PTH ligands and mutagenized receptors [49]. As also discussed in the section below on hormone/receptor

PEDIATRIC BONE

112

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

FIGURE 6.2 Sequence relationships of PTH family ligands. Comparisons of amino acid sequences of PTH and PTHrP peptides from different

species are shown in panels A and B, respectively. Note numbering indicates alignment position number, and not protein amino-acid sequence number. Comparison of TIP39 and a PTH-like peptide (PTH-L) from the pufferfish (Takifugu rubripes) with human PTH and PTHrP (the [1e84] region only) is shown in panel C. Amino acid sequences were aligned using the ClustalW software program (version 2.012; gap penalties: opening, 15; extending, 5) and further processed using the Boxshade program. Amino acid identities of 50% or more are shown in white type on black field, and similarities are shown in black type on gray field. Sequence identification or accession numbers are shown in the legend to Figure 6.4.

interactions, it has been determined that substitutions of non-naturally occurring amino acids (e.g. alpha-aminoisobutyric acid at positions 1 and 3 in the primary ligand structure) favoring formation of an alpha-helix, even in short peptides, such as PTH(1e14), produce peptides that are highly potent when tested in vitro using cellbased assays and have highly stabilized helical structure in solution (Fig. 6.3) [50e54]. The in vitro activity of the native PTH(1e14), which is quite weak, is improved about 100 000-fold by the modifications indicated in Figure 6.3. Such short-length PTH peptides have also been shown to be active in vivo, since some cause hypercalcemia and are anabolic on bone, although their potency is much less than that of PTH(1e34) due to a more rapid clearance [55]. Replacement of valine-2 in these peptides with bulky amino acids, such as tryptophan or parabenzoyl-L-phenylalanine

(Bpa), results in competitive antagonist peptides defective for AC/cAMP and PLC/IP3/Ca2þ signaling, thus confirming the critical role that this conserved valine plays in receptor activation [56]. Other longer-length PTH or PTHrP analogs having residue-1 (serine or alanine) replaced by glycine [57], Bpa [58] or tryptophan [59] exhibit signal selective properties in that they efficiently stimulate the cAMP cellular pathway but not the inositol triphosphate/intracellular Ca2þ pathway. Because of their generally demonstrated similar potencies at the PTH/PTHrP receptor, it seemed likely that both PTH(1e34) and PTHrP(1e34) ligands would adopt very similar conformations when part of the active hormone-receptor complex. However, recent data, discussed below, suggest that each ligand selectively binds to or induces a distinct receptor confirmation. Ideally, each hormone should be co-crystallized

PEDIATRIC BONE

PHYSIOLOGICAL ROLE OF PTH

113

FIGURE 6.3 Minimized N-terminal PTH analogs. Shown is the native (rat) PTH(1e14) sequence and the locations of activity-enhancing

substitutions. The six substitutions shown above the sequence, when combined, enhance activity by as much as 100 000-fold; the Bpa2 substitution shown below confers antagonist properties to the peptide. The (1e9) region (non-shaded circles) comprises the minimum-length agonist pharmacophore. Non-encoded amino acids include a-amino-isobutyric acid (Aib), homoarginine (Har), and para-benzoyl-L-phenylalanine (Bpa).

with the PTH/PTHrP receptor to permit analysis by x-ray diffraction of those intermolecular interactions that are characteristic of the biologically active hormonereceptor complexes. G protein-coupled receptors, such as the PTH/PTHrP receptor, have multiple membraneembedded domains and are likely to have complex three-dimensional structures. Interaction with either PTH or PTHrP appears to involve several distinct receptor domains (see later discussion) that may undergo significant conformational changes after ligand binding has occurred, which makes it even more challenging to conduct x-ray or multidimensional NMR analyses. Recent advances, however, have made it possible to co-crystallize the extracellular portion of the PTH/PTHrP receptor with either the carboxyl terminal half of PTH(1e34) or that of PTHrP(1e34) [60,61].

rubripes and Tetraodon fluviatilis, reveal the duplication of the PTH gene in each case [47,65]. Both the PTH1 and PTH2 peptides derived from the zebrafish activate the PTH/PTHrP receptors from different species [48,65] and, indeed, a fugu PTH(1e34) peptide has been shown to induce bone anabolic effects in osteopenic ovariectomized rats [66]. In addition to PTH, the teleost fish also express PTHrP, again encoded by duplicate genes [65,67e70]. Furthermore, PTHrP immunoreactivity has been detected in the cartilaginous sharks and rays [71], and in a more primitive agnathan, the lamprey [72]. The

Evolution To maintain extracellular calcium and phosphate concentrations within narrow limits, the intricate regulatory system outlined above, in which PTH plays the most important role, developed in the terrestrial animals. In mammals, PTH is produced almost exclusively by the parathyroid glands (only small amounts of its messenger RNA [mRNA] have been detected elsewhere [62,63]). During evolution, these glands first appear as discrete organs in amphibians e that is, with the migration of vertebrates from an aquatic to a terrestrial existence e and their appearance most likely represents an evolutionary adaptation to an environment that is, by comparison to seawater, low in calcium [17,18,64]. Parathyroid glands have not been identified in fish or invertebrate species. However, with the rapid advances in characterization of complete genomes of multiple species we have definitive proof of the earlier evolutionary origin of both PTH and PTHrP (Fig. 6.4). Gene analyses of several teleost fish species, including the zebrafish, Danio rerio, and the puffer fishes Takifugu

FIGURE 6.4 Phylogenetic relationships of PTH family ligands. The diagram shows the separate groupings of PTH and PTHrP ligands, with duplications of each ligand in pufferfish (Takifugu ruberipes) and zebra fish (Danio rerio), as well as the relationship to an apparent ancestral, PTH-like ligand (PTH-L) in fugu. Protein data base accession numbers are as follows: human PTH, P01270; chicken PTH, A9YX65; danio PTH-1, Q6WQ25; danio PTH-2, Q6WQ24; fugu PTH-1, Q2PCS7; fugu PTH-2, Q6W9J4; human PTHrP, P12272; chicken PTHrP, Q5TLZ2; danio PTHrP-A, Q1L5E7; fugu PTHrP-A, Q9I8E9; danio PTHrP-B, Q4VVA3; fugu PTHrP-B, Q2PCS8; fugu PTH-L, Q2PCS5.

PEDIATRIC BONE

114

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

teleost PTHrPs contain some amino acid residues characteristic of mammalian PTH; for example, fish PTHrP contains Met at position 8, Trp at position 23, and Leu at position 28, which are amino acid residues found in mammalian PTH. However, there is only one amino acid residue, Gln(Q)25, in fish PTH that is found in some mammalian PTHrP species, but not in mammalian PTH (see Fig. 6.4). This pattern suggests that the fish proteins may be phylogenetically closer to a common PTH/PTHrP precursor than are the mammalian proteins (see below). Indeed, in addition to duplicate copies of PTH and PTHrP genes, the puffer fish genome contains a fifth gene that encodes a protein containing the amino acid residues characteristic of both PTH and PTHrP. This gene, called PTH-L, is phylogenetically an intermediary to PTH and PTHrP, and may thus represent first definitive evidence for an ancestral gene from which the two divergent ligand forms evolved (see Fig. 6.4) [47,65].

The PTH Gene The human PTH gene consists of three exons located on chromosome 11p15 [73e76]. The first exon is 85 nucleotides in length and is non-coding (Fig. 6.5). Exon 2 (90 bp) encodes most amino acids of the prepropeptide sequence, whereas the third exon (612 bp) encodes the remainder of the propeptide sequence and all amino acids of the mature peptide, and it constitutes the 30 non-coding region [77]. Several frequent intragenic polymorphisms (TaqI and PstI [78], BstBI [79], DraIII [80], XmnI [81], and a tetranucleotide repeat ([AAAT]n [82]) have been identified in the human PTH gene, and some were shown to be informative in genetic linkage studies [83e85]. Two mRNAs that are 822 and 793 bp in length are derived in the human gene from the two transcriptional start sites which follow two different functional TATA boxes that are separated by 29 bp [77]. Two closely spaced TATA boxes and two distinct transcripts are also derived from the bovine PTH gene,

FIGURE 6.5 Schematic of the PTH gene. Shown is the gene along several thousand base pairs (approximate length shown by the scale marker for 500 bp). The three exons in the mRNA are represented as numbered rectangles. Control elements are identified in the 50 noncoding region (50 NC). A region responsive to vitamin D is within a few hundred base pairs of exon 1; far upstream are silencers involved in calcium regulation.

while rat and chicken PTH genes give rise to only one transcript; as a consequence of a long 30 non-coding region, the transcript from the chicken PTH gene is unusually long, and comprises 2.3 kilobases [24,86]. The genes encoding zebrafish PTH1 and PTH2 have a similar overall organization as the mammalian PTH genes [46].

Cellular Biosynthesis and Hormonal Processing During the synthesis of the preproPTH molecule, the signal sequence, which comprises the 25-amino acid containing “pre”-sequence, is cleaved off after entry of the nascent peptide chain into the intracisternal space bounded by the endoplasmic reticulum. A heterozygous mutation in this leader sequence, which changes a cysteine to an arginine at position 8 and thus impairs processing of preproPTH to proPTH, has been identified as the most plausible molecular cause of an autosomal dominant familial form of hypoparathyroidism [87,88]. The mutant hormone was found to be trapped intracellularly, predominantly in the endoplasmic reticulum (ER), leading to a marked upregulation of ER stressresponsive proteins (BiP and PERK) and the proapoptotic transcription factor CHOP, indicating that apoptosis-mediated parathyroid cell death is the likely cause of the observed hypoparathyroidism [89]. Subsequent to the removal of the pre-sequence, the pro-peptide is transported to trans-Golgi network where the pro-sequence (amino acid residues 6 through 1) is removed [90]. This latter process may involve furin (paired basic amino acid cleaving enzyme) and/or proprotein convertase-7 (PC-7), which are both expressed in parathyroid tissue; their expression levels do not appear to be regulated by either calcium or 1,25(OH)2D3 [91,92]. After removal of the basic pro-sequence, the mature polypeptide, PTH(1e84), is packaged into secretory granules. Two proteases, cathepsins B and H, are subsequently involved in the intraglandular generation of carboxyl-terminal PTH fragments from the intact hormone; no amino-terminal PTH fragments appear to be released from the gland [93e95]. Since small or intermediate size carboxyl-terminal fragments of PTH are unlikely to be involved in the regulation of calcium homeostasis, the intraglandular degradation of intact PTH is thought to represent an inactivating pathway, at least with regard to the regulation of mineral ion homeostasis. Consistent with this conclusion, hypercalcemia results in a substantial decrease in PTH secretion and, furthermore, favors the secretion of carboxylterminal PTH fragments, including a previously undetected large molecular species that is truncated at the amino-terminus (see section below) [95e98]. However, recent studies have shown that some amino-terminally truncated PTH fragments, such as PTH(7e84), have

PEDIATRIC BONE

PHYSIOLOGICAL ROLE OF PTH

115

hypocalcemic properties in vivo and can furthermore reduce the formation of osteoclasts in vitro [99]. The pool of stored, intracellular PTH is small and the parathyroid cell must therefore have mechanisms to increase hormone synthesis and release in response to sustained hypocalcemia. One such adaptive mechanism is to reduce the intracellular degradation of the hormone, thereby increasing the net amount of intact, biologically active PTH that is available for secretion. During hypocalcemia, the bulk of the hormone that is released from the parathyroid cell is intact PTH(1e84) [93e95,97,98]. As the level of Ca2þo increases, a greater fraction of intracellular PTH is degraded, and with overt hypercalcemia, most of the secreted immunoreactive PTH consists of biologically inactive C-terminal fragments [10,24,25].

stimulation of intestinal calcium absorption and bone resorption [105e107] and may thus be attractive candidates for treating the hyperparathyroidism of chronic renal insufficiency. Adjustment of the rate of parathyroid cellular proliferation is the third adaptive mechanism contributing to changes in the overall secretory activity of the parathyroid gland. Under normal conditions, parathyroid cells have little or no proliferative activity. The parathyroid glands, however, can enlarge greatly during states of chronic hypocalcemia, particularly in the setting of renal failure, probably because of a combination of hypocalcemia, hyperphosphatemia, and low levels of 1,25(OH)2D3 in the latter condition.

Regulation of PTH Gene Expression

A large number of factors modulate PTH secretion in vitro [11,25,108] but most of these factors are not thought to control hormonal secretion in vivo in a biologically relevant manner. Therefore, we focus in this section principally on factors that are the most physiologically meaningful regulators of PTH secretion e that is, the extracellular ionized calcium concentration itself (Ca2þo), 1,25(OH)2D3, and the level of extracellular phosphate ions. Of these three, Ca2þo is most important in the minute-to-minute control of PTH secretion. Indeed, the actions of 1,25(OH)2D3 and phosphate ions on the secretion of PTH probably result, at least in part, from their effects on hormonal biosynthesis rather than secretion per se [11,25,108]. Ca2þo also modulates several other aspects of parathyroid function that indirectly affect PTH secretion, including PTH gene expression, the hormone’s intracellular degradation, and parathyroid cellular proliferation, as described previously. Recent data have shown that novel factors playing key roles in phosphate homeostasis, especially fibroblast growth factor 23 (FGF-23) and aeKlotho (a co-receptor for FGF receptors), also modulate parathyroid function, inhibiting [109,110] and enhancing [111] parathyroid function, respectively. Our rapidly improving understanding of how these factors participate in phosphate homeostasis is described in detail in Chapter 7. The relationship between PTH and Ca2þo is represented by a steep inverse sigmoidal curve that can be quantitatively described [112e114]. Parathyroid cells can readily detect reductions in Ca2þo of a few percentage points [113] and the percent coefficient of variation in Ca2þo in humans is less than 2% [115]. The set point of the parathyroid gland is the key determinant of the level at which Ca2þo is “set” in vivo [116]. Thus, the parathyroid cell is normally more than half-maximally suppressed at normal levels of Ca2þo and has a large secretory reserve for responding to hypocalcemic stress. Nevertheless, PTH levels in vivo fall dramatically

Another adaptive mechanism of the parathyroid cell to sustained reductions in Ca2þo is to increase cellular levels of PTH mRNA, a response that takes several hours. A reduction in Ca2þo increases, whereas an elevation in Ca2þo reduces the cellular levels of PTH mRNA by affecting both its stability and the transcriptional rate of its gene [11,25,100,101]. Available data suggest that phosphate ions also regulate, directly or indirectly, PTH gene expression. Hypophosphatemia and hyperphosphatemia in the rat, respectively, lower and raise the levels of mRNA for PTH through a mechanism that is independent of changes in Ca2þo or 1,25(OH)2D3. An elevated extracellular phosphate concentration could, thus, contribute importantly to the secondary hyperparathyroidism frequently encountered in patients with end-stage renal failure, who often have chronically elevated serum phosphate concentrations. Metabolites of vitamin D, principally 1,25(OH)2D3, also play an important role in the long-term regulation of parathyroid function and may act at several levels: by affecting the secretion of PTH and regulation of its gene, by regulating transcriptional activity of the genes encoding the calcium-sensing receptor (CaSR) (see below) and the vitamin D receptor (VDR), as well as by regulating parathyroid cellular proliferation [11,25,100,102]. 1,25(OH)2D3 is by far the most important vitamin D metabolite that modulates parathyroid function. It acts through a nuclear receptor, the VDR, often in concert with other such receptors (i.e. those for retinoic acid or glucocorticoids), on DNA sequences upstream from the PTH gene [103,104]. 1,25(OH)2D3induced upregulation of VDR and CaSR expression in the parathyroid could potentiate its inhibitory action(s) on PTH synthesis and secretion [11,25,100]. Non-calcemic or less calcemic analogues of 1,25(OH)2D3 inhibit PTH secretion while producing relatively little

Regulation of Secretion

PEDIATRIC BONE

116

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

(e.g. by 80%) when Ca2þo rises to frankly hypercalcemic levels [112,113], which is thought to contribute importantly to the mineral ion homeostatic system’s defense against hypercalcemia [116]. Furthermore, elevating Ca2þo also decreases the proportion of secreted, intact PTH because of increased intraglandular degradation to inactive fragments (see the earlier section entitled PTH Biosynthesis and Intraglandular Processing and the later section entitled Metabolism of PTH) [96,117]. Even with severe hypercalcemia, however, some residual release of intact PTH(1e84) still occurs in vivo [28,98,118]. This non-suppressible basal component of PTH release may contribute to the hypercalcemia caused by hyperparathyroidism when the mass of abnormal parathyroid tissue is very great (e.g. in patients with renal failure) [114,119e121]. The parathyroid cell has a temporal hierarchy of responses to low Ca2þo that permits it to secrete progressively larger amounts of hormone during prolonged hypocalcemia [11,25,108]. To meet acute hypocalcemic challenges, PTH is released within seconds from preformed secretory vesicles by exocytosis as dictated by the sigmoidal curve. Sufficient PTH is stored in the parathyroid chief cell to sustain maximal, low Ca2þo-stimulated PTH release for about 60e90 minutes [116]. Another rapid response of the parathyroid cell to hypocalcemia that enhances its net synthetic rate of PTH is reduced intracellular hormonal degradation e the opposite of what occurs at high levels of Ca2þo e which occurs within minutes to an hour [96,117]. Hypocalcemia persisting for hours to days elicits increased PTH gene expression, whereas that lasting for days to weeks or longer stimulates parathyroid cellular proliferation [11,25,108,122]. A greater secretory capacity for PTH on a per-cell basis (e.g. as a result of enhanced PTH gene expression) increases maximal hormonal secretion in vivo, as does an increase in cell number as a result of parathyroid cellular proliferation. In severe secondary hyperparathyroidism, very large increases in parathyroid cellular mass can elevate circulating PTH levels by 100-fold or more. The molecular mechanism underlying Ca2þo-regulated PTH secretion involves a G protein-coupled, cell surface Ca2þo-sensing receptor (CaSR) [123]. The CaSR was first isolated from bovine parathyroid glands [124] and subsequently from human parathyroid and several other tissues and species [125]. The receptor exhibits the characteristic “serpentine” motif (seven membranespanning domains) of the superfamily of G proteincoupled receptors. Its long, N-terminal extracellular domain contains the major, but not all, determinants of Ca2þo binding [126e128]. Changes in Ca2þo modulate a number of second messenger systems via coupling of CaSR through its intracellular domains to the relevant G proteins regulating these signaling pathways [123].

These functions include activation of phospholipases C, A2, and D [129], stimulation of several mitogen-activated protein kinases [130] and inhibition of adenylyl cyclase [131]. Despite numerous studies conducted over the past 25 years, a full understanding of the major second messenger pathways through which changes in Ca2þo, acting via the CaSR, regulate various aspects of the function of parathyroid and other CaSR-expressing cells remains elusive. Recent evidence, however, indicates key roles for the G proteins, Gq and G11, but their downstream transduction pathways participating in the control of parathyroid function are not established [132]. In the parathyroid, the CaSR mediates the inhibitory actions of Ca2þo on PTH secretion and gene expression as well as parathyroid cellular proliferation [133,134]. The CaSR is also expressed in several additional tissues involved in systemic mineral ion homeostasis, including the calcitonin-secreting C-cells of the thyroid [135], diverse cells within the kidney [136], bone cells and/or their precursors [100], and intestinal epithelial cells. In the kidney, the CaSR in the cortical thick ascending limb of the nephron mediates direct, high Ca2þo-induced inhibition of the tubular reabsorption of Ca2þ and Mg2þ [136,137]. Therefore, raising Ca2þo both directly inhibits renal tubular reabsorption of Ca2þ via actions on the CaSR expressed in nephron segments involved in hormonal regulation of Ca2þ reabsorption (e.g. by PTH) and indirectly inhibits it by reducing PTH secretion (see Renal Calcium Reabsorption below). The identification of hypercalcemic (e.g. familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism) [138] and hypocalcemic (i.e. autosomaldominant hypocalcemia) [139] disorders caused by inactivating and activating mutations of the CaSR, respectively, illustrates the receptor’s central, nonredundant role in setting the serum calcium concentration [140,141]. Targeted disruption of the CaSR gene has also enabled the generation of mouse models of familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism via inactivation of one or both alleles of the CaSR [142], further supporting its importance in Ca2þo homeostasis. In addition to directly inhibiting PTH gene expression, 1,25(OH)2D3 also reduces PTH secretion [143,144] (for review [11,25,108]). It is not known whether this latter action is solely secondary to the effect of 1,25(OH)2D3 on biosynthesis of the hormone and/or represents a direct action on the secretory process per se. Increasing the ambient level of phosphate in vitro, independent of concomitant changes in Ca2þo, enhances parathyroid cellular proliferation, PTH gene expression and, ultimately, hormonal secretion [145e147]. Phosphate-induced changes in PTH secretion, however, take several hours and must result secondarily from

PEDIATRIC BONE

PHYSIOLOGICAL ROLE OF PTH

changes in hormonal biosynthesis rather than secretion per se [147]. Finally, Mg2þo clearly functions as a CaSR agonist in vitro when tested in cells containing an endogenous CaSR [148] (e.g. parathyroid cells) or expressing the cloned CaSR [124], although it is twofold to threefold less potent than Ca2þo on a molar basis. Because levels of serum ionized Mg2þo are lower than those of Ca2þo, it is presently unclear whether Mg2þo acts as a physiologically relevant CaSR agonist at the parathyroid gland in vivo under normal circumstances. Patients with inactivating or activating CaSR mutations, however, can exhibit mild hypermagnesemia or hypomagnesemia [140], respectively, thus suggesting that the CaSR does contribute to setting Mg2þo in vivo, as previously suggested [149]. It may do so, at least in part, in the kidney, where Mg2þo in the tubular fluid of the thick ascending limb exceeds that in blood and may be sufficient to activate the CaSR that regulates tubular reabsorption of Ca2þo and Mg2þo in this nephron segment [123,137,150,151]. In addition to the inhibitory effect of elevated Mg2þo on PTH secretion, low concentrations of Mg2þo e as in patients with overt magnesium deficiency e also reduce PTH secretion [152]. The mechanism(s) underlying this effect of hypomagnesemia has recently been suggested to involve increased activity of G proteins to which the CaSR normally couples, probably Gi and Gq/11, thereby leading to increased intracellular signalling and inhibition of PTH secretion [153].

Metabolism of PTH Studies performed over more than three decades by several laboratories have focused on the heterogeneity of circulating forms of PTH, which was first identified by Berson and Yalow in 1968 [154]. From these investigations, it is now apparent that, in addition to the fulllength polypeptide PTH(1e84), which is the biologically active hormone, much of the circulating hormone lacks an intact N-terminus and most of these fragments are, thus, devoid of biologic activity, at least with regard to the PTH/PTHrP receptor-mediated regulation of mineral ion homeostasis [24]. C-terminal PTH fragments are produced in and released from the parathyroid gland, but they are also derived from circulating intact hormone by efficient, high-capacity degradative systems in the liver and kidney and most likely at other peripheral sites (Fig. 6.6). Some PTH fragments, such as PTH(7e84), appear to be generated within the gland and to have some biological activity, perhaps as inhibitors [155e157]. Direct measurement of arterial and venous differences in parathyroid effluent blood (with vigorous conditions to prevent any ex vivo cleavage of hormone after sample collection) were performed in cattle and confirmed that smaller C-terminal fragments and intact

117

FIGURE 6.6 Scheme of peripheral PTH cleavage and the interaction of PTH with the PTH/PTH-related peptide receptor (PTH1R) and with other putative receptors on target cells. Within parathyroid cells, secretory vesicles (circles) and in peripheral organs various patterns of cleavages of PTH(1e84) occur, resulting in multiple circulating fragments, mostly C-terminal ones (solid bars); but not N-terminal ones (suggesting rapid degradation). The carboxyl end of intact PTH and possibly some C fragments interact with a putative C-terminal receptor and, as well, inhibit actions of PTH on the PTH1R. Cyclic adenosine monophosphate, cAMP.

hormone, but not N-terminal fragments, are secreted into the circulation. The relative concentration of these C-terminal fragments released from the gland increases under conditions of systemic hypercalcemia, when overall secretion rates of intact hormone are lower [95,158]. The C-terminal PTH fragments are similar to those generated by peripheral metabolism (see below) but were not chemically characterized. The peripheral metabolism of PTH has been analyzed by injecting intact hormone into the circulation of test animals. Such experiments have not been performed in human subjects, but it is assumed that the similar metabolism of PTH in rats, dogs, and cows is reflective of its metabolism in humans [159]. Clearance of intact PTH from plasma was found to be very rapid (halflife, 2e4 minutes) [160,161]; the major sites of clearance being the liver and kidney. Clearance by the liver predominates over clearance by the kidney; the two organs together account for virtually all clearance of intact hormone. Hepatic clearance of intact hormone has been estimated to be 40e75% and renal clearance, 20e30% [24]. In summary, current evidence indicates that intact PTH and multiple C-terminal fragments (which are derived from glandular and peripheral cleavage and may not be identical) are the principal circulating hormonal forms. In addition, recent data suggest the presence of a previously unrecognized, large,

PEDIATRIC BONE

118

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

N-terminally truncated form of the hormone. Biologically active, N-terminal fragments of PTH, if found in the circulation at all, are likely to circulate only at extremely low concentrations (<10e13e10e14 mol/L). Because of the lack of evidence of circulating forms of biologically active, N-terminal fragments, it was feasible to introduce immunometric assays that use two different antibodies, an immobilized capturing antibody directed against the C-terminal portion of PTH(1e84) and a radiolabeled or enzyme-labeled detection antibody that is directed against an epitope within the N-terminal portion of the intact molecule [162,163]. Although these two-site assays have been clinically useful and provided a great improvement over earlier assays [162], recent studies have demonstrated the presence of circulating PTH fragments that are different in character and composition from any of the hormone fragments discussed previously [98,118,164]. High performance liquid chromatography (HPLC) analysis of PTH in blood samples from uremic patients with end-stage renal disease and from patients with other forms of hyperparathyroidism revealed two distinct immunoreactive peaks in column effluent that were detectable (although with differing sensitivity) by different commercial assays. One peak corresponded to intact PTH(1e84), whereas the other peak migrated close to the position occupied chromatographically by synthetic PTH(7e84) [98,118]. This finding suggested that the epitope of the detection antibody in these assays did not require the presence of the first six or more amino acids of PTH(1e84) [118,119]. The current view is that the molecular entity or entities detected besides PTH(1e84) are N-terminally truncated forms of the intact molecule that are similar, but not necessarily identical, to synthetic PTH(7e84) [118]. In fact, more detailed chromatographic studies performed with one of these “intact” PTH assays showed significant variation in the ratio of the N-terminally truncated PTH to PTH(1e84). Individuals with normal renal function showed a lower ratio than did patients with uremia; furthermore, the percentage of immunoreactivity representing N-terminally truncated forms of PTH (PTH[7e84]) rose in both groups when hypercalcemia was present [98]. The newer immunoradiometric assays that have N-terminal epitopes at the extreme amino-terminus of PTH (1e84) show significantly lower PTH concentrations in patients with chronic renal failure during stimulation and suppression of glandular activity with alterations in calcium, a result consistent with the conclusion that only full length and therefore biologically active PTH(1e84) is detected by these assay systems. The findings outlined previously were expected to have considerable significance for the management of patients with parathyroid dysfunction, especially in

the presence of renal failure. Treatment of patients with end-stage renal disease with large amounts of vitamin D and/or calcium (or calcimimetics) can be associated with adynamic bone disease, which can be deleterious, particularly in growing children [165e167]. Particularly during hypercalcemia, N-terminally truncated forms of PTH become a significant PTH species [168,169]. Measurement of “intact” PTH by earlier assays [162], therefore overestimated the concentrations of biologically active PTH and could result in the overtreatment of uremic patients with vitamin D-analogs and/or calcium. The resulting excessive suppression of the parathyroid gland could reduce PTH-dependent bone turnover. When secretion of PTH is suppressed and the fractional concentration of the large, N-truncated PTH increases, inhibition of the actions of native PTH on calcium or bone could also occur. Recent experiments with synthetic PTH(7e84) support the conclusion that such actions occur in vivo and in vitro. For example, PTH(7e84) was shown to have hypocalcemic properties in vivo [155,157], and it reduces, presumably via receptors specific for C-terminal PTH fragments, bone resorption that may be partly due to impaired osteoclast differentiation [99,155]. It seems useful, therefore, to monitor patients with renal failure with the newer radioimmunometric assays that detect only intact PTH [164].

PTH-DEPENDENT REGULATION OF CALCIUM HOMEOSTASIS PTH is, as outlined earlier, the most important peptide regulator of mineral ion homeostasis in mammals. Through its actions on the kidney and bone, PTH maintains blood calcium concentration within narrow limits. In bone, it stimulates the release of calcium and, in the kidney, it enhances renal tubular reabsorption of calcium (and diminishes tubular reabsorption of phosphate). Furthermore, in the kidney, it increases the synthesis of renal 1a-hydroxylase, which stimulates 1,25(OH)2D3 production and thus increases, albeit indirectly, intestinal absorption of calcium (and phosphate). These direct and indirect endocrine actions of PTH are mediated through the PTH/PTHrP receptor (PTH1R), a G protein-coupled receptor that is abundantly expressed in both major target tissues of PTH action (PTH, along with other secreted hormones such as FGF-23 are critical regulators of phosphate homeostasis as discussed in Chapter 7).

Actions of PTH on Kidney In addition to regulating renal calcium and phosphate (see Chapter 7) transport, PTH modifies the tubular

PEDIATRIC BONE

PTH-DEPENDENT REGULATION OF CALCIUM HOMEOSTASIS

handling of magnesium, sodium, potassium, bicarbonate, and water and, moreover, stimulates renal gluconeogenesis. Specific regions of the nephron that are involved in each of the PTH-dependent actions have been defined through in vivo micropuncture analyses and through in vitro studies with nephron segments that have been dissected from the remainder of the kidney. Furthermore, cell lines from specific regions of the kidney have also been used. However, interpretation of these results has to take into account the complexity of the organization of the kidney as an organ (e.g. the complex anatomic relationship involving different renal tubular segments spanning both the cortex and medulla and the effects of countercurrent distribution that modify solute and water transport), particularly since certain in vivo features of renal tubules are not readily imitated in vitro through the use of isolated tubules or cells. Most of the calcium in the glomerular filtrate is reabsorbed. The bulk of this reabsorption (65%) occurs via passive, paracellular mechanisms, both in the proximal tubules and, to a lesser extent, in the thick ascending limb of Henle’s loop and the distal convoluted tubule [170e174]. The calcium-sensing receptor plays an important, PTH-independent role in the adjustment of renal calcium reabsorption in the cortical thick ascending limb. The physiologically important stimulation of renal calcium reabsorption by PTH occurs almost entirely in the distal nephron. In the cortical thick ascending limb, PTH increases the magnitude of the lumen positive potential that drives the passive, paracellular reabsorption of calcium and magnesium. In the distal convoluted tubule, in contrast, PTH promotes increased transcellular Ca2þ reabsorption by coordinated upregulation of molecular components of this transcellular pathway [175]. PTH enhances uptake of Ca2þ into the tubular cells via the (luminal) plasma membrane channel, TRPV5 [176,177] as well as its active extrusion against a steep electrochemical gradient at the basolateral membrane. This latter process of extrusion involves two types of transporters. One is the plasma membrane calcium pump (Ca2þ, Mg2þ-ATPase, PMCA) and the second is an Naþ/Ca2þ exchanger (NCX1) which, in turn, is indirectly regulated by Naþ/ Kþ-ATPase(s), which maintains the transcellular Naþ gradient. Studies performed with membrane vesicles from the distal region of the kidney show increased activity of the Naþ/Ca2þ exchanger in response to PTH [178]. PTH also stimulates the translocation of preformed Ca2þ channels sequestered within the interior of certain distal tubular cells, presumably TRPV5, to the apical surface [179] (i.e. luminal) surface of the renal tubular epithelial cell to mediate increased cellular Ca2þ uptake (Fig. 6.7). Because PTH simultaneously enhances the activity of Naþ/Ca2þ exchangers in the

119

FIGURE 6.7

PTH regulation of renal calcium transport. Parathyroid hormone (PTH) in distal tubular cells of kidney triggers the translocation of preformed voltage-dependent calcium channels (e.g. TRPV5) from sites of intracellular sequestration to the apical membrane, which also undergoes rapid morphologic change to greatly increase its surface area. PTH can also stimulate TRPV5 openchannel probability. Intracellular free calcium levels rise significantly, and increased net transepithelial calcium transport occurs, mainly via enhanced Naþ/Ca2þ exchange at the basolateral membrane, supported in turn by Naþ/Kþ-ATPase (see text for details).

basolateral (antiluminal) membrane, the overall process promotes an increase in transcellular Ca2þ transport from the lumen to blood e that is, from the apical to the basolateral membrane. PTH is a major inducer of the activity of proximal tubular 1a-hydroxylase, a microsomal cytochrome P-450 enzyme that synthesizes biologically active 1,25(OH)2D3 from the substrate 25(OH)D3 [180e182]. This effect of PTH on synthesis of the renal enzyme shows longer lag times than its effect on renal Ca2þ transport and is mediated, at least in part, by the protein kinase A (PKA) signaling pathway of the PTH/PTHrP receptor (see Chapter 8 for discussion of the critical role of 1,25 (OH)2D3 on intestinal calcium absorption) [183,184].

Actions of PTH on Bone PTH affects a wide variety of the highly specialized bone cells, including osteoblast/stromal cells, osteoclasts and oteocytes, the latter being the most numerous

PEDIATRIC BONE

120

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

cell type in bone. Some of these effects reflect direct actions of PTH; both osteoblasts and osteocytes have PTH receptors. Other effects are indirect and mediated in an autocrine/paracrine manner through factors released by cells (osteoblasts) expressing PTH/PTHrP receptors that regulate the activity of yet other cells (osteoclasts) that lack these receptors [185e187]. PTH action on bone cells can be considered from at least five distinct perspectives. First is its major physiological role: the maintenance of calcium homeostasis. This action can be analyzed most clearly in experimental animals through parathyroidectomy with resultant hypocalcemia. Renal losses of calcium are significant contributors to the severe, sometimes fatal hypocalcemia, but the loss of PTH action on bone cells is the predominant cause. The traditional explanation is that the hypocalcemia is due principally to the loss of PTH stimulation of osteoclastic bone resorption, but other mechanisms may be involved (see below). A second perspective is the action of PTH when administered pharmacologically, resulting in elevation of serum calcium. It is still unclear which specific cellular actions explain the biological actions known to follow PTH administration to animals in vivo. Earlier studies had shown that the administration of PTH leads within minutes to a transient lowering of blood calcium caused by uptake of the mineral by bone cells [188], which is rapidly followed by increased mobilization of calcium from the mineral phase into the bloodstream [188,189]. Although there continue to be uncertainties regarding the cellular/ anatomic basis of these rapid responses to PTH, considerable progress has been made in elucidating the mechanisms through which bone cells respond to PTH and to other autocrine/paracrine factors, such as cytokines. A major pathway for calcium release from bone involves osteoclasts; these cells undergo multiple cellular changes involving the activation of cellular transporters and pumps, as well as the secretion of enzymes such as cathepsin K and collagenases, but other mechanisms of calcium release are proposed [188,189]. A third perspective regarding PTH action on bone cells can be appreciated through results seen when PTH is used as a therapy for osteoporosis. Chronic administration of PTH, if given intermittently, stimulates bone formation, an action that involves a complex set of cellular responses in bone affecting principally stromal cell/osteoblast proliferation, differentiation and cellular actions [190e194]. It is also clear that actions on osteocytes are involved in PTH actions on bone [194,195]; together PTH effects on the two cell types, osteoblasts and osteocytes, stimulate bone matrix formation and bone mineral deposition, as well as bone mineral mobilization.

Fourthly, pathophysiological actions of PTH are seen in hyperparathyroidism with chronic excess levels of PTH. In this situation, both bone formation and bone resorption are stimulated, the latter effect being predominant. Finally, one must consider PTH action on bone (and that of the closely related PTHrP) from the important role it plays, along with multiple other hormones and cytokines, in the complex system biology of embryonic bone formation as well as bone formation and remodeling in the adult. Numerous other hormones and autocrine- and paracrine-acting cytokines work together with PTH and PTHrP in this still incompletely understood complex cellular biology of bone. Osteoblasts express the PTH/PTHrP receptor abundantly and show vigorous responses to the hormone. PTH stimulates the generation of cAMP, inositol triphosphate, and diacylglycerol in cells expressing the cloned PTH/PTHrP receptor [7,9,196]. Many cellular activities of osteoblasts are influenced by PTH; these include ion transport, cell shape, gene transcriptional activity, and secretion of multiple proteases. Continuous PTH administration in vivo results in decreased bone mass, whereas intermittent administration of PTH leads to an increase [24,197,198]. Osteoblast synthetic activity is strongly stimulated in both situations but osteoblast/stromal cell increased production of RANK ligand and suppression of osteoprotogerin secretion [199,200] dominate through stimulation of osteoclastic activity in chronic PTH administration. PTH administration leads to multiple osteoblastic responses including reduced rates of cell apoptosis [190], increased expression and activity of Runx 2 [201,202], increased rates of osteoblastic cell differentiation [191,203] and increased resistance to oxidative stress [204]. The exact cellular mechanisms whereby intermittent PTH administration selectively enhances bone formation remain unclear at present, as are correlations between in vivo and in vitro responses. Further exploration of these mechanisms is clearly of great interest for understanding the hormone’s therapeutic potential as a bone anabolic agent [205]. It is generally agreed that osteoclasts lack PTH receptors and hence actions of PTH are indirect largely through stimulation of cytokines elaborated from osteoblasts/stromal cells. These molecules include osteoclastdifferentiating factor, now usually called RANKL [206,207], a membrane-associated protein with homology to the family of tumor necrosis factors (TNFs) that induces e upon cell-to-cell contact and in the presence of macrophage colony-stimulating factor e the differentiation of osteoclast precursors into mature bone-resorbing osteoclasts [208e210]. These effects of RANKL are likely to be mediated through

PEDIATRIC BONE

PARATHYROID HORMONE-RELATED PEPTIDE

RANK, a member of the TNF receptor family that is expressed on osteoclast precursors [207,208]. However, RANKL also interacts with osteoprotegerin, a soluble decoy receptor with homology to the TNF receptor family [211]. Transgenic expression of osteoprotegerin in mice leads to impaired osteoclastogenesis and thus to osteopetrosis [212,213], whereas ablation of the osteoprotegerin gene through homologous recombination in mice results in osteoporosis associated with arterial calcifications [214]. Ablation of the gene for RANKL results in severe osteopetrosis because of the lack of osteoclasts, a defect in tooth eruption, and a complete lack of lymph nodes, but without obvious abnormalities in mineral ion homeostasis [201]. Similarly, ablation of the RANKL receptor (RANK), leads to osteopetrotic changes similar to those observed in RANKL-ablated mice, but also to hypocalcemia and secondary hyperparathyroidism and to renal phosphate wasting [202]. It appears plausible that challenging the homeostatic control mechanisms of either of these knockout mice, in particular, through dietary calcium and vitamin D deficiency, will further aggravate the degree of hypocalcemia and urinary phosphate excretion. However, despite the absence of such experimental data, the outlined findings further illustrate the importance of osteoclastic bone resorption for maintaining blood calcium concentrations. Some of the factors previously noted to have an important role in the paracrine stimulation of osteoclast formation, such as interleukin-6, interleukin-11, prostaglandin E2, 1,25(OH)2D3, and other peptides including PTH [215e217] were shown to stimulate directly the production of RANKL by osteoblasts [218]. Other cellular responses involved in bone resorption include the development of vitronectin-mediated anchorage of osteoclasts to the bone surface, acidification of the circumscribed and sealed-off extracellular environment that is created between the osteoclast and bone and, in addition, the secretion of a variety of proteases and other enzymes. Osteocytes are the most numerous cell type in bone, and there is a growing appreciation that they play a central biological role with a myriad of functions ranging from transducing mechanical signals into bone growth and increased bone mineral density to hitherto completely unappreciated roles in phosphate homeostasis [199,200,205]. Osteocytes contain abundant PTH receptors, and there is now a clearly defined, biologically significant series of responses to PTH action that have been described [193e195,219]. The clearly defined effect of PTH to reduce sclerostin (SOST) production by osteocytes in turn enhances osteoblastic activity by blocking the suppressive effects of SOST on osteoblast activity and the Wnt signaling pathway [193e195].

121

PARATHYROID HORMONE-RELATED PEPTIDE Analysis of the physiologic actions of PTH and the molecular basis of its biologic activity requires consideration of the functions of PTHrP. This peptide, discovered and characterized several decades after discovery of PTH, undoubtedly shares an evolutionary origin with PTH. PTHrP has (see Fig. 6.4), at least in mammals, both chemical and functional overlaps with PTH, but many of its biologic roles are quite different. When secreted in large concentrations, for example, by certain tumors, PTHrP has PTH-like properties. Typically, however, it functions as an autocrine/paracrine rather than an endocrine factor. PTHrP is a larger, more complex protein than PTH and is synthesized at multiple sites in different organs and tissues. The still evolving story of this protein and its proteolytic fragments is beyond the scope of this chapter (for comprehensive review see elsewhere [4,6,220]. However, selective functions in the regulation of mineral ion homeostasis and bone development are reviewed here. A substance with biologic properties similar to those of PTH was first proposed in the early 1940s, when Albright discussed a patient with malignancy-associated humoral hypercalcemia [221]. The clinical and biochemical characterization of similarly affected patients subsequently established the syndrome of humoral hypercalcemia of malignancy [222] and eventually led to the amino acid sequence analysis and molecular cloning of PTHrP from several different tumors [223e225].

The PTHrP Gene in Comparison to the PTH Gene The human PTHrP gene is located on chromosome 12p12.1-11.2 [225] which has a region analogous to that containing the human PTH gene on chromosome 11p15 [73e75]. Both the PTH and the PTHrP genes have a similar organization, including equivalent positions of the boundaries between some of the coding exons and the adjacent introns (see Fig. 6.5) [11,77, 225,226]. Like the PTH gene, the PTHrP gene contains a single exon that encodes most amino acid residues of the prepropeptide sequence, and both genes have an exon that encodes the remainder of the propeptide sequence, that is, two basic residues (Lys and Arg) that are required for endoproteolytic cleavage of the mature peptide, and either all or most of the amino acids of the secreted peptides. The similarities in their protein sequence and in the structure of their genes, as well as the overlap in some of their functional properties,

PEDIATRIC BONE

122

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

confirmed that both peptides are derived from a common ancestor [4,6,220]. By now, both mammalian genes have diverged considerably; for example, in contrast to the less complex PTH gene, which gives rise to a single gene product, the PTHrP gene uses at least three different promoters and alternative splice patterns that lead to the synthesis of several different mRNA species encoding peptides with different C-terminal ends [6,220,225,226]. A polymorphic dinucleotide repeat sequence that has been used for genetic linkage studies is located downstream of exon 4 (which is exon 6 according to a different nomenclature) of the human PTHrP gene [227] (see Fig. 6.5); thus far, no human disorder has been discovered that is caused by mutations in the PTHrP gene. When compared with each other, chicken PTHrP and the known mammalian species of PTHrP show strong amino acid sequence homology within the first 111 residues; the degree of amino acid sequence conservation of PTHrP is considerably higher than that of the known PTH species (see Fig. 6.2). The amino acid sequence homology between both peptide families is restricted to the N-terminal portion, where six of the first 12 amino acid residues are conserved in all PTH and PTHrP species (see Fig. 6.2); the middle and Cterminal regions of both peptides share no recognizable similarity. PTHrP is likely to undergo extensive post-translational processing, resulting in peptide fragments, some of which may have biologic properties distinct from those of PTHrP(1e34) on calcium and bone metabolism. The N-terminal PTHrP fragment, functionally homologous to PTH, that is derived through cleavage at amino acid residue Arg37 [228,229], PTHrP(1e36), interacts efficiently with the PTH1R [7e9,230] and it has an in vivo efficacy similar to that of PTH(1e34) [231e233]. Longer, glycosylated fragments of N-terminal PTHrP were also described; however, these forms appear to be generated predominantly by skin-derived cells, and their biologic role, if different from that of PTHrP(1e34) or PTHrP(1e36), remains to be established [234]. In addition to the biologically active N-terminal PTHrP fragment, different C-terminal fragments are generated and accumulate in patients with end-stage renal disease [235]. A PTHrP fragment consisting of amino acids 107 to 139 and a shorter peptide, PTHrP(107e111) may be relevant to the control of bone metabolism because both fragments were shown to inhibit osteoclastic bone resorption [236,237] and to stimulate osteoblast activity and proliferation [238]. Although some investigators, using modified experimental conditions, were unable to confirm the in vitro findings with osteoclasts [239], more recent data indicate that PTHrP(107e139) reduces the number of osteoclasts and inhibits bone resorption in vivo [240]. Taken

together, these findings suggest that C-terminal PTHrP fragments may have a role in regulating bone resorption and/or formation. Cleavage at amino acid residue Arg37 also generates PTHrP(38e94) amide, a PTHrP fragment that could be of considerable importance in maintaining fetal calcium homeostasis [228,241]. This peptide is found in the circulation [242] and appears to interact with a distinct receptor that signals through changes in intracellular free calcium and is likely to be an important regulator of transplacental calcium transfer [228,241,243e245]. Studies with PTHrP(38e94) amide and PTHrP(67e86) amide have shown that these fragments increase the blood calcium concentrations of parathyroidectomized fetal lambs and PTHrP-ablated murine fetuses, respectively [228,244,245] (see below). These results confirmed earlier data that had provided the first evidence for an important role of PTHrP in the regulation of fetal calcium homeostasis [246].

Functions of PTHrP The first actions of PTHrP to be defined were the PTH-like actions associated with the humoral hypercalcemia of malignancy [4,6,220]. In this pathologic circumstance, PTHrP acts like a hormone, that is, it is secreted from the tumor into the bloodstream and then acts on bone and kidney to raise calcium levels. Whether PTHrP circulates at high enough levels in normal adults to contribute at all as a hormone to normal calcium homeostasis is an unanswered question; the levels are certainly low, and patients with congenital or acquired hypoparathyroidism are hypocalcemic despite the presence of PTHrP. Although incomplete and somewhat conflicting, growing evidence suggests, however, that PTHrP may act as a hormone in two special circumstances: during fetal life and during lactation as outlined in the next sections. During intrauterine life, fetal blood calcium is higher than maternal blood calcium, at least partly because of active transport of calcium across the placenta. In fetal life, in contrast to adulthood, PTHrP is made in easily detectable amounts in the parathyroid gland. Parathyroidectomy lowers the blood level of calcium in fetal sheep and abolishes active calcium transport across the experimentally perfused placenta. PTHrP from human tumors and synthetic PTHrP(1e84), PTHrP(1e108), PTHrP(1e141), and PTHrP(67e86) amide acutely restored placental transport of calcium in a perfused placenta preparation [247,248]. PTHrP with an intact N terminus, PTHrP extracts, or synthetic peptides such as PTHrP(1e34) or PTHrP(1e36), as well as intact PTH and PTH(1e34), had no effect on placental calcium transport. These results suggest that PTHrP secreted from the fetal parathyroids acts on the

PEDIATRIC BONE

RECEPTORS FOR PTH AND PTHrP

placenta to induce calcium transfer from the mother to the fetus. The role of PTHrP in placental calcium transport is also supported by studies in mice missing both alleles of the PTHrP gene. The blood calcium of fetal PTHrPablated mice is identical to maternal blood calcium, that is, the transport of calcium from the mother into the fetus is diminished [244]. The defect in placental calcium transport can be corrected acutely by injecting PTHrP(1e86) or PTHrP(67e86) into the fetal blood circulation, but not by injecting PTHrP(1e34) or PTH(1e84). These studies in mice and sheep suggest that a receptor distinct from the cloned PTH/PTHrP receptor mediates the action of PTHrP on placental calcium transport. Consistent with this hypothesis, placental calcium transport is actually increased in mice missing the PTH/PTHrP receptor [244]. The possible role of the fetal parathyroid gland as the crucial source of the PTHrP is suggested by the abovementioned experiments in sheep [247,248] but no measurements of PTHrP in fetal sheep blood have been made. The second possible setting for humoral actions of PTHrP is during pregnancy and lactation. During lactation, transfer of calcium from bone into milk results in a measurable decline in bone mineral content [245]. In experimental animals, PTH and 1,25(OH)2D3 have been eliminated as possible agents responsible for directing this transfer [249,250]. Furthermore, the lactating breast secretes PTHrP into the circulation [251] and urinary cAMP rises in response to suckling [252]. Postpartum lactating women have elevated levels of PTHrP in the bloodstream [253e256], and hypoparathyroid patients who are maintained normocalcemic by treatment with 1,25(OH)2D3 can become hypercalcemic during lactation. Thus, PTHrP in the bloodstream may act on bone to release calcium and on the kidney to increase reabsorption of calcium from the urine, thus retaining the calcium for transport into milk. Consistent with this hypothesis, mice missing PTHrP production specifically in breast tissue have decreased bone turnover and preservation of bone mass [257]. PTH, alone cannot effectively serve these roles because the slight elevation in ionized calcium during lactation suppresses PTH levels [253e256,258]. An exaggeration of this lactational elevation of PTHrP may explain the rare occurrence of hypercalcemia and high PTHrP levels in pregnant and lactating women [259,260]. However, PTHrP was shown to have additional roles in the breast and it has a major role in breast development, acting through the PTH1R [261,262]. PTHrP is synthesized by breast tissue and is excreted in enormous amounts into breast milk. Thus, PTHrP in the breast appears to have both paracrine and endocrine roles. These roles may be subverted in breast cancer, a setting in which PTHrP may facilitate the growth of metastases

123

in bone [263] and also cause humoral hypercalcemia. The lactating mammary gland can sense extracellular calcium through the calcium-sensing receptor, thereby adjusting calcium and PTHrP secretion into milk. Further, in fetal life, PTHrP, acting through the PTH/ PTHrP receptor, is required for the normal development of breast tissue [257,262]. PTHrP has an essential role in bone development (see Chapters 1 and 2). This role is best illustrated by the phenotype of mice missing both copies of the PTHrP gene [264e266]. These mice die at birth and have diffuse abnormalities in all bones that form by the replacement of a cartilage mold with true bone (endochondral bone formation). Most of the actions of PTHrP are not thought to be hormonal, but rather to be paracrine or autocrine [267]. PTHrP is synthesized at one time or another during fetal life in virtually every tissue. This widespread expression of PTHrP in fetal life probably explains the extensive expression of PTHrP in a great variety of malignancies. Malignant tissues often revert to a fetal pattern of gene expression; synthesis of PTHrP may be part of this pattern. PTHrP is also synthesized by many adult tissues [4,220,267]. In tissues such as skin and hair, it is likely that PTHrP regulates cell proliferation and differentiation [268]. PTHrP is also synthesized widely in the smooth muscle of blood vessels and in the gastrointestinal tract, uterus, and bladder, and transgenic expression of PTHrP in smooth muscle cells leads to severe defects in cardiac development [269,270]. In these tissues, PTHrP is synthesized in response to stretch and acts on smooth muscle in an autocrine fashion to relax the muscle [271]. PTHrP is also widely expressed in neurons of the central nervous system; its function in the brain is unknown. In mice missing the PTHrP gene, widespread degeneration of neurons occurs postnatally; as explained earlier, these mice survive postnatally through expression of PTHrP only in cartilage cells [272].

RECEPTORS FOR PTH AND PTHrP Because of the diverse actions of PTH, which were shown to be either direct or indirect and to involve multiple signal transduction mechanisms, it was initially thought that several different receptors would mediate the pleiotropic actions of this peptide hormone. Although some of these actions were subsequently shown to be PTHrP- rather than PTH-dependent, it was somewhat surprising that the initial cloning approaches led to the isolation of complementary DNAs (cDNAs) encoding only a single G protein-coupled receptor, the common PTH/PTHrP receptor, also called the PTH1R (Fig. 6.8). The recombinant PTH/PTHrP receptor was shown to

PEDIATRIC BONE

124

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

FIGURE 6.8 Schematic of the PTH/PTHrP receptor. The PTH/PTHrP receptor shows the seven-transmembrane domain architecture of the G protein-coupled receptor protein (GPCR) superfamily. The receptor large, disulfide-bonded, amino extracellular domain structure is a hallmark of the class B subgroup of GPCRs. Key residues involved in receptor structure and/or function that are illustrated in the schematic, include the extracellular cysteines (C) that form the conserved disulfide bond network [60,61]; four glycosylated extracellular asparagine (N) residues [273]; Thr33 and Gln37, which contribute interactions involving residues at or near ligand residue tryptophan-23 [274]; Phe184 and Leu187, which contribute interactions involving ligand residues at or near lysine-13 [275,276]; Ser370, Ile371, Met425, Trp437, and Gln440, which contribute interactions involving ligand residues at or near valine-2 and hence receptor activation processes [277e281]; Arg233, Asn295 and Gln451 which form a putative network of interhelical interactions (dashed connectors) [282 359] and thus contribute to PTHR activation [283] and/or internalization [284] responses; conserved proline (P) residues, including Pro132, the site of an inactivating mutation (Leu) in Blomstrand’s neonatal lethal chondrodysplasia [285]; His223, Thr410 and Ile458, the sites of activating mutations in Jansen’s chondrodysplasia [286]; Lys319 and Lys388, which contibute to interactions involving Gq or Gs and Gq coupling, respectively [287,288]; the seven serine (S) residues in the carboxy-terminal tail that are phosphorylated upon agonist activation and mediate recruitment of b-arrestins [284,289e292]; and the four C-terminal residues Glu590eMet593 that mediate interaction with the sodium-hydrogen exchanger regulating factor (NHERF) family of proteins [293,294].

interact approximately equivalently with PTH and PTHrP ligands, and to activate at least two distinct second messenger pathways, namely, the adenylyl cyclase/cAMP/PKA and phospholipase C (PLC)/IP3, Ca2þ, DAG/PKC pathways, mediated by GaS and Gaq/11 respectively [7e9,295,296]. It is now clear that, depending on cell type, the PTH/PTHrP receptor can activate various other signaling cascades, including the extracellular signal-regulated kinase (ERK) cascade [59,289,297,298] and the phospholipase D/rho A cascade

[299], the former potentially involving in addition to GaS, b-arrestins [59] or transactivation of ERK via extracellularly released epidermal growth factor [298] and the latter through activation of the Ga12/13 subtype of heterotrimeric G proteins [299]. The initial finding that both PTH and PTHrP could activate the recombinant PTH/PTHrP receptor confirmed earlier studies using different clonal cell lines or renal membrane preparations that had shown that PTH and PTHrP bind to and activate a common G

PEDIATRIC BONE

RECEPTORS FOR PTH AND PTHrP

protein-coupled receptor with similar efficiencies and efficacies [230,300e302]. Based on these and subsequent findings, such as the similar phenotypes observed in mice that are null for either PTHrP or the PTH/PTHrP receptor [12,13], it is very likely that most of the endocrine actions of PTH and most of the paracrine/ autocrine actions of PTHrP are mediated through the PTH/PTHrP receptor. The second novel PTH receptor variant isolated, the PTH3 receptor (PTH3R), has so far been found in fish [303] and birds (see NCBI chicken genome website), but not in mammals (Fig. 6.9). Functional and phylogenetic analyses indicate that the PTH3R is more closely related to the PTH1R than to the PTH2R [303]. In addition to the three identified PTH receptor subtypes, there are functional and physicochemical data suggesting that there may be additional receptors that interact with portions of either PTH or PTHrP which are C-terminal of the principal bioactive region defined by the (1e34) segment. As of yet, however, no gene or cDNA encoding such a novel receptor has been identified.

FIGURE 6.9 Phylogenetic relationships of PTH family receptors. Receptor amino acid sequences, with predicted signal peptides and exon E2-encoded segments (mammalian PTH1Rs) removed, were aligned using the ClustalW(2.012) program (gap penalties: opening, 10; extending, 0.2), and an unrooted tree in which branch distances indicate amino acid sequence divergence was generated using the Phylip(3.67) DrawTree program. The diagram illustrates the grouping of the three subtypes of PTH receptors, with the PTH1R present in all vertebrate species, the PTH2R present in humans and fish (Takifugu rubripes and Danio rerio) but apparently absent in frog (Xenopus laevis) and chicken, and the PTH3R present in chicken and fish but not higher vertebrates. A PTHR homolog (z50% identity in the TM region) is present in the genome of the tunicate Ciona intestinalis. Protein data base accession or identification numbers are as follows: human PTH1R, Q03431; pig PTH1R, P50133; rat PTH1R, P25961; opossum PTH1R, P25107; chicken PTH1R, 418507; danio PTH1R, Q9PVD3; fugu PTH1R, Q2UZQ8; chicken PTH3R, XP_425837; danio PTH3R, Q9PVD2; fugu PTH3R, Q2UZR0; ciona PTHR, ci0100139945; human PTH2R, P49190; danio PTH2R, Q9PWB7; fugu PTH2R, Q2UZQ9; xenopus PTH1R(B) from Bergwitz et al. 1998 [304].

125

The PTH/PTHrP Receptor Type-1 e Evolution, Gene Structure and Protein Topology The PTH1R belongs to a distinct subgroup of G protein-coupled receptors called the class B, or secretin-family GPCRs. The first cDNAs encoding the PTH/PTHrP receptor were isolated through expression cloning techniques from two different model cell lines: OK cells, an opossum kidney derived proximal tubulelike cell, and ROS 17/2.8 cells, a rat osteosarcomaderived osteoblast-like cell [7,8]. Subsequently, cDNAs encoding the human [9,305,306], mouse [307], rat [308], chicken [13], porcine [309], dog [310], frog [304] and fish PTH/PTHrP receptors [311] were isolated through hybridization techniques from different tissue sources e i.e. kidney, osteoblast-like cells, brain, embryonic stem cells, and/or whole embryos. Northern blot and in situ studies [312e314] and data provided through available public EST (expressed sequence tag) databases confirmed that the PTH/PTHrP receptor is expressed in a wide variety of fetal and adult tissues. The tetraploid African clawed frog Xenopus laevis, expresses two nonallelic isoforms of the PTH/PTHrP receptor [304], whereas all other investigated species have only one copy of the receptor gene per haploid genome. The gene encoding the human PTH/PTHrP receptor is located on chromosome 3p (within the region 3p21.1e3p24.2). Its intron/exon structure [315e317] is largely preserved in the genes encoding the rat and mouse receptor homologs [318,319]. The gene spans at least 20 kb of genomic DNA, and consists of 14 coding exons and at least three non-coding exons. The size of the coding exons in the human gene ranges from 42 bp (exon M7) to more than 400 bp (exon T), and the introns vary in length from 81 bp (intron between exons M6/7 and M7) to more than 10 000 bp (intron between exons S and E1). Two promoters for the PTH/PTHrP receptor, P1 and P2, have been described in rodents [318e321]. The activity of P1 (also referred to as U3) is mainly restricted to the adult kidney, while that of P2 (also referred to as U1) is detected in several fetal and adult tissues, including cartilage and bone. In humans, a third promoter (P3, also referred to as S) appears to control PTH/PTHrP receptor expression in some tissues, including kidney and bone [317,322,323]. The expressed human PTH/PTHrP receptor protein is 593 amino acids in length, including the 22-amino acid N-terminal signal peptide sequence that is removed from the mature receptor during intracellular processing. The predicted topology is defined by a relatively large terminal extracellular domain, a juxtamembrane or J region concerning seven membranes spanning helices and interconnecting loops and a carboxy-terminal tail of about 110 amino acids (see Fig. 6.8).

PEDIATRIC BONE

126

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

PTH1R, along with the receptors for secretin [324], calcitonin [325] and several other peptide hormones, form a distinct GPCR subfamily, now called the class B or secretin-family receptors [326e328]. These class B receptors share a similar overall structural topology, which is defined by the large N-terminal extracellular domain containing the conserved disulfide bond network, as well as a number of other conserved amino acids dispersed throughout the receptor protein [328]. Protein alignment analyses reveal virtually no amino acid sequence homology between the family B GPCRs and the receptors comprising the four other major GPCR subgroups, including the well-studied b2-adrenergic receptor and rhodopsin representing the family A GPCRs [326]. The structural similarity between these groups of receptors is therefore limited to the common use of a heptahelical domain organization for the membrane-spanning region [326,329]. As an evolutionary protein class, the secretin receptor family appears to have arisen during the divergence of the metazoans, as representatives of the receptor family are found in the genomes of a variety of invertebrate species, including the insect Drosophila melanogaster, and the nematode Caenorhabditsi elegans, but not in yeast or bacteria [328]. A PTH/PTHrP receptor homolog is present in the genome of the tunicate sea squirt Ciona intestinalis (see Fig. 6.9), pointing to a much earlier evolutionary origin of the PTH receptor than previously known, in fact, many millions of years before emergence of mammals [328,330]. Since in seawater calcium levels are believed then as now to be higher than the calcium content of extracellular fluid, it is intriguing to speculate what functions of the PTHR existed then. Since evolution has preserved these structures over many millions of years, the question arises: are there functions of this receptor in mammals beyond that of calcium and phosphate homeostasis? Perhaps these functions will only become apparent when and if effective hormone replacement is deployed in hypoparathyroidism.

Mechanisms of Ligand Binding and Activation at the PTH1R The mechanisms of ligand binding used by the PTH receptor have been extensively analyzed by a combination of approaches, including functional methods based on receptor site-directed mutagenesis and ligand analog design strategies [49,50,275,277,331e334] and biophysical methods based on the use of photoreactive cross-linking ligand analogs. In the cross-linking approach, which identifies intermolecular proximities, the analogs are labeled at various positions with a photoreactive group, typically benzophenone, incorporated either directly into the peptide chain, as parabenzoyl-L-phenylalanine

(BPA) [278,334e336] or attached to the epsilon amino function of lysine13 (BpLys) [276]. The combined functional and cross-linking data suggest that the ligand, as represented by the bioactive PTH(1e34) peptide, binds to the receptor via a two-step mechanism [337e340]. The C-terminal portion of PTH(1e34), representing the principal binding domain [341,342], contacts the N-terminal domain of the receptor to establish initial docking interactions [343], subsequently, the N-terminal portion of the ligand interacts with the J domain portion of the receptor to induce the conformational changes that result in G protein coupling (Fig. 6.10A). This general scheme of interaction is believed to extend to most of the class B family of peptide hormone-binding G proteinecoupled receptors [338,339,345,346]. Specific sites of intermolecular contact between the ligand binding domain and the N domain of the receptor can now be defined by the crystal structure of the isolated PTH1R N domain in complex with either the (15e34) fragment of PTH [61] or that of PTHrP [60]. The ligand binding domain thus binds as an amphiphilic a-helix, with the hydrophobic face of the helix, formed in PTH by Trp23, Leu24 and Leu28, making extensive contacts with complementary hydrophobic surfaces that line a central groove that runs through the receptor’s N domain structure. The guanidinium side-chain of the highly conserved Arg20 of the ligand makes additional, mostly polar contacts with at least five receptor residues that form a pocket at the proximal end of the groove. Binding studies, performed using either the intact receptor or the isolated N domain fragment, confirm that the contacts identified in the co-crystal contribute importantly to overall ligand binding affinity [60,61]. The ligand interactions that occur within the receptor’s J domain, containing the seven transmembrane helices (TMs) and connecting loops, are known with far less certainty, given the current absence of a crystal structure. Photoaffinity cross-linking studies suggest that the interactions involve principally the N-terminal ligand segment extending from position 1 to about position 19 [335,339,340]. This N-terminal portion of the ligand contains the activation pharmacophore, defined minimally as the PTH(1e9) segment [49] (see Fig. 6.3). A principal contact site for conserved valine-2 in the ligand, which plays a critical role in receptor activation [56,347], has been mapped by cross-linking and functional methods to Met425 at the extracellular end of TM6 [279,280], and other nearby receptor sites (e.g. Ser370 and Ile371) have also been implicated as likely contact sites for Val2 [281] (see Fig. 6.8). Cross-linking studies have also identified proximities between residue 19 in the ligand and Lys240 at the extracellular end of TM2 [348], and between residue 13 in the ligand and

PEDIATRIC BONE

RECEPTORS FOR PTH AND PTHrP

127

FIGURE 6.10 Mechansisms of action at the PTH1R. The proposed two site mechanism of binding at the PTH1R (A). The ligand, PTH(1e34), first interacts with the PTH1R N-domain via its C-terminal helical portion and then engages the juxtamembrane (J) region via its N-terminal segment to induce the conformational changes involved in receptor activation and G protein coupling. Kinetic analyses of ligand binding (B) and G protein coupling (C) at the PTH1R by the fluorescence resonance energy transfer (FRET) approach reveals differences in binding and coupling mechanisms for PTH(1e34) and PTHrP(1e36). In (B), the ligands are labeled on lysine13 with tetramethylrhodamine (TMR) and the PTH1R contains green-fluorescent protein (GFP) in the N domain. Upon binding, GFP fluorescence emission is reduced due to FRET-based quenching by the TMR group. The ligand was applied for z20 seconds (black bar), and then washed out. In (C), the PTH1R contains yellow-fluorescent protein (YFP) in the cytoplasmic tail, and the Gg subunit is tagged with cyan-fluorescent protein (CFP). The ratiometric FRET response (YFP emission: CFP emission upon CFP excitation) increases upon R-G coupling. The recordings show that ligand occupancy and R-G coupling are prolonged after wash-out for PTH(1e34), as compared to PTHrP(1e36). Data are adapted from Ferrandon et al. Nature Chemical Biology, 2009 [344].

Arg186 at the boundary of the N domain and TM1 [276] (see Fig. 6.8). These and other data combined suggest that the ligand’s N-terminal domain binds as an a-helix to a contact surface formed along the extracellular surface of the receptor’s juxtamembrane region [339,348,349]. Such a binding mode would allow Val2 and the other key ligand residues that form the agonist pharmacophoric domain, including Ile5 and Met8, to extend into the core of the transmembrane region and make specific intermolecular contacts that induce receptor activation [49,58,349,350]. In support of this binding mode for the juxtamembrane region of the PTH receptor, the modified

N-terminal M-PTH(1e14) fragment analogs described above (see Fig. 6.3), maintain the same high potency for cAMP generation in cells expressing a PTH1R construct in which the N-terminal domain has been deleted, as they do in cells expressing the intact receptor [49e52,56,275]. The M-PTH analogs also exhibit highly stabilized a-helical structure, in part due to the incorporation of conformationally constrained amino acid analogs, such as a-amino-isobutyric (Aib) at positions 1 and 3 [50,53,54,351]. Such a modified PTH(1e14) analog was used in a drug-screening strategy aimed at identifying small molecule ligands for the PTH1R. One compound identified, SW106, inhibits binding of

PEDIATRIC BONE

128

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

M-PTH(1e14) tracer ligand to the PTH1R with an apparent affinity constant (IC50) of 1 mM; this compound and its analogs represent a new class of non-peptide mimetic ligand for the PTH1R that specifically targets the J domain region [352,353]. Although SW106 binds with only micromolar affinity and functions as a competitive antagonist, the findings suggest that it may be possible to develop related compounds that bind to the PTH1R J domain and function as potent agonists. Given the absence of a high-resolution, three-dimensional structure of the intact PTH1R or of the J domain region, it is not possible to describe precisely the conformational changes that occur in receptor upon agonist binding and subsequent activation and G protein coupling. Specific questions that need to be addressed include how are the N and J domains of the receptor oriented relative to each other and how does the orientation change during the binding processes; how is the PTH(1e34) ligand situated in the ligand-receptor complex, i.e. does it adopt a linear or U shaped structure [354e357]; what are the molecular movements that occur in the J domain upon agonist binding, activation, and G protein coupling, and how are the binding and activation processes related temporally? Initial clues to some of these questions come from recent studies using pharmacological and or biophysical approaches, as described below. Kinetic binding assays performed in membranes revealed that various PTH and PTHrP radioligand analogs display altered rates of receptor association and/or dissociation, as well as differential effects on binding of G protein coupling [337,358]. In particular, the studies show that PTH(1e34) can form a complex with the receptor that remains stable upon the addition of GTPgS, a reagent that is expected to dissociate the receptor-G protein heterotrimer complex and thus shift the receptor into a low-affinity state [358]. Moreover, PTH(1e34) can bind efficiently to the receptor in membranes prepared from cells lacking GaS. In contrast, the M-PTH(1e14) analog forms a complex that rapidly dissociates upon GTPgS addition and binds only poorly in the absence of GaS [358]. Thus, PTH(1e34) has the capacity to bind to, or induce, a novel, G proteinuncoupled high affinity receptor conformation, called R0 [359]; whereas M-PTH(1e14) preferentially binds mainly to a G protein-coupled high affinity conformation, called RG. The ligand PTHrP(1e36), like M-PTH(1e14), was found to bind poorly to R0 and thus more selectively to RG [360]. Analysis of the stability of the complexes using the fluorescent resonance energy transfer (FRET) approach with fluorescently-labeled ligands and proteins tagged with green fluorescent protein (GFP) confirmed a more stable binding of PTH(1e34) to the PTH1R, as compared to

PTHrP(1e36) (see Fig. 6.10B), as well as a more stable interaction of the receptor with G protein (see Fig. 6.10C). These data suggest that the binding of a PTH ligand to the R0 conformation can result in a sustained G protein coupling effect. Consistent with this possibility, the cAMP responses induced by PTH(1e34) in PTH1R-expressing cells were sustained for longer times after wash-out than were those induced by M-PTH(1e14) or PTHrP(1e36) [344,358,360].

Ligands Causing Prolonged Signaling at the PTH1R The potential biological relevance of high affinity binding to the R0 PTH1R conformation was demonstrated by studies of analogs based on the M-PTH(1e14) scaffold (see Fig. 6.3) but extended C-terminally so as to restore interaction to the receptor’s N-terminal domain [361]. The resulting analogs, M-PTH(1e28) and M-PTH(1e34), exhibit several fold higher binding affinities for R0 than does PTH(1e34), and they even induce more prolonged cAMP responses in PTH1R-expressing cells [361]. When injected into mice, M-PTH(1e28) and M-PTH(1e34) induced robust hypercalcemic responses that were sustained for several hours longer than that induced by an equivalent dose of PTH(1e34) (Fig. 6.11). Importantly, these prolonged calcemic responses could not be explained simply by a pharmacokinetic effect, as the M-PTH(1e28) and M-PTH(1e34) disappeared more rapidly from the circulation than did PTH(1e34) [361]. The subcellular mechanisms and pathways that underlie the differences in the duration of signaling responses seen for the different PTH and PTHrP analogs remain to be elucidated, but fluorescence confocal microscopy studies suggest altered modes of ligandreceptor trafficking. Thus, in transfected HEK-293 cells, the longer-acting ligands induce the formation of stable complexes that include the ligand, the receptor, G protein, and adenylyl cyclase, and these proteins remain associated as they move intracellularly and during times of continued cAMP generation [344]. These findings raise the intriguing possibility that in addition to, or as an extension of, the receptor-phosphorylation and arrestin-dependent internalization, desensitization and recycling processes that are known to contribute importantly to the regulation of PTH1R action [58,289,290,362e364], certain PTH ligands may induce a novel mechanism by which the ligand•receptor•G protein complex remains assembled and catalytically active within the endosomal domain [344]. Additional studies are needed to test this hypothesis and elucidate further the mechanisms of prolonged signaling at the PTH1R. In any case, the findings suggest potential new paths of discovery for PTH-based therapeutic

PEDIATRIC BONE

129

REFERENCES

discussion), as well as modulate biologic functions in skin [243]. Likewise, actions of the C-terminal PTHrP portion on osteoclasts and osteoblasts [236e238,240] and on the central nervous system [366] appear to be mediated through a specific receptor, and other receptors have been characterized that interact equivalently with the N-terminal portions of PTH and PTHrP but signal only through changes in intracellular free calcium [367e369].

SUMMARY

FIGURE 6.11

Properties of long-acting PTH analogs in vivo. PTH analogs were injected into mice to assess acute effects on blood ionized calcium levels. The modified ligands, M-PTH(1e28) and M-PTH(1e34), which bind to the Ro PTHR conformation with higher affinity than does unmodified PTH(1e34), induce markedly more prolonged increases in blood ionized Ca2þ, as compared to PTH(1e34), when tested at the same dose. These prolonged effects were not explainable by a prolonged half-life of the modified peptides in the circulation, and they were paralleled by prolonged cAMPstimulating activity in MC3T3-E1 osteoblastic cells in culture (not shown). Thus, high-affinity binding to the Ro PTHR conformation can lead to prolonged PTHR signaling actions in vitro and in vivo. Plotted are changes in blood Ca2þ following single i.v. injection of ligands at doses of 20 nmol peptide/kg body weight (data are meansse, n ¼ 2), adapted from Okazaki et al. 2008, Proc Natl Acad Sci. [361].

ligands. For example, a modified PTH analog that induces considerably longer actions at the PTH1R than does PTH(1e34) could prove to be particularly advantageous as a therapy for hypoparathyroidism [365].

Other Receptors for C-terminal PTH or PTHrP There is evidence for the presence of additional receptors and/or binding proteins that interact with portions of PTH or PTHrP C-terminal of the PTH(1e34), but thus far no cDNA encoding such a receptor has been identified. Considerable information has accumulated that indicates that regions of PTH(1e84) other than the N-terminal residues may be responsible for novel biologic actions, although many of these effects are still largely limited to in vitro studies. There is also evidence to suggest that non-PTH1R receptors can mediate actions induced by the midregion of PTHrP, and may thus play an important role in placental calcium transport [228,244] (see earlier

The actions of the amino-terminal portion of PTH and PTHrP (or fragments of this region) are mediated through a single receptor, the PTH/PTHrP receptor, or PTH1R, which belongs to a distinct family of G protein-coupled receptors. The PTH1R mediates the actions of at least the amino-terminal regions of PTH and PTHrP, and signals through multiple second messenger pathways, including the cAMP/PKA and inositol triphosphate/Ca2þ/diacylglycerol/PKC pathways. The PTH1R gene is expressed in a large variety of fetal and adult tissues, but the receptor is most abundant in kidney and bone, where it mediates the endocrine actions of PTH in mineral ion homeostasis, and in the metaphyseal growth plate, where it mediates the autocrine/paracrine actions of locally synthesized PTHrP. Gene deletion studies demonstrate a critical role for the PTH1R and PTHrP in embryonic and postnatal development of cartilage and bone, but the biologic role of this PTHrP-PTH1R paracrine interaction system in the adult remains incompletely understood. The PTH1R is thus used by two ligands for distinct biological functions, endocrine-homeostatic versus paracrine/autocrine-developmental, and it adopts multiple conformational states to support these disparate modes of action. The biological roles of other receptors, such as the PTH-2 receptor, which binds TIP39, or the still hypothesized but uncloned receptors that specifically interact with more C-terminal regions of PTH or PTHrP, also remain undefined. New therapeutic applications of PTH analogs for hypoparathyroidism may emerge from these studies.

References [1] Albright F, Bauer W, Ropes M, Aub JC. Studies of calcium and phosphorus metabolism. IV. The effect of the parathyroid hormone. J Clin Invest 1929;7:139e81. [2] Collip JB. Extraction of a parathyroid hormone which will prevent or control parathyroid tetany and which regulates the level of blood calcium. J Biol Chem 1925;63:395e438. [3] Hansen AM. The hydrochloric X sicca: a parathyroid preparation for intramuscular injection. Milit Surg 1924;54:218e9.

PEDIATRIC BONE

130

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

[4] Broadus AE, Stewart AF. Parathyroid hormone-related protein: structure, processing, and physiological actions. In: Bilezikian JP, Levine MA, Marcus R, editors. The Parathyroids Basic and Clinical Concepts. New York: Raven Press; 1994. p. 259e94. [5] Moseley JM, Martin TJ. Parathyroid hormone-related protein: physiological actions. In: Bilezikian JP, Raisz LG, Rodan RA, editors. Principles of Bone Biology. New York: Academic Press; 1996. p. 363e76. [6] Yang KH, Stewart AF. Parathyroid hormone-related protein: the gene, its mRNA species, and protein products. In: Bilezikian JP, Raisz LG, Rodan RA, editors. Principles of Bone Biology. New York: Academic Press; 1996. p. 347e62. [7] Abou-Samra AB, Ju¨ppner H, Force T, et al. Expression cloning of a common receptor for parathyroid hormone and parathyroid hormone-related peptide from rat osteoblast-like cells: a single receptor stimulates intracellular accumulation of both cAMP and inositol triphosphates and increases intracellular free calcium. Proc Natl Acad Sci USA 1992;89:2732e6. [8] Ju¨ppner H, Abou-Samra AB, Freeman MW, et al. A G proteinlinked receptor for parathyroid hormone and parathyroid hormone-related peptide. Science 1991;254:1024e6. [9] Schipani E, Karga H, Karaplis AC, et al. Identical complementary deoxyribonucleic acids encode a human renal and bone parathyroid hormone (PTH)/PTH-related peptide receptor. Endocrinology 1993;132:2157e65. [10] Potts Jr JT, Ju¨ppner H. Parathyroid hormone and parathyroid hormone-related peptide in calcium homeostasis, bone metabolism, and bone development: the proteins, their genes, and receptors. In: Avioli L, Krane S, editors. Metabolic Bone Disease. New York: Academic Press; 1997. p. 51e94. [11] Silver J, Kronenberg HM. Parathyroid hormone e molecular biology and regulation. In: Bilezikian JP, Raisz LG, Rodan GA, editors. Principles of Bone Biology. New York: Academic Press; 1996. p. 325e46. [12] Lanske B, Karaplis AC, Luz A, et al. PTH/PTHrP receptor in early development and Indian hedgehog-regulated bone growth. Science 1996;273:663e6. [13] Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM, Tabin CJ. Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science 1996;273:613e22. [14] Kronenberg HM, Lanske B, Kovacs CS, et al. Functional analysis of the PTH/PTHrP network of ligands and receptors. Recent Prog Horm Res 1998;53:283e301. [15] Bringhurst FR. Calcium and phosphate distribution, turnover, and metabolic actions. In: DeGroot LJ, editor. Endocrinology. 2nd ed. Philadelphia: W.B. Saunders; 1989. p. 805e43. [16] Neer RM. Calcium and inorganic phosphate homeostasis. In: DeGroot LJ, editor. Endocrinology. 2nd ed. Philadelphia: W.B. Saunders; 1989. p. 927e53. [17] Wendelaar-Bonga SE, Pang PK. Control of calcium regulating hormones in the vertebrates: parathyroid hormone, calcitonin, prolactin, and stanniocalcin. Int Rev Cytol 1991;128:139e213. [18] Pang PTK, Pang RK. Hormones and calcium regulation in vertebrates: an evolutionary and overall consideration. In: Pang PKT, Schreibman MP, editors. Regulation of Calcium and Phosphate. San Diego: Academic Press; 1989. p. 343e52. [19] Drezner MK. Phosphorus homeostasis and related disorders. In: Bilezikian JP, Raisz LG, Rodan GA, editors. Principles in Bone Biology. New York: Academic Press; 1996. p. 263e76. [20] Wagner G, Dimattia G, Davie J, Copp D, Friesen H. Molecular cloning and cDNA sequence analysis of coho salmon stanniocalcin. Mol Cell Endocrinol 1992;90:7e15.

[21] Olsen H, Cepeda M, Zhang Q, Rosen C, Vozzolo B. Human stanniocalcin: a possible hormonal regulator of mineral metabolism. Proc Natl Acad Sci USA 1996;93:1792e6. [22] Ishibashi K, Miyamoto K, Taketani Y, et al. Molecular cloning of a second human stanniocalcin homologue (STC2). Biochem Biophys Res Commun 1998;250:252e8. [23] White KE, Larsson TE, Econs MJ. The roles of specific genes implicated as circulating factors involved in normal and disordered phosphate homeostasis: frizzled related protein-4, matrix extracellular phosphoglycoprotein, and fibroblast growth factor 23. Endocr Rev 2006;27:221e41. [24] Potts Jr JT, Bringhurst FR, Gardella TJ, Nussbaum SR, Segre GV, Kronenberg HM. Parathyroid hormone: physiology, chemistry, biosynthesis, secretion, metabolism, and mode of action. In: DeGroot LJ, editor. Endocrinology. Philadelphia: W.B. Saunders; 1996. p. 920e65. [25] Diaz R, El-Hajj GF, Brown E. Regulation of Parathyroid Function. New York: Oxford University Press; 1998. [26] Nordin BEC, Peacock M. Role of kidney in regulation of plasma calcium. Lancet 1969;2:1280e3. [27] Peacock M, Robertson WG, Nordin BEC. Relation between serum and urinary calcium with particular reference to parathyroid activity. Lancet 1969;1:384e6. [28] Mayer G, Habener J, Potts Jr JT. Parathyroid hormone secretion in vivo. Demonstration of a calcium-independent nonsuppressible component of secretion. J Clin Invest 1976;57: 678e83. [29] Parsons JA, Potts Jr JT, editors. Physiology and Chemistry of Parathyroid Hormone. Philadelphia: Saunders; 1972. [30] Potts Jr JT, Deftos LJ. Parathyroid hormone, calcitonin, vitamin D, bone and bone mineral metabolism. In: Bondy PK, Rosenberg LE, editors. Duncan’s Disease of Metabolism. 3rd ed. Philadelphia: W.B. Saunders; 1974. p. 1225e430. [31] Rasmussen H, Bordier P. The Physiological and Cellular Basis of Metabolic Bone Disease. Baltimore: Williams & Wilkins; 1974. [32] Aurbach GD. Isolation of parathyroid hormone after extraction with phenol. J Biol Chem 1959;234:3179. [33] Rasmussen H, Craig LC. Purification of parathyroid hormone by use of counter-current distribution. J Am Chem Soc 1959;81: 5003. [34] Brewer Jr HB, Ronan R. Bovine parathyroid hormone: amino acid sequence. Proc Natl Acad Sci USA 1970;67:1862. [35] Niall HD, Keutmann HT, Sauer RT, et al. The amino-acid sequence of bovine parathyroid hormone I. Hoppe-Seyler’s Z Physiol Chem 1970;351:1586e8. [36] Sauer RT, Niall HD, Hogan ML, et al. The amino acid sequence of porcine parathyroid hormone. Biochemistry 1974;13:1994. [37] Brewer Jr HB, Fairwell T, Ronan R, et al. Human parathyroid hormone: amino acid sequence of the amino-terminal residues 1e34. Proc Natl Acad Sci USA 1972;69:3585. [38] Niall HD, Sauer RT, Jacobs JW, et al. The amino acid sequence of the amino-terminal 37 residues of human parathyroid hormone. Proc Natl Acad Sci USA 1974;71:384. [39] Keutmann HT, Sauer MM, Hendy GN, et al. The complete amino acid sequence of human parathyroid hormone. Biochemistry 1978;17:552. [40] Heinrich G, Kronenberg HM, Potts Jr JT, Habener J. Gene encoding parathyroid hormone: nucleotide sequence of the rat gene and deduced amino acid sequence of rat preproparathyroid hormone. J Biol Chem 1984;259:3320e9. [41] Khosla S, Demay M, Pines M, Hurwitz S, Potts Jr JT, Kronenberg HM. Nucleotide sequence of cloned cDNAs encoding chicken preproparathyroid hormone. J Bone Miner Res 1988;3:689e98.

PEDIATRIC BONE

131

REFERENCES

[42] Russell J, Sherwood LM. Nucleotide sequence of the DNA complementary to avian (chicken) preproparathyroid hormone mRNA and the deduced sequence of the hormone precursor. Mol Endocrinol 1989;3:325e31. [43] Rosol TJ, Steinmeyer CL, McCauley LK, Grone A, DeWille JW, Capen CC. Sequences of the cDNAs encoding canine parathyroid hormone-related protein and parathyroid hormone. Gene 1995;160:241e3. [44] Potts Jr JT, Tregear GW, Keutmann HT, et al. Synthesis of a biologically active N-terminal tetratriacontapeptide of parathyroid hormone. Proc Natl Acad Sci USA 1971;68:63e7. [45] Tregear GW, Van Rietschoten J, Greene E, et al. Bovine parathyroid hormone: minimum chain length of synthetic peptide required for biological activity. Endocrinology 1973;93:1349e53. [46] Gensure R, Ponugoti B, Gunes Y, et al. Isolation and characterization of two PTH-like molecules in zebrafish. Endocrinology 2004;145:1634e9. [47] Guerreiro PM, Renfro JL, Power DM, Canario AV. The parathyroid hormone family of peptides: structure, tissue distribution, regulation, and potential functional roles in calcium and phosphate balance in fish. Am J Physiol Regul Integr Comp Physiol 2007;292:R679e96. [48] Danks J, Ho P, Notini A, et al. Identification of a parathyroid hormone in the fish Fugu rubripes. J Bone Miner Res 2003;18: 1326e31. [49] Shimizu M, Carter P, Gardella T. Autoactivation of type 1 parathyroid hormone receptors containing a tethered ligand. J Biol Chem 2000;275:19456e60. [50] Shimizu N, Guo J, Gardella T. Parathyroid hormone (1 14) and (1 11) analogs conformationally constrained by {alpha} aminoisobutyric acid mediate full agonist responses via the Juxtamembrane region of the PTH 1 receptor. J Biol Chem 2001;276: 49003e12. [51] Shimizu M, Carter P, Khatri A, Potts JJ, Gardella T. Enhanced activity in parathyroid hormone (1-14) and (1-11): Novel peptides for probing the ligand-receptor interaction. Endocrinology 2001;142:3068e74. [52] Shimizu M, Potts JJ, Gardella T. Minimization of parathyroid hormone: novel amino-terminal parathyroid hormone fragments with enhanced potency in activating the Type-1 parathyroid hormone receptor. J Biol Chem 2000;275:21836e43. [53] Shimizu N, Dean T, Khatri A, Gardella T. Amino-terminal parathyroid hormone fragment analogs containing a,-a-dialkyl amino acids at positions 1 and 3. J Bone Miner Res 2004;19: 2078e86. [54] Tsomaia N, Pellegrini M, Hyde K, Gardella TJ, Mierke DF. Toward parathyroid hormone minimization: conformational studies of cyclic PTH(1-14) analogues. Biochemistry 2004;43: 690e9. [55] Shimizu M, Shimizu N, Okazaki M, et al. Parathyroid hormone (1-14) fragments increase bone mass in OVX rats. Advances in Skeltal Anabolic Agents for the treatment of osteoporosismeeting abstracts 2004. M15. [56] Shimizu N, Dean T, Tsang JC, Khatri A, Potts Jr JT, Gardella TJ. Novel parathyroid hormone (PTH) antagonists that bind to the juxtamembrane portion of the PTH/PTH-related protein receptor. J Biol Chem 2005;280:1797e807. [57] Takasu H, Gardella T, Luck M, Potts Jr J, Bringhurst F. Aminoterminal modifications of human parathyroid hormone (PTH) selectively alter phospholipase C signaling via the type 1 PTH receptor: implications for design of signal-specific PTH ligands. Biochemistry 1999;38:13453e60. [58] Bisello A, Chorev M, Rosenblatt M, Monticelli L, Mierke DF, Ferrari SL. Selective ligand-induced stabilization of active and

[59]

[60]

[61]

[62]

[63]

[64]

[65]

[66]

[67]

[68]

[69]

[70]

[71]

[72]

[73]

[74]

[75]

[76]

desensitized parathyroid hormone type 1 receptor conformations. J Biol Chem 2002;277:38524e30. Gesty-Palmer D, Chen M, Reiter E, et al. Distinct beta-arrestinand G protein-dependent pathways for parathyroid hormone receptor-stimulated ERK1/2 activation. J Biol Chem 2006;281: 10856e64. Pioszak AA, Parker NR, Gardella TJ, Xu HE. Structural basis for parathyroid hormone-related protein binding to the parathyroid hormone receptor and design of conformation-selective peptides. J Biol Chem 2009;284:28382e91. Pioszak AA, Xu HE. Molecular recognition of parathyroid hormone by its G protein-coupled receptor. Proc Natl Acad Sci USA 2008;105:5034e9. Fraser RA, Kronenberg HM, Pang PK, Harvey S. Parathyroid hormone messenger ribonucleic acid in the rat hypothalamus. Endocrinology 1990;127:2517e22. Nutley MT, Parimi SA, Harvey S. Sequence analysis of hypothalamic parathyroid hormone messenger ribonucleic acid. Endocrinology 1995;136:5600e7. Roth SI, Schiller AL, editors. Comparative Anatomy of the Parathyroid Glands. Washington, DC: American Physiological Society; 1981. Canario AV, Rotllant J, Fuentes J, et al. Novel bioactive parathyroid hormone and related peptides in teleost fish. FEBS Lett 2006;580:291e9. McManus JF, Davey RA, Maclean HE, et al. Intermittent Fugu parathyroid hormone 1 (1e34) is an anabolic bone agent in young male rats and osteopenic ovariectomized rats. Bone 2008;42:1164e74. Danks JA, Devlin AJ, Ho PMW, et al. Parathyroid hormonerelated protein is a factor in normal fish pituitary. Gen Comp Endocrinol 1993;92:201e12. Devlin AJ, Danks JA, Faulkner MK, et al. Immunochemical detection of parathyroid hormone-related protein in the saccus vasculosus of a teleost fish. Gen Comp Endocrinol 1996;101: 83e90. Danks JA, McHale JC, Martin JT, Ingleton PM. Parathyroid hormone-related protein in tissues of the emerging frog (Rana temporaria): immunohistochemistry and in situ hybridization. J Anat 1997;190:229e38. Trivett M, Officer R, Clement J, et al. Parathyroid hormonerelated protein (PTHrP) in cartilaginous and bony fish tissues. J Exp Zool 1999;284:541e8. Trivett MK, Walker TI, Macmillan DL, Clement JG, Martin TJ, Danks JA. Parathyroid hormone-related protein (PTHrP) production sites in elasmobranchs. J Anat 2002;201:41e52. Trivett MK, Potter IC, Power G, et al. Parathyroid hormonerelated protein production in the lamprey Geotria australis: developmental and evolutionary perspectives. Dev Genes Evol 2005;215:553e63. Antonorakis SE, Phillips JA, Mallonee RL, et al. b-Globin locus is linked to the parathyroid hormone (PTH) locus and lies between insulin and PTH loci in man. Proc Natl Acad Sci USA 1983;80:6615e9. Naylor SL, Sakaguchi AU, Szoka P, et al. Human parathyroid hormone gene (PTH) is on short arm of chromosome 11. Somat Cell Gene 1983;9:609e16. Mayer H, Breyel E, Bostock C, Schmidtke J. Assignment of the human parathyroid hormone gene to chromosome 11. Hum Genet 1983;64:283e5. Zabel BU, Kronenberg HM, Bell GI, Shows TB. Chromosome mapping of genes on the short arm of human chromosome 11: parathyroid hormone gene is at 11p15 together with the genes for insulin, c-Harvey-ras 1, and b-hemoglobin. Cytogenet Cell Genet 1985;39:200e5.

PEDIATRIC BONE

132

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

[77] Kronenberg HK, Igarashi T, Freeman MW, et al. Structure and expression of the human parathyroid hormone gene. Recent Prog Horm Res 1986;42:641e63. [78] Schmidtke J, Pape B, Krengel U, et al. Restriction fragment length polymorphism at the human parathyroid hormone gene locus. Hum Genet 1984;67:428e31. [79] Gong G, Johnson M, Barger-Lux M, Heaney R. Association of bone dimensions with a parathyroid hormone gene polymorphism in women. Osteoporos Int 1999;9:307e11. [80] Kanzawa M, Sugimoto T, Kobayashi T, Kobayashi A, Chihara K. Parathyroid hormone gene polymorphisms in primary hyperparathyroidism. Clin Endocrinol (Oxf) 1999;50:583e8. [81] Mullersman J, Shields J, Saha B. Characterization of two novel polymorphisms at the human parathyroid hormone gene locus. Hum Genet 1992;88:589e92. [82] Parkinson D, Shaw N, Himsworth R, Thakker R. Parathyroid hormone gene analysis in autosomal hypoparathyroidism using an intragenic tetranucleotide (AAAT)n polymorphism. Hum Genet 1993;91:281e4. [83] Ahn TG, Antonarakis SE, Kronenberg HM, Igarashi T, Levine MA. Familial isolated hypoparathyroidism: a molecular genetic analysis of 8 families with 23 affected persons. Medicine (Baltimore) 1986;65:73e81. [84] Miric A, Levine MA. Analysis of the preproPTH gene by denaturing gradient gel electrophoresis in familial isolated hypoparathyroidism. J Clin Endocrinol Metab 1992;74:509e16. [85] Bilous R, Murty G, Parkinson D, et al. Brief report: autosomal dominant familial hypoparathyroidism, sensorineural deafness, and renal dysplasia. N Engl J Med 1992;327:1069e74. [86] Kronenberg HM, Bringhurst FR, Nussbaum S, et al. Parathyroid hormone: biosynthesis, secretion, chemistry, and action. In: Mundy GR, Martin TJ, editors. Handbook of Experimental Pharmacology: Physiology and Pharmacology of Bone. Heidelberg, Germany: Springer-Verlag; 1993. p. 185e201. [87] Arnold A, Horst SA, Gardella TJ, Baba H, Levine MA, Kronenberg HM. Mutation of the signal peptide-encoding region of the preproparathyroid hormone gene in familial isolated hypoparathyroidism. J Clin Invest 1990;86:1084e7. [88] Karaplis AC, Lim SK, Baba H, Arnold A, Kronenberg HM. Inefficient membrane targeting, translocation, and proteolytic processing by signal peptidase of a mutant preproparathyroid hormone protein. J Biol Chem 1995;270:1629e35. [89] Datta R, Waheed A, Shah GN, Sly WS. Signal sequence mutation in autosomal dominant form of hypoparathyroidism induces apoptosis that is corrected by a chemical chaperone. Proc Natl Acad Sci USA 2007;104:19989e94. [90] Habener JF, Rosenblatt M, Potts Jr JT. Parathyroid hormone: biochemical aspects of biosynthesis, secretion, and metabolism. Physiol Rev 1984;64:985e1053. [91] Hendy GN, Bennett HP, Gibbs BF, Lazure C, Day R, Seidah NG. Proparathyroid hormone is preferentially cleaved to parathyroid hormone by the prohormone convertase furin. A mass spectrometric study. J Biol Chem 1995;270:9517e25. [92] Canaff L, Bennett HP, Hou Y, Seidah NG, Hendy GN. Proparathyroid hormone processing by the proprotein convertase-7: comparison with furin and assessment of modulation of parathyroid convertase messenger ribonucleic acid levels by calcium and 1,25-dihydroxyvitamin D3. Endocrinology 1999;140: 3633e42. [93] MacGregor RR, Hamilton JW, Kent GN. The degradation of proparathormone and parathormone by parathyroid and liver cathepsin B. J Biol Chem 1979;254:4428e33. [94] MacGregor RR, Hamilton JW, Shofstall RE, Cohn DV. Isolation and characterization of porcine parathyroid cathespin B. J Biol Chem 1979;254:4423e7.

[95] Mayer GP, Keaton JA, Hurst JG, Habener JF. Effects of plasma calcium concentration on the relative proportion of hormone and carboxyl fragments in parathyroid venous blood. Endocrinology 1979;104:1778e84. [96] Habener JF, Kemper B, Potts Jr JT. Calcium-dependent intracellular degradation of parathyroid hormone: A possible mechanism for the regulation of hormone stores. Endocrinology 1975;97:431e41. [97] D’Amour P, Palardy J, Bahsali G, Mallette LE, DeLean A, Lepage R. The modulation of circulating parathyroid hormone immunoheterogeneity in man by ionized calcium concentration. J Clin Endocrinol Metab 1992;74:525e32. [98] Brossard JH, Clouthier M, Roy L, Lepage R, Gascon-Barre M, D’Amour P. Accumulation of a non-(1e84) molecular form of parathyroid hormone (PTH) detected by intact PTH assay in renal failure: importance in the interpretation of PTH values. J Clin Endocrinol Metab 1996;81:3923e9. [99] Divieti P, John MR, Juppner H, Bringhurst FR. Human PTH-(7-84) inhibits bone resorption in vitro via actions independent of the type 1 PTH/PTHrP receptor. Endocrinology 2002;143:171e6. [100] Yamaguchi T, Chattopadhyay N, Brown EM. G Protein-coupled extracellular Ca2þ (Ca2þo)-sensing receptor (CaR): roles in cell signaling and control of diverse cellular functions. In: O’Malley B, editor. Hormones and Signalling. San Diego: Academic Press; 1998. [101] Moallem E, Kilav R, Silver J, Naveh-Many T. RNA-protein binding and post-transcriptional regulation of parathyroid hormone gene expression by calcium and phosphate. J Biol Chem 1998;273:5253e9. [102] Brown A, Zhong M, Finch J, et al. Rat calcium-sensing receptor is regulated by vitamin D but not by calcium. Am J Physiol 1996;270:F454e60. [103] Russell J, Sherwood L. The effects of 1,25-dihydroxyvitamin D3 and high calcium on transcription of the pre-proparathyroid hormone gene are direct. Trans Assoc Am Phys 1987;100: 256e62. [104] Okazaki T, Igarashi T, Kronenberg HM. 50 -Flanking region of the parathyroid hormone gene mediates negative regulation by 1,25(OH)2 vitamin D3. J Biol Chem 1989;263:2203e8. [105] Slatopolsky E, Finch J, Ritter C, et al. A new analog of calcitrol, 19-nor-1,25-(OH)2D2, suppress parathyroid hormone secretion in uremic rats in the absence of hypercalcemia. Am J Kidney Dis 1995;26:852e60. [106] Slatopolsky E. The role of calcium, phosphorus and vitamin D metabolism in the development of secondary hyperparathyroidism. Nephrol Dial Transplant 1998;13(Suppl 3):3e8. [107] Llach F, Keshav G, Goldblat M, et al. Suppression of parathyroid hormone secretion in hemodialysis patients by a novel vitamin D analogue: 19-nor-1,25-dihydroxyvitamin D2. Am J Kidney Dis 1998;32(Suppl 2):S48e54. [108] Silver J, Moallem E, Epstein E, Kilav R, Naveh-Many T. New aspects in the control of parathyroid hormone secretion. Curr Opin Nephrol Hypertens 1994;3:379e85. [109] Ben-Dov IZ, Galitzer H, Lavi-Moshayoff V, et al. The parathyroid is a target organ for FGF23 in rats. J Clin Invest 2007;117: 4003e8. [110] Krajisnik T, Bjorklund P, Marsell R, et al. Fibroblast growth factor-23 regulates parathyroid hormone and 1alpha-hydroxylase expression in cultured bovine parathyroid cells. J Endocrinol 2007;195:125e31. [111] Imura A, Tsuji Y, Murata M, et al. alpha-Klotho as a regulator of calcium homeostasis. Science 2007;316:1615e8. [112] Mayer GP, Hurst JG. Sigmoidal relationship between parathyroid hormone secretion rate and plasma calcium concentration in calves. Endocrinology 1978;102:1036e42.

PEDIATRIC BONE

133

REFERENCES

[113] Brent GA, LeBoff MS, Seely EW, Conlin PR, Brown EM. Relationship between the concentration and rate of change of calcium and serum intact parathyroid hormone levels in normal humans. J Clin Endocrinol Metab 1988;67:944e50. [114] Brown EM. Four-parameter model of the sigmoidal relationship between the parathyroid hormone release and extracellular calcium concentration in normal and abnormal parathyroid tissue. J Clin Endcrinol Metab 1983;56:572e81. [115] Parfitt AM. Bone and plasma calcium homeostasis. Bone 1987;8(Suppl. 1):1e8. [116] Brown EM. Extracellular Ca2þ sensing, regulation of parathyroid cell function, and role of Ca2þ and other ions as extracellular (first) messengers. Physiol Rev 1991;71:371e411. [117] Hanley D, Takatsuki K, Sultan J, Schneider A, Sherwood L. Direct release of parathyroid hormone fragments from functioning bovine parathyroid glands in vitro. J Clin Invest 1978;62: 1247e54. [118] Lepage R, Roy L, Brossard JH, et al. A non-(1-84) circulating parathyroid hormone (PTH) fragment interferes significantly with intact PTH commercial assay measurements in uremic samples. Clin Chem 1998;44:805e9. [119] Parfitt AM. Hypercalcemic hyperparathyroidism following renal transplantation: differential diagnosis, management, and implications for cell population control in the parathyroid gland. Min Electrol Metab 1982;8:92e112. [120] Gittes RF, Radde IC. Experimental model for hyperparathyroidism: effect of excessive numbers of transplanted isologous parathyroid glands. J Urol 1966;95:595e603. [121] Lewin E, Olgaard K. Influence of parathyroid mass on the regulation of PTH secretion. Kidney Int 2006;(Suppl):S16e21. [122] Levi R, Silver J. Pathogenesis of parathyroid dysfunction in endstage kidney disease. Pediatr Nephrol 2005;20:342e5. [123] Brown EM. The calcium-sensing receptor: physiology, pathophysiology and CaR-based therapeutics. Subcell Biochem 2007;45:139e67. [124] Brown EM, Gamba G, Riccardi D, et al. Cloning and characterization of an extracellular Ca2þ-sensing receptor from bovine parathyroid. Nature 1993;366:575e80. [125] Brown E, MacLeod R. Extracellular calcium sensing and extracellular calcium signaling. Physiol Rev 2001;81:239e97. [126] Nemeth EF. Calcium receptors as novel drug targets. In: Bilezikian JP, Raisz LG, Rodan GA, editors. Principles of Bone Biology. San Diego: Academic Press; 1996. p. 1019e35. [127] Brauner-Osborne H, Jensen AA, Sheppard PO, O’Hara P, Krogsgaard-Larsen P. The agonist-binding domain of the calcium-sensing receptor is located at the amino-terminal domain [In Process Citation]. J Biol Chem 1999;274:18382e6. [128] Hu J, Reyes-Cruz G, Chen W, Jacobson KA, Spiegel AM. Identification of acidic residues in the extracellular loops of the seven-transmembrane domain of the human Ca2þ receptor critical for response to Ca2þ and a positive allosteric modulator. J Biol Chem 2002;277:46622e31. [129] Kifor O, Diaz R, Butters R, Brown EM. The Ca2þ-sensing receptor (CaR) activates phospholipases C, A2, and D in bovine parathyroid and CaR-transfected, human embryonic kidney (HEK293) cells. J Bone Miner Res 1997;12:715e25. [130] McNeil SE, Hobson SA, Nipper V, Rodland KD. Functional calcium-sensing receptors in rat fibroblasts are required for activation of SRC kinase and mitogen-activated protein kinase in response to extracellular calcium. J Biol Chem 1998;273: 1114e20. [131] Chen CJ, Barnett JV, Congo DA, Brown EM. Divalent cations suppress 3’,5’-adenosine monophosphate accumulation by stimulating a pertussis toxin-sensitive guanine nucleotide-

[132]

[133]

[134]

[135]

[136]

[137]

[138]

[139]

[140] [141]

[142]

[143]

[144]

[145]

[146]

[147]

[148]

[149]

binding protein in cultured bovine parathyroid cells. Endocrinology 1989;124:233e40. Wettschureck N, Lee E, Libutti SK, Offermanns S, Robey PG, Spiegel AM. Parathyroid-specific double knockout of Gq and G11 alpha-subunits leads to a phenotype resembling germline knockout of the extracellular Ca2þ-sensing receptor. Mol Endocrinol 2007;21:274e80. Brown EM. Anti-parathyroid and anti-calcium sensing receptor antibodies in autoimmune hypoparathyroidism. Endocrinol Metab Clin North Am 2009;38:437e445, x. Ritter CS, Pande S, Krits I, Slatopolsky E, Brown AJ. Destabilization of parathyroid hormone mRNA by extracellular Ca2þ and the calcimimetic R-568 in parathyroid cells: role of cytosolic Ca and requirement for gene transcription. J Mol Endocrinol 2008;40:13e21. Garrett JE, Tamir H, Kifor O, et al. Calcitonin-secreting cells of the thyroid express an extracellular calcium receptor gene. Endocrinology 1995;136:5202e11. Riccardi D, Hall AE, Chattopadhyay N, Xu JZ, Brown EM, Hebert SC. Localization of the extracellular Ca2þ/polyvalent cation-sensing protein in rat kidney. Am J Physiol 1998;274: F611e22. Hebert SC, Brown EM, Harris HW. Role of the Ca(2þ)-sensing receptor in divalent mineral ion homeostasis. J Exp Biol 1997;200:295e302. Pollak MR, Brown EM, WuChou YH, et al. Mutations in the human Ca2þ-sensing receptor gene cause familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Cell 1993;75:1297e303. Pollak MR, Brown EM, Estep HL, et al. Autosomal dominant hypocalcaemia caused by a Ca2þ-sensing receptor gene mutation. Nat Genet 1994;8:303e7. Brown EM. Clinical lessons from the calcium-sensing receptor. Nat Clin Pract Endocrinol Metab 2007;3:122e33. Hauache OM. Extracellular calcium-sensing receptor: structural and functional features and association with diseases. Braz J Med Biol Res 2001;34:577e84. Ho C, Conner DA, Pollak M, et al. A mouse model for familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Nat Genet 1995;11:389e94. Cantley LK, Russell J, Lettieri D, Sherwood LM. 1,25-Dihydroxyvitamin D3 suppresses parathyroid hormone secretion from bovine parathyroid cells in tissue culture. Endocrinology 1985;117:2114e9. Chan YL, McKay C, Dye E, Slatopolsky E. The effect of 1,25 dihydroxycholecalciferol on parathyroid hormone secretion by monolayer cultures of bovine parathyroid cells. Calcif Tissue Int 1986;38:27e32. Naveh-Many T, Rahaminov R, Livini N, Silver J. Parathyroid cell proliferation in normal and chronic renal failure in rats. The effects of calcium, phosphate, and vitamin D. J Clin Invest 1995;96:1786e93. Almaden Y, Canalejo A, Hernandez A, et al. Direct effect of phosphorus on PTH secretion from whole rat parathyroid glands in vitro. J Bone Miner Res 1996;11:970e6. Slatopolsky E, Finch J, Denda M, et al. Phosphorus restriction prevents parathyroid gland growth. High phosphorus directly stimulates PTH secretion in vitro. J Clin Invest 1996;97:2534e40. Habener JF, Potts JTJ. Relative effectiveness of magnesium and calcium on the secretion and biosynthesis of parathyroid in vitro. Endocrinology 1976;98:197e202. Strewler GJ. Familial benign hypocalciuric hypercalcemia e from the clinic to the calcium sensor. West J Med 1994;160: 579e80.

PEDIATRIC BONE

134

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

[150] Brown EM. Physiology and pathophysiology of the extracellular calcium-sensing receptor. Am J Med 1999;106:238e53. [151] Brown EM, Vassilev PM, Quinn S, Hebert SC. G-proteincoupled, extracellular Ca(2þ)-sensing receptor: a versatile regulator of diverse cellular functions. Vitam Horm 1999;55: 1e71. [152] Anast CS, Winnacker JL, Forte LF, Burns TW. Impaired release of parathyroid hormone in magnesium deficiency. J Clin Endocrinol Metab 1976;42:707e17. [153] Quitterer U, Hoffmann M, Freichel M, Lohse MJ. Paradoxical block of parathormone secretion is mediated by increased activity of G alpha subunits. J Biol Chem 2001;276:6763e9. [154] Berson SA, Yalow RS. Immunochemical heterogeneity of parathyroid hormone in plasma. J Clin Endocrinol Metab 1968;28: 1037e47. [155] Nguyen-Yamamoto L, Rousseau L, Brossard JH, Lepage R, D’Amour P. Synthetic carboxyl-terminal fragments of parathyroid hormone (PTH) decrease ionized calcium concentration in rats by acting on a receptor different from the PTH/PTHrelated peptide receptor. Endocrinology 2001;142:1386e92. [156] D’Amour P, Brossard JH, Rousseau L, et al. Structure of non(1e84) PTH fragments secreted by parathyroid glands in primary and secondary hyperparathyroidism. Kidney Int 2005;68:998e1007. [157] Slatopolsky E, Finch J, Clay P, et al. A novel mechanism for skeletal resistance in uremia. Kidney Int 2000;58:753e61. [158] Flueck JA, Dibella FB, Edis AJ, Kehrwald J, Arnaud C. Immunoheterogeneity of parathyroid hormone in venous effluent serum from hyperfunctioning parathyroid glands. J Clin Invest 1977;60:1367e75. [159] Brasier A, Wang C, Nussbaum S. Recovery of parathyroid hormone secretion after parathyroid adenomectomy. J Clin Endocrinol Metab 1988;66:495e500. [160] Bringhurst FR, Stern AM, Yotts M. Peripheral metabolism of PTH: fate of the biologically active amino-terminus in vivo. Am J Physiol 1988;255:E886e93. [161] Bringhurst FR, Stern AM, Yotts M. Peripheral metabolism of [35S]PTH in vivo: influence of alterations in calcium availability and parathyroid status. Endocrinology 1989;122:237e45. [162] Nussbaum SR, Zahradnik RJ, Lavigne JR, et al. Highly sensitive two-site immunoradiometric assay of parathyrin, and its clinical utility in evaluating patients with hypercalcemia. Clin Chem 1987;33:1364e7. [163] Blind E, Schmidt-Gayk H, Scharla S, et al. Two-site assay of intact parathyroid hormone in the investigation of primary hyperparathyroidism and other disorders of calcium metabolism compared with a midregion assay. J Clin Endocrinol Metab 1988;67:353e60. [164] John M, Goodman W, Gao P, Cantor T, Salusky I, Ju¨ppner H. A novel immunoradiometric assay detects full-length human PTH but not amino-terminally truncated fragments: implications for PTH measurements in renal failure. J Clin Endocrinol Metab 1999;84:4287e90. [165] Kuizon BD, Goodman WG, Ju¨ppner H, et al. Diminished linear growth during intermittent calcitriol therapy in children undergoing CCPD. Kidney Int 1998;53:205e11. [166] Kuizon BD, Salusky IB. Intermittent calcitriol therapy and growth in children with chronic renal failure. Miner Electrolyte Metab 1998;24:290e5. [167] Sanchez CP, Salusky IB, Kuizon BD, Abdella P, Ju¨ppner H, Goodman WG. Growth of long bones in renal failure: roles of hyperparathyroidism, growth hormone and calcitriol. Kidney Int 1998;54:1879e87. [168] Rakel A, Brossard J, Patenaude J, et al. Overproduction of an amino-terminal form of PTH distinct from human PTH(1e84) in

[169]

[170] [171] [172] [173]

[174]

[175]

[176]

[177]

[178]

[179]

[180]

[181]

[182]

[183]

[184]

[185]

[186]

[187]

a case of severe primary hyperparathyroidism: influence of medical treatment and surgery. Clin Endocrinol (Oxf) 2005;62: 721e7. Rubin MR, Silverberg SJ, D’Amour P, et al. An N-terminal molecular form of parathyroid hormone (PTH) distinct from hPTH(1 84) is overproduced in parathyroid carcinoma. Clin Chem 2007;53:1470e6. Friedman PA, Gesek FA. Calcium transport in renal epithelial cells. Am J Physiol 1993;264:F181e98. Bourdeau J. Mechanisms and regulation of calcium transport in the nephron. Semin Nephrol 1993;13:191e201. Suki WN. Calcium transport in the nephron. Am J Physiol 1979;237:F1e6. Torikai S, Wang M-S, Klein KL, Kurokawa K. Adenylate cyclase and cell cyclic AMP of rat cortical thick ascending limb of Henle. Kidney Int 1981;20:649e54. Morel F, Imbert-Teboul M, Chabardes D. Distribution of hormone-dependent adenylate cyclase in the nephron and its physiological significance. Annu Rev Physiol 1981;43:569e81. van Abel M, Hoenderop JG, van der Kemp AW, Friedlaender MM, van Leeuwen JP, Bindels RJ. Coordinated control of renal Ca(2þ) transport proteins by parathyroid hormone. Kidney Int 2005;68:1708e21. Hoenderop JG, van der Kemp AW, Hartog A, et al. Molecular identification of the apical Ca2þ channel in 1, 25-dihydroxyvitamin D3-responsive epithelia. J Biol Chem 1999;274:8375e8. Mensenkamp AR, Hoenderop JG, Bindels RJ. TRPV5, the gateway to Ca2þ homeostasis. Handb Exp Pharmacol 2007;179: 207e20. Bouhtiauy I, LaJeunesse D, Brunette MG. The mechanism of parathyroid hormone action on calcium reabsorption by the distal tubule. Endocrinology 1991;128:251e8. Bacskai BJ, Friedman PA. Activation of latent Ca2þ channels in renal epithelial cells by parathyroid hormone. Nature 1990;347: 388e91. Takeyama K, Kitanaka S, Sato T, Kobori M, Yanagisawa J, Kato S. 25-Hydroxyvitamin D3 1alpha-hydroxylase and vitamin D synthesis. Science 1997;277:1827e30. St Arnaud R, Messerlian S, Moir JM, Omdahl JL, Glorieux FH. The 25-hydroxyvitamin D 1-alpha-hydroxylase gene maps to the pseudovitamin D-deficiency rickets (PDDR) disease locus. J Bone Miner Res 1997;12:1552e9. Fu GK, Lin D, Zhang MY, et al. Cloning of human 25-hydroxyvitamin D-1 alpha-hydroxylase and mutations causing vitamin D-dependent rickets type 1. Mol Endocrinol 1997;11:1961e7.0. Henry H. Parathyroid hormone modulation of 25-hydroxyvitamin D3 metabolism by cultured chick kidney cells is mimicked and enhanced by forskolin. Endocrinology 1985;116: 503e10. Murayama A, Takeyama K, Kitanaka S, et al. Positive and negative regulations of the renal 25-hydroxyvitamin D3 1alphahydroxylase gene by parathyroid hormone, calcitonin, and 1alpha,25(OH)2D3 in intact animals. Endocrinology 1999;140: 2224e31. Chambers TJ, Athanasou NA, Fuller K. Effect of parathyroid hormone and calcitonin on the cytoplasmic spreading of isolated osteoclasts. J Endocrinol 1984;102:281e6. Wong GL. Paracrine interactions in bone-secreted products of osteoblasts permit osteoclasts to respond to parathyroid hormone. J Biol Chem 1984;259:4019e22. Perry III HM, Skogen W, Chappel J, Kahn AJ, Wilner G, Teitelbaum SL. Partial characterization of a parathyroid hormone-stimulated resorption factor(s) from osteoblast-like cells. Endocrinology 1989;125:2075e82.

PEDIATRIC BONE

REFERENCES

[188] Parsons JA, Robinson CJ. Calcium shift into bone causing transient hypocalcaemia after injection of parathyroid hormone. Nature 1971;230:581e2. [189] Talmage RV, Doppelt SH, Fondren FB. An interpretation of acute changes in plasma 45Ca following parathyroid hormone administration to thyroparathyroidectomized rats. Calcif Tissue Res 1976;22:117e28. [190] Bellido T, Ali AA, Plotkin LI, et al. Proteasomal degradation of Runx2 shortens parathyroid hormone-induced anti-apoptotic signaling in osteoblasts. A putative explanation for why intermittent administration is needed for bone anabolism. J Biol Chem 2003;278:50259e72. [191] Jilka RL. Molecular and cellular mechanisms of the anabolic effect of intermittent PTH. Bone 2007;40:1434e46. [192] Keller H, Kneissel M. SOST is a target gene for PTH in bone. Bone 2005;37:148e58. [193] Leupin O, Kramer I, Collette NM, et al. Control of the SOST bone enhancer by PTH using MEF2 transcription factors. J Bone Miner Res 2007;22:1957e67. [194] O’Brien CA, Plotkin LI, Galli C, et al. Control of bone mass and remodeling by PTH receptor signaling in osteocytes. PLoS ONE 2008;3:e2942. [195] Bellido T, Ali AA, Gubrij I, et al. Chronic elevation of parathyroid hormone in mice reduces expression of sclerostin by osteocytes: a novel mechanism for hormonal control of osteoblastogenesis. Endocrinology 2005;146:4577e83. [196] Iida-Klein A, Guo J, Xie LY, et al. Truncation of the carboxylterminal region of the parathyroid hormone (PTH)/PTH-related peptide receptor enhances PTH stimulation of adenylate cyclase but not phospholipase C. J Biol Chem 1995;270:8458e65. [197] Habener JF, Potts Jr JT. Parathyroid physiology and primary hyperparathyroidism. In: Avioli LV, Krane SM, editors. Metabolic Bone Disease. New York: Academic Press; 1978. p. 1e147. [198] Finkelstein JS. Pharmacological mechanisms of therapeutics: parathyroid hormone. In: Bilezikian JP, Raisz LG, Rodan GA, editors. Principles of Bone Biology. New York: Academic Press; 1996. p. 993e1005. [199] Noble BS. The osteocyte lineage. Arch Biochem Biophys 2008;473:106e11. [200] You L, Temiyasathit S, Lee P, et al. Osteocytes as mechanosensors in the inhibition of bone resorption due to mechanical loading. Bone 2008;42:172e9. [201] Kong Y, Yoshida H, Sarosi I, et al. OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature 1999;397:315e23. [202] Li J, Sarosi I, Yan X, et al. RANK is the intrinsic hematopoietic cell surface receptor that controls osteoclastogenesis and regulation of bone mass and calcium metabolism. Proc Natl Acad Sci USA 2000;15:1566e71. [203] Krishnan V, Moore TL, Ma YL, et al. Parathyroid hormone bone anabolic action requires Cbfa1/Runx2-dependent signaling. Mol Endocrinol 2003;17:423e35. [204] Jilka RL, Almeida M, Ambrogini E, et al. Decreased oxidative stress and greater bone anabolism in the aged, when compared to the young, murine skeleton with parathyroid hormone administration. Aging Cell 2010;9:851e67. [205] Martin TJ, Sims NA, Ng KW. Regulatory pathways revealing new approaches to the development of anabolic drugs for osteoporosis. Osteoporos Int 2008;19:1125e38. [206] Wong BR, Rho J, Aaron J, et al. TRANCE is a a novel ligand of the tumor necrosis factor receptor family that activates c-Jun N-terminal kinase in T cells. J Biol Chem 1997;272:25190e4. [207] Anderson DA, Maraskovsky E, Billingsley WL, et al. A homologue of the TNF receptor and its ligand enhance T-cell growth and dendritic-cell function. Nature 1997;390:175e9.

135

[208] Yasuda H, Shima N, Nakagawa N, et al. Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesisinhibitory factor and is identical to TRANCE/RANKL. Proc Natl Acad Sci USA 1998;95:3597e602. [209] Quinn JM, Elliott J, Gillespie MT, Martin TJ. A combination of osteoclast differentiation factor and macrophage-colony stimulating factor is sufficient for both human and mouse osteoclast formation in vitro. Endocrinology 1998;139:4424e7. [210] Fuller K, Wong B, Fox S, Choi Y, Chambers T. OC activation by TRANCE is necessary and sufficient for osteoblast-mediated activation of bone resorption in osteoclasts. J Exp Med 1998;188: 997e1001. [211] Lacey DL, Timms E, Tan HL, et al. Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell 1998;93:165e76. [212] Simonet SW, Lacey DL, Dunstan CR, et al. Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell 1997;89:309e19. [213] Suda E, Goto M, Mochizuki S, et al. Isolation of a novel cytokine from human fibroblasts that specifically inhibits osteoclastogenesis. Biochem Biophys Res Commun 1997;234:137e42. [214] Bucay N, Sarosi I, Dunstan DR, et al. Osteoprotegerin-deficient mice develop early onset osteoporosis and arterial calcification. Genes Dev 1998;12:1260e8. [215] Lo¨wik CWGM, van der Pluijm G, Bloys H, et al. Parathyroid hormone (PTH) and PTH-like protein (PLP) stimulate interleukin-6 production by osteogenic cells: a possible role of interleukin-6 in osteoclastogenesis. Biochem Biophys Res Commun 1989;162:1546e52. [216] Paliwal I, Insogna K. Partial purification and characterization of the 9,000-dalton bone-resorbing activity from parathyroid hormone-related protein-treated SaOS2 cells (Abstr #245). J Bone Miner Res 1991;6(Suppl 1):S144. [217] Felix R, Fleisch H, Elford PR. Bone-resorbing cytokines enhance release of macrophage colony-stimulating activity by the osteoblastic cell MC3T3-E1. Calcif Tissue Int 1989;44:356e60. [218] Lee S, Lorenzo J. Parathyroid hormone stimulates TRANCE and inhibits osteoprotegerin messenger ribonucleic acid expression in murine bone marrow cultures: correlation with osteoclast-like cell formation. Endocrinology 1999;140:3552e61. [219] Robling AG, Niziolek PJ, Baldridge LA, et al. Mechanical stimulation of bone in vivo reduces osteocyte expression of Sost/sclerostin. J Biol Chem 2008;283:5866e75. [220] Martin JT, Moseley JM, Gillespie MT. Parathyroid hormonerelated protein: biochemistry and molecular biology. Crit Rev Biochem Mol Biol 1991;26:377e95. [221] Albright F. Case records of the Massachusetts General Hospital; case 27461. New Engl J Med 1941;255:789e91. [222] Stewart AF, Horst R, Deftos LJ, Cadman EC, Lang R, Broadus AE. Biochemical evaluation of patients with cancerassociated hypercalcemia. Evidence for humoral and nonhumoral groups. N Engl J Med 1980;303:1377e81. [223] Moseley JM, Kubota M, Diefenbach-Jagger H, et al. Parathyroid hormone-related protein purified from a human lung cancer cell line. Proc Natl Acad Sci USA 1987;84:5048e52. [224] Strewler GJ, Stern PH, Jacobs JW, et al. Parathyroid hormonelike protein from human renal carcinoma cells. Structural and functional homology with parathyroid hormone. J Clin Invest 1987;80:1803e7. [225] Mangin M, Webb AC, Dreyer BE, et al. Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy. Proc Natl Acad Sci USA 1988;85:597e601.

PEDIATRIC BONE

136

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

[226] Mangin M, Ikeda K, Dreyer BE, Broadus AE. Isolation and characterization of the human parathyroid hormone-like peptide gene. Proc Natl Acad Sci USA 1989;86:2408e12. [227] Pausova Z, Morgan K, Fujiwara TM, Bourdon J, Goltzman D, Hendy GN. Molecular characterization of an intragenic minisatellite (VNTR) polymorphism in the human parathyroid hormone-related peptide gene in chromsome 12p12.1-11.2. Genomics 1993;17:243e4. [228] Wu TL, Vasavada RC, Yang K, et al. Structural and physiological characterization of the mid-region secretory species of parathyroid hormone-related protein. J Biol Chem 1996;271: 24371e81. [229] Yang KH, dePapp AE, Soifer NE, et al. Parathyroid hormonerelated protein: evidence for isoform- and tissue-specific posttranslational processing. Biochemistry 1994;33:7460e9. [230] Ju¨ppner H, Abou-Samra AB, Uneno S, Gu WX, Potts Jr JT, Segre GV. The parathyroid hormone-like peptide associated with humoral hypercalcemia of malignancy and parathyroid hormone bind to the same receptor on the plasma membrane of ROS 17/2.8 cells. J Biol Chem 1988;263:8557e60. [231] Kemp BE, Moseley JM, Rodda CP, et al. Parathyroid hormonerelated protein of malignancy: active synthetic fragments. Science 1987;238:1568e70. [232] Horiuchi N, Caulfield MP, Fisher JE, et al. Similarity of synthetic peptide from human tumor to parathyroid hormone in vivo and in vitro. Science 1987;238:1566e8. [233] Everhart-Caye M, Inzucchi SE, Guinness-Henry J, Mitnick MA, Stewart AF. Parathyroid hormone (PTH)-related protein(1e36) is equipotent to PTH(1e34) in humans. J Clin Endocrinol Metab 1996;81:199e208. [234] Wu TL, Soifer NE, Burtis WJ, Milstone LM, Stewart AF. Glycosylation of parathyroid hormone-related peptide secreted by human epidermal keratinocytes. J Clin Endocrinol Metab 1991;73:1002e7. [235] Orloff JJ, Soifer NE, Fodero JP, Dann P, Burtis WJ. Accumulation of carboxy-terminal fragments of parathyroid hormone-related protein in renal failure. Kidney Int 1993;43:1371e6. [236] Fenton AJ, Kemp BE, Hammonds Jr RG, et al. A potent inhibitor of osteoclastic bone resorption within a highly conserved pentapeptide region of parathyroid hormone-related protein; PTHrP(107e111). Endocrinology 1991;129:3424e6. [237] Fenton AJ, Kemp BE, Kent GN, et al. A carboxyl-terminal peptide from the parathyroid hormone-related protein inhibits bone resorption by osteoclasts. Endocrinology 1991;129:1762e8. [238] Cornish J, Callon K, Lin C, Xiao C, Moseley J, Reid I. Stimulation of osteoblast proliferation by C-terminal fragments of parathyroid hormone-related protein. J Bone Miner Res 1999;14: 915e22. [239] Sone T, Kohno H, Kikuchi H, et al. Human parathyroid hormone-related peptide-(107e111) does not inhibit bone resorption in neonatal mouse calvariae. Endocrinology 1992;131: 2742e6. [240] Cornish J, Callon KE, Nicholson GC, Reid IR. Parathyroid hormone-related protein-(107e139) inhibits bone resorption in vivo. Endocrinology 1997;138:1299e304. [241] Soifer NE, Dee K, Insogna KL, et al. Parathyroid hormonerelated protein. Evidence for secretion of a novel mid-region fragment by three different cell types. J Biol Chem 1992;267: 18236e43. [242] Burtis WJ, Dann P, Gaich GA, Soifer NE. A high abundance midregion species of parathyroid hormone-related protein: immunological and chromatographic characterization in plasma. J Clin Endocrinol Metab 1994;78:317e22. [243] Orloff JJ, Ganz MB, Nathanson H, et al. A midregion parathyroid hormone-related peptide mobilizes cytosolic calcium

[244]

[245]

[246]

[247]

[248]

[249]

[250] [251]

[252]

[253]

[254]

[255]

[256]

[257]

[258]

[259]

[260]

[261]

and stimulates formation of inositol trisphosphate in a squamous carcinoma cell line. Endocrinology 1996;137:5376e85. Kovacs CS, Lanske B, Hunzelman JL, Guo J, Karaplis AC, Kronenberg HM. Parathyroid hormone-related peptide (PTHrP) regulates fetal placental calcium transport through a receptor distinct from the PTH/PTHrP receptor. Proc Natl Acad Sci USA 1996;93:15233e8. Kovacs CS, Kronenberg HM. Maternal-fetal calcium and bone metabolism during pregnancy, puerperium, and lactation. Endocr Rev 1997;18:832e72. Rodda CP, Kubota M, Heath JA, et al. Evidence for a novel parathyroid hormone-related protein in fetal lamb parathyroid glands and sheep placenta: comparison with a similar protein implicated in humoral hypercalcemia of malignancy. J Endocrinol 1988;117:261e71. Care A, Caple I, Abbas S, Pickard D. The effect of fetal thyroparathyroidectomy on the transport of calcium across the ovine placenta to the fetus. Placenta 1986;4:271e7. Abbas SK, Pickard DW, Rodda CP, et al. Stimulation of ovine placental calcium transport by purified natural and recombinant parathyroid hormone-related protein (PTHrP) preparations. Q J Exp Physiol 1989;74:549e52. Garner S, Boass A, Toverud S. Parathyroid hormone is not required for normal milk composition or secretion or lactationassociated bone loss in normocalcemic rats. J Bone Miner Res 1990;5:69e75. Halloran B, DeLuca H. Calcium transport in small intestine during pregnancy and lactation. Am J Physiol 1980;239:E64e8. Ratcliffe WA, Thompson GE, Care AD, Peaker M. Production of parathyroid hormone-related protein by the mammary gland of the goat. J Endocrinol 1980;133:87e93. Yamamoto M, Duong LT, Fisher JE, Thiede MA, Caulfield MP, Rosenblatt M. Suckling-mediated increases in urinary phosphate and 30 , 50 -cyclic adenosine monophosphate excretion in lactating rats: possible systemic effect of parathyroid hormonerelated protein. Endocrinology 1991;129:2614e22. Grill V, Hillary J, Ho PMW, et al. Parathyroid hormone-related protein: a possible endocrine function in lactation. Clin Endocrinol 1992;37:405e10. Dobnig H, Kainer F, Stepan V, et al. Elevated parathyroid hormone-related peptide levels after human gestation: relationship to changes in bone and mineral metabolism. J Clin Endocrinol Metab 1995;80:3699e707. Kovacs C, Chik C. Hyperprolactinemia caused by lactation and pituitary adenomas is associated with altered serum calcium, phosphate, parathyroid hormone (PTH), and PTH-related peptide levels. J Clin Endocrinol Metab 1995;80:3036e42. Sowers M, Hollis B, Shapiro B, et al. Elevated parathyroid hormone-related peptide associated with lactation and bone density loss. J Am Med Assoc 1996;276:549e54. VanHouten JN, Dann P, Stewart AF, et al. Mammary-specific deletion of parathyroid hormone-related protein preserves bone mass during lactation. J Clin Invest 2003;112:1429e36. Cross N, Hillman L, Allen S, Krause G, Vieira N. Calcium homeostasis and bone metabolism during pregnancy, lactation, and postweaning: a longitudinal study. Am J Clin Nutr 1995;61: 514e23. Reid I, Wattie D, Evans M, Budayr A. Post-pregnancy osteoporosis associated with hypercalcaemia. Clin Endocrinol (Oxf) 1992;37:298e303. Khosla S, van Heerden JA, Gharib H, et al. Parathyroid hormone-related protein and hypercalcemia secondary to massive mammary hyperplasia. N Engl J Med 1990;322:1157. Hens JR, Dann P, Zhang JP, Harris S, Robinson GW, Wysolmerski J. BMP4 and PTHrP interact to stimulate ductal

PEDIATRIC BONE

137

REFERENCES

[262]

[263]

[264]

[265]

[266]

[267]

[268]

[269]

[270]

[271]

[272]

[273]

[274]

[275]

[276]

[277]

outgrowth during embryonic mammary development and to inhibit hair follicle induction. Development 2007;134:1221e30. Wysolmerski J, Philbrick W, Dunbar M, Lanske B, Kronenberg H, Broadus A. Rescue of the parathyroid hormonerelated protein knockout mouse demonstrates that parathyroid hormone-related protein is essential for mammary gland development. Development 1998;125:1285e94. Guise TA, Yin JJ, Taylor SD, et al. Evidence for a causal role of parathyroid hormone-related protein in the pathogenesis of human breast cancer-mediated osteolysis. J Clin Invest 1996;98: 1544e9. Karaplis AC, Luz A, Glowacki J, et al. Lethal skeletal dysplasia from targeted disruption of the parathyroid hormone-related peptide gene. Genes Devel 1994;8:277e89. Amizuka N, Warshawsky H, Henderson JE, Goltzman D, Karaplis AC. Parathyroid hormone-related peptide-depleted mice show abnormal epiphyseal cartilage development and altered endochondreal bone formation. J Cell Biol 1994;126: 1611e23. Lee K, Lanske B, Karaplis AC, et al. Parathyroid hormonerelated peptide delays terminal differentiation of chondrocytes during endochondral bone development. Endocrinology 1996;137:5109e18. Philbrick WM, Wysolmerski JJ, Galbraith S, et al. Defining the roles of parathyroid hormone-related protein in normal physiology. Physiol Rev 1996;76:127e73. Wysolmerski JJ, Broadus AE, Zhou J, Fuchs E, Milstone LM, Philbrick WM. Overexpression of parathyroid hormone-related protein in the skin of transgenic mice interferes with hair follicle development. Proc Natl Acad Sci USA 1994;91:1133e7. Qian J, Lorenz J, Maeda S, et al. Reduced blood pressure and increased sensitivity of the vasculature to parathyroid hormonerelated protein (PTHrP) in transgenic mice overexpressing the PTH/PTHrP receptor in vascular smooth muscle. Endocrinology 1999;140:1826e33. Maeda S, Sutliff R, Qian J, et al. Targeted overexpression of parathyroid hormone-related protein (PTHrP) to vascular smooth muscle in transgenic mice lowers blood pressure and alters vascular contractility. Endocrinology 1999;140:1815e25. Thiede MA, Daifotis AG, Weir EC, et al. Intrauterine occupancy controls expression of the parathyroid hormone-related peptide gene in preterm rat myometrium. Proc Natl Acad Sci USA 1990;87:6969e73. Philbrick WM, Dreyer BE, Nakchbandi IA, Karaplis AC. Parathyroid hormone-related protein is required for tooth eruption. Proc Natl Acad Sci USA 1998;95:11846e51. Zhou A, Assil I, Abou Samra A. Role of asparagine linked oligosaccharides in the function of the rat PTH/PTHrP receptor. Biochemistry 2000;39:6514e20. Mannstadt M, Luck M, Gardella T, Ju¨ppner H. Evidence for a ligand interaction site at the amino-terminus of the parathyroid hormone (PTH)/PTH-related protein receptor from cross-linking and mutational studies. J Biol Chem 1998;273: 16890e6. Carter P, Shimizu M, Luck M, Gardella T. The hydrophobic residues phenylalanine 184 and leucine 187 in the type-1 parathyroid hormone (PTH) receptor functionally interact with the amino-terminal portion of PTH-(1e34). J Biol Chem 1999;274: 31955e60. Adams A, Bisello A, Chorev M, Rosenblatt M, Suva L. Arginine 186 in the extracellular N-terminal region of the human parathyroid hormone 1 receptor is essential for contact with position 13 of the hormone. Mol Endocrinol 1998;12:1673e83. Lee C, Luck MD, Ju¨ppner H, Potts Jr JT, Kronenberg HM, Gardella TJ. Homolog-scanning mutagenesis of the parathyroid

[278]

[279]

[280]

[281]

[282]

[283]

[284]

[285]

[286]

[287]

[288]

[289]

[290]

[291]

[292]

hormone (PTH) receptor reveals PTH-(1-34) binding determinants in the third extracellular loop. Mol Endocrinol 1995;9: 1269e78. Bisello A, Adams AE, Mierke DF, Pellegrini M, Rosenblatt M, Suva LJ, Chorev M. Parathyroid hormone-receptor interactions identified directly by photocross-linking and molecular modeling studies. J Biol Chem 1998;273:22498e505. Behar V, Bisello A, Bitan B, Rosenblatt M, Chorev M. Photoaffinity cross-linking identifies differences in the interactions of an agonist and an antagonist with the parathyroid hormone/ parathyroid hormone-related protein receptor. J Biol Chem 1999;275:9e17. Gensure R, Carter P, Petroni B, Juppner H, Gardella T. Identification of determinants of inverse agonism in a constitutively active parathyroid hormone/parathyroid hormone related peptide receptor by photoaffinity cross linking and mutational analysis. J Biol Chem 2001;276:42692e9. Gardella TJ, Ju¨ppner H, Wilson AK, et al. Determinants of [Arg2]PTH-(1-34) binding and signaling in the transmembrane region of the parathyroid hormone receptor. Endocrinology 1994;135:1186e94. Chugunov AO, Simms J, Poyner DR, et al. Evidence that interaction between conserved residues in transmembrane helices 2, 3, and 7 are crucial for human VPAC1 receptor activation. Mol Pharmacol 2010;78:394e401. Gardella TJ, Luck MD, Fan M-H, Lee CW. Transmembrane residues of the parathyroid hormone (PTH)/PTH-related peptide receptor that specifically affect binding and signaling by agonist ligands. J Biol Chem 1996;271:12820e5. Vilardaga J, Krasel C, Chauvin S, Bambino T, Lohse M, Nissenson R. Internalization determinants of the parathyroid hormone receptor differentially regulate beta arrestin/receptor association. J Biol Chem 2002;277:8121e9. Zhang P, Jobert AS, Couvineau A, Silve C. A homozygous inactivating mutation in the parathyroid hormone/parathyroid hormone-related peptide receptor causing Blomstrand chondrodysplasia. J Clin Endocrinol Metab 1998;83:3365e8. Schipani E, Langman CB, Hunzelman J, et al. A novel PTH/ PTHrP receptor mutation in Jansen’s metaphyseal chondrodysplasia. J Clin Endocrinol Metab 1999;84:3052e7. Iida-Klein A, Guo J, Takamura M, et al. Mutations in the second cytoplasmic loop of the rat parathyroid hormone (PTH)/PTHrelated protein receptor result in selective loss of PTH-stimulated phospholipase C activity. J Biol Chem 1997;272:6882e9. Huang Z, Chen Y, Pratt S, et al. The N-terminal region of the third intracellular loop of the parathyroid hormone (PTH)/ PTH-related peptide receptor is critical for coupling to cAMP and inositol phosphate/Ca2þþ signal transduction pathways. J Biol Chem 1996;271:33382e9. Rey A, Manen D, Rizzoli R, Caverzasio J, Ferrari SL. Proline-rich motifs in the parathyroid hormone (PTH)/PTH-related protein receptor C terminus mediate scaffolding of c-Src with betaarrestin2 for ERK1/2 activation. J Biol Chem 2006;281:38181e8. Tawfeek HA, Qian F, Abou-Samra AB. Phosphorylation of the receptor for PTH and PTHrP is required for internalization and regulates receptor signaling. Mol Endocrinol 2002;16:1e13. Malecz N, Bambino T, Bencsik M, Nissenson R. Identification of phosphorylation sites in the G protein-coupled receptor for parathyroid hormone. Receptor phosphorylation is not required for agonist-induced internalization. Mol Endocrinol 1998;12: 1846e56. Qian F, Leung A, Abou-Samra A. Agonist-dependent phosphorylation of the parathyroid hormone/parathyroid hormonerelated peptide receptor. Biochemistry 1998;37:6240e6.

PEDIATRIC BONE

138

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

[293] Mahon M, Donowitz M, Yun C, Segre G. Na(þ)/H(þ) exchanger regulatory factor 2 directs parathyroid hormone 1 receptor signalling. Nature 2002;417:858e61. [294] Mahon MJ, Cole JA, Lederer ED, Segre GV. Naþ/Hþ exchanger-regulatory factor 1 mediates inhibition of phosphate transport by parathyroid hormone and second messengers by acting at multiple sites in opossum kidney cells. Mol Endocrinol 2003;17:2355e64. [295] Ju¨ppner H. Molecular cloning and characterization of a parathyroid hormone (PTH)/PTH-related peptide (PTHrP) receptor: a member of an ancient family of G protein-coupled receptors. Curr Opin Nephrol Hypertens 1994;3:371e8. [296] Ju¨ppner H, Schipani E. Receptors for parathyroid hormone and parathyroid hormone-related peptide: from molecular cloning to definition of diseases. Curr Opin Nephrol Hypertens 1996;5: 300e6. [297] Sneddon WB, Yang Y, Ba J, Harinstein LM, Friedman PA. Extracellular signal-regulated kinase activation by parathyroid hormone in distal tubule cells. Am J Physiol Renal Physiol 2007;292:F1028e34. [298] Syme CA, Friedman PA, Bisello A. Parathyroid hormone receptor trafficking contributes to the activation of extracellular signal-regulated kinases but is not required for regulation of cAMP signaling. J Biol Chem 2005;280:11281e8. [299] Singh AT, Gilchrist A, Voyno-Yasenetskaya T, Radeff-Huang JM, Stern PH. G{alpha}12/G{alpha}13 subunits of heterotrimeric G proteins mediate parathyroid hormone activation of phospholipase D in UMR-106 osteoblastic cells. Endocrinology 2005;146: 2171e5. [300] Shigeno C, Yamamoto I, Kitamura N, et al. Interaction of human parathyroid hormone-related peptide with parathyroid hormone receptors in clonal rat osteosarcoma cells. J Biol Chem 1988;34:18369e77. [301] Nissenson RA, Diep D, Strewler GJ. Synthetic peptides comprising the amino-terminal sequence of a parathyroid hormone-like protein from human malignancies: binding to parathyroid hormone receptors and activation of adenylate cyclase in bone cells and kidney. J Biol Chem 1988;263:12866e71. [302] Orloff JJ, Wu TL, Heath HW, Brady TG, Brines ML, Stewart A. Characterization of canine renal receptors for the parathyroid hormone-like protein associated with humoral hypercalcemia of malignancy. J Biol Chem 1989;264:6097e103. [303] Rubin DA, Ju¨ppner H. Zebrafish express the common parathyroid hormone/parathyroid hormone-related peptide (PTH1R) and a novel receptor (PTH3R) that is preferentially activated by mammalian and fugufish parathyroid hormonerelated peptide. J Biol Chem 1999;84:28185e90. [304] Bergwitz C, Klein P, Kohno H, et al. Identification, functional characterization, and developmental expression of two nonallelic parathyroid hormone (PTH)/PTH-related peptide (PTHrP) receptor isoforms in Xenopus laevis (Daudin). Endocrinology 1998;139:723e32. [305] Schneider H, Feyen JHM, Seuwen K, Movva NR. Cloning and functional expression of a human parathyroid hormone (parathormone)/parathormone-related peptide receptor. Eur J Pharmacol 1993;246:149e55. [306] Eggenberger M, Flu¨hmann B, Muff R, et al. Structure of a parathyroid hormone/parathyroid hormone-related peptide receptor of the human cerebellum and functional expression in human neuroblastoma SK-N-MC cells. Brain Res Mol Brain Res 1997;36:127e36. [307] Karperien M, van Dijk TB, Hoeijmakers T, et al. Expression pattern of parathyroid hormone/parathyroid hormone related peptide receptor mRNA in mouse postimplantation embryos

[308]

[309]

[310]

[311]

[312]

[313]

[314]

[315]

[316]

[317]

[318]

[319]

[320]

[321]

indicates involvement in multiple developmental processes. Mech Dev 1994;47:29e42. Pausova Z, Bourdon J, Clayton D, et al. Cloning of a parathyroid hormone/parathyroid hormone-related peptide receptor (PTHR) cDNA from a rat osteosarcoma (UMR106) cell line: chromosomal assignment of the gene in the human, mouse, and rat genomes. Genomics 1994;20:20e6. Smith DP, Zang XY, Frolik CA, et al. Structure and functional expression of a complementary DNA for porcine parathyroid hormone/parathyroid hormone-related peptide receptor. Biochim Biophys Acta 1996;1307:339e47. Smock S, Vogt G, Castleberry T, Lu B, Owen T. Molecular cloning and functional characteirzation of the canine parathyroid hormone receptor 1 (PTH1). J Bone Miner Res 1999;14(Suppl. 1):S288. Rubin DA, Hellman P, Zon LI, Lobb CJ, Bergwitz C, Ju¨ppner HA. G protein-coupled receptor from zebrafish is activated by human parathyroid hormone and not by human or teleost parathyroid hormone-related peptide: Implications for the evolutionary conservation of calcium-regulating peptide hormones. J Biol Chem 1999;274:23035e42. Tian J, Smorgorzewski M, Kedes L, Massry SG. Parathyroid hormone-parathyroid hormone related protein receptor messenger RNA is present in many tissues besides the kidney. Am J Nephrol 1993;13:210e3. Urena P, Kong XF, Abou-Samra AB, et al. Parathyroid hormone (PTH)/PTH-related peptide (PTHrP) receptor mRNA are widely distributed in rat tissues. Endocrinology 1993;133:617e23. van de Stolpe A, Karperien M, Lo¨wik CWGM, et al. Parathyroid hormone-related peptide as an endogenous inducer of parietal endoderm differentiation. J Cell Biol 1993;120:235e43. Schipani E, Weinstein LS, Bergwitz C, et al. Pseudohypoparathyroidism type Ib is not caused by mutations in the coding exons of the human parathyroid hormone (PTH)/PTH-related peptide receptor gene. J Clin Endocrinol Metab 1995;80:1611e21. Bettoun JD, Minagawa M, Kwan MY, et al. Cloning and characterization of the promoter regions of the human parathyroid hormone (PTH)/PTH-related peptide receptor gene: analysis of deoxyribonucleic acid from normal subjects and patients with pseudohypoparathyroidism type Ib. J Clin Endocrinol Metab 1997;82:1031e40. Manen D, Palmer G, Bonjour J, Rizzoli R. Sequence and activity of parathyroid hormone/parathyroid hormone-related protein receptor promoter region in human osteoblast-like cells. Gene 1998;218:49e56. McCuaig KA, Clarke JC, White JH. Molecular cloning of the gene encoding the mouse parathyroid hormone/parathyroid hormone-related peptide receptor. Proc Natl Acad Sci USA 1994;91:5051e5. Kong XF, Schipani E, Lanske B, Joun H, Karperien M, Defize LHK, Ju¨ppner H, Potts JT, Segre GV, Kronenberg HM, Abou-Samra AB. The rat, mouse and human genes encoding the receptor for parathyroid hormone and parathyroid hormonerelated peptide are highly homologous. Biochem Biophys Res Comm 1994;200:1290e9. McCuaig KA, Lee H, Clarke JC, Assar H, Horsford J, White JH. Parathyoid hormone/parathyroid hormone related peptide receptor gene transcripts are expressed from tissue-specific and ubiquitous promotors. Nucleic Acids Res 1995;23:1948e55. Joun H, Lanske B, Karperien M, Qian F, Defize L, AbouSamra A. Tissue-specific transcription start sites and alternative splicing of the parathyroid hormone (PTH)/PTH-related peptide (PTHrP) receptor gene: a new PTH/PTHrP receptor splice variant that lacks the signal peptide. Endocrinology 1997;138:1742e9.

PEDIATRIC BONE

REFERENCES

[322] Bettoun JD, Minagawa M, Hendy GN, et al. Developmental upregulation of the human parathyroid hormone (PTH)/PTHrelated peptide receptor gene expression from conserved and human-specific promoters. J Clin Invest 1998;102:958e67. [323] Giannoukos G, Williams L, Chilco P, Abou-Samra A. Characterization of an element within the rat parathyroid hormone/ parathyroid hormone-related peptide receptor gene promoter that enhances expression in osteoblastic osteosarcoma 17/2.8 cells. Biochem Biophys Res Commun 1999;258:336e40. [324] Ishihara T, Nakamura S, Kaziro Y, Takahashi T, Takahashi K, Nagata S. Molecular cloning and expression of a cDNA encoding the secretin receptor. EMBO J 1991;10:1635e41. [325] Lin HY, Harris TL, Flannery MS, et al. Expression cloning of an adenylate cyclase-coupled calcitonin receptor. Science 1991;254: 1022e4. [326] Fredriksson R, Schioth HB. The repertoire of G-protein-coupled receptors in fully sequenced genomes. Mol Pharmacol 2005;67: 1414e25. [327] Kolakowski LFJ. GCRDb: a G-protein-coupled receptor database. Receptors Channels 1994;2:1e7. [328] Cardoso JC, Pinto VC, Vieira FA, Clark MS, Power DM. Evolution of secretin family GPCR members in the metazoa. BMC Evol Biol 2006;6:108. [329] Fredriksson R, Lagerstrom MC, Schioth HB. Expansion of the superfamily of G-protein-coupled receptors in chordates. Ann NY Acad Sci 2005;1040:89e94. [330] Kamesh N, Aradhyam GK, Manoj N. The repertoire of G protein-coupled receptors in the sea squirt Ciona intestinalis. BMC Evol Biol 2008;8:129. [331] Turner PR, Bambino T, Nissenson RA. A putative selectivity filter in the G-protein-coupled receptors for parathyroid hormone and secretin. J Biol Chem 1996;271:9205e8. [332] Turner PR, Bambino T, Nissenson RA. Mutations of neighboring polar residues on the second transmembrane helix disrupt signaling by the parathyroid hormone receptor. Mol Endocrinol 1996;10:132e9. [333] Bergwitz C, Jusseaume SA, Luck MD, Ju¨ppner H, Gardella TJ. Residues in the membrane-spanning and extracellular regions of the parathyroid hormone (PTH)-2 receptor determine signaling selectivity for PTH and PTH-related peptide. J Biol Chem 1997;272:28861e8. [334] Mannstadt M, Luck M, Gardella TJ, Ju¨ppner H. Evidence for a ligand interaction site at the amino-terminus of the parathyroid hormone (PTH)/PTH-related protein receptor from cross-linking and mutational studies. J Biol Chem 1998;273: 16890e6. [335] Gensure R, Gardella T, Juppner H. Multiple sites of contact between the carboxyl terminal binding domain of PTHrP (1 36) analogs and the amino terminal extracellular domain of the PTH/PTHrP receptor identified by photoaffinity cross linking. J Biol Chem 2001;276:28650e8. [336] Greenberg Z, Bisello A, Mierke D, Rosenblatt M, Chorev M. Mapping the bimolecular interface of the parathyroid hormone (PTH) PTH1 receptor complex: spatial proximity between Lys(27) (of the hormone principal binding domain) and Leu(261) (of the first extracellular loop) of the human PTH1 receptor. Biochemistry 2000;39:8142e52. [337] Hoare S, Gardella T, Usdin T. Evaluating the signal transduction mechanism of the parathyroid hormone 1 receptor: effect of receptor-G-protein interaction on the ligand binding mechanism and receptor conformation. J Biol Chem 2001;276:7741e53. [338] Bergwitz C, Gardella TJ, Flannery MR, et al. Full activation of chimeric receptors by hybrids between parathyroid hormone and calcitonin. J Biol Chem 1996;271:26469e72.

139

[339] Gensure RC, Gardella TJ, Juppner H. Parathyroid hormone and parathyroid hormone-related peptide, and their receptors. Biochem Biophys Res Commun 2005;328:666e78. [340] Wittelsberger A, Corich M, Thomas BE, et al. The mid-region of parathyroid hormone (1e34) serves as a functional docking domain in receptor activation. Biochemistry 2006;45:2027e34. [341] Nussbaum SR, Rosenblatt M, Potts Jr JT. Parathyroid hormone/ renal receptor interactions: demonstration of two receptorbinding domains. J Biol Chem 1980;255:10183e7. [342] Rosenblatt M, Segre GV, Tyler GA, Shepard GL, Nussbaum SR, Potts Jr JT. Identification of a receptor-binding region in parathyroid hormone. Endocrinology 1980;107:545e50. [343] Ju¨ppner H, Schipani E, Bringhurst FR, et al. The extracellular, amino-terminal region of the parathyroid hormone (PTH)/ PTH-related peptide (PTHrP) receptor determines the binding affinity for carboxyl-terminal fragments of PTH(1e34). Endocrinology 1994;134:879e84. [344] Ferrandon S, Feinstein TN, Castro M, et al. Sustained cyclic AMP production by parathyroid hormone receptor endocytosis. Nat Chem Biol 2009;5:734e42. [345] Dong M, Lam PC, Pinon DI, Sexton PM, Abagyan R, Miller LJ. Spatial approximation between secretin residue five and the third extracellular loop of its receptor provides new insight into the molecular basis of natural agonist binding. Mol Pharmacol 2008;74:413e22. [346] Fortin JP, Zhu Y, Choi C, Beinborn M, Nitabach MN, Kopin AS. Membrane-tethered ligands are effective probes for exploring class B1 G protein-coupled receptor function. Proc Natl Acad Sci USA 2009;106:8049e54. [347] Gardella TJ, Axelrod D, Rubin D, et al. Mutational analysis of the receptor-activating region of human parathyroid hormone. J Biol Chem 1991;266:13141e6. [348] Gensure R, Shimizu N, Tsang J, Gardella T. Identification of a contact site for residue 19 of PTH (PTH) and PTH-related protein analogs in transmembrane domain two of the type 1 PTH receptor. Mol Endocrinol 2003;17:2642e58. [349] Monticelli L, Mammi S, Mierke D. Molecular characterization of a ligand tethered parathyroid hormone receptor. Biophys Chem 2002;95:165e72. [350] Vilardaga JP, Bunemann M, Krasel C, Castro M, Lohse MJ. Measurement of the millisecond activation switch of G proteincoupled receptors in living cells. Nat Biotechnol 2003;21:807e12. [351] Piserchio A, Shimizu N, Gardella T, Mierke D. Residue 19 of parathyroid hormone: structural consequences. Biochemistry 2002;41:13217e23. [352] Carter PH, Liu RQ, Foster WR, et al. Discovery of a small molecule antagonist of the parathyroid hormone receptor by using an N-terminal parathyroid hormone peptide probe. Proc Natl Acad Sci USA 2007;104:6846e51. [353] Gardella TJ. Mimetic ligands for the PTHR1: approaches developments, and considerations. IBMS BoneKEy e on line 2009;6:71e85. [354] Pellegrini M, Royo M, Rosenblatt M, Chorev M, Mierke D. Addressing the tertiary structure of human parathyroid hormone-(1e34). J Biol Chem 1998;273:10420e7. [355] Marx U, Adermann K, Bayer P, Forssmann W, Rosch P. Solution structures of human parathyroid hormone fragments hPTH(1 34) and hPTH(1 39) and bovine parathyroid hormone fragment bPTH(1 37). Biochem Biophys Res Commun 2000;267:213e20. [356] Chen Z, Xu P, Barbier J-R, Willick G, Ni F. Solution structure of the osteogenic 1-31 fragment of the human parathyroid hormone. Biochemistry 2000;39:12766e77. [357] Jin L, Briggs S, Chandrasekhar S, et al. Crystal structure of ˚ resolution. J Biol human parathyroid hormone 1 34 at 0.9 A Chem 2000;275:27238e44.

PEDIATRIC BONE

140

6. PARATHYROID HORMONE AND CALCIUM HOMEOSTASIS

[358] Dean T, Linglart A, Mahon MJ, et al. Mechanisms of ligand binding to the PTH/PTHrp receptor: selectivity of a modified PTH(1-15) radioligand for G{alpha}S-coupled receptor conformations. Mol Endocrinol 2006;20:931e42. [359] Hoare SR, Sullivan SK, Pahuja A, Ling N, Crowe PD, Grigoriadis DE. Conformational states of the corticotropin releasing factor 1 (CRF1) receptor: detection, and pharmacological evaluation by peptide ligands. Peptides 2003;24:1881e97. [360] Dean T, Vilardaga JP, Potts Jr JT, Gardella TJ. Altered selectivity of parathyroid hormone (PTH) and PTH-related protein (PTHrP) for distinct conformations of the PTH/PTHrP receptor. Mol Endocrinol 2008;22:156e66. [361] Okazaki M, Ferrandon S, Vilardaga JP, Bouxsein ML, Potts Jr JT, Gardella TJ. Prolonged signaling at the parathyroid hormone receptor by peptide ligands targeted to a specific receptor conformation. Proc Natl Acad Sci USA 2008;105:16525e30. [362] Tawfeek HA, Abou-Samra AB. Important role for the V-type H(þ)-ATPase and the Golgi apparatus in the recycling of PTH/ PTHrP receptor. Am J Physiol Endocrinol Metab 2004;286: E704e10. [363] Ferrari S, Bisello A. Cellular distribution of constitutively active mutant parathyroid hormone (PTH)/PTH related protein receptors and regulation of cyclic adenosine 30 ,50 monophosphate signaling by beta arrestin2. Mol Endocrinol 2001;15: 149e63.

[364] Vilardaga J, Frank M, Krasel C, Dees C, Nissenson R, Lohse M. Differential conformational requirements for activation of G proteins and regulatory proteins, arrestin and GRK in the G protein coupled receptor for parathyroid hormone (PTH)/PTH related protein. J Biol Chem 2001;31:31. [365] Winer KK, Sinaii N, Peterson D, Sainz Jr B, Cutler Jr GB. Effects of once versus twice-daily parathyroid hormone 1e34 therapy in children with hypoparathyroidism. J Clin Endocrinol Metab 2008;93:3389e95. [366] Fukayama S, Tashjian AH, Davis JN. Signaling by N- and C-terminal sequences of parathyroid hormone-related protein in hippocampal neurons. Proc Natl Acad Sci USA 1995;92: 10182e6. [367] Orloff JJ, Ganz MB, Ribaudo AE, et al. Analysis of PTHrP binding and signal transduction mechanisms in benign and malignant squamous cells. Am J Physiol 1992;262:E599e607. [368] Gaich G, Orloff JJ, Atillasoy EJ, Burtis WJ, Ganz MB, Stewart AF. Amino-terminal parathyroid hormone-related protein: specific binding and cytosolic calcium responses in rat insulinoma cells. Endocrinology 1993;132:1402e9. [369] Orloff JJ, Kats Y, Urena P, et al. Further evidence for a novel receptor for amino-terminal parathyroid hormone-related protein on keratinocytes and squamous carcinoma cell lines. Endocrinology 1995;136:3016e23.

PEDIATRIC BONE

C H A P T E R

7

Phosphate Homeostasis Regulatory Mechanisms Clemens Bergwitz 1, Harald Ju¨ppner 1, 2 1

Endocrine Unit and Pediatric Nephrology Unit 2 Massachusetts General Hospital and Harvard Medical School, Boston, MA, USA

INTRODUCTION Phosphate is a rare mineral that is essential for numerous biological functions. In sea and fresh water, phosphate levels are low and even for land-living animals phosphate supply is usually limited. As a result, regulatory mechanisms developed during vertebrate evolution that enhance absorption in the intestinal tract (NPT2b), minimize the loss of phosphate into the urine (NPT2a/c), and allow storage of phosphate (bone) [1e5]. These phosphate transporters in kidney and gut help maximize phosphate retention and absorption, respectively, and help maintain the extracellular concentration of inorganic phosphate (Pi) at an elevated level during growth and development when the prevailing plasma Pi concentration is considerably higher than in the adult organism. During that time, skeletal growth is particularly rapid and there is an increased need for mineralizing newly synthesized osteoid. The mechanisms responsible for maintaining higher plasma Pi levels during growth and development are not completely understood, but are likely to involve, directly or indirectly, factors that allow higher expression of Npt2c during development [6]. Two hormones, parathyroid hormone (PTH) and fibroblast growth factor 23 (FGF-23), were adopted during evolution for the regulation of phosphate homeostasis [7e12]. PTH augments plasma phosphate levels by enhancing the release of phosphate from bone (indirectly through osteoblast-mediated stimulation of osteoclast formation and activity) and by enhancing the intestinal absorption of phosphate (indirectly through an increase of renal 1,25(OH)2D production); furthermore, it can reduce plasma phosphate levels by preventing its reabsorption in the proximal tubule thus promoting urinary phosphate excretion. FGF-23 reduces intestinal phosphate absorption by reducing the renal synthesis of 1,25(OH)2D and by

Pediatric Bone, Second Edition DOI: 10.1016/B978-0-12-382040-2.10007-3

increasing its metabolism through activation of the 24hydroxlase [13]. Like PTH, FGF-23 furthermore promotes urinary phosphate excretion and it may promote the deposition of phosphate in the skeleton. Disturbances in either of these two hormonal systems can lead to severe abnormalities in phosphate homeostasis. Hypophosphatemia is particularly problematic during growth and development, for example, in children with diminished urinary phosphate reabsorption because of secondary hyperparathyroidism due to vitamin D deficiency or because of inherited mutations in genes affecting the regulation of phosphate homeostasis, which depletes the skeletal phosphate reservoir and leads to abnormal bone mineralization and strength, impaired growth, and skeletal deformities [8,10,14e16]. Hyperphosphatemia can be the result of inappropriately reduced urinary phosphate excretion due to the lack of PTH or FGF-23, or due to resistance towards these two hormones. This can result in vascular calcifications, mineral ion deposits in skin, kidneys and other organs that impair their function and appears to decrease life expectancy [17e20]. Too little or too much phosphate is therefore associated with significant morbidity, and maintaining serum Pi concentration within normal limits is therefore of critical importance for health and longevity. This chapter will review the physiology of Pi homeostasis and the regulatory mechanisms that are involved.

PHYSIOLOGICAL ASPECTS Distribution of Phosphate in the Body The adult human body contains 15e20 moles of Pi, 80e90% of which is present in bone as hydroxyapatite [21]. The remaining 10e20% is found in soft tissues

141

Copyright Ó 2012 Elsevier Inc. All rights reserved.

142

7. PHOSPHATE HOMEOSTASIS REGULATORY MECHANISMS

(primarily muscle and internal organs), extracellular fluid, and erythrocytes. In soft tissues, Pi comprises 0.1e0.3% of wet weight and is contained intracellularly as phosphorylated sugars, phospholipids, phosphoproteins, nucleic acids, and unbound inorganic Pi. In blood, Pi is present in both erythrocytes and plasma. In plasma, phospholipids comprise the main fraction (2.2e3.1 mmol/L), followed by phosphate esters (0.9e1.5 mmol/L) and unbound Pi (0.7e1.4 mmol/L). Although the concentration of Pi in plasma is not as strictly maintained at a steady-state level as the concentration of calcium, a number of homeostatic mechanisms exist that maintain Pi levels within certain limits. This normal range varies among animal species [22], with the highest levels in fish [2,3] and the lowest levels in adult humans. In the fasting human, the plasma Pi concentration varies with age: 0.71e1.36 mmol/L in adults, 1.28e2.0 mmol/L in children, and 1.39e2.67 mmol/L in newborns. The amount of Pi in plasma and extracellular fluid, approximately 15 mmol in the adult human, represents less than 0.1% of the total phosphate in the body. Plasma Pi concentrations are a reflection of the various fluxes entering and leaving the extracellular pool. Pi enters this pool from the intestine, soft tissues, and bone. It leaves the extracellular fluid through the urine, as a result of the difference between glomerular filtration and net tubular reabsorption, by back flux into the intestinal lumen, and by transfer into soft tissue and bone.

Intestinal Absorption of Phosphate The Pi content of different foods is variable. The concentration, expressed per 100 grams, is highest in fish, liver and other organs, eggs, meat, milk, and unprocessed cheese (30e200 mmol). Furthermore, Pi is present in bread (30e60 mmol), vegetables (10e30 mmol), and fruit (3e10 mmol). The abundance of Pi in our food explains the rarity of Pi deficiency. The average Pi intake in humans is approximately 30e50 mmol/day. The minimum requirement is approximately 25 mmol/day for males and slightly higher for children and pregnant women. Pi is absorbed in the small intestine, where the Pi absorptive capacity is highest in the duodenum and lowest in the ileum. Seventy percent of Pi absorption occurs by a non-saturable, paracellular pathway, which explains why increasing dietary Pi intake results in a proportional increment in net Pi absorption, with no indication of saturation in intact animals. Thirty percent of Pi absorption occurs via an active transfer of Pi across the mucosal membrane [23e26] and involves vitamin D-regulated, sodium-dependent high-affinity transporters, named NPT2b [27e29] and Pit2 [30]. Along with vitamin D, dietary Pi regulates the expression of these intestinal sodiumephosphate co-transporters

[31], which will be described later. Furthermore, there appears to be a phosphate-sensing mechanism at the luminal surface of the intestine that contributes, presumably indirectly, to the regulation of renal phosphate excretion, independent of the proximal tubular actions of PTH and FGF-23 [32].

Extrarenal Soft Tissue Handling of Phosphate In contrast to the growing knowledge of Pi transport in intestine, bone, and kidney, the molecular mechanisms mediating Pi fluxes into soft tissues remain poorly understood. For example, insulin elicits a rapid increase in Pi uptake by primary rat hepatocyte cultures [33] and in skeletal muscle [34] by increasing the Vmax of an Nadependent Pi transport system without influencing the Km. These findings suggest that insulin mediates the insertion of a preformed Pi carrier(s) into the plasma membrane. The stimulation of Pi uptake by insulin likely occurs in response to the insulin-dependent increase in glucose metabolism, a process that utilizes ATP and increases the demand for Pi from oxidative phosphorylation; this process likely contributes to the hypophosphatemia observed in malnourished individuals who are given glucose infusions (“refeeding hypophosphatemia”) [35]. The type III sodiumephosphate transporter Pit-1 furthermore appears to be important for normal liver development and is upregulated after partial liver resection in mice [36], thereby providing a plausible mechanism for the FGF-23-independent hypophosphatemia which can be observed in humans after liver resection [37,38]. However, details of the regulatory mechanisms governing the rate of Pi transfer from the extracellular and intracellular compartments and their role in the maintenance of serum Pi concentration remain unclear.

Phosphate Transport and Bone A major function of bone is to provide mechanical support for the entire body. This is achieved by mineralization of an extracellular matrix, which is formed by osteogenic cells and comprises Pi as an integral component of hydroxyapatite crystals. Thus, in addition to its structural role, bone serves as a reservoir for Pi (and calcium). Pi also affects the function of chondrocytes, osteoblasts, osteocytes, and osteoclasts, thereby modifying the rate of bone growth, matrix production and bone resorption [39,40]. As mentioned above, the plasma Pi concentration is higher in growing individuals than in adults, most likely to accommodate the increased requirement for Pi during growth and skeletal development. Although the mechanisms responsible for the regulation of Pi homeostasis during growth are not completely understood, growth factors that also affect

PEDIATRIC BONE

PHYSIOLOGICAL ASPECTS

bone elongation, either directly or indirectly, are likely to play a critical role. The importance of Pi in bone development is illustrated by abnormalities associated with hypophosphatemic disorders such as X-linked, autosomal dominant, and autosomal recessive forms of hypophosphatemia [8,41e48]. Phosphate Transport and Osteoclast Function Osteoclasts, the bone-resorbing cells, are exposed to high ambient Pi concentrations during the active resorptive process. Their precursors are derived from monocyteemacrophage lineage cells, which require macrophage colony-stimulating factor (M-CSF) and physical contact with bone-forming osteoblasts for differentiation into mature bone-resorbing osteoclasts. This process furthermore involves receptor activator of nuclear factor kappa B (NF-kappaB) (RANK) ligand (RANKL), which is a membrane-anchored protein at the surface of osteoblasts that binds to RANK, a receptor at the surface of mature osteoclasts and their precursors [49e52]. Osteoprotegerin (OPG), secreted by osteoblasts and probably more importantly by osteocytes [53], is a decoy receptor that binds to RANKL, thus limiting RANKeRANKL interaction and preventing osteoclast differentiation [50,54]. Osteoclasts comprise specific Pi transporters, including the co-transporters NPT2a and Pit1 [40,55], which are activated in vitro upon attachment of osteoclasts to bone particles in a manner that is independent of new protein synthesis [55]. On one hand, Pi is essential for osteoclast function by providing the substrate for ATP synthesis, which is required for supporting the high rates of proton transport activity involved in bone resorption. On the other hand, increased Pi inhibits both osteoclast differentiation and bone resorption [56,57], likely by enhancing osteoprotegerin expression in osteoblasts by reducing RANKLinduced JNK and Akt activation [58], and by inducting of osteoclasts apoptosis [57]. Phosphate Transport and Osteogenic Cell Function Like all eukaryotic cells, osteogenic cells (i.e. osteoblasts and chondrocytes) express the co-transporters NPT2a and Pit1 [59]. There are several differences between Na-dependent Pi transport in osteoblasts and that in renal epithelial cells. Affinity constants for Pi are significantly higher in osteoblasts (300e500 vs 50e100 mM for renal epithelial cells) and Na/Pi cotransport in osteoblasts is stimulated by an acidic extracellular pH [60], whereas renal epithelial Pi transport is stimulated by more alkaline pH. PTH, a potent osteotropic factor, stimulates Na/Pi cotransport in osteoblasts [61], but inhibits transport in renal proximal cells. Other factors that stimulate Na/Pi co-transport in osteoblasts include insulin-like growth factor-1 (IGF-1),

143

platelet-derived growth factor, and fibroblast growth factor (FGF) [62e65]. Finally, fluoride, another potent activator of bone formation, also stimulates Pi transport in osteoblastic cells via the activation of a tyrosine phosphorylation process [66]. Pi affects osteogenic cell function on multiple levels as recently reviewed [67]. It induces chondrocyte apoptosis and thereby limits bone growth and permits replacement of the hypertrophic layer of the growth plate by primary spongiosa. It stimulates osteoblastic differentiation and bone formation, and it is important for matrix vesicle function, specialized extrusions of osteoblast membranes, which play a role in the initial events of bone matrix calcification. Primary mineralization is regulated by chondrocytes, osteoblasts, and odontoblasts and occurs in epiphyseal cartilage, embryonic bone, postnatal ossification, and the development of predentin. Two distinct but not mutually exclusive theories e collagen nucleation and matrix vesicles production e have been proposed to explain the mechanism involved in the initiation of calcification in skeletal tissues [68]. The first holds that the collagen fibril is the major site of crystal nucleation and that Ca/Pi crystals are deposited along the entire length of collagen fibrils. The alternative theory involves the participation of matrix vesicles, which are produced by osteogenic cells and serve as nucleation sites for mineralization of the extracellular matrix. Matrix vesicles are small organelles (100e200 nm in diameter) that have been observed in mineralizing tissues in contact with newly formed mineral crystals. Matrix vesicles arise from bone-forming cells by a process of budding from elongated tubular extensions that project from the plasma membrane of these cells [69]. The mechanism for matrix vesicle-mediated calcification is not fully understood. Several lines of evidence indicate that uptake of Ca and Pi by matrix vesicles, from the extracellular environment, is required for initiation of calcification [70]. Calcium enters matrix vesicles by a protease-sensitive carrier that may be related to the annexins [71]. Matrix vesicles also express Pit1 [72]. Formation of PieCaephospholipid complexes in the vesicular space is believed to maintain a favorable Pi gradient, allowing the continuation of Pi transfer into matrix vesicles. In this system, Na only facilitates translocation of Pi across the membrane of matrix vesicles since an Na/K ATP-ase dependent mechanism for maintaining the Na gradient is not present in these structures. Accumulation of Pi through this system allows calcification to occur inside matrix vesicles. The calcified vesicles then serve as nucleators of matrix calcification. Studies have shown that Pi transport activity is low in matrix vesicles released during the proliferative phase of osteoblast development but is significantly increased during osteoblast differentiation, peaking at

PEDIATRIC BONE

144

7. PHOSPHATE HOMEOSTASIS REGULATORY MECHANISMS

the time of bone matrix formation [72]. The increase in Pi transport activity in matrix vesicles released during the formation of the collagenous matrix may be explained by an enrichment of Pi carriers during the differentiation process. Because Na/Pi co-transport in osteogenic cells is regulated by calciotropic hormones and growth factors, regulation of Pi transport in released matrix vesicles may represent a mechanism by which osteogenic cells modulate the calcification of extracellular matrix. Pi also modulates chondrocyte differentiation and mineralization of cartilage matrix. When analyzing sections of epiphyseal growth cartilage, Pi is present at a very low concentration in pre-mineralized cartilage. At the mineralization front, however, the Pi concentration increases with mineral deposition [73]. Phosphate appears to suppress collagen type II, PTHrP and PTH/ PTHrP receptor expression, while it stimulates type X collagen in CFK2 and ATDC5 chondrogenic cell lines [74e77] and thereby promotes cartilage maturation. Terminal differentiation of growth plate chondrocytes involves a hypertrophic conversion associated with matrix mineralization and ultimately apoptosis of hypertrophic chondrocytes [78]. Several studies have shown that exposing chondrocytes to a high level of Pi leads to their terminal maturation and subsequent matrix mineralization [76,79e83]. The role of Pi in these processes is highlighted by the mineralization defects that could be observed in the case of inherited hypophosphatemias [84]. Finally, the work of Mansfield and Sabbagh et al. [82,84] has linked the elevation in environmental Pi concentration and the concomitant rise in intracellular Pi levels to rapid chondrocytic death through the apoptotic pathway. This effect of Pi is increased in the presence of calcium [85]. It has early been recognized that addition of b-glycerophosphate to the medium favors osteoblastic differentiation of several cell lines, likely by release of Pi by alkaline phosphatase leading to an increased Pi concentration in the extracellular environment [86]. The role of Pi is further emphasized by the fact that the expression level of alkaline phosphatase (ALP) increases during osteogenic differentiation. Several studies have recently implicated Pi as an important molecule capable of modulating osteoblastic proliferation. A genome-scale proteomic study in the pre-osteoblastic MC3T3-E1 cell line [87], showed that Pi modulates the expression levels of a large set of proteins within 18e24 h [88]. A pathway/function analysis of these proteins revealed wide-ranging effects from transcriptional regulators to signal transduction molecules. Several upregulated proteins suggest involvement of Pi in the regulation of cell cycle, proliferation and DNA synthesis [88]. These studies are supported by data showing that extracellular Pi dose-dependently

stimulated DNA synthesis in MC3T3-E1 cells [89] and increased the number of cells in S-phase [88,90,91]. This effect may occur at least in part via IGF-1, which is known as one of the main growth factors involved in osteoblastic cell proliferation, since neutralizing IGF1 antibodies partially inhibited Pi-induced proliferation [92]. The potential role of Pi as a signaling molecule during the course of osteoblast differentiation was first suggested by Beck et al. [93]. They showed that osteopontin expression was strongly induced in direct response to increased Pi levels in the culture medium [94]. Furthermore, Pi stimulates ERK1/2, Pit1 and Pit2 expression in the murine odontoblast-like cell line MO6-G3, which may depend at least partially on calcium/phosphate crystal formation [95]. ERK phosphorylation by Pi furthermore appears to be required for osteopontin and matrix gla protein expression [95,96]. Once mineralized, osteoblasts may become osteocytes or lining cells or die by apoptosis. The work of Adams et al. [97] has linked extracellular Pi to a decrease in the mitochondrial membrane permeability leading to the apoptosis of osteoblasts. It should be noted, however, that osteoblasts are much less sensitive to Piinduced apoptosis than chondrocytes, and that calcium is required during this process [97,98].

Renal Phosphate Transport In an adult human with a plasma Pi concentration of z1.01 mmol/L, and a glomerular filtration rate z120 ml/min the amount of Pi filtered daily z210 mmol. If 20% of the filtered load is excreted in the urine, the mass of Pi reabsorbed is z168 mmol/ day. This net renal reabsorptive flux for Pi is z10 times greater than the net intestinal absorptive flux in adults with a dietary Pi intake of 25 mmol/day and an intestinal fractional absorption of 70% [99,100]. Under normal conditions, >80% of the Pi filtered load is reabsorbed [101,102]. The proximal tubule is the major site of Pi reabsorption, with approximately 70% of the filtered load reclaimed in the proximal convoluted tubule and approximately 10% in the proximal straight tubule (Fig. 7.1). In addition, a small but variable portion (<10%) of filtered Pi is reabsorbed in the distal segments of the nephron [101,104,105]. There is evidence for interand intranephron heterogeneity in proximal tubular Pi transport capacity, with higher transport rates in early (S1/S2) vs late (S3) and in deep (juxtamedullary) vs superficial (cortical) proximal tubular segments [101,102]. Clearance studies in humans and experimental animals have shown that when the filtered load of Pi is progressively increased, Pi reabsorption increases until a maximum tubular reabsorptive rate for Pi, or TmP, is reached, after which Pi excretion increases in proportion to its filtered load. The measurement of

PEDIATRIC BONE

PHYSIOLOGICAL ASPECTS

145

appropriate compensatory change of TmP/GFR, while renal disorders of phosphate homeostasis indicate their influence on renal handling of Pi by inappropriately altering TmPi/GFR. Therefore, an understanding of the mechanisms that underlie changes in TmPi/GFR is key to our understanding of Pi homeostasis in health and disease. Cellular and Molecular Aspects

FIGURE 7.1 Intestinal and proximal tubular phosphate transport. The renal Pi-reabsorption machinery in rat and mouse proximal tubules. Naþ/Pi-co-transporters NPT2a, NPT2c and Pit-2 are localized at the brush borders of proximal tubules. NPT2a and Pit-2 proteins are detected in S1, S2 and S3 segments, whereas NPT2c co-transporter is absent in S3 segments (from [103]).

TmP varies among individuals and within the same individual, due in part to variation in glomerular filtration rate (GFR). Thus, the ratio, TmP/GFR, or the maximum tubular reabsorption of Pi per unit volume of GFR, is the most reliable quantitative estimate of the overall tubular Pi reabsorptive capacity and can be considered to reflect the quantity of sodium-dependent phosphate co-transporters (Na/Pi) available per unit of kidney mass [106]. The serum Pi concentration below which Pi reabsorption is maximal is called the “theoretical renal Pi threshold”; this value is equal to the ratio, TmP/GFR, and closely approximates the normal fasting serum Pi concentration [99,106], indicating that the capacity of the renal tubule to transport Pi is a major determinant of extrarenal Pi homeostasis. In the mammalian kidney, Pi transport is a saturable process with no appreciable simple diffusion component and is characterized by a maximum rate of Pi transfer across the tubular epithelium from lumen to blood. The maximum rate is not an absolute constant but varies with the physiological or pathological condition [99,101,105,106]. The tubular maximum for Pi reabsorption per unit of glomerular filtration rate (TmPi/GFR) represents the most reliable quantitative estimate of the overall tubular Pi transport capacity. Most extrarenal abnormalities of phosphate homeostasis lead to an

Transepithelial Pi transport is essentially unidirectional and involves uptake across the brush border membrane, translocation across the cell and efflux at the basolateral membrane (see Fig. 7.1) as recently reviewed [107]. Pi uptake at the apical cell surface is the rate-limiting step in the overall Pi reabsorptive process and the major site of its regulation. It is mediated by Naþ-dependent Pi transporters that depend on the basolateral membrane associated Naþ/Kþ-dependent ATPase. Na/Pi co-transport is either electrogenic (NPT2a) or electroneutral (NPT2c) and sensitive to changes in pH, with 10- to 20-fold increases observed when the pH is raised from 6 to 8.5. Little is known about the translocation of Pi across the cell except that Pi anions rapidly equilibrate with intracellular inorganic and organic Pi pools. There are few data regarding the mechanisms involved in the efflux of Pi at the basolateral cell surface. Both anion exchange mechanisms and Pi leak pathways have been proposed [108e110]. In comparison, the apical mechanism of phosphate transport is better understood: three classes of Na/Pi co-transporters have been identified by expression and homology cloning, respectively. The type I Na/Pi co-transporter (NPT1, SLC17A1) is expressed predominately in brush border membranes (BBM) of proximal tubule cells [111]. The longest splice-variant of human NPT1 is 467 amino acids in length with at least seven to nine membrane spanning segments. NPT1 mediates high affinity Na/Pi co-transport, although its pH profile differs significantly from that of the pH-dependence of Na/Pi co-transport in isolated renal brush border membrane vesicles. NPT1 exhibits broad substrate specificity and mediates the transport of Cl and organic anions as well as Pi. Conditions that physiologically regulate proximal tubule phosphate transport, such as dietary phosphorus or PTH, do not alter type I Na/Pi co-transporter protein or mRNA expression. Mice that are null for NPT1 display normal serum phosphate and renal phosphate handling. Subtle changes include increased reabsorption of phosphate probably due to increased NPT2c expression [112]; defining the physiological role of NPT1 will thus require further study. The human gene encoding the type I Na/ Pi co-transporter (SLC17A1) is located on chromosome 6p21.3-p23. The type II family of Na/Pi co-transporters is comprised of three highly homologous isoforms, which

PEDIATRIC BONE

146

7. PHOSPHATE HOMEOSTASIS REGULATORY MECHANISMS

share only 20% amino acid sequence homology with NPT1 [113,114]. The type IIa (NPT2a, SLC34A1) and the type IIc transporters (NPT2c, SLC34A3) [6,115] are expressed exclusively in the brush border membrane of the renal proximal tubule, while the type IIb transporter (NPT2b, SLC34A2) is expressed in several tissues, including small intestine and lung, but not in kidney, and it is thought to be responsible for about 30% of intestinal absorption of Pi [27,116]. The longest splice variants of human NPT2a and human NPT2c are comprised of 639 and 599 amino acids, respectively; both proteins are predicted to have eight complete and four partially membrane-spanning segments. The human genes encoding NPT2a and NPT2c are located on chromosomes 5q35 and 9q34(116), respectively. NPT2amediated Na/Pi co-transport is electrogenic and involves the inward flux of three Naþ-ions and one Pianion (preferentially divalent) [117]. The type IIb intestinal Na/Pi co-transporter is also electrogenic, whereas the Npt2c isoform mediates the electroneutral transport of two Naþ-ions with one divalent Pi-anion. In the mouse, Npt2a and Npt2c are detected exclusively in the brush border membrane of proximal tubular cells. At the mRNA level, Npt2c is approximately one order of magnitude less abundant than Npt2a. Hybrid depletion studies suggested that Npt2c accounts for approximately 30% of Na/Pi co-transport in kidneys of Pideprived adult mice [115]. The relative abundance of Npt2c protein is significantly higher in kidneys of 22-day-old rats than in those of 60-day-old rats, suggesting that Npt2c has a particularly important role during early postnatal development [6]. However, several different homozygous and compound heterozygous mutations in SLC34A3, the gene encoding human NPT2c, have been found in patients affected by hereditary hypophosphatemic rickets with hypercalciuria (HHRH) [43e45], indicating that this co-transporter has a more prominent role than initially thought. Type III Na/Pi co-transporters are cell surface retroviral receptors (gibbon ape leukemia virus [Glvr-1, Pit1, SLC20A1] and murine amphotropic virus [Ram-1, Pit-2, SLC20A2]) that mediate high affinity, electrogenic Naþ-dependent Pi transport when expressed in oocytes and in mammalian cells [30,118]. Glvr-1 and Ram-1 show no sequence similarity to NPT1 or NPT2a. Both Glvr-1 and Ram-1 proteins are widely expressed in mammalian tissues, including the basolateral membrane of the proximal tubule and are believed to serve as “housekeeping” Na/Pi co-transporters, which maintain cellular Pi homeostasis. However, recently it was suggested that the renal expression of Pit-2 is regulated by PTH and FGF-23 in a manner similar to that of NPT2a and NPT2c [13,119]. Thus, the role of type III Na/ Pi co-transporters in the regulation of phosphate homeostasis may need to be re-evaluated.

ENDOCRINE REGULATION OF PHOSPHATE HOMEOSTASIS Human Phosphate Homeostasis Over the last decade, information derived from genetic analyses of familial disorders has led to the discovery of novel genes involved in the regulation of phosphate homeostasis which, in contrast to the regulation of calcium homeostasis [120,121], has been less well understood to date. Among these novel genes is fibroblast growth factor 23 (FGF-23), named after its similarity to other fibroblast growth factors. However, different from other members of this family, it is a circulating hormone that acts at the level of the kidney to regulate phosphate reabsorption [122]. FGF-23 is produced by osteocytes and osteoblasts in bone and upregulated by an increase in dietary phosphate and by the active form of vitamin D, 1,25(OH)2D, while it is downregulated, through yet unknown mechanisms, by PHEX, DMP1, ENPP1 and probably several additional, as-of-yet unknown proteins (Fig. 7.2) [7]. FGF23 acts through one or more FGF receptors, with Klotho as co-receptor [123], to inhibit renal phosphate reabsorption [124e126], and to decrease circulating 1,25(OH)2D levels by inhibiting the 1a-hydroxylase and increasing the 24-hydroxylase [127,128]; the net effect of these actions is to lower serum phosphate levels. Furthermore, FGF-23 appears to inhibit PTH secretion by the parathyroid glands [129,130] , which leads to a reduction in bone resorption, thereby limiting the amount of phosphate that enters the blood circulation. Like FGF-23, PTH decreases renal phosphate reabsorption, thus reducing serum phosphate levels. However, it stimulates renal 1a-hydroxylase thereby increasing the serum levels of 1,25(OH)2D, which acts through VDR/RXR heterodimers to enhance the intestinal absorption of phosphate [131] and to stimulate FGF-23 synthesis and secretion by osteocytes. Phosphate feeds back to stimulate FGF-23 and PTH secretion (see below). For a detailed discussion of the receptors and signal transduction cascades for PTH, 1,25(OH)2D, and FGF-23, the reader is referred to several recent reviews [7,8,12,122,132e137].

Parathyroid Hormone The major physiological role of the parathyroid glands is to function as a “calciostat”. Consequently, PTH secretion by the parathyroid glands is tightly regulated on a transcriptional and post-transcriptional level dependent on the concentration of extracellular calcium (Cae) [138]. In addition to calcium, PTH regulates serum phosphate concentration through its actions on several organs. An elevated serum phosphate level in turn

PEDIATRIC BONE

ENDOCRINE REGULATION OF PHOSPHATE HOMEOSTASIS

147

FIGURE 7.2 Regulation of mammalian phosphate homeostasis by PTH, FGF23, and 1,25(OH)2-D. Modified from [12], see text for an explanation of the abbreviations.

stimulates PTH-secretion, presumably by lowering extracellular calcium and increasing stability of the PTH mRNA [139,140]. PTH is synthesized as prepropeptide containing a 25-amino acid presequence (signal sequence) and a 6-amino acid prosequence [121]. Both are cleaved off in the endoplasmic reticulum and mature full-length PTH(1e84) is stored in secretory vesicles [120]. Activation of the calcium-sensor receptor (CaR) in the parathyroid cell membrane by Cae stimulates release of intracellular calcium via Gq/11/phospholipase C (PLC) and suppresses adenylate cyclase via the inhibitory G-protein Gi, respectively [141]. Mice with the parathyroid-specific ablation of Gq combined with the global ablation of G11 develop severe hyperparathyroidism similar to that present in mice homozygous for

the deletion of the CaR, thus illustrating the important role of this signal transduction pathway for calciumsensing [142]. Hydrolysis of PIP3 by PLC releases IP3, which stimulates release of intracellular calcium (Cai) and activates calcium-sensitive proteases in the secretory vesicles of the parathyroids. This results in cleavage and inactivation of PTH [120]. The activation of CaR also suppresses protein synthesis and release of PTH(1e84) into the circulation via mechanisms involving changes in the actin cytoskeleton [143]. Heterozygous activating CaR mutations cause familial forms of hypoparathyroidism [144], while heterozygous and homozygous inactivating mutations lead to familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism, respectively [145]. PTH gene expression is

PEDIATRIC BONE

148

7. PHOSPHATE HOMEOSTASIS REGULATORY MECHANISMS

negatively regulated by 1,25(OH)2D [146]. Parathyroid gland development is regulated by Pax9 [147], GCMB [148], GATA3 [149], and possibly other, yet unknown factors. GCMB may also be involved in parathyroid cell differentiation and hormone synthesis. Phosphate modulates PTH mRNA stability [139,150] as will be reviewed in more detail below. FGF-23 suppresses PTH mRNA synthesis and secretion in vitro and in vivo in an alpha Klotho (KL)-dependent fashion [130,151e153]. End organ-resistance to FGF-23 at the level of the parathyroid may explain why one individual with hyperphosphatemic tumoral calcinosis due to a homozygous inactivating KL mutation developed parathyroid hyperplasia [154]. KL may also have an FGF-23-independent role by facilitating PTH-secretion through maintenance of membrane Na/K-ATPase activity in the setting of hypocalcemia and KL-null mice are thus desensitized to hypocalcemic stress [155]. PTH and PTH-related peptide (PTHrP) act through a common G protein-coupled receptor, the PTH/ PTHrP-receptor (PTHR1) [120]. The PTHR1 is coupled to the Gs-alpha/AC/PKA, the Gq/PLC/PKC, and the MAPK pathway, but thus far it has been difficult to attribute individual functions of PTH to selected signaling pathways. Continuous exposure to PTH induces bone resorption by activation of osteoclasts indirectly through osteoblasts, while intermittent PTH increased bone formation by activation of osteoblasts. Osteoclasts do not have receptors for PTH and thus recruitment of osteoclast precursors and activation of bone resorption occurs indirectly via osteoblasts (see above). Conversely, intermittent PTH may lead to activation of the anabolic Wnt-signaling pathway by suppressing sclerostin and dickkopf 1 expression [156]. At the level of the proximal renal tubule, PTH acts via the PTHR1 expressed at the basolateral and apical membrane to activate Gs-alpha/AC/PKA and Gq/ PLC/PKC, respectively [125,157]. Acute regulation of the sodiumephosphate co-transporters NPT2a and NPT2c by PTH appears to involve primarily the Gsalpha/AC/PKA signaling pathway of the activated PTHR1 [158], while chronic PTH-mediated regulation of phosphate appears to involve also Gq/PLC/PKC pathway downstream of the PTHR1 [159]. Besides enhancing renal phosphate excretion, PTH increases proximal tubular bicarbonate excretion by inhibiting the amiloride-sensitive Na/H-exchanger and Na/KATPase [160]. It also increases epithelial Cl efflux, thereby hyperpolarizing the distal tubular cell, which leads to increased Ca reabsorption via TRPV5 voltagesensitive Ca channels [161,162]. The net effect of the PTH actions on bone and kidneys is an increase in serum calcium level and a decrease in serum phosphorus level, and prolonged elevations can lead to (mild) hyperchloremic metabolic acidosis.

The analysis of mice lacking PTH or PTHR1, or “knock-in” mice carrying a mutant PTHR1 has provided important insights into the function of PTH and PTHrP in vivo [163e166]. For the purpose of this review, only findings relevant for phosphate homeostasis will be discussed. Mice lacking PTH are viable, yet newborns display diminished matrix mineralization, decreased neovascularization and reduced metaphyseal osteoblasts and trabecular bone [166]. PTH-null animals suffer from increased urinary calcium excretion and phosphate retention, just like humans with hypoparathyroidism [167]. Mice lacking PTHrP or the PTHR1 die at birth or shortly thereafter [168], which is similar to the findings in individuals with Blomstrand disease, a disorder caused by homozygous or compound heterozygous inactivating mutations in the PTHR1 [169,170]; no data regarding blood phosphate homeostasis have been reported for these animals. Mice in which the wild-type PTHR1 has been replaced by a receptor deficient in the activation of Gq/PLC/PKC failed to develop hypophosphatemia when secondary hyperparathyroidism is induced by a calcium-deficient diet [165], while mice expressing a PTHR1 which lacks all phosphorylation sites within the C-terminal receptor portion that are important for receptor desensitization, develop hypophosphatemia despite normal parathyroid function [171]. These findings indicate that the long-term effects of PTH on phosphate homeostasis are at least partly mediated through the Gq/PLC/PKC signaling pathway and are subject to desensitization at the level of PTHR1. Healthy individuals injected with PTH(1e34) develop hypophosphatemia and elevated 1,25(OH)2D levels, along with an increase of serum FGF-23 [172], suggesting that calcitriol is an important regulator of FGF-23 synthesis, independent of the serum phosphate concentration. Also, the parathyroid-specific knockout of the CaR leads to increased FGF-23 production along with severe hyperparathyroidism, despite presence of hypophosphatemia [173]. Increased circulating FGF-23 levels were also reported in PTH-null mice [167] as well as in some patients with hypoparathyroidism [174], indicating that the hyperphosphatemia observed under these conditions can modulate FGF-23 despite low or normal calcitriol levels. Phosphate-independent regulation of FGF-23 by 1,25(OH)2D may also explain why FGF-23 levels are not adequately adjusted in patients with hyper- or hypoparathyroidism, i.e. conditions in which 1,25(OH)2D is elevated to stimulate inappropriately, or decreased to reduce inappropriately FGF23 levels, respectively. No abnormality of phosphate homeostasis and circulating FGF-23 levels was observed in mice expressing a constitutively active PTHR1 under the control of the DMP-1 or the col1a1(3.6 kb) promoter, or in mice lacking GNAS exon 1 in osteoblasts,

PEDIATRIC BONE

ENDOCRINE REGULATION OF PHOSPHATE HOMEOSTASIS

which leads to Gs-alpha deficiency in this tissue [163,164,175,176]. However, some patients with McCuneeAlbright syndrome [177e179] and one individual with Jansen metaphyseal dysplasia [180] had increased serum FGF-23 levels. Furthermore, parathyroidectomy appears to reverse an increase of FGF-23 mRNA expression and circulating FGF-23 levels in a rat model of adenine-induced renal failure [181] and thus it remains unclear to date whether there is a direct role for PTH in the regulation of FGF-23 synthesis and/or secretion.

1,25(OH)2-vitamin D Cholecalciferol is generated from its precursors 7-dehydrocholesterol and ergosterol in the skin, subjected to 25-hydroxylation in the liver and converted to the active 1,25-dihydroxycholecalciferol (1,25(OH)2D) in the kidney [182]. CYP27B1 encodes the enzyme responsible for 1a-hydroxylation in the kidney and is induced by PTH, hypocalcemia and hypophosphatemia [183]. FGF-23, hypercalcemia and hyperphosphatemia inhibit CYP27B1 expression [183,184]. Also FGF-7 and sFRP-4 appear to inhibit synthesis of 1,25(OH)2D [185,186], while MEPE lacks this inhibitory activity [187]. FGF-23 and 1,25(OH)2D also increase renal CYP24 activity [184,188,189], which converts 25-OH-vitamin D and 1,25(OH)2D into the inactive metabolites. Similar degrees of hypocalcemia and hypophosphatemia are seen in both the VDR-null mouse [190] and the CYP27B1-null mouse [191]. These findings are similar to those observed in individuals with vitamin-dependent rickets types 1 and 2 (VDDR1 and VDDR2), respectively, carrying loss-of-function mutations in either of these genes [192,193], and indicate that the effects of vitamin D on calcium and phosphate homeostasis are mediated by the liganded VDR. Upon ligand binding, the 1,25(OH)2D/VDR complex enters the nucleus, where it forms heterodimers with RXR to activate vitamin D responsive elements (VREs). 1,25(OH)2D increases expression of the transient receptor potential cation channel, subfamily V, member 6 (TRPV6) and plasma membrane Ca2þ ATPase (PMCA) in enterocytes of the intestinal tract to facilitate transcellular calcium uptake [194]. It also increases phosphate uptake from the diet [195] possibly via upregulation of Pit-2 [31], while e at least in mice e transcellular phosphate uptake via NPT2b appears to be regulated by dietary phosphate in a vitamin D-independent fashion [196,197]. VDR is also expressed in osteoblasts and 1,25(OH)2D was reported to increase bone formation and resorption. However, the complete rescue of rickets/osteomalacia of the VDR null mouse by a diet high in calcium and phosphate suggests that the major role of VDR is the delivery of calcium and phosphate to bone [198]. 1,25(OH)2D stimulates the

149

synthesis and secretion of FGF-23 by osteoblasts and osteocytes [199]. At the level of the parathyroid gland, 1,25(OH)2D acts to reduce PTH synthesis and secretion directly [200] and it increases CaR expression, thereby sensitizing the parathyroid gland to inhibition by calcium [201]. At the renal distal tubules, 1,25(OH)2D increases the intracellular expression of calbindin-28kDa, expression of TRPV5 at the apical membrane, and expression of the ATP-dependent calcium transporter at the basolateral membrane, thereby enhancing PTH-dependent calcium-reabsorption from the glomerular filtrate [194]. The net effect of the actions of 1,25(OH)2D on parathyroid, gut, bone and kidneys is an increase in serum calcium and phosphate level. Intravenous injection of calcitriol increases FGF-23 levels in humans [202] and mice [199]. Mice that are null for VDR [190] or CYP27B1 [191] exhibit hypophosphatemia and have accordingly low FGF-23 levels [204]. VDR null animals on a rescue diet, which corrects secondary hyperparathyroidism and hypophosphatemia, and thus improves bone mineralization, are able to normalize circulating FGF-23 levels despite absence of 1,25(OH)2D action, suggesting a vitamin D-independent role of Pi [203]. Finally, FGF-23 levels are markedly increased in animals with selective ablation of the CaR in the parathyroid gland [173]. These animals show hypophosphatemia and increased 1,25(OH)2D because of severe hyperparathyroidism, which is known to induce CYP27B1 activity [204]. Findings from these three animal models suggest that phosphate and 1,25(OH)2D are independent regulators of the circulating FGF-23 levels. Interestingly, FGF-23 synthesis and secretion is decreased when VDR is selectively ablated in chondrocytes using VDRfl/fl mice that mated with pcol2a1-cre animals to target ablation of the VDR to proliferating chondrocytes [205]. These data suggest that a VDR-dependent regulator of FGF-23 is present in the growth plate.

Fibroblast Growth Factor 23 FGF-23 was first identified in mouse embryos by homology-based polymerase chain reaction (PCR) [206]. However, its importance for phosphate homeostasis only became apparent when FGF-23 loss-of-function mutations were shown to cause autosomal dominant hypophosphatemic rickets (ADHR) [207]. Furthermore, FGF-23 was found to be secreted by tumors causing oncogenic osteomalacia (OOM) and recombinant FGF-23 was shown to induce renal phosphate-wasting leading to hypophosphatemia and osteomalacia [208]. The human FGF-23 gene on chromosome 12p13.3 encodes for a glycoprotein comprising 251 amino acids. The main sources of FGF-23 are osteocytes and osteoblasts in the skeleton, but

PEDIATRIC BONE

150

7. PHOSPHATE HOMEOSTASIS REGULATORY MECHANISMS

low levels of unclear significance can be detected in the ventrolateral thalamic nucleus, the thymus, small intestine and heart [206]. The phosphate-regulating gene with homologies to endopeptidases on the X chromosome (PHEX) and dentin matrix protein 1 (DMP1) suppress expression of FGF-23 in bone most likely through indirect mechanisms [7]. Intact DMP1 is cleaved into a 35- and a 57-kDa fragment, possibly by bone morphogenic protein 1 (BMP1) [209] which, in turn, may be activated by a complex consisting of the subtilisin propeptide convertase SPC2 and the co-activator 7B2 [210]. Transgenic overexpression of the C-terminal 57kDa DMP1 fragment is both necessary and sufficient to rescue the bone phenotype (and probably the hypophosphatemia) resulting from increased FGF-23 secretion of DMP1-null mice [211]. This 57-kDa DMP1 fragment appears to have nuclear effects, which may be required for suppression and/or feedback regulation of FGF-23 gene transcription and/or FGF-23 secretion [48,211]. In contrast, dietary phosphate [212] and serum 1,25(OH)2D stimulate FGF-23 synthesis [199,202]. After cleavage of the signal sequence comprising 24 amino acids and O-glycosylation by UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyl-transferase 3 (GALNT3), the mature protein, FGF-23(25e251), is secreted into the circulation. O-glycosylation of FGF23 occurs in the 162e228 region [213] and this posttranslational modification appears to protect FGF-23 from cleavage by subtilisin-like proprotein convertases when using recombinant peptides in vitro [214]. Mutations identified in individuals affected by hyperphosphatemic familial tumoral calcinosis (HFTC2) reside in the N-terminal portion of FGF-23; these include H41Q [215], Q54K [216], S71G [217,218], M96T [219], and S129F [220]. S71G leads to an accumulation of mutant FGF-23 in the Golgi apparatus [217] and the impaired secretion of Flag-tagged versions of [G71]hFGF-23 and [F129]hFGF-23 by HEK293 cells can be rescued by lowering the culture temperature to 25 C or by compounding the mutant FGF-23 with R176Q [221]. The R176Q mutation, which was identified in patients with ADHR, appears to stabilize hFGF-23 by protecting a subtilisin-furin cleavage site [214,222]. We have recently shown that the HFTC2 mutations S129P, S71G, and S129F impair O-glycosylation of FGF-23 resulting in the intracellular accumulation of intact FGF-23 [223]. Lossof-function mutations in GALNT3 cause hyperphosphatemic familial tumoral calcinosis (HFTC1) in humans; equivalent findings were made in mice that are null for Galnt3 [224]. O-glycosylation is essential for secretion of FGF-23 by CHO cells [222] and for secretion of FGF-7 by human embryonic kidney cells (HEK293) [225]. This suggests that GALNT3 may be an important component of the regulatory mechanism of FGF-23 secretion in vivo, which is disrupted by HFTC2 mutations.

FGF-23 lacks heparan-sulfate- (HS-) binding motifs, which are characteristic for the fibroblast growth factor family. Lack of HS-binding motifs reduces matrixbinding and enable this ligand to function in an endocrine fashion [226]. Four distinct genes encode FGF receptors (FGFR; FGFR1eFGFR4). All FGFRs share a similar domain structure. The extracellular domain is made up of three immunoglobulin-like domains (D1eD3), followed by a single-pass transmembrane domain and an intracellular domain which contains tyrosine kinase activity [227]. A major tissue-specific alternative splicing event in the second half of D3 of FGFR1e3 creates epithelial lineage-specific "b" (FGFR1beFGFR3b) and mesenchymal lineage-specific "c" (FGFR1ceFGFR3c) isoforms with distinct ligand-binding specificities [229]. FGF-23 requires alpha-Klotho (KL) as a co-receptor. Immunoprecipitation experiments, surface plasmon resonance (SPR) spectroscopy, and functional assays measuring the mitogenic response of BaF3 cells or activation of the MAPK-pathway in HEK293 cells have shown that KL forms a ternary complex with FGF-23 and either FGFR1c, FGFR2c, FGFR3c, or FGFR4 [123,229e232]. Recent work using neutralizing anti-FGF-23 antibodies indicates that the N-terminal portion of FGF-23 interacts with FGFR1c, while the C-terminus binds to KL, and both interactions appear to be important for bioactivity in vitro and in vitro [233]. Deletion of FGFR3 or FGFR4 in Hyp mice, a mouse model of human X-linked hypophosphatemia (XLH), did not correct [234] and double mutants only partially rescued the hypophosphatemia in those mice [235]. Based on these data, it was concluded that neither FGFR3 nor FGFR4 are sufficient to mediate the phosphaturic activity of FGF-23, but instead act in concert with FGFR1. Indeed, mice with kidney-specific deletion of FGFR1 [236] suggest that FGFR1 mediates the phosphaturic effects of FGF-23, although lack of suppression of 1,25(OH)2D in these animals may suggest that deletion of FGFR1 in the kidney was incomplete. The site of action of FGF-23 in the kidney is still controversial. While FGF-23 decreases expression of NPT2a and NPT2c [237e239] and CYP27B1 activity in the proximal tubules [8,240,241], its co-receptor KL is expressed mainly in the distal tubules. Mice injected with FGF-23 furthermore show phosphorylation of MAPK and expression of the early growthresponse gene 1 (Egr-1) in the distal tubules [242]. These findings suggest either that FGF-23 uses a noncanonical signal-transduction pathway at the proximal tubules or that it induces the secretion of an intermediary phosphatonin in the distal tubules, which acts in a paracrine fashion on the proximal tubules. KL may furthermore have ligand-independent actions by regulating the expression of calcium channels (TRPV5) [243] and potassium channels (ROMK) at the distal tubules [244].

PEDIATRIC BONE

ENDOCRINE REGULATION OF PHOSPHATE HOMEOSTASIS

The effects of FGF-23 on renal function lead to hypophosphatemia, decreased 1,25(OH)2D synthesis, increased 24-hydroxylated vitamin D analogs and suppressed or inappropriately normal parathyroid function. Regulation of PTH secretion by serum calcium independent of the effects of phosphate, FGF-23 and KL at the parathyroid gland may furthermore explain, why PTH is unable to compensate in states of FGF-23 excess or deficiency, conditions in which serum calcium is decreased to stimulate inappropriately, or increased to reduce inappropriately PTH secretion, respectively. Much has been learned about the regulation of phosphate homeostasis through the discovery of genetic causes of human hypo- and hyperphosphatemic disorders. These findings were extended by the generation of a number of animal models. Individuals suffering from familial hyperphosphatemic tumoral calcinosis (HFTC) have homozygous loss-of-function mutations in GALNT3 [245], FGF-23 [217,246], or KL [154]. Like mice that are null for FGF-23 [247,248], GALNT3 [224], or KL [249], individuals lacking these proteins suffer from hyperphosphatemia and increased 1,25(OH)2D levels due to the loss of FGF-23 activity or end-organ resistance to FGF-23, respectively. Consistent with an increased intestinal absorption of calcium from the gut, patients and mice with these genetic modifications display mild hypercalcemia, suppressed PTH levels, and hypercalciuria. The increased calciumephosphorus product in these disorders is thought to cause the characteristic tissue calcifications. Ablation of Npt2a [250], VDR [248], or CYP27B1 [251] rescues the serum biochemical abnormalities of FGF-23-null mice, and ablation of CYP27B1 was also shown to rescue the Klotho-null mice [252]. Likewise, low-phosphate/lowvitamin D diets [253] can normalize the changes in mineral ion homeostasis of FGF-23- and Klotho-null animals, although mineralization defects in the skeleton may persist [250]. Conversely, increased FGF-23 levels in most individuals affected by X-linked hypophosphatemia [46], autosomal dominant hypophosphatemic rickets [207,254], or autosomal recessive hypophosphatemia (ARHP) [47,48] leads to renal phosphate wasting. More prominent elevations in FGF-23 are observed in mice lacking PHEX (hyp mice) [255,256] or overexpressing FGF-23 [189,257e259]. Along with hypophosphatemia, these mice show low 1,25(OH)2D levels and low-normal serum calcium levels, which lead to the development of hyperparathyroidism [257,259]. Overexpression of PHEX systemically or targeted to osteoblasts of Hyp mice [260e262] rescued the skeletal phenotype, while the serum biochemical abnormalities of these animals persist (with exception of reversal of secondary hyperparathyroidism with systemic overexpression of PHEX [262]). This is in contrast to studies of Hyp mice crossed with mice carrying a reporter expressed under

151

the control of the FGF-23 promoter, which show elevated FGF-23 gene transcription in bone. These findings suggest that the FGF-23 excess in mice with an abnormal PHEX function is originating from the skeleton [256,263]. Furthermore, the FGF-23-null mice and mice lacking PHEX and FGF-23 [256] as well as mice lacking DMP1 and FGF-23 [264] show indistinguishable phenotypes suggesting that the regulatory actions of PHEX and DMP1 reside upstream of FGF-23. Distinct from the FGF-23-dependent forms of renal phosphate wasting, hereditary hypophosphatemic rickets with hypercalciuria (HHRH) [45,265] leads to appropriate upregulation of CYP27B1, leading to increased 1,25(OH)2D levels and thus absorptive hypercalciuria due to loss of SLC34A3/ NPT2c in the kidney. Mice lacking SLC34A1/NPT2a also display FGF-23-independent renal phosphate wasting and absorptive hypercalciuria [266]. In contrast, mice lacking SLC34A3/NPT2c show only mild hypercalcemia and absorptive hypercalciuria at an early age only due to increased 1,25(OH)2D levels, but these animals do not develop hypophosphatemia, and thus have a milder phenotype than human individuals with HHRH [128].

Metabolic and Endocrine Effects of Phosphate Metabolic Effects of Phosphate/Activation of MAPK by Phosphate It has long been recognized that differentiation of primary or permanent osteogenic cells requires the addition of inorganic phosphate in the form of hydroxyapatite [267e269], or beta-glycerophosphate [87] along with ascorbic acid which is believed to support formation of collagen matrix [270]. Expression of the bonecell specific genes dentin matrix protein 1 (DMP1), osteopontin (OPN), and matrix-gla-protein (MGP) is stimulated by phosphate on a transcriptional level, while the expression of alkaline phosphatase (TNSALP) is suppressed [93,94,271]. Cellular uptake of phosphate by specialized transporters appears to be required since addition of phosphonoformic acid (PFA, forscarnet), an inhibitor of sodiumephosphate co-transporters, blocks these effects of Pi [94,272,273]. The downstream effects resulting in suppression of TNSALP possibly require BMP-signaling in ST2 cells [274], however, dependence on the p42/p44-MAPK/ERK pathway was shown in ATDC5 cells [275]. Likewise, activation of the p42/p44MAPK/ERK pathway is required for the induction of OPN and MGP, which can be blocked by UO126, a specific inhibitor of MAPK-kinase, MEK [276,277]. Activation of MAPK by calcium phosphate crystals in primary fibroblasts was described by Nair et al. [278]. Beck et al. subsequently showed that inorganic phosphate at concentrations between 5 and 10 mM alone is

PEDIATRIC BONE

152

7. PHOSPHATE HOMEOSTASIS REGULATORY MECHANISMS

sufficient to activate MAPK in MC3T3 mouse fibroblast cells [276], and subsequently, activation of MAPK by inorganic phosphate was demonstrated in multiple other cell lines, including chondrogenic ATDC5 cells, MC3T3-E1 osteoblasts and ST2 murine bone marrow stromal cells [277], HEK293 human proximal tubular cells [279], and lung alveolar cells [273]. Although some cell lines, for example C2C12 or L929 cells, are less responsive than others [277], activation of MAPK by phosphate appears to be quite universal, and conserved evolutionarily, since it is likewise observed in Drosophila S2Rþ hemocyte cells [280]. Addition of PFA [82,272] or siRNA-mediated knockdown of Pit1 sodiumephosphate co-transporters blocks activation of MAPK by phosphate [279] indicating that cellular uptake of phosphate is required for the activation of MAPK. Furthermore, using cell lines expressing a Pitransport-deficient Pit1 transporter, Beck et al. recently reported that Pit1 may have transport-independent effects on cell proliferation and tumor growth in vitro and in vivo, although it remains to be shown whether these effects are dependent on phosphate binding to Pit1 [281]. Pit1 belongs, along with its mammalian paralogue Pit2, the bacterial pitA, and yeast pho89 transporters, to the NPT3 class of sodiumephosphate cotransporters [282,283]. Phosphate appears to induce phosphorylation of FRS2alpha, and siRNA mediated knockdown of FGFR1 is able to interfere with Pi-induced MAPK [275,279]. Furthermore, phosphorylation of Akt and c-Raf by phosphate was shown in human bronchial epithelial cells [273] and proliferating chondrocytes [275], respectively, suggesting that phosphate interacts with the MAPK pathway relatively close to the cell membrane. Activation of p42/p44-MAPK by phosphate is rapid and occurs within 5 min, but biphasic upregulation with a second peak after 8e12 h has been reported in some cell lines, while related kinases JNK and p38MAPK appear not to be affected by phosphate at least in those cell lines reported to date [276,277]. It is possible that binding of extracellular phosphate to Pit1 activates the MAPK pathway. However, since knockdown of members of the MFS family (i.e. NPT1), likewise blocks phosphate-induced MAPK, at least in Drosophila S2Rþ cells [280], intracellular phosphate after uptake via multiple transporter classes may be the signal for MAPK and the activation of possibly other pathways. Furthermore, block of phosphate-induced MAPK by knockdown of FGFR1 or FRS2alpha either suggests a cooperative interaction between Pit1 and FGFR1 to sense extracellular phosphate after binding to Pit1 or that intracellular phosphate acts to modulate flow through the MAPK pathway at one or multiple levels downstream of the FGFR1/FRS2alpha. Egr-1 was shown to be a downstream effector of phosphate-induced MAPK [96,284]. Pi also induces the expression of Fra-1

[96], Nrf2 [90,91], although dependence of these factors on MAPK as the intermediary has not been demonstrated [88,90]. Phosphate-induced MAPK has been implicated in proliferation of the chondrogenic cell line ATDC5, possibly by activating cyclin D1 [275]. Finally, activation of MAPK by phosphate stimulates apoptosis of hypertrophic chondrocytes [84], which also requires changes of the mitrochondrial membrane potential and activation of caspase-9 [77]. Conversely, inhibition of phosphate uptake or phosphate restriction prevents apoptosis of hypertrophic chondrocytes in vitro [76,82,285], and lead to a 2.5-fold increase in parathyroid hormone-related protein mRNA expression pointing to an important role for phosphate in regulating growth plate maturation [77]. Both effects may explain expansion of the growth plates in the growing skeleton in vivo, for example in children with hypophosphatemic rickets [286]. Regulation of Parathyroid Hormone Secretion by Phosphate In addition to calcium and 1,25(OH)2D (see above), parathyroid hormone secretion is regulated by serum phosphate levels through direct and indirect mechanisms. Elevated serum phosphate stimulates PTH-secretion presumably by lowering extracellular calcium [139,140], while hypophosphatemia suppresses PTHsecretion indirectly by upregulation of 1,25(OH)2D. Upregulation of 1,25(OH)2D also induces FGF-23 synthesis, which acts at the parathyroids to suppress PTH mRNA synthesis and secretion in vitro and in vivo in a KL-dependent fashion [130,151,153,287]. Finally, KL may also have an FGF-23-independent role by facilitating PTH-secretion through maintenance of membrane Na/K-ATPase activity in the setting of hypocalcemia and KL-null mice are thus desensitized to hypocalcemic stress [155]. In addition to these indirect effects, phosphate directly acts on the parathyroids to stimulate PTH secretion through post-transcriptional mechanisms, which have been elucidated in recent years. Using Northwestern blot analysis, RNA electrophoretic mobility shift and cross-linking analysis of parathyroid extracts, cytosolic trans-acting factors were identified which bind to a defined 63 bp cis-acting instability element in the PTH mRNA 30 -untranslated region (UTR) [139,150]. It appears that there is a balanced interaction of the PTH mRNA with stabilizing proteins AUF1 (AU-rich element binding protein, isoforms p37, p40, p42 and p45) and Unr (upstream of N-ras) [288] and the destabilizing protein KSRP (K-homology splicing regulator protein) in vivo [289]. In the setting of hypocalcemia or chronic kidney disease, the peptidyl-prolyl isomerase Pin1 is inactive [290], resulting in KSRP phosphorylation and hence its inactivation. This presumably

PEDIATRIC BONE

REFERENCES

allows AUF1 and Unr to bind the PTH mRNA 30 UTR ARE with a greater affinity, leading to increased PTH mRNA stability. Conversely, hypercalcemia and hypophosphatemia lead to destabilization of the PTH mRNA, which then is targeted for degradation by the exosome. Since studies to show direct regulation of mRNA stability by phosphate in transfected cells using a reporter containing the PTH 30 -UTR are missing, the nature of the upstream phosphate sensing mechanism continues to remain unclear. Regulation of 1a-hydroxylase by Phosphate Cholecalciferol is generated from its precursors 7-dehydrocholesterol and ergosterol in the skin, subjected to 25-hydroxylation in the liver and converted to the active 1,25-dihydroxycholecalciferol (1,25(OH)2D) in the kidney [182,291]. 1a-hydroxylation in the kidney is tightly regulated and induced by PTH, hypocalcemia and hypophosphatemia, which appear to induce gene expression of CYP27B1, the gene encoding 1ahydroxylase [183]. FGF-23, hypercalcemia and hyperphosphatemia, on the other hand, inhibit CYP27B1 expression [183,184]. Also, FGF-7 and sFRP-4 appear to inhibit synthesis of 1,25(OH)2D [185,186]. FGF-23 and 1,25(OH)2D also increase renal CYP24 activity [184,188,189], which converts 25-OH-vitamin D and 1,25(OH)2D into inactive metabolites. The upstream sensing mechanism and whether phosphate regulates CYP27B1 on the transcriptional or post-transcriptional level remain unclear. Regulation of FGF-23 Secretion by Phosphate The main sources of FGF-23 are osteocytes and osteoblasts in the skeleton [207]. As mentioned above, dietary phosphate and 1,25(OH)2D stimulate FGF-23 secretion [199,202,212], which appear to occur independently from each other. For example, injection of 1,25-dihydroxyvitamin D3 increases serum FGF-23 levels within hours in rodents [292] without significant increase in serum phosphate levels, indicating that vitamin D can increase FGF-23 independently of phosphate [292]. The effect of 1,25-dihydroxyvitamin D3 is via its nuclear vitamin D receptor (VDR) which heterodimerizes with another nuclear receptor RXR. The VDReRXR heterodimer in turn binds to the promoter region of the FGF-23 gene and transactivates its expression [133]. Similarly, phosphate positively regulates FGF-23 expression, although the exact mechanisms need to be defined. VDR-deficient mice (VDR/ mice) have low serum levels of phosphate and FGF-23, but when placed on a “rescue” diet (rich in calcium and phosphate) serum FGF-23 levels are restored, indicating that phosphate can increase FGF-23 independently of vitamin D [203]. Due to lack of suitable in vitro culture models which show regulation of FGF-23 secretion by phosphate, it remains

153

unclear whether the in vivo effects of phosphate on FGF-23 transcription and/or secretion are cell autonomous or mediated via intermediary factors. Insights from cell lines transfected with plasmids encoding for human FGF-23 indicate that FGF-23 is subjected to post-translational modification, and that this modification may be regulated by phosphate. After cleavage of the signal sequence comprising 24 amino acids is removed, FGF-23(25e251) is O-glycosylated by GALNT3. O-glycosylation is essential for secretion of FGF-23 by CHO cells [222] and for secretion of FGF-7 by human embryonic kidney cells (HEK293) [225], and mutations impairing O-glycosylation of FGF-23 lead to hyperphosphatemic familial tumoral calcinosis in humans [221,223] and equivalent findings in mice [224] due to lack of bioactive FGF-23. Expression of GALNT3 appears to be stimulated by extracellular phosphate and is suppressed by extracellular calcium and 1,25(OH)2D in HEK293 cells [225]. It also appears to be stimulated by AMP medicated mechanisms in vitro [294] and by fibrous dysplastic lesions caused by activating GNAS mutations in vivo [178]. This suggests that GALNT3 may be an important component of the regulatory mechanism of FGF-23 secretion by phosphate and cAMP. Recently, ecto-nucleotide pyrophosphatase/phosphodiesterase 1 (ENPP1) was found to be a negative regulator of FGF-23 secretion. ENPP1 is a membrane-bound ecto-enzyme responsible for the generation of the mineralization inhibitor pyrophosphate (PPi) [294]. Loss-of function mutations in this enzyme are the cause of generalized arterial calcifications of infancy (GACI) [295,296], and hypophosphatemic rickets due to FGF-23-dependent renal phosphate-wasting [297,298]. The cause of FGF-23 excess may be directly related to lack of PPi production, or may be due to accumulation of precursors, such as ATP, in the extracellular space. However, the presence of mild hyperphosphatemia in individuals and carriers suffering from hypophosphatasia, which is caused by loss-of-function mutations in the PPi-degrading enzyme, namely tissue non-specific alkaline phosphatase (TNALP) [299], suggests that PPi is the intermediary suppressing FGF-23 production.

References [1] Coloso RM, King K, Fletcher JW, Weis P, Werner A, Ferraris RP. Dietary P regulates phosphate transporter expression, phosphatase activity, and effluent P partitioning in trout culture. J Comp Physiol B 2003;173:519e30. [2] Sugiura SH, Ferraris RP. Contributions of different NaPi cotransporter isoforms to dietary regulation of P transport in the pyloric caeca and intestine of rainbow trout. J Exp Biol 2004; 207:2055e64. [3] Sugiura SH, Hardy RW, Roberts RJ. The pathology of phosphorus deficiency in fish e a review. J Fish Dis 2004;27:255e65.

PEDIATRIC BONE

154

7. PHOSPHATE HOMEOSTASIS REGULATORY MECHANISMS

[4] Beyenbach KW. Kidneys sans glomeruli. Am J Physiol Renal Physiol 2004;286:F811e27. [5] Bijvoet OL, Reitsma PH. Phylogeny of renal phosphate transport in the vertebrates. Adv Exp Med Biol 1977;81:41e53. [6] Segawa H, Kaneko I, Takahashi A, et al. Growth-related renal type II Na/Pi cotransporter. J Biol Chem 2002;277:19665e72. [7] Quarles LD. Endocrine functions of bone in mineral metabolism regulation. J Clin Invest 2008;118:3820e8. [8] Strom TM, Ju¨ppner H. PHEX, FGF23, DMP1 and beyond. Curr Opin Nephrol Hypertens 2008;17:357e62. [9] Razzaque MS. The FGF23-Klotho axis: endocrine regulation of phosphate homeostasis. Nat Rev Endocrinol 2009;5:611e9. [10] Ju¨ppner H, Wolf M, Salusky IB. FGF23: more than a regulator of renal phosphate handling? J Bone Miner Res 2010;25:2091e7. [11] Kuro-o M. Overview of the FGF23-Klotho axis. Pediatr Nephrol 2010;25:583e90. [12] Bergwitz C, Ju¨ppner H. Regulation of phosphate homeostasis by PTH, vitamin D, and FGF23. Annu Rev Med 2010;61:91e104. [13] Tomoe Y, Segawa H, Shiozawa K, et al. Phosphaturic action of fibroblast growth factor 23 in Npt2 null mice. Am J Physiol Renal Physiol 2010;298:F1341e50. [14] Yu X, White KE. FGF23 and disorders of phosphate homeostasis. Cytokine Growth Factor Rev 2005;16:221e32. [15] Gattineni J, Baum M. Regulation of phosphate transport by fibroblast growth factor 23 (FGF23): implications for disorders of phosphate metabolism. Pediatr Nephrol 2010;25:591e601. [16] Bergwitz C, Ju¨ppner H. Disorders of phosphate homeostasis and tissue mineralisation. Endocr Dev 2009;16:133e56. [17] Parker BD, Schurgers LJ, Brandenburg VM, et al. The associations of fibroblast growth factor 23 and uncarboxylated matrix Gla protein with mortality in coronary artery disease: the Heart and Soul Study. Ann Intern Med 2010;152:640e8. [18] Kanbay M, Goldsmith D, Akcay A, Covic A. Phosphate e the silent stealthy cardiorenal culprit in all stages of chronic kidney disease: a systematic review. Blood Purif 2009;27:220e30. [19] Hruska KA, Mathew S, Lund R, Qiu P, Pratt R. Hyperphosphatemia of chronic kidney disease. Kidney Int 2008; 74:148e57. [20] Kuro-o M. A potential link between phosphate and aging e lessons from Klotho-deficient mice. Mech Ageing Dev 2010; 131:270e5. [21] Bringhurst FR, Leder BZ. Regulation of calcium and phosphate homeostasis. In: DeGroot LJ, Jameson JL, editors. Endocrinology. 5th ed. Philadelphia: W.B. Saunders Co.; 2006. p. 805e43. [22] Kuro-o M, Klotho. Pflu¨gers Arch 2010;459:333e43. [23] Berner W, Kinne R, Murer H. Phosphate transport into brushborder membrane vesicles isolated from rat small intestine. Biochem J 1976;160:467e74. [24] Danisi G, Bonjour JP, Straub RW. Regulation of Na-dependent phosphate influx across the mucosal border of duodenum by 1,25-dihydroxycholecalciferol. Pflu¨gers Arch 1980;388:227e32. [25] Lee DB, Walling MW, Corry DB. Phosphate transport across rat jejunum: influence of sodium, pH, and 1,25-dihydroxyvitamin D3. Am J Physiol 1986;251:G90e5. [26] Peterlik M, Wasserman RH. Effect of vitamin D on transepithelial phosphate transport in chick intestine. Am J Physiol 1978;234:E379e88. [27] Sabbagh Y, O’Brien SP, Song W, et al. Intestinal npt2b plays a major role in phosphate absorption and homeostasis. J Am Soc Nephrol 2009;20:2348e58. [28] Radanovic T, Wagner CA, Murer H, Biber J. Regulation of intestinal phosphate transport. I. Segmental expression and adaptation to low-P(i) diet of the type IIb Na(þ)-P(i)

[29]

[30]

[31]

[32]

[33]

[34]

[35] [36]

[37]

[38]

[39]

[40]

[41]

[42] [43]

[44]

[45]

[46]

[47]

cotransporter in mouse small intestine. Am J Physiol Gastrointest Liver Physiol 2005;288:G496e500. Stauber A, Radanovic T, Stange G, Murer H, Wagner CA, Biber J. Regulation of intestinal phosphate transport. II. Metabolic acidosis stimulates Na(þ)-dependent phosphate absorption and expression of the Na(þ)-P(i) cotransporter NaPi-IIb in small intestine. Am J Physiol Gastrointest Liver Physiol 2005; 288:G501e6. Collins JF, Bai L, Ghishan FK. The SLC20 family of proteins: dual functions as sodium-phosphate cotransporters and viral receptors. Pflu¨gers Arch 2004;447:647e52. Katai K, Miyamoto K, Kishida S, et al. Regulation of intestinal Naþ-dependent phosphate co-transporters by a low-phosphate diet and 1,25-dihydroxyvitamin D3. Biochem J 1999;343:705e12. Berndt T, Thomas LF, Craig TA, et al. Evidence for a signaling axis by which intestinal phosphate rapidly modulates renal phosphate reabsorption. Proc Natl Acad Sci USA 2007;104: 11085e90. Butterworth PJ, Younus MJ. Uptake of phosphate by rat hepatocytes in primary culture: a sodium-dependent system that is stimulated by insulin. Biochim Biophys Acta 1993;1148:117e22. Polgreen KE, Kemp GJ, Leighton B, Radda GK. Modulation of Pi transport in skeletal muscle by insulin and IGF-1. Biochim Biophys Acta 1994;1223:279e84. Marinella MA. The refeeding syndrome and hypophosphatemia. Nutr Rev 2003;61:320e3. Beck L, Leroy C, Beck-Cormier S, et al. The phosphate transporter PiT1 (Slc20a1) revealed as a new essential gene for mouse liver development. PLoS One 2010;5:e9148. Nafidi O, Lepage R, Lapointe RW, D’Amour P. Hepatic resection-related hypophosphatemia is of renal origin as manifested by isolated hyperphosphaturia. Ann Surg 2007;245:1000e2. Salem RR, Tray K. Hepatic resection-related hypophosphatemia is of renal origin as manifested by isolated hyperphosphaturia. Ann Surg 2005;241:343e8. Caverzasio J, Bonjour JP. Characteristics and regulation of Pi transport in osteogenic cells for bone metabolism. Kidney Int 1996;49:975e80. Gupta A, Miyauchi A, Fujimori A, Hruska KA. Phosphate transport in osteoclasts: a functional and immunochemical characterization. Kidney Int 1996;49:968e74. Baylink D, Wergedal J, Stauffer M. Formation, mineralization, and resorption of bone in hypophosphatemic rats. J Clin Invest 1971;50:2519e30. Albright F, Butler AM, Bloomberg E. Rickets resistant to vitamin D therapy. Am J Dis Child 1937;54:529e47. Bergwitz C, Roslin NM, Tieder M, et al. SLC34A3 mutations in patients with hereditary hypophosphatemic rickets with hypercalciuria predict a key role for the sodium-phosphate cotransporter NaPi-IIc in maintaining phosphate homeostasis. Am J Hum Genet 2006;78:179e92. Ichikawa S, Sorenson AH, Imel EA, Friedman NE, Gertner JM, Econs MJ. Intronic deletions in the SLC34A3 gene cause hereditary hypophosphatemic rickets with hypercalciuria. J Clin Endocrinol Metab 2006;91:4022e7. Lorenz-Depiereux B, Benet-Pages A, Eckstein G, et al. Hereditary hypophosphatemic rickets with hypercalciuria is caused by mutations in the sodium-phosphate cotransporter gene SLC34A3. Am J Hum Genet 2006;78:193e201. HYP-Consortium. A. gene (PEX) with homologies to endopeptidases is mutated in patients with X-linked hypophosphatemic rickets. Nat Genet 1995;11:130e6. Feng JQ, Ward LM, Liu S, et al. Loss of DMP1 causes rickets and osteomalacia and identifies a role for osteocytes in mineral metabolism. Nat Genet 2006;38:1310e5.

PEDIATRIC BONE

155

REFERENCES

[48] Lorenz-Depiereux B, Bastepe M, Benet-Pages A, et al. DMP1 mutations in autosomal recessive hypophosphatemia implicate a bone matrix protein in the regulation of phosphate homeostasis. Nat Genet 2006;38:1248e50. [49] Anderson DM, Maraskovsky E, Billingsley WL, et al. A homologue of the TNF receptor and its ligand enhance T-cell growth and dendritic-cell function. Nature 1997;390:175e9. [50] Lacey DL, Timms E, Tan HL, et al. Osteoprotegerin ligand is a cytokine that regulates osteoclast differentiation and activation. Cell 1998;93:165e76. [51] Wong BR, Rho J, Arron J, et al. TRANCE is a novel ligand of the tumor necrosis factor receptor family that activates c-Jun N-terminal kinase in T cells. J Biol Chem 1997;272:25190e4. [52] Yasuda H, Shima N, Nakagawa N, et al. Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesisinhibitory factor and is identical to TRANCE/RANKL. Proc Natl Acad Sci USA 1998;95:3597e602. [53] Kramer I, Halleux C, Keller H, et al. Osteocyte Wnt/beta-catenin signaling is required for normal bone homeostasis. Mol Cell Biol 2010;30:3071e85. [54] Simonet WS, Lacey DL, Dunstan CR, et al. Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell 1997;89:309e19. [55] Gupta A, Guo XL, Alvarez UM, Hruska KA. Regulation of sodium-dependent phosphate transport in osteoclasts. J Clin Invest 1997;100:538e49. [56] Yates AJ, Oreffo RO, Mayor K, Mundy GR. Inhibition of bone resorption by inorganic phosphate is mediated by both reduced osteoclast formation and decreased activity of mature osteoclasts. J Bone Miner Res 1991;6:473e8. [57] Kanatani M, Sugimoto T, Kano J, Kanzawa M, Chihara K. Effect of high phosphate concentration on osteoclast differentiation as well as bone-resorbing activity. J Cell Physiol 2003;196:180e9. [58] Mozar A, Haren N, Chasseraud M, et al. High extracellular inorganic phosphate concentration inhibits RANK-RANKL signaling in osteoclast-like cells. J Cell Physiol 2008;215:47e54. [59] Zoidis E, Ghirlanda-Keller C, Gosteli-Peter M, Zapf J, Schmid C. Regulation of phosphate (Pi) transport and NaPi-III transporter (Pit-1) mRNA in rat osteoblasts. J Endocrinol 2004;181:531e40. [60] Caverzasio J, Selz T, Bonjour JP. Characteristics of phosphate transport in osteoblastlike cells. Calcif Tissue Int 1988;43:83e7. [61] Selz T, Caverzasio J, Bonjour JP. Regulation of Na-dependent Pi transport by parathyroid hormone in osteoblast-like cells. Am J Physiol 1989;256:E93e100. [62] Montessuit C, Bonjour JP, Caverzasio J. Pi transport regulation by chicken growth plate chondrocytes. Am J Physiol 1994; 267:E24e31. [63] Palmer G, Bonjour JP, Caverzasio J. Expression of a newly identified phosphate transporter/retrovirus receptor in human SaOS-2 osteoblast-like cells and its regulation by insulin-like growth factor I. Endocrinology 1997;138:5202e9. [64] Suzuki A, Palmer G, Bonjour JP, Caverzasio J. Stimulation of sodium-dependent phosphate transport and signaling mechanisms induced by basic fibroblast growth factor in MC3T3-E1 osteoblast-like cells. J Bone Miner Res 2000;15:95e102. [65] Zhen X, Bonjour JP, Caverzasio J. Platelet-derived growth factor stimulates sodium-dependent Pi transport in osteoblastic cells via phospholipase Cgamma and phosphatidylinositol 30 -kinase. J Bone Miner Res 1997;12:36e44. [66] Caverzasio J, Palmer G, Suzuki A, Bonjour JP. Mechanism of the mitogenic effect of fluoride on osteoblast-like cells: evidences for a G protein-dependent tyrosine phosphorylation process. J Bone Miner Res 1997;12:1975e83. [67] Khoshniat S, Bourgine A, Julien M, Weiss P, Guicheux J, Beck L. The emergence of phosphate as a specific signaling molecule

[68]

[69] [70]

[71]

[72]

[73]

[74]

[75]

[76]

[77]

[78]

[79]

[80]

[81]

[82]

[83]

[84]

[85]

in bone and other cell types in mammals. Cell Mol Life Sci 2010;68:205e18. Williams DC, Frolik CA. Physiological and pharmacological regulation of biological calcification. Int Rev Cytol 1991;126:195e292. Anderson HC. Matrix vesicle calcification. Fed Proc 1976;35:104. Felix R, Herrmann W, Fleisch H. Stimulation of precipitation of calcium phosphate by matrix vesicles. Biochem J 1978;170:681e91. Genge BR, Cao X, Wu LN, et al. Establishment of the primary structure of the major lipid-dependent Ca2þ binding proteins of chicken growth plate cartilage matrix vesicles: identity with anchorin CII (annexin V) and annexin II. J Bone Miner Res 1992;7:807e19. Montessuit C, Caverzasio J, Bonjour JP. Characterization of a Pi transport system in cartilage matrix vesicles. Potential role in the calcification process. J Biol Chem 1991;266:17791e7. Kakuta S, Golub EE, Shapiro IM. Morphochemical analysis of phosphorus pools in calcifying cartilage. Calcif Tissue Int 1985;37:293e9. Wang D, Canaff L, Davidson D, et al. Alterations in the sensing and transport of phosphate and calcium by differentiating chondrocytes. J Biol Chem 2001;276:33995e4005. Fujita T, Meguro T, Izumo N, et al. Phosphate stimulates differentiation and mineralization of the chondroprogenitor clone ATDC5. Jpn J Pharmacol 2001;85:278e81. Magne D, Bluteau G, Faucheux C, et al. Phosphate is a specific signal for ATDC5 chondrocyte maturation and apoptosisassociated mineralization: possible implication of apoptosis in the regulation of endochondral ossification. J Bone Miner Res 2003;18:1430e42. Miedlich SU, Zalutskaya A, Zhu ED, Demay MB. Phosphateinduced apoptosis of hypertrophic chondrocytes is associated with a decrease in mitochondrial membrane potential and is dependent upon Erk1/2 phosphorylation. J Biol Chem 2010; 285:18270e5. Magne D, Julien M, Vinatier C, Merhi-Soussi F, Weiss P, Guicheux J. Cartilage formation in growth plate and arteries: from physiology to pathology. Bioessays 2005;27:708e16. Cecil DL, Rose DM, Terkeltaub R, Liu-Bryan R. Role of interleukin-8 in PiT-1 expression and CXCR1-mediated inorganic phosphate uptake in chondrocytes. Arthritis Rheum 2005; 52:144e54. Alini M, Carey D, Hirata S, Grynpas MD, Pidoux I, Poole AR. Cellular and matrix changes before and at the time of calcification in the growth plate studied in vitro: arrest of type X collagen synthesis and net loss of collagen when calcification is initiated. J Bone Miner Res 1994;9:1077e87. Mansfield K, Rajpurohit R, Shapiro IM. Extracellular phosphate ions cause apoptosis of terminally differentiated epiphyseal chondrocytes. J Cell Physiol 1999;179:276e86. Mansfield K, Teixeira CC, Adams CS, Shapiro IM. Phosphate ions mediate chondrocyte apoptosis through a plasma membrane transporter mechanism. Bone 2001;28:1e8. Teixeira CC, Mansfield K, Hertkorn C, Ischiropoulos H, Shapiro IM. Phosphate-induced chondrocyte apoptosis is linked to nitric oxide generation. Am J Physiol Cell Physiol 2001;281: C833e9. Sabbagh Y, Carpenter TO, Demay MB. Hypophosphatemia leads to rickets by impairing caspase-mediated apoptosis of hypertrophic chondrocytes. Proc Natl Acad Sci USA 2005; 102:9637e42. Mansfield K, Pucci B, Adams CS, Shapiro IM. Induction of apoptosis in skeletal tissues: phosphate-mediated chick

PEDIATRIC BONE

156

[86]

[87]

[88]

[89]

[90]

[91]

[92] [93]

[94]

[95]

[96]

[97]

[98]

[99]

[100]

[101]

[102]

[103]

[104] [105]

7. PHOSPHATE HOMEOSTASIS REGULATORY MECHANISMS

chondrocyte apoptosis is calcium dependent. Calcif Tissue Int 2003;73:161e72. Bellows CG, Heersche JN, Aubin JE. Inorganic phosphate added exogenously or released from beta-glycerophosphate initiates mineralization of osteoid nodules in vitro. Bone Miner 1992; 17:15e29. Quarles LD, Yohay DA, Lever LW, Caton R, Wenstrup RJ. Distinct proliferative and differentiated stages of murine MC3T3-E1 cells in culture: an in vitro model of osteoblast development. J Bone Miner Res 1992;7:683e92. Conrads KA, Yi M, Simpson KA, et al. A combined proteome and microarray investigation of inorganic phosphate-induced pre-osteoblast cells. Mol Cell Proteomics 2005;4:1284e96. Kanatani M, Sugimoto T, Kano J, Chihara K. IGF-I mediates the stimulatory effect of high phosphate concentration on osteoblastic cell proliferation. J Cell Physiol 2002;190:306e12. Conrads KA, Yu LR, Lucas DA, et al. Quantitative proteomic analysis of inorganic phosphate-induced murine MC3T3-E1 osteoblast cells. Electrophoresis 2004;25:1342e52. Beck Jr GR, Moran E, Knecht N. Inorganic phosphate regulates multiple genes during osteoblast differentiation, including Nrf2. Exp Cell Res 2003;288:288e300. Baylink DJ, Finkelman RD, Mohan S. Growth factors to stimulate bone formation. J Bone Miner Res 1993;8(Suppl. 2):S565e72. Beck Jr GR, Sullivan EC, Moran E, Zerler B. Relationship between alkaline phosphatase levels, osteopontin expression, and mineralization in differentiating MC3T3-E1 osteoblasts. J Cell Biochem 1998;68:269e80. Beck Jr GR, Zerler B, Moran E. Phosphate is a specific signal for induction of osteopontin gene expression. Proc Natl Acad Sci USA 2000;97:8352e7. Wittrant Y, Bourgine A, Khoshniat S, et al. Inorganic phosphate regulates Glvr-1 and -2 expression: role of calcium and ERK1/2. Biochem Biophys Res Commun 2009;381:259e63. Julien M, Khoshniat S, Lacreusette A, et al. Phosphate-dependent regulation of MGP in osteoblasts: role of ERK1/2 and Fra-1. J Bone Miner Res 2009;24:1856e68. Adams CS, Mansfield K, Perlot RL, Shapiro IM. Matrix regulation of skeletal cell apoptosis. Role of calcium and phosphate ions. J Biol Chem 2001;276:20316e22. Meleti Z, Shapiro IM, Adams CS. Inorganic phosphate induces apoptosis of osteoblast-like cells in culture. Bone 2000;27:359e66. Bonjour JP, Caverzasio J, Fleisch H, Muhlbauer R, Troehler U. The adaptive system of the tubular transport of phosphate. Adv Exp Med Biol 1982;151:1e11. Bonjour JP, Fleisch H. Tubular adaption to the supply and requirement of phosphate. In: Massry SG, Fleisch H, editors. Renal Handling of Phosphate. New York: Plenum; 1980. p. 243e64. Berndt J, Knox FG. Renal regulation of phosphate excretion. In: Seldin DW, Giebisch G, editors. The Kidney: Physiology and Pathophysiology. New York: Raven Press; 1992. p. 2511e32. Silve C, Friedlander G. Regulation of phosphate excretion. In: Seldin DW, Giebisch G, editors. The Kidney: Physiology and Pathophysiology. Philadelphia: Lippincott Williams&Wilkins; 2000. p. 1885e904. Biber J, Hernando N, Forster I, Murer H. Regulation of phosphate transport in proximal tubules. Pflu¨gers Arch 2009;458: 39e52. Suki W, Lederer E, Rouse D. Renal Transport of Calcium, Magnesium, and Phosphate. Philadelphia: W.B. Saunders; 2000. Bonjour JP, Caverzasio J. Phosphate transport in the kidney. Rev Physiol Biochem Pharmacol 1984;100:161e214.

[106] Bijvoet OLM. The importance of the kidneys in phosphate homeostasis. In: Avioli LV, editor. Phosphate Metabolism, Kidney and Bone. Paris: Armour Montagu; 1976. p. 421e74. [107] Ju¨ppner H, Portale A. Endocrine regulation of phosphate homeostasis. In: Singh AK, Williams GH, editors. Textbook of Nephro-Endocrinology. New York: Academic Press; 2009. [108] Murer H, Hernando N, Forster I, Biber J. Proximal tubular phosphate reabsorption: molecular mechanisms. Physiol Rev 2000;80:1373e409. [109] Murer H, Kaissling B, Forster I, Biber J, editors. Cellular mechanisms in proximal tubular handling. 3rd ed. New York: Lippincott Williams & Wilkins; 2000. [110] Barac-Nieto M, Alfred M, Spitzer A. Basolateral phosphate transport in renal proximal-tubule-like OK cells. Exp Biol Med (Maywood) 2002;227:626e31. [111] Custer M, Meier F, Schlatter E, et al. Localization of NaPi-1, a Na-Pi cotransporter, in rabbit kidney proximal tubules. I. mRNA localization by reverse transcription/polymerase chain reaction. Pflu¨gers Arch 1993;424:203e9. [112] Segawa H, Sawai Y, Tominaga R et al. Inorganic phosphate homeostasis in the type I Na/Pi co-transporter (NPT1) null mice. Renal Week 2009. San Diego; abstract F-FC255. [113] Werner A, Moore ML, Mantei N, Biber J, Semenza G, Murer H. Cloning and expression of cDNA for a Na/Pi cotransport system of kidney cortex. Proc Natl Acad Sci USA 1991;88: 9608e12. [114] Magagnin S, Werner A, Markovich D, et al. Expression cloning of human and rat renal cortex Na/Pi cotransport. Proc Natl Acad Sci USA 1993;90:5979e83. [115] Ohkido I, Segawa H, Yanagida R, Nakamura M, Miyamoto K. Cloning, gene structure and dietary regulation of the type-IIc Na/Pi cotransporter in the mouse kidney. Pflu¨gers Arch 2003; 446:106e15. [116] Hilfiker H, Hattenhauer O, Traebert M, Forster I, Murer H, Biber J. Characterization of a murine type II sodium-phosphate cotransporter expressed in mammalian small intestine. Proc Natl Acad Sci USA 1998;95:14564e9. [117] Forster IC, Loo DD, Eskandari S. Stoichiometry and Naþ binding cooperativity of rat and flounder renal type II Naþ-Pi cotransporters. Am J Physiol 1999;276:F644e9. [118] Kavanaugh MP, Kabat D. Identification and characterization of a widely expressed phosphate transporter/retrovirus receptor family. Kidney Int 1996;49:959e63. [119] Breusegem SY, Takahashi H, Giral-Arnal H, et al. Differential regulation of the renal sodium-phosphate cotransporters NaPiIIa, NaPi-IIc, and PiT-2 in dietary potassium deficiency. Am J Physiol Renal Physiol 2009;297:F350e61. [120] Ju¨ppner H, Gardella TJ, Brown EM, Kronenberg HM, Potts Jr JT. Parathyroid hormone and parathyroid hormone-related peptide in the regulation of calcium homeostasis and bone development. In: DeGroot LJ, Jameson JL, editors. Endocrinology. Philadelphia: Elsevier Saunders; 2006. p. 1377e417. [121] Potts Jr JT, Ju¨ppner H. Parathyroid hormone and parathyroid hormone-related peptide in calcium homeostasis, bone metabolism, and bone development: the proteins, their genes, and receptors. In: Avioli L, Krane S, editors. Metabolic Bone Disease. New York: Academic Press; 1997. p. 51e94. [122] White KE, Larsson TE, Econs MJ. The roles of specific genes implicated as circulating factors involved in normal and disordered phosphate homeostasis: frizzled related protein-4, matrix extracellular phosphoglycoprotein, and fibroblast growth factor 23. Endocr Rev 2006;27:221e41. [123] Urakawa I, Yamazaki Y, Shimada T, et al. Klotho converts canonical FGF receptor into a specific receptor for FGF23. Nature 2006;444:770e4.

PEDIATRIC BONE

REFERENCES

[124] Miyamoto KI, Ito M, Tatsumi S, Kuwahata M, Segawa H. New aspect of renal phosphate reabsorption: the type IIc sodiumdependent phosphate transporter. Am J Nephrol 2007;27: 503e15. [125] Forster IC, Hernando N, Biber J, Murer H. Proximal tubular handling of phosphate: A molecular perspective. Kidney Int 2006;70:1548e59. [126] Murer H, Forster I, Biber J. The sodium phosphate cotransporter family SLC34. Pflu¨gers Arch 2004;447:763e7. [127] Stubbs J, Liu S, Quarles LD. Role of fibroblast growth factor 23 in phosphate homeostasis and pathogenesis of disordered mineral metabolism in chronic kidney disease. Semin Dial 2007;20:302e8. [128] Segawa H, Onitsuka A, Kuwahata M, et al. Type IIc sodiumdependent phosphate transporter regulates calcium metabolism. J Am Soc Nephrol 2009;20:104e13. [129] Silver J, Naveh-Many T. FGF23 and the parathyroid glands. Pediatr Nephrol 2010;25:2241e5. [130] Krajisnik T, Bjorklund P, Marsell R, et al. Fibroblast growth factor23 regulates parathyroid hormone and 1alpha-hydroxylase expression in cultured bovine parathyroid cells. J Endocrinol 2007;195:125e31. [131] Wilz DR, Gray RW, Dominguez JH, Lemann Jr J. Plasma 1,25(OH)2-vitamin D concentrations and net intestinal calcium, phosphate, and magnesium absorption in humans. Am J Clin Nutr 1979;32:2052e60. [132] Nabeshima Y. Discovery of alpha-klotho unveiled new insights into calcium and phosphate homeostasis. Proc Jpn Acad Ser B Phys Biol Sci 2009;85:125e41. [133] Kuro-o M. Endocrine FGFs and klothos: emerging concepts. Trends Endocrinol Metab 2008;19:239e45. [134] Bikle D. Nonclassic actions of vitamin D. J Clin Endocrinol Metab 2009;94:26e34. [135] Silver J, Levi R. Regulation of PTH synthesis and secretion relevant to the management of secondary hyperparathyroidism in chronic kidney disease. Kidney Int Suppl 2005;95:S8e12. [136] Gardella TJ. Mimetic ligands for the PTHR1: approaches developments, and considerations. IBMS BoneKey 2009:71e85. [137] Kronenberg HM. PTH regulates the hematopoietic stem cell niche in bone. Adv Exp Med Biol 2007;602:57e60. [138] Kemper B, Habener JF, Rich A, Potts Jr JT. Parathyroid secretion: discovery of a major calcium-dependent protein. Science 1974;184:167e9. [139] Moallem E, Kilav R, Silver J, Naveh-Many T. RNA-protein binding and post-transcriptional regulation of parathyroid hormone gene expression by calcium and phosphate. J Biol Chem 1998;273:5253e9. [140] Naveh-Many T, Rahaminov R, Livini N, Silver J. Parathyroid cell proliferation in normal and chronic renal failure in rats. The effects of calcium, phosphate, and vitamin D. J Clin Invest 1995; 96:1786e93. [141] Diaz R, Brown EM. Familial hypocalciuric hypercalcemia and other disorders due to calcium-sensing receptor mutations. In: DeGroot LJ, Jameson JL, editors. Endocrinology. Philadelphia: Elsevier Saunders; 2006. p. 1595e609. [142] Wettschureck N, Lee E, Libutti SK, Offermanns S, Robey PG, Spiegel AM. Parathyroid-specific double knockout of Gq and G11 alpha-subunits leads to a phenotype resembling germline knockout of the extracellular Ca2þ-sensing receptor. Mol Endocrinol 2007;21:274e80. [143] Quinn SJ, Kifor O, Kifor I, Butters Jr RR, Brown EM. Role of the cytoskeleton in extracellular calcium-regulated PTH release. Biochem Biophys Res Commun 2007;354:8e13.

157

[144] Pollak MR, Brown EM, Estep HL, et al. Autosomal dominant hypocalcaemia caused by a Ca2þ-sensing receptor gene mutation. Nat Genet 1994;8:303e7. [145] Pollak MR, Brown EM, WuChou YH, et al. Mutations in the human Ca2þ-sensing receptor gene cause familial hypocalciuric hypercalcemia and neonatal severe hyperparathyroidism. Cell 1993;75:1297e303. [146] Silver J, Russell J, Sherwood LM. Regulation by vitamin D metabolites of messenger ribronucleic acid for preproparathyroid hormone in isolated bovine parathyroid cells. Proc Natl Acad Sci USA 1985;82:4270e3. [147] Peters H, Neubuser A, Kratochwil K, Balling R. Pax9-deficient mice lack pharyngeal pouch derivatives and teeth and exhibit craniofacial and limb abnormalities. Genes Dev 1998;12: 2735e47. [148] Ding C, Buckingham B, Levine MA. Familial isolated hypoparathyroidism caused by a mutation in the gene for the transcription factor GCMB. J Clin Invest 2001;108:1215e20. [149] Van Esch H, Groenen P, Nesbit MA, et al. GATA3 haploinsufficiency causes human HDR syndrome. Nature 2000;406: 419e22. [150] Kilav R, Silver J, Naveh-Many T. Parathyroid hormone gene expression in hypophosphatemic rats. J Clin Invest 1995; 96:327e33. [151] Galitzer H, Ben-Dov I, Lavi-Moshayoff V, Naveh-Many T, Silver J. Fibroblast growth factor 23 acts on the parathyroid to decrease parathyroid hormone secretion. Curr Opin Nephrol Hypertens 2008;17:363e7. [152] Galitzer H, Lavi-Moshayoff V, Nechama M, Meir T, Silver J, Naveh-Many T. The calcium-sensing receptor regulates parathyroid hormone gene expression in transfected HEK293 cells. BMC Biol 2009;7:17. [153] Ben-Dov IZ, Galitzer H, Lavi-Moshayoff V, et al. The parathyroid is a target organ for FGF23 in rats. J Clin Invest 2007; 117:4003e8. [154] Ichikawa S, Imel EA, Kreiter ML, et al. A homozygous missense mutation in human KLOTHO causes severe tumoral calcinosis. J Clin Invest 2007;117:2684e91. [155] Imura A, Tsuji Y, Murata M, et al. alpha-Klotho as a regulator of calcium homeostasis. Science 2007;316:1615e8. [156] Kousteni S, Bilezikian JP. The cell biology of parathyroid hormone in osteoblasts. Curr Osteoporos Rep 2008;6:72e6. [157] Mahon MJ. Ezrin promotes functional expression and parathyroid hormone-mediated regulation of the sodium-phosphate cotransporter 2a in LLC-PK1 cells. Am J Physiol Renal Physiol 2008;294:F667e75. [158] Nagai S, Okazaki M, Segawa H, et al. Acute down-regulation of sodium-dependent phosphate transporter NPT2a involves predominantly the cAMP/PKA pathway as revealed by signaling-selective parathyroid hormone analogs. J Biol Chem 2010;286:1618e26. [159] Guo J, Liu M, Yang D, et al. Phospholipase C signaling via the parathyroid hormone (PTH)/PTH-related peptide receptor is essential for normal bone responses to PTH. Endocrinology 2010;151:3502e13. [160] Alpern RJ. Cell mechanisms of proximal tubule acidification. Physiol Rev 1990;70:79e114. [161] Mensenkamp AR, Hoenderop JG, Bindels RJ. TRPV5, the gateway to Ca2þ homeostasis. Handb Exp Pharmacol 2007; 179:207e20. [162] Friedman PA, Gesek FA. Calcium transport in renal epithelial cells. Am J Physiol 1993;264:F181e98. [163] Calvi L, Sims N, Hunzelman J, et al. Activation of the PTH/ PTHrP receptor in osteoblastic cells has differential effects on cortical and trabecular bone. J Clin Invest 2001;107:277e86.

PEDIATRIC BONE

158

7. PHOSPHATE HOMEOSTASIS REGULATORY MECHANISMS

[164] Schipani E, Lanske B, Hunzelman J, et al. Targeted expression of constitutively active PTH/PTHrP receptors delays endochondral bone formation and rescues PTHrP-less mice. Proc Natl Acad Sci USA 1997;94:13689e94. [165] Guo J, Chung U-i, Kondo H, Brighurst FR, Kronenberg HM. The PTH/PTHrP receptor can delay chondrocyte hypertrophy in vivo without activating phospholipase C. Mol Cell 2002;3: 183e94. [166] Miao D, He B, Karaplis A, Goltzman D. Parathyroid hormone is essential for normal fetal bone formation. J Clin Invest 2002;109:1173e82. [167] Bai X, Miao D, Goltzman D, Karaplis AC. Early lethality in Hyp mice with targeted deletion of Pth gene. Endocrinology 2007; 148:4974e83. [168] Lanske B, Karaplis AC, Luz A, et al. PTH/PTHrP receptor in early development and Indian hedgehog-regulated bone growth. Science 1996;273:663e6. [169] Zhang P, Jobert AS, Couvineau A, Silve C. A homozygous inactivating mutation in the parathyroid hormone/parathyroid hormone-related peptide receptor causing Blomstrand chondrodysplasia. J Clin Endocrinol Metab 1998;83:3365e8. [170] Karperien MC, van der Harten HJ, van Schooten R, et al. A frame-shift mutation in the type I parathyroid hormone/ parathyroid hormone-related peptide receptor causing Blomstrand lethal osteochondrodysplasia. J Clin Endocrinol Metab 1999;84:3713e20. [171] Bounoutas GS, Tawfeek H, Frohlich LF, Chung UI, AbouSamra AB. Impact of impaired receptor internalization on calcium homeostasis in knock-in mice expressing a phosphorylation-deficient parathyroid hormone (PTH)/PTH-related peptide receptor. Endocrinology 2006;147:4674e9. [172] Burnett-Bowie SM, Henao MP, Dere ME, Lee H, Leder BZ. Effects of hPTH(1-34) infusion on circulating serum phosphate, 1,25-dihydroxyvitamin D, and FGF23 levels in healthy men. J Bone Miner Res 2009;24:1681e5. [173] Chang W, Tu C, Chen TH, Bikle D, Shoback D. The extracellular calcium-sensing receptor (CaSR) is a critical modulator of skeletal development. Sci Signal 2008;1. ra1. [174] Gupta A, Winer K, Econs M, Marx S, Collins M. FGF-23 is elevated by chronic hyperphosphatemia. J Clin Endocrinol Metab 2004;89:4489e92. [175] O’Brien CA, Plotkin LI, Galli C, et al. Control of bone mass and remodeling by PTH receptor signaling in osteocytes. PLoS One 2008;3:e2942. [176] Wu JY, Purton LE, Rodda SJ, et al. Osteoblastic regulation of B lymphopoiesis is mediated by Gs{alpha}-dependent signaling pathways. Proc Natl Acad Sci USA 2008;105:16976e81. [177] Yamamoto T, Miyamoto KI, Ozono K, et al. Hypophosphatemic rickets accompanying McCune-Albright syndrome: evidence that a humoral factor causes hypophosphatemia. J Bone Miner Metab 2001;19:287e95. [178] Riminucci M, Collins MT, Fedarko NS, et al. FGF-23 in fibrous dysplasia of bone and its relationship to renal phosphate wasting. J Clin Invest 2003;112:683e92. [179] Collins MT, Chebli C, Jones J, et al. Renal phosphate wasting in fibrous dysplasia of bone is part of a generalized renal tubular dysfunction similar to that seen in tumor-induced osteomalacia. J Bone Miner Res 2001;16:806e13. [180] Brown AJ, Slatopolsky E. Vitamin D analogs: therapeutic applications and mechanisms for selectivity. Mol Aspects Med 2008;29:433e52. [181] Lavi-Moshayoff V, Wasserman G, Meir T, Silver J, NavehMany T. PTH increases FGF23 gene expression and mediates the high-FGF23 levels of experimental kidney failure: a bone

[182]

[183] [184]

[185]

[186]

[187]

[188] [189]

[190]

[191]

[192]

[193]

[194]

[195] [196]

[197]

[198]

[199]

[200]

parathyroid feedback loop. Am J Physiol Renal Physiol 2010; 299:F882e9. Boullion R. Vitamin D: from photosynthesis, metabolism, and action to clinical application. In: DeGroot LJ, Jameson JL, editors. Endocrinology. Philadelphia: Elsevier Saunders; 2006. p. 1435e63. Sakaki T, Kagawa N, Yamamoto K, Inouye K. Metabolism of vitamin D3 by cytochromes P450. Front Biosci 2005;10:119e34. Bai XY, Miao D, Goltzman D, Karaplis AC. The autosomal dominant hypophosphatemic rickets R176Q mutation in fibroblast growth factor 23 resists proteolytic cleavage and enhances in vivo biological potency. J Biol Chem 2003;278:9843e9. Carpenter TO, Ellis BK, Insogna KL, Philbrick WM, Sterpka J, Shimkets R. Fibroblast growth factor 7: an inhibitor of phosphate transport derived from oncogenic osteomalacia-causing tumors. J Clin Endocrinol Metab 2005;90:1012e20. Berndt T, Craig T, Bowe A, et al. Secreted frizzled-related protein 4 is a potent tumor-derived phosphaturic agent. J Clin Invest 2003;112:785e94. Sommer S, Berndt T, Craig T, Kumar R. The phosphatonins and the regulation of phosphate transport and vitamin D metabolism. J Steroid Biochem Mol Biol 2007;103:497e503. DeLuca HF. The metabolism and functions of vitamin D. Adv Exp Med Biol 1986;196:361e75. Inoue Y, Segawa H, Kaneko I, et al. Role of the vitamin D receptor in FGF23 action on phosphate metabolism. Biochem J 2005;390:325e31. Li YC, Pirro AE, Amling M, et al. Targeted ablation of the vitamin D receptor: an animal model of vitamin D-dependent rickets type II with alopecia. Proc Natl Acad Sci USA 1997;94:9831e5. Panda DK, Miao D, Tremblay ML, et al. Targeted ablation of the 25-hydroxyvitamin D 1alpha-hydroxylase enzyme: evidence for skeletal, reproductive, and immune dysfunction. Proc Natl Acad Sci USA 2001;98:7498e503. Kitanaka S, Takeyama K, Murayama A, et al. Inactivating mutations in the 25-hydroxyvitamin D3 1alpha-hydroxylase gene in patients with pseudovitamin D-deficiency rickets. N Engl J Med 1998;338:653e61. Hughes MR, Malloy PJ, Kieback DG, et al. Point mutations in the human vitamin D receptor gene associated with hypocalcemic rickets. Science 1988;242:1702e5. Suzuki Y, Landowski CP, Hediger MA. Mechanisms and regulation of epithelial Ca2þ absorption in health and disease. Annu Rev Physiol 2008;70:257e71. DeLuca HF. New developments in the vitamin D endocrine system. J Am Diet Assoc 1982;80:231e7. Capuano P, Radanovic T, Wagner CA, et al. Intestinal and renal adaptation to a low-Pi diet of type II NaPi cotransporters in vitamin D receptor- and 1alphaOHase-deficient mice. Am J Physiol Cell Physiol 2005;288:C429e34. Segawa H, Kaneko I, Yamanaka S, et al. Intestinal Na-P(i) cotransporter adaptation to dietary P(i) content in vitamin D receptor null mice. Am J Physiol Renal Physiol 2004;287:F39e47. Amling M, Priemel M, Holzmann T, et al. Rescue of the skeletal phenotype of vitamin D receptor-ablated mice in the setting of normal mineral ion homeostasis: formal histomorphometric and biomechanical analyses. Endocrinology 1999;140:4982e7. Kolek OI, Hines ER, Jones MD, et al. 1alpha,25-Dihydroxyvitamin D3 upregulates FGF23 gene expression in bone: the final link in a renal-gastrointestinal-skeletal axis that controls phosphate transport. Am J Physiol Gastrointest Liver Physiol 2005;289:G1036e42. Demay MB, Kiernan MS, DeLuca HF, Kronenberg HM. Sequences in the human parathyroid hormone gene that bind the 1,25-dihydroxyvitamin D3 receptor and mediate

PEDIATRIC BONE

REFERENCES

[201]

[202]

[203]

[204]

[205]

[206]

[207]

[208]

[209]

[210]

[211]

[212]

[213]

[214]

[215]

[216]

[217]

transcriptional repression in response to 1,25-dihydroxyvitamin D3. Proc Natl Acad Sci USA 1992;89:8097e101. Canaff L, Hendy GN. Human calcium-sensing receptor gene. Vitamin D response elements in promoters P1 and P2 confer transcriptional responsiveness to 1,25-dihydroxyvitamin D. J Biol Chem 2002;277:30337e50. Nishi H, Nii-Kono T, Nakanishi S, et al. Intravenous calcitriol therapy increases serum concentrations of fibroblast growth factor-23 in dialysis patients with secondary hyperparathyroidism. Nephron Clin Pract 2005;101:c94e9. Yu X, Sabbagh Y, Davis SI, Demay MB, White KE. Genetic dissection of phosphate- and vitamin D-mediated regulation of circulating Fgf23 concentrations. Bone 2005;36:971e7. Murayama A, Takeyama K, Kitanaka S, et al. Positive and negative regulations of the renal 25-hydroxyvitamin D3 1alphahydroxylase gene by parathyroid hormone, calcitonin, and 1alpha,25(OH)2D3 in intact animals. Endocrinology 1999; 140:2224e31. Masuyama R, Stockmans I, Torrekens S, et al. Vitamin D receptor in chondrocytes promotes osteoclastogenesis and regulates FGF23 production in osteoblasts. J Clin Invest 2006; 116:3150e9. Yamashita T, Yoshioka M, Itoh N. Identification of a novel fibroblast growth factor, FGF-23, preferentially expressed in the ventrolateral thalamic nucleus of the brain. Biochem Biophys Res Commun 2000;277:494e8. ADHR Consortium T, White KE, Evans WE, O’Riordan JLH, et al. Autosomal dominant hypophosphataemic rickets is associated with mutations in FGF23. Nat Genet 2000;26:345e8. Shimada T, Mizutani S, Muto T, et al. Cloning and characterization of FGF23 as a causative factor of tumor-induced osteomalacia. Proc Natl Acad Sci USA 2001;98:6500e5. von Marschall Z, Fisher LW. Dentin matrix protein-1 isoforms promote differential cell attachment and migration. J Biol Chem 2008;283:32730e40. Yuan B, Meudt J, Feng JO, Drezner MK. 7B2 protein mediated inhibition of DMP1 cleavage in osteoblasts enhances FGF-23 production in hyp-mice. J Bone Miner Res 2008;23:s16 (abstract 1053). Lu Y, Qin C, Xie Y, Bonewald LF, Feng JQ. Studies of the DMP1 57-kDa functional domain both in vivo and in vitro. Cells Tissues Organs 2009;189:175e85. Burnett SM, Gunawardene SC, Bringhurst FR, Ju¨ppner H, Lee H, Finkelstein JS. Regulation of C-terminal and intact FGF23 by dietary phosphate in men and women. J Bone Miner Res 2006;21:1187e96. Shimada T, Muto T, Urakawa I, et al. Mutant FGF-23 responsible for autosomal dominant hypophosphatemic rickets is resistant to proteolytic cleavage and causes hypophosphatemia in vivo. Endocrinology 2002;143:3179e82. Kato K, Jeanneau C, Tarp MA, et al. Polypeptide GalNActransferase T3 and familial tumoral calcinosis. Secretion of fibroblast growth factor 23 requires O-glycosylation. J Biol Chem 2006;281:18370e7. Masi L, Gozzini A, Carbonell S, et al. A novel recessive mutation in fibroblast growth factor-23 (FGF23) causes a tumoral calcinosis. J Bone Miner Res 2005;(Suppl):S128. Garringer HJ, Malekpour M, Esteghamat F, et al. Molecular genetic and biochemical analyses of FGF23 mutations in familial tumoral calcinosis. Am J Physiol Endocrinol Metab 2008; 295:E929e37. Benet-Pages A, Orlik P, Strom TM, Lorenz-Depiereux B. An FGF23 missense mutation causes familial tumoral calcinosis with hyperphosphatemia. Hum Mol Genet 2005;14:385e90.

159

[218] Larsson T, Yu X, Davis SI, et al. A novel recessive mutation in fibroblast growth factor-23 causes familial tumoral calcinosis. J Clin Endocrinol Metab 2005;90:2424e7. [219] Chefetz I, Heller R, Galli-Tsinopoulou A, et al. A novel homozygous missense mutation in FGF23 causes familial tumoral calcinosis associated with disseminated visceral calcification. Hum Genet 2005;118:261e6. [220] Araya K, Fukumoto S, Backenroth R, et al. A novel mutation in fibroblast growth factor 23 gene as a cause of tumoral calcinosis. J Clin Endocrinol Metab 2005;90:5523e7. [221] Larsson T, Davis SI, Garringer HJ, et al. Fibroblast growth factor-23 mutants causing familial tumoral calcinosis are differentially processed. Endocrinology 2005;146:3883e91. [222] Frishberg Y, Ito N, Rinat C, et al. Hyperostosis-hyperphosphatemia syndrome: a congenital disorder of O-glycosylation associated with augmented processing of fibroblast growth factor 23. J Bone Miner Res 2007;22:235e42. [223] Bergwitz C, Banerjee S, Abu-Zahra H, et al. Defective O-glycosylation due to a novel homozygous S129P mutation is associated with lack of fibroblast growth factor 23 secretion and tumoral calcinosis. J Clin Endocrinol Metab 2009;94:4267e74. [224] Ichikawa S, Sorenson AH, Austin AM, et al. Ablation of the Galnt3 gene leads to low-circulating intact fibroblast growth factor 23 (Fgf23) concentrations and hyperphosphatemia despite increased Fgf23 expression. Endocrinology 2009;150:2543e50. [225] Chefetz I, Kohno K, Izumi H, Uitto J, Richard G, Sprecher E. GALNT3, a gene associated with hyperphosphatemic familial tumoral calcinosis, is transcriptionally regulated by extracellular phosphate and modulates matrix metalloproteinase activity. Biochim Biophys Acta 2009;1792:61e7. [226] Mohammadi M, Olsen SK, Ibrahimi OA. Structural basis for fibroblast growth factor receptor activation. Cytokine Growth Factor Rev 2005;16:107e37. [227] Powers CJ, McLeskey SW, Wellstein A. Fibroblast growth factors, their receptors and signaling. Endocr Relat Cancer 2000; 7:165e97. [228] Ornitz DM, Itoh N. Fibroblast growth factors. Genome Biol 2001;2:3005. [229] Zhang X, Ibrahimi OA, Olsen SK, Umemori H, Mohammadi M, Ornitz DM. Receptor specificity of the fibroblast growth factor family. The complete mammalian FGF family. J Biol Chem 2006; 281:15694e700. [230] Yu X, White KE. Fibroblast growth factor 23 and its receptors. Ther Apher Dial 2005;9:308e12. [231] Yamashita T, Konishi M, Miyake A, Inui K, Itoh N. Fibroblast growth factor (FGF)-23 inhibits renal phosphate reabsorption by activation of the mitogen-activated protein kinase pathway. J Biol Chem 2002;277:28265e70. [232] Kurosu H, Yamamoto M, Clark JD, et al. Suppression of aging in mice by the hormone Klotho. Science 2005;309:1829e33. [233] Yamazaki Y, Tamada T, Kasai N, et al. Anti-FGF23 neutralizing antibodies show the physiological role and structural features of FGF23. J Bone Miner Res 2008;23:1509e18. [234] Liu S, Vierthaler L, Tang W, Zhou J, Quarles LD. FGFR3 and FGFR4 do not mediate renal effects of FGF23. J Am Soc Nephrol 2008;19:2342e50. [235] Li H, Martin AC, David V, Quarles LD. Compound deletion of FGFR3 and FGFR4 partially rescues the Hyp mouse phenotype. Am J Physiol Endocrinol Metab 2010;300:E508e17. [236] Gattineni J, Bates C, Twombley K, et al. FGF23 decreases renal NaPi-2a and NaPi-2c expression and induces hypophosphatemia in vivo predominantly via FGF receptor 1. Am J Physiol Renal Physiol 2009;297:F282e91.

PEDIATRIC BONE

160

7. PHOSPHATE HOMEOSTASIS REGULATORY MECHANISMS

[237] Segawa H, Yamanaka S, Ohno Y, et al. Correlation between hyperphosphatemia and type II Na-Pi cotransporter activity in klotho mice. Am J Physiol Renal Physiol 2007;292:F769e79. [238] Baum M, Schiavi S, Dwarakanath V, Quigley R. Effect of fibroblast growth factor-23 on phosphate transport in proximal tubules. Kidney Int 2005;68:1148e53. [239] Segawa H, Onitsuka A, Aranami F, et al. Npt2a and Npt2c in mice play distinct and synergistic roles in inorganic phosphate metabolism and skeletal development. Renal Week 2006. San Francisco: JASN; 2007. 2007. p. abstract SA-FC101. [240] Liu S, Gupta A, Quarles LD. Emerging role of fibroblast growth factor 23 in a bone-kidney axis regulating systemic phosphate homeostasis and extracellular matrix mineralization. Curr Opin Nephrol Hypertens 2007;16:329e35. [241] Fukumoto S, Yamashita T. FGF23 is a hormone-regulating phosphate metabolism e unique biological characteristics of FGF23. Bone 2007;40:1190e5. [242] Farrow EG, Davis SI, Summers LJ, White KE. Initial FGF23mediated signaling occurs in the distal convoluted tubule. J Am Soc Nephrol 2009;20:955e60. [243] Chang Q, Hoefs S, van der Kemp AW, Topala CN, Bindels RJ, Hoenderop JG. The beta-glucuronidase klotho hydrolyzes and activates the TRPV5 channel. Science 2005;310:490e3. [244] Cha SK, Hu MC, Kurosu H, Kuro-o M, Moe O, Huang CL. Regulation of renal outer medullary potassium channel and renal K(þ) excretion by Klotho. Mol Pharmacol 2009;76:38e46. [245] Frishberg Y, Araya K, Rinat C, et al. Hyperostosis-hyperphosphatemia syndrome caused by mutations in GALNT3 and associated with augmented processing of FGF-23. Philadelphia: American Society of Nephrology; 2004. 2004. p. F-P0937. [246] Ichikawa S, Lyles KW, Econs MJ. A novel GALNT3 mutation in a pseudoautosomal dominant form of tumoral calcinosis: evidence that the disorder is autosomal recessive. J Clin Endocrinol Metab 2005;90:2420e3. [247] Shimada T, Kakitani M, Yamazaki Y, et al. Targeted ablation of Fgf23 demonstrates an essential physiological role of FGF23 in phosphate and vitamin D metabolism. J Clin Invest 2004;113: 561e8. [248] Hesse M, Frohlich LF, Zeitz U, Lanske B, Erben RG. Ablation of vitamin D signaling rescues bone, mineral, and glucose homeostasis in Fgf-23 deficient mice. Matrix Biol 2007;26:75e84. [249] Kuro-o M, Matsumura Y, Aizawa H, et al. Mutation of the mouse klotho gene leads to a syndrome resembling ageing. Nature 1997;390:45e51. [250] Sitara D, Kim S, Razzaque MS, et al. Genetic evidence of serum phosphate-independent functions of FGF-23 on bone. PLoS Genet 2008;4:e1000154. [251] Razzaque MS, Sitara D, Taguchi T, St-Arnaud R, Lanske B. Premature aging-like phenotype in fibroblast growth factor 23 null mice is a vitamin D-mediated process. Faseb J 2006;20: 720e2. [252] Ohnishi M, Nakatani T, Lanske B, Razzaque MS. Reversal of mineral ion homeostasis and soft-tissue calcification of klotho knockout mice by deletion of vitamin D 1alpha-hydroxylase. Kidney Int 2009;75:1166e72. [253] Stubbs JR, Liu S, Tang W, et al. Role of hyperphosphatemia and 1,25-dihydroxyvitamin d in vascular calcification and mortality in fibroblastic growth factor 23 null mice. J Am Soc Nephrol 2007;18:2116e24. [254] Brownstein CA, Adler F, Nelson-Williams C, et al. A translocation causing increased alpha-klotho level results in hypophosphatemic rickets and hyperparathyroidism. Proc Natl Acad Sci USA 2008;105:3455e60.

[255] Eicher E, Southard J, Scriver C, Glorieux F. Hypophosphatemia: mouse model for human familial hypophosphatemic (vitamin D-resistant) rickets. Proc Natl Acad Sci USA 1976;73:4667e71. [256] Liu S, Zhou J, Tang W, Jiang X, Rowe DW, Quarles LD. Pathogenic role of Fgf23 in Hyp mice. Am J Physiol Endocrinol Metab 2006;291:E38e49. [257] Bai X, Miao D, Li J, Goltzman D, Karaplis AC. Transgenic mice overexpressing human fibroblast growth factor 23 (R176Q) delineate a putative role for parathyroid hormone in renal phosphate wasting disorders. Endocrinology 2004;145:5269e79. [258] DeLuca S, Sitara D, Kang K, et al. Amelioration of the premature ageing-like features of Fgf-23 knockout mice by genetically restoring the systemic actions of FGF-23. J Pathol 2008;216: 345e55. [259] Larsson T, Marsell R, Schipani E, et al. Transgenic mice expressing fibroblast growth factor 23 under the control of the alpha1(I) collagen promoter exhibit growth retardation, osteomalacia, and disturbed phosphate homeostasis. Endocrinology 2004;145:3087e94. [260] Bai X, Miao D, Panda D, et al. Partial rescue of the Hyp phenotype by osteoblast-targeted PHEX (phosphate-regulating gene with homologies to endopeptidases on the X chromosome) expression. Mol Endocrinol 2002;16:2913e25. [261] Liu S, Guo R, Tu Q, Quarles LD. Overexpression of Phex in osteoblasts fails to rescue the Hyp mouse phenotype. J Biol Chem 2002;277:3686e97. [262] Erben RG, Mayer D, Weber K, Jonsson K, Ju¨ppner H, Lanske B. Overexpression of human PHEX under the human beta-actin promoter does not fully rescue the Hyp mouse phenotype. J Bone Miner Res 2005;20:1149e60. [263] Sitara D, Razzaque MS, Hesse M, et al. Homozygous ablation of fibroblast growth factor-23 results in hyperphosphatemia and impaired skeletogenesis, and reverses hypophosphatemia in Phex-deficient mice. Matrix Biol 2004;23:421e32. [264] Liu S, Zhou J, Tang W, Menard R, Feng JQ, Quarles LD. Pathogenic role of Fgf23 in Dmp1-null mice. Am J Physiol Endocrinol Metab 2008;295:E254e61. [265] Bergwitz C, Kremke B, Bounoutas G, Hiort O, Insogna K, Ju¨ppner H. Hypophosphatemic rickets with hypercalciuria (HHRH) can be associated with renal stones. ASBMR. Philadelphia. J Bone Miner Res 2006. p. SU419. [266] Beck L, Karaplis AC, Amizuka N, Hewson AS, Ozawa H, Tenenhouse HS. Targeted inactivation of Npt2 in mice leads to severe renal phosphate wasting, hypercalciuria, and skeletal abnormalities. Proc Natl Acad Sci USA 1998;95:5372e7. [267] Beck Jr GR. Inorganic phosphate as a signaling molecule in osteoblast differentiation. J Cell Biochem 2003;90:234e43. [268] Schoeters GE, de Saint-Georges L, Van den Heuvel R, Vanderborght O. Mineralization of adult mouse bone marrow in vitro. Cell Tissue Kinet 1988;21:363e74. [269] Xie J, Baumann MJ, McCabe LR. Osteoblasts respond to hydroxyapatite surfaces with immediate changes in gene expression. J Biomed Mater Res A 2004;71:108e17. [270] Otsuka E, Yamaguchi A, Hirose S, Hagiwara H. Characterization of osteoblastic differentiation of stromal cell line ST2 that is induced by ascorbic acid. Am J Physiol 1999;277:C132e8. [271] Berendsen AD, Smit TH, Schoenmaker T, et al. Inorganic phosphate stimulates DMP1 expression in human periodontal ligament fibroblasts embedded in three-dimensional collagen gels. Cells Tissues Organs 2010;192:116e24. [272] Yoshiko Y, Candeliere GA, Maeda N, Aubin JE. Osteoblast autonomous Pi regulation via Pit1 plays a role in bone mineralization. Mol Cell Biol 2007;27:4465e74.

PEDIATRIC BONE

REFERENCES

[273] Chang SH, Yu KN, Lee YS, et al. Elevated inorganic phosphate stimulates Akt-ERK1/2-Mnk1 signaling in human lung cells. Am J Respir Cell Mol Biol 2006;35:528e39. [274] Goseki-Sone M, Yamada A, Hamatani R, Mizoi L, Iimura T, Ezawa I. Phosphate depletion enhances bone morphogenetic protein-4 gene expression in a cultured mouse marrow stromal cell line ST2. Biochem Biophys Res Commun 2002;299:395e9. [275] Kimata M, Michigami T, Tachikawa K, et al. Signaling of extracellular inorganic phosphate up-regulates cyclin D1 expression in proliferating chondrocytes via the Na(þ)/Pi cotransporter Pit-1 and Raf/MEK/ERK pathway. Bone 2010;47:938e47. [276] Beck Jr GR, Knecht N. Osteopontin regulation by inorganic phosphate is ERK1/2-, protein kinase C-, and proteasomedependent. J Biol Chem 2003;278:41921e9. [277] Julien M, Magne D, Masson M, et al. Phosphate stimulates matrix Gla protein expression in chondrocytes through the extracellular signal regulated kinase signaling pathway. Endocrinology 2007;148:530e7. [278] Nair D, Misra RP, Sallis JD, Cheung HS. Phosphocitrate inhibits a basic calcium phosphate and calcium pyrophosphate dihydrate crystal-induced mitogen-activated protein kinase cascade signal transduction pathway. J Biol Chem 1997;272:18920e5. [279] Yamazaki M, Ozonoa K, Okada T, et al. Both FGF23 and extracellular phosphate activate Raf/MEK/ERK pathway via FGF receptors in HEK293 cells. J Cell Biochem 2010;111:1210e21. [280] Bergwitz C, DeRobertis C, Chen H, Friedman A, Ju¨ppner H, Perrimon N. Role of sodium-phosphate co-transporters in the activation of the MAPK pathway by phosphate. J Am Soc Nephrol 2009. abstract F-FC258. [281] Beck L, Leroy C, Salaun C, Margall-Ducos G, Desdouets C, Friedlander G. Identification of a novel function of PiT1 critical for cell proliferation and independent of its phosphate transport activity. J Biol Chem 2009;284:31363e74. [282] Werner A, Kinne RK. Evolution of the Na-P(i) cotransport systems. Am J Physiol Regul Integr Comp Physiol 2001;280: R301e12. [283] Hubbard TJ, Aken BL, Beal K, et al. Ensembl 2007. Nucleic Acids Res 2007 Jan;35(Database issue):D610e7. [284] Meng Z, Camalier CE, Lucas DA, Veenstra TD, Beck Jr GR, Conrads TP. Probing early growth response 1 interacting proteins at the active promoter in osteoblast cells using oligoprecipitation and mass spectrometry. J Proteome Res 2006;5:1931e9. [285] Oshima Y, Akiyama T, Hikita A, et al. Pivotal role of Bcl-2 family proteins in the regulation of chondrocyte apoptosis. J Biol Chem 2008;283:26499e508. [286] Donohue MM, Demay MB. Rickets in VDR null mice is secondary to decreased apoptosis of hypertrophic chondrocytes. Endocrinology 2002;143:3691e4.

161

[287] Lavi-Moshayoff V, Silver J, Naveh-Many T. Human PTH gene regulation in vivo using transgenic mice. Am J Physiol Renal Physiol 2009;297:F713e9. [288] Dinur M, Kilav R, Sela-Brown A, Jacquemin-Sablon H, NavehMany T. In vitro evidence that upstream of N-ras participates in the regulation of parathyroid hormone messenger ribonucleic acid stability. Mol Endocrinol 2006;20:1652e60. [289] Nechama M, Ben-Dov IZ, Briata P, Gherzi R, Naveh-Many T. The mRNA decay promoting factor K-homology splicing regulator protein post-transcriptionally determines parathyroid hormone mRNA levels. Faseb J 2008;22:3458e68. [290] Nechama M, Uchida T, Mor Yosef-Levi I, Silver J, NavehMany T. The peptidyl-prolyl isomerase Pin1 determines parathyroid hormone mRNA levels and stability in rat models of secondary hyperparathyroidism. J Clin Invest 2009;119:3102e14. [291] Bikle D, Adams J, Christakos C. Vitamin D: production, metabolism, mechanism of action, and clinical requirements. In: Rosen C, editor. Primer on Metabolic Bone Disease and Disorders of Mineral Metabolism. Philadelphia, PA: Lippincott-Raven; 2008. p. 141e9. [292] Shimada T, Hasegawa H, Yamazaki Y, et al. FGF-23 is a potent regulator of vitamin D metabolism and phosphate homeostasis. J Bone Miner Res 2004;19:429e35. [293] Bhattacharyya N, Andreopoulou P, Dumitrescu C, Miwa H, Gafni R, Collins M. Cyclic AMP-mediated processing of FGF23: Regulation by O-glycosylation. J Bone Miner Res 2009. abstract A09003028. [294] Terkeltaub R. Physiologic and pathologic functions of the NPP nucleotide pyrophosphatase/phosphodiesterase family focusing on NPP1 in calcification. Purinergic Signal 2006;2: 371e7. [295] Rutsch F, Vaingankar S, Johnson K, et al. PC-1 nucleoside triphosphate pyrophosphohydrolase deficiency in idiopathic infantile arterial calcification. Am J Pathol 2001;158:543e54. [296] Rutsch F, Ruf N, Vaingankar S, et al. Mutations in ENPP1 are associated with ’idiopathic’ infantile arterial calcification. Nat Genet 2003;34:379e81. [297] Levy-Litan V, Hershkovitz E, Avizov L, et al. Autosomal-recessive hypophosphatemic rickets is associated with an inactivation mutation in the ENPP1 gene. Am J Hum Genet 2010;86:273e8. [298] Lorenz-Depiereux B, Schnabel D, Tiosano D, Hausler G, Strom TM. Loss-of-function ENPP1 mutations cause both generalized arterial calcification of infancy and autosomalrecessive hypophosphatemic rickets. Am J Hum Genet 2010; 86:267e72. [299] Chodirker BN, Evans JA, Seargeant LE, Cheang MS, Greenberg CR. Hyperphosphatemia in infantile hypophosphatasia: implications for carrier diagnosis and screening. Am J Hum Genet 1990;46:280e5.

PEDIATRIC BONE

C H A P T E R

8

Vitamin D Biology Rene´ St-Arnaud 1, Marie B. Demay 2 1

Genetics Unit, Shriners Hospital for Children, Montre´al, Que´bec and Departments of Surgery and Human Genetics, McGill University, Montre´al, Que´bec, Canada 2 Endocrine Unit, Massachusetts General Hospital, Harvard Medical School, Boston, MA, USA

METABOLIC ACTIVATION OF VITAMIN D Overview Following the seminal work that established vitamins (a term derived from the contraction of “vital amines”) A and B as essential micronutrients, the observation that a fat-soluble component of aerated and heated cod liver oil cured nutritional rickets led to the hypothesis that the healing activity was due to a previously unidentified vitamin which was termed vitamin D [1]. Parallel and subsequent work demonstrating that exposure to sunlight cures rickets in patients and experimental animals [2] challenged the notion that vitamin D is truly a vitamin, but the term initially coined has endured despite the identification of the endocrine system regulating the synthesis and activity of the active form of the D compound. Indeed, vitamin D, produced endogenously in the skin, upon exposure to ultraviolet light (sunlight), must be metabolized twice to be activated and function as a key regulator of mineral ion homeostasis. Vitamin D, bound to the vitamin D binding protein, DBP, is transported to the liver where the enzyme vitamin D 25-hydroxylase (CYP2R1) adds a hydroxyl group on carbon 25 to produce 25-hydroxyvitamin D (25(OH) D). The 25(OH)D metabolite also circulates in the bloodstream bound to DBP. It must be further hydroxylated in the kidney to gain hormonal bioactivity. Hydroxylation at position 1a by the enzyme 25-hydroxyvitamin D-1a-hydroxylase (CYP27B1) converts 25(OH)D to 1a,25-dihydroxyvitamin D (1,25(OH)2D), the active, hormonal form of vitamin D. Upon reaching target tissues, 1,25(OH)2D binds to its specific receptor the vitamin D receptor (VDR) to regulate the transcription of vitamin D target genes responsible for carrying out the physiological actions of 1,25(OH)2D: mineral

Pediatric Bone, Second Edition DOI: 10.1016/B978-0-12-382040-2.10008-5

homeostasis, skeletal homeostasis, and cellular differentiation. Following exposure to sunlight, both plants and animals are able to synthesize vitamin D. Vitamin D2 (ergocalciferol) is generated in yeast and plants; vitamin D3 (cholecalciferol) is produced in fish and mammals. The slight differences in the chemical structure of the two compounds (Fig. 8.1A) do not affect function or metabolism in mammals. The generic term of vitamin D (without subscript) will be used hereafter. This chapter will review several aspects of vitamin D biology. Vitamin D metabolism will be detailed first, followed by a presentation of the physiological roles of the vitamin D hormone. Finally, an in-depth analysis of the mechanism of action of vitamin D will be presented. The reader is referred to Chapter 25 for a discussion of the pediatric disorders involving the vitamin D endocrine system.

Hepatic 25-Hydroxylation In humans, a large percentage (80%) of the vitamin D requirement can be produced in the skin upon exposure to ultraviolet light (sunlight). The rest must be acquired through dietary sources such as fish, plants and grains. Ultraviolet B photons penetrate the epidermis and photolize 7-dehydrocholesterol into previtamin D which rapidly becomes a more thermodynamically stable molecule, vitamin D [3]. Vitamin D then exits the keratinocyte cells and enters the dermal capillary bed where it is bound to the vitamin D binding protein, DBP. Once associated with DBP in the circulation, vitamin D is transported to the liver where the cytochrome P450 enzyme vitamin D 25-hydroxylase (CYP2R1) adds a hydroxyl group on carbon 25 to produce 25-hydroxyvitamin D (25(OH)D).

163

Copyright Ó 2012 Elsevier Inc. All rights reserved.

164

8. VITAMIN D BIOLOGY

FIGURE 8.1 Structure of vitamin D and cytochrome P450 activity. (A) Structure of vitamin D3 (cholecalciferol) and vitamin D2 (ergocalciferol). Plants and yeast synthesize vitamin D2; fish and mammals synthesize vitamin D3. The slight differences in the chemical structure of the two compounds do not affect function or metabolism. The open cyclopentanoperhydrophenantren core identifies vitamin D metabolites as seco-steroids and not steroids. (B) Mechanism of hydroxylation of vitamin D metabolites by cytochrome P450 hydroxylases. NADPH, dihydronicotinamide adenine dinucleotide phosphate; NADP, nicotinamide adenine dinucleotide phosphate; FR, ferredoxin reductase; ox, oxidized; red, reduced; FDX, ferredoxin.

All vitamin D hydroxylases characterized to date belong to the superfamily of cytochrome P450 enzymes. They are heme-containing, mixed function oxidases that use molecular oxygen as a terminal electron acceptor. They require the accessory electron transfer proteins, ferredoxin and ferredoxin reductase, to accept reducing equivalents from nicotinamide adenine dinucleotide phosphate (NADPH) and stereospecifically hydroxylate vitamin D metabolites (see Fig. 8.1B). Early studies using perfused rat liver revealed kinetics of vitamin D metabolism that supported two 25-hydroxylase activities: a microsomal (endoplasmic reticulum) high-affinity, low-capacity enzyme and a mitochondrial low-affinity, high capacity form [4]. The microsomal, high-affinity vitamin D 25-hydroxylase was recently identified as CYP2R1 using an elegant expression-based screening strategy [5]. Several criteria suggest that CYP2R1 is the physiologically relevant 25-hydroxylase in vivo. CYP2R1 is a microsomal cytochrome P450 expressed primarily in liver and testis [5]. It can hydroxylate vitamin D2 and vitamin D3 at physiologically-relevant substrate concentrations [5]. It exhibits specificity towards vitamin D as a substrate and does not metabolize cholesterol or 7-dehydrocholesterol [6]. Finally, a mutation in CYP2R1 was reported in a patient with vitamin D-dependent rickets, type 1A [7e9]. Another cytochrome shown to hydroxylate vitamin D at position 25 is the bifunctional CYP27A1 that derives

its name for its ability to 27-hydroxylate the side-chains of cholesterol-derived intermediates involved in bile acid biosynthesis [10]. The physiological relevance of CYP27A1 as a vitamin D 25-hydroxylase was always considered debatable. Indeed, mice with a disrupted Cyp27a1 gene have reduced bile acid synthesis, but normal vitamin D metabolite levels [11]. Also, patients with the inherited disease cerebrotendinous xanthomatosis, caused by mutations in CYP27A1 [12,13], exhibit normal vitamin D metabolism and no obvious 25(OH)D or 1,25(OH)2D deficiency [14]. Finally, CYP27A1 is a mitochondrial enzyme [15,16]. It is likely that CYP2R1 is the physiologically relevant enzyme at normal, nanomolar vitamin D concentrations, but that it is backed up by CYP27A1 when substrate concentrations rise into the pharmacological range (high nanomolar to low micromolar).

Renal 1a-Hydroxylation 25(OH)D must be further hydroxylated to gain hormonal bioactivity. This takes place in the convoluted and straight portions of the proximal kidney tubule. Hydroxylation at position 1a by the mitochondrial cytochrome P450 enzyme 25-hydroxyvitamin D1a-hydroxylase (CYP27B1, hereafter referred to as 1a-hydroxylase) converts 25(OH)D to 1a,25-dihydroxyvitamin D (1,25(OH)2D), the active, hormonal form of vitamin D.

PEDIATRIC BONE

METABOLIC ACTIVATION OF VITAMIN D

The 1a-hydroxylase also belongs to the class of the mixed-function oxidases. The 1a-hydroxylase cDNA was cloned from rat and mouse kidney, as well as from human keratinocytes and kidney [17e20]. The cDNAs from all species examined to date show high sequence similarity. For example, the sequence of the coding region of the human cDNA is 82% identical to that of mouse 1a-hydroxylase at both the nucleotide and the amino acid levels. The human 1a-hydroxylase cDNA is 2469 bp in length, and codes for a deduced protein of 508 amino acids containing a ferredoxinbinding domain and a heme-binding domain. The deduced amino acid sequence has substantial homology to members of the mitochondrial P450 family [21], particularly CYP27A1 (40%) [16], CYP24A1 (32%) [22], P450scc, the cholesterol side-chain cleavage enzyme (CYP11A, 33%) [23], and P450c11b, the steroid 11b-hydroxylase (CYP11B1, 30%) [24]. Every laboratory that isolated the 1a-hydroxylase cDNA rapidly obtained the sequence of the 1a-hydroxylase gene in various species. The gene exists as a single copy in the human genome and contains nine exons spanning 5 kb of sequence. The ferredoxin-binding domain is encoded by sequences contained in exons 6 and 7, while the heme-binding domain is contained in exon 8 [25,26]. The human gene has been localized to chromosome 12 using somatic cell hybrids [26], then mapped to 12q13.1e13.3 by fluorescence in situ hybridization [18,27,28]. The chromosomal location provided further circumstantial evidence that mutations in the gene were responsible for the hereditary disease, pseudo vitamin D deficiency rickets (PDDR), also termed vitamin D dependency rickets type I (see Chapter 25), since the disease had been previously mapped to this locus by linkage analysis [29,30]. Incontrovertible proof that mutations of the 1a-hydroxylase caused PDDR was provided by the characterization of CYP27B1 mutations in patients with the disease (reviewed in [31]). Animal models of the disease have recently been engineered by gene targeting technology (see below) [32,33]. The main site for the 1a-hydroxylation of 25(OH)D is the proximal tubule of the renal cortex [34]. The expression of the enzyme has also been reported in cells from other tissues: osteoblasts [35], keratinocytes [17], and cells of the lympho-hematopoeitic system [36]. The identification of these extrarenal sites of expression of the 1a-hydroxylase has led investigators to hypothesize that local production of 1,25(OH)2D could play an important autocrine or paracrine role in the differentiation or function of these cells. In the kidney, the expression of the 1a-hydroxylase gene is subject to complex regulation by parathyroid hormone, calcitonin, fibroblast growth factor 23, calcium, phosphorus, and 1,25(OH)2D itself.

165

Parathyroid hormone (PTH) has long been known to stimulate 1a-hydroxylase enzymatic activity in kidney [37] and this has now been demonstrated to occur at the level of gene transcription [38,39]. The PTH response involves signal transduction through cyclic AMP and protein kinase A [38e41]. Putative cyclic AMP response elements have been identified within the proximal 1a-hydroxylase promoter [39], but individual mutation of these sites did not significantly affect transcriptional responses [42]. Recently, regulated epigenetic modification was demonstrated to contribute to the PTH control of CYP27B1 expression. Treatment with PTH induces active demethylation of CpG sites within the CYP27B1 promoter [43]. This mechanism involves the DNA glycosylase, MBD4 [44], which is phosphorylated through protein kinase C upon PTH treatment. This promotes incision of methylated DNA through glycosylase activity, and a base-excision repair process leads to DNA demethylation and transcriptional derepression [43]. Conversely, treatment with 1,25(OH)2D induces methylation through the DNA methyltransferases, DNMT1 and DNMT3B [43]. The identification of this methylation switching at the DNA level constitutes a novel mechanism in the hormonal control of gene transcription. Calcitonin is also a positive regulator of 1a-hydroxylase activity [45,46], and this also occurs at the transcriptional level [38]. Results obtained in a rat model demonstrated that while PTH is mainly responsible for Cyp27b1 induction in hypocalcemic animals, calcitonin appears to be the major regulator of the expression of the 1a-hydroxylase gene in normocalcemic rats [47]. Dietary calcium and phosphate intake are critical in the control of 1a-hydroxylase enzymatic activity [48]. Decreases in blood calcium stimulate the synthesis and secretion of PTH which, in turn, increases expression of the 1a-hydroxylase gene as mentioned above [49], and thus regulation by calcium is indirect. Hyperphosphatemia inhibits CYP27B1 expression. This regulation involves the phosphaturic hormone fibroblast growth factor 23 (FGF-23) [50]. Dietary phosphate stimulates FGF-23 synthesis [51]. In turn, FGF-23 inhibits CYP27B1 expression [52]. The regulation of phosphate homeostasis by PTH, FGF-23, and vitamin D remains a current research focus and has been the subject of recent reviews [50,53]. PTH induces the expression of the 1a-hydroxylase gene, leading to increased 1,25(OH)2D synthesis and intestinal calcium absorption. To prevent sustained production of 1,25(OH)2D that would lead to hypercalcemia, the vitamin D hormone in turn inhibits PTH and 1a-hydroxylase gene expression [54e58]. The characterization of this transcriptional repression feedback has highlighted a novel mechanism of action for the VDR [59e62] which is detailed below.

PEDIATRIC BONE

166

8. VITAMIN D BIOLOGY

24-Hydroxylation Hypocalcemia results in increased production of 1,25(OH)2D via PTH. As discussed above, the expression of the 1a-hydroxylase gene is controlled in a classic feedback loop to avoid sustained production of 1,25(OH)2D leading to hypercalcemia. To provide for an even faster “shut-off” mechanism, the 1,25(OH)2D hormone induces the expression of the gene encoding the key effector of its catabolic breakdown: 25-hydroxyvitamin D-24-hydroxylase (CYP24A1). The CYP24A1 enzyme is also a mixed-function oxidase cytochrome P450 molecule. It is localized to the mitochondrial membrane and catalyzes the addition of a hydroxyl group on carbon 24 of the vitamin D secosteroid backbone. It can utilize several substrates: 25(OH) D, to produce 24,25-dihydroxyvitamin D (24,25(OH)2D); 1,25(OH)2D, to produce 1,24,25-trihydroxyvitamin D (1,24,25(OH)3D), and even 1a-hydroxyvitamin D (1a (OH)D), to generate 1a,24-dihydroxyvitamin D (1,24(OH)2D). The 24,25(OH)2D metabolite is the most abundant dihydroxylated metabolite in the circulation. Its ease of detection helped in the analysis of the 24-hydroxylase enzyme, long before 1,25(OH)2D and the 1a-hydroxylase were identified. The enzyme was purified to homogeneity from rat kidney mitochondria [63] and the purified protein was used to raise antibodies [64] permitting cloning of the cDNA [22]. This then allowed cloning of the gene from various species [65e67], analysis and characterization of the promoter control elements, and production of the recombinant protein. In the mid- to late-1970s, the 24-hydroxylation step was shown to be induced by 1,25(OH)2D itself [68,69]. Since the product of that reaction, 1,24,25(OH)3D, was 10 times less active than the 1,25(OH)2D substrate [68], investigators began to reason that the 24-hydroxylation reaction was perhaps the first step in an inactivation process. It was also discovered that the 24-hydroxylated metabolites, 24,25(OH)2D and 1,24,25(OH)3D, could be further converted to different metabolic products sporting 24-oxo and/or 23-hydroxy groups [70e72]. Studies using perfused rat kidney then led to the identification of additional metabolites: a 23-alcohol [73] and a 23-acid [74,75]. Those metabolites had not been previously identified in vitro. Calcitroic acid, the 1a-hydroxylated 23-acid, was shown to be the main biliary excretory form of 1,25(OH)2D [76]. With most metabolites identified, investigators deduced that 24-hydroxylation initiates the C-24 oxidation pathway that leads to 1,25(OH)2D degradation [74,75]. This pathway comprises five enzymatic steps which involve successive hydroxylation/oxidation reactions at carbons 24 and 23, followed by cleavage of the secosteroid at the C-23/C-24 bond and subsequent oxidation of the

cleaved product to calcitroic acid [74,75]. Under basal conditions, low levels of Cyp24a1 mRNA [34], protein [77], and enzymatic activity [78] can be detected in kidney, but treatment with 1,25(OH)2D induces expression in a wide range of tissues, such as bone, heart, intestine, kidney, lung, pancreas, skin, spleen, testis and thymus [79]. The 1,25(OH)2D-inducible 24-hydroxylation and calcitroic acid production is also observed in cell lines from kidney, bone, intestine, skin, and breast [80e82], demonstrating that the C-24 oxidation catabolic pathway can be induced in most vitamin D target cells. Interestingly, the CYP24A1 enzyme is able to hydroxylate both the C23 or the C24 side-chain carbons of 25(OH)D or 1,25(OH)2D [83]. The relative level of C23and C24-hydroxylase activity appears species-specific and the structural basis of this altered specificity has recently been examined using sequence alignment and site-directed mutagenesis [84]. C24 hydroxylation leads to side-chain cleavage and oxidation to a carboxylic acid (C24 oxidation pathway), while hydroxylation at carbon 23 results in side-chain lactone formation (C23 hydroxylation pathway). The recombinant CYP24A1 protein, when associated with its electron-transport co-factors, NADPH-ferredoxin reductase and ferredoxin, has been shown to perform multiple steps of the C-24 oxidation pathway. This includes 23-hydroxylation, dehydrogenation of the 24-hydroxyl group, and side-chain cleavage [85,86]. The hypothesis that the main role of the C-24 oxidation pathway is attenuation of the 1,25(OH)2D biological signal inside target cells was tested in vitro using cytochrome P450 inhibitors. Blocking P450 activity by treatment of cells with ketoconazole inhibits catabolism and results in 1,25(OH)2D accumulation and extended hormone action [87]. This hypothesis was also tested and confirmed in vivo by engineering Cyp24a1-deficient mice. Animals homozygous for the Cyp24a1 mutation cannot effectively clear 1,25(OH)2D from their circulation [88]. The phenotype of the Cyp24a1 knockout mice will be described in detail below. There has been significant interest in performing structureefunction analyses and generating homology models of the CYP24A1 structure while awaiting crystal structure resolution, which was recently reported [89]. Efforts stemmed from two different perspectives: on the one hand, investigators were intrigued by the speciesspecific bias for C23- or C24-hydroxylation [83,85,86, 90,91]. On the other hand, there has been steady pharmacological interest in the development of CYP24A1 inhibitors to prolong the bioactivity of 1,25(OH)2D or its relevant analogs [92e95]. Information on the tertiary structure of the substrate-binding pocket was perceived as relevant to develop specific inhibitors. Recombinant CYP24A1 crystals were obtained following ferredoxinsepharose affinity chromatography purification of

PEDIATRIC BONE

MECHANISM OF ACTION

bacterially expressed rat Cyp24a1 sequence deleted of its mitochondrial import signal (D2e32) [96] and mutated at residue 57 (S57D) to stabilize the recombinant protein [89,97]. The CYP24A1 crystal structure displays the canonical P450 fold, including the 12 a-helices (AeL) and four b-sheet systems (b1eb4). Five additional short helices (A’, B’, G’, K’ and K”) were also identified [89]. The substrate-binding cavity is defined by the b1 and b4 sheets, the BeC loop, and helices E, F, G, I, and K surrounding the heme. Alignment of helices A’ and G’ with other mitochondrial P450 sequences identifies them as membrane insertion sequences (MIS) and computational modeling suggests that residues in the hydrophobic surfaces of helices A’ and G’ can penetrate ˚ into the mitochondrial inner approximately 7 A membrane to serve as anchors flanking the substrate access channel. The CYP24A1 crystal structure thus provides a template for understanding membrane insertion, substrate binding, and electron chain partner interactions. This molecular understanding of the structuree function relationships of the CYP24A1 protein will greatly facilitate biorational drug development.

MECHANISM OF ACTION Overview The vitamin D receptor (VDR) is a member of the family of nuclear hormone receptors. This ligand-activated transcription factor belongs to a subfamily that also includes the triiodothyronine, retinoid-X and retinoic acid receptors. The VDR has been shown to mediate the effects of 1,25(OH)2D by binding this ligand, heterodimerizing with the retinoid-X receptor (RXR) and interacting with DNA sequences on target genes, thereby regulating their transcription. Nuclear receptor co-activators have been shown to contribute to the transcriptional effects of the liganded VDReRXR heterodimer. The VDR has also been shown to bind non-traditional ligands including lithocholic acid [98] and curcumin [99], as well as to have actions which are not thought to be dependent upon ligand binding [100].

Vitamin D Receptor The biological effects of 1,25(OH)2D are thought to be mediated by a nuclear receptor, the VDR (reviewed in [101]). The VDR belongs to the subfamily of nuclear hormone receptors, which also includes the retinoic acid receptors, retinoid X receptors and thyroid hormone receptors. Unlike these other members of the subfamily, which each has more than one characterized isoform (a, b and g), only one nuclear VDR has been

167

FIGURE 8.2

Evolutionary conservation of functional domains in the vitamin D receptor (VDR). A schematic representation of the VDR is shown with its principal domains: AF1 and AF2 activation domains, DNA binding domain (DBD), heterodimerization domain (HD) and hormone binding domain (HBD). The evolutionary conservation of the amino acid sequence of the various domains.

isolated. Like other members of the nuclear receptor superfamily, the principal domains of the VDR are those involved in DNA binding, hormone binding, dimerization and transcriptional activation (Fig. 8.2). These domains are highly evolutionarily conserved among vertebrates, with 75% identity between the human [102] and Xenopus [103] VDRs. The DNA binding domain is more highly conserved with greater than 90% conservation of amino acid sequence across vertebrate species [103] and 84% between the human and invertebrate lamprey VDR [104]. Unlike most nuclear hormone receptors that contain a substantial amino terminal transactivation domain (AF1), the human VDR has a very short region N-terminal to the two zinc fingers that comprise the DNA binding domain. Sequences within the DNA binding domain (residues 24e90) are responsible for DNA binding as well as for nuclear localization and also have been shown to contribute to heterodimerization. The region of the VDR carboxy terminal to the DNA binding domain contains residues involved in hormone binding, heterodimerization, transactivation and interactions with nuclear receptor co-activators (reviewed in [101]). The affinity of the VDR for 1,25(OH)2D is approximately three orders of magnitude higher than that for 25(OH)D. Hormone binding by the receptor results in phosphorylation, promotes heterodimerization, high affinity binding to DNA response elements and the recruitment of nuclear receptor co-activators. An amphipathic alpha-helical region at the C terminus (residues 416e422), referred to as the AF2 region, has been shown to be critical for transactivation and for recruitment of nuclear receptor co-activators. The transcriptional activity of the VDR is modulated by post-translational modifications as well as by association with nuclear receptor co-activators. Like other members of the nuclear receptor superfamily, the VDR undergoes rapid phosphorylation. Both in vitro and in vivo studies have demonstrated that serine 208 is an important site of VDR phosphorylation. This residue is flanked by a casein kinase II recognition site and, in

PEDIATRIC BONE

168

8. VITAMIN D BIOLOGY

fact, purified casein kinase II phosphorylates the human VDR at this residue [105]. Phosphorylation at serine 208 has been shown to be the principal site of hormonedependent VDR phosphorylation [106]. Although phosphorylation of this residue does not alter ligand binding [105], nuclear localization or binding to vitamin D response elements, it results in a dose-dependent enhancement of 1,25(OH)2D-mediated transactivation of reporter genes [107] due to enhanced interaction with the DRIP nuclear receptor co-activator complex [108]. In contrast, the rapid protein kinase A-mediated phosphorylation of the VDR is neither mediated by, nor dependent upon ligand. Protein kinase A-dependent phosphorylation of serine 182 impairs induction of target genes by impairing RXR heterodimerization [109]. Attenuation of ligand-mediated transactivation is also seen with protein kinase C-mediated VDR phosphorylation at serine 51 [110], correlating with impaired binding of the VDR to its DNA response elements [111]. The carboxy-terminal region of the vitamin D receptor interacts with the basal transcription apparatus by directly contacting the transcription factor, TF IIB [112]. Although this interaction contributes to transactivation by the VDR, the observation that it occurs in a ligand-independent fashion, suggests that it is only one of a series of proteineprotein interactions that ultimately leads to the modulation of gene expression by the VDR.

Nuclear Receptor Co-activators Nuclear receptor co-activators provide a critical link between ligand-activated nuclear receptors and the basal transcription machinery. The best characterized nuclear receptor co-activators belong to the SRC/p160 (steroid receptor coactivator) family [113,114]. The members of this family interact with nuclear receptors via an alpha-helical LXXLL motif that binds to an alpha helical region in the distal carboxy terminal region (416e422) of the VDR. It is postulated that ligand binding by the VDR results in a conformational change, exposing residues of the carboxy terminal to the DNA binding domain (224e246, 255e278 and 416e422) which, in turn bind SRC-1. In fact, mutagenesis of these sequences results in impaired transactivation in the setting of normal hormone binding and heterodimerization with RXR [115]. SRC-1 has also been shown to enhance the ligand-dependent interaction between Smad 3, a protein involved in the transforming growth factor (TGF) beta signaling pathway, and the liganded VDR, suggesting that nuclear co-activators play a key role in modulating the VDR-mediated transcriptional effects of growth factors [116]. SRC-1 knockout mice

exhibit abnormal response to several nuclear receptors but have not been shown to have impaired 1,25-dihydroxyvitamin D action in vivo. In addition to interacting with general transcription factors, including TF IIB and TATA binding protein [117], SRC-1 family members have been shown to have histone acetyl transferase activity [118]. This latter enzymatic activity is thought to increase access to the general transcriptional apparatus by remodeling chromatin, thereby modifying the repressive effects of nucleosomes on gene expression. SRC/p160 family members form complexes with CBP/p300, which also provides histone acetyl transferase activity [119]. Although CBP/p300 binds nuclear receptors with low affinity, its interactions with SRC-1 family members link CBP/p300, nuclear receptors and other proteins that mediate gene regulation by nuclear receptors. NCoA-62 (also known as SKIP) is a co-activator that was cloned based on its interactions with the VDR. The mechanism by which NCoA-62 performs its transcriptional regulatory function is distinct from that of the SRC family members. Notable in this respect, it interacts with unliganded receptors and does not require the AF2 domain [120]. However, sequences in helix 10 of the VDR which interact with RXR, also interact with NCoA62 and TFIIB [121]. A mulimeric complex, isolated based on its ability to interact with the hormone binding domain of the VDR, DRIP (D receptor interacting proteins), plays a crucial role in direct recruitment of the transcriptional machinery. This complex is capable of enhancing VDRmediated transactivation in a cell free system [122] and is essential for ligand-dependent transactivation [123]. Binding of liganded VDR to the DRIP complex enhances binding to RNA polymerase II, suggesting that this is a critical mechanism by which the liganded VDR mediates transcriptional activation [124]. However, several components of the DRIP complex are also present in the activation complexes purified using non-nuclear receptor transactivators, such as Sp1, suggesting that they may be universally required for transcriptional activation. Studies in epidermal keratinocytes have demonstrated that different co-activatoreVDR interactions are found in proliferating versus differentiating keratinocytes [125]. Thus, the finding that DRIPeVDR complexes predominate in proliferative cells, whereas SRC-1 predominates in differentiating cells provides a paradigm for how a transcription factor can regulate different subsets of genes during differentiation of a single cell type. Co-repressors (NcoR and SMRT) also interact with nuclear hormone receptors and their actions are thought to be responsible for the transcription repressing activities of unliganded receptors for triiodothyronine and

PEDIATRIC BONE

169

MECHANISM OF ACTION

retinoic acid. These co-repressors stabilize chromatin by deacetylation of histones. In contrast, 1,25(OH)2D recruits SMRT and NCoR to the promoters of target genes. The ligand-bound VDR promotes binding of these co-repressors to RXR, whereas, the RXR ligand results in co-repressor release from the heterodimer [126]. Hairless, which was first characterized as a thyroid hormone receptor co-repressor, binds the VDR and represses VDR-mediated transcription in both the presence and absence of ligand [127]. While the in vivo consequences of this interaction have not been established, the absence of functional VDR or Hairless protein is associated with alopecia in humans and mice [128,129], suggesting that their cooperative effects are critical for maintenance of hair follicle homeostasis.

Vitamin D Response Elements and Target Genes The VDR has been shown to bind to direct repeat hexameric response elements, separated by three bases, on target genes that are upregulated by 1,25(OH)2D [130,131]. These response elements have been identified in several genes, including the osteocalcin [132,133], osteopontin [134], aVb3 integrin [135,136] and vitamin D 24-hydroxylase (Cyp24a1) genes [137,138]. Vitamin D responsiveness has also been demonstrated for the calbindin-D9K and 28K genes. Although vitamin D response elements have been characterized in both of these genes [139,140], 1,25(OH)2D does not induce the expression of calbindin-D9K in all cells that express this transcript [141,142]. Interestingly, transgenic experiments have demonstrated that the 1,25(OH)2D responsiveness of the 50 regulatory region of calbindin-D9K is

not dependent upon the characterized vitamin D response element, but rather requires other DNA sequences, including the consensus binding motif for the homeodomain gene Cdx2 [143]. The VDR has also been shown to bind to direct repeat response elements separated by four or five bases and to palindromic sequences, in addition to being capable of binding to response elements as a homodimer. In the case of the human c-fos promoter, nuclear factor 1 has been shown to be involved in the VDReRXR complex that interacts with a DNA sequence consisting of three direct repeats, separated by seven bases [144]. In an analogous fashion, perhaps binding of the VDR to “non-traditional” response elements requires stabilization of the DNA protein interactions by recruitment of other nuclear proteins. With the advent of chromatin immunoprecipitation and analyses of DNA sequences that bind the VDR in the context of intact chromatin, a complex regulatory network is being unveiled. Studies of the 24 hydroxylase (CYP24A1) gene, which is induced by 1,25(OH)2D, demonstrate that, in addition to the two VDREs located near the proximal promoter, the VDReRXR heterodimer also binds a cluster of potential enhancers in the intergenic region, 50e69 kilobase pairs downstream from the human gene and 35e45 kilobase pairs downstream from the mouse gene. These sequences contribute to transcriptional activation by 1,25(OH)2D as well as to co-regulator recruitment [145]. The VDR also suppresses the expression of several genes (Table 8.1). The VDR interacts with DNA sequences in the parathyroid hormone gene that are homologous to the motifs required for transcriptional induction by this receptor [56,146]. The mechanism by which these sequences lead to 1,25(OH)2D-mediated

TABLE 8.1 Activating and Repressing Vitamin D Response Elements (VDREs) Activating VDREs

RXR

VDR

Rat osteocalcin

GGGTGA

atg AGGACA

Human osteocalcin

GGGTGA

acg GGGGCA

Mouse osteopontin

AGGTTC

acg AGGTTC

Avian aVb3 Integrin

GAGGCA

gaa GGGAGA

Rat 24 hydroxylase (i)

AGGTGA

gtg AGGGCG

(ii)

GGTTCA

gcg GGTGCG

Repressing VDREs Human PTH (antisense strand)

ATCTCAACTATAGGTTCAAAGCAGCACATA

Avian PTH

TGAGGGTCAGGAGGGTGTGCCTGCAGG

Human PTHrP

TAAAGTGCTATAGATTCATATTTGGTTTAT

RXR: half-site binding retinoid X receptor; VDR: half-site binding vitamin D receptor.

PEDIATRIC BONE

170

8. VITAMIN D BIOLOGY

transcriptional repression is thought to be due to the use of alternate heterodimerization partners [147] and to additional sequences which bind VDR interacting proteins [148]. The human parathyroid hormone-related peptide (PTHrP) negative VDRE also binds the VDR but not RXR. Transcriptional repression mediated by this negative VDRE is dependent on interactions of the VDR with the Ku antigen [149]. The sequences that are responsible for 1,25(OH)2D-mediated transcriptional repression of the vitamin D 1a-hydroxylase gene, bind a basic helix-loop helix transcription factor known as the VDR interacting repressor (VDIR) [62]. The VDIR binds this response element resulting in transactivation. The liganded VDReRXR heterodimer interacts with VDIR, leading to the dissociation of the histone acetyl transferase p300/CBP and recruitment of the histone deacetylase nuclear receptor co-repressor HDAC. This results in transcriptional repression of the vitamin D 1a-hydroxylase gene. Similar interactions of the VDIR with sequences in the PTH and PTHrP promoters have been implicated in the transcriptional repression of these genes by the liganded VDR [148]. In vitro data have suggested that the unliganded VDR can repress basal transcription and that the unliganded VDReRXR heterodimer causes VDR-mediated repression of basal transcription on classic vitamin D response elements [150]. The in vivo significance of these observations has not been established, but the existence of ligand-independent VDR actions are supported by the observation that mice and humans lacking functional VDRs develop alopecia [129], whereas absence of ligand does not result in this phenotype [151].

Chromatin and DNA Methylation In addition to binding histone acetyl transferases and deacetylases, the VDR interacts with chromatin remodeling complexes that rearrange nucleosomes in an energy-dependent fashion, rendering chromosomal DNA accessible to transcription factors. The VDR binds a multimeric complex with ATP-dependent chromatin remodeling activity known as WINAC (WSTF including nucleosome assembly complex). The complex derives its name, in part from the Williams syndrome transcription factor (WSTF), a protein that is mutated in a congenital disorder characterized by abnormal vitamin D metabolism, vascular lesions, developmental delay and atypical facies. The VDR binds directly to WSTF which, in turn, binds to ATP-dependent chromatin remodeling enzymes, including Brg1 and Brm [152]. In addition to promoting ligand-dependent transactivation by the VDR, the WINAC complex is also required for transrepression of the 1a-hydroxylase gene by the liganded VDR. This transrepression requires the bromodomain of WSTF that interacts with acetylated histones.

As previously mentioned, the VDR also promotes DNA methylation of CpG islands in the 1a-hydroxylase promoter, revealing another level at which the liganded VDR represses expression of this gene [43]. The upregulation of the 1a-hydroxylase by parathyroid hormone involves demethylation of the methylated CpG sites. The complex that associates with the VDR to regulate methylation involves two DNA methyl transferases as well as a DNA glycosylase, MBD4. This latter protein is phosphorylated by PKC in response to PTH stimulation, leading to incision of methylated DNA promoting a base-excision repair process that results in complete DNA demethylation. Thus, the VDR regulates transcription of target genes by direct binding to DNA response elements, recruiting nuclear receptor co-modulators, as well as by modifying the chromatin environment in association with the WINAC complex and regulating DNA methylation.

Non-classical Effects Several actions of 1,25(OH)2D occur too rapidly to be mediated by transcriptional mechanisms. These effects involve rapid activation of second messengers [153,154] and activation of voltage-dependent calcium channels [153e156]. As well, naturally occurring vitamin D metabolites that bind the nuclear VDR with very low affinity, have been shown to have specific biological effects, notably the effect of 24-hydroxylated metabolites on growth plate chondrocyte maturation [157,158]. Studies in mice lacking the VDR DNA binding and AF1 domains have demonstrated absence of rapid increases in intracellular calcium in response to 1,25dihydroxyvitamin D, demonstrating that this response requires an intact nuclear VDR [159]. ERp57/GRp58 is also known as the membrane-associated rapid response steroid binding (MARRS) protein that binds vitamin D metabolites. Its biological role in mediating effects of 1,25(OH)2D and other vitamin D metabolites will require investigations in mice lacking this protein [160].

ROLE OF VITAMIN D IN CALCIUM HOMEOSTASIS Physiological Actions of 1a,25-Dihydroxyvitamin D Animal models and studies in humans with dietary vitamin D deficiency have contributed significantly to our understanding of the role of 1,25(OH)2D in mineral ion homeostasis [161e164]. These studies have demonstrated that 1,25(OH)2D plays a critical role in intestinal calcium absorption. Vitamin D deficient animals develop hypocalcemia, hypophosphatemia, hyperparathyroidism, rickets and osteomalacia [161]. In vitro

PEDIATRIC BONE

ROLE OF VITAMIN D IN CALCIUM HOMEOSTASIS

studies have demonstrated that 1,25(OH)2D has an antiproliferative effect on parathyroid cells [165]. Furthermore, 1,25(OH)2D has been shown both in vitro [166,167] and in vivo [58] to repress PTH gene transcription. These data provide much of the rationale for preventing and treating uremic hyperparathyroidism with pharmacological doses of vitamin D metabolites [168]. However, investigations in mice lacking functional 1ahydroxylase or VDR genes have demonstrated that normalizing mineral ion levels can prevent hyperparathyroidism, thus, in the setting of normocalcemia, the effects of 1,25(OH)2D on parathyroid function are redundant [169,170]. Numerous studies have examined the skeletal actions of 1,25(OH)2D. Disorganized growth plates are observed in rickets associated with vitamin D deficiency as well as with hypophosphatemia. Pathologically, these growth plates are characterized by an expansion of the hypertrophic chondrocyte layer [161]. Healing of the growth plate is seen with normalization of calcium and phosphorus levels in vitamin D deficient animals and children, suggesting that impaired mineral ion homeostasis contributes to the rachitic changes [171e174]. Murine studies directed at clarifying the cellular and molecular basis for the rachitic changes demonstrated that expansion of the growth plate was due to impaired hypertrophic chondrocyte apoptosis [175]. This impaired apoptosis was a result of hypophosphatemia, and was not prevented by suppression of PTH levels or hypercalcemia [176]. Osteoblasts express vitamin D receptors and 1,25(OH)2D plays a critical role in the regulation of several bone matrix proteins. 1,25(OH)2D has been shown to downregulate the transcription of the alpha1(I) collagen gene in osteoblasts [177] and is a potent transcriptional activator of the genes encoding osteocalcin and osteopontin [134]. However, experiments performed in vitamin D deficient rats have failed to show significant differences in the bone content of numerous matrix proteins, including osteocalcin [178]. Studies performed in vitamin D deficient rats [179] and in humans [173] with vitamin D receptor mutations have demonstrated that calcium and phosphorus repletion can mineralize osteomalacic lesions in the presence of impaired 1,25(OH)2D action, suggesting that this steroid hormone is not required for mineralization. Similarly, preventing hypocalcemia can prevent the osteomalacia observed in mice with 1a-hydroxylase and VDR mutations [169,172]. 1,25(OH)2D also stimulates the differentiation of osteoclasts from monocyteemacrophage stem cell precursors. However, monocyteemacrophage precursors isolated from vitamin D receptor null mice are capable of differentiating into multinucleated osteoclasts [180]. This is consistent with the effect of 1,25(OH)2D and

171

parathyroid hormone on inducing the synthesis of RANK ligand (osteoclast differentiating factor) by the osteoblast. This membrane bound factor then interacts with the RANK receptor on osteoclast precursors which, in the presence of M-CSF, leads to their differentiation into mature osteoclasts. Because RANK ligand synthesis is also induced by PTH, in the absence of the genomic actions of 1,25(OH)2D, PTH-stimulated production of this factor is sufficient to sustain osteoclast differentiation. One of the most important in vivo roles of 1,25(OH)2D is to promote intestinal calcium absorption. Several proteins present in the brush border of the intestinal cell membrane, including the Ca/Mg ATPase, brush border alkaline phosphatase and intestinal membrane calcium binding protein, are induced by 1,25(OH)2D. In addition, two calcium channels, expressed in the intestine, TRPV5 and TRPV6 [181,182] have been shown to promote entry of calcium into the enterocyte. These transient receptor potential vanilloid receptor (TRPV) subfamily members are both induced by 1,25(OH)2D. However, TRPV5 is expressed primarily in the kidney and mice lacking TRPV5 exhibit renal calcium wasting with enhanced intestinal calcium absorption, due to a compensatory increase in 1,25(OH)2D [183]. 1,25(OH)2D is also a potent inducer of the gene encoding calbindin-D9K, a protein that binds calcium ions and is thought to play a role in transcellular calcium transport. Studies in vitamin D deficient animals have demonstrated that calbindin-D9K levels are increased early and dramatically after injection of vitamin D metabolites and correlate with an increase in active transport of calcium across the intestine [184]. However, mice lacking both TRPV6, the predominant intestinal calcium channel, and calbindin-D9K exhibit enhancement of calcium transport in response to 1,25(OH)2D [185], suggesting that additional proteins or pathways are involved in 1,25(OH)2D regulated intestinal calcium absorption. Two proteins thought to form paracellular calcium channels, claudin 2 and claudin 12, are also induced by 1,25(OH)2D [186], suggesting that this steroid hormone regulates paracellular as well as transcellular calcium transport. Vitamin D has been shown to have effects not related to mineral ion homeostasis. Consistent with these observations, the VDR is expressed in several tissues including skin, breast, prostate, pancreas, colon, muscle and immune cells. 1,25(OH)2D induces the differentiation and attenuates the proliferation of hematopoietic tumor cells [187], breast cancer cells [188,189], prostate cancer cells [190] and keratinocytes [191e193]. While the biological implications of VDR expression in many of these non-traditional tissues is an active area of investigation, 1,25(OH)2D analogs have been used for the treatment of psoriasis [194] and clinical studies have

PEDIATRIC BONE

172

8. VITAMIN D BIOLOGY

demonstrated that vitamin D deficiency leads to impaired muscle function and an increase in falls [195]. The molecular basis for this latter effect of vitamin D metabolites has yet to be elucidated. Studies of the immunomodulatory effects of vitamin D metabolites have demonstrated that activation of Toll-like receptors (TLRs) induces the 1a-hydroxylase in cells of the macrophage lineage. Coupled with the increase in VDR expression which is also observed, this leads to a dramatic enhancement in local autocrine signaling by 1,25(OH)2D which, in turn, induces the synthesis of antimicrobial peptides that play a role in host defense to microbes, including mycobacteria [196]. In addition to demonstrating the importance of the VDR in immune function, this model system identifies a critical biological role for the local activation of vitamin D to 1,25(OH)2D in target tissues. Similarly, the molecular basis for the effects of 1,25(OH)2D on colon cancer have been extensively studied. Mutations in APC occur in colonic polyps in the early stages of carcinogenesis [197]. These mutations result in constitutive activation of the canonical Wnt signaling pathway that plays a critical role in subsequent neoplastic transformation. The liganded VDR attenuates this pathway by causing redistribution of b-catenin, a key transcriptional effector of this pathway, from the nucleus to the cell membrane, promoting the formation of adherens junctions and attenuating canonical Wnt signaling [198].

Animal Models Cyp27a1 Knockout Currently, there are no published reports of mice deficient for CYP2R1, the microsomal vitamin D-25-hydroxylase. A strain deficient for Cyp27a1, the bifunctional mitochondrial P450 able to hydroxylate vitamin D at position 25 [199,200] as well as 27-hydroxylate the side chains of cholesterol-derived intermediates involved in bile acid biosynthesis [10,15,16], has been described [11]. Mutations in the gene cause cerebrotendinous xanthomatosis (CTX), a lipid storage disorder leading to premature atherosclerosis and progressive neurological dysfunction [12,13]. Homozygous Cyp27a1/ animals have larger livers and larger adrenals [201], decreased synthesis and excretion of bile acids [11], and hypertriglyceridemia [201]. The increased formation of 25-hydroxylated bile alcohols and cholestarol observed in CTX patients was not observed in Cyp27a1/ mice, and no CTX-related pathological abnormalities were evident [11]. At present, it remains unclear whether the Cyp27a1-deficient mouse is a valid animal model for CTX. Interestingly, Cyp27a1-null mice had normal serum concentrations of 1,25(OH)2D and slightly

elevated levels of 25(OH)D in their blood [11]. These results support the hypothesis that CYP27A1 is not the sole vitamin D-25-hydroxylase and that CYP2R1 is physiologically relevant in vitamin D metabolism. DBP Knockout The bulk of 25(OH)D circulates bound to the carrier protein, vitamin D binding protein (DBP), also known as the group-specific component of serum (Gc-globulin). DBP shows higher binding affinity for 25(OH)D, but can also bind 1,25(OH)2D and the parental vitamin D, albeit with 10-fold reduced affinity [202]. The role of DBP in vitamin D biology remained unclear until a line of mice deficient in DBP was generated. When fed a normal, vitamin D-replete diet, DBP/ mice had significantly reduced serum levels of 25(OH)D and 1,25(OH)2D, but were otherwise normal [203]. The effect of the mutation was more evident when the mice were challenged by feeding them a vitamin D-deficient diet. Under those conditions, the DBP-deficient mice became hypocalcemic, hypophosphatemic, and developed secondary hyperparathyroidism. These biochemical changes were accompanied by the typical bone changes associated with vitamin D deficiency: increased unmineralized bone (osteoid) and increased osteoblastic activity [203]. Thus, absence of DBP leads to increased sensitivity to dietary vitamin D deprivation. With respect to vitamin D homeostasis, DBP/ mice had a significantly decreased half-life of 25(OH)D in the circulation and increased liver uptake of vitamin D [203]. Urinary excretion of 25(OH)D was higher in DBP-null mice [203]. DBP-deficient animals were less susceptible to the toxic effects of hypervitaminosis D, exhibiting reduced nephrocalcinosis and reduced hypercalcemia when compared with wild-type littermates [203]. This observation correlates with the profile of serum clearance of vitamin D measured in DBP-null mice. Overall, analysis of the DBP/ phenotype is consistent with a role for DBP in maintaining stable serum stores of vitamin D metabolites and influencing its bioavailability and activation. Megalin Knockout The key role played by DBP in vitamin D metabolite activation was further confirmed by the analysis of surviving megalin knockout mice. Megalin is a multifunctional clearance receptor involved in the uptake of ligands from the luminal site into the proximal tubular cells of the kidney [204,205]. It binds numerous molecules including vitamin-binding proteins, hormones, lipoproteins, proteases, and protease inhibitors [204,205]. Megalin is expressed in the neuroepithelium, in proximal tubular cells of the kidney and in the parathyroids; mice deficient for megalin die soon after birth from a developmental defect of the forebrain [206]. The

PEDIATRIC BONE

ROLE OF VITAMIN D IN CALCIUM HOMEOSTASIS

severity of the phenotype differs between animals, however, and one in 50 of the megalin/ mice make it to adulthood. Analysis of the phenotype of these survivors identified a key endocytic pathway involved in renal uptake and activation of 25(OH)D [207]. Analysis of the urine from surviving adult megalin/ mice revealed several excreted low-molecular-weight proteins that are normally reabsorbed in normal mice. Amino acid sequence analysis of the major protein band from knockout urine matched the sequence of DBP [207]. This suggested that megalin normally binds DBP and mediates its reabsorption from the urine. Indeed, it was demonstrated that megalin is the renal DBP receptor and that it mediates tubular uptake of unliganded DBP as well as 25(OH)D-DBP complexes [207]. Moreover, perfused rat kidney experiments showed that blocking megalin activity in the tubules with a specific antagonist prevented conversion of 25(OH)D into 1,25(OH)2D [207]. These results suggest that filtered and reabsorbed DBP-bound 25(OH)D serves as a substrate for the renal 1a-hydroxylase enzyme and that loss of megalin activity prevents delivery of the substrate to tubular cells. Since close to 90% of circulating 25(OH)D is bound to DBP [208], the massive excretion of DBP in the urine of megalin/ mice leads to vitamin D deficiency and bone defects in megalin-null mice [207]. Megalin requires co-receptors to achieve ligand specificity [209], and one such co-receptor is the plasmamembrane anchored protein cubilin [210]. It was shown that cubilin binds DBP [211]. Interestingly, dogs with an uncharacterized mutation affecting cubilin biosynthesis excrete DBP and 25(OH)D in the urine and show reduced levels of blood 25(OH)D and 1,25(OH)2D [211], supporting a role for cubilin in the delivery of DBP-bound 25(OH)D to tubular cells. A model for the role of cubilin and megalin in vitamin D homeostasis was proposed [207,211]. Cubilin binds the excreted 25(OH)D-DBP complexes on the cell surface of proximal tubular kidney cells. This facilitates the endocytotic process by sequestering the vitamin Dcarrier complex before internalization via megalin. Delivery of the endocytosed complexes to lysosomes leads to DBP degradation and release of 25(OH)D, which is hydroxylated to 1,25(OH)2D and resecreted into the circulation. These studies have elucidated a key step in vitamin D metabolism that was previously unrecognized. Cyp24a1 Knockout The CYP24A1 enzyme initiates the C-24 oxidation pathway, a succession of hydroxylation/oxidation reactions at carbons 24 and 23 that lead to 1,25(OH)2D inactivation [74, 75]. The role of the CYP24A1 enzyme in the catabolism of 1,25(OH)2D had already been

173

demonstrated in tissue culture [87]. The Cyp24a1 gene has been inactivated in mice to examine the role of the CYP24A1 enzyme in vitamin D homeostasis in vivo [88]. Fifty percent of Cyp24a1/ mice die before 3 weeks of age [88,212]. Analysis of macrophage function ruled out impaired responses to infection as the cause for postnatal death. The perinatal lethality is most likely a consequence of hypercalcemia secondary to hypervitaminosis D, since the inactivation of the Cyp24a1 gene in mice impaired the ability of the animals to clear 1,25(OH)2D. Bolus and chronic 1,25(OH)2D administration resulted in a marked elevation in serum 1,25(OH)2D levels in the mutant animals [88]. Chronic 1,25(OH)2D administration in Cyp24a1/ mutants resulted in histological changes consistent with hypervitaminosis D in the kidney: cortical tubular dilation, necrotic debris and mineralization (nephrocalcinosis). The inability to regulate 1,25(OH)2D and calcium homeostasis presumably leads to fatal hypercalcemia. Indeed, extremely high levels of circulating 1,25(OH)2D and calcium were measured in runted animals that died before weaning [88]. Since half of the mutant progeny appear unaffected by the Cyp24a1 deficiency, these animals most likely use alternate means of regulating vitamin D homeostasis. Clearance and metabolism of labeled 1,25(OH)2D was measured in Cyp24a1/ survivors and heterozygote controls. These experiments have shown that Cyp24a1-null mice have impaired clearance of 1,25(OH)2D [213,214]. Surprisingly, Cyp24a1/ mice appear to lack not only 24-hydroxylated metabolites but also 1,25(OH)2D-26,23-lactone, supporting the view that the CYP24A1 enzyme is also responsible for hydroxylating 1,25(OH)2D at C-23 and C-26 [86,215]. These surprising findings suggest that the Cyp24a1null survivors adapt to the impaired vitamin D catabolism not by using an alternative catabolic route, but by limiting the synthesis of the active compound. Indeed, reduced expression of the 1a-hydroxylase gene, Cyp27b1, was measured in Cyp24a1/ mice [214]. The survival of some Cyp24a1/ mutant animals to adulthood has also allowed experiments designed to address the effect of perturbing vitamin D metabolism during development. Bone development is abnormal in homozygous mutants born of homozygous females [88,216]. Histological examination of the bones from these animals revealed an accumulation of osteoid at sites of intramembranous ossification [88,216]. No significant disruption of growth plate organization was noted. Control heterozygote littermates showed normal bone structure. Two major hypotheses can be formulated to account for the phenotype of the Cyp24a1-deficient embryos from Cyp24a1 mutant dams: (1) perturbation of 1,25(OH)2D catabolism through the inactivation of the

PEDIATRIC BONE

174

8. VITAMIN D BIOLOGY

C-24 oxidation pathway affects bone development; (2) metabolites of vitamin D hydroxylated at position 24 are essential for bone development. To differentiate between these possibilities, the Cyp24a1-deficient animals were bred to mice carrying an inactivating mutation of the vitamin D receptor gene [217]. If elevated 1,25(OH)2D levels, acting through the vitamin D receptor, were responsible for the observed phenotype, then mice lacking the receptor and the Cyp24a1 gene should not show the aberrant intramembranous bone development. Using this elegant genetic strategy, incontrovertible evidence was obtained that expression of the VDR is required for the impaired mineralization phenotype of the Cyp24a1-deficient animals: double mutant homozygotes (Cyp24a1/ and VDR/) showed normal intramembranous bone formation at all sites examined [88]. This demonstrates that elevated 1,25(OH)2D levels during gestation affect mineralization and suggest that impaired vitamin D metabolism during development perturbs bone formation. 1a-hydroxylase (Cyp27B1) Knockout The 1a-hydroxylase enzyme (CYP27B1) converts 25(OH)D to 1,25(OH)2D, the biologically active metabolite of vitamin D. Mutations in the CYP27B1 gene cause pseudo vitamin D deficiency rickets (PDDR), also named vitamin D dependent rickets type I, a rare autosomal disease characterized by growth retardation, failure to thrive, rickets and osteomalacia [218,219] (see also Chapter 25). Biochemical analysis of serum from affected patients reveals hypocalcemia, secondary hyperparathyroidism, and undetectable levels of 1,25(OH)2D3. An animal model of PDDR was generated by targeted inactivation of the 1a-hydroxylase gene in mice [32]. The strategy, based on the Cre/lox methodology, allows tissue-specific inactivation of the targeted gene [220]. This conditional 1a-hydroxylase allele provides an invaluable genetic tool to analyze the putative autocrine/paracrine roles that have been hypothesized for 1,25(OH)2D in various cell types such as osteoblasts, chondrocytes, macrophages, or keratinocytes. Exon 8 of the 1a-hydroxylase gene, encoding the heme binding domain [25], was flanked by loxP recognition sites. Homologous recombination at the 1a-hydroxylase locus followed by transient transfection of the embryonic stem cells with the Cre recombinase generated a targeted allele in which exon 8 was deleted, thus engineering a conventional knockout allele [32]. Homozygous mutant animals were phenotypically normal at birth but exhibited retarded growth as measured by weight gain from 3 to 8 weeks of age (not shown) and femur length at 8 weeks (Fig. 8.3). Serum analysis of homozygous mutant animals confirmed that they were hypocalcemic (Fig. 8.4),

FIGURE 8.3 Reduced growth of 25-hydroxyvitamin D-1ahydroxylase (Cyp27b1; 1a-hydroxylase) mouse mutants. Animals from all genotypes (þ/þ, þ/, /) and þ/ and / littermates were sacrificed at weaning and at 8 months of age, respectively. Femurs were collected and measured with a caliper. There was no significant difference between femur length at 3 weeks of age (weaning), but 1a-hydroxylase/ animals (/) exhibited reduced growth rates and had significantly shorter femurs at 8 weeks when compared to heterozygote (þ/) littermate controls, *** P<0.001.

FIGURE 8.4 Serum concentrations of total calcium in 25-hydroxyvitamin D-1a-hydroxylase (Cyp27b1; 1a-hydroxylase) mutant mice. Pups were sacrificed by exsanguination under anesthesia at 3 weeks of age and genotyped by Southern blotting of tail DNA. Total calcium was measured from serum samples of wild-type (þ/þ), heterozygotes (þ/), and homozygote mutant (/) animals using an automated analyzer. The horizontal bars indicate the mean for each population. ** P<0.01 by analysis of variance (ANOVA). The mean value for / mice is at the lower end of the normal range for this strain.

hypophosphatemic, suffered from secondary hyperparathyroidism and exhibited undetectable circulating levels of 1,25(OH)2D3 [32]. From a biochemical standpoint, the only difference between the 1a-hydroxylase/ mice and patients with PDDR is that patients with the disease have normal serum levels of 25(OH)D [221e223] and 24,25(OH)2D [224], whereas elevated levels of 25(OH)D and very low levels of 24,25(OH)2D

PEDIATRIC BONE

ROLE OF VITAMIN D IN CALCIUM HOMEOSTASIS

are seen in 1a-hydroxylase mutant mice [32]. These discrepancies with the human disease remain to be explained but could result from species differences. Histological analysis of the bones from 3 week-old mutant animals confirmed the evidence of rickets [32]. At the age of 8 weeks, femurs from 1a-OHase-ablated mice present a severe disorganization in the architecture of the growth plate and marked osteomalacia [32]. The x-ray features of the bones from 1a-hydroxylase/ animals also matched the clinical manifestations of PDDR. Contact radiography of femurs from mutant animals revealed diffuse osteopenia (hypomineralization) and rachitic metaphyseal changes [225]. Interestingly, the expression of vitamin D-dependent genes such as osteopontin and osteocalcin was not changed in bone tissue from 1a-hydroxylase mutant mice [32]. The treatment of choice for PDDR is long-term replacement therapy with 1,25(OH)2D3 [219,221,226]. Treatment of 1a-hydroxylase-deficient mice with 1,25(OH)2D for 5 weeks corrects the hypocalcemia and secondary hyperparathyroidism. Bone histology and histomorphometry confirmed that the rickets and osteomalacia were cured. The biomechanical properties of the bone tissue (load bearing, deformation, and stiffness) were also normalized by the rescue treatment [227]. Rescuing mineral homeostasis in 1a-hydroxylasedeficient mice by feeding of a high calcium, high lactose diet corrected all aspects of the phenotype, except long bone growth [169]. Since the 1a-hydroxylase enzyme that synthesizes 1,25(OH)2D is expressed in chondrocytes, it was suggested that local production of 1,25(OH)2D could play an autocrine or paracrine role in the differentiation of these cells and explain the partial rescue of the phenotype when mineral homeostasis is corrected. To test this hypothesis, mutant mice that do not express the 1a-hydroxylase gene in chondrocytes were generated. This led to increased width of the hypertrophic zone of the growth plate at E15.5, increased bone mass in neonatal long bones, and increased expression of the chondrocytic differentiation markers Indian Hedgehog and PTH/PTHrP receptor. VEGF mRNA levels were decreased, accompanied by decreased PECAM-1 immunostaining, suggesting a delay in vascularization [228]. These results agree with the phenotype observed in chondrocyte-specific VDR-ablated mice [229] and support an autocrine/paracrine role of 1,25(OH)2D in endochondral ossification and chondrocyte development in vivo. VDR Knockout Although studies in vitamin D deficient animals and in vitro studies using cell culture models clarified many actions of vitamin D metabolites, there remained several unanswered questions concerning the principal actions of the VDR in vivo. To clarify further the role of the

175

VDR in vivo, mice with targeted ablation of the vitamin D receptor were generated. As anticipated, these mice demonstrate several of the phenotypic abnormalities present in humans with vitamin D receptor mutations [217,230]. The pups are phenotypically indistinguishable from their wild-type and heterozygous littermates at birth. At the end of the third week of life, the mice develop hyperparathyroidism, presumably secondary to impaired intestinal calcium absorption [231]. This hyperparathyroidism is accompanied by hypophosphatemia and hypocalcemia. The timing of the development of impaired intestinal calcium absorption is consistent with studies performed in rat pups, which demonstrate that intestinal calcium absorption is 1,25(OH)2D-independent the first 3 weeks of life [232]. Thereafter, it gradually becomes hormone dependent and, by 7 weeks of life, a 1,25(OH)2D-dependent active transport mechanism is largely responsible for the active transport of calcium from the intestinal lumen. Associated with an elevation in circulating PTH levels is the gradual onset of parathyroid hyperplasia, due to increased parathyroid cellular proliferation. There is a marked increase in proliferating nuclear antigen (PCNA) staining in the parathyroid glands of the VDR null mice by 35 days of age, associated with an increase in parathyroid glandular volume [170]. By 70 days of age, the circulating immunoreactive PTH levels in the VDR null mice are 16-fold elevated and the parathyroid glandular volume is 10 times that of wild-type control littermates. Interestingly, prevention of abnormal mineral ion homeostasis in the VDR null mice prevents the development of secondary hyperparathyroidism and parathyroid glandular hyperplasia [159,170]. Thus, in the presence of normocalcemia, the genomic actions of 1,25(OH)2D are not required for parathyroid homeostasis. Whether these actions play an in vivo role in attenuating parathyroid cellular proliferation and PTH gene transcription in hypocalcemic states is not clear. However, these data suggest that hypocalcemia, rather than lack of hormone, is the pathophysiological basis for hyperparathyroidism when 1,25(OH)2D action is impaired. Analogous to humans with VDR mutations and to conditions associated with vitamin D deficiency during growth, the VDR null mice develop severe rickets and osteomalacia. Expansion of the hypertrophic chondrocyte layer of the growth plate is evident as early as 21 days, 2 days after the development of secondary hyperparathyroidism. The absence of a growth plate phenotype prior to the development of impaired mineral ion homeostasis suggested that these rachitic changes were a direct consequence of hypocalcemia, hypophosphatemia or secondary hyperparathyroidism, rather than to impaired genomic actions of 1,25(OH)2D. Confirming this hypothesis is the observation that prevention of

PEDIATRIC BONE

176

8. VITAMIN D BIOLOGY

impaired mineral ion homeostasis prevents the growth plate abnormalities in the VDR null mice [170]. Although chondrocyte proliferation and differentiation was not altered in the VDR null mice, there was a marked impairment of hypertrophic chondrocyte apoptosis [175]. Investigations in additional mouse models, including the murine model of X-linked hypophosphatemia, demonstrated that hypophosphatemia led to impaired apoptosis, regardless of circulating calcium and PTH levels [176,233]. Studies in cellular models and in growing mice demonstrated that phosphate-induction of chondrocyte apoptosis is differentiation-stage specific and dependent upon Erk1/2 phosphorylation [234]. Impaired mineralization of newly synthesized osteoid (osteomalacia) is a prominent feature in the VDR null mice [172]. By 70 days of age, there is a 30fold increase in osteoid volume which leads to a fivefold increase in bone volume. In spite of this increase in bone volume, biomechanical analyses demonstrate a marked decrease in the strength of the bones in the VDR null mice, consistent with the increased fracture risk of patients with osteomalacia [235e237]. Analysis of the cellular content of the bones of the VDR null mice demonstrates a twofold increase in osteoblast number, presumably due to acceleration of bone turnover in response to profound secondary hyperparathyroidism. Paradoxically, the number of osteoclasts is not significantly altered, despite the elevation of immunoreactive PTH levels. In vitro studies demonstrated that the absence of the VDR in osteoclast precursors does not impair differentiation of these cells into mature osteoclasts. However, absence of the VDR in marrow stromal cells (osteoblast precursors), leads to impaired osteoclastogenesis in response to 1,25(OH)2D, but not to PTH [180]. These in vitro data suggest that there should be a compensatory increase in osteoclast number in response to the secondary hyperparathyroidism observed in the VDR null mice. Two additional variables may explain the inappropriately normal osteoclast number observed in these mice. First, the osteoclast avb3 integrin gene is highly induced by 1,25(OH)2D [135,136], thus cell attachment may be impaired; and secondly, osteoclasts are unable to resorb osteoid. Prevention of abnormal mineral ion homeostasis prevents the development of osteomalacia [172]. The increased bone volume observed in the hypocalcemic VDR null mice is not apparent in the normocalcemic counterparts, suggesting that the increase in matrix formation is due to the PTH-stimulated increase in bone formation and impaired resorption of unmineralized matrix by osteoclasts. VDR null mice with normal mineral ion homeostasis have a normal mineral apposition rate, confirming that the VDR is not required for mineralization of newly formed osteoid [172]. The

biomechanical properties of the bones of the normocalcemic VDR null mice are indistinguishable from those of control littermates, as is the cellular content of the bone [172]. These data demonstrate that the genomic actions of the VDR are not essential for skeletal homeostasis. The dramatic phenotypic rescue by normalization of mineral ion homeostasis in the VDR null mice confirms that the intestine is one of the critical in vivo targets of the liganded VDR. The VDR null mice exhibit a dramatic impairment in intestinal calcium absorption, associated with a reduction in the mRNA levels encoding two calcium channels, TRPV5 and TRPV6, the latter of which is thought to play a critical role in the regulation of calcium entry into the enterocyte [231]. Levels of calbindin-D9K mRNA were also dramatically reduced in the duodenum of the VDR null mice [170,231], however, the level of the plasma membrane ATPase was not affected by VDR status [231]. These data suggest that expression of the channels that regulate calcium entry into the enterocyte and that of calbindin-D9K, which is thought to play a role in intracellular calcium transfer, are the two principal mechanisms by which the nuclear VDR acts to promote intestinal calcium transport. However, mice lacking TRPV5, the major renal calcium transporter, or lacking both TRPV6 and calbindinD9K exhibit 1,25(OH)2D-dependent intestinal calcium absorption [183,185]. Thus, 1,25(OH)2D-dependent calcium absorption involves other modulators. Notable in this respect is the induction of claudin 2 and claudin 12 by 1,25(OH)2D. These proteins are thought to form paracellular calcium channels, thereby providing an alternative to transcellular calcium absorption and do not require the expression of membrane calcium channels for their action [186]. A striking feature of both humans and mice with VDR mutations is the presence of alopecia. Alopecia totalis is not a feature of vitamin D deficiency [151,238], however, there have been no cases of vitamin D deficiency reported with undetectable circulating levels of 1,25(OH)2D. Both mice and humans with VDR mutations have normal hair neonatally, suggesting that hair follicle morphogenesis does not require a functional VDR. However, clinically, the VDR null mice begin to develop alopecia by the fourth week of life [217,230]. This process is not prevented by normalization of mineral ion levels, suggesting that it is truly VDR dependent [170]. Because 1,25(OH)2D has been shown to play an important role in inhibiting proliferation and promoting differentiation of neonatal keratinocytes [191], studies were undertaken to determine whether absence of the VDR led to increased keratinocyte proliferation and impaired differentiation. Studies using neonatal keratinocytes isolated from VDR null mice demonstrated that the proliferation rate and the

PEDIATRIC BONE

ROLE OF VITAMIN D IN CALCIUM HOMEOSTASIS

acquisition of selected markers of keratinocyte differentiation were indistinguishable from those of keratinocytes isolated from control littermates [239]. However, in vivo studies demonstrated impaired keratinocyte differentiation in the VDR null mice, a phenotype that was reversed by maintenance of normal calcium levels [240]. Thus, similar to the parathyroid gland, the effects of calcium and 1,25(OH)2D on keratinocyte proliferation and differentiation are redundant. Hair follicle morphogenesis in mice begins at embryonic day 14.5 and ends day 14 of life, the end of the first hair cycle. While there is no apparent defect in hair follicle morphogenesis, the VDR null mice are unable to initiate post-morphogenic hair cycles [239]. Hair reconstitution assays [151] and studies in VDR knockout mice expressing a VDR transgene in keratinocytes demonstrated that the presence of the VDR in the keratinocyte compartment of the hair follicle is both necessary and sufficient to restore post-morphogenic hair cycling. This was somewhat at odds with the apparently redundant effects of calcium and the VDR on keratinocyte proliferation and differentiation, since maintaining normal calcium levels cannot restore post-morphogenic hair cycles [170]. This suggested there was a unique population of keratinocytes in which normocalcemia cannot compensate for the lack of VDR. The bulge region of the hair follicle, which forms below the sebaceous gland at the end of the morphogenic period (Fig. 8.5), contains keratinocyte stem cells that give rise to the hair follicle, the sebaceous glands and play a role in epidermal regeneration postinjury. While this stem cell niche forms normally in

FIGURE 8.5 Schematic representation of the hair follicle. Keratinocyte stem cells reside in the bulge of the hair follicle. These cells give rise to the sebaceous gland and the keratinocytes in the lower part of the hair follicle. They also contribute to epidermal regeneration during wound repair. (Figure reproduced from Vitamin D. Pike JW, Adams JS and Feldman D, eds.)

177

VDR null mice, the number of keratinocyte stem cells decreased with age [241,242]. However, at a time when keratinocyte stem cell number is normal, these cells are unable to regenerate a hair follicle. This observation, combined with the expanded sebocyte compartment observed in VDR null mice, and lipid laden dermal cysts suggests a defect in lineage progression of these keratinocyte stem cells [241]. The observation that wild-type mice with undetectable circulating levels of 25(OH)D and 1,25(OH)2D do not develop alopecia [151] suggested that the actions of the VDR required to maintain post-morphogenic hair cycles are ligand independent. This was confirmed by studies in VDR knockout mice with keratinocytespecific expression of a VDR transgene containing a mutation that abolishes ligand binding and liganddependent transactivation [100]. Mice with keratinocyte specific ablation of RXRa also demonstrate impairment of post-morphogenetic hair cycling, suggesting that a functional VDReRXR heterodimer is required for normal skin homeostasis. The keratinocyte ablated RXRa mice have a more profound skin phenotype than the VDR null mice, including keratinocyte hyperproliferation and impaired keratinocyte differentiation [243], suggesting that RXRa interacts with alternative nuclear receptors to mediate these latter homeostatic effects. Humans and mice lacking the nuclear co-repressor Hairless also develop alopecia [128]. Hairless mice develop lipid-laden dermal cysts, analogous to those observed in the VDR null mice. Hairless binds the VDR and represses its activity in both the presence and absence of ligand [127]. Hairless also suppresses the expression of Soggy and WISE [244], two inhibitors of the canonical Wnt signaling pathway, a pathway that is essential for post-morphogenic hair cycling [245] and which is dependent upon the VDR for activation of a reporter gene in keratinocytes [241]. Thus, maintenance of keratinocyte stem cell function by Hairless and the VDR may involve modulation of the canonical Wnt signaling pathway. The immune system has also been the focus of numerous investigations in the VDR null mice. The VDR is expressed in T lymphocytes, dendritic cells and macrophages. The 1a-hydroxylase expressed in cells of the immune system is identical to the renal enzyme, however, it is induced by cytokines, including interferon (IFN) g and by activation of Toll-like receptors (TLRs), rather than by PTH, growth hormone (GH) and hypophosphatemia. In addition, 1,25(OH)2D does not exert negative feedback regulation in these cells, thus local hormone production in cells of the immune system may contribute to circulating levels of 1,25(OH)2D, resulting in the hypercalcemia seen with granulomatous disease and some hematologic malignancies.

PEDIATRIC BONE

178

8. VITAMIN D BIOLOGY

1,25(OH)2D has been shown to prevent the development of autoimmune diseases [246] and delay graft rejection in experimental models. Furthermore, 1,25(OH)2D regulates the expression of several key genes involved in immunomodulation, including interleukin-1, interleukin-12, IFNg and granulocyte macrophage colonystimulating factor (GM-CSF). Vitamin D deficient animals exhibit defects in macrophage and neutrophil chemotaxis as well as impaired cell-mediated immunity. However, the contribution of impaired genomic actions of 1,25(OH)2D to the immune defects in vitamin D deficiency is not clear. Specific studies of dendritic cell function in VDR null mice demonstrate an increase in mature dendritic cells, consistent with the known effect of 1,25(OH)2D on inhibition of dendritic cell maturation [247]. Interestingly, the increase in mature dendritic cells in the VDR knockout animals was seen only in lymph nodes, not in the spleen. Other studies in the VDR null mice demonstrated normal leukocyte and lymphocyte subset composition [248]. Characterization of splenocyte proliferation in response to numerous stimuli was notable only for a minor decrease in anti-CD3 stimulation. In spite of mildly impaired macrophage chemotaxis, phagocytosis and killing by these cells was normal as was in vivo graft rejection. These minor abnormalities in T cells and macrophages were not observed in cells isolated from normocalcemic VDR null mice, thus are not a direct reflection of impaired VDR action. Perhaps the most intriguing observation was the protection of the VDR null mice from low dose streptozotocin-induced diabetes mellitus, a response that was reversed by correction of mineral ion homeostasis [248], thus demonstrating specific effects of hypocalcemia rather than impaired VDR activity. In contrast, normocalcemic VDR null mice were less susceptible to experimentally-induced autoimmune encephalomyelitis, the murine model of multiple sclerosis [249]. Studies in murine models demonstrated increased severity of inflammatory bowel disease in the absence of the VDR, associated with an increase in inflammatory and Th1-related cytokines [250]. In contrast, a decrease in experimentally-induced asthma and airway inflammation was observed, perhaps reflecting the absence of 1,25(OH)2D-mediated migration of immune cells [251]. These data suggest that many of the immunomodulatory effects of 1,25-dihydroxyvitamin D are not dependent on the nuclear receptor and that at least some of the in vivo immune phenotype of vitamin D deficiency is a consequence of impaired mineral ion homeostasis.

Vitamin D Metabolites The 1,25(OH)2D hormone is the biologically active metabolite of vitamin D involved in the control of calcium homeostasis. More than 37 vitamin D

metabolites have been characterized to date [252]; while most of them are catabolic products, it has been proposed that some of these metabolites may exert distinct biological effects. The putative bioactivity of the most abundant dihydroxylated vitamin D metabolite, 24,25(OH)2D, remains controversial. An extensive literature demonstrates that Cyp24a1 is expressed in growth plate chondrocytes and that cells from the growth plate respond to 24,25(OH)2D in a cell maturation-dependent manner [253]. Most of these studies were performed using the in vitro rat costochondral primary culture system. Dissection of the tissue allows culture of the cells from different regions of the growth plate. Each region represents a different maturation stage along the chondrocytic differentiation pathway. In this model system, the less differentiated cells of the resting zone, also called the reserve zone, respond to 24,25(OH)2D [254]. The more mature cells of the growth zone, comprising the prehypertrophic and hypertrophic compartments, respond primarily to 1,25(OH)2D [255]. Interestingly, treatment of resting zone chondrocytes with 24,25(OH)2D induces a change in maturation state [256], supporting the hypothesis that 24,25(OH)2D plays a role in cartilage development. The maturation stage-dependent responses of chondrocytes to the vitamin D metabolites include both genomic and non-genomic effects [257]. Contrasting with the tissue culture results is the observation that the growth plates from Cyp24a1/ mice do not show major defects [88,258]. These observations suggest that the absence of CYP24A1 activity does not affect growth plate development and that 24,25(OH)2D is not required for chondrocyte maturation in vivo [88]. It remains possible, however, that a redundant endocrine system is able to compensate for the function of 24,25(OH)2D in animals. It has also been proposed that 24,25(OH)2D might play a role in fracture repair, but there is limited information available on this putative function of the metabolite. The circulating levels of 24,25(OH)2D increase during fracture repair in chickens due to an increase in CYP24A1 activity [259]. When the effect of various vitamin D metabolites on the mechanical properties of healed bones was tested, treatment with 24,25(OH)2D3 was necessary to achieve maximal healing [260]. The Cyp24a1-deficient mouse strain [88] represents an invaluable tool to examine the putative role of 24,25(OH)2D in mammalian fracture repair. Fracture repair was compared between Cyp24a1/- mice and wild-type controls. A delay in the mineralization of the cartilaginous matrix of the soft callus was observed in Cyp24a1/ mutant animals [261]. The repair delay and the aberrant pattern of gene expression could be rescued by treatment with 24,25(OH)2D3 [261]. These results strongly support a role for 24,25(OH)2D in mammalian fracture repair.

PEDIATRIC BONE

179

REFERENCES

These studies could open up exciting perspectives for treatment following fracture or orthopedic surgery using 24-hydroxylated vitamin D metabolites or analogs. The CYP24 enzyme acts on 1,25(OH)2D to produce 1,24,25-trihydroxyvitamin D, the initial reactant in the C-24 oxidation pathway that leads to metabolite inactivation [74,75]. Treatment of ovariectomized rats with 1,24,25-trihydroxyvitamin D increased bone mass, serum calcium, and reduced bone resorption [262]. The second enzymatic step in the C-24 oxidation pathway is the oxidation of 1,24,25-trihydroxyvitamin D to 1,25(OH)224-oxo-D, a metabolite which showed activity in bone resorption assays and antiproliferation assays [263,264]. Hydroxylation of 1,25(OH)2D on carbon 26 eventually leads to formation of 1,25(OH)2D-26,23-lactone [265]. This metabolite affects intestinal calcium transport and can modulate bone resorption [266,267]. There have also been claims that 1,25(OH)2D-26,23-lactone could act as a VDR antagonist [268,269]. The conversion of 1,25(OH)2D into 3-epi-1,25(OH)2D is characterized by a switch of the hydroxyl group orientation on carbon C-3 from the b to the a position. The enzyme responsible for this epimerization remains unknown. The 3-epimerization pathway is only detected in differentiated Caco-2 cells, but not in proliferating, undifferentiated cells [270]. This observation suggests that 3-epimerization is a tightly regulated metabolic pathway and supports the hypothesis that 3-epi1,25(OH)2D may constitute a biologically active metabolite contributing to the diverse responses of target cells to the vitamin D endocrine system. Production of 3-epi-1,25(OH)2D was further detected in bovine parathyroid cells [271], human keratinocytes [272], rat osteosarcoma cells [273], but not in perfused rat kidney or human promyelocytic leukemia cells [274]. The 3-epi1,25(OH)2D compound was also detected as a circulating metabolite in rats [275]. Biological activity associated with the 3-epi-1,25(OH)2D metabolite includes suppression of parathyroid hormone (PTH) secretion in bovine parathyroid cells [271] and induction of keratinocyte differentiation [276]. Despite lower affinity for the VDR [271,277], all the experimental evidence accumulated so far indicates that any bioactivity of the 3-epi1,25(OH)2D metabolite is mediated through the VDR and not a distinct receptor [278,279]. In summary, while some vitamin D metabolites have been shown to exhibit bioactivity, they are less active than 1,25(OH)2D and seem to act through the classical VDR, raising doubts as to their importance under physiological conditions. The identification of putative specific receptors [280,281] and the further characterization of the novel genetic models with targeted deletions in vitamin D metabolic enzymes or effector pathways will help to establish the physiological role of these metabolites.

SUMMARY AND PERSPECTIVES Molecular genetics-based research has allowed dramatic progress in our understanding of vitamin D metabolism and function. For example, the engineering of VDR-deficient mice confirmed the major physiological role of 1,25(OH)2D in the regulation of calcium absorption from the gut and the regulation of mineral homeostasis. The same strain of mutant animals identified the hair follicle keratinocyte as a critical target tissue. The VDR-ablated mice also served as a useful tool to allow the cloning of the 1a-hydroxylase cDNA. The analysis of the negative VDRE from the 1a-hydroxylase gene characterized new mechanisms of vitamin D-controlled gene expression. Mice deficient in 1a-hydroxylase activity were engineered and represent a valid animal model for pseudo vitamin D deficiency rickets. The conditional ablation strategy used to engineer these animals has identified a role for locally synthesized 1,25(OH)2D3 in the neovascularization of the growth plate and will help elucidate the hypothesized autocrine/paracrine roles of 1,25(OH)2D in other target cells such as osteoblasts, keratinocytes, and macrophages. Yet another strain of knockout mice, the megalin-deficient animals, permitted the identification and characterization of a major metabolic pathway for vitamin D: megalin-dependent renal uptake and activation of 25(OH)D. Finally, studies using the animal models developed to date and additional molecular biological analysis will help clarify unresolved aspects of vitamin D biology, including whether the non-nuclear 1,25(OH)2D receptor is involved in vitamin D biology, or whether other receptors with high affinity for alternative vitamin D metabolites play physiological roles in vitamin D action. It was recently shown that some forms of idiopathic infantile hypercalcemia (IIH), a genetic condition characterized by hypercalcemia and nephrocalcinosis, were due to mutations in the vitamin D inactivating enzyme, CYP24A1. (Schlingmann et al. 2011. New Engl J M 10.1056/NEJMoa1103864). The mutations occcur in key parts (C-or I-Helices) of the CYP24A1 protein which affect enzyme function.

References [1] McCollum EV, Simmonds N, Becker JE, Shipley PG. An experimental demonstration of the existence of a vitamin which promotes calcium deposition. J Biol Chem 1922;53:293e8. [2] Steenbock H, Black A. Fat-soluble vitamins. XVII. The induction of growth-promoting and calcifying properties in a ration by exposure to ultraviolet light. J Biol Chem 1924;61:405e22. [3] Holick MF. Photobiology of vitamin D. In: Feldman D, Glorieux FH, Pike JW, editors. Vitamin D. San Diego: Academic Press; 1997. p. 33e9.

PEDIATRIC BONE

180

8. VITAMIN D BIOLOGY

[4] Fukushima M, Suzuki Y, Tohira Y, Nishii Y, Suzuki M. 25-Hydroxylation of 1alpha-hydroxyvitamin D3 in vivo and in perfused rat liver. FEBS Lett 1976;65:211e4. [5] Cheng JB, Motola DL, Mangelsdorf DJ, Russell DW. De-orphanization of cytochrome P450 2R1: a microsomal vitamin D 25-hydroxylase. J Biol Chem 2003;278:38084e93. [6] Strushkevich N, Usanov SA, Plotnikov AN, Jones G, Park HW. Structural analysis of CYP2R1 in complex with vitamin D3. J Mol Biol 2008;380:95e106. [7] Casella SJ, Reiner BJ, Chen TC, Holick MF, Harrison HE. A possible genetic defect in 25-hydroxylation as a cause of rickets. J Pediatr 1994;124:929e32. [8] Cheng JB, Levine MA, Bell NH, Mangelsdorf DJ, Russell DW. Genetic evidence that the human CYP2R1 enzyme is a key vitamin D 25-hydroxylase. Proc Natl Acad Sci USA 2004;101: 7711e5. [9] Fraser D, Kooh SW, Kind HP, Holick MF, Tanaka Y, DeLuca HF. Pathogenesis of hereditary vitamin-D-dependent rickets. An inborn error of vitamin D metabolism involving defective conversion of 25-hydroxyvitamin D to 1 alpha,25-dihydroxyvitamin D. N Engl J Med 1973;289:817e22. [10] Okuda KI, Usui E, Ohyama Y. Recent progress in enzymology and molecular biology of enzymes involved in vitamin D metabolism. J Lipid Res 1995;36:1641e52. [11] Rosen H, Reshef A, Maeda N, et al. Markedly reduced bile acid synthesis but maintained levels of cholesterol and vitamin D metabolites in mice with disrupted sterol 27-hydroxylase gene. J Biol Chem 1998;273:14805e12. [12] Salen G, Shefer S, Cheng FW, Dayal B, Batta AK, Tint GS. Cholic acid biosynthesis: the enzymatic defect in cerebrotendinous xanthomatosis. J Clin Invest 1979;63:38e44. [13] Cali JJ, Hsieh CL, Francke U, Russell DW. Mutations in the bile acid biosynthetic enzyme sterol 27-hydroxylase underlie cerebrotendinous xanthomatosis. J Biol Chem 1991;266:7779e83. [14] Kuriyama M, Fujiyama J, Kubota R, Nakagawa M, Osame M. Osteoporosis and increased bone fractures in cerebrotendinous xanthomatosis. Metabolism 1993;42:1497e8. [15] Cali JJ, Russell DW. Characterization of human sterol 27hydroxylase. A mitochondrial cytochrome P-450 that catalyzes multiple oxidation reactions in bile acid biosynthesis. J Biol Chem 1991;266:7774e8. [16] Andersson D, Davis DL, Dahlback H, Jornvall H. Cloning, structure and expression of the mitochondrial cytochrome P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme. J Biol Chem 1989;264:8222e9. [17] Fu GK, Lin D, Zhang MY, et al. Cloning of human 25-hydroxyvitamin D-1 alpha-hydroxylase and mutations causing vitamin D-dependent rickets type 1. Mol Endocrinol 1997;11:1961e70. [18] St-Arnaud R, Messerlian S, Moir JM, Omdahl JL, Glorieux FH. The 25-hydroxyvitamin D 1-alpha-hydroxylase gene maps to the pseudovitamin D-deficiency rickets (PDDR) disease locus. J Bone Miner Res 1997;12:1552e9. [19] Shinki T, Shimada H, Wakino S, et al. Cloning and expression of rat 25-hydroxyvitamin D3-1alpha-hydroxylase cDNA. Proc Natl Acad Sci USA 1997;94:12920e5. [20] Takeyama K, Kitanaka S, Sato T, Kobori M, Yanagisawa J, Kato S. 25-Hydroxyvitamin D3 1alpha-hydroxylase and vitamin D synthesis. Science 1997;277:1827e30. [21] Hasemann CA, Kurumbail RG, Boddupalli SS, Peterson JA, Deisenhofer J. Structure and function of cytochromes P450: a comparative analysis of three crystal structures. Structure 1995;3:41e62. [22] Ohyama Y, Noshiro M, Okuda K. Cloning and expression of cDNA encoding 25-hydroxyvitamin D3 24-hydroxylase. FEBS Lett 1991;278:195e8.

[23] Chung BC, Matteson KJ, Voutilainen R, Mohandas TK, Miller WL. Human cholesterol side-chain cleavage enzyme, P450scc: cDNA cloning, assignment of the gene to chromosome 15, and expression in the placenta. Proc Natl Acad Sci USA 1986;83:8962e6. [24] Mornet E, Dupont J, Vitek A, White PC. Characterization of two genes encoding human steroid 11 beta-hydroxylase (P-450(11) beta). J Biol Chem 1989;264:20961e7. [25] Panda DK, Al Kawas S, Seldin MF, Hendy GN, Goltzman D. 25-hydroxyvitamin D 1alpha-hydroxylase: structure of the mouse gene, chromosomal assignment, and developmental expression. J Bone Miner Res 2001;16:46e56. [26] Fu GK, Portale AA, Miller WL. Complete structure of the human gene for the vitamin D 1alpha- hydroxylase, P450c1alpha. DNA Cell Biol 1997;16:1499e507. [27] Kitanaka S, Takeyama K, Murayama A, et al. Inactivating mutations in the 25-hydroxyvitamin D3 1alpha-hydroxylase gene in patients with pseudovitamin D-deficiency rickets. N Engl J Med 1998;338:653e61. [28] Yoshida T, Monkawa T, Tenenhouse HS, et al. Two novel 1alphahydroxylase mutations in French-Canadians with vitamin D dependency rickets type I. Kidney Int 1998;54:1437e43. [29] Labuda M, Morgan K, Glorieux FH. Mapping autosomal recessive vitamin D dependency type I to chromosome 12q14 by linkage analysis. Am J Hum Genet 1990;47:28e36. [30] Labuda M, Labuda D, Korab-Laskowska M, et al. Linkage disequilibrium analysis in young populations: pseudo-vitamin D- deficiency rickets and the founder effect in French Canadians. Am J Hum Genet 1996;59:633e43. [31] Portale AA, Miller WL. Human 25-hydroxyvitamin D-1alphahydroxylase: cloning, mutations, and gene expression. Pediatr Nephrol 2000;14:620e5. [32] Dardenne O, Prud’homme J, Arabian A, Glorieux FH, St-Arnaud R. Targeted inactivation of the 25-hydroxyvitamin D(3)-1(alpha)- hydroxylase gene (CYP27B1) creates an animal model of pseudovitamin D-deficiency rickets. Endocrinology 2001;142:3135e41. [33] Panda DK, Miao D, Tremblay ML, et al. Targeted ablation of the 25-hydroxyvitamin D 1alpha-hydroxylase enzyme: evidence for skeletal, reproductive, and immune dysfunction. Proc Natl Acad Sci USA 2001;98:7498e503. [34] Yamagata M, Kimoto A, Michigami T, Nakayama M, Ozono K. Hydroxylases involved in vitamin D metabolism are differentially expressed in murine embryonic kidney: application of whole mount in situ hybridization. Endocrinology 2001;142: 3223e30. [35] Puzas JE, Turner RT, Howard GA, Brand JS, Baylink DJ. Synthesis of 1,25-dihydroxycholecalciferol and 24,25-dihydroxycholecalciferol by calvarial cells. Characterization of the enzyme systems. Biochem J 1987;245:333e8. [36] Reichel H, Bishop JE, Koeffler HP, Norman AW. Evidence for 1,25-dihydroxyvitamin D3 production by cultured porcine alveolar macrophages. Mol Cell Endocrinol 1991;75:163e7. [37] Fraser DR, Kodicek E. Regulation of 25-hydroxycholecalciferol1-hydroxylase activity in kidney by parathyroid hormone. Nat New Biol 1973;241:163e6. [38] Murayama A, Takeyama K, Kitanaka S, Kodera Y, Hosoya T, Kato S. The promoter of the human 25-hydroxyvitamin D3 1 alpha-hydroxylase gene confers positive and negative responsiveness to PTH, calcitonin, and 1 alpha,25(OH)2D3. Biochem Biophys Res Commun 1998;249:11e6. [39] Brenza HL, Kimmel-Jehan C, Jehan F, et al. Parathyroid hormone activation of the 25-hydroxyvitamin D3-1alphahydroxylase gene promoter. Proc Natl Acad Sci USA 1998;95: 1387e91.

PEDIATRIC BONE

181

REFERENCES

[40] Horiuchi N, Suda T, Takahashi H, Shimazawa E, Ogata E. In vivo evidence for the intermediary role of 30 ,50 -cyclic AMP in parathyroid hormone-induced stimulation of 1alpha,25-dihydroxyvitamin D3 synthesis in rats. Endocrinology 1977;101:969e74. [41] Henry HL. Parathyroid hormone modulation of 25-hydroxyvitamin D3 metabolism by cultured chick kidney cells is mimicked and enhanced by forskolin. Endocrinology 1985;116: 503e10. [42] Gao XH, Dwivedi PP, Choe S, et al. Basal and parathyroid hormone induced expression of the human 25-hydroxyvitamin D 1alpha-hydroxylase gene promoter in kidney AOK-B50 cells: role of Sp1, Ets and CCAAT box protein binding sites. Int J Biochem Cell Biol 2002;34:921e30. [43] Kim MS, Kondo T, Takada I, et al. DNA demethylation in hormone-induced transcriptional derepression. Nature 2009;461: 1007e12. [44] Hendrich B, Hardeland U, Ng HH, Jiricny J, Bird A. The thymine glycosylase MBD4 can bind to the product of deamination at methylated CpG sites. Nature 1999;401:301e4. [45] Horiuchi N, Takahashi H, Matsumoto T, et al. Salmon calcitonininduced stimulation of 1 alpha,25-dihydroxycholecalciferol synthesis in rats involving a mechanism independent of adenosine 30 :50 -cyclic monophosphate. Biochem J 1979;184:269e75. [46] Galante L, Colston KW, MacAuley SJ, MacIntyre I. Effect of calcitonin on vitamin D metabolism. Nature 1972;238:271e3. [47] Shinki T, Ueno Y, DeLuca HF, Suda T. Calcitonin is a major regulator for the expression of renal 25-hydroxyvitamin D31alpha-hydroxylase gene in normocalcemic rats. Proc Natl Acad Sci USA 1999;96:8253e8. [48] Friedlander EJ, Henry HL, Norman AW. Studies on the mode of action of calciferol. Effects of dietary calcium and phosphorus on the relationship between the 25-hydroxyvitamin D3-1alphahydroxylase and production of chick intestinal calcium binding protein. J Biol Chem 1977;252:8677e83. [49] Heaney RP. Vitamin D: role in the calcium economy. In: Feldman D, Glorieux FH, Pike JW, editors. Vitamin D. SanDiego: Academic Press; 1997. p. 485e98. [50] Quarles LD. Endocrine functions of bone in mineral metabolism regulation. J Clin Invest 2008;118:3820e8. [51] Burnett SM, Gunawardene SC, Bringhurst FR, Juppner H, Lee H, Finkelstein JS. Regulation of C-terminal and intact FGF23 by dietary phosphate in men and women. J Bone Miner Res 2006;21:1187e96. [52] Bai XY, Miao D, Goltzman D, Karaplis AC. The autosomal dominant hypophosphatemic rickets R176Q mutation in fibroblast growth factor 23 resists proteolytic cleavage and enhances in vivo biological potency. J Biol Chem 2003;278:9843e9. [53] Bergwitz C, Juppner H. Regulation of phosphate homeostasis by PTH, vitamin D, and FGF23. Annu Rev Med 2010;61:91e104. [54] Henry HL. Regulation of the hydroxylation of 25-hydroxyvitamin D3 in vivo and in primary cultures of chick kidney cells. J Biol Chem 1979;254:2722e9. [55] Booth BE, Tsai HC, Morris Jr RC. Vitamin D status regulates 25hydroxyvitamin D3-1 alpha-hydroxylase and its responsiveness to parathyroid hormone in the chick. J Clin Invest 1985;75: 155e61. [56] Demay MB, Kiernan MS, DeLuca HF, Kronenberg HM. Sequences in the human parathyroid hormone gene that bind the 1,25-dihydroxyvitamin D3 receptor and mediate transcriptional repression in response to 1,25-dihydroxyvitamin D3. Proc Natl Acad Sci USA 1992;89:8097e101. [57] Murayama A, Takeyama K, Kitanaka S, et al. Positive and negative regulations of the renal 25-hydroxyvitamin D3 1alphahydroxylase gene by parathyroid hormone, calcitonin, and

[58]

[59]

[60]

[61]

[62]

[63]

[64]

[65]

[66]

[67]

[68] [69]

[70]

[71]

[72]

[73]

[74]

1alpha,25(OH)2D3 in intact animals. Endocrinology 1999;140: 2224e31. Silver J, Naveh-Many T, Mayer H, Schmelzer HJ, Popovtzer MM. Regulation by vitamin D metabolites of parathyroid hormone gene transcription in vivo in the rat. J Clin Invest 1986;78:1296e301. Kato S, Kim MS, Yamaoka K, Fujiki R. Mechanisms of transcriptional repression by 1,25(OH)2 vitamin D. Curr Opin Nephrol Hypertens 2007;16:297e304. Kim MS, Fujiki R, Kitagawa H, Kato S. 1alpha,25(OH)2D3induced DNA methylation suppresses the human CYP27B1 gene. Mol Cell Endocrinol 2007;265e266:168e73. Murayama A, Takeyama K, Asahina T, Kitanaka S, Kato S. Cloning of a novel transcription factor mediating the negative vitamin D responsiveness through the human 25-hydroxyvitamin D-1alpha-hydroxylase nVDRE. J Bone Miner Res 2000;15:S199. Murayama A, Kim MS, Yanagisawa J, Takeyama K, Kato S. Transrepression by a liganded nuclear receptor via a bHLH activator through co-regulator switching. Embo J 2004;23: 1598e608. Ohyama Y, Hayashi S, Okuda K. Purification of 25-hydroxyvitamin D3 24-hydroxylase from rat kidney mitochondria. FEBS Lett 1989;255:405e8. Ohyama Y, Okuda K. Isolation and characterization of a cytochrome P-450 from rat kidney mitochondria that catalyzes the 24-hydroxylation of 25-hydroxyvitamin D3. J Biol Chem 1991;266:8690e5. Chen KS, DeLuca HF. Cloning of the human 1 alpha,25-dihydroxyvitamin D-3 24-hydroxylase gene promoter and identification of two vitamin D-responsive elements. Biochim Biophys Acta 1995;1263:1e9. Hahn CN, Kerry DM, Omdahl JL, May BK. Identification of a vitamin D responsive element in the promoter of the rat cytochrome P450(24) gene. Nucleic Acids Res 1994;22:2410e6. Ohyama Y, Noshiro M, Eggertsen G, et al. Structural characterization of the gene encoding rat 25-hydroxyvitamin D3 24-hydroxylase. Biochemistry 1993;32:76e82. Tanaka Y, Castillo L, DeLuca HF. The 24-hydroxylation of 1,25dihydroxyvitamin D3. J Biol Chem 1977;252:1421e4. Tanaka Y, DeLuca HF. Stimulation of 24,25-dihydroxyvitamin D3 production by 1,25-dihydroxyvitamin D3. Science 1974;183: 1198e200. Napoli JL, Horst RL. C(24)- and C(23)-oxidation, converging pathways of intestinal 1,25-dihydroxyvitamin D3 metabolism: identification of 24-keto-1,23,25-trihydroxyvitamin D3. Biochemistry 1983;22:5848e53. Ohnuma N, Norman AW. Identification of a new C-23 oxidation pathway of metabolism for 1,25-dihydroxyvitamin D3 present in intestine and kidney. J Biol Chem 1982;257:8261e71. Takasaki Y, Suda T, Yamada S, Takayama H, Nishii Y. Isolation, identification, and biological activity of 25-hydroxy-24-oxovitamin D3: a new metabolite of vitamin D3 generated by in vitro incubations with kidney homogenates. Biochemistry 1981;20:1681e6. Jones G, Kano K, Yamada S, Furusawa T, Takayama H, Suda T. Identification of 24,25,26,27-tetranor-23-hydroxyvitamin D3 as a product of the renal metabolism of 24,25-dihydroxyvitamin D3. Biochemistry 1984;23:3749e54. Makin G, Lohnes D, Byford V, Ray R, Jones G. Target cell metabolism of 1,25-dihydroxyvitamin D3 to calcitroic acid. Evidence for a pathway in kidney and bone involving 24oxidation. Biochem J 1989;262:173e80.

PEDIATRIC BONE

182

8. VITAMIN D BIOLOGY

[75] Reddy GS, Tserng KY. Calcitroic acid, end product of renal metabolism of 1,25-dihydroxyvitamin D3 through C-24 oxidation pathway. Biochemistry 1989;28:1763e9. [76] Esvelt RP, Schnoes HK, DeLuca HF. Isolation and characterization of 1 alpha-hydroxy-23-carboxytetranorvitamin D: a major metabolite of 1,25-dihydroxyvitamin D3. Biochemistry 1979;18: 3977e83. [77] Kumar R, Schaefer J, Grande JP, Roche PC. Immunolocalization of calcitriol receptor, 24-hydroxylase cytochrome P-450, and calbindin D28k in human kidney. Am J Physiol 1994;266: F477e85. [78] Kawashima H, Torikai S, Kurokawa K. Localization of 25hydroxyvitamin D3 1 alpha-hydroxylase and 24-hydroxylase along the rat nephron. Proc Natl Acad Sci USA 1981;78: 1199e203. [79] Akeno N, Saikatsu S, Kawane T, Horiuchi N. Mouse vitamin D24-hydroxylase: molecular cloning, tissue distribution, and transcriptional regulation by 1alpha,25-dihydroxyvitamin D3. Endocrinology 1997;138:2233e40. [80] Masuda S, Strugnell S, Calverley MJ, Makin HL, Kremer R, Jones G. In vitro metabolism of the anti-psoriatic vitamin D analog, calcipotriol, in two cultured human keratinocyte models. J Biol Chem 1994;269:4794e803. [81] Tomon M, Tenenhouse HS, Jones G. Expression of 25-hydroxyvitamin D3-24-hydroxylase activity in Caco-2 cells. An in vitro model of intestinal vitamin D catabolism. Endocrinology 1990;126:2868e75. [82] Reinhardt TA, Horst RL. Self-induction of 1,25-dihydroxyvitamin D3 metabolism limits receptor occupancy and target tissue responsiveness. J Biol Chem 1989;264:15917e21. [83] Sakaki T, Sawada N, Komai K, et al. Dual metabolic pathway of 25-hydroxyvitamin D3 catalyzed by human CYP24. Eur J Biochem/FEBS 2000;267:6158e65. [84] Prosser DE, Kaufmann M, O’Leary B, Byford V, Jones G. Single A326G mutation converts human CYP24A1 from 25-OH-D3-24hydroxylase into -23-hydroxylase, generating 1alpha,25-(OH) 2D3-26,23-lactone. Proc Natl Acad Sci USA 2007;104:12673e8. [85] Akiyoshi-Shibata M, Sakaki T, Ohyama Y, Noshiro M, Okuda K, Yabusaki Y. Further oxidation of hydroxycalcidiol by calcidiol 24-hydroxylase. A study with the mature enzyme expressed in Escherichia coli. Eur J Biochem/FEBS 1994;224:335e43. [86] Beckman MJ, Tadikonda P, Werner E, Prahl J, Yamada S, DeLuca HF. Human 25-hydroxyvitamin D3-24-hydroxylase, a multicatalytic enzyme. Biochemistry 1996;35:8465e72. [87] Reinhardt TA, Horst RL. Ketoconazole inhibits self-induced metabolism of 1,25-dihydroxyvitamin D3 and amplifies 1,25dihydroxyvitamin D3 receptor up-regulation in rat osteosarcoma cells. Arch Biochem Biophys 1989;272:459e65. [88] St-Arnaud R, Arabian A, Travers R, et al. Deficient mineralization of intramembranous bone in vitamin D-24- hydroxylaseablated mice is due to elevated 1,25-dihydroxyvitamin D and not to the absence of 24,25-dihydroxyvitamin D. Endocrinology 2000;141:2658e66. [89] Annalora AJ, Goodin DB, Hong WX, Zhang Q, Johnson EF, Stout CD. Crystal structure of CYP24A1, a mitochondrial cytochrome P450 involved in vitamin D metabolism. J Mol Biol 2010;396:441e51. [90] Engstrom GW, Reinhardt TA, Horst RL. 25-Hydroxyvitamin D323-hydroxylase, a renal enzyme in several animal species. Arch Biochem Biophys 1986;250:86e93. [91] Sakaki T, Sawada N, Nonaka Y, Ohyama Y, Inouye K. Metabolic studies using recombinant Escherichia coli cells producing rat mitochondrial CYP24. CYP24 can convert 1alpha,25-dihydroxyvitamin D3 to calcitroic acid. Eur J Biochem/FEBS 1999;262:43e8.

[92] Kahraman M, Sinishtaj S, Dolan PM, et al. Potent, selective and low-calcemic inhibitors of CYP24 hydroxylase: 24-sulfoximine analogues of the hormone 1alpha,25-dihydroxyvitamin D(3). J Med Chem 2004;47:6854e63. [93] Schuster I, Egger H, Nussbaumer P, Kroemer RT. Inhibitors of vitamin D hydroxylases: structureeactivity relationships. J Cell Biochem 2003;88:372e80. [94] Schuster I, Egger H, Reddy GS, Vorisek G. Combination of vitamin D metabolites with selective inhibitors of vitamin D metabolism. Recent Results Cancer Res 2003;164:169e88. [95] Schuster I, Egger H, Herzig G, et al. Selective inhibitors of vitamin D metabolism e new concepts and perspectives. Anticancer Res 2006;26:2653e68. [96] Annalora A, Bobrovnikova-Marjon E, Serda R, et al. Rat cytochrome P450C24 (CYP24A1) and the role of F249 in substrate binding and catalytic activity. Arch Biochem Biophys 2004; 425:133e46. [97] Omdahl JL, Swamy N, Serda R, Annalora A, Berne M, Rayb R. Affinity labeling of rat cytochrome P450C24 (CYP24) and identification of Ser57 as an active site residue. J Steroid Biochem Mol Biol 2004;89e90:159e62. [98] Makishima M, Lu TT, Xie W, et al. Vitamin D receptor as an intestinal bile acid sensor. Science 2002;296:1313e6. [99] Bartik L, Whitfield GK, Kaczmarska M, et al. Curcumin: a novel nutritionally derived ligand of the vitamin D receptor with implications for colon cancer chemoprevention. J Nutr Biochem 2010. [100] Skorija K, Cox M, Sisk JM, et al. Ligand-independent actions of the vitamin D receptor maintain hair follicle homeostasis. Mol Endocrinol 2005;19:855e62. [101] Haussler MR, Whitfield GK, Haussler CA, et al. The nuclear vitamin D receptor: biological and molecular regulatory properties revealed. J Bone Miner Res 1998;13:325e49. [102] Baker AR, McDonnell DP, Hughes M, et al. Cloning and expression of full-length cDNA encoding human vitamin D receptor. Proc Natl Acad Sci USA 1988;85:3294e8. [103] Li YC, Bergwitz C, Juppner H, Demay M. Cloning and characterization of the vitamin D receptor from Xenopus laevis. Endocrinology 1997;138:2347e53. [104] Whitfield GK, Dang HT, Schluter SF, et al. Cloning of a functional vitamin D receptor from the lamprey (Petromyzon marinus), an ancient vertebrate lacking a calcified skeleton and teeth. Endocrinology 2003;144:2704e16. [105] Jurutka PW, Hsieh JC, MacDonald PN, et al. Phosphorylation of serine 208 in the human vitamin D receptor. The predominant amino acid phosphorylated by casein kinase II, in vitro, and identification as a significant phosphorylation site in intact cells. J Biol Chem 1993;268:6791e9. [106] Hilliard GMT, Cook RG, Weigel NL, Pike JW. 1,25-dihydroxyvitamin D3 modulates phosphorylation of serine 205 in the human vitamin D receptor: site-directed mutagenesis of this residue promotes alternative phosphorylation. Biochemistry 1994;33:4300e11. [107] Jurutka PW, Hseih J-C, Nakajima S, Haussler CA, Haussler M. Human vitamin D receptor phosphorylation by casein kinase II at Ser-208 potentiates transcriptional activation. Proc Natl Acad Sci USA 1996;93:3519e24. [108] Arriagada G, Paredes R, Olate J, et al. Phosphorylation at serine 208 of the 1alpha,25-dihydroxy vitamin D3 receptor modulates the interaction with transcriptional coactivators. J Steroid Biochem Mol Biol 2007;103:4259. [109] Hsieh JC, Dang HT, Galligan MA, et al. Phosphorylation of human vitamin D receptor serine-182 by PKA suppresses 1,25(OH)2D3-dependent transactivation. Biochem Biophys Res Commun 2004;324:801e9.

PEDIATRIC BONE

REFERENCES

[110] Hsieh JC, Jurutka PW, Galligan MA, et al. Human vitamin D receptor is selectively phosphorylated by protein kinase C on serine 51, a residue crucial to its trans-activation function. Proc Natl Acad Sci USA 1991;88:9315e9. [111] Hsieh JC, Jurutka PW, Nakajima S, et al. Phosphorylation of the human vitamin D receptor by protein kinase C. Biochemical and functional evaluation of the serine 51 recognition site. J Biol Chem 1993;268:15118e26. [112] MacDonald PN, Sherman DR, Dowd DR, Jefcoat Jr SC, DeLisle RK. The vitamin D receptor interacts with general transcription factor IIB. J Biol Chem 1995;270:4748e52. [113] McKenna N, Xu J, Nawaz Z, Tsai S, Tsai M, O’Malley B. Nuclear receptor coactivators: multiple enzymes, multiple complexes, multiple functions. J Steroid Biochem Molec Biol 1999;69:3e12. [114] Onate S, Tsai S, Tsai M, O’Malley B. Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 1995;270:1354e7. [115] Kraichely D, Collins J, DeLisle R, MacDonald PN. The autonomous transactivation domain in helix H3 of the vitamin D receptor is required for transactivation and coactivator interaction. J Biol Chem 1999;274:14352e8. [116] Yanagisawa J, Yanagi Y, Masuhiro Y, et al. Convergence of transforming growth factor beta and vitamin D signaling pathways on SMAD transcriptional coactivators. Science 1999; 283:1317e21. [117] Takeshita A, Yen P, Misiti S, Cardona G, Liu Y, Chin W. Molecular cloning and properties of a full-length putative thyroid hormone receptor coactivator. Endocrinology 1996; 137:3594e7. [118] Spencer T, Jenster G, Burcin M, et al. Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 1997;389:194e8. [119] Bannister A, Kouzarides T. The CBP coactivator is a histone acetyl transferease. Nature 1996;384:641e3. [120] Baudino TA, Kraichely DM, Jefcoat Jr SC, et al. Isolation and characterization of a novel coactivator protein, NCoA-62, involved in vitamin D-mediated transcription. J Biol Chem 1998;273:16434e41. [121] Barry JB, Leong GM, Church WB, Issa LL, Eisman JA, Gardiner EM. Interactions of SKIP/NCoA-62, TFIIB, and retinoid X receptor with vitamin D receptor helix H10 residues. J Biol Chem 2003;278:8224e8. [122] Rachez C, Suldan Z, Ward J, et al. A novel protein complex that interacts with the vitamin D3 receptor in a ligand-dependent manner and enhances VDR transactivation in a cell-free system. Genes Dev 1998;12:1787e800. [123] Rachez C, Lemon B, Suldan Z, et al. Ligand-dependent transcription activation by nuclear receptors requires the DRIP complex. Nature 1999;398:824e8. [124] Chiba N, Suldan Z, Freedman LP, Parvin J. Binding of liganded vitamin D receptor to the vitamin D receptor interacting protein coactivator complex induces interaction with RNA polymerase II holoenzyme. J Biol Chem 2000;275:10719e22. [125] Oda Y, Ishikawa MH, Hawker NP, Yun QC, Bikle DD. Differential role of two VDR coactivators, DRIP205 and SRC-3, in keratinocyte proliferation and differentiation. J Steroid Biochem Mol Biol 2007;103:776e80. [126] Sanchez-Martinez R, Zambrano A, Castillo AI, Aranda A. Vitamin D-dependent recruitment of corepressors to vitamin D/ retinoid X receptor heterodimers. Mol Cell Biol 2008; 28:3817e29. [127] Hsieh JC, Sisk JM, Jurutka PW, et al. Physical and functional interaction between the vitamin D receptor and hairless corepressor, two proteins required for hair cycling. J Biol Chem 2003;278:38665e74.

183

[128] Ahmad W, Faiyaz ul Haque M, Brancolini V, et al. Alopecia universalis associated with a mutation in the human hairless gene. Science 1998;279:720e4. [129] Marx SJ, Bliziotes MM, Nanes M. Analysis of the relation between alopecia and resistance to 1,25-dihydroxyvitamin D. Clin Endocrinol 1986;25:373e81. [130] Demay MB, Kiernan MS, DeLuca HF, Kronenberg HM. Characterization of 1,25-dihydroxyvitamin D3 receptor interactions with target sequences in the rat osteocalcin gene. Mol Endocrinol 1992;6:557e62. [131] Umesono K, Murakami KK, Thompson CC, Evans RM. Direct repeats as selective response elements for the thyroid hormone, retinoic acid and vitamin D3 receptors. Cell 1991;65:1255e66. [132] Demay MB, Gerardi JM, DeLuca HF, Kronenberg HM. DNA sequences in the rat osteocalcin gene that bind the 1,25-dihydroxyvitamin D3 receptor and confer responsiveness to 1,25dihydroxyvitamin D3. Proc Natl Acad Sci USA 1990;87:369e73. [133] Ozono K, Liao J, Kerner SA, Scott RA, Pike JW. The vitamin Dresponsive element in the human osteocalcin gene: association with a nuclear proto-oncogene enhancer. J Biol Chem 1990; 265:21881e8. [134] Noda M, Vogel RL, Craig AM, Prahl J, DeLuca HF, Denhardt DT. Identification of a DNA sequence responsible for binding of the 1,25-dihydroxyvitamin D3 receptor and 1,25dihydroxyvitamin D3 enhancement of mouse secreted phosphoprotein 1 (Spp-1 or osteopontin) gene expression. Proc Natl Acad Sci USA 1990;87:9995e9. [135] Cao X, Ross FP, Zhang L, MacDonald PN, Chappel J, Teitelbaum SL. Cloning of the promoter for the avian integrin b3 subunit gene and its regulation by 1,25-dihydroxyvitamin D3. J Biol Chem 1993;268:27371e80. [136] Medhora MM, Teitelbaum S, Chappel J, Alvarez J, Mimura H, Ross FP, Hruska K. 1a,25-Dihydroxyvitamin D3 up-regulates expression of the osteoclast integrin avb3. J Biol Chem 1993; 268:1456e61. [137] Kerry DM, Dwivedi PP, Hahn CN, Morris HA, Omdahl JL, May BK. Transcriptional synergism between vitamin Dresponsive elements in the rat 25-hydroxyvitamin D3 24hydroxylase (CYP24) promoter. J Biol Chem 1996;271:29715e21. [138] Ohyama Y, Ozono K, Uchida M, et al. Identification of a vitamin D-responsive element in the 50 -flanking region of the rat 25hydroxyvitamin D3 24-hydroxylase gene. J Biol Chem 1994;269:10545e50. [139] Darwish HM, DeLuca HF. Identification of a 1,25-dihydroxyvitamin D3-response element in the 50 -flanking region of the rat calbindin D-9k gene. Proc Natl Acad Sci USA 1992;89:603e7. [140] Gill RK, Christakos S. Identification of sequence elements in mouse calbindin-D28k gene that confer 1,25-dihydroxyvitamin D3- and butyrate-inducible responses. Proc Natl Aca Sci USA 1993;90:2984e8. [141] Dupret JM, L’Horset F, Perret C, Bernaudin J-F, Thomasset M. Calbindin-D9K gene expression in the lung of the rat. Absence of regulation by 1,25-dihydroxyvitamin D3 and estrogen. Endocrinology 1992;131:2643e8. [142] Glazier JD, Mawer EB, Sibley CP. Calbindin-D9k gene expression in rat chorioallantoic placenta is not regulated by 1,25dihydroxyvitamin D3. Pediatr Res 1995;37:720e5. [143] Colnot S, Ovejero C, Romagnolo B, et al. Transgenic analysis of the response of the rat calbindin-D 9k gene to vitamin D. Endoocrinology 2000;141:2301e8. [144] Candeliere GA, Jurutka PW, Haussler MR, St-Arnaud R. A composite element binding the vitamin D receptor, retinoid X receptor alpha, and a member of the CTF/NF-1 family of transcription factors mediates the vitamin D responsiveness of the c-fos promoter. Mol Cell Biol 1996;16:584e92.

PEDIATRIC BONE

184

8. VITAMIN D BIOLOGY

[145] Meyer MB, Goetsch PD, Pike JW. A downstream intergenic cluster of regulatory enhancers contributes to the induction of CYP24A1 expression by 1alpha,25-dihydroxyvitamin D3. J Biol Chem 2010;285:15599e610. [146] Liu SM, Koszewski N, Lupez M, Malluche HH, Olivera A, Russell J. Characterization of a response element in the 50 -flanking region of the avian (chicken) PTH gene that mediates negative regulation of gene transcription by 1,25-dihydroxyvitamin D3 and binds the vitamin D3 receptor. Mol Endocrinol 1996;10:206e15. [147] Mackey SL, Heymont JL, Kronenberg HM, Demay MB. Vitamin D receptor binding to the negative human parathyroid hormone vitamin D response element does not require the retinoid x receptor. Mol Endocrinol 1996;10:298e305. [148] Kim MS, Fujiki R, Murayama A, et al. 1Alpha,25(OH)2D3induced transrepression by vitamin D receptor through E-boxtype elements in the human parathyroid hormone gene promoter. Mol Endocrinol 2007;21:334e42. [149] Nishishita T, Okazaki T, Ishikawa T, et al. A negative vitamin D response DNA element in the human parathyroid hormonerelated peptide gene binds to vitamin D receptor along with Ku antigen to mediate negative gene regulation by vitamin D. J Biol Chem 1998;273:10901e7. [150] Yen P, Liu Y, Sugawara A, Chin W. Vitamin D receptors repress basal transcription and exert dominant negative activity on triiodothyronine-mediated transcriptional activity. J Biol Chem 1996;271:10910e6. [151] Sakai Y, Kishimoto J, Demay MB. Metabolic and cellular analysis of alopecia in vitamin D receptor knockout mice. J Clin Invest 2001;107:961e6. [152] Kitagawa H, Fujiki R, Yoshimura K, et al. The chromatinremodeling complex WINAC targets a nuclear receptor to promoters and is impaired in Williams syndrome. Cell 2003; 113:905e17. [153] Barsony J, Marx S. Rapid accumulation of cyclic GMP near activated vitamin D receptors. Proc Natl Acad Sci USA 1991; 88:1436e40. [154] Civitelli R, Kim YS, Gunsten SL, et al. Nongenomic activation of the calcium message system by vitamin D metabolites in osteoblast-like cells. Endocrinology 1990;127:2253e62. [155] de Boland AR, Nemere I, Norman AW. Ca2þ-Channel agonist bay K8644 mimics 1,25(OH)2-vitamin D3 rapid enhancement of Ca2þ transport in chick perfused duodenum. Biochem Biophys Res Commun 1990;166:217e22. [156] Farach-Carson MC, Sergeev I, Norman AW. Nongenomic actions of 1,25-dihydroxyvitamin D3 in rat osteosarcoma cells: structure-function studies using ligand analogs. Endocrinology 1991;129:1876e84. [157] Schwartz Z, Brooks B, Swain L, Del Toro F, Norman A, Boyan B. Production of 1,25-dihydroxyvitamin D3 and 24,25-dihydroxyvitamin D3 by growth zone and resting zone chondrocytes is dependent on cell maturation and is regulated by hormones and growth factors. Endocrinology 1992;130:2495e504. [158] Schwartz Z, Sylvia VL, Luna MH, et al. The effect of 24R,25(OH)(2)D(3) on protein kinase C activity in chondrocytes is mediated by phospholipase D whereas the effect of 1alpha,25(OH)(2)D(3) is mediated by phospholipase C. Steroids 2001;66:683e94. [159] Erben RG, Soegiarto DW, Weber K, et al. Deletion of deoxyribonucleic acid binding domain of the vitamin D receptor abrogates genomic and nongenomic functions of vitamin D. Mol Endocrinol 2002;16:1524e37. [160] Khanal RC, Nemere I. The ERp57/GRp58/1,25D3-MARRS receptor: multiple functional roles in diverse cell systems. Curr Med Chem 2007;14:1087e93.

[161] Halloran BP, DeLuca HF. Effect of vitamin D deficiency on skeletal development during early growth in the rat. Arch Biochem Biophys 1981;209:7e14. [162] Peacock M, Selby PL, Francis RM, Brown WB, Hordon L. Vitamin D deficiency, insufficiency, sufficiency, and intoxication: what do they mean? In: Norman AW, Schaefer K, Grigoleit H-G, von Herrath D, editors. Vitamin D: Chemical, Biochemical, and Clinical Update: Sixth Workshop on Vitamin D. New York: Walter de Gruyter; 1985. p. 569e70. [163] Pettifor MP, Daniels ED. Vitamin D Deficiency and Nutritional Rickets in Children. San Diego, CA: Academic Press; 1997. [164] Thomas MK, Demay MB. Vitamin D deficiency and disorders of vitamin D metabolism. Endocrinol Metab Clin North Am 2000;29:611e27. viii. [165] Ishimi Y, Russell J, Sherwood LM. Regulation by calcium and 1,25-(OH)2D3 of cell proliferation and function of bovine parathyroid cells in culture. J Bone Miner Res 1990;5:755e60. [166] Russell J, Lettieri D, Sherwood LM. Suppression by 1,25(OH)2D3 of transcription of the pre-proparathyroid hormone gene. Endocrinology 1986;119:2864e6. [167] Silver J, Russell J, Sherwood LM. Regulation by vitamin D metabolites of messenger ribonucleic acid for preproparathyroid hormone in isolated bovine parathyroid cells. Proc Natl Acad Sci USA 1985;82:4270e3. [168] Szabo A, Merke J, Beier E, Mall G, Ritz E. 1,25(OH)2 vitamin D3 inhibits parathyroid cell proliferation in experimental uremia. Kidney Int 1989;35:1049e56. [169] Dardenne O, Prud’homme J, Hacking SA, Glorieux FH, StArnaud R. Correction of the abnormal mineral ion homeostasis with a high-calcium, high-phosphorus, high-lactose diet rescues the PDDR phenotype of mice deficient for the 25-hydroxyvitamin D-1alpha-hydroxylase (CYP27B1). Bone 2003;32: 332e40. [170] Li YC, Amling M, Pirro AE, et al. Normalization of mineral ion homeostasis by dietary means prevents hyperparathyroidism, rickets, and osteomalacia, but not alopecia in vitamin D receptor-ablated mice. Endocrinology 1998;139:4391e6. [171] Al-Aqeel A, Ozand P, Sobki S, Sewairi W, Marx S. The combined use of intravenous and oral calcium for the treatment of vitamin D dependent rickets type II (VDDRII). Clin Endocrinol 1993; 39:229e37. [172] Amling M, Priemel M, Holzmann T, et al. Rescue of the skeletal phenotype of vitamin D receptor-ablated mice in the setting of normal mineral ion homeostasis: formal histomorphometric and biomechanical analyses. Endocrinology 1999;140:4982e7. [173] Balsan S, Garabedian M, Larchet M, et al. Long-term nocturnal calcium infusions can cure rickets and promote normal mineralization in hereditary resistance to 1,25-dihydroxyvitamin D. J Clin Invest 1986;77:1661e7. [174] Weinstein RS, Underwood JL, Hutson MS, DeLuca HF. Bone histomorphometry in vitamin D-deficient rats infused with calcium and phosphorus. Am J Physiol 1984;246:E499e506. [175] Donohue MM, Demay MB. Rickets in VDR null mice is secondary to decreased apoptosis of hypertrophic chondrocytes. Endocrinology 2002;143:3691e4. [176] Sabbagh Y, Carpenter TO, Demay MB. Hypophosphatemia leads to rickets by impairing caspase-mediated apoptosis of hypertrophic chondrocytes. Proc Natl Acad Sci USA 2005; 102:9637e42. [177] Harrison JR, Petersen DN, Lichtler AC, Mador AT, Rowe DW, Kream BE. 1,25-dihydroxyvitamin D3 inhibits transcription of type I collagen genes in the rat osteosarcoma line ROS 17/2.8. Endocrinology 1989;125:327e33.

PEDIATRIC BONE

185

REFERENCES

[178] Wientroub S, Fisher L, Reddi A, Termine J. Noncollagenous bone proteins in experimental rickets in the rat. Mol Cell Biochem 1987;74:157e62. [179] Underwood JL, DeLuca HF. Vitamin D is not directly necessary for bone growth and mineralization. Am J Physiol 1984; 246:E493e8. [180] Takeda S, Yoshizawa T, Nagai Y, et al. Stimulation of osteoclast formation by 1,25-dihydroxyvitamin D requires its binding to vitamin D receptor (VDR) in osteoblastic cells: studies using VDR knockout mice. Endocrinology 1999;140:1005e8. [181] Hoenderop J, VanDerKemp A, Hartog A, et al. Molecular identification of the apical Ca2þ channel in 1,25-dihydroxyvitamin D-responsive epithelia. J Biol Chem 1999;274:8375e8. [182] Peng J, Chen X, Berger U, et al. Molecular cloning and characterization of a channel-like transporter mediating intestinal calcium absorption. J Biol Chem 1999;274:22739e46. [183] Hoenderop JG, van Leeuwen JP, van der Eerden BC, et al. Renal Ca2þ wasting, hyperabsorption, and reduced bone thickness in mice lacking TRPV5. J Clin Invest 2003;112:1906e14. [184] Wasserman RH, Fullmer CS. Calcium transport proteins, calcium absorption, and vitamin D. Ann Rev Physiol 1983; 45:375e90. [185] Benn BS, Ajibade D, Porta A, et al. Active intestinal calcium transport in the absence of transient receptor potential vanilloid type 6 and calbindin-D9k. Endocrinology 2008;149:3196e205. [186] Fujita H, Sugimoto K, Inatomi S, et al. Tight junction proteins claudin-2 and -12 are critical for vitamin D-dependent Ca2þ absorption between enterocytes. Mol Biol Cell 2008;19:1912e21. [187] Manolagas SC, Yu X-P, Girasole G, Bellido T. Vitamin D and the hematolymphopoietic tissue: a 1994 update. Semin Nephrol 1994;14:129e43. [188] Colston KW, Mackay AG, James SY, Binderup L, Chanders S, Coombes RC. EB 1089: a new vitamin D analogue that inhibits the growth of breast cancer cells in vivo and in vitro. Biochem Pharmacol 1992;44:2273e80. [189] Colston KW, Perks CM, Xie SP, Holly JM. Growth inhibition of both MCF-7 and Hs578T human breast cancer cell lines by vitamin D analogues is associated with increased expression of insulin-like growth factor binding protein-3. J Mol Endocrinol 1998;20:157e62. [190] Feldman D, Skowronski RJ, Peehl DM. Vitamin D and prostate cancer. Adv Exp Med Biol 1996;375:53e63. [191] Bikle DD, Pillai S. Vitamin D, calcium, and epidermal differentiation. Endocr Rev 1993;14:3e19. [192] Sorensen S, Solvsten H, Politi Y, Kragballe K. Effects of vitamin D3 on keratinocyte proliferation and differentiation in vitro: modulation by ligands for retinoic acid and retinoid X receptors. Skin Pharmacol 1997;10:144e52. [193] Su MJ, Bikle DD, Mancianti ML, Pillai S. 1,25-Dihydroxyvitamin D3 potentiates the keratinocyte response to calcium. J Biol Chem 1994;269:14723e9. [194] Holick MF, Smith E, Pincus S. Skin as the site of vitamin D synthesis and target tissue for 1,25-dihydroxyvitamin D3. Use of calcitriol (1,25-dihydroxyvitamin D3) for treatment of psoriasis. Arch Dermatol 1987;123:1677e83. [195] Bischoff-Ferrari HA. Optimal serum 25-hydroxyvitamin D levels for multiple health outcomes. Adv Exp Med Biol 2008; 624:55e71. [196] Liu PT, Stenger S, Li H, et al. Toll-like receptor triggering of a vitamin D-mediated human antimicrobial response. Science 2006;311:1770e3. [197] Powell SM, Zilz N, Beazer-Barclay Y, et al. APC mutations occur early during colorectal tumorigenesis. Nature 1992;359:235e7. [198] Palmer HG, Sanchez-Carbayo M, Ordonez-Moran P, Larriba MJ, Cordon-Cardo C, Munoz A. Genetic signatures of

[199]

[200]

[201]

[202] [203]

[204]

[205]

[206]

[207]

[208]

[209]

[210]

[211]

[212] [213]

[214]

[215]

differentiation induced by 1alpha,25-dihydroxyvitamin D3 in human colon cancer cells. Cancer Res 2003;63:7799e806. Usui E, Noshiro M, Okuda K. Molecular cloning of cDNA for vitamin D3 25-hydroxylase from rat liver mitochondria. FEBS Lett 1990;262:135e8. Su P, Rennert H, Shayiq RM, et al. A cDNA encoding a rat mitochondrial cytochrome P450 catalyzing both the 26-hydroxylation of cholesterol and 25-hydroxylation of vitamin D3: gonadotropic regulation of the cognate mRNA in ovaries. DNA Cell Biol 1990;9:657e67. Repa JJ, Lund EG, Horton JD, et al. Disruption of the sterol 27-hydroxylase gene in mice results in hepatomegaly and hypertriglyceridemia. Reversal by cholic acid feeding. J Biol Chem 2000;275:39685e92. Cooke NE, Haddad JG. Vitamin D binding protein (Gc-globulin). Endocr Rev 1989;10:294e307. Safadi FF, Thornton P, Magiera H, et al. Osteopathy and resistance to vitamin D toxicity in mice null for vitamin D binding protein. J Clin Invest 1999;103:239e51. Verroust PJ, Kozyraki R. The roles of cubilin and megalin, two multiligand receptors, in proximal tubule function: possible implication in the progression of renal disease. Curr Opin Nephrol Hypertens 2001;10:33e8. Barth JL, Argraves WS. Cubilin and megalin: partners in lipoprotein and vitamin metabolism. Trends Cardiovasc Med 2001;11:26e31. Willnow TE, Hilpert J, Armstrong SA, et al. Defective forebrain development in mice lacking gp330/megalin. Proc Natl Acad Sci USA 1996;93:8460e4. Nykjaer A, Dragun D, Walther D, et al. An endocytic pathway essential for renal uptake and activation of the steroid 25-(OH) vitamin D3. Cell 1999;96:507e15. Bikle DD, Gee E, Halloran B, Kowalski MA, Ryzen E, Haddad JG. Assessment of the free fraction of 25-hydroxyvitamin D in serum and its regulation by albumin and the vitamin D-binding protein. J Clin Endocrinol Metab 1986; 63:954e9. Gliemann J. Receptors of the low density lipoprotein (LDL) receptor family in man. Multiple functions of the large family members via interaction with complex ligands. Biol Chem 1998;379:951e64. Moestrup SK, Kozyraki R, Kristiansen M, et al. The intrinsic factor-vitamin B12 receptor and target of teratogenic antibodies is a megalin-binding peripheral membrane protein with homology to developmental proteins. J Biol Chem 1998;273: 5235e42. Nykjaer A, Fyfe JC, Kozyraki R, et al. Cubilin dysfunction causes abnormal metabolism of the steroid hormone 25(OH) vitamin D(3). Proc Natl Acad Sci USA 2001;98:13895e900. St-Arnaud R. Targeted inactivation of vitamin D hydroxylases in mice. Bone 1999;25:127e9. Masuda S, Kaufmann M, Byford V, et al. Insights into Vitamin D metabolism using cyp24 over-expression and knockout systems in conjunction with liquid chromatography/mass spectrometry (LC/MS). J Steroid Biochem Mol Biol 2004;89e90:149e53. Masuda S, Byford V, Arabian A, et al. Altered pharmacokinetics of 1alpha,25-dihydroxyvitamin D3 and 25-hydroxyvitamin D3 in the blood and tissues of the 25-hydroxyvitamin D-24hydroxylase (Cyp24a1) null mouse. Endocrinology 2005;146: 825e34. Miyamoto Y, Shinki T, Yamamoto K, et al. 1alpha,25-dihydroxyvitamin D3-24-hydroxylase (CYP24) hydroxylates the carbon at the end of the side chain (C-26) of the C-24-fluorinated analog of 1alpha,25-dihydroxyvitamin D3. J Biol Chem 1997;272: 14115e9.

PEDIATRIC BONE

186

8. VITAMIN D BIOLOGY

[216] St-Arnaud R, Glorieux FH. Vitamin D and bone development. In: Feldman D, Glorieux FH, Pike JW, editors. Vitamin D. San Diego: Academic Press; 1997. p. 293e303. [217] Li YC, Pirro AE, Amling M, et al. Targeted ablation of the vitamin D receptor: an animal model of vitamin D-dependent rickets type II with alopecia. Proc Natl Acad Sci USA 1997;94: 9831e5. [218] Miller WL, Portale AA. Genetic causes of rickets. Curr Opin Pediatr 1999;11:333e9. [219] St-Arnaud R, Glorieux FH. In: DeGroot LJ, Jameson JL, editors. Endocrinology. Hereditary defects in vitamin D metabolism and action. 4th ed, Vol. 2. Philadelphia: W.B. Saunders Company; 2000. p. 1154e68. [220] Schipani E. Conditional gene inactivation using cre recombinase. Calcif Tissue Int 2002;71:100e2. [221] Delvin EE, Glorieux FH, Marie PJ, Pettifor JM. Vitamin D dependency: replacement therapy with calcitriol. J Pediatr 1981; 99:26e34. [222] Rosen JF, Finberg L. Vitamin D-dependent rickets: actions of parathyroid hormone and 25-hydroxycholecalciferol. Pediatr Res 1972;6:552e62. [223] Scriver CR, Reade TM, DeLuca HF, Hamstra AJ. Serum 1,25dihydroxyvitamin D levels in normal subjects and in patients with hereditary rickets or bone disease. N Engl J Med 1978; 299:976e9. [224] Mandla S, Jones G, Tenenhouse HS. Normal 24-hydroxylation of vitamin D metabolites in patients with vitamin D-dependency rickets type I. Structural implications for the vitamin D hydroxylases. J Clin Endocrinol Metab 1992;74:814e20. [225] St-Arnaud R, Dardenne O, Glorieux FH. Etiologie mole´culaire des rachitismes vitamino-de´pendents he´re´ditaires. Me´d/Sci 2001;17:1289e96. [226] Glorieux FH, St-Arnaud R. Vitamin D pseudodeficiency. In: Feldman D, Glorieux FH, Pike JW, editors. Vitamin D. SanDiego: Academic Press; 1997. p. 755e64. [227] Dardenne O, Prudhomme J, Hacking SA, Glorieux FH, StArnaud R. Rescue of the pseudo-vitamin D deficiency rickets phenotype of CYP27B1-deficient mice by treatment with 1,25dihydroxyvitamin D3: biochemical, histomorphometric, and biomechanical analyses. J Bone Miner Res 2003;18:637e43. [228] Naja RP, Dardenne O, Arabian A. St Arnaud R. Chondrocytespecific modulation of Cyp27b1 expression supports a role for local synthesis of 1,25-dihydroxyvitamin D3 in growth plate development. Endocrinology 2009;150:4024e32. [229] Masuyama R, Stockmans I, Torrekens S, et al. Vitamin D receptor in chondrocytes promotes osteoclastogenesis and regulates FGF23 production in osteoblasts. J Clin Invest 2006; 116:3150e9. [230] Yoshizawa T, Handa Y, Uematsu Y, et al. Mice lacking the vitamin D receptor exhibit impaired bone formation, uterine hypoplasia and growth retardation after weaning. Nat Genet 1997;16:391e6. [231] Van Cromphaut SJ, Dewerchin M, Hoenderop JG, et al. Duodenal calcium absorption in vitamin D receptor-knockout mice: functional and molecular aspects. Proc Natl Acad Sci USA 2001;98:13324e9. [232] Dostal LA, Toverud SU. Effect of vitamin D3 on duodenal calcium absorption in vivo during early development. Am J Physiol 1984;246:G528e34. [233] Tu Q, Pi M, Karsenty G, Simpson L, Liu S, Quarles LD. Rescue of the skeletal phenotype in CasR-deficient mice by transfer onto the Gcm2 null background. J Clin Invest 2003;111:1029e37. [234] Miedlich SU, Zalutskaya A, Zhu ED, Demay MB. Phosphateinduced apoptosis of hypertrophic chondrocytes is associated with a decrease in mitochondrial membrane potential and is

[235]

[236]

[237]

[238]

[239]

[240]

[241]

[242]

[243]

[244]

[245]

[246]

[247]

[248]

[249]

[250]

[251]

[252]

[253]

dependent upon Erk1/2 phosphorylation. J Biol Chem 2010; 285:18270e5. Baker MR, McDonnell H, Peacock M, Nordin BE. Plasma 25-hydroxy vitamin D concentrations in patients with fractures of the femoral neck. Br Med J 1979;1:589. Chapuy MC, Arlot ME, Duboeuf F, et al. Vitamin D3 and calcium to prevent hip fractures in elderly women. N Engl J Med 1992;327:1637e42. Lips P, Graafmans WC, Ooms ME, Bezemer PD, Bouter LM. Vitamin D supplementation and fracture incidence in elderly persons. Ann Intern Med 1996;124:400e6. Pavlovitch JH, Galoppin L, Rizk M, Didierjean L, Balsan S. Alterations in rat epidermis provoked by chronic vitamin D deficiency. Am J Physiol 1984;247:E228e33. Sakai Y, Demay MB. Evaluation of keratinocyte proliferation and differentiation in vitamin D receptor knockout mice. Endocrinology 2000;141:2043e9. Xie Z, Komuves L, Yu QC, et al. Lack of the vitamin D receptor is associated with reduced epidermal differentiation and hair follicle growth. J Invest Dermatol 2002;118:11e6. Cianferotti L, Cox M, Skorija K, Demay MB. Vitamin D receptor is essential for normal keratinocyte stem cell function. Proc Natl Acad Sci USA 2007;104:9428e33. Palmer HG, Anjos-Afonso F, Carmeliet G, Takeda H, Watt FM. The vitamin D receptor is a Wnt effector that controls hair follicle differentiation and specifies tumor type in adult epidermis. PLoS One 2008;3:e1483. Li M, Chiba H, Warot X, et al. RXR-alpha ablation in skin keratinocytes results in alopecia and epidermal alterations. Development 2001;128:675e88. Beaudoin 3rd GM, Sisk JM, Coulombe PA, Thompson CC. Hairless triggers reactivation of hair growth by promoting Wnt signaling. Proc Natl Acad Sci USA 2005;102:14653e8. Huelsken J, Vogel R, Erdmann B, Cotsarelis G, Birchmeier W. beta-Catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell 2001;105:533e45. Mathieu C, Waer M, Laureys J, Rutgeerts O, Bouillon R. Prevention of autoimmune diabetes in NOD mice by 1,25 dihydroxyvitamin D3. Diabetologia 1994;37:552e8. Griffin M, Lutz W, Phan V, et al. Dendritic cell modulation by 1,25-dihydroxyvitamin D and its analogs: A vitamin D receptordependent pathway that promotes a persistent state of immaturity in vivo and in vitro. Proc Natl Acad Sci USA 2001; 98:6800e5. Mathieu C, VanEtten E, Gysemans C, et al. In vitro and in vivo analysis of the immune system of vitamin D receptor knockout mice. J Bone Miner Res 2001;16:2057e65. Meehan TF, DeLuca HF. The vitamin D receptor is necessary for 1alpha,25-dihydroxyvitamin D(3) to suppress experimental autoimmune encephalomyelitis in mice. Arch Biochem Biophys 2002;408:200e4. Froicu M, Cantorna MT. Vitamin D and the vitamin D receptor are critical for control of the innate immune response to colonic injury. BMC Immunol 2007;8:5. Wittke A, Chang A, Froicu M, et al. Vitamin D receptor expression by the lung micro-environment is required for maximal induction of lung inflammation. Arch Biochem Biophys 2007;460:306e13. Bouillon R, Okamura WH, Norman AW. Structureefunction relationships in the vitamin D endocrine system. Endocr Rev 1995;16:200e57. Boyan BD, Sylvia VL, Dean DD, Schwartz Z. 24,25-(OH)(2)D(3) regulates cartilage and bone via autocrine and endocrine mechanisms. Steroids 2001;66:363e74.

PEDIATRIC BONE

187

REFERENCES

[254] Boyan BD, Sylvia VL, Dean DD, Del Toro F, Schwartz Z. Differential regulation of growth plate chondrocytes by 1alpha,25-(OH)2D3 and 24R,25-(OH)2D3 involves cell-maturation-specific membrane-receptor-activated phospholipid metabolism. Crit Rev Oral Biol Med 2002;13:143e54. [255] Boyan BD, Jennings EG, Wang L, Schwartz Z. Mechanisms regulating differential activation of membrane-mediated signaling by 1alpha,25(OH)2D3 and 24R,25(OH)2D3. J Steroid Biochem Mol Biol 2004;89e90:309e15. [256] Schwartz Z, Dean D, Walton J, Brooks B, Boyan B. Treatment of resting zone chondrocytes with 24,25-dihydroxyvitamin D3 [24,25-(OH)2D3] induces differentiation into a 125-(OH)2D3responsive phenotype characteristic of growth zone chondrocytes. Endocrinology 1995;136:402e11. [257] Boyan BD, Schwartz Z. Cartilage and vitamin D: genomic and nongenomic regulation by 1,25(OH)2D3 and 24,25(OH)2D3. In: Feldman D, Pike JW, Glorieux FH, editors. Vitamin D. 2nd ed, Vol. 1. San Diego: Elsevier Academic Press; 2005. p. 575e97. [258] St-Arnaud R. In: Feldman D, Pike JW, Glorieux FH, editors. Vitamin D. Mutant mouse models of vitamin D metabolic enzymes. 2nd ed. Vol. 1. San Diego: Elsevier Academic Press; 2005. p. 105e16. [259] Seo EG, Norman AW. Three-fold induction of renal 25-hydroxyvitamin D3-24-hydroxylase activity and increased serum 24,25dihydroxyvitamin D3 levels are correlated with the healing process after chick tibial fracture. J Bone Miner Res 1997; 12:598e606. [260] Seo EG, Einhorn TA, Norman AW. 24R,25-dihydroxyvitamin D3: an essential vitamin D3 metabolite for both normal bone integrity and healing of tibial fracture in chicks. Endocrinology 1997;138:3864e72. [261] Naja RP. The role of vitamin D metabolic enzymes in bone development and repair. Ph.D. Thesis, Department of Human Genetics. Montreal: McGill; 2009. [262] Erben RG, Bante U, Birner H, Stangassinger M. Prophylactic effects of 1,24,25-trihydroxyvitamin D3 on ovariectomy-induced cancellous bone loss in the rat. Calcif Tissue Int 1997;60:434e40. [263] Campbell MJ, Reddy GS, Koeffler HP. Vitamin D3 analogs and their 24-oxo metabolites equally inhibit clonal proliferation of a variety of cancer cells but have differing molecular effects. J Cell Biochem 1997;66:413e25. [264] Stern PH, Rappaport MS, Mayer E, Norman AW. 24-Oxo and 26,23-lactone metabolites of 1,25-dihydroxyvitamin D3 have direct bone-resorbing activity. Arch Biochem Biophys 1984; 230:424e9. [265] Jones G. Analog metabolism. In: Feldman D, Glorieux F, Pike J, editors. Vitamin D. San Diego, CA: Academic Press; 1997. p. 973e94. [266] Ishizuka S, Ishimoto S, Norman AW. Biological activity assessment of 1 alpha,25-dihydroxyvitamin D3-26,23-lactone in the rat. J Steroid Biochem 1984;20:611e5. [267] Ishizuka S, Norman AW. The difference of biological activity among four diastereoisomers of 1 alpha,25-dihydroxycholecalciferol-26,23-lactone. J Steroid Biochem 1986;25:505e10. [268] Toell A, Gonzalez MM, Ruf D, Steinmeyer A, Ishizuka S, Carlberg C. Different molecular mechanisms of vitamin D(3) receptor antagonists. Mol Pharmacol 2001;59:1478e85. [269] Ishizuka S, Kurihara N, Reddy SV, Cornish J, Cundy T, Roodman GD. (23S)-25-Dehydro-1{alpha}-hydroxyvitamin

[270]

[271]

[272]

[273]

[274]

[275]

[276]

[277]

[278]

[279]

[280]

[281]

D3-26,23-lactone, a vitamin D receptor antagonist that inhibits osteoclast formation and bone resorption in bone marrow cultures from patients with Paget’s disease. Endocrinology 2005;146:2023e30. Bischof MG, Siu-Caldera ML, Weiskopf A, et al. Differentiationrelated pathways of 1 alpha,25-dihydroxycholecalciferol metabolism in human colon adenocarcinoma-derived Caco-2 cells: production of 1 alpha,25-dihydroxy-3epi-cholecalciferol. Exp Cell Res 1998;241:194e201. Brown AJ, Ritter C, Slatopolsky E, Muralidharan KR, Okamura WH, Reddy GS. 1Alpha,25-dihydroxy-3-epi-vitamin D3, a natural metabolite of 1alpha,25-dihydroxyvitamin D3, is a potent suppressor of parathyroid hormone secretion. J Cell Biochem 1999;73:106e13. Astecker N, Reddy GS, Herzig G, Vorisek G, Schuster I. 1alpha,25-Dihydroxy-3-epi-vitamin D3 a physiological metabolite of 1alpha,25-dihydroxyvitamin D3: its production and metabolism in primary human keratinocytes. Mol Cell Endocrinol 2000;170:91e101. Siu-Caldera ML, Sekimoto H, Weiskopf A, et al. Production of 1alpha,25-dihydroxy-3-epi-vitamin D3 in two rat osteosarcoma cell lines (UMR 106 and ROS 17/2.8): existence of the C-3 epimerization pathway in ROS 17/2.8 cells in which the C-24 oxidation pathway is not expressed. Bone 1999;24:457e63. Rao DS, Campbell MJ, Koeffler HP, et al. Metabolism of 1alpha,25-dihydroxyvitamin D(3) in human promyelocytic leukemia (HL-60) cells: in vitro biological activities of the natural metabolites of 1alpha,25-dihydroxyvitamin D(3) produced in HL-60 cells. Steroids 2001;66:423e31. Sekimoto H, Siu-Caldera ML, Weiskopf A, et al. 1alpha,25dihydroxy-3-epi-vitamin D3: in vivo metabolite of 1alpha,25dihydroxyvitamin D3 in rats. FEBS Lett 1999;448:278e82. Schuster I, Astecker N, Egger H, et al. Vitamin D-metabolism in human keratinocytes and biological role of products. In: Norman A, Bouillon R, Thomasset M, editors. Vitamin D: Chemistry, Biology and Clinical Applications of the Steroid Hormone. Riverside, CA: University of California Press; 1997. p. 551e8. Norman A, Bouillon R, Farach-Carson M, et al. Demonstration that 1b,25-dihydroxyvitamin D3 is an antagonist of the nongenomic but not genomic biological responses and biological profile of the three A-ring diastereomers of 1a,25-dihydroxyvitamin D3. J Biol Chem 1993;268:20022e30. Harant H, Spinner D, Reddy GS, Lindley IJ. Natural metabolites of 1alpha,25-dihydroxyvitamin D(3) retain biologic activity mediated through the vitamin D receptor. J Cell Biochem 2000; 78:112e20. Messerlian S, Gao X, St-Arnaud R. The 3-epi- and 24-oxoderivatives of 1alpha,25 dihydroxyvitamin D(3) stimulate transcription through the vitamin D receptor. J Steroid Biochem Mol Biol 2000;72:29e34. Seo EG, Kato A, Norman AW. Evidence for a 24R,25(OH)2vitamin D3 receptor/binding protein in a membrane fraction isolated from a chick tibial fracture-healing callus. Biochem Biophys Res Commun 1996;225:203e8. Kato A, Seo EG, Einhorn TA, Bishop JE, Norman AW. Studies on 24R,25-dihydroxyvitamin D3: evidence for a nonnuclear membrane receptor in the chick tibial fracture-healing callus. Bone 1998;23:141e6.

PEDIATRIC BONE

C H A P T E R

9

Peak Bone Mass and Its Regulation Jean-Philippe Bonjour, Thierry Chevalley, Serge Ferrari, Rene Rizzoli Division of Bone Diseases*, University Hospitals and Faculty of Medicine of Geneva, Switzerland

DEFINITION AND IMPORTANCE OF PEAK BONE MASS The concept of “peak bone mass” became familiar about 25 years ago with the frequent use of non-invasive quantitative technology enabling the measurement of the amount of mineral contained at several sites of the skeleton. Interestingly, the first quoted papers referring to “peak bone mass” (PBM) dealt with the influence of disease (anorexia nervosa), medication (glucocorticoids in rheumatoid arthritis) or environmental factors (physical activity) on bone health in young adults [1e3]. It is still convenient to refer to this concept even though “stricto sensu” its actual meaning is not limited to the maximal bone “mass” attained by the end of the period of growth. In the clinical setting, areal (a) bone mineral density (BMD) measured by dual x-ray energy absorptiometry (DXA) in young healthy adults is used as the reference value for evaluating the risk of osteoporotic fracture. It is based on the inverse relationship found between areal BMD values determined at the forearm, spine and hip and the risk of fragility fracture at these three skeletal sites. The relative contribution of peak bone mass to fracture risk has been explored by examining the variability of areal bone mineral density (aBMD) values in relation with age. If peak bone mass is relatively unimportant to aBMD and fracture risk in later life, then the range of aBMD values would become wider as a function of age during adult life. However, several observations are not consistent with such an increased range in aBMD values in relation to age. In untreated postmenopausal women, the standard deviation (SD) of bone mineral mass measured at both the proximal and distal radius was no greater in women aged 70e75 than in women aged 55e59 years [4]. Similar findings were reported at two other clinically relevant skeletal sites at risk of osteoporotic fractures. At both the lumbar spine and femoral

neck, the range of aBMD values was no wider in women aged 70e90 than in women aged 20e30 years [5]. This constant range of individual aBMD values was observed despite the marked reduction in spine and femoral neck aBMD values in the older women (see for review [6]). In agreement with these cross-sectional findings, a longitudinal study of women ranging in age from 20 to 94 years (median age 60 years), with follow-up periods of 16 to 22 years, showed that the average annual rate of bone loss was relatively constant and tracked well within an individual [7,8]. High correlations were observed between the baseline aBMD values and those obtained after 16 (r ¼ 0.83) and 22 (r ¼ 0.80) years of follow up [7,8]. This tracking pattern of aBMD, which was already observed during growth, appears to be maintained over six decades of adult life. This notion of “tracking” has two important implications. First, the prediction of fracture risk based on one single measurement of femoral neck aBMD remains reliable in the long term [8]. Second, within the large range of femoral neck aBMD values little variation occurs during adult life in individual Z-scores or percentiles. From these two implications, it can be inferred that bone mass acquired at the end of the growth period appears to be more important than bone loss occurring during adult life. In a mathematical model using several experimental variables to predict the relative influences of PBM, menopause and age-related bone loss on the development of osteoporosis [9], it was calculated that an increase in peak bone mass of 10% would delay the onset of osteoporosis by 13 years [10]. In comparison, a 10% increase in the age of menopause, or a 10% reduction in age-related (non-menopausal) bone loss would only delay the onset of osteoporosis by 2 years [9]. Thus, this theoretical analysis indicates that peak bone mass might be the single most important factor for the prevention of osteoporosis later in life [9].

*World Health Organization Collaborating Center for Osteoporosis Prevention

Pediatric Bone, Second Edition DOI: 10.1016/B978-0-12-382040-2.10009-7

189

Copyright Ó 2012 Elsevier Inc. All rights reserved.

190

9. PEAK BONE MASS AND ITS REGULATION

There is also evidence that the risk of fracture after the sixth decade may be related to bone structural and biomechanical properties acquired during the first few decades of life. Duan et al. [11,12] calculated the fracture risk index (FRI) of the vertebral bodies based on the ratio of the compressive load and strength in young and older adults (z30e70 years of age). Load was determined by upper body weight, height and the muscle moment arm, whereas bone strength was estimated from the bone cross-sectional area (CSA) and volumetric (v) BMD [11]. From young to older adulthood, this index increased more in women (Chinese and Caucasian) than in men of the same ethnicity [12]. However, the dispersion of CSA, vBMD and FRI values around the mean did not increase with age within a given sex in either the Chinese or the Caucasian ethnic groups [12], suggesting an important role of bone acquired prior to the age of 30. The importance of maximizing peak bone mass has also been estimated from the determination of the risk of experiencing an osteoporotic fracture in adulthood. Epidemiological studies allow one to predict that a 10% increase (about 1 SD) in peak bone mass could reduce the risk of fracture by 50% in women after the menopause [10,13e15]. Altogether, these findings provide strong evidence for the notion that maximizing bone health during growth may represent an important strategy to prevent osteoporosis and fractures during aging. As a result, there has been considerable interest in exploring whether environmental factors can modify the genetically predetermined bone mineral mass trajectory during growth. Before discussing this possibility, the role of heredity and putative candidate genes that might be implicated in the determination of peak bone mass are presented.

CHARACTERISTICS OF BONE MASS AND STRENGTH ACQUISITION Assessment Several structural elements determine the mechanical strength of bone. The size of the bone, the amount of bony tissue within the periosteal envelope and its spatial distribution, i.e. the micro- and macroarchitecture, and the degree of mineralization and structural organization of the organic matrix are the most important elements that determine the resistance to mechanical loading. In each individual, these components as a whole follow a trajectory from intrauterine life to completion of the skeletal growth process, i.e. at the attainment of peak bone mass. To date, aBMD (in g/cm2), as assessed by DXA, is the most common variable studied during infancy, childhood and adolescence. There are several explanations for the widespread use of aBMD

measurement to study bone acquisition during growth in relation to the risk of osteoporosis in adulthood. Determination of aBMD is particularly convenient in terms of availability of equipment, low exposure to irradiation, reproducibility of the measurement at several sites of the skeleton and, last but not least, its relationship with adult osteoporosis fracture risk as adequately documented in large cohorts of women and men. Because of this last characteristic, aBMD was recognized by several national and international institutions, including the World Health Organization (WHO) [10], as the variable to be measured for establishing the diagnosis of adult osteoporosis. More recent practical guides and recommendations for the use of DXA scans in children and adolescents have been presented by national and international bone specialist societies [16,17]. The positive aspects of DXA scanning in clinical use do not mean that aBMD measurement integrates all the determinants of bone strength. Structural and functional components contribute to the degree of bone fragility and therefore to the risk of experiencing fragility fractures. In clinical research, the recent increasing use of high-resolution peripheral quantitative computed tomography (HR-pQCT) and finite element analysis (FEA) can provide additional information on more subtle bone structural mechanical resistance components [18e25]. This technical approach is expected to improve the prediction of bone strength as compared to the current use of the variables that can easily be captured by DXA: aBMD, bone mineral content (BMC), and the bone size of the region of interest. In addition, at some skeletal sites, an estimate of volumetric BMD, cortical thickness, cross-sectional area and moment of inertia can also be computed. Quantitative ultrasonography (QUS) has been compared to DXA for identifying adults with osteoporosis and fragility fractures. Although QUS parameters determined in some but not all tested devices can predict the osteoporotic fracture risk, their use is still not recommended for the diagnosis or treatment monitoring of adult osteoporosis [26]. The application of QUS technology in pediatric populations is attractive because of several characteristics including absence of ionizing radiation, portability and low cost. Calcaneous QUS measurements can detect low bone mass during childhood and adolescence. However, the clinical utility of QUS in children is yet to be determined, and thus this technique remains a research tool in the pediatric population [16,27,28].

Structural Development During growth, aBMD increment is essentially due to an increase in bone size [29,30], which is closely linked to a virtually commensurate increment in the amount of

PEDIATRIC BONE

CHARACTERISTICS OF BONE MASS AND STRENGTH ACQUISITION

Lumbar Spine Increment (%) from Prepuberty to Postpuberty

260 240 220 200 180 160 140 120 BM C (g)

AR E (cm A )

aB (g/ MD cm 2 )

Tr ab . (g/ vBM cm 3 D )

100

FIGURE 9.1 Change in bone traits at the lumbar spine from prepuberty to postpuberty in white females. The results are expressed as the percent increment from prepubertal values. The trabecular volumetric density (Trab.vBMD) change is taken from Gilsanz et al. [32]. The areal bone mineral density (aBMD), bone size (AREA) and bone mineral content (BMC) are from Bonjour et al. [29] and Theintz et al. [33]. They were measured by dual-energy x-ray absorptiometry (DXA) in the anteroposterior view. The much greater change in BMC (þ151%) as compared to Trab.vBMD (þ14%), demonstrates that pubertal bone growth is essentially due to an increase in bone size including an increment in cortical thickness, with very little gain in volumetric trabecular density. (See text for further details.)

Δ L2-L4 aBMD

9–10

g/cm2 per year ± SEM

mineralized tissue contained within the periosteal envelope. Consequently, as compared to bone size, vBMD increases very little from infancy to the end of the growth period [31]. Changes in bone traits from prepuberty to postpuberty also indicate the much greater increment in bone size and BMC, including increased cortical thickness, than in trabecular vBMD as illustrated in the lumbar spine (Fig. 9.1). In healthy girls, longitudinal examination of lumbar spine development indicates that the standard deviation scores (Z-scores) of aBMD, BMC, apparent vBMD, as well as vertebral body width and height are highly correlated, with correlation coefficients (R) ranging from 0.83 to 0.92, as compared to 0.91 for standing height [34]. Before puberty, no substantial sex difference has been reported in the bone mineral mass of the axial (lumbar spine) or appendicular (e.g. radius and femur) skeleton when adjusted for age, nutrition and physical activity. There is no evidence of a sex difference in bone mass at birth; the vBMD appears to be similar in female and male newborns. This absence of substantial sex differences in bone mass is maintained until the onset of pubertal maturation. The gender dimorphism in bone mass is expressed during puberty. It appears to be mainly due to a longer period of bone maturation in males than in females, resulting in a larger increment in bone size and cortical thickness (Figs 9.2 and 9.3).

191

Age range (years) FIGURE 9.2 Bone mass gain at the lumbar spine during the years of pubertal maturation. The approximately fourfold increment in bone mass gain, as estimated by aBMD measurement by DXA, is particularly pronounced during 3 and 4 years in females (from 11e14) and males (from 13e17), respectively. (Adapted from Theintz et al. [33].)

As mentioned above, pubertal maturation affects bone size much more than it does vBMD [31]. There is no significant sex difference in trabecular vBMD at the end of pubertal maturation [30,32,35,36]. Bone mass accumulation rate at both lumbar spine (Fig. 9.2) and femoral neck regions increases four- to sixfold over a 3- and 4-year period in females and males, respectively. The increment in bone mass gain is less marked in long bone diaphyses (Fig. 9.3) [33]. As first described by Garn [37] by measuring metacarpal bones during sexual maturation, cortical thickness increases more by periosteal development in males, but more by endosteal deposition in females. This concept is illustrated in Figure 9.3 depicting the gain in femoral shaft cortical thickness from 9 to 20 years in both female and male healthy subjects. In the lumbar spine, the gender difference observed when PBM is attained consists essentially of a greater vertebral body diameter in the frontal plane of males as compared to females [38,39] (Fig. 9.4A and B). This gender-related structural dimorphism does not attenuate with aging. It certainly represents an important macroarchitectural characteristic accounting for the greater incidence of vertebral fragility fractures recorded in female than male subjects in later life. Within each gender, this structural property also plays an important role in vertebral fracture risk. In postmenopausal women, a smaller cross-sectional area of vertebral bodies was measured in those with than without vertebral fractures despite the fact that the two groups displayed equally low trabecular vBMD as determined by spinal QCT [40]. The gender difference in either

PEDIATRIC BONE

192

9. PEAK BONE MASS AND ITS REGULATION

Femoral Shaft aBMD g/cm2 per year ± SEM

Males

Females 9–10

–

Age Range (years)

FIGURE 9.3 Bone mass gain in the midfemoral shaft during the years of pubertal maturation. The increment in bone mass gain, as estimated by aBMD measurement by DXA, takes place during 3 and 4 years in females (from 11e14) and males (from 13e17), respectively. (Adapted from Theintz et al. [33].) On the right side is schematized the sex difference occurring during pubertal maturation in the cross-section of a long bone. Before pubertal maturation (age 9e10 years), both periosteal and endosteal circumferences (dotted circles) are similar in girls and boys. At the end of pubertal maturation (age 17e20 years), cortical thickness has increased by more periosteal deposition in males than in females (continuous circles) in whom the increment in cortical width is also due to increased endosteal formation. (See text for further details.)

(A)

Morphometric lumbar spine gender differences

Lumbar vertebral endplate Measured diameters Sagittal: small arrows Diagonal: mid-sized arrows Transverse: bold arrows

Lumbar vertebral body Measured heights Posterior: thin arrows Anterior: bold arrows

Male

Female

Transverse diameter

56.1 ± 5.5

50.6 ± 8.6

1.11*

Diagonale diameter

49.4 ± 5.6

45.4 ± 5.1

1.09*

Sagittal diameter

36.1 ± 3.9

35.4 ± 3.6

1.02

Vertebral height ant.

35.5 ± 4.2

27.0 ± 4 .1

1.32*

Vertebral height post.

27.4 ± 5.4

25.9 ± 4.2

1.06

Measurements are in millimeters ± SD

Male/Female Ratio

*P<0.05

FIGURE 9.4 (A) Sex-related morphometric differences in lumbar vertebrae. Measurements were made on 68 macerated lumbar vertebrae. Note the significantly wider transversal diameter in males than in females, whereas there is no difference in the sagittal diameter. These direct morphometric measurements from Aharinejad et al. [38] are relevant to the sex differences in PBM as recorded by DXA and illustrated in (B).

aBMD or BMC observed in the radial or femoral diaphysis once PBM is attained also appears to be essentially due to a greater gain in bone size in males than in females during pubertal maturation. A study comparing bone variables (BMC, aBMD and vBMD) in opposite-sex twins corroborates this notion [41].

Peripubertal Transient Fragility There is an asynchrony between the gain in standing height and the growth of bone mineral mass during pubertal maturation [33,42]. This phenomenon may be responsible for the occurrence of a transient bone

PEDIATRIC BONE

193

CHARACTERISTICS OF BONE MASS AND STRENGTH ACQUISITION

Lumbar spine osteodensitometric gender differences

(B)

C

V

B

V

A

C BM

R A B V

BM

-l

-la EA

D M aB B V

at

t

t -la

p -a C BM

R A

aB

M

EA

D

-a

-a

p

p

L3 BMC =

FIGURE 9.4 (B) Sex-related osteodensitometric differences in lumbar vertebrae. Measurements of aBMD, AREA and BMC were made by both anteroposterior (ap) and lateral (lat) DXA scans in 65 male and female subjects with ages ranging from 20 to 35 years. Vertebral BMC of L2eL3 or L3 alone, was quite similar in anteroposterior and lateral scans, as schematized in the upper part of the diagram. Male to female ratios were not different from 1.0 for aBMD in ap view, but significantly higher for aBMD in lat view as shown in the lower part of the diagram. VB, vertebral body; VA, vetebral arch. ***P < 0.001 as compared with a sex ratio of 1.0. Note that the most prominent difference between male and female osteodensitometric values was for VB BMC in lat view, as explained, at least in part, by the greater transverse (frontal) than sagittal dimension of the vertebral body in males than in females as shown in Figure 9.4A. (Adapted from Fournier et al. [39].)

fragility in adolescence that may contribute to the higher incidence of fractures that occurs when the dissociation is maximal between the rates of standing height and mineral mass accrual [43,44]. In healthy girls and boys aged 6 to 21 years, bone structure measurement by HR-pQCT associated with FEA at the distal radius suggests that the proportion of load borne by cortical bone decreased transiently during mid- to late puberty [23]. This change could correspond to an increase in cortical porosity during the pubertal growth spurt and may contribute to the adolescent peak in forearm fractures [23]. This possibility would be consistent with the hypothesis that cortical porosity would develop in response to the increased calcium demand related to the rapid peripubertal skeletal growth [45]. Nevertheless, some trauma fractures observed during childhood or adolescence may be unrelated to transient bone

fragility that occurs at peak height velocity during the peripubertal growth phase. It is possible that some of these fractures may also be determined by tracking, from infancy to the end of skeletal maturation, along a relatively low bone mass percentile (Z-score) [46]. Thus, the deficit would be permanent and expressed by a relatively low PBM and increased risk of fragility fracture in later adult life [47].

Time of Peak Bone Mass Attainment In adolescent females, gain in bone mass declines rapidly after menarche (Fig. 9.5) [33]. No further statistical significant gains can be monitored within 2e4 years postmenarche, at least in sites such as the lumbar spine or femoral neck (Fig. 9.5). In adolescent males, the gain

PEDIATRIC BONE

194

9. PEAK BONE MASS AND ITS REGULATION

in 16-year-old and 30-year-old subjects [48]. This observation supports the notion that the modest increase in vertebral trabecular vBMD is achieved soon after menarche. This is in keeping with numerous observations indicating that, at most skeletal sites, total bone mineral mass does not significantly increase from the third to the fifth decade. Nevertheless, a few crosssectional studies suggest that bone mass acquisition may still be substantial during the third and fourth decades. In any case, the balance of published data does not sustain the concept that bone mass at any skeletal site, in either gender and in any ethnic and/or geographic population group, continues to accumulate through the fourth decade [30].

FIGURE 9.5 Relationship between spinal and femoral aBMD gains and years after menarche in healthy girls. Results are means  SEM. Time after menarche: P5a, less than 1.0 yr (age: 13.8  0.4 yearrs); P5b, 1e2 years (age 14.5  0.2 years); P5c, 2e4 years (age: 16.6  0.3 years); P5d, more than 4 years (age: 17.4  0.3 years). Statistical significance of aBMD gain: *P < 0.05; **P < 0.01; ***P < 0.001. The increment in aBMD dramatically fell after 16 years (see Figure 9.2) and/or 2 years after menarche. The mean aBMD gains in healthy girls at the level of lumbar spine, femoral neck and femoral shaft were not statistically significant between 17 and 20 years. Data from Theintz et al. [33].

Peak Bone Mass Variability At the beginning of the third decade, there is a large variability (CV ¼ SD/mean100) in the normal values of aBMD or BMC in the axial and appendicular skeleton [30]. This large variability, which is observed at sites particularly susceptible to osteoporotic fractures, such as the lumbar spine and femoral neck, is only slightly reduced after correction for standing height and does not appear to increase substantially during adult life (Fig. 9.6) [39]. The height-independent broad variability in bone mass that is present before puberty appears to increase further during pubertal maturation at sites such as the lumbar spine and femoral neck [29,33]. Note that in young healthy adults the biological variability in lumbar spine BMC is four or five times higher than that in standing height. Of note, the variability in standing height does not increase during pubertal maturation [42].

Bone Biochemical Markers During Puberty in BMD or BMC that is accelerated particularly from 13 to 17 years declines markedly thereafter, although it remains significant between 17 and 20 years in both lumbar spine BMD and BMC and in mid-femoral shaft BMD; in contrast, no significant increase is observed in femoral neck BMD [33]. In subjects who reached pubertal stage P5 and grew less than 1 cm/year, a significant bone mass gain persisted in males but not in females [33]. This suggests the existence of an important sex difference in the magnitude and/or duration of the so-called “consolidation” phenomenon that contributes to PBM. As described above, the change in trabecular vBMD during growth is very modest as compared to the increment in bone size (see Fig. 9.1). Furthermore, the increased vBMD, as measured by QCT, has been detected in vertebral cancellous bone but not in appendicular cortical tissue [35]. In the lumbar vertebral body, no difference is observed between the mean values

Taking into account the different bone growth processes which encompass endochondral formation, modeling and remodeling, it is no wonder that the interpretation of the changes in bone biochemical markers during growth is more complex than that for adulthood, particularly for the markers of bone resorption [49e53]. The plasma concentrations of the bone formation markers are highest when the velocity of bone mineral accrual is maximal, suggesting that the two phenomena are related. The high urinary excretion of bone resorption markers, such as collagen pyridinium cross-links, observed during childhood, decreases after the growth spurt and reaches adult values at the end of pubertal maturation (i.e. 15 or 16 years of age in females and 17 or 18 years of age in males) [49e53]. This probably reflects the decrease in the resorption rate associated with the reduction and eventually the arrest in longitudinal bone growth. In a prospective study of pubertal girls, bone turnover markers (osteolcalcin, bone-specific

PEDIATRIC BONE

DETERMINANTS OF PEAK BONE MASS AND STRENGTH

L2 - L4 BMC (g)

FEMALES

MALES

70

70

60

60

50

50

40

40

30

30

20

20

10 0 120

P1 130

140

195

10

P2 P3 P4 P5 150

160

170

180

P1

P2 P3 P4 P5

0 120 130 140 150 160 170 180 190 200

STANDING HEIGHT (cm)

FIGURE 9.6

Relationship between lumbar spine bone mineral content (BMC) and standing height in healthy females and males from prepuberty to completion of pubertal maturation. Data are from 207 healthy Caucasian subjects aged 9e18 years. BMC was measured by DXA. Pubertal stages (P1 to P5) are marked on the standing height horizontal axis. Vertical lines illustrate the marked variability of bone mineral mass at the end of pubertal maturation for a standing height corresponding to the mean value of the young adult population of reference. A twofold difference in the amount of bone mineral contained within the three lumbar vertebrae is observed for the same standing height in both female and male subjects. The mean L2eL4 BMC at the end of pubertal maturation as indicated by the horizontal solid lines was 10% greater in males than in females. Data from Bonjour et al. [29].

alkaline phosphatase, and collagen pyridium crosslinks) were modestly related to standing height gain, but they were not predictive of gains in either total body BMC or BMD as assessed by DXA [54]. The reader should refer to Chapter 15 for more detailed discussion on the clinical use of biochemical markers of bone metabolism.

DETERMINANTS OF PEAK BONE MASS AND STRENGTH Several interconnected factors influence bone mass accumulation during growth. These physiological determinants classically include heredity, vitamin D and bonetropic nutrients, endocrine factors, and mechanical forces (Fig. 9.7). Quantitatively, the most prominent determinant appears to be genetically related.

Genetic Factors Parent(s)eoffspring comparison studies reveal a significant relationship in the risk of osteoporosis within families, with apparent transmission from either mothers or fathers to their children [34,55e58]. The

familial resemblance for bone mineral mass in mothers and daughters is expressed before the onset of pubertal maturation [34]. Comparison in the degree of correlation between pairs of monozygotic versus dizygotic twins allows one to estimate more precisely the contribution of heritability to the variance of bone mineral mass [59,60]. This computation suggests that heritability, i.e. the additive effects of genes, explains 60e80% in the variance of adult bone mineral mass. This “genetic effect” appears to be greater in skeletal sites such as the lumbar spine compared to the femoral neck [61]. It is possible that mechanical factors (e.g. physical activity, body weight, muscle force) exert a greater influence on the cortical component of the bony structure of the femur, thus explaining the relatively low heritability at that site. Despite the strong impact of heritability on aBMD, environmental factors still play an important role since they may account for up to 20e40% of PBM variance. Two main approaches have dominated the search for genetic factors that influence bone acquisition and thereby modify the susceptibility to osteoporosis in later life. One approach is to search by genome-wide screening for loci flanked by DNA microsatellite markers that would co-segregate with the phenotype of interest in a population of related individuals. The

PEDIATRIC BONE

196

9. PEAK BONE MASS AND ITS REGULATION

FIGURE 9.7 Physiologic determinants of peak bone mass and

Genetics

Endocrine Sex Hormones IGFIGF-I

strength. The black arrows and dashed lines illustrate the interdependency of the four categories of factors influencing the mass and strength acquired by the end of skeletal development in healthy female and male subjects. IGF-I: Insulin-like growth factor-I. The major importance of heredity in peak bone mass and strength is symbolized by the wider white arrow from the “Genetics” box. (See text for further details on the determinants and their interactions as schematized on this diagram.)

pedigrees investigated to date consist mainly of families with a member at either extreme of the skeletal phenotype spectrum; particularly those exhibiting either very high or very low bone mineral mass or areal density [62e64]. Genome screening for quantitative trait loci (QTLs) has also been used to detect within the “normal” population families and/or siblings with marked difference in bone mass, size [65e67], or geometry [64,68,69]. The second frequently used approach is to search for an association between allelic variants or polymorphisms of genes coding for products that are implicated in bone acquisition or loss. The most studied phenotype has been aBMD or bone mineral content (BMC) because of both the ease of access and reliability of its measurement, as well as the relatively good predictability for osteoporotic fracture risk [10,13e15]. Association between polymorphic candidate genes and fracture has also been reported [70e73]. The fracture phenotype is certainly attractive since it is the most convincing evidence of osteoporosis-induced bone fragility. However, fragility fracture is a very complex phenotype that depends not only on bone quantity and quality, but also on other endogenous factors, such as the propensity to fall, protective responses, soft tissue padding, and exogenous elements present in the living environment [74e76]. Numerous studies have reported an association between bone phenotype and polymorphic candidate genes coding for hormones, hormonal receptors or enzymes involved in their biochemical pathways; local regulators of bone metabolism; structural molecules of the bone matrix [59,60,77e79]. Meta-analyses have been reported for the most studied polymorphisms, which include: vitamin D receptor (VDR) [80,81], estrogen receptor alpha (ESR1) [72] and type I collagen A1 chain (CollA1) [71]. The polymorphisms considered in these three genes were significantly associated with aBMD, BMC and/or fracture risk [82]. However, none of these polymorphisms appears to be responsible for

a substantial proportion, i.e. more than 1e3%, of PBM variance. Furthermore, significant associations appear to depend upon several factors including the skeletal sites measured, age, gender, ethnicity, genetic homogeneity of the investigated population, and the interaction between genes and environmental factors (refer to the next sections of this chapter). Only a few studies have explored the contribution of these candidate genes using bone geometry or strength as an outcome. Findings from these studies are contradictory which, given the small sample size, are largely explained by a lack of statistical power. One of the most interesting aspects concerning heritability of bone mass and strength is the implication of the gene coding for low-density lipoprotein receptorrelated protein-5 (LRP5). LRP5 is a member of the lowdensity lipoprotein (LDL) receptor-related family coding for a transmembrane co-receptor for Wnt signaling [83]. Several lines of evidence point to LRP5 as a candidate gene for osteoporosis. Mutation in the LRP5 gene has been found in patients with the human osteoporosis pseudoglioma syndrome (OPPG), an autosomal recessive disorder characterized by low bone mass, spontaneous fractures and blindness [84,85]. Interestingly LRP5-deficient mice develop osteoporosis and sustain fractures due to reduced osteoblast proliferation and function [86]. In sharp contrast to LRP5 mutations reducing the functional osteogenic capacity, other mutations in the same gene can lead to increased bone formation. Such a gain-of-function mutation in LRP5 is associated with an autosomal dominant high bone mass (HBM) and sclerosing bone dysplasias [87e89]. Most importantly, a QTL for aBMD in the general population was mapped at 11q12-13, the LRP5 locus [65,69,90]. A population-based study of five LRP5 polymorphisms with allele frequencies > 2% found that a missense substitution in exon 9 (c.2047G > A, p.V667M) and haplotypes based on exon 9 and exon 18 (c.4037 C > T, p.A1330V) alleles were significantly

Nutrition Vitamin D Calcium Proteins

Peak Bone Mass/Strength

Mechanics Physical Activity Body Weight

PEDIATRIC BONE

DETERMINANTS OF PEAK BONE MASS AND STRENGTH

associated with lumbar spine bone mass and projected area in adult males, but not females. These polymorphisms accounted for up to 15% of the population variance for these traits in men [91]. Consistent with the presence of a QTL for stature at 11q12-13 [92,93], the exon 9 variant was also significantly associated with standing height in both genders [91]. Moreover, 1-year changes in lumbar spine bone mass and size in prepubertal boys were also significantly associated with these LRP5 variants, suggesting that LRP5 polymorphisms could contribute to the risk of spine osteoporosis in men by influencing vertebral bone growth during childhood [91]. These observations in young healthy males led to investigating LRP5 polymorphisms in men with idiopathic osteoporosis [79]. This rather uncommon form of osteoporosis affects middle-aged men and is characterized by low PBM and an increased incidence of vertebral fractures in the absence of any secondary causes, and by a clear heritable component [58,94]. In keeping with the previous association study, exon 9A and exon 18T alleles were twice as common in men with idiopathic osteoporosis as in age-matched controls (mean age: 50.4 years, range 23e70). The odds were greater than two for idiopathic male osteoporosis and fractures among carriers of the 9A-18T haplotype [79]. In a large prospective population-based study, a variant (1330valine) of the LRP5 gene was associated with decreased aBMD and reduced bone size (vertebral body size and femoral neck width) at both the lumbar spine and femoral neck in elderly white men [95]. In summary, these different studies suggest that some LRP5 gene variants would increase the osteoporosis risk profile in men, possibly by influencing bone size during growth and thereby affecting an important component of peak bone strength. In a recent meta-analysis of several studies, nine out of the 150 candidate genes were associated with bone mineral density at the lumbar spine and only three at both lumbar spine and femoral sites [96]. In another large scale meta-analysis of genome-wide association studies (GWAS), only nine out of 20 gene loci were associated with bone mineral density at both lumbar and femoral neck sites [97]. The contribution of these genes to the inter-individual wide range of bone mineral density was very weak, explaining only z3% and z2% of the variance, respectively [97]. This very small variance contribution markedly contrasts with the large genetic effects on bone mineral density reported in twin studies [61,98,99]. Possible limitations regarding large-scale studies to identify important genetic determinants have been explicitly considered, including ethnic heterogeneity, population sampling, use of genetic markers instead of functional variants, lack of geneegene or geneeenvironment interaction analysis

197

[100]. The disappointing outcome of large scale metaanalysis of either candidate gene or GWAS studies suggests that other methodology approaches should be explored, particularly regarding geneeenvironment interactions, in order better to identify the main factors explaining the large PBM variance, and thereby the individual osteoporosis risk in later adulthood [100,101].

Endocrine Factors Among endocrine factors, both sex hormones [36,102,103) and the growth hormoneeinsulin-like growth factor-1 (GH-IGF-1) system [104,105] exert a specific impact on bone and play an important role, particularly during the phase of pubertal maturation. Furthermore, these two hormonal systems interact to stimulate the longitudinal and cross-sectional growth of the skeleton. Sex Hormones As already discussed, the development of bone mineral mass during the whole growth period, including pubertal maturation, is due essentially to an increase in bone size, with a very small change in the unit amount of mineralized tissue within the bone envelope [30,36,103,106]. In other words, the volumetric bone mineral density (vBMD) remains virtually constant from birth to the end of the growth period. Similarly, once pubertal maturation is achieved, the gender difference in bone mass results essentially from a greater bone size in male subjects [30,36,103,106]. In boys, the onset of puberty occurs later than in girls and the period of accelerated bone growth lasts 4 years, as compared to 3 years in girls [33]. These two characteristics probably account, to a large extent, for the gender difference in mean PBM observed in healthy young adults. Androgen receptors have been localized in growth plate chondrocytes in humans during pubertal maturation [107,108]. However, there is no evidence that androgens stimulate longitudinal bone growth by a direct action on the skeleton. At adult age, patients affected by the androgen insensitivity syndrome and who have an XY genotype associated with a markedly female phenotype, are taller than the average standing height of the corresponding female population [109]. In contrast, it is well documented that estrogens play an essential role in longitudinal bone growth. Estrogens exert biphasic effects, accelerating bone growth at the beginning of puberty and playing a key role in the closing of growth plates in both genders [36,102,103]. During pubertal maturation, cross-sectional analysis of appendicular bone, at least in the upper limb, reveals distinct gender dimorphisms. In female subjects, bone mineral mass increases more by endosteal than

PEDIATRIC BONE

198

9. PEAK BONE MASS AND ITS REGULATION

periosteal accrual [37]. In male subjects, the opposite structural modifications are observed, with a greater increase in periosteal than endosteal deposition, resulting in an increment in both external and internal perimeters of the cortex [37]. As mentioned above, at the end of pubertal maturation, cortical thickness is greater in male than in female subjects. In vertebral bodies, the gender structural dimorphism is mainly expressed in the frontal axis, which is 10e15% larger in males than in females [39]. These morphological differences and mineral mass distribution of both axial and appendicular bones confer to male skeleton a greater resistance to mechanical loading. The increased deposition of bone mineral at the level of the endosteal surface during puberty in female subjects may represent, according to a teleological explanation, a biological adaptation allowing the rapid mobilization of bone mineral in response to increased need during pregnancy and lactation. Experimental evidence indicates that alterations in maternal estrogen levels during pregnancy can not only influence the early phases of fetal bone tissue development, but can also exert long-term imprinting effects on bone cellular activity and eventually on adult skeletal mass [110]. The Growth Hormone-IGF-I System From birth to the end of adolescence, the GH-IGF-I system is essential for the harmonious development of the skeleton [111]. During puberty, the plasma level of IGF-I transiently rises according to a pattern similar to the curve of the gain in bone mass and size [30]. IGF-I positively influences the growth of the skeletal pieces in both length and width. IGF-I exerts a direct action on growth plate chondrocytes as well as on osteogenic cells responsible for building both cortical and trabecular bone tissue constituents [111]. This activity is also expressed by parallel changes in the circulating biochemical markers of bone formation, osteocalcin and alkaline phosphatase. In addition, IGF-I exerts an important impact on renal endocrine and transport functions that are essential for bone mineral economy. IGF-I receptors are localized in renal tubular cells. They are connected to both the production machinery of the hormonal form of vitamin D, namely 1,25dihydroxyvitamin D (1,25(OH)2D) [112,113], and to the transport system of inorganic phosphate (Pi) [114] localized in the luminal membrane of tubular cells. By enhancing the production and circulating level of 1,25(OH)2D [115], IGF-I indirectly stimulates the intestinal absorption of Ca and Pi. Coupled with the stimulation of the tubular capacity to reabsorb Pi [115], the extracellular CaePi product is increased by IGF-I which, through this dual renal action, favors bone matrix mineralization. Furthermore, at the bone level, IGF-I directly enhances the osteoblastic formation of the extracellular

matrix [116]. Growth plate chondrocytes as well as their plasma membrane derived extracellular matrix vesicles are equipped with a Pi transport system that plays a key role in the process of primary mineralization and, thereby, in bone development [117e119]. This Pi transport system is also present in other osteogenic cells [120] and is regulated by IGF-I [121]. The hepatic production of IGF-I, which is the main source of circulating IGF-I, is influenced not only by GH, but also by other factors, particularly by amino acids from dietary proteins (see below). During pubertal maturation, there is an interaction between sex steroids and the GH-IGF-1 system. The modalities of this interaction remain to be delineated in humans. In animal studies, relatively low concentrations of estrogens stimulate the hepatic production of IGF-I, whereas large concentrations exert an inhibitory effect [103]. Androgens act mainly at the pituitary level, but only after being converted into estrogens by the enzymatic activity of aromatase [103].

Importance of Pubertal Timing Physiologically, there are large variations in the onset of pubertal maturation which ranges from 8 to 12 and from 9 to 13 years of age in girls and boys respectively [122]. In affluent populations, the coefficient of variation (CV) is around 10%. It may even be larger in developing countries [123]. Pubertal timing is much easier to determine in females than in males. Indeed, the first menstruation represents a relatively precise milestone of sexual development, remaining a memorable event for most subjects. The occurrence of the first menstruation is a relatively late marker of pubertal maturation [122]. Nevertheless, it is a quite reliable milestone of pubertal maturation onset, since menarcheal age is highly correlated with the thelarcheal age, the time of first appearance of breast bud development [124]. The notion that pubertal timing within the physiological range is related to the risk of osteoporosis during adult life has been mostly documented in female subjects. Thus, in postmenopausal women, the risk of osteoporotic (fragility) fractures occurring at several skeletal sites, including forearm, spine and proximal femur, is associated with later age at menarche [125e128]. That these observations were related to an intrinsic bone fragility component was documented by other observations reporting low aBMD at these three skeletal sites in postmenopausal women with later menarche [129e132]. Taking into account the tracking phenomenon described above, it is no wonder that low aBMD was also recorded in premenopausal women with later menarche [133e135]. An inverse relationship between menarcheal age and osteoporosis risk is not limited to some regional distinctive characteristics, since

PEDIATRIC BONE

DETERMINANTS OF PEAK BONE MASS AND STRENGTH

it was observed in adult women living in Asia, Europe and/or North America. More recently, prospective studies from prepuberty to time of PBM attainment in healthy subjects indicate that menarcheal age is inversely related to aBMD at several sites of the skeleton, including forearm, lumbar spine and proximal femur [21,22,136]. As a tentative explanation, this inverse relationship was supposed to be the expression of an uneven duration of estrogen exposure from sexual maturation to menopause [137e139]. However, recent data do not sustain this concept. Indeed, in a prospective study, the mean aBMD gain from prepuberty (mean age 8.9 years) to PBM (mean age 20.4 years) of six skeletal sites including radial metaphysis and diaphysis, femoral neck and shaft, trochanter and lumber spine, was not different in subjects having experienced a relatively earlier or later menarche [136]. In fact, the difference in PBM between those who experienced a relatively later vs earlier pubertal timing was already fully expressed before any sign of pubertal maturation [136]. Menarcheal age is under the strong influence of heritable factors as reported many years ago [140]. By the mid1930s, mean differences in menarcheal age between identical twins, non-identical twins, sisters and unrelated women had been found to be 2.2, 12.0, 12.9 and 18.6 months, respectively [140]. Further reports on menarcheal age corroborated these early findings by documenting a greater correlation coefficient within monozygotic (MZ, R ¼ 0.75) than dizygotic (DZ, R ¼ 0.31) twin pairs, as shown for instance, in a Finnish study [141]. From a mathematical analysis that included the contribution of body mass index (BMI) to pubertal onset, 74% and 26% of the variance in menarcheal age could be attributed to genetic and environmental factors, respectively [141]. The genetic regulation of pubertal timing in females is also supported by significant correlations between ages at which mothers and daughters experience their first menstruation [142]. Thus, like PBM, pubertal timing is under strong genetic influence. From twin models, it can be estimated that heredity accounts for about 75% of the variance of either menarcheal age [141] or PBM [59]. In the general population, both pubertal timing and PBM with its mechanical strength components are traits characterized by large variance and Gaussian distribution. Both variables are under the strong influence of heredity and moderately affected by environmental factors. Therefore, it was postulated that pubertal timing, PBM and consecutive osteoporosis risk later in life may well be part of common programming in which both genetic factors and in uteri influences are important determinants [47]. Both variables probably arise from the additive influence of multiple genes. Several variants in relation to either pubertal timing [143,144] or PBM [59,96,97,100,101,145] have been identified. However,

199

none of them can explain more than a few percent of the wide physiological variance in these two traits. By the end of the growth period in healthy females, the negative influence of later menarcheal age was expressed not only in lower aBMD but also in decreased cortical thickness without reduced cortical surface area (CSA) [21], a finding compatible with less endocortical accrual. Such structural characteristics could explain how later menarcheal age can increase the risk of forearm osteoporotic fractures in postmenopausal women [127]. Likewise, regarding the increased risk of hip fracture with later menarche [146] in young healthy women with later pubertal timing, lower femoral neck aBMD was associated with reduced cortical thickness and vBMD in the distal tibia [22]. Of note, the deleterious influence of later menarcheal age at weight-bearing sites was of similar magnitude in premenopausal middle-aged as compared to adult females in their early twenties [22]. Furthermore, this effect was independent of age-related premenopausal bone loss (Fig. 9.8) [22]. In growing males, pubertal timing was prospectively estimated by determining the age at peak height velocity (PHV), an anthropometric characteristic which occurred at a mean age of 13.6 years, ranging from 10.9 to 16.9 years [147]. Age at PHV was a negative predictor of several bone variables measured a few years later at an age close to PBM attainment [147]. In addition, an association was found between age at PHV and fracture incidence during growth [147]. A one year increment in age at PHV increased by 40% the risk of upper limb fracture occurring during growth [147]. Thus, in both healthy females and males, later pubertal timing is associated with low PBM, and increases the risk of fragility fractures in later life, taking account, as discussed above, that bone traits track during adulthood. In addition, the deficit in bone acquisition that is detectable before the first clinical expression of sexual maturation [136], may also explain the influence of pubertal timing on the risk of fracture during growth [46,147e149].

Mechanical Factors Mechanical forces impinge on the skeleton by enhancing osteoblastic bone formation, while inhibiting osteoclastic bone resorption [150]. The effect on osteoblast number and activity probably involve several local factors. Some appear to be produced by the osteocytes. The density, distribution and extensive communication network of osteocytes make them particularly well structured to function as detectors of mechanical strain by sensing fluid movement within the bone canaliculi. They can direct the formation of new bone by activating lining cells to differentiate into preosteoblasts [150]. A key molecule implicated in this

PEDIATRIC BONE

200

9. PEAK BONE MASS AND ITS REGULATION

EARLIER LATER 0.6

Menarche

Femoral Neck aBMD (g/cm 2)

0.4

0.4

0.3 0.2

T-score

0.2

0.1

0

0 –0.1

–0.2

–0.2

–0.4

–0.3 –0.4

–0.6 –0.8 Age at menarche Age at examination

Distal Tibia vBMD (mg/cm3)

–0.5 –0.6

12.1 14.0 11.8 14.4 20.4 20.4 45.6 46.0 YAD

PREMENO

*P = 0.0001 #P

= 0.004

12.1 14.0

11.8 14.4

yrs

20.4 20.4

45.6 46.0

yrs

YAD

*Difference between YAD and PREMENO # Difference between EARLIER and LATER

PREMENO *P = 0.024 #P

= 0.0005

FIGURE 9.8 Deleterious impact of later pubertal timing on bone traits in healthy women. Two cohorts of young adult (YAD, 20.4 years, n ¼ 124) and middle-aged premenopausal (PREMENO, 45.8 years, n ¼ 120) women. Menarcheal age (MENA) represents a reliable marker of pubertal timing. Each cohort was dichotomized by the median of MENA into EARLIER and LATER. Values are T-scores (  SEM) of femoral neck aBMD and trabecular density (vBMD) of distal tibia measured by DXA and HR-pQCT, respectively. Age at MENA and bone trait measurements are indicated below the histogram. The data show the significant negative impact of later pubertal timing on peak femoral neck aBMD and tibial vBMD. The deleterious effect of later MENA remains unabated 25 years later, and adds to the significant age-dependent bone loss that occurs at these weight-bearing skeletal sites during the premenopausal years. Data are from Chevalley et al. [22].

mechanotransduction process appears to be sclerostin, the product of the SOST gene [151] (see later).

Age and Optimal Response to Loading Growing bones are usually more responsive to mechanical loading than adult bones. Physical activity increases bone mineral mass accumulation in both children and adolescents. However, the impact appears to be stronger before than during or after the period of pubertal maturation [152]. Children and adolescents involved in various competitive sports such as gymnastics, freestyle skiing, figure or speed skating, soccer, and therefore undergoing intense training, display increased bone mineral mass gain. The greater gain in aBMD or BMC in young athletes compared with less active controls is preferentially localized in weight-bearing bones, such as the proximal femur. Studies in adult elite athletes strongly indicate that increased bone mass gains resulting from intense physical activity during childhood and adolescence are maintained after training attenuates or even completely ceases (see next section).

Exercise During Growth and Fracture Prevention in Adulthood The question whether the increased PBM induced by physical exercise will be maintained into old age and confer a reduction in fracture rate remains uncertain. A cross-sectional study of retired Australian elite soccer players suggested that this might not be the case [153]. However, in another study, benefits were attenuated but not lost [154]. Thus, in ice hockey and soccer players, although exercise-induced BMD benefits during growth are partially reduced after retirement from sports, higher PBM may contribute to the lower incidence of fragility fractures observed in retired athletes beyond 60 years of age compared to matched controls [154]. Some of the bone structural change can be retained after training discontinuation. This can be explainable when exercise produces an increased bone size as observed in adult former tennis players [155]. Higher humeral shaft side-to-side differences in crosssectional area, cortical area, bone strength index were recorded, consistent with the persistence of exerciseinduced periosteal expansion [155]. Nevertheless,

PEDIATRIC BONE

201

DETERMINANTS OF PEAK BONE MASS AND STRENGTH

residual benefits to bone structural properties conferring increased resistance to loading may not be the only factor explaining the reduced fragility fracture risk recorded in former athletes [156,157]. A positive impact on skeletal muscle strength and improved movement coordination and balance may also contribute to the residual benefits [156].

Moderate Exercise for Public Health Program In the perspective of public health programs aimed at increasing bone mineral mass gain in children and adolescents, it is obvious that only physical exercise of moderate intensity, duration and frequency, but which would still be effective, can be taken into consideration. In children, prepubertal individuals or those at an early stage of sexual maturation, several interventions implemented within the school curriculum indicate that physical exercise can positively impact on bone development (Fig. 9.9) [158e165]. Nevertheless, it remains uncertain to what extent the greater bone mineral accrual in response to moderate and readily accessible weightbearing exercise is associated with a commensurate increase in bone strength. The magnitude of benefit in terms of bone strength will depend upon the nature of the structural change. The structural change underlying the beneficial effects of weight-bearing exercises on aBMD and BMC remains to be better determined. Surface-specific effects on long bones appear to be

pubertal maturation and sex specific [166]. Prior to puberty, exercise leads to increased periosteal apposition in both sexes, although weight-bearing bones could be more responsive to physical exercise in prepubertal or early pubertal boys than in girls [167]. During pubertal maturation, this specific surface effect persists in boys, whereas exercise in girls leads to endocortical contraction [166]. Basic concepts of biomechanics predict that an effect consisting primarily of an increased periosteal apposition should confer greater resistance than a response limited to the endosteal apposition rate leading essentially to a reduction in the endocortical “diameter” [157]. Skeletal Site Specificity Recent studies suggest site-specific differences in how the prepubertal skeleton develops in response to repetitive loading [168]. At some sites, such as the tibia diaphysis, loading will result in geometrical changes with larger bone and greater cortical area, whereas at sites consisting predominantly of trabecular tissue, such as the distal radius and tibia, physical activity may increase the volumetric mineral density [168]. Quantitative bone structural analysis in children and adolescents [27] will provide a clearer assessment of the actual effects of mechanical loading components, such as intensity, duration and frequency of various types of exercises on the size, geometry and mineral density of cortical and trabecular bones in children and adolescents.

Controls Jumpers Percent Change BMC 12

p < 0.01

p < 0.05

10 8 6 4 2 0

Femoral Neck

Lumbar Spine

FIGURE 9.9 Impact of increased physical activity on bone acquisition. Prepubescent children with an age range of 5.9 to 9.8 years were randomized into a jumping (25 boys and 20 girls) and a control group (26 boys and 18 girls). The jumping group performed 100 two-footed jumps off 61-cm boxes during the school day, three times a week, during 7 months, as shown by the pictorial representation on the left side of the figure. The control group performed during the same time non-impact stretching exercises. Seven months of jumping significantly improves gains in both femoral neck and lumbar spine BMC (g) as shown by the diagram on the right side of the figure. Data adapted are from Fuchs et al. [158].

PEDIATRIC BONE

202

9. PEAK BONE MASS AND ITS REGULATION

Role of Energy Intake and Muscle Mass Development In healthy subjects, the energy intake is adjusted to increased physical activity. Hence it is difficult to ascribe the additional gain in bone mass to mechanical loading alone. Indeed, nutrients such as calcium and proteins that are usually consumed in various amounts in relation to physical activity could substantially contribute to the positive effect on bone mass acquisition. The independent mechanical contribution can be measured by the differential effect observed according to the skeletal sites solicited. However, the best evidence of the distinct effect of mechanical loading from concomitant increase in nutritional intakes is provided by studies on the use of rackets, as determined by measuring the difference between loaded and unloaded arms. It has been suggested that the exercise-induced gain in bone mass, size and strength essentially results from an adaptation secondary to the increase in muscle mass and strength [169]. However, this model has been challenged by several observations demonstrating that bone growth can be dissociated from muscle development [170,171].

GeneeEnvironment Interaction in the Bone Response to Physical Activity There is evidence from several studies that suggests geneeenvironment interactions in the skeletal responses to exercise in children and young adults. The findings from a cross-sectional study in pre- and early pubertal girls revealed that PvuII polymorphism in the estrogen receptor-alpha (ER-alpha) gene may modulate the effect of exercise on aBMD at loaded sites [172]. Girls with heterozygote ER-alpha genotype (Pp) and high physical activity had higher total body, lumbar spine and femur BMC and aBMD, in addition to greater tibia cortical thickness, than their low physical activity counterparts. Interestingly, no differences were found between the groups in bone properties at the distal radius, a nonweight bearing site. Consistent with these findings, Remes et al. [173] reported that changes in lumbar spine aBMD following an exercise intervention were associated with the ER-a genotype in men who completed the exercise training. Other retrospective [174] and cross-sectional studies [175] of the VDR genotype have also reported variances in the osteogenic responses to loading in young adults. The VDR genotype was also attributed to variance in the bone metabolic response following strenuous resistance training in young adult males [176]. There is also preliminary evidence for an association between a functional polymorphism in the interleukin-6 (IL-6) gene and the response of femoral cortical bone area to 10 weeks of training in male army recruits [177]. Together, these studies provide some

evidence that genetic polymorphisms may influence an individual’s response to mechanical loading. These data are important because they open a way to study inter-individual differences in the bone response to physical activity. Furthermore, they provide new information on how the human genome can affect the relationship between mechanical loading and bone health (or vice versa). Along this line, one may also speculate on the interaction of mechanical strain and bone formation in relation to osteocyte function [178e180]. Osteocyctes are terminally differentiated osteoblasts that become embedded within the newly mineralized matrix during bone formation. Each osteocyte has long cell processes or canaliculi that connect other osteocytes and surface lining cells [181]. The density, distribution and extensive communication network of osteocytes make them particularly well structured to function as detectors of mechanical strain by sensing fluid movement within the bone canaliculi [178e180]. They can direct the formation of new bone by activating lining cells to differentiate into pre-osteoblasts. A key molecule implicated in this mechanotransduction process appears to be sclerostin, the product of the SOST gene [182e184]. Patients with sclerosteosis and high bone mass can have mutations in either the LRP5 or SOST gene [87e89,182e184]. Sclerostin can bind and antagonize LRP5 [185], a Wnt coreceptor that is required for bone formation in response to a mechanical load [186]. Mechanical loading can induce a marked reduction of sclerostin in both osteocytes and in the canaliculi network [151]. Furthermore, evidence for a key role of this molecular pathway has been reported by demonstrating that administration of sclerostin monoclonal antibodies to primates leads to dramatic increases in bone formation, trabecular thickness, radial, femoral and vertebral BMD as well as bone strength [187]. Therefore, genes coding for the LRP5-Wnt co-receptor and sclerostin are implicated in the bone anabolic response to increased mechanical strain. Polymorphisms in the SOST gene region that may modulate its expression have been shown to be associated with aBMD in elderly white subjects [188]. Thus, it will be of interest to explore in the future whether polymorphisms already observed in both LRP5 [79,91,95] and SOST [188,189] genes may be associated with variability in the bone anabolic response to mechanical loading during infancy, childhood and adolescence.

Negative Impact of Intensive Physical Exercise Impaired bone mass acquisition can occur when intensive physical activity leads to hypogonadism and low body mass [190]. Both nutritional and hormonal factors probably contribute to this impairment.

PEDIATRIC BONE

DETERMINANTS OF PEAK BONE MASS AND STRENGTH

Disordered eating in combination with high physical activity expenditure can lead to a negative energy balance and menstrual cycle disturbance [191]. Intake of energy, protein and calcium may be inadequate as athletes go on diets to maintain an idealized physique for their sport. Intensive training during childhood may contribute to a later onset and completion of puberty. Hypogonadism, as expressed by the occurrence of oligomenorrhea or amenorrhea, can lead to bone loss in females who begin training intensively after menarche [190,192]. Reduced IGF-1, presumably mainly due to low protein intake, can explain the decreased bone formation, contributing to reduce bone acquisition during adolescence and bone loss in young adulthood in combination with estrogen deprivation.

Nutritional Factors The extent to which variations in the intake of certain nutrients by healthy, apparently well-nourished children and adolescents affect bone mass accumulation, particularly at sites susceptible to osteoporotic fractures in late adulthood, has received increasing attention over the last two decades. Most studies have focused on the intake of calcium. In a tight relationship with calcium, vitamin D is also presented in this section, because of its essential role in calciumephosphate economy, although its supply does not only depend on dietary sources. Moreover, several studies have reported on the relationship between the vitamin D status and bone acquisition, and/or on the effects of vitamin D supplementation. Proteins, the intake of which is essential for adequate bone accrual, not only as brick builders but also as a stimulators of the bone tropic growth factor IGF-1, are also considered in relation to bone acquisition.

Vitamin D Vitamin D plays a pivotal role in calcium homeostasis and bone mineral mass gain during growth. Nutritional sources of vitamin D, whether ergocalciferol (vitamin D2) or cholecalciferol (vitamin D3) are limited. Oily fishes represent the main dietary supply. Nevertheless, adequate sunshine exposure through the activity of the UVB radiation provides vitamin D3, by the conversion of dehydrocholecalciferol to cholecalciferol in the skin. (See Chapter 8 for detailed discussion on vitamin D metabolism and action.) The circulating level of 25-hydroxycholecalciferol (25OHD), the enzymatic conversion product of vitamin D in the liver, is a reliable marker of vitamin D status. Serum level of 25OHD < 15 nmol/L ( < 6 ng/mL) indicates a state of severe vitamin D deficiency that leads to rickets, bone deformities and increased risk of fracture due to impaired mineralization of osteoid and

203

cartilage growth plates, and secondary hyperparathyroidism. This last anomaly can be observed in less severe vitamin D deficiency associated with reduced bone mass. Observational Studies Lower forearm and/or tibia aBMD was associated with serum 25OHD level  25e40 mol/L, concentrations found in up to 62% of healthy females aged 10e16 years and living in Finland or Ireland [177,193,194]. In other epidemiological studies, a serum level of 25OHD < 30 nmol/L was recorded during winter and spring in 30e50% and in 17e35% of non-immigrant children living in European countries located in relatively higher [195,196] and lower latitudes [197,198], respectively. In several other regions of the world, vitamin D insufficiency and/or deficiency was also documented not only in elderly but also in children and adolescents [199,200]. The important notion that vitamin D is usually very low in human milk (z20 IU, or z0.5 mg/L), and is thus far from meeting the needs (400 IU ¼ 10 mg/day) of breastfed infants, is not fully appreciated, not only in the general population, but also among heath-care providers [201]. Inadequate supplementation during the first year of life can have not only short-term severe consequences [202] but also longer-term negative effects on bone health [203]. Furthermore, as recently reported, maternal vitamin D status appears to influence tibia mineral content and size during intrauterine life, as assessed by pQCT a few days postpartum [204]. In late pubertal girls (11 to 16.9 years), adverse interactions were seen between relatively low 25OHD (40 nmol/L) and calcium intake below 600 mg/day, as expressed by a significantly reduced lumbar spine aBMD or BMC as compared to subjects with higher dietary calcium and/or vitamin D status [205]. Interventional Studies Scarce supplemental vitamin D randomized control trials (RCTs) have so far been reported in children and adolescents. In girls living in Finland with mean age 11.4 years, vitamin D supplementation of 5 (200 IU) and 10 mg/day (400 IU) during one year, increased femoral BMC by 14.3 and 17.2%, respectively [206]. Only the 10 mg dose induced a positive effect on lumbar spine BMC [206]. In another randomized placebo controlled trial in girls aged 10e17 years living in Lebanon, total hip BMC measured by DXA significantly increased at an equivalent daily dose of 2000 IU ( ¼ 50 mg) taken during one year [207]. Dietary Vitamin D Recommendations Taking into account: (i) the relatively high prevalence of low vitamin D status, particularly in winter time, which seems to have negative effects on bone

PEDIATRIC BONE

204

9. PEAK BONE MASS AND ITS REGULATION

acquisition; (ii) the limited natural dietary sources of vitamin D and adequate sunshine exposure; (iii) the positive effect of supplemental vitamin D observed in interventional trials, it is recommended that not only infants, but also children and adolescents have a minimum intake of 400 IU (10 mg) per day [202]. To meet this intake requirement, recent specific recommendations from the American Academy of Pediatrics have been made for breastfed and non-breastfed infants, children with increased risk of vitamin D deficiency, and adolescents who do not obtain 400 IU (10 mg) per day through the consumption of fortified foods [202]. In November 2010, the US Institute of Medicine (IOM) released a report on “Dietary Reference Intakes for Calcium and Vitamin D” that proposes new reference values. Regarding vitamin D, for the life stage groups from 1 to 30 years, the estimated average requirement (EAR) and the recommended dietary allowance (RDA) are set at 400 and 600 IU/day, respectively (www.iom. edu/vitamind). In European children and adolescents, based on relatively high prevalence of lower limb deformities in relation to low serum 25OHD level combined with low calcium/dairy product intake, dietary fortification or supplementation with vitamin D was also recently recommended at least during winter/spring time [208].

Calcium In most regions of the world, the supply of calcium is sufficient to avoid the occurrence of clinically manifest bone disorders during growth. Nevertheless, by securing adequate calcium intake, provided the skin and food supply of vitamin D is adequate, it is expected

that bone mass gain can be increased during infancy, childhood and adolescence and thereby optimal PBM can be achieved. The prevention of adult osteoporotic fractures is the main reason for this widespread preoccupation. Observational Studies Retrospective epidemiological data obtained in women aged 20e49 years indicated that milk consumption during childhood and adolescence can be positively correlated to bone mineral mass [209]. In some but not all observational studies carried out during childhood and adolescence, a positive correlation between dietary calcium and bone mineral mass was reported [210,211]. In our own longitudinal prospective observational study, results were analyzed by taking into account the influence of age and pubertal maturation [211]. A significant positive relationship between total calcium intake, as determined by two 5-day diaries, and bone mineral mass accrual was found in the pubertal subgroup P1, but not in the P2eP4 or P5 subgroups (Fig. 9.10). These results suggested that dietary calcium might be more important before than during pubertal maturation [211]. Interventional Studies Several calcium intervention studies have been carried out in children and adolescents. (See the following for reviews [210,213].) Overall, these studies indicated a greater bone mineral mass gain in children and adolescents receiving calcium supplementation over periods varying from 12 to 36 months (Table 9.1). Nevertheless, the response appears to vary markedly according to several factors including the skeletal sites

Yearly Z-score Gain

Lumbar spine BMC

Calcium intake (mg/day)

FIGURE 9.10 Relation between calcium intakes and changes in lumbar BMC in pre-, peri- and postpubertal female and male adolescents. Mean calcium intakes from dairy, vegetable and mineral sources were recorded in two five-day diet diaries at one year interval in 193 healthy adolescents (96 females and 97 males) aged 9e19 years. Each dot corresponds to individual change in BMC adjusted for age and gender (Z score). A positive correlation was found in prepubertal (P1), but not in either peripubertal (P2eP4) or postpubertal (P5) subjects. The methods and corresponding macronutrient intakes are described in Clavien et al. [212]. The BMC data are from Theintz et al. [33].

PEDIATRIC BONE

205

DETERMINANTS OF PEAK BONE MASS AND STRENGTH

TABLE 9.1 Calcium Intervention Trials. Annualized % Differences in aBMD or BMC Between Calcium Supplemented and Placebo Groups Triala (Calcium salt e mg/day)

Age (years)

Johnston et al. 1992 (Citrate malate e 1000)

Spontaneous Ca intake (mg/day)

Midradius aBMD/ BMC

LS aBMD/ BMC

FN aBMD/ BMC

FS aBMD/ BMC

Sex

n

Duration (months)

6e14

Twins (all) Prepubertal

90

36

900

0.8 1.7*

0.2 0.9*

0.1 0.4

NA

Lloyd et al. 1993 (Citrate malate e 350)

11e13

F

94

18

960

NA

2.0*/1.6#

NA

NA

Lee et al. 1994 (Calcium carbonate e 300)

6e8

F/M

162

18

280

1.1#

1.2

0.4

NA

Lee et al. 1995 (Calcium carbonate e 300)

6e8

F/M

84

18

565

NA/0.7b

0.6/2.7*

NA

NA

Bonjour et al. 1997 (Milk extracted Ca-Pi salt e 850)

6e9

F

144

12

900

1.7*

0.4

1.0

1.2*

Nowson et al. 1997 (Lactate gluconate e 1000)

10e17

F, twins

74

18

730

NA

1.5*

0.9

NA

Dibba et al. 2000 (Ca carbonate e 700)

8e12

F/M

160

12

340

3.9***/2.1

NA

NA

NA

Cameron et al. 2004 (Ca carbonate e 1200)

8e17

F, twins

48

24

715

NA

0.7

0.3

NA

Prentice et al. 2005 (Ca carbonate e 1000)

16e18

M

143

13

1200

0.3/0.8

1.0/2.5**

1.5*/2.4*

NA

Chevalley et al. 2005 (Milk extracted Ca-Pi salt e 850)

6e8

M

235

12

750

0.7/0.7

0.3/0.0

0.0/0.1

1.3**/1.3

Iuliano-Burns et al. 2006 (Milk minerals or Ca carbonate e 800)

5e11

F/M

99

10

800

NA

NA/0.1

NA

NA/0.2

Lambert et al. 2008 (Citrate malate e 792)

11e12

F

96

18

636

NA

2.1/4.0*

2.2*/2.3

NA

a

Analysis in Intention-to-Treat except in trials from Johnston et al., 1992, Lloyd et al., 1993, Nowson et al., 1997 and Cameron et al., 2004. P < 0.10 * P < 0.05 ** P < 0.01 *** P < 0.001. b By single photon absorptiometry. F ¼ females; M ¼ males; NA: not available; LS ¼ lumbar spine; FN ¼ femoral neck; FS ¼ femoral shaft. References: Johnston CC et al. N Engl J Med 1992;327:82e7; Lloyd T et al. J Am Med Assoc 1993;270:841e4; Lee WT et al. Am J Clin Nutr 1994;60:744e50 and Br J Nutr 1995;74:125e39; Bonjour JP et al. J Clin Invest 1997;99:1287e94; Nowson CA et al. Osteoporos Int 1997;7:219e25; Dibba B et al. Am J Clin Nutr 2000;71:544e9; Cameron MA et al. J Clin Endocrinol Metab 2004;89:4916e22; Prentice A et al. J Clin Endocrinol Metab 2005;90:3153e61; Chevalley T et al. J Clin Endocrinol Metab 2005;90:3342e9. Iuliano-Burns S et al. Osteoporos Int 2006;17:1794e800. Lambert HL et al. Am J Clin Nutr 2008;87:455e62. #

examined, the stage of pubertal maturation, the basal nutritional conditions, i.e. spontaneous calcium and protein intakes, the level of physical activity and the genetic background (Fig. 9.11). DIFFERENTIAL SKELETAL SITE RESPONSIVENESS

The benefit of supplemental calcium was usually greater in the appendicular than in the axial skeleton [210,213]. Thus, in prepubertal children, calcium supplementation is more effective on cortical appendicular bone (radial and femoral diaphysis) than on axial

trabecular rich bone (lumbar spine) or in the proximal femur [210,213]. INFLUENCE OF PUBERTAL MATURATION

In agreement with our longitudinal observation in healthy subjects aged 8 to 19 years (see Fig. 9.10), the skeleton appears to be more responsive to calcium supplementation before the onset of pubertal maturation than during the peripubertal period [210,213]. Randomized placebo-controlled trials in twins are particularly informative in this regard [214]. Indeed,

PEDIATRIC BONE

206

9. PEAK BONE MASS AND ITS REGULATION

Genetics Gender

Other Nutrients

Physical Activity

4

Gain induced by Ca Supplement

Skeletal Sites

Mean aBMD Difference (%) within Twin Pairs between Calcium Suppplemented and Placebo Groups

3

2 Spontaneous Ca Intake Vitamin D Status

Pubertal Stage 1

FIGURE 9.11

Potential factors influencing the bone response to calcium supplementation in healthy children and adolescents. As presented in Table 9.1, analysis of 12 randomized controlled trials reveals variability in aBMD or BMC response to calcium supplementation. Differences in annualized percent gains between calcium supplemented and placebo groups vary from less than 1.0% to 2.1, 2.2 and 3.9%, in lumbar spine, femoral neck and midradius, respectively. The impact of increasing calcium intake during growth appears to be better in boys than girls; in predominantly cortical than trabecular bone; before pubertal maturation; with relatively low spontaneous calcium consumption; and with increased physical activity, this factor possibly explaining the gender difference in the calcium response. Vitamin D status below a certain threshold may be expected to influence the calcium response. Interactions with some genotypes/ haplotypes, and pubertal timing have also been suggested. (See text for further details.)

the co-twin design to test the effect of calcium supplementation confers a substantial advantage in statistical power, compared with interventional studies in unrelated individuals. Co-twin studies strongly suggest that increasing calcium intake after the onset of pubertal maturation above a daily spontaneous intake of about 800e900 mg does not exert a significant positive effect on bone mineral mass acquisition (Fig. 9.12) [215,216]. This contrasts with the widespread intuitive belief that the period of pubertal maturation, with its acceleration of bone mineral mass accrual, would be the most attractive time for enhancing calcium intake well above the prepubertal requirements. As described above, efficient adaptive mechanisms secure an adequate bone mineral economy in response to the increased demand of the peripubertal growth spurt. Thanks to these adaptive processes, one can infer that the dependency on environmental mineral supply to secure bone growth demand is not necessarily much increased during the peripubertal period as compared to the years preceding the onset of sexual maturation [214]. SPONTANEOUS CALCIUM INTAKE

As intuitively expected, the benefit observed at the end of intervention is particularly substantial in children with a relatively low calcium intake [210,213]. In 8-year-old prepubertal girls with relatively low spontaneous calcium intake, increasing the calcium intake resulted in an additional gain by about 0.25 SD as

0 Prepubertal Twin Pairs

Pubertal or Postpubertal Twin Pairs

FIGURE 9.12 Influence of pubertal status on the response to calcium supplementation in a twin study. Mean percent differences in aBMD measured at several skeletal sites, including midshaft and distal radius, lumbar spine and hip, after 3 years of intervention. The average difference in aBMD within twin pairs between the calciumsupplemented and the placebo groups was significant in prepubertal twins (þ2.9%), but not in peripubertal and postpubertal twins (þ0.3%). Data adapted from Johnston et al. [215].

compared to the placebo group after one year of supplementation. In contrast, the additional gain was minimal in those girls with a relatively high calcium intake (Fig. 9.13) [217]. Therefore, below a certain threshold in the spontaneous supply, it is quite likely that increasing the calcium intake can “push upward” the individual’s bone growth trajectory and thereby positively influence the value of PBM. According to the “programming” concept, environmental stimuli during critical periods of early development can provoke long-lasting modifications in structure and function of various biological systems [218]. Interventions limited to the first period of life may modify the trajectory of bone mass accrual [219]. This concept received some support in relation to calcium economy since, as discussed above, vitamin D given in physiological doses (400 IU ¼ 10 mg/day) to female infants for an average of one year was associated with a significant increase in aBMD measured at the age of 7e9 years [203]. In this study, the aBMD difference between the vitamin D-supplemented and non-supplemented infants was most significant at the femoral neck, trochanter and radial metaphysis [203]. CALCIUM INTAKE AND PHYSICAL ACTIVITY INTERACTION

The possibility that physical activity could modulate the bone response to dietary calcium supplementation during growth has been considered in infants, children and adolescents. Overall, the results suggest an interaction: the higher the calcium intake, the more positive the

PEDIATRIC BONE

DETERMINANTS OF PEAK BONE MASS AND STRENGTH

Spontaneous Ca intake (mg/day)

<

Median 855 > Placebo Ca Suppl.

6 aBMD Gain (% per year)

*** 5 4 3 2 1 0 Total Ca Intake (mg/day±SEM)

694 1238 ±16 ±56

1175 1805 ±64 ±54

FIGURE 9.13 Influence of spontaneous calcium intake on change in aBMD in response to calcium-supplementation in prepubertal girls. Bars are means (  SEM) of aBMD change after 12 months of intervention. Average of six skeletal sites, including lumbar spine, radial diaphysis and radial metaphysis, femoral neck, femoral diaphysis and trochanter. The median spontaneous calcium intake is indicated above the bars. The total calcium intake of each group is indicated below the bars. ***P < 0.001 for the calcium supplemented (Ca Suppl.) as compared to the corresponding placebo group with spontaneous calcium intake below the median. Intention-to-Treat cohort (n ¼ 144) with mean age at baseline of 7.9 years. Data adapted from Bonjour et al. [217].

207

effect that increased physical activity exerts on bone growth. At moderately low calcium intake, the effect may not be positive. Thus, in a longitudinal study in infants 6e18 months of age, i.e. during rapid bone growth, loading of the skeleton was associated with a reduced increase in total body BMC in the presence of a moderately low calcium intake [220]. In young children aged 3e5 years, the bone response to calcium supplement was greater in children with gross than fine motor activity (Fig. 9.14) [221,222]. Furthermore, in another study in 8e9-year-old girls, greater gains in bone mass at weight-bearing skeletal sites were observed when moderate exercise was combined with calcium supplementation [223]. Likewise, in premenarcheal girls, calcium supplementation significantly enhanced the positive impact of physical activity in the femoral neck but not in the forearm [224]. Thus, the positive interaction of calcium intake and physical activity appears to be region specific. This regional specificity suggests that the effect of physical activity alone or combined with relatively high calcium supply is not merely due to an indirect influence on the energy intake, which in turn would positively affect bone mass acquisition.

FIGURE 9.14

Interaction between calcium intake and physical activity. Results from a randomized trial, enrolling 239 children aged 3e5 years, designed to test of interaction between physical exercise and calcium intake [221]. Half the children were randomized to participate in a gross motor activity program involving bone-loading exercises, 30 min per day, 5 days per week for 1 year. The other half of children were assigned to a fine motor activity program that was designed to keep them sitting quietly. On the right part, the change in leg BMC measured by DXA shows a significant interaction of exercise-by-calcium intake. The images above the bars illustrate the pQCT findings of the cross-section analyzed at 20% of distal tibia. In the left upper part is schematically illustrated the periosteal and endosteal circumference and thickness of the cortical shell (gray-shaded area) in which cortical volumetric (v)BMD can be measured by pQCT. These morphometric changes suggest that physical activity increases periosteal circumference, whereas calcium supplementation appears to decrease endosteal expansion. Data adapted from Specker and Binkley [222].

PEDIATRIC BONE

208

9. PEAK BONE MASS AND ITS REGULATION

INDIVIDUAL HETEROGENEITY IN BONE RESPONSE TO CALCIUM SUPPLEMENTATION

This notion is illustrated in two randomized doubleblind placebo-controlled trials in which the effect of calcium supplementation (850 mg/day for one year) was examined in prepubertal girls and boys (Fig. 9.15A and B) [217,225]. The greatest response in terms of gain in aBMD was observed at the femoral

Analysis of calcium intervention trials indicate that there is a marked interindividual variability in bone mineral accrual, despite recruitment of homogeneous cohorts with respect to age and pubertal maturation.

Yearly Gain in FS aBMD (mg/cm2 ±SEM)

(A)

Mean Gain

6.4%

80 70

6.3%

5.3%

Ca suppl. (+850 mg/d)

60 50

53

88

55

86

N

40

Placebo

30 20 10 0

Baseline Age (yrs) Height (cm) Weight (kg) Ca Intake (mg/d)

(B)

Yearly Gain in FS aBMD (mg/cm2)

P < 0.001 8.1%

P < 0.01

90

Girls

Boys

7.9 128

7.4 126

27 890

25 760

Individual Gain Range

180

P < 0.001

160

*** P < 0.01

140

100

Ca-suppl. (+850 mg/d)

**

120 53

88

55

86

80

+ 1.8%

+ 1.1%

60

N

Placebo 40 20 0 –20 –40

Girls

Boys

FIGURE 9.15 Gain of femoral shaft aBMD in prepubertal girls and boys: response to calcium supplementation. Data are from two randomized, placebo controlled trials [217,225]. The calcium supplement (Ca suppl.) was given during one year. All subjects remained prepubertal at the end of the intervention. Femoral shaft was the most responsive site to the calcium supplementation among the six sites examined that also included: lumbar spine, radial metaphysis and diaphysis, femoral neck and trochanter. The calcium supplementation was given as phosphate salt extracted from milk. This salt was used to enrich several foods: cakes, biscuits, fruit juices, powdered drinking chocolate or chocolate bars. It is important to underscore that the same foods were consumed by the placebo groups, so that the ingested amounts of energy, proteins, lipids, and glucides were identical in the two groups. Mid femoral shaft (FS) was measured by DXA. (A) Mean gain. The baseline characteristics are indicated under the histogram. In the placebo groups, the mean gain (  SEM) in FS aBMD was slightly greater in boys than in girls. Likewise, the response to calcium supplementation, þ1.8% as compared to þ1.1% in girls. (B) Individual gain range. In both genders, there was a wide range of FS aBMD gain. In girls, the effect of calcium supplementation was to increase the lower limit of the range without affecting the upper limit. In contrast, in boys the effect of calcium supplementation appeared to shift upward the whole range of FS aBMD gain. (See text for further details.)

PEDIATRIC BONE

DETERMINANTS OF PEAK BONE MASS AND STRENGTH

shaft. In both trials, the differences between the placebo and the calcium-supplemented group (Ca) were significant (P < 0.01) in both the intention-to-treat and the active-treatment cohorts [217,225]. In the active treatment cohort of girls (mean age at entry: 7.9 years, range 6.6e9.4), the yearly gain in femoral shaft aBMD was 54  4 and 66  3 mg/cm2 (mean  SEM, P < 0.01) in the placebo and Ca supplemented group, respectively (Fig. 9.15A) [217]. This represented a gain of 5.3% and 6.4% in the placebo and Ca supplemented groups, respectively. In the active treatment boy cohort (mean age at entry: 7.4 years, range 6.5e8.5), the yearly gain in femoral shaft aBMD was 64.3  4 and 76.3  3 mg/ cm2 (P < 0.01) in the placebo and Ca supplemented group, respectively [225]. This represented a gain of 6.3% and 8.1% in the placebo and Ca supplemented group, respectively (Fig. 9.15A). In both studies, there was a wide range of individual bone mineral mass accrual [217,225]. In girls, the yearly gains in femoral shaft aBMD ranged from 19 to þ127 mg/cm2 and from þ10 to þ122 mg/cm2 in the placebo and Ca supplemented groups, respectively [217] (see Fig. 9.15B). In boys, the yearly gains ranged from 12 to þ140 mg/cm2 and from þ2 to þ160 mg/ cm2 in the placebo and Ca supplemented groups, respectively (see Fig. 9.15B) [225]. Similar ranges of aBMD gains were recorded at the other five skeletal sites measured: radial metaphysis and diaphysis, femoral neck and trochanter, and lumbar spine. However, in neither study could the marked variability in bone mineral accrual be explained, even to a small extent, by interindividual differences in the spontaneous (baseline) dietary calcium consumed during the intervention year. Furthermore, in boys, the large variance in aBMD gains was not significantly reduced after adjustment for both physical activity and dietary protein intake [225]. GENEeENVIRONMENT INTERACTION IN RESPONSE TO DIETARY CALCIUM

As discussed above in relation to the impact of physical activity on prepuberty, compared to peri- or postpuberty, may represent an opportune time for environmental factors to modify the genetically predetermined bone growth trajectory [214]. The relatively modest effect of calcium supplementation, even at the femoral shaft, a weight-bearing cortical bone site, contrasts with the large variability in bone mass accrual observed in healthy prepubertal children. The strong influence of heritability in peak bone mass variance does not exclude the possibility that environmental factors, either mechanical or nutritional in nature, modulate the expression of genetic susceptibility to osteoporosis. Variability in the bone response to environmental factors can have several origins in relation to

209

individual genetic profiles. With regard to nutrition, food ingredients may modulate the induction or expression of genes. They can also modify, by quantitative or qualitative alterations, the activity of protein gene products and their metabolites. Nutrients may also interact with variants in the coding or promoter sequences of specific genes, thus modulating the level of expression, or the number copies or even the function of protein products. These kinds of interaction responsible for interindividual variability belong to the field termed “nutrigenetics” [226e229]. Whether some of these genetic polymorphisms may alter bone mineral accretion in response to specific nutrients with or without physical activity is a vast research domain which, to date, has received little attention. However, such an interaction has been explored in relation to calcium intake and VDR polymorphisms [230]. Geneeenvironment interactions may explain the inconsistent relationships reported between bone mineral mass and vitamin D receptor (VDR)-30 and 50 -genotypes [80e82,231,232]. Significant aBMD differences between VDR-30 BsmI genotypes (BB, Bb and bb) were detected in children [230,233], but were absent in premenopausal women with the same genetic background [231]. Moreover, the latter study found that aBMD gain in prepubertal girls increased at several skeletal sites in Bb and BB girls in response to calcium supplements. In contrast, calcium supplementation had no apparent effect in bb girls, who had a trend for greater aBMD gain than other genotypes on their usual calcium diet [230,231]. Accordingly, a model taking into account the early influence of VDR-30 polymorphisms, calcium intake and puberty on aBMD gain has been proposed to explain the relation between these genotypes and peak bone mass [230,231]. The theory that VDR-30 alleles together with environmental calcium might exert an indirect and complex influence on peak bone mass by regulating skeletal growth remains speculative [59,231]. Therefore, the possibility that calcium supplementation could be associated with a greater bone mass response in carriers of the VDR allele B needs to be investigated in prospective, calcium-dosing trials stratifying the cohort by VDR genotypes [59,230,231]. This type of investigation will require a large investment and intricate study design. OTHER UNCERTAINTIES

It has not been established whether the type of calcium salt used to supplement diets may modulate the nature of the bone response. The observation that calcium supplementation can increase bone size, at least transiently, has been observed using either milk extracted calcium phosphate or calcium carbonate salt [210,211]. It is interesting to note that an effect on bone size has been observed in response to whole milk supplementation [234]. In this type of intervention, the

PEDIATRIC BONE

210

9. PEAK BONE MASS AND ITS REGULATION

effect could be due to other nutrients, or their association with calcium, such as milk proteins. The associated increase in circulating IGF-1 supports a key role of milk proteins on bone size [234]. Another uncertainty is the question of whether gains observed by the end of the intervention are maintained or lost after discontinuation of calcium supplementation. A clear answer to this question requires long-term follow up, since sustained gain even on bone mass and size may be transient, possibly resulting from some indirect influence of calcium supplementation on the tempo of pubertal and thereby bone maturation [235,236].

(IOM) as indicated in its report released on November 2010 (www.iom.edu/calcium) (Table 9.2). For female adolescents aged 11e14 years, a similar calcium intake difference of 500 mg/day (800 vs 1300 mg/day) separates the UK from the US recommendations (Table 9.2). Such a variability in calcium intake recommendations can partly be explained by the discrepant results obtained in observational and interventional studies (see Table 9.1). As discussed above, numerous factors can modulate the bone response to calcium intake, hence, the difficulty to reach a scientifically based worldwide consensus on dietary allowance recommendation for children and adolescents.

Dietary Calcium Recommendations International and national agencies have adopted recommendations for calcium intake from infancy to the last decades of life. Decisions from these recommending bodies can be based on either calcium balance e enabling the estimations of maximal retention e or on the factorial calculation that takes into account calcium accretion for growth, and the amount needed to cover endogenous losses, adjusted for fractional absorption to determined required intake. Observational and interventional studies are also taken into consideration. The recommendations vary widely among regional agencies (Table 9.2) [237e240]. Thus, for children aged 4e10 years, the recommended daily calcium intakes can vary from 450 to 550 mg/day for the UK Reference Nutrient Intake (RNI) to 1000 mg/day for the US Institute of Medicine

Proteins Effect of Protein Intake on CalciumePhosphate Economy and Bone Metabolism Protein supply from foods is required to promote bone formation. As for any other organs of the body, amino acids are required for the synthesis of intracellular and extracellular bone proteins, and other nitrogen-containing compounds. Besides this role as “brick supplier”, proteins, through some of their amino acids, can influence calciumephosphate economy and bone metabolism. Thus, dietary proteins stimulate the formation of IGF-1 from hepatic cells, which are the main source of this circulating growth factor (Fig. 9.16).

TABLE 9.2 Dietary Calcium Reference Values for Toddlers, Children and Adolescents Country Age group (years)

A/G/S RNI

UK RNI

UK LRNI

EU PRI

French ANC

Nordic NR

USA RDA

Canadian RNI

USA/ Canadian AI

Aust/NZ RDI

1e3

600

350

200

400

600

600

700

500e550

500

700

4e6

700

450

275

400

700

600

600

800

800

7-10

900

550

325

550

700 (7e9)

700

1000 (4e8)

700 (7e9)

800 (7e8) 1300 (9e10)

900 F (8e11) 800 M (8e11)

11e14 M

1100e1200

1000

325

1000

1000 (10e12) 1200 (13e14)

900

900 (10e12) 1100 (13e15)

1300

1200 (12e15)

11e14 F

1100e1200

800

325

800

1000 (10e12) 1200 (13e14)

900

1100 (10e12) 1000 (13e15)

1300

1000 (12e15)

15e18 M

1200

1000

480

1000

1200

900

900 (16e18)

1300

1000 (16e18)

15e18 F

1200

800

450

800

1200

900

700 (16e18)

1300

800 (16e18)

1300 (9e13)

1300 (14e18)

Values are in mg per day. F ¼ females; M ¼ males. Subgroup year ranges are indicated in parenthesis. Adapted from: (a) Valeurs de re´fe´rence pour les apports nutritionnels. Socie´te´ Suisse de Nutrition 2002. (b) Departement of Health Nutrition and Bone Health: with particular reference to calcium and vitamin D. Report on Health and Social Subjects 1998; 49. (c) World Health Organization Prevention and management of osteoporosis. Report of a scientific group. WHO Technical Report Series 2003; 921. (d) Dietary Reference intakes for calcium and vitamin D. Institute of Medicine of the National Academy. Report Released November 2010. (www.iom.edu/calcium). (e) Apports Nutritonnels Conseille´s pour la Population Franc¸aise. 3rd edn. TEC & DOC. 2001. A/G/S RN ¼ Austrian-German & Swiss Reference Nutrient Intake; UK RNI ¼ UK Reference Nutrient Intake; UK LRNI ¼ UK Lower Reference Nutrient Intake; *EU PRI ¼ European Union Population Reference Intake; ANC ¼ Apports Nutrionnels Conseille´s; NR ¼ Nutrition Recommendations; RDA ¼ Recommended Dietary Allowance; RNI ¼ Recommended Nutrient Intake; AI ¼ Adequate Intake; Aust/NZ RDI ¼ Australian & New Zealand Recommended Dietary Intake; *A nutrient intake level notionally representing 2 SD below the estimated average requirement (EAR). People habitually having intakes less than the LRNI will almost certainly be deficient.

PEDIATRIC BONE

DETERMINANTS OF PEAK BONE MASS AND STRENGTH

Skin

Dietary Supply

Liver

Vit D

Vit D, Ca, Pi, Proteins IGF-I

GH

+

Bone

a.a Gut G t

Ca Pi

Ca Pi

+

TmPi

Blood IGF-I

Heredity Sex Hormones Mechanical Forces

+ 1,25D

Kidney

+

211

FIGURE 9.16 Relation between essential nutrients for bone mass accrual, insulin-like growth factor-1 (IGF-1), and calcium phosphate metabolism during growth. The hepatic production of IGF-1 is under the positive influence of growth hormone (GH) and essential amino acids (a.a.). IGF-1 exerts a direct action on bone growth. In addition, at the kidney level, IGF-1 increases both the 1,25-dihydroxyvitamin D (1,25D) conversion from 25-hydroxyvitamin D (25D) and the maximal tubular reabsorption of Pi (TmPi). By this dual renal action IGF-1 favors a positive calcium and phosphate balance as required for the increased bone mineral accrual. The effects of essential nutrients for bone growth can interact with factors such as heredity, mechanical forces, sex hormones and risk factors. (See text for further details.)

+

25D

Ca Pi

An increment in the circulating level of IGF-1 can be observed in response to increased protein intake. This effect can be observed in the absence of any difference in dietary energy supply [241,242]. As decribed above, by stimulating IGF-1, food proteins can also exert a favorable impact on bone mineral economy by a dual renal action (see Fig. 9.16). The indirect positive effect of proteins on intestinal calcium absorption, via the IGF-1-1,25(OH)2D link, is associated with a direct stimulatory effect of amino acids such as arginine and lysine on calcium translocation from the luminal to the contraluminal side of the intestinal mucosa (see below). The overall effect of increased protein intake is enhanced intestinal calcium absorption, and this accounts for the associated increased calciuria. In fact, the increased urinary calcium excretion which can be associated with a high protein diet does not result in negative skeletal calcium balance that would reflect bone loss [243]. Another effect of dietary proteins on mineral metabolism could include an inhibitory activity of L-amino acids on Ca2þ-sensing receptors (CaR), leading to a decrease in PTH secretion [244]. Furthermore, broadspectrum amino acid-sensing receptors from class 3 of the G-protein coupled receptors superfamily that also includes CaR, could be involved in the positive impact of protein on bone acquisition [245]. The stimulatory effect of arginine on the osteoblatic production of both IGF-1 and collagen synthesis [246] could be mediated by these amino acid sensing receptors [245]. Protein Intake and Bone Acquisition Both animal and human studies indicate that low protein intake per se could be particularly detrimental

to bone acquisition [242]. Malnutrition, including inadequate supplies of energy and protein during growth, can severely impair bone development [247]. An inadequate protein supply appears to play a central role in the pathogenesis of the delayed skeletal growth and reduced bone mass that is observed in undernourished children. Low protein intake could be detrimental to skeletal integrity by lowering the production of IGF-1 [248]. Variations in the production of IGF-1 could explain some of the changes in bone and calcium phosphate metabolism that have been observed in relation to dietary protein intake. Indeed, the plasma level of IGF-1 is closely related to the growth rate of the organism. In humans, circulating IGF-1 rises progressively from 1 year of age to reach peak values during puberty. As mentioned above, this factor appears to play a key role in calciumephosphate metabolism during growth. Furthermore, the positive effect of dietary proteins on bone longitudinal growth, by stimulating the proliferation and differentiation of chondrocytes in the epiphyseal plate, appears to be mediated, at least in part, by IGF-1. Likewise, the physiological link between protein intake and IGF-1 production exerts positive effects on trabecular and cortical bone formation. During growth, this nutritionaleendocrine link influences bone mass and size by increasing the external diameter of long bone, probably by enhancing the process of periosteal apposition. Therefore, during childhood and adolescence, a relative deficiency in IGF-1 or a resistance to its action due to an inadequate supply in protein [242] may result in a reduction in the skeletal longitudinal growth, and impaired width- or cross-sectional bone development.

PEDIATRIC BONE

212

9. PEAK BONE MASS AND ITS REGULATION

FN BMC

FN aBMD

0.4

Physical activity (kcal.d–-1) Protein intake (g. d–-1)

0.2 0.1 0

– 0.2 – 0.3

>

< > < >

< < > >

< < > >

< > <

P =0.006 0.6 0.5 0.4 0.3 0.2 0.1 0 – 0.1 – 0.2 – 0.3 – 0.4

Z-score ± SEM

0.3

– 0.1

–0.1 -0.1 –-0.2 –0.3 -0.3 –0.4 -0.4

FN AREA or FN Width

P =0.040

0.5

0.6 0.5 0.4 0.3 0.2 0.1 0

Z-score ± SEM

Z-score ± SEM

P =0.001

< > < > < < > >

Median

FIGURE 9.17 Influence of protein intake on the impact of increased physical activity on BMC, aBMD and AREA or width of femoral neck (FN) in prepubertal boys. Data, as expressed in Z-scores, are from 237 healthy boys, with mean age 7.4 years. They are distributed in four subgroups according to the median of both physical activity and protein intake. Increased physical activity from 168  40 to 303  54 (SD) kcal/ day was not associated with a significant increment in Z-score of FN variables, when protein intake was below the median (38.0  6.9 g/day). In contrast, increased physical activity of a similar magnitude, i.e. from 167  33 to 324  80 kcal/day was associated with a marked increment in FN variables, when protein intake was above the median (56.2  9.5 g/day). In this situation of relatively high protein intake, the greater FN Zscore associated with more sustained physical activity was þ0.66 and þ0.59 for BMC and AREA. The morphometric difference reflected a larger width of the femoral neck, since for all DXA scans the height of the region of interest parallel to the femoral axis was constant. (Adapted data from Chevalley et al. [262]. See text for further details.)

In “well-nourished” children and adolescents, the question arises whether or not variations in the protein intake within the “normal” range can influence skeletal growth and thereby modulate the influence of genetic determinants on peak bone mass attainment [6]. In the relationship between protein intake and bone mass gain, it is not surprising to find a positive correlation between these two variables [242,249,250]. Similar to calcium intake, the association appears to be particularly significant in prepubertal children [242]. These observations suggest that relatively high protein intakes could favor bone mass accrual during childhood. Positive relationships were reported between increased calcium intake from dairy foods and bone mineral acquisition during childhood and adolescence [234,251e254]. The associated increase in protein intake from dairy foods may have substantially contributed to such positive relationships. Likewise, in the often-quoted study carried out in two Yugoslav populations, the difference in young adult bone mass has usually been ascribed to calcium intake [255]. However, both protein intake and physical activity were also associated with peak bone mass [255]. The reasons why protein intake was not considered early on as an essential nutrient for calcium economy and bone health appears to stem from longterm prejudice or “belief sytems in the conduct of nutritional science” as thoughtfully analyzed by Heaney [256]. Claims against dietary proteins, particularly against those from animal food sources were mainly

based on a questionable dietary acid load hypothesis which has been refuted by several analyses or metaanalyses of experimental data [257e261]. In order to determine the quantitative relationship between protein intake and bone mass acquisition during childhood and adolescence, interventional studies testing different levels of protein intakes in otherwise isocaloric diets remain to be conducted. Furthermore, calcium requirement for optimal bone mass accrual could vary according to the level of protein intake. Thus, the possible positive interaction between protein and calcium intake deserves to be investigated in the perspective of increasing peak bone mass by modifying bone trophic nutrients. Interaction of Protein Intake and Physical Activity As already underscored, growing bones are usually more responsive to mechanical loading than adult bones. Increased physical activity was shown to increase bone mineral mass accumulation in children and adolescents. The positive impact of increased physical activity on bone acquisition might be greater before than during or after the period of pubertal maturation [6], although this pubertal maturation modulation may depend upon the skeletal site (axial vs appendicular) and/or structural (cortical vs trabecular) components examined [166]. Adequate nutritional supply can be expected to sustain the anabolic effect of mechanical loading on bone tissue as it does on skeletal muscle development.

PEDIATRIC BONE

213

CONCLUSIONS

Among nutrients, high calcium intake was shown to enhance the response to physical activity in healthy children aged 3e5 years [221]. In healthy children and adolescents aged 6e18 years, long-term protein consumption exerts a stronger impact than calcium intake on bone mass and strength acquisition [249]. That high protein intake may enhance the bone response to increased physical activity has been recently reported in 8-year-old prepubertal boys [262]. At the femoral neck level, the increased aBMD and BMC was associated with a wider external perimeter (Fig. 9.17) [262]. Such an effect on the macroarchitecture of the femoral neck would be compatible with a greater resistance to mechanical load [166,263]. Potential of Increased Protein Intake in the Management of a Genetic Bone Disorder An interesting observation has been reported regarding the effect of a specific nutritional intervention to correct a defect in skeletal development. The CoffineLowry syndrome is a rare X-linked disorder in which males show severe mental retardation associated with several skeletal defects including short stature, kyphosis and/or scoliosis [264]. The skeletal manifestations worsen over time. The genetic defect is caused by loss-of-function mutations in a gene (RPS6KA3) coding for a growth factor-regulated protein kinase hRSK2 [265]. One mechanism whereby RSK2 favors skeletal development and bone formation appears to be by phosphorylating ATF4. This transcriptional factor itself regulates osteoblast differentiation during development and favors bone formation postnatally [266]. ATF4 exerts a stimulatory effect on amino acid import in eukaryotic cells [267]. Likewise, in osteoblasts, this transcription factor stimulates the amino acid import and regulates the synthesis of type I collagen, the main constituent of the bone matrix [266]. ATF4 deficiency in mice results in delayed bone formation during embryonic development and low bone mass throughout postnatal life [266]. Interestingly, a high protein diet in ATF4 deficient mice normalizes osteoblast differentiation and collagen synthesis in bone [268]. Furthermore, both bone formation and bone mass are enhanced. These observations suggest that the severe expression of genetic defect could be alleviated by simple dietary manipulation [269]. Dietary Protein Recommendations According to several national and international agencies, the daily recommended protein allowance for children and adolescents declines slightly from age 5 (1.05 g/kg b.w.) to 17 years (0.80 g/kg b.w.) [270e273]. In sharp contrast to a recommended amount of approximately 0.9e1.0 kg/b.w. per day for children aged 7e12 years, surveys made from several countries

in Europe, as well as in North America and Australia have recorded much higher daily protein intake of about 1.9e2.0 g/kg b.w. [24,212,249,250,262,273,274]. It has been underscored that the literature is essentially void of studies specifically directed at quantifying protein needs of healthy children between 7 and 12 years of age [275]. Current recommendations for protein intake in children remain speculative, since they correspond to estimates derived from interpolation of very shortterm nitrogen balance studies carried out in infants and young adults [272,275,276]. As described above in prepubertal boys aged 7.4 years (see Fig. 9.17), increased physical activity from about 170 to 315 Kcal/day in the presence of a spontaneous protein intake of z2.0 instead of 1.5 g/kg b.w. per day was associated with higher mean BMC at six skeletal sites of þ 0.64 vs þ 0.15 Z-score. This difference of z0.5 Z-score could well be expressed by a substantial shift of the BMC trajectory, resulting in a higher PBM and possibly in a reduction of fragility fractures in adulthood [15]. Likewise, such an upward shift in bone mass acquisition could also reduce the incidence of fractures during growth [46,147].

CONCLUSIONS Bone mass and strength achieved at the end of the growth period, simply designated as “peak bone mass (PBM)”, play an essential role in the risk of osteoporotic fractures occurring in adulthood. It is considered that an increase of PBM by 1 standard deviation would reduce the fracture risk by 50%. As estimated from twin studies, genetics is the major determinant of PBM, accounting for about 60e80% of its variance. Numerous polymorphisms of “candidate” genes have been found to be associated with the areal bone mineral density (aBMD), so far the most convenient measurable surrogate of bone mass and strength. The studied genes code for molecules implicated in bone function and structure such as circulating endocrine factors, hormone receptors, local regulators of bone modeling and remodeling or matrix molecules. None of these genes appears to account for more than a few percent of PBM variance. Before puberty, there is no substantial gender difference in aBMD when adjusted for age, nutritional factors and physical activity. During pubertal maturation, the size of the bone increases whereas the volumetric bone mineral density remains constant in both genders. At the end of puberty, the sex difference is essentially due to a greater bone size in male than female subjects. This is achieved by larger periosteal deposition in boys, thus conferring at PBM a better resistance to mechanical forces in men than in women. Sex hormones and the IGF-1 system are implicated in the bone sexual dimorphism occurring

PEDIATRIC BONE

214

9. PEAK BONE MASS AND ITS REGULATION

during pubertal maturation. The genetically determined trajectory of bone mass development can be modulated to a certain extent by modifiable environmental factors. Interventions aimed at increasing the physical activity of children have been shown to exert a positive impact on cortical bones of the weight-bearing appendicular skeleton. Likewise, interventional studies using either calcium salt or milk supplementation have documented an increased bone mass gain, particularly at weightbearing cortical bones. Some studies suggest a positive interaction between calcium supplementation and increased physical activity on bone development. In healthy prepubertal boys, the impact of increased physical activity affecting bone acquisition is enhanced by protein intake within limits above the usual recommended allowance. Prepuberty appears to be an opportune time to modify environmental factors that impinge on bone mineral mass acquisition and eventually peak bone mass and strength.

References [1] Block JE, Genant HK, Black D. Greater vertebral bone mineral mass in exercising young men. West J Med 1986;145:39e42. [2] de Deuxchaisnes CN, Devogelaer JP, Esselinckx W, et al. The effect of low dosage glucocorticoids on bone mass in rheumatoid arthritis: a cross-sectional and a longitudinal study using single photon absorptiometry. Adv Exp Med Biol 1984;171: 209e39. [3] Crosby LO, Kaplan FS, Pertschuk MJ, Mullen JL. The effect of anorexia nervosa on bone morphometry in young women. Clin Orthop Relat Res 1985;201:271e7. [4] Davis JW, Grove JS, Ross PD, Vogel JM, Wasnich RD. Relationship between bone mass and rates of bone change at appendicular measurement sites. J Bone Miner Res 1992;7:719e25. [5] Buchs B, Rizzoli R, Slosman D, Nydegger V, Bonjour JP. Densite´ mine´rale osseuse de la colonne lombaire, du col et de la diaphyse fe´moraux d’un e´chantillon de la population genevoise. Schweiz Med Wochenschr 1992;122:1129e36. [6] Bonjour JP, Chevalley T, Rizzoli R, Ferrari S. Gene-environment interactions in the skeletal response to nutrition and exercise during growth. Med Sport Sci 2007;51:64e80. [7] Melton 3rd LJ, Atkinson EJ, O’Connor MK, O’Fallon WM, Riggs BL. Determinants of bone loss from the femoral neck in women of different ages. J Bone Miner Res 2000;15:24e31. [8] Melton 3rd LJ, Atkinson EJ, Khosla S, Oberg AL, Riggs BL. Evaluation of a prediction model for long-term fracture risk. J Bone Miner Res 2005;20:551e6. [9] Hernandez CJ, Beaupre GS, Carter DR. A theoretical analysis of the relative influences of peak BMD, age-related bone loss and menopause on the development of osteoporosis. Osteoporos Int 2003;14:843e7. [10] World Health Organization. Assessment of fracture risk and its application to screening for postmenopausal osteoporosis. Report of a WHO study group. WHO Technical Report Series. 1994;No 843. [11] Duan Y, Seeman E, Turner CH. The biomechanical basis of vertebral body fragility in men and women. J Bone Miner Res 2001;16:2276e83.

[12] Duan Y, Wang XF, Evans A, Seeman E. Structural and biomechanical basis of racial and sex differences in vertebral fragility in Chinese and Caucasians. Bone 2005;36:987e98. [13] Cummings SR, Black DM, Nevitt MC, et al. Bone density at various sites for prediction of hip fractures. The Study of Osteoporotic Fractures Research Group. Lancet 1993;341:72e5. [14] Melton 3rd LJ, Atkinson EJ, O’Fallon WM, Wahner HW, Riggs BL. Long-term fracture prediction by bone mineral assessed at different skeletal sites. J Bone Miner Res 1993;8:1227e33. [15] Marshall D, Johnell O, Wedel H. Meta-analysis of how well measures of bone mineral density predict occurrence of osteoporotic fractures. Br Med J 1996;312:1254e9. [16] Adams JE, Shaw N. A Practical Guide to Bone Densitometry in Children. National Osteoporosis Society, Camerton, Bath, UK; 2004. [17] Baim S, Leonard MB, Bianchi ML, et al. Official Positions of the International Society for Clinical Densitometry and executive summary of the 2007 ISCD Pediatric Position Development Conference. J Clin Densitom 2008;11:6e21. [18] Boutroy S, Bouxsein ML, Munoz F, Delmas PD. In vivo assessment of trabecular bone microarchitecture by high-resolution peripheral quantitative computed tomography. J Clin Endocrinol Metab 2005;90:6508e15. [19] Sornay-Rendu E, Boutroy S, Munoz F, Delmas PD. Alterations of cortical and trabecular architecture are associated with fractures in postmenopausal women, partially independent of decreased BMD measured by DXA: the OFELY study. J Bone Miner Res 2007;22:425e33. [20] Boutroy S, Van Rietbergen B, Sornay-Rendu E, Munoz F, Bouxsein ML, Delmas PD. Finite element analysis based on in vivo HR-pQCT images of the distal radius is associated with wrist fracture in postmenopausal women. J Bone Miner Res 2008;23:392e9. [21] Chevalley T, Bonjour JP, Ferrari S, Rizzoli R. Influence of age at menarche on forearm bone microstructure in healthy young women. J Clin Endocrinol Metab 2008;93:2594e601. [22] Chevalley T, Bonjour JP, Ferrari S, Rizzoli R. Deleterious effect of late menarche on distal tibia microstructure in healthy 20-yearold and premenopausal middle-aged women. J Bone Miner Res 2009;24:144e52. [23] Kirmani S, Christen D, van Lenthe GH, et al. Bone structure at the distal radius during adolescent growth. J Bone Miner Res 2009;24:1033e42. [24] Bacchetta J, Boutroy S, Vilayphiou N, et al. Early impairment of trabecular microarchitecture assessed with HR-pQCT in patients with stage IIeIV chronic kidney disease. J Bone Miner Res 2010;25:849e57. [25] Burghardt AJ, Issever AS, Schwartz AV, et al. High-resolution peripheral quantitative computed tomographic imaging of cortical and trabecular bone microarchitecture in patients with type 2 diabetes mellitus. J Clin Endocrinol Metab 2010;95: 5045e55. [26] Briot K, Roux C. What is the role of DXA, QUS and bone markers in fracture prediction, treatment allocation and monitoring? Best Pract Res Clin Rheumatol 2005;19:951e64. [27] Specker BL, Schoenau E. Quantitative bone analysis in children: current methods and recommendations. J Pediatr 2005;146: 726e31. [28] Binkley TL, Berry R, Specker BL. Methods for measurement of pediatric bone. Rev Endocr Metab Disord 2008;9:95e106. [29] Bonjour JP, Theintz G, Buchs B, Slosman D, Rizzoli R. Critical years and stages of puberty for spinal and femoral bone mass accumulation during adolescence. J Clin Endocrinol Metab 1991;73:555e63.

PEDIATRIC BONE

REFERENCES

[30] Bonjour JP, Theintz G, Law F, Slosman D, Rizzoli R. Peak bone mass. Osteoporos Int 1994;4(Suppl. 1):7e13. [31] Rizzoli R, Bonjour JP. Determinants of peak bone mass and mechanisms of bone loss. Osteoporos Int 1999;9(Suppl. 2): S17e23. [32] Gilsanz V, Roe TF, Mora S, Costin G, Goodman WG. Changes in vertebral bone density in black girls and white girls during childhood and puberty. N Engl J Med 1991;325:1597e600. [33] Theintz G, Buchs B, Rizzoli R, et al. Longitudinal monitoring of bone mass accumulation in healthy adolescents: evidence for a marked reduction after 16 years of age at the levels of lumbar spine and femoral neck in female subjects. J Clin Endocrinol Metab 1992;75:1060e5. [34] Ferrari S, Rizzoli R, Slosman D, Bonjour JP. Familial resemblance for bone mineral mass is expressed before puberty. J Clin Endocrinol Metab 1998;83:358e61. [35] Gilsanz V, Skaggs DL, Kovanlikaya A, et al. Differential effect of race on the axial and appendicular skeletons of children. J Clin Endocrinol Metab 1998;83:1420e7. [36] Seeman E. Pathogenesis of bone fragility in women and men. Lancet 2002;359:1841e50. [37] Garn SM. The earlier gain and later loss of cortical bone. In: nutritional perspective: Charles C Thomas, Springfield IL; 1970. p 3e120. [38] Aharinejad S, Bertagnoli R, Wicke K, Firbas W, Schneider B. Morphometric analysis of vertebrae and intervertebral discs as a basis of disc replacement. Am J Anat 1990;189:69e76. [39] Fournier PE, Rizzoli R, Slosman DO, Buchs B, Bonjour JP. Relative contribution of vertebral body and posterior arch in female and male lumbar spine peak bone mass. Osteoporos Int 1994;4:264e72. [40] Gilsanz V, Loro ML, Roe TF, Sayre J, Gilsanz R, Schulz EE. Vertebral size in elderly women with osteoporosis. Mechanical implications and relationship to fractures. J Clin Invest 1995;95:2332e7. [41] Naganathan V, Sambrook P. Gender differences in volumetric bone density: a study of opposite-sex twins. Osteoporos Int 2003;14:564e9. [42] Fournier PE, Rizzoli R, Slosman DO, Theintz G, Bonjour JP. Asynchrony between the rates of standing height gain and bone mass accumulation during puberty. Osteoporos Int 1997;7: 525e32. [43] Bailey DA, Wedge JH, McCulloch RG, Martin AD, Bernhardson SC. Epidemiology of fractures of the distal end of the radius in children as associated with growth. J Bone Joint Surg Am 1989;71:1225e31. [44] Landin LA. Fracture patterns in children. Analysis of 8,682 fractures with special reference to incidence, etiology and secular changes in a Swedish urban population 1950e1979. Acta Orthop Scand Suppl 1983;202:1e109. [45] Parfitt AM. The two faces of growth: benefits and risks to bone integrity. Osteoporos Int 1994;4:382e98. [46] Ferrari SL, Chevalley T, Bonjour JP, Rizzoli R. Childhood fractures are associated with decreased bone mass gain during puberty: an early marker of persistent bone fragility? J Bone Miner Res 2006;21:501e7. [47] Bonjour JP, Chevalley T. Pubertal timing, peak bone mass and fragility fracture risk. BoneKey-Osteovision 2007;4:30e48. http:// www.bonekey-ibms.org/cgi/content/full/ibmske 4/2/30. [48] Gilsanz V, Gibbens DT, Roe TF, et al. Vertebral bone density in children: effect of puberty. Radiology 1988;166:847e50. [49] Szulc P, Seeman E, Delmas PD. Biochemical measurements of bone turnover in children and adolescents. Osteoporos Int 2000;11:281e94.

215

[50] Rauch F, Georg M, Stabrey A, et al. Collagen markers deoxypyridinoline and hydroxylysine glycosides: pediatric reference data and use for growth prediction in growth hormone-deficient children. Clin Chem 2002;48:315e22. [51] Yang L, Grey V. Pediatric reference intervals for bone markers. Clin Biochem 2006;39:561e8. [52] Jurimae J. Interpretation and application of bone turnover markers in children and adolescents. Curr Opin Pediatr 2010;22:494e500. [53] Jurimae J, Maestu J, Jurimae T. Bone turnover markers during pubertal development: relationships with growth factors and adipocytokines. Med Sport Sci 2010;55:114e27. [54] Cadogan J, Blumsohn A, Barker ME, Eastell R. A longitudinal study of bone gain in pubertal girls: anthropometric and biochemical correlates. J Bone Miner Res 1998;13(10):1602e12. [55] Seeman E, Hopper JL, Bach LA, et al. Reduced bone mass in daughters of women with osteoporosis. N Engl J Med 1989;320:554e8. [56] Soroko SB, Barrett-Connor E, Edelstein SL, Kritz-Silverstein D. Family history of osteoporosis and bone mineral density at the axial skeleton: the Rancho Bernardo Study. J Bone Miner Res 1994;9:761e9. [57] Barthe N, Basse-Cathalinat B, Meunier PJ, et al. Measurement of bone mineral density in mother-daughter pairs for evaluating the family influence on bone mass acquisition: a GRIO survey. Osteoporos Int 1998;8:379e84. [58] Cohen-Solal ME, Baudoin C, Omouri M, Kuntz D, De Vernejoul MC. Bone mass in middle-aged osteoporotic men and their relatives: familial effect. J Bone Miner Res 1998;13:1909e14. [59] Eisman JA. Genetics of osteoporosis. Endocr Rev 1999;20(6):788e804. [60] Peacock M, Turner CH, Econs MJ, Foroud T. Genetics of osteoporosis. Endocr Rev 2002;23:303e26. [61] Pocock NA, Eisman JA, Hopper JL, Yeates MG, Sambrook PN, Eberl S. Genetic determinants of bone mass in adults. A twin study. J Clin Invest 1987;80:706e10. [62] Johnson ML, Gong G, Kimberling W, Recker SM, Kimmel DB, Recker RB. Linkage of a gene causing high bone mass to human chromosome 11 (11q12-13). Am J Hum Genet 1997;60:1326e32. [63] Devoto M, Shimoya K, Caminis J, et al. First-stage autosomal genome screen in extended pedigrees suggests genes predisposing to low bone mineral density on chromosomes 1p, 2p and 4q. Eur J Hum Genet 1998;6:151e7. [64] Deng HW, Shen H, Xu FH, et al. Several genomic regions potentially containing QTLs for bone size variation were identified in a whole-genome linkage scan. Am J Med Genet A 2003;119:121e31. [65] Koller DL, Rodriguez LA, Christian JC, et al. Linkage of a QTL contributing to normal variation in bone mineral density to chromosome 11q12-13. J Bone Miner Res 1998;13:1903e8. [66] Koller DL, Econs MJ, Morin PA, et al. Genome screen for QTLs contributing to normal variation in bone mineral density and osteoporosis. J Clin Endocrinol Metab 2000;85:3116e20. [67] Karasik D, Myers RH, Cupples LA, et al. Genome screen for quantitative trait loci contributing to normal variation in bone mineral density: the Framingham Study. J Bone Miner Res 2002;17:1718e27. [68] Koller DL, Liu G, Econs MJ, et al. Genome screen for quantitative trait loci underlying normal variation in femoral structure. J Bone Miner Res 2001;16:985e91. [69] Carn G, Koller DL, Peacock M, et al. Sibling pair linkage and association studies between peak bone mineral density and the gene locus for the osteoclast-specific subunit (OC116) of the vacuolar proton pump on chromosome 11p12-13. J Clin Endocrinol Metab 2002;87:3819e24.

PEDIATRIC BONE

216

9. PEAK BONE MASS AND ITS REGULATION

[70] Langdahl BL, Ralston SH, Grant SF, Eriksen EF. An Sp1 binding site polymorphism in the COLIA1 gene predicts osteoporotic fractures in both men and women. J Bone Miner Res 1998;13:1384e9. [71] Mann V, Hobson EE, Li B, et al. A COL1A1 Sp1 binding site polymorphism predisposes to osteoporotic fracture by affecting bone density and quality. J Clin Invest 2001;107:899e907. [72] Ioannidis JP, Stavrou I, Trikalinos TA, et al. Association of polymorphisms of the estrogen receptor alpha gene with bone mineral density and fracture risk in women: a meta-analysis. J Bone Miner Res 2002;17:2048e60. [73] Garnero P, Munoz F, Borel O, Sornay-Rendu E, Delmas PD. Vitamin D receptor gene polymorphisms are associated with the risk of fractures in postmenopausal women, independently of bone mineral density. J Clin Endocrinol Metab 2005;90:4829e35. [74] Cummings SR, Nevitt MC. Non-skeletal determinants of fractures: the potential importance of the mechanics of falls. Study of Osteoporotic Fractures Research Group. Osteoporos Int 1994;4(Suppl. 1):67e70. [75] Cummings SR. Treatable and untreatable risk factors for hip fracture. Bone 1996;18(Suppl):165Se7S. [76] Schwartz A, Capezuti E, Grisso JA. Risk factors for falls as a cause of hip fracture in women. In: Marcus R, Feldman D, Kelsey J, editors. Osteoporosis. San Diego: Academic Press; 2001. p. 795e808. [77] Rizzoli R, Bonjour JP, Ferrari SL. Osteoporosis, genetics and hormones. J Mol Endocrinol 2001;26:79e94. [78] Liu YZ, Liu YJ, Recker RR, Deng HW. Molecular studies of identification of genes for osteoporosis: the 2002 update. J Endocrinol 2003;177:147e96. [79] Ferrari SL, Deutsch S, Baudoin C, et al. LRP5 gene polymorphisms and idiopathic osteoporosis in men. Bone 2005;37: 770e5. [80] Thakkinstian A, D’Este C, Attia J. Haplotype analysis of VDR gene polymorphisms: a meta-analysis. Osteoporos Int 2004;15: 729e34. [81] Thakkinstian A, D’Este C, Eisman J, Nguyen T, Attia J. Metaanalysis of molecular association studies: vitamin D receptor gene polymorphisms and BMD as a case study. J Bone Miner Res 2004;19:419e28. [82] Ferrari SL. Osteoporosis: a complex disorder of aging with multiple genetic and environmental determinants. World Rev Nutr Diet 2005;95:35e51. [83] Hey PJ, Twells RC, Phillips MS, et al. Cloning of a novel member of the low-density lipoprotein receptor family. Gene 1998;216:103e11. [84] Gong Y, Slee RB, Fukai N, et al. LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development. Cell 2001;107:513e23. [85] Ai M, Heeger S, Bartels CF, Schelling DK. Clinical and molecular findings in osteoporosis-pseudoglioma syndrome. Am J Hum Genet 2005;77:741e53. [86] Kato M, Patel MS, Levasseur R, et al. Cbfa1-independent decrease in osteoblast proliferation, osteopenia, and persistent embryonic eye vascularization in mice deficient in Lrp5, a Wnt coreceptor. J Cell Biol 2002;157:303e14. [87] Boyden LM, Mao J, Belsky J, et al. High bone density due to a mutation in LDL-receptor-related protein 5. N Engl J Med 2002;346:1513e21. [88] Little RD, Carulli JP, Del Mastro RG, et al. A mutation in the LDL receptor-related protein 5 gene results in the autosomal dominant high-bone-mass trait. Am J Hum Genet 2002;70:11e9. [89] Van Wesenbeeck L, Cleiren E, Gram J, et al. Six novel missense mutations in the LDL receptor-related protein 5 (LRP5) gene in

[90]

[91]

[92]

[93]

[94]

[95]

[96]

[97]

[98]

[99]

[100]

[101] [102]

[103]

[104]

[105] [106]

[107]

[108]

different conditions with an increased bone density. Am J Hum Genet 2003;72:763e71. Livshits G, Trofimov S, Malkin I, Kobyliansky E. Transmission disequilibrium test for hand bone mineral density and 11q12-13 chromosomal segment. Osteoporos Int 2002;13:461e7. Ferrari SL, Deutsch S, Choudhury U, et al. Polymorphisms in the low-density lipoprotein receptor-related protein 5 (LRP5) gene are associated with variation in vertebral bone mass, vertebral bone size, and stature in whites. Am J Hum Genet 2004;74:866e75. Perola M, Ohman M, Hiekkalinna T, et al. Quantitative-traitlocus analysis of body-mass index and of stature, by combined analysis of genome scans of five Finnish study groups. Am J Hum Genet 2001;69:117e23. Hirschhorn JN, Lindgren CM, Daly MJ, et al. Genomewide linkage analysis of stature in multiple populations reveals several regions with evidence of linkage to adult height. Am J Hum Genet 2001;69:106e16. Van Pottelbergh I, Goemaere S, Zmierczak H, De Bacquer D, Kaufman JM. Deficient acquisition of bone during maturation underlies idiopathic osteoporosis in men: evidence from a threegeneration family study. J Bone Miner Res 2003;18:303e11. van Meurs JB, Rivadeneira F, Jhamai M, et al. Common genetic variation of the low-density lipoprotein receptor-related protein 5 and 6 genes determines fracture risk in elderly white men. J Bone Miner Res 2006;21:141e50. Richards JB, Kavvoura FK, Rivadeneira F, et al. Collaborative meta-analysis: associations of 150 candidate genes with osteoporosis and osteoporotic fracture. Ann Intern Med 2009;151: 528e37. Rivadeneira F, Styrkarsdottir U, Estrada K, et al. Twenty bonemineral-density loci identified by large-scale meta-analysis of genome-wide association studies. Nat Genet 2009;41:1199e206. Dequeker J, Nijs J, Verstraeten A, Geusens P, Gevers G. Genetic determinants of bone mineral content at the spine and radius: a twin study. Bone 1987;8:207e9. Slemenda CW, Turner CH, Peacock M, et al. The genetics of proximal femur geometry, distribution of bone mass and bone mineral density. Osteoporos Int 1996;6:178e82. Eisman J. Is the genomics glass half empty or completely empty? BoneKey IBMS 2010:27e31. http://www.bonekey-ibms. org/cgi/content/full/ibmske 7/1/27. Ferrari S. Human genetics of osteoporosis. Best Pract Res Clin Endocrinol Metab 2008;22:723e35. Riggs BL, Khosla S, Melton 3rd LJ. Sex steroids and the construction and conservation of the adult skeleton. Endocr Rev 2002;23:279e302. Vanderschueren D, Vandenput L, Boonen S. Reversing sex steroid deficiency and optimizing skeletal development in the adolescent with gonadal failure. Endocr Dev 2005;8:150e65. Bonjour JP, Rizzoli R. Bone acquisition in adolescence. In: Marcus R, Feldman D, Kelsey J, editors. Osteoporosis. San Diego: Academic Press; 2001. p. 621e38. Niu T, Rosen CJ. The insulin-like growth factor-I gene and osteoporosis: a critical appraisal. Gene 2005;361:38e56. Vanderschueren D, Vandenput L, Boonen S, Lindberg MK, Bouillon R, Ohlsson C. Androgens and bone. Endocr Rev 2004;25:389e425. Abu EO, Horner A, Kusec V, Triffitt JT, Compston JE. The localization of androgen receptors in human bone. J Clin Endocrinol Metab 1997;82:3493e7. Nilsson O, Chrysis D, Pajulo O, et al. Localization of estrogen receptors-alpha and -beta and androgen receptor in the human growth plate at different pubertal stages. J Endocrinol 2003;177: 319e26.

PEDIATRIC BONE

REFERENCES

[109] Marcus R, Leary D, Schneider DL, Shane E, Favus M, Quigley CA. The contribution of testosterone to skeletal development and maintenance: lessons from the androgen insensitivity syndrome. J Clin Endocrinol Metab 2000;85:1032e7. [110] Migliaccio S, Newbold RR, Bullock BC, et al. Alterations of maternal estrogen levels during gestation affect the skeleton of female offspring. Endocrinology 1996;137:2118e25. [111] Yakar S, Rosen CJ. From mouse to man: redefining the role of insulin-like growth factor-I in the acquisition of bone mass. Exp Biol Med (Maywood) 2003;228:245e52. [112] Condamine L, Menaa C, Vrtovsnik F, Friedlander G, Garabedian M. Local action of phosphate depletion and insulinlike growth factor 1 on in vitro production of 1,25-dihydroxyvitamin D by cultured mammalian kidney cells. J Clin Invest 1994;94:1673e9. [113] Menaa C, Vrtovsnik F, Friedlander G, Corvol M, Garabedian M. Insulin-like growth factor I, a unique calcium-dependent stimulator of 1,25-dihydroxyvitamin D3 production. Studies in cultured mouse kidney cells. J Biol Chem 1995;270:25461e7. [114] Palmer G, Bonjour JP, Caverzasio J. Stimulation of inorganic phosphate transport by insulin-like growth factor I and vanadate in opossum kidney cells is mediated by distinct protein tyrosine phosphorylation processes. Endocrinology 1996;137: 4699e705. [115] Caverzasio J, Montessuit C, Bonjour JP. Stimulatory effect of insulin-like growth factor-1 on renal Pi transport and plasma 1,25-dihydroxyvitamin D3. Endocrinology 1990;127:453e9. [116] Spelsberg TC, Subramaniam M, Riggs BL, Khosla S. The actions and interactions of sex steroids and growth factors/cytokines on the skeleton. Mol Endocrinol 1999;13:819e28. [117] Montessuit C, Bonjour JP, Caverzasio J. Pi transport regulation by chicken growth plate chondrocytes. Am J Physiol 1994;267:E24e31. [118] Montessuit C, Caverzasio J, Bonjour JP. Characterization of a Pi transport system in cartilage matrix vesicles. Potential role in the calcification process. J Biol Chem 1991;266:17791e7. [119] Palmer G, Zhao J, Bonjour J, Hofstetter W, Caverzasio J. In vivo expression of transcripts encoding the Glvr-1 phosphate transporter/retrovirus receptor during bone development. Bone 1999;24:1e7. [120] Caverzasio J, Bonjour JP. Characteristics and regulation of Pi transport in osteogenic cells for bone metabolism. Kidney Int 1996;49:975e80. [121] Palmer G, Bonjour JP, Caverzasio J. Expression of a newly identified phosphate transporter/retrovirus receptor in human SaOS-2 osteoblast-like cells and its regulation by insulin-like growth factor I. Endocrinology 1997;138:5202e9. [122] Ducharme JR, Forest MG. Normal pubertal development. In: Betrand J, Rappaport R, Sizonenko PC, editors. Pediatric Endocrinology Physiology, Pathophysiology, and Clinical Aspects. Baltimore: Williams & Wilkins; 1993. p. 372e86. [123] Parent AS, Teilmann G, Juul A, Skakkebaek NE, Toppari J, Bourguignon JP. The timing of normal puberty and the age limits of sexual precocity: variations around the world, secular trends, and changes after migration. Endocr Rev 2003;24: 668e93. [124] Tanner JM. Growth at Adolescence. 2nd ed. Oxford, UK: Blackwell; 1962. [125] Johnell O, Gullberg B, Kanis JA, et al. Risk factors for hip fracture in European women: the MEDOS Study. Mediterranean Osteoporosis Study. J Bone Miner Res 1995;10:1802e15. [126] Melton 3rd LJ. Epidemiology of spinal osteoporosis. Spine 1997;22(Suppl):2Se11S.

217

[127] Silman AJ. Risk factors for Colles’ fracture in men and women: results from the European Prospective Osteoporosis Study. Osteoporos Int 2003;14:213e8. [128] Paganini-Hill A, Atchison KA, Gornbein JA, Nattiv A, Service SK, White SC. Menstrual and reproductive factors and fracture risk: the Leisure World Cohort Study. J Womens Health (Larchmt) 2005;14:808e19. [129] Ribot C, Pouilles JM, Bonneu M, Tremollieres F. Assessment of the risk of post-menopausal osteoporosis using clinical factors. Clin Endocrinol (Oxf) 1992;36:225e8. [130] Fox KM, Magaziner J, Sherwin R, et al. Reproductive correlates of bone mass in elderly women. Study of Osteoporotic Fractures Research Group. J Bone Miner Res 1993;8:901e8. [131] Tuppurainen M, Kroger H, Saarikoski S, Honkanen R, Alhava E. The effect of gynecological risk factors on lumbar and femoral bone mineral density in peri- and postmenopausal women. Maturitas 1995;21:137e45. [132] Varenna M, Binelli L, Zucchi F, Ghiringhelli D, Gallazzi M, Sinigaglia L. Prevalence of osteoporosis by educational level in a cohort of postmenopausal women. Osteoporos Int 1999;9: 236e41. [133] Rosenthal DI, Mayo-Smith W, Hayes CW, et al. Age and bone mass in premenopausal women. J Bone Miner Res 1989;4:533e8. [134] Ito M, Yamada M, Hayashi K, Ohki M, Uetani M, Nakamura T. Relation of early menarche to high bone mineral density. Calcif Tissue Int 1995;57:11e4. [135] Fujita Y, Katsumata K, Unno A, Tawa T, Tokita A. Factors affecting peak bone density in Japanese women. Calcif Tissue Int 1999;64:107e11. [136] Chevalley T, Bonjour JP, Ferrari S, Rizzoli R. The influence of pubertal timing on bone mass acquisition: a predetermined trajectory detectable five years before menarche. J Clin Endocrinol Metab 2009;94:3424e31. [137] Armamento-Villareal R, Villareal DT, Avioli LV, Civitelli R. Estrogen status and heredity are major determinants of premenopausal bone mass. J Clin Invest 1992;90:2464e71. [138] Nguyen TV, Jones G, Sambrook PN, White CP, Kelly PJ, Eisman JA. Effects of estrogen exposure and reproductive factors on bone mineral density and osteoporotic fractures. J Clin Endocrinol Metab 1995;80:2709e14. [139] Galuska DA, Sowers MR. Menstrual history and bone density in young women. J Womens Health Gend Based Med 1999;8: 647e56. [140] Petri E. Untersuchungen zur Erbbedingheit der Menarche. Z Morphol Anthropol 1935;33:43e8. [141] Kaprio J, Rimpela A, Winter T, Viken RJ, Rimpela M, Rose RJ. Common genetic influences on BMI and age at menarche. Hum Biol 1995;67:739e53. [142] Salces I, Rebato EM, Susanne C, San Martin L, Rosique J. Familial resemblance for the age at menarche in Basque population. Ann Hum Biol 2001;28:143e56. [143] Gajdos ZK, Butler JL, Henderson KD, et al. Association studies of common variants in 10 hypogonadotropic hypogonadism genes with age at menarche. J Clin Endocrinol Metab 2008;93: 4290e8. [144] Seminara SB. Lack of association of hypogonadotropic genes with age at menarche: prospects for the future. J Clin Endocrinol Metab 2008;93:4224e5. [145] Ralston SH, Uitterlinden AG. Genetics of osteoporosis. Endocr Rev 2010;31:629e62. [146] Johnell O, Kanis JA, Oden A, et al. Predictive value of BMD for hip and other fractures. J Bone Miner Res 2005;20:1185e94. [147] Kindblom JM, Lorentzon M, Norjavaara E, et al. Pubertal timing predicts previous fractures and BMD in young adult men: the GOOD study. J Bone Miner Res 2006;21:790e5.

PEDIATRIC BONE

218

9. PEAK BONE MASS AND ITS REGULATION

[148] Ferrari S, Chevalley T, Van Rietbergen B, Bonjour J-P, Rizzoli R. Reduced bone strength in young adult women with clinical fractures during childhood and adolescence. J Bone Miner Res 2010;25(Suppl. 1):S40. [149] Chevalley T, Bonjour J-P, Van Rietbergen B, Ferrari S, Rizzoli R. Fractures in healthy adolescent boys are associated with reduced bone strength as assessed by finite element analysis at weightbearing skeletal sites. J Bone Miner Res 2010;25(Suppl. 1):S64e5. [150] Robling AG, Castillo AB, Turner CH. Biomechanical and molecular regulation of bone remodeling. Annu Rev Biomed Eng 2006;8:455e98. [151] Robling AG, Bellido TM, Turner CH. Mechanical loading reduced osteocyte expression of sclerostin protein. J Bone Miner Res 2006;21(Suppl. 1):S72. [152] Bass SL, Saxon L, Daly RM, et al. The effect of mechanical loading on the size and shape of bone in pre-, peri-, and postpubertal girls: a study in tennis players. J Bone Miner Res 2002;17:2274e80. [153] Karlsson MK, Linden C, Karlsson C, Johnell O, Obrant K, Seeman E. Exercise during growth and bone mineral density and fractures in old age. Lancet 2000;355:469e70. [154] Nordstrom A, Karlsson C, Nyquist F, Olsson T, Nordstrom P, Karlsson M. Bone loss and fracture risk after reduced physical activity. J Bone Miner Res 2005;20:202e7. [155] Haapasalo H, Kontulainen S, Sievanen H, Kannus P, Jarvinen M, Vuori I. Exercise-induced bone gain is due to enlargement in bone size without a change in volumetric bone density: a peripheral quantitative computed tomography study of the upper arms of male tennis players. Bone 2000;27:351e7. [156] Karlsson MK. Does exercise during growth prevent fractures in later life? Med Sport Sci 2007;51:121e36. [157] Kontulainen SA, Hughes JM, Macdonald HM, Johnston JD. The biomechanical basis of bone strength development during growth. Med Sport Sci 2007;51:13e32. [158] Fuchs RK, Bauer JJ, Snow CM. Jumping improves hip and lumbar spine bone mass in prepubescent children: a randomized controlled trial. J Bone Miner Res 2001;16:148e56. [159] MacKelvie KJ, Khan KM, McKay HA. Is there a critical period for bone response to weight-bearing exercise in children and adolescents? a systematic review. Br J Sports Med 2002;36: 250e7. discussion 7. [160] McKay HA, MacLean L, Petit M, et al. “Bounce at the Bell”: a novel program of short bouts of exercise improves proximal femur bone mass in early pubertal children. Br J Sports Med 2005;39:521e6. [161] Hind K, Burrows M. Weight-bearing exercise and bone mineral accrual in children and adolescents: a review of controlled trials. Bone 2007;40:14e27. [162] Hughes JM, Novotny SA, Wetzsteon RJ, Petit MA. Lessons learned from school-based skeletal loading intervention trials: putting research into practice. Med Sport Sci 2007;51:137e58. [163] Gunter K, Baxter-Jones AD, Mirwald RL, et al. Impact exercise increases BMC during growth: an 8-year longitudinal study. J Bone Miner Res 2008;23:986e93. [164] Gunter K, Baxter-Jones AD, Mirwald RL, et al. Jump starting skeletal health: a 4-year longitudinal study assessing the effects of jumping on skeletal development in pre and circum pubertal children. Bone 2008;42:710e8. [165] Macdonald HM, Kontulainen SA, Petit MA, Beck TJ, Khan KM, McKay HA. Does a novel school-based physical activity model benefit femoral neck bone strength in pre- and early pubertal children? Osteoporos Int 2008;19:1445e56. [166] Daly RM. The effect of exercise on bone mass and structural geometry during growth. Med Sport Sci 2007;51:33e49.

[167] Kriemler S, Zahner L, Puder JJ, et al. Weight-bearing bones are more sensitive to physical exercise in boys than in girls during pre- and early puberty: a cross-sectional study. Osteoporos Int 2008;19:1749e58. [168] Ward KA, Roberts SA, Adams JE, Mughal MZ. Bone geometry and density in the skeleton of pre-pubertal gymnasts and school children. Bone 2005;36:1012e8. [169] Schoenau E, Frost HM. The ”muscle-bone unit“ in children and adolescents. Calcif Tissue Int 2002;70:405e7. [170] Daly RM, Saxon L, Turner CH, Robling AG, Bass SL. The relationship between muscle size and bone geometry during growth and in response to exercise. Bone 2004;34:281e7. [171] Ducher G, Courteix D, Meme S, Magni C, Viala JF, Benhamou CL. Bone geometry in response to long-term tennis playing and its relationship with muscle volume: a quantitative magnetic resonance imaging study in tennis players. Bone 2005; 37:457e66. [172] Suuriniemi M, Mahonen A, Kovanen V, et al. Association between exercise and pubertal BMD is modulated by estrogen receptor alpha genotype. J Bone Miner Res 2004;19:1758e65. [173] Remes T, Vaisanen SB, Mahonen A, et al. Aerobic exercise and bone mineral density in middle-aged Finnish men: a controlled randomized trial with reference to androgen receptor, aromatase, and estrogen receptor alpha gene polymorphisms small star, filled. Bone 2003;32:412e20. [174] Omasu F, Kitagawa J, Koyama K, et al. The influence of VDR genotype and exercise on ultrasound parameters in young adult Japanese women. J Physiol Anthropol Appl Human Sci 2004;23:49e55. [175] Nakamura O, Ishii T, Ando Y, et al. Potential role of vitamin D receptor gene polymorphism in determining bone phenotype in young male athletes. J Appl Physiol 2002;93:1973e9. [176] Tajima O, Ashizawa N, Ishii T, et al. Interaction of the effects between vitamin D receptor polymorphism and exercise training on bone metabolism. J Appl Physiol 2000;88:1271e6. [177] Dhamrait SS, James L, Brull DJ, et al. Cortical bone resorption during exercise is interleukin-6 genotype-dependent. Eur J Appl Physiol 2003;89:21e5. [178] Klein-Nulend J, Bacabac RG, Mullender MG. Mechanobiology of bone tissue. Pathol Biol (Paris) 2005;53:576e80. [179] Suva LJ, Gaddy D, Perrien DS, Thomas RL, Findlay DM. Regulation of bone mass by mechanical loading: microarchitecture and genetics. Curr Osteoporos Rep 2005;3:46e51. [180] Rubin J, Rubin C, Jacobs CR. Molecular pathways mediating mechanical signaling in bone. Gene 2006;367:1e16. [181] Klein-Nulend J, Nijweide PJ, Burger EH. Osteocyte and bone structure. Curr Osteoporos Rep 2003;1:5e10. [182] Balemans W, Ebeling M, Patel N, et al. Increased bone density in sclerosteosis is due to the deficiency of a novel secreted protein (SOST). Hum Mol Genet 2001;10:537e43. [183] Balemans W, Van Hul W. Identification of the disease-causing gene in sclerosteosis e discovery of a novel bone anabolic target? J Musculoskelet Neuronal Interact 2004;4:139e42. [184] Balemans W, Cleiren E, Siebers U, Horst J, Van Hul W. A generalized skeletal hyperostosis in two siblings caused by a novel mutation in the SOST gene. Bone 2005;36:943e7. [185] Li X, Zhang Y, Kang H, et al. Sclerostin binds to LRP5/6 and antagonizes canonical Wnt signaling. J Biol Chem 2005;280: 19883e7. [186] Sawakami K, Robling AG, Ai M, et al. The Wnt co-receptor LRP5 is essential for skeletal mechanotransduction but not for the anabolic bone response to parathyroid hormone treatment. J Biol Chem 2006;281:23698e711. [187] Ominsky M, Stouch B, Doellgast G, et al. Administration of sclerostin antibodies to female cynomolgus monkeys results in

PEDIATRIC BONE

219

REFERENCES

[188]

[189]

[190] [191]

[192]

[193]

[194]

[195]

[196]

[197]

[198]

[199]

[200]

[201]

[202]

[203]

[204]

[205]

[206]

increased bone formation, bone mineral density and bone strength. J Bone Miner Res 2006;21(Suppl. 1):S44. Uitterlinden AG, Arp PP, Paeper BW, et al. Polymorphisms in the sclerosteosis/van Buchem disease gene (SOST) region are associated with bone-mineral density in elderly whites. Am J Hum Genet 2004;75:1032e45. Husted LB, Carstens M, Stenkir L, Langdahl BL. A polymorphism in the Van Buchem deletion region of the SOST gene is associated with increased bone mass. J Bone Miner Res 2006;21(Suppl. 1):S423. Warren MP, Goodman LR. Exercise-induced endocrine pathologies. J Endocrinol Invest 2003;26:873e8. Zanker C, Hind K. The effect of energy balance on endocrine function and bone health in youth. Med Sport Sci 2007;51: 81e101. Gremion G, Rizzoli R, Slosman D, Theintz G, Bonjour JP. Oligoamenorrheic long-distance runners may lose more bone in spine than in femur. Med Sci Sports Exerc 2001;33:15e21. Outila TA, Karkkainen MU, Lamberg-Allardt CJ. Vitamin D status affects serum parathyroid hormone concentrations during winter in female adolescents: associations with forearm bone mineral density. Am J Clin Nutr 2001;74:206e10. Cashman KD, Hill TR, Cotter AA, et al. Low vitamin D status adversely affects bone health parameters in adolescents. Am J Clin Nutr 2008;87:1039e44. Cheng S, Tylavsky F, Kroger H, et al. Association of low 25hydroxyvitamin D concentrations with elevated parathyroid hormone concentrations and low cortical bone density in early pubertal and prepubertal Finnish girls. Am J Clin Nutr 2003;78:485e92. Andersen R, Molgaard C, Skovgaard LT, et al. Teenage girls and elderly women living in northern Europe have low winter vitamin D status. Eur J Clin Nutr 2005;59:533e41. Lapatsanis D, Moulas A, Cholevas V, Soukakos P, Papadopoulou ZL, Challa A. Vitamin D, a necessity for children and adolescents in Greece. Calcif Tissue Int 2005;77:348e55. Ginty F, Cavadini C, Michaud PA, et al. Effects of usual nutrient intake and vitamin D status on markers of bone turnover in Swiss adolescents. Eur J Clin Nutr 2004;58:1257e65. Mithal A, Wahl DA, Bonjour JP, et al. Global vitamin D status and determinants of hypovitaminosis D. Osteoporos Int 2009;20:1807e20. Arabi A, El Rassi R, El-Hajj Fuleihan G. Hypovitaminosis D in developing countries e prevalence, risk factors and outcomes. Nat Rev Endocrinol 2010;6:550e61. Taylor JA, Geyer LJ, Feldman KW. Use of supplemental vitamin d among infants breastfed for prolonged periods. Pediatrics 2010;125:105e11. Wagner CL, Greer FR. Prevention of rickets and vitamin D deficiency in infants, children, and adolescents. Pediatrics 2008;122:1142e52. Zamora SA, Rizzoli R, Belli DC, Slosman DO, Bonjour JP. Vitamin D supplementation during infancy is associated with higher bone mineral mass in prepubertal girls. J Clin Endocrinol Metab 1999;84:4541e4. Viljakainen HT, Saarnio E, Hytinantti T, et al. Maternal vitamin D status determines bone variables in the newborn. J Clin Endocrinol Metab 2010;95:1749e57. Esterle L, Nguyen M, Walrant-Debray O, Sabatier JP, Garabedian M. Adverse interaction of low-calcium diet and low 25(OH)D levels on lumbar spine mineralization in late-pubertal girls. J Bone Miner Res 2010;25:2392e8. Viljakainen HT, Natri AM, Karkkainen M, et al. A positive doseresponse effect of vitamin D supplementation on site-specific bone mineral augmentation in adolescent girls: a double-

[207]

[208]

[209]

[210] [211]

[212]

[213]

[214]

[215]

[216]

[217]

[218] [219]

[220]

[221]

[222]

[223]

[224]

[225]

blinded randomized placebo-controlled 1-year intervention. J Bone Miner Res 2006;21:836e44. El-Hajj Fuleihan G, Nabulsi M, et al. Effect of vitamin D replacement on musculoskeletal parameters in school children: a randomized controlled trial. J Clin Endocrinol Metab 2006;91:405e12. Voloc A, Esterle L, Nguyen TM, et al. High prevalence of genu varum/valgum in European children with low vitamin D status and insufficient dairy products/calcium intakes. Eur J Endocrinol 2010;163:811e7. Kalkwarf HJ, Khoury JC, Lanphear BP. Milk intake during childhood and adolescence, adult bone density, and osteoporotic fractures in US women. Am J Clin Nutr 2003;77:257e65. Wosje KS, Specker BL. Role of calcium in bone health during childhood. Nutr Rev 2000;58:253e68. Bonjour JP, Ammann P, Chevalley T, Ferrari S, Rizzoli R. Nutritional aspects of bone growth: an overview. In: New S, Bonjour JP, editors. Nutritional Aspects of Bone Health. Cambridge, UK: The Royal Society of Chemistry; 2003. p. 111e27. Clavien H, Theintz G, Rizzoli R, Bonjour JP. Does puberty alter dietary habits in adolescents living in a western society? J Adolesc Health 1996;19:68e75. Bonjour JP, Chevalley T, Ferrari S, Rizzoli R. The importance and relevance of peak bone mass in the prevalence of osteoporosis. Salud Publica Mex 2009;51(Suppl. 1):S5e17. Bonjour JP. Is peripuberty the most opportune time to increase calcium intake in healthy girls? BoneKEy-Osteovision 2005 March;2(3):6e11. http://wwwbonekey-ibmsorg/cgi/content/ full/ibmske 2/3/6. Johnston Jr CC, Miller JZ, Slemenda CW, et al. Calcium supplementation and increases in bone mineral density in children. N Engl J Med 1992;327:82e7. Nowson CA, Green RM, Hopper JL, et al. A co-twin study of the effect of calcium supplementation on bone density during adolescence. Osteoporos Int 1997;7:219e25. Bonjour JP, Carrie AL, Ferrari S, et al. Calcium-enriched foods and bone mass growth in prepubertal girls: a randomized, double-blind, placebo-controlled trial. J Clin Invest 1997;99:1287e94. Barker DJ. Intrauterine programming of adult disease. Mol Med Today 1995;1:418e23. Cooper C, Westlake S, Harvey N, Javaid K, Dennison E, Hanson M. Review: developmental origins of osteoporotic fracture. Osteoporos Int 2006;17:337e47. Specker BL, Mulligan L, Ho M. Longitudinal study of calcium intake, physical activity, and bone mineral content in infants 6e18 months of age. J Bone Miner Res 1999;14:569e76. Specker B, Binkley T. Randomized trial of physical activity and calcium supplementation on bone mineral content in 3- to 5year-old children. J Bone Miner Res 2003;18:885e92. Specker B, Vukovich M. Evidence for an interaction between exercise and nutrition for improved bone health during growth. Med Sport Sci 2007;51:50e63. Iuliano-Burns S, Saxon L, Naughton G, Gibbons K, Bass SL. Regional specificity of exercise and calcium during skeletal growth in girls: a randomized controlled trial. J Bone Miner Res 2003;18:156e62. Courteix D, Jaffre C, Lespessailles E, Benhamou L. Cumulative effects of calcium supplementation and physical activity on bone accretion in premenarchal children: a double-blind randomised placebo-controlled trial. Int J Sports Med 2005;26:332e8. Chevalley T, Bonjour JP, Ferrari S, Hans D, Rizzoli R. Skeletal site selectivity in the effects of calcium supplementation on areal bone mineral density gain: a randomized, double-blind,

PEDIATRIC BONE

220

[226] [227] [228]

[229]

[230]

[231] [232]

[233]

[234]

[235]

[236]

[237]

[238]

[239] [240]

[241]

[242] [243]

[244]

[245]

9. PEAK BONE MASS AND ITS REGULATION

placebo-controlled trial in prepubertal boys. J Clin Endocrinol Metab 2005;90:3342e9. Ordovas JM, Mooser V. Nutrigenomics and nutrigenetics. Curr Opin Lipidol 2004;15:101e8. van Ommen B. Nutrigenomics: exploiting systems biology in the nutrition and health arenas. Nutrition 2004;20:4e8. Mutch DM, Wahli W, Williamson G. Nutrigenomics and nutrigenetics: the emerging faces of nutrition. Faseb J 2005;19: 1602e16. Mariman EC. Nutrigenomics and nutrigenetics: the ’omics’ revolution in nutritional science. Biotechnol Appl Biochem 2006;44:119e28. Ferrari SL, Rizzoli R, Slosman DO, Bonjour JP. Do dietary calcium and age explain the controversy surrounding the relationship between bone mineral density and vitamin D receptor gene polymorphisms? J Bone Miner Res 1998;13:363e70. Ferrari S, Bonjour JP, Rizzoli R. The vitamin D receptor gene and calcium metabolism. Trends Endocrinol Metab 1998;9:259e65. Gong G, Stern HS, Cheng SC, et al. The association of bone mineral density with vitamin D receptor gene polymorphisms. Osteoporos Int 1999;9:55e64. Sainz J, Van Tornout JM, Loro ML, Sayre J, Roe TF, Gilsanz V. Vitamin D-receptor gene polymorphisms and bone density in prepubertal American girls of Mexican descent. N Engl J Med 1997;337:77e82. Cadogan J, Eastell R, Jones N, Barker ME. Milk intake and bone mineral acquisition in adolescent girls: randomised, controlled intervention trial. Br Med J 1997;315:1255e60. Chevalley T, Rizzoli R, Hans D, Ferrari S, Bonjour JP. Interaction between calcium intake and menarcheal age on bone mass gain: an eight-year follow-up study from prepuberty to postmenarche. J Clin Endocrinol Metab 2005;90:44e51. Prentice A, Ginty F, Stear SJ, Jones SC, Laskey MA, Cole TJ. Calcium supplementation increases stature and bone mineral mass of 16- to 18-year-old boys. J Clin Endocrinol Metab 2005;90:3153e61. Institute of Medicine Food and Nutrition Board. Dietary References Intakes for Calcium, Phosphorus, Magnesium, Vitamin D and Fluoride. Washington, DC: National Academy Press; 1997. Committee on Medical Aspects of Food and Nutrition Policy (COMA). Nutrition and Bone Health: with particular reference to calcium and vitamin D. London, UK: The Stationery Office; 1998. Valeur de re´fe´rences pour les apports nutrtritionnels. Socie´te´ Suisse de Nutrition; 2002. World Health Organization. Prevention and management of osteoporosis. Report of a scientific group. WHO Technical Report Series. 2003;No 921. Schurch MA, Rizzoli R, Slosman D, Vadas L, Vergnaud P, Bonjour JP. Protein supplements increase serum insulin-like growth factor-I levels and attenuate proximal femur bone loss in patients with recent hip fracture. A randomized, double-blind, placebo-controlled trial. Ann Intern Med 1998;128:801e9. Bonjour JP, Ammann P, Chevalley T, Rizzoli R. Protein intake and bone growth. Can J Appl Physiol 2001;26(Suppl):S153e66. Kerstetter JE, O’Brien KO, Insogna KL. Dietary protein, calcium metabolism, and skeletal homeostasis revisited. Am J Clin Nutr 2003;78(Suppl):584Se92S. Conigrave AD, Mun HC, Delbridge L, Quinn SJ, Wilkinson M, Brown EM. L-amino acids regulate parathyroid hormone secretion. J Biol Chem 2004;279:38151e9. Conigrave AD, Brown EM, Rizzoli R. Dietary protein and bone health: roles of amino acid-sensing receptors in the control of

[246]

[247]

[248]

[249]

[250]

[251]

[252]

[253]

[254]

[255]

[256]

[257] [258] [259]

[260]

[261]

[262]

[263]

[264] [265]

calcium metabolism and bone homeostasis. Annu Rev Nutr 2008;28:131e55. Chevalley T, Rizzoli R, Manen D, Caverzasio J, Bonjour JP. Arginine increases insulin-like growth factor-I production and collagen synthesis in osteoblast-like cells. Bone 1998;23:103e9. Garn SM, Rohmann CG, Behar M, Viteri F, Guzman MA. Compact bone deficiency in protein-calorie malnutrition. Science 1964;145:1444e5. Thissen JP, Triest S, Maes M, Underwood LE, Ketelslegers JM. The decreased plasma concentration of insulin-like growth factor-I in protein-restricted rats is not due to decreased numbers of growth hormone receptors on isolated hepatocytes. J Endocrinol 1990;124:159e65. Alexy U, Remer T, Manz F, Neu CM, Schoenau E. Long-term protein intake and dietary potential renal acid load are associated with bone modeling and remodeling at the proximal radius in healthy children. Am J Clin Nutr 2005;82:1107e14. Iuliano-Burns S, Stone J, Hopper JL, Seeman E. Diet and exercise during growth have site-specific skeletal effects: a co-twin control study. Osteoporos Int 2005;16:1225e32. Cheng S, Lyytikainen A, Kroger H, et al. Effects of calcium, dairy product, and vitamin D supplementation on bone mass accrual and body composition in 10-12-y-old girls: a 2-y randomized trial. Am J Clin Nutr 2005;82:1115e26. quiz 47e8. Du X, Zhu K, Trube A, et al. School-milk intervention trial enhances growth and bone mineral accretion in Chinese girls aged 10e12 years in Beijing. Br J Nutr 2004;92:159e68. Merrilees MJ, Smart EJ, Gilchrist NL, et al. Effects of diary food supplements on bone mineral density in teenage girls. Eur J Nutr 2000;39:256e62. Teegarden D, Lyle RM, Proulx WR, Johnston CC, Weaver CM. Previous milk consumption is associated with greater bone density in young women. Am J Clin Nutr 1999;69:1014e7. Matkovic V, Kostial K, Simonovic I, Buzina R, Brodarec A, Nordin BE. Bone status and fracture rates in two regions of Yugoslavia. Am J Clin Nutr 1979;32:540e9. Heaney RP. Protein intake and bone health: the influence of belief systems on the conduct of nutritional science. Am J Clin Nutr 2001;73:5e6. Rizzoli R, Bonjour JP. Dietary protein and bone health. J Bone Miner Res 2004;19:527e31. Bonjour JP. Dietary protein: an essential nutrient for bone health. J Am Coll Nutr 2005;24(Suppl):526Se36S. Fenton TR, Lyon AW, Eliasziw M, Tough SC, Hanley DA. Metaanalysis of the effect of the acid-ash hypothesis of osteoporosis on calcium balance. J Bone Miner Res 2009;24:1835e40. Darling AL, Millward DJ, Torgerson DJ, Hewitt CE, LanhamNew SA. Dietary protein and bone health: a systematic review and meta-analysis. Am J Clin Nutr 2009;90:1674e92. Fenton TR, Eliasziw M, Tough SC, Lyon AW, Brown JP, Hanley DA. Low urine pH and acid excretion do not predict bone fractures or the loss of bone mineral density: a prospective cohort study. BMC Musculoskelet Disord 2010;11:88. Chevalley T, Bonjour JP, Ferrari S, Rizzoli R. High-protein intake enhances the positive impact of physical activity on BMC in prepubertal boys. J Bone Miner Res 2008;23:131e42. Bouxsein ML. Biomechanics of age-related fractures. In: Marcus R, Feldman D, Kelsey J, editors. Osteoporosis. San Diego: Academic Press; 2001. p. 509e34. Hanauer A, Young ID. CoffineLowry syndrome: clinical and molecular features. J Med Genet 2002;39:705e13. Pereira PM, Schneider A, Pannetier S, Heron D, Hanauer A. CoffineLowry syndrome. Eur J Hum Genet 2010;18:627e33.

PEDIATRIC BONE

REFERENCES

[266] Yang X, Matsuda K, Bialek P, et al. ATF4 is a substrate of RSK2 and an essential regulator of osteoblast biology; implication for CoffineLowry syndrome. Cell 2004;117:387e98. [267] Harding HP, Zhang Y, Zeng H, et al. An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol Cell 2003;11:619e33. [268] Elefteriou F, Benson MD, Sowa H, et al. ATF4 mediation of NF1 functions in osteoblast reveals a nutritional basis for congenital skeletal dysplasiae. Cell Metab 2006;4:441e51. [269] Martin TJ. Protein nutrition as therapy for a genetic disorder of bone? Cell Metab 2006;4:419e20. [270] World Health Organization. Energy and protein requirements. Report of a joint FAO/WHO/UNO expert consultation. Geneva, Switzerland; 1985.

221

[271] National Research Council. Recommended Dietary Allowances. 10th ed. Washington, DC: National Academy Press; 1989. [272] Dewey KG, Beaton G, Fjeld C, Lonnerdal B, Reeds P. Protein requirements of infants and children. Eur J Clin Nutr 1996;50(Suppl. 1):S119e47. discussion S47e50. [273] Martin AD. Apports nutritionnels conseille´s pour la population franc¸aise. 3rd ed. Paris: TEC&DOC; 2001. [274] Bounds W, Skinner J, Carruth BR, Ziegler P. The relationship of dietary and lifestyle factors to bone mineral indexes in children. J Am Diet Assoc 2005;105:735e41. [275] Rodriguez NR. Optimal quantity and composition of protein for growing children. J Am Coll Nutr 2005;24:150Se4S. [276] Young VR, Borgonha S. Nitrogen and amino acid requirements: the Massachusetts Institute of Technology amino acid requirement pattern. J Nutr 2000;130:1841Se9S.

PEDIATRIC BONE

C H A P T E R

10

Pregnancy and Lactation Ann Prentice Medical Research Council Human Nutrition Research, Elsie Widdowson Laboratory, Cambridge, UK

INTRODUCTION The fluxes of the primary bone-forming minerals, calcium, phosphorus, magnesium, and zinc, that occur between mother and offspring during pregnancy and lactation place considerable demands on maternal mineral economy. There are several possible biological strategies for meeting these extra requirements, including increased food consumption, elevated gastrointestinal absorption efficiencies, decreased mineral excretion, and mobilization of tissue stores. This chapter presents a review of the evidence on the extent to which these strategies apply in the human situation, the mechanisms by which they occur, the limitations imposed by maternal diet, and the possible consequences for the growth of the infant and bone health of the mother. It also discusses the importance of maternal vitamin D status in the mineral metabolism of the mother and infant. The evidence suggests that pregnancy and lactation are associated with physiological adaptive changes that are independent of maternal mineral supply, within the range of normal dietary intakes. These processes appear to provide the minerals necessary for fetal growth and breast milk production without requiring an increase in maternal dietary intake or compromising maternal bone health in the long term. More research is needed to define the limitations of these processes in women with marginal mineral intakes and poor vitamin D status.

MINERAL FLUXES FROM MOTHER TO OFFSPRING At birth, the skeleton contains approximately 20e30 g calcium [1e3]. This represents 98e99% of the total body content of this mineral. The proportion of calcium in fetal ash increases during early gestation and reaches a plateau of approximately 27% (g/g) by 4 months [2]. Substantial skeletal growth occurs from mid-gestation

Pediatric Bone, Second Edition DOI: 10.1016/B978-0-12-382040-2.10010-3

and maximal fetal calcium accretion occurs during the third trimester. Quantitatively, fetal calcium accretion increases from approximately 50 mg/day at 20 weeks of gestation to 330 mg/day at 35 weeks [4]. For the third trimester of pregnancy, 200 mg/day is considered a typical calcium accretion rate. After delivery, skeletal growth and calcium accretion continue at a slower pace. A typical child accretes approximately 140 mg/ day of calcium during the first year of life, with the rate being highest in the first months and slowing progressively with age [3,5]. The flux of calcium from mother to child across the placenta and via breast milk needs to be sufficient to match this accretion rate and, in the child, to meet any additional requirements imposed by gastrointestinal absorption and obligatory losses in urine, feces, and sweat. Breast milk calcium secretion averages approximately 200 mg/day at peak lactation but can be as high as 400 mg/day in some individuals [6]. Similar estimates can be made for the fluxes of the other primary bone-forming minerals e phosphorus, magnesium, and zinc [3]. A newborn baby contains approximately 16 g of phosphorus, of which approximately 80% is contained in the skeleton. A typical whole-body phosphorus accretion rate in the first year of life is 70 mg/day. The magnesium content at birth is approximately 750 mg, of which 60% is in the skeleton, and a typical whole-body accretion rate in infancy is 3 mg/day. For zinc, typically the whole-body content is around 50 mg at birth, of which 30% is in the skeleton, and the accretion rate in infancy is around 0.4 mg/day [7,8]. Breast milk secretion during full lactation averages approximately 120, 25, and 1.6 mg/day for phosphorus, magnesium, and zinc, respectively, but the ranges of values between individuals are wide. These mineral fluxes from mother to child represent a significant proportion of the mineral intakes of the mother, especially for calcium [9]. Intakes of these minerals vary in different areas of the world and range

223

Copyright Ó 2012 Elsevier Inc. All rights reserved.

224

10. PREGNANCY AND LACTATION

widely between individuals, but average intakes for women are of the order of 300e1500 mg/day calcium, 1000 mg/day phosphorus, 250 mg/day magnesium, and 10 mg/day zinc [10e13]. There are several possible biological strategies for meeting the extra demands that pregnancy and lactation make on the mineral economy of the mother, including increases in food consumption, elevated gastrointestinal absorption efficiencies, decreased mineral excretion, and mobilization of tissue stores. The extent to which these strategies apply in the human situation, the mechanisms by which they occur, the limitations imposed by maternal diet, and the possible consequences for the growth of the baby and bone health of the mother are discussed next.

PREGNANCY Mineral Metabolism and Bone Biochemistry Human pregnancy is associated with major changes in mineral and bone metabolism (Table 10.1). These changes occur from early in gestation, in advance of the mineral requirement for skeletal development of the fetus. Calcium During pregnancy, intestinal calcium absorption efficiency and urinary calcium excretion approximately double compared to the non-pregnant state (Fig. 10.1) [14e20]. The elevation in calcium absorption is associated with increased intestinal expression of calbindinD9K, a vitamin D-dependent calcium-binding protein [21,22]. The increased expression of calbindin-D9K is a result of increased transcription and reduced posttranslational degradation mediated by 1,25-dihydroxyvitamin D, which is elevated in pregnancy, and by other factors [21]. 1,25-Dihydroxyvitamin D also acts at the enterocyte brush border to open voltage-gated calcium channels (primarily TRPV6). However, there is evidence TABLE 10.1

from animal studies to suggest that this mechanism may not be fully responsible for the upregulation of intestinal calcium absorption in pregnancy, which has been shown to occur in the absence of 1,25-dihydroxyvitamin D and its receptor [23]. The increase in urinary calcium excretion is largely due to the combined effects of the increases in glomerular filtration rate and calcium absorption. Fasting calcium excretion, corrected for creatinine clearance, is normal or decreased [16,24e26]. Measured calcium balance in the later stages of pregnancy is generally positive and retention approximates to that required for fetal growth [27]. The proportion of serum calcium circulating in the ionized form is increased in pregnancy. Serum ionized calcium concentration is unchanged or decreases slightly but remains within a narrow physiological range throughout [28,29]. The concentration of total serum calcium declines to a greater extent, with a slight increase toward the end of gestation. The decrease in total serum calcium largely reflects the change in serum albumin concentration associated with the increased intravascular fluid volume of pregnancy and the resulting hemodilution [29,30]. Calcium transport across the placenta is predominantly through an active transcellular pathway involving TRPV6 expressed on the apical membrane of the trophoblast, intracellular calcium-binding proteins (primarily calbindin-D9K) and active transport into the fetal circulation at the basolateral membrane through the calcium pump PMCA3 [31,32]. The fetal calcium concentration is maintained at a higher level than the maternal concentration through the actions of fetal parathyroid hormone (PTH) and parathyroid hormone-related peptide (PTHrP) on the expression of the intracellular calbindins [32,33]. Other regulators of calbindin expression include progesterone and estrogen, but studies in animals do not support an essential role for the vitamin D system in placental calcium transfer, although it may have a role as a negative modulator [31e33].

Calcium and Bone Metabolic Changes in Human Pregnancy, Compared to the Non-Pregnant, Non-Lactating State

Calcium absorption

[

Serum 1,25 (OH)2 vitamin D (free and bound)

[

Urinary calcium excretion, daily

[

Serum parathyroid hormone (intact)

4Y

Fasting urinary calcium, creatinine corrected

4Y

Serum parathyroid hormone-related protein

[

Serum calcium (ionized)

4(Y)

Nephrogenous cyclic AMP

4

Serum calcium (total)

Y

Serum calcitonin

[4

Tubular phosphate reabsorption

4Y

Bone resorption histology and markers*

[

Urinary phosphate excretion

[4

Bone formation markers (except Oc)**

[

Serum phosphate

4Y

Osteocalcin (intact)

Y

* Urinary collagen cross-links, telopeptides, hydroxyproline, serum tartrate-resistant acid phosphatase. ** Serum bone alkaline phosphatase and procollagen peptides

PEDIATRIC BONE

PREGNANCY

↑ 1,25 (OH)2D ↑ PTHrP ↑ Prolactin ↑ Placental lactogen

pregnancy to term. This has been attributed to hemodilution, decreased concentrations of the zinc binding protein, hormonal changes in pregnancy and active transport of zinc to the fetus [8]. There is evidence that zinc absorption and urinary zinc excretion are increased, although individual responses are highly variable [13,41e43].

↑ intestinal Ca++ absorption ↑ Ca-release from bone ↑ Ca-uptake into bone

↑ urinary Ca excretion

225

Bone Turnover

Ca transport to fetus

FIGURE 10.1 Schematic representation of the changes in calcium and bone metabolism that occur during pregnancy.

Phosphorus, Magnesium, and Zinc The patterns of change in the metabolism of the other bone-forming minerals largely parallel that of calcium, with decreases in serum concentrations coupled with increases in intestinal absorption and urinary excretion. There is no evidence for increased renal conservation of any of these minerals. Phosphorus balance becomes increasingly positive (i.e. absorption exceeds excretion) as gestation advances [14], and net absorption is higher in pregnant women compared with non-pregnant women [34]. Some studies have indicated a decrease in serum phosphorus concentration [16] and the renal phosphate threshold in the second and third trimesters of pregnancy, with a corresponding increase in urinary phosphate excretion [16,18]. The data are inconsistent, and other studies have shown no changes in phosphate metabolism [18,24,35]. Little is known about the mechanisms of transporting phosphate to the fetus [32]. As with calcium, fetal phosphate concentrations are maintained at a higher level than in the maternal circulation which suggests that there is active transport across the placenta, although the mechanisms involved have yet to be fully elucidated [32]. The data on magnesium absorption and retention in pregnant women are very limited and inconclusive [10]. Ionized and total serum magnesium concentrations decrease with increasing gestational age [36e39] and are lower in pregnant women than preconception [18] or compared to non-pregnant controls [40]. These effects parallel the changes in serum proteins due to hemodilution and are not considered to represent alterations in maternal magnesium status [10]. Lymphocyte magnesium concentration is unchanged or decreased in pregnancy [38,39]. Urinary magnesium excretion is elevated in late pregnancy [18]. Serum zinc concentration decreases in pregnancy by around 35% from early

Bone resorption increases during pregnancy. This has been indicated both histologically [44] and biochemically by urinary markers, such as collagen cross-links, telopeptides, and hydroxyproline, serum markers such as tartrate-resistant acid phosphatase [17e19,45,46] and stable isotope kinetic studies [47]. After an initial decrease, increases are also noted in biochemical indices of bone formation, such as serum bone alkaline phosphatase and procollagen peptides, to levels higher than those observed prepregnancy [17e19,45,46,48e50]. However, serum osteocalcin concentration, a commonly used marker of bone formation, is decreased relative to preconception levels [17,18], although its concentration in late gestation is higher than in early pregnancy [17e19,51]. Increases in bone turnover indices are observed in early gestation. Their levels increase by 50e200% during pregnancy [17e19,46,48,52]. The increases in markers of bone resorption occur before those of bone formation [19,53], suggestive of bone mineral mobilization. In support of this, a stable isotope study of Brazilian women at 10e12 weeks of pregnancy recorded a net deficit in bone calcium turnover [47]. A study of women with multifetal pregnancies demonstrated that selective fetal reduction reduced circulating concentrations of the cross-linked carboxy (C)-terminal telopeptide of type-1 collagen (ICTP), a marker of bone resorption, without corresponding changes in the C-terminal propeptide of type I procollagen (PICP), an index of bone formation [45]. This suggests that factors derived from the fetoplacental unit are involved in the stimulation of maternal bone turnover, primarily via an effect on bone resorption. Decreases in bone resorption markers have been noted in pregnant women following calcium supplementation [54,55], indicating that the physiological response to an increased calcium load remains intact during pregnancy. There are problems in interpreting changes in biochemical indices during pregnancy because of the effects of hemodilution, alterations in creatinine excretion and renal clearance, and the contribution to and metabolism of these markers by the products of conception [22]. The disparity between the different indices of bone formation, for example, may be due to the degradation or uptake of osteocalcin by the placenta [49,56]. It has been suggested that the reduction in osteocalcin

PEDIATRIC BONE

226

10. PREGNANCY AND LACTATION

concentration may facilitate bone formation [28]. Measurements of an osteocalcin metabolite e octeocalcin N terminal fragment, Ocf e adjusted for alterations in creatinine clearance, have indicated that despite the low measurable concentrations of the intact protein, osteocalcin production is not decreased in pregnancy [19]. Total alkaline phosphatase is not a useful index of bone formation in pregnancy because of the contribution from the placental isoform [22]. The increase in resorption markers may partly reflect a contribution from the turnover of the fetal skeleton. However, a study of the ratio of a to b isomers of the C-terminal telopeptide of type 1 collagen (CTX), a bone resorption marker, suggested that the fetal contribution to maternal CTX excretion is small, amounting to less than 10% of a-CTX and only 2% of b-CTX [19]. Calciotropic Hormones The concentration of serum 1,25-dihydroxyvitamin D is increased substantially throughout pregnancy [16e18,57], while observational studies suggest there is no change or a modest decline in 25-hydroxyvitamin D concentration [23]. The elevation in 1,25-dihydroxyvitamin D concentration occurs in both the free and protein-bound forms [24,58]. The increase is apparent in the first trimester and continues to rise during gestation by several-fold. Until late in pregnancy, the increase in 1,25-dihydroxyvitamin D parallels an increase in the concentration of vitamin D-binding protein, such that the proportion of the free hormone in the circulation is only elevated in the last trimester [23,59,60]. It is unlikely, therefore, that the early rise in 1,25-dihydroxyvitamin D is fully responsible for the increase in intestinal absorption at that time, and there is animal evidence to suggest that neither this hormone nor its receptor are necessary for the higher calcium absorption efficiency of pregnancy [23]. The mechanisms underlying the increase in 1,25dihydroxyvitamin D are unclear but may involve placental or fetal synthesis of the hormone from maternal 25-hydroxyvitamin D, upregulation of maternal renal 1a-hydoxylase by a variety of pregnancy-associated hormones, or an alteration in the balance between the production of 1,25-dihydroxyvitamin D and 24,25-dihydroxyvitamin D [20,22,61e64]. It is likely that the production of 1,25-dihydroxyvitamin D by the maternal kidneys plays the greater role because low serum concentrations of this hormone have been reported from an anephric individual during pregnancy [22]. Fetal cord blood concentrations of 25-hydroxyvitamin D are similar to or up to 20% lower than maternal concentrations [23], while fetal 1,25-dihydroxyvitamin D concentrations are low. There is evidence of placental transfer of 25-hydroxyvitamin D, but the quantities are thought to be small and considered unlikely to compromise the vitamin D status of pregnant women [10,65]. Furthermore,

although vitamin D and its metabolites are essential for mineral ion homeostasis in adults, there is growing evidence from animal studies that fetal mineral ion homeostasis appears to be mostly independent of this hormonal system [32], or that it plays only a minor modulating role in placental calcium transfer [33]. Although serum 1,25-dihydroxyvitamin D is raised, there is no evidence of an increase in intact PTH concentration in pregnancy [16,20,24,35,52,66], and it may be decreased [17,18,53,67]. There may be a nadir in PTH concentration in early gestation followed by an increase in later pregnancy [28]. Early studies reported high concentrations of PTH during pregnancy, but these have had to be reinterpreted in light of research conducted after the advent of a sensitive two-site immunoassay specific for the intact molecule of PTH [20]. The elevated concentrations reported in the earlier studies are likely explained by the detection of multiple fragments of PTH, many of which are biologically inactive. Although increases in PTH production and turnover cannot be discounted, it appears that human pregnancy is not associated with an increase in PTH bioactivity [20,68]. This is supported by normal nephrogenous cyclic adenosine monophosphate (NcAMP) production, a marker of PTH-like bioactivity [16,35,66]. Consequently, the view of pregnancy as a period of physiological hyperparathyroidism driven by the fetal demand for calcium [69] is no longer regarded as tenable [16]. However, the homeostatic response to a calcium load by an increase in PTH appears to remain intact [70]. Fetal serum concentrations of PTH, which originates from the fetal parathyroids and thymus, are low and decrease further towards the end of gestation, although fetal serum ionized calcium remains stable [20]. Increased concentrations of PTHrP are detected in the maternal circulation during pregnancy [71], probably originating from fetal, placental, or mammary tissues [20]. PTHrP, or more specifically its amino-terminal fragments, has close homology with the N-terminal 1e34 amino acid sequence of PTH. It has the ability to activate the PTH/PTHrP receptor [72] and, consequently, has PTH-like characteristics. It stimulates renal 1a-hydoxylase activity and NcAMP production, thereby promoting 1,25-dihydroxyvitamin D synthesis and calcium reabsorption [21]. In addition, N-terminal PTHrP promotes bone resorption via the classical PTH/PTHrP receptor, although the C-terminal fragment PTHrP (107e139) inhibits osteoclastic bone resorption through a different receptor [72]. The role of PTHrP during pregnancy is unclear, however, but its presence may account, at least in part, for the increase in 1,25-dihydroxyvitamin D, which occurs even though intact PTH concentrations are reduced. Non-pregnant women administered PTHrP (1e36) subcutaneously have elevated 1,25-dihydroxyvitamin D levels, urinary calcium excretion, and

PEDIATRIC BONE

PREGNANCY

NcAMP production with no alteration in serum PTH or calcium concentrations [73] e a response that resembles some of the biochemical changes of pregnancy. The response of calcitonin (CT) to pregnancy appears to be highly variable [74], with some studies reporting elevations [20,40,75] and others reporting no changes [17,28,61,74]. Increases in circulating CT have been observed in thyroidectomized women during pregnancy, probably as a result of CT synthesis by mammary and placental tissues [20]. The physiological function of CT is not fully understood, although a role in protecting the maternal skeleton from resorption during pregnancy has been proposed [76], and it may promote renal calcium excretion [22]. Calcitonin is secreted by the fetal thyroid and concentrations in the fetal circulation are higher than maternal concentrations [32]. Nevertheless, animal studies do not suggest a major role for calcitonin in fetal mineral homeostasis or bone metabolism [32]. Many other hormones, growth factors, and cytokines are elevated in the maternal circulation during pregnancy that could stimulate or drive the observed changes in calcium absorption, bone turnover, and 1,25-dihydroxyvitamin D synthesis. These include prolactin, estrogen, progesterone, placental lactogen, placental growth hormone, tumor necrosis factor-a, insulin-like growth factor-1 (IGF-1), components of the OPG/RANKL/RANK system and the ratio of osteoprotegerin to the other components [19,20,50,77,78]. Their relative contributions to mineral and bone metabolism in human pregnancy, and the interactions between their effects, have yet to be established. Positive correlations with bone turnover markers and kinetically derived measures of bone mineral mobilization have been observed in pregnant women for maternal IGF-1, estrogen and placental lactogen concentrations [47,79e81)] but not for components of the OPG/ RANKL/RANK system [78].

Maternal Skeleton Physiological Changes Biochemical data suggest that human pregnancy is accompanied by alterations in the uptake and release of calcium and other minerals from the maternal skeleton. Whether the balance between storage and mobilization is sufficient to result in an overall increase or decrease in bone mineral content is not clear. Direct assessments of skeletal changes during pregnancy are restricted by the fact that the most sensitive methods for the measurement of bone mineral content are based on the attenuation of ionizing radiation, such as dualand single-energy x-ray absorptiometry, and quantitative computed tomography. Although the radiation doses incurred with modern instruments are generally

227

low and similar to that received from background radiation, these techniques are not useful for measurements of the axial skeleton in pregnant women because of the involvement of fetal tissues. As a consequence, investigations of the axial skeleton and whole body are limited to estimating the integrated skeletal response over the whole of pregnancy by measuring bone mineral status before conception and after delivery. Pregnancy is accompanied by changes in weight and advances in age, both of which can have independent effects on the bone mineral content of the skeleton, and these should be factored into any conclusions about bone mineral changes during pregnancy [82]. In addition, the bone mineral content of the skeleton postpartum is affected by lactation (discussed later) and, consequently, the timing of the postpartum measurement can confound the interpretation of the bone changes during pregnancy in women who breastfeed. To date, of the prospective studies that have been undertaken, most involved relatively small numbers of individuals [17e19,46,52,53,82e89], and only a few have compared the results with a group of non-pregnant women, measured over the same time period, to consider age and weight changes [82,89]. Changes in bone mineral content have been reported in many of these studies, but the observed response differs widely between studies, between individual women and between skeletal sites. The average effect of pregnancy on the axial skeleton reported in these studies ranges from no change in bone mineral content to a decrease of around 4e5%. Nevertheless, a pattern is emerging for pregnancy to be associated with a reduction in bone mineral content at one or more axial sites, reflected in a decrease in whole-body bone mineral content of around 2%. In a longitudinal study of pregnant women in the UK, the decrease in bone mineral content at the spine and whole body was largely independent of concomitant changes in weight and age [82], but the decrease at the femoral neck was similar to that experienced by non-pregnant women studied over the same time period, and therefore could not be ascribed to pregnancy [82]. The calculated release of calcium from the maternal skeleton over the course of pregnancy was estimated to be have been sufficient to cover most of the calcium required for fetal bone mineral accretion [82]. In the case of women entering pregnancy during or after a period of extended lactation, substantial increases in bone mineral content have been reported [83,85], suggesting that maternal adaptative processes are sufficient to supply mineral for both maternal and fetal mineral accretion. Measurements at peripheral skeletal sites, using single- or dual-energy absorptiometry (DXA), peripheral quantitative computed tomography or bone ultrasonography, have also been used to investigate the pattern

PEDIATRIC BONE

228

10. PREGNANCY AND LACTATION

of skeletal response during pregnancy [18,24,28,48, 52,82,86,90e94]. Many of these studies are difficult to interpret because the initial measurements were made when the women were already pregnant rather than before conception and, as is now well recognized, major changes in bone metabolism occur in the early stages of pregnancy [44]. Decreases in bone mineral content over the course of pregnancy have been noted in ultradistal scans of the forearm, a region rich in trabecular bone [28,52,86,91,92], but generally not at more proximal appendicular sites and not in all studies [18,24,28,82]. Ultrasound studies of the os calcis and phalanges have reported decreases in the measured variables in the later stages of pregnancy [48,90,93,94]. Speed of sound and broadband ultrasound attenuation, measured by bone ultrasonography are regarded as indices of bone mineral density for fracture risk prediction in older people. However, the validity of this assumption for quantifying changes in bone mineral content during pregnancy is not known, particularly in the presence of peripheral edema, and has been called into question by a longitudinal study of lactating women in which ultrasound measurements of the os calcis were not concordant with the skeletal bone mineral changes observed by DXA [95]. The reasons for the variability in maternal skeletal response to pregnancy have yet to be determined. It is possible that the changes in bone mineral content are governed by a variety of influences, such as the mother’s age or parity and her nutritional or endocrinological status prior to or after conception. For example, in studies of women who conceived during or soon after a period of extended lactation, increases in bone mineral content occurred during pregnancy that were similar to those required for the recovery of lactational bone losses [83,85]. However, those women who conceived after recovery of lactational bone loss had taken place showed little further change in bone mineral content by the end of the subsequent pregnancy. Slim pregnant women (body mass index <22 kg/m2) exhibited significant increases in bone mineral content at the femoral neck that were independent of weight gain in pregnancy and were not observed in larger pregnant women or size-matched controls [89,96]. Weight changes in pregnancy have been shown to be positively associated with similar changes in bone mineral content to nonpregnant women who gain weight, which are superimposed on the skeletal response to pregnancy [82]. In addition, there may be pregnancy changes in the size, internal architecture and orientation of the skeleton that may influence the in vivo measurement of bone mineral content and bone mineral density and alter their interpretation in terms of bone strength [82,97]. A study of older women reported a positive correlation between bone area of the whole body or femoral neck with parity,

without changes in bone mineral content (implying an increase in bone strength despite a decrease in bone mineral density), which supported studies suggesting that higher parity (i.e. greater number of pregnancies) is associated with lower fracture risk in later life [97]. However, any change in tissue depth, bone mineral content, soft tissue composition or bone orientation can affect bone measurements using the currently available techniques because of alterations in bone edge detection and calibration, and, therefore, the possibility of technical artifacts also needs to be considered [82]. Osteoporosis of Pregnancy Fragility fractures due to osteoporosis can occur in pregnancy, although the incidence is rare [26,98e100]. The condition often involves the spine or hip, is more common in the first pregnancy, and usually resolves spontaneously a few months postpartum [26]. Osteoporosis of pregnancy is generally either idiopathic or secondary to treatment with corticosteroids, magnesium, or warfarin [99e101]. Some studies have suggested that pregnancy may unmask rather than cause low bone mineral density and that fractures result from alterations in posture or load bearing [26,102]. However, fractures associated with pregnancy can occur in the absence of low bone mineral density [103]. There are no data to suggest that osteoporosis of pregnancy is either an exaggerated metabolic response to pregnancy or a consequence of dietary deficiencies or other environmental factors [104,105]. Therefore, the fact that osteoporosis can occur in pregnant women cannot be taken as evidence either that bone mineral loss is a necessary corollary of normal pregnancy or that the condition can be prevented by alterations in diet and lifestyle. Effect of Pregnancy on Later Bone Health The peak bone mass a women achieves as a young adult, before the onset of bone loss, is a predictor of her risk of fragility fracture after menopause. As a consequence, if the changes in bone mineral content associated with pregnancy are of sufficient magnitude to increase or decrease the mother’s bone mineral status in the long term, pregnancy could alter the woman’s risk of osteoporosis later in life. Retrospective studies of older women that have investigated the possible impact of pregnancy on osteoporosis risk have produced conflicting results [9,106]. The disparities may be due to the difficulties of defining reproductive history adequately, of separating the effects of pregnancy and lactation, and of controlling for possible confounders such as socioeconomic factors and body size. In addition, there appears to be considerable interindividual variability in the response to pregnancy. In general, however, evidence from retrospective studies indicates that increasing parity is either associated

PEDIATRIC BONE

PREGNANCY

with higher bone mineral content, greater bone area and/or reduced fracture risk [97,107e114] or has no effect [114e120]. There is no evidence that women who have become pregnant but miscarried have altered bone mineral status [121]. These data suggest that pregnancy is not a risk factor for osteoporosis and may be protective. This conclusion has to be viewed with caution because nulliparous women may have hormonal or metabolic characteristics that reduce their ability to conceive or to have successful pregnancies and that, independently, place them at greater risk of osteoporotic fracture in later life [106,114]. The potential influence of individual differences in hormonal milieu has been suggested by a report of an interaction between parity and oral contraceptive use on hip fracture risk [111]. In this study, parity was associated with a reduction in hip fracture incidence among the population as a whole but with an increase in fracture incidence among women with a history of oral contraception [111].

Influence of Maternal Diet and Nutritional Status on Mineral Metabolism of the Pregnant Mother and Skeletal Development of the Fetus Calcium There is only limited information about the impact of dietary calcium intake on maternal calcium and bone metabolism in pregnancy, and the studies that are available generally involve well-nourished women with a moderate to high calcium intake. Pregnant women exhibit an exaggerated calcemic response to an acute calcium load compared to non-pregnant controls [16,70] but experience similar increases in urinary excretion and decreases in bone resorption [70]. These data provide further evidence that pregnancy is a state of physiological hyperabsorption [16]. It is therefore unlikely that the observed biochemical changes imply an inadequacy of maternal dietary supply to meet the fetal demands for calcium. In support of this view, pregnancy-associated changes in calcium and bone metabolism are observed in women with a high calcium intake and in those who consume calcium supplements [18,122]. Few investigations have been conducted on women with a low calcium intake. Cross-sectional studies of Malay and Brazilian women reported lower urinary calcium excretion [47,123] and higher serum concentrations of intact PTH in late pregnancy compared to early pregnancy [123]. This pattern of biochemical response differs from that reported from populations with higher customary calcium intakes and may indicate that PTHinduced renal conservation of calcium occurs in situations in which maternal calcium intake is low. Similarly,

229

studies in Brazil and Mexico (where mean calcium intakes are around 450e500 mg/day) reported larger increments in bone turnover markers from the second to the third trimester in pregnant women with the lower calcium intake. Balance studies conducted in Indian women show that they achieve similar calcium retention as that of women in other countries despite their lower plane of calcium nutrition [27,124]. However, a stable isotope study in 10 Brazilian women reported smaller deficits in net calcium balance in early and late pregnancy associated with higher calcium intake [47]. There is also little evidence to suggest that the plane of maternal calcium nutrition modifies the integrated skeletal response to pregnancy. In absorptiometric studies of Western women consuming an average of 1100e1200 mg/day of calcium, the decreases in bone mineral content observed across pregnancy were not correlated with calcium intake [82,87]. This contrasts with the report of larger decreases in phalangeal ultrasonographic bone propagation velocity in pregnant women with a calcium intake less than 1000 mg/day compared with those with a higher intake [90]. The effects of calcium supplementation in pregnancy have also been little studied. The consumption of calcium supplements by pregnant Indian women with a customary calcium intake of approximately 300 mg/ day did not lead to differences in radiographic bone density of the hand compared to women who did not receive the supplements [125], whereas a small, nonblinded study of Chinese women given milk powder (350 mg/day of calcium) with and without calcium supplements (600 mg/day of calcium) reported greater bone mineral density, measured by absorptiometry, at the whole body and spine in those consuming milk powder [54]. Conversely, a randomized, placebocontrolled study of Gambian women (mean intake 355 mg/day) supplemented with 1500 mg/day of calcium from 20 weeks’ pregnancy to term demonstrated no significant differences in these absorptiometric measures at 2 weeks postpartum but lower bone mineral at the hip in those who had received the calcium supplement [126]. An increase in serum lead concentration has been observed in pregnant women. It has been suggested that lead may be released from the skeleton because of the elevated bone turnover of pregnancy [127e129]. The increase in lead concentration is less in women with a high calcium intake and in those who take calcium supplements. It has yet to be established whether this is because a higher calcium intake alters the amount of skeletal lead released or decreases intestinal lead absorption [130]. Taken together, the limited data indicate that physiological adaptations occur during human pregnancy that provide an adequate supply of calcium to meet fetal

PEDIATRIC BONE

230

10. PREGNANCY AND LACTATION

demands for bone growth and mineralization and that are not dependent on maternal dietary intake. However, whether fetal bone growth and development can be adequately supported by a very low maternal intake of calcium has still to be established. In an early study using radiographic densitometry, calcium supplementation of pregnant Indian mothers with an intake of approximately 300 mg/day of calcium resulted in higher neonatal bone density compared with that of infants of control mothers, with no effect on birth weight or length [125]. A possible effect of maternal calcium intake on fetal mineralization has also been suggested from a study of US women taking part in a calcium supplementation trial during pregnancy (2 g/day calcium or placebo from 22 weeks’ gestation) [131]. For women with a low customary calcium intake (<600 mg/day), calcium supplementation was associated with greater total bone mineral content of the neonate, but there was no significant difference in infant size. No supplement effect was noted for women with higher calcium intakes. However, a trial of Gambian women (mean dietary intake 350 mg/day of calcium) supplemented with 1500 mg/day of calcium or placebo from 20 weeks’ pregnancy to term reported no significant effects on birth weight or length, or on infant size and bone mineral content at 2, 13 or 52 weeks of age [132] or on stature at age 5e8 years [133]. Phosphorus, Magnesium, and Zinc No studies have investigated the effect of dietary phosphorus on phosphorus economy in pregnancy [10]. A number of studies have examined the impact of magnesium supplementation on aspects of pregnancy outcome, including preterm delivery and pre-eclampsia. These have shown no effect on fetal bone growth and intrauterine growth retardation [10]. Long-term use of intravenous magnesium sulfate treatment for preterm labor and pre-eclampsia has been associated with neonatal hypermagnesemia, elevated alkaline phosphatase and bone abnormalities [134e136]. Some observational studies suggest that poor maternal zinc status is associated with fetal growth retardation, but the data are conflicting [137]. Meta-analyses and systematic reviews of zinc supplementation trials in pregnant mothers have not shown an effect on infant birth weight or other indicators of fetal growth such as crowneheel length, fetal femur diaphysis length and head circumference [8,137,138]. There is some evidence of a positive effect in a subset of studies involving underweight or zinc-deficient women, but the data are limited [8]. There is evidence of greater fractional zinc absorption and intestinal conservation of endogenous fecal zinc in pregnant mothers with low zinc intakes or plasma zinc concentrations [139,140]. It is probable, therefore, that, in healthy women, metabolic adaptations during

pregnancy ensure an adequate transfer of zinc to the fetus even when dietary zinc intakes are marginal [12,139]. Vitamin D Status Vitamin D deficiency during pregnancy is associated with congenital rickets and craniotabes in the newborn and with the development of rickets in infancy, especially when the child is exclusively breastfed [10,141]. Pregnant women who receive regular sunlight exposure during the summer months are not at risk of vitamin D deficiency, but women who wear concealing clothes, are housebound, or for other reasons do not receive adequate UVB exposure are at risk unless their diet provides sufficient vitamin D [10,141]. Osteomalacia and hypovitaminosis D are common among subgroups of pregnant women from many parts of the world [142] but there is little to suggest that this problem is specific to or is worsened by pregnancy [23]. The effect of the seasonal variations in vitamin D status experienced in temperate countries on maternal bone outcomes has been little investigated. One observational study of British women reported greater reductions in calcaneal ultrasound bone measures during pregnancy among those pregnant in the winter than in the summer [94]. Supplementation of pregnant women with vitamin D increases circulating 25-hydroxyvitamin D concentrations but there is no evidence that other maternal outcomes are affected [23]. Poor maternal vitamin D status in pregnancy can affect fetal and infant skeletal growth and ossification, tooth enamel formation, and calcium handling [65,143,144], although there have been no systematic studies [23]. In a Chinese study, the appearance of ossification centers was more likely to be delayed in infants from the north than from the south of the country and in those with low cord serum 25-hydroxyvitamin D concentrations [145]. Lower 25-hydroxyvitamin D concentrations in pregnant women are associated with greater ‘splaying’ of the fetal femoral metaphysis assessed with high-resolution ultrasound [146] and with shorter kneeeheel length at birth [147]. In Japan, seasonal variations in the rate of neonatal craniotabes parallel the seasonal variations in maternal vitamin D status [148] while in America birth length is greater among neonates born in winter/spring than those born in summer/autumn [149]. Seasonal variations in maternal vitamin D status are reflected in neonatal bone mineral content [150e152], though the patterns observed in different populations are not consistent. In Korea, where women are at risk of vitamin D deficiency in the winter, lower total body bone mineral content and higher bone turnover were observed in winter-born neonates [150]. Conversely, in American studies, neonates born in the winter had higher bone mineral

PEDIATRIC BONE

231

LACTATION

content and lower bone turnover than those born in the summer [151,152]. The differences in these findings may indicate that there is a vulnerable period to vitamin D insufficiency in early gestation [65] or that there is greater use of vitamin D supplements by American women in winter [150] or that they reflect other seasonal factors unrelated to vitamin D. Newborns of mothers at risk of vitamin D deficiency given a vitamin D supplement during pregnancy have higher serum calcium concentrations than those of mothers who have not been supplemented [143,145,153]. Vitamin D supplementation of British Asian mothers, who are at risk of vitamin D deficiency, resulted in smaller fontanels and a trend to higher birth weight in their newborns compared to controls [153]. The influence of season and maternal vitamin D status on infant growth appears to be long lasting. In a follow up of the British Asian study, the children born to the vitamin D-supplemented mothers were heavier and longer at 1 year than those born to control mothers [154]. Lower vitamin D status in pregnant British women was associated with lower whole body and lumbar spine bone mineral content in their children at 9 years of age [155], and winter/spring born American infants were heavier, taller and had larger head circumference at seven years of age than those born in summer/autumn [149].

nutritional environment in utero and in early life, in addition to influencing the risk of adult chronic diseases [165], may be an important modulating factor of skeletal growth in childhood and of bone health in old age.

LACTATION Mineral Metabolism and Bone Biochemistry Major changes in mineral and bone metabolism occur for several months postpartum (Figs 10.2 and 10.3). The pattern of change is dependent on whether the mother chooses to breastfeed and, if lactation is initiated, on the pattern of breastfeeding adopted by the mother. Likely lactation-associated variables include the duration of exclusive breastfeeding, the timing of introduction of other foods to the infant (as a complement to breastfeeding), breastfeed frequency (which will vary with stage of lactation), the initiation of replacement of breastfeeding by other meals (when breastfeeding frequency is reduced), and the timing of cessation of breastfeeding. The term weaning is ambiguous because it is used variously to describe the process of introducing the infant to solid foods, the transition period between introducing solid foods and the cessation of breastfeeding, and the cessation of breast-feeding.

General Nutrition

Suckling

Maternal undernutrition, in a general sense, has a major impact on fetal growth and birth weight, and hence on skeletal mass. With respect to bone formation, an adequate supply of protein and energy is required for collagen matrix synthesis, in addition to provision of the elements required for bone mineralization [156]. Poor nutrition during pregnancy may reduce neonatal bone density as well as size [156,157]. A detailed discussion of the relationship between maternal nutrition and fetal growth, and the extent and limitations of adaptive mechanisms is beyond the scope of this chapter, but nutritional interventions aimed at preventing or treating impaired fetal growth have been subjected to systematic analysis and review [158,159]. The intakes of specific foods in pregnancy, such as milk, milk products, pulses and green-leafy vegetables have been related to high bone mineral status in the infant [160] and child [161]. Deficiencies of specific nutrients, such as folic acid and other micronutrients, and their replenishment through supplementation, can also influence fetal bone growth and development, and are associated with increases in weight, size, bone mineral content and indices of calcium and bone metabolism at birth [159,162] and later in childhood [161]. Size at birth and in infancy predicts adult bone mineral mass, probably through tracking of skeletal size through childhood [163,164]. This suggests that the

↑ prolactin

↓ GnRH

↑ PTHrP

↓ estrogen

↑ bone resorption

↑ blood Ca++

↓ PTH

↑ Ca++uptake by mammary tissue

milk calcium

FIGURE 10.2 Schematic representation of the proposed mechanism by which the infant regulates calcium release from maternal bone and provision to the mammary gland for milk production (reproduced with permission from Kalkwarf [166]).

PEDIATRIC BONE

232

10. PREGNANCY AND LACTATION

Estrogen repletion

alterations in mineral and bone metabolism postpartum, changes in lactating women cannot be attributed solely to a response to lactation because they may be a consequence of having recently been pregnant. Also, because non-lactating women may experience changes as a result of not initiating breastfeeding or stopping breastfeeding early, in addition to no longer being pregnant, comparisons between lactating and non-lactating postpartum women can obscure or exaggerate the response to lactation.

↑ osteoblast activity

↑ Ca-uptake into bone

↓ serum Ca++

Calcium

↑ PTH

↑ 1,25 (OH)2D

↑ renal Ca++ reabsorption

↑ intestinal Ca++ absorption

FIGURE 10.3 Schematic representation of the proposed mechanism that increases bone mineral after weaning permission from Kalkwarf [166]).

(reproduced with

The main metabolic and biochemical differences for breastfeeding mothers during full lactation (first 3e6 months) and during the periods before and after cessation of breastfeeding are summarized in Tables 10.2 and 10.3. Interpretation is made difficult by the paucity of studies in which markers of mineral metabolism and bone biochemistry in lactation are compared to prepregnant levels within the same individual. In general, comparisons are made either with women of similar age and characteristics who have not recently been pregnant or to mothers at the same stage postpartum who are not lactating. Data using these two comparative groups are shown in Tables 10.2 and 10.3. It should be appreciated that because non-lactating women may experience TABLE 10.2

Calcium absorption and urinary calcium excretion decline from the high levels of pregnancy to prepregnancy levels after delivery [15,17,19,81,167,168]. The decrease in urinary calcium output partly reflects the reduction in glomerular filtration rate after parturition [22]. Further decreases in total urinary calcium output, and reductions in fasting calcium excretion, have been reported for breast-feeding women [17,20,40,42,65,169e171]. This finding has not been observed in all studies, particularly those that have made comparisons with non-lactating mothers at the same stage postpartum [18,172e175]. Serum ionized and total calcium concentrations are raised in lactation compared to late pregnancy and normal controls [17,20,122,126,171], whereas studies comparing lactating and non-lactating mothers at the same stage postpartum have reported no differences [172,174]. Studies comparing serum calcium in lactation and prepregnancy show either an elevation or no difference [17,18]. Taken together, the data suggest that the first 3e6 months of breastfeeding are, or can be, associated with increased renal conservation of calcium but not with increased calcium absorption. The period immediately following the cessation of breastfeeding and, for women who breastfeed for 6e12 months or more, the later months of lactation may be

Calcium and Bone Metabolic Changes in Human Lactation During 3e6 Months of Full Breastfeeding NP

NL

NP

NL

Calcium absorption

4

4

Serum 1,25 (OH)2 vitamin D (free and bound)

4Y

[4

Urinary calcium excretion, daily

4Y

4

Serum parathyroid hormone (intact)

4Y

4Y

Fasting urinary calcium, creatinine corrected

Y

nk

Serum parathyroid hormone-related protein

[

[

Serum calcium (ionized)

[4

4

Nephrogenous cyclic AMP

[4

[

Serum calcium (total)

[4

4

Serum calcitonin

[4

4

Tubular phosphate reabsorption

[

4Y

Bone resorption markers*

[

[

Urinary phosphate excretion

Y

[

Bone formation markers (not osteocalcin)**

[

[

Serum phosphate

[

[4

Osteocalcin (intact)

4

[

* Urinary collagen cross-links, telopeptides, hydroxyproline, serum tartrate-resistant acid phosphatase. ** Serum bone alkaline phosphatase and procollagen peptides. nk¼not known Data for lactating women compared to not-recently pregnant women (NP) and to post-pregnant mothers who did not lactate (NL).

PEDIATRIC BONE

233

LACTATION

TABLE 10.3

Calcium and Bone Metabolic Changes in Human Lactation During the Later Stages or After the Cessation of Breastfeeding NP

NL

NP

NL

Calcium absorption

4

[

Serum 1,25 (OH)2 vitamin D

[

[4

Urinary calcium excretion, daily

4Y

4

Serum parathyroid hormone (intact)

[4

[4

Fasting urinary calcium, creatinine corrected

4Y

nk

Serum parathyroid hormone-related protein

nd

nd

Serum calcium (ionized)

4

nk

Serum calcitonin

4

4

Serum calcium (total)

4

4

Nephrogenous cyclic AMP

4

4

Tubular phosphate reabsorption

[4

4

Bone resorption markers*

4

[4

Urinary phosphate excretion

4Y

4

Bone formation markers (except Oc)**

4

[4

Serum phosphate

4Y

4

Osteocalcin

4

[4

* Urinary collagen cross-links, telopeptides, hydroxyproline, serum tartrate-resistant acid phosphatase. ** Serum bone alkaline phosphatase and procollagen peptides. nd¼not detectable, nk¼not known Data for lactating women compared to not-recently pregnant women (NP) and to post-pregnant mothers who did not lactate (NL).

a time of recovery when the changes in calcium and bone metabolism are relaxed and calcium retention is increased. Some studies have reported decreases in calcium excretion in women after breastfeeding has stopped [18,171]. Others indicate that urinary calcium output increases during long lactation and after the cessation of breastfeeding to prepregnancy levels or to levels typical of women of the same age who have not recently been pregnant [17,169,176]. A study comparing women in the period after breastfeeding to mothers at the same stage postpartum but who had not breastfed found no differences in urinary calcium excretion or serum calcium concentration [174]. Increased calcium absorption efficiency has been observed 2 or 3 months after the cessation of breastfeeding [168] but not in all studies [17,18] and not 6 months or longer after breastfeeding has stopped [167]. The return of ovarian function may complicate the findings, although the picture is not clear-cut [166]. The resumption of menstruation has been associated with decreased urinary calcium excretion [17,171] and higher calcium absorption efficiency [166] but not in all studies [17,174]. Use of oral contraceptives containing ethinyl estradiol by lactating women has been associated with reduced urinary calcium excretion [169]. Interpretation of changes in calcium metabolism during and after human lactation may be further complicated by alterations in dietary intake of calcium and other nutrients during and after lactation and, in many studies, by small subject numbers. Phosphorus, Magnesium, and Zinc Lactating women have greater tubular reabsorption, reduced urinary excretion of phosphate, and elevated serum phosphate compared with women who have not recently been pregnant [171,173,176]. Compared to non-lactating mothers at the same stage postpartum, breastfeeding women have similar or raised serum

phosphate concentrations [10,172,174] and increased urinary phosphate excretion [172]. Tubular phosphate reabsorption is decreased [174] or unchanged [172]. In the later stages of lactation and after the cessation of breastfeeding, serum and urinary phosphate levels normalize [171,173,176] and may be reduced compared to prepregnancy, with an increase in tubular phosphate reabsorption [18]. The picture for phosphorus therefore resembles that of calcium in that lactation is marked by renal conservation with normal or raised serum concentrations, with no evidence of changes in intestinal absorption. Similarly, urinary magnesium excretion appears to be reduced [177] or unaffected by lactation [18,169]. Lactating women have been reported to excrete less zinc than non-lactating mothers and women who have not recently been pregnant [169], but not in a longitudinal study comparing zinc excretion in lactation with that in preconception [41,42]. The potential for conserving endogenous zinc by reducing renal excretion is regarded as limited [139]. However, in contrast to calcium and the other minerals, zinc absorption efficiency has been shown to increase markedly in early lactation compared to late pregnancy and to preconception levels [42,139,140] and for there to be greater intestinal conservation of endogenous fecal zinc in lactating mothers with a low zinc intake [139]. Bone Turnover Biochemical markers of bone turnover are elevated in the first months of lactation compared to those of nonlactating mothers and to controls who were not recently pregnant [171,175,178,179]. Indices of bone resorption (e.g. cross-linked amino-terminal telopeptide of procollagen 1 (NTX), cross-linked carboxy-terminal telopeptide of type 1 collagen (CTX), carboxy-terminal telopeptide of type 1 collagen (1CTP), deoxypridinoline

PEDIATRIC BONE

234

10. PREGNANCY AND LACTATION

and hydroxyproline) and of bone formation (e.g. osteocalcin, amino-terminal telopeptide of procollagen 1 (P1NP), carboxy-terminal propeptide of type 1 collagen (P1CP), and bone alkaline phosphatase) have been studied. Some changes are evident after delivery even in women who do not breastfeed [172,174,179]. Longitudinal studies suggest that bone turnover in early lactation is similar to or greater than that at the end of pregnancy and is higher than that of prepregnancy [17,18,52]. Measured osteocalcin concentration is at variance with other markers because, although it is elevated in lactation compared to non-lactating controls, this represents an increase from the low concentrations observed in pregnancy to levels similar to those prepregnancy [17,18,48,51]. The length of lactation and the duration of postpartum amenorrhea influence the patterns of changes of these markers, which occur for longer and are more pronounced in those who breastfeed for a longer time and in those whose menses return later [48,178,180]. The concentrations of bone turnover markers decline after 6e12 months, even in women who continue to breastfeed for 18 months or longer [176]. The levels also decline when lactation stops, but differences have been observed for several weeks after the cessation of breastfeeding between mothers who lactated and those at the same stage postpartum who did not [174,178]. There is evidence of an asynchrony in the patterns of change between resorption and formation in the postpartum period, with the peak of resorption preceding that of formation by several weeks [52,174,176,180,181]. Such a pattern would allow for the release of mineral from bone, followed by its restitution after a period of time (as described later) [176]. However, other explanations have been proposed for bone loss in the face of these increases in both bone resorption and formation, a pattern that distinguishes lactation from pathological bone loss where marked decoupling of resorption and formation occurs [179]. These include the possibility that completion of osteoblast differentation and osteoid mineralization does not occur during lactation in spite of accelerated initiation of the osteoblast program in the bone remodeling unit, and that the accumulated pre-osteoblasts rapidly proceed to complete the differentiation cycle after lactation stops [179]. Calciotropic Hormones Serum PTH and 1,25-dihydroxyvitamin D concentrations are not elevated in lactating women compared to preconception concentrations in the same individual or to levels in women who have not recently been pregnant, and they may be slightly depressed [17,18,58,167,172,176,182,183]. Similar or higher concentrations of 1,25-dihydroxyvitamin D have been reported in lactating women compared to non-

lactating mothers [168,172,182e185], but similar or slightly decreased compared to prepregnancy or nonpregnant, non-lactating women [17,172,176,183]. PTH is similar or lower in lactating women than in nonlactating women [174,183] and in women before pregnancy or who have not been pregnant recently [17,172,176,182,183,186]. Raised serum CT concentrations in early lactation have been reported in some studies [40,176], but not in others [17,172,187]. Elevated or normal NcAMP production indicates enhanced PTH-like activity during lactation in the face of normal or lowered PTH concentrations [171,174]. Mothers who are breastfeeding twins have elevated concentrations of PTH, 1,25-dihydroxyvitamin D, and calcitonin compared to women nursing singletons [188]. In general, however, postpartum changes in the three calciotropic hormones do not correlate with the response to lactation as indicated by bone turnover markers, bone mineral content, or breast milk calcium concentration [172,176,183,187]. The later stages of lactation and the period following the cessation of breastfeeding have been associated with increased serum PTH and 1,25-dihydroxyvitamin D concentrations [18,171,176], although this finding is not consistent [182,183] and no changes are seen in serum CT concentration [17,172]. Increases in PTH and 1,25dihydroxyvitamin D have been reported by 6 months of lactation, with 1,25-dihydroxyvitamin D concentrations exceeding those of non-lactating mothers by this stage postpartum [174]. Other studies show no difference by breastfeeding status [183]. No difference in NcAMP production has been noted between women who have recently stopped breastfeeding and either non-lactating controls or women who have not recently been pregnant [171,174]. It therefore appears that the changes in calcium and bone metabolism observed in lactation are not driven by the classical PTHevitamin D endocrine system and that other hormonal mechanisms must be involved in regulating calcium homeorhesis. There is evidence that PTH and 1,25-dihydroxyvitamin D may continue to play a role in the homeostatic regulation of serum calcium in response to a change in calcium load [174]. There is also evidence that PTH and 1,25-dihydroxyvitamin D may play a role during the period of recovery toward the end of lactation and after breastfeeding stops or in situations in which the demand for breast milk production is particularly high. However, it is clear that, as with pregnancy, current knowledge does not support the early concept that human lactation is a period of physiological hyperparathyroidism [189]. PTHrP is regarded as a prime candidate for the role of principal regulator of calcium and bone metabolism in lactation [173,190,191]. It is produced by the lactating mammary gland, possibly under the influence of

PEDIATRIC BONE

235

LACTATION

progresses [183], and there is little evidence of synchronization between the skeletal response and the pattern of changes in these hormones. There is evidence that breastfeeding mothers who have resumed menstruation, and therefore have normalized estrogen levels, have higher serum 1,25-dihydroxyvitamin D concentrations than those who have not [174], but this has not been observed in all studies [168]. In addition, estrogen deficiency in non-pregnant, non-lactating women of reproductive age resulting from GnRH agonist therapy causes increased calcium excretion with suppression of PTH and 1,25-dihydroxyvitamin D, a pattern that does not resemble the metabolic response to lactation [20]. It is likely that the observed changes seen in lactation are due to the combined effects of many different factors.

Effect on the Maternal Skeleton Physiological Changes Human lactation is accompanied by significant decreases in maternal bone mineral content during the first 3e6 months, as shown by prospective, longitudinal studies [52,88,91,170e172,175,195e203]. The reductions are particularly pronounced in the axial skeleton, where average decreases of 3e5% have been observed at the spine and hip (Fig. 10.4). Changes in appendicular sites are less marked or absent. Whole-body bone mineral content is generally decreased by approximately 0.5e1%. For a typical woman, this represents Effect of lactation on bone mineral content 4

Cambridge Mean±SE, n=38

Lumbar spine

2 Change in BMC (%)

prolactin, and is secreted into breast milk and released in significant amounts into the maternal bloodstream [173,192,193]. PTHrP has PTH-like activity in the kidney, where it stimulates renal calcium conservation, increases urinary phosphorus excretion, and elevates NcAMP production [174]. Serum PTHrP concentration is higher in lactating women than in non-lactating postpartum women [183,190,191] and in those who are postlactation [173]. The possibility that PTHrP derived from the mammary gland plays a key role in calcium metabolism during lactation is supported by a clinical case report of a woman with PTH deficiency whose requirement for supplemental calcium and 1,25-dihydroxyvitamin D abated during lactation, a circumstance that was attributed to her elevated concentration of PTHrP [194]. In addition, women with pseudohypoparathyroidism, who are resistant to the amino-terminal actions of PTH and PTHrP, reportedly do not show the expected lactational changes in calcium metabolism [22]. However, evidence regarding the importance of PTHrP in lactation is inconsistent. Subcutaneous administration of PTHrP(1e36) to non-pregnant, non-lactating women elevates serum 1,25-dihydroxyvitamin D concentration, increases urinary phosphate and calcium excretion, and decreases serum phosphate [73]. This pattern of changes does not resemble the metabolic response to lactation. One study of lactating women demonstrated that higher PTHrP concentrations were associated with higher prolactin concentrations, lower estradiol concentrations, and greater bone mineral changes, with no correlation with calciotropic hormone concentrations [183,190]. In contrast, serum PTHrP concentration has been shown to decrease over time in all postpartum women and becomes virtually undetectable after approximately 6 months, even in those who continue to breastfeed [183]. In addition, no correlations have been demonstrated between PTHrP and other biochemical indices or bone mineral changes during established lactation [181,190], although an inverse correlation was observed with PTH during the initiation of lactation (2 or 3 days postpartum) [181]. However, the biology of PTHrP is complex, and it exists as a family of closely related peptides, all originating from the PTHrP gene but each with its own distinct physiological functions [72]. It is likely that investigations of PTHrP in relation to lactation have been limited by the assay systems used, and more studies are needed. Lactation is associated with changes in many other hormones and factors, and these may be involved in regulating the changes in maternal calcium and bone metabolism. For example, elevated prolactin and low estradiol levels are characteristic of the early stages of lactation and both have recognized effects on calcium and bone metabolism. However, the concentrations of prolactin and estradiol tend to normalize as lactation

Whole body

0

Femoral neck

–2

–4

–6

0

13

26

39

52

65

W eeks post-partum

FIGURE 10.4 Effect of lactation on change in maternal bone mineral content (BMC) in British women. Data represent the percentage change in BMC from 0.5 months postpartum (mean  SE) at 3, 6, and 12 months postpartum for 38 women who breastfed exclusively for at least 2 months (reproduced with permission from Prentice et al. [6]).

PEDIATRIC BONE

236

10. PREGNANCY AND LACTATION

a mobilization of approximately 5e10 g of calcium which, when averaged over a 3-month period, equates to approximately 50e100 mg/day. The corresponding data for the release of phosphorus, assuming a Ca:P ratio in adult bone of 2.3:1 g/g [3], are approximately 2e4 g overall and 20e40 mg/day averaged over 3 months. These rates of change are remarkably rapid, given that menopausal bone loss is typically 1e3% per year. The magnitude and duration of the skeletal response are greater in women who breastfeed longer [190,196,203] and who produce larger volumes of breast milk [204]. The effects are attenuated or do not occur in mothers who do not breastfeed [52,196,198], indeed, increases in bone mineral content have been reported [196,205]. On an individual basis, the bone changes associated with lactation are highly variable, with some women losing up to 10% at the spine and with others experiencing little alteration in bone mineral content, even when exclusively breastfeeding for several months [6]. The reasons for this interindividual variability are not known. Predictors that have been identified in some studies, but not all, include maternal height [204], age, and parity [203]. Lactation-associated bone loss is recovered during late lactation and after breastfeeding stops [170,195,196,199]. For women who conceive during lactation, increases in bone mineral are observed during the following pregnancy [83]. At most skeletal sites, women have a higher bone mineral status after breastfeeding has stopped for at least 2 or 3 months than immediately after delivery [196,199]. Exceptions occur at the femoral neck and wrist, where bone mineral status tends to be lower later in lactation [91,196,201] and after the cessation of breastfeeding [196] than immediately postpartum. However, similar changes at these sites are observed in mothers who do not breastfeed, and there is no evidence that duration of lactation, or lactation itself, is a determinant of a mother’s bone mineral status after lactation [196,199]. Furthermore, breastfeeding among adolescent mothers is not associated with decreased hip bone mineral density compared with adolescent mothers who did not breastfeed [206]. There has been considerable debate about whether the trigger for the recovery of bone mineral is cessation of breastfeeding or the return of ovarian function. However, the strong interrelation between length of lactation and duration of amenorrhea makes it difficult to examine their influence independently. It is possible that neither factor is directly involved but provides information about some aspect of lactation behavior, such as suckling frequency or intensity [196]. This leads to difficulties in interpreting studies of long-term bone changes because of differences in the timing of the final measurement. This has been defined variously relative to the cessation of breastfeeding, the onset of regular menstruation, or delivery, with no control of the other

variables [17,86,99,195,196,200,201,207]. In a study in which all women fully breastfed for 6 months and stopped breastfeeding soon afterwards, those with an early return of menses had smaller decreases in bone mineral content from the spine by 6 months of lactation but gained less afterward [199]. By 18 months, there was no difference between these women and those mothers with a later return of menses. This adds to the evidence that there are different patterns of bone loss and gain depending on a number of reproductive and lactationassociated factors. Osteoporosis in the Postpartum Period In osteoporosis of pregnancy, symptoms often develop during the postpartum period and are more common among women who are breastfeeding [208]. In one study, more than half the patients had onset of symptoms after delivery and approximately threefourths breastfed [208]. A combination of increased plasma PTHrP concentration and a low bone mineral density has been implicated in postpartum-onset osteoporosis of pregnancy [209], but case reports have not addressed whether the patients had an exaggerated response compared to healthy mothers who had breastfed for a similar amount of time. As for pregnancy-onset osteoporosis, there is no evidence that these effects are influenced by dietary calcium intake or other environmental factors [98,104,210]. Effect of Lactation on Later Bone Health There is conflicting evidence about the possible effects of lactation on the later bone health of the mother. Retrospective studies of pre- and postmenopausal women have associated lactation history and duration of breastfeeding with increased bone mineral [107,211,212], with decreased bone mineral [213e215], or with no effect [107,110,201,216,217]. No association has been observed between lactation history and risk of spinal deformity [118]. Postmenopausal women who breastfed when younger appear to be at lower risk of hip fracture than women who had children but did not breastfeed, with the protective effect increasing with duration of lactation [115,119,218]. The lack of consistent definitions and the failure adequately to control for confounding factors, such as obesity and estrogen use, make interpretation of these studies difficult [6,106]. The term lactation encompasses a range of breastfeeding behaviors that differ in the duration of exclusive and partial breastfeeding, the number of breastfeeds given per day, the time at which other foods are introduced, the extent to which they are used, and the lactational performance of the mother. There are marked social class differentials in breastfeeding incidence and in body size that may confound the associations between bone mineral measurements and lactation history

PEDIATRIC BONE

LACTATION

[6,117,219]. In addition, few studies have investigated the possibility that pregnancy and lactation may only pose a risk for later osteoporosis in women with a low intake of calcium or with other potentially adverse diet and lifestyle characteristics. In studies that have attempted to explore such interactions, no effects of low calcium intake have been identified [220]. However, women with a low customary calcium intake in developing countries who have many children and long lactation periods are not at increased risk of low bone mineral status or osteoporotic fractures in later life compared with women in Western countries [221e223].

Secretion of Minerals in Breast Milk Calcium is present in breast milk predominantly (60e70%) in a diffusible form, either as ionized calcium or associated with small inorganic ions such as citrate and phosphate [224,225]. The remaining 30e40% is associated with casein and whey proteins, such as a-lactalbumin and serum albumin. This contrasts with bovine milk, in which 60e70% of calcium is associated with casein. This is due in part to the fact that the caseins of human milk (which are 75% b- and 25% k-casein) bind less calcium per molecule than the caseins of bovine milk (which are 50% a-, 37.5% b-, and 12.5% k-casein). Phosphorus is a constituent of phospholipids and caseins, and it is also present as ionic phosphate and orthophosphate. Magnesium is mainly found as the free ion or bound to citrate and phosphate, with a small proportion associated with lipids and membranes [224]. The compartmentation of zinc in human milk is unclear, but at least 25% occurs in the fat layer. Because some breast milk calcium, phosphorus, magnesium, and zinc is associated with the fat layer, particularly in stored samples, it is essential to use whole milk for the measurement of breast milk concentrations [226] and, in the case of zinc, to take precautions to collect samples containing a representative amount of fat. The calcium concentration of breast milk remains relatively constant during the first 6e12 weeks of lactation but declines progressively thereafter [6,227,228]. There are geographical variations in breast milk calcium concentration. Average values at 2 or 3 months of lactation range from 300 mg/L in regions of the USA and Europe to 200 mg/L in areas of Africa and Asia [6,229]. Regional differences of similar magnitude have also been observed within the same country [6]. In addition, individual women differ in their breast milk calcium concentration, and these differences are maintained throughout the lactation period [6]. Typically, there is a twofold range of calcium concentrations between women from the same community measured at the same stage of lactation; this variation is threefold when women are compared across regions. Associations

237

have been reported between breast milk calcium concentration and the concentrations of PTHrP in breast milk [230,231] and plasma [232], but the major determinants of an individual’s breast milk calcium concentration are likely to be those that regulate the casein, phosphate and citrate contents of breast milk [225]. The total amount of calcium transferred from the mother to her breastfed infant depends on both the calcium concentration and the quantity of breast milk consumed; there is no relationship between the two [6,233,234]. Since both the calcium concentration and the volume of breast milk produced differ between women, there is a large variation in the amount of calcium secreted into breast milk on a daily basis. Quantitative measurements of breast milk calcium intake in healthy, exclusively breastfed infants from the UK and The Gambia resulted in a range of 79e450 mg/day [6]. Breast milk concentrations of phosphorus, magnesium, and zinc also decline as lactation progresses [13,235e238]. The following are typical concentrations at 3 months of lactation: phosphorus, 150 mg/L; magnesium, 30 mg/L; and zinc, 2 mg/L [13,229,238]. These correspond to intakes of these minerals by a child consuming 0.8 liters of breast milk per day of 120, 25, and 1.6 mg/day, respectively. In Western women, the ratio of breast milk calcium to phosphorus is approximately 2:1 mg/mg, and this remains relatively constant throughout the lactation period [236]. Studies in Africa suggest that women from developing countries may have a lower ratio of calcium to phosphorus, which declines further during lactation [236,237].

Other Modulators of Bone Growth in Breast Milk The breast milk of well-nourished mothers contains all the nutrients required to support infant growth for at least the first 6 months of life [239]. In addition, breast milk contains hormones and growth factors that may promote bone development. Examples include PTH, calcitonin, thyroid hormones, IGF, and transforming growth factor [240]. Breastfed infants have higher circulating concentrations of osteocalcin than formula-fed infants, which suggests that they have higher rates of bone turnover [241].

Influence of Maternal Diet and Nutritional Status on Mineral Metabolism and Breast Milk Production of the Lactating Mother Calcium The evidence to date suggests that maternal calcium intake does not modify the biochemical response to human lactation. Lactating women have an exaggerated

PEDIATRIC BONE

10. PREGNANCY AND LACTATION

reduction in urinary hydroxyproline excretion and decreased calciuric response to an acute oral calcium load but similar calcemic response compared to nonpregnant, non-lactating control women [70]. However, there is no indication that this pattern differs depending on the mother’s calcium intake. Randomized, controlled intervention studies, conducted in women with high and low customary calcium intakes, have shown no effects of an increased calcium supply on bone turnover markers, serum mineral concentrations, fractional calcium absorption, or renal calcium handling [168,170,174,176,197,242]. Calcium supplementation produced a similar decrease in PTH and 1,25-dihydroxyvitamin D concentrations in lactating and non-lactating American mothers [174], whereas no significant effect of supplementation on calciotropic hormone levels or intestinal calcium absorption efficiency was seen in Gambian women [176,242]. In a small study, breast milk PTHrP concentration was not altered by calcium supplementation, suggesting that maternal calcium intake does not influence the production of this hormone in the mammary gland [193]. The pattern of bone loss and gain that accompanies lactation is also independent of the current calcium intake of the mother [6,243,244]. Lactating women with high customary calcium intakes exhibit the typical changes in bone mineral, as do those who consume calcium supplements [91,197,199,200,204]. Randomized, placebo-controlled studies have demonstrated little effect of calcium supplementation on the magnitude of bone changes during and after lactation [170,197,198,245]. Calcium supplementation postpartum produces a small increase in bone mineral status [198,199], but this is seen in both lactating and nonlactating women [198] and is likely a bone remodeling transient effect [199,246]. Conversely, calcium supplementation in the preceding pregnancy among Gambian women with a very low customary intake has been associated with more accentuated lactational bone changes in the mother, especially at the spine and distal radius [126]. Most observational studies have found no correlation between lactational bone changes and maternal calcium intake [91,195,196,200,204]. Where associations have been reported [171,247], these have been in bone mineral status and not in the magnitude of the lactational bone response, and they probably reflect the interrelationships between bone mineral density, body size, and dietary intake [219]. Adolescent mothers may be an exception because a high calcium intake was associated with an attenuated bone response in teenage American mothers compared with those with lower intakes [248]. However, no differences have been observed between teenage and adult lactating Gambian women in their response to calcium supplements, despite their very low customary calcium intake [170,176].

Similarly, the amount of calcium transferred into breast milk is not dependent on the calcium intake of the breastfeeding mother. Although breast milk calcium concentrations tend to be lower in countries in which the customary diet is low in calcium, and some observational studies have reported sig