OXYGEN SENSING MOLECULE TO MAN
ADVANCES IN EXPERIMENTAL MEDICINE AND BIOLOGY Editorial Board: NATHAN BACK, State Univ...
65 downloads
1307 Views
12MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
OXYGEN SENSING MOLECULE TO MAN
ADVANCES IN EXPERIMENTAL MEDICINE AND BIOLOGY Editorial Board: NATHAN BACK, State University of New York at Buffalo IRUN R. COHEN, The Weizmann Institute of Science DAVID KRITCHEVSKY, Wistar Institute ABEL LAJTHA, N. S. Kline Institute for Psychiatric Research RODOLFO PAOLETTI, University of Milan Recent Volumes in this Series Volume 467 TRYPTOPHAN, SEROTONIN, AND MELATONIN: Basic Aspects and Applications Edited by Gerald Huether, Walter Kochen, Thomas J. Simat, and Hans Steinhart Volume 468 THE FUNCTIONAL ROLES OF GLIAL CELLS IN HEALTH AND DISEASE: Dialogue between Glia and Neurons Edited by Rebecca Matsas and Marco Tsacopoulos Volume 469 EICOSANOIDS AND OTHER BIOACTIVE LIPIDS IN CANCER, INFLAMMATION, AND RADIATION INJURY, 4 Edited by Kenneth V. Honn, Lawrence J. Marnett, and Santosh Nigam Volume 470 COLON CANCER PREVENTION: Dietary Modulation of Cellular and Molecular Mechanisms Edited under the auspices of the American Institute for Cancer Research Volume 471 OXYGEN TRANSPORT TO TISSUE XXI Edited by Andras Eke and David T. Delpy Volume 472 ADVANCES IN NUTRITION AND CANCER 2 Edited by Vincenzo Zappia, Fulvio Delia Ragione, Alfonso Barbarisi, Gian Luigi Russo, and Rossano Dello Iacovo Volume 473 MECHANISMS IN THE PATHOGENESIS OF ENTERIC DISEASES 2 Edited by Prem S. Paul and David H. Francis Volume 474 HYPOXIA: Into the Next Millennium Edited by Robert C. Roach, Peter D. Wagner, and Peter H. Hackett Volume 475 OXYGEN SENSING: Molecule to Man Edited by Sukhamay Lahiri, Naduri R. Prabhakar, and Robert E. Forster, II
A Continuation Order Plan is available for this series. A continuation order will bring delivery of each new volume immediately upon publication. Volumes are billed only upon actual shipment. For further information please contact the publisher.
OXYGEN SENSING MOLECULE TO MAN Edited by
Sukhamay Lahiri University of Pennsylvania Medical Center Philadelphia, Pennsylvania
Nanduri R. Prabhakar Case Western Reserve University Cleveland, Ohio
and
Robert E. Forster, II University of Pennsylvania Medical Center Philadelphia, Pennsylvania
KLUWER ACADEMIC PUBLISHERS NEW YORK, BOSTON, DORDRECHT, LONDON, MOSCOW
eBook ISBN: Print ISBN:
0-306-46825-5 0-306-46367-9
©2002 Kluwer Academic Publishers New York, Boston, Dordrecht, London, Moscow
All rights reserved
No part of this eBook may be reproduced or transmitted in any form or by any means, electronic, mechanical, recording, or otherwise, without written consent from the Publisher
Created in the United States of America
Visit Kluwer Online at: and Kluwer's eBookstore at:
http://www.kluweronline.com http://www.ebooks.kluweronline.com
PREFACE By a close vote in Chile, 1996, the membership decided to hold the XIV meeting of the International Society of Arterial Chemoreception (ISAC) in Philadelphia,, USA, with Sukhamay Lahiri as its president. The XIV meeting of the ISAC was held on June 24-28, 1999, in Philadelphia. Since its inception, these meetings have been focused on arterial chemoreceptors and their functions. This time, it was expanded to include oxygen sensing in other tissues and cells in the body, and the genes involved. This genetic flavour made the meeting more exciting, and it was attended by more than two hundred participants at a time. The idea was to bring together scientists from cellular and systemic boundaries of physiology, working at the interface of cellular and molecular biology. As a result, a new conference was born and the title of the conference was Oxygen Sensing: Molecule to Man. The organizers of the conference were Sukhamay Lahiri and Nanduri Prabhakar, Dr. Robert W. Torrance died on January 8, 1999. C.C. Michel who was a student of his and was close to him presented a Tribute. Two other students of his, Mark Hanson and Prem Kumar, also wrote reminiscences. Bob also collaborated with Patricio Zapata in Chile occasionally during the last few years. Patricio and Carolina also wrote a reminiscence. Bob was a founder member of the ISAC, and as the president of the Oxford meeting, 1966, when he wrote a seminal article, prolegomena, reviewing the state of knowledge of arterial chemoreception at that time. This article was a landmark in the history of chemoreception. One special feature of the symposium was that twelve experts had been asked to write articles for a volume of Respiration Physiology pertaining to the symposium, which was precirculated to the participants. This volume gave a preview of the symposium, thanks to the Editor of Respiration Physiology, Dr. Peter Scheid. It was to provide a focus for the participants and background reading for the forthcoming
meeting.
The first two days of the symposium were devoted to the genes and genetic expression of oxygen sensing, beginning with systemic phenomena in man and animals. It quickly went onto bacteria and yeast, bringing out how similar their oxygen sensing was to the mammals at the molecular level. As the meeting proceeded, it became clear that oxygen sensing in mammals can be divided primarily into two distinct categories: one is the membrane based NAD(P)H oxidase systems and another is mitochondrial. These were present in various cells and systems. A controversy arose as to how more oxygen radicals are generated during hypoxia. It was felt that the differences probably pertained to demanding methods using fluorescent dye. Potassium ion channels figured most prominently in the glomus cell membrane depolarization. Inhibition of the classical oxygen sensitive potassium currents did not inhibit oxygen sensing, as a result the role of voltage insensitive leak potassium current was v
resurrected, in addition to the of voltage sensitive HERG–like potassium current in all the glomus cells. Several features of glomus cells fit the criteria of oxygen chemoreceptors but their sensory discharge did not always fit these criteria. It was therefore proposed that sensory nerves may be the ultimate sensors whereas glomus cells play only a secretory role, but recoding from the petrosal ganglion cells did not support this notion. There were fourteen papers from the young investigators competing for the awards, four of whom were judged winners by the audience: two for the Heymans-de Castro-Neil Awards, (Beth Ann Summers and Roger J. Thompson) and two for Comroe, Forster & Lambertsen Awards (Ricardo Pardal and Nicholas A. Ritucci). There was a roundtable conference at the end of the second day, discussing the genomic aspects. A similar roundtable conference was originally planned to take place at the end of fourth day but by then there had been so much discussion that it was felt unnecessary. The original gramophone recordings of the carotid body sensory discharged, which were made in the 1930s by Drs. Zotterman, von Euler,and Liljestrand, were played to the audience at the banquet. We are grateful to Professor Curt von Euler, Karolinska Institut, Stockholm, Sweden, for the gift. The council of the ISAC met and at a business meeting the membership decided on the venue of the next meeting which is to be Lyon, France, in 2002, with Jean-Marc Pequignot as its president. Tentatively the meeting after that is to be held
in Kita-kyushu, Japan,in 2005. There will be a section on Arterial Chemoreception at IUPS Meeting in New Zealand,in 2001. The Symposium was only possible because of the funds made available to us by generous gifts, particularly from the Barra Foundation, US Army Research Administration, Ecosystems Tech Transfer, Inc.,and by Merck & Company, and for the contribution of David E. Millhorn. The Division of Lung Diseases National Heart, Lung,and Blood Institute provided a conference grant (R13-III–60955). We are also fortunate to have received additional anonymous donations. We are grateful to them all. Finally, we are grateful to the participants who came and contributed to the success of the Symposium. Special thanks are due to Mrs. Mary Pili (University of
Pennsylvania, Philadelphia, PA., USA) and Mrs. Marianne Sperk (Case Western Reserve University, Cleveland, Ohio, USA) and Mrs. Michele Deparc, Ruhr-University at Bochum, Germany, for their secretarial managements.
The Editors Sukhamay Lahiri (Philadelphia, PA, USA) Nanduri R. Prabhakar (Cleveland, OH, USA) Robert E. Forster, II (Philadelphia, PA, USA) August 12, 1999
vi
CONTENTS
A Tribute to Robert W. Torrance................................................ Charles C. Michel
1
Reminiscence of Bob Torrance (1) ............................................. Patricio and Carolina Zapata
7
Reminiscence of Bob Torrance (2) ........................................... Mark Hanson and Prem Kumar
9
Genomics of Oxygen Sensing Placticity and Multiplicity in the Mechanisms of Oxygen Sensing ....... Sukhamay Lahiri
13
Evolution of Human Hypoxia Tolerance Physiology ........................
25
Comparative Aspects of High-Altitude Adaptation in Human Populations..........................................................................................
45
Peter W. Hochachka, and C. Carlos Monge
Lorna G. Moore, V. Fernando Armaza, Mercedes Villena, and Enrique Vargas
Tibetan and Andean Contrasts in Adaptation to High-Altitude Hypoxia............................................................................................
63
A Genomic Model for Differential Hypoxic Ventilatory Responses .... Clarke G. Tankersley
75
Cynthia M. Beall
Regulation of the Hypoxia-Inducible necessary for hypoxic induction of
: ARNT is not in the nucleus ..................
Max Gassman, Dmitri Chilov, and Roland H. Wenger
Intracellular Pathways Linking Hypoxia to Activation of c-fos and
AP-1..................................................................................
Daniel R. Premkumar, Gautam Adhikary, Jeffery L. Overholt, Michael S. Simonson, Neil S. Cherniack, and Nanduri R. Prabhakar
87
101
vii
Hypoxia-Induced Regulation of mRNA Stability ...................................... Waltke R. Paulding and Maria Czyzyk-Krzeska
111
Hypoxia, HIF-1, and the Pathophysiology of Common Human Diseases..... Gregg L. Semenza, Faton Agani, David Feldser, Narayan Iyer, Lori Kotch, Erik Laughner, and Aimee Yu
123
Gene Regulation during Hypoxia in Excitable Oxygen-Sensing Cells: Depolarization-Transcription Coupling ............................................................. David E. Millhorn, Dana Beitner-Johnson, Laura Conforti, P. William Conrad, Suichi Kobayashi, Yong Yuan, and Randy Rust Regulation of CREB by Moderate Hypoxia in PC 12 Cells............................ Dana Beitner-Johnson, Randy T. Rust, Tyken Hsieh, and David E. Millhorn Reactive Oxygen Species as Regulators of Oxygen Dependent Gene Expression................................................................................................. Jochim Fandrey and Just Genius A Glycolytic Pathway to Apoptosis of Hypoxic Cardiac Myocytes:
Molecular Pathways of Increased Acid Production .................................. Keith A. Webster, Daryl J. Discher, Olga M. Hernandez, Kazuhito Yamashita, and Nanette H. Bishorpric Mitochondrial-Nuclear Crosstalk Is Involved in Oxygen-Regulated Gene Expression in Yeast................................................................................ Robert O. Poyton and Christopher J. Dagsgaard Rox1 Mediated Repression: Oxygen dependent repression in yeast............ Alexander J. Kastaniotis, and Richard S. Zitomer Oxygen Dependence of Expression of Cytochrome c and Cytochrome c Oxidase Genes in S. cerevisiae ................................................................... Pastricia V. Burke, and Kurt E. Kwast Hypoxic and Redox Inhibition of the Human Cardiac L-Type Channel........................................................................................... I.M. Fearon, A.C.V. Palmer, A.J. Balmforth, S.G. Ball, G. Varadi, and C. Peers Molecular Identification of and Poassium Channels in the Pulmonary Circulation ........................................................................ Stephen L. Archer, E. Kenneth Weir, Helen L. Reeve, and Evangelos Michelakis
viii
131
143
153
161
177
185
197
209
219
Chemosensing at the Carotid Body: Involvement of a HERG-like potassium current in glomus cells ...................................................... Jeffrey L. Overholt, Eckhard Ficker, Tianen Yang, Hashim Shams, Gary R. Bright, and Nanduri R. Prabhakar
Oxidant Signalling and Vascular Oxygen Sensing: Role of Responses of the Bovine Pulmonary Artery to Changes in
in ...............
241
249
Kamal M. Mohazzab-H. and Michael C. Wolin
Tissue and Mitochondrial Enzymes: Cytochrome c Oxidase as as Sensor.............................................................................................. D.F. Wilson, A. Mokashi, S. Lahiri, and S.A. Vinogradov
259
Regulation of Shaker-Type Potassium Channels by Hypoxia: Oxygen-sensitive channels in PC12 cells ...................................... Laura Conforti and David E. Millhorn
265
HIF-1 Is Essential for Multilineage Hematopoiesis in the Embryo ......... David M. Adelman, Emin Maltepe, and M. Celeste Simon
275
Dual Influence of Nitric Oxide on Gene Regulation during Hypoxia ...... Gautam Adhikary, Daniel R.D. Premkumar, and Nanduri R. Prabhakar
285
Hypoxia Differentially Regulates the Mitogen- and Stress-Activated Protein Kinases: Role of in the activation of MAPK and p38y .............................................................................. P. William Conrad, David E. Millhorn, and Dana Beitner-Johnson Chairman’s Summary: Mechanisms of Oxygen Homeostasis, Circa 1999 ......................................................................................... Gregg L. Semenza
293
303
Arterial Chemoreceptors
Oxygen, Homeostasis, and Metabolic Regulation ................................... Peter W. Hochachka
311
Evidence that Nitric Oxide Plays a Role in Sensing from Tissue NO and Measurements in Cat Carotid Body .................................. Donald G. Buerk and Sukhamay Lahiri
337
Carotid Body Gap Junctions: Secretion of Transmitters and Possible Electric Coupling between Glomus Cells and Nerve Terminals .............. Carlos Eyzaguirre
349
ix
Short- and Long-Term Regulation of Rat Carotid Body Gap Junctions by cAMP Identification of Connexin43, a Gap Junction Subunit............... Verónica Abudara, Carloa Eyzaguirre, and Juan C. Sáez
Subcellular Localization and Function of B-Type Cytochromes in Carotid Body and Other Paraganglionic Cells ..................................... Wolfgang Kummer, Brigette Höhler, Anna Goldenberg,and Bettina Lange Acetylcholine Sensitivity of Cat Petrosal Ganglion Neurons .................
Machiko Shirahata, Yumiko Ishizawa, Maria Rudisill, James S.K. Sham, Brian Schofield, and Robert S. Fitzgerald
Responses of Petrosal Ganglion Neurons in vitro to Hypoxic Stimuli
and Putative Transmitters ...............................................................
359
371
377
389
J. Alcayaga, R. Varas, J. Arroyo, R. Iturriaga, and P. Zapata The Metabolic Hypothesis Revisited .................................................. Charmaine Rozanov, Arijit Roy, Anil Mokashi, Shinobu Osanai, Peter Daudu, Bayard Storey, and
397
Sukhamay Lahiri
Effect of Adenosine on Chemosenstivity, Functional, Cellular and Molecular Studies ........................................................................ P. Kumar, A.F. Conway, C. Vandier, N.J. Marshall,
405
J. Bruynseels, and G.M. Matthews
The Present Status of the Mechanical Hypothesis for Chemoreceptor Stimulation............................................................................................ Ashima Anand and A.S. Paintal
411
Identification of An Oxygen-Sensitive Potassium Channel in Neonatal Rat Carotid Body Type I Cells .......................................................... Betrice A. Williams and Keith J. Buckler
419
Significancy of ROS in Oxygen Chemoreception in the Carotid Body Chemoreception: Apparent Lack of a Role of NADPH Oxidase ........... A. Obeso, G. Sanz-Flfayate, M.T. Agapito , and C. Gonzalez
425
ATP-Dependent and Voltage-Gated Channels in Endothelial Cells of Brain Capillaries: Effect of Hypoxia ..................................... Marco A. Delpiano
435
Different
441
x
Mechanisms by Different Gabriel C. Haddad and Huajun Liu
Channels................
Response of Intracellular pH to Acute Anoxia in Individual Neurons from Chemosensitive and Nonchemosensitive Regions of the Medulla..... Laura Chambers-Kersh, Nick A. Ritucci, Jay B. Dean, and Robert W. Putnam
453
Hyperbaric Oxygen Depolarized Solitary Complex Neurons in Tissue Slices of Rat Medulla Oblongata ............................................. Daniel K. Mulkey, Richard A. Henderson III, and Jay B. Dean
465
Chronic Hypoxia Induces Changes in the Central Nervous System Processing of Arterial Chemoreceptor Input......................................... M.R. Dwinell, K.A. Huey, and F.L. Powell
477
Acetylcholine Is Released from in vitro Cat Carotid Bodies during
Hypoxic Stimulation.............................................................................. R.S. Fitzgerald, M. Shirahata, and H-Y. Wang
485
Interactions between Acetylcholine and Dopamine in Chemoreception..... P. Zapata, C. Larraín, R. Iturriaga, J. Alcayaga, and C. Eyzauirre
495
Interactions between Catecholamines and Neuropeptides in the Carotid Body: Evidence for Dopamine Modulation of Neutral Endopeptidase Activity..................................................................................................... Ganesh K. Kumar, Eui K. Oh, and Myeong-Seon Lee
507
Pharmacological Effecs of Endothelin in Rat Carotid Body: Activation of Second Messenger Pathways and Potentiation of Chemoreceptor Activity.................................................................................................... J. Chen, L. He, B. Dinger, and S. Fidone
517
Oxygen and Acid Chemoreception by Pheochromocytoma (PC 12) Cells.... S.C. Taylor and C. Peers
527
Postnatal Changes in Cardiovascular Regulation during Hypoxia .............. Phyllis M. Gootman and Norman Gootman
539
Expression and Localization of A2a and Al-Adenosine Receptor Genes in the Rat Carotid Body and Petrosala Ganglia: A2a and A1-adenosine receptor mRNAs in the rat carotid body ................................................. E.B. Gauda Serotonin and the Hypoxic Ventilatory Response in Awake Goats .......... J.K. Herman, K.D. O’Halloran, and G.E. Bisgard
549 559
xi
Peripheral Chemosensitivity in Mutant Mice Deficient in Nitric Oxide Synthase.................................................................................................. David D. Kline and Nanduri R. Prabhakar
571
Dopaminergix Excitation in Goat Carotid Body May be Mediated by Serotonin Receptors ...... ........................................................................ K.D. O’Halloran, J.K. Herman, P.L. Janssen, and G.E. Bisgard
581
Augmentation of Calcium Current by Hypoxia in Carotid Body Glomus Cells........................................................................................ B.A. Summers, J.L. Overholt, and N.R. Prabhakar
589
in Developing Rat Adrenal Chromaffin Cells ......... Roger J. Thompson and Colin A. Nurse by Model Airway Chemoreceptors: Hypoxic inhibition of channels in H146 cells .................................................................... Ita O’Kelly, Chris Peers, and Paul J. Kemp Morphological Adaptation of the Peptidergic Innervation to Chronic Hypoxia in the Rat Carotid Body ........................................................ H. Matsuda, T. Kusakabe, Y. Hayashida, F.L. Powell, M.H. Ellisman, T. Kawakami, and T. Takenaka Continuous But Not Episodic Hypoxia Induces CREB Phosphorylation in Rat Carotid Body Type I Cells .......................................................... Z.-Y. Wang, T.L. Baker, I.M. Keith, G.S. Mitchell, and G.E. Bisgard Intracellular of the Carotid Body .................................................... D.F. Wilson, S.M. Evans, C. Rozanov, A. Roy, C.J. Koch, K.M. Laughlin, and S. Lahiri Redox-Based Inhibition of Channel/Current Is Not Related to Hypoxic Chemosensory Responses in Rat Carotid Body ........................................ Arijit Roy, Charmaine Rozanov, Anil Mokashi, and Sukhamay Lahiri
Effects of 2, 4-Dinitrophenol (DNP) on the Relationship between Intracellular Calcium of Glomus Cells and Chemosensory Activities of the Rat Carotid Body ........................................................................... Peter A. Dauda, Charmaine Rosanov, Arijit Roy, Anil Mokashi, and Sukhamay Lahiri
xii
601
611
623
631
637
645
655
Estimation of Chemosensitivity from the Carotid Body in Humans .... M. Tanaka, A. Masuda, T. Kobayashi, and Y. Honda Adenosine-Dopamine Interactions and Ventilation Mediated through Carotid Body Chemoreceptors .............................................................. Emilia C. Monteiro and J. Alexandre Ribeiro Carotid Body NO-CO Interaction and Chronic Hypoxia .......................... C. Di Giulio, A. Grillo, I. Ciocca, M.A. Macrì, F. Daniele, G. Sabatino, M. Cacchio, M.A. De Lutiis, R. Da Porto, F. Di Natale, and M. Felaco
663
671 685
Interplay between the Cytosolic Increase and Potential Changes in Glomus Cells in Response to Chemical Stimuli..................................... Yoshiaki Hayashida, Katsuaki Yoshizaki, and Tatsumi Kusakabe
691
Characteristics of Carotid Body Chemosensitivity in the Mouse: Baseline Studies for Future Experiments with Knockout Animals ........................ L. He, J. Chen, B. Dinger, and S. Fidone
697
Role of Substance P in Neutral Endopeptidase Modulation of Hypoxic Response of the Carotid Body ............................................................ Ganesh K. Kumar, Yu Ru-Kou, Jeffrey F. Overholt, and Nanduri R. Prabhakar Effect of Barium on Rat Carotid Body Glomus Cell and Carotid Chemosensory Response........................................................................ A. Mokashi, A. Roy, C. Rozanov, P. Daudu, and S. Lahiri
705
715
A Dual-Acid Influx Transport System in the Carotid Body Type I Cell: Acid influx in carotid body type I cells .......................................... Ke-Li Tsai, Richard D. Vaughan-Jones, and Keith J. Buckler
723
L-Dopa and High Oxygen Influence Release of Catecholamines from the Cat Carotid Body ........................................................................... Hay-Yan J. Wang, Machiko Shirahata, and Robert S. Fitzgerald
733
Effects of a Dopamine Agonist on Cytosolic Changes Induced by Hypoxia in Rat Glomus Cells ................................................................ Katsuaki Yoshizaki, Hideki Momiyama, and Yoshiaki Hayashida
743
Carotid Chemoreceptors Participation in Brain Glucose Regulation: Role of arginine-vasopressin .................................................................. Sergio A. Montero, Alexander Yarkov, and Ramon Alvarez-Buylla
749
xiii
Nitric Oxide Modulation of Carotid Chemoreception ............................ Rodrigo Iturriaga, Sandra Villanueva, and Julio Alcayaga and Respiration in Exercising Human Muscle: The Regulation of
761
Oxidative Phosphorylation in vivo .............................................................. Youngran Chung, Paul Mole, Tuan K. Tran, Ulrike Kreutzer, Napapon Sailasuta, Ralph Hurd, and Thomas Jue
769
pH Sensitivity in the Isolated CNS of Newborn Mouse ............................. Claudia D. Infante and Jaime Eugenin
785
Aortic Body Chemoreflex of the Anesthetized Rat: Electrophysiological
morphological and reflex studies ........................................................... James F.X. Jones
Changes in the Peptidergic Innervation of the Rat Carotid Body a Month after the Termination of Chonic Hypoxia ................................................ T. Kusakabe, Y. Hayashida, H. Matsuda, T. Kawakami, and T. Takenaka
789
793
Carotid Bodies and the Sigh Reflex in the Conscious and Anesthetised Guine-Pig....................................................................................................
801
Immunohistochemical Study of the Carotid Body during Hibernation.......
815
Daryl O. Schwenke and Patricia A. Cragg
Kazuo Ohtomo, Kohko Fukurara, and Katsuaki Yoshizaki
Neurochemical Reorganization of Chemoreflex Pathway after Carotid Body Denervation in Rats....................................................................... J.C. Roux, J. Peyronnet, O. Pascual, Y. Dalmaz, and
823
J.M. Pequignot
Index..........................................................................................................
xiv
829
This page intentionally left blank.
A TRIBUTE TO ROBERT W. TORRANCE
C. C. Michel Section of Cellular and Integrative Biology, Division of Biomedical Sciences, Imperial College School of Medicine, Exhibition Road, London SW7 2AZ, UK.
Bob Torrance, who organised the first international meeting entirely devoted to arterial chemoreceptors, died in Oxford on 8m January 1999. Bob will be remembered not only for that meeting, but for his own contributions to the subject both as a leader of a research group, as the author of reviews of great insight, a stimulating contributor to discussion and above all for his warm and generous personality. Bob Torrance spent nearly all his working life in Oxford, as a Fellow and Tutor of St John’s College and as Lecturer in the University Laboratory of Physiology. He did not start working on arterial chemoreceptors until the early 1960’s when he was in his late thirties. Appreciating the great stimulus which the Haldane Centenary Symposium had given to respiratory physiology in 1961, he toyed with idea of arranging a small meeting on chemoreceptors alone, to coincide with a visit which Carlos Eyzaguirre was planning to make to the UK in 1963. He discussed this with Sir Lindor Brown, who was head of the University Laboratory at the time and with Dan Cunningham, who with Brian Lloyd, had organised the Haldane Meeting. Lack of time in which to raise the necessary funds meant that the idea had to put aside but fortunately it was not forgotten. One Wednesday in the summer of 1965, Sir Lindor Brown happened to share a taxi with Sir Ifor Evans of University College, London. To pass the time of day, Evans told Brown that he was about to become a trustee of a small foundation which was being set up to support medical science. “What do you suggest that would be both different and worthwhile for us to encourage?” he asked. “Small scientific meetings” replied Brown and proceeded to expound enthusiastically on the benefits of face to face discussions and personal interactions in science particularly when people with slightly different expertise are brought together. “ There’s someone in my
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
1
department who has an interesting idea for a meeting of this kind,” he
concluded. “Let me have the proposal in three days” said Evans. So Brown returned to Oxford and told Bob Torrance. By Friday, the plans for a meeting on aortic and carotid chemoreceptors were in the post. On the following Wednesday, Bob heard that £2500 had been allocated for him set up the first Wales Foundation Symposium. Several factors made the meeting a remarkable success. First it was very much a family affair. While there was an organising committee (Sir Lindor
Brown, Eric Neil, Dan Cunningham and Bob), this met formally only once, though (according to the Preface of the Symposium Proceedings, 3) its members, encouraged by their secretary, communicated constantly. The secretary to the committee was Margaret Torrance (Bob’s wife) who, in
addition, acted as Bob’s secretary while also taking care of the general administration of the meeting including accommodation and social functions. The scientific programme was developed by Bob in consultation with Dan
Cunningham and Eric Neil. At that time the carotid and aortic chemoreceptors were usually described in the textbooks as “peripheral chemoreceptors.” By 1965, this term had lost its specificity for in the late 1950’s and early 1960’s there was speculation about the importance of chemoreceptors which detected changes in and in the mixed venous blood. To clarify that it was to be about the carotid and aortic receptors, the meeting was given the title “arterial chemoreceptors”, a term that has continued. Speakers were asked to address a particular topic so that a comprehensive view of the arterial
chemoreceptors could emerge. To provide participants with an up to date account of the subject, before the meeting they all received a scholarly review which Bob had written for the occasion. This review, which was circulated and eventually published in the proceedings of the symposium (3) under the title of “Prolegomena,” was the first of several important reviews on chemoreceptors that Bob was to write over the next two decades. It arose from a series of four advanced lectures which Bob had given in November and December 1965. They had been delivered on successive Saturday mornings and Bob wrote them up in a rough form for the benefit of one of his research students who had been unable to attend the lectures as he was captain of the Oxford University rugby
team. The rough copy began to circulate among other students and interested colleagues in the department, so Bob started to polish the text. At Eric Neil’s
suggestion, it was circulated to all participants “...for them to read or ignore as they think fit.” It was wonderful background reading for the meeting, and even those who were working on chemoreceptors at that time benefited from following Bob’s account of how an understanding of the chemoreceptors must be compatible with the broader picture of the regulation of breathing. Its main aim was to provide a focus for the speakers; to make it easier for them to address the specific questions which they had been asked to consider in their presentations. It was successful in this respect and perhaps even more so in
2
raising the standard of the general discussions. So successful were these, that instead of the meeting finishing on Friday lunchtime as planned, at the request of the participants, themselves, it continued until the end of the afternoon so that a final concluding discussion could be held. Over the following 20 years Bob Torrance and his students made a series of important contributions to our understanding of the properties of the chemoreceptors. Perhaps the two most important of these were first, the demonstration of their different transient responses to step changes in oxygen and carbon dioxide tensions (2) and then that impulses from the chemoreceptors (and other peripheral sense organs) only have reflex effects on breathing if they arrive in the central nervous system during inspiration (1). In addition, there were Bob’s reviews of the subject. These were always scholarly, intellectually stimulating and well written. Bob Torrance was born in Wolverhampton, Staffordshire on the 4th September, 1923 .His father taught Physics in the local grammar school. When the family moved to Yorkshire in the 1930’s, Bob attended Bradford Grammar School, going through the middle school on the classical side. Attracted to the idea of becoming a doctor, he switched to sciences in the sixth form. After some tutorials at home from his father, he developed a real enthusiasm for mathematics and physics. By contrast, he found the learning involved for Chemistry “rather dull,” so he concentrated on maths and physics, winning a Hastings Scholarship to The Queen’s College, Oxford, in November 1941. At Queen’s, he read Physiology and Medicine and was awarded First Class Honours in Physiology in the summer of 1945. This success led Professor J.H.Burn to invite him to interrupt his medical studies to spend a year doing research in the department of Pharmacology. Bob accepted the invitation but made little progress over the first few months with the project which he, himself, had chosen to work on. In December of that year, Burn agreed for Bob to move to the department of Physiology. Here under the supervision of David Whitteridge, his work flourished and by the summer of 1946 he had been elected to a research fellowship at St John’s College. Although Bob had plans to use the fellowship to follow up Leskell’s then very recent report of the motor innervation of muscle spindles, the College saw Bob as a future medical tutor and persuaded him to use the fellowship to qualify in medicine with a view to succeeding Professor C.G.Douglas who had held the position since 1908. Such opportunities were rare at the time and Bob agreed, going on to University College Hospital in London to pursue his clinical studies. After qualifying in medicine, he spent six months as a house physician and two years in the Royal Army Medical Corps before returning to St John’s College in 1952. In addition to his College duties, Bob became departmental demonstrator with teaching commitments and a small research room in the University Laboratory of Physiology. In the six years since his election to the Fereday
3
fellowship, several groups had started to investigate the motor innervation of the muscle spindles so Bob decided that instead he would investigate the
properties of receptors in the cardiovascular and respiratory systems. His first substantial piece of research, however, was with Jean Banister on the hemodynamics of the pulmonary circulation. In a series of well planned experiments they showed unambiguously how blood flow through the lungs is influenced by the pressure in the airways. Their single paper was followed by a flurry of publications from elsewhere, some of which acknowledged their precedence. With the paper in press, Bob departed for a year’s sabbatical leave, where he worked in Stanley Sarnoff’s laboratory at the National Institutes of Health in Bethesda. This proved to be the most important period of his personal life, for during this year he met Margaret Aspinwall, who was English but working in Washington, and before he returned to Oxford they were married. This was a most happy and successful partnership. Bob Torrance was a large man. Six feet five inches tall and at times
weighing over 280 pounds, he was always easy to find in a crowd and for over forty years, his huge figure on a not so large bicycle was a familiar sight in North Oxford. But after only a brief conversation with Bob, most people forgot his size and were impressed by the sharpness of his mind and the warmth and
generosity of his personality. He was particularly good in talking to young
people, quickly finding common experiences and allegiances he could share with them and use to introduce them to others. He delighted in being a fellow of St John’s College. He was a tutor for nearly forty years and his ability to review areas in a broad yet analytical way made him an inspiring teacher, particularly of more able students. He also served as Junior Dean and Tutor for Admissions at various times. His pleasure in the College increased when in the late 1960’s it repossessed St Giles House, which had formerly been the Judges’
Lodgings in Oxford. It was adjacent to the College and Bob moved his teaching rooms there, appreciating that with its elegant reception rooms and well planned garden, it would be a wonderful place to entertain pupils colleagues
and friends. With Margaret, he enjoyed arranging receptions and dinners in these beautiful surroundings. On such occasions he was a wonderful host, welcoming and particularly thoughtful with newcomers and visitors, always ready to laugh with old friends and tell stories against himself.
For someone who enjoyed conversation so much, it must have been particularly hard for Bob to discover in early middle age that he was becoming progressively deaf. He faced this stoically and sensibly, producing the microphone of his hearing aid to be spoken into if he had difficulty in following a conversation. It seemed as if he treated his hearing aid in the same way as he would treat a piece of laboratory equipment, continuously adjusting it to obtain the optimal signal. Although his deafness was a major handicap in following the discussions at scientific meetings, his hearing aid could occasionally help in a way of which he, himself, was unaware. When he felt
4
that he had a point to make, his intervention would be preceded by a squeaking and a whining which would invariably catch the chairman’s attention. On such occasions he could be most impressive. After detecting an error in a presentation at a Physiological Society meeting some years ago, Bob rose to his feet as soon as the discussion opened, took one massive stride over the front
row of seats and producing a piece of chalk from his pocket, proceeded to draw a diagram on the blackboard to give the correct explanation of the point in question. The paper had been given by a small man and Bob towered over him, not an aggressive, dominating figure but rather that of a patient schoolmaster concerned by the lack of understanding of a wayward pupil. Ill health blighted the last two and a half years of his life but he continued to think and write about physiology in spite of it. He published a biographical paper on Mabel Fitzgerald, one the early women physiologists who is best known for her collaboration with J.S.Haldane in his studies (with Douglas, Henderson and Schneider) on acclimatisation to high altitude; a paper on carbon monoxide transport and oxygen secretion and a paper on the scaling of blood flow in the aorta. He presented his last communication to the Physiological Society in September 1998, less than three and a half months before he died. To the end he retained his mental sharpness and the warmth of his personality. He leaves his wife, Margaret and their two sons.
REFERENCES 1 . Black, A..M. S., McCloskey, D. I. and Torrance, R.W. The responses of carotid body
chemoreceptors in the cat to sudden changes in hypercapnic and hypoxic stimuli. Respiration Physiology, 1971, 13, 3 6 - 4 9 . 2. Black, A.M.S. and Torrance, R.W. Respiratory oscillations in chemoreceptor discharge and the control of breathing. Respiration Physiology, 1971, 13, 221 - 237. 3. Torrance, R.W. (Editor) The Proceedings of the Wates Foundation Symposium on Arterial Chemoreceptors. Blackwell Scientific Publications, Oxford, 1968, pp 1 - 40.
5
This page intentionally left blank.
REMINISCENCE OF BOB TORRANCE
Patricio and Carolina Zapata Laboratory of Neurobiology, Catholic University of Chile, Santiago, Chile
It is almost impossible to realise that Bob is no longer with us. He was full of life, and plans, which he carried into practice with rare, characteristic
enthusiasm and consistency. He continued to publish scientific papers until quite recently. He kept his enthusiasm to the last, in the vigour of his
conversation, and in his warm and generous friendship. He was an exacting and outstanding scholar. His creative mind was always bursting with enthusiasm for work and advice. He had strong
convictions and defended them, but he left nothing to interfere with his enjoyment of life. He firmly believed that life is for involvement and
enjoyment. He lived every day with great eagerness. In addition, he was gentle and understanding with his friends. His broad range of interests was truly exceptional. He was refined in his tastes and a wine “connoisseur”. We had the opportunity to see his wine cellar at his home in Oxford, where he offered us one of his best, aged, and “dusty” red wines. He insisted on being called Bob, not Dr. Torrance. That was too formal to his taste. It was not difficult to do so, because we know of no person who would not call him Bob after a first conversation. He was always ready for help and counsel, rarely lost his trustworthy smile. He was a charming, intelligent and pleasant companion, with a wonderful sense of humour, whose friendship was greatly valued by the many people who knew him. From the period in which he lived in Chile in the early sixties, Bob turned
very fond of this country. In fact, he returned to Chile with Margaret on three occasions, where we had the opportunity to become good friends. Working together in the laboratory was always exciting because he kept his boyish fascination with discovery. It was not uncommon to see him going to
the library to search for an article or specific data right in the middle of an
Oxygen Sensing: Molecule to Man, edited by S. Lahiri el al. Kluwer Academic/Plenum Publishers, 2000
7
experiment. We wondered how he managed to make himself understood, since the librarians did not speak a word of English. But, apparently, he was quite successful in using signs and gestures. The last letter we sent to Bob was dated January 8th, the very same day he died. In that moment we had the strange feeling that something was wrong with him because he had not answered our Christmas card. He could not have done it: he was already in the hospital. Because of his fine human qualities, Bob’s passing has also left a great void. We will remember him with admiration as a forceful, dynamic yet unpretentious and warm personality. He had integrity, youthful enthusiasm, and great personal charm. Finally, we would like to transcribe part of a poem by Nezahual Coyotl, Prince of Tezcoco, Mexico (1402–1472), which was published in Biological Research 26:405 (1993). Bob Torrance and one of us (CL) translated it from Spanish into English. Bob worked very hard on this translation. He intended to grasp not only the right wording of the poem, but the poetic intonation and rhythm as well. It stands as follows: “Listen to me, my Lords! I have solved the mystery, I know the secret. I know what we are: We are all of us mortals! “All men who were born like us on this earth Have to move on from stage to stage of our lives: All of us have to die, here on this earth...” We shall forever keep memories of this remarkable man.
8
REMINISCENCE OF BOB TORRANCE Mark Hanson* and Prem Kumar** *UCL Medical School. London, U.K, **University of Birmingham, Birmingham, U.K.
We have the same story to tell. It is a bright crisp morning in Oxford and a large man is laconically riding a bicycle, of a size more suited to a young teenager, round to the rear of the University Laboratory of Physiology. Bob Torrance leans the bicycle casually against the wall and strolls through the back door and along a short corridor, kicking his heels and singing to himself. One side of his raincoat flaps; the other holds a heavy volume in a capacious inside pocket. As he pushes through the door of his laboratory (Room 3) past boxes of assorted equipment and a blackboard, he extracts this volume, the Journal of Physiology, and lifts his glasses on to his forehead to focus on the
Table of Contents on the rear cover. His eyebrows rise in mild astonishment. After ten seconds he pulls his glasses down and in one movement swings his coat and the journal on to a side bench. The laboratory has a timeless atmosphere: a radio plays softly; in a corner a bunsen burner flickers under a large beaker of coffee. The walls are hung with stuffed animals and birds. Ignoring all this, he’s excited to find out what is happening in an inner room, metal-clad and lit only by a dissecting lamp. Someone looks up from the microscope. “Any joy, maestro?” Bob hails through the doorway, not going in. An answer is shouted, but imperfectly heard. Bob makes Caesar’s gesture questioningly: thumbs up? thumbs down? Thumbs up, the reply is grinned. “I’ll keep out of the way then” and he goes off to attend to other matters in the Department or in College. We don’t know how many times this little drama, or a version of it, was played out: maybe once for every chemoreceptor recording that was attempted by every one of a long line of D.Phil students and post-docs who worked with Bob Torrance over many years. For us, it encapsulates what was so special about him. Research was always a priority and his support for those engaged
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
9
in it was boundless: to relish the excitement of it when it was going well, to
commiserate when it wasn’t. He could cap any account by a sad student, who had messed up the preparation or broken something, by a tale of some disaster that had befallen him as a student of David Whitteridge. Bob was a dedicated and inspiring teacher, not only to his postgraduate students, but also to undergraduates. For many years at St. John’s College, he transmitted his insight in physiological mechanisms to generations of medical and science students, sitting on the sofa in his room in St. Giles’ House, with the portrait of his predecessor, C.G. Douglas presiding. Bob would occasionally refer to a paper, or bring down a book from his impressive library: but usually he drew diagrams or graphs on paper with a soft pencil. Understanding science for him was intensely pictorial and depended on developing simple diagrams. If it couldn’t be shown in this way, it seemed that it wasn’t worth discussing. He also believed in working things out from first principles, an approach that, if mastered, could stand the student in good stead as it permitted a dramatic reduction in the rote learning which seemed essential for other subjects such as anatomy and histology.
Bob’s empirical approach seemed to extend to everything, for example when he remarked that the Chinese invention of the hemispherical wok
permitted the rapid cooking of large quantities of food with the minimum of expensive ingredients - oil and fuel. Clearly he thought about everything in
detail and time spent in his cottage in France would often result in letters back to the lab, containing not only ideas for experiments inspired by the French countryside but also anecdotes on home improvements - a long black pipe to warm sufficient water in the day’s sunshine for a shower (“one can get perfectly clean in a shower, but only asymptotically clean in a bath”). Even the
ailments which beset him, whether his deafness, migraine or later the sequelae of a coronary thrombosis, provided the focus for experimental approaches. He would breathe various concentrations of and oxygen to improve (or not as the case may be) his migraine and discuss the relative merits of diuretics acting, on him as a whole as opposed to the single carotid body chemoreceptor.
Equal importance seemed to be given to whether variable x had a ‘relation’ or a ‘relationship’ to variable y as to whether breath-by-breath oscillations in chemoreceptor discharge played any role in respiratory control. Fowler’s modern usage and D.Phil theses of previous students seemed, at times, to be the only universal truths on which we could base my findings. Statistics seemed to Bob only necessary when experiments hadn’t been designed properly.
Bob’s intelligence was prodigious: he could get to the root of a problem
long before others and because he excelled at thinking on his feet, he could often come to a conclusion of devastating clarity. But he had no arrogance: he could be as gentle and patient with his students as when he was dissecting
chemoreceptor fibers. He had a great sense of humor and loved an anecdote.
10
He was incredibly kind and generous. But above all, he had an enthusiasm which was utterly infectious. When he said, delighted at a Michelangelo drawing of the head of a youth, which his technician Chris Hirst had framed for him “Isn’t it a beautiful thing?”, he might have been talking about the result of the experiment, later in the day when he came back to the lab to see how things were going. Countless students owe a love and a respect for nature to Bob Torrance.
11
This page intentionally left blank.
PLASTICITY AND MULTIPLICITY IN THE MECHANISMS OF OXYGEN SENSING
Sukhamay Lahin Department of Physiology, University of Pennsylvania Medical Center, Philadelphia PA. 19104, USA
1.
INTRODUCTION
This brief review about the plasticity and mechanisms of oxygen sensing in vertebrates is divided into the following sections. It describes the time-dependent appearance and disappearance of oxygen sensing after birth. The principle of plasticity is that the time dependent phenomena and resetting are related primarily to the availability of oxygen and, therefore, to oxygen related changes in gene expression. The mechanisms do not change with time but their multiplicity can be expressed differentially.
2.
RESULTS
2.1
PLASTICITY
2.1.1
Developmental
It is abundantly clear that plasticity is the rule rather than an exception in mammalian oxygen sensors. This is a time-dependent phenomenon involving gene expression. Until that occurs, the responses can be
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
13
considered as acute. From fetal life, sensing begins to develop in the carotid body at different rates in different species to reach a stable state in two to three weeks after birth (e.g., Wasicko, et al., 1999). Hypoxia stimulates increase in in glomus cells at about the same rate, and glomus cell currents are barely developed at birth (Hatton et al., 1997). Taken together, these results show that the hypoxic effect develops slowly with time. These oxygen sensing functions seem to suggest that there is a connection between these events. But there need not be. For example, adreno - medullary cells which are of the same neural crest origin, seem to undergo a loss of oxygen sensitivity as animals mature ( Mojet et al., 1997; Thomson and Nurse, 1998). It has been argued that fetal and neonatal animals need a surge of catecholamine secretion as a result of asphyxia by a non-neurogenic mechanism in adrenomedullary cells not innervated at that time. As animals mature, sympathetic innervations develop, and the hypoxic response is no longer needed and therefore is dispensed with (Seidler and Slotkin, 1985). The Ductus arteriosus is located as a bridge between the pulmonary artery and the descending aorta. At birth, the ductus arteriosus switches from the hypoxic environment in utero to an air-filled oxygen rich environment. At this time, the lumen of the ductus contracts to the point of self-obliteration whereas the pulmonary circulation vasodilates. Ductus constriction is supposed to be inhibited by inhibition of sensitive channels (Abman, 1996). Thus, the following are examples of plasticity. a) Increased hypoxic response of chemosensory discharge with time in animals grown in normoxia (Wasicko et al., 1999). b) Increased hypoxic response of glomus cell with time grown in normoxia (Wasicko et al., 1999). c) Increased responses of glomus cell to hypoxia with time grown in normoxia (Hatton el al., 1997). d) Loss of hypoxic response of adreno-medullary cells as the animal matures in normoxia (Mojet et al., 1997; Thompson and Nurse, 1998). e) Reversed sensitivity of ductus arteriosus (Abman, 1996). 2.1.2
Environmental
If the environment is kept low from birth, development of hypoxic sensitivity is delayed (Hanson et al., 1989). However, with time, full chemosensitivity develops. For example, children born at any altitude have a low ventilatory sensitivity initially but they do develop normal oxygen sensitivity with time (Lahiri et al., 1976). However, as they grow older their chemosensitivity may become blunted (Byrn-quinn et al., 1972; Lahiri and Milledge, 1965; Severinghaus et al., 1966). Soon after birth the sensitivity at
14
any altitude is nearly zero (Lahiri et al., 1976). Then it develops with age. Often the sensitivity to hypoxia decreases, that is, the greater the altitude of residence, people become less sensitive to hypoxia (Lahiri et al., 1976). Hypoxia a) Ventilatory acclimatization to chronic hypoxia in adults (Lahiri and Milledge, 1965; Lahiri etal., 1976). b) Increased chemosensory response to chronic hypoxia in adult cats (Barnard et al., 1987). c) Diminished chemosensory response to acute hypoxia in kittens grown in chronic hypoxia (Hanson et al., 1989). d) Blunted ventilatory response to hypoxia in the natives of high altitude (Milledge and Lahiri, 1967). e) Loss of hypoxic ventilatory response without loss of erythropoietic response (Winslow and Monge, 1987). f) Hypertrophy of glomus cells and associated cellular changes in chronic hypoxia (McGregor et al., 1984). g) Increased tyrosine hydroxylase and catecholamine levels with chronic
hypoxia (Czyzyk-Kreska et al., 1992; Hanbauer et al., 1981). Hyperoxia a) Loss of chemosensory response to hypoxia and not to hypercapnia (Lahiri et al., 1987). b) Graded effects of hyperoxia (Lahiri et al., 1989). Reversal of blunted hypoxic response There is evidence that a blunted ventilatory response to hypoxia in adults
at high altitude is reversed if they come down to sea level, the reversal being more prompt if their return to sea level is earlier in life. This reversal is also seen in the patients with congenital heart disease who manifest a blunted hypoxic ventilatory response (Edelman et al., 1970) and show a normal response after surgical correction with return to normal arterial (Blesa et al., 1977). Carotid body Unlike many other organs, chronic hypoxia makes the carotid body grow. Much of this growth involves the type I cell (e.g, McGregor et al., 1984).These cells contain tyrosine hydroxylase, which also increases. As a consequence, catecholamine levels which include tyrosine hydroxylase increase significantly (Hanbauer et al., 1981; Pequignot et al., 1986). Obviously many other enzymes and proteins are modified or formed with altered gene expression (Guillemin and Krasnow, 1997).
15
Hyperoxia and carotid body After exposure of cats to hyperoxia for approximately 60 hours carotid bodies lose their oxygen sensitivity (Lahiri et al., 1987). However, the response to hypercapnia remains augmented. These responses resemble those of oligomycin treatment of carotid body (Mulligan et al., 1981). This means that a blockade of oxidative phosphorylation is lost in hyperoxia. Nothing much is known about other aspects of carotid body except that its cells show signs of degeneration with hyperoxia.
2.2
Lessons from plasticity
It is safe to assume that the initial reaction of oxygen sensing is so fundamental that it isn’t going to change with time. It is the manifestation of the response that normally involves altered gene expression, which constitutes plasticity.
3.
CONCLUSIONS
3.1
MULTIPLICITY OF MECHANISMS
The mechanisms involve a heme-based oxygen sensor: cytochrome oxidase, NAD(P)H oxidase and ion channels. The focus of this section will be on the heme ligand carbon monoxide. It has been used in the mammalian carotid body and in yeast cells to show that oxygen sensing properties are shared by both organisms (Bunn and Poyton, 1996).
3.1.1
Aerobic CO effects on carotid body and yeast in the dark
a) High CO in the absence of hypoxia excites chemosensory discharge which is inhibited by light (Fig. 1) (Lahiri, 1994). b) This CO excitation is divisible into different wave-lengths (Fig. 2A) which is matched by a similar absorption spectra of respiratory enzyme in yeast
(Fig. 2B) as is shown in K. (1963). c) The effect of C O excitation in the carotid body is associated in the dark with the decrease in uptake which is reversed by light (Fig. 3). A similar effect of absence and presence of light on cytochrome oxidase in yeast (Keilin, 1966). d) The effect of CO on chemosensory excitation is associated with dopamine release from carotid body (Buerk et al., 1997). But the light effect on chemosensory discharge is not shared by dopamine release, suggesting different mechanisms for chemosensory discharge and dopamine secretion (Lahiri and Acker, 1999).
16
17
18
3.1.2
CO effect during hypoxia on carotid body and yeast
a) Hypoxic chemosensory discharge is inhibited by CO (Lahiri et al 1993) (Fig. 4). b) CO (Lopez-Lopez and Gonzalez, 1992) (Fig. 4) relieves hypoxic suppression of current. But no light effect has been demonstrated in this paper. c) Induction of HIF-1 by hypoxia is blocked by CO, an intracellular event (Huang et al., 1999; Kwast et al., 1999). Light effect on suppression of HIF-1 by CO is not known.
3.1.3
CO induced excitation and dopamine release is dissociated with light effect
High Pco induced excitation is associated with dopamine release but light while suppressing excitation does not inhibit dopamine release (Fig. 5).
19
4.
DISCUSSION
Plasticity is ingrained into the developmental aspects which are dependent on genes. Environment can modify these changes which can work through multiple mechanisms. Many of the mechanisms are heme-based
which can react with carbon monoxide. The effect of carbon monoxide provides the key evidence for such a role of heme proteins (Lahiri and Acker, 1999). In the absence of hypoxia high Pco excites carotid chemoreceptors. This excitation is inhibited by light. The effect of light is divisible into wavelengths (Wilson et al., 1994). This CO mediated
activity matches the action spectra for cytochrome c oxidase in yeast and
cardiac muscles. Also, CO inhibits oxygen uptake, which is relieved by light as shown in Fig. 3 (Lahiri et al., 1997). It is expected that oxygen uptake will be
dependent on the wavelength of light.
CO has been shown to offset the effect of hypoxia on chemosensory
discharge (Lahiri et al., 1997). This corresponds to reversal of
current
suppression of the glomus cell membrane by hypoxia (Lopez-Lopez and
Gonzalez, 1992). But the mechanisms need not be the same (Huang et al., 1999). CO also suppresses the hypoxic activation of HIF-1, and consequently
the subsequent series of gene expression (Guillemin and Krasnow, 1997). But this CO suppression resembles the effect of
currents of the glomus
cell membrane (Lopez-Lopez and Gonzalez, 1992). How these intracellular events are transferred to a membrane is not clear. CO also suppresses the
hypoxia excitation of chemoreception (Lahiri et al., 1997). It could be that
20
release from stores up-regulates the current that accounts for the membrane phenomena and suppression of excitation. All the effects of CO related to cytochrome oxidase are expected to be inhibited by light. Thus, the suppression effect of CO on hypoxia activation should also be effected by light. However, the effect of light on this phenomenon has not been demonstrated. Also, in severe hypoxia, light excites the chemoreceptors. One explanation is that this phenomenon occurs due to a conformational change of hemoprotein (Lahiri and Acker, 1999). The light effect on chemosensory excitation should be reflected in changes which needs to be measured. However, light inhibition of chemosensory discharge is not shared by dopamine release (Buerk et al., 1997) which suggest two different sites for chemosensory excitation and dopamine secretion (Lahiri and Acker, 1999). The source of dopamine is the glomus cells. But neural excitation originates from nerve ending possibility without involving secretion from the glomus cells. This idea is reminiscent from the work of for examole, Mitchell et al.(1972). The transition metals, and , mimic the hypoxic effects on gene expression. But and also block channels and subsequently block the hypoxic response. However, the relationship between channel blockade and gene expression is not fully elucidated.
ACKNOWLEDGEMENTS Supported in part by the NIH grant R 37 HL-43413
REFERENCES Abman, S.H. (1996). Oxygen sensing, potassium channels, and the ductus arteriosus. J. Clin. Invest. 98: 1945–1946. Barnard, P.S., Andronikou, S., Pokorski, M., Smatrsk, NJ., Mokashi, A. and Lahiri, S.(1987). Time-dependent effect of hypoxia on carotid body chemosensory function. J. Appl. Physiol. 63: 851–691. Blesa, M., Lahiri, S., Rankind. W. and Fishman, A.P. (1977). Normalization of the blunted ventilatory response to acute hypoxia in congenital cyanotic heart disease. New. Engl. J. Med. 296: 237–241. Buerk, D.G., Chugh, O.K., Osanai, S., Mokashi, A. and Lahiri, S. (1997). Dopamine increases in cat carotid body during excitation by carbon monoxide: implications for a chromophore theory of chemoreception. J. Autonom. Nerv. System. 67: 130–136. Bunn, H.F. and Poyton, R.O. (1996). Oxygen-sensing and molecular adaptation to hypoxia. Physiol. Rev. 76: 839–855. Byrn-quinn, E., Sodal, I.E. and Weil, J.V. Hypoxia and hypercapnic ventilatory drive in children native to high altitude. J. Appl. Physiol. 32: 44–46, 1972
21
Czyzyk-Kreska, M.F., Baliss, D.A., Luwson, E.E. and Milhorn, D.E. (1992). Regulation of tyrosine hydroxylase gene expression in carotid body by hypoxia. J. Neurochem. 58: 1538– 1546. Edelman, N.H., Lahiri, S., Cherniack, NS. and Fishman, A.P. The ventilatory response to hypoxia in cyanotic congenital heart disease. New Eng. J. Med. 282:405Guillemin, K. and Krasnow, M.H. (1997). The hypoxic response: Huffing and Miffing. Cell 89: 9-12. Hanbauer, I ., Karoum, F. Hellstorm, S. and Lahiri, S. (1981). Effect of long term hypoxia on the catocholamine content in rat carotid body. Nuerosciencc 6: 81-86. Hanson, M.A., Eden, G.J., Niglnis, JG. and Moore, P.J. (1989) Peripheral chemoreceptors and other oxygen sensors in the fetus and newborn. I n : Chemoreceptors and Reflexes in Breathing: Cellular and molecular aspects. Eds, S. Lahiri, R.E. Foster, I I . R.O. Davies and A.I Pack. pp. 113-120. Hatton, C.J., Carpenter, E., Pepper, D.R., Kumar, P. and Peers, C. (1997). Developmental changes in isolated rat type I carotid body cell K+ current and their modulation by hypoxia. J. Physiol. 501: 49-58 Huang, L.E., Willmore W., Gu J., Goldberg, M.A. and Bunn, H.F. (1999). Inhibition of H1F–1 activation by carbon monoxide and nitric oxide: implications for oxygen sensing and signaling. J. Biol. Chem. 274: 9038-9044. Kwast, K.E., Burke, P.V., Staahl, B.T. and Poyton, R.O. (1999). Oxygen sensing in yeast: evidence for the involvement of the respiratory chain in regulating the transcription of a subset of hypoxic genes. P.N.A.S. 96:5446-5451. Keilin, D. (1966). The history of cell respiration and cytochrome. Cambridge, UK. Cambridge Univ. Press. Lahiri, S. (1994). Chromophores in chemoreception: The carotid body model. NIPS 9: 161 –164 Lahiri, S. and Acker, H. (1999). Redox-dependent binding of to heme protein controls chemoreceptor discharge of the rat carotid body. Respir. Physiol. 169-177. Lahiri, S., Iturriaga, R., Mokashi, A., Ray, D.K. and Chugh, D. (1993). reveals dual mechanisms of chemoreception in the cat carotid body. Respir. Physiol. 94: 227-240. Lahiri, S., Buerk, D.G., Chugh, D., Osanai, S and Mokashi, A. (1997). Reciprocal photolabile consumption and chemoreceptor excitation by carbon monoxide in the cat carotid body: evidence for cytochrome as the primary sensor. Brain Res. 684: 194-200 Lahiri, S., Delaney, R.G., Brody, J.S., Simpser, M., Velasquez, T., Motoyama, E.K. and Polger, G. (1976). Relative role of environmental and genetic factors in respiratory adaption to high altitude. Nature 261: 133-135. Lahiri, S. and Milledge J.S (1965). Sherpa Physiology, Nature 207:610-612. Lahiri, S., Mulligan, E., Indronikou, S., Shirahata, M. and Mokashi, A. (1987). Carotid body chemosensory function in prolonged normobaric hyperoxia in the cat. J. Appl. Physiol 62: 1924–1931. Lahiri, S. M u l l i g a n , E., Smatresk, N.J., Barnard, P., Mokashi, A., Torbati, D., Pokorski, M., Zhang, R., P.G. Data and Albertine, K. (1989). Neurotransmission of carotid body responses to chronic low and high oxygen pressures. In: Chemoreceptors and Chemoreflexes in Breathing: Cellular and Molecular Aspects. Eds. S. Lahiri, R.E. Foster I I , R.O. Davies and A.I. Pack. Oxford Univ. Press, New York. pp. 215-227. Lopez-Lopez, J.R. and Gonzalez., C. (1992). Time course of current inhibition by tow oxygen in chemoreceptor cells of adult rabbit carotid body. Effects of carbon monoxide. FEBS Lett., 299: 251-254. McGregor, K.H., Gil, J. and Lahiri, S. (1984). A morphometric study of the carotid body in chronically hypoxic rats. J. Appl. Physiol 57: 1430-1438.
22
Milledge, J.S. and Lahiri, S. (1967). Respiration control in lowlanders and sherpa highlanders at altitude. Respir. Physiol. 2: 323Mitchell, R.A., Shuiha, A.K. and McDonald, D.M. (1972). Chemoreceptive properties of regenerated endings of the carotid sinus nerve. Brain Res. 43: 1077-1088. Mojet, M.H., M i l l s , E.,and Duchen, M.R. (1997). Hypoxia-induced catecholamine secretion in isolated newborn rat adrenal chromaffin cells is mimicked by inhibition of mitochondrial respiration. J. Physiol. 504: 175-189. M u l l i g a n , E., Lahiri, S. and Storey, B. (1981). Carotid body chemoreception and mitochondrial oxidative phosphorylation. J. Appl. Physiol. 51:438-446. Pequignot, J.H., Cottet-Emrad, J.M., Dalmaz, Y., Dehaut D. Sigy, M. and Pey (1986). Biochemical evidence for dopamine and norepinephrine stores outside the sympathetic nerves in rat carotid body. Brain Res. 367:238-243. Seidler, F.J. and Slotkin, T.A. (1985). Adrenomedullary function in the neonatal rat: responses to acute hypoxia. Physiol. 385: 1 - 1 6 . Severihaus, J.W, Bainton, C.R. and Carcelen. (1966) Respiratory insensitativity to hypoxia in chronically hypoxic man. Respir. Physiol. 1: 308-334. Thompson, R.J. and Nurse, C.A. (1998). Anoxia differentially modulates multiple currents and depolarizes neonatal rat drenal chromaffin cells. J. Physiol. 512: 421-434. Wasicko, M.J., Sterni, L.M., Bramford, O.S., Montrose M.H. and Carrol I, J.L. (1999). Resetting and postnatal maturation pf oxygen chemosensitivity in rat carotid chemoreceptor cells. J. Physiol. 514: 493-503. Wilson, D.F., Mokashi, A., Chugh, D., Vinogradov S., Osanai, S. and Lahiri, S. (1994). The primary oxygen sensor of the cat carotid body is cytochrome of the mitochondrial respiratory chain. FEBS Lett.351: 370-374 Winslow R.M. and Monge, C. (1987). Hypoxia, polycythemia and chronic mountain sickness. The John Hopkins University Press, Baltimore, MD, USA.
23
This page intentionally left blank.
EVOLUTION OF HUMAN HYPOXIA TOLERANCE PHYSIOLOGY
Peter W. Hochachka* and Carlos Monge, C.** *Depts. of Zoology and Radiology and the Sports Medicine Division, University of British Columbia, Vancouver, B.C., Canada V6T 1Z4** Dept. of Physiological Sciences, Universidad Peruana Cayetano Heredia, Lima 100, Peru
Abstract
Analysis of human responses to hypobaric hypoxia in different lineages (lowlanders, Andean natives, Himalayan natives, and East Africans) indicates 'conservative' and 'adaptable' physiological characters involved in human
responses to hypoxia. Conservative characters, arising by common descent, dominant and indeed define human physiology, but in five hypoxia response systems analyzed, we also found evidence for 'adaptable' characters at all levels of organization in all three high altitude lineages. Since Andeans and Himalayans have not shared common ancestry with East Africans for most of our
species history, we suggest that their similar hypoxia physiology may represent the 'ancestral' condition for humans – an interpretation consistent with recent evidence indicating that our species evolved under 'colder, drier, and higher' conditions in East Africa where the phenotype would be simultaneously advantageous for endurance performance and for high altitude hypoxia. It is presumed that the phenotype was retained in low capacity form in highlanders and in higher capacity form in most lowland lineages (where it would be recognized by most physiologists as an endurance performance phenotype). Interestingly, it is easier for modern molecular evolution theory to account for the origin of ‘adaptable’ characters through positive selection than for conserved traits. Many conserved physiological systems are composed of so many gene products that it seems difficult to account for their unchanging state (for unchanging structure and function of hundreds of proteins linked in sequence to form the physiological system) by simple models of stabilizing selection.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
25
1.
HOW TIME INTERPLAYS WITH HYPOXIA ADAPTATION OPTIONS It is widely accepted in comparative biology that how a species deals with
hypoxia, or any other selectively relevant factor, depends upon the time
available for orchestrating the response. Usually the timeline for response is divided into three categories: acute, acclimatory, and genetic or phylogenetic. The formal relationship [27] between these three timelines of responses begins first with sensing mechanisms which inform the organism when an limitation problem arises. Second, this information must be transduced at various levels of organization into appropriate acute responses. Third, either the same or different sets of sensing and signal transduction pathways may be utilized to achieve more complex acclimatory responses. Finally fourth, any of the above the sensing step, the signal transduction pathways, the acute response, and the acclimatory responses - during generational time (i) may change randomly due to genetic drift (characters arising by this means in extant lineages are not adaptations), (ii) may change due to positive natural selection at rates proportional to selection pressures (characters arising by this process are termed adaptations), or (iii) may be conserved or stabilized essentially
unchanged by negative or stabilizing selection pressures (these kinds of characters are expressed in extant lineages as a result of common descent and are designed for function in many settings; they may be used along with (ii) above in physiologically adaptive responses to hypoxia but technically they are not hypoxia adaptations per se). Except for the frequent casual use (or misuse) of the term ‘adaptation’ by mammalian physiologists, the acute and acclimatory responses to hypobaric hypoxia are fairly well known [3-8, 14,17,27,30,31 ]; however, much less insight is available on how these response systems change in humans through evolutionary time – the fourth process above, which we wish to focus upon in this overview.
2.
STUDIES OF DIVING ANIMALS SUPPLY GUIDELINES FOR HUMAN EVOLUTIONARY PHYSIOLOGY
Probably the main reason why the evolution of human hypoxia tolerance was not investigated earlier was because there were few if any guidelines for the study of the evolution of complex physiological systems in humans or in animals. In our case, initial guidelines [23,46] arose from recent quantitative analyses of the variability of the diving response in pinnipeds (seals and sea lions). Some 50 years of research established the main physiological features of diving to include apnea, bradycardia, and peripheral vasoconstriction, with
26
hypometabolism of hypoperfused tissues. Together these features are referred to as the diving response which serves to conserve for the heart and brain; peripheral tissues in contrast may become more and more limited as diving is extended. Over the years significant amounts of information gradually accumulated for almost all of the 30 or so species of pinnpeds. This allowed a comparative analysis [23,46] and led to three principles of evolution of the diving response which we found useful as framework for probing the evolution of complex physiological systems: (i) some physiological / biochemical characters considered necessary in diving animals are conserved in all pinnipeds; these traits (including diving apnea, bradycardia, tissue hypoperfusion, and hypometabolism of hypoperfused tissues) probably arose in response to factors other than - or in addition to - diving requirements and presumably were and are maintained largely by negative or stabilizing selection (any mutations affecting them not surviving). At this stage in our understanding of diving physiology and biochemistry, we are unable to detect any correlation between these characters and diving capacity, even though they are clearly used during diving and are so important that (the cardiovascular control systems for) diving bradycardia plus peripheral vasoconstriction are often referred to in this literature as the ‘master switch of life’. It is reasonable to assume that the cardiovascular control systems in seals and sea lions in fact are ancient characters and are expressed in extant species as a result of common descent, (ii) A few other diving characters are more malleable and are clearly correlated with long duration diving and prolonged foraging at sea. These characters are more lineage specific, and include spleen weight, blood volume, and red blood cell (RBC) mass. The larger these are, the greater the diving capacity (defined as diving duration). Since the relationships between
diving capacity and any of these traits are evident even when corrected for body weight, it is reasonable to conclude that these three traits - large spleens, large blood volume and large RBC mass – are true adaptations, selected because they extend diving duration, probably through effects on storage and management during diving. That is, in contrast to conserved traits such as bradycardia, these kinds of characters have evolved presumably by positive selection to enable prolonged dive times, (iii) The evolutionary physiology of the diving response thus can be interpreted in terms of the degree of development of adaptable vs conservative categories of diving characters; i.e., in terms of how these patterns change through time and how the patterns are lineage specific. Using these studies as guidelines, we then turned our attention to the evolution of human responses to hypobaric hypoxia. Working with several low and high altitude lineages, our own studies [2,20-31, 41] focussed on four systems: integrated whole body physiology and metabolism, muscle metabolism at rest and during work, heart metabolism in normoxia vs hypoxia, and brain metabolic organization. In addition, we also relied on data already in
27
the literature (see ref [22,27]). Guided by the diving studies above, our detailed earlier analysis [27] looked for and found strong evidence that the physiology of hypoxia tolerance in humans displays both conservative and adaptable characters. Brain metabolism can serve as an example of the former and heart metabolism as an example of the latter.
3.
BRAIN METABOLIC ORGANIZATION AS AN EXAMPLE OF A CONSERVATIVE CHARACTER
To evaluate the nature of brain metabolism through generational time, we compared mass-specific glucose metabolic rates (using Positron Emission Tomography, PET) in over 20 anatomically distinguishable regions of the brain in lowlanders and compared these patterns to those found in indigenous highlanders [24,25 ]. In all three lineages, (i) glucose is the preferred fuel of the brain, ( i i ) brain metabolic rates are qualitatively similar, and (iii) region by region comparisons indicate qualitatively similar metabolic organization. As these are measurements of the brain in physiological steady state, the results indicate that pathways of adenosine triphosphate (ATP) demand and ATP supply (and presumably associated regulatory mechanisms in brain ATP turnover) are all conserved in our phylogeny. In fact, studies from other laboratories indicate the above features apply for the brain in other (e.g., Japanese) lineages [42] also. As these different human groups have been evolving separately for a significant part of our species history, the above stability of expression implies that the genes specifying structure and function of the central nervous system (CNS) involved in regulated ATP demand and ATP supply pathways have been stabilized by negative selection through our phylogeny (any mutations causing change either being prevented or being deleted). Human brain metabolic organization thus well illustrates a physiological character that is strikingly conserved in our evolution and whose functions appear both in normoxia and in hypobaric hypoxia.
4.
MOST PHYSIOLOGICAL CHARACTERS IN OUR SPECIES ARE CONSERVATIVE
A key point is that the conservative nature of human brain metabolism is by no means exceptional. Since we here are assessing traits within a single species, conservative characters are probably the rule and are too numerous to outline in detail. Three additional, well worked out examples are hemoglobin (Hb) affinity and regulation [60], muscle organization into different fiber types [34,50], and, the cardiovascular control system (used in regulation of
28
heart and perfusion in many physiological settings including diving, as mentioned above [46]). Such categories of physiological traits - in sum they make up most of our physiology - and the way they are used on hypoxia exposure appear common in humans no matter what the lineage or the content of the inspired air in the normal environment.
5.
HEART METABOLISM AS AN ADAPTABLE PHYSIOLOGICAL CHARACTER
In contrast to the brain, the heart displays a prominently adaptable metabolic organization. In lowlanders, heart metabolism is opportunistic and w i l l utilize free fatty acids (FFAs), glucose, or lactate on an availability basis. To evaluate the nature of heart metabolism through generational time, we used Magnetic Resonance Spectroscopy and compared the spectra in lowlanders to those found in indigenous highlanders in normoxia vs hypoxia. We found [26] that the concentration ratios of phosphocreatme (PCr)/ATP were maintained at steady state normoxic values (0.9 -1) that were unusually low, about 1/2 those found in normoxic lowlanders (1.8) monitored the same way at the same time. Because the creatine phosphokinase reaction functions close to equilibrium, these steady state PCr/ATP ratios presumably coincide with about 3-fold higher free adenosine diphosphate (ADP) concentrations. Higher ADP concentrations (i.e., lower [PCr]/[ATP] ratios) correlate with the Km values for ADP-requiring kinases of glycolysis and reflect elevated carbohydrate contributions to heart energy needs. This metabolic organization was presumably selected in highlanders because the ATP yield/02 is 25–60% higher
with glucose than with free fatty acids (the usual fuels utilized in the human heart in postfasting conditions). In addition, the effects of hypoxia acclimation on heart PCr/ATP signatures also differ in the two groups. In highlanders, the PCr/ATP signature of glucose fuel preference remains stable even after four weeks of deacclimation at low altitudes [26], while a similar period of acclimation in lowlanders leads to a modest shift towards the highlander pattern (P.W.Hochachka and R.V.Menon, unpublished data). Recent studies of rats also found that hypobaric hypoxia acclimation for 3 – 4 weeks leads to a decrease in fatty acid oxidation capacity, with a relative increase in glucose preference as fuel for the heart [51]. Taken together, these data indicate that heart adaptations seem to rely upon stoichiometric efficiency adjustments [26,31], improving the yield of ATP per mole of consumed, as in muscle [6-8], by increased preference for carbohydrate as a carbon and energy source. Together with increased blood volume and RBC mass (i.e. increased whole body carrying capacity), these adaptations imply dampened heart work requirements at any given altitude for
29
a similar submaximal level of whole body exercise. The key point is that in contrast to the brain, in the heart, some component or components of the ATP supply pathways appear to be under positive selective pressure in high altitude natives, leading to two adaptations: elevated preference for glucose as fuel for the heart and a modified hypoxia acclimation response.
6.
ADAPTABLE CHARACTERS AND A HIGH ALTITUDE PHYSIOLOGICAL PHENOTYPE
In spite of the overwhelmingly conservative nature of human physiology, we also found evidence for other metabolic and physiological responses to hypobaric hypoxia that, like heart metabolism, appear to be true adaptations in Quechuas and Sherpas. Such adaptable characters seemingly occur at all levels of organization examined and can be summarized as five adjustable hypoxia response systems (AHRS) which seem to form a key and common basis for the complex physiology of hypoxia tolerance: (i) blunted hypoxic ventilatory response (HVR) mediated by the carotid body sensor [1,37], serving to counteract acid-base problems [54] arising from hyperventilation; (ii) blunted hypoxic pulmonary vasoconstrictor response (HPVR) mediated by pulmonary vasculature sensors [58], serving to minimize risks of pulmonary hypertension [18]; (iii) up regulated expression of vascular endothelial growth factor 1 (mediated by vascular sensors [15]), angiogenesis and hence increased blood volume [17,36,47]; (iv) maintained erythropoietin regulation of erythropoiesis (mediated by kidney sensors), and hence increased RBC mass and carrying capacity [9,43,57,59]; and (v) regulatory adjustments of metabolic pathways to alter fuel/pathway preferences (including the ratio of aerobic/glycolytic metabolism) and, in striated muscle, to attenuate concentrations of enzymes in energy metabolism (for representative data, see [20,30,33,34,39]). The AHRS in turn set the stage for additional ‘downstream’ effects. For example, we find that in Andean and Himalayan natives maximum aerobic and anaerobic exercise capacities are down regulated. The acute effects of hypoxia (making up the energy deficit due to lack) expected from lowlanders [7] are blunted, and metabolic acclimation effects [29,41] are also attenuated. The in vivo biochemical properties of skeletal muscles, in Quechuas formed predominantly of slow twitch fibers [34,50], are consistent with regulatory adjustments of glycolytic vs oxidative contributions to energy supply to improve the yield of ATP per mole of carbon fuel utilized. These fiber type distributions in indigenous highlanders are unchanged by acclimation [34] and correlate with better coupling between ATP demand and ATP supply pathways (lesser perturbation of phosphate metabolite pools during rest-exercise transitions [2,41]), with lower lactate accumulation [29]
30
and with improved endurance [41]. Indeed, low lactate accumulation during exercise is one of the most characteristic metabolic features of indigenous highlanders [21,22,29]. Kenyans native to medium altitude environments, even
if not as much studied [52,53], show similar, if higher capacity, biochemical and physiological properties (adjustments at least in part based on preponderance of slow twitch fibers in skeletal muscles); this is not evident in Africans originating from lowland regions of West Africa, showing a much higher preponderance of fast twitch fibers in their muscles [3]. Finally, a blunted catecholamine response to hypoxia in indigenous highlanders indicates reduced hypoxic sensitivity of sympathadrenergic control [4,5,11,14,44], below the normally expected desensitization on exposure of human cells to hypoxia [48]. Compared to acute or acclimatory adjustments, these longer term (phylogenetic) adaptations appear to compensate pretty well for deficits caused by hypoxia, but the advantage appears to be gained at the cost of some attenuation of maximum aerobic and anaerobic metabolic capacities. On balance the picture emerging so far is that of a high altitude physiological phenotype based on numerous similar physiological traits (data mainly from Andean and Himalayan natives). Parenthetically, we might add that while overall hypoxia responses appear to involve fine tuning each of the above sensing and signal transduction pathway cascades, the hypoxia defense adjustments of Andean and Himalayan natives are not always exactly the same. For example, the HVR is more robust in Tibetans than in Quechuas [55]or Sherpas [38], altitude associated birth weight perturbations are less in Tibetan than in Quechau newborns [61], and hypoxia mediated increases in RBC mass in Andean natives [24,29] are more robust than in Himalayans [24,25]. Similarily, Hb affinities need special explanation. Most other vertebrates that tolerate extremes of high altitude display Hb homologues with increased affinities; as a result full saturation can be achieved at quite high altitudes (see ref [45,60]). In humans, as one of us (CM) has been well aware for nearly half a century, Hb seems to be designed for ‘low altitude’ function because in all lineages it displays a monotonic decline in saturation with altitude. Why this should be so has been perplexing to workers in this field, since intuitively it seemed reasonable that high altitude humans would be selected for higher affinity Hb to allow saturation at altitude. A solution to this paradox may be proposed which arises
from recent work [ 19] showing that the benefit of a left shifted saturation curve is achieved only at unusually high altitudes and high work rates. Since humans typically do not live above about 4500 m, there may have been little selective pressure for high affinity Hb. At sea level or low altitudes, a left shifted saturation curve is detrimental to unloading and leads to a decline in maximum whole body consumption rates. At intermediate altitudes, left shifting the saturation curve does not seem to have much effect on maximum aerobic metabolism [19]. These results, along with the finding that
31
high altitude humans display low maximum consumption rates, help to explain why they have managed hypobaric hypoxia with essentially normal or lowlander types of Hb binding properties. However, as with HVR and developmental adaptations [61], there may be modest differences in Hb affinity regulation between Sherpas, Quechuas, and other high altitude natives [60). Given the length of time these lineages have been evolving separately (see below), some differences in a few physiological characters are not
unexpected and do not alter our impression of a high altitude physiological phenotype based on numerous similar traits in Andean and Himalayan natives.
7.
PHYSIOLOGICAL PHENOTYPES FOR HYPOXIA TOLERANCE AND FOR ENDURANCE PERFORMANCE
Because of well known effects of exercise and altitude [7,21,29,41,45], it is perhaps not surprising that most of the above adjustable hypoxia response systems (AHRS) are also found in humans adapted for endurance performance. The common traits often include a blunted HVR and HPVR, expanded blood
volume, altered expression of metabolic enzymes and metabolite transporters, fuel preference adjustments, enhanced ratio of aerobic/anaerobic contributions to exercise, high ratios of slow twitch/fast twitch fibers in skeletal muscle, and enhanced endurance [7,20,28,29,39,41,52,53]. In endurance athletes, who display much higher maximum aerobic capacities than do altitude natives, many of these series of traits appear as high performance versions of those found in high altitude natives, with up regulation of muscle mitochondrial volume density (of flux capacities at the working tissues) being perhaps the only serious modification to the physiological phenotype described above [34,52,53], The comparisons of lowlanders and highlanders under normoxia are qualitatively good descriptions of the difference between individuals who
are well adapted for endurance vs those who are not. For example, low plasma [ lactate] in exercise eliciting maximum aerobic metabolism is as characteristic of endurance performers as it is of highlanders [7,21]. Or, to put it another way, the biochemical and physiological organization of both indigenous highlanders and individuals adapted for endurance performance are similar to each other, but both differ strikingly from the homologous organization in 'burst performance' individuals [7,21]. Similar contrasts emerge when East Africans (medium altitude origins [52]) are compared to West Africans (lowland origins), where fast twitch fibers form a much larger percentage of skeletal muscle [3]. In the latter, exercise-induced lactate concentrations can
reach very high levels, and cardiovascular adjustments play as important a role in recovery from performance as they do during performance per se [7,21].
32
Because the differences between acclimated and unacclimated (and trained vs untrained) individuals may be as great or greater than the difference between genetically distinct individuals (and because acclimation responses themselves are genotype dependent), genetic vs environmental contributions to these character traits are hard to quantify. Actually, most physiological studies are not properly designed to evaluate this issue, and in fact much of the physiological literature ignores genotype and usually reports no information at all on the genetics of the subjects under study. However, studies which have examined this issue usually find that genetic factors account for about 50% or more of the variance of these kinds of physiological systems [3,13]. It is important to remind physiologists that this estimate refers to genes affecting 50% or more of the variance, not the structural components, of physiological systems per se. Structural components - usually being gene products - could be nearly 100% ‘genetic’, which is a small but fundamental point often overlooked by physiologists (but not by pathophysiologists who well know the connection between genes and physiology). What is more, the % genetic contribution to variation in trait expression, such as HVR, may vary in different lineages (higher in Tibetans than in Andean natives [55] or Sherpas [38], for example). For any given system of course, natural selection can act only upon components that arc under genetic influence.
8.
PHYLOGENETIC ORIGINS OF HUMAN HYPOXIA TOLERANCE
If the AHRS compromises the primary 'solution' of our species to 'problems/requirements' of hypobaric hypoxia and/or endurance performance, the problem remains of when it arose in our species history. To explore this issue requires insight into the evolutionary pathways of our species. To this end, we relied upon a simplified 'phylogenetic tree' for the human species (Figure 1) from a recent summary of human genetics and evolution [10]. The main groups whose physiological responses to hypobaric hypoxia to date have been extensively studied [22,45,60] are shown on the Figure. The age of our species is not known exactly, but we can assume approximately 100,000 years (this is controversial, but if our species is older, the arguments below will be stronger). Several insights arise [22,27]. First, Figure 1 suggests that the last lime Caucasians, Sherpas and Quechuas shared common ancestors was over half the age of our species. Second, the last time the Himalayan highlanders (Sherpas and Tibetans) and the Andean highlanders (Quechuas and Aymaras) shared common ancestors was equivalent to about 1/3 of our species history. Third, divergence times between these groups and East Africans from medium altitude environments are even greater. Even if many details of human
33
34
phylogeny remain unsettled and Figure 1 is overly simplified, accepting other possibly phylogenies would not alter our main conclusion that the lengths of
separation of the Andean, the Himalayan, and the East African lineages represent large fractions of our species’ history. Despite such phylogenetically deep divergences, the latter three groups express many similar metabolic and
physiological responses to hypobaric hypoxia. Fourth, in numerous other lineages (intermediate branches in our phylogeny) the AHRS features when present often are ‘high performance’ versions of the high altitude phenotype. These provocative phylogenetic data are consistent with two possible interpretations.
One plausible model is that, with only modest differences, similar metabolic and physiological 'solution' arose independently by positive natural
selection in the two high altitude (Andean and Himalayan) lineages for which we have the most data and possibly in a third east African lineage for which the data are not as extensive. If so, such convergence (same characters arising independently in different lineages) would satisfy one of the criteria of
evolutionary biology and would indicate that the above suite of physiological characters are defense adaptations against hypobaric hypoxia and arose by positive selection. Whereas this was our thinking initially, the phylogenetic
observations are not easily incorporated into this interpretation. An alternative view – hypothesis (ii) – is that the above suite of physiological and metabolic traits, the AHRS, while arising by positive natural selection, represents the 'ancestral’ condition, which would be consistent with
evidence suggesting that the origin of our species occurred under conditions that were getting colder, drier, and higher. As emphasized elsewhere [22,27], key environmental influences on the root of our phylogeny, on the origins of our species, go back a long way. During early phases, hommid evolution in the East African Rift was occurring under conditions of mild altitude hypoxia – ideal from a training point of view [39] – aggravated by drier and colder climates. These conditions, where the AHRS would be advantageous, prevailed at the origins of our species (indeed, they prevail in East Africa today) and may have been particular important during the so-called
‘bottleneck’ period, thought perhaps to have been caused by unusually harsh ice-age conditions beginning at around 75,000 years ago. At this time, human populations may have been driven to remarkably low levels (possibly close to extinction). In any event, according to this model, over some 5000 or more generations of our species history, the ancestral condition was 'retained' in a
down regulated form in high altitude groups and was 'retained' in an up regulated high capacity form in groups selected for endurance performance (including Kenyan highlanders, who continue to thrive on the same plateau that served as the colder, drier, and higher place of our species beginnings). The fact that most lineages have a significant proportion of endurance type
phenotypes indicates that the ancestral condition was ‘retained’ in many
35
intermediate lineages in our species. In situations such as the moderate hypobaric hypoxia of East Africa, selection pressures for both hypoxia tolerance and endurance performance may well have been applied simultaneously (see ref [39] for a recent detailed analysis of the interaction between endurance performance and hypobaric hypoxia). In any event, our hypothesis (ii) predicts that the ancestral organization of our physiology was inherently very dependent upon efficient physiological delivery systems and upon 'aerobic' metabolic pathways and fiber types, with relatively minor development of, or reliance on, anaerobic metabolic systems to sustain short, intense bursts of whole body exercise. If this hypothesis is correct, then (in terms of our original framework for evaluating the evolution of complex physiological systems) it appears that much is determined by so called initial or ancestral conditions. Much of the evolution of physiological systems seems to involve stabilizing or negative selection (pruning out genotypes in which the ancestral 'models' are altered). Only a part of the evolution of our physiology seems to be the result of positive selection for new functional capacities and fundamentally new physiological characters - the AHRS described above and some parallel developmental adaptations [61], and even these traits appear be ancestral (to have arisen very early in our evolution). Finally, it is satisfying to note the similarities between these interpretations of the evolution of a complex physiological system within the hominids to the picture obtained in an analysis of the diving response in pinnipeds; in one case, we are dealing mainly with one species, or at most a few, evolving for about a million years, while in the latter case, we are dealing with 30 species whose phylogeny extends back about 20 millions years [46]. Nevertheless, these conclusions raise two problems for modern molecular evolution theory - how to account for conservative and for adaptable traits in the evolution of complex physiological systems.
9.
CAN MOLECULAR EVOLUTION MODELS EXPLAIN ADAPTABLE TRAITS IN HYPOXIA TOLERANCE?
Most evolutionary biologists today assume that selection can be an overwhelming force. Population genetics theory tells us that the response to selection depends on the amount of phenotypic variation upon which selection can operate (the % variation that is heritable) and on the intensity of selection. As mentioned above, most physiological studies are not designed for teasing out the values of these parameters. However, for physiological and morphological systems which have been studied quantitatively, the coefficient of variation is often about 10% or even higher. Heritabilities vary a lot, but a
36
range of between about 0.3 – 0.7 is reported by physiological studies using family inheritance patterns or monozygotic vs dizygotic twins to quantity genetic contributions to variance in physiologcal traits. Selection coefficients also vary greatly; at the upper extreme values as high as 0.43 are known. A 43% selective advantage means a selection intensity so extreme that individuals one phenotypic standard deviation above the mean are more than twice as fit as individuals one deviation below the mean [35]. Armed with these values, evolutionary biologists calculate that positive selection can produce evolutionary rates in excess of 1% change in the mean value for a trait per generation. As our species history goes back at least 100,000 years (early hominid phylogeny, when much of our basic physiological phenotype was being formed, goes back even further, to 3–4 million years ago), it is not hard to conclude that characters arising under positive selection and observed within extant lineages of our human family can be easily accommodated by current evolutionary theory. Of course there remains a caveat; namely, that these kinds of calculations are almost always focussed onto a single trait. For situations where the evolution of two or more systems must be coordinated (as in AHRS above) the probability and mechanisms of such coevolution remain obscure. Nonetheless, at least in a general sense, the answer to the question posed appears affirmative.
10.
CAN MOLECULAR EVOLUTION MODELS EXPLAIN TRAITS CONSERVED THROUGH HUMAN PHYLOGENY?
Interestingly, when considering this second issue - can conserved traits such as brain metabolic organization or such as the pathways of cardiovascular or ventilatory control be explained by modern molecular evolution theory - the answer is not so obvious. To put it in perspective, we first must remind the reader of the enormous complexity of the physiological systems involved. A hint of this arose in our earlier analysis of a number of major sensing, signal transduction, and effector pathways involved in cardiovascular control in diving animals [23,46]; this control system is equally well conserved in human evolution. At the molecular level each arm of this enormously complex regulatory system is composed of up to 100 already identified gene products; from each protein being linked in a highly precise manner with others in the pathway emerges the coordinated (and evolutionanly conserved) physiological function of cardiovascular control [46]. In the case of the CNS, well over 200 currently known gene products are involved in pathways of ATP demand and ATP supply, in sensing, signal transduction, and regulation, and in structural integration. Conserving the emergent physiologies formed from the expression
37
of linked function of many gene products means conserving the structure and function of at least key parts of gene products (those specifying ‘active’ or otherwise functionally important sequences). That is, it means deleting most mutations which arise - this is negative or stabilizing selection. To estimate how much negative or stabilizing selection is required to keep such systems from randomly changing through phylogenetic time we need to have an estimate of the selective cost of substitutions in each of the gene products in such integrated sequences. Of course this information is not available for all components of complex physiological systems such as the CNS. However, these kinds of values are known for other presumably comparable macromolecular systems (see ref [12] for a comparable such study of 46 genes in humans and other homimds). A particular clear example is given for 16/18S rRNAbydolding[16]. Ribosomal RNAs have been used to peer into the deepest recesses of the phylogeny of living organisms on earth because these macromolecules are ubiquitous and because their primary sequences change slowly due to powerful negative selection. To figure out how powerful, Golding [16] examined the primary sequences for 16/18S rRNAs from 51 species, including representatives from all major branches of life. The secondary structures of rRNAs are stabilized by many hydrogen bonded pairs of nucleotides, with stability of bonding being dependent upon the actual nucleotide pairs utilized and on their neighbors. In the total absence of selection, one would expect to see any base pair at any one site in the secondary structure among the 51 species, but this is not observed. Instead, most species are restricted to pairs that form strong hydrogen bonds and some sites are more conserved (are selected more strongly) than others. For estimating the selection coefficient for each hydrogen bonded pair in the secondary structure of the rRNA molecule, what was actually calculated was a composite parameter, 4Ns, where N is the effective population size and s is the selective advantage of hydrogen bonding at a site. Golding [16] found that was sufficiently large to account for complete conservation of hydrogen bonding at a site; i.e. for all 51 taxa to have a hydrogen bonded base pair at a site. Assuming a reasonable value for N (say 16,000), then a value of is large enough to maintain a specific site in a sequence over long phylogenetic time periods. This means that on average a 0.01% advantage is adequate to assure 100% conservation of a given site in rRNA; a 1% advantage would be consistent with the conservation of about 100 such sites, which in fact is close to what is observed, with the most conservative sites tending to be located in the middle of the molecule. (During the ‘bottleneck’ in human history, N may have been dangerously low. If in the above equation N is taken to be only 4000, then s rises drastically to about 0.0012. Now on average a 0.12% advantage is required to assure conservation at a site and a 12% advantage presumably would be required to assure conservation of 100 such
38
sites. Such selective pressures may be inordinately high under most conditions; however, as mentioned above, even higher values of s have been previously reported [35]). While these calculations for gene products whose structures are necessarily extremely conservative may overestimate the selective disadvantage of ammo acid altering mutations for proteins generally, they should be fairly appropriate for ‘active’ or ‘functionally important’ regions of proteins generally. This is because similar structural constraints (requiring the conservation of weak bonding interactions at specific sites) are commonly observed and in fact are considered a ‘rule of thumb’ for the ‘active sites’ of macromolecules such as enzymes, channels, exchangers, pumps, metabolite transporters, and ligand (signal) specific receptors. In fact, the ‘rule of thumb’ applies pretty well across the board for functionally critical regions of all gene products since (from mRNA onwards) their functions almost ubiquitously depend upon weak bonding interactions. Such natural selection based conservation of structure (i.e., of specific sites in specific sequences) of course is the basis of maintained functional specificity of macromolecules through evolutionary time [28] and in principle should be applicable to the conservation of specific physiological systems in human hypoxia tolerance. To indicate the flavor of the problems involved, we here will stick to the example of ATP turnover in the CNS because it is relatively well described and understood. Assuming that similar selection pressures operate on the proteins in these
pathways as in conserving rRNA sequences [16], we can estimate s for simple multiple-component pathways (such as glucose transporter function coupled to glucose-glycogen conversion to pyruvate). Assuming modest sized active sites, we arrive at the conclusion that a small (about a 1.5%) selective advantage is adequate to assure that 10 sites in each of the 15 gene products in such a pathway in brain metabolism will be conserved (many metabolic enzymes are formed of more than one subunit and are highly conserved; hence, lor this example the actual numbers of genes involved and the numbers of conserved sites per gene are substantially higher, in which event the overall selective advantage would have to be proportionately higher than 1.5%). Still this seems helpful for it suggests that modern molecular evolutionary concepts should be able to readily accommodate the conservation of complex (multigene dependent) physiological systems. However, to experimental biologists, the implications are disturbing for two reasons. First, there is the practical problem of this being experimentally intractable - signal to noise ratios in physiological studies almost always are in the 5–10% range. In most physiological studies, a 1.5% advantage would be undetectable, which is one reason why physiologists should turn to evolutionary studies with caution [40]. Secondly, a serious theoretical problem seems to arise because the above illustrative estimates apply to only one pathway. In contrast, human hypoxia defense mechanisms involve many such highly conserved pathways. As
39
mentioned above, in CNS energy supply + energy demand pathways alone, it is easy to demonstrate over 200 genes, not the 15 or so selected for illustrative purposes for a simple metabolic pathway. We are not certain about how far we can advance such analyses, but it seems clear that as the numbers of gene products required for given physiological systems increase towards 100s or even 1000s, the strength of selection required to conserve them unchanged (to conserve the complex physiological system unchanged) through evolutionary time may rise without limit. To molecular physiologists, his may not be very satisfying. Nevertheless, the relationship does suggest that the problem of conserving complex physiological systems through human phylogeny may be more difficult to explain than the appearance of so called ‘adaptable’ physiological traits, which in the context of this paper traditionally would be considered pivotal for extending tolerance of, and performance in, hypobaric hypoxia. Whereas evolutionary literature has addressed this problem in general terms [49J, to our knowledge the selective forces required to stabilize complex physiological systems composed of 100s or even 1000s of well defined gene products so far have never been quantified, or for that matter, even addressed.
Interestingly, a recent study of a random collection of 46 genes in humans and other hominids (12) unexpectedly found such high deleterious mutation rates in humans and other hominids that they doubted such species could survive if mutational effects on fitness were to combine in simple multiplicative way. The authors thus took their data to indicate that the effects of deleterious mutations may combine synergistically and such synergistic epistasis might help to explain the lower amount of ‘genetic death’ required to delete undesirable mutations and thus conserve ancestral physiological function. Be that as it may, this analysis appears to indicate that keeping complex physiological systems the same through long evolutionary time, keeping them the same as in our ancestors, may be more difficult than adjusting them to suite specific environmental challenges.
ACKNOWLEDGEMENTS This work was supported by NSERC (Canada). Especial thanks to Dr. Hans Christian Gunga whose questions and insights initiated this project in the first place.
REFERENCES I.
40
Acker H, X u e D (1995) Mechanism of oxygen sensing in the carotid body in comparison with other oxygen sensing cells. News Physiol. Sci. 10, 2 1 1 – 2 1 6
2.
Alien PS, Matheson GO, Zhu G, Gheorgiu D, Dunlop RS, Falcomer T, Stanley C, Hochachka PW (1997) Simultaneous 3 I P Magnetic Resonance spectroscopy of the soleus
and gastrocnemius in Sherpas during graded calf muscle exercise. Amer. J. Physiol. 273, R999-R1007 3. Amu PMH, Simoneau JA, Boulay MR, Serresse CW, Theriault G, Bouchard C (1986)
Skeletal muscle characteristics in sedentary Black and Caucasian males. J. Appl. Physiol. 61, 1758-1761 4. Antenzana AM, Richalet JP, Antenzana G, Spielvogel H, Kacini R.( 1992) Adrenergic system in high altitude residents. Intl. J. Sports Med. 13, S92-95 5. Antenzana AM, Richalet JP, Noriega I, Galarza M, Antenzana G (1995) Hormonal changes in normal and polycythemic high-altitude residents. J. Appl. Physiol. 79, 795-800 6 Brooks GA (1998) Mammalian fuel preferences during exercise. Comp. Biochem. Physiol., in press Brooks GA, Fahey TD, and White TP (1996) Exercise Physiology - Human Biocnergetics and Its Applications. Mayfield Publ. Co., London pp 1-750. 8 Brooks GA, Butterfield GE, Wolfe RR,Groves BM, Mazzeo RS.Sutton JR, Wolfel EE, Reeves JT ( 1 9 9 1 ) Increased dependence on blood glucose after acclimatization to 4,300 m. J. Appl. Physiol. 70, 919-927 9 Bunn HF, Poyton RO (1996) Oxygen sensing and molecular adaptation to hypoxia. Physiol. Rev. 76, 839-885 10 Cavalli-Sforza LL, Menozzi P, Piazza A (1994) The History and Geography of Human Genes. Princeton Univ. Press, Princeton, NJ pp 1-535 11 Colice GL, Lawrason J, Munsef A, Bittle, P, Dietz J, Ramirez G (1993) Hormonal 7
responses to exercise in high altitude natives and COPD patients. Aviation Space & Env. 12
Med. 64, 5 1 2 - 5 1 6 Eyre-Walker, A. and Keightley, P.D. High genomic deleterious mutation rates in
13
hominids. Nature 1999; 397, 344-347. Fagard R, Biclen E, Amery A (1991) Heritability of aerobic power and anaerobic energy generation during exercise. J. Appl. Physiol. 70, 357-362
14
Favier R, Desplanches D, Hoppeler H, Caceres E, Grunenfelder A, Koubi H,
Leuenberger M, Sempore B, Tuscher L, Spielvogel H (1996) Hormonal and metabolic adjustments during exercise in hypoxia and normoxia in highland natives. J. Appl. Physiol. 80, 632-637 15 Forsythe JS, Hang BH, Iyer NV, Agani F, Leung SW, Koos RD, Semenza GL (1996) Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1 . Mol. Cellular Biol. 16, 4604-4613 16 Golding GB (1994) In: Golding GB (ed), Non-Neutral Evolution – Theories and Molecular Data. Chapman and Hall, London, pp 126-138 17 Harik N, Harik SI, Kuo NT, Sakai K, Przybylski RJ, LaManna JC (1996) Time-course and reversibility of the hypoxia induced alterations in cerebral vascularity and cerebral capillary glucose transporter density. Brain Research 737, 335-338
18
Heath D, Williams DR (1981) Man at High Altitude. Churchill Livingstone, London pp 3-23
19 20
Henderson K, McCanse W, Urano T, and Gonzalez NC, FASEB J. 12, 5, 3701 (1998). Hochachka PW (1992) Muscle enzymatic composition and metabolic regulation in
21
high altitude adapted natives. Int. J. Sport Med. 13, S89-91 Hochachka PW (l994) Muscles as Molecular and Metabolic Machines. CRC Press,
22
Boca Raton, Florida pp 1 - 1 5 8 Hochachka PW (1998) Mechanism and evolution of hypoxia-tolerance in humans. J. Exp. Biol. 201, 1243-1254.
41
23
Hochachka PW, and Mottishaw PD (1998) Evolution and adaptation of the diving response: Phocids and otariids. In: Pörtner HO, Playle R (eds) Cold Ocean Physiology, Cambridge University Press, Cambridge, UK 391-431. 24 Hochachka PW, Clark CM, Brown WD, Stanely C, Stone CK, Nickles RJ, Zhu G, A l i e n PS, Holden JE (1995) The brain at high altitude: Hypometabolism as a defense against chronic hypoxia? J. Cerebral Blood Flow and Metabolism, 14, 671-679
25
Hochachka PW, Clark CM, C.Monge C, Stanley C, Brown WD, Stone CK., Nickles RJ, Holden JE (1996) Sherpa brain glucose metabolism and defense adaptations against chronic
hypoxia. J. Appl. Physiol., 81: 1355-1361 Hochachka PW, Clark CM, Holden JE, Stanley C, Ugurbil K, Menon RS (1996) 31P Magnetic Resonance Spectroscopy of the Sherpa Heart: A PCr/ATP Signature of Metabolic Defense Against Hypobaric Hypoxia. Proc. Natl. Acad. Sci., U.S.A. 93: 1215–1220 27 Hochachka PW, Gunga HC, Kirsch K (1998) Our ancestral physiological phenotype: An adaptation for hypoxia tolerance and for endurance performance? Proc. Natl. Acad. Sci. USA 95, 1915-1920 28 Hochachka PW, Somero GN (1984) Biochemical Adaptation. Princeton University Press, Princeton, pp 1-557 29 Hochachka PW, Stanley C, Matheson GO, McKenzie DC, Alien PS, Parkhousc WS ( 1 9 9 1 ) Metabolic and work efficiencies during exercise in Andean natives. J. Appl. 26
Physiol , 70: 1720-1730
30
Hochachka PW, Stanley C, McKenzie DC, Villena A, C Monge C (1992) Enzyme
mechanisms for pyruvate-to-lactatc flux attentuation: A study of Sherpas, Quechuas, and
hummingbirds Int. J. Sport Med. 13, S11-123 31
Hlolden JE, Stone CK, Brown WD, Nickles RJ, Stanley C, Clark CM, Hochachka PW (1995) Enhanced cardiac metabolism of plasma glucose in high altitude natives. Adaptations against chronic hypoxia J. Appl. Physiol., 79: 222-228
32
Jones S, Martin R, Pilbeam D, Editors (1995) Human Evolution. Cambridge Univ. Press, Cambridge, UK p 1-506 33 Kayser B, Hoppeler H, Classsen H, Cerretelli P (1991) Muscle structure and performance capacity of Himalayan Sherpas. J. Appl. Physiol. 70, 1938-1942 34 Kayser B, Hoppeler H, Desplanches D, Marconi C, Broers B, Cerretelli P (1996) Muscle ultrastructure and biochemistry in lowland Tibetans. J. Appl. Physiol. 80, 632-637 Kirkpatrick M (1997) Genes and adaptation: A pocket guide to the theory. In: Rose M R , Lauder GV (eds), Adaptation.. Academic Press, San Diego, pp .125-146 36 Ladoux A, Felin C (1993) Hypoxia is a strong inducer of vascular endothelial growth factor m R N A expression in the heart Biochem. Biophys. Res. Commun. 195, 1005-1010 35
37
Lahiri S (1996) Peripheral chemoreceptors and their sensory neurons in chronic states
of hypo- and hyperoxygenation. Handbook of Physiology 2 (4), 1 183-1206 38 L a h i r i S, Edelman NH, Cherniack NS, and Fishman AP (1969) Blunted hypoxic drive to v e n t i l a t i o n in subjects with life-long hypoxemia. Fed. Proc. 28, 1289-1295
39
L.evine RD, Stray-Gunderson J (1996) A practical approach to altitude training: Where to live and tram for optimal performance enhancement. J. Appl. Physiol. 13, S209-212
40
Mangum CP, Hochachka PW (1998) New directions in comparative physiology and biochemistry: Mechanisms, adaptations, and evolution. Physiol. Zool., 71, 471-484. 41 Matheson GO, A l i e n PS, E l l i n g e r DC, Hanstock CC, Gheorghiu D, McKenzie DC,
Stanley C, Parkhouse WS, Hochachka, PW (1991) Skeletal muscle metabolism and work capacity: a 3 I P-NMR study of Andean natives and lowlanders. J. Appl. Physiol., 70: 19631976
42
42
Matsubayashi K, Ozawa T, Nakashima M, Saito A, Fukuyamu H, Harada N, Kameyama M (1986) Cerebral blood flow and metabolism before and after staying at high
altitude. J. Mountain Medicine 6, 51-57 Maxwell PH, Pugh CW, Ratcliffe PJ (1993) Inducible operation of the erythropoitin 3' enhancer in multiple cell lines: evidence for a widespread oxygen sensing mechanism. Proc. Natl. Acad. Sci. USA 90, 2423-2427 44 Mazzeo RS, Bender PR, Brooks GA, Butterfield GE, Groves BM, Sutton JR, Wolfel EE, Reeves JT ( 1 9 9 1 ) Arterial catecholamine responses during exercise with acute and chronic high-altitude exposure. Amer. J. Physiol. 261, E419-424 45 Moore LG, Curran-Everett L, Drama TS, Groves BM, McCullough RE, Sun SF, Sutton JR, Zamudio S, Zhuang JG (1992) Arc Tibetans better adapted? Intl. J. Sports Med. 43
13, S86-S88
46
Mottishaw PD, Thornton SK and Hochachka PW (1999). The diving response and its
surprisingly evolutionary path in seals and sea lions. Amer. Zool., 39, 434-450. 47 Ogita HE,Nakaoka, T, Matsuoka R, Takao A, Kira Y (1994) Rapid induction of vascular endothelial growth factor expression by transient ischemia in rat heart. Amer. J. Physiol. 267, H1948-1954
48
Resink T, Buravkova L, Mirzapoyazova E, Kohler E, Erne P, Tkachuk V. (1996)
Involvement of protein kinase C in hypoxia induced desensitization of the beta-adrenergic system in human endothelial cells. Biochem. Biophys. Res. Commun. 222, 753-758 49 Ridley M (1993) Evolution. Blackwell Scientific, Cambridge, MA, USA p141-183
50
Rosser BWC, Hochachka PW (1994) Metabolic capacity of muscle fibers from highaltitude natives. Europ. J. Appl. Physiol., 67: 513-517
5I
Rumsey WL Abbot B, Bertelsen D, Mallamaci M, Hagan K, Nelson D, Erecinska M (1999) Adaptation to hypoxia alters energy metabolism in rat heart. Amer. J. Physiol., in press 52 Saltin B, Kim CK. Terrados N, Larsen H, Svedenhag J, Rolf CJ (1995) Morphology,
enzyme activities, and buffer capacity in leg muscles of Kenyan and Scandinavian runners
53
Scand. J. Med. Sci. Sports 5, 222-230 Saltin B, Larsen H, Torrados N, Bangsbo J, Bak T, Kim CK, Svedenhag J, Rolf CJ (1995) Aerobic exercise capacity at sea level and at altitude in Kenyan boys, junior and senior
runners compared with Scandinavian runners. Scand. J. Med. Sci. Sports 5, 209-221 54
Samaja M, Mariani C, Prestini A, Cerretelli P (1997) Acid-base balance and 02 transport at high altitude. Acta Physiol. Scand. 159, 249-256
55
Strohl KP, Beall CM (1997) Ventilatory response to experimental hypoxia in adult male and female natives of the Tibetan and Andean pleateaus. In: Houston C. (ed) Women at Altitude. Queen City Printers, Burlington, VT pp 154-165
56
Terrados N (1992) Altitude training and muscular metabolism. Intl. J. Sports Med. 13, S206-209
57 58
Wang GL, Jian BH, Rue EA, Semenza G.L (1995) Hypoxia inducible factor 1 is a basic-helix-loop-helix PAS heterodimer regulated by cellular oxygen tension. Proc. Natl. Acad. Sci. USA 92, 5510-5514 Weir EK, Archer SL (1995) The mechanism of acute hypoxic pulmonary vasoconstriction: a tale of two channels. FASEB J. 9, 183-189
59
Wenger, RH, Gassman M (1997) Oxygen(es) and the hypoxia inducible factor 1. Biol. Chem. 378, 609-616
60
Winslow RM, C Mongr C (1987) Hypoxia, Polycythemia, and Chronic Mountain
Sickness. Johns Hopkins Univ. Press, Baltimore, pp 1-255 61 Zamudio S, Droma T, Norkyel KY, Acharya G, Zamudio JA, Niermeyer SN, Moore LG (1993) Protection from intrauterine growth retardation in Tibetans at high altitude. Amer. J. Physical Anthropol. 91, 215-224 (1993).
43
This page intentionally left blank.
COMPARATIVE ASPECTS OF HIGHALTITUDE ADAPTATION IN HUMAN POPULATIONS
Lorna G. Moore 1, 2, Fernando Armaza V .3, 4 Mercedes Villena 3 , Enrique Vargas 3 1
Department Of Anthropology, University Of Colorado At Denver, Denver, CO 80217-3364 Center For Women ’s Health Research, University of Colorado Health Center, 4200 East Ninth Avenue, Denver, CO 80262; 3Caja Nacional de Salud, La Paz, Bolivia; 4Instituto Boliviano de Biolog’a de la Altura, La Paz, Bolivia 2
1.
POPULATION DIFFERENCES IN DURATION OF
HIGH-ALTITUDE RESIDENCE
Nearly 140 million people live permanently above 2500 m (8,000 ft) throughout the world, with about 17% of these persons residing in Africa, 56% in Asia, 26% in Central and South, and <1% in North America (Moore et al 1998). Investigations at high altitude have helped to define the principal pathways through which organisms respond to hypoxic stress. As demonstrated by the presentations and publications of this conference, these studies have spanned the full range of levels of biological organization, from the molecular to cellular, organ, organ system, individual, population, species and beyond. The central question here is whether the physiological responses to hypoxia vary in relation to the length of time (in generations) of high-altitude residence and, if so, the mechanisms responsible. The opportunity to answer this question has been provided by several, recent, in-depth studies conducted in the Himalayan, Andean and Rocky Mountain high-altitude areas. As a result, the requisite data are available with which to determine whether
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
45
adaptation in the evolutionary sense of permitting an organism to live and reproduce (Dobzhansky, 1968) increases with the number of generations of altitude exposure. A lack of comparable studies in Africa prevents inclusion of that region and there are no permanent human settlements above 2500 m in Europe. From considerations of evolutionary theory, we would predict that natural selection has operated to select the genetic traits conferring the greatest adaptive advantage in the populations which have lived the longest at high altitude and have had the least degree of interbreeding (genetic admixture) from lowland groups.
1.1
Archaeologic/paleontologic evidence
Homimds have been present in Asia for more than a million years, longer than the duration of homimid occupation of North and South America (Wanpo el al. 1995). Late Pliocene artifacts million yrs old in northern Pakistan (Denell el al. 1988) indicate the presence of hominids within 75 km the Tibetan Plateau. Archaeologic materials have been found at 4500 to 5200 m in northern Tibet, consisting of more than 100 flakes and microliths that are similar in form and technology to Upper Paleolithic northern Asian tool cultures dated at 25,000 to 50,000 years of age (Sensui, 1981; Zhimin, 1982). Material dated in situ is more recent, consisting of 5000 yr old farming implements (Chang, 1992). Newcomer populations are also present on the Tibetan Plateau. Increasing numbers of Han (ethnic Chinese) began settling in Tibet in significant numbers following the 1951 Chinese takeover of Tibet, although small numbers of Han have lived longer in the northern portion of the Tibetan Plateau (Qinghai Province). Hence, the Han have resided at high altitude in significant numbers for less than 50 years. Humans reached South America as early as 9,000 to 12,000 years ago, having migrated in several waves over the Beringian land bridge from northeastern Asian groups (Neel et al. 1994). The source population for these early migrants is not likely to be closely related to ancestral Tibetans (Lell et al. 1997). Early South American inhabitants lived at coastal sites, relying on fishing but spent some of their time foraging or trading in the highlands, as demonstrated by the presence of stone tools made of obsidian from highland quarries (Sandweiss et al. 1998). Persons of European origin have lived at high altitudes in Central and South America for the yrs following the Spanish Conquest in the early 1500s. Considerable genetic admixture has occurred with indigenous inhabitants, resulting in the introduction of 5-30% of European genes into the contemporary gene pool (sum total of all genes present in a population) of Ecuador, Peru and Bolivia (Moore et al. 1998).
46
Permanent habitation of the high-altitude region of North America , encompassing portions of Wyoming, Colorado, Utah and New Mexico, began only 150 years ago. Current residents are genetically heterogeneous groups
which are descended from low-altitude Amerindian, European and Hispanic populations.
1.2
Linguistic and genetic evidence Linguistic and genetic evidence supports a longer period of residence
with less genetic admixture from lowland groups for the Tibetan population than the Andean population. Dental morphology, mitochondrial and nuclear genetic markers show Tibetans to be related to Korean, Siberian, Mongolian, Japanese and northern Han populations and to differ considerably from
southern Han, Cambodian and other southern Asian groups which are likely to be more recent migrants to Asia (Matsumoto, 1987; Torroni et al 1994; Turner, 1987; Lee et al. 1988; Zhao and Lee, 1989; Chu et al. 1998). The Tibetans’ membership in the Tibeto-Burmese language group differentiates them from northern Asian (including Mongolian) populations and indicates that Tibetans
have resided in their current location long enough for linguistic separation to have occurred. Surprisingly, Quechua and Aymara belong to separate linguistic groups, even though they reside next to each other on the altiplano and have much in common with each other culturally (Merriwether et al. 1995). The continued separation of language groups may reflect their comparatively recent arrival, since languages would be expected to become
more closely related with time, and/or the effectiveness of cultural isolating mechanisms. Unlike the Tibetan population, the Andean gene pool has undergone two major events, both of which are likely to have limited the range of genetic variation present. The first resulted from the lack of genetic variation throughout the Americas, suggesting a relatively small number of initial migrants or a source population with little genetic variation (Neel et al. 1994; Merriwether et al. 1995; Chen et al. 1995; Torroni et al. 1993). The
second was the loss of 95% of the population within the hundred years
following Spanish Conquest as the result of fighting, infectious disease, malnutrition and forced resettlement (Cook, 1981).
1.3
Geographic evidence
The over 800,000 sq mi Tibetan Plateau is twice as large as the 400,000 sq mi Andean altiplano. At least 1000 miles from the Bay of Bengal, it is more than ten times more distant from the nearest sea coast. Whereas the Andean altiplano is readily accessible from the Pacific Coast, the Tibetan Plateau is bounded by the world’s tallest mountains to the south, multiple
47
chains of very high peaks to the west and east, and one of the world’s largest deserts to the north. Consistent with their different geographic situations, trade routes descended from the Altiplano to the Amazon and Pacific Coastal Plain
at frequent intervals and the Pacific Coast was a ready point-of-contact for the devastating Spanish Conquest in the 1500s. While Tibetans traded with adjacent groups and, in the 13th and 14th centuries, were conquered by the Mongolians, the major trading routes such as the Silk Road avoided the Tibetan Plateau. The period of Mongolian domination was brief and more in the form
of patronage than subjugation (Avedon, 1986). Therefore, occupation of the Tibetan Plateau by lowland groups, until the arrival of the Han some 50 yrs ago, has been relatively limited in comparison with the Andean region. In summary, it is likely that persons have lived the longest on the Tibetan Plateau, for an intermediate length of time on the Andean altiplano and for the
shortest length of time in the Rocky Mountain region. Newcomer groups of European origin have lived on the Andean altiplano for yrs and of Han origin on the Tibetan Plateau for yrs. In addition to these differences in the duration of high-altitude residence, the Tibetan population is distinguished from the Andean population by living in a larger and more isolated region that is more distant from coastal regions. The Tibetan Plateau also, until recently, has not been conquered by low-altitude groups nor undergone known reduction(s) in the amount of genetic variation present (genetic drift). This means that the Tibetan population is more likely than the Andean population to have undergone natural selection and become genetically adapted to its environment.
2.
2.1
POPULATION DIFFERENCES IN PHYSIOLOGIC RESPONSE TO HYPOXIA Ventilation and HVR
Ventilation rises after ascent due to hypoxic stimulation which gradually overcomes the inhibitory effects of hypocapnia (ventilatory acclimatization). Because ventilation as measured at the mouth reflects the movement of air in dead space as well as the gas-exchange regions of the lung and also variation in metabolic rate, end-tidal is commonly used as an index of alveolar ventilation per unit carbon dioxide production (effective alveolar ventilation). A Rahn-Otis diagram, in which end-tidal (stimulus) is plotted against endtidal (response), is a convenient way to summarize the extent to which ventilatory acclimatization is present. Ventilatory acclimatization results in a
lower end-tidal
48
(higher effective alveolar ventilation) at a given end-tidal
in acclimatized newcomers of European or Han descent (Figure 1A, before vs. after acclimatization line). The similarity in responses suggests that genetic factors influencing ventilatory acclimatization are broadly distributed among human groups. Rocky Mountain (Dempsey et al. 1971; Weil et al. 1971) and Andean lifelong high-altitude residents (Severinghaus et al. 1966; Beall et al. 1997) show a diminution in ventilation relative that present in acclimatized newcomers (Figure IB). Earlier reports suggested that Sherpa, a population residing in Nepal but of Tibetan origin, also hypoventilated relative to acclimatized newcomers but these studies were conducted in small numbers of subjects, some of whom had been exposed to a range of altitudes (Lahiri, 1968; Lahiri and Milledge, 1967). Most (Zhuang et al. 1993; Huang et al. 1981; Hackett et al. 1980) but not all (Santolaya et al.1989) recent studies find levels of effective alveolar ventilation in Tibetans which are equivalent to those of acclimatized newcomers. Summarizing these data (Figure 1B), nearly all the Tibetan high-altitude points are closer to the "after-acclimatization" curve than the Andean ones, indicating a greater effective alveolar ventilation in the Tibetan than Andean highlanders (Zhuang et al. 1993). This conclusion is supported by direct comparisons by Beall and co-workers in large numbers of Aymara and Tibetans living at the same altitude (Beall et al. 1997). An important factor influencing ventilation at high altitude is the hypoxic ventilatory response (HVR) (Huang et al. 1984; Lahiri et al. 1969; Weil et al. 1971; Milledge and Lahiri, 1967: Severinghaus et al. 1966). Consistent with the maintenance of higher ventilation, we have found HVRs in lifelong Tibetan high-altitude residents that are at least as great as those of acclimatized newcomers, greater than newcomers who migrated to high altitude as children, and greater than Andean residents of similar altitudes (Zhuang et al. 1993; Huang et al. 1981; Hackett et al. 1980; Beall et al. 1997). The higher HVRs in Tibetans than Andeans are likely due to genetic factors. Twin studies at low altitude demonstrate that a significant portion of the variation in HVR is due to genes (Collins et al. 1978; Kawakami et al. 1982). At high altitude, the studies of Beall and co-workers demonstrate significant, higher heritability in Tibetans (34%) than Andeans (22%), leading the authors to suggest that natural selection has acted to increase the frequency of genes for high ventilation and maintain HVR in the Tibetans (Beall et al. 1997).
2.2
Pulmonary arterial pressure
Pulmonary arterial pressure rises after ascent to high altitude as a result of hypoxic pulmonary vasoconstriction. Elevated pulmonary arterial pressure and resistance are probably maladaptive responses to high altitude, because
49
50
they result in minimal improvement in ventilation-perfusion matching, increased work load for the right ventricle, limited cardiac output reserve, and can lead to right ventricular decompensation and death. We found pulmonary arterial pressure and resistance to be remarkably low and unresponsive to added hypoxia in healthy Tibetan residents of high altitude in comparison with lifelong Rocky Mountain or Andean high-altitude natives (Figure 2). Neither exercise to near-maximal levels nor breathing hypoxic gas mixtures sufficient to lower arterial to 36 mmHg raised the Tibetans’ pulmonary arterial pressure (Figure 2) or resistance (Groves et al. 1993). Consistent with the absence of hypoxic pulmonary vasoconstriction were observations in Tibetan men at 3600 m in Ladakh which showed a lack of smooth muscle in the small pulmonary arteries (Gupta et al. 1992). Resistance to hypoxic pulmonary hypertension, a trait for which a genetic contribution has been well established, has also been observed in yak and other long-resident, high-altitude species (Durmowicz et al. 1993; Sun et al. 1989; Banchero et al. 1971). Thus, it appears that Tibetans, unlike Andeans or Rocky Mountain high-altitude residents, are protected from hypoxic pulmonary hypertension.
2.3
Hemoglobin concentration
Hemoglobin concentration is lower in Himalayan than Andean highlanders, averaging 1-4 gm/100 ml whole blood at a given altitude (Beall et al 1990; Beall and Reichsman, 1984; Beall and Goldstein, 1987; Beall and Goldstein, 1990; Beall et al. 1998; Winslow et al. 1989). Lower hemoglobin may result from a lesser hypoxic stimulus, due perhaps to better-maintained ventilation during the day or night and/or a lesser erythropoietic response (Winslow et al.1990). Other factors may be involved, including developmental 51
regulation of hemoglobin production, red blood cell destruction, and factors influencing the likelihood of developing chronic lung disease (Hsu et al.1988;
Frisancho, 1988). For hemoglobin values within the physiological range, the reduction in arterial content is likely offset by decreased blood viscosity and improved organ perfusion, and may be an important means of guarding against the development of chronic mountain sickness.
2.4
Chronic Mountain Sickness (CMS) Chronic Mountain Sickness (CMS), sometimes called Monge's disease
or excessive polycythemia, is an example of adaptive failure (Monge, 1948). It occurs among adults and older-aged persons after prolonged residence at high altitude and can eventually be fatal unless treated by phlebotomy, respiratory stimulants or descent. Diagnosis is based on hemoglobin or hematocrit values above the normal range for that altitude in the absence of chronic lung or leftsided heart disease (Monge-C et al.1992; Kryger et al. 1978). Symptoms of
headache, dizziness, shortness of breath, fatigue, loss of memory, and insomnia are sometimes used as well (Leon-Velarde et al. 1997).
The prevalence of CMS varies by region and by gender. Women have lower prevalence than men in all regions and prevalence in Tibetans is one-third to half as great as that seen in Han or Peruvian residents of the same altitude (Moore et al. 1999a). Since common criteria for diagnosing CMS have not been used in all studies, these comparisons are necessarily imprecise but the protection afforded Tibetans is sufficiently great that it is unlikely to be due to differences in diagnostic criteria alone. The protection afforded Tibetans may be due to higher ventilation during wakefulness or sleep, and other factors such as improved blood flow, differences in tissue oxygenation or
erythropoietic response.
3.
BARKER HYPOTHESIS AND INTRAUTERINE OXYGENATION As judged by their maintenance of high ventilation and HVR, absence
of elevated pulmonary arterial pressure, lower hemoglobin, comparative freedom from CMS, protection from intrauterine growth restriction and better neonatal oxygenation (see below), Tibetans appear better adapted to high altitude than Andeans. These physiological differences probably reflect the operation of one or more genes. Exactly what genes are involved is not currently known but the search for candidate genes has begun (Zhao et al.1999; Stelzner et al.1997; Moore et al.1999c). An understanding of the operation of such genes will improve our knowledge of the processes by which natural
selection and adaptation have occurred and may reveal insights as to the
52
source(s) of differences between the Tibetan and Andean cases. A complementary line of inquiry is to consider existing evidence regarding the
processes by which natural selection may have operated in these populations. In the absence of definitive information regarding the genetic basis of Tibetan Andean differences in physiologic response to high altitude, we elected to follow the second approach. According to classical evolutionary theory, the effects of natural selection are most pronounced when the influences of the trait in question act before the completion of the reproductive period. In this regard, pregnancy and intrauterine life is a particularly important period because the mortality risk to mother and offspring are greater than at any other time for the fetus, and are elevated for the mother as well. Factors influencing survival during pregnancy/intrauterine life not only have immediate impact but, as developed by David J. P. Barker, poor intrauterine growth and development appear to increase susceptibility to cardiovascular diseases later in life (Barker et al 1992; Barker and Martyn, 1992). Evidence in support of this idea, termed the "Barker hypothesis", has come from extensive epidemiological studies in Great Britain in which Barker and colleagues found that lower infant birth weight, higher placental weights, and/or higher ratios of placental to birth weight increased the risk of systemic hypertension later in life more than body mass index or alcohol consumption (Barker et al. 1992). Considerable research is currently taking place to investigate the mechanisms by which intrauterine and early postnatal characteristics might influence subsequent susceptibility to disease. Several studies support the applicability of the Barker hypothesis to high-altitude physiology. Okubo and Mortola showed in rats that neonatal hypoxia altered their ventilatory characteristics and heart weight ratios as adults (Okubo and Mortola, 1990) (Table 1). Those experiencing neonatal hypoxia had low acute hypoxic ventilatory responses, similar to what has been reported for North and South American highlanders. Higher blood pressures and heart weight ratios indicative of right ventricular hypertrophy suggested that neonatal hypoxia may also have predisposed the animals to developing cardiovascular problems as adults. Similar findings have been reported by Hohimer and colleagues who studied mice which were made hypoxic (12% for 16 days following birth. As adults, the previously-hypoxic animals had 43% greater right ventricular hypertrophy than controls. Genderspecific effects were seen in left heart dimensions such that previously-hypoxic males exhibited an increase in left ventricular diastolic dimension and intraventricular septal diastolic and systolic thickness, whereas previouslyhypoxic females showed a decrease relative to controls (Hohimer et al. 1999). In humans, men who had experienced hypoxic pulmonary hypertension as neonates demonstrated higher pulmonary arterial pressures after exposure to
53
4559 m as adults (Sartori et al.1999). When at 4559 m, breathing nitric oxide decreased pulmonary arterial pressure in both groups but to a greater extent in the men with transitory neonatal pulmonary hypertension, leading the authors to suggest that newborn hypoxia may impair the ability to increase NO synthesis and diminish pulmonary artery pressure during adulthood (Sartori et al.1999).
Applying this hypothesis to high altitudes, the question becomes whether differences between the Tibetan and Andean patterns of physiological response to high altitude might be the result of differences in intrauterine development. In other words, does better intrauterine or neonatal oxygenation protect Tibetans from pulmonary hypertension and CMS?
3.1
Population differences in birth weight reduction at high altitude
One of the best-documented effects of high altitude is a progressive reduction in birth weight. Babies are both lighter and shorter for gestational age, conforming to a model of growth retardation throughout pregnancy with the greatest absolute reduction in fetal size occurring in the mid to late third trimester (McCullough et al. 1977; Unger et al. 1988). This birth weight reduction or, more specifically the degree of intrauterine growth restriction (IUGR), can serve as a useful index of fetal oxygenation. This is justified by the observation that birth weight is reduced under a variety of circumstances in which intrauterine hypoxia is exaggerated, by epidemiological observations showing that the reduction in birth weight at high altitude is a direct effect of high-altitude hypoxia and not effects of other risk factors (Jensen and Moore, 1997), and by studies which show that the amount of oxygen delivered to the uteroplacental circulation relates directly to infant birth weight at high altitude (Zamudio et al. 1995).
54
Summarizing all published data for Andean, Tibetan and North American high-altitude residents, birth weights decline an average of 100 gm per 1000 m altitude gain . When data are differentiated by population ancestry, the magnitude of fetal growth retardation varies in relation to the duration of high-altitude residence (Figure 3). The longest-resident
population (Tibetans) experienced the least decline, followed by the Andeans, Europeans, and lastly the Han.
These population differences are supported by three kinds of studies. The first is the comparison of studies conducted by the same investigator in women of the same genetic background who resided at sea level or 31003600 m. The greatest birth weight reduction was seen in the Rocky Mountain
region an intermediate decline occurred in Andeans (-270 gm in Peru and -282 gm in Bolivia, ), and the least change was found in Tibetans (reviewed in (Zamudio et al. 1993). Second, we collected birth weight, gestational age and related data from Tibetan and Han residents of 2800 to 4800 m altitudes in Tibet. The altitude-associated birth weight reduction in the Tibetans was much less than that observed in the Han (Moore et al. 1999b). Third, we studied healthy Tibetan, Han, European, and Andean women residing at 3600 m (Table 2, Figure 4). No woman smoked cigarettes during her pregnancy, all received prenatal care, and all were well-nourished, representing a middle- to upper-class segment of the 1 Data reported by Wiley for women residing in Ladakh, India are not included in the data set used for generating the Tibetan line since only 6% of the sample was Tibetan (Wiley, 1994).
55
population in their respective communities. Birth weights were heaviest in the babies born to the Tibetan women and progressively lower in the Andean, European and Han women (Figure 4). Gestational age was greater in the Tibetan than Andean or European women but if births were restricted to term births (37-40 wks gestational age), a similar pattern of variation in birth weight was seen. Gravidity was greater in the Andean women than in each of the
56
other groups. When only first pregnancies were considered, a similar pattern of decline in birth weights was observed but the Andean babies weighed significantly less than the Tibetan newborns (Table 2).
3.2
Population differences in neonatal oxygenation at high altitude
At birth, the lungs change from fluid-to air-filled, and vascular shunts reverse directions and close. Current evidence indicates that this cardiopulmonary transition is altered under conditions of ambient hypoxia. Arterial saturation at high altitudes falls during the first week of postnatal life whereas it doesn't change at sea level (Thilo et al. 1991; Niermeyer et al. 1993; Niermeyer et al. 1995). Remarkably, Tibetan newborns had higher
arterial saturations throughout the first four months of life than Han babies born at the same altitude (Niermeyer et al. 1995). Further, arterial saturation stabilized in the Tibetans at four months of age above the values seen by the same investigators in Colorado some 500 m lower, while arterial saturation declined progressively to an average of 76% in the Han (Niermeyer et al. 1995). Higher arterial saturations may be responsible for the protection reported for Tibetan compared with Han babies from a syndrome of pulmonary hypertension and right heart failure ("subacute infantile mountain sickness") (Khoury and Hawes, 1963; Sui et al. 1988).
4.
SUMMARY AND CONCLUSIONS
The conditions and duration of high-altitude residence differ among high-altitude populations. The Tibetan Plateau is larger, more geographically remote, and appears to have been occupied for a longer period of time than the Andean Altiplano and, certainly, the Rocky Mountain region as judged by archaeological, linguistic, genetic and historical data. In addition, the Tibetan gene pool is less likely to have been constricted by small numbers of initial migrants and/or severe population decline, and to have been less subject to genetic admixture with lowland groups. Comparing Tibetans to other highaltitude residents demonstrates that Tibetans have •
less intrauternine growth retardation
•
better neonatal oxygenation
•
higher ventilation and hypoxic ventilatory response
•
lower pulmonary arterial pressure and resistance
•
lower hemoglobin concentrations and less susceptibility to CMS 57
These findings are consistent with the conclusion that "adaptation" to high altitude increases with time, considering time in generations of high-altitude exposure. Future research is needed to compare the extent of IUGR and neonatal oxygenation in South American high-altitude residents of Andean vs. European ancestry, controlling for gestational age and other characteristics. Another fruitful line of inquiry is likely to be determining whether persons with CMS or other altitude-associated problems experienced exaggerated hypoxia during prenatal or neonatal life. Finally, the comparison of high-altitude populations with respect to the frequencies of genes involved in oxygen sensing and physiologic response to hypoxia will be useful, once candidate genes have been identified.
REFERENCES Avedon, J.F., 1986, In Exile in the Land of Snows. Vintage Books, New York, NY, USA. Pp.3-33. Bunchero, N., Grover, R.F., and Will, J.A., 1971, High altitude-induced pulmonary arterial hypertension in the llama (Lama glama). Am. J. Physiol. 220:422-427.
Barker, D.J.P., Bull, A.R., Osmond, C, and Simmonds, S.J., 1992, Fetal and placental size and risk of hypertension in adult life. In Fetal and Infant Origins of Adult Disease. (D.J.P.
Barker, ed.), British Medical Journal, London, pp. 175-186. Barker, D.J.P. and Martyn, C.N., 1992, Review: Maternal and fetal origins of cardiovascular disease. In Fetal and Infant Origins of Adult Disease. (D.J.P. Barker and R.J. Robinson,
eds.), British Medical Journal, London, pp.315-322. Beall, C.M. and Rcichsman, A.B., 1984, Hemoglobin levels in a Himalayan high altitude population. Am. J. Phys. Anthropol. 63:301-306.
Beall, C.M. and Goldstein, M.C., 1987, Hemoglobin concentration of pastoral nomads permanently resident at 4,850–5,450 meters in Tibet. Am. J. Phys. Anthropol. 73:433-438.
Beall, C.M., Brittenham, G.M., Macuaga, F., and Barragan, M., 1990, Variation in hemoglobin concentration among samples of high-altitude natives in the Andes and the Himalayas. Am. J. Hum. Bial. 2:639-651. Beall, C.M. and Goldstein, M.C., 1990, Hemoglobin concentration, percent oxygen saturation and arterial oxygen content of Tibetan nomads at 4850 to 5450 m. In Hypoxia: The Adaptations. (J.R. Sutton, G. Coates and J.E. Remmers, eds.), Decker, Inc, Toronto, pp.59-65. Beall, C.M., Strohl, K.P., Blangero, J., Williams-Blangero, S., Almasy, L.A., Decker, M.J., Worthman, C.M., Goldstein, M.C., Vargas, E., Villena, M., Soria, R., Alarcon, A.M., and Gonzales, C., 1997, Ventilation and hypoxic ventilatory response of Tibetan and Aymara high altitude natives. Am. J. Phys. Anthropol. 104:427-447.
Beall, C.M., Brittenham, G.M., Strohl, K.P., Blangero, J., Williams-Blangero, S., Goldstein, M.C., Decker, M.J., Vargas, E., Villena, M., Soria, R., Alarcon, A.M., and Gonzales, C., 1998, Hemoglobin concentration of high-altitude Tibetans and Bolivian Aymara. Am. J. Phys Anthropol. 106:385-400.
58
Chang, K.C., 1992, China. In Chronologies in Old World Archaeology. (R.W. Ehrich, ed.), University of Chicago Press, Chicago, IL. Chen, Y.S., Torroni, A., Excoffier, L., Santachiara-Benerecetti, A.S., and Wallace, D.C., 1995, Analysis of mtDNA variation in African populations reveals the most ancient of all human continent-specific haplogroups. Am. J. Hum. Genet. 57:133-149.
Chu, J.Y., Huang, W., Kuang, S.Q., Wang, J.M., Xu, J.J., Chu, Z.T., Yang, Z.Q., Lin, K.Q., Li, P., Wu, M., Geng, Z.C., Tan, C.C., Du, R.F., and Jin, L., 1998, Genetic relationship of populations in China. Proc. Natl. Acad. Sci. U. S. A , 95:11763-11768. Collins, D.D., Scoggin, C.H., Zwillich, C.W., and Weil, J.V., 1978, Hereditary aspects of
decreased hypoxic response. J. Clin. Invest. 62:105-110. Cook, N.D., 1981, Demographic Collapse, Indian Peru, 1520-1620. Cambridge University Press, New York, NY, USA. Dempsey, J.A., Reddan, W.G., Birnbaum, ML., Forster, H.V., Thoden, J.S., Graver, R.F., and Rankin, J., 1971, Effects of acute through life-long hypoxic exposure on exercise pulmonary gas exchange. Respir. Physiol. 13:62-89. Denell, R.W., Rendell, H.M., and Hialwood, E., 1988, Late Pliocene artifacts from northern Pakistan. Curr. Anthropol. 29:495-498.
Dobzhansky, T., 1968, Adaptedness and fitness. In Population Biology and Evolution. (R.C. Lewontin, ed.), Syracuse University Press, Syracuse, NY, pp.111-205. Durmowicz, A.G., Hofmeistcr, S., Kadyraliev, T.K., Aldashev, A.A., and Stenmark, K.R., 1993, Functional and structural adaptation of the yak pulmonary circulation to residence
at high altitude. J. Appl. Physiol. 74:2276-2285. Frisancho, A.R., 1988, Origins of differences in hemoglobin concentration between Himalayan and Andean populations. Respir. Physiol. 72:13-18. Groves, B.M., Droma, T., Sutton, J.R., McCullough, R.G., McCullough, R.E., Zhuang, J., Rapmund, G., Sun, S., Janes, C., and Moore, L.G., 1993, Minimal hypoxic pulmonary hypertension in normal Tibetans at 3,658 m. J. Appl. Physiol. 74:312-318. Gupta, M.L., Rao, K.S., Anand, I.S., Banerjee, A.K., and Boparai, M.S., 1992, Lack of
smooth muscle in the small pulmonary arteries of the native Ladakhi. Is the Himalayan highlander adapted? Am. Rev. Respir. Dis. 145:1201-1204.
Hackett, P.H., Reeves, J.T., Reeves, C.D., Grover, R.F., and Rennie, D., 1980, Control of breathing in Sherpas at low and high altitude. J. Appl. Physiol. : Respir. Environ. Exer. Physiol. 49:374-379.
Hohimer, A.R., Davis, L.E., and Pantley, G.A., 1999, Perinatal hypoxia caused residual right ventricular (RV) hypertrophy and gender specific effects on left ventricular (LV) and septal dimensions in young adult mice. In Hypoxia.- into the next mil/enium. (P. Hackett and R. Roach, eds.), pp.2000-20001.
Hsu, S.L., Marks, J., Shaw, J.P., Tam, M., Higgs, D.R., Shen, C.C., and Shen, C.K., 1988, Structure and expression of the human theta 1 globin gene. Nature 331:94-96. Huang, S.Y., Alexander, J.K., Grover, R.F., Maher, J.T., McCullough, R.E., McCullough, R.G., Moore, L.G., Sampson, J.B., Weil, J.V., and Reeves, J.T., 1984, Hypocapnia and sustained hypoxia blunt ventilation on arrival at high altitude. J. Appl. Physiol. : Respir. Environ. Exer. Physiol. 56:602-606.
Huang, Z.R., Zhu, S.C., Ba, Z.F., and Hu, S.T., 1981, Ventilatory control in Tibetan highlanders. In Geological and Ecological Studies of Qinghai-Xizang Plateau. (D.S. Liu, cd.), Science Press, Beijing, PRC, pp. 1363-1369. Jensen, G.M. and Moore, L.G., 1997, The effect of high altitude and other risk factors on birthweight: Independent or interactive effects’? Am. J. Pub. Hlth. 87:1003-1007. Kawakami, Y., Yoshikawa, T., Shida, A., Asanuma, Y., and Murao, M., 1982, Control of breathing in young twins. J. Appl. Physiol. : Respir. Environ. Exer. Physiol. 52:537-542.
59
Khoury, G.H. and Hawes, C.R., 1963, Primary pulmonary hypertension in children living at high altitude, J. Pediatr. 62:177-185. Kryger, M., McCullough, R.E., Collins, D., Scoggin, C.H., Weil, J.V., and Grover, R.F., 1978, Treatment of excessive polycythemia of high altitude with respiratory stimulant drugs. Am. Rev Respir. Dis. 117:455-464.
Lahiri, S. and Milledge, J.S., 1967, Acid-base in Sherpa altitude residents and lowlanders at 4880 m. Respir. Physiol. 2:323-334. L a h i r i , S., 1968, Alveolar gas pressures in man with life-time hypoxia. Respir. Physiol. 4:373-386. Lahiri, S., Kao, F.F., Velasquez, T., Martinez, C., and Pezzia, W., 1969, Irreversible blunted respiratory sensitivity to hypoxia in high altitude natives. Respir. Physiol. 6:360-374. Lee, T.D., Zhao, T.M., Mickey, R., Sun, Y.P., Lee, G., Song, C.X., Cheng, D.Z., Zhou, S., Ding, S.Q., and Cheng, D.X., 1988, The polymorphism of HLA antigens in the Chinese. Tissue Antigens 32:188-208. Lell, J.T., Brown, M.D., Schurr, T.G., Sukernik, R.I., Starikovskaya, Y.B., Torroni, A., Moore, L.G., Troup, G.M., and Wallace, D.C., 1997, Y chromosome polymorphisms in native American and Siberian populations: identification of native American Y chromosome haplotypes. Hum. Genet 100:536-543. Leon-Velarde, F., Ramos, M.A., Hernandez, J.A., Deidiaquez, D., Munoz, L.S., Gaffo, A., Cordova, S., Durand, D., and Monge, C., 1997, The role of menopause in the development of chronic mountain sickness. Am. J. Physiol. 41:R 90-R 94. Matsumoto, H., 1987, Characteristics of the Mongloid and neighboring populations on the basis of the genetic markers of immunoglobins. J. Anthro. Soc. Nippon 95:291 -304.
McCullough, R.E., Reeves, J.T., and Liljegren, R.L., 1977, Fetal growth retardation and increased infant mortality at high altitude. Archiv. Environ. Hlth. 32:36-40. Merriwethcr, D.A., Rothhammer, F., and Ferrell, R.E., 1995, Distribution of the four founding lineage haplotypes in Native Americans suggests a single wave of migration for the New World. Am. J. Phys. Anthropol. 98:411-430. Milledge, J.S. and Lahiri, S., 1967, Respiratory control in lowlanders and Sherpa highlanders at altitude. Respir. Physiol. 2:310-322. Monge, C.M., 1948, Acclimatization in the Andes. Johns Hopkins Press, Baltimore, MD, USA., pp. 36-37. Mongc-C, C., Arregui, A., and Leon-Velarde, F., 1992, Pathophysiology and epidemiology of chronic mountain sickness. Int. J. Sports Med. 13:S79-S81. Moore, L.G., Niermeyer, S., and Zamudio, S., 1998, Human adaptation to high altitude: Regional and life cycle perspectives. Am. J. Phys. Anthropol. Yearb. 41:25-64. Moore, L.G., Asmus, I., and Curran, L., I999a, Chronic Mountain Sickness: Gender and geographic variation. In Progress in Mountain Medicine and High Altitude Physiology. (3rd World Congress on Mountain Medicine and High Altitude Physiology, (in press). Moore, L.G., Young, D.Y., Droma, T.S., Zhuang, J.G., and Zamudio, S., 1999b, Tibetan protection from intrauterine growth retardation at high altitude. J. Am. Med. Assoc. (in press). Moore, L.G., Zamudio, S., Zhuang, J., Droma, T.S., McCullough, R.E., and Shohet, R., 1999c, Variation in the myoglobin gene among Tibetans living at 3000–4500 m. Am. J. Phys. Anthropol. (in press). Neel, J.V., Biggar, R.J., and Sukernik, R.I., 1994, Virologic and genetic studies relate Amerind origins to the indigenous people of the Mongolia/Manchuria/southeastern Siberia region. Proc. Nad Acad. Sci. U. S. A 91:10737-10741.
60
Niermeyer, S., Shaffer, E.M., Thilo, E., Corbin, C., and Moore, L.G., 1993, Arterial oxygenation and pulmonary arterial pressure in healthy neonates and infants at high altitude. J Pediatr. 123:767-772.
Niermeyer, S., Yang, P., Shanmina, J., Drolkar, T., Zhuang, J., and Moore, L.G., 1995, Arterial oxygen saturation in Tibetan and Han infants born in Lhasa, Tibet. N. Engl. J. Med. 333:1248-1252.
Okubo, S. and Mortola, J.P., 1990, Control of ventilation in adult rats hypoxic in the neonatal period. J. Appl Physiol. 259:R836-R841. Sandweiss, D.H., McInnis, H., Burger, R.L., Cano, A., Ojeda, B., Paredes, R., del Carmen
Sandweiss, M., and Glascock, M.D., 1998, Quebrada Jaguay: Early South American maritime adaptations. Sci. 281:1830-1832. Santolaya, R.B., Lahiri, S., Alfaro, R.T., and Schoene, R.B., 1989, Respiratory adaptation in
the highest inhabitants and highest Sherpa mountaineers. Respir. Physiol. 77:253-262. Sartori, C., Allemann, Y., Trueb, L., Delabays, A., Nicod, P., and Scherrer, U., 1999, Augmented vasorcactivity in adult life associated with perinatal vascular insult. Lancet 353:2205-2207. Sensui, Z., 1981, Uncovering prehistoric Tibet. China Reconstructs 1:64-65. Severinghaus, J.W., Bainton, C.R., and Carcelen, A., 1966, Respiratory insensitivity to hypoxia in chronically hypoxic man. Respir. Physiol. 1:308-334.
Stelzner, T., Hoffmann, T.A., Brown, D., Deng, A., and Jacob, H.J., 1997, Genetic determinants of pulmonary hypertension in fawn–hooded rats. Chest 111:968. Sui, G.J., Liu, Y.H., Cheng, X.S., Anand, I.S., Harris, E., Harris, P., and Heath, D., 1988, Subacutc i n f a n t i l e mountain sickness. J. Pathol. 155:161-170.
Sun, S.F., Sui, G.Z., Liu, Y.H., Cheng, X.S., Anand, I.S., Harris, P., and Heath, D., 1989, The pulmonary circulation of the Tibetan snow pig (marmota himalaya hodgson). J. Zool. 217:85-91. Thilo, E.H., Park-Moore, B., Berman, E.R., and Carson, B.S., 1991, Oxygen saturation by pulse oximetry in healthy infants at an altitude of 1610 m (5280 ft). What is normal?. Am.
J Dis. Child. 145:1137-1140. Torroni, A., Schurr, T.G., Cabcll, M.F., Brown, M.D., Neel, J.V., Larsen, M., Smith, D.G., Vullo, C.M., and Wallace, D.C., 1993, Asian affinities and continental radiation of the four founding Native American mtDNAs. Am. J. Hum. Genet. 53:563-590. Torroni, A., Miller, J.A., Moore, L.G., Zamudio, S., Zhuang, J., Droma, T., and Wallace, D.C., 1994, Mitochondrial DNA analysis in Tibet: implications for the origin of the Tibetan population and its adaptation to high altitude. Am. J. Phys. Anthropol. 93:189199.
Turner, C.G., 1987, Late Pleistocene and Holocenc population history of East Asia based on dental variation. Am. J. Phys. Anthropol. 73:305-321. Unger, C., Weiser, J.K., McCullough, R.E., Keefer, S., and Moore, L.G., 1988, Altitude, low
birth weight, and infant mortality in Colorado. J. Am. Med. Assoc. 259:3427-3432. Wanpo, H., Ciochon, R., Yumin, G., Larick, R., Qiren, F., Schwarcz, H., Yonge, C., deVos, J., and Rink, W., 1995, Early Homo and associated artefacts from Asia. Nature 378:275278. Weil, J.V., Byrne-Quinn, E., Sodal, I.E., Filley, G.F., and Grover, R.F., 1971, Acquired attenuation of chcmoreceptor function in chronically hypoxic man at high altitude. J. din. Invest. 50:186-195.
Wiley, A.S., 1994, Neonatal size and infant mortality at high altitude in the western Himalaya. Am. J. Phys. Anthropol. 94:289-305.
61
Winslow, R.M., Chapman, K.W., Gibson, C.C., Samaja, M., Monge, C.C., Goldwasser, E., Sherpa, M., Blumc, F.D., and Santolaya, R., 1989, Different hematologic responses to hypoxia in Sherpas and Quechua Indians. J. Appl. Physiol. 66:1561–1569. Winslow, R.M., Chapman, K.W., and Monge, C.C., 1990, Ventilation and the control of erythropoiesis in high-altitude natives of Chile and Nepal. Am. J. Hum. Biol. 2:653–662. Zamudio, S., Droma,., Norkyel, K.Y., Acharya, G., Zamudio, J.A., Niermeyer, S.N., and Moore, L.G., 1993, Protection from intrauterine growth retardation in Tibetans at high altitude. Am. J. Phys. Anthropol. 91:215–224. Zamudio, S., Palmer, S.K., Stamm, E., Coffin, C, and Moore, L.G., 1995, Uterine blood flow at high altitude. In Hypoxia and the Brain. (J.R. Sutton and C.S. Houston, eds.), Queen City Press, Burlington, VT, USA, pp.112–124. Zhao, L., Long, L., Morrell, N.W., and Wilkins, M.R., 1999, NPR-A-Deficient mice show increased susceptibility to hypoxia-induced pulmonary hypertension. Circulation 99:605607.
Zhao, T.M. and Lee, T.D., 1989, Gm and Km allotypes in 74 Chinese populations: a hypothesis of the origin of the Chinese nation. Hum. Genet 83:101–1 10. Zhimin, A., 1982, Paleoliths and microliths from Shenja and Shuanghu, Northern Tibet. Curr. Anthropol. 23:493–499. Zhuang, J., Droma, T., Sun, S., Janes, C., McCullough, R.E., McCullough, R.G., Cymerman, A., Huang, S.Y., Reeves, J.T., and Moore, L.G., 1993, Hypoxic ventilatory responsiveness in Tibetan compared with Han residents of 3,658 m. J. Appl. Physiol. 74:303–311.
62
TIBETAN AND ANDEAN CONTRASTS IN ADAPTATION TO HIGH-ALTITUDE HYPOXIA
Cynthia M. Beall Department of Anthropology, Case Western Reserve University, Cleveland, OH 44106–7125
USA
Abstract:
High-altitude environments provide natural experimental settings to investigate adaptation to environmental stress. An important evolutionary and functional question is whether sea-level human biology constrains the adaptive response. This paper presents evidence that indigenous populations of the Tibetan and Andean plateaus exhibit quantitatively different responses to
hypobaric hypoxic stress. At the same altitude, Tibetan mean resting ventilation and hypoxic ventilatory response were more than one-half standard deviation higher than Andean Aymara means while Tibetan mean oxygen saturation and hemoglobin concentration were more than one standard deviation below the Andean means. Quantitative genetic analyses of the familial patterning of these traits provided indirect evidence of population
differences in genes influencing them. The Tibetan and Andean patterns of oxygen transport appear equally effective functionally as evaluated by birthweight and maximal aerobic capacity across a range of altitudes.
1.
INTRODUCTION High-altitude environments provide natural experimental
settings to investigate the processes of adapting to and maintaining
homeostasis
under
an
environmental
stress.
Reasoning
that
adaptations of oxygen transport systems will occur to offset the hypobaric hypoxic stress of high altitude, research has focused on the pulmonary and hematological systems. A key question is whether human biology constrains the adaptive response to high-altitude hypoxia or whether human biology is capable of a range of responses.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
63
A related question is the influence of genetic factors on the adaptive response. These questions can be addressed by comparing highaltitude native populations descended from different founding populations. A natural experiment in evolution has occurred twice as human populations have occupied high-altitude areas of the Tibetan plateau in Asia and the Andean plateau in South America. The outcomes of the experiments were different as indicated by one pattern of adaptation among populations indigenous to the Tibetan and another among those indigenous to the Andean plateau.
2.
TIBETAN-ANDEAN CONTRASTS
The first purpose of this report is to present evidence that indigenous Tibetan and Andean populations differ in their adaptive responses. The second is to describe knowledge of the genetic bases of these responses. The report focuses on data from one comparative study designed to maximize comparability of findings. It used the same recruitment processes, measurement and analytic techniques to compare large samples of Tibetan
and Andean Aymara
high-altitude natives living at the same altitude and under the same hypobaric stress. The study communities were rural agropastoral village areas located at a median altitude of 4000m (13,200’) in the Tibet Autonomous Region of China and in Bolivia. The low barometric pressure at that altitude results in a volume of inspired air that has just 63% of the oxygen molecules that it would have at sea level. Detailed results have been reported elsewhere (Beall et al., 1999; Beall et al., 1998; Beall et al., 1997a and b). Four oxygen transport traits widely reported in studies of high-altitude adaptation are resting ventilation, hypoxic ventilatory response, oxygen saturation of arterial hemoglobin and hemoglobin concentration.
2.1
Resting Ventilation
High resting ventilation was characteristic of Tibetan, but not Aymara, lifelong high-altitude adaptation. The scatterplot in Figure 1 compares Tibetans and Aymara on the basis of resting ventilation for males and females from early adolescence through old age. Tibetan resting ventilation was roughly 50% higher than Aymara resting ventilation. For example, adult male Tibetans had an average resting ventilation of 19.7 L/min compared with an average of 13.4 L/min for adult male Aymara (Beall et al., 1997a).
64
Such striking differences in mean values of a quantitative trait measured in samples of healthy people are generally interpreted as evidence of ‘genetic differences’ even though the genetic bases of the trait are unknown and the trait is known to be influenced by individual and environmental factors. The quantitative genetic approach to
analyses of such traits is to partition the variance into contributions by various sources including covariates such as age and sex, shared
household environments, random environmental differences among individuals and that due to genetic relationships among individuals in the sample. A summary value for such quantitative genetic analyses is the heritability , calculated as the proportion of variance attributable to genetic relationships among individuals (Falconer, 1989). Heritability can take values from zero to one, that is, from none to all of the variance in a trait may be attributable to genetic factors. There was significant genetic variance in resting ventilation in the Tibetan, but not the Aymara sample. The of Tibetan resting ventilation was 0.32 or 32% while there was no significant in the Aymara. That is indirect evidence of population genetic differences: the Tibetan sample with significant genetic variance may have alleles absent in the Aymara sample that has no genetic variance. These two samples are put into larger perspective by comparison with published sample means of resting ventilation measured in natives and long-term residents of a range of altitudes (Figure 2). U. S. and European samples represent a population with
65
no long-term history of exposure to high altitude and therefore little opportunity for natural selection to act to improve the adaptive response. In contrast, the Tibetan Plateau has been inhabited for at least 7,000 years and the Andean Plateau for about 11,000 years (see Beall et al., 1999 for a discussion). Therefore, natural selection has had the opportunity to act on these two populations to improve adaptation to lifelong hypoxia. Compared with sea level natives at sea level, Tibetans generally have high resting ventilation and Andean highlanders have high normal resting ventilation. That is, Tibetans depart markedly from the usual sea-level phenotype, but, Aymara do not. The combination of high Tibetan resting ventilation compared with sea level and the presence of intrapopulation genetic variation suggests that natural selection has acted to increase the frequency of alleles for high ventilation. The similarity of Aymara resting ventilation compared with sea level and the absence of Aymara genetic variation suggests that natural selection has not acted on resting ventilation because there was no heritable variation upon which to act.
2.2
Hypoxic ventilatory response
The Tibetan-Andean contrast in resting ventilation suggested differences in the physiologic control of ventilation. This hypothesis
66
was addressed by measuring the hypoxic ventilatory response (HVR). The scatterplot in Figure 3 compares the Tibetan and Aymara samples on the basis of HVR. Tibetan HVR was roughly double that of the Aymara. For example, a 10% fall in the oxygen saturation of arterial hemoglobin results in an average 9.3 L/minute increase in ventilation among Tibetan men compared with a 4.5 L/minute increase among Aymara men. There was significant genetic variance in both samples while a larger proportion of the HVR variance was attributable to genetic factors in the Tibetan sample than in the Aymara sample (Beall et al., 1997a).
Comparing these two sample means with published mean values of HVR measured in natives or long-term residents of a range of altitudes reveals that Tibetan HVR are generally in the middle of the sea-level range while Andean highlanders are very low in or below that range (Figure 4). The combination of normal Tibetan HVR values compared with sea level, the existence of Tibetan genetic variation, and of genetic variation in HVR among sea level populations (see Beall et al., 1997a for a review) suggests that natural selection may have acted to maintain genetic variation in the Tibetan sample. The very low Aymara HVR and the relatively low genetic variance suggests that genetic variation has been lost in the Andean population, perhaps due to natural selection or genetic drift, and that alleles for high genotypic mean values were lost.
67
2.3
Oxygen Saturation Higher Tibetan resting ventilation and HVR would seem likely
to be more effective at offsetting ambient hypoxia. This was assessed by measurement of oxygen saturation of arterial hemoglobin Contrary to expectation, the Tibetan highlanders had lower than the Aymara at the same altitude and exposed to the same hypoxic stress (Figure 5). The average of the Tibetans was 89% compared with 92% among the Aymara (Beall et al., 1997b; Beall et al, 1999). The heritability of in the Tibetan sample was 35% while there was no significant genetic variance in in the Aymara sample. Furthermore, evidence for a major gene was detected in the Tibetan sample. A major gene is an inferred allele with a large quantitative effect at a segregating autosomal locus (Weiss, 1993). The major gene for is an autosomal dominant allele for 5–6% higher Homozygotes for the recessive low allele had a mean of 82.6% whereas heterozygotes and homozyotes for the dominant high allele had averages of 87.6 and 88.3%, respectively. The major gene has now been detected in two Tibetan samples (Beall et al., 1994). Figure 6 puts the data into larger perspective by comparison with published mean values of measured in natives and long-term residents of a range of altitudes. In the altitude range up to 4000m, Andean samples had higher than Tibetan. Over 4000m, Andean samples had lower than Tibetan. More data are
68
69
needed from samples above 4000m in order to determine whether the apparent reversal is real. The presence of genetic variance and a major gene for in the Tibetan sample described in Figure 5 and its absence in the Aymara sample indicates that the Tibetan population has alleles absent in the Aymara population. The finding that the Andean sample in the comparative study had higher - more like sea level – and less genetic variance suggests that natural selection may have acted in the past to favor an allele with a high genotypic mean that has now reached fixation.
2.4
Hemoglobin concentration
The lower of the Tibetans could be offset by higher hemoglobin concentration in order to achieve similar arterial oxygen content. However, the Tibetans had lower hemoglobin concentration than the Aymara. For example, Tibetan males had a mean hemoglobin concentration of 15.6 gm/dL compared with 19.2 gm/dL for Aymara males (Beall et al., 1998). The heritability of hemoglobin concentration was 64% in the Tibetan and 89% in the Aymara sample.
Figure 8 summarizes published sample means of hemoglobin concentration among adult male natives and long term residents at various altitudes. The Andean highlanders consistently have higher hemoglobin concentration. Indeed, Tibetan mean hemoglobin
70
concentration values differ little from the sea level mean at altitudes as high as 4000m. Tibetan samples above 4500m do exhibit an increase in hemoglobin concentration demonstrating the capacity to respond to a sufficiently severe hypoxic stimulus.
The combination of normal Tibetan hemoglobin concentration compared with sea level and the presence of genetic variance in both Tibetan and sea level populations, suggests that stabilizing natural selection has acted to maintain genetic variation in the Tibetan population. The combination of high hemoglobin concentration of Aymara and the presence of genetic variance in both Aymara and sea level populations suggests that directional selection has acted to increase the frequency of alleles with high genotypic means. 2.5
Tibetan and Andean contrasts
Thus the suites of adaptations differ in the two high-altitude native populations. The quantitative contrasts in the four traits were reported above in units appropriate to each measurement. To standardize comparison across traits, the population differences were quantified in terms of an ‘effect size’ using data from the comparative study described in Figures 1, 3,5, and 7. Effect size was calculated by subtracting the Andean mean from the Tibetan mean for 20-29 year
71
old males and dividing by their pooled standard deviation. The result is in units of standard deviation. The effect sizes for the pulmonary components of oxygen transport, resting ventilation and HVR, were and respectively (Tibetan means higher than Aymara). The effect sizes for the hematological components of oxygen transport, and hemoglobin concentration, were and (Tibetan means lower than Aymara). Those are all large effects. Furthermore, the genetic influences on the traits are different. Tibetans have significant for all four traits while Aymara have for HVR and hemoglobin concentration only. The inference of ‘population genetic differences’ can be made for resting ventilation and because Tibetans have significant genetic variance and Aymara do not and because there is a major gene for higher in the Tibetans. In the case of HVR and hemoglobin concentration, that inference is more uncertain because both have significant The population differences in could be due to different allele frequencies. Alternatively they could be due to some unidentified environmental factor. That alternative seems unlikely because altitude is the one factor known to influence these traits in healthy people. provides information about the sources of the variance in a trait, but, not about the mean value of that trait in a sample.
3.
FUNCTIONAL CONSEQUENCES
It is useful to consider whether there are functional consequences of these population differences that might influence survival and reproduction in the high-altitude environment. That can be addressed indirectly by examining other traits. For example, birthweight has been used as an index of the effectiveness of maternal oxygen delivery to the fetus (e.g. Haas, 1980). Figure 9 illustrates that there is no consistent Tibetan-Andean population contrast in mean birthweight across a range of altitudes. This suggests that despite the Tibetan-Andean contrasts in the four oxygen transport components reported here, women in both populations are equally effective at supporting fetal development as measured by birthweight. This conclusion differs from other published evaluations that report fewer Tibetan and Andean samples (Moore et al., 1998). Similarly, maximal aerobic capacity has been used as an integrated index of the effectiveness of oxygen delivery to working muscle. Figure 10 illustrates that there is no consistent population contrast in in
72
men measured across a range of altitudes. That also suggests that the Tibetan and Andean patterns of oxygen transport are equally effective at oxygen delivery to working muscle. Thus, these two functional evaluations do not indicate that one pattern is better than the other. They may simply be different.
73
4.
CONCLUSION
In conclusion, these findings illustrate that there is no speciesspecific response to lifelong high altitude hypoxic stress. While the universal problem at high altitude is delivering enough oxygen to maintain aerobic metabolism despite reduced oxygen availability, the solution to that problem and the genetic basis of that solution is different for Tibetan and Andean high-altitude natives. NOTE Portions of this paper are based on a manuscript submitted to Human Biology. The hentability reported here is the residual heritability calculated as the additive genetic variance divided by (1- variance due to covariates).
REFERENCES Beall, C. M. under submission. Tibetan and Andean patterns of adaptation to high-altitude hypoxia. Human Biology.
Beall, C. M., L. A. Almasy, J. Blangero, S. Williams-Blangero, G. M. Brittenham, K. P. Strohl, M. Decker, L. Vargas, M. Villena, R. Soria, A. Alarcon, and C. Gonzales. 1999. Percent of oxygen saturation of arterial hemoglobin of Bolivian Aymara at 3900-4000m. Amer J Phys. Anthropol 108:41-51. Beall, C. M., G. M. Brittenham, K. P. Strohl, J. Blangero, S. Williams-Blangero, M. C.
Goldstein, M. J. Decker, E. Vargas, M. Villena, R. Soria, A. M. Alarcon, and C. Gonzales. 1998. Hemoglobin concentration of high-altitude Tibetans and Bolivian Aymara. Amer. J. Physl Anthropol. 106:385-400. Beall, C. M., G. M. Brittenham, K. P. Strohl, J. Blangero, S. Williams-Blangero, L. A. Almasy, M. J. Decker, C. M. Worthman, M. C. Goldstein, E. Vargas, M. Villena, R. Soria, A. M. Alacron, and C. Gonzales. 1997. Ventilation and Hypoxic Ventilatory Response of Tibetan and Aymara High Altitude natives. Amer. J. Phys. Anthropol. 104:427-447.
Beall, C. M., K. Strohl, J. Blangero, S. Williams-Blangero, G. M. Brittenham, and M. C. Goldstein. 1997. Quantitative Genetic Analysis of Arterial Oxygen Saturation in Tibetan Highlanders. Human Biology 69 (5):597-604.
Beall, C . M., J. Blangero, S. Williams-Blangero, and M. C. Goldstein. 1994, A major gene for percent of oxygen saturation of arterial hemoglobin in Tibetan highlanders. Am. J. Phys. Anthropol. 95:271-276.
Falconer, D. S. 1989. Introduction to Quantitative Genetics. Third ed. New York: Longman Scientific & Technical.
Moore, L. G., S. Niermeyer, S. Zamudio. 1998. Human adaptation to high altitude: regional and life-cycle perspectives. Yrbk. Phys. Anthropol. 41: 25-64. Weiss, K. M. 1993. Genetic variation and human disease. Principles and evolutionary
approaches. Cambridge: Cambridge University Press.
74
A GENOMIC MODEL FOR DIFFERENTIAL HYPOXIC
VENTILATORY RESPONSES
Clarke G. Tankersley Division of Physiology, The Johns Hopkins School of Public Health
Abstract
Inbred mice are routinely used as genetic models in lung biology. Among many phenotypic differences in lung function and structure, C3H/HeJ (C3) and
C57BL/6J (B6) inbred mice also demonstrate a significantly different ventilatory pattern during acute hypoxic challenge. The present study rejects the hypothesis that a genomic basis for differential hypoxic ventilatory
responses (HVR) is linked to loci which determine differential breathing pattern at baseline, while proposing an alternative genetic model for HVR variation. Twelve BXH recombinant inbred (RI) strains derived from C3 and B6 progenitors were examined to enumerate the genes regulating differential HVR. In each of 134 mice, HVR was assessed using whole-body plethysmography to measure tidal volume
and breathing frequency (f).
With respect to f during hypoxia, three distinct and reproducible phenotypes arc evident in the BXH RI strain distribution pattern (SDP). The SDP for hypoxic f is consistent with the hypothesis that parental strain differences are regulated by two genes. Cosegregation analysis suggest that the genetic control of f during hypoxia differs from the genes which control differential baseline f. Although the genetic control of appears more complex, differences in the minute ventilation during hypoxia is determined by
Therefore, this study suggests that the phenotypic variation in HVR between C3 and B6 parental strains, especially related to f during hypoxia, is regulated by as few as two major genetic determinants. Support: HL53700
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
75
1.
INTRODUCTION
The phenotypic distribution of hypoxic ventilatory responses (HVR) in healthy human subjects has been described by Weil and Colleagues, 4, 8, 17 This group and others3, 18, 19 have characterized high and low responsive subpopulations. Patterns of inheritance suggest that familial background is important in determining an individual's ventilatory response to hypoxia.7, 9, 16 Indeed, the strongest evidence that genetic determinants influence HVR in humans is derived from monozygotic and dizygotic twin studies. 1, 2, 5, 6 Often, it is difficult to distinguish between genetic and environmental components in human studies. Using highly inbred mouse strains, however, can provide empirical control of genetic background and environmental factors. In this paper, the overall aim of our studies is to enumerate the genes that are critical in determining the magnitude and pattern of hypoxic breathing using inbred mice. First, we intend to dissect HVR, and survey different phenotypes between standard inbred strains. Previous work in our has identified two strains that are differentially responsive to acute hypoxia; that is, the C3H/HeJ (C3) strain has a slow, deep breathing pattern compared to the rapid, shallow breathing pattern of C57BL/6J (B6) mice. This differential HVR pattern is akin to the phenotypic differences observed at baseline, which are linked to mouse chromosome Therefore, as a second goal, we intend to explore the phenotypic association between differential baseline breathing and differential HVR in our genetic model. Finally, we intend to evaluate the inheritance of phenotypes among recombinant inbred strains derived from C3 and B6 progenitors (BXH RI strains). If our hypotheses are supported empirically, we achieve significant understanding of the genetic complexity controlling mouse HVR. In addition, since there is substantial synteny between the human and mouse genomes, our results may be directly applicable to the genetic control of human HVR.
76
2.
METHODS
2.1
Animals
Male inbred mice were purchased from Jackson Laboratories (Bar Harbor, ME). The following strains were examined in a total of 134 experiments: C3H/HeJ (C3), C57BL/6J (B6), B6C3F1/J, and twelve BXH recombinant inbred (RI) strains. The animals were provided water and mouse chow ad libitum, and all procedures were reviewed and approved by the Animal Care and Use Committee at the Johns Hopkins School of Public Health. The standard inbred and RI strains represent the product of 20 or more generations of brother-sister matings which results in The BXH RI strains are propagated by inbreeding randomly selected progeny, and represent stable segregant genotypes of the B6 and C3 progenitor strains. The RI strain distribution pattern (SDP) is used to estimate the number of distinct phenotypes when compared to the progenitor Allelic polymorphisms between the B6 and C3 strains account for phenotypic strain differences, and each gene locus has a specific BXH RI SDP. To determine distinct phenotypes, the response distributions of the twelve BXH RI and two progenitor strains are examined by one-way ANOVA, and mean comparisons between each RI strain and the two progenitor strains are performed.
2.2
Hypoxic Challenge Protocol
Breathing frequency (f) and tidal volume at baseline and during acute (3-5 min) hypoxic exposure were measured using whole-body plethysmorgraphy.11 The change in volume that occurs with temperature fluctuations during different phases of respiration can be measured as a change in pressure in a closed chamber. Compressed air of various gas mixtures was directed through the chamber. Changes in pressure were measured using a differential pressure transducer, and recorded using a dedicated computer and data acquisition system. Chamber temperature was measured using a Type-T thermocouple, and controlled
77
within the thermoneutral zone for mice. For each measurement, peak inspiration and expiration were sampled from consecutive tidal breaths.
3.
RESULTS
3.1
Baseline and Hypoxic Ventilation in C3, B6 and mice
As shown in figure 1, the pattern of breathing in C3 mice is distinguishable from B6 mice at comparable minute volumes that is, at baseline (fig. la) and during hypoxia (fig. 1b), C3 mice demonstrate a significantly lower f and greater relative to B6 mice. While mice are similar to the B6 progenitor in terms of f at baseline and during hypoxia, in this offspring class is significantly lower during hypoxia compared to both progenitors.
3.2
Cosegregation of Hypoxic f and
Responses
In figure 2, cosegregation plots demonstrate differential HVR phenotypes. Along the ordinate (fig. 2a), the distribution of hypoxic f responses for the BXH RI strains segregate into three distinct phenotypes. The BXH RI strains encircled with the C3 progenitor are significantly different from B6 and mice. Likewise, the BXH RI strains encircled with the B6 progenitor are significantly different from the C3 progenitor. Hypoxic f in BXH 14 represents the third phenotype, since this response is significantly greater relative to both progenitor strains.
Along the abscissa (fig. 2a), the phenotypic distribution of hypoxic among the BXH RI strains is less discrete. Within each circled group, a continuous distribution of hypoxic responses exist, and both extend a similar range. If these data are plotted as function of hypoxic (fig. 2b), there is a tight linear relationship between hypoxic and within each encircled group. A significant correlation between hypoxic f and does not exist (data not shown).
78
79
80
3.3
Cosegregation of Hypoxic and Baseline f Responses
In figure 3, a cosegregation plot of hypoxic and baseline f responses is shown for the BXH RI strains. The phenotypic distribution of responses differs between baseline and hypoxic conditions. Several BXH RI strains
(BXH 4, 7, 10, 1 1 and 12) are not different from B6 mice with respect to either baseline or hypoxic f. However, f responses in BXH 2, 3, 6, 9 and 19
differ from the C3 progenitor at baseline12 but not during hypoxia. Alternatively, BXH 8 differs from the C3 progenitor during hypoxia, but not at baseline. Again, the baseline and hypoxic phenotypes of BXH 14 are distinguishable from both progenitors.
3.4
Cosegregation Responses
of
Hypoxic
and
Baseline
In figure 4, a cosegregation plot of hypoxic and baseline responses is shown. Along the abscissa, baseline varies continuously between the high response of the C3 progenitor and the low response of the offspring. Along the ordinate, hypoxic responses range between the high of BXH 2 and the low of BXH 12. A tight linear relationship between baseline and hypoxic responses exists among the BXH RI strains. Linear regression analysis suggests that the relative increase in
going from baseline to hypoxic ventilation is, on average, . Several strains exceed the average hypoxic response including BXH 10 and 1 1 . I n contrast, the hybrid and the BXH 12 strain appear to under achieve the average hypoxic response.
4.
DISCUSSION
This paper presents the phenotypic characterization of a genomic model for differential HVR using inbred mice. In exploring these data, the withinstrain variance represents environmental factors while the between-strain variance represents the genetic component, which provides insight to the complexity of the genetic interaction. The hypoxic f responses, for example, separate into three distinct phenotypes (fig. 2a and 3), and is consistent with a genetic model which incorporates at least two gene loci. In contrast, the distribution of hypoxic phenotypes is continuous in our genetic model suggesting that this trait is governed by a suite of genes likely exceeding two loci.
81
82
Differential f at baseline between C3 and B6 progenitors has also been shown to be conferred by as few as two genes.12 Subsequently, linkage analysis suggest that this phenotypic difference in baseline ventilation is determined by loci on mouse chromosome 3.13 In this paper, we explore whether or not differential hypoxic f is regulated by similar loci as baseline f. Cosegregation analysis, as shown in figure 3, suggest that phenotypes of baseline f do not predict phenotypes of hypoxic f among BXH RI strains. Therefore, these results suggest that the genetic determinants regulating differential hypoxic f differ from loci which regulate differential baseline f in this model.
The present study also suggests that phenotypic differences in hypoxic f and responses between C3 and B6 mice are independently regulated (fig. 2). The hypoxic appears to determine the magnitude of the hypoxic (fig. 2b) whereas variation in hypoxic f is not proportional to hypoxic The genetic control of differential hypoxic among the progenitor and BXH RI strains appears to be more complex, and is likely controlled by a suite of genes polymorphic between C3 and B6 mice. In this genetic model, the increase in that occurs in response to acute hypoxia is on average above baseline, which is similar to the average increase in hypoxic among an assortment of standard inbred strains.11 This similarity suggests that the complex genetic control of hypoxic observed in our genetic model resembles the heterogeneity that occurs broadly across the mouse species.
A closer examination of the strain distribution patterns for the BXH RI strains (fig. 4) and the standard inbred strains11 reveals that both baseline and hypoxic responses are significantly abbreviated in the hybrid. Although the hypoxic f phenotype of the B6 progenitor appears inherited by the progeny, hypoxic is significantly reduced in mice (compared to both progenitor strains) due to the markedly attenuated hypoxic response. One hypothesis consistent with the current results suggests that characteristics of the HVR phenotype in the mice represents abnormally low responsiveness (or susceptibility) to acute hypoxic challenges.
Hirshman et al. demonstrated a distribution of hypoxic responsiveness among 44 healthy, human subjects.4 The shape of this distribution was bimodal suggesting the potential influence of at least one major genetic determinant. In addition, the individual with the highest response was sixfold greater than the lowest responding individual. A similar spectrum of ventilatory responses to hypoxia has been demonstrated in the cat species.15 For the mouse species, the highest responding inbred strain is two-fold
83
greater than the lowest responding strain.11 Although the spectrum of HVR among inbred strains of mice is modest relative to humans, the probability of homology between genomes is quite high. Therefore, future studies are planned to position the genes regulating HVR in mice, and use comparative genomic mapping to understand the genetic control of HVR in humans.
In conclusion, the present study suggests that differential hypoxic f between C3 and B6 parental strains is reproducible and inheritable among the BXH RI strains. Furthermore, this phenotypic variation appears to be determined by as few as two major genes. The genetic control of hypoxic f is distinguishable from the genes which control differential baseline f in this model. Although the genetic control of hypoxic in our model is more complex and likely regulated by more than two genes, differences in hypoxic are proportional to the magnitude of the hypoxic response. Therefore, mice with relatively low hypoxic such as the progeny of C3 and B6 parental strains appear least responsive to acute hypoxic challenges. Future studies will explore genome mapping techniques to position the genes which determine differential HVR in our model.
REFERENCES Arkinstall, W.W., K. Nirmall, V. Klissouras, and J. Milic-Emili. Genetic differences in the ventilatory response to inhaled J. Appl. Physiol. 36: 6 - 1 1 , 1974. Collins, D.D., C.H. Scoggin, C.W. Zwillich, and J.V. Weil. Hereditary aspects of decreased hypoxic response. J Clin. Invest. 62: 105-110, 1978.
Greksa, L.P. Evidence for a genetic basis to the enhanced total lung capacity of Andean highlanders. Hum. Biol. 68: 119-129, 1996.
Hirshman, C.A., R.E. McCullough, and J.V. Weil. Normal values for hypoxic and hypercapnic ventilatory drives in man. J. Appl. Physiol. 38: 1095-1098, 1975. Hubert, H.B., R.R. Fabsitz., M. Feinleib, and C. Gwinn. Genetic and environmental influences on pulmonary function in adult twins. Am. Rev. Respir. Dis. 125: 409-415, 1982. Kawakami, Y., H. Yamamoto, T. Yoshikawa, and A. Shida. Chemical and behavioral control of breathing in adult twins. Am. Rev. Respir. Dis. 129: 703-707, 1984.
Mountain, R.C., C.W. Zwillich, and J.V. Weil. Hypoventilation in obstructive lung disease; the role of familial factors. N. Engl. J. Med. 298: 521-525, 1978.
Sahn, S.A., C.W. Zwillich, N. Dick, R.E. McCullough, S. Lakshminarayan, and J.V Weil. Variability of ventilatory responses to hypoxia and hypercapnia. J. Appl. Physiol.: Resp. Environ. Exer. Physiol. 43: 1019-1025, 1977.
Scoggin, C.H., R.D. Doekel, M.H. Kryger, C.W. Zwillich, and J.V. Weil. Familial aspects of decreased hypoxic drive in endurance athletes. J. Appl. Physiol.: Resp. Environ. Exer. Physiol. 44: 464-468, 1978. Silver, J. Confidence limits for estimates of gene linkage based on analysis of rccombinant inbred strains. J. Heredity. 76: 436-440, 1985.
84
Tankersley, C.G., R.S. Fitzgerald, and S.R. Kleeberger. Differential control of ventilation among inbred mice strains. Amer. J. Physiol. 267 (Reg. Integrat. Comp. Physiol. 36): R1371-R1377, 1994. Tankersley, C.G., R.S. Fitzgerald, R.C. Levitt, W.A. Mitzner, S.L. Ewart, and S.R. Kleeberger. Genetic control of differential baseline breathing pattern. J. Appl. Physiol. 82: 874-881, 1997. Tankersley, C.G., D.A. DiSilvestre, A.E. Jedlicka, H.M. Wilkins, and L. Zhang. Differential inspiratory timing is genetically linked to mouse chromosome 3.J. Appl. Physiol. 85(1): 360-365. 1998. Taylor, B.A. Recombinant inbred strains. In: M. Lyon and A.G. Searle (eds). Genetic Variants and Strains of the Laboratory Mouse, 2nd edition, Oxford University Press, New York, pp. 773-779, 1989. Vizek, M. C.K. Pickett, and J.V. Weil. Interindividual variation in hypoxic ventilatory responses: potential role of carotid body. J. Appl. Physiol. 63: 1884-1889, 1987. Weil, J.V. Familial factors, ventilatory control, and sudden infant death. N. Engl. J. Med 302: 517-519, 1980. W e i l , J.V., E. Bryne-Quinn, I.E. Sodal, W.O. Friesen, B. Underhill, G.F. Filley, and R.F. Grover. Hypoxic ventilatory drive in normal man. J. Clin. Invest. 49: 1061-1072, 1970. Winslow, R.M., K.W. Chapman, C.C. Gibson, M. Samaja, C.C. Monge, E. Goldwasser, M. Sherpa, F.D. Blume, and R. Santolaya. Different hematologic responses to hypoxia in Sherpas and Quechua Indians. J. Appl. Physiol. 66: 1561-1569, 1989. Winslow, R.W., K..W. Chapman, and C.M. Monge. Ventilation and control of erythropoiesis in high altitude natives in Chile and Nepal. Am. J. Hum. Biol. 2: 653-662, 1990. Wright, S. Systems of mating. V. General considerations. Genetics. 6: 167-178, 1921.
85
This page intentionally left blank.
REGULATION OF THE HYPOXIA-INDUCIBLE ARNT is not necessary for hypoxic induction of nucleus
in the
Max Gassmann, Dmitri Chilov, and Roland H. Wenger Institute of Physiology, University of Zürich-Irchel, CH-8057 Zürich, Switzerland
1.
SUMMARY
Hypoxia-inducible factor-1 (HIF-1) is a master regulator of mammalian oxygen homeostasis. HIF-1 consists of two subunits, and the aryl hydrocarbon receptor nuclear translocator (ARNT). Whereas hypoxia prevents ubiquitination and proteasomal degradation of ARNT expression is thought to be oxygen-independent. We and others previously showed that ARNT is indispensable for HIF-1 DNA-binding and transactivation function. To examine the requirement of ARNT for accumulation and nuclear translocation of in hypoxia, we used ARNT-mutant mouse hepatoma and ARNT-deficient embryonic stem cells.
As shown by immunofluorescence, accumulation in the nucleus of hypoxic cells did not require ARNT, demonstrating that nuclear translocation is intrinsic to During biochemical separation, both and ARNT tend to leak from the nuclei in the absence of the corresponding subunit, suggesting that heterodimerization is required for stable association within the nuclear compartment. Nuclear stabilization of the heterodimer might also explain the hypoxically increased total cellular ARNT levels observed in some of the cell lines examined.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
87
2.
INTRODUCTION
In response to reduced oxygenation, activation of the hypoxia-inducible factor-1 (HIF-I) regulates transcription of several genes involved in oxygen homeostasis (reviewed in Bunn and Poyton, 1996; Semenza, 1998; Wenger and Gassmann, 1997). The transcription factor HIF-1 was originally discovered as a critical factor binding to the hypoxia-inducible 3’ enhancer of the erythropoietin gene. Subsequently, HIF-1 was shown to be involved in oxygen-dependent expression of many other genes, including vascular endothelial growth factor, glycolytic enzymes, glucose transporter-1, transferrin, inducible nitric oxide synthase and heme oxygenase-1 (Wenger and Gassmann, 1997). HIF-1 is a heterodimeric complex composed of the two basic-helix-loop-helix Per-ARNT-Sim (PAS) subunits and (Wang et al., 1995). As determined in HeLa cells, highest protein levels are reached at 0.5% oxygen (Jiang et al., 1996) by a process that involves redox-dependent proteolytic stabilization to prevent ubiquitinylation and rapid degradation in proteasomes (Ema et al., 1999; Huang et al., 1998; Huang et al., 1996; Kallio et al., 1999; Salceda and Caro, 1997). Recently, the von Hippel-Lindau (VHL) tumor suppressor protein has been shown to bind to and to confer its oxygen-dependent ubiquitination in normoxic cells (Maxwell et al., 1999).
is identical to the aryl hydrocarbon receptor nuclear translocator (ARNT), that was first cloned as the heterodimerization partner of the aryl hydrocarbon receptor (AhR), also known as the dioxin receptor (reviewed in Gassmann and Wenger, 1997; Hankinson, 1995; Schmidt and Bradfield, 1996). By using an ARNT-mutant cell line (HepalC4) derived from Hepal mouse hepatoma cells, we (Gassmann et al., 1997; Gradin et al., 1996) and others (Forsythe et al., 1996; Salceda et al., 1996; Wood et al., 1996) have shown that ARNT is indispensable for HIF-1 DNA binding and transactivation. Mice homozygous for a targeted deletion in the gene encoding are not viable and die around midgestation, mainly due mesenchymal cell death leading to defective vascularization, heart malformations and failure in neuronal tube closure (lyer et al., 1998; Kotch et al., 1999; Yu et al., 1999). In addition, embryonic stem (ES) cell-derived solid tumour formation is also affected in the absence of (Carmeliet et al., 1998; Ryan et al., 1998). Similar to ARNT deficiency is also embryonic lethal (Kozak et al., 1997; Maltepe et al., 1997), indicating that the heterodimeric HIF-1 complex
88
is a non-redundant master regulator of oxygen homeostasis. Interestingly, targeted deletion of the related results also in embryonic lethality, because the impaired function of the organ of Zuckerkandl results in reduced catecholamine synthesis (Tian et al., 1998).
protein stabilization in hypoxia is generally considered to be the rate-limiting step in HIF-1 activation. However, a (weaker) concomitant increase in ARNT protein levels has also been observed by immunoblot analyses of nuclear extracts derived from many different cell types (Iyer et al., 1998; Jiang et al., 1997; Jiang et al., 1996; Jiang et al., 1996; Jiang et al., 1997; Lee et al., 1997; Liu et al., 1998; Martin et al., 1998; Wang et al., 1995; Wang et al., 1995; Wang et al., 1995). The significance of these observations has not been further investigated, but hypoxically increased ARNT levels in nuclear extracts might be related to nuclear translocation. To clarify the role of ARNT in regulation, we analyzed and ARNT levels and subcellular localization following exposure to hypoxia in cell lines that are either wild type or deficient for ARNT.
3.
RESULTS AND DISCUSSION
3.1 ARNT expression in the presence (hypoxia) or absence (normoxia) of and ARNT protein levels were examined in cytoplasmic fractions and nuclear extracts derived from HeLa, Hep3B, LN229, L929 and Hepal cells that were cultured at either normoxia or hypoxia. The samples were analyzed by immunoblotting using an affinity-purified chicken antiIgY (Camenisch et al., 1999) or a rabbit anti-ARNT antibody. As shown in Fig. 1A, : protein was detected exclusively in nuclear extracts of hypoxically induced cells. No additional bands were observed, confirming the specificity of the IgY antibody (not shown). While ARNT was not detectable in normoxic nuclear extracts of HeLa, Hep3B and Hepal cells, it was found in LN229 and L929 cells. Unexpectedly, following exposure to hypoxia, increased ARNT protein levels were found in nuclear extracts of all cell lines. No and ARNT could be detected in the same amount of cytoplasmic protein derived from the same cell lines (Fig. 1A).
89
We next tested whether nuclear ARNT accumulation in hypoxia is due to increased cellular ARNT protein concentrations. As shown in Fig. 1B, ARNT levels in total cellular lysates remained unchanged after hypoxic induction of the human cell lines HeLa, Hep3B and LN229, whereas ARNT was repeatedly induced in the mouse L929 and Hepal cell lines. was not detectable in normoxic total cellular lysates (not shown).
Taken together, these results might imply that hypoxic nuclear ARNT accumulation was a result of translocation from the cytoplasm to the nucleus. At least in some cell lines, also increased ARNT production and/or reduced degradation contributes to the elevated ARNT levels in nuclear extracts. However, the fact that no cytoplasmic ARNT could be detected in normoxia
90
provides evidence against the ,,translocation hypothesis“. Thus, we assume that nuclear ARNT was lost during isolation (but before extraction) of the nuclei rather than being induced by hypoxia. This would suggest a higher affinity of ARNT for the nuclear compartment in hypoxia (i. e. in the presence of than in normoxia (i. e. in the absence of
3.2 expression in the presence of wild-type (Hepal cells) or mutant (HepalC4 cells) ARNT To analyze whether ARNT is necessary for hypoxic induction and nuclear accumulation of , we used an ARNT-mutant Hepal-derived subline (termed HepalC4) that was originally selected for its resistance against 3,4-benzopyrene treatment (Hoffman et al., 1991). We and others previously showed that in HepalC4 cells (i) ARNT mRNA levels were decreased, (ii) hypoxic response of endogenous as well as reporter gene transcription was impaired, and (iii) no functional HIF-1 DNA-binding activity was detected (Forsythe et al., 1996; Gassmann et al., 1997; Gradin et al., 1996; Salceda et al., 1996; Wenger et al., 1998; Wood et al., 1996). As shown in Fig. 2A, also ARNT protein was hardly detectable in nuclear extracts from normoxic and hypoxic HepalC4 cells. Interestingly, was still induced in nuclear extracts from HepalC4 cells, although at lower levels compared to wild type Hepal cells. Reduced levels in nuclear extracts from HepalC4 cells were paralleled by increased levels in the cytoplasmic fraction (Fig. 2A). As for ARNT, these findings suggest that the affinity of for the nuclear compartment is higher in the presence of its heterodimerization partner. To directly assess this hypothesis, a titration experiment was performed, using increasing concentrations of NaCl to extract the nuclei. As shown in Fig. 2B, at least 300 mM NaCl was necessary to extract from ARNT-wild type cells, whereas in ARNTmutant cells, leaked out of the nuclei already in the absence of NaCl. In addition, was more efficiently extracted with all used NaCl concentrations in HepalC4 than in Hepal cells. Correspondingly, the content was much lower in cytoplasmic fractions from Hepal than from HepalC4 cells. In contrast, the unrelated transcription factor Sp-1 was efficiently extracted at 300 mM NaCl in both cell lines. Taken together, these results suggest that ARNT is required to retain in the nucleus but not for nuclear translocation.
91
3.3 expression in the presence cells) or absence (ARNT-/- ES cells) of ARNT An ARNT point mutation
ES
in HepalC4 cells has recently
been reported, which leads to increased proteolytic susceptibility and a
higher turnover-rate (Numayama-Tsuruta et al., 1997). Despite reduced
92
ARNT mRNA and protein levels, as well as lack of HIF-1 DNA-binding and HIF-1-mediated gene activation (Gassmann et al., 1997; Gradin et al., 1996; Wenger et al., 1998), this ARNT mutation did not abrogate its ability to translocate to the nucleus and to form heterodimers with AhR (NumayamaTsuruta et al., 1997). Thus, residual amounts of ARNT might have been responsible for the nuclear localization of observed in HepalC4 cells (Fig. 2). To rule out this possibility, ES cells in which the ARNT gene has been targeted by homologous recombination (Maltepe et al., 1997) were examined. As shown in Fig. 3A, was detected by immunoblotting in nuclear extracts of hypoxic as well as ARNT-/- ES cells, albeit at a lower level in the latter cell line. Nuclear ARNT levels were increased in hypoxic ES cells, but, as expected, could not be detected in ARNT-/- ES cells.
3.4 Immunofluorescence analysis of subcellular ARNT localization It has previously been reported that, unlike the dioxin receptor, ARNT levels remain spatially and temporarily constant in the nucleus following treatment with dioxin-analogs (Pollenz, 1996). In contrast, in our
93
immunoblotting experiments (see Figs 1A, 2A), as well as in those of others (see introduction), ARNT seemed to be regulated by hypoxia. Because these data might be compromised by artifacts occurring during biochemical separation, we performed indirect immunofluorescence experiments using the anti-ARNT monoclonal antibody 2B10. As shown in Fig. 4-b/c, the ARNT level in the nucleus of Hepal cells increased following exposure to hypoxia. A nonspecific cross-reactivity of the 2B10 antibody gave rise to background signals in Hepal and HepalC4 cells, which overwhelmed normoxic ARNT signals in Hepal cells. Opposite to Hepal cells, no hypoxic ARNT induction has been observed in HeLa cells (Chilov et al., 1999). Taken together, these results confirm our immunoblot data using total cellular extracts (Fig. IB), and show that (i) ARNT is a nuclear protein and its disappearance from normoxic nuclear extracts is due to leakage during preparation of the nuclei, and (ii) certain cell lines are capable of inducing ARNT protein levels in a hypoxia-dependent manner.
3.5 Immunofluorescence analysis of subcellular localization Since was prone to leak from the nuclei during biochemical separation in the absence of ARNT (see above), we examined the subcellular localization of by indirect immunofluorescence and confocal laser scanning microscopy. Normoxic and hypoxic ARNT-wild type Hepal and ARNT-mutant HepalC4 cells were analyzed using the chicken
94
IgY antibody (Camenisch et al., 1999). Upon hypoxic exposure, all cell lines, including ARNT-mutant HepalC4 cells, responded with a drastic increase in levels in the nucleus, but not in the nucleoli (Fig. 5), demonstrating that ARNT is not required for hypoxic accumulation and nuclear translocation of In contrast to the immunoblot results (Fig. 2A), was not detectable in the cytoplasm of hypoxic HepalC4 cells (Fig. 5-f), supporting our notion that the presence of in cytoplasmic fractions is mainly due to leakage from the nucleus.
4.
CONCLUSIONS
In the present study, we used ARNT-mutant HepalC4 cells (Numayama-Tsuruta et al., 1997) as well as ARNT-deficient ES cells (Maltepe et al., 1997) to demonstrate that protein accumulation and nuclear translocation can occur independently of ARNT. This finding is not compatible with the term ,,nuclear translocator“ in ,,ARNT“. A similar discrepancy between biochemical fractionation and immunofluorescence data as we showed in this work for the ARNT complex has also been reported for the AhR:ARNT complex (reviewed in Hankinson, 1995; Schmidt and Bradfield, 1996). In Hepal, but not in HepalC4 cells, the liganded AhR can be purified from the nucleus. The complementing ARNT
95
was hence believed to be responsible for nuclear translocation of AhR. That this model is wrong has been demonstrated by immunofluorescence experiments showing that AhR and ARNT are translocated to the nucleus independently (Hord and Perdew, 1994; Pollenz et al., 1994), and that following ligand binding the AhR translocates to the nucleus where it is rapidly depleted, whereas ARNT remains at constant levels in the nucleus (Pollenz, 1996). Thus, upon homogenization almost all of the ARNT present in a cell is found outside of the nuclei, apparently because it leaches out of the nuclei (Hord and Perdew, 1994). A plausible explanation for the failure of subcellular fractionation methods to accurately preserve the distribution of AhR and ARNT observed in vivo might be that heterodimer formation in the nucleus renders the complex more stably associated with the nuclear compartment during isolation of the nuclei. Hence monomeric subunits are more prone to leakage. In this work, we found partial loss of both HIF-1 subunits during isolation of the nuclei in the absence of one of the respective heterodimerization partners in HepalC4 and ES cells (lacking ARNT) or under normoxic conditions (lacking Whether this is due to interaction of the heterodimer with the nuclear scaffold and/or specific DNA binding is a matter of further investigations. In this context, it is noteworthy that Poellinger and coworkers reported a conformational change of upon interaction with ARNT as shown by altered resistance to proteolytic digestion in vitro (Kallio et al., 1997). Even if this effect might be due to steric hindrance, it provides evidence that also increased proteolytic stability in vivo during isolation of the nuclei could contribute to the difference observed in monomeric versus heterodimeric protein levels of the HIF-1 subunits.
ACKNOWLEDGMENTS This work was supported by the Swiss National Science Foundation (3147111.96) and the Roche Research Foundation. R.H.W. is a recipient of the ,,Sondermassnahmen des Bundes zur Förderung des akademischen Nachwuchses“.
REFERENCES Bunn, H. F., and Poyton, R. O., 1996, Oxygen sensing and molecular adaptation to hypoxia. Physiol. Rev. 76: 839-885.
Camenisch, G., Tini, M., Chilov, D., Kvietikova, I., Srinivas, V., Caro, J., Spielmann, P., Wenger, R. H., and Gassmann, M., 1999, General applicability of chicken egg yolk
96
antibodies: the performance of IgY immunoglobulins raised against the hypoxia-inducible factor FASEB J. 13:81-88. Carmeliet, P., Dor, Y., Herbert, J. M, Fukumura, D., Brusselmans, K., Dewerchin, M., Neeman, M., Bono, F., Abramovitch, R., Maxwell, P., Koch, C. J., Ratcliffe, P., Moons, L., Jain, R. K., Collen, D., and Keshet, E., 1998, Role of in hypoxia-mediated
apoptosis, cell proliferation and tumour angiogenesis. Nature 394: 485-490.
Chilov, D., Camenisch, G., Kvietikova, I., Ziegler, U., Gassmann, M., and Wenger, R. H., 1999, Induction and nuclear translocation of hypoxia-inducible factor-1 (HIF- 1): heterodimerization with ARNT is not necessary for nuclear accumulation of J. CellSci. 112: 1203-1212. Ema, M., Hirota, K., Mimura, J., Abe, H., Yodoi, J., Sogawa, K., Poellinger, L., and FujiiKuriyama, Y., 1999, Molecular mechanisms of transcription activation by HLF and in response to hypoxia: their stabilization and redox signal-induced interaction with CBP/p300. EMBO J. 18: 1905-1914. Forsythe, J. A., Jiang, B. H., Iyer, N. V., Agani, F., Leung, S. W., Koos, R. D., and Semenza, G. L., 1996, Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol. Cell. Biol. 16: 4604-4613. Gassmann, M., Kvietikova, I., Rolfs, A., and Wenger, R. H., 1997, Oxygen- and dioxinregulated gene expression in mouse hepatoma cells. Kidney Int. 51: 567-574. Gassmann, M., and Wenger, R. H., 1997, HIF-1, a mediator of the molecular response to hypoxia. News Physiol. Sci. 12: 214-218. Gradin, K., McGuire, J., Wenger, R. H., Kvietikova, I., Whitelaw, M. L., Toftgard, R., Tora, L., Gassmann, M., and Poellinger, L., 1996, Functional interference between hypoxia and dioxin signal transduction pathways: competition for recruitment of the Arnt transcription factor. Mol. Cell. Biol. 16: 5221-5231. Hankinson, O., 1995, The aryl hydrocarbon receptor complex. Annu. Rev. Pharmacol. Toxicol.
35: 307-340.
Hoffman, E. C., Reyes, H., Chu, F. F., Sander, F., Conley, L. H., Brooks, B. A., and Hankinson, O., 1991, Cloning of a factor required for activity of the Ah (dioxin) receptor. Science 252: 954-958. Hord, N. G., and Perdew, G. H., 1994, Physicochemical and immunocytochemical analysis of the aryl hydrocarbon receptor nuclear translocator: characterization of two monoclonal antibodies to the aryl hydrocarbon receptor nuclear translocator. Mol. Pharmacol. 46: 618626.
Huang, E. L., Gu, J., Schau, M., and Bunn, H. F., 1998, Regulation of hypoxia-inducible factor is mediated by an oxygen-dependent domain via the ubiquitin-proteasome pathway. Proc. Natl. Acad. Sci. U.S.A. 95: 7987-7992. Huang, L. E., Arany, Z., Livingston, D. M., and Bunn, H. F., 1996, Activation of hypoxiainducible transcription factor depends primarily upon redox-sensitive stabilization of its subunit. J. Biol. Chem. 271: 32253-32259. Iyer, N. V., Kotch, L. E., Agani, F., Leung, S. W., Laughner, E., Wenger, R. H., Gassmann, M., Gearhart, J. D., Lawler, A. M., Yu, A. Y., and Semenza, G. L., 1998, Cellular and developmental control of homeostasis by hypoxia-inducible factor Genes Dev. 12: 149-162. Jiang, B. H., Agani, F., Passaniti, A., and Semenza, G. L., 1997, V-SRC induces expression of hypoxia-inducible factor 1 (HIF-1) and transcription of genes encoding vascular endothelial growth factor and enolase 1: involvement of HIF-1 in tumor progression. Cancer Res. 57: 5328-5335. Jiang, B. H., Rue, E., Wang, G. L., Roe, R., and Semenza, G. L., 1996, Dimerization, DNA binding, and transactivation properties of hypoxia-inducible factor 1. J. Biol. Chem. 271: 17771-17778.
97
Jiang, B. H., Semenza, G. L., Bauer, C., and Marti, H. H., 1996, Hypoxia-inducible factor 1 levels vary exponentially over a physiologically relevant range of tension. Am. J. Physiol. 271: C1172-1180. Jiang, B. H., Zheng, J. Z., Leung, S. W., Roe, R., and Semenza, G. L., 1997, Transactivation and inhibitory domains of hypoxia-inducible factor Modulation of transcriptional activity by oxygen tension. J. Biol. Chem. 272: 19253-19260. Kallio, P. J., Pongratz, I., Gradin, K., McGuire, J., and Poellinger, L., 1997, Activation of hypoxia-inducible factor posttranscriptional regulation and conformational change by
recruitment of the Arnt transcription factor. Proc. Natl. Acad. Sci. U.S.A. 94: 5667-5672.
Kallio, P. J., Wilson, W. J., S, O. B., Makino, Y., and Poellinger, L., 1999, Regulation of the hypoxia-inducible transcription factor by the ubiquitin-proteasome pathway. J. Biol. Chem. 274:6519-6525.
Kotch, L. E., lyer, N. V., Laughner, E., and Semenza, G. L., 1999, Defective vascularization of embryos is not associated with VEGF deficiency but with mesenchymal cell death. Dev. Biol. 209: 254-267.
Kozak, K. R., Abbott, B., and Hankinson, O., 1997, Arnt-deficient mice and placental differentiation. Dev. Biol. 191: 297-305. Lee, P. J., Jiang, B. H., Chin, B. Y., lyer, N. V., Alam, J., Semenza, G. L., and Choi, A. M., 1997. Hypoxia-inducible factor-1 mediates transcriptional activation of the heme oxygenase-1 gene in response to hypoxia. J. Biol. Chem. 272: 5375-5381. Liu, Y. X., Christou, H., Morita, T., Laughner, E., Semenza, G. L., and Kourembanas, S., 1998, Carbon monoxide and nitric oxide suppress the hypoxic induction of vascular endothelial growth factor gene via the 5’enhancer. J. Biol. Chem. 273: 15257-15262.
Maltepe, E., Schmidt, J. V., Baunoch, D., Bradfield, C. A., and Simon, M. C., 1997, Abnormal angiogenesis and responses to glucose and oxygen deprivation in mice lacking the protein ARNT. Nature 386: 403-407. Martin, C., Yu, A. Y., Jiang, B. H., Davis, L., Kimberly, D., Hohimer, A. R., and Semenza, G. L., 1998, Cardiac hypertrophy in chronically anemic fetal sheep - increased vascularization is associated with increased myocardial expression of vascular endothelial growth factor and hypoxia-inducible factor 1. Am. J. Obst. Gynecol. 178: 527-534. Maxwell, P. H., Wiesener, M. S., Chang, G. W., Clifford, S. C., Vaux, E. C., Cockman, M. E., Wykoff, C. C., Pugh, C. W., Maher, E. R., and Ratcliffe, P. J., 1999, The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 399: 271-275.
Numayama-Tsuruta, K., Kobayashi, A., Sogawa, K., and Fujii-Kuriyama, Y., 1997, A point
mutation responsible for defective function of the aryl-hydrocarbon-receptor nuclear
translocator in mutant Hepa-lclc7 cells. Eur. J. Biochem. 246: 486-495. Pollenz, R. S., 1996, The aryl-hydrocarbon receptor, but not the aryl-hydrocarbon receptor nuclear translocator protein, is rapidly depleted in hepatic and nonhepatic culture cells exposed to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Mol. Pharmacol. 49: 391-398. Pollenz, R. S., Sattler, C. A., and Poland, A., 1994, The aryl hydrocarbon receptor and aryl hydrocarbon receptor nuclear translocator protein show distinct subcellular localizations in Hepa 1c1c7 cells by immunofluorescence microscopy. Mol. Pharmacol. 45: 428-438.
Ryan, H. E., Lo, J., and Johnson, R. S., 1998,
is required for solid tumor formation
and embryonic vascularization. EMBO J. 17: 3005-3015.
Salceda, S., Beck, I., and Caro, J., 1996, Absolute requirement of aryl hydrocarbon receptor nuclear translocator protein for gene activation by hypoxia. Arch. Biochem. Biophys. 334: 389-394. Salceda, S., and Caro, J., 1997, Hypoxia-inducible factor protein is rapidly degraded by the ubiquitin-proteasome system under normoxic conditions. Its stabilization by hypoxia depends on redox-induced changes. J. Biol. Chem. 272: 22642-22647.
98
Schmidt, J. V., and Bradfield, C. A., 1996, Ah receptor signaling pathways. Ann. Rev. Cell. Dev. Biol. 12: 55-89. Semenza, G. L., 1998, Hypoxia-inducible factor 1: master regulator of homeostasis. Current Opinion in Genetics & Development 8: 588-594. Tian, H., Hammer, R. E., Matsumoto, A. M., Russell, D. W., and McKnight, S. L., 1998, The hypoxia-responsive transcription factor EPAS1 is essential for catecholamine homeostasis and protection against heart failure during embryonic development. Genes Dev. 12: 33203324. Wang, G. L., Jiang, B. H., Rue, E. A., and Semenza, G. L., 1995, Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular tension. Proc. Natl. Acad. Sci. U.S.A. 92: 5510-5514. Wang, G. L., Jiang, B. H., and Semenza, G. L., 1995, Effect of altered redox states on expression and DNA-binding activity of hypoxia-inducible factor 1. Biochem. Biophys. Res. Commun. 212: 550-556. Wang, G. L., Jiang, B. H., and Semenza, G. L., 1995, Effect of protein kinase and phosphatase inhibitors on expression of hypoxia-inducible factor 1. Biochem. Biophys. Res. Commun. 216: 669-675.
Wenger, R. H., Camenisch, G., Desbaillets, I., Chilov, D., and Gassmann, M., 1998, Upregulation of hypoxia-inducible
is not sufficient for hypoxic/anoxic p53
induction. Cancer Res. 58: 5678-5680. Wenger, R. H., and Gassmann, M., 1997, Oxygen(es) and the hypoxia-inducible factor-1. Biol. Chem. 378:609-616. Wood, S. M., Gleadle, J. M., Pugh, C. W., Hankinson, O., and Ratcliffe, P. J., 1996, The role of the aryl hydrocarbon receptor nuclear translocator (ARNT) in hypoxic induction of gene expression. Studies in ARNT-deficient cells. J. Biol. Chem. 271: 15117-15123. Yu, A. Y., Shimoda, L. A., Iyer, N. V., Huso, D. L., Sun, X., McWilliams, R., Beaty, T.,
Sham, J. S., Wiener, C. M., Sylvester, J. T., and Semenza, G. L., 1999, Impaired physiological responses to chronic hypoxia in mice partially deficient for hypoxiainducible factor J. Clin. Invest. 103: 691-696.
99
This page intentionally left blank.
INTRACELLULAR PATHWAYS LINKING HYPOXIA TO ACTIVATION OF C-FOS AND AP-1
Daniel R. Premkumar, Gautam Adhikary, Jeffery L. Overholt, Michael S. Simonson, Neil S. Cherniack, and Nanduri R. Prabhakar Department of Physiology and Biophysics, Case Western Reserve University, Cleveland, OH 44106-4970
Abstract:
1.
Organisms respond to hypoxia through detection of blood oxygen levels by sensors at peripheral chemoreceptors and by receptors in certain key cells of the body. The pathways over which peripheral chemoreccptor signals are transmitted to respiratory muscles arc well established. However, the intracellular pathways that transmit hypoxic stimulus to gene activation are just being identified. Using anti-sense c-fos strategy, we have shown that c-fos is essential for the activation of activator protein-1 transcription factor complex (AP-1) and subsequent stimulation of downstream genes such as tyrosine hydroxylase (TH; Mishra et al. 1998). The purpose of the present study was to identify intracellular pathways that link hypoxia to activation of c-fos. The results of the present study show that hypoxia causes influx through L-type voltage gated channels and that hypoxia-induccd c-fos gene expression is dependent. We also demonstrate that hypoxia activates the extracellular-regulated kinase (ERK) and p38, but not JNK. Further, phosphorylation of ERK is essential for c-fos activation via SRE cis-element. Further characterization of nuclear signalling pathways provides evidence for the involvement of Src, a non receptor protein tyrosine kinase, and Ras, a small G protein, in the hypoxia-induced c-fos gene expression. These results suggest a possible role for non-receptor protein tyrosine kinases in propagating signals from G-protein coupled receptors to the activation of immediate early genes such as c-fos during hypoxia.
INTRODUCTION It is not surprising that there are so many similarities between artificial
control systems built by humans and the natural, biological control systems
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
101
that regulate human performance. Both kinds of control systems have been considered to have two major divisions: the controller, which comprises sensors and the mechanisms that integrate signals from sensors; and the plant, which comprises components and processes that are adjusted by the controller. Communication channels link the subdivisions. One of the most important regulating systems in man uses the level of in the arterial blood as its signal, the peripheral chemoreceptors as the sensors, the CNS for integrating signals, respiratory skeletal and smooth muscles and the lung as plant components and the blood stream and nerves as communication channels. Much work has been done on describing the overall behaviour of this system in terms of the quantitative relationship between changes in arterial and ventilation, blood pressure, cardiac output, cerebral blood flow, and the effect of changes in levels on these relationships. Unlike a physical system, the biological system responding to signals can undergo changes that may continue over long periods of time (days and months) that can lead to substantial changes in the characteristics of both controller and plant components as a result of the activation of new genes. Thus, unlike the physical control system, the biological control system behaves as if it were constantly in flux, never reaching a steady state (Powell et al. 1998). Another difference is that the biological control system has multiple sensors with varying degrees of sensitivity located in plant components, so that the distinction between plant and controller is more difficult to make than in the physical system. Some of these sensors monitor local changes, which produces changes in their own properties by altering gene expression. The prime objective of the cellular systems may be optimisation of the use of available energy supplies. It is now apparent that these genomic changes can be initiated quite rapidly and can lead to changes in the amount and kinds of neurotransmitters released by the carotid body, cause the secretion of erythropoietin into the blood, and can alter the enzymatic capabilities of tissues such as the liver, heart, blood vessels, and kidneys. In fact, it may be that these long term adaptive changes are more crucial to the survival of humans than the immediate ventilatory and circulatory changes that systemic hypoxia produces. Systemic hypoxia probably occurs less frequently than local hypoxia in humans. Hence, increasing interest has developed in the molecular mechanisms that are involved in detection of hypoxia by tissues and the intercellular pathways over which this signal is carried to alter gene activity. In general, the genes that are activated by low oxygen fall into two classes: immediate early genes (lEGs) that are induced within minutes after the onset of hypoxia (e.g. c-fos); and late response genes (LRGs) that are activated more slowly over hours (e.g. Tyrosine Hydroxylase, TH). Previous studies demonstrated that hypoxia stimulates expression of the c-
102
fos gene, a member of the IEG family, in intact animals (Taniguchi et al. 1994; Haxhiu et al. 1995), isolated cells (Prabhakar et al. 1995) and that cfos is an essential element in the heterodimeric complexes that function as AP-1 transcription factor. The AP-1 binding motif is a relatively common constituent of transcriptional regulatory elements in many late response genes activated during hypoxia. It has been previously shown that c-fos plays an essential role in regulation of downstream genes such as TH during hypoxia, which suggests that IEGs participate in cellular adaptation to hypoxia via formation of the AP-1 complex (Mishra et al 198). The purpose of this article is to briefly describe the signalling pathways that link the hypoxic stimulus to the transcriptional regulation of the c-fos gene. Some of these results have been reported previously (Premkumar et al. 1999).
2.
METHODS
Experiments were performed on PC12 cells grown in Dulbecco’s modified Eagle’s medium (DMEM). Cells were exposed to normoxia (21% and 10% balanced with or to hypoxia (1 % and 10 % balanced with in an oxygen regulated incubator (Heraeus) for 3h unless otherwise indicated. In the experiments involving drug treatments, cells were pre-incubated for 30 min with the desired concentration of drug(s) and then exposed either to hypoxia or normoxia. The following plasmids were used in the present study: pfos-LUC wild type and mutations in the Ca/CRE or Ets or CArG DNA binding motif of cfos-promoters (Wang and Simonson 1996); wild type ERK1 and ERK2, and dominant negative ERK1 and ERK2 (Robbins et al. 1993); the dominant negative H-Ras (Feig and Cooper 1988); wild type and constitutively active CaMK II (Matthews et al. 1994); c-Src wild type (Roche et al. 1995) and cSrc dominant negative (Twamley-Stein et al. 1993); COOH-terminal Src kinase (csk; Sabe et al. 1992); 2 X AP-1 Luc (Nelson et al. 1988); c-fos sense and antisense Curran et al. 1987); and TH wt and mutation in AP-1 binding site (Gizang-Ginsberg and Ziff 1994). expressing plasmid pRSV Lac Z was from American Type Culture Collection (McGreggor et al. 1987). c-fos mRNA was analysed by a reverse-transcnptase polymerase-chain reaction (RT-PCR) assay. For assessing the c-fos promoter activation by hypoxia, cells were transfected with wild type or with point mutation in various cis-elements in the c-fos promoter linked to luciferase reporter gene. Luciferase and activity was measured according to the manufacturers protocol (Tropix, Inc).
103
Two methods were employed to assay protein kinase activities. These include Western blot assay using antibodies specific for phosphorylated kinases and in vitro measurement of kinase activity using specific substrates. The following protein kinases were analysed: CaMK II, ERK 1 and 2, p38, JNK and c-Src. Ras activation was determined by measuring GTP loading as described previously (Herman and Simonson 1995). Data are expressed as from 3-5 individual experiments each run in duplicate. Statistical analysis was performed by analysis of variance (ANOVA) or by paired 't' test where appropriate and p values less than 0.05 were considered significant.
3.
RESULTS AND DISCUSSION
3.1
Activation of voltage-gated channels is essential for c-fos activation by hypoxia
Hypoxia increases in PC12 cells (Bright et al. 1996; Kumar et al. 1998). To determine whether increases in contribute to the induction
of c-fos gene expression by hypoxia, cells were pre-treated with varying concentrations of BAPTA-AM, a
chelator, and then subjected to
hypoxic challenge. Hypoxia-induced c-fos mRNA and promoter activation was abolished by BAPTA-AM. Nitrendipine, an L-type channel blocker abolished, whereas BayK-8644, an L-type channel agonist, enhanced
c-fos mRNA and promoter activation by hypoxia.
In addition, hypoxia
increased current in patch-clamp experiments. These observations demonstrate that influx mediated by L-type channels is essential for c-fos activation by hypoxia.
3.2
CaMK II and CREB phosphorylation are downstream events in c-fos activation by hypoxia
regulates c-fos gene expression in response to various stimuli through activation of dependent protein kinases (CaMKs), especially CaMK II and CaMK IV (Finkbeiner and Greenberg 1998). Since PC12 cells does not express CaMK IV (Enslen et al 1996), we determined the effect of hypoxia on CaMK II activity. Hypoxia rapidly increased CaMK I I activity (3 fold within 15 min) and returned to the basal level after 1h. KN-93, a CaMK inhibitor, not only blocked CaMK II activation, but also cfos promoter activation by hypoxia. Additionally, ectopic expression of an
104
active mutant of CaMK II significantly stimulated c-fos promoter activity
under normoxia. These observations suggest that CaMK II is a downstream effector in signalling by hypoxia. We also examined the role of cAMP responsive element-binding protein (CREB) transcription factor in c-fos activation by hypoxia. Hypoxia increased phosphorylation of CREB at Ser133, and maximal increases were
seen after 3 h of hypoxia. KN-93 significantly attenuated hypoxia-induced
CREB phosphorylation at Ser133 suggesting the involvement of CaMK II in hypoxia-induced CREB phosphorylation. Point mutations at the element (Ca/CRE), which prevent CREB binding, markedly attenuated transcriptional activation of c-fos by hypoxia. These experiments demonstrate that activation of CaMK II and phosphorylations of CREB at
Ser133 are downstream signalling events in c-fos activation by hypoxia.
3.3
Hypoxia activates ERK and p38 but not JNK
It has been shown that influx through voltage-activated channels activate the mitogen-activated protein kinase (MAPK) pathway and
most of this activation was calmodulin-dependent (Egea et al. 1999). Therefore, we characterized the effect of hypoxia on the MAPK pathway. Western analysis and in vitro kinase assay revealed that hypoxia activates ERK and p38 but not JNK. ERK activation can be stimulated by 5, 3 and 1%
oxygen, whereas p38 was activated only by 3 and 1% oxygen. Activation of
ERK 1 and 2 by 1% could be seen within 15 min of hypoxia, whereas p38 activation was seen after 2h of hypoxia. Con focal microscopic analysis revealed nuclear translocation of ERK and p38 during hypoxia and this effect of hypoxia could be reversed within 15 min of re-oxygenation. PD98059 and SB203580, selective pharmacological inhibitors of ERK and p38, respectively, blocked hypoxia-induced ERK and p38 activation and nuclear translocation. Co-transfecting the cells with wild type ERK1 and ERK2 significantly potentiated hypoxia-induced c-fos promoter activation; whereas dominant negative ERK1 and ERK2 completely abolished the hypoxia-induced c-fos promoter activation. In order to determine the importance of SRE cis-element in hypoxiainduced c-fos promoter activation, we transfected the cells with c-fos promoter constructs with point mutations at SRE. Point mutations in Ets (which prevents binding of ternary complex factor, TCF), CArG (which prevents the binding of serum response factor, SRF) c-fos promoter abolished the hypoxia-induced activation. These results demonstrate that intact CArG and Ets motifs of SRE cis-element is required for hypoxiainduced c-fos transcriptional activation by hypoxia.
105
3.4
Evidence for activation of Ras and Src, an up-stream signalling event in c-fos regulation by hypoxia
Most of the signalling pathways involved in the activation of ERK MAP kinases converge on a small G protein (Finkbeiner and Greenberg 1996). Hypoxia stimulated a 2-fold increase in Ras-GTP loading, suggesting activation of Nitrendipine or BAPTA-AM blocked the hypoxiainduced Ras GTP loading suggeting that hypoxia-induced Ras activation is dependent. To evaluate the role of Ras in hypoxia-induced c-fos
promoter activation, cells were co-transfected with wild type c-fos luciferase and Ras dominant negative construct and then subjected to hypoxia. Hypoxia-induced c-fos promoter activation is completely abolished by Ras dominant negative mutant. These data demonstrate that hypoxia-induced cfos promoter activation requires intact Ras. c-Src is a non-receptor protein tyrosine kinase (Brown and Cooper, 1996). Activation of c-Src has been implicated in regulation of Vascular Endothelial Growth Factor (VEGF) gene expression (Mukhopadhyay, et al. 1995). In P C 1 2 cells, hypoxia increased the autophosphorylation of c-Src, and also its catalytic activity, as evidenced by in vitro kinase assay using KVEKIGEGTYGVVVK peptide, a specific substrate for Src. Kinetic analysis revealed maximum activation (a 5 fold increase) by 1h and then returned to the basal level. To assess the role of c-Src in hypoxia-induced cfos promoter activation, cells were co-transfected with c-Src wild type or dominant negative expression vectors. Activation of c-fos promoter was potentiated by wild type c-Src, whereas dominant negative mutant of c-Src abolished c-fos activation by hypoxia. Similar attenuation of c-fos activation by hypoxia was also seen with COOH-terminal Src kinase (csk), which suppresses Src kinase activity by phosphorylating a COOH-terminal tyrosine These results demonstrate that c-fos activation by hypoxia requires activation of non-receptor tyrosine kinases such as c-Src. The protein kinase signalling cascade associated with activation of c-fos transcription by hypoxia is schematically outlined in Figure 1. Hypoxia can serve as a physiological signal in cells, but how these signals are transduced to target genes is poorly understood. The results described in the present study provide evidence for the involvement of dependent mechanisms in hypoxic signalling. Voltage gated influx is required for c-fos induction via activation of a non-receptor protein tyrosine kinase, c-Src, and GTP-binding protein, Ras. This in turn initiates a sequential kinase cascade that activates MAP kinases resulting in transactivation of SRH and Ca/CRE cis-elements leading to stimulation of c-fos transcription. The resulting Fos protein in turn increases AP-1 activity and increases transcription of late response genes such as TH (Fig. 1).
106
HYPOXIA
ACKNOWLEDGEMENTS This work is supported by NIH-HL-25830.
REFERENCES Bright, G.R., Agani, F.H., Haque, U., Overholt, J.L., and Prabhakar, N.R. Heterogeneity in cytosolic calcium responses to hypoxia in carotid body cells. Brain Res. 706:297-302, 1996. Brown, M.T., and Cooper, J.A. Regulation, substrates and functions of src. Biochim. Biophys Acta 7: 121-149, 1996.
Curran, T., Gordon, M.B., Rubino, K.L. and Sambucetti, L.C. Isolation and characterization of the c-fos (rat) cDNA and analysis of post translational modification in vitro. Oncogene 2:79-84, 1987. Egea, J., Espinet, C., and Cornelia, J.X. Calcium influx activates extracellular-regulated
kinase/mitogen activated protein kinase pathway through a calmodulin sensitive mechanism in PC12 cells. J. Biol. Chem. 274: 75-85, 1999. Enslen, H., Tokumitsu, H., Astork, P.J.S., Davis, R.J., and Sodering, T.R. Regulation of mitogen-activated protein kinases by calcium/calmodulin-dependent protein kinase cascade. Proc. Natl. Acad. Sci. USA. 93: 10803-10808, 1996.
107
Feig, L.A., and Cooper, G.M. Inhibition of NIH 3T3 cells proliferation by a mutant ras protein with preferential affinity for GDP. Mol. Cell. Biol. 8: 3235-3243, 1988. F i n k beiner, S., and Greenberg, ME. dependent routes to Ras: Mechanisms for neuronal survival, differentiation, and plasticity? Neuron 16: 233-236, 1996. Finkbeiner, S., and Greenberg, M.E. channel-regulated neuronal gene expression. J. Neurobiol. 37: 171-189, 1998.
Gizang-Ginsberg, E., and Ziff, E.B. Fos family members successively occupy the tyrosine hydorxylase gene AP-1 site after nerve growth factor or epidermal growth factor stimulation and can repress transcription. Mol. Endocrinol. 8: 249-262, 1994.
H u x h i u , M.A., Strohl, K.P., and Cherniack, N.S. The N-methyl-D-aspartate receptor pathway is involved in hypoxia-induccd c-fos protein expression in the rat nucleus of the solitary tract. J. Auton. Nerv. Syst. 55: 65-68, 1995. Herman, W. H., and Simonson, M.S. Nuclear signalling by endothelin-1. A Ras pathway for activation of the c-fos serum response element. J. Biol. Chem. 270: 11654-11661, 1995. Kumar, G.K. Overholt, J.L., Bright, G.R., Hui, K.Y., Lu, H., Gratzl, M., and Prabhakar, N.R. Release of dopamine and norepinephrine by hypoxia from PC12 cells. Am. J. Physiol. 274: C1592-C1600, 1998. Matthews, R.P., Guthrie, C.R., Wailes, L.M., Zhao, X., Means, A.R. and McKnight, G.S.
Calcium/calmodulin-dependent protein kinase type I I and IV differentially regulate CREB-dependent gene expression. Mol.Cell.Biol. 14:6107-6116, 1994 McGreggor, G.R., Mogg, A.E., Burke, J.F., and Caskey, C.T. Histochemical staining of clonal
mammalian cell lines expressing E.coli
indicates
heterogeneous
expression of the bacterial gene. Somatic Cell Mol. Genet. 1 3 : 253-265, 1987.
Mishra, R., Adhikary, G., Simonson, M.S., Cherniack, N.S., and Prabhakar, N.R. Role of c-
fos in hypoxia-induced AP-1 cis-element activity and tyrosine hydroxylase gene expression. Mol. Brain Res. 59:74-83, 1998.
Mukhopadhyay, D., Tsiokas, L., Zhou, X., Foster, D., Brugge, J.S. and Sukhatme, V.P. Hypoxic induction of human vascular endothelial growth factor expression through c-Src activation. Nature 375: 577-581, 1995. Nelson, V.R., Albert, H.P., Elsholtz, L.I., Lu.W., Rosenfield, M.G. Activation of cell specific expression of hormone and prolactin genes by a common transcription factor. Science 239: 1400-1405, 1988.
Powell, F.L., Milsom, W.K., and Mitchell, G.S. Time domains of the hypoxic ventilatory response. Respir Physiol. 112: 123-134, 1998. Prabhakar, N.R., Shenoy, B.C., Simonson, M.S., and Cherniack, N.S. Cell selective induction and transcriptional activation of immediate early genes by hypoxia. Brain Res. 697: 266270, 1995.
Premkumar, D.R.D. Adhikary, G., Simonsons, M.S., Cherniack, N.S., and Prabhakar, N.R. Src, a non-receptor tyrosine kinase is required for c-fos expression by hypoxia. FASEB J. 13: 1 0 9 1 , 1999.
Robbins, D.J., Zhen, E., Owaki, H., Vanderbilt, C.A., Ebert,D., Gerpert, D.D., and Cobb, M.H. Regulation and properties of extracellular signal-regulated protein kinases 1 and 2 in vitro. J.Biol. Chem. 268: 5097-5106, 1993. Roche, S., Koegl, M., Barone, M.V., Roussel, M.F., and Courtneidge, S.A. DNA synthesis induced by some but not all growth factors requires Src family protein tyrosine kinases. Mol. Cell, Biol. 15: 1 102-1 109, 1995. Sabe, H., Knudsen, B., Okada, M., Nada, S., Nakagwa, H., and Hanafusa, H. Molecular cloning and expression of chicken C-terminal Src kinase: Lack of stable association with c-Src protein. Proc. Natl. Acad. Sci. U.S.A. 89: 2190-2194, 1992.
108
Taniguchi, T., Fukunaga, R., Matsuoka, Y., Tooyamam, I., and Kimura, H. Delayed expression of c-fos protein in rat hippocampus and cerebral cortex following transient in vivo exposure to hypoxia. Brain Res. 640: 119-125, 1994. Twamley-Stein, G.M., Pepperkok, R., Ansorge, W., and Courtneidge, S.A. The Src family tyrosine kinase are required for platelet-derived growth factor-mediated signal transduction in N I H 3T3 cells. Proc. Natl. Acad. Sci. U.S.A. 90: 7696-7700, 1993. Wang, Y., and Simonson, M.S. Voltage-insensitive channels and calmodulindependent protein kinases propagate signals from endothelin-1 receptors to the c-fos promoter. Mol Cell. Biol. 16: 5915-5923, 1996.
109
This page intentionally left blank.
HYPOXIA-INDUCED REGULATION OF mRNA STABILITY
Waltke R. Paulding and Maria F. Czyzyk-Krzeska Department of Molecular and Cellular Physiology, University of Cincinnati, College of
Medicine, PO Box 670576, Cincinnati, OH 45267-0576, USA
Abstract:
Because molecular oxygen is essential for generating cellular energy in aerobic organisms, and because survival depends on this fundamental requirement for oxygen, all higher organisms have evolved numerous diversely regulated mechanisms to detect and respond to potentially lifethreatening occurrences of decreased oxygen availability (hypoxia). While the oxygen-dependent regulation of gene expression involves both transcriptionaland post-transcriptional mechanisms, investigations have focused mainly on mechanisms working at the transcriptional level. In this review, the focus is on a growing body of work that looks at post-transcriptional mechanisms
acting at a level of mRNA stability.
1.
INTRODUCTION
The adaptation of mammalian organisms to hypoxia involves a complex system of short-term, intermediate, and long-term actions. In the short run, the organism’s ventilation rate increases to supply more oxygen, while over a period of days, the production of red blood cells rises to boost the oxygencarrying capacity of the blood. Finally, long-term angiogenesis enhances the organism’s vasculature, permanently improving its ability to survive in a hypoxic environment. All three responses are driven by an increased activity of hypoxia-sensitive genes, as are most of the known adaptations to hypoxia. Hypoxia-induced regulation of gene expression can occur at the levels of transcription, mRNA stability, or both. The mRNA stability is an important factor regulating gene expression because mRNA half-lives directly affect
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
111
the steady-state mRNA levels, and mRNA abundance is the primary
determinant of translationally derived protein quantities. Hypoxia is known to specifically increase the stability of various mRNAs such as vascular endothelial growth factor (VEGF), tyrosine hydroxylase (TH), and erythropoietin (EPO). Below, we discuss how the hypoxia-induced stabilization of these and other mRNAs comes about as a result of interactions between specific protein factors and regulatory sequences within the mRNAs.
2.
VEGF mRNA STABILITY VEGF, an important angiogenic factor, plays crucial roles during
embryonic development, wound healing, and the neovascularization of oxygen deprived tissues (Folkman 1992, Carmeliet et al 1996, Ferrara et al 1996). Further, hypoxia-induced VEGF expression is a prominent pathological feature associated with solid tumor progression (Shweiki et al. 1992 & Plate et al. 1994). The mechanisms by which hypoxia induces VEGF mRNA expression is dual in nature, taking place not only at the level of gene
transcription, but at the level of mRNA stability as well.
While VEGF mRNA has a half-life in the range of 40-60 mm during normoxia, several investigators have shown that hypoxia (1-2% increases it by as much as 3 to 4-fold (Ikeda et al 1995, Levy et al. 1995, 1996a, Shima et al 1995, Stein et al 1995, Dibbens et al. 1999). Analysis of the VEGF mRNA 3’-untranslated region (3’UTR) shows several sequence motifs that could be important in regulating VEGF mRNA stability, including nine canonical AUUUA sequences, one AUUUUA sequence, and
one A U U U U U A sequence.
In vitro RNA decay assays show that two
fragments of the VEGF 3’ UTR, which correspond to the NsiI-XbaI and StuI-NsiI restriction fragments, appear to be functional instability elements (Levy et al 1996a). Moreover, in vitro, the NsiI-XbaI fragment is necessary for the hypoxia-induced stabilization of VEGF mRNA. This requirement is supported by the observation that half-lives of VEGF transcripts containing the NsiI-XbaI fragment are significantly longer when incubated with S100 cytoplasmic extracts from hypoxic cells. These transcripts form hypoxiainducible protein-RNA complexes in electromobility shift assays (EMSA). Note that transcripts lacking the previously mentioned fragment are neither stabilized by hypoxia, nor do they form EMSA complexes. Further mapping of the binding sites has revealed three similar AU-rich elements corresponding to nucleotides 1472-1510, 1508-1573, and 1631-1678 of VEGF mRNA 3’UTR region, all of which form hypoxia-inducible EMSA complexes (Levy et al, 1996b). Importantly these elements are conserved
112
between the human and rat VEGF 3’ UTRs (Levy et al 1997). RNA affinity purification and UV light cross-linking has identified three proteins of 32, 28, and 17 kDa that participate in complex formation. One of these hypoxia-
inducible protein factors was identified as a 36 kDa HuR factor (Levy et al 1998). HuR appears to be necessary for the post-transcriptional induction of
VEGF expression by hypoxia, although hypoxia does not appear affect the total cellular concentration of HuR. A decrease in HuR accumulation, caused by overexpression of HuR antisense RNA, abolishes the hypoxic stabilization of VEGF mRNA, while the overexpression of HuR augments the hypoxic inducibility of VEGF mRNA stability (Levy et al 1998). Another AU-rich element (125 bases long) has been identified in the proximal region of the 3’ UTR of the human VEGF mRNA (Claffey et al. 1998). Studies of function show that the presence of this element in the chimeric reporter constructs results in significantly higher hypoxia-induced activity of the reporter construct than the construct without the VEGF insert. This element forms hypoxia-inducible complexes with cytoplasmic protein extracts. The UV light cross-linking studies of the hypoxia inducible complexes identified several hypoxia-induced proteins of 90/88, 72, 56, and 46 kDa. A later study shows that one of the proteins involved in forming the hypoxia-inducible complex was heterogeneous nuclear ribonucleoprotein L (hnRNPL) (Shih & Claffey 1999). This protein binds to the VEGF mRNA in vivo. Blocking the VEGF mRNA interaction with hnRNPL using an antisense oligonucleotide results in the destabilization of VEGF mRNA (Shih & Claffey 1999).
In spite of the presence of the hypoxia-inducible protein-binding elements within the 3’ UTR of VEGF mRNA, it is clear that the 3’ UTR alone is not sufficient to confer hypoxic-inducibility to the chimeric mRNA. Interestingly, a recent study shows that recapitulation of the hypoxic
induction of VEGF mRNA stability requires elements located in the 5’ UTR and 3’ UTR, as well as the coding region of VEGF mRNA (Dibbens et al 1999). This study also shows that the destabilizing elements are located in the 3'UTR and 5'UTR, as well as in the coding region of the VEGF mRNA. Either of these three regions can independently promote mRNA degradation and act in an additive fashion to promote rapid degradation under normoxic conditions (Dibbens et al. 1999). The von Hippel-Lindau tumor suppressor protein (pVHL) modulates the regulation of VEGF mRNA stability (Levy et al 1996b). Mutations and the loss of heterozygosity for pVHL are associated with hereditary VHL disease, which results in hemangioblastomas, renal clear cell carcinomas, and pheochromocytomas (Latif et al. 1993). These tumors are highly vascularized, and in fact, hemangioblastomas and angiomas are actually formed of capillaries—an indication of an active angiogenic process (Plate et
113
al. 1994). VHL-associated hemangioblastomas have high levels of VEGF mRNA in stromal cells, while renal tumors show an increase in the expression of VEGF in clear cells (Stratmann et al. 1997). Interestingly, VHL patients show higher levels of VEGF in the aqueous fluid of the anterior chamber of the eye, as well as in serum, when compared to a control group—even in cases without clinically present tumors (Los et al. 1997). This finding suggests that an increase in VEGF production, which results from either abnormal- or nonexistent activity of the VHL protein, could be an early factor in the development of a VHL phenotype preceding tumor growth. Cell culture studies show an increase in the expression of VEGF mRNA in renal carcinoma cells (RCCs) that lack the normal VHL gene. Furthermore, in these cells, the expression of VEGF cannot be further stimulated by hypoxia. Reintroduction of the wild-type VHL represses VEGF mRNA, and it reestablishes the hypoxia inducibility (Iliopolous et al. 1996, Siemeister et al. 1996). Results are similar for a platelet-derived growth factor (PDGF) B chain and a glucose transporter, Glut-1 (Iliopoulos et al. 1996). Two laboratories using two different RCC cell lines have reported no effect of VHL on VEGF promoter activity and no change in transcription rates measured by nuclear runoff assays (Gnarra et al. 1996 & Iliopoulos et al. 1996). In contrast, measurements of the VEGF mRNA showed a decreased half-life in the presence of wild-type VHL (Ilipoulos et al. 1996). A corresponding change in the formation of a VEGF mRNAprotein complex has also been reported (Levy et al. 1996b). The identity of the protein factor forming this VEGF mRNA associated complex, however, is unknown, and the mechanism by which VHL regulates mRNA stability remains unclear. The mechanism is attractive, however, because more VHL is present in the cytoplasm than in the nucleus, indicating functionality in the cytoplasm. While most studies of VEGF mRNA stability have used actinomycin D both as an inhibitor of transcription and to measure the mRNA halt-life, recent findings show that actinomycin D causes VHL to translocate to the nucleus (Lee et al. 1999). Therefore, the measured decrease in the VEGF mRNA stability in the presence of wild-type VHL could be secondary to the effect of actinomycin D, which results from a decrease in the concentration of cytoplasmic VHL.
3.
TYROSINE HYDROXYLASE mRNA STABILITY
Tyrosine hydroxylase (TH), the rate limiting enzyme in the biosynthesis of catecholamines, is expressed in specific populations of neurons in the central and peripheral nervous systems, in the neuroendocrine cells of
114
adrenal medulla and carotid body, and in cultured cell lines such as the pheochromocytoma-derived PC 12 cell line. As discussed below, evidence is growing that the regulation of TH gene expression involves changes in TH mRNA stability, as well as transcriptional control. TH mRNA is a stable message with a half-life that varies from 9 to 16 h in various subclones of PC12 cells (Summerhill et al. 1987, Fossom et al 1992, Vyas et al. 1992). It is enhanced during the differentiation of neuroblastoma cells (Summerhill et al 1987), and during the stimulation of the protein kinase C pathway in PC 12 cells (Vyas et al. 1990). In contrast, the stability of TH mRNA does not change in PC 12 cells during the stimulation of TH mRNA expression by dexamethasone or forskolin (Fossom et al. 1992). A recent study demonstrates that substantial differences exist in basal TH mRNA turnover rates between different neuronal populations, ranging from as short as 6-7 h in the dopaminergic neurons of the arcuate nucleus to as long as 11-23 h in the dopaminergic midhypothalamic neurons (Maurer et al. 1997). The stability of TH mRNA is also regulated by oxygen tension. Expression of the TH gene is induced by hypoxia at the level of transcription and at the level of RNA stability in PC 12 cells (Czyzyk-Krzeska et al 1994a). The initial increase in TH mRNA is caused primarily by fast, transcriptional induction. The transcriptional rate, however, declines during sustained hypoxia, and augmented mRNA stability takes over as the primary contributor to the accumulation of TH mRNA. Hence, an increase in TH mRNA stability is necessary to maintain TH mRNA levels at the elevated concentration during long-term hypoxia. A hypoxia-inducible protein-binding sequence (or HIPBS) has been identified that is a 27-base-long pyrimidine-rich sequence within the TH mRNA 3’UTR (1552-1578 bases of TH mRNA). The HIPBS binds the protein factors in a hypoxia-inducible manner in PC 12 cells (CzyzykKrzeska et al. 1994b, Czyzyk-Krzeska and Beresh 1996), catecholaminergic cells of the superior cervical ganglia, and in the dopaminergic cells of the carotid body (Czyzyk-Krzeska et al. 1997). Mutational analysis reveals that the optimal protein-binding site is represented by the motif within the pyrimidine-rich sequence, where the underlined cytosines represent the core binding site (Czyzyk-Krzeska and Beresh 1996). This motif is conserved in TH mRNAs of different species, which implies that the formation of the ribonucleoprotein complex associated with the HIPBS is involved in the physiological regulation of TH mRNA stability in catecholaminergic cells. The HIPBS is definitely a stabilizing element that is required for both constitutive and hypoxia-regulated control of TH mRNA (Paulding et al. 1999). Importantly, while the HIPBS alone confers a constitutive increase in
115
mRNA stability to a chloramphenicol acetyltransferase (CAT) reporter mRNA, additional elements located in the coding region of the gene appear to be necessary for hypoxic regulation. The HIPBS-binding protein is represented by two isoforms of a 40 kDa poly(C) binding protein (PCBP), also known as or hnRNPE (Kiledjian et al. 1995, Wang et al. 1995, Holcik & Liebhaber 1997, Gamarnik & Andino 1997). Expression of the PCBP1 isoform is induced by hypoxia in PC12 cells.
4.
EPO mRNA
Erythropoietin (EPO) is a glycoprotein hormone essential for regulating red blood cell production during environmental hypoxia. Hypoxia induces EPO gene expression, increasing mRNA levels up to 100-fold and serum levels of EPO protein up to 1000-fold. Most studies investigating the mechanisms regulating EPO gene expression by hypoxia were performed in two cells lines derived from liver tumor, HepG2 and Hep3B. The major mechanism responsible for the hypoxic induction of EPO gene expression is transcription, although here too, evidence suggests a role for the hypoxic
stabilization of EPO mRNA. An accurate determination of the half-life of
EPO mRNA, however, is complicated, because the stability of the EPO message is modulated by ongoing transcription and translation (Goldberg et al. 1991). Analysis of the 3’ untranslated region (3’ UTR) of EPO mRNA confirms the putative stability and instability elements. Deletion of the 186-base conserved sequence from the distal 3’ UTR of EPO mRNA increased the from 2 h to 15 h (Ho et al. 1995). This finding suggests that the deleted fragment of the 3’ UTR could contain an RNA instability element, while the remaining region, which is 5’ from the deleted region, could contain an RNA stability element. Deletion of the 104 bases immediately downstream from the EPO translation stop codon results in a destabilization of EPO mRNA from 7 h to 2.6 h, thus indicating that this fragment could contain an RNA stability element (McGary et al. 1997). These experiments, however, were performed in the presence of actinomycin D, which stabilizes EPO mRNA in a nonspecific manner. Thus, it is difficult to estimate the role of this fragment of the EPO 3’UTR in regulating EPO mRNA stability. This putative EPO mRNA stability region was previously found to bind cytoplasmic proteins (Rondon et al. 1991, 1995). UV light cross-linking and SDS-PAGE analysis of the EPO RNA-protein complexes revealed two bands of 70 and 135-140 kDa (Rondon et al. 1991). Except in the brain and the spleen, however, the binding activity in most cell lines and tissues studied was not induced by
116
hypoxia. The binding of these proteins to EPO mRNA was redox-sensitive and required the use of reduced thiol groups (Rondon et al. 1995). The sequence of the protein-binding putative EPO mRNA stability element shows a high level of homology with the HIPBS stability element identified within the TH mRNA. This homology led to the identification of two 40kDa poly(C) binding proteins, (PCBP1 and PCBP2), as part of the EPO mRNA-associated complex (Czyzyk-Krzeska & Bendixen, 1999). In
contrast to PCl2 cells, however, the expression of the PCBP1 is not regulated by hypoxia in Hep3B or HepG2 cells, implying that they might participate in a constitutive- rather than hypoxia-inducible stability of EPO mRNA.
5.
MISCELLANEOUS GENES AND mRNA STABILITY
The hypoxia-induced stabilization of few additional genes has been described but in less detail than for the above genes. The additional genes include the glucose transporter 1 (GLUT1), which is a mammalian specific carrier facilitating glucose uptake in brain cells (Bruckner et al. 1999), and a plasminogen activator inhibitor-1 (PAI-1), which is a serine protease inhibitor that profoundly inhibits fibrinolysis. As such, PAI-1 may have important implications for the pathogenesis of diseases associated with hypoxemia (Pinsky et al. 1998). Both of these messages are stabilized by hypoxia, but the mechanisms mediating stabilization remain unknown. Hypoxia was recently shown to differentially regulate the expression of the iron-regulatory proteins 1 and 2 (IRP1 and IRP2) (Hanson et al. 1999). These proteins are RNA binding proteins that post-transcriptionally regulate the expression of mRNAs that code for proteins involved in the maintenance of iron and energy homeostasis. IRP1 and IRP2 bind specific RNA stemloop structures termed iron-responsive elements (IREs) that may be located in both the 5'- and 3' UTRs of specific mRNAs. Examples of IRE containing proteins include, ferritin (iron storage), transferrin receptor (iron transport), erythroid-aminolevulinate synthase (heme biosynthesis), and mitochondrial aconitase (energy metabolism). With respect to the stem-loop structures, the control of IRP1 and IRP2 regulation for given transcripts is functionally quite similar to the mechanisms discussed above for TH, VEGF, and EPO. It should be mentioned that hypoxia has been shown to decrease mRNA stability for the following three genes: endothelial constitutive nitric oxide synthase (eNOS) (McQuillan et al. 1995), mitochondrial manganesecontaining superoxide dismutase (Mn-SOD), and the cytosolic copper and zinc-containing superoxide dismutase (Cu,Zn-SOD) (Jackson et al. 1996).
117
Again, the mechanisms mediating the effects of hypoxia in these cases remain unknown.
6.
CONCLUSION
Since the abundance of mRNA is an important factor in establishing cellular protein levels, control of the transcript half-life is vitally important in determining an organism’s ability to respond to life-threatening environmental changes. For this reason, the role oxygen plays in regulating mRNA stability and, ultimately, gene expression is deservedly gaining increased attention. While common post-transcriptional regulatory mechanisms for many genes are currently emerging in the form of closely related cis-elements and even shared trans-acting factors, the complete elucidation of regulatory mechanisms remains quite complicated. Considering the physiological importance of hypoxia on the bestcharacterized genes, VEGF, TH, and EPO, it is obvious that a thorough understanding of the hypoxia-induced processes that control mRNA stability is clinically significant, offering much potential for pharmacological interventions.
ACKNOWLEDGEMENTS This work was supported by NIH Grants HL51078 and HL58678 and by AHA Grant-in-Aid 9750110N. WRP was supported by Training grant T32 HL07571 and HL MPDS.
REFERENCES Bruckner, B.A., Ammini, C.V., Otal, M.P., Raizada, M.K., and Stacpoole, P.W., 1999, Regulation of brain glucose transporters by glucose and oxygen deprivation. Metabolism. 48:422-431. Carmeliet, P., Ferreira, V.,Breier, G., Pollefeyt, S., Kieckens, L., Gertsenstein, M., Fahrig, M.,
Vandenhoeck, A., Harpal, K., Eberhardt, C, Declercq, C., Pawling, J., Moons, L., Collen, D., Risau, W., and Nagy, A., 1996, Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature. 380:435-439. Claffey, K.P., Shih, S.C., Mullen, A., Dziennis, S., Cusick, J.L., Abrams, K.R., Lee, S.W., and Detmar, M., 1998, Identification of a human VPF/VEGF 3' untranslated region
mediating hypoxia-induced mRNA stability. Mol. Biol. Cell. 9:469-481.
118
Czyzyk-Krzeska, M.F., Furnari, B.A., Lawson, E.E., and Millhorn, D.E., 1994a, Hypoxia
increases rate of transcription and stability of tyrosine hydroxylase mRNA in pheochromocytoma (PC12) cells. J. Biol. Chem. 269:760-764. Czyzyk-Krzeska, M.F., Dominski, Z., Kole, R., and Millhorn, D.E., 1994b, Hypoxia stimulates binding of a cytoplasmic protein to a pyrimidine- rich sequence in the 3'untranslated region of rat tyrosine hydroxylase mRNA. J. Biol. Client. 269:9940-9945.
Czyzyk-Krzeska, M.F., and Beresh, J.E., 1996, Characterization of the hypoxia-inducible protein binding site within the pyrimidine-rich tract in the 3'-untranslated region of the tyrosine hydroxylase m R N A . J. Biol Chem. 271:3293-3299. Czyzyk-Krzeska, M.F., Paulding, W.R., Beresh, J.E., and K r o l l , S.L., 1997, Posttranscriptional regulation of tyrosine hydroxylase gene expression by oxygen in PC 12 cells. Kidney Int. 51:585-590.
Czyzyk-Krzeska, M.F., and Bendixen, A.C., 1999, Identification of the poly(C) binding protein in the complex associated with the 3 ' untranslated region of crythropoietin messenger R N A . Blood. 93:21 11-2120. Dibbens, J.A., M i l l e r , D.L., Damert, A., Risau, W., Vadas, M.A., and Goodall, G.J., 1999, Hypoxic Regulation of Vascular Endothelial Growth Factor mRNA Stability Requires the
Cooperation of Multiple RNA Elements. Mol. Biol. Cell. 10:907-919. Ferrara, N., Carver-Moore, K., Chen, H., Dowd. M., Lu, L., O'Shea, K.S., Powell-Braxton, L.,
Hillan, K.J., and Marme, M.W., 1996, Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature. 380:439-442. F i n k e n z e l l e r , G., Technau, A., and Marine, D., 1995, Hypoxia-induccd transcription of the vascular endothelial growth factor gene is independent of functional AP-1 transcription factor, Biochem. Biophys. Res. Commun. 208:432-439. Fossom, L.H., Sterling, C.R., and Tank, A.W., 1992, Regulation of tyrosine hydroxylase gene transcription rate and tyrosine hydroxylase m R N A stability by cyclic AMP and glucocorticoid. Mol. Pharmacol. 42:898-908. Folkman, J., and Shing, Y., 1992, Angiogenesis. J. Biol. Chem. 267:10931-10934. Gamarnik, A.V., and Audio, R., 1997, Two functional complexes formed by KH domain containing proteins with the 5’ noncoding region of poliovirus RNA. RNA. 3:882-892. Gnarra, J.R., Zhou, S., M e r i l l , M.J., Wagner, J.R., Krumm, A., Papavassiliou, E., Oldfield, E.H., Klausner, R.D., and Linchan, W.M., 1996, Post-transcriptional regulation of vascular e n d o t h e l i a l growth factor m R N A by the product of the VHL tumor suppressor gene. Proc. Natl. Acad. Sci. 93:10589-10594. Goldberg, M.A., Gaut, C.C., and Bunn, H.F., 1991, Erythropoietin m R N A levels are
governed by both the rate of gene transcription and posttranscriptional events. Blood. 77:271-277.
Hanson, E.S., Foot, E.M., and Leibold, E.A., 1999, Hypoxia post-translationally activates iron-regulatory protein 2. J. Biol. Chem. 274:5047-5052. Ho, V., Acquaviva, A., Duh, E., and Bunn, H. F., 1995, Use of a marked erythropoietin gene
for investigation of its cis-acting elements. J. Biol. Chem. 270:1084-10090. Holcik, M., and Liebhaber, S.A., 1997, Four highly stable eukaryotic mRNAs assemble 3’ untranslated region RNA-protein complexes sharing cis and trans components. Proc. Natl. Acad. Sci. 94:2410-2414. Ikeda, E., Achen, M.G., Breier, G., and Risau, W., 1995, Hypoxia-induced transcriptional
activation and increased mRNA stability of vascular endothelial growth factor in C6 glioma cells. J. Biol. Chem. 270:19761-19766.
119
Iliopoulos, O., Levy, A.P., Jiang, C., Kaelin, W.G. Jr., and Goldberg, M.A., 1996, Negative regulation of hypoxia-inducible genes by the von Hippel-Lindau protein, Proc. Natl. Acad. Sci. 93:10595-10599.
Jackson, R.M., Parish, G., and Ho, Y.S., 1996, Effects of hypoxia on expression of superoxide dismutases in c u l t u r e d ATII cells and lung fibroblasts. Am. J. Physiol. 271:L955-62. Kiledjian, M., Wang, X., and Liebhaber, S.A., 1995, Identification of two KH domain proteins in the alpha-globin m R N P stability complex. EMRO. 14:4357-4364. Latif F., Tory, K., Gnarra, J., Yao, M., Duh, F-M., Orcutt, M.L., Stackhouse, T., Kuzmin, I., Modi, W., Geil, L, Schmidt, L., Zhou, F., Li, H., Wei, M.H., Chen, F., Glenn, G., Choyke, P., Walther, M.M., Weng, Y., Duan, D-S., Dean, M., Glavac, D., Richards, F.M., Crossey, P.A., Ferguson-Smith, M.A., Le Paslier, D., Chumakov, I., Cohen, D., Chinault, A.C., Maher, E.R., Linehun, W.M., Zbar, B., and Lerman, M.I., 1993, Identification of the von
Hippel-Lindau disease tumor suppressor gene. Science. 260:13 17-1320. Lee, S., Neumann, M., Stearman, R., Stauber, R., Pause, A., Pavlakis, G.N., and Klausner, R.D., 1999, Transcription-dependent nuclear-cytoplasmic trafficking is required for the function of the von Hippel-Lindau tumor suppressor protein. Mol. Cell. Biol. 19:14861497. Levy, A.P., Levy, N.S., Wegner, S., and Goldberg, M.A., 1995, Transcriptional regulation of the rat vascular endothelial growth factor gene by hypoxia. J. Biol. Chem. 270:1333313340. Levy, A.P., Levy, N.S., and Goldberg, M.A., 1996a, Post-transcriptional regulation of vascular endothelial growth factor by hypoxia. J. Biol. Chem. 271:2746-2753. Levy, A.P., Levy, N.S., and Goldberg, M.A., 1996b, Hypoxia-inducible protein binding to
vascular endothelial growth factor mRNA and its modulation by the von Hippel-Lindau protein. J. Biol. Chem. 271:25492-25497.
Levy, N.S., Goldberg, M.A., and Levy, A.P., 1997, Sequencing of the human vascular endothelial growth factor (VEGF) 3' untranslated region (UTR): conservation of five h y p o x i a - i n d u c i b l e R N A - protein binding sites. Biochim. Biophys. Acta. 1352:167-173. Levy, N.S., C h u n g , S., Furneaux, H., and Levy, A.P., 1998, Hypoxic stabilization of vascular endothelial growth factor m R N A by the RNA-binding protein HuR. J. Biol. Chem. 273:6417-6423. Los, M., Aarsman, C.J., Terpstra, L., Wittebol-Post, D., Lips, C.J., Blijham, G.H., and Voest,
E.E., 1997, Elevated ocular levels of vascular endothelial growth factor in patients with von Hippel-Lindau disease. Ann. Oncol. 8:1015-1022.
Maurer, J.A., and Wray, S., 1997, Neuronal dopamine subpopulations maintained in hypothalamic slice explant cultures exhibit distinct tyrosine hydroxylase mRNA turnover rates.J. Neurosci. 17:4552-4561. Maxwell, P., Wiesener, M.S., Chang, G-W., Clifford, S.C., Vaux, E.C., Cockman, M.E.,
Wykoff, C.C., Pugh, C.W., Maher, E.R., and Ratcliffe, P.J., 1999, The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature. 399:271-275. McGary, E.C., Rondon, I.J., and Beckman, B.S., 1997, Post-transcriptional regulation of erythropoietin mRNA stability by erythropoietin mRNA-binding protein. J. Biol. Chem. 272:8628-8634. M c Q u i l l a n , L.P., Leung, (G.K., Marsden, P.A., Kostyk, S.K., and Kourembanas, S., 1994, Hypoxia i n h i b i t s expression of eNOS via transcriptional and posttranscriptional mechanisms. Am. J. Physiol. 267:H1921-7.
120
Paulding, W.R.,and Czyzyk-Krzeska, M.F., 1999, Regulation of tyrosinc hydroxylase mRNA stability by protein-binding, pyrimidine-rich sequence in the 3'-untranslated region. J. Biol. Client. 274:2532-2538. Pinsky, D.J., Liao, H., Lawson, C.A., Van, S.F., Chen, J., Carmeliet, P., Loskutoff, D.J., and Stern, D.M., 1998, Coordinated induction of plasminogen activator inhibitor-1 (PAI-1) and i n h i b i t i o n of plasminogen activator gene expression by hypoxia promotes pulmonary vascular fibrin deposition. J. Clin. Invest. 102:919-928. Plate, K.H., Breier, G., and Risau, W., 1994, Molecular mechanisms of developmental and tumor angiogenesis. Brain Pathol. 4:207-218.
Rondon, I.J., MacMillan, L.A., Beckman, B.S., Goldberg, M.A., Schneider, T., Bunn, H.F., and Malter, J.S., 1991, Hypoxia up-regulates the activity of a novel erythropoietin mRNA binding protein. J. Biol. Chem. 266:16594-16598. Scandurro, A.B., Rondon, I.J., Wilson, R.B., Tenenbaum, S.A., Carry, R.F., and Beckman, B.S., 1997, Interaction of erythropoietin RNA binding protein with erythropoietin R N A requires an association with heat shock protein 70. Kidney Int. 51:579-584. Shih, S.C., and Claffey, K.P., 1999, Regulation of human vascular endothelial growth factor m R N A stability in hypoxia by heterogeneous nuclear ribonucleoprotein L. J. Biol. Chem. 274:1359-1365. Shima, D.T., Deutsch, U., and D'Amore, P.A., 1995, Hypoxic induction of vascular endothelial growth factor (VEGF) in human epithelial cells is mediated by increases in mRNA stability. FEBS Lett. 370:203-208. Shweiki, D., I t i n , A., Soffer, D., and Keshet, E., 1992, Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature. 359:843-845.
Siemeister, G., Weindel, K., Mohrs, K., Barleon, B., Martiny-Baron, G., and Marme, D., 1996, Reversion of deregulated expression of vascular endothelial growth factor in human renal carcinoma cells by von Hippel-Lindau tumor suppressor protein. Cancer Res. 56:2299-2301. Stein, I., Neeman, M., Shweiki, D., Itin, A., and Keshet, E., 1995, Stabilization of vascular endothelial growth factor mRNA by hypoxia and hypoglycemia and coregulation with other ischemia-induced genes. Mol. Cell Biol. 15:5363-5368. Stratmann, R., Krieg, M., Haas, R., and Plate, K.H., 1995, Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol. Exp. Neurol. 56:1242-1252. S u m m e r h i l l , E.M., Wood, K., and Fishman, M.C.,Shweiki, 1987, Regulation of tyrosine hydroxylase gene expression during differentiation of neuroblastoma cells, Brain Res. Vyas, S., Faucon Biguet, N., and Mallet, J., 1990, Transcriptional and post-transcriptional regulation of tyrosine hydroxylase gene by protein kinase C. EMBO. 9:3707-3712. Wang, X., Kiledjian, M., Weiss, I.M., and Liebhaber, S.A., 1995, Detection and characterization of a 3’ untranslated region ribonucleoprotein complex associated with huma alpha-globin mRNA stability. Mol. Cell. Biol. 15:1769-1777.
121
This page intentionally left blank.
HYPOXIA, HIF-1, AND THE PATHOPHYSIOLOGY OF COMMON HUMAN DISEASES Gregg L. Semenza, Faton Agani, David Feldser, Narayan lyer, Lori Kotch, Erik Laughner, and Aimee Yu Institute of Genetic Medicine and Department of Pediatrics, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21287 USA
ABSTRACT Hypoxia plays a fundamental role in the pathophysiology of common causes of mortality, including ischemic heart disease, stroke, cancer, chronic lung disease, and congestive heart failure. In these disease states, hypoxia
induces changes in gene expression in target organs that either fail to result in adequate adaptation or directly contribute to disease pathogenesis. Hypoxiainduciblc factor I (HIF-1) is a transcriptional activator that is expressed in response to cellular hypoxia and mediates multiple cellular and systemic
homeostatic responses to hypoxia. Recent studies have provided evidence that important pathophysiological responses to hypoxia in pulmonary hypertension,
myocardial ischemia, and cancer are mediated by HIF-1. Pharmacologic and gene therapy strategies designed to modulate HIF-1 activity may represent a
novel and effective therapeutic approach to these common disorders.
1.
INTRODUCTION
Since its discovery in 1992 (Semenza and Wang, 1992), the number of published studies involving the transcriptional activator hypoxia-inducible factor 1 (HIF-1) have increased exponentially. These studies have provided increasing evidence that HIF-1 is a master regulator of O2 homeostasis that
Oxygen Sensing: Molecule to Man, edited by S. Lahiri el al. Kluwer Academic/Plenum Publishers, 2000
123
coordinates cellular and systemic responses to hypoxia from early stages of embryogenesis through adult life (reviewed by Semenza, 1998, 1999). Systemic hypoxia, which occurs in the context of chronic lung disease or congenital heart disease, induces the expression of erythropoietin (EPO) which stimulates red blood cell production, thus increasing blood O2carrying capacity. Local hypoxia/ischemia, which occurs in the context of ischemic heart disease, induces the expression of vascular endothelial growth factor (VEGF) which stimulates angiogenesis, thus increasing O2 delivery. At the cellular level, hypoxic cells undergo metabolic adaptation by increasing the synthesis of glucose transporters and glycolytic enzymes in order to maintain ATP production in the presence of reduced O2 availability.
HIF-1 is responsible for increased transcription of the genes encoding these proteins in hypoxic cells. HIF-1 is a heterodimer consisting of HIF-la and HIF-lb subunits (Wang and Semenza, 1995; Wang et al., 1995). Whereas HIF-lb (also
known as the aryl hydrocarbon nuclear translocator) is a common subunit for several transcription factors, HIF-la is unique to HIF-1 and is the O2regulated subunit. Although HIF-1 activity appears to be controlled at many levels, a critical step appears to be regulation of the steady-state levels of H I F - l a protein, which increase exponentially as cellular O2 concentration is decreased, both in cultured cells and in vivo (Jiang et al., 1996; Yu et al., 1998). Current data suggest that under non-hypoxic conditions HIF-la is subject to ubiquitination and proteasomal degradation and that this process is inhibited under hypoxic conditions (Huang et al., 1998; Kallio et al., 1999; Salceda and Caro, 1997). Recently, the von Hippel-Lindau tumor suppressor
protein has been implicated in the degradation of HIF-la under non-hypoxic conditions (Maxwell et al., 1999). The mechanisms by which hypoxia induces accumulation of HIF-la protein are under active investigation, as described in several other papers in this volume. This review will focus on recent studies which have provided evidence that HIF-1 plays important roles in embryonic development and disease pathophysiology.
2.
HIF-1 IS REQUIRED FOR EMBRYOGENESIS
Homologous recombination in mouse embryonic stem cells resulted in targeted inactivation of the gene encoding HIF-la and the generation of mice that were heterozygous for the null allele (Iyer et al., 1998; Ryan et al., 1998). When these mice were intermated no homozygous-null (Hifla-/-) mice were identified among several hundred live births. Timed matings revealed that the Hifla-/- embryos arrested in their development by E9.0 and
124
died at El0.5 with multiple major malformations including cardiac, vascular, and neural tube defects as well as extensive cell death especially in the cephalic region. Vasculogenesis was initiated properly but by E9.25 extensive regression of vessels in the cephalic and branchial regions had occurred (Iyer et al., 1998). The basis for the dramatic vascular regression appeared to be the death of pre- and post-migratory cephalic neural crest cells, which was detected prior to the appearance of any vascular or gross morphological defects (Kotch et al., 1999). These neural crest cells give rise to mesenchymal cells which are recruited to the endothelium (Bergwerff et al., 1998; Fukuiishi and Morriss-Kay, 1992). These pericytes establish gap junctions with endothelial cells by E9.0 (Fujimoto, 1995) and failure of pericyte recruitment has been shown to result in vascular regression (Benjamin et al., 1998). At this stage in development, the embryo has grown to the point at which cells can no longer obtain sufficient O2 by simple diffusion and the failure to establish a functional circulatory system results in embryonic lethality. HIF-la protein expression in wild-type embryos increased markedly between E8.5 and E9.0, the stage at which HIF-ladeficient embryos declared their pathology (Iyer et al., 1998).
3.
HIF-1 MEDIATES HYPOXIC PULMONARY HYPERTENSION
The effect of complete HIF-la deficiency on physiological responses to hypoxia in the postnatal period could not be ascertained since Hifla-/- mice did not survive past midgestation. However, Hifla+/- mice developed normally and could not be distinguished from their Hifla+/+ littermates under normoxic conditions. However, when subjected to an ambient environment of 10% O2 for 1-6 weeks, Hifla+/- mice demonstrated impaired physiological responses (Yu et al., 1999). Compared to Hifla+/+ littermates, Hifla+/- mice manifested a blunted erythropoietic response to chronic hypoxia. In addition, the hypoxia-induced increases in right ventricular hypertrophy and pressure that were documented in Hifla+/+ mice were significantly impaired in Hifla+/- mice. These differences were shown to be due to reduced pulmonary vascular remodeling in the partially HIF-la-deficient mice. Compared to wild-type controls, the pulmonary arterioles of these mice showed significantly less medial wall hypertrophy. In patients with chronic obstructive pulmonary disease (COPD), the development of pulmonary hypertension is a major cause of morbidity and mortality. Hypoxia has been shown to induce expression of HIF-la in multiple parenchymal and vascular cell types in the lung (Yu et al., 1998). Thus, in patients with COPD, chronic alveolar hypoxia induces HIF-la
125
expression and the transcriptional activation of genes whose protein products mediate the remodeling of pulmonary arterioles. An incomplete list of candidate genes that may be regulated by HIF-1 and participate in this process include endothelin-1, insulin-like growth factor-2, platelet-derived growth factor-B, and VEGF. These results suggest that local pulmonary administration (via inhalation therapy) of a HIF-1 inhibitor in at-risk patients with COPD might block or delay the development of pulmonary hypertension.
4.
HIF-1 MEDIATES VEGF-INDUCED MYOCARDIAL VASCULARIZATION
There is extensive data demonstrating the HIF-1 is required for the transcriptional activation of the VEGF gene in cultured cells subjected to hypoxia (Forsythe et al., 1996; Iyer et al., 1998; Ryan et al., 1998). To study the relationship of HIF-1 and VEGF in response to a physiologic stimulus in vivo, we utilized a model in which near-term fetal sheep were subjected to vascular catheterization in utero and isovolemic hemorrhage was performed to cause a chronic anemia in which the hematocrit and arterial O2 content were decreased 3-4 fold over the course of one week (Martin et al., 1998). In response to the anemia, the fetuses increased their cardiac output by 50% in an effort to maintain tissue O2 delivery. The hearts of anemic fetuses showed significantly increased mean capillary density and minimal capillary diameter and significantly decreased mean intercapillary distance. Thus, there were more blood vessels, the vessels were larger, and there was a shorter diffusion distance between any myocardial cell to the nearest blood vessel. These changes allow increased myocardial O2 delivery to compensate for increased myocardial O2 consumption. Increased myocardial vascularization was associated with 3-5-fold increases in the expression of VEGF mRNA and protein as well as a comparable increase in HIF-1a protein expression in the hearts of anemic as compared to control fetuses (Martin et al., 1998). Each year approximately 1.5 million people in the U.S. alone suffer a myocardial infarction and 400,000 individuals undergo coronary artery bypass graft surgery. This is due in part to the fact that, for unknown reasons, in the adult human myocardium hypoxia does not elicit the dramatic angiogenic response demonstrated in fetal sheep. Clinical trials are presently underway to determine whether increased delivery of VEGF or other angiogenic growth factors to the myocardium, either by protein administration or gene therapy, will result in myocardial neovascularization as a non-surgical means of treating ischemic heart disease (reviewed by Lewis et al., 1997). Delivery of HIF-1a to the myocardium by gene therapy
126
has the theoretical advantage of activating expression of multiple angiogenic factors (e.g. all of the VEGF isoforms) as well as growth/survival factors such as IGF2 (Feldser et al., 1999). As a result, neovascularization may occur more effectively and myocardial cell death may be prevented. Preclinical trials to test this hypothesis are currently underway.
5.
HIF-1 IS OVEREXPRESSED IN COMMON HUMAN CANCERS
Human cancer results from somatic mutations that activate oncogenes and inactivate tumor suppressor genes, resulting in uncontrolled cellular proliferation. In order to grow beyond several mm3, tumors must induce angiogenesis (reviewed by Hanahan and Folkman, 1996). A positive correlation between tumor vascular density or VEGF expression and malignant progression has been established in many types of cancer (reviewed by Zetter, 1998). If angiogenesis were the sole controlling factor, one would predict that the most malignant tumors, because they are the most highly vascularized, would have the highest intratumoral O2 concentrations. However, several clinical studies have reported the opposite conclusion: the risk of tumor invasion and metastasis and patient death increases as the intratumoral pO2 decreases (Brizel et al., 1996; Hockel et al., 1996). This is due in part to the high rate of cellular proliferation and because tumor vessels are structurally and functionally abnormal such that a cell immediately adjacent to a blood vessel can have a PO2 of 0 (Helmlinger et al., 1997; Vaupel et al., 1989). Therefore adaptation to hypoxia appears to be essential for tumor progression.
In a recent immunohistochemical study (Zhong et al., 1999), increased HIF-1 a expression was detected in the vast majority of human breast, colon, lung, and prostate cancers, which represent the most common causes of cancer death in the U.S. HIF-1 a expression was detected in the earliest malignant lesions such as prostatic intraepithelial neoplasia and breast ductal carcinoma in situ. In contrast, HIF-1 a expression was not detected in the corresponding normal tissues, nor in non-malignant tumors such as breast fibroadenoma or uterine leiomyoma (Zhong et al., 1999). Furthermore, HIF-1a overexpression was detected in one-third of primary breast tumors but two-thirds of metastases, suggesting that it may represent an early biomarker for aggressive disease. The overexpression of HIF-la is due both to genetic alterations, such as oncogene activation (Feldser et al., 1999; Jiang et al., 1997) and tumor suppressor gene inactivation (Maxwell et al., 1999), as well as induction of physiologic responses to hypoxia
127
(Maxwell et al., 1997; Zhong et al., 1999). HIF-1 expression has significant effects on the growth and vascularization of tumor xenografts in nude mice (Jiang et al., 1997; Maxwell et al., 1997). HIF-1 plays an important role in tumor angiogenesis (via activation of VEGF expression), metabolic adaptation (via expression of genes encoding glucose transporters and glycolytic enzymes), and other aspects of tumor growth, invasion and metastasis. The greatly increased expression of HIF-1a in cancer cells suggests that a therapeutic window exists such that inhibitors of HIF-1 may represent a novel approach to malignant neoplasia.
ACKNOWLEDGMENTS This work was supported by grants from the American Heart Association National Center and Maryland Affiliate and the National Institutes of Health (R01-DK39869 and R01-HL55338). HIF-la gene therapy and monoclonal antibody technologies described in this paper have been licensed by the Johns Hopkins University to Genzyme Corporation and Novus Biologicals, Inc, respectively. The terms of these arrangements are being managed by the university in accordance with its conflict of interest policies.
REFERENCES Benjamin, L.E., Memo, I., and Keshet, E. A plasticity window for blood vessel remodeling is
defined by pericyte coverage of the preformed endothelial network and is regulated by PDGF-B and VEGF. Development 125:8761-8766, 1998.
Bergwerff, M., Verberne, ME., DeRuiter, M.C., Poelmann, R.E., and Gittenberger-de Groot, A.C. Neural crest cell contribution to the developing circulatory system: implications for vascular morphology? Circ. Res. 82:221-231,1998.
Brizel, D.M., Scully, S.P., Harrelson, J.M., Layfield, L.J., Bean, J.M., Prosnitz, L.R., and Dewhirst, M.W. Tumor oxygenation predicts the likelihood of distant metastases in human soft tissue sarcomas. Cancer Res. 56:941-943, 1996.
Feldser, D., Agani, F., lyer, N.V., Pak, B., Ferreira, G., and Semenza, G.L. Reciprocal positive regulation of hypoxia-inducible factor 1a and insulin-like growth factor 2. Cancer Res. 59:in press, 1999. Forsythe, J.A., Jiang, B.-H., Iyer, N.V., Agani, F., Leung, S.W., Koos, R.D., and Semenza,
G.L. Activation of vascular endothelial growth factor gene transcription by hypoxiainducible factor 1. Mol. Cell. Biol. 16:4604-4613, 1996. Fujimoto, K. Pericyte-endothelial gap junctions in developing rat cerebral capillaries: a fine structural study. Anat. Rec. 242:562-565, 1995. F u k u i i s h i , Y., and Morriss-Kay, G.M. Migration of cranial neural crest cells to the pharyngeal arches and heart in rat embryos. Cell Tissue Res. 268:1-8, 1992.
128
Hanahan, D., and Folkman, J. Patterns and emerging mechanisms of the angiogenic switch d u r i n g tumorigenesis. Cell 86:353-364, 1996. Helmlinger, G., Yuan, P., Dellian, M., and Jain, R.K. Interstitiial pH and pO2 gradients in solid tumors in vivo: high-resolution measurements reveal a alack of correlation. Nat. Med. 3:177-182,1997. Hockel, M., Schlenger, K., Aral, B., Mitze, M., Schaffer, U., and Vaupel, P. Association
between tumor hypoxia and malignant progression in advanced cancer of the uterine
cervix. Cancer Res. 56:4509-4515,1996. Huang, L.E., Gu, J., Schau, M., and Bunn, H.F. Regulation of hypoxia-inducible factor la is mediated by an O2-dcpendent degradation domain via the ubiquitin-proteasome pathway. Proc. Natl. Acad. Sci. USA 95:7987-7992, 1998. Iyer, N.V., Kotch, L.E., Agani, F., Leung, S.W., Laughner, E., Wenger, R.H., Gassmann, M., Gearhart, J.D., Lawler, A.M., Yu, A.Y., and Semenza, G.L. Cellular and developmental control of O2 homeostasis by hypoxia-inducible factor 1a. Genes Dev. 12:149-162, 1998. Jiang, B.-H., Agani, P., Passaniti, A., and Semenza, G.L. V-SRC induces expression of hypoxia-inducible factor 1 (HIF-1) and transcription of genes encoding vascular endothelial growth factor and enolase 1: involvement of H I F - 1 in tumor progression. Cancer Res. 57:5328-5335, 1997. Jiang, B.-H., Semenza, G.L., Bauer, C., and Marti, H.H. Hypoxia-inducible factor 1 levels vary exponentially over a physiologically relevant range of O2 tension. Am. J. Physiol. 271:C1172-C1180, 1996. Kallio, P.J., Wilson, W.J., O'Brien, S., Makino, Y., and Poellinger, L. Regulation of the hypoxia-inducible transcription factor 1a by the ubiquitin-proteasome pathway. J. Biol. Chem. 274:6519-6525, 1999. Kotch, L.E., Iyer, N.V., Laughner, E., and Semenza, G.L. Defective vascularization of HIF1 a-null embryos is not associated with VEGF deficiency but with mesenchymal cell death. Dev. Biol. 209:254-267, 1999. Lewis, B.S., Flugelman, M.Y., Weisz, A., Keren-Tal, I., and Schaper, W. Angiogenesis by gene therapy: a new horizon for myocardial revascularization? Cardiovasc. Res. 35:490497, 1997. Martin, C., Yu, A.Y., Jiang, B.-H., Davis, L., Kimberly, D., Hohimer, A.R., and Semenza, G.L. Cardiac hypertrophy in chronically anemic fetal sheep: increased vascularization is associated with increased myocardial expression of vascular endothelial growth factor and hypoxia-inducible factor 1. Am. J. Obstet. Gynecol. 178:527-534, 1998. Maxwell, P.H., Dachs, G.U., Gleadle, J.M., Nicholls, L.G., Harris A.L., Stratford, I.J., Hankinson, O., Pugh, C.W., and Ratcliffe, P.J. Hypoxia-inducible factor-1 modulates gene expression in solid tumors and influences both angiogenesis and tumor growth. Proc. Natl. Acad. Sci. USA 94:8104-8109, 1997. Maxwell, P.H., Wiesener, M.S., Chang, G.-W., Clifford, S.C., Vaux, B.C., Cockman, M.E., Wykoff, C.C., Pugh, C.W., Maher, E.R., and Ratcliffe, P.J. The tumor suppressor protein V H L targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 399:271-275, 1999. Ryan, H.E., Lo, J., and Johnson, R.S. HIF-1a is required for solid tumor formation and embryonic vascularization. EMBO J. 17:3005-3015,1998. Salceda, S., and Caro, J. Hypoxia-inducible factor la (HIF-1a) protein is rapidly degraded by the ubiquitin-proteasome system under normoxic conditions: its stabilization by hypoxia depends upon redox-induced changes. J. Biol. Chem. 272: 22642-22647, 1997. Semenza, G.L. Hypoxia-inducible factor 1: master regulator of O2 homeostasis. Curr. Opin. Genet. Dev. 8:588-594, 1998.
129
Semenza, G.L. Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1.
Annu. Rev. Genet. Dev. 15:551-578, 1999. Semenza, G.L., and Wang, G.L. A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol. Cell. Biol. 12:5447-5454,1992. Vaupel, P., Kallinowski, F., and Okunieff, P. Blood flow, oxygen and nutrient supply, and metabolic microenvironment of human tumors: a review. Cancer Res. 49:6449-6465, 1989. Wang, G.L., Jiang, B.-H., Rue, E.A., and Semenza, G.L. Hypoxia-inducible factor 1 is a
basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc. Natl. Acad. Sci. USA 92:55 10-5514, 1995.
Wang, G.L., and Semenza, G.L. Purification and characterization of hypoxia-inducible factor 1. J. Biol. Chem. 270:1230-1237, 1995. Yu, A.Y., Frid, M.G., Shimoda, L.A., Wiener, C.M, Stenmark, K., and Semenza, G.L. Temporal, spatial and oxygen-regulated expression of hypoxia-inducible factor 1 in the lung. Am. J. Physiol. 275:L818-L826, 1998.
Yu, A.Y., Shimoda, L.A., Iyer, N.V., Huso, D.L., Sun, X., McWilliams, R., Beaty, T., Sham, J.S.K.. Wiener, C.M., Sylvester, J.T., and Semenza, G.L. Impaired physiological responses to chronic hypoxia in mice partially deficient for hypoxia-inducible factor 1a. J. Clin. Invest. 103:691-696, 1999. Zetter, B.R. Angiogenesis and tumor metastasis. Annu. Rev. Med. 49:407-424, 1998. Zhong, H., De Marzo, A.M., Laughner, E., Lim, M., Hilton, D.A., Zagzag, D.,Buechler, P., Isaacs, W.B., Semenza, G.L., and Simons, J.W. Overexpression of H I F - l a in common
human cancers and their metastases. Submitted for publication, 1999.
130
Gene Regulation during Hypoxia in Excitable
Oxygen-Sensing Cells: Depolarization-Transcription Coupling David E. Millhorn, Dana Beitner-Johnson, Laura Conforti, P. William Conrad, Suichi Kobayashi, Yong Yuan, and Randy Rust Department of Molecular and Cellular Physiology, College ofMedicine, University of Cincinnati, PO Box 67-0576, Cincinnati, OH 45267-0576
1.
INTRODUCTION
Oxygen-sensing cells detect changes in oxygen tension and transduce this signal into various cellular responses including gene expression, protein synthesis and secretion. The mechanisms involved in regulation of these important responses may vary from tissue-to-tissue, and depending upon
whether or not the oxygen-sensing cell is excitable, i.e. whether or not it depolarizes during hypoxia. Oxygen-sensing cells in the carotid body, pulmonary vasculature, and pulmonary neuroepithelial bodies depolarize during exposure to hypoxia (Lopez-Barneo, et al., 1988; Peers, 1990; Weir and Archer, 1995). We have shown that the oxygen-sensing pheochromocytoma (PC 12) cell line also depolarizes during hypoxia, and that this depolarization occurs as the result of inhibition of a hypoxiasensitive potassium (K) channel (Zhu et al., 1996). We also found that hypoxia regulates expression of the gene for tyrosine hydroxylase (TH), the rate-limiting enzyme for dopamine biosynthesis, in both carotid body type I cells and in PC12 cells (Czyzyk-Krzeska et al. 1992; Czyzyk-Krzeska et al., 1994) (Figure 1). These observations lead to the question is membrane depolarization coupled to gene regulation in excitable oxygen sensing cells? Here we shall describe work from our laboratory, which shows that this is
indeed the case. Our experiments are performed mostly on PC 12 cells, which we have established as a model cell line for investigations of the biophysical and molecular aspects of oxygen-sensing and gene regulation.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
131
132
2.
MEMBRANE DEPOLARIZATION AND REGULATION OF CYTOSOLIC CALCIUM
An initial event in the response to hypoxia in both carotid body type I cells and PC12 cells is inhibition of an outward current, which leads to membrane depolarization (Lopez-Barneo et al., 1988; Zhu et al., 1996). Whole cell voltage-clamp experiments revealed that a voltage-gated K current was inhibited by reduced oxygen. The magnitude of inhibition of this current, and therefore membrane depolarization, is dependent upon the intensity of the hypoxia stimulus. Thus, a progressive reduction in oxygen tension led to an increase in the magnitude of inhibition of oxygen-sensitive We also found that neither IK nor inwardly rectifying are responsible for the hypoxia-induced depolarization. These results were first to show that PC12 cells express an oxygen-sensitive , inhibition of which leads to membrane depolarization and increased intracellular free , making this cell line a valuable model for studying the molecular and biophysical aspects of oxygen chemosensitivity. We next performed studies to attempt to identity and characterization the oxygen-sensitive K channel. These studies revealed that the oxygensensitive K channel in PC 12 cells belongs to the Shaker subfamily of voltage-gated K channels (Conforti and Millhorn, 1997). We found that PC 12 cells express four types of electrophysiologically distinct voltagegated K channels. Excised inside-out patch clamp recordings revealed that the oxygen-sensitive channel has a conductance of 20 pS and has slowinactivating properties. We found that inhibition of this channel during hypoxia is due to a decrease in open probability rather than a decrease in single channel current amplitude. We also examined the effect of prolonged hypoxia (18 hrs of 10% on the oxygen-sensitive in PC 12 cells (Conforti and Millhorn, 1997). We found that prolonged hypoxic exposure lead to enhanced inhibition of Based on this finding we hypothesized that the gene for the oxygen-sensitive K channel would be up-regulated by chronic hypoxia. We therefore used reverse transcriptase-polymerase chain reaction (RT-PCR) to examine K channel gene expression during hypoxia. We found that expression of the of the Kv1.2 Shaker channel, but not the other voltage-gated K channels (Kv1.3, Kv2.1, Kv3.1 and Kv3.2), was markedly increased during prolonged exposure to hypoxia. Thus, the enhanced inhibition of the outward K current in PC 12 cells during chronic hypoxia correlates well with the increased expression of the Kvl.2 channel exposed to the same hypoxic conditions. These data were the first evidence that the Kvl.2 channel mediates membrane depolarization during hypoxia. More direct evidence that this is the case comes from on-going research in our laboratory which 133
shows that the oxygen-sensitive is blocked with antibody against Kvl.2, which is dialyzed into the cell. We also have results which show that injection of Kvl.2 cRNA into Xenopus Oocytes leads to expression of an oxygen-sensitive IK . A primary consequence of membrane depolarization is activation of voltage-dependent calcium channels and a subsequent increase in intracellular free We found that exposure to moderate hypoxia led to an increase in cytosolic in both carotid body type I cells and in PC 12
cells (Raymond and Millhorn, 1997) (Figure 2). This hypoxia-induced
increase in intracellular free was reversible upon return to normoxia. We also found that removal of extracellular media plus EGTA) prevented the hypoxia-induced increase in intracellular free These data indicate that membrane depolarization and activation of voltagedependent channels in PC 12 cells during hypoxia results in an increase in cytosolic
The channels that mediate the increase in intracellular level during hypoxia are unknown, but could involve either the L-, N-, or P/Q-type channels; all of which are expressed in PC 12 cells. In this regard, we did
find that pharmacological blockade of the L-type channel failed to prevent
the increase in cytosolic
134
during hypoxia. It is becoming clear that
activation of the different channel types may be involved in different cellular functions in response to specific stimuli. A major challenge is to determine which of the voltage-dependent channels mediate different cellular functions during hypoxia, e.g. exocytosis, gene regulation, etc. In this regard, it is interesting to note
that Taylor and Peers (1998) found that influx via the N-type channel in PC12 cells is responsible for catecholamine exocitosis during hypoxia. This conclusion is based on findings which showed that pharmacological blockade of the N-type was sufficient to prevent hypoxia-induced exocitosis. Preliminary results in our laboratory also indicate that the N-, and P/Q-type channels may be important for mediating altered intracellular free during hypoxia. Recent preliminary results from our laboratory show that
expression of the genes for the N- and P/Q-subtypes, but not the L-type channel gene, is up-regulated during hypoxia. A major question is how does an entry of via a specific voltage-dependent channel regulate specific cellular responses to environmental stimuli. Regardless, there is little doubt that depolarization and increased cytosolic is a major regulatory mechanism in excitable cells including oxygen-sensitive excitable cells.
3.
THE ROLE OF CALCIUM IN REGULATION OF OXYGEN RESPONSIVE GENES
The entry of into excitable cells through voltage-gated channels regulates a diverse set of functions including gene expression. It is possible that changes in intracellular free may play a central role in adaptation to environmental signals that involve altered gene expression (Ghosh and Greenberg, 1995). Here we shall discuss briefly our research on the role of intracellular in hypoxia-induced gene regulation. Our foray into this problem began with our work to identify the ciselements on the TH gene that confer hypoxia responsiveness (CzyzykKrzeska et al., 1994: Norris and Millhorn, 1995). We have used this gene as a model to study hypoxia-induced transcription. Our work on this gene revealed that only a short fragment of the 5’ flanking region of the TH gene that extends from –284 to nucleotides relative to transcription start-site is needed for increased transcription during hypoxia. Additional truncation closer to start-site abolished hypoxia-responsiveness. We were able to identify a fragment of the gene (-284 to –190) that is absolutely critical for hypoxia-induced regulation of the TH gene. Located within this critical region are two potentially important DNA elements; an Activator-Protein 1 (AP1;TGATTCA) site and a sequence that corresponds closely with a Hypoxia Regulatory Element (HRE;CCCTACGTCGTGCC). Gel shift 135
assays revealed enhanced protein binding at both the AP1 and HRE elements of the TH gene. Further investigations using super-shift and shift-western analysis showed that c-Fos and JunB, but not c-Jun, bind to the AP1 element during hypoxia and that these protein levels are stimulated by hypoxia. Importantly, site-specific mutation of this element prevented induction of transcription of the TH gene by reduced oxygen. This finding shows that the AP1 element is essential for hypoxia-mediated transcription of the TH gene. In most reported cases, hypoxia-induced protein binding to the HRE involves a hypoxia-inducible protein referred to as which forms a dimer with the aromatic hydrocarbon nuclear translocator protein (ARNT) (Semenza and Wang, 1992; Wang and Semenza, 1993; Bunn and Poyton, 1996). Surprisingly, we found that is not inducible by hypoxia in PC12 cells. However, we found that a closely related helix-loop-helix pasdomain protein called endothelial PAS domain protein 1 (EPAS1) is regulated by hypoxia and mediates transcription of a HRE-Luciferase reporter gene in PC 12 cells during hypoxia (Conrad et al., 1999). Does increased intracellular play a role in the regulation of hypoxiarelated transcription factors? To answer this question we first examined the role of cytosolic in the regulation of the transcription factors (c-Fos and JunB) which we showed bind to the AP1 element on the TH gene during hypoxia (Norris and Millhorn, 1995). We found that a graded reduction in oxygen tension resulted in a progressive increase in JunB and c-fos (not shown) gene expression (Figure 3A). We next examined the effect of removal of from the extracellular environment on expression of the cfos and JunB genes (Figure 3B). It is clear from these data that reduced oxygen tension robustly activates both of these genes and that removal of extracellular prevents induction of these genes by hypoxia. There is
136
growing evidence that implicates increased intracellular free in the regulation of these immediate early gene transcription factors in response to membrane depolarization or activation of membrane growth factor receptors (Morgan and Curran, 1986; Ghosh and Greenberg, 1995). We next tested the possibility that regulation of the TH gene during hypoxia is dependent upon an increase in intracellular free We found this to be the case. Briefly, we found that removal of extracellular from the media and chelation of cytosolic prevented the hypoxia-induction of the TH gene (Figure 4A). These data are strong
evidence that an increase in intracellular is involved in the induction of gene expression by hypoxia. The biochemical effects of cytosolic are mediated by an assortment of different proteins. One such protein is calmodulin, which acts as an intracellular modulator for increased cytosolic modulates the activity of a number of different kinases and phosphatases. We have examined the possibility that calmodulin is involved in regulation of TH gene expression during hypoxia. We found that pretreatment of cell with calmidazolium chloride (CMZ), an anticalmodulin drug, blocked the hypoxia-induction of TH gene expression (Figure 4B). These results show that expression of the TH gene and the transcription factors, c-Fos and JunB, are regulated by hypoxia in a dependent manner, and that calmodulin is involved in this regulation.
We have also initiated a series of experiments to investigate the role of the HRE in regulation of TH gene expression. As we mentioned above, 137
HIF-1a is not induced by hypoxia in PC 12 cells. However, we have found that a similar basic HLH PAS protein (EPAS1) is robustly regulated in PC 12
cells during hypoxia. How does this regulation occur? Again, we examined
the possibility that an increase in intracellular is involved, and found this to be the case (Conrad et al., 1999). Briefly, we found that accumulation of EPAS1 during hypoxia was either abolished or markedly attenuated in the absence of extracellular Moreover, we found that transactivation of a transfected HRE-Luciferase reporter gene by EPAS1 during hypoxia was prevented by removal of extracellular Thus, an increase in intracellular is involved in both the accumulation of EPAS1 and regulation of transactivation of HRE target genes containing by EPAS1. Is cytosolic the only signaling mechanism involved in regulation of EPAS1 function during hypoxia? We now have convincing evidence that the mitogen-activated protein kinase (MAPK) pathway is also involved. This is based on our finding that pharmacological blockade of this pathway prevents transactivation of the HRE-Luciferase reporter gene, but does not prevent accumulation of EPAS1 by reduced oxygen. Thus, it appears that EAPS1 function is a two-step process that involves EPAS1 accumulation and subsequent transactivation of genes that contain an HRE. We also have
data which shows that calmodulin is involved in the induction of EPAS1 activity during hypoxia. Additional support for the involvement of the MAPK pathway comes from studies in which transfected MEK, an intermediate enzyme in this pathway, enhanced the transactivation of the HRE-Luciferase reporter gene. In addition, inhibition of MEK markedly attenuated the transactivation of the HRE-Luciferase reporter. Thus our research indicates that plays a major role in regulation of gene expression during hypoxia in excitable oxygen-sensitive cells. We found that stimulation of gene expression for the immediate early genes that interact with the AP1 element, and EPAS1 which interacts with the HRE require an increase in intracellular calcium and subsequent activation of calmodulin. An important observation is that MAPK is also involved in the activation of EPAS1 activity during hypoxia.
4.
REGULATION OF INTRACELLULAR CALCIUM HOMEOSTASIS BY MEMBRANE FEEDBACK MECHANISMS
We have established that an increase in cytosolic is an important signal for regulation of gene expression in PC12 cells during hypoxia. In addition, intracellular is also involved in exocytosis of a number of substances from PC 12 cells (and carotid body type I cells) including dopamine and adenosine. PC 12 cells and carotid body type I cells both express receptors for dopamine and adenosine (Figure 5). Both of 138
these receptor types are coupled to protein kinase A (PKA); activation of the receptor causes inhibition of protein kinase A (PKA), whereas activation of the receptor causes stimulation of PKA. We wondered therefore if these receptors might be involved in “feedback” regulation of homeostasis during hypoxia. We found that receptor stimulation with quinpirole, a receptor agonist, caused reversible inhibition of a voltage-dependent current in PC 12 cells (Zhu et al., 1997). Inhibition of the voltage-dependent current by quinpirole resulted in an attenuation of the hypoxia induced increase in intracellular (Figure 6). This effect of quinpirole on intracellular levels during hypoxia was reversed by the receptor
139
antagonist sulpiride. These results indicate that dopamine released from PC 12 cells during hypoxia acts via a receptor to “autoregulate” the voltage-dependent current and the increase in intracellular We next performed experiments to determine if the PKA pathway
mediates the effect of receptor stimulation on the voltage-dependent current and the increase in intracellular free Briefly, we found that the -induced inhibition of the voltage-dependent current during hypoxia is not PKA-dependent, as it persisted both in the presence of a specific PKA inhibitor (PKI) and in PKA-deficient PC 12 cells. It is worth noting that exposure of PC 12 cells to chronic hypoxia attenuated the inhibitory effect of the receptor on the current, which may be an important adaptive response to prolonged hypoxia. We have also examined the effect of adenosine on modulation of the current and intracellular levels during hypoxia. It is important to note that PC 12 cells and carotid body type I cells express the adeonosine receptor, not the receptor subtypes (Kobayashi et al., 1998a). We have investigated the role adenosine and the receptor in the regulation of homeostasis during hypoxia. imaging studies revealed that the increase in intracellular during hypoxia was attenuated significantly by adenosine (Kobayashi et al., 1998b) (Figure 7). Voltage-clamp studies showed that adenosine caused a reversible inhibition of the voltagedependent current in PC 12 cells (Figure 7, inset). Moreover, this
140
inhibition was abolished by the non-selective adenosine antagonist (8phenytheophylline) and by a selective A2 antagonist (ZM241385) (not shown). We found that the inhibitory effect of adenosine on the current and intracellular levels of during hypoxia are mediated by PKA (Kobayashi et al., 1998a). The effect of adenosine on the hypoxia-activation of the current was absent in PKA-deficient PC 12 cells. Importantly, we found the effect of adenosine on the current and intracellular was greatly attenuated by exposure of PC 12 cells to chronic hypoxia. Thus, it appears that adenosine via the receptor inhibits the hypoxia-induced increase in cytosolic . This regulation is perhaps important for maintaining intracellular at the proper level to mediate cellular functions and to prevent excessive intracellular which could result in toxicity and cell death. Our results show that both dopamine and adenosine, via their respective receptors, can regulate homeostasis during hypoxia. It will be important to understand how these two “feedback” systems interact under conditions of acute and chronic hypoxia.
5.
CONCLUSION
The manner in which excitable and non-excitable oxygen-sensing cells respond to reduced oxygen tension differ based on the regulation of
membrane potential and intracellular free We have shown that increased intracellular can play a pivotal role in gene regulation. The major challenge is to identify “downstream” signaling pathways and transcription factors that are regulated by the signal and to understand how individual voltage-dependent channels regulate specific cell functions during hypoxia.
ACKNOWLEDGEMENTS This work was supported by grants to DEM from the National Institutes of Health (HL33831 and HL59945) and the U.S. Army (DAMD 17-99-19544)(DEM). This work was also supported by grants from the Parker B. Francis Foundation (DBJ) and the American Heart Association (DBJ). PWC and SK were supported by a NIH training grant (HL07571).
141
REFERENCES Bunn, H.F, and Poyton, R.O. (1996) Physiol. Rev. 76, 839-885. Conforti, L. and Millhorn, D.E. (1997) J. Physiol., 502, 293-305. Conrad, W.P. , Beitner-Johnson, D., Freeman, T., and Millhorn, D.E. (submitted for publication) Czyzyk-Krzeska, M.F., D.A. Bayliss, E.E. Lawson, and D.E. Millhorn (1992) J. Neurochem. 58, 1538-1546. Czyzyk-Krzeska, M.F., B.A. Furnari, E.E. Lawson, and D.E. Millhorn (1994) J. Biol. Chem.
269, 760-764. Ghosh, A., and Greenberg, M.E. (1995) Science 268: 239-247. Lopez-Barneo, J., Lopez-Lopez, J.R., Urena, J. and Gonzalez, C. (1988) Science 241: 580582. Kobayashi, S., L. Conforti, R. Pun, and D.E. Millhorn (I998b) J. Physiol. (London) 508: 95107. Kobayashi, S., D. Beitner-Johnson. L. Conforti and D.E. Millhorn (1998b) J. Physiol. (London) 512: 351-363.
Morgan, J.I. and Curran, T. (1986) Nature 322: 552-555. Norris, M.L. and Millhorn, D.E. (1995) J. Biol. Chem. 270, 23774-23779. Peers, C. (1990) Neurosci. Lett. 119:253-256. Raymond, R. and Millhorn, D. (1997) Kidney Int., 51, 536-541.
Semenza, G. and Wang, G. (1992; Mol Cell Biol. 12: 5447-5454.
Taylor, S.C. and Peers, C. (1998) Biochem. Biophys. Res. Comm. 248:13-17. Wang, G. and Semenza, G. (1993) J. Biol. Chem. 268: 21513-21518. Weir, E.K. and Archer, S. (1995) FASEB J. 9:183-189. Zhu, W.H., Conforti, L., Czyzyk-Krzeska, M.F., and Millhorn, D.E. (1996) Am. J. Physiol., 40, C658-C665. Zhu, W.H., Conforti, L., and Millhorn, D.E. (1997) Am. J. Physiol., 42: Cl143-1150.
142
REGULATION OF CREB BY MODERATE HYPOXIA IN PC12 CELLS
Dana Beitner-Johnson, Randy T. Rust, Tyken Hsieh, David E. Millhorn Department of Molecular and Cellular Physiology, College of Medicine, University of
Cincinnati, PO Box 67-0576, Cincinnati, OH 45267–0576
Key words: CREB; kinase; phosphorylation; gene expression
Abstract The mechanisms by which excitable cells adapt and respond to changes in levels remain largely unknown. We have investigated the effect of hypoxia on the cyclic AMP response element binding protein (CREB) transcription factor. PC 12 cells were exposed to moderate levels of hypoxia for various times between 20 min and 6 hr. We found that hypoxia rapidly and persistently induced ser133 phosphorylation of CREB. This effect was more robust than that produced by exposing PC 12 cells to either forskolin, KCl, or NGF. This effect was not due to activation of any of the previously known CREB kinases, including PKA, CaMK, PKC, p70s6k, or MAPKAP kinase-2. Thus, hypoxia may induce activation of a novel CREB kinase. To test whether phosphorylation of CREB was associated with an
activation of CRE-dependent gene expression, cells were transfected with wild type and mutated regions of the 5’-flanking region of the tyrosine hydroxylase (TH) gene fused to a CAT reporter gene. Mutation of the CRE element in a TH reporter gene reduced, but did not abolish, the effects of hypoxia on TH gene expression. However, hypoxia did not induce transactivation of a GAL4-luciferase reporter by a GAL4-CREB fusion protein. Thus, the mechanism by which hypoxia regulates CREB is distinct, and more complex, than that induced by forskolin, depolarization, or nerve growth factor.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
143
1.
INTRODUCTION
Hypoxic and/or ischemic trauma is a primary factor in the pathophysiology of a diverse range of disease states, including wound healing, stroke, and solid tumour proliferation. However, the mechanisms by which cells adapt and respond to hypoxia are only just beginning to be established. The specific response to hypoxia is highly dependent on the particular cell type being studied. A major component of the mechanism by which cells adapt to hypoxia is via regulation of gene expression. Relatively severe hypoxia (1% or less) induces activation of the hypoxia-inducible factor (HIF-1) and other related transcription factors (Guillemin and Krasnow, 1997). These transcription factors facilitate the expression of genes that contain HRE (HIF response element) sites in their 5’-flanking regions, such as the erythropoietin and VEGF genes. We have recently shown that more moderate hypoxia in vitro (Beitner-Johnson and Milhorn, 1998) activates the cAMP-response element binding protein (CREB). Other recent studies have shown that CREB is also regulated by hypoxia/ischemia in vivo (Walton et al., 1996; Hu et al., 1999; Tanaka et al., 1999).
2.
PC12 CELLS AS A MODEL SYSTEM
We and others have extensively characterized the effects of hypoxia on pheochromocytoma (PC 12) cells. These catecholaminergic cells are derived from rat adrenal medulla, and are responsive to hypoxia in a number of ways. Like carotid body type 1 (glomus) cells, PC 12 cells depolarize and secrete the neurotransmitter dopamine in response to hypoxia (Kumar et al., 1998; Taylor and Peers, 1999). PC 12 cells are excitable cells which respond to hypoxia with inhibition of an outward conductance, depolarization, and calcium influx (Zhu et al., 1996; Conforti and Millhorn, 1997). These cells respond to relatively small reductions in pO2 with changes in protein phosphorylation (Beitner-Johnson et al., 1998; Beitner-Johnson and Millhorn, 1998) and gene expression (Norris and Millhorn, 1995; Levy et al., 1995; Prabhakar et al., 1995; Raymond and Millhorn, 1997). PC 12 cells
also respond to long-term exposure to hypoxia with an increase in tyrosine hydroxylase (TH) gene expression and TH mRNA stability (CzyzykKrzeska et al., 1992, 1994). Thus, PC 12 cells represent a valuable in vitro model system that can be used to study cellular mechanisms involved in the adaptive response to hypoxia.
144
3.
CREB IS A CONVERGENCE POINT OF MULTIPLE SIGNALING PATHWAYS
CREB is a 43-kD transcription factor that belongs to the leucine zipper family of DNA-binding proteins. CREB is primarily localized in the nucleus, although there have been reports of CREB localization in distal neuronal dendrites (Crino et al., 1998). CREB contains a C-terminal leucine zipper dimerization motif and an N-terminal transactivation domain. Upon phosphorylation at ser133, which is contained with in the activation domain, CREB can either homodimerize or heterodimerize with other members of the CREB/ATF family of transcription factors. These complexes then effect transcription of a multitude of genes containing the cyclic AMP response element (CRE) motif in the 5’-flanking region. While phosphorylation of is necessary, phosphorylation is not sufficient for CREB at ser133 transcriptional activation (Sun et al., 1994; Ginty, 1997). Activation of transcription also requires binding of the co-activator protein, CREB-binding protein (CBP/p300), which links CREB to the basal transcription machinery (Chawla et al., 1998). CREB was initially identified as a transcription factor that was phosphorylated by PKA, and thereby activated by agents that increase levels of intracellular cAMP (Gonzalez and Montminy, 1989). In the past 10 years, however, it has become clear that CREB can be phosphorylated by many protein kinases with significantly higher affinity for CREB than PKA. A diverse array of cellular signals, including cAMP, calcium, growth factors, neurotrophins, hypoxia, and various cellular stressors can induce ser133 phosphorylation of CREB. To date, the known CREB kinases include PKA, CaMKI, CaMKIV, PKC, MAPKAP-kinase 2, RSK1,2, and 3, and RLPK/MNK1 (Yamamoto et al., 1988; Sheng et al., 1991; Xie and Rothstein, 1995; Xing et al., 1996; Tan et al., 1996; Pierrat et al., 1998; see Figure 1). In general, upon activation by extracellular stimuli, these and other protein kinases can translocate to the nucleus to mediate phosphorylation of CREB and other transcription factors.
4.
REGULATION OF CREB BY HYPOXIA IN PC12 CELLS
We have found that moderate hypoxia produces a robust phosphorylation of CREB in PC12 cells (Figure 2). The onset of the effect is rapid and biphasic, with a small induction occurring within 20 min and a larger effect peaking at 6 h. The effect was also persistent, lasting up to 24 h
145
146
during exposure to hypoxia. This phosphorylation profile is distinct from that produced by other stimuli known to induce CREB phosphorylation, including forskolin, depolarization, and neurotrophins, which typically elicit a rapid response which then declines (Bonni et al., 1995).
The effect of hypoxia on CREB phosphorylation was more robust than any other prototypical stimuli used to activate CREB, including forskolin, KC1-induced depolarization (Figure 3), or osmotic stress (Beitner-Johnson and Millhorn, 1998). This suggests that hypoxia-induced phosphorylation of CREB occurs by a mechanism distinct from those that mediate the effects of forskolin, KC1, and sorbitol on CREB (i.e., protein kinase A, calcium/calmodulindependent protein kinase IV, and MAPKAP kinase-2).
We next sought to identify the signaling pathway by which the hypoxia-induced phosphorylation of CREB occurred. This effect was not mediated by PKA, as it was found to persist in PKA-deficient (123.7) PC12 cells (Beitner-Johnson and Millhorn, 1998). To test whether other known CREB kinases mediated this effect, PC12 cells were exposed for 6 h to either normoxia or hypoxia in the presence or absence of specific inhibitors of various signaling pathways. Hypoxia-induced phosphorylation of CREB persisted in the absence of both intracellular and extracellular calcium (Figure 4a). A robust phosphorylation of CREB was also observed in the presence of inhibitors of MEK-1, p38, phosphatidylinositol 3-kinase, cyclic GMP-dependent protein kinase, p70 S6 kinase, and protein kinase C (Figure 4 b-f and Beitner-Johnson and Millhorn, 1998). Taken together, these data suggest that hypoxia induces phosphorylation of CREB via a novel signaling mechanism.
147
148
Phosphorylation of CREB is necessary, but not sufficient to activate CREB-mediated transcription (Sun et al., 1994; Ginty, 1997). Expression of the tyrosine hydroxylase (TH) gene has been shown to be induced in response to physiological levels of hypoxia both in PC12 cells (CzyzykKrzeska et al. 1994) and in vivo (Czyzyk-Krzeska et al. 1992). To test whether phospho-CREB is involved in regulation of TH gene expression, we compared the effect of hypoxia on a TH reporter plasmid (-272TH)CAT and a similar construct in which the CRE was mutated (-272CRE-)CAT. We found that activation of TH-CAT reporter activity by hypoxia was reduced, though not abolished, in CAT compared to wild-type (Figure 5). This suggests that CREB participates in hypoxia-induced regulation of TH
gene expression, but that CREB per se appears to be unlikely to mediate this entire effect. This is consistent with the previous findings that an AP-1 element located at –199/-205 also plays a critical role in mediating hypoxia and depolarization-induced activation of TH gene expression (Norris and Millhorn, 1995; Nagamato-Combs et al., 1997). To further evaluate how hypoxia regulates CREB function, we tested the effects of hypoxia on a GAL4-responsive luciferase reporter by a chimeric GAL4-CREB protein, containing the GAL4 DNA binding motif and the CREB activation domain (4-283). GAL4 is a yeast transcription factor that is not expressed in mammalian cells. This construct does not contain the CREB leucine zipper motif (delta-b-ZIP, Sun et al., 1996), and thereby permits analysis of the transcriptional activity of CREB in the absence of heterodimerization with other endogenous CREB/ATF family members. Thus, only GAL4-CREB homodimers can activate the GAL4responsive luciferase reporter. Hypoxia (both 1% and 5% for various times, between 3 and 24 h), failed to activate the GAL4-responsive luciferase reporter, whereas stimulation of PC12 cells with forskolin, KC1 or nerve growth factor (NGF) did activate GAL4-CREB (Figure 6). One interpretation of this data is that hypoxia-induced regulation of CREdependent gene expression may require heterodimerization of CREB with other members of the CREB/ATF family of transcription factors. However, we also cannot rule out the possibility that a putative novel hypoxiaactivated CREB kinase fails to recognize and phosphorylate the artificial GAL4-CREB fusion protein. Finally, hypoxia-mediated activation of CREdependent gene expression by CREB may require auxiliary elements that can be co-assembled only in the context of an endogenous promoter, and not in an artificial system such as the GAL4 reporter system. Clearly, hypoxiainduced phosphorylation of CREB and the subsequent regulation of gene expression is distinct from and more complex than that produced by forskolin, KCI or NGF.
149
5.
REGULATION OF CREB PHOSPHORYLATION
BY HYPOXIA/ISCHEMIA IN VIVO Recent evidence from several laboratories suggests that CREB may be regulated by hypoxia-ischemia in vivo, as well as in vitro. Two studies have shown that phospho-CREB immunoreactivity is increased in rat dentate granule cells and neocortex 1-2 days after hypoxic-ischemic induced brain damage (Walton et al., 1996; Hu et al., 1999). In these studies, phosphoCREB immunoreactivity was induced selectively in ischemia-resistant cells, but not in CA1 pyramidal cells, which undergo neuronal death after hypoxiaischemia in vivo. Similarly, Tanaka et al have recently shown that middle
cerebral artery occlusion in rats induces phospho-CREB immunoreactivity selectively in the peri-infarct region. Taken together, these studies suggest that phosphorylation of CREB induced by hypoxia may be a protective mechanism to promote the survival of cells exposed to low oxygen.
6.
CONCLUSIONS
In summary, PC12 cells respond to hypoxia with a robust and persistent phosphorylation of CREB. Unlike other stimuli, which induce peak CREB phosphorylation relatively rapidly and then decline (Bonni et al., 1995), the effects of hypoxia on CREB phosphorylation are maximal after 3 to 6 h
exposure to hypoxia and persist for at least 24 h. We propose that this
150
phosphorylation occurs via a novel protein kinase signalling pathway, that we term “HACK” (Hypoxia-Activated CREB Kinase). We further propose that phosphorylation of CREB the subsequent regulation of a subset of hypoxia-responsive genes may be an adaptive cellular response to a reduction in levels. Taken together with the in vivo data described above, there is increasing evidence that hypoxia-induced phosphorylation of CREB may be involved in the process of neuroprotection. Identification and characterization of HACK will further our understanding of the response to oxygen deprivation by excitable cells. This, in turn, will facilitate analysis of the molecular mechanisms underlying the pathology of hypoxic and/or ischemic trauma.
ACKNOWLEDGEMENTS We thank Dr. Richard Maurer (Oregon Health Sciences University, Portland, OR) for providing GAL4-CREB and GAL4-luciferase plasmids. This work was supported by grants from the Parker B. Francis Foundation (DBJ) and the American Heart Association (DBJ) and from the National Institutes of Health (DEM). Figures 2 through 5 are adapted from BeitnerJohnson and Millhorn (1998), J. Biol. Chem., 273, 19834-19839, with permission from the American Society for Biochemistry and Molecular Biology.
REFERENCES Beitner-Johnson, D., and Millhorn, D.E. (1998) Hypoxia induces phosphorylation of the cyclic AMP response element-binding protein by a novel signaling mechanism. J. Biol. Chem., 273, 19834-19839. Beitner-Johnson, D., Leibold, J., and Millhorn, D.E. (1998) Biochem. Biophys. Res. Commun. 241, 61-66. Bonni, A., Ginty, D.D., Dudek, H., and Greenberg, M.E. (1995) Mol. Cell. Neurosci., 6: 168183. Chawla, S., Hardingham, G.E., Quinn, D.R., and Bading, H. (1998) Science 281, 1505-1509. Conforti, L. and Millhorn, D.E. (1997) J. Physiol., 502, 293-305. Crino, P., Khodakhah, K., Becker, K., Ginsberg, S., Hemby, S., and Eberwine, J. (1998) Proc. Natl. Acad. Sci. USA 95, 2313-2318. Czyzyk-Krzeska, M.F., D.A. Bayliss, E.E. Lawson, and D.E. Millhorn (1992) J. Neurochem. 58, 1538-1546.
151
Czyzyk-Krzeska, M.F., B.A. Furnari, E.E. Lawson, and D.E. Millhorn (1994) J. Biol. Chem. 269, 760-764.
Fung, B.F., Yoon, S.O. and Chikaraishi, D.M. (1992) J. Neurochem., 58, 2044-2052. Gonzalez, G.A. and Montminy, M.R. (1989) Cell, 59: 675-680. Guilletnin, K. and Krasnow, M.A. (1997) Cell 89, 9-12. Hu, B.R., Fux, C.M., Martone, M.E., Zivin, J.A., and Ellisman, M.H. (1999) Neuroscience 89, 437-452. Kumar, G.K., Overholt, J.L., Bright, G.R., Hui, K.Y., Lu, H., Gratzl, M., and Prabhakar, N.R. (1998)Am J. Physiol. 274, C1592-1600.
Levy, A.P., Levy, N.S., Wegner, S., and Goldberg, M.A. (1995) J. Biol. Chem. 270, 1333313340. Nagamoto-Combs, K., Piech, K.M., Best, J.A., Sun, B., and Tank, A.W. (1997)J. Biol. Chem., 272, 6051-6058. Norris, M.L. and Millhorn, D.E. (1995) J. Biol. Chem. 270, 23774-23779. Pierrat, B., da Siva Correia, J., Mary, J.-L., Tomas-Zuber, M. and Lesslauer, W. (1998) J. Biol. Chem., 273, 29661-29671. PrabhaKar, N.R., Shenoy, B.C., Simonson, M.S., and Cherniack, N.S. (1995) Brain Res. 697, 266-270. Raymond, R. and Millhorn, D . E . (1997) Kidney Int. 51, 536-541. Sheng, M., Thompson, M.A., and Greenberg, M.E. (1991) Science 252, 1427-1430.
Tan, Y., Rouse, J., Zhang. A., Cariati, S., Cohen, P., and Comb, M.J. (1996) EMBO J., 15, 4629-4642. Tanaka, K.., Nagata, E., Suzuki, S., Dembo, T., Nogawa, S., and Fukuuchi, Y. (1999) Brain Res., 818, 520-526. Taylor, S.C. and Peers, C. (1998) Biochem. Biophys. Res. Commun. 9, 13-17.
Walton, M., Sirimanne, E., Williams, C., Gluckman, P., and Dragunow, M. (1996) Mol. Brain Res., 43, 21-29. Xie, H. and Rothstein, T.L. (1995) J Immunol. 154, 1717-1723. Xing, J., Ginty, D.D. and Greenberg, M.E. (1996) Science 273, 959-963. Yamamoto, K.K., Gonzales. G.A., Biggs, W.H., I I I , and Montminy, M.R. (1988) Nature, 334, 494-498. Yoon, S.O. and Chikaraishi, D.M. (1992) Neuron 14, 241-242. Zhu, W.H., Conforti, L., Czyzyk-Krzeska, M.F., and Millhorn, D.E. (1996) Am. J. Physiol.,
40, C658-C665.
152
REACTIVE OXYGEN SPECIES AS REGULATORS OF OXYGEN DEPENDENT GENE EXPRESSION
Joachim Fandrey l and Just Genius 2 1
Physiologishes Institut der Universität GH Essen, Germany;2Physiologisches Institut der
Medizinischen Universität zu Lübeck, Germany
1.
INTRODUCTION
Gene expression in tissues short of oxygen is governed by the transcription factor complex hypoxia inducible factor 1 (HIF-1) that binds to its cognate response element in the enhancers of genes encoding for erythropoietin (EPO), vascular endothelial growth factor (VEGF) and heme oxygenase 1 (HOX-1). Reactive oxygen species (ROS) have been proposed to act as the signal between the oxygen sensor that recognizes changes in the cell’s ambient oxygen tension and the transcriptional apparatus. Prerequisite for this concept of oxygen sensing are a production rate of ROS that is dependent of the oxygen tension and respective effects of ROS on the expression of oxygen regulated genes.
2.
HYPOXIA INDUCIBLE FACTOR 1 (HIF-1)
How is oxygen tension sensed by the cell? We may come closer to an answer of this important still unresolved question in physiology by the recent advances in the understanding of molecular biology of the transcription factor complex hypoxia inducible factor 1 (HIF-1). HIF-1 isolated and cloned a few years ago by Wang et al. (1995) turned out to be half known since its is identical to ARNT (for aryl hydrocarbon nuclear translocator), the dimerisation partner of the dioxin receptor (for review Wenger & Gassmann,
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
153
1997). The although a member of the same family of transcription factors, the basic helix-loop-helix PAS-proteins, like the turned out to be a so far unknown protein. Today we have realized, that the transcription factor HIF-1 appears to be the principal regulator of the oxygen dependent expression of a growing number of genes (reviewed by Bunn & Poyton, 1996). Both the directly contact the DNA of the hypoxia response elements (HRE) that are found in many oxygen regulated genes (Wenger & Gassmann, 1997). Although the DNA binding activity of the entire HIF-1 complex is increased by hypoxia only the is oxygen regulated. HIF-1 levels are low in normoxia because the is degraded by the ubiquitin proteasome pathway (Huang et al., 1998). Under hypoxia, however, stabilized HIF-1 accumulates and is available for dimerisation with the The classical example of an oxygen regulated gene is that of the glycoprotein hormone erythropoietin (EPO) that is the primary regulator of erythropoiesis. Studies of the mechanism that result into an up to 1000-fold increase in the production of EPO in the kidneys and the liver during phases of tissue hypoxia (Jelkmann, 1992) have helped to isolate HIF-1 and to start unravelling hypoxia inducible gene expression. However, it has also become clear that for full hypoxic inducibility of the EPO gene by HIF-1 the binding of an orphan nuclear receptor, HNF-4, is required (Bunn & Poyton, 1996). Whereas HIF-1 binds as the above mentioned dimer composed of its subunit to the 5'-part of the enhancer a further downstream lying tandem repeat of consensus hexanucleotide hormone response elements is necessary for full enhancer function. Binding of HNF-4 to this and a similar site in the promotor contributes importantly to tissue specific high level hypoxic induction (Bunn & Poyton, 1996). Furthermore, indispensable for the activation of transcription by hypoxia is recruitment of the transcriptional adapter/histone acetyltransferase proteins p300 and CREB-binding protein (CBP; Arany et al., 1996). Only very recently, it was found that a novel protein p35srj critically controls the binding of (Bhattacharya et al., 1999).
3.
SIGNALS TO ACTIVATE HIF-1
With respect to activation of the HIF-1 complex, a linkage to classical signalling pathways was provided by the fact that phosphorylation of HIF-1 seems to be essential for its functional activity (Wang & Semenza, 1993). In an earlier approach to investigate the possible involvement of well-known signalling mechanisms the role of protein kinase C in oxygen dependent gene expression had already been addressed (reviewed in Jelkmann, 1992). A proposed role for c-Sre tyrosine kinase in hypoxic induction of gene expression
154
appears to be ruled out since it was later found that only under anoxic conditions or at an oxygen tension that is much lower than to activate HIF-1 the c-Src kinase was active. In addition, cells deficient in c-Src kinase did not support the notion that this kinase is essential for HIF-1 activation (reviewed in Wenger & Gassmann, 1997). In conclusion, no clear cut picture of the involvement of protein kinases has appeared yet. Phosphorylation may be important in the activation process of the HIF-1 complex although mutation of all putative phosphor acceptor sites in the had no effect on the transactivation properties of this part of the transcription factor complex (Pugh et al., 1997) Therefore, other than classical signalling pathways had to be considered between a potential oxygen sensor and the transcriptional apparatus of the EPO and other oxygen regulated genes. We have put forward the hypothesis that a b-type cytochrome with similarity to the NADPH oxidase from leucocytes produces reactive oxygen species, in particular hydrogen peroxide, in a dependent manner that act as signalling molecules to control transcription factor activity (Fandrey et al., 1994; Fandrey et al., 1997). Hep3B hepatoma cells are very well suited to study oxygen dependent gene expression since they produce and secrete EPO into the culture supernatant following expression of the gene in dependence of the pericellular (Fandrey and Bunn, 1993). Fig 1 gives an example of the dependence of the endogenous production of hydrogen peroxide and respective EPO protein secreted by Hep3B cells grown on gas-permeable culture dishes.
155
Hydrogen peroxide was measured by using horse-radish peroxidase catalyzed luminol luminescence in the culture supernatant of the cells. Please note that under hypoxic conditions samples from the medium of the cells were taken and used for hydrogen peroxide measurements in the absence of cells. Therefore, we have measured hydrogen peroxide that was produced during hypoxic or normoxic incubation respectively, and not in a phase of reoxygenation. To prove, that the cells also respond to reoxygenation with increased levels of hydrogen peroxide we have brought the cells back to low or high after hypoxic incubation and measured hydrogen peroxide levels 4 minutes thereafter (Fig 1). These data support the notion that one can distinguish between production of hydrogen peroxide and reoxygenation phenomena in Hep3B cells.
4.
A b-TYPE CYTOCHROME AS THE PUTATIVE OXYGEN SENSOR I n i t i a l l y , this concept of oxygen sensing was put forward by Acker and co-
workers (1989) while they were studying oxygen sensing in the carotid body. This hypothesis has become increasingly attractive since other systems with
oxygen sensing capability appear to have an enzyme system similar to what Acker et al. (1989) and we have found in hepatoma cells (Fandrey et al., 1994). In summary, the current concept of oxygen sensing includes a b-cytochrome, probably assembled of proteins with strong similarity to the subunits of the NADPH oxidase (Babior, 1999). The enzyme system should be responsible for the oxygen-dependent production of hydrogen peroxide which, as a signalling molecule, can affect potassium channel opening probability (Acker et al., 1989) the contraction state of smooth muscle cells (Mohazzab-H. et al., 1995), the activity neuroepithelial bodies in the airways (Youngson et al., 1993) or transcriptional factors (Bunn & Poyton, 1996). Huang and colleagues (1996) reported that is sensitive towards degradation by hydrogen peroxide just like under conditions of a high However, the enzyme system that is responsible for the oxidative burst in macrophages and phagocytes is clearly distinct from the b-type cytochrome which we propose as a cellular oxygen sensor. This becomes evident from cells in which the large subunit gp91 of the phagocyte oxidase had been genetically knocked out. These cells (kindly provided by Dr. M. Dinauer, Indianapolis, IN) still respond to a hypoxic stimulus with increased expression of the hypoxia inducible angiogenic growth factor VEGF (data not shown). Likewise, cells of patients with chronic granulomatous disease who lack either the p22 or the gp91 subunit still show hypoxia induced gene expression (Wenger et al., 1996).
156
5.
PIVOTAL ROLE OF ROS ON OXYGEN DEPENDENT GENES
Unfortunately, a role for hydrogen peroxide in oxygen dependent gene expression does not appear as clear-cut as it has been found with the EPO gene and the stability of the HIF-1 also controls hypoxic induciblity
of the expression of the VEGF (Levy et al., 1995) and heme oxygenase 1 (HOX-1) genes (Lee et al., 1997). For both genes it has been shown in the past that HOX-1 as well as VEGF can be induced by hydrogen peroxide. Table 1 displays results from studies with the two well-known mouse hepatoma lines Hepa-lclc7 and its derivative Hepa-lc4 that is deficient in functionally active (kindly provided by Dr. O. Hankinson, Los Angeles, CA).
Hepa-1c1c7 cells responded to the iron chelator 2,2-dipyridyl and hypoxia
as expected with a significant HIF-1 mediated stimulation of HOX-1 and VEGF expression whereas C4 - due to the lack of the active HIF-1 complex did not. Unexpectedly, hydrogen peroxide significantly stimulated HOX-1 and VEGF expression in Hepa lclc7 cells despite a destabilized subunit (Huang et al., 1996) and in Hepa 1c4 cells although the active HIF-1 complex is absent. Thus, we have to consider that in contrast to the EPO gene where
destabilization of by hydrogen peroxide is sufficient to inhibit hypoxia induced expression other HIF-1 dependent genes - herein shown for HOX-1 and VEGF - are under control of other transcription factors sensitive to ROS. The net effect of ROS on expression of these genes depends on the integration of different trans-acting factors on promoter-/enhancer activity.
157
Does this have implications for physiology? Tissue hypoxia in vivo is not a stable condition but one can rather expect fluctuations of very low values that initiate cellular responses, e. g. the induction of the enzymes NO synthase (Melillo et al., 1995) or HOX-1 (Lee et al., 1997), that produce vasodilating mediators to reoxygenate the tissue. It is conceivable that these fluctuations of the and respectively the levels of ROS in the tissue are the physiological stimulus for the expression of genes like HOX-1 and VEGF. The fact that regulation of the EPO gene appears to be more straightforward (low - low ROS - high EPO and vice versa) may be more appropriate for situations of anemia or hypoxemia (continuous decrease in the venous or arterial respectively). Moreover, in addition to ROS reducing the stimulation of EPO expression by HIF-1 inactivation Imagawa et al. (1996) have shown that hydrogen peroxide increases the level of GATA-2 a strong repressor of the EPO gene.
6.
CONCLUSION
Our concept of ROS as signalling molecules from the oxygen sensor appears attractive since it allows one to link redox sensitivity of transcription factors with changes in the cell’s ambient One has to keep in mind that multiple transcription factors may be affected. In addition, other molecules like iron or nitric oxide could affect the reactivity of hydrogen peroxide and other ROS or the susceptibility of transcription factors towards these ROS.
REFERENCES Acker H., Dufau, E., Huber, J. and Sylvester D., 1989, Indications to an NAD(P)H oxidase as a possible sensor in the rat carotid body. FEBS Lett. 256:75-78. Arany, Z., Huang, L.E., Eckner, R., Bhattacharya, S., Jiang, C., Goldberg, M.A., Bunn, H.F., and Livingston, D.M., 1996, An essential role for p300/CBP in the cellular response to hypoxia. Proc. Natl. Acad. Sci. 93: 12969-12973. Babior, B.M., 1999, NADPH Oxidase: An Update. Blood 93, 1464-1476 Bhattacharya, S., Michels, C.L., Leung, M.K., Arany, Z.P., Kung, A.L., Livingston, D.M., 1999, Functionla role of p35srj, a novel p300/CBP binding protein, during transctivation by HIF-1. Genes & Dev. 13:64-75. Bunn, H.F. and Poyton, R.O., 1996, Oxygen sensing and molecular adaptation to hypoxia. Physiol. Rev.76: 839-885. Fandrey, J., Frede, S., Ehleben, W., Porwol, T., Acker, H. and Jelkmann, W., 1997, Cobalt chloride and desferrioxamine antagonize the inhibition of erythropoietin production by reactive oxygen species. Kidney Int. 51: 492-496. Fandrey, J., Frede, S. and Jelkmann, W., 1994, Role of hydrogen peroxide in hypoxia-induced erythropoietin production. Biochem J. 303: 507-510.
158
Fandrey, J. and Bunn, H.F., 1993, In vivo and in vitro regulation of erythropoietin mRNA: Measurement by competitive polymerase chain reaction. Blood 81: 617-623. Huang, L.E., Arany, Z., Livingston, D.M. and Bunn, H.F., 1996, Activation of hypoxia-inducible transcription factor depends primarily upon redox-sensitivc stabilization of its_-subunit. J.
Biol. Chem. 271: 32253-32259. Huang, L.E., Gu, J., Schau, M., and Bunn, H.F., 1998, Regulation of hypoxia-inducible factor 1 alpha is mediated by an O2-dependent degradation domain via the ubiquitin-proteasome pathway. Proc. Natl. Acad. Sci. 95: 7987-7992. Imagawa, S., Yamamoto, M., Ueda, M. and Miura, Y., 1996, Erythropoietin gene expression by hydrogen peroxide. Int. J. Hematol. 64: 189-195. Jelkmann, W., 1992, Erythropoietin: Structure, control of production and function. Physiol. Rev. 72: 449-489. Lee, P.J., Jiang, B.-H., Chin, B.Y., Iyer, N.V., Alam, J., Semenza, G.L. and Choi, A.M.K., 1997, Hypoxia-inducible factor-1 mediates transcriptional activation of the heme oxygenase-l gene in response to hypoxia. J. Biol. Chem. 272: 5375-5381. Levy, A.P., Levy, N.S., Wegner, S., and Goldberg, M.A., 1995, Transcriptional regulation of the rat vascular endothelial growth factor gene by hypoxia. J. Biol. Chem. 270, 13333-13340.
Melillo, G., Musso, T., Sica, A. and Taylor L.S., 1995, A hypoxia-responsive element mediates a novel pathway of activation of the inducible nitric oxide synthase promoter. J. Exp. Med. 182: 1683-1693. Mohazzab-H., K.M., Fuyngersh, R.P., Kaminski, P.M. and Wolin, M.S., 1995, Potential role of N A D H oxidoreductase-derived reactive species in calf pulmonary arterial -elicited responses. Am. J. Physiol. 269: L637-644.
Pugh, C.W., O´Rourke, J.F., Nagao, M., Gleadle, J.M. Ratcliffe, P.J., 1997, Activation of hypoxia-inducible factor–1; definition of regulatory domains within the α-subunit. .J. Biol. Chem. 272: 11205-11214. Wang, G.L., Jiang, B.-H., Rue, E.A. and Semenza, E.A., 1995, Hypoxia-inducible factor 1 is a basic-helix-loop-heclix-PAS heterodimer regulated by cellular
tension. Proc. Natl. Acad.
Sci. USA 92: 5510-5514. Wang, G.L., and Semenza, G.L., 1993, Characterization of hypoxia-inducible factor 1 and regulation of DNA binding activity by hypoxia. J. Biol. Chem. 268, 21513-21518. Wenger, R.H., Marti, H.H., Schueler-Maly, C.C., Kvietikova, I., Bauer, C., Gassmann, M. and Maly, F.E., 1996, Hypoxic induction of gene expression in chronic granulomatous disease-
derived B-cell lines: oxygen sensing is independent of the cytochrome containing nicotinamide adenine dinucleotide phosphate oxidase. Blood 87: 756-761. Wenger, R.H. and Gassmann, M., 1997, Oxygen(es) and the hypoxia-inducible factor-1. Biol. Chem. 378: 609-616. Youngson, C., Nurse, C., Yeger, H. and Cutz, E., 1993, Oxygen sensing in airways chemoreceptors. Nature 365:153-155.
159
This page intentionally left blank.
A GLYCOLYTIC PATHWAY TO APOPTOSIS OF HYPOXIC CARDIAC MYOCYTES Molecular Pathways of Increased Acid Production
Keith A. Webster, Daryl J. Discher, Olga M. Hernandez, Kazuhito Yamashita, and Nanette H. Bishopric Department of Molecular and Cellular Pharmacology, University of Miami Medical Center,
Miami, FL.
1.
INTRODUCTION
Recent studies have implicated acidosis as a central component of apoptosis in a number of systems. Work from our laboratory suggest that acidosis may be the actual signal that initiates apoptosis in cardiac myocytes subjected to chronic hypoxia (Webster et al., 1999). Exposure of cardiac myocytes to hypoxia results in the activation of glycolysis and the coordinate induction of glycolytic enzyme genes. The transcription rates of glycolytic enzyme genes increase by about 5 fold during exposure of myocytes to hypoxia, and there is a corresponding enhancement of protein and glycolytic enzyme activity. Therefore chronic hypoxia significantly augments the glycolytic capacity of muscle cells and the potential for acid production. The association of acidosis with apoptosis suggests that enhanced glycolytic capacity may be part of the pathology of ischemic heart disease, and the first step towards apoptosis, rather than a positive adaptive response to hypoxia. In this chapter we will discuss the pathways that lead to hypoxia-mediated activation of glycolytic enzyme genes, the role of augmented acid production in ischemia-mediated cardiac myocyte apoptosis, and the possibility that glycolytic enzyme gene activation has both positive and negative survival roles in the ischemic myocardium.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
161
2.
BACKGROUND
Apoptosis is a cellular endpoint in many developmental and pathological conditions (reviewed in (Korsmeyer, 1995; Thompson, 1995; Haunstetter and Izumo, 1998)). It constitutes a safe and micro environmentally sound way of eliminating superfluous cells during tissue differentiation, aging, and disease. While the physiological benefits in the former situations are usually quite clear, this is not necessarily true in the latter, where apoptosis may be part of the pathology rather than the cure. Cardiac myocyte cell death by apoptosis accompanies heart disease of both ischemic and non-ischemic origin (reviewed in (Haunstetter and Izumo, 1998; MacLellan and Schneider, 1997; Fliss and Gattinger, 1996)). It has been demonstrated in the myocardium from failing human hearts (Olivetti et al., 1997; Olivetti et al., 1994; Kajstura et al., 1998; Narula et al, 1996), in patients with arrhythmogenic right ventricular dysplasia (Mallat et al., 1996), and in association with myocardial infarction, both within the infarcted area itself and in the surrounding viable tissue (Misao et al., 1996; Olivetti et al., 1994; Itoh et al., 1995; Saraste et al., 1997; Cheng et al., 1996). In animals models, increased apoptosis accompanies pacing-induced dilated cardiomyopathy (Kajstura et al., 1995; Leri et al., 1998), pressureoverload hypertrophy (Gottlieb et al., 1994; Teiger et al., 1996), hypertension (Hamet et al., 1996), hibernating myocardium (Chen et al., 1997), and both phases of ischemia and reperfusion (Fliss and Gattinger, 1996). Little is known about the initiating events and mechanisms of apoptosis in ischemic heart disease. Circulating neurohumoral factors, such as atrial natnuretic peptide, angiotensin II, norepmephrine and endothelin, are elevated in chronic congestive heart failure and may contribute to apoptosis (reviewed in (Narula et al., 1996; Olivetti et al., 1997; Thompson, 1995; Anversa and Kajstura, 1998)). Mechanical factors, such as wall stress and stretch may also play a role, and there is strong evidence for a direct involvement of oxygen free radicals generated during ischemia and reperfusion (Gottlieb et al., 1994; Bialik et al., 1997). Other studies have shown that intracellular acidification is frequently associated with apoptosis in some cell types although the relationship between the two is not clear (Li and Eastman, 1995; Gottlieb et al., 1995; Perez-Sala et al., 1998). All ischemic conditions involve reduced washout of waste metabolites, consequently acidosis is a common feature of ischemic tissues. In ischemic myocardial tissue the buildup of extracellular acid influences other ion channel activities and can have profound effects on and contractility (Buja, 1998). As such, acidosis is well positioned to be a stress sensor and survival signal.
162
3.
CHRONIC HYPOXIA: A MODEL OF LOWFLOW OR REPETITIVE ISCHEMIA.
Coronary artery disease (CAD) involves the progressive accumulation of plaque in the coronary arteries, restricting blood flow, and causing myocardial ischemia (angina pectoris and silent ischemia) (Swan, 1990; Carbajal and Deedwania, 1991). Chronic mild ischemia may result from poorly perfused coronary arteries, and severe acute ischemia results when an artery becomes fully (usually reversibly) occluded (Yeung et al., 1992; Homans et al., 1986). Ischemic heart disease involves combinations of both of these conditions, and patients with severe CAD may experience more than 10 ischemic episodes per day, each with durations of between 20 and 40 minutes (Deanfield et al., 1984; Deedwania and Carbajal, 1990). One of the consequences of this is myocardial hypoxia which parallels both acute and chronic ischemia and, like the ischemia, may be prolonged and severe. To mimic these conditions for molecular studies we established in vitro models of acute ischemia, chronic ischemia, ischemia with reperfusion, and chronic hypoxia using isolated cardiac and skeletal myocytes (Webster and Bishopric, 1992; Webster et al., 1993; Webster et al., 1994; Laderoute and Webster, 1997; Webster et al., 1997). In the model of chronic hypoxia, myocytes are exposed to an oxygen tension of 10-15 Torr (0.5% O2) for periods of up to one week with frequent media changes to maintain bioenergetic substrates and eliminate waste metabolites (Webster and Bishopric, 1992). To simulate chronic ischemia in the same model, the medium is left unchanged for 48h permitting metabolic buildup and accumulation of lactic acid (Webster et al., 1999).
4.
COORDINATE INDUCTION OF GLYCOLYTIC ENZYME GENES BY CHRONIC HYPOXIA
The glycolytic enzyme pathway consists of 11 separate enzymes that catalyze the hydrolysis of glycogen through glucose to lactic acid. Two moles of ATP are generated per mole of glucose so the system is only 10%
as efficient as oxidative phosphorylation in this respect. Numerous low molecular weight regulators determine the rate of glycolytic flux through the glycolytic pathway the most famous of which was discovered by Louis Pasteur in 1860. Pasteur observed that the rate of glucose consumption of cells was inversely proportional to the oxygen tension, i.e.. that glycolysis was positively regulated by hypoxia. Over one century later our laboratory reported that the transcription rates of glycolytic enzyme genes were also
163
positively regulated by hypoxia (Webster, 1987; Webster et al., 1990). Increased transcription rates supported increased steady states of the glycolytic enzyme mRNAs under hypoxia (Webster and Murphy, 1988), as well as increased proteins and enzyme activities (Robin et al., 1984). Since these earlier reports there have been a number of confirmatory reports in different cells and tissues (Semenza et al., 1996; Firth et al., 1995). Glycolytic enzyme gene regulation by hypoxia appears to be ubiquitous in eucaryotic cells including plants and animals, and inductions of the genes varies between about 3 and 10 fold; there may be some quantitative variability between individual enzyme genes and/or between different cells. At least 8 of the 11 glycolytic enzymes have been shown to be induced by hypoxia, and the inference is that the complete pathway of genes is hypoxiaresponsive (Webster et al., 1990). Muscle cells express specific isoforms of phosphoglycerate kinase, aldolase, enolase, PFK, PK, and LDH proteins that are either splice variants or distinct genes, all of these are induced in muscle (Webster et al., 1990). At least 3 pathways have been implicated in the activation of glycolytic enzyme gene expression by hypoxia in different systems, and these will be discussed below.
5.
HYPOXIA-REGULATED PATHWAYS OF GLYCOLYTIC ENZYME GENE EXPRESSION
5.1
GC and TG-Rich Elements in Maize ADH, and Aldolase genes
Some of the first candidate hypoxia/anaerobic gene regulatory elements were identified from studies on Zea Mays (maize). Exposure of maize root cells to hypoxia results in the induction of approximately 20 proteins, deemed anaerobic polypeptides (ANPs) (Dennis et al., 1988; Olive et al., 1991; Dolferus et al., 1994). Many of these proteins are enzymes involved in glycolytic or fermentative carbohydrate metabolism, and they include the two alcohol dehydrogenases, glucose phosphate isomerase, aldolase, and lactate dehydrogenase. On exposure to hypoxia, aerobic protein synthesis is repressed in these cells, and ANPs account of total protein synthesis after 5h of hypoxia. Regulation is at least in part at the level of transcription; steady state levels of Adhl mRNA transcripts for example increase 50-fold within 7h of exposure to hypoxia. Promoter deletion and mutation analyses identified two binding sites for putative anaerobic response element binding proteins in the proximal promotes of
164
aldolase and Adhl genes. The first site contained the consensus TGGTTT and was present in the aldolase promoter at -70 bp upstream from the transcription start site, and in the Adhl promoter at position -111. The second site contained the consensus GC(G/C)CC and was present at -135 and -120 of the Adhl promoter(Olive et al., 1991). Mutation of these elements resulted in the loss of response to hypoxia. Further studies revealed the specific binding of a protein to the GC-rich element and this protein was designated GCBP-1 (GC-rich binding protein-1). This protein has not been fully characterized; its abundance is not changed by hypoxia, it requires accessory proteins and/or post translational modifications to mediate transcriptional activation by hypoxia, and its binding to the GC site is competed by members of the Spl family of zinc finger transcription factors. There may be strong parallels between this regulatory pathway and that described below for the regulation of mammalian muscle-specific pyruvate kinase (PKM) and genes. There may be differences in the responses of mono- and dicotyledons to environmental stresses including hypoxia. The Adh gene in the roots of the dicot Arabidopsis thaliana is induced by low oxygen, dehydration, and low temperature. The promoter elements for these responses have been mapped (Dolferus et al., 1994). The Arabidopsis Adh promoter contains a single GT/GC motif, which has a similar sequence to the maize AREs described above, except that the GT motif is in reverse orientation. The Arabidopsis Adh promoter also contains a motif at position -216 to -219, referred to as G-box-1, with the sequence CCACGTGC. This sequence contains the sequence ACGTG which is the binding site for well characterized mammalian factor, hypoxia inducible factor-1 (HIF-1) , see below. Interestingly the G-box-1 motif appears to be required for Adh gene induction by hypothermia, dehydration, and possibly UV light, but not hypoxia; while the GT/GC sequences are required for the hypoxia response. It seems remarkable that the GC-box binding site, is the principal hypoxiaresponse element in plants, and the site homologous to HIF-1 controls other stress responses. As discussed below, both elements (GC and HIF-1) appear to be involved in the hypoxia-response in higher mammals.
5.2
HIF-1 Regulation of Liver-Specific Glycolytic Enzyme Genes
The transcription factor HIF-1 has been implicated in the hypoxiamediated activation of the liver-specific isogenes PFK-L, aldolase-A, PGK1, enolase-1, and LDH-A (Firth et al., 1994; Semenza et al., 1996). Northern and RNAse protection analyses indicate inductions of 5 to 10 fold for the endogenous transcripts of these genes in hepatoma, L-cell, or HeLa
165
cells exposed to hypoxia for 16 to 20h. Sequence analyses identified one or more HIF-1 binding sites in these genes at the following positions: mouse PFKL, first intron, +336/+361; human PGK1, promoter, -309/-290, and 5'
untranslated region, +31/+11; human ENO1, promoter, -585/-610; human ALDA, promoter, -204/-180, and first intron, +125/+150; mouse LDHA,
promoter, -75/-50.
Mutation, and or deletion analyses confirmed and
definitively identified the active HIF-1 sites in the PGK-1, ALD-A, Eno-1, and LDH-A genes (Firth et al., 1994; Semenza et al., 1996). Although other regulatory elements and pathways may be involved in the activation of these genes by hypoxia, the HIF-1 pathway seems in most cases to be sufficient to account for the inductions. Interestingly, not all HIF-1 consensus sites are active, and in the case of this set of glycolytic enzyme genes, only the 5' promoter sites were confirmed to be functional. Although these elements
appear to behave as classical enhancers in the erythropoietin gene, where they function independently of position and orientation, this may not be the general case. HIF-1 sites within the intron elements of PFKL and ALDA have not been shown to be functional, in fact the ALDA intron sequence does not appear to be active (Semenza et al., 1996). A non-functional HIF-1 site is also present in the VEGF gene. Therefore, the presence of a HIF-1 binding element does not necessarily confer hypoxia responsiveness. Flanking sequences and positioning within the gene are also important. Active HIF-1 elements have not yet been described in muscle-specific glycolytic enzyme genes.
5.3
GC-Box Regulation of Muscle-Specific Glycolytic Enzyme Genes
Genbank screens of muscle-specific pyruvate kinase (PKM), and enolase revealed two putative HIF-1 binding sites in the PKM gene, both in intron 1 at positions +1504 and +1737, but there were no matches in
7194 base pairs of the human
gene. Therefore there are no HIF-1
binding sites in the proximal 5' promoter regions of either of these genes. Transcripts of both genes are induced about 4 fold by hypoxia in cardiac and skeletal muscle, ((Discher et al., 1998) and Webster et al, unpublished). All of the liver-specific glycolytic enzyme promoters described above conferred hypoxia regulation to heterologous (reporter) genes in chimeric constructs. Therefore we isolated PKM and promoters, inserted them upstream of the luciferase gene, and asked whether they were regulated by hypoxia after transfection into muscle cells. Both promoters conferred hypoxia responsiveness to the luciferase gene; expression directed by the PKM promoter truncated to -230 bp upstream of
the transcription start site, and
166
truncated to -326 bp was induced 3.7
fold respectively, compared with aerobic controls (Discher et al., 1998). Therefore these promoters are regulated by hypoxia independently of HIF-1. Deletion and mutation analyses identified conserved sequences in the PKM and promoters that were required for activation by hypoxia. Alignment of these regions is shown in Figure 1 with the conserved bases highlighted. In both promoters a strongly conserved GC-rich element is located approximately 20 bp upstream from a
GATA element. The GATA element is situated in the position usually occupied by the TATA box and resembles a TATA-box with a T to G transition. Interestingly this combination of elements is highly reminiscent of promoters of hematopoietic genes (Max-Audit et al., 1993; Youssoufian, 1994). In Figure 1, the Eno mutant Ml (GC-box) eliminated the response to hypoxia, M2 (GC-flanking sequence), was without effect.
These studies identified the GC-rich element in the PKM and proximal promoters as an HRE. Protein-binding studies revealed that transcription factors Spl and Sp3 bound in approximately equal amounts to the element when myocytes were cultured under aerobic conditions (Discher et al., 1998). Under hypoxic conditions only Spl was found to bind. Sp3 binding decreased rapidly within the first hour after exposure to hypoxia and was no longer evident after 4-8h in most experiments. Therefore, because loss of Sp3 binding correlated with increased promoter activity, we explored the possibility that Sp3 was acting as a repressor of these promoters under aerobic conditions. Overexpression of Sp3 using a CMV directed Sp3 expression vector, inhibited the hypoxia-mediated induction of 80% (Discher et al., 1998). Therefore, we propose that the hypoxiamediated depletion of Sp3 alleviates a repressor activity, thereby activating transcription from these promoters. Previous studies support this interpretation insofar as Sp3 has been shown to be a strong repressor of other GC-dependent promoters that functions by antagonizing multiple classes of positive-acting factors (Hagen et al., 1994; Luca et al., 1996; Birnbaum et al., 1995; Kumar and Butler, 1997; Majello et al., 1997).
167
5.4
HRE Activities are Regulated by Redox-Dependent Proteolytic Pathways.
The accumulation of HIF-1 protein and binding activity in cells exposed to hypoxia has been shown to be independent of changes in HIF-1 gene transcription, or the stability of the mRNA (Huang et al., 1998; Srinivas et al., 1998; Kallio et al., 1999). On the contrary, all available evidence suggests that HIF-1 and its cofactor/binding protein ARNT (aryl
hydrocarbon receptor nuclear transporter) are constitutively transcribed and translated in an unregulated manner in all mammalian cells tested so far. Under aerobic conditions HIF-1 is rapidly polyubiquitinated and degraded by the ubiquitin-proteasome pathway. The half life of HIF-1 protein in well oxygenated cells is 5 to 10 minutes. Under hypoxic conditions ubiquitination does not occur, the protein is stabilized and accumulates. Accumulated HIF-1 dimerizes with ARNT, and the complex translocates to the cell nucleus where it binds to and activates genes containing the consensus DNA sequence. Aerobic ubiquitination of HIF-1 is determined by a central domain of the protein consisting of about 200 amino acids (Huang et al., 1998). Deletion of this domain results in stable HIF-1 that is no longer regulated by hypoxia. Oxygen sensing may be mediated by an iron center contained within this domain that acts as a catalyst for the redoxdependent modification of specific amino acids rendering them targets for ubiquitin. The precise mechanism has not been determined. The discovery that HIF-1 was regulated by redox-dependent degradation of the protein was unexpected. However, analyses of the regulation of the hypoxia-sensitive GC-Sp3 pathway indicates that it also may be regulated at the level of protein stability. Our studies demonstrated that whereas Sp3 protein and binding activity dropped rapidly after the exposure of cells to hypoxia, there was no change in the level of Sp3 mRNA at any time (Discher et al., 1998). This suggests that, like HIF-1, Sp3 is also constitutively expressed under aerobic or hypoxic conditions but, unlike HIF-1, Sp3 is stable under aerobic conditions and preferentially degraded under hypoxia. The two pathways for hypoxia-mediated regulation of glycolytic enzyme gene expression are summarized in Figures 2 and 3. Figure 2 shows a hypothetical promoter with HIF-1 and GC/Sp consensus binding sites. Under aerobic conditions HIF-1 is degraded and the binding site is either vacant or occupied by other factors such as CREB and ATF-1. The site does not contribute to transcriptional activation under these conditions. In the oxygenated state members of the Spl family compete for binding to the GC site. Spl and Sp3 are the principal factors in muscle, they appear to be present in approximately equal amounts, and bind correspondingly, as
168
estimated by in vitro gel mobility shift assay (Discher et al., 1998). Spl is a transcriptional activator whereas Sp3 represses. Therefore the activity of
the site is determined by the relative contributions of each factor. With high levels of Sp3, the activity will be repressed. Therefore, the hypothetical promoter containing two HREs will be weak or inactive under aerobic conditions. Under hypoxic conditions HIF-1, represented in the figure by the helix-loop-helix structure, is stabilized, it accumulates, associates with ARNT, occupies the ACGTGC site and becomes a strong positive transcriptional activator. In parallel, Sp3 is degraded under hypoxia and the GC-Box becomes fully occupied by Spl, repression is relieved and this site also becomes fully active.
Figure 3 summarizes a remarkable feature of these two pathways of hypoxia-mediated gene regulation. The mechanisms are mirror images of each other. Sp3 is a transcriptional repressor that appears to be degraded specifically under hypoxic conditions; HIF-1 is a transcriptional activator that is degraded under aerobic conditions. It is not immediately clear what selective advantage such regulatory mechanisms would convey over the more usual transcriptional regulation of genes. One strong possibility is that regulation by protein stability allows an extremely rapid response time
169
because new protein synthesis is not required, both factors being
continuously produced. This may be very important for an appropriate cell response to acute hypoxia or ischemia where aerobic pathways of energy metabolism are immediately inhibited and anaerobic energy pathways must be rapidly recruited to compensate. The rapid and coordinate activation of glucose metabolizing pathways (and glucose transport) may be essential to survive hypoxia.
6.
AUGMENTED GLYCOLYTIC ENZYMES: A BLESSING AND A CURSE
By increasing the capacity to transport more glucose into the cell and activating the coordinate transcription of glycolytic enzyme genes, chronic hypoxia may augment glycolytic capacity by as much as 5 fold. In chronically ischemic cardiac muscle there are two critical outcomes of this.
The first is the capacity to generate and maintain higher levels of ATP which will support myocyte functions, including contractility; the second is the parallel increase of lactic acid production that can signal cell death
170
(Webster et al., 1999). Glycolytic flux in cardiac myocytes increases fold within 30 minutes of exposure to hypoxia (Webster and Bishopric, 1992). If the rate limiting step of this flux is increased five fold then a 50 fold increase becomes possible, with a corresponding increase in the rate of acid production. At some stage acid will be produced too rapidly to be cleared, and when this point is reached the developing acidosis initiates apoptosis. Augmented glycolytic capacity is therefore a double edged sword, promoting survival through enhanced energy production on the one hand, but signaling death through excess acid on the other. It is possible to visualize how this may occur in the pathophysiological setting of ischemia heart disease. During the early stages of ischemia there will be normal levels of glycolytic enzymes; an ischemic episode of 10 to 15 minutes will result in enhanced glycolysis and the build up of acid in the ischemic region. The level of acidosis will be determined by the rate of glycolytic flux and the duration of the ischemic episode, and may not reach critical levels if ischemia is short, and reperfusion occurs to wash out the acid. In late stage ischemia acidosis may occur much more rapidly, under this condition, the myocardium has been exposed to numerous ischemic episodes with increasing frequency and duration. Severe coronary artery disease may include more than 10 ischemic episodes per day, some of up to 40 min. duration (Deanfield et al., 1984; Deedwania and Carbajal, 1990). Under these conditions glycolytic enzyme transcription rates, and the steady state levels of the enzymes, will be increased several fold. With the increased basal levels of enzymes, a much greater stimulus by hypoxia/ischemia is possible. Consequently each ischemic episode mediates a larger surge of acid production which, if not cleared, will reach apoptosis signaling threshold correspondingly faster. Therefore, augmented glycolytic enzyme production during ischemia is both a blessing and a curse.
7.
CONCLUSIONS
Glycolytic enzyme gene transcription is induced by hypoxia through at least two distinct pathways. One involves the positive factor HIF-1, the other involves the repressor Sp3. Both pathways have parallels in the animal and plant kingdoms. Augmented glycolytic capacity in ischemic muscle has positive and negative attributes. There is the direct advantage of increased capacity for anaerobic energy production during the ischemic period, and the more subtle initiation of apoptosis by increased acid production, through an apparent “acid survival sensor”. The latter property is of questionable value; on the one hand, cells lost to apoptosis in the heart
171
are not replaced, on the other, apoptosis is the safest way to, eliminate cells that may otherwise die through necrosis.
ACKNOWLEDGMENTS The studies described were supported by NIH grant CAW).
HL-44578 (to
REFERENCES Anversa, P. and Kajstura, J. (1998). Myocyte cell death in the diseased heart. Circ. Res. 82, 1231-1233. Bialik, S., Geenen, D.L., Sasson, I.E., Cheng, R., Horner, J.W., Evans, S.M., Lord, E.M., Koch, C.J., and Kitsis, R.N. (1997). Myocyte apoptosis during acute myocardial infarction in the mouse localizes to hypoxic regions but occurs independently of p53. J. Clin. Invest. 100, 1363-1372. Birnbaum, M.J., van Wijnen, A.J., Odgren, P.R., Last, T.J., Suske, G., Stein, G.S., and Stein, J.L. (1995). Spl trans-activation of cell cycle regulated promoters is selectively repressed by Sp3. Biochemistry 34, 16503-16508. Buja, L.M. (1998). Modulation of the myocardial response to ischemia. Lab. Invest. 78, 1345-1373. Carbajal, E.V. and Deedwania, P.C. (1991). Silent Ischemia: Mechanisms, Diagnosis, and Prevalence. Primary Cardiology 17, 30-40. Chen, C., Ma, L., Linfert, D.R., Lai, T., Fallon, J.T., Gillam, L.D., Waters, D.D., and Tsongalis, G.J. (1997). Myocardial cell death and apoptosis in hibernating myocardium. J. Am. Coll. Card. 30, 1407-1412. Cheng, W., Kajstura, J., Nitahara, J.A., Li, B., Reiss, K., Liu, Y., Clark, W.A., Krajewski, S., Reed, J.C., Olivetti, G., and Anversa, P. (1996). Programmed myocyte cell death affects the viable myocardium after infarction in rats. Exp. Cell Res. 226, 316-327. Deanfield, J.E., Shea, M., Ribiero, P., Landsheere, C.M., Wilson, R.A., Horlock, P., and Selwyn, A. P. (1984). Transient ST-segment depression as a marker of myocardial ischemia during daily life. Am. J. Cardiol. 54, 1195-1200. Deedwania, P.C. and Carbajal, E.V. (1990). Silent ischemia during daily life is an independent predictor of mortality in stable angina. Circulation 81, 748-756. Dennis, E.S., Gerlach, W.L., Walker, J.C., Lavin, M., and Peacock, W.J. (1988). Anaerobically regulated aldolase gene of Maize. Mol. Biol. 202, 759-767. Discher, D.J., Bishopric, N.H., Wu, X., Peterson, C.A., and Webster, K.A. (1998). Hypoxia regulates b-enolase and pyruvate kinase-M promoters by modulating Spl/Sp3 binding to a conserved GC element. J. Biol. Chem. 273, 26087-26093. Dolferus, R., Jacobs, M., Peacock, W.J., and Dennis, E.S. (1994). Differential interactions of promoter elements in stress responses of the Arabidopsis Adh gene. Plant Physiol. 105, 1075-1087. Firth, J.D., Ebert, B.L., Pugh, C.W., and Ratcliffe, P.J. (1994). Oxygen-regulated control elements in the phosphoglycerate kinase and lactate dehydrogenase A genes: similarities with the erythropoietin 3' enhancer. Proc. Natl. Acad. Sci. USA 91, 6496-6500.
172
Firth, J.D., Ebert, B.L., and Ratcliffe, P.J. (1995). Hypoxic regulation of lactate
dehydrogenase A. Interaction between hypoxia inducible factor 1 and cAMP response elements. J. Biol. Chem. 270, 21021-21027. Fliss, H. and Gattinger, D. (1996). Apoptosis in ischemic and reperfused rat myocardium. Circ. Res. 79, 949-956. Gottlieb, R.A., Burleson, K.O., Kloner, R.A., Babior, B.M., and Engler, R.L. (1994). Reperfusion injury induces apoptosis in rabbit cardiomyocytes. J. Clin. Invest. 94, 16121628.
Gottlieb, R.A., Giesing, H.A., Zhu, J.Y., Engler, R.L., and Babior, B.M. (1995). Cell acidification in apoptosis: granulocyte colony-stimulating factor delays programmed cell death in neutrophils by up-regulating the vacuolar H+ ATPase. Proc. Natl. Acad. Sci. USA 92, 5965-5968. Hagen, G., Muller, S., Beato, M., and Suske, G. (1994). Spl-mediated transcriptional
activation is repressed by Sp3. EMBO J. 13, 3843-3851. Hamet, P., Moreau, P., Dam, T.V., Orlov, S.N., Tea, B.S., de Blois, D., and Tremblay, J.
(1996). The time window of apoptosis: a new component in the therapeutic strategy for cardiovascular remodeling. J. Hypertens. Suppl. 14, S65-S70. Haunstetter, A. and Izumo, S. (1998). Apoptosis: Basic mechanisms and implications for cardiovascular disease. Circ. Res. 82, 1 1 1 1 - 1 1 2 9 . Homans, D.C., Sublett, E., Dai, X-Z., and Bache, R.J. (1986). Persistence of Regional Left Ventricular Dysfunction after Exercise-induced Myocardial Ischemia. J. Clin. Invest. 77, 66-73. Huang, L.E., Gu, J., Schau, M., and Bunn, H.F. (1998). Regulation of hypoxia-inducible factor 1 alpha is mediated by an O2-dependent degradation domain via the ubiquitinproteasome pathway. Proc. Natl. Acad. Sci. USA 95, 7987-7992. Itoh, G., Tamura, J., Suzuki, M., Suzuki, Y., Ikeda, H., Koike, M., Nomura, M., Jie, T., and Ito, K. (1995). DNA fragmentation of human infarcted myocardial cells demonstrated by the nick end labeling method and DNA agarose gel electrophoresis. Am. J. Pathol. 146, 1325-1331.
Kajstura, J., Zhang, X., Liu, Y., Szoke, E., Cheng, W., Olivetti, G., Hintze, T.H., and Anversa, P. (1995). The cellular basis of pacing-induced dilated cardiomyopathy: myocyte cell loss and myocyte cellular reactive hypertrophy. Circulation 92, 2306-2317. Kajstura, J., Leri, A., Finato, N., Loreto, C., Beltrami, C.A., and Anversa, P. (1998). Myocyte proliferation in end-stage cardiac failure in humans. Proc. Natl. Acad. Sci. USA 95, 88018805. Kallio, P.J., Wilson, W.J., O'Brien, S., Makino, Y., and Poellinger, L. (1999). Regulation of the hypoxia-inducible transcription factor 1 alpha by the ubiquitin-proteasome pathway. J. Biol. Chem. 274, 6519-6525. Korsmeyer, S.J. (1995). Regulators of cell death. Trends. Genet. 11, 101-105. Kumar, A.P. and Butler, A.P. (1997). Transcription factor Sp3 antagonizes activation of the
ornithine decarboxylase domains. Nucl. Acids. Res. 25, 2012-2019. Laderoute, K.R. and Webster, K.A. (1997). Hypoxia/Reoxygenation Stimulates Jun Kinase Activity Through Redox Signaling in Cardiac Myocytes. Circ. Res. 80, 336-344. Leri, A., Liu, Y., Malhotra, A., Li, Q., Stiegler, P., Claudio, P.P., Giordano, A., Kajstura, J., Hintze, T.H., and Anversa, P. (1998). Pacing-induced heart failure in dogs enhances the expression of p53 and p53-dependent genes in ventricular myocytes. Circulation 97, 194203.
Li, J. and Eastman, A. (1995). Apoptosis in an interleukin-2-dependent cytotoxic T lymphocyte cell line is associated with intracellular acidification. J. Biol. Chem. 270, 3203-3211.
173
Luca, P.D., Mujello, B., and Lania, L. (1996). Sp3 represses transcription when tethered to
promoter DNA or targeted to promoter proximal RNA. J. Biol. Chem. 271, 8533-8536. MacLellan, W.R. and Schneider, M.D. (1997). Death by design: programmed cell death in cardiovascular biology and disease. Circ. Res. 81, 137-144. Majello, B., Luca, P.D., and Lania, L. (1997). Sp3 is a bifunctional transcription regulator with modular independent activation and repression domains. J. Biol. Chem. 272, 40214026. Mallat, Z., Tedgui, A., Fontaliran, F., Frank, R., Durigon, M., and Fontaine, G. (1996). Evidence of apoptosis in arrhythmogenic right ventricular dysplasia. N. Engl. J. Med. 335, 1190-1196. Max-Audit, I., Eleouet, J., and Romeo, P. (1993). Transcriptional regulation of the pyruvate kinase erythroid-specific promoter. J. Biol. Chem. 268, 5431-5437.
Misao, J., Hayakawa, Y., Ohno, M., Kato, S., Fujiwara, T, and Fujiwara, H. (1996). Expression of bcl-2 protein, an inhibitor of apoptosis, and Bax, an accelerator of apoptosis, in ventricular myocytes of human hearts with myocardial infarction. Circulation. 94, 1506-1512.
Narula, J., Haider, N., Virmani, R., DiSalvo, T.G., Kolodgie, F.D., Hajjar, R.J., Schmidt, Y., Semigran, M.J., Dec, G.W., and Khaw, B.-A. (1996). Apoptosis in myocytes in end-stage heart failure. N. Engl. J. Med. 1182, 1182-1189.
Olive, M.R., Peacock, W.J., and Dennis, E.S. (1991). The anaerobic response element contains two GC-rich sequences essential for binding a nuclear protein and hypoxic activation of the maize A d h l promoter. Nucl. Acids. Res. 19, 7053-7060. Olivetti, G., Quaini, F., Sala, R., Lagrasta, C., Corradi, D., Bonacina, E., Gambert, S.R.,
Cigola, E., and Anversa, P. (1994). Acute myocardial infarction in humans is associated with activation of programmed myocyte cell death in the surviving portion of the heart. J.
Mol. Cell Cardiol. 28, 2005-2016. Olivetti, G., Abbi, R., Quaini, F., Kajstura, J., Cheng, W., Nitahara, J.A., Quaini, E., Di Loreto, C., Beltrami, C.A., Krajewski, S., Reed, J.C., and Anversa, P. (1997). Apoptosis in the failing human heart. N. Engl. J. Med. 336, 1 1 3 1 - 1 1 4 1 . Perez-Sala, D., Collado-Escobar, D., and Mollinedo, F. (1998). Intracellular alkalinization suppresses lovaststin-induced apoptosis in HL-60 cells through the inactivation of a pHdependent endonuclease. J. Biol. Chem. 270, 6235-6242. Robin, E.D., Murphy, B.J., and Theodore, J. (1984). Coordinate regulation of glycolysis by hypoxia in mammalian cells. J. Cell Physiol. 118, 287-190. Saraste, A., P u l k k i , K., Kallajoki, M., Henriksen, K., Parvinen, M., and Voipio-Pulkki, L.M.
(1997). Apoptosis in human acute myocardial infarction. Circulation 95, 320-323. Semenza, G.L., Jiang, B., Leung, S.W., Passantino, R., Concordet, J., Maire, P., and
Giallongo, A. (1996). Hypoxia Response Elements in the Aldolase A, Enolase 1, and Lactate Dehydrogenase A Gene Promoters Contain Essential Binding Sites for Hypoxia I n d u c i b l e Factor-1. J. Biol. Chem. 271, 32529-32537. Srinivas, V., Zhu, X., Salceda, S., Nakamura, R., and Caro, J. (1998). Hypoxia-inducible factor-1 (HIF-1) is a non-heme iron protein. Implications for oxygen sensing. J. Biol. Chem. 273, 18019-18022. Swan, H.J.C. (1990). Pathophysiology of Myocardial Infarction and Ischemia. Baylor Cardiology Series 13, 5-9. Teiger, E., Than, V.D., Richard, L., Wisnewsky, C., Tea, B.S., Gaboury, E., Tremblay, J., Schwartz, K., and Hamet, P. (1996). Apoptosis in pressure overload-induced heart hypertrophy in the rat. J. Clin. Invest. 97, 2891-2897.
174
Thompson, C.B. (1995). Apoptosis in the pathogenesis and treatment of disease. Science 267, 1456-1462. Webster, K.A. (1987). Regulation of glycolytic enzyme RNA transcriptional rates by oxygen availability in skeletal muscle cells. Mol. Cell. Biochem. 77, 19-28. Webster, K.A. and Murphy, B.J. (1988). Regulation of tissue-specific glycolytic isozyme genes: coordinate regulation by oxygen availability in skeletal muscle cells. Can. J. Zool. 66, 1046-1058.
Webster, K.A., Gunning, P.W., Hardeman, E., Wallace, D.C., and Kedes, L.H. (1990). Coordinate reciprocal trends in glycolytic and mitochondrial transcript accumulations
during the in vitro differentiation of human myoblasts. J. Cell. Physiol. 142, 566-573. Webster, K.A. and Bishopric, N.H. (1992). Molecular Regulation of Cardiac Myocytc Adaptations to Chronic Hypoxia. J. Mol. Cell. Cardiol. 24, 741-751. Webster, K.A., Discher, D., and Bishopric, N.H. (1993). Induction and nuclear accumulation of fos and j u n proto-oncogenes in hypoxia cardiac myocytes. J. Biol. Chem. 268, 1685216859. Webster, K.A., Discher, D., and Bishopric, N.H. (1994). Cardioprotection in an in vitro model of hypoxic preconditioning. J. Mol. Cell. Cardiol. (in press) Webster, K.A., Discher, D.J., and Bishopric, N.H. (1997). Early cardiac myocyte responses to hypoxia, ischemia, and rcoxygenation. Acta Andina VI, 89-107. Webster, K.A., Discher, D.J., Hernandez, O., Kaiser, S., Sato, B., and Bishopric, N.H. (1999). Hypoxia activated apoptosis of cardiac myocytes requires a pH shift and is independent of p53. Miami Nature Biotechnology Short Reports. 10, 124. Yeung, A.C., Raby, K.E., Ganz, P., and Selwyn, A.P. (1992). New Insights into the Management of Myocardial Ischemia. Am. J. Cardiol. 70, 8G-13G. Youssoufian, H. (1994). Furhter characterization of Cis-acting regulatory sequences in the genomic locus of the murine crythropoietin receptor: Evidence for stage-specific regulation. Blood 83, 1428-1435.
175
This page intentionally left blank.
Mitochondrial-Nuclear Crosstalk is Involved in Oxygen-Regulated Gene Expression in Yeast Robert O. Poyton and Christopher J. Dagsgaard Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, CO 80309
Key words:
Mitochondria, Oxygen Sensing, Yeast, Gene Expression
Abstract:
The expression of several oxygen-regulated nuclear genes in the yeast Saccharomyces cerevisiae is affected by the mitochondrion. Recent evidence suggests two levels of mitochondrial involvement. On the one hand, mitochondrial respiratory function is essential for the anoxic induction of some hypoxic genes. On the other hand, the mitochondrial genome itself functions independently of its respiratory function, in the optimal expression of some aerobic genes. These findings suggest that the mitochondrion release at least two types of 'signals' that function in the expression of oxygen-regulated
genes.
1.
INTRODUCTION
Oxygen has a profound effect on the expression of a number of nuclearencoded genes in yeast and other eucaryotes (Bunn and Poyton 1996). The expression of some of these genes is up-regulated by the presence of oxygen while the expression of others is down-regulated. In the yeast Saccharomyces cerevisiae those genes that are transcribed optimally in the presence of air are referred to as aerobic genes, while those genes that are transcribed optimally under anoxic or micro-aerophilic conditions are referred to as hypoxic genes.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
177
1.1
Yeast Cells Can Adapt to Growth in A Wide Range of Oxygen Concentrations
As a facultative anaerobe S. cerevisiae cells can grow under normoxic or anoxic conditions and at any oxygen concentration in between.
In the
presence of air yeast cells increase their respiratory functions, repress their fermentative enzymes, and rely heavily on oxidative phosphorylation for their ATP production. In the absence of oxygen yeast cells de-repress these fermentative enzymes, increase glycolytic flux, and support their energy needs by fermentation. The expression of both aerobic and hypoxic genes is important for growth in different oxygen environments and during transitions from one oxygen environment to another. The expression of both aerobic and hypoxic genes is determined by the actual concentration of oxygen and not merely its presence or absence (Burke et al. 1997). Moreover, the dose-response curves
relating the steady state mRNA levels from these genes to oxygen concentration are complex. They are composed of two phases separated by a threshold between 0.25 and 0.5 When yeast cells are shifted from normoxic to anoxic conditions aerobic genes are up-regulated while hypoxic genes are down-regulated. Conversely, when they are shifted from anoxic to normoxic conditions hypoxic genes are down-regulated and aerobic genes are up-regulated. Recently, Burke et al. (1997) and Kwast et al. (1999) have followed the kinetics of transcript appearance or disappearance of several aerobic genes (COX4, COX5a, COX6, COX7, COX8, COX9, CYC1, T1F51A, and AAC2) and hypoxic genes (COX5b, CYC7, OLE1, ANB1, AAC3, HEM13, ERG11, and CPR1) during these shifts. Results from these studies have revealed that: 1) the induction of aerobic genes is rapid compared to hypoxic genes, 2) hypoxic genes are induced with widely variant kinetics, and 3) transcripts from both aerobic and hypoxic genes decline rapidly when cells are shifted to oxygen concentrations that are sub-optimal for their transcription. Transcript levels from both aerobic and hypoxic genes decline exponentially at rates that are faster than expected if transcript synthesis is halted immediately after the shift and transcript levels decrease simply because of mRNA dilution. These later findings indicate that transcripts from both aerobic and hypoxic genes are actively degraded at oxygen concentrations that are sub-optimal for their expression. Together, these findings serve to illustrate that yeast cells are highly adaptable to growth in markedly different oxygen concentrations and that a large part of this adaptability is attributable to changes in the oxygenregulated expression of several aerobic and hypoxic nuclear genes.
178
1.2
Mitochondrial Involvement in Oxygen-Regulated Expression of Nuclear Genes
There is growing evidence that the mitochondrion is intimately involved in the expression of both aerobic and hypoxic genes in yeast. Recent evidence suggests at least two levels of mitochondrial involvement in the expression of oxygen-regulated genes in the yeast cell's nucleus. First, the mitochondrial respiratory chain and its respiratory function are important for the anoxic induction of some nuclear-encoded hypoxic genes (Kwast et al. 1999). Second, the mitochondrial genome, acting independently of respiratory function, is required for the optimal expression of some nuclearencoded aerobic genes (for review see Poyton and McEwen 1996). In the following two sections we discuss evidence for each type of mitochondrial involvement in the expression of oxygen-regulated nuclear genes.
2.
INVOLVEMENT OF RESPIRATION IN THE INDUCTION OF SOME HYPOXIC GENES
Recently, we have reported that carbon monoxide (CO) affects the induction of a subset of hypoxic genes in yeast (Kwast et al. 1999). It completely inhibits the induction of OLE1 and CYC7 and partially inhibits the induction of COX5b. CO has no effect on the induction of the other
seven hypoxic genes examined (HEM13, HMG1, HMG2, ERG11, CPR1(NCP1), ANB1, and AAC3) OLE1 and CYC7 are also induced in aerobic cells by cobalt, a transition metal which when incorporated into heme affects its ability to bind oxygen (see Kwast et al. 1999). Together, these findings are similar to those obtained with mammalian cells (Goldberg et al. 1988; Goldberg and Schneider 1994) and suggested that the redox state of a hemoprotein is involved in controlling the expression of at least two hypoxic genes. By using mutants deficient in each of two major yeast CObinding hemoproteins (cytochrome c oxidase and flavohemoglobin), we found that cytochrome c oxidase but not flavohemoglobin is required for the anoxic induction of OLE1 and CYC7. To further address how cytochrome c oxidase is implicated in the induction of these hypoxic genes we examined the expression of OLE1 and CYC7 in a strain, that is respiration deficient (Table 1). Importantly, this strain is isogenic with the nuclear genome of JM43 but lacks a mitochondrial genome. These studies provide two important insights. First, the anoxic induction of both OLE1 and CYC7 is blocked in cells. Second, the level of expression of OLE1 in aerobic
179
cells is two-fold higher than it is in JM43, the wild type strain that contains a mitochondrial genome. Because cells lack a mitochondrial genome as well as a functional respiratory chain this finding can be interpreted in one of two ways. Either the mitochondrial genome itself is essential for the anoxic induction of OLE1 and CYC7 and suppresses the aerobic expression of OLE1 or it is the lack of the respiratory chain and respiration that is responsible. To decide between these possibilities we used two different approaches to block respiration in cells that have a mitochondrial genome. First, we added the respiratory inhibitor antimycin A to JM43 cells at a concentration that completely blocks cyanide-sensitive (i.e., mitochondrial) respiration (Table 1). Second, we used a respiratory-deficient mutant strain, aM7-40-5B, that carries a missense mutation in the mitochondrial cytochrome b gene but which otherwise has a fully functional mitochondrial genome. This strain also lacks cyanide-sensitive respiration (Table 1). From Figure 1 it is clear that the expression patterns seen with JM43 incubated with antimycin A and in strain aM7-40-5B are similar to that seen in In both cases the level of expression in the absence of mitochondrial respiration is increased relative to JM43, the respiratoryproficient wild type strain, and there is no induction of either OLE1 or CYC7 under anoxic conditions. These results are similar to those reported for JM43-GD5ab, a cytochrome c oxidase respiratory-deficient strain (Kwast et al. 1999) that lacks respiration but which has a wild-type mitochondrial genome. Together, these findings indicate that it is the respiratory function of the mitochondrion and not the mitochondrial genome per se that is essential for the induction of OLE1 and CYC7 under anoxic conditions and the up-regulation of OLE1 under normoxic conditions.
The up-regulation of OLE1 in normoxic cells and in normoxic JM43 cells poisoned with antimycin A is also interesting because it implies that this hypoxic gene, like several aerobic genes, is under the control of the retrograde regulation pathway (Butow 1988; Liao and Butow 1993) by which mitochondria signal to the nucleus their level of energy production. Like OLE1, aerobic nuclear genes that are regulated by this pathway are upregulated in cells and in the presence of respiratory inhibitors like
180
antimycin A (Liao et al. 1991). In addition, this finding raises the possibility that the retrograde regulation pathway also functions in the anoxic induction of OLE1.
3.
THE MITOCHONDRIAL GENOME IS ESSENTIAL FOR OPTIMAL EXPRESSION OF SOME AEROBIC GENES.
To ask if the mitochondrion is involved in the expression of oxygenregulated aerobic nuclear genes in S. cerevisiae, we compared the levels of the mRNAs encoded by COX4, COX5a, COX6, COX8, and COX9 in the same set of iso-chromosomal wild type and mitochondrial genome deficient strains used for the above studies. From Northern blot analysis of poly RNA from JM43 and cells it is clear that the steady state levels of mRNA from all five of these genes is reduced in cells (Figure 2). In contrast, the steady state levels of the mRNA
181
from the yeast actin gene, ACT1, are similar in JM43 and cells. When normalized to the actin transcript, the levels of all five COX transcripts are reduced (Table 2). Although it has been reported previously that COX6 mRNA levels increase in cells (Parikh et al. 1987) the authors appear to have mistaken the mRNA from an open reading frame, ORF-D,
that lies immediately downstream of COX6 (Wright et al, 1989), for that of COX6 mRNA (Trawick, Farrell, and Poyton in preparation).
As mentioned in the previous section JM43 cells differ from
cells
both genotypically and phenotypically; they lack a mitochondrial genome
and are respiration-deficient. To determine if it is the absence of the mitochondrial genome or the absence of respiration that leads to the downregulation of the nuclear COX genes, we analyzed the levels of their mRNA in two different respiratory-deficient mutants that carry mutations on their mitochondrial DNA; aM7-40-5B, the cytochrome b mutant used above, and aM10-150-4D, a cox1 mutant that does not produce cytochrome c oxidase subunit I (Bonitz et al,1980). Both mutants retain a mitochondrial genome, carry missense mutations in their respective mitochondrial genes, and are respiratory-deficient (Table 1). The levels of transcripts from COX4, COX5a, COX6, COX8, and COX9 in both respiration-deficient mutants are equivalent to those levels observed in JM43, when normalized to the ACT1
transcript (Figure 2 and Table 2). Similar results were obtained with respiration-deficient mutants that result from deletions in nuclear genes (Trawick, Kraut, and Poyton in preparation). Thus, a deficiency in respiration can not explain the decrease in COX4, COX5a, COX6, COX8, and COX9 mRNA levels in cells. Instead, this decrease in gene
182
expression is attributable to the lack of a mitochondrial genome. The involvement of the mitochondrial genome per se in the expression of these nuclear genes implies that one or more mitochondrial genes are required.
4.
CONCLUSION
The results presented here serve to illustrate that the mitochondrion can affect the expression of oxygen-regulated yeast nuclear genes in two fundamentally different ways. In the first, mitochondrial respiratory function is essential for the induction of some hypoxic genes, as cells are shifted from normoxic to anoxic conditions (Kwast et al. 1999). It will be interesting to determine whether the retrograde regulation pathway, by which yeast cells sense the energy state of their mitochondria (Butow 1988), is involved in this induction. In the second, the mitochondrial genome per se
is essential for optimal expression of aerobic genes under normoxic conditions. We refer to this a intergenomic signalling (Poyton and McEwen 1996). It should be emphasized that intergenomic signalling and retrograde regulation differ in three important ways. First, nuclear genes are downregulated in the absence of a mitochondrial genome, via intergenomic signalling. Second, nuclear genes are up-regulated by the lack of respiration, via retrograde regulation. Third, intergenomic signalling affects expression of nuclear genes for mitochondrial proteins whereas retrograde regulation does not. The finding that the transcription of several nuclear genes is influenced by mitochondrial respiration or by the presence of a mitochondrial genome, while other nuclear genes, like ACT1, are unaffected implies that the mitochondrion sends "signals" to specific nuclear genes. It seems likely that different "signals" are involved in signalling the level of mitochondrial respiration than are involved in signalling the presence or absence of the mitochondrial genome. It is not known if these "signals" are exported mitochondrial macromolecules (e.g., proteins, peptides, or RNA), metabolites, reactive oxygen species, or the products of a mitochondrial
183
signal transduction system. More study is required to decide between these possibilities.
ACKNOWLEDGEMENTS This work was supported by grant HL63324 from the National Institutes of Health. The authors wish to thank Drs. John Trawick and Norbert Kraut, and Lynn Farrell for preliminary studies that formed the basis for some of the work reported here.
REFERENCES Bonitz, S.G., Coruzzi, G., Thalenfeld, B.E., Tzagoloff, A. and Macino, G., 1980, Assembly of the mitochondria membrane system. Physical map of the oxi3 locus of yeast mitochondria DNA.. J. Biol. Chem. 255: 11922-11926. Bunn, H.F. and R. O. Poyton, 1996, Oxygen sensing and molecular adaptation to hypoxia. Physiol Rev. 76: 839-885.
Burke, P.V., Raitt, D., Allen, L.A., Kellogg, E.A., and Poyton, R.O., 1997, Effects of oxygen
concentration on the expression of cytochrome c and cytochrome c oxidase genes. J. Biol. Chem. 272: 14705-14712. Butow, R.A., 1988, A path from mitochondria to the nucleus. Philos. Trans. R. Soc. London B Biol.Sci. 319(1193): 127-133. Goldberg, M.A., Dunning, S.P., and Bunn, H.F., 1988, Regulation of the erythropoietin gene: evidence that the oxygen sensor is a heme protein. Science 242: 1412-1415. Goldberg, M.A., and Schneider, T.J., 1994, Similarities between oxygen-sensing mechanisms regulating the expression of vascular endothelial growth factor and erythropoietin. J. Biol. Chem. 269: 4355-4359. Kwast, K..E., Burke, P.V., Staahl, B.T., and Poyton, R.O., 1999, Oxygen sensing in yeast: evidence for the involvement of the respiratory chain in regulating the transcription of a subset of hypoxic genes. Proc. Natl. Acad. Sci. USA 96: 5446-5451. Liao, X.S. and Butow, R.A., 1993, RTG1 and RTG2: two yeast genes required fora novel path of communication from mitochondria to the nucleus. Cell 72: 61-71. Liao, X.S., Small, W.C., Srere, P.A., and Butow, R.A., 1991, Intramitochondrial functions regulate nonmitochondrial citrate synthase (CIT2) expression in Saccharomyces cerevisiae. Mol. Cell. Biol. 11:38-46. Parikh, V.S., Morgan, M.M., Scott, R., Clements, L.S., and Butow, R.A., 1987, The mitochondrial genotype can influence nuclear gene expression in yeast. Science 235: 576580. Poyton, R.O., and McEwen, J.E., 1996, Crosstalk between nuclear and mitochondria genomes. Ann. Rev. Biochem. 65: 563-607. Wright, R.M., Rosenzweig, B. and Poyton, R.O., 1989, Organization and expression of the COX6 gene locus in Saccharomyces cerevisiae: multiple mRNAs with different 3' termini are transcribed from COX6 and regulated differentially. Nucl. Acids, Res. 17: 1103-1120.
184
ROX1 MEDIATED REPRESSION Oxygen dependent repression in yeast
Alexander J. Kastaniotis and Richard S. Zitomer Dept. Biol. Sci., University at Albany, SUNY
Keywords: Abstract
Saccharomyces cerevisiae, ROXl, HAPI, Ssn6/Tupl, repression, Heme For a large number of oxygen-regulated genes in the facultative aerobe, Saccharomyces cerevisiae, the presence of oxygen is sensed through the ability to use oxygen for heme biosynthesis. Heme induces the transcription of oxygeninduced genes and represses the transcription of hypoxic genes. Repression is mediated by the Rox1 protein in conjunction with the Ssn6/Tupl general repression complex. The differential repression of hypoxic genes results from a combination of the tightness of Rox1 binding to the regulatory region of specific hypoxic genes and the presence or absence of binding sites for Mot3 which enhances Rox1 repression.
1. INTRODUCTION Unlike mammalian cells, yeast is capable of growing in the total absence of molecular oxygen, provided sterols and unsaturated fatty acids, which require oxygen for their synthesis, are abundant (Andreasen and Stier, 1953; 1954). In hindsight, it is therefore not surprising that the sensing and response mechanisms to low oxygen levels that evolved in yeast are quite different from the ones observed in mammalian cells (Wang and Semenza, 1993; Maxwell et al., 1999). Below, we describe the well characterized pathway of Rox1 mediated hypoxic gene repression in S. cerevisiae.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
185
2. HEME REGULATION 2.1. Aerobic and Hypoxic genes Oxygen regulated genes fall into two groups: Oxygen activated and oxygen repressed (hypoxic) genes. The former group, the majority of whose members encode functions involved in respiration, heme, sterol and fatty acid synthesis and protection from oxidative stress, is highly expressed in the presence of oxygen. Hypoxic genes are fully expressed when oxygen concentrations become limiting, and they fall into two regulatory classes. The products of some hypoxic genes such as HEM13, ERG11 and OLE1, which utilize oxygen as a substrate, are needed even under aerobic conditions and are therefore not fully repressed in the presence of oxygen. Other hypoxic genes actually possess aerobic counterparts, which allow a tighter control of expression. Transcripts of these genes are virtually undetectable under aerobic conditions. The best characterized pathway of oxygen sensing is mediated via cellular heme levels. The biosynthesis of heme requires molecular oxygen in two consecutive steps (Labbe-Bois and Labbe, 1990), and limiting oxygen levels in the environment are reflected by lowered heme levels in the cell. The principal
2.2. Roxl
186
player in heme level sensing is the Hap1 protein, a zinc finger DNA binding protein. Under aerobic conditions, when heme levels are high, Hap1 binds heme in its central region and activates transcription of the aerobic genes via its C-terminal activation domain (Zhang and Guarente, 1994). In a hypoxic environment, additional proteins are associated with the bound Hap1 protein, forming a large complex that represses transcription (Fig.1) (Zhang and Guarente, 1996, Fytlovich et al., 1993). Among the Hap1 regulated genes is ROX1, encoding the represser of one class of hypoxic genes (Fig.l). Constitutive expression of hypoxic genes in a rox1 deletion strain illustrates that Rox1 indeed functions as a represser (Lowry and Zitomer, 1988). It has been shown that heme is only required for transcription of ROX1, but not for Rox1 function, as Rox1 expression from a heterologous promoter will result in heme- independent repression (Keng, 1992). 2.2.1. Rox1 structure and DNA binding
The Rox1 protein can be divided into an N-terminal DNA-binding domain, a glutamine run of unknown function, and a C-terminal repression domain (Balasubramanian et al., 1993; Deckert et al, 1995b). The DNA-binding domain, which extends from residues 1 to 100, comprises an HMG (high mobility group) DNA-binding motif. HMG-containing proteins bend DNA at sharp angles and are considered architectural proteins. There are two general classes, those that bind specific DNA sequences and those that bind DNA non-specifically. The Rox1 DNA-binding domain falls into the first class and is closely related to HMG-domains of the mammalian SRY/Sox proteins. The structure of the SRY HMG domain bound to DNA has been determined by NMR (Werner et al., 1995), and it is likely that the structure of the Rox1 HMG-domain is very similar. Extensive mutational analysis of Rox1 showed that changes in residues that are conserved between Rox1 and SRY cause loss or weakened Rox1 binding of DNA (Deckert et al, 1999). The Rox1 target site was identified by inspection and comparison of regulatory sequences of four hypoxic genes. The sequence found, rendered a reporter gene subject to repression by Rox1 (Lowry et al., 1990). Subsequent gel retardation experiments using the
Rox1 HMG domain expressed in and purified from E.coli showed that the protein bound the target site with a dissociation constant of 20nM (Balasubramanian et al., 1993, Deckert et al., 1998). The internal bases were designated the core sequence since it is the most highly conserved
187
part of the Rox 1 consensus site. Mutation of any of the bases in the central bases resulted in reduced binding by 10-30 fold. In other positions, some alterations are tolerated. For instance, a T in position or a C in position only cause about a four-fold decrease in binding affinity. It is worthwhile noting that the core sequence TTTGTT is a preferred target for the HMG proteins LEF-1, TCF-1 and Stel 1 (Giese et al., 1992; Van der Wetering and Clevers, 1992), and this sequence appears in the upstream region of some Rox1 regulated genes, as does the sequence ATTGTC (Table 1). Rox1, like SRY, bends DNA at an angle of about (Deckert et al., 1995). The Rox1 C-terminal amino acids 123-368 constitute a repression domain. Deletion analysis suggests that there are at least two domains each of which can function independently. Deletion of either region (residues 100-247 or 246-368) does not drastically affect repression, while deletion of the entire C-terminus results in a protein that is unable to repress, although it still binds DNA. It has also been shown that either region (amino acids 124-247 or 246-368) reconstitutes a functional represser when fused to the Gal4 DNA binding domain (Deckert et al., 1995b). Surprisingly, there is no apparent sequence similarity between these two subdomains. Both are thought to provide surfaces for interaction with the Tup1/Ssn6 general yeast repression complex.
2.2.2. Requirement of Tup1/Ssn6 for Rox1-mediated repression Rox1 binding to its target sequence is not sufficient to cause repression of hypoxic genes, but repression requires the presence of the Tup1/Ssn6 complex (Fig1). This complex constitutes a general repression module utilized in a variety of regulons including a mating type genes (Keleher et al.,1992), catabolite repressed genes (Schultz and Carlson, 1987), DNA repair (Elledgeetal., 1993) and flocculence genes (Fujita et al., 1990). The Ssn6/Tup1 repression complex interfaces with its targets by binding to specific DNA-binding represser proteins. This strategy leaves opportunity for modular evolution; when there is a need for repression, the only new factor needed is a specific DNA binding module that will recruit the already existing repression module to its site of action (see Carrico and Zitomer, 1998). It appears that similar repression complexes exist in mammals and are therefore well conserved throughout evolution (Palparti et al., 1997; Grbavec et al., 1999).
188
189
The Tup1/Ssn6 complex consists of one Ssn6 and three or four Tupl monomers (Varanasi et al,1996; Redd et al, 1997). Tup1 appears to carry the actual represser function, as it is able to repress in the absence of Ssn6 when fused to a LexA DNA binding domain that binds to the promoter of a reporter gene. Similar experiments suggest a role for Ssn6 as an adapter for Tup1 (Keleher et al, 1992). While Ssn6 is a large protein of 966 amino acids, only the N-terminal third is absolutely required for function. Residues 46-398 form 10 TPR (tetratricopeptide) repeats that are thought to provide specific surfaces for interaction with other proteins (Sikorski et al., 1990, Goebl and Yanagida, 1991). Tupl/1sn6 interaction is mediated by repeats 1-3, while Rox1 interaction occurs through repeats 4-7 (Tzamarias and Struhl, 1995). The 713 amino acid protein Tup1 can be divided into three domains. Mutational analysis (Carrico and Zitomer, 1998) and deletion studies (Tzamarias and Struhl, 1994) have shown that residues 1-72 are required for Tup1 multimerization and interaction with Ssn6. The central part, consisting of amino acids 73- 385, had been shown to interact with the N-termini of Histones H3 and H4 (Edmondson et al., 1996), while the carboxy terminus harbors six WD repeats (containing
tryptophan/aspartic acid residues in
characteristic positions). Analyses of point mutations in the WD repeats suggest that distinct repeats mediate repression of distinct regulons. (Carrico and Zitomer, 1998; Komachi and Johnson, 1997). Repression by the Tup1/Ssn6 is proposed to be mediated by interaction the RNA polymerase II (Herschbach et al., 1994) and with nucleosomes (Shimizu et al., 1991, Cooper et al., 1994, Roth et al., 1992, Roth 1995, Edmondson et al, 1996), but recent data argues against an important role on the regulation of several hypoxic genes (Deckert et al., 1998).
2.2.3. ROX1 autoregulation The gene products of a subset of the hypoxic genes are required at moderate levels even under aerobic conditions. In these cases, partial repression seems to be accomplished through lower affinity Rox1 binding sites in the regulatory region. This strategy calls for a tight control of Rox1 levels, as a high concentration would lead to permanent occupation of even the low affinity sites. On the other hand, sufficient Rox1 is required in the nucleus to prevent expression of genes that must be completely repressed. Maintaining this delicate balance is achieved by negative feedback of Rox1 on its own
190
expression (Fig.1). There are two Rox1 binding sites upstream of the ROX1 TATA box, one of which is a low affinity site which would remain mostly unoccupied when Rox1 levels are low, resulting in higher transcriptional rates from the ROX1 promoter. When Rox1 is too abundant, even the low affinity site would be bound by the protein, and transcription rates would be reduced. That Rox1 indeed represses its own transcription has been demonstrated by showing that ROX1 mRNA levels are dramatically increased in strains harboring a non-functional mutant of roxl (Deckert et al., 1995a). The Rox1 protein is also rapidly degraded to afford a rapid response to hypoxia (Zitomer et al., 1997) 2.3. ANB1 regulation - a paradigm for Rox1-mediated repression ANB1 encodes an essential protein, eIF-5A, but has an aerobic counterpart, TIF51A, that allows for tight repression of the ANB1 gene in the presence of oxygen, rendering it an ideal subject for studies of cis-acting repression elements. Rox1-dependent repression is mediated through four Rox1-binding sites in the ANB1 upstream region (Fig.2). These sites can be grouped into two operators, OpA (from -316 to -274 relative to the ANB1 start codon) and OpB (from -218 to -186). These four sites exert more than 260-fold repression on an ANB1/lacZ reporter construct (Deckert et al., 1998). In order to dissect out the relative contributions of the two operators and the individual Rox1 binding sites, we recently conducted several deletion and operator swap experiments in the ANBI/lacZ construct (Deckert et al., 1998). There is no directional requirement for the proper functioning of the operators, as they are able to exert repression in either orientation (A.J. Kastaniotis and R.S. Zitomer, unpublished data), and accordingly the Rox1 binding site can be found in both orientations in the regulatory region of hypoxic genes. In addition, the helical phasing of sites is not essential (Deckert et al., 1998). Deletion of either the A or B operator revealed that the bulk of repression activity is mediated by the OpA. In an OpB deletion, galactosidase expression was still 76 fold repressed, while deletion of OpA resulted in a reduction of repression to about six fold. This result was surprising, because the Rox1 core binding sites in both operators are equivalent and bind Rox1 in vitro with similar affinities. The difference between OpA and OpB is that the two Rox1 sites in OpB act additively, while those in OpA act synergistically. The most conspicuous physical differences between the two operators are the distance between the two Rox1 binding sites and the distance of the operators
191
to the TATA box. A deletion of 10 bp in the sequence intervening the OpA Rox1 sites resulted in loss of synergistic repression of the two sites. The insertion of 10 bp into the B operator, however, did not improve OpB repression ability. Transplanting OpB into the location of the A operator also did not improve OpB performance, while in the reverse experiment (OpA in the OpB position), OpA still repressed strongly. These experiments pointed to something intrinsic to the OpA sequence between the Rox1 sites that makes it a strong repression element (Deckert et al., 1998). The sequence GTTGCCT can be found just 3’ to the 5’ Rox1 binding site in OpA and is also present and closely associated with Rox1 binding sites in COX5b and AAC3 (Sabova et al., 1993). There are a similar sequences in the regulatory regions of other hypoxic genes. The sequence had been noted previously (Lowry et al., 1990; Mehta and Smith, 1989), but largely ignored due to the overpowering effect of the Rox1 binding sites. The 10 bp deletion in the A operator described above changes the last bp of this sequence. We generated point mutations in this site and inserted a wild type copy into the OpB site to confirm that this sequence promotes synergism between two Rox1 binding sites (A.J. Kastaniotis and R.S Zitomer, unpublished). Recently, we
were alerted to a possible role of an additional factor involved in ANB1 repression, Mot3, that is shared with an alternate hypoxic repression mechanism that controls the expression of the DAN 1 gene (Sertil et al., 1997; Charles V. Lowry, personal communication). The Mot3 protein contains two zinc finger DNA binding domains and binds the sequence T(G/A)CCT(A/T/G) (Grishin et al., 1998; Madison et al., 1998), similar to the sequence in OpA. We have demonstrated that Mot3 binds to OpA, and that the synergy of the two
OpA Rox1 sites is lost in a mot3 deletion. We have also shown that the mot3 deletion results in reduced repression of other hypoxic genes. Thus, Mot3 promotes a synergistic interaction between Rox1 binding sites (Kastaniotis and Zitomer, unpublished). 192
REFERENCES Andreasen A, Stier T, 1953: Anaerobic nutrition of Saccharomyces cerevisiae. I. Ergosterol requirement for growth in defined medium. J. Cell Comp. Physiol 41: 23-36 Andreasen A, Stier T, 1954: Anaerobic nutrition for Saccharomyces cerevisiae. II. Unsaturated fatty acid requirement for growth in defined medium. J. Cell Comp. Physiol 43: 271-281 Balasubramanian B, Lowry CV, Zitomer RS, 1993: The Rox1 represser of the Saccharomyces cerevisiae hypoxic genes is a specific DNA-binding protein with a high-mobility-group motif. Mol. Cell. Biol. 13: 6071-6078 Bourot S, Karst F, 1995: Isolation and characterization of the Saccharomyces cerevisiae SUT1 gene involved in Sterol uptake. Gene 165: 97-102 CarricoPM and Zitomer RS, 1998: Mutational analysis of the Tup1 general represser of yeast. Genetics 148: 637-644
Cooper, Roth SY, Simpson RT, 1994: The global transcription regulators, Ssn6 and Tup 1, play distinct roles in the establishment of a repressive chromatin structure. Genes Dev. 8: 1400-1410 Deckert J, Perini R, Balasubramanian B, and Zitomer RS, 1995a: Multiple elements and auto-repression regulate Rox1, a repressor of hypoxic genes in Saccharomyces cerevisiae. Genetics 139: 1149-1158 Deckert J, Rodriguez Torres AM, Simon JT, and Zitomer RS, 1995b: Mutational analysis of Rox1, a DNA-bending repressor of hypoxic genes in Saccharomyces cerevisiae. Mol. Cell. Biol. 15: 6109-6117 Deckert J, Rodriguez Torres AM, Hwang SM, Kastaniotis AJ, and Zitomer RS, 1998: The anatomy of a hypoxic operator in Saccharomyces cerevisiae. Genetics 150: 1429-1441 Deckert J, Khalaf RA, Hwang S.M., and Zitomer RS, 1999: The characterization of the DNA binding and bending HMG-domain of the yeast hypoxic repressor Rox1. In revision for Nucleic Acids Res. Edmondson DG, Smith M and Roth SY, 1996: Repression domain of the yeast global repressor Tup1 interacts directly with histones H3 and H4. Genes Dev. 10: 1247 -1259 Elledge SJ, Zhou Z, Alien JB, and Navas TA, 1993: DNA damage and cell cycle regulation of ribonucleotide reductase. BioEssays 15: 333-339 Fujita A, Matsumoto S, Kuhara S, Misumi Y, and Kobayashi H, 1990: Cloning of the yeast SFL2 gene: Its disruption results in pleiotropic phenotypes characteristic for tup1 mutants. Gene 89: 93-99
Fytlovich, S, Gervais M, Agrimonti, C, and Guiard, B, 1993: Evidence for an interaction between Cyp1 (Hap1) activator and cellular factor during heme-dependent transcriptional regulation in the yeast Saccharomyces cerevisiae. EMBO J. 12: 1209-1218 Giese KJ, Cox and Grosschedl R, 1992: The HMG-domain of lymphoid enhancer factor 1 bends
DNA and facilitates assembly of functional nucleoporin structures. Cell 69: 185-195 Goebl M and Yanagida M, 1991: The TPR snap helix: A novel protein repeat motif from mitosis to transcription. TIBS 16: 173-177
Grbavec D, Lo R, Liu Y, Greenfield A, Stifani S, 1999: Groucho/transducin-like enhancer of split (TLE) family members interact with the yeast transcriptional co-repressor SSN6
and mammalian SSN6-related proteins: implications for evolutionary conservation of transcription repression mechanisms. Biochem. J. 337: 13-17
193
Grishin AV, Rothenberg M, Downs MA, and Blumer KJ, 1998: Mot3, a Zn finger transcription
factor that modulates gene expression and attenuates mating pheromone signaling in Saccharomyces cerevisiae. Genetics 149: 879-892 Herschbach BM, Arnaud MB, Johnson AD, 1994: Transcriptional repression directed by the yeast protein in vitro. Nature 370: 309-311
Keleher CA, Redd MR, Schultz J, Carlson M, and Johnson AD, 1992: Ssn6-Tupl is a general repressor in yeast. Cell 68: 709-719 Keng T, 1992: HAP1 and ROX1 form a regulatory pathway in the repression of HEM13 transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 12:2616-2632 Komachi K., and Johnson AD, 1997: Residues in the WD repeats of Tup1 are required for interaction with Mol. Cell. Biol. 17: 6023-6028 Labbe-Bois R and Labbe P, 1990: Tetrapyrole and heme biosynthesis in the yeast Saccharomyces cerevisiae. New York McGraw-Hill: In Biosynthesis of Heme and Chlorophylls (ed. Dailey HA): 235-285 Lowry CV and Zitomer RS, 1988: ROX1 encodes a heme-induced repression factor regulating ANB1 and CYC7 of Saccharomyces cerevisiae. Mol. Cell Biol. 8: 4651 -4658 Lowry CV, Cerdan ME, and Zitomer RS, 1990: A hypoxic consensus operator and a constitutive activation region regulate the ANB1 gene of Saccharomyces cerevisiae. Mol. Cell. Biol. 10: 5921-5926 Madison JM, Dudley AM, and Winston F, 1998 : Identification and analysis of Mot3, a zinc
finger protein that binds to the retrotransposon Ty long repeat (delta) in Saccharomyces cerevisiae. Mol. Cell. Biol. 18: 1879-1819
Maxwell PH, Wiesener MS. Chang GW, Clifford XC, Vaux EC, Cockman ME, Wykoff CC, Pugh CW, Maher ER, and Ratcliffe PJ, 1999: The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen -dependent proteolysis. Nature 399: 271 -275
Mehta KD and Smith M, 1989: Identification of an upstream repressor site controlling the expression of an anaerobic gene (ANB1) in Saccharomyces cerevisiae. J. Biol. Chew. 264: 8670-8675
Palpurti A, Baratz A, and Stifani S, 1997: The groucho/transducin-like enhancer of split transcriptional repressors interact with the genetically defined amino-terminal silencing domain of histone H3. J. Biol. Chem. 272: 26604-26610 Redd MR, Arnaud MB, and Johnson AD, 1997: A complex composed of Tup1 and Ssn6 represses transcription in vivo. J. Biol. Chem. 272: 11193-1197 Roth SY, Shimizu M, Johnson L, Grunstein M, and Simpson RT, 1992: Stable nucleosome
positioning and complete repression by the yeast a2 repressor are disrupted by aminoterminal mutations in histone H4. Genes Dev. 6: 411-425 Roth SY, 1995 : Chromatin mediated transcriptional repression in yeast. Curr. Opin. Gen. Dev. 5: 168-173 Sabova L, Zeman I, Supek F, and Kolarov J, 1993: Transcriptional control of AAC3 gene encoding mitochondrial ADP/ATP translocator in Saccharomyces cerevisiae by oxygen,
heme and ROX1 factor. Eur. J. Biochem. 213: 547-553 Schultz J, and Carlson, M, 1987: Molecular analysis of SSN6, a gene functionally related to the SNF1 kinase of Saccharomyces cerevisiae. Mol. Cell. Biol. 7: 3637-3645
Sertil O, Cohen BD, Davies KJA and Lowry C, 1997: The DAN1 gene of S. cerevisiae is regulated in parallel with the hypoxic genes, but by a different mechanism. Gene 192: 199-205
194
Shimizu M, Roth SY, Szent-Gyorgyi C, Simpson RT, 1991: Nucleosomes are positioned with base pair precision adjacent to the operator in Saccharomyces cerevisiae. EMBO J. 10: 3033-3041 Sikorski RS, Boguski MS, Goebl M and Hieter, P, 1990: A repeating amino acid motif in CDC23 defines a family of proteins and a new relationship among genes required for mitosis and RNA synthesis. Cell 60: 307-317 Tzamarias D and Struhl K, 1994: Functional dissection of the yeast Cyc8-Tupl transcriptional co-repressor. Nature 369: 758-761 Tzamarias D and Struhl K, 1995: Distinct TPR motifs of Cyc8 are involved in recruiting the Cyc8-Tup1 corepressor complex to differentially regulated promoters. Genes Dev. 9: 821-831 van de Wetering M, and Clevers H, 1992: Sequence specific interaction of the HMG box proteins TCF-1 and SRY occurs within the minor groove of a Watson-Crick double helix. EMBO J. 1 1 : 3039-3044 Varanasi US, Klis M, Mikesell PB, and Trumbly, RJ, 1996: The Cyc8 (Ssn6)-Tup1 complex is composed of one Cyc8 and four Tup1 subunits. Mol. Cell. Biol. 16: 6707-6714 Wang GL, Semenza, 1993: General involvement of hypoxia-inducible factor 1 in transcriptional response to hypoxia. Proc. Natl. Acad. Sci. USA 90: 4304-4308 Werner MH, Huth JR, Gronnenborn AM, and Clore GM, 1995: Molecular basis of human 6X,Y sex reversal revealed from the three-dimensional solution structure of the human SRY-DNA complex. Cell 81: 705-713 Zhang L, and Guarente L, 1994: The yeast activator Hap1 -a Gal4 family member- binds DNA
in a direct repeat orientation. Genes Dev. 8: 2110-2119 Zhang L, and Guarente L, 1996: Hap1 is nuclear but is bound to a cellular factor in the absence of heme. J. Biol. Chem. 269: 14643-14647
ZitomerRS, Limbach MP, Rodriguez-Torres AM, Balasubramanian, B, Deckert J, and Snow, PM 1997: Aproaches to the study of Rox1 repression of the hypoxic genes in the yeast Saccharomyces cerevisiae. Methods 1 1 : 279-288
195
This page intentionally left blank.
OXYGEN DEPENDENCE OF EXPRESSION OF CYTOCHROME C AND CYTOCHROME C OXIDASE GENES IN S. CEREVISIAE
Patricia V. Burke and Kurt E. Kwast Department of Molecular and Integrative Physiology. University of Illinois, Urbana, IL
1.
INTRODUCTION Over the past 20 years we have made great strides in unraveling sensory
and signal transduction pathways in yeast. Classical genetic approaches identified many of the genes involved. With the advent of lacZ reporter constructs and maturation of the tools for molecular genetics, our knowledge increased rapidly. The last five years have seen another major shift: the yeast genome has been sequenced and major efforts are underway to survey genome-wide changes in the expression of both RNA and protein, and in protein modification in response to environmental and intracellular signals. With the opportunities offered by new experimental techniques and
computer analysis of the data available, we are reviewing the status of one segment of these sensory and signal transduction pathways: and carbon source regulation of cytochrome c and cytochrome c oxidase in yeast.
Although the proximal sensors for and glucose are not known, major transcription factors that control the expression of cytochrome c and cytochrome c oxidase include the Hap2/3/4/5 complex for glucose derepression, Hap1p (Cyp1p) for both aerobic activation and glucose
derepression, and Rox1p for aerobic repression. Other transcription factors
that have been implicated in regulating their expression include the glucose repressors Mig1p and Mig2p (Wu and Trumbly, 1998) and the stress activators Msn2p and Msn4p (Boy-Marcotte et al., 1998). Co-activators
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
197
include Cyc8p (Ssn6p) and Tup1p, as well as components of the various complexes associated with RNA polymerase II. Other components within the signal transduction pathways include Snf1p for glucose repression signaling, and possibly Cat8p, Sip4p, the cAMP-dependent protein kinase, and cAMP for glucose induction, stress signaling, and general coordination of signal transduction pathways. In addition, Ydj1p and Hsp82p are implicated as chaperones in Hap1 regulation (Zhang et al., 1998). Finally heme is intimately involved in sensing and signal transduction. There are several recent reviews (Zitomer et al., 1997a; Bunn and Poyton, 1996; Kwast et al., 1998) that address questions of regulation. Gancedo’s 1998 review of carbon regulation includes some of the pathways that appear to link carbon metabolism to and respiration. Here we focus on the known regulators of the genes for cytochrome c and cytochrome c oxidase to ask if these regulators are sufficient to explain changes in transcript levels as a function of both tension and time after shifting cells between aerobic and anaerobic conditions.
1.1
Interaction of carbon and oxygen control during normal, laboratory growth
Under normal culture conditions in the laboratory, cell number increases exponentially until glucose is exhausted and then more slowly until the resulting ethanol is exhausted (Monod, 1947). This massive change in metabolism from fermentation to respiration at the diauxic transition involves thousands of genes (DeRisi et al., 1997). In such a culture, as cell density increases glucose concentration and tension decline at different rates, generating a multitude of signals for the regulation of fermentativerespiratory growth. For a given strain, the pattern of gene expression during exponential growth on glucose is remarkably stable (DeRisi et al., 1997). Although the cellular response to a changing environment is robust, the multiply interconnected, regulatory pathways have been difficult to analyse. In an attempt to control the experimental system, the effects of carbon source on the regulation of growth and metabolism are usually studied by comparing growth on different sugars during early to mid-log growth phase (fermentative-respiratory growth) when other nutrients are not limiting. The assumption of a stable system, dependent on one major variable, is corroborated by the data of DeRisi et al. (1997), mentioned above. Similarly, in our studies of regulation, we chose to examine early-to-mid-log-phase cultures using galactose as the carbon source, which does not activate the major glucose-repression pathways and allows concomitant respiration and
198
fermentation. Under these conditions, (Burke et al., 1997).
1.2
becomes the limiting nutrient
Standard Model of Oxygen Sensing in Yeast
In a standard model for sensing in yeast (Zitomer et al., 1997a), cells use the level of heme to sense the molecular oxygen concentration, taking advantage of the requirement for heme biosynthesis. Heme is the effector, which controls the activity and/or cellular concentration of rram--acting factors that regulate gene expression. At _ tensions below the Km of the heme biosynthetic enzymes the heme precursor coproporphyrinogen III accumulates instead of heme (Labbe-Bois and Labbe, 1990). When the tension increases, heme is again synthesized.
Thus heme-dependent changes in expression should occur at tensions that are several orders of magnitude below the tension for air-saturated yeast media (about
Heme modulates the activity of the transcriptional activator Hap1p. Under heme-proficient conditions (e.g., aerobiosis) Hap1p activates a set of aerobic genes, whereas under heme-deficient conditions Hap1p may be a weak repressor of these same genes. One of the Hap 1 p-regulated aerobic genes is ROX1, which encodes a transcriptional repressor of hypoxic genes. Rox1p itself has no oxygen-dependent cofactors. Under heme-proficient conditions, Hap1p activates ROX1 transcription and Rox1p is available to
repress the transcription of hypoxic genes. When becomes limiting, heme synthesis ceases, Hap1p represses ROX1 transcription (Chantrel et al., 1998), Rox1p synthesis stops, and the protein decays rapidly (Zitomer et al., 1997b), resulting in derepression of the hypoxic genes and repression of the aerobic genes. Fine tuning of the response is accomplished by increased HAP1 expression in the absence of heme (Fytlovich et al., 1993), feedback inhibition of ROX1 by Rox1p (Deckert et al., 1995), and positive and negative effects of the Tup1p and Cyc8p (Ssn6p) corepressors on Hap1p and Rox1p (see Kwast et al., 1998). Oxygen and carbon source regulation are linked through the action of the Hap2/3/4/5 complex, a transcriptional activator for respiratory and Krebscycle genes as well as some others. Although the mechanism is not understood, the activity of this complex is heme dependent (Pinkham and Keng, 1994). Unlike Hap1p, however, the addition of heme does not affect in vitro binding of Hap2/3/4/5 to DNA sites. Glucose repression is probably regulated through HAP4, which is derepressed as glucose concentration falls (DeRisi et al., 1997). This may be mediated through the Snf1 kinase and the Mig1p and Mig2p repressors (Wu and Trumbly, 1998). Hap1p also mediates glucose derepression (Pinkham and Keng, 1994).
199
1.3
Variation of cytochrome c and cytochrome c oxidase mRNA levels as a function of oxygen tension
Any model of the regulatory pathways that control the expression of oxygen-responsive genes must explain steady-state levels of mRNA observed at different concentrations as well as temporal changes in their levels after cultures are shifted from air to nitrogen (aerobiosis to anaerobiosis) or from nitrogen to air. For example, data from several studies of cytochrome c and cytochrome c oxidase genes (Burke et al., 1997; Kwast et al., 1998, 1999; Kwast et al., in prep.) are summarized in Figure 1 and illustrate the following points. First, transcript levels of the aerobic genes COX4, COX6, COX7, COX8, and COX9 vary over a wide range of concentrations (Fig. 1A, solid line). Second, transcript levels of the aerobic isoforms COX5a and CYC1 decrease abruptly below 1 (Fig. 1A, long dashed lines), whereas their hypoxic isoforms COX5b and CYC7 increase (Fig. 1A short dashed lines, respectively). Third, after a shift from air to nitrogen, mRNAs for the aerobic genes decrease to new, lower steady state values (Fig. 1B, solid line). This decrease is greater and faster for COX5a and CYC1 than for the other aerobic genes (Fig. 1B, long dashed lines). Furthermore, mRNAs for the two hypoxic genes behave differently. COX5b increases slowly to a new steady state value over a period of hours while CYC7 does not increase until about 16 hours after the shift (Fig. 1B, short dashed lines). Fourth, after a shift from nitrogen to air mRNAs for the aerobic genes increase rapidly (Fig. 1C, solid line), with COX5a (Fig. 1C, long dashed line) and CYC1 (Fig. 1C insert, long dashed line) increasing more rapidly than the others. Again, the two hypoxic genes behave differently: COX5b decreases rapidly (Fig. 1C, short dashed line) whereas CYC7 increases dramatically before decreasing to steady state levels (Fig. 1C insert, short dashed line).
2.
COMPARING THE EXPERIMENTAL DATA AND THE MODEL
Aerobic COX genes and Hap2/3/4/5 The expression of these
genes is proportional to tension, yet neither Hap1p nor Rox1p is known to have any effect on the expression of aerobic COX genes. In fact difference spectra of a hap 1 delta strain reveals nearly wild-type levels of heme and thus cytochrome c oxidase (Defranoux et al., 1994). Is regulation by the Hap2/3/4/5 complex sufficient to explain the variation in their transcript levels as a function of concentration?
200
The Hap2/3/4/5 complex regulates the expression of COX4, COX5a, and COX6 (see Kwast et al., 1998). Although there are consensus binding sequences for the Hap2/3/4/5 complex in the 5’-untranslated regions of
COX7, COX8, COX9, COX12, and COX 13, regulation by Hap2/3/4/5 has not been shown. The increase in the steady state levels of the mRNAs for all these genes with increasing tension near might be accounted for by Hap2/3/4/5 complex activation. However this would not explain the increase in their transcript levels above where cellular heme levels should be saturated. After a shift from air to nitrogen, heme levels would not be expected to change rapidly, even after synthesis ceases, because there are no known
201
mechanisms for its degradation and thus heme is stable in yeast (Labbe-Bois and Labbe, 1990). Yet the mRNA levels for aerobic COX genes decline rapidly during the first hour and then more slowly (Fig1B). After a shift from nitrogen to air, COX gene transcripts begin to increase within 5 minutes. Although heme synthesis will occur within this time, how heme regulates the activity of the Hap2/3/4/5 complex is not known. Thus, changes in their mRNA levels in the latter case might be explained by Hap2/3/4/5 regulation. However, changes in their mRNA levels after a shift from air to nitrogen are not consistent with the standard model of regulation. CYC1 The expression of CYC1 (Hap1and Hap2/3/4/5 regulated) is very similar to that of COX5a (Hap2/3/4/5 regulated), except for the overshoot observed for CYC1 mRNA upon aeration (Fig. 1C). This transient increase in expression upon aeration is also observed for other Hap 1-regulated genes (Kwast et al., in prep). For CYC1, this rapid rise in mRNA levels might be explained by a switch from Hap1p repression in the absence of heme to activation in the presence of heme newly synthesized from coproporphyrinogen III. The mechanism responsible for the subsequent decline to steady-state aerobic values is unknown. After a shift from air to nitrogen, the initial, rapid decline in CYC1 mRNA matches the half-life for this RNA measured by Yun and Sherman (1996), implying that transcription has ceased. What may account for the much slower decay toward zero after one hour is not known. Hypoxic genes CYC7 (Hap1and Rox1 regulated) and COX5b (Rox1 regulated), as members of the isoform pairs CYC1/CYC7 and COX5a/COX5b, were thought to be similarly regulated. Their steady-state mRNA levels at different oxygen tensions are similar, with repression occurring above (Fig. 1A). However the transient responses of their transcripts are very different. After a shift from air to nitrogen, COX5b mRNA accumulates slowly, reaching steady-state values after about 10 hours (Fig 1B). This slow accumulation is probably not attributable to the presence of Rox1p because this protein disappears rapidly after a shift to anaerobiosis (Zitomer et al., 1997b). In contrast to COX5b, CYC7 mRNA accumulates much later, rising to anaerobic levels within 2-3 hours after a lag of 16 hours (Fig 1B). This long delay in CYC7 mRNA accumulation cannot be explained by Hap1p regulation; in that case CYC7 mRNA would be expected to increase shortly after the shift as Rox1p declines, and then later to decrease when heme becomes depleted and Hap1p repression occurs, yet nearly the opposite change in transcript levels is observed. Overall, the standard model of regulation does not explain the observed changes in transcript levels of COX5b and CYC7 after a shift to anaerobic conditions. After a shift from nitrogen to air (Fig. 1C), COX5b mRNA declines without any time lag. What is responsible for this rapid decline is not known.
202
In contrast CYC7 mRNA transiently increases before declining. This transient increase is consistent with a switch from Hap1 repression under
anaerobic conditions to activation in the presence of newly synthesized heme upon aeration. Concomitant activation of ROX1 should lead to synthesis of Rox1p and the subsequent decline in CYC7 mRNA levels as observed. Indeed three Rox1p repressed genes, ROX1, CYC7, and ANB1, all begin to decrease about 10-15 minutes after the shift (Kwast et al., in prep.). The difference in the responses of COX5b and CYC7 reaffirms the lack of Hap1 regulation of COX5b reported by Trueblood et al. (1988).
3.
REGULATORY ELEMENTS
The 5’-untranslated regions of COX5b, COX6, CYC1, and CYC7 contain multiple regulatory domains. Little is known about the promoter regions of the other COX genes. Most of the previous work on promoter sites has focused on carbon source and heme regulation as it pertains to Hap1p, the Hap2/3/4/5 complex, or Rox1p. Aside from COX5b, possible oxygenregulation domains have received little attention. Given the complex nature
of the environmental and intracellular signals to which yeast respond it is not surprising that multiple control elements and signal pathways are involved. COX5b has two UASs (upstream activation sequence) and one URS (upstream repression sequence). The latter includes the Rox1p binding site
and another sequence found in other hypoxic genes (Hodge et al., 1990). Ixr1p is an HMG-box protein that also binds to the URS and represses
COX5b aerobically but not other hypoxic genes (Lambert et al., 1994). The physiological relevance of this repression has not been explored. The UAS1
of COX5b appears to be required for anaerobic induction (Hodge et al., 1990), but has no known binding proteins. There are also several stress
elements (STRE) within UAS1, which may account for the diauxic induction of COX5b (Hodge et al., 1989; DeRisi et al., 1997). There may be an
additional repressor, other than Rox1p, that is associated with the slow derepression of COX5b under nitrogen. If it has a heme ligand, it might also be responsible for the rapid repression of COX5b upon aeration. In terms of both heme and carbon source regulation, the only aerobic COX promoter that has been investigated in detail is that of COX6. Trawick et al. (1992) identified four regulatory elements: Domain 1, which includes an Abf1p binding site and a Hap2/3/4/5 consensus sequence, functions as a Hap2/3/4/5 activation site; Domain 2 is responsible for increased expression
in heme-sufficient, glucose-repressed cells; the other two sites mediate heme repression independent of carbon source. The heme sites could be involved in
regulation. Oxygen dependence has not been tested directly.
203
The CYC1 promoter has both Hap1 (UAS1) and Hap2/3/4/5 (UAS2) binding sites, which have been studied extensively in regard to carbonsource regulation (Pinkham and Keng, 1994). In addition, the RC2 complex also binds to UAS1 in a heme- and oxygen-dependent manner (Pinkham and Keng, 1994). Its function is currently unknown. The CYC7 promoter contains several positive and negative regulatory regions. Hap1p binds in a positive region to a sequence that is quite different from that found in the UAS1 of CYC1. A Rox1 consensus sequence is found in a negative region. Another complex, A2, binds downstream of the Hap1p
site and enhances Hap1 activation; A2 binding is heme independent (Prezant et al., 1987). Yet another complex, X, binds upstream of the Hap1 and Rox1 sites, and may be involved in Hap1p regulation (Lodi et al., 1996). The rapid
rise in CYC7 expression upon aeration is consistent with a switch from Hap1
repression to activation for this second type of Hap1 site as well. The CYC7
promoter also has several stress elements, which are involved in diauxic
induction, in induction during the approach to stationary phase (Pillar and Bradshaw, 1991), and in temperature and osmotic stress (Evangelista et al., 1996). These regulatory elements may augment the Hap1 response after shifting from nitrogen to air. There is also a negative site/domain (Iborra et
al. 1985; Wright and Zitomer, 1985), which does not overlap with the proposed Rox1 site but may lead to weak repression in nitrogen in addition
to glucose repression. It contains a STRE element, as does the UAS1 of
COX5b mentioned above. Several other complexes, which bind to the DNA of the CYC7 UAS, have been observed (Prezant et al., 1987), but their function is unknown.
In vitro, in the presence of heme, Hap1p binds DNA in a dimeric form (DC), while in its absence a high molecular weight complex (HMC) binds DNA (see Kwast et al., 1998). The HMC contains at least 4 other proteins, two of which are the Hsp90’s, Hsp82 and Ydj1 (Zhang et al., 1998). The identification of chaperones associated with the HMC lends strong support
to the model that chaperones act as regulators of gene expression, facilitating the formation of the appropriate complexes (Mayer and Bukau, 1999). Here the signal and ligand are Hap1 and heme, but both liganded and unliganded forms appear to be involved in activation and repression, respectively (Chantrel et al., 1998). Complexities of Rox1p binding and interactions are discussed by Zitomer et al. (1999).
4.
SOME UNRESOLVED QUESTIONS Within the context of the known regulators, several questions arise
regarding both heme and
204
control of cytochrome genes.
1. What is the growth requirement for heme? Some
strains will grow when supplemented with Tween 80, ergosterol, and methionine, yet others require small amounts of aminolevulinic acid, amounts insufficient to produce detectable cytochromes or respiration
(Keng, 1992; Verdiere et al., 1991). If the requirement involves general metabolic regulation (Chantrel et al., 1998), genome- and proteome-wide studies may help to identify important factors.
2. What is the nature of the synergy between Hap1p and
heme? Overexpression of Hap1p is toxic to cells (Schneider and Guarente, 1991), as is its absence under heme-deficient conditions (Chantrel et al., 1998), and there is a synergy between HAP1 and HEM1. What is responsible for this toxicity, and the nature of the synergy, is still unresolved. Apparently the double mutant (or hap 1 grown anaerobically) is lethal in some genetic backgrounds but not others. This paradox should be addressed.
3. What is the heme requirement for the Hap2/3/4/5
complex? Unlike Hap1p, but similar to Rox1p, heme does not affect the function of Hap2/3/4/5 directly, but whether it is required for expression of the mRNAs or it acts indirectly is unknown.
4. Why are both CYC1 and CYC7 actively synthesized
upon aeration? Could the rapid accumulation cytochrome c upon aeration be required as a sink for electrons passed from a newly assembled
ubiquinole-cytochrome c reductase (complex III)? Because Complex III is thought to be a major source of reactive species within the cell, especially when electron flux is inhibited downstream of the complex, accumulation of
both iso-2-cytochrome c and iso-1-cytochrome c may protect cells from
oxidative damage during respiratory induction. The kinetics of assembly of the respiratory complexes and their linkage into larger functional units are not known (Boumans et al., 1998).
5. What other factors regulate the aerobic COX genes?
The Hap2/3/4/5 complex probably regulates all of the aerobic COX genes but is unlikely to mediate their down regulation after a shift to nitrogen. Thus a search for these regulators is warranted.
6. Is cytochrome c oxidase a sensor for hypoxic genes?
Several hypoxic genes, including COX5b and CYC7, are regulated both by Rox1p and by a sensory pathway that involves the mitochondrial respiratory
chain (Kwast et al., 1999). Unlike other Rox1-regulated hypoxic genes, the
anoxic derepression of these genes is inhibited by carbon monoxide and their aerobic repression is suppressed by transition metals. These observations suggest that the redox state of a hemoprotein sensor is involved in regulating their transcription. Although the signaling pathway is not known, redox signaling by the terminal portion of the respiratory chain (cytochrome
c oxidase) appears to be involved (Kwast et al., 1999).
205
5.
CONCLUDING REMARKS The standard model of oxygen sensing involving heme is consistent with
the observed steady-state mRNA levels of cytochrome c and cytochrome c oxidase genes in both air and nitrogen. The major break point above
for mRNA expression is probably associated with saturation of the heme synthetic pathway. However the standard model does not explain changes in steady-state levels of these mRNAs above For the temporal data, the model appears to be consistent with the response of the aerobic COX genes, CYC7, and the initial rise in CYC1 mRNA upon shifting from nitrogen to air, but not the rapid decline of aerobic COX genes and the delay in CYC7 expression after a shift from air to nitrogen. Similarly, the rapid decay of COX5b after aeration is inconsistent with this model. Even given the amazing complexity of Hap1p and Rox1p regulation, other factors are probably involved. Additional DNA binding complexes, some and/or heme dependent that have already been seen within the promoters of CYC1, CYC7, COX6, and HEM13 suggest a starting point in the search for such regulators. Amillet et al., (1995) have seen signs for additional sites within the HEM 13 promoter that are differentially affected by heme and Thus, in future studies, it may be wise to look for specific effects within several of the promoters of genes discussed here.
ACKNOWLEDGEMENTS We thank the curators of the Saccharomyces Genome Database (Cherry et al., 1997) and the Yeast Protein Database (Hodges et al., 1999) for providing a service to the yeast community. This work was supported in part by a grant from the American Heart Association to KEK.
REFERENCES Amillet, J.-M., Buisson, N. and Labbe-Bois, R. (1995). Positive and negative elements involved in the differential regulation by heme and oxygen of the HEM 13 gene (coproporphyrinogen oxidase) in Saccharomyces cerevisiae. Curr. Genet. 28, 503-511. Boumans, H., Grivell, L.A. and Berden, J.A. (1998). The respiratory chain in yeast behaves as a single functional unit. J. Biol. Chem. 273, 4872-4877. Boy-Marcotte, E., Perrot, M., Bussereau, F., Boucherie, H. and Jacquet, M. (1998). Msn2p and Msn4p control a large number of genes induced at the diauxic transition which are repressed by cyclic AMP in Saccharomyces cerevisiae. J. Bacterial. 180, 1044-1052. Bunn, H.F. and Poyton, R.O. (1996). Oxygen sensing and molecular adaptation to hypoxia. Physiol. Rev. 76, 839-885.
206
Burke, P.V., Raitt, D.C., Alien, L.A., Kellogg, E.A. and Poyton, R.O. (1997). Effects of oxygen concentration on the expression of cytochrome c and cytochrome c oxidase genes in yeast. J. Biol. Chem. 272,14705-14712. Chantrel, Y., Gaisne, M., Lions, C. and Verdiere, J. (1998). The transcriptional regulator Hap1p (Cyp1p) is essential for anaerobic or heme-deficient growth of Saccharomyces cerevisiae. Genetic and molecular characterization of an extragenic suppressor that encodes a WD repeat protein. Genetics 148, 559-569. Cherry J.M., Ball C., Weng S., Juvik G., Schmidt R., Adler C., Dunn B., Dwight S., Riles L., Mortimer R.K. and Botstein D. (1997). Genetic and physical maps of Saccharomyces cerevisiae. Nature 387(6632 Suppl), 67-73. Defranoux, N., Gaisne, M. and Verdiere, J.(1994). Functional analysis of the zinc cluster domain of the CYP1 (HAP1) complex regulator in heme-sufficient and heme-deficient yeast cells. Mol. Gen. Genet. 242, 699-707.
Deckert, J., Perini, R., Balasubramanian, B. and Zitomer, R.S. (1995). Multiple elements and auto-repression regulate Rox1, a repressor of hypoxic genes in Saccharomyces cerevisiae. Genetics 139, 1149-1158. DeRisi, J.L., Iyer, R.I. and Brown, P.O. (1997). Exploring the metabolic and genetic control of gene expression on a genomic scale. Science 278, 680-686. Evangelista, C.C. Jr., Rodriguez Torres, A.M., Limbach, M.P. and Zitomer, R.S. (1996). Rox3 and Rts1 function in the global stress response pathway in Baker’s yeast. Genetics 142, 1083-1093. Fytlovich, S., Gervais, M., Agrimonti, C. and Guiard, B. (1993). Evidence for an interaction between the CYP1 (HAP1) activator and a cellular factor during heme-dependent transcriptional regulation in the yeast Saccharomyces cerevisiae. EMBO J. 62, 1209-1218. Gancedo, J.M. (1998). Yeast carbon catabolite repression. Microbiol. Mol. Biol. Rev. 62, 334361. Hodge, M.R., Kim, G., Singh, K. and Cumsky, M.G. (1989). Inverse regulation of the yeast COX5 genes by oxygen and heme. Mol. Cell. Biol. 9, 1958-1964.
Hodge, M.R., Singh, K. and Cumsky, M.G. (1990). Upstream activation and repression elements control transcription of the yeast COX5b gene. Mol. Cell. Biol. 10, 5510-5520.
Hodges, P.E., McKee, A.H.Z., Davis, B.P., Payne, W.E. and Garrels, J.I. (1999). Yeast Protein Database (YPD): a model for the organization and presentation of genome-wide functional data. Nuc. Acids Res. 27, 9-73. Iborra, F., Francingues, M.-C. and Cuerineau, M. (1985). Localization of the upstream regulatory sites of yeast iso2-cytochrome c gene. Mol. Gen. Genet. 199, 117-122. Keng, T. (1992). HAP1 and ROX1 form a regulatory pathway in the repression of HEM13 transcription in Saccharomyces cerevisiae. Mol. Cell. Biol. 12, 2616-2623. Kwast, K.E., Burke, P.V. and Poyton, R.O. (1998). Oxygen sensing and the transcriptional regulation of oxygen-responsive genes in yeast. J. Exp. Biol. 201, 1177-1195. Kwast, K.E., Burke, P.V., Staahl, B.T. and Poyton, R.O. (1999). Oxygen sensing in yeast: Evidence for the involvement of the respiratory chain in regulating the transcription of a subset of hypoxic genes. Proc. Nat. Acad. Sci. USA 96, 5446-5451. Labbe-Bois, R. and Labbe, P. (1990). Tetrapyrrole and heme biosynthesis in the yeast Saccharomyces cerevisiae. In Biosynthesis of Heine and Chlorophvlls, (ed. H.A. Dailey), pp235-285. New York: McGraw-Hill Pub. Co. Lambert, J.R., Bilanchone, V.W. and Cumsky, M.G. (1994). The ORD1 gene encodes a transcription factor involved in oxygen regulation and is identical to IXR1, a gene that confers cisplatin sensitivity to Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 91, 7345-7349.
207
Lodi, T., Petrochilo, E., Gaisne, M. and Verdiere, J. (1996). Characterization of a promoter mutation in the CYC3 gene of Saccharomyces cerevisiae which cancels regulation by Cyplp (Hap1p) without affecting its binding site. Mol. Gen. Genet. 253, 103-110. Mayer, M.P. and Bukau, B. (1999). Molecular chaperones: the busy life of Hsp90. Curr. Biol. 9, R322-R325. Monod, J. (1947). The phenomenon of enzymatic adaptation. Growth Symp. 11, 223-289. Pillar, T.M. and Bradshaw, R.E. (1991). Heat shock and stationary phase induce transcription
of the Saccharomyces cerevisiae iso-2 cytochrome c gene. Curr. Genet. 20, 185-188. Pinkham, J.L. and Keng, T. (1994). Heme-mediated gene regulation in Saccharomyces cerevisiae. In: Metal Ions in Fungi, (ed. G. Winkelmann and D.R. Winge), pp. 455-501. New York: Marcel Dekker. Pressant, T., Pfeiffer,K. and Guarente, L. (1987). Organization of the regulatory region of the yeast CYC7 gene: multiple factors are involved in regulation. Mol. Cell. Biol. 7, 32523259. Schneider, J.C. and Guarente, L. (1991). Vectors for expression of cloned genes in yeast: regulation, overproduction, and underproduction. Meth. Enzymol. 194, 373-388. Trawick, J.D., Kraut, N., Simon, F.R. and Poyton, R.O. (1992). Regulation of yeast COX6 by the general transcription factor ABF1 and separate HAP2 and heme-responsive elements. Mol. Cell. Biol. 12, 2302-2314. Trueblood, C.E., Wright, R.M. and Poyton, R.O. (1988). Differential regulation of the two genes encoding Saccharomyces cerevisiae cytochrome c oxidase subunit V by heme and
the HAP2 and REO1 genes. Mol. Cell. Biol. 8, 4537-4540. Verdiere, J., Gaisne, M. and Labbe-Bois, R. (1991). CYP1(HAP1) is a determinant effector of
alternative expression of heme-dependent transcription in yeast. Mol. Gen. Genet. 228, 300-306. Wright, C.F. and Zitomer, R.S. (1985). Point mutations implicate repeated sequences as essential elements of the CYC7 negative upstream site in Saccharomyces cerevisiae. Mol. Cell. Biol. 5,2951-2958. Wu, J. and Trumbly, R.J. (1998). Multiple regulatory proteins mediate repression and activation by interaction with the yeast Mig1 binding site. Yeast 14, 985-1000. Yun, D.F. and Sherman, F. (1996). Degradation of CYC1 mRNA in the yeast Saccharomyces cerevisiae does not require translation. Proc. Natl. Acad. Sci. USA 93, 8895-8900. Zhang, L., Hach, A. and Wang, C. (1998). Molecular mechanism governing heme signaling in yeast: a higher-order complex mediates heme regulation of the transcriptional activator HAP1. Mol. Cell. Biol. 18, 3819-3828. Zitomer, R.S., Carrico, P. and Deckert, J. (1997a). Regulation of hypoxic gene expression in yeast. Kidney Internat. 51, 507-513. Zitomer, R.S., Kastanoitis, A.J., Deckert, J. and Khalaf, R.A. (1999). Regulation of gene expression by hypoxia in yeast. In: Oxygen Sensing : Molecule to Man (ed . S. Lahiri and N. Probhakar). New York: Plenum. Zitomer, R.S., Limbach, M.P., Rodriguez-Torres, A.M., Balasubramanian, B., Deckert, J. and Snow, P.M. (1997b). Approaches to the study of Rox1 repression of the hypoxic genes in the yeast Saccharomyces cerevisiae. Methods 11, 279-288.
208
HYPOXIC AND REDOX INHIBITION OF THE HUMAN CARDIAC L-TYPE CHANNEL 1 1
I.M. Fearon, 1 A.C.V. Palmer, 1A.J. Balmforth, 1 S.G. Ball, 2G. Varadi and C. Peers
1
Institute for Cardiovascular Research, University of Leeds, Leeds, LS2 9.JT., U.K; University of Cincinnati College of Medicine, Institute of Molecular Pharmacology and Biophysics, Cincinnati, OH 45267-0828, U.S.A. 2
1.
INTRODUCTION
Ion channel regulation by tension was first demonstrated in type I cells of the carotid body, where channels were shown to be inhibited by hypoxia (Lopez-Barneo et al., 1988). Similar observations have since been made in a wide range of cell types (see Peers, 1997). More recently, hypoxic inhibition of voltage-gated L-type channels was demonstrated in type I cells (Montoro et al., 1996) and smooth muscle cells isolated from pulmonary and systemic blood vessels (Franco-Obregon et al., 1995; Franco-Obregon and Lopez-Barneo, 1996a,b). In the systemic circulation, inhibition of L-type channels by hypoxia has been observed in various vascular beds, and may well contribute to hypoxic arterial vasodilatation (Franco-Obregon and Lopez-Barneo, 1996b). The mechanism of hypoxic inhibition of ion channels is unknown, but some evidence suggests that modulation of channels by hypoxia involves redox modulation of the channel protein (Archer et al., 1993; Weir & Archer, 1995). Moreover, studies on recombinant vascular smooth muscle channels have shown channel modulation by reducing and oxidising agents (Chiamvimonvat et al., 1995). However, no studies to date have addressed the possible involvement of redox modulation in channel inhibition by hypoxia. Here, we examine the effects of hypoxia on recombinant human cardiac L-type channel subunits and whether redox modulation may be involved in hypoxic inhibition of these channels.
Oxygen Sensing: Molecule to Man, edited by S.Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
209
2.
MATERIALS AND METHODS
Experiments were carried out in HEK 293 cells stably expressing the human cardiac L-type channel subunit (Schultz et al., 1995; Fearon et al., 1997). Whole-cell patch clamp recordings were performed as previously described (Fearon et al., 1997), using 20mM
as
charge carrier. Cells were voltage-clamped at -80 mV, and currents evoked by depolarising the membrane to various potentials for 100 ms (at 0.1 Hz). Currents were filtered at 1-2 kHz and digitised at 2-4 kHz for off-line analysis following leak subtraction. Drug solutions were prepared by dissolution in the appropriate extracellular perfusate. In studies using (2-aminoethyl) methane thiosulphonate (MTSEA) and (2-sulphonatoethyl) methanethio- sulphonate (MTSES) cells were incubated for 5 min in the drug solution immediately
following dissolution. 1,4-dithiothreitol (DTT) and p-chloro mercuribenzene (PCMBS) was bath applied to cells under low light intensity.
3.
RESULTS
3.1
Hypoxic inhibition of the recombinant
subunit
Step depolarisations evoked inward channel currents in HEK 293 cells at test potentials that could be enhanced by BAY K 8644 and fully inhibited by nifedipine, indicating that all recorded currents are attributable to activation of recombinant L-type channel subunits (Fearon et al., 1997). Figure 1A shows that as bath was reduced to a final level of 5 mmHg there was a rapid reduction in current amplitude that was fully reversible. A versus inhibition curve was constructed, using either as charge carrier (Figure 1B). This revealed that, using either charge carrier, currents were reduced by hypoxia in a graded manner with increasing hypoxia below 90 mmHg, and inhibition did not appear to saturate even at a level of 5 mmHg. The degree of inhibition appeared to be dependent on the charge carrier used; for currents inhibition was detectable at levels as high as 125 mmHg, whereas for currents hypoxic inhibition was only observed at levels mmHg.
210
211
As was the case for native vascular smooth muscle L-type channels (Franco-Obregon et al., 1995; Franco-Obregon and Lopez- Barneo, 1996a), we found that hypoxic inhibition of currents in stably transfected HEK 293 cells was voltage-dependent (Figure 1C): hypoxic inhibition was more pronounced at test potentials up to and including those at which currents were maximal, and was reduced or absent at higher test potentials
3.2
Redox modulation of the recombinant
channel
The mechanism of hypoxic inhibition of ion channels remains unknown, but studies on native channels in pulmonary smooth muscle (and other) cells have proposed the involvement of redox modulation in mediating hypoxic inhibition (see Introduction). Other recent studies have shown that both native (Lacampagne et al., 1995; Campbell et al., 1996) and recombinant (Chiamvimonvat et al., 1995; Hu et al., 1997) L-type channels can be modulated by oxidising and reducing agents acting at thiol groups of cysteine residues in the channel protein. Therefore, we investigated whether redox modulation of the recombinant subunit has any effect on channel function, and also examined the effects of such modulation on hypoxic inhibition of this channel. Initial experiments examined the ability of known channel oxidising and reducing compounds to alter channel function. The reducing agent DTT (2 mM) was without effect on channel currents in HEK 293 cells. Bath application of the oxidising agent PCMBS caused a reduction in current amplitudes; an example of this effect is shown in Figure 2A. This effect of PCMBS was always irreversible, but current amplitudes could be partially restored by 2 mM DTT (Figure 2A), indicating that inhibition due to PCMBS arose from thiol modification of the channel protein. A concentration-response relationship for PCMBS showed that the inhibitory effects of PCMBS were not significantly increased by raising the concentration from to 2 mM (Fearon et al., 1999) indicating that this compound could not fully inhibit the channel. We also investigated the effects on channel activity of two methanethiosulphonate (MTS) compounds, the negatively charged MTSES and the positively charged MTSEA. Due to the highly unstable nature of these compounds in solution, cells were pre-exposed to these reagents for 5 mm immediately following dissolution. Pretreatment of cells with 10 mM MTSES was without effect on channel current density (Figure 2B). In contrast, pretreatment with 2.5 mM MTSEA caused a significant decrease in current density. Like the effects of PCMBS, the inhibitory effect of MTSEA occurred via an interaction with thiol groups on
212
213
cysteine residues since current density could be enhanced in MTSEAtreated cells with 2 mM DTT (Figure 2B). Previous studies (Akabas et al., 1992; Holmgren et al., 1996) indicated that maximal effects of MTSEA should be observed under the conditions used in these experiments (5 min exposure to 2.5 mM MTSEA). We were unable to test this for ourselves, since longer exposure times and higher drug concentrations invariably caused degradation in cell appearance and detachment from coverslips. However, the observations that neither PCMBS nor MTSEA could fully inhibit channel activity prompted us to investigate whether the two compounds were acting at the same or at different sites on the channel protein. In cells pretreated with 2.5 mM MTSEA, bath-applied PCMBS inhibited channel activity by (n = 7). This degree of inhibition was not significantly different to that seen in cells which had not been previously exposed to the MTS reagent. In further experiments, current densities were measured in untreated cells, in cells pretreated with 2.5 mM MTSEA or with PCMBS, and in cells pretreated with both MTSEA and PCMBS. These studies, results of which are summarised in Figure 2C, led to the important observation that pretreatment with PCMBS did not abolish the inhibitory action of MTSEA. Indeed, the effect of MTSEA to reduce current density (by approximately 32 %; unpaired t test) was similar following PCMBS treatment (38 %; unpaired t test). These findings support the idea that the two agents used act to inhibit channel currents by acting at different sites on the subunit protein. As described above, redox modulation of cysteine residues on the ion channel protein has been suggested as a putative mechanism of hypoxic inhibition. Therefore, we investigated the ability of the hypoxic stimulus to modulate channel currents following pretreatment of cells with either MTSEA or PCMBS. As illustrated in Figure 3A, pretreatment of cells with 2.5 mM MTSEA did not prevent inhibition of currents by hypoxia, and the degree of inhibition in response to a hypoxic stimulus of 15-25 mmHg was (n = 10), a value not significantly different to that previously reported by us (Fearon et al., 1997) at this level. In contrast to this finding, prior exposure to PCMBS completely abolished hypoxic inhibition of channel activity (n = 8; see Figure 3B). Thus, redox modulation of channels with PCMBS, but not MTSEA, prevented channel inhibition by hypoxia (Figure 3C).
4.
DISCUSSION
Initial results described in this chapter demonstrated that exposure of HEK 293 cells stably expressing the human cardiac L-type channel
214
215
subunit to a hypoxic stimulus resulted in a rapid and reversible inhibition of channel activity. Inhibition was associated with a shift in the 1-V relationship towards more positive potentials, a slowing of channel activation (Fearon et al., 1997) and was also dependent on the ionic species used as charge carrier. These findings are in excellent agreement with the inhibitory effects of hypoxia on native currents in myocytes isolated from the pulmonary vasculature (Franco-Obregon et al., 1995; Franco-Obregon & Lopez-Barneo, 1996,b). This suggests that the actions of hypoxia on the native channels are likely due to specific regulation of the smooth muscle subunit (with which the subunit used in our studies shows around 95 % sequence homology; Hofmann et al., 1994), since our data were obtained in cells expressing the pore-forming subunit alone in the absence of any auxiliary subunits. The effects of auxiliary subunits in modulating the response to hypoxia of the recombmant subunit remains to be determined, though preliminary data from our laboratory suggests that co-expression of the modulatory subunit has no effect on the hypoxic response. The mechanism(s) underlying hypoxic inhibition are unknown. Given the rapidity of the effect of hypoxia observed here, a direct (or membranelimited) effect on the channel protein seems more likely than a response to altered cellular metabolism. Indeed, ATP was present intracellularly in all the recordings described here. Moreover, hypoxic inhibition of channels in other tissues has been shown to occur in excised membrane patches devoid of potential intracellular mediators (Ganfornina & Lopez-Barneo, 1991; J i a n g & Haddad, 1994). Redox modulation of the ion channel itself or a closely associated regulatory protein has been proposed as a mediator of hypoxic inhibition of channels (Archer et al., 1993; Weir & Archer, 1995). Furthermore, chemical redox modulation of native cardiac L-type currents from ferret (Campbell et al., 1996) and guinea-pig (Lacampagne et al., 1995) has been shown to modulate channel activity, although there appears to be species dependence with regards to the specific effects of oxidising and reducing agents in these cells. Our observations, using the recombinant human cardiac subunit, are in excellent agreement with the previous results obtained from guinea-pig but not ferret myocytes. Our observations arc also in excellent agreement with previous demonstrations of channel inhibition in response to oxidising agents in cells expressing recombinant vascular smooth muscle and cardiac subunits (Chiamvimonvat et al., 1995; Hu et al., 1997). The finding that PCMBS inhibited currents in cells pretreated with MTSEA provides strong evidence that these agents interact with different cysteine residues, and this conclusion is supported by previous studies on channels which were found to be unaffected by thimerosal or
216
DTDP (oxidising agents; Chiamvimonvat et al., 1995) but were strongly inhibited by MTSEA (Hu et al., 1997). Results presented in Figure 3 provide further evidence for the suggestion that MTSEA and PCMBS act at different cysteine residues. Hypoxic inhibition of currents was observed in MTSEA-treated cells, indicating that the residues with which MTSEA interacts are not involved in hypoxic inhibition but are important in normal channel function. By contrast, hypoxic inhibition was abolished in PCMBS-treated cells, indicating that cysteine residues sensitive to PCMBS treatment are of importance in both normal channel functioning and in the response of the channel to acute hypoxia. In conclusion, the recombinant human cardiac L-type channel subunit is inhibited by acute hypoxia, and this effect is identical to that previously reported on native vascular smooth muscle channels. The mechanism of this effect is unknown, though extracellular cysteine residues sensitive to PCMBS treatment appear to be involved. It is also presently unknown whether sensing is intrinsic to the ion channel itself or involves a closely associated but distinct sensory element endogenously expressed by the host cell.
ACKNOWLEDGEMENTS This work was supported by the British Heart Foundation.
REFERENCES Akabas, M.H., Stauffer, D.A., Xu, M. and Karlin, A., 1992, Acetylcholine-receptor channel
structure probed in cysteine-substitution mutants. Science 258: 307-310. Archer, S.L., Huang, J., Henry, T., Peterson, D. and Weir, E.K., 1993, A redox-based sensor in rat pulmonary vasculature. Circ Res 73: 1100-1 1 12.
Campbell, D.L., Stamler, J.S. and Strauss, H.C., 1996, Redox modulation of L-type calcium channels in ferret ventricular myocytes - dual mechanism regulation by nitric-oxide and snitrosothiols. J Gen Physiol 108: 277-293.
Chiamvimonvat, N., O’Rourke, B., Kamp, T.J., Kallen, R.G., Hofmann, F., Flockerzi, V. and Marban, E., 1995, Functional consequences of sulfhydryl modification in the poreforming subunits of cardiovascular and channels. Circ Res 76: 325-334. Fearon, I.M., Palmer, A.C.V., Balmforth, A.J., Ball, S.G., Mikala, G., Schwartz., A. and Peers, C., 1997, Hypoxia inhibits the recombinant subunit of the human cardiac L-type channel. J Physiol 500: 551 -556. Fearon, I.M., Palmer, A.C.V., Balmforth, A.J., Ball, S.G., Varadi, G. & Peers, C., 1999,
Modulation of recombinant human cardiac L-type
channel
subunits by redox
agents and hypoxia. J. Physiol. 514: 629-637.
Franco-Obregon, A and Lopez-Barneo, J., 1996a, Differential oxygen sensitivity of calcium channels in rabbit smooth muscle cells of conduit and resistance pulmonary arteries. J Physiol 491: 511-518.
217
Franco-Obregon, A and Lopez-Barneo, J., 1996b, Low inhibits calcium channel activity in arterial smooth muscle cells. Am J Physiol 271: H2290-H2299. Franco-Obregon, A., Urena, J. and Lopez-Barneo, J., 1995, Oxygen-sensitive calcium channels in vascular smooth muscle and their possible role in hypoxic arterial relaxation. Proc Natl Acad Sci USA 91: 4715-4719. Ganfornina, M.D. and Lopez-Barneo, J., 1991, Single channels in membrane patches or arterial chemoreceptor cells are modulated by tension. Proc Natl Acad Sci USA 88: 2927-2930. Hofmann, F., B i e l , M. and Flockerzi, V., 1994, Molecular basis for channel diversity. Ann Rev Neurosci 17: 399-418.
Holmgren, M., Liu, Y., Xu, Y. and Yellen, G., 1996, On the use of thiol-modifying agents to determine channel topology. Neuropharm 35: 797-804.
Hu, H., Chiamvimonvat, N., Yamagishi, T. and Marban, E., 1997, Direct inhibition of expressed cardiac L-type channels by s-nitrosothiol nitric oxide donors, Circ Res, 8 1 : 742-752.
Jiang, C . and Haddad, G.G., 1994, Oxygen deprivation inhibits a of cytosolic factors in rat central neurons. J Physiol 481: 15-26.
channel independently
Lacampagne, A., Duittoz, A., Bolanos, P., Peineau, N. and Argibay, J.A., 1995, Effect of sulfhydryl oxidation on ionic and gating currents associated with L-type calcium channels in isolated guinea-pig ventricular myocytes. Cardiovasc Res 30: 799-806. Lopez-Barneo, J., Lopez-Lopez., J.R., Urena, J. and Gonzalez, C., 1988, Chemotransduction in the carotid body current modulated by in type-I chemoreceptor cells. Science 241: 580-582.
Montoro, R.J., Urena, J., Fernandez-Chacon, R., De Toledo, G.A. and Lopez-Barneo, J., 1996, Oxygen sensing by ion channels and Chemotransduction in single glomus cells. J Gen Physiol 107: 133-143. Peers, C., 1997, Oxygen-sensitive ion channels. Trends Pharmacol Sci 18: 405-408.
Weir, E.K. and Archer, S.L., 1995, The mechanism of acute hypoxic pulmonary vasoconstriction - the tale of two channels. FASEB J 9: 183-189.
218
MOLECULAR IDENTIFICATION OF SENSORS AND -SENSITIVE POTASSIUM CHANNELS IN THE PULMONARY CIRCULATION *STEPHEN L. ARCHER, **E. KENNETH WEIR, ***HELEN L. REEVE, and *EVANGELOS MICHELAKIS *University of Alberta, Canada, Department of Medicine and Physiology, **University of Minnesota, Department of Cardiology, ***University of Minnesota, Department of Physiology and Medicine
Abstract Small, muscular pulmonary arteries (PAs) constrict within seconds of the onset of alveolar hypoxia, diverting blood flow to better-ventilated lobes, thereby matching ventilation to perfusion and optimizing systemic This hypoxic
pulmonary vasoconstriction (HPV) is enhanced by endothelial derived vasoconstrictors, such as endothelin, and inhibited by endothelial derived nitric
oxide. However, the essence of the response is intrinsic to PA smooth muscle cells in resistance arteries (PASMCs). HPV is initiated by inhibition of the Kv channels in PASMCs which set the membrane potential It is currently uncertain whether this reflects an initial inhibitory effect of hypoxia on the channels or an initial release of intracellular which then inhibits
channels.
In cither scenario, the resulting depolarization activates L-type,
voltage gated channels, which raises cytosolic calcium levels and causes vasoconstriction. N i n e families of Kv channels are recognized from cloning studies (Kv1-Kv9), each with subtypes (i.e. Kv1.1-1.6). The
contribution of an individual Kv channel to the whole-cell current is difficult to determine pharmacologically because Kv channel inhibitors arc nonspecific. Furthermore, the PASMC’s is an ensemble, reflecting activity of several channels. The channels which set and inhibition of which
initiates HPV, conduct an outward current which is slowly inactivating, and which is blocked by the Kv inhibitor 4-aminopyridine (4-AP) but not by inhibitors of -or ATP-sensitive channels. Using anti-Kv antibodies to immunolocalize and inhibit Kv channels, we showed that the PASMC contains numerous types of Kv channels from the Kv1and Kv2 families. , Furthermore
Kv1.5 and Kv2.1 may be important in determining the
and play a role as
effectors of HPV in PASMCs. While the Kv channels in PASMCs are the
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
219
“effectors” of HPV, it is uncertain whether they are intrinsically -sensitive or arc under the control of an “ sensor”. Certain Kv channels are rich in cysteine, and respond to the local redox environment, tending to open when oxidized and close when reduced. Candidate sensors vary the PASMC redox potential in proportion to These include Nicotinamide Adenine Dinucleotide Phosphate Oxidase, (NADPH oxidase) and the cytosolic ratio of reduced/oxidized redox couples (i.e. glutathione GSH/GSSG), as controlled by electron flux in the mitochondrial electron transport chain (ETC). Using a mouse that lacks the gp91phox component of NADPH oxidase, we have recently shown that loss of the gp91phox-containing NADPH oxidase as a source of activated oxygen species does not impair HPV. However, inhibition of complex 1 of the mitochondrial electron transport chain mimics hypoxia in that it i n h i b i t s reduces the production of activated species and causes vasoconstriction. We hypothesize that a redox sensor, perhaps in the mitochondrion, senses through changes in the accumulation of freely diffusible electron donors. Changes in the ratio of reduced/oxidized redox couples, such as NADH/NAD+ and glutathione (GSH/GSSG) can reduce or oxidize the channels, resulting in alterations of PA tone.
1.
THE MECHANISM OF HPV
HPV is defined as the rapid, reversible, increase in pulmonary vascular resistance which occurs in the small PAs serving an hypoxic segment of lung. HPV matches ventilation to perfusion and thereby optimizes systemic by avoiding excessive perfusion of hypoxic lung segments, that would otherwise occur in diseases such as pneumonia. Since its modern description (Von Euler
and Liljestrand, 1946), many features of HPV have been elucidated (for review see (Weir and Archer, 1995) (Figure 1). HPV is strongest in small muscular PAs ( generation, diameter (Kato and Staub,1966, Shirai, et al.,1991). Hypoxic contraction can even be demonstrated in isolated SMCs from resistance PAs, but not proximal PAs or cerebral arteries (Madden, et al.,1992) (Figure 1). HPV begins within seconds of a decrease in alveolar tension below a threshold fractional inspired concentration of ~10% (Jensen, et al.,1992). While the basic mechanism resides in the PASMC, the magnitude of HPV is significantly modulated by circulating endothelial mediators (e.g. nitric oxide (Archer, et al.,1989a), endothelin (Oparil, et al.,1995), leukotrienes (Ovetsky, et al.,1987) and prostaglandins (Voelkel, et al.,1981, Weir, et al.,1976) and the autonomic nervous system (Voelkel, 1986). For example, inhibition of nitric oxide synthase (NOS) augments HPV (Archer, et al.,1989b, Brashers, et al.,1988) whilst inhibition of endothelin receptors impairs HPV (Oparil, et al.,1995). HPV results from the integrated action of and channels in the PASMC plasmalemma (Weir and Archer, 1995). HPV is inhibited by drugs, such as nifedipine, which block the
220
voltage-gated, L-type channel (Archer, et al.,1985, McMurtry, et al.,1976, Young, et al.,1983) and enhanced by channel agonists, such as BAY K 8644 (McMurtry,1985, Tolins, et al.,1986). The Ca2+ channel is crucial in providing the for contraction but is primarily regulated by the
activity of channels through the latter’s control of membrane potential . L-type channels are relatively inactive at resting and activate at voltages positive to ~ -20mV (Franco-Obregon and LopezBarneo,1996). A major advance in our understanding of HPV is the recognition that hypoxia-induces membrane depolarization and increases by inhibiting channels in PASMC (Post, et al.,1992). It also appears that hypoxia causes the release of from intracellular stores which in turn might inhibit channels (Post, et al.,1995). The relative importance of this mechanism is uncertain. Hypoxia does not inhibit in systemic arterial SMCs (Post, et al.,1992, Yuan, et al.,1993), perhaps explaining the lack of hypoxic constriction in these arteries (Hampl, et al.,1994). Indeed, hypoxia dilates systemic arteries, in some vessels by activating channels (Dart and Standen,1995, Daut, et al.,1990, Gasser, et al.,1993) and in others by
activating
channels (Gebremedhin, et al.,1994).
221
2.
A FAMILY OF RESPONSIVE
-SENSITIVE TISSUES WITH CHANNELS
The partial pressure of oxygen, in the arterial circulation of normal individuals ranges from near 100 mmHg, at sea level, to approximately 40 mmHg in normal individuals at an altitude equivalent to the summit of Everest (Groves, et al.,1987). Prolonged survival at lower is not possible. To achieve such tight control of oxygenation most aerobic organisms, are equipped with chemoreceptors which sense the level in the arteries or alveoli. In humans there are central chemoreceptors in the brain and peripheral chemoreceptors in the arterial vasculature (the carotid and aortic bodies). The carotid body monitors arterial oxygenation and increases its rate of sinus nerve discharge progressively as arterial is reduced from 150-50 mm Hg (Mills and Jobsis, 1972). It is responsible for virtually all of the increase in ventilation which occurs with hypoxemia in humans (West, 1991). The afferent signal from the carotid body is relayed to the brainstem by cranial nerve IX and stimulates the respiratory center in the brainstem, resulting in increased respiration, which optimizes arterial The situation in the pulmonary vasculature is analogous, although the entire hypoxic response is intrinsic to
the lung. In the fetus, hypoxia (the normal situation in utero) maintains the ductus arteriosus in a relaxed state. This large fetal vessel, provides a conduit to divert blood away from the non-aerated fetal lung. At birth, the rises and the ductus constricts. The of the type 1 cell of the carotid body (Lopez-Barneo, et al.,1988) and the SMCs of the ductus arteriosus (TristaniFirouzi, et al.,1996) are controlled by a collection of responsive channels, similar to the situation in the PASMC. In each tissue, a change in tension inhibits depolarizes the membrane, activates L-type channels and culminates in a tissue-specific effect-neural discharge, ductal constriction or HPV.
3.
CHANNELS
channels are tetrameric, membrane-spanning proteins which have high selectivity for K+ due to the universal presence of a “K+ recognition
sequence” which constitutes a selectivity filter at the mouth of the channel (Doyle, et al.,1998). There are 3 major types of K channels: The Kv family (including Kv1-9) (Salkoff and Jegla,1995), the inward rectifier/G-proteinmodulated channels, such as GIRK-1 (Dascal, et al.,1995, Dascal, et al.,1993) and a recently recognized family of channels with a tandem, 2-pore motif (Salkoff and Jegla, 1995). For the Kv superfamily each subunit in the tetramer is comprised of 6 membrane-spanning domains with a pore-region (H5)
222
223
between the S5-S6. Kv channel function is regulated by the assembly of channel subunits into homo- or heterotetramers, each with distinct pharmacological and kinetic properties. Although the inward rectifier channels are comprised of only 2 transmembrane spanning domains they also form tetrameric channels.
4.
K+ CHANNELS REGULATE
IN PASMC
in vascular SMC is largely controlled by K+ channels (Nelson, et al.,1990, Nelson and Brayden,1993). When K+ channels are inhibited, the basal efflux of positively charged K+ ions is diminished. This renders the interior of the cell more positive, i.e. depolarized. The resting of PASMCs from resistance arteries is ~-50mV (Archer, et al.,1996, Post, et at.,1992, Post, et al.,1995, Smirnov, et al.,1994, Yuan,1995a). At EMS negative to ~-20mV, the open-state probability of the L-type channel is low, reducing i n f l u x and promoting relaxation. K+ channel blockers cause pulmonary vasoconstriction (Hasunuma, et al.,1991, Post, et al.,1992), largely through their ability to depolarize Em and thus open channels. Conversely, K+ channel openers causes vasodilatation (Chang, et al.,1992). It has long been suspected that a K+ conductance was important to the regulation of pulmonary vascular tone (Archer, et al.,1986b, Lloyd,1966). The application of patchclamp techniques provided the first direct evidence of the involvement of K+ channels in regulation of the pulmonary circulation and in the mechanism of HPV (Post, et al., 1992). PASMCs contain various types of K+ channels (see Table 1), including: Ca2+ sensitive, (Archer, et al.,1994), delayed rectifier ( K D R ) (now included in the group of Kv channels) (Archer, et al.,1998, Yuan, et al.,1996, Yuan,1995b, Yuan, et al.,1998) and adenosine triphosphate ( K ATP)-gated K channels (Clapp and Gurney,1991, Clapp and Gurney,1992). Kv channels are inhibited by 4-aminopyridine (4-AP) (Bouchard and Fedida,1995, Sheehan, et al.,1994, Shieh and Kirsch,1994) and it is this class of channels which appears to set the resting in PASMCs (Archer, et al.,1996, Archer, et al.,1998, Yuan,1995b). This family may also include the hypoxia-inhibited K+ channels involved in HPV (Arai, et al.,1990, Archer, et al.,1998, Yuan, et al.,1998). In the late 1990s, we have gradually moved from a pharmacological system for classifying K+ channels to a molecular scheme-based on the fact that many K+ channels have now been cloned. Recently we have learned the three dimensional structure of Kv channels from X-ray crystallography (Doyle, et al.,1998). Mammalian Kv channels are closely homologous to those cloned from Drosophila (Chandy and Gutman,1993). For example Kvl, Kv2, Kv3, Kv4 in mammals correspond to Shaker, Shab, Shaw and Shal in Drosophila, respectively (Xu, et al.,1995) PASMCs contains all the Shaker Kv channels (except for Kvl.4) and Kv2.1 is also present (Archer, et al.,1998).
224
225
5.
MOLECULAR IDENTIFICATION OF KV CHANNELS WHICH SET AND RESPOND TO HYPOXIA IN PASMCS
Dissection of the largely rests on the use of pharmacological inhibitors (of varying specificity) (Table 1). The biophysical attributes of the Kv channel families and their subtypes (i.e. Kv 1.1-1.6 (Chandy and Gutman,1993) are not sufficiently distinct to allow their separation by biophysical classification. This is particularly true in mammalian cells, in which many types of K+ channel are simultaneously active, creating an “ensemble” current. However, expression of these channels in oocytes and other cell lines has defined the pharmacological and electrophysiological characteristics (Grissmer, et al.,1994) of the current each conducts. This can be compared with the profile of the hypoxia-inhibited in PASMCs, allowing one to construct a relatively short list of the K+ channels that may be responsible for the in PASMCs (Table 1). The “candidate” current is slowly-inactivating, voltage-gated and is inhibited by 4-AP (1-5mM) but not charybdotoxin (CTX) or glyburide (Table 1). Quinine has also been suggested to inhibit the hypoxia-sensitive Kv channel (Evans, et al.,1996). The role of inward rectifier K+ channels (Kir) remains unexplored whilst rapidly inactivating channels (Kv1.4, Kv4.3) are unlikely candidates because their current morphology is not concordant. By these criteria, Kv1.5 and Kv 2.1 are on the “short-list” of candidate Kv channels which may be involved in HPV, because the observed current is slowly inactivating (Grissmer, et al.,1994), inhibited by 4-AP (Bouchard and Fedida,1995) (and by quinine in the case of Kv1.5) (Yang, et al.,1995), similar to those of the hypoxia-inhibited K+ channel. However, it is unlikely that
only one Kv channel accounts for HPV. For example, Figure 4 illustrates that hypoxia inhibits several Kv channels. This finding indicated to us the necessity of taking a molecular, rather than a biophysical, approach to identification of the families of channels involved in HPV. Kv2.1 is sensitive both to TEA and 4-AP (Shi, et al.,1994, Taglialatela, et al.,1993, Trimmer, 1993), although it is much less sensitive to 4-AP than Kvl.5 . Other members of the Kv 1 family were excluded by their pharmacology. Kv 1.2 (Grissmer, et al.,1994) and Kvl.3 and 1.6 (Garcia, et al.,1994) are quite sensitive to CTX, while Kvl.5 and Kv2.1 are insensitive to 100nM CTX (Garcia, et al.,1994). Recently, we used intracellularly administered, anti-Kv channel antibodies to determine the contribution of particular clonal Kv channels (i.e. Kv2.1) to the composite (Archer, et al.,1998). We showed that ~15% of is provided by Kvl.5 and another 15% by Kv2.1 in PASMCs (Figure 4B). Furthermore, anti-Kv2.1 antibodies partially depolarized the PASMC, suggesting the importance of the channel to control of PASMC (Figure 4C).
226
227
228
Kv1.5: Kv1.5 is a member of the Shaker family which is found in vascular myocytes (Overturf, et al.,1994) including PASMCs (Archer, et al.,1985, Archer, et al.,1998, Yuan, et al.,1998). Kvl.5 may also control the and modulate tension in bronchial SMCs (Adda, et al.,1996). It is inhibited by 4-AP and has a single channel conductance of roughly 17pS. Its expression is dynamically regulated and the turnover of Kv1 .5 is rapid with an estimated channel half-life of 4 hours, in some cell lines (Takimoto, et al., 1993). This means expression of channel protein can be dynamically upor down-regulated under a variety of pathophysiological conditions (hypertension, depolarization etc). This channel has been shown to be susceptible to redox regulation (Duprat, et al.,1995). Kv2.1: Kv2.1 is a member of the Shab family that is found in rat PASMCs (Archer, et al.,1998, Patel, et al.,1997). Recently it has been learned that the amino-terminus of Kv2.1 participates in transitions leading to activation through interactions involving reduced cysteine(s) that can be modulated from the cytoplasmic phase (Pascual, et al.). This is consistent with the “redox theory” for control of by freely diffusible cytosolic reducing equivalents (Archer, et al.,1986b, Archer, et al.,1993c), (Figures 2 and 3).
6.
RECENTLY RECOGNIZED FACTORS MODULATING KV CHANNEL ACTIVITY
A current’s characteristics (activation threshold, inactivation etc.) are not simply a function of the comprising the tetramer. and electrically silent (members of families Kv5-9) can associate with of functional Kv channels (families Kv1-4) and thereby modulate their activation and inactivation characteristics.
1) Beta-subunits: Three genes are expressed in PASMC (Yuan, et al.,1998), however, their function is unknown, induces inactivation in all of the Kv1 members, except Kv 1.6 (Heinemann, et al., 1996). shifts the activation threshold of Kvl.5 by ~ -10 mV but has no effect on channel deactivation (Heinemann, et al., 1996). 2) Electrically silent Kv channels: Kv channels in families 5-9 do not conduct current themselves but, when associated with functional Kv channel proteins, may form heterotetramers with altered activation and inactivation properties. Kv9.3 forms heteromultimers with Kv2.1 and this may be important in conferring responsiveness to this channel. For example, the Kv2.1/9.3 heteromultimer activates in the voltage range of the resting of
229
PA myocytes (Patel, et al.,1997); whereas Kv2.1 itself only activates at more positive potentials. The heterotetramer is more likely to be active, and thus to be physiologically important, than the homomultimeric Kv2.1 channel.
7.
REDOX REGULATION OF K+ CHANNELS
There are several means by which hypoxia might alter the function of ion channels in the pulmonary circulation. In the simplest scenario, hypoxia might act to directly inhibit the channel by a redox mechanism. K+ channels can be opened or closed by redox modulation in vitro (Kuo, et al.,1993, Post, et
al.,1993, Ruppersberg, et al.,1991). Reducing agents, such as GSH, NADH and dithionite inhibit channels in PASMCs (Lee, et al.,1994, Post, et al.,1993, Reeve, et al.,1995, Weir and Archer,1995, Yuan, et al.,1994); conversely, oxidants, such as diamide or GSSG, activate channels (Lee, et
al.,1994. Post, et al.,1993, Reeve, et al.,1995). Reduction or oxidation of sulfhydryl groups on ammo acids, such as cysteine, may cause conformational changes in the channel which close or open the channel, respectively (Ruppersberg, et al.,1991). The concept of a redox gated channel is also invoked by other hypotheses which relate sensing to the activity of the mitochondrial electron transport chain (ETC) or the activity of NADPH oxidase. In both models a freely diffusible electron donor signals the change in and initiates a redox modulation of the channel (Archer, et al.,1993b, Archer, et al.,1986b, Archer, et al.,1993c).
8.
MITOCHONDRIA AS Hypoxia could control
SENSORS
channel activity in the carotid body’s type 1 cell
or the PASMC through its ability to modulate mitochondrial respiration. Inhibitors of the mitochondrial electron transport chain mimic hypoxia’s effects on the carotid body (they increase sinus nerve activity) (Mills and Jobsis,1972, Mulligan, et al.,1981, Mulligan and Lahriri,1981) and PA (they cause vasoconstriction) (Archer, et al.,1993a, Rounds and McMurtry,1981). There are at least 3 means by which a change in mitochondrial function could be responsive to and thus serve as an sensor: 1) Energy depletion. Although it is tempting to ascribe vasoconstriction caused by hypoxia and metabolic inhibitors to ATP depletion, HPV occurs with mild-moderate hypoxia in the absence of decreased ATP or phosphocreatine levels (Buescher, et al.,1991). HPV begins to occur at s in the low normoxic range (70-80mmHg) (Madden, et al.,1985). In the isolated
230
rat lung, ATP and ATP/ADP ratios are preserved after exposure to an alveolar of 7 mm Hg or ratios of 10/1 for up to 1 hour (Fisher and Dodia,1981). Similarly, in the type 1 cell, metabolic uncouplers (dinitrophenol and cyanide) stimulate dopamine secretion and enhance nerve activity (Obeso, et al.,1988). Metabolic inhibitor-induced pulmonary vasoconstriction occurs without lowering of Thus it is a shared effect of hypoxia and metabolic inhibitors, not per se, which causes HPV. 2) Novel cytochromes: A cytochrome with an unusually low affinity for (high ) has been reported in carotid body mitochondria ( of ~ 70 mm Hg) (Mills and Jobsis, 1972). Although this might permit the cytochrome to vary its reduction/oxidation ratio over the relevant range of there have subsequently been no confirmatory reports. There has been recent interest in cytochrome P-450 enzymes which metabolize arachidonic acid to form the inhibitor and systemic vasoconstrictor, 20-hydroxyeicosatetraenoic acid (HETE) (Zou, et al., 1996a) or activator and vasodilator epoxyeicosatrienoic acid (EET) (Zou, et al.,1996b). Cytochrome P-450 is an NADPH-requiring and -dependent monooxygenase system found in lung and has been postulated to act as an sensor. Yuan et al have shown that P-450 inhibitors reduce in PASMCs (Yuan, et al., 1995). The change in vascular tone resulting from inhibition of endogenous EET formation appears too small to account for HPV, but further studies are required. 3) Accumulation of reduced forms of electron donors in the cytosol:
Hypoxia increases the ratio of NADPH/NADP (Duchen and Biscoe, 1992a, Duchen and Biscoe, 1992b) and GSH (Archer, et al.,1986a) in a dosedependent fashion over the physiologically relevant range of This suggests that the activity of the mitochondrial electron shuttle is diminished by hypoxia, resulting in the accumulation of the reduced form of electron donors in the cytosol. This cytosolic redox change could serve as an sensor (Archer, et al.,1993a, Archer, et al.,1986b). Five percent of metabolized by mitochondria generates activated species (AOS), such as the superoxide anion. Hypoxia decreases the production of AOS (Archer, et al.,1988a, Archer, et al.,1988b, Paky, et al.,1993) and shifts the ratio of cytosolic redox couples, such as NADPH/NADP, to a more reduced ratio (Freeman and Crapo,1981) Mitochondria also produce hydrogen peroxide (Boveris and Chance, 1973) which has a fairly wide diffusion radius and can alter the function of K+ channels (Archer, et al.,1993b, Kuo, et al.,1993). The relative contribution of reduced redox couples, versus diminished levels of AOS, to sensing in the lung and carotid body remains to be established. Both hypoxia and mitochondrial ETC inhibitors rapidly reduce the production of AOS in the lung, inhibit Kv channels and elicit pulmonary vasoconstrction (Archer, et al.,1993c). Furthermore, the inhibitory effects of rotenone and
231
antimycin A on occur in cells patched with a pipette replete with ATP, in the presence of a normal and are not diminished by glyburide (Archer, et al.,1993c). We speculate these effects are due to the intracellular accumulation of NADH and GSH, or other reduced species which readily inhibit K+ channels.
9.
NADPH OXIDASE
Is it possible that another cytochrome-containing, electron shuttle could modulate the supply of reduced electron donors or AOS and thus regulate an -sensitive channels? NAD(P)H oxidase, a flavocytochrome also known as cytochrome is present in phagocytes , carotid body type 1 cells (Cross, et al.,1990), neuroepithelial bodies (Wang, et al.,1996), PASMCs (Marshall, et al.,1996, Mohazzab-H, et al.,1995, Mohazzab-H and Wolin, 1994) and endothelial cells (Zulueta, et al., 1995). The classical form of the enzyme, which preferentially uses NADPH as an electronm source, is comprised of a membrane-bound flavocytochrome containing two subunits, gp91phox and p22phox, and the cytosolic proteins p47phox and p67phox, which bind to the flavocytochrome to form the active enzyme complex (Jones, et al.,1995, Umeki,1994). NADPH oxidase uses both flavin and heme groups to shuttle electrons from NADPH to yielding superoxide radical. Wolin et al have hypothesized that a discrete, but related enzyme, an NADH oxidase, may be the sensor in PASMCs. This oxidase produces radicals, in proportion to PO2 and could thereby provide a redox signal, the effects of which may then be to modulate an effector mechanism (perhaps a K+ channel), resulting in HPV (Mohazzab-H, et al.,1995). Both NADPH (Archer, et al.,1999, Marshall, et al.,1996) and NADH oxidase (Mohazzab-H, et al.,1995) are present in PASMCs. It is uncertain if these are unique isoforms of the same enzyme. The names acknowledge a different substrate preference for the electron donorNADPH vs. NADH. Radical formation by the NADH isoform decreases as falls and AOS production is inhibited by DPI, but not rotenone (Mohazzab-H, et al.,1995, Mohazzab-H and Wolin,1994). Much of the data implicating the oxidase in sensing in blood vessels has relied on the use of a relatively nonspecific flavin inhibitor, diphenyleneiodonium (DPI). Unfortunately, DPI nonspecifically inhibits flavoprotein-containing enzymes, including membrane oxidases (NADH and NADPH (Cross and Jones,1986), NOS (Stuehr, et al.,1991) and complex 1 of the mitochondrial ETC (Gatley and Sheratt,1976, Gatley and Sherratt,1976). There are some observations which appear inconsistent with NADPH oxidase acting as a redox sensor in the PA. Although DPI does inhibit IK (Weir, et al.,1994), and causes some vasoconstriction (Grimminger, et al.,1995), it inhibits HPV (Thomas, et al.,1991). This is unexpected from a drug that is meant to mimic hypoxia by blocking the sensor. However, this effect may be
232
because DPI is also a L-type channels blocker (Weir, et al.,1994). Thus, DPI is a poor tool for establishing the physiological role of NADPH oxidase in regulating vascular tone. The development of mice deficient in NADPH oxidase activity (CGD mice) (Polock, et al.,1995), by mutation of the X-linked gene for the 91-kD membrane subunit of the enzyme provides an opportunity to study the role of NAD(P)H oxidase in HPV. Most -responsive cell types contain a similar form of the oxidase, containing the gp91phox component. The type 1 cell and neuroepithelial body, have an NADPH oxidase similar to that of neutrophils (containing both p22phox and gp91phox) (Youngson, et al.,1997). Even the “low output” form of this oxidase (which makes a lower level of superoxide radical under basal conditions), contains the gp91phox found in human neutrophils (Radeke, et al.,1991). We recently published a study testing the hypotheses that NADPH is the sensor. We examined HPV and K+ currents in mice lacking the gp91phox component of NADPH oxidase. Our findings of robust HPV response, despite total loss of NADPH oxidase activity (Figure 5), suggest strongly that this enzyme is not the sensor in PASMC (Archer, et al.,1999). The preserved constriction to rotenone and hypoxia in CGD mice indicates the mitochondrial “O2-sensor” remains a viable hypothesis.
233
ACKNOWLEDGMENTS Dr. Archer is supported by the Alberta Heritage Foundation for Medical Research (AHFMR), the Medical Research Council of Canada and the Alberta Heart and Stroke Foundation. Dr. Michelakis is supported by AHFMR. Dr. Weir is supported by the Department of Veterans Affairs. Dr. Reeve is supported by NIH R29 29182, the American Heart Association and a Giles Filley Award.
REFERENCES 1.
Adda, S., Fleischmann, B., Freedman, B., Yu, M., DW, H. and Kotlikoff, M., 1996, Expression and function of voltage dependent potassium channel genes in human airway smooth muscle, J Biol Chem 271: 13239-13243. 2. Arai, H., Hori, S., Aramori, I., Ohkubo, H. and Nakanishi, S., 1990, Cloning and expression of a cDNA encoding an endothelin receptor, Nature 348: 730-732. 3. Archer, S., Eaton, J., Nelson, D., Kelly, P., Peterson, D. and Weir, E., 1988a, Oxygen radicals and a n t i o x i d a n t enzymes alter pulmonary vascular reactivity in the rat lung, ./. Appl. Physiol. 66: 1 0 2 - 1 1 . 4. Archer, S., Huang, J., Henry, T., Peterson, D. and Weir, E., 1993a, A redox-based O2 sensor in rat pulmonary vasculature, Circ Res 73: 1100-1112. 5. Archer, S., Huang, J., Post, J., Hume, J. and Weir, E., 1993b, t-butyl hydroperoxide and glutathione modulate an outward current in rat pulmonary vascular smooth muscle cells, Circulation 88: I-143. 6. Archer, S., McMurtry, I. and Weir, E., 1988b, Mechanisms of acute hypoxic and hyperoxic changes in pulmonary vascular reactivity, in Weir, E.K. and Reeves, J.T. 241289, 7. Archer, S., Nelson, D., Eaton, J. and Weir, E., 1986a, Changes in glutathione status parallel changes in pulmonary vascular reactivity, Proc. Int. Union Physiol. Sci. 16: 448. 8. Archer, S., Tolins, J., Raij, L. and Weir, E., 1989a, Hypoxic pulmonary vasoconstriction is enhanced by i n h i b i t i o n of the synthesis of an endothelium derived relaxing factor, Biochem Biophys Res Comm164:1198-1205. 9. Archer, S., W i l l , J. and Weir, E., 1986b, Redox status in the control of pulmonary vascular tone, Herz 11: 127-141. 10. Archer, S., Yankovich, R., Chesler, E. and Weir, E., 1985, Comparative effects of nisoldipine, nifedipine and bepridil on experimental pulmonary hypertension, J. Pharmacol Exp Ther. 233: 12-17. 11. Archer, S. L., Huang, J., Hampl, V., Nelson, D. P., Shultz, P. J. and Weir, E. K., 1994, N i t r i c oxide and cGMP cause vasorelaxation by activation of a charybdotoxin-sensitive K channel by cGMP-dependent protein kinase, Proc. Natl. Acad. Sci. USA 91: 7583-7587. 12. Archer, S. L., Huang, J., Henry, T., Peterson, D. and Weir, E. K., 1993c, A redox based oxygen sensor in rat pulmonary vasculature, Circ. Res. 73: 1100-1112. 13. Archer, S. L., Huang, J. M. C, Reeve, H. L., Hampl, V., Tolarova, S., Michelakis, E. D. and Weir, E. K., 1996, Differential distribution of electrophysiologically distinct myocytes in conduit and resistance arteries determines their response to nitric oxide and hypoxia., Circ Res 78: 431-442.
234
14. Archer, S. L., Reeve, H. L., Michelakis, E., Puttagunta, L., Waite, R., Nelson, D. P., Dinauer, M. C. and Weir, E. K.., 1999, O2-sensing is preserved in mice lacking the 91 PHOX subunit of NADPH oxidase, Proc. Natl. Acad. Sci. 96: 7944-7949. 15. Archer, S. L., Souil, E., Dinh-Xuan, A. T., Schremmer, B., Mercier, J. C., El Yaagoubi, A., Nguyen-Huu, L., Reeve, H. L. and Hampl, V., 1998, Molecular identification of the role of voltage-gated channels, kv1.5 and kv2.1, in hypoxic pulmonary vasoconstriction and control of resting membrane potential in rat pulmonary artery myocytes, J Clin Invest 101: 2319-30. 16. Archer, S. L., Tolins, J. P., Reye, L. and Weir, E. K., 1989b, Hypoxic pulmonary vasoconstriction is enhanced by inhibition of the synthesis of an endothelium derived relaxing factor,Biochem.Biophys.Res.Comm . 164: 1 198-1205. 17. Bouchard, R. and Fedida, D., 1995, Closed-and open-state binding of 4-aminopyridine to the cloned human potassium channel Kv q.5, J. Pharm. Exp. Ther. 275: 864-876. 18. Boveris, A. and Chance, B., 1973, The mitochondrial generation of hydrogen peroxide, Biochem. J . 134: 707-716. 19. Brashers, V. L., Peach, M. J. and Rose, C. E., 1988, Augmentation of hypoxic pulmonary vasoconstriction in the isolated perfused rat lung by in vitro antagonists of endotheliumdependent relaxation, J Clin Invest 82: 1495-1502. 20. Buescher, P., Perse, D., Pillai, R., Litt, M., Mitchell, M. and Sylvester, J. T., 1991, Energy state and vasomotor tone in hypoxic pig lungs, J. Appl Physiol 70: 1874-1881. 2 1 . Chandy, K. G. and Gutman, G. A., 1993, Nomenclature for mammalian potassium channel genes, Trends Pharmacol. 14: 434-440. 22. Chang, J. K., Moore, P., Fineman, J. R., Soifer, S. J. and Heymann, M. A., 1992, channel pulmonary vasodilation in fetal lambs: role of endothelium-derived nitric oxide, J Appl Physiol 73: 188-94. 23. Clapp, L. and Gurney, A., 1991, Outward currents in rabbit pulmonary artery cells disassociated with a new technique., Exp Physiol 76: 667-693. 24. Clapp, L. H. and Gurney, A. M., 1992, ATP-sensitive channels regulate resting potential of pulmonary arterial smooth muscle cells, Am J Physiol 262: H916-20. 25. Cross, A., Henderson, L., Jones, O., Delpiano, M., Hentschel, J. and Acker, H., 1990, Involvement of an NAD(P)H oxidase as a pO2 sensor protein in the rat carotid body, Biochem J 272: 743-747. 26. Cross, A. and Jones, O., 1986, The effect of the inhibitor diphenylene iodonium on the superoxide generating system of neutrophils, Biochem. J. 237: 1 1 1 - 1 1 6 . 27. Dart, C. and Standen, N. B., 1995, Activation of ATP-dependent channels by hypoxia in smooth muscle cells isolated from the pig coronary artery, J. Physiol. 483: 29-39. 28. Dascal, N., Doupnik, C. A., Ivanina, T., Bausch, S., Wang, W., Lin, C., Garvey, J., Chavkin, C., Lester, H. A. and Davidson, N., 1995, Inhibition of function in Xenopus oocytes of the inwardly rectifying G-protein-activated atrial K channel (GIRK1) by overexpression of a membrane-attached form of the C-terminal tail, Proc Nail Acad Sci U S A 92: 6758-62. 29. Dascal, N., Schreibmayer, W., Lim, N. F., Wang, W., Chavkin, C., Di Magno, L., Labarca, C., Kieffer, B. L., Gaveriaux-Ruff, C., Trollinger, D. and et al., 1993, Atrial G protein-activated channel: expression cloning and molecular properties, Proc Natl Acad Sci U S A 90: 10235-9. 30. Daut, J., Maier-Rudolph, W., von Beckerath, Mehrke, G., Gunther, K. and GoedelMeinen, L., 1990, Hypoxic dilatation of coronary arteries is mediated by ATP-sensitive potassium channels, Science 247: 1341-1344.
235
3 1 . Doyle, D. A., Cabral, J. M., Pfuetzner, R. A., Kuo, A., Gulbis, J. M., Cohen, S. L., Chait, B. T. and MacKinnon, R., 1998, The structure of the potassium channel: Molecular basis of
conduction and selectivity, Science 280: 69-77.
32. Duchen, M. and Biscoe, T., 1992a, Mitochondrial function in type 1 cells isolated from rabbit arterial chemoreceptors, J Physiol 450: 13-31. 33. Duchen, M. R. and Biscoe, T. J., 1992b, Relative mitochondrial membrane potential and in type I cells isolated from the rabbit carotid body, J. Physiol. 450: 33-61. 34. Duprat, F., Guillemare, E., Romey, G., Fink, M., Lesage, F., Lazdunski, M. and Honore,
E., 1995, Susceptibility of cloned
channels to reactive oxygen species, Proc Natl Acad
Sci U S A 92: 11796-800.
35.
Evans, A., Osipenko, O. and Gurney, A., 1996, Properties of a novel current that is active at resting potential in rabbit pulmonary artery smooth muscle cells, J Physiol 496: 407-420.
36. Fisher, A. B. and Dodia, C., 1981, Lung as a model for evaluation of critical intracellular PO2 and PCO, Am. J. Physiol. 241: E47-E50. 37.
Franco-Obregon, A. and Lopez-Barneo, J., 1996, Differential oxygen sensitivity of
calcium channels in rabbit smooth muscle cells of conduit and resistance pulmonary arteries, J Physiol 491.2: 5 1 1 -518.
38. Freeman, B. A. and Crapo, J. D., 1981, Hyperoxia increases oxygen radical production in rat lungs and lung mitochondria, J. Biol. Chem. 256: 10986-10992.
39
Garcia, M. L., Garcia-Calvo, M., Hidalgo, P., Lee, A. and McKinnon, R., 1994, Purification and characterization of three inhibitors of voltage-depenent channels from Leiurus quinquestriatus var. hebraeus venom, Biochemistry 33: 6834-6839.
40.
Gasser, R., Klein, W. and Kickenweiz, E., 1993, Vasodilative response to hypoxia and simulated ischemia is mediated by ATP-sensitive channels in guinea pig thoracic aorta, Angiology 44: 228-43.
41.
Gatley, J. S. and Sheratt, H. S. A., 1976, Relation of binding of diphenylene[125I] iodonium to mitochondria to the extent of inhibition of oxygen uptake, Biochem. J. 158: 307-315.
42. Gatley, S. and Sherratt, H., 1976, The effects of diphenyleneiodonium on mitochondrial reactions, Biochem J 158: 307-315.
43. Gebremedhin, D., Bonnet, P., Greene, A. S., England, S. K., Rusch, N. J., Lombard, J. H. and Harder, D. R., 1994, Hypoxia increases the activity of channels in cat cerebral arterial muscle cell membranes, Pflügers Arch. 428: 621-630.
44. Grimminger, F., Weissmann, N., Spriestersbach, R., Becker, E., Rosseau, S. and Seeger, W., 1995, Effects of NADPH oxidase inhibitors on hypoxic vasoconstriction in bufferperfused rabbit lungs. Lung Cell Mol Physiol 12: L747-L752. 45.
Grissmer, S., Nguyen, A. N., Aiyar, J., Hanson, D. C., Mather, R. J., Gutman, G. A.,
Karmilowicz, M. J., Auperin, D. D. and Chandy, K. G., 1994, Pharmacological characterization of five cloned voltage-gated channels, types Kv 1.1, 1.2, 1.3, 1.5, and 3.1, stably expressed in mammalian cell lines, J. Pharm. Exp. Ther. 45: 46. Groves, B. M., Reeves, J. T., Sutton, J. R., Wagner, P. D., Cymerman, A., Malconian, M. K., Rock, P. B., Young, P. M. and Houston, C. S., 1987, Operation Everest II: elevated high-altitude pulmonary resistance unresponsive to oxygen, J. Appl. Physiol. 63: 521-530.
47. Hampl, V., Weir, E. K. and Archer, S. L., 1994, Endothelium-derived nitric oxide is less important for basal tone regulation in the pulmonary than the renal circulation of the adult rat, J Vasc Med Biol 5: 22-30. 48. Hasunuma, K., Rodman, D. and McMurtry, I., 1991, Effects of . _ channel blockers on vascular tone in the perfused rat lung, Am Rev Respir Dis 144: 884-887.
236
49.
Heinemann, S. H., Rettig, J., Graack, H. R. and Pongs, O., 1996, Functional characterization of Kv channel beta-subunits from rat brain, J Physiol (Lond) 493: 625-33. 50. Jensen, K., Mico, A., Czartolomna, J., Latham, L. and Voelkel, N., 1992, Rapid onset of hypoxic vasoconstriction in isolated lungs, J Appl Physiol 72: 2018-2023. 51. Jones, S. A., Hancock, J. T., Jones, O. T., Neubauer, A. and Topley, N., 1995, The expression of NADPH oxidase components in human glomerular mesangial cells: detection of protein and mRNA for p47phox, p67phox, and p22phox, J Am Soc Nephrol 5: 1483-91. 52. Kato, M. and Staub, N., 1966, Response of small pulmonary arteries to unilobar alveolar hypoxia and hypercapnia, Circ. Res. 19: 426-440. 53. Kuo, S., Saad, A., Koong, A., Hahn, G. and Giaccia, A., 1993, Potassium-channel activation in response to low doses of involves reactive oxygen intermediates in nonexcitatory cells, Proc Natl Acad Sci 90: 908-912. 54. Lee, S., Park, M., So, I. and Earm, Y., 1994, NADH and NAD modulates channels in small pulmonary arterial smooth muscle cells of the rabbit, Pflugers Arch 427: 378-380. 55. Lloyd, T. C., 1966, PO2-dependent pulmonary vasoconstriction caused by procaine, J. Appl. Physiol. 21: 1439-1442. 56. Lopez-Barneo, J., Lopez-Lopez, J., Urena, J. and Gonzalez, C., 1988, Chemotransduction in the carotid body: current modulated by PO2 in type 1 chemoreceptor cells, Science 242: 580-582. 57. Madden, J., Dawson, C. and Harder, D., 1985, Hypoxia-induced activation in small isolated pulmonary arteries from the cat, J Appl Physiol 59: 113-118. 58. Madden, J., Vadula, M. and Kurup, V., 1992, Effects of hypoxia and other vasoactive agents on pulmonary and cerebral artery smooth muscle cells, Am J Physiol 263: L384L393. 59. Marshall, C., Mamary, A., Verhoeven, A. and Marshall, B., 1996, Pulmonary artery NADPH-oxidase is activated in hypoxic pulmonary vasoconstriction, Am J Reap Cell Mol
Biol 15: 633-644. 60. McMurtry, I., 1985, Bay K8644 potentiates and A23187 inhibits hypoxic vasoconstriction in rat lungs, Am J Physiol 249: H741-H746. 61. McMurtry, I., Davidson, B., Reeves, J. and Grover, R., 1976, Inhibition of hypoxic pulmonary vasoconstriction by calcium antagonists in isolated rat lungs, Circ Res 38: 99104. 62. Mills, E. and Jobsis, F. F., 1972, Mitochondrial respiratory chain of carotid body and chemoreceptor response to changes in oxygen tension, J. Neurophsiol. 35: 405-428. 63. Mohazzab-H, K., Fayngersh, R. and Kaminski, P., 1995, Potential role of NADPH oxidoreductase-derived reactive species in calf pulmonary arterial responses, Am J Physiol 269: L637-L644. 64. Mohazzab-H, K. and Wolin, M., 1994, Properties of a superoxide anion-generating microsomal NADH oxidoreductase, a potential pulmonary artery sensor, Am J Physiol 267:L823-L831. 65. Mulligan, E., Lahiri, S. and Storey, B. T., 1981, Carotid body chemoreception and mitochondrial oxidative phosphorylation, J. Appl. Physiol. 51: 438-446. 66. Mulligan, E. and Lahriri, S., 1981, Dependence of carotid chemoreceptor stimulation by metabolic agents on PaO2 and Pa CO2, J. Appl. Physiol. 50: 884-891. 67. Nelson, M., Patlak, J., Worley, J. and Standen, N., 1990, Calcium channels, potassium channels, and voltage dependence of arterial muscle tone., Am J Physiol 259: C3-C18. 68. Nelson, M. T. and Brayden, J. E., 1993, Regulation of arterial tone by calcium-dependent channels and ATP-scnsitive channels, Cardiovasc Drugs Ther 3: 605-10.
237
69.
Obeso, A., Almaraz., L. and Gonzalez, C., 1988, Effects of cyanide and uncouplers on chemoreceptor activity and ATP content of the cat carotid body, Brain Research 481: 250257.
70.
Oparil, S., Chen, S. J., Meng, Q. C., Elton, T. S., Yano, M. and Chen, Y. F., 1995, Endothelm-A receptor antagonist prevents acute hypoxia-induced pulmonary hypertension in the rat. Am. J. Physiol. 12: L95-L100. 7 1 . Overturf, K. E., Russell, S. N., Carl, A., Vogalis, F., Hart, P. J., Hume, J. R., Sanders, K. M . and Horowitz, B., 1994, Cloning and characterization of a K v l . 5 delayed rectifier channel from vascular and visceral smooth muscles, Am J Physiol 267: C1231-8. 72. Ovetsky, R., Sprague, R., Stephenson, A., Dahms, T. and Lonigro, A., 1987, Inhibition of leukotriene synthesis does not alter the pulmonary pressor response to alveolar hypoxia, Am.Rev. Resp. Dis. 135: A 127 (abstract). 73
Paky, A., Michael, J., Burke-Wolin, T. and Wolin, M., 1993, Endogenous production of superoxidc by rabbit lungs: effects of hypoxia or metabolic inhibitors, J Appl Physiol 74: 2868-2874. 74 Patel, A. J., Lazdunski, M. and Honore, E., 1997, Kv2.l/Kv9.3, a novel ATP-dependent
delayed-rectifier
channel in oxygen-sensitive pulmonary artery myocytes, Embo J 16:
6615-25. 75. Polock, J. D., Williams, D. A., Gifford, M. A. C., Li, L. L., Du, X., Fisherman, J., Orkin,
S. H . , Doerschuk, C. M. and Dinauer, M. C., 1995, Mouse model of X-linked chronic granulomatous disease, an inherited defect in phagocyte superoxide production, Nature Genetics 9: 202-209. 76. Post, J., Hume, J., Archer, S. and Weir, E., 1992, Direct role for potassium channel
i n h i b i t i o n in hypoxic pulmonary vasoconstriction., Am J Physiol 262: C882-C890. 77. Post, J., Weir, E., Archer, S. and Hume, J., 1993, Redox regulation of channels and hypoxic pulmonary vasoconstriction. In Ion Flux in Pulmonary Vascular Control. Edited by Weir, E. K., Hume, J. R. and Reeves, J. T. Plenum Press: New York. 189-204 78. Post, J. M., Gelband, C. H. and Hume, J. R., 1995, inhibition of channels in canine pulmonary artery: Novel mechanism for hypoxia-induced membrane depolarization, Circ Res 77: 131-139. 79. Radeke, H . H., Cross, A. R., Hancock, J. T., Jones, O. T., Nakamura, M., Kaever, V. and Resell, K., 1991, Functional expression of NADPH oxidase components (alpha- and betasubunits of cytochrome b558 and 45-kDa flavoprotein) by intrinsic human glomerular mesangial cells, J Biol Chem 266: 21025-9. 80. Reeve, H. L., Weir, E. K., Nelson, D. P., Peterson, D. A. and Archer, S. L., 1995, Opposing Effects of Oxidants and Antioxidants on Channel Activity and Tone in Vascular Tissue, Exp. Physiol. 80: 825-834.
81. 82.
Rounds, S. and McMurtry, I., 1981, Inhibitors of oxidative ATP production cause transient vasoconstriction and block subsequent pressor responses in rat lungs, Circ. Res. 48: 393-400. Ruppersberg, J., Stocker, M., Pongs, O., Heinemann, S., Frank, R. and Koenen, M.,
1991, Regulation of fast inactivation of cloned mammalian 1K(A) channels by cysteine oxidation. Nature 352: 711-714. 83. Salkoff, L. and Jegla, T., 1995, Surfing the DNA databases for channels nets yet more diversity, Neuron 15: 489-92. 84. Sheehan, D., Sylvester, J. and Sham, J., 1994, 4-aminopyridinc sensitive, delayed
rectifier potassium
current is the major
current controlling resting membrane
potential in porcine pulmonary vascular smooth muscle, Am J C C Med 149: A293. 85. Shi, G., Kleinklaus, A. K., Marrion. N. V. and Trimmer, J. S., 1994, Properties of Kv2.1 channels expressed in transfected mammalian cells, J Biol Chem 269: 23204-11.
238
86.
Shieh, C. C. and Kirsch, G. E., 1994, Mutational analysis of ion conduction and drug binding sites in the inner mouth of voltage-gated
87.
channels, Biophys J 67: 2316-25.
Shirai, M., Ninomiya, I. and Sada, K.., 1991, Constrictor response of small pulmonary arteries to acute pulmonary hypertension during left atrial pressure elevation, Jap J Physiol 41: 129-142.
88.
Smirnov, S., Robertson, T., Ward, J. and Aaronson, P., 1994, Chronic hypoxia is associated with reduced delayed rectifier current in rat pulmonary artery muscle cells, Am J Physiol 266: H365-H370. 89. Stuehr, D., Fasehun, O., Kwon, N., Gross, S., Gonzalez, J., Levi, R. and Nathan, C., 1991, Inhibition of macrophage and endothelial cell nitric oxide synthase by diphenylenciodonium and its analogs, FASEB J 5: 98-103.
90.
Taglialatela, M., Drewe, J. A. and Brown, A. M., 1993, Barium blockade of a clonal
potassium channel and its regulation by a critical pore residue, Mol Pharmacol 44: 180-90. 91. Takimoto, K.., Fomina, A. F., Gealy, R., Trimmer, J. S. and Levitan, E. S., 1993, Dexamethasone rapidly induces Kvl.5
channel gene transcription and expression in
clonal pituitary cells, Neuron 11: 359-369. 92. Thomas, H. M. I., Carson, R. C., Fried, E. D. and Novitch, R. S., 1991, Inhibition of hypoxic pulmonary vasoconstriction by diphenyleneiodonium, Biochem Pharmacol. 42: R9-12. 93. Tolins, M., Weir, E., Chesler, E., Nelson, D. and From, A., 1986, Pulmonary vascular tone is increased by a voltage-dependent calcium channel potentiator,.J Appl Physiol 60: 942-948.
94. Trimmer, J. S., 1993, Expression of Kv2.1 delayed rectifier developing rat brain, FEBS Lett 324: 205-10. 95.
channel isoforms in the
Tristani-Firouzi, M., Reeve, H. L., Tolarova, S., Weir, E. K. and Archer, S. L., 1996, Oxygen-induced constriction of the rabbit ductus arteriosus occurs via inhibition of a 4-
aminopyridine-sensitive potassium channel, J. Clin. Investigation 98: 1959-1965. 96.
Umeki, S., 1994, Activation factors of neutrophil NADPH oxidase complex, Life Sciences 55: 1 - 1 3 . 97 Voelkel, N., 1986, Mechanisms of hypoxic pulmonary vasoconstriction, Am.Rev. Resp. Dis. 133: 1186-1195. 98. Voelkel, N. F., Gerber, J. G., McMurtry, I. F., Nies, A. S. and Reeves. J. T., 1981, Release of vasodilator prostaglandin, from isolated rat lung during vasoconstriction, Circ Res 48: 207-213. 99. von Euler, U. and Liljestrand, G., 1946, Observations on the pulmonary arterial blood
pressure in the cat, Acta Physiol Scand 12: 301-320. 100. Wang, D., Youngson, C., Wong, V., Yeger, H., Dinauer, M. C., Vega-Saenz Miera, E.,
Rudy, B. and Cutz, E., 1996, NADPH-oxidase and a hydrogen peroxide-sensitive channel may function as an oxygen sensor complex in airway chemoreceptors and small cell lung carcinoma cell lines, Proc Natl Acad Sci U S A 93: 13182-7. 1 0 1 . Weir, E. K. and Archer, S. L., 1995, The mechanism of acute hypoxic pulmonary vasoconstriction: the tale of two channels, FASEB 9: 183-189.
102.
Weir, E. K., Dinauer, M., Nelson, D. and Archer, S., 1996, Hypoxic pulmonary
vasoconstriction
is
unchanged
in
NAPH-oxidase
“knock-out”
mice.
FASEB
Meeting Washington, D.C., (Abstract 572): 103. Weir, E. K., McMurtry, I. P., Tucker, A., Reeves, J. T. and Grover, R. P., 1976, Prostaglandin synthetase inhibitors do not decrease hypoxic pulmonary vasoconstriction, J. Appl. Physiol. 4 1 : 7 1 4 - 7 1 8 .
239
104. Weir, E. K., Wyatt, C. N., Reeve, J., Huang, J., Archer, S. L. and Peers, C., 1994, Diphenyleneiodonium inhibits both potassium and calcium currents in isolated pulmonary artery smooth muscle cells, J Appl Physiol 76: 2611 -2615.
105. West, J., 1991, Control of Ventilation. In Physiological Basis of Medical Practice. Edited by West, J. Williams & Wilkins: Baltimore, MD. 579-603 106. Xu, J., Yu, W., Jan, Y. N., Jan, L. Y. and Li, M., 1995, Assembly of voltage-gated potassium channels. Conserved hydrophilic motifs determine subfamily-specific interactions between the alpha-subunits, J Biol Chem 270: 24761-8. 107. Yang, T., Kupershmidt, S. and Roden, D. M., 1995, Anti-minK. antisense decreases the amplitude of the rapidly activating cardiac delayed rectifier 1246-1253.
108.
current, Circ. Res. 77:
Young, T., Lundquist, L., Chesler, E. and Weir, E., 1983, Comparative effects of
nifedipine, verapamil, and d i l t i a z e m on experimental pulmonary hypertension, Am J Cardiol 51: 195-200.
109. Youngson, C., Nurse, C, Yeger, H., Curnutte, J. T., Vollmer, C., Wong, V. and Cutz, H., 1997, Immunocytochemical localization of O2-sensing protein (NADPH oxidase) in chemoreceptor cells, Micro. Res. Tech. 37: 101-106.
1 1 0 . Yuan, X.-J., 1995a, Voltage gated currents regulate resting membrane potential and in pulmonary artery myocytes, Circ Research 77: 370-378. 111.
Yuan, X.-J., Aldinger, A., Orens, J., Conte, J. and Rubin, L., 1996, Dysfunctional
voltage-gated potassium channels in the pulmonary artery smooth muscle cells of patients with primary pulmonary hypertension, Circulation 94: 1-49. 112. Y u a n , X.-J., Goldman, W., Tod, M., Rubin, L. and Blaustein, M., 1993, Hypoxia reduces potassium currents in cultured rat pulmonary but not mesenteric arterial myocytes, Am J Physiol 264: L116-L12.V
1 1 3 . Yuan, X.-J., Tod, M. L., R u b i n , L. J. and Blaustein, M. P., 1994, Deoxyglucose and reduced g l u t a t h i o n c mimic effects of hypoxia on and conductances in pulmonary artery cells, Am J Physiol 267: L52-L63. 114. Yuan, X. J., 1995b, Voltage-gated currents regulate resing membrane potential and in pulmonary arterial myocytes, Circ. Res. 77: 370-378. 1 1 5 . Yuan, X. J., Tod, M. L., Rubin, L. J. and Blaustein, M. P., 1995, Inhibition of cytochrome P-450 reduces voltage-gated currents in pulmonary arterial myocytes, Am J Physiol 268: C259-70.
116. Yuan, X. J., Wang, J., Juliaszova, M., Golovina, V. A. and Rubin, L. J., 1998, Molecular basis and function of voltage-gated channels in pulmonary arterial smooth muscle cells. Am J Physiol 274: L621 -35. 117. Zou, A. P., Fleming, J. T., Falck, J. R., Jacobs, E. R., Gcbremedhin, D., Harder, D. R. and Roman, R. J., 1996a, 20-HETE is an endogenous inhibitor of the large-conductance channel in renal arterioles, Am J Physiol 270: R228-37. 1 1 8 . Zou, A. P., Fleming, J. T., Falck, J. R., Jacobs, E. R., Gebremedhin, D., Harder, D. R. and Roman, R. J., 1996b, Stereospecific effects of epoxyeicosatrienoic acids on renal vascular tone and activity, Am J Physiol 270: F822-32. 119. Zulueta, J . , Yu, F.-S., Hertig, I .A., Thannickal, V. J. and Hassoun, P. M., 1995, Release of hydrogen peroxide in response to hypoxia-reoxygenation: role of NAD(P)H oxidaselike enzyme in endothelial cell plasma membrane, Am. J. Respir. Cell Mol. Biol. 12: 4149.
240
CHEMOSENSING AT THE CAROTID BODY
Involvement of a HERG-like potassium current in glomus cells Jeffrey L. Overholt, Eckhard Ficker, Tianen Yang, Hashim Shams1, Gary R. Bright,and Nanduri R. Prabhakar Department of Physiology and Biophysics, Case Western Reserve University. Cleveland, OH 44106-4970; 1Permanent address: Institute fur Physiologie, Ruhr-Universitat Bochum, Germany
Abstract:
Currently, it is not clear what type of channel(s) is active at the resting membrane potential (RMP) in glomus cells of the carotid body (CB). HERO channels produce currents that are known to contribute to the RMP in other neuronal cells. The goal of the present study was to determine whether CB glomus cells express HERG-like (HL) current, and if so, to determine whether HL currents regulate the RMP. With high depolarizing voltage steps from mV revealed a slowly deactivating inward tail current indicative of HL current in whole-cell, voltage clamped glomus cells. The HL currents were blocked by dofetilide (DOF) in a concentration-dependent manner and high concentrations (1 and 10 mM) of . The steady-state activation properties of the HL current suggest that it is active at the R M P in glomus cells. Whole-cell, current clamped glomus cells exhibited a RMP of mV. 150 nM DOF caused a significant (14 mV)
depolarizing shift in the RMP. In isolated glomus cells, increased in response to DOF In an in-vitro CB preparation, DOF increased basal sensory discharge in a concentration-dependent manner and significantly attenuated the sensory response to hypoxia. These results suggest that the HERG-like current is responsible for controlling the RMP in glomus cells of the rabbit CB, and that it is involved in the chemosensory response to hypoxia of the CB.
1.
INTRODUCTION
It is believed that hypoxia causes membrane depolarization in glomus cells causing influx of through voltage-gated channels, leading to release of neurotransmitter(s) that act on apposing afferent nerve terminals to
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
241
increase sensory discharge in the carotid sinus nerve. However, the cellular basis for the initial depolarization of glomus cells during hypoxia remains poorly understood. Several studies have reported that hypoxia inhibits outward currents in glomus cells. Therefore, it was proposed that the hypoxia-sensitive channels contribute to the initial depolarization that is essential for the transduction of the hypoxic stimulus (for review see: Gonzalez et al. 1994). However, these channels are not active at the reported resting membrane potential of glomus cells, and known blockers of these channels had no affect on basal or hypoxia stimulated sensory activity of the carotid body or on intracellular in isolated glomus cells (Cheng and Donnelly 1995; Buckler 1997; Lahiri et al. 1998). Consequently, which current regulates the resting membrane potential and the role of channels in the transduction process of the hypoxic stimulus remain uncertain. Inwardly rectifying channels contribute to the resting membrane potential in many different cell types including neurons. One such channel is the protein encoded by the human ether-a-gogo-related gene, HERG (Wyatt et al. 1995). The goal of the present study was to determine whether carotid body glomus cells express HERG-like current, and if so, to determine whether HERG-like currents regulate the resting membrane potential and affect the carotid body sensory response to hypoxia.
2.
MATERIALS AND METHODS
currents and membrane potential were measured from glomus cells freshly isolated from adult rabbits in the whole cell configuration of the patch clamp technique using an Axopatch 200 amplifier (Axon Instruments). For voltage clamp, the intracellular solution contained (in mM): 100 K aspartate, 10 EGTA, 10 HEPES, and 20 glucose pH 7.2. The standard extracellular solution contained (in mM): 140 NaCl, 5
10 HEPES, 10 glucose, pH 7.4. The concentration in the extracellular solution was varied by equimolar
replacement of NaCl with KCl. For membrane potential measurements, the internal solution contained (in mM): 120 K glutamate, 20 KC1, 5 Mg-ATP, 5 EGTA, 5 HEPES, 0.1 Tris-GTP, pH 7.2. Cells were perfused with KrebsHeinseliet buffer equilibrated with in air (in mM): 120 NaCl, 4.8 11 glucose, pH 7.4. P C l a m p programs (Axon Instruments) were used for data acquisition and analysis. The extracellular solution was changed using a fast-flow device consisting of a linear array of borosilicate glass capillary tubings (Overholt and Prabhakar 1997).
242
Changes in in individual glomus cells were measured using Indo-l-PE3 (Texas Fluorescence Lab, Inc.). Cells were placed in a gas-tight, temperature regulated chamber (Bioptics, Inc.) and superfused with Hank’s Balanced Salt Solution (HBSS) equilibrated with oxygen and Images were recorded with a Zeiss LSM-410 equipped with a UV laser. Excitation was 360 nm with emission at 408 nm and 475 nm. Cells responding to hypoxia with increases in were considered to be glomus cells. Carotid sinus nerve discharge was measured in-vitro. The carotid bifurcation along with the carotid sinus nerve was excised from anesthetized, adult rabbits. The carotid bifurcation was placed in a recording chamber, and the common carotid artery was cannulated and perfused with DMEM solution at a rate of ml/min. Stopping the perfusion (i.e., hypoxia for 1-2 min) augmented the sensory activity, suggesting that the action potentials were of chemoreceptor origin. The superfusion medium was equilibrated with room air (normoxia) or (hypoxia). In each experiment, the carotid body was perfused with normoxic fluid for 5 min followed by hypoxia challenge.
3.
RESULTS
Depolarizing voltage steps from a holding potential of mV gave rise to large, outward, delayed rectifier-like currents in glomus cells. The threshold for activation was reached between and mV and was halfmaximal at 4.7 mV. The characteristics of the outward currents are similar to those described in rabbit glomus cells by other investigators (Lopez-Lopez et al. 1993). No inward tail currents were seen on return to mV in cells exposed to external solutions containing 5 mM . However, raising the external concentration to 40 or 70 mM revealed a slowly deactivating, inward tail current characteristic of current conducted by inward rectifier channels such as HERG. The current was very slowly activating (seconds) and displayed a prominent “nose” suggesting that it was being conducted by a HERG-like channel. As seen in figure 1, eliciting currents from a holding potential of 0 mV is optimal for observing the HERG-like current in glomus cells, since HERG channels are maximally activated at 0 mV and the large, outward, delayed rectifier-like currents are inactivated. Using this protocol, HERG-like tail currents first increased for a few ms, due to rapid removal of inactivation, and then deactivated in a voltage-dependent manner. The delayed rectifierlike outward currents can also be seen upon return to 0 mV due to removal of inactivation during the hyperpolarizing steps. These results show that
243
glomus cells express an inward rectifier current with biophysical characteristics typical of currents conducted by HERG channels. In contrast, this inward tail current could not be seen under similar conditions in carotid body type II cells.
HERG channels are blocked with highest affinity and selectivity by class III antiarrhythmic methanesulfonanilide drugs such as dofetilide (Arcangeli et al. 1997), and cations such as have been used to differentiate HERG-like currents from classical inward rectifier currents. HERG currents are less sensitive to block by external than strong inward rectifiers in the gene family (Kubo et al. 1993). To further confirm that HERG channels underlie the inward tail current in glomus cells, we tested the effect of dofetilide and on tail currents elicited on hyperpolarization from 0 to mV in 40 mM external HERG-like tail currents in glomus cells were blocked by dofetilide in a concentrationdependent manner with an of 13 nM, whereas transient outward currents were slightly augmented. Figure 1A shows an example of block of the HERG-like current by 1 dofetilide. Figure 1B shows the effect of on the HERG-like current. In marked contrast to the strong block of classical inward rectifiers by the inward currents in glomus cells were only slightly reduced. Raising the concentration of to 10 mM reduced
244
HERG-like currents at mV by whereas outward currents at 0 mV were only moderately reduced. These results demonstrate that the pharmacological profile of the HERG-like current in glomus cells is similar to that described for HERG currents in other cells (Bianchi et al. 1998), and suggest that inward rectifier current in glomus cells is conducted by HERG-like channels. To determine whether the HERG-like current is active at the resting membrane potential, we first examined the steady-state activation properties of this current. Normalized conductances measured on return to –120 mV were well fit by a Boltzman equation with at mV. The steady-state activation properties suggest that the HERG-like current in glomus cells is active around mV, which is close to the resting membrane potential of these cells. To assess whether the HERG-like current could regulate the resting membrane potential in glomus cells, we examined the effect of dofetilide on the resting membrane potential using the current-clamp mode. On average, the resting membrane potential was mV. Most importantly, 150 nM dofetilide caused a significant and reversible depolarization of mV. In contrast, 10 mM TEA, which completely blocked the large, outward current, had no effect on the resting membrane potential. These results show that the HERG-like current is involved in regulating the resting membrane potential in glomus cells. If the HERG-like current is of functional significance, then inhibition of this current by dofetilide should elevate in isolated glomus cells, stimulate carotid sinus nerve activity under normoxia and attenuate the response to hypoxia in the in-vitro preparation. TEA had no effect on whereas 77% of the same cells responded with a prompt increase in in response to dofetilide. returned slowly to baseline levels on washout of dofetilide. To further elucidate the importance of the HERG-like current we also examined the effects of dofetilide on sensory activity of the carotid body during normoxia and hypoxia. Dofetilide increased the sensory discharge of the carotid sinus nerve in a concentration-dependent manner under normoxia. Most importantly, dofetilide significantly attenuated (by ) the sensory response to hypoxia from mmHg). These results demonstrate that block of HERG channels mimics the effects of hypoxia on the sensory discharge of the carotid body and provide evidence for a functional role of the HERG-like current in hypoxic chemosensing by the intact carotid body.
4.
DISCUSSION
HERG channels are members of the voltage-gated ether-a-go-go channel family and are characterized by an unusually slow current activation
245
and deactivation paired with a fast C-type inactivation mechanism. In the present study we clearly identify a HERG-like current component in glomus cells based on biophysical and pharmacological characterization. The HERG-like tail current in glomus cells increased for a few milliseconds before deactivating at hyperpolarized membrane potentials, a characteristic unique to HERG channels. This “nose” clearly identifies this current as carried by HERG-like gene products since it results from a unique inactivation mechanism that recovers rapidly at negative potentials. Further, the HERG-like current shows voltage dependent deactivation and slow current activation, all characteristics of HERG channel currents. The kinetic evidence that a HERG channel protein conducts the HERG-like current in glomus cells is further corroborated by pharmacological evidence. In contrast to conventional inward rectifier channels (Kubo et al. 1993), the HERG-like current was little affected by concentrations of Furthermore, inward tails were blocked with nM affinity by dofetilide, a potent and specific blocker of HERG channels (Snyders and Chaudhary 1996). These results show that a HERG channel protein conducts the HERGlike current in glomus cells. We also found that the HERG-like
current plays a functional role in
regulating the resting membrane potential in rabbit glomus cells. Activation of the HERG-like current was half-maximal at mV, and the threshold for current activation was reached between and mV. This is
sufficiently negative to stabilize the membrane potential between and mV, as we measured in current clamp recordings from glomus cells. In addition, dofetilide significantly depolarized glomus cells and increased Further, dofetilide significantly augmented baseline sensory activity and attenuated the sensory response to hypoxia in the isolated carotid body. The fact that we have identified a HERG-like current in glomus cells that is blocked by dofetilide suggests that these effects are mediated by effects on glomus cells themselves. However, given the constraints of the experimental
conditions, we can not rule out possible effects of dofetilide on sensory nerve endings. None-the-less, this is the first study to show that block of a specific channel has a significant effect on the function of the intact carotid body and suggest that this HERG-like current is linked to the expression of the hypoxic response.
5.
CONCLUSIONS AND PERSPECTIVES
Glomus cells of the rabbit carotid body express an inward rectifier current with biophysical and pharmacological properties similar to that described for currents carried by HERG channels in other cells. This suggests that HERG-like channels conduct the inward rectifier current in
246
glomus cells. Further, the HERG-like current is active at, and involved in regulating the resting membrane potential in glomus cells. Most importantly,
block of the HERG-like current mimics the effects of, and attenuates the sensory response to hypoxia in the intact carotid body, suggesting that the HERG-like current plays a functional role in chemotransduction at the carotid body. Interestingly, reactive oxygen species (ROS) have been shown
to modulate the activity of HERG channels expressed in Xenopus oocytes (Taglialatela et al. 1997). Therefore, it is possible that hypoxia-induced changes in ROS could inhibit the HERG-like current in glomus cells leading to depolarization and augmentation of sensory discharge. We are currently investigating these possibilities. The current findings may also have important clinical implications. Many drugs that are widely used clinically (e.g., second-generation antihistamines and haloperidol) have been found to block HERG channels (Taglialatela et al. 1998) and therefore may affect carotid body activity and respiration. In
addition, mutations in HERG channels have been implicated in long QT syndrome. Recently it has been shown that long QT is associated with SIDS in infants (Schwartz et al. 1998). It would be interesting to determine if there is a mechanistic link between mutation in the HERG channel protein and carotid body function in SIDS-prone infants.
ACKNOWLEDGMENTS This work was supported by a National Institute of Health grant HL25830 to NRP, an AHA grant in aid to EF and JLO is a Parker B. Francis Fellow in Pulmonary Research.
REFERENCES Arcangeli, A., Rosati, B., Cherubini, A., Crociani, O., Fontana, L., Zillcr, C., Wanke, E., and Olivotto, M. HERG- and IRK-like inward rectifier currents are sequentially expressed
during neuronal development of neural crest cells and their derivatives. Eur.J.Neurosci. 9:2596-2604, 1997.
Bianchi, L., Wible, B., Arcangeli, A., Taglialatela, M., Morra, P., Castaldo, P., Crociani, O., Rosati, B., Faravelli, L., Olivotto, M., and Wanke, E. herg encodes a
current highly
conserved in tumors of different histogenesis: a selective advantage for cancer cells? Cancer Res. 58:815-822, 1998.
Buckler, K . J . A novel oxygen-sensitive potassium current in rat carotid body type I cells. J.Physiol.(Lond.) 498.3:649-662, 1997.
Cheng, P.M. and Donnelly, D.F. Relationship between changes of glomus cell current and neural response of rat carotid body. Journal of Neurophysiology 74:2077-2086, 1995. Gonzalez, C., Almaraz., L., Obeso, A., and Rigual, R. Carotid body chemoreceptors: from
natural stimuli to sensory discharges. Physiol.Rev. 74:829-898, 1994.
247
Kubo, Y., Baldwin, T.J., Jan, Y.N., and Jan, L.Y. Primary structure and functional expression of a mouse inward rectifier potassium channel. Nature 362:127-133, 1993.
Lahiri, S., Roy, A., Rozanov, C., and Mokashi, A.
modulated by
in type I cells
in rat carotid body is not a chemosensor. Brain Res. 794:162-165, 1998.
Lopez-Lopez, J.R., De Luis, D.A., and Gonzalez, C. Properties of a transient
current in
chemoreceptor cells of rabbit carotid body. J.Physiol.(Lond.) 460:15-32, 1993. Overholt, J.L. and Prabhakar, N.R. current in rabbit carotid body glomus cells is conducted by multiple types of high-voltage-activated channels. J. Neurophysiol. 78: 2467-2474, 1997. Snyders, D.J. and Chaudhary, A. High affinity open channel block by dofetilide of HERG expressed in a human cell line. Mol.Pharmacol. 49(6):949-955, 1996. Schwartz, P.J., Stramba-Badiale, M., Segantini, A., Austoni, P., Bosi, G., Giorgetti, R.,
Grancini, F., Marni, E.D., Perticone, F., Rosti, D. and Salice, P. Prolongation of the QT interval and sudden infant death syndrome. N. Engl. J. Med. 338: 1709-1714, 1998.
Taglialatela, M., Castaldo, P., lossa, S., Pannaccione, A., Fresi, A., Ficker, E., and A n n u n z i a t o , L. Regulation of the human ether-a-gogo related gene (HERG) by reactive oxygen species. Proc.Natl.Acad.Sci.U.S.A. 94:1 1698-11703, 1997.
channels
Taglialatela, M., Castaldo, P., Pannaccione, A., Giorgio, G., and Annunziato, L. Human ethera-gogo related gene (HERG) channels as pharmacological targets. Biochem. Pharmacol. 55:1741-1746, 1998.
Wyatt, C.N., Wright, C., Bee, D., and Peers, C. currents in carotid body chemoreceptor cells from normoxic and chronically hypoxic rats and their roles in hypoxic chemotransduction. Proc.Natl.Acad.Sci.U.S.A. 92:295-299, 1995.
248
OXIDANT SIGNALLING AND VASCULAR OXYGEN SENSING Role of in Responses of the Bovine Pulmonary Artery to Changes in Kamal M. Mohazzab-H. and Michael S. Wolin Department of Physiology, New York Medical College, Valhalla, NY
1.
INTRODUCTION
The literature contains evidence for the involvement of a substantial number of mechanisms in responses of various vascular preparations to changes in Our previous work has provided support for the hypothesis that the contractile response of bovine pulmonary arteries to hypoxia and
relaxation upon reoxygenation appear to be mediated primarily through changes in the levels of intracellular hydrogen peroxide In this signalling mechanism, seems to originate from superoxide anion production by a membrane bound oxidase whose activity is controlled by and the availability of cytosolic NADH (Omar et al. 1993, Mohazzab-H. and Wolin 1994b, Mohazzab-H. et al. 1995, Wolin et al. 1996). Vascular force generation in this preparation appears to be determined by the expression of a tonically active cyclic guanosine ,5'-monophosphate (cGMP) mediated relaxation process controlled by the levels of (Burke-Wolin and Wolin 1989, 1990). A model describing this signalling mechanism is shown in Figure 1. There is also substantial evidence from studies in other vascular preparations for mediation of the contraction of pulmonary arterial smooth muscle to hypoxia through changes in membrane potential resulting from the closing of a voltage sensitive potassium channel (Weir and Archer 1995). It is hypothesised by Weir and Archer that cytosolic redox processes controlled by regulate the opening of this channel through oxidation of thiols on the potassium channel. Since one of the most important mechanisms potentially linking multiple cytosolic redox systems to the redox status of protein thiol groups is the redox status of
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
249
250
glutathione (GSH), we developed an approach to study responses of bovine pulmonary arteries to changes in which could distinguish between signalling processes linked to levels of intracellular and processes linked to the redox status of GSH.
2.
PROPERTIES OF THE SIGNALING MECHANISM POTENTIALLY INVOLVED IN RESPONSES OF THE BOVINE PULMONARY ARTERY TO CHANGES IN
Our laboratory initially identified a mechanism of stimulation of the activity the soluble or cytosolic form of guanylate cyclase (sGC) mediated through the metabolism of by catalase which seemed to have properties consistent with it functioning as part of a sensing mechanism that controlled vascular contractile function (Burke and Wolin 1987). The mechanism of stimulation of sGC by peroxide metabolism through catalase appears to be caused by a process linked to the formation of the compound I species of catalase, which occurs at high picomolar to low nanomolar levels of (Chance et al. 1979). It has been demonstrated that the compound I species of catalase can be detected in tissues under physiological conditions and that electron donors to catalase can increase the levels of needed to form the compound I species. Our studies have provided evidence that can produce vascular relaxation through increases in cGMP and that electron donors for catalase including alcohols, superoxide anion and nitric oxide can influence the expression of this processes potentially as a result of their influence on the metabolism of by catalase (Burke and Wolin 1987, Burke-Wolin and Wolin 1990, Cherry et al. 1990, Mohazzab-H. et al 1996b, Wolin et al. 1998). Many of the tools used to study the mechanism of relaxation to have been employed to document its potential role in -elicited vascular responses (Burke-Wolin and Wolin 1989, 1990, Mohazzab-H. et al. 1999). Evidence exists that the product of the sGC reaction, cGMP, may mediate smooth muscle relaxation through processes including inhibition of increase in intracellular mediators of contraction, including calcium and diacylglycerol, and by accelerating the reversal of multiple signalling processes activated by various stimuli of vascular contraction (Lincoln and Cornwell 1993). The promotion of hyperpolarization through opening potassium channels seems to be one the more dominant processes in the mechanisms that contribute to vascular relaxation processes activated by cGMP (Archer et al. 1994). Thus, the modulation of the activity of sGC by changes in the metabolism of has the properties of a signalling process which could participate in the sensing of by vascular tissue, and this mechanism appears to be
251
particularly important in responses of isolated endotheliumremoved bovine calf pulmonary arteries.
3.
A SUPEROXIDE ANION GENERATING NADH OXIDASE LINKED TO THE REDOX STATUS OF CYTOSOLIC NADH HAS CHARACTERISTICS OF A VASCULAR SENSOR
Initial observations that lactate increased the expression of the bovine pulmonary response to hypoxia associated with increases in the production of superoxide anion (Omar et al. 1993) resulted in the recognition of the importance of an oxidase whose activity is linked to the redox status of cytosolic NAD(H) as a potential sensor in this vascular preparation (Mohazzab-H. and Wolin 1994b). The actions of scavengers of superoxide which inhibited (nitroblue tetrazolium) and promoted (tiron) the formation of on the pulmonary artery response to hypoxia and reoxygenation supported a role for the generation of from superoxide in these responses. Characterisation of the NADH oxidase activities present
in bovine pulmonary arterial smooth muscle identified the existence of a microsomal flavoprotein-dependent electron transport chain which contained a cytochrome b55g (Mohazzab-H. and Wolin 1994a, 1994b, Mohazzab-H. et al. 1995, Wolin et al. 1996). In these studies, lucigenin chemiluminescencedetectable superoxide generation by both the microsomal NADH oxidase and by pulmonary arterial smooth muscle was observed to be regulated by physiologically relevant levels of and reoxygenation after exposure to hypoxia appeared to produce a transient overproduction of superoxide. The pulmonary artery response to post-hypoxic reoxygenation was previously shown be an initial transient relaxation associated with increased levels of and cGMP which preceded the return of force generation to the steady-state levels observed under prior to exposure to hypoxia (BurkeWolm and Wolin 1989, 1990). Thus, the requirements for the production of superoxide anion by this microsomal NADH oxidase appear to permit it to function as a sensor in the bovine pulmonary artery.
4.
THE INFLUENCE OF GLUTATHIONE PEROXIDASE ACTIVITY ON THE EXPRESSION OF PULMONARY ARTERIAL RESPONSES TO AND
Inhibition of GSH peroxidase activity by the depletion of GSH was previously observed to decrease force generation and inhibit responses of the
252
bovine pulmonary to changes in (Wolin et al. 1996). The depletion of GSH also caused an increase in the rates of metabolism by catalase under hypoxia to levels that somewhat exceeded the rates observed in the presence of Ebselen is a probe which mimics the activity of GSH peroxidase by utilising intracellular GSH for the metabolism of peroxides (Muller et al 1985). Thus, Ebselen can be viewed as a probe which increases the activity of GSH peroxidase. As shown in Figure 2, the relaxation of bovine pulmonary arteries to exogenous is inhibited by Ebselen, suggesting that it functions by lowering the levels of intracellular It has previously been reported that lactate appears to cause relaxation of bovine pulmonary arterial smooth muscle through increasing the production of endogenous from NADH oxidase-derived superoxide anion, as a result of its effect on increasing cytosolic NADH by the lactate dehydrogenase reaction (Omar et al 1993, Mohazzab-H. 1994b, Wolin et al 1996). As shown in Figure 3, Ebselen also attenuated the relaxation to lactate. Ebselen appears to be selective in its effects on mediated responses, since relaxation of the bovine pulmonary arteries to the nitric oxide donor S-nitroso-N-acetyl-penicillamine (SNAP) is not altered by this probe (See Fig. 4). Thus, Ebselen attenuates relaxation of bovine pulmonary arterial smooth muscle to acute increases in exogenous or endogenously generated
253
254
Based on the previously hypothesised role of in responses of bovine pulmonary arterial smooth muscle to changes in several actions of Ebselen would be expected. Since it is thought that under normoxia
precontracted bovine pulmonary arterial smooth muscle is tonically relaxed by and hypoxia removes this relaxation, Ebselen should increase force under normoxia, but not under hypoxia. As shown in Figure 5, Ebselen increased force generation under normoxia up to the levels observed under hypoxia, and it did not further increase force under hypoxia. It is perhaps important to note that pulmonary arteries used in these experiments were not maximally contracted under hypoxia. The data in Figure 6 shows that the contraction to hypoxia was essentially eliminated by Ebselen. The transient phase of the relaxation to post-hypoxic reoxygenation which is thought to be mediated by an increase in generation that exceeds the levels observed under normoxia was also inhibited by Ebselen (See Figure 6). Thus, the effects of Ebselen on responses of bovine pulmonary arterial smooth muscle are consistent with it lowering the levels of intracellular in a manner which attenuates its influence on alterations in force generation caused by changes in
255
5.
IMPLICATIONS OF THE INFLUENCE OF CHANGES IN GLUTATHIONE PEROXIDASE ACTIVITY ON MECHANISMS OF VASCULAR RESPONSES TO ALTERATIONS IN
Vascular responses elicited by changes in that involve alterations in intracellular generation should be markedly influenced by the activity of GSH peroxidase. While the bovine pulmonary artery responds to changes in intracellular primarily through modulation of the activity of sGC, other systems such as the production of vasoactive prostaglandins (Wolin et al 1990, Omar et al 1992) and changes in the activity of potassium channels (Weir and Archer 1995) are often involved in responses to and Responses involving signalling systems which are dependent on the levels of such as the stimulation of sGC or prostaglandin 256
formation, should be inhibited by increases in the activity of GSH peroxidase. Whereas, systems potentially regulated by the redox status of GSH through mechanisms dependent on the metabolism of peroxide by GSH
peroxidase, such as the hypothesised role of thiol redox in the control of potassium channels (Weir and Archer 1995), might show an enhancement of responses when GSH peroxidase activity is increased because of the
increased efficiency of oxidized GSH formation. The bovine coronary artery has recently reported to have mechanisms of relaxation activated by the stimulation of sGC by metabolism by catalase and by a diamideelicited thiol oxidation-mediated process not involving catalase or sGC (Mohazzab-H. et al. 1999). While the relaxation response of bovine coronary arterial smooth muscle to hypoxia appears to involve a mechanism not dependent on changes in peroxide, cGMP or thiol redox, the transient
relaxation of these vessels to post-hypoxic reoxygenation seems to be mediated through an increase in and the stimulation of sGC (Mohazzab-H. et al. 1996a). Interestingly, Ebselen has recently been shown to selectively inhibit the response of these vessels to reoxygenation (Mohazzab-H. et al. 1999). Since the activity of GSH peroxidase in tissues seems to be very sensitive to alterations in various redox systems, it may have a major influence on the expression of vascular responses to changes in involving “ in altered metabolic states and pathophysiological conditions. Overall, the effects of Ebselen on responses of bovine pulmonary arteries to changes in supports an essential role for in the responses that are observed and a signalling mechanism for that does not appear to be mediated through alterations in the redox status of GSH through the GSH peroxidase reaction.
ACKNOWLEDGEMENTS This work was supported by Grants HL31069 and HL43023 from the National Heart, Lung and Blood Institute and Grant 970118 from the American Heart Association (New York State Affiliate).
REFERENCES Archer, S.L., Huang, J.M.C., Hampl, V., Nelson, D.P., Shultz, P.J., and Weir, E.K., 1994, Nitric oxide and cGMP cause vasorelaxation by activation of a charybdotoxin-sensitive K channel by cGMP-dependent protein kinase. Proc. Nat. Acad. Sci. USA 91: 7583-7587. Burke, T.M., and Wolin, M.S., 1987, Hydrogen peroxide elicits pulmonary arterial relaxation and guanylate cyclase activation. Am. J Physiol. 252: H721-H732.
257
Burke-Wolin, T.M., and Wolin, M.S., 1989, and cGMP may function as an in the pulmonary artery. J. Appl. Physiol. 66: 167-170.
sensor
Burke-Wolin, T.M., and Wolin, M.S., 1990, Inhibition of cGMP-associatcd pulmonary arterial relaxation to and by ethanol. Am. J. Physiol 258: H1267-H1273. Chance, B., Sies H., and Boveris, A., 1979, Hydroperoxide metabolism in mammalian organs. Physiol. Rev 59: 527-605. Cherry, P.O., Omar, H.A., Farrell, K.A., Stuart, J.S., and Wolin M.S., 1990, Superoxide anion inhibits cGMP-associatcd bovine pulmonary arterial relaxation. Am. J. Physiol. 259: H1056-H1062.
Lincoln, T.M., and Cornwall, T.L., 1993, Intracellular cyclic GMP receptor proteins. FABEB J. 7: 328-338.
Mohazzab-H., K.M., and Wolin, M.S., I994a, Sites of superoxidc anion production in calf pulmonary arterial smooth muscle. Am. J. Physiol. 267: L815-L822. Mohazzab-H., K.M., and Wolin, M.S., 1994b, Properties of a superoxide anion generating microsomal NADH-oxidoreductasc, a potential pulmonary artery sensor. Am. J. Physiol. 267: L823-L831.
Mohazzab-H., K.M., Fayngersh, R.P., and Wolin, M.S., 1995, Potential role of NADH
oxidoreductase-derived reactive
species in the calf pulmonary arterial
I
responses. Am. J. Physiol. 269: L637-L644.
Mohazzab-H., K.M., Fayngersh, R.P., Kaminski, P.M., and Wolin, M.S., 1996a. Oxygenelicited responses in calf coronary arteries: Role of production via NADH-derived superoxide. Am. J. Physiol. 270: H1044-H1053.
Mohazzab-H., K.M., Fayngersh, R.P., and Wolin, M.S., 1996b. Nitric oxide inhibits pulmonary artery catalase and H1906.
relaxation. Am. J. Physiol. 271: H1900-
Mohazzab-H., K.M., Agarwal, R., and Wolin, M.S., 1999, Influence of glutathione peroxidase on coronary artery responses to alterations in H241.
and
. Am. J. Physiol. 276: H235-
Muller, A., Gabriel, H., and Sies, H., 1985, Protective glutathione-dependent effect of PZ 51 (Ebselen) against ADP-induced lipid peroxidation in isolated hepatocytes. Biochem. Pharmacol.34: 1185-1189.
Omar, H.A., Figueroa, R., Omar, R.A., Tejani, N., and Wolin, M.S., 1992, Hydrogen peroxide and reoxygenation cause prostaglandin-mediated contraction of human placental arteries and veins. Am. J. Obstet. Gynecol. 167: 201-207. Omar, H.A., Mohazzab-H., K.M., Mortelliti, M.P., and Wolin, M.S., 1993, dependent
modulation of calf pulmonary artery tone by lactate: Role of Physiol. 264: L I 4 1 - L I 4 5 .
and cGMP. Am. J.
Weir, E.K., and Archer, S.L., 1995, The mechanism of acute hypoxic pulmonary vasoconstnction: the talc of two channels. FASEB J. 9: 183-189.
Wolin, M.S., Burke-Wolin, T.M., Kaminski, P.M., and Mohazzab-H., K.M., 1996, Reactive oxygen species and vascular oxygen sensors. In: Nitric oxide and radicals in the pulmonary vasculature (E.K. Weir, S.L. Archer, and J.T. Reeves eds.), Futura Publishing Co., Armonk, New York, pp. 245-263. Wolin, M.S., Davidson, C.A., Kaminski, P.M., Fayngersh, R.P., and Mohazzab-H., K.M., 1998, Oxidant-nitric oxide signalling mechanisms in vascular tissue. Biochemistry (Moscow) 6 3 : 810-816. Wolin, M.S., Rodenburg, J.M., Messina, E.J., and Kaley, G., 1990, Similarities in the
pharmacological modulation of reactive hyperemia and vasodilation to in rat skeletal muscle arterioles: Effects of probes for endothelium-derived mediators. J. Pharmacol. Exp. Ther. 253: 508-512.
258
TISSUE AND MITOCHONDRIAL ENZYMES Cytochrome C Oxidase As Sensor D. F. Wilson1, A. Mokashi2, S. Lahiri2, and S. A. Vinogradov’ Departments of 1Biochemistry and Biophysics, and of 2Physiology, Medical School, University of Pennsylvania, Philadelphia, PA 19104
1.
INTRODUCTION
The carotid body senses both oxygen and carbon dioxide, responding to either decreasing oxygen pressure or increasing carbon dioxide pressure with increasing afferent activity (for review see Lahiri, 1994; Gonzles et al. 1994). Although the afferent electrical activity indicates some interaction between the two sensory systems, the sensors themselves
are independent (Mulligan and Lahiri, 1982). The afferent neural activity of the carotid body responds rapidly and precisely to alterations in the oxygen pressure of the blood in the carotid artery. This afferent neural activity increases many fold as the oxygen pressure in the carotid artery falls from about 100 mm Hg to about 30 mm Hg. The general problem of how the levels of nutrients, such as oxygen, in tissues is measured (sensed) and how that information is used to generate the appropriate physiological adjustment remain incompletely understood. In principle, a cell must "measure" the metabolite through a biochemical component that interacts in a concentration dependent manner. This interaction must then be communicated to the appropriate cellular response element via an intermediate signaling system. There have been several competing hypotheses concerning the identity of the oxygen sensor. These include mitochondrial oxidative phosphorylation (see Mulligan et al. 1981; Biscoe and Duchen, 1990), an oxygen sensitive ion channel (see Donnelly, 1999), a plasma membrane NADH oxidase (Acker and Xue, 1995). The idea that mitochondrial oxidative phosphorylation is responsible for oxygen sensing in the carotid
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
259
body has generally referred to as the metabolic hypothesis (see for example Mulligan et al. 1981; Biscoe and Duchen, 1990). Supporting evidence was primarily the observation that some inhibitors of mitochondral oxidative phosphorylation, such as cyanide, and uncouplers, such as ptnfluoromethoxy-phenyhydrazone of carbonyl cyanide (FCCP), elicit increases in afferent activity comparable to that of hypoxia. Not all such agents behaved in the predicted manner, however, and the possibility remained that mitochondral oxidative phosphorylation was an important intermediate in the sensing process (energy is necessary for nerve activity, etc.) but not the sensor per se. In this communication, we will discuss identification of the primary oxygen sensor of the carotid body and the relationship of that sensor to mitochondrial oxidative phosphorylation.
2.
CARBON MONOXIDE AND THE PHOTOCHEMICAL ACTION SPECTRA
2.1
Background of the method
There are, however, cases in which it has been possible to accurately and specifically identify a component reacting with oxygen in intact cells and tissue. Warburg and coworkers (Warburg, 1926; Warburg and Negelein, 1928) demonstrated that the enzyme responsible for oxygen consumption by yeast and mammalian cells could be identified by the fact that the inhibition by CO can be reversed by light. They first demonstrated that carbon monoxide (CO) was a competitive inhibitor with respect to oxygen and that this inhibition could be reversed by light.
260
In the photo-induced release of the inhibition by CO, only photons that are absorbed by the CO complex can contribute to reversal of the inhibition by CO. This makes the light effect highly specific to inhibitory CO complex. When the wavelength dependence of the efficacy of the illuminating light (at non-saturating levels) in reversing the inhibition is measured, the result is an accurate measure of the absorption spectrum of that CO complex. Thus, even in cells containing many different pigments, the spectrum of the inhibitory CO compound is obtained (photochemical action spectrum) without interference. The wavelength dependence of this light induced reversal of inhibition by CO is referred to as the photochemical action spectrum or just action spectrum. The spectrum obtained by Warburg and Negelein (1928) for yeast and mammalian cells was attributed to the CO complex of a heme oxidase they called atmungsferment. Many years later the name of this heme oxidase became cytochrome Photochemical action spectrua obtained for reversal of CO inhibition by light are a uniquely effective means for identifying heme oxidases. Carbon monoxide (CO) has been shown to be a competitive inhibitor with respect to oxygen for many heme oxidases and hydroxylases, including cytochrome
cytochrome o,
cytochrome and cytochrome (see also Melnick, 1942; Caster and Chance, 1955; Cooper et al. 1970). In each case, the CO inhibition was reversed by absorption of light and the action spectrum was used to identify the heme protein responsible for the oxidase or hydroxylase activity.
261
2.2
Carbon monoxide and oxygen sensing in isolated perfused-superfused carotid body preparations
In order to see if CO could be used to identify the oxygen sensor of the carotid body, it was necessary to develop an in vitro preparation retaining chemosensory activity and from which the hemoglobin had been removed. Iturriaga et al.(1991) developed an isolated carotid bifurcation preparation from the cat in which the afferent neural activity can be measured while perfusing and superfusing the carotid body with defined media. This preparation retains high levels of the oxygen sensory activity and is essentially hemoglobin free. The afferent activity increases by many fold as the oxygen pressure in the perfusate is decreased from air saturation to anoxia. Addition of CO to the perfusate without altering the oxygen content increases the afferent activity for each oxygen level. Competition between oxygen and CO was demonstrated by the increase in afferent activity with increasing ratio in the perfusate and by the observation that bright white light reversed the effect of having CO in the perfusate (Lahiri et al. 1995; Wilson et al. 1994).
2.3
The photochemical action spectrum of oxygen chemosensory activity of the carotid body
The photochemical action spectrum of the light induced reversal of the CO effect in the carotid body was measured by Wilson et al (1994). At oxygen pressures sufficient to maintain very low afferent chemosensory activity increasing the CO from 1:1 to 8:1 relative to results in progressively increasing afferent chemosensory activity. At each CO pressure illumination with strong white light caused complete reversal of the CO effect, lowering the afferent activity to that observed for the same oxygen pressure in the absence of CO. Conditions were selected for which in the dark the afferent activity was approximately 50% of that the maximum observed as oxygen approaches zero. The carotid body was then illuminated for 6 second intervals with monochromatic light of wavelengths from about 400 nm to 650 nm. The light intensity was selected to give maximally about 50% reversal of the CO effect at all wavelengths and calibrated so that the effect could be corrected to the same intensity at all wavelengths. After appropriate corrections, the spectrum obtained had maxima at nm and nm with relative absorption values (432:589) of about 6 to 1. This photochemical action spectrum is the same as that originally reported by Warburg and Negelein (1928) for yeast cells and as that obtained for the
262
cytochrome complex of the mitochondrial respiratory chain (see also Melnick, 1942; Caster and Chance, 1955). There are no other pigments in mammalian cells that form complexes with CO and have spectra similar to that of cytochrome
3.
RELATIONSHIP TO OTHER OPTICAL STUDIES OF THE CAROTID BODY PIGMENTS.
Direct measurements of the absorption by pigments in the carotid body have not been very informative. This is due to: 1. the extreme technical demands imposed by the fact that the carotid body is very small and surrounded by adventitious tissue; 2. the carotid body contains many different pigments and the light absorbed is the sum of that by all of the pigments in the tissue; 3. the presence of a pigment or enzyme in the carotid body is necessary but not sufficient to its involvement in sensory activity. Even in isolated perfused carotid body preparations from which most of the hemoglobin has been removed, the many remaining pigments can easily obscure the contribution by an individual pigment with low absorption. Reports by Mills and Jobsis (1972) of a low oxygen affinity cytochrome oxidase in the carotid body was probably due to the presence of small amounts hemoglobin and myoglobin in the preparation. Similarly, the reported failure to observe the spectrum of the cytochrome compound associated with the light induced reversal of the CO effect in rat carotid body (see Acker, 1995) was likely due to its absorption change being less than the noise level in the data. In summary: The primary oxygen sensor of the carotid body can be
identified unambiguously using the photochemical action spectrum determined for reversal of the effect of carbon monoxide. The sensor is cytochrome of the mitochondrial respiratory chain.
ACKNOWLEDGEMENTS This research was supported in part by grants HL-60100 and HL43413 from the National Institutes of Health.
263
REFERENCES Acker, H. (1989) Chemoreception in arterial chemoreceptors. Ann. Rev. Physiol. 51: 835-
844. Acker, H. and D. Xue (1995) Mechanisms of sensing in the carotid body in comparison w i t h other News in Physiol. Sci. 10:211-216. Biscoe, T.J. and M.L. Duchen (1990) Monitoring by the carotid chemoreceptor. News in Physiol. Sci. 5: 229-233.
Caster, L.N. and B. Chance, (1955) Photochemical action spectra of carbon monoxideinhibited respiration. J. Biol. Chem. 217: 453-464. Cooper, D.Y., S. Scheyer, and O. Rosenthal, (1970) Some chemical properties of cytochrome P-450 and its carbon monoxide compound Ann. N.Y. Acad. Sci. 174:205-217. Donnelly, D.F. (1999) currents of glomus cells and chemosensory functions of carotid body. Resp Physiol. 115: 151-160. Gonzalez., C., L. Almaraz, A. Obeso, and R. Rigual, (1994) Carotid body chemoreceptors: from natural stimuli to sensory discharges. Physiol. Rev. 74: 829-898. Iturriaga, R, W.L. Rumsey, A. Mokashi, D. Spergel, D.F. Wilson, and S. Lahiri, (1991) In vitro perfused-superfused cat carotid body for physiological and pharmacological studies. J.Appl. Physiol. 70: 1393-1400. Lahiri, S. (1994) Chromophores in chemoreception: the carotid body model. NIPS 9: 161-165. Lahiri, S., Buerk, D.G., Chugh, D., Osanai, S., and Mokashi, A. (1995) Reciprocal photolabile consumption and chemoreceptor excitation by carbon monoxide in the cat carotid body: evidence for a cytochrome as the primary sensor. Brain Res. 684: 194-200. Mills, E., and F.F. Jobsis (1972) Mitochondrial respiratory chain of carotid body and chemoreceptor response to changes in oxygen tension. J. Neurophysiol. 35: 405-428. Melnick, J.L. (1942) The photochemical spectrum of cytochrome oxidase. J. Biol. Chem. 146: 385-390. Mulligan, E., S. Lahiri, and B.T. Storey, (1981) Carotid body chemoreception and mitochondrial oxidative phosphorylation. J. Appl. Physiol. 51: 438-446. Warburg, O. (1926) Uber die Wirkung des Kohlenoxyds auf den Stoffwechsel der Hefe. Biochem.Z. 177:471-486. Warburg, O. and E. Negelein, (1928) Uber die photochemische Dissoziation bei intermittierender Belichtung und das absolute Absorptionsspektrum des Atmungsferments. Biochem Z. 202: 202-228. Wilson, D.F., A. Mokashi, D. Chugh, S.A. Vinogradov, S. Osanai, and S. Lahiri, (1994) The primary oxygen sensor of the cat carotid body is cytochrome of the mitochondrial respiratory chain. FEBS Letters, 351, 37-374.
264
REGULATION OF SHAKER-TYPE POTASSIUM CHANNELS BY HYPOXIA Oxygen-sensitive
channels in PC12 cells
Laura Conforti, David E. Millhorn Department of Molecular and Cellular Physiology, College of Medicine, University of Cincinnati, PO Box 67-0576, Cincinnati, OH 45267-0576
Key words:
-sensitive
channels; Kv 1.2; Xenopus oocytes
Abstract: Little is known about the molecular composition of the sensitive channels. The possibility that these channels belong to the Shaker subfamily (Kvl) of voltage-dependent (Kv) channels has been
raised in pulmonary artery (PA) smooth muscle cells. Numerous findings suggest that the channel in PC 12 cells is a Kvl channel, formed by the Kvl.2
subunit. The
channel in PC12 cells is a slow-inactivating
voltage-dependent channel of 20 pS conductance. Other Kv channels, also expressed in PC 12 cells, are not inhibited by hypoxia. Selective upregulation by chronic hypoxia of the Kvl.2 subunit expression correlates with an increase of the current. Other Kv 1 subunit genes encoding slow-inactivating Kv channels, such as Kvl.3, Kv2.1, Kv3.1 and Kv3.2 are not modulated by chronic hypoxia. The current in PC 12 cells is blocked by 5 mM externally applied tetraethylammonium chloride (TEA)
and by charydbotoxin (CTX). The responses of the Kvl.2 channel to hypoxia have been studied in the Xenopus oocytes and compared to those of Kv2.1, also proposed as channel in PA smooth muscle cells. Twoelectrode voltage clamp experiments show that hypoxia induces inhibition of current amplitude only in oocytes injected with Kvl.2 cRNA. These data indicate that Kvl .2 channels are inhibited by hypoxia.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et at.
Kluwer Academic/Plenum Publishers, 2000
265
1.
INTRODUCTION
A common cascade of events is triggered by hypoxia in various sensitive cells: inhibition of channels, cell depolarization and increase in intracellular calcium (Lopez Barneo, 1996). The increase in intracellular calcium is associated with cell-specific and important functional events that can ultimately result in better tissue oxygenation (Lahiri, 1997). Although cells play a critical role in whole body homeostasis as well as the genesis of pathological conditions, the mechanisms by which cells detect a change in tension and transduce this signal into the appropriate functional response remain unknown. It has been established that channels are key elements in the detection of changes in availability by chemosensitive cells. Electrophysiological studies have indicated that in most cells such as type I cells of the carotid body, rat pulmonary artery smooth muscle cells and pulmonary neuroepithelial body cells, the current is voltagedependent (Archer et al., 1996; Peers, 1990; Youngson et al., 1993). However, in rat carotid body a background current (K leak) has been recently shown to be also inhibited by hypoxia (Buckler, 1997). Little is still known about the molecular identity of the channels. In the current manuscript we present evidence showing that native as well as recombinant Shaker-type Kv channels are
2.
VOLTAGE-DEPENDENT CHANNELS IN CHEMOSENSITIVE CELLS
Voltage-dependent channels are complex hetero-oligomeric proteins formed by and subunits (Pongs, 1992). The subunit consists of six conserved hydrophobic transmembrane domains (S1-S6) and variable cytoplasmic flanking amino and carboxy terminal sequences. Four of these peptides are sufficient to assemble and form a functional Kv channel. The genes that encode the Kv subunits have been classified in at least six
subfamilies: Shaker-type or Kvl (Kvl .1-1.7), Shab-type or Kv2 (Kv2.1-2.2), Shaw-type or Kv3 (Kv3.1-3.4), Shal-type or Kv4 (Kv4.1-4.3), KvS.l and Kv6.1 (Pongs, 1992). In addition, a novel family of electrically silent Kv channel a subunits was recently identified (Patel et al., 1997). Functional Kv channels can be formed by four identical subunits or by four different a subunits encoded by different genes of the same subfamily (e.g., Kvl) but not from different subfamilies (e.g., Kvl and Kv2) (Salkoff et al., 1992). This wide range of possible combinations of subunits provides cells with a variety of Kv channels that can mediate different functions. Because
266
multiple Kv channel subtypes are expressed in a single cell, their separation based on electrophysiological properties or drug-channel interaction is extremely difficult. The channels in chemosensitive cells have been investigated extensively using electrophysiological techniques, thus there is little information about their molecular identity. Recently a channel composed of Kv2.1 and the silent Kv 9.3 subunits has been proposed as possible channel in pulmonary artery smooth muscle cells (Patel et al., 1997). In addition, an channel formed by Kvl.5 was also proposed to be expressed in pulmonary artery smooth muscle cells express (Archer et al., 1998). Yet there is no direct evidence that implicates these particular subunits as channels. The pharmacological profile of the channel recorded in pulmonary artery smooth muscle cells (insensitive to CTX) led to the conclusion that the channel in pulmonary artery might not include Kvl.2 subunits (Archer et al., 1998; Patel et al., 1997). It is known that homomultimeric K.vl.2 channels are CTXsensitive while homomultimeric Kvl.5 channels are not (Grissmer et al., 1994). It has also been shown that a single Kvl.5 subunit can render the Kvl.2/Kvl.5 heteromeric channel insensitive to CTX (Russell et al., 1994). Therefore, the channel in pulmonary artery might be an heteromultimer formed by Kv1.5 and Kvl.2 subunits. Recently, it has been shown that expression of Kvl.2 and Kvl.5 subunits in pulmonary artery smooth muscle cells is down regulated by chronic hypoxia (Wang et al., 1997). The down-regulation of expression of these subunits correlates with the decreased of pulmonary artery in rat exposed to chronic hypoxia. This observation suggests the possibility that Kvl.2 and Kvl.5 channels might indeed be involved in pulmonary vasoconstriction. Other investigators have suggested that other Kv channel subfamilies are implicated in hypoxia-induced depolarization in pulmonary artery smooth muscle cells and other cell types (Vega-Saenz de Miera et al., 1992). Thus, the identity of these important channels remains unclear.
3.
OXYGEN-SENSITIVE CELLS
CHANNELS IN PC12
Our laboratory has used the pheochromocytoma (PC 12) cell as a model system for studying chemosensory mechanisms (Conforti et al., 1998). PC 12 cells are cells that respond to hypoxia in the characteristic manner of other chemosensitive cells, i.e. with inhibition of a current, membrane depolarization, increase in intracellular calcium, and gene regulation (Conforti et al., 1998; Czyzyk-Krzeska et al., 1994; Taylor
267
and Peers, 1998). The effects of hypoxia on current and resting membrane potential (Em) in PC 12 cells are shown in Figure 1.
PC 12 cells display a slow-inactivating Kv current. This current is not sensitive to (not a -activated current), and it is independent of the holding voltage (not an A type current) (Zhu et al., 1996). This same is inhibited by hypoxia in a reversible manner (Figure 1A), and the amount of inhibition has been shown to depend on the severity of the hypoxia (Fig. IB; Zhu et al., 1996). The current-voltage relationship for the current shows that a
current of ~10 pA is present at the voltage
range of the resting potential (normal resting membrane potential in PC 12
268
cells is to mV; figure 1C). Inhibition of this current is sufficient to induce cell depolarization (Zhu et al., 1996). In fact, hypoxia triggers membrane depolarization in PC 12 cells (figure ID). Thus, the physiological responses of PC 12 cells to reduced tension are similar to those of other excitable cells in various tissues. Hence, this cell line provides a unique and useful model for combining electrophysiological studies with molecular biological experiments designed to clarify the molecular nature of voltage-dependent channels and basic mechanisms in mammalian cells. PC 12 cells express different type of Kv channels, distinguished by their conductance and time-dependent properties (Conforti and Millhorn, 1997; Hoshi and Aldrich, 1988). We have shown that PC 12 cells express an sensitive slow-inactivating Kv channel of 20 pS conductance that is selectively inhibited by hypoxia (figure 2; Conforti and Millhorn, 1997).
Numerous findings suggest that this channel is formed by the Kvl.2 subunit. Recombinant Kvl.2 channels display conductance and gating
269
properties similar to the channel identified in PC12 cells (Grissmer et al., 1994). In contrast, the Kv2.1 and Kv2.1/Kv9.3 genes, which have been proposed to encode the Ko2 channel in pulmonary artery, are associated with channels of much different conductances (8 pS and 14 pS respectively; Patel et al., 1997). We have shown that the current in PC 12 cells is blocked by 5 mM externally applied TEA (Zhu et al., 1996). This concentration of TEA is also able to evoke release of cathecolamine from PC 12 cells (Taylor and Peers, 1998). Such high doses of extracellular TEA are required for blockade of channels formed by Kvl.2, 1.3 and 1.5 subunits (Mathie et al., 1998). The current is also blocked by CTX (20 mM). CTX is a blocker of Kvl.2 and Kvl.3 channels (Grissmer et al., 1994). The sensitivity to TEA and CTX of the current in PC 12 cells is shown in Figure 3. Thus, electrophysiological and pharmacological properties of the channel in PC 12 cells are consistent with a Kvl channel formed by Kvl.2 subunit/s.
Further evidence indicate that this channel is formed by the Kvl.2 subunit (Conforti and Millhorn, 1997). PC 12 cells express the following a subunits encoding slow-inactivating Kv channels: Kvl.2 and Kvl.3; Kv2.1; Kv3.1 and Kv3.2. Of these, only the gene encoding the Kvl.2 subunit is selectively stimulated during prolonged exposure to hypoxia (Figure 4, inset). Over-expression of the Kvl.2 subunit in PC 12 cells exposed to 10% for 18 hr correlated with an enhanced of in these cells during a subsequent acute exposure to hypoxia (Figure 4).
270
271
4.
EXPRESSION AND
SENSITIVITY OF
CHANNELS IN THE XENOPUS OOCYTES Because of the complex heteromultimeric structure of native channels, we studied the Kvl.2 and Kv2.1 channel responses to changes in tension in Xenopus oocytes. This expression system provides a means of expressing Kv channels homomultimers of known subunits. Kvl.2 and Kv2.1 channels, which have been proposed as channels in other chemosensitive cells, were expressed in Xenopus oocytes by microinjection of the corresponding cRNAs. Control oocytes were injected with the same volume (50 nl) of water. Electrophysiological experiments were performed 1-2 days after injection. Outward currents were elicited only in oocytes injected with channel cRNAs. The effect of hypoxia on the expressed Kv channels was studied by exposing the injected oocytes to an anoxic recording medium (100% N2 and 5 mM sodium dithionite, an chelator). Figure 5 shows the response of the expressed Kvl.2 and Kv2.1 channels to anoxia. Anoxia inhibited the current carried by Kvl .2 of 11 2 % and had no effect or slightly increased the current carried by Kv2.1 (-1 1%, The hypoxic inhibition of Kvl .2 current correlated with the time of exposure to hypoxia and was reversed upon returning to normoxia. The inhibition of current was not due to the possible formation of radicals, that might have occurred using the sodium dithionide (Archer et al., 1995). Kvl .2 channels expressed in Xenopus oocytes have been shown to be insensitive to reactive species (Duprat et al., 1995). In conclusion, native Kv channels composed by the Kvl .2 subunit/s are inhibited by hypoxia in PC 12 cells. Similar behaviour is displayed by recombinant Kvl.2 channels expressed in Xenopus oocytes.
ACKNOWLEDGEMENTS This work was supported by grants HL33831 and HL59945 from the National Institutes of Health (DEM) and grant DAMD179919544 from the U.S. Army (DEM). Figures 2 and 4 are adapted from Conforti and Millhorn (1997), J. Physiol, 502, 293-305.
REFERENCES Archer S. L., Hampl V., Nelson D. P., Sidney E., Peterson D. A. and Weir E. K. Dithionite increases radical formation and decreases vasoconstriction in the lung - Evidence that
dithionate does not mimic alveolar hypoxia. Circ. Res. 77: 174-181, 1995.
272
Archer S. L., Huang J. M. C., Reeve H. L., Hampl V., Tolarova S., Michelakis E., and E. K.
Weir. Differential distribution of electrophysiologically distinct myocytcs in conduit and resistance arteries determines their response to nitric oxide and hypoxia. Circ. Res. 78: 431442, 1996. Archer SL, Souil E, Dinh-Xuan AT, Schremmer B, Mercier J-C, El Yaagoubi A, Nguyen-Huu L, Reeve HL, Hampl V: Molecular identification of the role of voltage-gated channels, Kvl.5 and 2.1 in hypoxic pulmonary vasoconstriction and control of resting membrane potential in rat pulmonary artery myocytes. J. Clin. Inv. 101: 2319-2330, 1998. Buckler K. J. A novel oxygen-sensitive potassium current in rat carotid body type I cells. J. Physiol. 498: 649-662, 1997. Conforti L., and Millhorn D. E.: Selective inhibition of a slow-inactivating voltage-dependent channel in rat PC 12 cells by hypoxia. J. Physiol. 502: 293-305, 1997. Conforti L., Zhu H. W., Kobayashi S., and Millhorn D. E.: Mechanisms of oxygen chemosensitivity in a model cell line system. In: Oxygen Regulation ofIon Channels and
Gene Expression. Ed. J. Lopez-Barneo and E. K. Weir. Futura Publishing Co., NY pg. 181-192, 1998. Czyzyk-Krzeska M. F., Furnari B. A., Lawson E. E., and D. E. Millhorn. Hypoxia increases rate of transcription and stability of tyrosine hydroxylase mRNA in pheochromocytoma (PC12) cells. Journal of Biological Chemistry 269: 760-764, 1994. Duprat F., Guillemare E., Romey G., Fink M., Lesage F., Lazdunski M. and Honore E. Susceptibility of cloned
channels to reactive oxygen species. Proc. Natl. Acad. Sci.
USA 92: 11796-800, 1995. Grissmer S., Nguyen A. N., Aiyar J., Hanson D. C., Mather R. J., Gutman G. A., Karmilowicz
M. J., Auperin D. A., and K. G. Chandy. Pharmacological characterization of five cloned voltage-gated channels, type K.vl.1, 1.2, 1.2, 1.5 and 3.1, stably expressed in mammalian cell lines. Molecular Pharm. 45: 1227-1234, 1994. Hoshi, T. and R.W. Aldrich. Voltage-dependent currents and underlying single channels in pheochromocytoma cells. J. Gen. Physiol. 91: 73-106, 1988.
Lahiri S. Physiological responses: peripheral chemoreceptors and chemoreflexes. In “The lung” . Scientific foundations Second Edition. Edited by R.G. Crystal, J. B. West, et al. Lippincott. Raven Publishers, Philadelphia. Pg. 1747-1756, 1997.
Lopez Barneo J. Oxygen-sensing by ion channels and the regulation of cellular functions. Trends in Neurosciences 19: 435-440, 1996. Mathie A., Wooltorton J. R. A. and Watkins C. S. Voltage-activated potassium channels in mammalian neurons and their block by novel pharmacological agents. Gen. Pharmac. 30: 13-24, 1998. Patel A. J., Lazdunski M. and Honore’ E. Kv2.1/Kv9.3, a novel A IP-dependent delayedrectifier channel in oxygen-sensitive pulmonary artery myocytes. EMBO J. 16: 66156625, 1997. Peers C. Hypoxic suppression of -currents in type I carotid body cells: Selective effect on the -activated current. Neurosc. Lett. 119: 253-256, 1990.
Pongs O. Molecular biology of voltage-dependent potassium channels. Physiol. Rev. 72: S69S88, 1992. Russell, S. N., Overturf, K. E. and Horowitz, B. Heterotetramer formation and charybdotoxin sensitivity of two
channels cloned from smooth muscle. Am. J. Physiol. 267, C1729-33,
1994. Salkoff L., K. Baker, A. Butler, M. Covarrubias, M. D. Pak, and A. Wei. An essential ‘set’ of channels conserved in flies, mice and humans. Trends Neurosc. 15: 161-166, 1992. Taylor, S. C. and Peers, C. Hypoxia evokes cathecolamine secretion from rat phechromocytomaPC-12cells. Biochem. Biophys. Res. Com. 248, 13-7, 1998.Vega-
273
Saenz de Miera E. and Rudy B. Modulation of channels by hydrogen peroxide. Bioch. Bioph. Res. Com. 186: 1681-1687, 1992. Wang J., Juhaszova M., Rubin L. J. and X-J Yuan. Hypoxia inhibits gene expression of voltage-gated channel a subunits in pulmonary artery smooth muscle cells. J. Clin. Inv. 100:2347-2353, 1997. Youngson C., Nurse C., Yeger H., and E. Cutz. Oxygen sensing in airway chemoreceptors. Nature 365: 153-155, 1993. Zhu W. H., Conforti L., Czyzyk-Krzeska M. F. and Millhorn D. E.: Membrane depolarization in PC 12 cells during hypoxia is regulated by an channel. Am. J. Physiol., 271:C658-C665, 1996.
274
HIF-1 IS ESSENTIAL FOR MULTILINEAGE HEMATOPOIESIS IN THE EMBRYO
David M. Adelman1, Emin Maltepe2, and M. Celeste Simon2,3 1Department of Pathology, 2Committee on Cancer Biology, 3Departments oj Medicine and Molecular Genetics and Cell Biology, and the Howard Hughes Medical Institute, University of Chicago, Chicago, IL 60637, LISA
1.
INTRODUCTION
Mammalian development occurs in an environment exhibiting oxygen tensions in the hypoxic range (Rodesch et al. 1992; Fischer and Bavister 1993). Once embryonic growth progresses to a stage where diffusion is limiting, establishment of a circulatory system capable of delivering oxygenated blood to the embryo becomes essential. Numerous genes that are critical to these processes are transcriptionally upregulated during hypoxic stress. Our data demonstrate that ARNT is a critical component of this transcnptional machinery, as animals deficient in ARNT fail to enhance expression of these genes and do not survive beyond day 10.5 of development (Kozak et al. 1997; Maltepe et al. 1997). In this study we demonstrate the hematopoietic consequences that result from this inability to respond to hypoxia during development.
1.1
Initial Comments
Hypoxia-inducible factor 1 (HIF-1) is a heterodimeric transcription factor comprised of the bHLH-PAS proteins ARNT and ( (Wang et al. 1995). HIF-1 mediates responses to deprivation by influencing the accumulation of effector proteins including VEGF, EPO, glycolytic enzymes, glucose transporters, transferrin (reviewed in Bunn and Poyton
Oxygen Sensing: Molecule to Man, edited by S. Lahin et al. Kluwer Academic/Plenum Publishers, 2000
275
1996; Wenger and Gassmann 1997) and p53 (An et al. 1998). We have previously shown that mice die in utero between E9.5 and E10.5 due to inadequate VEGF expression and subsequent vascular defects (Maltepe et al. 1997), suggesting that hypoxia-induced VEGF production, which is important for tumor angiogenesis (Shweiki et al. 1992), also regulates developmental angiogenesis. The production of extraembryonic yolk sac blood islands marks the beginning of vasculogenesis and hematopoiesis in the mouse embryo. There is much evidence suggesting that vascular endothelial and hematopoietic stem cells originate from a bipotential precursor referred to as a hemangioblast (Choi et al. 1998). Based on this principle, and the common expression of many cytokines, cytokine receptors, and transcription factors to both cell types, we sought to determine if HIE-1-mediated gene expression is important to hematopoietic development. We now show that embryos exhibit a multilmeage hematopoietic defect which is cellextrinsic to the hematopoietic progenitors, and is rescuable by exogenous VEGF administration. Furthermore, we demonstrate that hematopoietic precursors are proliferative under hypoxia, similar to vascular endothelial and placental cytotrophoblast cells, and that this stimulation is dependent upon hypoxic ARNT-mediated activity.
2.
2.1
DECREASED HEMATOPOIESIS IN THE ABSENCE OF ARNT Yolk Sac Analyses of Arnt Embryos
Many E9.5 embryos were easily distinguished from and littermates by the absence of blood-filled vitelline vessels, suggesting a deficiency in blood cell maturation. To determine if a requirement exists
for ARNT in embryonic hematopoiesis,
animals were mated to yield
and offspring. Because animals exhibit embryonic lethality by E10.5, E9.5 embryos were analyzed by hematopoietic colony formation assays (Fig. la). Yolk sac platings were scored for erythrocyte (E), macrophage (M), granulocyte-erythrocyte megakaryocyte-macrophage (GEMM), granulocyte-macrophage (GM), and granulocyte (G) colony forming units (CPU) (Fig. 1b). A statistically significant decrease in the number of CFU-E, CFU-M, CFU-GEMM, CFUGM, and CFU-G progenitors was observed in yolk sacs Interestingly, mice also generated statistically fewer (approx. 50%) CFU-GEMM and CFU-GM than animals
276
0.03). These hematopoietic defects, however, could be secondary to stunted growth and apoptotic cell death observed in some E9.5 embryos. To address this issue, we performed yolk sac progenitor assays on E8.5 embryos, when animals appear morphologically indistinct from their and littermates. Only CFU-E could be properly enumerated at this earlier developmental stage, however, as other CPU progenitors are produced at very low numbers (Olson et al. 1995).Similar to E9.5, E8.5 embryos showed a significant decrease in hematopoietic progenitor number (Fig. Ic; ), supporting the conclusion that this phenotype is not secondary to other defects. These data indicate that ARNT is required for the production of normal numbers of yolk sac hematopoietic progenitors.
277
2.2 In Vitro Differentiations of Arnt ES Cells Under Normoxia To further corroborate these in vivo results, and ES cells were differentiated in vitro to form embryoid bodies (EBs), from which hematopoietic progenitors were quantitated in similar CFU assays (Keller et al. 1993; Kennedy et al. 1997). Following nine days of differentiation in semi-solid agar, EBs were disaggregated and replated into fresh methylcellulose. ES cells, when compared to or ES cells subjected to the same selection protocol (Mortensen et al. 1992), generated significantly fewer CFU-E, CFU-M, CFU-GEMM, CFU-GM, and CFU-G progenitors (Fig. 2a; ). EBs yielded wild-type numbers of all progenitors with the exception of CFU-GEMM,
278
reminiscent of yolk sacs. These data recapitulate the in vivo yolk sac data, confirming an ARNT-dependent defect in generating hematopoietic
progenitors. Moreover, this progenitor deficiency is not a consequence of placental or other vascular defects, which are circumvented during in vitro
EB culture.
2.3
In Vitro Differentiations of Arnt ES Cells Under Hypoxia
To test whether the ARNT-dependent hematopoietic defect results from an inability to respond to hypoxic conditions in vivo, we performed in vitro differentiations of ES cells under hypoxia (3% O2). Hypoxia induced a dramatic increase in most CPU types generated by EBs (Fig. 2b). In contrast, no hypoxic stimulation of progenitors was detected, implicating ARNT in oxygen-dependent progenitor proliferation. These results suggest that "physiologic" hypoxia stimulates progenitor numbers during development via an ARNT-dependent manner, similar to vascular endothelial cell proliferation.
3.
CHIMERIC ANIMAL STUDIES
3.1
Bone Marrow Analysis
To determine if the ARNT-mediated hematopoietic defect is intrinsic to
CPU progenitors, we injected and ES cells (129 strain) into wild-type C57BL/6 blastocysts and assayed chimeric animals for CPU formation in adult bone marrow (Robb et al. 1996; Wang et al. 1998). The degree of ES cell contribution was initially estimated by coat color, and later precisely determined by Southern blot analysis of bone marrow DNA. Femur and tibial bone marrow was extracted from six week old animals and cultured in methylcellulose in the presence or absence of G418, which selects for neomycin resistance introduced during the original ES cell targeting. As expected, the number of G418-resistant CPUs correlated with the degree of ES cell contribution to chimeric animals (Table 1). If the progenitor deficiency were due to a cell-intrinsic defect, few to no CPUs should appear in cultures of bone marrow cells derived from chimeric animals. Interestingly, the number of CPUs derived from these animals correlated with the percent chimerism of each animal, indicating a cell-extrinsic defect (Table1). Southern blot analysis of colonies confirmed they were exclusively derived from ES cells.
279
3.2
Yolk Sac Analysis
We extended this approaeh to include yolk sac hematopoietic progenitors,
since considerable evidence suggests yolk sac and bone marrow progenitor populations are derived from distinct mesodermal progenitor cells (Medvinsky and Dzierzak 1996). Because embryos display a yolk sac progenitor phenotype, we wanted to determine if this population also exhibited a cell-extrinsic defect. Toward this end, we generated chimeric
animals with
ES cells and harvested E10.5 yolk sacs.
Percent
chimensm of each animal was determined by Southern blot analysis of the embryo proper, and yolk sac cells were split between methylcellulose cultures with and without G418. Similar to results from the chimeric bone marrow assays, the number of yolk sac CPUs correlated with the degree of chimerism, demonstrating a cell-extrinsic defect of the yolk sac progenitor population (Table 1). Therefore, the hematopoietic defect is not intrinsic to hematopoietic progenitors, but rather to some other cellular population(s). These findings suggest that yolk sacs are deficient in extracellular cytokine(s), which are essential for progenitor proliferation or survival, but not lineage commitment. embryos and EBs generate all progenitor types, albeit in fewer numbers, consistent with a cytokinemediated deficit.
280
4. 4.1
CYTOKINE RESCUE EXPERIMENTS VEGF Rescues the Hematopoietic Defect, whereas EPO, GM-CSF, SCF, IL-1 and IL-3 Do Not
EPO and VEGF are critical hematopoietic cytokines (Wu et al. 1995; Ferrara et al. 1996; Lin et al. 1996; Shalaby et al. 1997) and direct targets of ARNT transcriptional activity (via HIF-1) (Bunn and Poyton 1996; Wood et al. 1996; Maltepe et al. 1997; Wenger and Gassmann 1997). To determine if these cytokines were dysregulated in our in vitro cultures, RNA extracted from and EBs differentiated under both normoxic and hypoxic conditions was analyzed by Northern blot. EBs are three-dimensional structures which exhibit oxygen gradients due to their relatively large size (Gassmann et al. 1996). Thus, even when cultured under normoxic conditions (20% EBs can contain regions of mild hypoxia. EBs produced less VEGF mRNA than EBs indicating that the observed progenitor defect may be due to decreased VEGF expression as a result of an inability to respond to such hypoxic stimuli. EBs expressed much higher levels of VEGF in 3% while EBs showed only a slight increase in VEGF expression, consistent with earlier studies (Maltepe et al. 1997). We were unable to detect EPO expression with this assay. To determine if inadequate VEGF levels caused the progenitor defect, we added exogenous VEGF to EB cultures. Exogenous VEGF restored CFU-E, CFU-M, CFU-GEMM, and CFU-GM progenitor numbers to wild-type levels in EBs. In contrast, addition of EPO failed to increase progenitor number in the EBs, demonstrating that inadequate EPO production does not cause the hematopoietic defect in EBs. Other cytokines, including GM-CSF, IL-1, IL-3, and SCF, are not known to be direct targets of ARNT transcriptional activity, but were also tested in this assay. All failed to rescue a variety of CFU progenitors, although SCF did partially rescue the CFU-E precursors. Thus, VEGF is playing a specific role in the survival and/or proliferation of a broad spectrum of hematopoietic progenitors during EB formation. These data are reminiscent of mice, as VEGF mRNA levels are lower in both the yolk sac and embryo proper (Maltepe et al. 1997).
5.
CONCLUSION
In this study, we have shown that ARNT is essential to multilineage hematopoiesis in embryos and embryoid bodies. Whereas cytokines,
281
cytokine receptors, and transcription factors are well-established factors governing hematopoiesis, our data demonstrate the importance of environmental stimuli, such as hypoxia, as critical to the onset, maintenance, and expansion of hematopoietic precursors during embryonic development subsequent to E8.5. Interestingly, it is precisely at this stage when embryos begin to show stunted development. Therefore, we propose a molecular pathway in which the hypoxia-inducible factor HIF-1 activates the transcription of Vegf, the expression of which stimulates the proliferation and/or survival (Katoh et al. 1998) of the hemangioblast, hematopoietic stem cell and/or lineage-committed progenitors, likely through Flk-1 signaling (Fig. 3a and b). Our data also demonstrate that hematopoietic progenitors proliferate in response to hypoxia, joining endothelial cells (Phillips et al. 1995) and placental cytotrophoblasts (Genbacev et al. 1997) as cell types which exhibit this ability. Furthermore, hypoxic cell culture may represent
an efficient way to promote hematopoietic progenitor proliferation in vitro, which may increase the feasibility of using these cells for human stem cell transplantation.
282
ACKNOWLEDGMENTS We thank Cynthia Clendinin, Michele Hadhazy, Kirsten Sigrist and Donna Fackenthal for technical assistance; Navdeep Chandel for help with hypoxic cell culture; Brian Keith and Jeffrey Leiden for critically reviewing the manuscript; Cheryl Small for secretarial assistance; and Denise Wiler for preparing the illustrations. D.M.A. is a fellow of the Medical Scientist Training Program. E.M. is a Nathan and Francis Goldblatt Society Fellow. M.C.S. is an investigator of the Howard Hughes Medical Institute.
REFERENCES An, W.G., M. Kanckal, M.C. Simon, E. Multepe, M.V. Blagosklonny, and L.M. Neckers. 1998. Stabilization of wild-type p53 by hypoxia-inducible factor lalpha. Nature 392: 405 408. Bunn, H.F. and R.O. Poyton. 1996. Oxygen sensing and molecular adaptation to hypoxia. Physiol Rev 76: 839-885. Choi, K., M. Kennedy, A. Kazarov, J.C. Papadimitriou, and G. Keller. 1998. A common precursor for hematopoietic and endothelial cells. Development 125: 725-732. Ferrara, N., K. Carver-Moore, H. Chen, M. Dowd, L. Lu, K.S. O'Shea, L. Powell-Braxton, K.J. H i l l a n , and M.W. Moore. 1996. Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature 380:439-442. Fischer, B. and B.D. Bavister. 1993. Oxygen tension in the oviduct and uterus of rhesus monkeys, hamsters and rabbits. J Reprod Fertil 99: 673-679. Gassmann, M., J. Fandrey, S. Bichet, M. Wartenberg, H.H. Marti, C. Bauer, R.H. Wenger, and H. Acker. 1996. Oxygen supply and oxygen-dependent gene expression in differentiating embryonic stem cells. Proc Natl Acad Sci USA 93: 2867-2872. Genbacev, O., Y. Zhou, J.W. Ludlow, and S.J. Fisher. 1997. Regulation of human placental development by oxygen tension. Science 277: 1669-1672. Katoh, O., T. Takahashi, T. Oguri, K. Kuramoto, K. Mihara, M. Kobayashi, S. Hirata, andH. Watanabe. 1998. Vascular endothelial growth factor inhibits apoptotic death in hematopoietic cells after exposure to chemotherapeutic drugs by inducing MCL1 acting as an antiapoptotic factor. Cancer Res 58: 5565-5569. Keller, G., M. Kennedy, T. Papayannopoulou, and M.V. Wiles. 1993. Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol Cell Biol 13: 473486. Kennedy, M., M. Firpo, K. Choi, C. Wall, S. Robertson, N. Kabrun, and G. Keller. 1997. A common precursor for primitive erythropoiesis and definitive haematopoiesis. Nature 386: 488-493. Kozak, K.R., B. Abbott, and O. Hankmson. 1997. ARNT-deficient mice and placental differentiation. Dev Biol 191: 297-305. Lin, C.S., S.K. Lim, V. D’Agati, and F. Costantini. 1996. Differential effects of an erythropoietin receptor gene disruption on primitive and definitive erythropoiesis. Genes Dev 10: 154-164. Maltepe, E., J.V. Schmidt, D. Baunoch, C.A. Bradfield, and M.C. Simon. 1997. Abnormal angiogenesis and responses to glucose and oxygen deprivation in mice lacking the protein ARNT. Nature 386: 403-407.
283
Medvinsky, A. and E. Dzierzak. 1996. Definitive hematopoiesis is autonomously initiated by the AGM region. Cell 86: 897-906. Mortensen, R.M., D.A. Conner, S. Chao, A.A. Geisterfer-Lowrance, and J.G. Seidman. 1992. Production of homozygous mutant ES cells with a single targeting construct. Mol Cell Biol 12: 2391-2395. Olson, M.C., E.W. Scott, A.A. Hack, G.H. Su, D.G. Tenen, H. Singh, and M.C. Simon. 1995. PU. 1 is not essential for early myeloid gene expression but is required for terminal myeloid differentiation. Immunity 3: 703-714. P h i l l i p s , P.G., L.M. Birnby, and A. Narendran. 1995. Hypoxia induces capillary network formation in cultured bovine pulmonary microvessel endothelial cells. Am J Physiol 268: L789-800. Robb, L., N.J. Elwood, A.G. Elefanty, F. Kontgen, R. Li, L.D. Barnett, and C.G. Begley. 1996. The scl gene product is required for the generation of all hematopoietic lineages in the adult mouse. Embo J 15: 4123-4129. Rodesch, P., P. Simon, C. Donner, and E. Jauniaux. 1992. Oxygen measurements in endometrial and trophoblastic tissues during early pregnancy. Obstet Gynecol 80: 283-285. Shalaby, F., J. Ho, W.L. Stanford, K..D. Fischer, A.C. Schuh, L. Schwartz, A. Bernstein, and J. Rossant. 1997. A requirement for Flkl in primitive and definitive hematopoiesis and vasculogenesis. Cell 89: 981-990. Shweiki, D., A. Itin, D. Soffer, and E. Keshet. 1992. Vascular endothelial growth factor induced by hypoxia may mediate hypoxia-initiated angiogenesis. Nature 359: 843-845. Wang, G.L., B.H. Jiang, E.A. Rue, and G.L. Semenza. 1995. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer regulated by cellular O2 tension. Proc Natl Acad
Sci U S A 92: 5510-5514.
Wang, L.C., W. Swat, Y. Fujiwara, E. Davidson, J. Visvader, F. Kuo, F.W. Alt, D.G. Gilhland, T.R. Golub, and S.H. Orkin. 1998. The TEE/ETV6 gene is required specifically for hematopoiesis in the bone marrow. Genes Dev 12: 2392-2402. Wenger, R.H. and M. Gassmann. 1997. Oxygen(es) and the hypoxia-inducible factor-1. Biol Chem 378: 609-616. Wood, S.M., J.M. Gleadle, C.W. Pugh, O. Hankinson, and P.J. Ratcliffe. 1996. The role of the aryl hydrocarbon receptor nuclear translocator (ARNT) in hypoxic induction of gene expression. Studies in ARNT-deficient cells. J Biol Chem 271: 15117-15123. Wti, H., X. L i u , R. Jaenisch, and H.F. Lodish. 1995. Generation of committed erythroid BFUE and CFU-E progenitors docs not require erythropoietin or the erythropoietin receptor. Cell 83: 59-67.
284
DUAL INFLUENCE OF NITRIC OXIDE ON GENE REGULATION DURING HYPOXIA
Gautam Adhikary, Daniel R. D. Premkumar, and Nanduri R. Prabhakar Department of Physiology and Biophysics, Case Western Reserve University,Cleveland, OH 44106-4970, USA
Abstract:
It is being increasingly recognized that nitric oxide (NO) is associated with many physiological processes, including regulation of gene expression. NO shares certain similarities with molecular oxygen Previous studies have shown that hypoxia up-regulates c-fos , an immediate early gene, and tyrosine hydroxylase (TH), a late response gene that encodes rate limiting enzyme in catecholamine synthesis. Given the similarities between NO and we hypothesized that NO inhibits hypoxia-induced up-regulation of c-fos and TH. Experiments were performed on rat pheochromocytoma (PC 12) cells, c-fos and TH mRNA’s were analysed by Northern blot and promoter activities by reporter gene assays, respectively. Hypoxia ( for 6 h) up-regulated c-fos and TH mRNAs and increased c-fos promoter activity. Hypoxia-induced c-fos mRNA expression, and promoter activities were significantly potentiated in presence of spermine nitric oxide (SNO), a NO donor. By contrast, SNO significantly inhibited TH mRNA expression and TH promoter activity during hypoxia. Electrophoretic mobility shift-assay showed increased binding of AP1 and HIF-1 transcription factors to the TH promoter in cells exposed to hypoxia. SNO abolished the binding of AP-1 and HIF-1 to the TH promoter during hypoxia, suggesting that inhibition of hypoxia-induced TH transcription by NO are due to reduced binding of AP-1 and HIF-1 transcription factors. These result demonstrate that NO has both positive and negative influence on gene regulation by hypoxia and suggest that although NO resembles does not always inhibit gene expression during low oxygen.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
285
1.
INTRODUCTION
Nitric oxide (NO) is a gas molecule with free radical properties that is produced during the catabolic conversion of arginine to citrulline by the enzyme NO synthase (NOS) (Moncada et al, 1991). NO has been implicated in many biological processes including neurotransmission, control of vascular tone, and immune responses (Snyder, 1992). Recent studies suggest that NO also regulates gene expression. Depending on the genomic type, NO can either suppress or activate gene expression. For example, NO activates gene transcription from AP-1 responsive promoters via a guanylate cyclasedependent pathway (Pilz et al, 1995). On the other hand, NO suppress the expression of macrophase-colony-stimulating factor induced by tumor necrosis factor-1 by decreasing the binding of nuclear transcription factor NF-kB (Peng et al. 1995). Recent reports also indicate that NO modulates gene expression during hypoxia. NO inhibits stimulation of erythropoietin (Epo; Sogawa, et al, 1998 and Huang et al, 1999) and vascular endothelial growth factor (VEGF, Liu et al, 1998) gene expression by hypoxia. Genes that are activated by low oxygen fall into two categories. Immediate early genes (lEGs) are activated within minutes after hypoxia
(e.g., c-fos), whereas the late response genes (LRGs) are activated more slowly over hours (e.g., tyrosine hydroxylase, TH). NO shares many similarities with molecular oxygen Like oxygen, NO is a gas molecule and binds to heme perhaps with greater affinity than oxygen. The biological actions of NO, like are coupled to activation of heme proteins and redox status of the cell (See Review; Prabhakar 1999). Given these similarities with and that NO inhibits hypoxia-induced Epo and VEGF gene
expression (Huang et al, 1999 and Liu et al, 1998), we hypothesized that NO inhibits c-fos and TH expression. To test this possibility, we examined the effects of spermine nitric oxide (SNO), a well established NO donor, on hypoxia-induced c-fos (an IEG) and TH (a LRG) mRNA expression in rat pheochromocytoma (PC12) cells. Much to our surprise, SNO enhanced c-fos mRNA expression, whereas inhibited TH mRNA expression during hypoxia.
2.
MATERIALS AND METHODS
PC12 cells were grown in DMEM growth medium (Dulbecco’s modified Eagle’s medium) supplemented with 10% horse serum, 5% fetal bovine serum (FBS) in a humidified incubator circulated with 10% 21% Experiments were performed on cells were grown to confluence. Prior to the experiment, cells placed in low serum containing media (0.5%) FBS for 18 hr, and then were exposed either to normoxia (21% ) or to
286
hypoxia (1% ) 10% balance in an oxygen regulated incubator (Heraeus). Stock solutions of SNO were prepared fresh before each experiment and desired concentrations were added to cells 30 min prior to the gas challenges. mRNA’s encoding TH, c-fos and were analyzed by Norther blot assay as described previously (Prabhakar et al, 1995; Mishra
et al, 1998). TH and c-fos promoter activities were determined by reporter gene assay using either Chloramphenicol Acetyl Transferase (CAT for TH)
or luciferase (for c-fos) as expression vectors. TH plasmid construct (Gift from Dr. E.Ziff) is composed of a of 5’-flanking TH sequence, the transcriptinal initiation site and the first 27 bases of transcribed TH sequence cloned adjacent to a DNA segment coding for the bacterial enzyme CAT. cfos plasmid construct (gift from Dr, Gilman) is composed of a to genomic DNA fragment of the c-fos promoter linked to the luciferase reporter gene. Cells were transiently transfected with either TH-CAT or cfos-Luc plasmid along with plasmid, the latter as an index of transfection efficiency. DNA binding of AP-1 and HIF-1 transcription factors to the TH promoter was determined by electrophoretic mobility shift assay (EMSA). The following are the sequences of the TH promoters used for EMSA assay: TH-AP-1, 5' GCTGAGGGTGATTCAGAGG 3'; TH-HIF1 , 5 ’ CAGCCAGCCCCTGCCCTACGTCGTGCCTCGGC 3’ mutant probe (mutation positions are in italics) used for competition experiments are, mTH-AP-1, 5' GCTGAGGGTTATT GAGAGGC 3’ mTH-HIF-1 5’ CAGCCAGCCCCTGCCCTACGTAAA CGCTCGG 3’. Sense and antisense strands of oligonucleotides were annealed into double-stranded oligonucleotides and were 5' end-labeled with T4 polynucleotide kinase and For competition experiments, cold probes were added before
adding probes labeled with All data are expressed as from 3 individual experiments each ran in duplicate. Statistical analyses were performed by analyses of variance (ANOVA) or by paired "t" test where appropriate and p values less than 0.05 were considered significant.
3.
RESULTS
3.1
NO stimulates c-fos expression during hypoxia
Hypoxia stimulates c-fos expression both in vivo (Erickson & Millhorn, 1991) and in vitro (Prabhakar et al, 1995). To determine the effects of NO on c-fos mRNA expression during hypoxia, cells were treated with various concentrations of SNO (30, 100, 300, 600 ) for 30 mm and then were
287
288
exposed to hypoxia (1% ) for 6h. Hypoxia stimulated c-fos mRNA by 5 fold and the effects of low oxygen were potentated by SNO. In the presence of SNO, hypoxia caused in a 15 fold stimulation of c-fos mRNA. Example of an experiment depicting the effect of SNO on c-fos mRNA expression is shown in figure 1 (middle pannel). On the other hand, neither hypoxia nor SNO had any effect on mRNA expression (Figure 1, bottom panel) To determine whether the enhanced c-fos expression is due to stimulation of transcription, c-fos promoter activity was determined by reporter gene assay. SNO significantly enhanced c-fos promoter activation by hypoxia (control hypoxia 2.5 fold vs SNO hypoxia 9 fold increase; ). These observations demonstrate that NO stimulates c-fos mRNA expression during hypoxia, an effect that appears to be due in part to increased c-fos transcription.
3.2
NO inhibits TH mRNA expression during hypoxia
PC12 cells synthesize catecholamines and hypoxia stimulates expression of the gene encoding TH, the rate-limiting enzyme in catecholamine synthesis (Czyzyk-Krzeska et al, 1994). The effects of SNO on TH expression during hypoxia were examined in the same experiments as above. Hypoxia increased TH mRNA (1% O2; 6h). However, unlike c-fos expression, SNO inhibited TH mRNA expression during hypoxia (Figure 1 top panel). In the presence of 600 hypoxia caused only a 1.5 fold increase in TH mRNA expression compared to 3.5 fold increase without NO donor To determine whether NO affects TH transcription during hypoxia, cells were transfected with TH-CAT plasmid and then were exposed to normoxia or to hypoxia In the presence of SNO, there was only a 2
fold increase in TH-CAT activity during hypoxia, compared to 4.5 fold increase in the absence of NO donor These observations demonstrate that SNO inhibits TH transcription during hypoxia. Previous studies have shown that binding of AP-1 transcription factor to the TH promoter increase during hypoxia (Norris & Millhorn, 1995), and mutations at the AP-1 binding site prevents TH-CAT activation by low oxygen (Norris & Millhorn; 1995; Mishra et al, 1998). To determine whether SNO affects AP-1 binding during hypoxia, gel shift assays were preformed on nuclear extracts from cells exposed to normoxia or hypoxia. Low oxygen increased AP-1, and SNO (600 ) totally blocked TH-AP-1 complex formation during hypoxia. Hypoxia inducible transcription factor (HIF-1) plays a critical role in trancriptional stimulation of many genes during hypoxia. HIF binding sites are located in close proximity to AP-1 binding sites in the HRE (hypoxic responsive element) region of the TH promoter 289
(Conforti et al, 1999). EMSA assay showed increased TH-HIF-1 complex, and SNO blocked the binding of HIF-1 to the TH promoter. These results demonstrate that SNO prevents the binding of AP-1 and HIF-1 transcription factors to the TH promoter during hypoxia.
4.
SUMMARY AND DISCUSSION
The results of the present study demonstrate that NO exerts dimetrically opposite influence on c-fos versus TH gene expression during hypoxia. NO, on one hand, potentiated c-fos expression, on the other, inhibited TH expression during hypoxia. These observations demonstrate that NO does not uniformly inhibit hypoxia-mduced gene expression even though shares many similarities with molecular Inhibition of hypoxia-induced TH expression by NO donor is similar to that reported for other late response genes such as Epo (Sogawa et al, 1998 and Huang et al, 1999) and VEGF (Liu et al, 1998). Results with the TH-
CAT activity suggest that the effects of SNO are in part due to reduced TH transcription. AP-1 transcription factor is critical for TH stimulation by
hypoxia (Mishra et al, 1998). We found that SNO completely inhibited AP-1
binding to the TH promoter during hypoxia. These observations indicate that inhibition of TH transcription is due to reduced AP-1 binding. It is interesting to note that hypoxia increased binding of HIF-1 transcription factor and SNO also inhibited HIF-1 binding. These observations are consistent with those reported by Huang et al, who also observed that NO donors inhibit HIF binding to Epo promoter (Huang et al, 1999). However, unlike Epo, the role of HIF-1 transcription in hypoxia-induced TH expression is less certain. HIF-1 consensus binding sites in the TH promoter
are close to AP-1 (Conforti et al, 1999). Hence, it is possible that TH transcription by hypoxia may involve interactions between AP-1 and HIF-1. In addition to its effect at the transcriptional level, NO might have affected TH mRNA stability, which might have contributed to the reduced TH mRNA expression during hypoxia.
In contrast to TH, SNO potentiated c-fos mRNA expression during hypoxia. This effect of SNO is in part due to increased c-fos transcription as evidenced by increased c-fos promoter activity. However, we have not investigated the mechanisms underlying the potentiation of hypoxia-induced
c-fos expression by NO. Ca/CRE and SRE cis-elements are essential for stimulation of c-fos transcription by hypoxia (Premkumar et al, 1999). It is
possible that NO increased transcativation of Ca/CRE and/or SRE cis-
elements during hypoxia resulting in increased c-fos transcription. Alternatively, increased c-fos transcription by NO might be consequence of
290
inhibition of AP-1 binding to the c-fos promoter. Because it is known that increased AP-1 binding to the FAP cis-element in the c-fos promoter represses c-fos transcription (Angel & Karin, 1991). Finally, NO might have affected c-fos mRNA stability during hypoxia resulting in increased c-fos mRNA. In summary, the present results demonstrate that NO stimulates c-fos on one hand and inhibits TH expression during hypoxia. The effects NO appear to be in part due to its effects at the transcriptional level. These observations implicate NO as a potential modulator of gene expression during hypoxia. However, the effects of NO are not uniform. Depending on the gene, NO might either enhance or inhibit gene expression during low oxygen.
ACKNOWLEDGEMENT This work is supported by grants from National Institutes of Health, Heart, Lung and Blood Institute, HL-25830.
REFERENCES Abate, C., Patel, L., Rauscher I I I , F. J., Curren, T. (1990) Science 249, 1157-1161. Angel P and Karin M, (1991), Biochimia et Biophysics Acta, 1072, 129-157. Boyle, W. J., Smeal, T., Defize, L. H . K., Angel, P., Woodgett, J. R., curran, M., Hunter, T. (1991) Cell, 64, 573-584. Conforti L, Kobayashi, S., Jonson D. B., Conrad, P.W., Freeman, T. and Millhorn, D. E. (1999), Resp. Physol, 1 1 5 , 249-260. Czyzyk-Krzeska, M. F. Dominiski, Z. Kole, R., Millohorn, D. E. (1994). J. Biol. Chem. 269, 760-764.
Enckson J.T. and Millhorn, D. E. (1991), Brain Res, 567, 11-24. Ginsberg, E. G. and Zif'f, E. B. (1994) Mol Endocrinol. 8, 249-262.
Gorman, C. M., Moffat, E. F. Howard B. H. (1982) Mol. Cell. Biol. 2, 1044-1051. Huang, L. E., Arany, Z., Livingston, D. M., Bunn, H. F. (1996) J. Biol. Chem. 271, 3225332259. Hibbs J. B., Vavrin Z, Taintor R.R. (1987), J. Immunol, 138, 550-556. Huang L.E., Willmore W.G., Gu J., Goldberg MA, and Bunn H.F., (1999) J. Biol Chem, 274,
9038-9044. Huang, L. E., Gu, J. Schau, M., Bunn H. F. (1998) Proc. Natl. Acad. Sci. USA, 95, 79877992.
K l i n e , D. D., Yang, T., Huang, P. L., Prabhakar, N. R. (1998) J. Physiol (Lond) 5 1 1 , 273287. Kourembanas, S., McQuillan, E. P., Leung, G. K., Faiier, D. V. (1993) 104.
J. Clin. Invest. 92, 99-
L i u Y., Christou, H., Morita, T., Laughner, E., Semenza, G.L., and Kourembanas, S. (1998), J. Biol. Chem, 273, 15257-15262. Mac Greggor, G. R., Mogg, A. E., Burke, J. F., Laskey, C. T. (1987) Somatic Cell. Mol. Genet. 13, 253-265.
291
Mishra, R. R, Adhikary, G. Simonson, M. S., Cherniack, N. S., Prabhakar N. R. (1998) Mol. Brain. Res. 59, 74-83. Moncada, S. Plainer, R. M. J. and Higgs, E. A. (1991), Pharmacol. Rev, 43, 109-142. Morgan, J. I., Curren, T., (1989) TINS. 12, 459-462. Norris, M. L, Millhorn D. E. (1995) J. Biol. Chem. 270, 23774-23779. Prabhakar, N. R. (1999), Resp. Physiol, 115, 161-168.
Prabhakar, N. R., Pieraminic, S. F., Premkumar, D. R. D., Kumar, G. K., Kalaria, R. N. (1996) Mol Brain Res. 43, 341 -346. Prabhakar N.R., Shenoy, B. C., Simonson M. S. and Cherniack N. S. (1995), Brain Res. 697, 266-270.
Paulding, W., Czyzyk-Krzeska, M. F. (1999) J Biol. Chem. 274, 2532-2538. Peng, H. B., Rajavashisth, T. B. libby, P. Liao, J. K. (1995) J. Biol. Chem. 270, 17050-17055. Pilz, R. B., Suhasini, M., Idriss, S., Meinkoth, J. L., Boss, G. R. (1995) FESEB J. 9, 552-558.
Premkumar, D.R.D., Adhikary, G., Simonsons, M.S., Cherniack, N.S. and Prabhakar, N.R. FASEB J. 13: 1091, 1999. Snyder, S.H. (1992), Science, 257, 494-496. Sogawa K . , Tsuruta, K . N , Ema M., Abe M., Abe, H., and Kuriyama Y. F., (1998). Proc. Nat. .Acad. Sci., 95, 7368-7373.
Wenger R. H., and Gassmann, M. (1997), Biol. Chem. 378, 609-616. Wang, G. L. and Semanza, G. L. (1993) J. Biol. Chem, 268, 21513-21518.
292
Hypoxia Differentially Regulates the Mitogen- and Stress-Activated Protein Kinases Role of
in the activation of MAPK and
P. William Conrad, David E. Millhorn, and Dana Beitner-Johnson Department of Molecular and Cellular Physiology, College of Medicine, University of
Cincinnati, PO Box 67-0576, Cincinnati, OH 45267-0576
Key words:
MAPK, ERK, JNK, p38, SAPK
Abstract: Hypoxic/ischemic trauma is a primary factor in the pathology of various vascular, pulmonary, and cerebral disease states. Yet, the signaling mechanisms by which cells
respond and adapt to changes in oxygen levels are not clearly established. The effects of hypoxia on the stress-and mitogen-activated protein kinase (SAPK and MAPK) signaling pathways were studied in PC12 cells. Exposure to moderate hypoxia
progressively stimulate phosphorylation and activation of
was found to
in particular, and also
two isoforms of the p38 family of stress-activated protein kinases. In contrast, hypoxia had no effect on enzyme activity of or on JNK, another stress-activated protein kinase. Prolonged hypoxia also induced phosphorylation and activation of p42/p44 MAPK, although this activation was modest when compared to NGF and UV-induced
activation. We further showed that activation of and MAPK during hypoxia requires calcium, as treatment with media or the calmodulin antagonist, W13, blocked the activation of and MAPK, respectively. These studies demonstrate that an extremely typical physiological stress (hypoxia) causes selective activation of specific elements of the SAPKs and MAPKs, and identifies as a critical upstream activator.
1. INTRODUCTION Mammalian cell function is critically dependent on a continuous supply of oxygen. Even brief periods of oxygen deprivation (hypoxia/ischemia) can result in profound cellular and tissue damage. Thus, it is vital that organisms
Oxygen Sensing: Molecule to Man, edited by S. Lahiri el al.
KluwerAcademic/Plenum Publishers,2000
293
meet changes in tension with appropriate cellular adaptations. However, the specific intracellular pathways by which this occurs are not welldelineated. The stress- and mitogen-activated protein kinase (SAPK and MAPK) pathways play a critical role in responding to cellular stress and promoting cell growth and survival (Widmann et al., 1999; Su and Karin, 1996). We therefore investigated the effect of hypoxia on the SAPK and MAPK signaling pathways. SAPKs and MAPKs are the downstream components of three-member protein kinase modules (Garrington and Johnson, 1999) (Figure 1). Five homologous subfamilies of these kinases have been identified, and the three major families include p38/SAPK2/RK, JNK/SAPK, and p42/p44 MAPKs/ERKs (Widmann et al., 1999; Su and Karin, 1996; Garrington and Johnson, 1999; Rouse et al., 1994; Raingeaud et al., 1995; Kyriakis and Avruch, 1996). In general, the stress-activated protein kinases (p38 and JNK) are activated primarily by noxious environmental stimuli, such as ultraviolet light, osmotic stress, inflammatory cytokines, and inhibition of protein synthesis (Hibi et al., 1993; Derijard et al., 1994; Kyriakis et al., Han et al., 1994). In contrast, p42/p44 MAP kinases are primarily stimulated by mitogenic and differentiative factors in a Ras-dependent manner (Raingeaud et al., 1995; Woodgett et al., 1996; Whitmarsh and Davis, 1994), although these enzymes can also be activated by certain environmental stressors (Widmann et al., 1999; Su and Karin, 1996; Garrington and Johnson, 1999). Thus, we hypothesized that hypoxia, a prevalent physiological stressor in many disease states, may regulate the activity of the SAPK and MAPK signaling pathways. The PC12 cell line is a catecholaminergic, excitable cell type that has
been widely used as an in vitro model for neural cells (Green, 1995). It has also been shown that PC12 cells are an cell type that provides a useful system to study the effects of hypoxia on catecholaminergic gene expression (Czyzk-Krzeska et al., 1994; Norris and Millhorn, 1995; Levy et al., 1995; Raymond and Millhorn, 1997; Beitner-Johnson and Millhorn, 1998). Very small reductions in atmospheric dramatically induce tyrosine hydroxylase gene expression and mRNA stability in this cell type (Czyzk-Krzeska et al., 1994). Hypoxia also induces activation of the CREB and c-Fos transcription factors in this cell type (Norris and Millhorn, 1995; Beitner-Johnson and Millhorn, 1998; Prabhakar et al., 1995). Finally, PC12 cells also express hypoxia-regulated ion channels, as shown by the finding that PC12 cells depolarize during hypoxia via an oxygen-regulated current (Zhu et al., 1996; Kumar et al., 1998) and secrete dopamine and norepinephrine (Kumar et al., 1998; Taylor and Peers, 1999). Thus, we have used this cell type to study the regulation of intracellular signaling systems by hypoxia.
294
2. THE p38 FAMILY OF PROTEIN KINASES ARE DIFFERENTIALLY REGULATED BY HYPOXIA
The p38 family of protein kinases consists of several isoforms, including and (Rouse et al., 1994; Han et al., 1994; Li et al., 1996; Jiang et al., 1996; Jiang et al., 1997; Lechner et al., 1996; Mertens et al., 1996; Cuenda et al., 1997; Stein et al., 1997; Wang et al., 1997). To investigate the effects of hypoxia on the p38 family of protein kinases, PC12 cells were exposed to 5% for various times, between 20 min and 6 hr, followed by immunoblotting with an antibody specific for It can be seen in Figure 2A that exposure to hypoxia progressively induced phospho-p38 immunoreactivity in two closely migrating bands. Phospho-p38 blots were then stripped and re-blotted with an antibody that equally recognizes phospho-and (i.e., total ). Figure 2B shows that the lower phospho-p38 immunoreactive protein shown in Figure 2A corresponded to as determined by alignment of films using luminescent markers affixed directly to the blot. As shown in Figure 2B, hypoxia did not alter the total amount of protein. Of the time points examined, maximal hypoxia-induced phosphorylation of occurred at 6 hr, where there was an average 4.5-fold increase in phosphoimmunoreactivity (Figure 2C). The upper phospho-p38 immunoreactive
295
band was identified as an isoform of Phosphoimmunoreactivity of was more strongly increased by hypoxia, with an average of 12.7-fold increase over control levels by a 6 hr exposure to hypoxia (Figure 2C). To further characterize the effects of hypoxia on p38 enzyme activity, PC12 cells were transfected with FLAG epitope-tagged versions of or Cells were then exposed to either normoxia (21% ) or hypoxia (5% 6h). The various kinases were then immunoprecipitated with an anti-FLAG antibody, and immune complex kinase assays were performed. As shown in Figure 3A, hypoxia stimulated both and enzyme activity. In contrast to these results, hypoxia did not significantly alter or enzyme activity. Hypoxiainduced changes in enzyme activity were not the result of differences in transfection efficiency as cell lysates blotted with anti-FLAG show equal amounts of the transfected protein (Figure 3B). It can be seen that the effect of hypoxia on the isoform is by far the most robust (average 5.9-fold activation, Figure 3C).
296
Our results demonstrate, for the first time, that physiological levels of hypoxia selectively activate and Phosphorylation of has been shown to occur following ischemia in heart and kidney (Yin et al., 1997). Taken together with our findings, it is possible that the hypoxic component of ischemia, rather than the other types of substrate depletion (glucose, ATP, etc.), results in the activation of and 3.
HYPOXIA HAS NO EFFECT ON JNK ACTIVITY
The other major stress-activated signaling pathway acts through the c-Jun N-terminal kinase (JNK) family of protein kinases (Widmann et al., 1999; Su and Karin, 1996; Garrington and Johnson, 1999). Like p38, the JNK family is activated by a number of stressors, but is distinctive in its ability to phosphorylate the transcription factor c-Jun (Kyriakis and Avruch, 1996; Hibi et al., 1993; Derijard et al., 1994). To evaluate the effect of hypoxia on JNK, PC12 cells were exposed to hypoxia for various times, from 20 min to 6 hr, and JNK enzyme activity was measured in an immune complex kinase assay. Unlike its effects on p38, hypoxia did not significantly alter JNK enzyme activity, whereas exposure of cells to UV light markedly increased JNK activity (Figure 4).
297
It has been reported previously that ischemia/reperfusion in the kidney and hypoxia/reoxygenation in cardiac myocytes induces activation of JNK (Yin et al., 1997; Pombo et al., 1994). These groups found JNK activity to be activated by the reoxygenation event, but not during the initial hypoxia or ischemia. It has also recently been reported that severe hypoxia transiently activated JNK in human squamous carcinoma cells (Laderoute et al., 1999). In contrast, we found that neither hypoxia nor hypoxia plus reoxygenation (data not shown) stimulated JNK enzyme activity in PC12 cells. Clearly, various stressors can have different effects, depending on the specific cell type and its environment. 4.
HYPOXIA INDUCES PHOSPHORYLATION AND ACTIVATION OF p42/p44 MAPK
To determine the effect of hypoxia on p42/p44 MAPK, PC12 cells were again exposed to either normoxia (21% ), or hypoxia (5% ) for various times, between 20 min and 6 hr. Samples of whole cell lysates were immunoblotted with either an antibody specific for tyrosine phosphorylated (activated) p42/p44 MAPK or an antibody that equally recognizes phosphoand dephospho-p42/p44 MAPK (total MAPK). Hypoxia had no significant effect on the levels of either phospho-p42/p44 MAPK at the earliest time points studied. However, exposure to hypoxia for six hours caused an increase in the tyrosine phosphorylation of p42/p44 MAPK (Figure 5A). The total amount of p42/p44 MAPK was not affected by hypoxia, as shown in Figure 5B. MAPK enzyme activity was measured directly by immune complex kinase assay. Figure 5C shows that p42 MAPK enzyme activity, like MAPK phosphorylation state, increased following six hours of hypoxia. To compare the effects of hypoxia with the prototypical activators of MAPK, we also evaluated p42/p44 MAP kinase phosphorylation in response to nerve growth factor (NGF) and UV light. In contrast to the rather modest effect of hypoxia, these stimuli caused a robust phosphorylation of p42/p44 MAP kinase (Fig. 5D).
298
5.
ACTIVATION OF
AND MAPK BY HYPOXIA IS
Previous experiments have shown that hypoxic exposure of PC12 cells results in membrane depolarization and calcium influx (Zhu et al., 1996; Raymond and Millhorn, 1997; Kumar et al., 1998). This increase in intracellular calcium is known to be a critical mediator of gene expression and transcription factor activation. Thus, we hypothesized that upon hypoxic depolarization was involved in the signaling cascade leading to activation. To test this hypothesis, cells were incubated in media or media (supplemented with 1 mM EGTA). Cells were then exposed to normoxia or hypoxia and subjected to immunecomplex kinase assay. Figure 6A shows that the hypoxia-induced activation of is attenuated by incubation in media, suggesting a critical role for intracellular calcium in the activation of Lysates immunoblotted with anti-FLAG antibodies showed that expression of was the same (data not shown).
299
300
Egea et al. have shown that KCl-induced depolarization of PC12 cells results in MAPK activation via a calmodulin-dependent mechanism (Egea et
al., 1998; Egea et al., 1999). Thus, we hypothesized that calmodulin could
be involved in the hypoxia-induced activation of MAPK. Figure 7 shows that pre-treatment of PC12 cells with the calmodulin antagonist, W13 (20 ), caused a pronounced reduction in the hypoxia-induced phosphorylation of both p42 and p44 MAPK. These results are shown quantitatively in Figure 7B, and show that p42/p44 MAPK phosphorylation during hypoxia is calmodulin-dependent. 6.
CONCLUSIONS
Taken together, these studies demonstrate that hypoxia, an extremely typical physiological stress, causes specific regulation of the stress- and mitogen-activated protein kinase signaling pathways. We also show that one isoform of p38, is particularly strongly activated by hypoxia. In addition, the traditional growth factor-stimulated kinase, MAPK, is also phosphorylated and activated by hypoxia. Future studies are aimed at delineating the specific mechanisms by which a reduction in levels causes regulation of these pathways, as well as determining the mechanism by which target the MAPK and SAPK pathways.
ACKNOWLEDGEMENTS We thank G. Doerman and R. Glover for preparation of figures. This work was supported by NIH grants, R37HL33831 and RO1HL59945 (DEM), a U.S. Army grant, DAMD179919544 (DEM), grants from the American Heart Association (9806242) and the Parker B. Francis Foundation (DBJ), and an NIH Training Grant HL07571 (PWC). Figures 2 through 5 are adapted from Conrad et al. (1999), J. Biol. Chem. 274, 23570-23576. REFERENCES Beitner-Johnson, D. and Millhorn, D.E. (1998) J. Biol. Chem. 273, 19834-19839 Conforti, L., and Millhorn, D.E. (1997) J. Physiol. 502, 293-305
Conrad, P.W., Rust, R.T., Han, J., Millhom, D.E., and Beitner-Johnson, D. (1999) J. Biol Chem. 274, 23570-23576 Cuenda, A., Cohen, P., Buee-Scherrer, V., and Goedert, M (1997) EMBO J. 16, 295-305 Czyzk-Krzeska, M.F., Furnari, B.A., Lawson, E.E., and Millhorn, D.E. (1994) J. Biol. Chem. 269, 760-764
301
Derijard, B., Hibi, M., Wu, I-H, Barrett, T., Su, B., Deng, T., Karin, M., and Davis, R.J. (1994) Cell 76, 1025-1037 Egea, J., Espinet, C., and Cornelia, J.X. (1999) J. Biol. Chem. 1, 75-85 Egea, J., Espinet, C., and Cornelia, J.X. (1998) J. Neurochem. 70, 2554-2564 Garrington, T.P. and Johnson, G.L. (1999) Curr. Biol. 11, 211-218. Green, S.H. (1995) Methods: a companion to Meth. in Enzymol. 7, 222-237 Han, J., Lee, J.D., Bibbs, L., and Ulevitch, R.J. (1994) Science 265, 808-811 Hibi, M., Lin, A., Smeal, T., Minden, A., and Karin, M. (1993) Genes & Dev. 7, 2135-2148 Jiang, Y., Chen, C, Li, Z., Guo, W., Gegner, J.A., Lin, S., and Han, J. (1996) J. Biol. Chem. 271, 17920-17926 Jiang, Y., Gram, H., Zhao, M., New, L., Gu, J., Feng, L., De Padova, F., Ulevitch, R.J., and Han, J. (1997) J. Biol. Chem. 272, 30122-30128 Kyriakis, J.M., Banerjee, P., Nikolakaki, E., Dal, T., Rubie, E.A., Ahmad, M.F., Avruch, J., and Woodgett, J.R. (1994) Nature 369, 156-160 Kyriakis, J.M., and Avruch, J. (1996) J. Biol. Chem. 271, 24313-24316 Kumar, G.K., Overholt, J.L., Bright, G.R., Hui, K.Y., Lu, H., Gratzl, M., and Prabhakar, N.R. (1998) Am J Physiol. 274, C1592-600 Laderoute, K.R., Mendonca, H.L., Calaoagan, J.M., Knaoo, A.M., Giaccia, A.J., and Stork, P.J.S. (1999) J. Biol. Chem. 274, 12890-12897 Lechner, C., Zahalka, M.A., Giot, J.F., Moller, N.P.H., and Ullrich, A. (1996) Proc. Natl. Acad. Sci. 93, 4355-4359 Levy, A. P., Levy, N. S., Wegner, S., and Goldberg, M. A. (1995) J. Biol. Chem. 270, 1333313340 Li, Z., Jiang, Y., Ulevitch, R.J., and Han, J. (1996) Biochem. Biophys. Res. Commun. 228, 334-34011 Mertens, S., Craxton, M., and Goedert, M. (1996) FEBS Letters 383, 273-276 Norris, M.L. and Millhorn, D.E. (1995) J. Biol Chem. 270, 23774-23779 Pombo, C.M., Bonventre, J.V., Avruch, J., Woodgett, J.R., Kyriakis, J.M., and Force, T. (1994) J. Biol. Chem. 269, 26546-26551 Prabhakar, N.R., Shenoy, B.C., Simonson, M.S., and Cherniack, N.S. (1995) Brain Res. 697, 266-270 Raingeaud, J., Gupta, S., Rogers, J.S., Dickens, M., Han, J., Ulevitch, R.J., and Davis, R.J. (1995) J. Biol. Chem. 270, 7420-7426 Raymond, R., and Millhorn, D. E. (1997) Kidney Int. 51, 536-541 Rouse, J., Cohen, P., Trigon, S., Morange, M., Alonso-Llamazares, A., Zamanillo, D., Hunt, T., and Nebreda, A. (1994) Cell, 78, 1027-1037 Stein, B., Yang, M., Young, D.B., Janknecht, R., Hunter, T., Murray, B.W., and Barbosa, M.S. (1997) J. Biol. Chem., 272, 19509-19517 Su, B. and Karin, M. (1996) Curr. Biol. 8, 402-411. Taylor, S.C. and Peers, C. (1999) Biochem. Biophys. Res. Commun. 248, 13-17 Wang, X.S., Diener, K., Manthey, C.L., Wang, S., Rosenzweig, B., Bray, J., Delaney, J., Cole, C.N., Chan-Hui, P.-Y., Mantlo, N., Lichenstein, H.S., Zukowski, M., and Yao, Z. (1997) J. Biol. Chem., 272, 23668-23674. Whitmarsh, A.J., and Davis, R.J. (1994) J. Mol. Medicine 74, 589-607 Widmann, C., Gibson, S., Jarpe, B., and Johnson, G.L. (1999) Phys. Rev. 79, 143-180. Woodgett, J.R., Avruch, J., and Kyriakis, J. (1996) Cancer Surveys 27, 127-138 Yin, T., Sandhu, G., Wolfgang, C.D., Burrier, A., Webb, R.L., Rigel, D.F., Hai, T., and Whelan, J. (1997) J. Biol. Chem., 272, 19943-19950 Zhu, W.H., Conforti, L., Czyzk-Krzeska, M.F., and Millhorn, D.E. (1996) Am. J. Physiol. 40, C658-C665
302
CHAIRMAN'S SUMMARY: MECHANISMS OF OXYGEN HOMEOSTASIS, CIRCA 1999 Gregg L. Semenza Institute of Genetic Medicine, Departments of Pediatrics and Medicine, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21287
ABSTRACT Oxygen sensing is a fundamental physiologic requirement of all living organisms and all cells within the human body. This paper presents a brief summary of recent investigations into the molecular mechanisms underlying oxygen sensing and adaptive responses to hypoxia, with particular reference to other papers in this volume.
1.
IN THE BEGINNING: HOMEOSTASIS AS AN EVOLUTIONARY DRIVING FORCE
The appearance of photosynthetic organisms 2.7 billion years ago made possible the subsequent evolution of systems that utilize glucose and to produce ATP by oxidative phosphorylation. However, these biochemical reactions also result in the generation of superoxide ions, hydroxyl radicals, peroxides, and other reactive species (ROS) capable of damaging many cellular macromolecules including DNA. homeostasis therefore represents a major evolutionary constraint: organisms must acquire sufficient to meet metabolic requirements for ATP while minimizing steady-state levels of ROS. In the case of unicellular organisms exposed to ambient concentrations, this could be achieved by inhabiting an environment (e.g. aquatic or subterranean) with an optimal concentration and by utilizing redox sinks such as glutathione and enzymes such as superoxide dismutase (SOD), catalase, and glutathione peroxidase. The Cambrian explosion of multicellular organisms 540 million years ago was temporally correlated with a sudden rise in pressure above 0.1 atm (reviewed by Kerr, 1999). Despite the increased atmospheric
Oxygen Sensing Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
303
pressure, as larger and more complex organisms arose simple diffusion was insufficient to ensure adequate oxygenation, leading to the evolution of specialized systems for delivery. In Drosophila melanogaster, a system of tracheal tubes allows direct diffusion of to all cells of the insect's body. The greatly-increased size of mammals necessitated the evolution of even more complex respiratory and circulatory systems to maintain tissue oxygenation in a narrow physiologic range designed to maximize ATP production while minimizing ROS levels.
2.
HOMEOSTASIS IN HUMAN DEVELOPMENT, PHYSIOLOGY, AND DISEASE
In humans, the requirement is continuous and absolute: a 70-kg adult consumes at a rate of 250 ml/mm or 360 L/d and interruption of for more than a few minutes is lethal. The maintenance of homeostasis represents a fundamental requirement for survival that impacts on many aspects of human development, physiology, and pathophysiology (reviewed by Semenza, 1999). During embryogenesis it is likely that hypoxia represents a driving force for the establishment of physiologic systems such as the circulatory system that are necessary to maintain homeostasis in fetal and postnatal life. Hypoxia also is a major factor contributing to the pathogenesis of diseases that represent the most common causes of mortality in western populations (Table 1).
3.
PHYSIOLOGIC RESPONSES TO HYPOXIA: ACUTE VS CHRONIC
As with other physiologic stimuli, responses to hypoxia can be classified as either acute or chronic (Table 2). Acute responses occur over a time scale
304
of seconds to minutes and involve the post-translational modification of preexisting proteins or other macromolecules, for example, through reductionoxidation reactions or phosphorylation-dephosphorylation. Chronic responses occur over a time scale of minutes to hours and involve changes in gene expression and/or de novo protein synthesis.
4.
SENSING: ALTRUISTIC IMPULSES VS SELFPRESERVATION
Specialized chemoreceptor cells in the carotid and neuroepithelial bodies were first shown to sense in arterial blood and inspired air, respectively. In these cells, hypoxia inhibits channel activity, leading to calcium influx, depolarization, neurotransmitter release, and the delivery of neural
impulses to the central nervous system (reviewed by Cutz and Jackson, 1999; Lopez-Barneo et al., 1999). Pulmonary artery smooth muscle cells have also been shown to constrict in response to hypoxia, whereas smooth muscle cells from the ductus arteriosus constrict in response to increased arterial associated with the transition from fetal to postnatal life (see papers by Archer et al. and Reeve et al. in this volume). The four cell types described above have been designated "oxygen sensitive cells" by respiratory physiologists and appear to share in common the presence of channels. However, in 1999 use of the term "oxygen sensor" to refer to a cell type should be regarded as an anachronism as it is clear that all nucleated cells are able to sense and respond to both acute and chronic changes in concentration. For example, hypoxiainducible factor 1 (HIF-1) activates transcription of genes encoding vascular endothelial growth factor, which stimulates angiogenesis leading to increased delivery, and glucose transporters and glycolytic enzymes, which facilitate ATP production in the absence of (reviewed by Semenza, 1999). This modulation of target-gene transcriptional activity is achieved via regulation of the HIF-1a subunit at multiple levels,
305
including mRNA expression, protein synthesis and stability, nuclear
localization, and transactivation domain function (reviewed by Semenza, 1999; see papers by Gassmann and Wenger, Ratcliffe et al, Semenza et al., Srinivas et al., and Zhu et al. in this volume). In addition to the fact that carotid and neuroepithelial body cells possess channels not found in other cell types, there is one other major difference between these cells and other cell types. Most cells sense in order to match intracellular consumption with availability and
to maintain intracellular ATP levels and redox states, which are essential for their individual survival. In contrast, chemoreceptor cells perform the altruistic function of sensing concentrations for the organism as a whole. It is possible that a different mechanism of sensing may exist in chemoreceptor cells to sense extracellular for the ultimate benefit of all cells rather than (or in addition to) sensing the concentration within (and for the benefit of) a single cell.
5.
MODELS OF SENSING: ALL FOR ONE OR ONE FOR ALL?
How do cells sense changes in concentration? A priori, one could postulate a variety of mechanisms by which cells might measure In the simplest model, the sensor binds directly, such that as concentration declines, the fraction of sensor molecules containing bound ligand declines (Figure 1A). In the bacterium Rhizobium meliloti, a twocomponent signalling system consists of FixL, a hemoprotein kinase that is active in the deoxy state, and FixJ, a transcription factor that is active when phosphorylated by FixL (see paper by Gilles-Gonzalez in this volume). A hemoprotein sensor was also proposed for mammalian cells (Goldberg et
al., 1988). There has been no experimental support for a ligand model, but it remains possible that mammalian sensing involves molecular interactions with one or more hemoproteins (see below). Besides heme, iron-sulfur clusters represent another intracellular target for (Figure 1B). In the presence of iron regulatory protein 1 is degraded via iron-sulfur cluster formation (Iwai et al., 1998). Although preliminary studies suggested that HIF-1 contained non-heme iron, the
results could not be reproduced (Salceda and Caro, 1998). HIF-1a is a basichelix-loop-helix-PAS protein and the PAS domain is extensively utilized for and redox sensing in Archaea, Bacteria (e.g. FixL), and Eucarya (reviewed by Taylor and Zhulin, 1999), suggesting that HIF-1 activity may
be directly affected by changes in
306
concentration. The HERG
channel
also contains a PAS domain and may be expressed in carotid body glomus cells (see paper by Overholt et al. in this volume).
Alternatively, a metabolite of may be sensed. An NAD(P)H oxidase could convert to superoxide anion which is converted to hydrogen peroxide by SOD (Figure 1C). As concentration declines the production of ROS ( and hydroxyl radical) declines, thus providing a redox signal for hypoxia (see papers by Acker et al., Fandrey, Kietzmann et al., and Wolin et al. in this volume). Diphenylene iodonium (DPI), an inhibitor of NAD(P)H oxidases (and other flavoproteins) stimulates depolarization of carotid and neuroepithelial bodies (Youngson et al., 1993), as predicted by the model. However, DPI inhibits induction of HIF-1 and downstream genes in response to hypoxia (Gleadle et al., 1995),
307
an effect opposite to that predicted. In contrast to wild-type mice, hypoxia did not inhibit channel activity in neuroepithelial bodies from mice lacking expression of the gp91 subunit of NADPH oxidase (see paper by Fu et al. in this volume). Thus, the data are most consistent with involvement of an NADPH oxidase in hypoxia-induced depolarization of neuroepithelial body cells. Additional genetic studies will be required to determine whether this pathway is involved in sensing in other chemoreceptors and in nondepolarizable cells. An alternative model proposes that mitochondrial electron transport chain (ETC) complex IV (cytochrome c oxidase) plays an important role in sensing. Data supporting this model have been obtained for both yeast and human cells (see papers by Chandel et al., Kwast and Burke, Poyton, and Wilson et al. in this volume). Under hypoxic conditions the reduction of to by cytochrome oxidase is inhibited, resulting in release of electrons upstream at the ubisemiquinone cycle (complex III) and generation of (Figure 1D). Inhibition of complex I (by DPI or rotenone) decreases formation and inhibits induction of HIF-1 and downstream genes in response to hypoxia, as predicted by the model. In r0 Hep3B cells, which lack mitochondrial DNA and ETC activity, hypoxia does not induce ROS production or the expression of HIF-1 or downstream genes (Chandel et al., 1998). One might assume that measurement of ROS levels as a function of concentration would be sufficient to distinguish between these latter two models. Unfortunately, direct measurements of ROS are technically demanding and experiments utilizing different probes that become fluorescent upon oxidation by ROS (dihydrorhodamine 123, dichlorofluorescin diacetate) have yielded data supporting one or the other model (see papers by Acker et al., Fandrey, and Chandel et al. in this volume). One interpretation is that different probes are measuring different oxidants which are generated in response to hypoxia and that these probes (and the catchword "ROS") lack sufficient precision to be useful in resolving this debate. Since conflicting results have been obtained using the same cell line, the differences are unlikely to reflect cell type specificity, although this is not meant to exclude the possibility of different sensing mechanisms in different cell types or even within a single cell. Finally, the role of NO in sensing represents another important question receiving considerable attention (see papers by Adhikary et al., Buerk and Lahiri, Kline et al., and Stuehr et al. in this volume). Of particular interest is the hypothesis that NO produced by a recentlydescribed mitochondrial NO synthase inhibits cytochrome oxidase activity under hypoxic conditions (Clementi et al., 1999; Giulivi, 1998). In
308
Drosophila, NO appears to play a major role in acute and chronic responses to hypoxia (Wingrove and O'Farrell, 1999).
6.
LOOKING TO THE FUTURE: THE POWER OF GENETICS
The complete dissection of fundamental and complex pathways of sensing cannot be achieved using crude pharmacologic instruments alone. In 1999, the ability to precisely inactivate any gene of interest in order to determine its functional role represents a tool of unparalleled power for understanding cellular and systemic physiology at the molecular level. This has been well demonstrated by elegant studies in bacteria (see papers by Gilles-Gonzalez and Gunsalus in this volume) and yeast (see papers by Kwast and Burke, Poyton, and Zitomer et al. in this volume). Similar approaches are now proving productive in multicellular organisms, both invertebrates, notably Drosophila melanogaster (Ma et al., 1999; Wingrove and O'Farrell, 1999) and vertebrates, notably the laboratory mouse Mus musculus (see papers by Adelman et al., Fu et al., Kazemian et al., Kline et al., Maltepe et al., Semenza et al., and Tankersley in this volume). Somatic cell genetics represents an additional powerful approach to cellular physiology (Wood et al., 1998) that perhaps could be applied to PC12 cells, which have proven to be a useful culture model of carotid body glomus cells (see papers by Beitner-Johnson et al., Conrad et al., Czyzyk-Krzeska et al., Millhorn et al., and Paulding and Czyzyk-Krzeska in this volume). Just as it is now appreciated that O2 sensing is not restricted to specialized chemoreceptor cell types, the paradigm of a monolithic sensor responsible for initiating biological responses to hypoxia may represent an oversimplification. Given the fundamental importance of homeostasis for survival, it is likely that multiple hypoxia signal-transduction and modulatory cross-talk pathways will eventually be identified. The impressive body of scientific data summarized in this volume provides both the current status of this quest and a road map for future exploration.
ACKNOWLEDGMENTS The author regrets that due to the brevity of this review many important contributions to the field could not be cited directly. Work in the author's laboratory is supported by grants from the American Heart Association Maryland Affiliate and the National Institutes of Health (R01-DK39869 and R01-HL55338).
309
REFERENCES Chandel, N.S., Maltepe, E., Goldwasser, E., Mathieu, C.E., Simon, M.C., and Schumacker, P.T. Mitochondria! reactive oxygen species trigger hypoxia-induced transcription. Proc. Natl. Acad. Sci. USA 95;11715-11720, 1998. Clementi, E., Brown, G.C., Foxwell, N., and Moncada, S. On the mechanism by which vascular endothelial cells regulate their oxygen consumption. Proc. Natl. Acad. Sci. USA 96;1559-1562, 1999. Cutz, E., and Jackson, A. Neuroepithelial bodies as airway oxygen sensors. Respir. Physiol. 115:201-214, 1999. G i u l i v i , C. Functional implications of nitric oxide produced by mitochondria in mitochondrial metabolism. Biochem. J. 332:673-679, 1998. Gleadle, J.M., Ebert, B.L., and Ratcliffe, P.J. Diphenylene iodonium inhibits the induction of erythropoietin and other mammalian genes by hypoxia: implications for the mechanism of oxygen sensing. Eur. J. Biochem. 234:92-99, 1995. Goldberg, M.A., Dunning, S.P., and Bunn, H.F. Regulation of the erythropoietin gene: evidence that the oxygen sensor is a heme protein. Science 242:1412-1415, 1988. Iwai, K., Drake, S.K., Wehr, N.B., Weissman, A.M., LaVaute, T., Minato, N., Klausner, R.D., Levine, R.L., and Rouault, T.A. Iron-dependent oxidation, ubiquitination, and degradation of iron regulatory protein 2: implications for degradation of oxidized proteins. Proc. Natl. Acad. Sci. USA 95:4924-4928, 1998. Kerr, R.A. Early life thrived despite earthly travails. Science 284:2111-2113, 1999.
Lopez-Barneo, J., Pardal, R., Montoro, R.J., Smani, T., Garcia-Hirschfeld, J., and Urena, J.
and channel activity and cytosolic in oxygen-sensing tissues. Respir. Physiol. 115:215-227, 1999. Ma, E., Xu, T., and Haddad, G.G. Gene regulation by O2 deprivation: an anoxia-regulated novel gene in Drosophila melanogaster. Mol. Brain Res. 63:217-224, 1999. Salceda, S., and Caro, J. Hypoxia-inducible factor la is a non-heme iron protein: implications for oxygen sensing. J. Biol. Chem. 273:18019-18022, 1998. Correction: J. Biol. Chem. 274:1180, 1999.
Semenza, G.L. Regulation of mammalian O2 homeostasis by hypoxia-inducible factor 1. Annu. Rev. Cell Devel. Biol., in press, 1999. Taylor, B.L., and Zhulin, I.B. PAS domains: internal sensors of oxygen, redox potential, and
light. Microbiol. Mol. Biol. Rev. 63:479-506, 1999. Wingrove, J.A., and O'Farrell, P.H. Nitric oxide contributes to behavioral, cellular, and developmental responses to low oxygen in Drosophila. Cell 98:105-114, 1999. Wood, S.M., Wiesener, M.S., Yeates, K.M., Okada, N., Pugh, C.W., Maxwell, P.H., and Ratcliffe, P.J. Selection and analysis of a mutant cell line defective in the hypoxiainducible factor-la subunit (HIF-1a): characterization of HIF-1a-dependent and independent hypoxia-inducible gene expression. J. Biol. Chem. 273:8360-8368, 1998. Youngson, C., Nurse, C., Yeger, H., and Cutz, E. Oxygen sensing in airway chemoreceptors. Nature 365:153-155, 1993.
310
OXYGEN, HOMEOSTASIS, AND METABOLIC REGULATION
Peter W. Hochachka Depts. of Zoology and Radiology, and Sports Medicine Division University of British Columbia, Vancouver, Canada V6T 1Z4
Abstract
Even a cursory review of the literature today indicates that two views dominate experimental approaches to metabolic regulation. Model I assumes that cell behavior is quite similar to that expected for a bag of enzymes. Model II assumes that 3-D order and structure constrain metabolite behavior and that metabolic regulation theory has to incorporate structure to ever come
close to describing reality. The phosphagen system may be used to illustrate that both approaches lead to very productive experimentation and significant advances are being made within both theoretical frameworks. However, communication between the two approaches or the two 'groups' is essentially nonexistent and in many cases (our own for example) some experiments are done in one framework and some in the other (implying some potential schizophrenia in the field). In our view, the primary paradox and problem which no one has solved so far is that essentially all metabolite concentrations are remarkably stable (are homeostatic) over large changes in pathway fluxes. For muscle cells is one of the most perfectly homeostatic of all even though delivery and metabolic rate usually correlate in a 1 : 1 fashion. Four explanations for this behavior are given by traditional metabolic regulation models. Additionally, there is some evidence for universal sensors which could help to get us out of the paradox. In contrast, proponents of an ultrastructurally dominated view of the cell assume intracellular perfusion or convection as the main means for accelerating enzyme-substrate encounter and as a way to account for the data which have been most perplexing so far: the striking lack of correlation between changes in pathway reaction rates and changes in concentrations of pathway substrates and intermediates, including Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
311
oxygen. The polarization illustrated by these two views of living cells extends throughout the metabolic regulation field (and has caused the field to progress along two surprisingly independent paths with minimal communication between them). The time may have come when cross talk between the two fields may be useful. Two Solitudes in Metabolic Regulation Research
It is widely recognized in biology that many physiological and molecular functions are the sum of individual processes linked in sequence; in isolation many such individual processes have no clear functions at all. The design and regulation of such systems have represented perplexing problems for both physiologists and biochemists. In vivo physiological function often is evaluated by comparing changes in flux through the pathway per se with changes in concentrations of substrates and products of individual enzyme reactions within the pathway. Two guiding paradigms or frameworks (for convenience we will term them Model I and II) have guided these evaluations. Although rarely stated, the implicit assumptions in Model I studies are that simple ‘solution chemistry’ rules apply to the cell/tissue as a whole, that changes in rates of enzyme-substrate or protein-ligand interactions generally are diffusion dominated, and that cell behavior thus can be considered to be similar to that expected for a watery bag of organic materials. In Model II approaches, the analysis starting point is structure – the microanatomy of the inside of the cell. These studies acknowledge that cells are filled with membranous networks, microfilaments, microtubules, organelles, pumps, and motors, and that movements (not dead-still solutions) dominate metabolic functions inside of cells. Model II approaches in short explicitly assume that 3-D order and structure influence metabolite behavior and that metabolic regulation theory has to incorporate this information to realistically describe in vivo processes. Interestingly, there is little communication between the two research approaches (hence reference above to ‘two solitudes’); the entire phenomenon (polarization and solitude) can be well illustrated by considering the phosphagen system in vertebrate tissues. Model I Developments in Phosphagen Research
Creatine phosphokinase (CPK, EC 2.7.3.2 ATP:creatine phosphotransferase) catalyzes the reversible reaction,
N-
(where ADP and ATP are adenosine di- and triphosphate, respectively; PCr and Cr are phosphocreatine and creatine, respectively). The term ‘phosphagen 312
system’ refers to all the above components considered together, while PCr is the ‘phosphagen’ per se. The most widely accepted framework of phosphagen function in skeletal and cardiac muscles in lower vertebrates and in mammals assumes (i) that the total acid-extractable pool of (termed tCr) occurs in aqueous solution and is fully accessible to CPK, (ii) that solution chemistry rules apply globally in phosphagen containing cells in vivo, and (iii) that the main CPK-phosphagen function is to 'buffer' ATP concentrations during large scale changes in muscle work and in ATP turnover rates. To be sure, recent researchers working within this framework continue to make rather striking and important contributions. A by no means inclusive list of such developments include the following: (1) Our own 3 1P MRS studies of human calf muscle at rest and at various quantified work levels show (i) that changes in [PCr] and [Pi] accurately reflect change in work, (ii) that changes in [PCr] and [Pi] are greater in fast twitch fibers than in slow twitch fibers, and (iii) that change in the concentrations of these metabolites in both fast and slow muscles are less than in the relative change in work (3-4 fold changes in gastrocnemius [PCr] reflecting up to a 40 fold change in muscle ATP turnover rate). (2.) Similar 3 1P MRS studies of heart in large mammals including humans (5,18,28) show that transitions from low to higher work rates are not reflected in changes in the 3 1P MRS visible pools sizes of PCr or Pi. (3.) More recently, work from Hogan’s laboratory (32) showed that these kinds of phosphagen responses to work are perturbed by breathing hypoxic gas mixtures. Under hypoxia, for any absolute work intensity, the relative changes in [PCr] and in [Pi] exceed the changes observed in normoxia; these noninvasive studies in effect confirmed earlier biopsy-based chemical extraction studies that arrived at the same conclusions (2,31). (4.) Working within the same, if implicit, set of provisos, Meyer and his coworkers (16) were able to measure change in V02 vs work and [PCr] vs work over the same rest-work transitions. Combining the two data sets allowed calculation of the in vivo ratio of umoles ATP synthesized/umols 02 utilized; their data implied an in vivo ratio close to 6, or the theoretical value expected for fully coupled mitochondria . Careful 3 1P monitoring of PCr, Pi, and other metabolites also showed that putative glycolytic regulators, such as ADP and Pi, were less important than degrees of muscle activation as signals for glycolytic activation (9). Recent work from several laboratories has tried to tease out the relationship between 02 availability, muscle work, and the phosphagen system. Their studies indicate (i) that [PCr] again reliably reflects change in work of skeletal muscle (1,32,65), but not in heart (5,28), (ii) that %Mb02 remains constant over a broad range of work levels in both cardiac (39) and skeletal muscle (52), and (iii) that change in PCr correlates with change in oxygenation status of the cell only when Mb is seriously desaturated (65). Finally, clever genetic techniques have been used to influence expressions of CPK genes expression and so test 313
the functional roles of the phosphagen by modifying the cell’s abilities to utilize PCr. In fact, studies focussing on gene expression or gene regulation form a growth area in current literature on CPK/phosphagen function in the mouse model (37,38,67). So the summary conclusion, that the Model I approach to phosphagen function is alive and well and is leading to interesting new information, is hard to deny. How does this apparent progress compare to happenings in the Model II view of things. Model II Developments in Phosphagen Research
Given that Model I represents the prevalent view in the current literature and includes other phosphagen systems in invertebrate muscles, it is nevertheless problematical, for this model is not easily rationalized with tissue-specific isozyme occurrence, with intra cellular localization of specific isozyme forms of CPK, or with intracellular structural constraints. That is why alternative hypotheses (various versions of which we group together for this discussion as Model II) consider (i) that the structural organization of phosphagen containing cells physically constrains tCr (ii) that solution chemistry rules may apply in vivo mainly to localized PCr/Cr pools, and (iii) that intracellularly localized CPK isoforms in vivo create complex and possibly directional pathways of PCr and Cr metabolism - forming so-called creatine shuttles in muscle metabolism. The extent of parallel development of research within these two different frameworks is well illustrated in a comprehensive series of review papers summarizing thinking in this field (68,69). Just as in the Model I approaches used in the studies listed above, there have been several striking advances in research that falls more comfortably into the Model II approach above. For example, Walliman and his coworkers have recently solved the 3D structure of the mitochondrial isoform of CPK (miCPK). Structure-function analysis is consistent with function within the creatine shuttle concept; even at the level of the binding site, it appears that function is ordered and directional, that ADP and PCr probably preferentially access the active site together and that catalysis proceeds with the preferential release and exit of Cr and ATP into the cytosol. Similarly, several recent in vivo studies are hard to reconcile with simply Model I versions of phosphagen function. For example, a recent study (25) tested Model I assumptions in fast twitch or white muscle (WM) by introducing 14C-Cr into the WM pool in vivo. To avoid complications arising from working with muscles formed from a mixture of fast and slow fibers, it was advantageous to work with fish WM since it is uniformly fast twitch and is anatomically separated from other fiber types. The expected result, based on traditional views of CPK function in vivo, was that at steady state following 14C-Cr administration, the specific activities of PCr and Cr would 314
be the same under essentially all conditions. In contrast, the study showed that, in various metabolic states between rest and recovery from exercise, the specific activity of PCr greatly exceeded that of Cr. The data implied that a significant fraction of Cr was ‘missing’ in the sense that it was not free to rapidly exchange with exogenously added 14C-Cr. Releasing this ‘missing’ and hence unlabelled Cr upon acid extraction could account for the lowered Cr specific activities measured (25). Since this unexpected result was not consistent with traditional models of phosphagen function, we later decided to evaluate the issue using a different and independent experimental approach. To this end, we turned to 1H Magnetic Resonance Spectroscopy (MRS) to evaluate the pool size and behavior of tCr (16,66) under different metabolic states in human gastrocnemius muscle.
We examined human gastrocnemius with and without creatine supplementation at both rest and ischemic fatigue in order to perturb the tCr pool and to examine it in varying metabolic states. We focussed on the methyl resonance at 3.05 ppm and initially expected that the peak intensity in ischemic fatigue would be similar to the resting condition (chemically extracted [tCr] is the same in resting and fatigued muscle because PCr disappearance and Cr appearance during muscle work are stoichiometrically related through the CPK reaction (1,2)). In contrast, we found that at the 3.05 ppm peak intensity in ischemic fatigue decreased. Further analysis at varying TE showed that this was due to rapid decay of the 3.05 ppm signal intensity; tCr in muscle in ischemic fatigue displayed line broadening and its effective transverse relaxation time, was decreased to
about ¼ the value for the same peak at rest. Since Cr is the major contributor to tCr in ischemic fatirue, the implications are that there is a pool of Cr displaying reduced mobility in vivo corresponding to that described in the earlier studies with 14C creatine (25). Quite analogous 1H MRS studies were carried out by Kreis and his coworkers (46) focussing on the methylene residues. These studies led to equally unexpected results. Whereas in solution, the methylene hydrogens of PCr and Cr are indistinguishable, in vivo 1H MRS appears able to detect only the methylene doublet of PCr. Cr methylene hydrogens are 1H MRS ‘invisible’ (46). Again, these kinds of results imply that the structure of the internal milieu is an important determinant of the behavior of metabolites such as PCr and Cr; i.e., the properties of the phosphagen system are strongly determined by intracelluar structure and order. From the above short overview it is clear that both Model I and Model II approaches to phosphagen research are enjoying significant success and making significant progress. The extent of parallel development of research within these two different frameworks indicates that the polarization extends 315
throughout the metabolic regulation field and has caused the field to progress along two surprisingly independent paths with minimal communication between them. In our view, the primary problem and paradox that neither approach has so far resolved is the notable homeostasis of metabolites during large scale transitions in work and ATP turnover. Metabolite Homeostasis is Ubiquitous
A kind of watershed in our analysis of this problem was reached when we
realized that the results for human muscles are in no way unusual. Similar results for the adenylates, phosphagen, Pi, and are found in studies of a wide assortment of animals (2,11,12,18,) as well as in other human studies (1,32). Included in this list are invertebrates (53,72), fishes and other ectothermic vertebrates (11,12), mammals and birds (see (18)). Additionally some of these studies have also analyzed many of the intermediates in specific ATP supply pathways such as glycolysis (11,12,21,23) and the Krebs cycle (53); in these systems, as in the ones above, changes in [pathway intermediates] are modest (0.5-3 fold) despite large changes (up to an over 100 fold increases) in pathway fluxes that are simultaneously sustained by the
working tissue.
Emerging from these studies are two key implications (i) that [ATP] is almost perfectly homeostatic under most conditions (except under very extreme
fatigue conditions) and (ii) that other intermediates in pathways of ATP supply or ATP demand are stabilized within less rigorously controlled concentration ranges. When we first analyzed this problem (14) the latter condition was described as 'relatively' homeostatic, since the % changes in concentrations of intermediates are far less than the % changes in metabolic rates with which they correlate. We will here refer to the homeostasis of
substrate concentration, [s], in the face of large changes in cell work and cell metabolism as the [s] stability paradox, for which there are several
explanations already advanced. Model I Accounts of the [s] Stability Paradox
Our analysis of the literature on this problem shows that currently advanced explanations for metabolite homeostasis at any given step in metabolism
depend on the kind of enzyme involved. For simple enzymes obeying Michaelis-Menten kinetics, in vivo function generally is assumed to be under
near-equilibrium conditions with very high catalytic capacities assuring sensitive 'high gain' responses to small changes in [substrate]/[product] ratios (see (6,30,58), for literature in this area). Such near-equilibrium function of creatine phosphokinase (CPK) is the accepted explanation for the especially 316
precise regulation of [ATP] during rate transitions - the traditional ATP 'buffering' role of CPK (1). In the case of allosteric enzymes, usually functioning far from equilibrium under in vivo conditions, large changes in rate can often be sustained with relatively modest change in key modulators. Phosphofructokinase (PFK) is a quintessential example of an enzyme that fits this pattern. In vivo PFK is regulated by several modulators that operate mainly through effects on enzyme-substrate affinity rather than through changes in maximum reaction velocity. Substrate and product concentrations would be expected to change a lot during large scale allosteric activation of PFK, because comparable in vitro catalytic rates require the enzyme to be approaching saturation with its substrates (see (21)). In liver and other tissues, where the difference between rest and maximally activated metabolism is modest, an accepted and well known model used to explain stable concentrations of adenylates (and other intermediates) at varying ATP turnover rates assumes coordinate control by of both ATP supply and ATP demand pathways (see ref (47)). Formally similar to other allosteric regulations, these mechanisms only apply to sensitive steps, which represent a small fraction of all the enzyme catalyzed reactions in ATP demand and supply pathways. Another problem is that for muscle and heart, these mediated mechanisms seem inadequate to account for the large rate changes observed and the same may apply for the kidney which can sustain a very high metabolic scope between ischemic, low flow states and maximally activated, high flow states (21).
A third category of enzymes are those that
are regulated by phosphorylation-dephosphorylation or other covalent modifications; when coupled with signal amplification (43), large changes at
these specific loci in metabolism can be achieved with modest change in substrate/product concentrations. Here again these processes directly apply to but a modest subset of enzymes in the complex web of pathways that
contribute to ATP turnover during cell work. In cases involving covalent modification, the ratio of catalytically active to inactive enzyme is the main parameter being modulated; this is why change in reaction rate can occur with
minimal change in substrate concentrations. Some time ago, we generalized this concept and reasoned (18,22,29) that the simplest model to account for widespread metabolite homeostasis assumes regulation of the concentrations of catalytically active enzymes in pathways of both ATP demand and ATP supply ( regulation). This kind of regulation would achieve changes in ATP turnover rates proportional to the of the enzymes involved with no required change in substrates or products. From currently available information, it is clear that such regulation could be achieved by proteinprotein based ‘on-off’ switching between active and in active forms of enzymes, as in actomyosin ATPase (5,29), by redox-based ‘on-off’ switching, as in V-type ATPases (17) or by translocation from an inactive to an active intracellular location, as in glucose transporters (50). 317
In summary, to account for metabolite homeostasis in varying metabolic states with simultaneous integration oflinked sequences of enzyme function, several regulatory models are currently being evaluated by scientists in this research area (2-4,13,29,45,64). These include: (i) simple feedback and mass action controls (for so called equilibrium enzymes), (ii) allosteric controls (for regulatory enzymes such as PFK),
(iii)
(iv)
models involving the regulation of (the concentration of functional catalytic sites by means of alteration in protein interactions, by change in phosphorylation state, by change in redox state, or by translocation from inactive to an active intracellular location), and additionally, various versions of metabolic control analysis originally introduced over a decade ago (see (42)).
When considered case by case, these studies are variably successful in explaining metabolite homeostasis during changes in work rate (some, like metabolic control analysis, are empirical mathematical models that do not directly address the issue of mechanisms of metabolite homeostasis and in fact only recognized this as an issue after our papers began to appear in the literature (64)). Yet inspite of some admitted success of these earlier analyses, for models assuming key regulatory roles for pathway intermediates, the striking homeostasis of most metabolites consistently presents a thorny problem that has not really been acceptably explained: namely, the % change in [putative regulatory intermediate] is always less than the % change in flux required to match the change in ATP turnover rate. Phrased in terms more familiar to biochemists, the kinetic order is usually less than 1, too low for change in [s] to be 'driving' the observed flux or metabolic rate changes. Assuming that this is observed (and applies) for all categories of enzymes discussed above, it would be a statistical miracle to observe similar [s] stability for all them. Yet a cursory count (18,21) shows that the % changes in
concentrations of substrates and intermediates (in glucose, fat, and amino acid metabolic pathways) quantified to date are far less than the % changes in flux rates with which they correlate. The only metabolite that seems to be an exception is oxygen. Even molecular oxygen turns out not to be a real exception, but to appreciate its role in metabolic regulation we need to focus on the way this metabolite is managed during different activity and metabolic states. Oxygen Delivery and Metabolic Regulation
There is a large literature on both as a substrate and as a potential regulator of tissue metabolism over varying times of exposure (19,23,27), which need 318
not be reviewed in depth at this time. Suffice to remind the reader that over and over again numerous studies have found essentially 1:1 relationships between delivery and muscle work, in some cases somewhat influenced by changes in extraction. Our own recent studies using a dog gastrocnemius preparation (2,31) supply a case in point. In these studies, we found a 1:1 relationship between delivery and work over an 18 fold change in ATP
turnover rate. Later, Hogan et al (33) used the same preparation to analyze subtle submaximal work changes; these transitions were sustained with immeasurable change in [PCr], [Pi] and [ATP], and therefore the concentrations of other metabolites in participating metabolic pathways presumably were also stable, as in other systems (5,11,12,19). Nevertheless, throughout these transitions a 1:1 relationship between change in work and change in delivery was maintained. Because these kinds of data are qualitatively similar to those found in many other systems and settings, we and many others in the field accept that plays a key role in regulating change in ATP turnover (19). But how is the signal transduced within the cell? How Oxygen Signal Transduction Occurs in Working Muscle is not
Understood Rather to our disappointment, the answer to this question is actually unknown and the only mechanisms proposed by traditional analyses in this area assume the Krogh cylinder and calculate smooth diffusion gradients within the cell ending in mitochondrial sinks. To date this approach has been less than satisfactory for, to resolve the problem of how delivery translates into effects on metabolism within the cell, we require hard data on intracellular concentration., and this is where we confront a huge conundrum: for most tissues this key parameter remains unknown (and in some cases possibly remains unknowable, given our current technologies). The problem in muscles is probably resolvable, however. In this tissue, myoglobin (Mb) supplies a direct intracellular detector of At 37°C, solubility in physiological solutions is about 1 uM/torr. Because the reaction is always in equilibrium (36), with a P50 of 3 torr ( of about 3 uM), measures of % directly estimate intracellular . Earlier studies trying to achieve such measurements with working muscle preparations almost exclusively relied upon near infrared spectroscopy (for example, see ref. (15,65)). More recently, MRS is being used to take advantage of a histidine H being 1H MRS 'visible' in deoxyMb but being MRS 'invisible' in oxyMb. Now, for the first time, this new technology delivers to workers in the field a noninvasive window on the oxygenation state of Mb-containing muscles in different work and metabolic states. When directed towards working human skeletal muscles (49,52,65,) and to heart (39) the same intriguing picture emerges: essentially stable through large changes in work rate. 319
Considered together with gold labeling studies showing a random Mb distribution in rat heart and skeletal muscles (S.Shinn and P.W.Hochachka, unpublished data), these MRS provocative new data indicate that %Mb02 and intracellular both remain relatively constant up to the maximum sustainable aerobic metabolic rate of the tissue (39,52). As CPK serves to 'buffer' ATP concentrations during changes in muscle work so Mb serves to 'buffer' intracellular oxygen concentrations in different metabolic states. To be sure, the regions of interest in these kinds of MRS studies are large and the MRS data necessarily are averages of large numbers of fibers. Muscles in humans like in other mammals are formed from mixtures of fiber types and as work intensity rises for a given muscle mass, there may be changes in recruitment and in the % contribution of different fiber types (1). Richardson et al (52) seem to have avoided this artifact, while this problem does not arise in studies of heart muscle, which is biochemically more homogenous (39). Recent data on an unknown mix of fibers in human gastrocnemius showed a linear decrease in [PCr] as work increased; at maximum work, [PCr] changed by maximally about 3 fold (49). Since the same [PCr] change occurs when gastrocnemius work rate reaches only 40% of sustained aerobic maximum, but much smaller changes in [PCr] occur in (the mainly slow fibers of) soleus during the same work transition(l), we consider it likely that the regions of interest in the Mole et al (49) study may have overlapped into muscles rich in slow twitch fibers, where the change in [PCr] is less for a given level of work than in fast twtich fibers (1). Otherwise it would be difficult to understand why their preparation had to be pushed to its maximum work level to achieve the same [phosphagen] shifts as we observed at only 40% of aerobic maximum (1). For these reasons, the % values recorded at different work intensities almost certainly represent different combinations of fiber types. Nevertheless, these studies (49) reported that at about 50% and 80% of sustained aerobic maximum work rate (representing huge ATP turnover rates, equivalent to did not change significantly, in agreement with earlier studies (52), while at the maximum work rate, a further modest desaturation to about 50% occurred, which is not in full agreement with the data of Richardson et al (52). Because of the mixed fiber problem, we are not surprised by these modestly different results; and, at least tentatively we consider that the small discrepancies in different studies probably arise from artifacts caused by differing metabolic states in different fiber types. Thus they do not strongly influence our main conclusion. In fact, even if most workers probably would accept that Mb should function to buffer intracellular th e significance of this has not been fully appreciated. As Carl Honig put it to the author in a discussion in 1987, this may be because of a too enthusiastic acceptance of traditional diffusion models assuming smooth gradients across the capillarymuscle cell threshold all the way to the mitochondrial sinks (49). In contrast, 320
Honig and his coworkers (10,14,35) argue that the structure of the capillarymuscle system develops steep gradients (and localized high fluxes) only at the capillary-muscle interface but very shallow gradients within the muscle cell per se, as indeed found by the above later MRS data on in vivo. That is why even in our earlier review (24) we accepted the MRS data on at face value and emphasized that, under normoxic conditions, is close to perfectly homeostatic in the sense that its concentration is stable (in the range) even while its flux to cytochrome oxidase can change by 2 or more orders of magnitude. To overview the situation, the picture emerging from these new studies of and metabolic regulation can be summarized as follows: First, because of the buffering role of Mb, concentrations are low (in the P50 or range of about ) and intracellular [oxygen] gradients must be quite shallow. The latter point is more fully discussed by the Rochester group (14,35); one of the most important insights emphasized by these researchers is that the capillarymuscle contact surface area is only a fraction of the surface area of inner mitochondrial membranes and cristae; at steady state of course the same net transfers are occurring at both sites. That is why the highest gradients and highest fluxes must be at the smaller contact zones (i.e., at capillary-muscle cell interfaces) and why gradients are necessarily much shallower in the cytosol. Secondly, the low intracellular is powerfully 'buffered' by Mb and remains essentially stable throughout large changes in work and metabolic
rates. For these reasons, at least tentatively, we conclude that the [s] stability paradox (constant [s] when flux and hence enzyme-substrate encounter and
catalysis rates are increasing) applies to as well as to other metabolites. Nevertheless, consumption and delivery are closely related, suggesting a key role for oxygen in metabolic regulation. Since it is oxygen delivery – not intracellular – which correlates with work rate, we are still faced with the problem of how the signal is transmitted to the machinery of cell metabolism. For the time being, we admit that there is no widely accepted answer. When we first recognized this puzzling situation, we proposed a model which required an sensing system presumably located in the cell membrane (or even more distally) and signal transduction pathways or mechanisms for 'telling' the cell metabolic machinery when and how potently to respond to changing availability of oxygen (18). However, the nature and even existence of such sensing and signal transducing systems remain to be elucidated. In any event, this and all of the other above (Model I) attempts to explain the [s] stability paradox are based on diffusion control of change in enzyme-substrate encounter rates. Model II approaches on the other hand question this assumption and take an entirely different tack: these analyses hypothesize that intracellular circulation, not 321
diffusion, is the main means for bringing ligands and their binding sites together. Model II and the Role of Intracellular Circulation in Accounting for the [s] Stability Paradox
In conceptual terms, the chief difference between the above traditional approach to metabolic regulation and Model II is the emphasis placed upon intracellular order and structure. The starting point for the latter view is that the cell is not a bag of enzymes; instead, it assumes that many, and probably most, metabolic systems operate within an ordered milieu and that there are important functional consequences that follow as a result. This is not an appropriate time for a detailed review of the evidence for this position. Briefly, this conceptual framwork arises from a variety of approaches and the overall hypothesis is constructed from several different lines of evidence favoring intracellular perfusion and of evidence not favoring diffusion as the main means for changing the rates at which enzymes and their substrates are brought together. Perhaps most fundamental is the structural argument: well over a half century of ultrastructural, histochemical, and cytochemical studies do not indicate the cell to be a static bag of enzymes, but rather a 3D membrane bound microworld housing an internal milieu filled with complex organelles, motors, membranes, cables, trabecullae, and channels. Instead of a static, dead-still solution (as would be required for formal application of laws of diffusion (75)), the intracellular milieu seems very much ‘alive’ in the sense that movement is the rule of thumb, movement of particles, of membranes, of organelles, and of cytosol. Cytoplasmic streaming in large cells occurs at rates from less than 1 to about 80 urn per sec (41,54). The process is physiologically regulated (62), it varies with cell activity and metabolic states (41), and it is based on myosin motors (so called unconventional myosin isoforms (48)) which can be activated to run on actin filaments (36,48). The macromolecular system that causes cytoplasmic streaming, for all practical purposes, behaves like an intracellular circulation system. What is more, because of the conservative nature of macromolecular structures and functions, here are good reasons for thinking that this, and comparable systems based on kinesin and dynein motors running on microtubules, are widespread and probably characteristic of all cells (36). Yet this is not all. In contrast to what might be expected of a bag of enzymes, over a half-century of research has clearly concluded that many metabolic pathways and their component enzymes are restricted to specific cell compartments and numerous so called soluble enzymes (the case for aldolase is made in ref (71)) show intracellular binding to specific intracellular sites (68,69).
Macromolecular order, macromolecular structure, and intracellul circulation thus are the key players in the game, as far as the literature on cell 322
ultrastructure is concerned, and it is not a diffusion-dominated game. Model II frameworks assume that without intracellular order the system behavior falls apart; sometimes function is lost completely. An interesting example of this comes from genetic studies of Drosophila flight muscle metabolism. While earlier studies had shown that aldolase, glyceraldehyde-3-phosphate dehydrogenase, and alpha-glycerophosphate dehydrogenase colocalize mainly at Z-discs, Wojtas et al (76) used clever genetic manipulations (that influenced binding but not overall catalytic activities) to show that mislocating these enzyme activities in the cytosol rather than correctly bound to Z-discs would render Drosophila flightless. For researchers working in the Model II framework, this represents a compelling demonstration that enzyme substrate encounter by simple diffusion mechanisms is inadequate to maintain function even if the requisite enzymes are expressed at high activities; their 3D organization is fundamental to in vivo regulated function of the pathway.
A second line of analysis and of argument focuses attention on macromolecular diffusional constraints. As we might well expect from the above, the intracellular mobilities of enzymes and of carrier proteins such as Mb are not equivalent to those in simple aqueous solutions. Mb serves as an interesting case in point. Recent intracellular diffusibility estimates for Mb in the cytosol are found to be as low as those found in simple solutions (40), to values that are only ½ those expected for Mb in simple solutions. (70). However, it is important to note that the latter MRS study estimated rotational diffusion, while Juergens et al (40) estimated translational diffusion and these may change independently (41). Additionally, and as already mentioned, many so-called soluble cytosolic enzymes also apparently are highly restricted in their intracellular mobility (40) – again this picture is not easily compatible with the concept of the cell as a bag of easily diffusible enzymes. Order and structure seem to be constraining the intracellular behavior of macromolecules and their restricted intracellular mobilities would not facilitate the kind of enzyme-substrate encounters required for simple solution models of cell function. On the other hand, an intracellular perfusion system could easily circumvent these kinds of limitations on bringing enzymes and substrates together. A third line of analysis and of argument focuses attention on metabolite mobility: given the enormous complexity of the internal milieu, we may well expect that the translational mobility even of simple molecules may be restricted compared to simple solutions (41), and this is especially true in the mitochondrial matrix (55). A recent study dissected different contributions to limiting mobility of intracellular metabolites. Compared to water, hindrance to translational diffusion in cytoplasm could be attributed to three independent factors - viscosity, binding, and interference from cell solids. 323
First, the fluid-phase cytoplasmic viscosity in the fibroblasts used in the study was nearly 30% greater than water; second, nonspecific, transient binding of small solutes (like the fluorescent probe used in the study) by intracellular components of low mobility decreased metabolite mobility by about 20%; and third, translational diffusion of small solutes was hindered 2.5 fold by collisions with cell solids compromising about 15% of isosmotic cell volume. Taken together, these three factors could fully account for the translational
diffusion in cytosol being decreased to only 27% that observed in water (41). Equally interesting was the observation that these mobility estimates varied with cell activity and metabolic states. In particular, these studies also demonstrated that during osmotic stress (cell volume increasing to 2 times isosmotic volume), the relative translational diffusion coefficient increased by about 6 fold while the rotational diffusion constant remained constant. Similar insights arise from recent studies of the phosphagen system in vertebrate muscles. As already mentioned above, there are two fundamental assumptions underlying traditional dogma on CPK function in phosphagen containing cells: (i) CPK always operates near equilibrium, and (ii) CPK has access to, and
reacts with, the total pool (tCr) of PCr and Cr. We tested the latter assumption in fish fast twitch muscle by introducing 14C-Cr into the muscle pool in vivo (25). Current theory would predict that at steady state following 14C-Cr administration, the specific activities of PCr and Cr should be the same under essentially all conditions. In contrast, we found that the specific activity of PCr greatly exceeded that of Cr in various metabolic states between rest and recovery from exercise. The data imply that a significant fraction of Cr is not free to rapidly exchange with exogenously added 14C-Cr; releasing of this unlabelled or 'missing' Cr upon acid extraction accounts for lowered specific activities. In a follow up study described above, 1H Magnetic MRS was used to further evaluate the in vivo behavior of (the methyl triplet of) tCr in human gastrocnemius muscle. We found (16,66) that the of tCr decreases on transition from rest to ischemic fatigue. Since Cr forms the bulk of tCr in ischemic fatigue, its MRS behavior (especially the reduced molecular mobility implied by the reduced values) is consistent with the earlier 14C results and may explain the mystery of ‘missing’ creatine in the 14C study. The key point is that just as in the Kao et al fibroblast study (41), the solution behavior of metabolite sized molecules such as PCr and Cr seem to be a function of the metabolic state of the tissue – high molecular mobilities correlating with high metabolic rates (and with high intracellular circulation rates?). In all of these kinds of studies, order and structure seem to dominate the intracellular behavior of micomolecules such as metabolite intermediates, and serious constraints on diffusion would again not readily facilitate largescale increases or decreases in enzyme-substrate encounters as required for simple solution models of cells functioning in widely varying activity and 324
metabolic states. Again these limitations could be easily circumvented with intracellular circulation systems. Starting with two key provisos arising from the above analysis – first, that enzymes are structurally localized and not free to readily diffuse about, and second, that substrates are also relatively restricted compared to simple solutions, workers in this area (20,74,75) consider diffusion by itself to be an inadequate, inefficient, and minimally regulatable means of delivering carbon substrates and oxygen to appropriate enzyme targets in the cell under the variable conditions and rates that are required in vivo. Instead, an intracellular circulation or convection system is proposed as an elegantly simply resolution of the question of how substrates and enzymes are brought together under varying metabolic conditions. The chief evidence for this concept is indirect and comes from studies showing cytoplasmic steaming at velocities far exceeding those to be reasonably expected from diffusion alone, especially in the absence of steep gradients. We already mentioned above that such intracellular movements are known to be regulated and to be based upon two kinds of molecular motors: myosin motors travelling on actin filaments and kinesin or dynein motors travelling on tubulin tracks (46,57). Even organelles such as mitochondria display metabolically – regulated movement in cells. Actins and tubulins can both be used as tracks for moving mitochondria, but questions of where and how such motors interact with (and are localized on) the outer mitochondria!
membrane are still to be resolved (34,44). With the exception of a few recent analyses (20,74,75), the metabolic implications of such intracellular convection systems have been completely overlooked (or ignored). Nevertheless, the idea of intracellular convection as a means for increasing enzyme-substrate encounter rates with increasing tissue work is rather compelling. Not only is the rate of cytoplasmic streaming variable (over at least a 60 fold or more range (51,54) as would be required in vivo), in several cell systems (8,77) we now have evidence for a direct relationship between cell work and cytoplasmic streaming rates. In similar studies of a plant cell model, a linear relationship exists between the myosin motor velocity and the force against which it must operate (8). Thus we already have reasons for anticipating that changes in intracellular convection correlate with changes in cell metabolic rate, although more studies along these lines clearly are still
needed.
From the point of view of the current paper, the fundamental advantage of this model is that it easily explains how enzymes and substrates can be brought together and how reaction rates can occur at widely varying rates with minimal change in substrate concentrations; i.e., a regulated intracellular circulation sysem easily explains the [s] stability paradox of pathway 325
substrates and intermediates, including
Just as in the perfusion of tissues, such as muscle mentioned above, the rate of intracellular metabolism by this model is a product of intracellular perfusion rate: the greater the intracellular perfusion rate the greater the metabolic rate with no concomitant change in substrate concentrations required. This is a coarse and time honored control principle long appreciated in physiology as the Fick principle. Finally, we should mention that the occurrence of this system need not rule out other control mechanisms, the kinds that have so far absorbed much of metabolic research; it merely puts them into a different physiological context.
Interestingly, for transport, this view places Mb function into a different perspective as well, where the basic function of an intracellular Mb may be to equalize everywhere in the cytosol. In terms of cell metabolism, this would assure that intracellular convection would always be delivering similar amounts of per unit volume of cytosol to cytochrome oxidases. In this view, the ‘buffering’ function of Mb, the function of a half saturated, randomly distributed Mb, is to assure a similar everywhere in the cytosol (and simultaneously to minimize or even destroy intracellular gradients). While this model is consistent with the minimal intracellular gradients in muscle cells proposed by the Honig, Connett, and Gayeski work, it takes on a quite a different meaning. Finally, it seems to us that an intracellular
perfusion system supplies purpose and meaning to intracellular movements (motor driven or otherwise induced cytoplasmic streaming) which to this point in time have been pretty well ignored by traditional studies of metabolism, tissue work, and regulation.
To biologists with a structural bias, diffusion is considered a limited solution
to limited problems. Earlier (18) we pointed out that, in the up regulation of metabolic capacities of skeletal and cardiac muscles (for example in organisms such as hummingbirds and insects (26,59-61)), the higher the fluxes required, the less and less dependent upon diffusion muscle metabolic organization seems to become. To the present time, physiologists have generally agreed that organisms get around diffusion limitation problems of transport by relying on convection systems: ventilation at the lungs and circulation to the tissues, interspersed with diffusion-based steps along the way. Our concept of intracellular convection modifies our overall view to include an intracellular component to the chain of convective and diffusive steps in the overall path of from air to mitochondria (56,63,73).
When evaluating the concept of intracellular convection, early pioneers in this field may be prone to over-enthusiastic pressing of their case; perhaps this is understandable, since the concept seems to explain so much previously puzzling data so easily (74,75). Nevertheless, it is obvious that many critical 326
functions remain that are largely or solely diffusion based, so the
understandable over-enthusiasm with which Model II proponents minimize the
importance of diffusion in energy metabolism puts them at risk of throwing the
baby out with the bathwater. If the end game is the assembly ofa model which can realistically explain a realistic working range of metabolic systems, then
what seems to be required for the future is an opening up of channels of
communication between the above two very differing views of metabolic regulation. Overview Acute responses to increases in cell work (to increases in ATP demand) always require the activation of ATP supply pathways. Cell homeostasis requirements would also require that these transitions occur with minimal perturbation of metabolite concentrations, while most metabolic regulation models seemingly predict major changes in concentrations of pathway intermediates. In system after system analyzed, it is observed that the demands of cell homeostasis
prevail; i.e. that during transition from low to high work rates, the
concentrations of most substrates in ATP demand and ATP supply pathways are remarkably stable. In this paper, we term this the [s] stability paradox. Researchers have tried to resolve this paradox while working within two
guiding theoretical frameworks. The first, Model I, assumes that the cell is similar to a watery bag of enzymes. Several Model I explanations have been
advanced to explain the apparent homeostasis of pathway metabolites during small and large scale changes in pathway fluxes. While successful to variable degree, different mechanisms have to be postulated to account for different kinds of enzymes and thus different mechanisms have to be postulated for specific loci in metabolic pathways. Thus we consider that on balance it is unlikely that the all of these different mechanisms would summate to similar [s]
stabilities observed for
metabolites at different loci in different metabolic
pathways. That is why within Model I approaches we consider that the [s] paradox remains unresolved. The main hallmark of Model II approaches to metabolic regulation is the recognition of cell structure as an inherent part of cell function. Many of these studies place especial emphasis on the fact that the intracellular milieu is not a still watery solution in which bulk transfer of metabolites occurs mainly by diffusion; instead, it is a 3D structured system in which transport of materials is dominated by intracellular circulation or convection systems. Current evidence suggests that cytoplasmic streaming (at impressively high maximum rates) is controlled by means of controlling molecular motors on actin filaments or on microtubules. The current analysis of the metabolic implications of an intracellular circulation system leads to the concept of intracellular convection 327
as an added and critical means for regulating rates of enzyme substrate encounter. Changing enzyme substrate encounter rates with changing perfusion rates easily explains changes in pathway fluxes with minimal changes in substrate concentrations. Intracellular perfusion as a coarse mechanism for accelerating reaction rates would work equally well at all steps in complex metabolic pathways, no matter what the catalytic and regulatory properties of enzymes might be at these loci in metabolism. As a matter of fact, the ease with which the Model II (intracellular convection) model explains the [s] paradox is one of its most appealing features.
Finally, we should remind the reader that developments in the above two research approaches have been progressing for the last 3-4 decades along rather independent trajectories, with minimal communication between the two fields (though the analysis by Brooks and Storey (7) can be viewed as an appreciation of both approaches). This usual lack of dialogue between the two research approaches is odd when it is pointed out that some of us sometimes work within the Model I paradigm while at other times we work within Model II frameworks. Interestingly, we include ourselves in this schizophrenic situation; for example, the study by Alien et al (1) illustrates Model I approaches while Hochachka and Mossey (25) clearly illustrate a Model II bias. Since both paradigms cannot be right, we consider that it may be time to treat the schizophrenia in these two fields, a process that for certain will require opening up communication channels between them. The present paper is part of our ongoing attempts to facilitate this process.
References 1. Alien, P.S., Matheson, G.O., Zhu, G., Gheorgiu, D , Dunlop, R.S., Falconer, T., Stanley, C. and Hochachka, P.W. (1997) Simultaneous 3 1 P magnetic resource spectroscopy of the soleus and gastrocnemius in sherpas during graded calf muscle exercise and recovery. Amer. J. Physiol.., 273, R999-R1007. 2. Arthur, P.G., M.C. Hogan, P.D. Wagner, and P.W. Hochachka (1992) Modelling the effects of hypoxia on ATP turnover in exercising muscle. J. Appl. Physiol. 73, 737-760.
3. Atkinson, D.E. (1977) Cellular energy metabolism and its regulation. Academic Press, New York. 4. Atkinson, D.E. (1990) Control of Metabolic Processes (Ed. CornishBowden, A. an M.L. Cardenas), Plenum Press, N.Y., pp. 11-27. 328
5. Balban, R.S. (1990) Regulation of oxidative phosphorylation in the mammalian cell. Am. J. Physiol. 258, C377-C389.
6. Betts, D.F. and D.K. Srivastava (1991) The rationalization of high enzyme concentrations in metabolic pathways such as glycolysis. J. Theoret. Biol. 151, 155-167. 7. Brooks, S.P. and Storey, K.B. (1991) Where is the glycolytic complex? A cricial evaluation of the present data from muscle tissue. FEBS Lett. 278, 135-138. 8. Chaen, S., J. Inoue, and H. Sugi (1995) The force-velocity relationship of the ATP-dependent actin-myosin sliding causing cytoplasmic streaming in algal cells studied using a centrifuge microscope. J. Exp. Biol. 198, 10211027. 9. Conley KE. Kushmerick MJ. Jubrias SA. (1998) Glycolysis is independent of oxygenation state in stimulated human skeletal muscle in vivo. J. Physiol. 511, 935-945. 10. Connett, R.J. and C.R. Honig, (1989) Regulation of VO2max. Do current biochemical hypothesis fit in vivo data? Am. J. Physiol. 256, R898-R906. 11. Dobson, G.P. and P. W. Hochachka (1987) Role of glycolysis in adenylate depletion and repletion during work and recovery in teleost white muscle. J. exp. Biol. 129, 125-140.
12. Dobson, G.P., W.S. Parkhouse, J.M. Weber, E. Stuttard, J. Harman, D.H. Snow, and P.W. Hochachka (1988) Metabolic changes in skeletal muscle and blood in greyhounds during 800 m track sprint. Am. J. Physiol. 255, R513-R519. 13. From, A.H.L., S.D. Zimmer, S.P. Michurski, P. Mohanakrishnan, V.K. Ulstad, W.J. Thomas, and K. Ugurbil (1990) Regulation of oxidative phosphorylation in the intact cell. Biochemistry 29, 3733-3743.
14. Gayeski, T.E.J. and C.R. Honig (1986) O2 gradients from sarcolemma to cell interior in red muscle at maximal V02. Am. J. Physiol. 251, 789-H799. 15. Guyton G.P.,K.S.Stanek, R.C.Schneider, P.W.Hochachka,W.E.Hurford, D.G.Zapol, G.C.Liggins, and W.M.Zapol (1996) Myoglobin saturation in free-diving Weddell seals. J. Appl. Physiol. 79, 1148-1155. 329
16. Harkema SJ. Meyer RA. (1997) Effect of acidosis on control of respiration in skeletal muscle. Am. J. Physiol.. 272, C491-C500. 17. Hanstock, C.C., R.B.Thompson, M.E.Trump, D.Gheorghiu, P.W.Hochachka, and P.S.Allen (1999) The residual dipolar couopling of the Cr/PCr methyl resonance in resting human medial gastrocnemius muscle. Magn. Res. Med., in press. 18. Harvey, W.R. and Wieczoreck, H. (1997) Animal plasma membrane energization by chemiosmotic V ATPase control. J. Exp. Biol. 200: 203-216. 19. Hochachka, P. W. (1994) Muscles and Molecular and Metabolic Machines. CRC Press, Boca Raton, FL pp 1-157. 20. Hochachka, P.W. (1998) Oxygen - a key regulatory metabolite in metabolic defense against hypoxia. Amer. Zoologist 37, 595-603. 21. Hochachka, P.W. (1999) Two research paths for probing the roles of oxygen in metabolic regulation. Br. J. Med. Biol. Res. 12, 166-176.
22. Hochachka, P.W. and G.N. Somero (1984) Princeton University Press, Biochemical Adaptation., pp. 1-521. 23. Hochachka, P.W. and G.O.Matheson (1992) Regulation of ATP turnover over broad dynamic muscle work ranges. J. Appl. Physiol. 73, 570. 24. Hochachka, P.W. and M. Guppy (1987) Metabolic arrest and the control of biological time. Cambridge, Mass.: Harvard University Press, pp. 1-237. 25. Hochachka, P.W. and McClelland, G.B.(1997) Cellular metabolic homeostasis during large scale change in ATP turnover rates in muscles. J. Exp. Biol. 200, 381-386. 26. Hochachka, P.W. and Mossey, M.K.P. (1998) Does muscle creatine phosphokinase have access to the total pool of phosphocreatine creatine. Amer. J. Physiol., 274, R868-R872. 27. Hochachka, P.W., B. Emmett and R.K. Suarez (1988) Limits and constraints in the scaling of oxidative and glycolytic enzymes in homeotherms. Can. J. Zool. 66, 1128-1138.
330
28. Hochachka, P.W., Buck, L.T., Doll, C.J., and Land, S.C. Unifying theory of hypoxia tolerance: Molecular/metabolic defense and rescue mechanisms for surviving oxygen lack (1996) Proc. Natl. Acad. Sci. 93, 9493-9498. 29. Hochachka, P.W., Clark, C.M., Holden, J.E.,Stanley, C., Ugurbil, K., and Menon, R.S. (1996). 31P Magnetic Resonance Spectroscopy of the Sherpa heart: A PCr/ATP signature of metabolic defense against hypobaric hypoxia. Proc. Natl. Acad. Sci., U.S.A. 93: 1215-1220. 30. Hochachka, P.W., M. Bianconcini, W.S. Parkhouse, and G.P. Dobson (1991) Role of actomyosin ATPase in metabolic regulation during intense
exercise. Proc. Natl. Acad. Sci. USA, 88, 5764-5768.
31. Hochachka, P.W., McClelland G.B., Burness, G.P., JF.Staples, and R.K.Suarez (1998) Integrating metabolic pathway fluxes with gene-toenzyme expression rates. Comp. Biochem. Physiol. B 120, 17-26. 32. Hogan, M.C., P.G. Arthur, D.E. Bebout, P.W. Hochachka, and P.D. Wagner (1992) The role of O2 in regulating tissue respiration in dog muscle working in situ. J. Appl. Physiol. 73, 728. 33. Hogan, M.C., Richardson, R.S., and Haseler, L.J. (1999) Human muscle performance and PCr hydrolysis with varied inspired oxygen fractions: a 31P MRS study. J. Appl. Physiol. 86, 1367-1373.
34. Hogan, M.C., S.S.Kurdak and P.G.Arthur (1996) Effect of gradual
reduction in 02 delivery on intracellular homeostasis in contracting skeletal muscle. J. Appl. Physiol. 80, 1313-1321.
35. Hollenbeck, P.J. (1996) The pattern and mechanism of mitochondrial transport in axons. Frontiers in Bioscience 1: d91-d102. 36. Honig, C.R., Connett, R.J., and Gayeski, T.E. (1992) 02 transport and its
interaction with metabolism, a systems view of aerobic capacity. Med. & Sci. Sports & Exer. 24, 47-53. 37. Howard, J. (1998) Molelcular motors: structural adaptations to cellular functions. Nature 391: 239-240.
38. Ingwall JS. Creatine kinase knockout mice--what is the phenotype: heart (1998) Magma. 6, 120-121. 39. in't Zandt HJ. Wieringa B. Heerschap A. (1998) Creatine kinase knockout mice--what is the phenotype: skeletal muscle. Magma. 6, 122-123. 331
40. Jelicks, L.A. and B.A.Wittenberg (1995) 1H NMR studies of sarcoplasmic oxygenation in the red cell perfused rat heart. Biophys. J. 68, 2129-2136.
41. Juergens, K.D., Peters, T., and Gros, G. (1994) Diffusivity of myoglobin in intact. Proc. Natl. Acad. Sci. USA 91, 3829-3833. 42. Kao H.P., Abney, J.R., and Verkman A.S. (1993) Determinants of the translational mobility of a small solute in cell cytoplasm. Journal of Cell Biology 120, 175-184. 43. Kashiwaya, Y., K. Sato, N. Tshuchiya, S. Thomas, D.A.Fell, R.L.Veech, and J. V.Passonneau. Control of glucose utilization in working perfused rat heart. J. Biol. Chem. 269, 25502-25514; 1994.
44. Koshland, D.E. (1998) The era of pathway quantification. Science 280, 353-353. 45. Krendel, M., Sgourdas, G., Bonder, E.M. (1998) Disassembly of actin filaments leads to increased rate and frequency of mitochondrial movements along microtubules. Cell Motility & the Cytoskeleton 40: 368378.
46. Kreis R., Jung, B., Slotboom, J., Felblinger, J., and Boesch, C. (1999) Effect of exercise on the creatine resonances in 1H MR spectra of human skeletal muscle. J. Magn. Resonance 137, 350-357 47. Kushmerick, M.J., R.A. Meyer, and T.R. Brown (1992) Regulation of oxygen consumption in fast- and slow-twitch muscle. Am. J. Physiol. 263, C598-C606.
48. Langford, G.M. (1995) Actin- and microtubule-dependent organelle motors: interrelationships between the two motility systems. Current Opinion in Cell Biology 7, 82-88. 49. McCormack, J.G. and Denton, R.M. (1990) The role of transport and matrix Ca in signal transduction in mammalian tissues. Biochim. Biophys. Acta. 1018, 287-291.
50. Mermall, V., Post, P.L. and Mooseker, M.S. (1998) Unconventional myosins in cell movement, membrane traffic, and signal transduction. Science 279: 527-533.
332
51. Mole, P.A., Chung, Y., Tran, K., Sailasuta, N., Hurd, R, and Jue, T.
(1999) Myoglobin desaturation with exercise intensity in human gastrocnemius muscle. Am. J. Physiol. 277: R173-R180.
52. Norris, A.J., Martin, S.S., Harita, T., Nelson, J.G., Vollenweider, P., Gustafson, T.A., Mueckler, M., Rose, D.W., and Olefsky, J.M. (1996) Evidence for an insulin substrate 1 independent insulin signaling pathway that mediates insulin responsive glucose transporter (GLUT4) translocation. Proc. Natl. Acad. Sci. USA 93: 8401-8406. 53. Reid, R.J. and N. A.Walker (1983) Adenylate concentrations in Chara: variability, effects of inhibitors, and relationship to protoplasmic streaming. Australian J. Plant Physiol. 10: 373-383. 54. Richardson, R.S., E.A.Noyszewski, K.F.Kendrick, J.S.Leigh, and P.D.Wagner (1996) Myoglobin 02 desaturation during exercise. Evidence of limited 02 transport. J. Clin. Invest. 96, 1916-1926.
55. Rowan, A.N. and E.A. Newsholme, (1979) Changes in the contents of adenine nucleotides and intermediates of glycolysis and the citric acid cycle in flight muscle of the locust upon flight and the relationship to the control of the cycle. Biochem. J. 178, 209-216. 56. Ryan, P.R. and N.A.Walker (1994) The regulation of ammonia uptake in
Chara australis. J. Exp. Botany 45: 1057-167.
57. Scalettar, B.A., Abney, J.R., and Hackenbrock, C.R. (1991) Dynamics, structure, and function are coupled in the mitochondrial matrix. Proc. Natl. Acad. Sci. USA 88, 8057-8061. 58. Schmidt-Nielsen, K. (1979) Scaling: Why is Animal Size So Important. Cambridge Univ. Press, Cambridge, UK p 1-241. 59. Simon, V.R. and L.A. Pon (1996) Actin-based organelle movement. Experientia 52, 1117-1122. 60. Staples, J.F. and R.K.Suarez (1997) Honeybee flight muscle phosphoglucoseisomerase: matching enzyme capacities to flux requirements at a near-equilibrium reaction. J. Exp. Biol. 200,1247-1254. 61. Suarez RK. Lighten JR. Joos B. Roberts SP. Harrison JF (1996) Energy metabolism, enzymatic flux capacities, and metabolic flux rates in flying honeybees . Proc. Natl. Acad. Sci. USA 93(22): 12616-20, 1996 333
62. Suarez RK. Staples JF. Lighton JR. West TG.(1997) Relationships
between enzymatic flux capacities and metabolic flux rates: nonequilibrium reactions in muscle glycolysis. Proc.Natl. Acad. Sci. USA 94,7065-7069. 63. Suarez, R.K. (1992) Hummingbird flight: sustaining the highest massspecific metabolic rates among vertebrates. Experientia 48, 565-570.
64. Takagi, S. (1997) Photoregulation of cytoplasmic streaming: cell biological dissection of signal transduction pathway. J. Plant Res. 110: 299-303. 65. Taylor, C.R., E.R.Weibel, J-M.Weber, R.Vock, J.Hoppeler, T.J.Roberts, and G.Brichon. Design of the oxygen and substrate pathways. I. Model and strategy to test symmorphosis in a network structure. J. Exp. Biol. 199, 1643-1649; 1996. 66. Thomas, S. And Fell, D.A. (1998) A control analysis exploration of the role of ATP utilization in glycolytic-flux control and glycolytic-metabolite concentration regulation. European J. Biochemistry 258, 956-967. 67. Tran, T-K., Sailasuta, N., Kreutzer, U., Hurd, R., Chung, Y., Mole, P., Kuno, S., and Jue, T. (1999) Comparative analysis of NMR and NIRS measurements of intracellular P02 in human skeletal muscle. Am. J. Physiol. 276: R1682-R1690.
68. Trump,
M.E.,
P.S.Allen,
D.Gheorghiu,
C.C.Hanstock,
and
P.W.Hochachka. 1H-MRS evaluation of the phosphocreatine-creatine
(PCr/Cr) pool in human muscle. Proc. Intl. Soc. Magn. Res. Med. p 1337, 1997. 69. Van Dorsten FA. Nederhoff MG. Nicolay K. Van Echteld CJ (1998) 31P NMR studies of creatine kinase flux in M-creatine kinase-deficient mouse heart. American Journal of Physiology. 275, H1191-H1199. 70. Walliman, T. Dolder, M., Schlattner, U., Eder, M., Hornemann, T., O’Gorman E., Ruck, A. and Brdiczka D. (1998) Some new aspects of
creatine kinase (CK): compartmentation, structure, function, and regulation for cellular mitochondrial bioenergetics and physiology. BioFactors 8,229234.
71. Wallimann, T., M. Wyss, D. Brdiczka, K. Nicolay, and H.M. Eppenberger (1992) Intracellular compartmentation, structure, and function of creatine
kinase isozymes in tissues with high and fluctuating energy demands: the
'phosphocreatine circuit' for cellular energy homeostasis. Biochem. J. 281, 21-40. 334
72. Wang, D., Kruetzer, U., Chung, Y., and Jue, T. (1997) Myoglobin and hemoglobin rotational diffusion in the cell. Biophys. J. 73, 2764-2770. 73. Wang, J., Tolan, D.R., and Pagliaro, L. (1997) Metabolic compartmentation in living cells: structural association of aldolase. Exptl. Cell Res. 237, 445-451.
74. Wegener, G., N.M. Bolas, and A.A.G.Thomas (1991) Locust flight metabolism studied in vivo with 31P NMR spectroscopy. J. Comp. Physiol. B. 161, 247-256.
75. Weibel, E.R., C.R.Taylor, and H.Hoppeler. The concept of symmorphosis: A testable hypothesis of structure-function relationships. Proc. Natl. Acad. Sci. USA 88, 10357-10361; 1991. 76. Wheatley D.N. and Clegg, J.S. (1994) What determines the metabolic rate of vertebrate cells. Biosystems 32, 83-92. 77. Wheatley, D.N. (1998) Diffusion theory, the cell, and the synapse. Biosystems 45, 151-163.
78. Wojtas, K., N. Slepecky, L. von-Kalm and D. Sullivan. Flight muscle function in Drosophila requires colocalization of glycolytic enzymes.
Molecular Biology of the Cell. 8: 1665-1675, 1997 79. Yamaya, M., T. Fukushima, K. Sekizawa, T. Ohrui, and H. Sasaki (1995) Cytoplasmic motility reflects phagocytic activity in alveolar macrophages from dog lungs. Resp. Physiol. 101, 199-205.
335
This page intentionally left blank.
EVIDENCE THAT NITRIC OXIDE PLAYS A ROLE IN SENSING FROM TISSUE NO AND MEASUREMENTS IN CAT CAROTID BODY 1,2
Donald G. Buerk and 1Sukhamay Lahiri Departments of 1Physiology and 2Bioengineering, University of Pennsylvania School of Medicine, Philadelphia, PA Key words: calcium channels, carotid body, cellular respiration, chemosensor, cytochrome c oxidase, hypoxia, Michaelis-Menten kinetics, microelectrodes, neural activity, nitric oxide, nitric oxide synthase, oxygen, oxygen consumption, tissue
1.
INTRODUCTION
There is increasing evidence that nitric oxide (NO) plays a role as an sensor through several different mechanisms. It is now well known that NO activates soluble guanylate cyclase and increases the second messenger cyclic GMP which mediates the potent vasodilatory effect of NO on vascular smooth muscle. NO also interacts with the O2-binding heme site of cytochrome c oxidase and reversibly inhibits mitochondrial respiration (Brown and Cooper, 1994, Cleeter et
al., 1994, Schweizer and Richter, 1994). Shen et al. (1995) have shown that NO inhibits consumption in strips of skeletal muscle, and in hind limbs of conscious dogs. In the in vivo study, intravenous infusion of a NOS inhibitor (nitro-L-arginine) caused a 55% increase in hind limb consumption, while NO donor drugs inhibited consumption. Boveris et al. (1999) have shown that the inhibition of mitochondrial respiration by NO depends on , with increasing inhibition as the ratio decreases. When the ratio is , NO has essentially no effect on respiration. A similar effect on NO inhibited respiration and ATP synthesis was reported for cultured cancer cells by Nishikawa et al. (1996). At relatively low concentrations ( ,or , they found that NO in the range inhibited respiration for longer time periods, caused greater increases in cytosolic , and greater decreases in cellular ATP levels than found with higher concentrations. Clementi et al. (1999) have shown that NO generated by cultured endothelial cells modulates cellular respiration in response to acute changes in They demonstrated that the consumption rate increased after inhibiting NO synthase (NOS) and became much less dependent on .The for half of the initial rate of consumption for cultured endothelial cells was relatively high , or ~ 7 Torr), but decreased below after inhibiting NO production. The effects of NO on respiration depended on the influx of calcium.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
337
Clementi et al. (1999) estimated that basal NO levels in the 20 to 65 nM range could be sufficient for the decrease in endothelial cell respiration under the control conditions of their study. The consumption rate for the carotid body has been found to be very dependent on concentration. Buerk et al. (1989a, 1989b) reported values in the 20 to 30 Torr range from in vivo measurements in normal blood perfused cat carotid bodies, much higher than in vivo values (~ 3 Torr) that we measured in gerbil brain tissue (Nair et al., 1987, Buerk and Nair, 1993). The dependent respiration of the carotid body and the intriguing observations from cultured endothelial cells by Clementi et al. (1999) suggest the possibility that NO could act as an sensor in the carotid body (or in other sensing tissues) by regulating cellular respiration in addition to regulating vasculartone and blood flow Lahiri and Buerk (1998) have presented preliminary evidence in support ofthis hypothesis. Although tissue NO levels in the carotid body have not been directly measured, other indirect physiological measurements have convincingly implicated NO in carotid body chemotransduction. It is clear from histological studies that the necessary enzymes (neuronal and endothelial NOS) are present and can influence blood vessels and glomus cells (Prabhakar et al., 1993, Wang et al., 1993, Hohler et al., 1994, Grimes et al., 1995). Wang et al. (1994) found that L-arginine (the required precursor for NO production) and an NO donor (nitroglycerin) inhibited
chemosensory responses to hypoxia in superfused cat carotid bodies, and elevated
cGMP in glomus cells and vascular smooth muscle. A NOS inhibitor (L-NAME) augmented hypoxic responses, which could be reversed with L-arginine. In our laboratory, Chugh et al. (1994) found similar chemosensory excitation with LNAME in perfused cat cat carotid bodies, which could be eliminated with the NO donor sodium nitroprusside (SNP). Both studies suggest that endogenous NO plays an inhibitory role in hypoxic chemoreception by the carotid body, although it is not possible to distinguish between the relative contributions of vascular or metabolic effects in either study. NO might also influence chemotransduction through other mechanisms, such as binding to heme or sulfhydryl sites in ion channels. There is
recent evidence that NO inhibits L-type calcium channels in isolated rabbit glomus cells, independent of changes in cGMP (Summers et al., 1999). In the present study, we investigated the role of NO in the carotid body by measuring tissue with recessed microelectrodes in isolated, perfused cat carotid bodies before and after inhibiting NOS. We compared disappearance measurements following brief flow interruption to quantify changes in consumption after inhibiting NO production, or with increased tissue NO levels using donor drugs. We also examined whether there were any differences in the relationship between neural discharge and tissue during the development of hypoxia with flow interruption for different NO levels. In a few studies, we also measured tissue NO using a polymer coated recessed microsensor (Buerk et al., 1996). The results of this study are consistent with the hypothesis that NO plays a role as an sensor in the carotid body.
2.
METHODS After cats were anesthetized with sodium pentobarbital (35 mg/kg, i.p.), the
338
carotid bifurcation was exposed and isolated by ligating and cutting the external carotid, internal carotid, occipital and ascending pharyngeal arteries, and the ganglioglomerular nerves, as described previously (Buerk et al., 1994). The carotid sinus nerve was cut at its junction with the glossopharyngeal nerve. The carotid body was removed and mounted in a temperature regulated (37 °C) perfusion chamber. Control perfusate was modified Tyrode's solution containing (in mM) ; sodium glutamate 22; glucose 5; buffer 21.4; HEPES buffer 5; and dextran 5 g/L; equilibrated with 20% and 5% (pH 7.40, osmotic pressure 320 mOsm). Neural discharge (ND) was measured from the whole carotid sinus nerve, passing the signal through a 60 Hz notch filter, amplitude discriminator and spike counter. Recessed gold microelectrodes (Whalen et al., 1967) polarized at -0.7 V were used to measure tissue . consumption was determined from the O2 disappearance rate (dPO2/dt) by briefly interrupting flow and measuring neural discharge until zero was reached. After control flow interruption measurements were made, carotid bodies were perfused with Tyrode's containing LNAME, followed by a higher dose of . disappearance measurements after L-NAME were compared to control measurements. Similar flow interruption measurements were made during perfusion with SNP and compared to controls. concentration dependent cellular respiration was characterized by a single oxidase Michaelis-Menten kinteic model
where
is the maximum
consumption rate and
is the Michaelis-Menten
constant for the concentration (or partial pressure) at half of the maximum rate. It
should be recognized that is not the same as , and that as a general rule since the initial disappearance rate is measured at a level below saturation. Tissue NO levels were measured in three experiments, using recessed gold microelectrodes coated with Nafion polymer (DuPont) membranes. NO microsensors were polarized at +0.85 V to measure NO by electrochemical oxidation. Calibration details are described by Buerk et al. (1996). Tissue NO and neural discharge were monitored continuously during perfusion with L-NAME or with SNP. Experimental signals were digitized by computer (either 2 Hz or 5 Hz sampling rates, 12 bit resolution) for subsequent data analysis. Statistical comparisons were based on equally weighted averages, using a paired t-test to compare values before and after L-NAME or SNP.
3.
RESULTS
Tissue NO measurements in a perfused cat carotid body are shown in Fig. 1, for increasing concentrations of L-NAME. Initial tissue NO was ~ 350 nM prior to L-NAME, represented by the upper dashed lines in the bottom panels, with an initial baseline ND ~ 40 impulses per sec, represented by dashed lines in the top panels. There was a significant decrease in tissue NO, to about two-thirds of the initial level after perfusing with L-NAME for 10 min, with little change in the chemosensory activity (left panels). After switching to L-NAME at , tissue NO decreased below 100 nM by min and ND increased to 339
~ 160 impulses per-sec (middle panels). After this time period, the carotid body was briefly perfused with SNP, which increased tisssue NO by 40 to 50 nM and restored ND to baseline levels (data not shown). At (right panels), the carotid body was perfused with L-NAME and tissue NO decreased to undetectable levels. Chemosensory activity was at the maximum ND rate at this time, but the high ND rate could not be sustained and ND began falling. After 1 hour, the carotid body was unable to increase ND during flow interruption, and the experiment was terminated. Tissue NO was also measured in another cat carotid body, and in one rat carotid body. Similar decreases in tissue NO were observed after inhibiting NOS, which required at least 30 minutes to fully deplete NO. Changes in tissue and consumption following NOS inhibition were measured in 10 cat carotid bodies. Ten consecutive flow interruption measurements from one experiment are shown in Fig. 2. The initial baseline ND was ~ 40 impulses per sec (top panel, lower dashed line) and tissue was ~118 Torr (lower panel, upper dashed line) prior to L-NAME. Each time the flow was stopped, tissue fell to zero within 30 to 40 sec and chemosensory activity increased to the maximum ND rate. After restoring flow, both tissue and ND returned quickly back to steady levels After perfusing with L-NAME (at there was a transient increase in tissue which then decreased to ~ 87 Torr after 10 min with little change in baseline ND or maximum ND during flow interruption. After perfusing with L-NAME at tissue continued to decline and baseline ND began to rise. After the ND rose to ~ 225 impulses per sec as tissue fell to ~ 28 Torr. The maximum ND reached during flow interruption was essentially the same for all ten measurements. 340
341
The first and last flow interruption measurements from the sequence in Fig. 2 are shown in greater detail in Fig. 3. For the control measurement prior to LNAME (solid circles), ND rose to the maximum ND rate within ~ 20 sec as tissue fell to near zero. The initial disappearance rate was
(dashed line, lower panel). The disappearance curve clearly departs from the initial rate as tissue decreases below 60 Torr. The slope of the control curve was half of the initial rate when tissue fell to ~ 29 Torr (open square). After LN AME (open circles), the tissue was lower and reached zero within 10 sec after interrupting flow. The initial ND was also higher and reached the maximum ND more quickly than the control measurement. The characteristics of the
last
disappearance curve after L-NAME were more difficult to characterize since
the tissue was much lower than the control measurement. By examining the relationship between ND and tissue during flow interruption (inset of Fig. 3), a leftward shift from the control (solid circles) can be seen after inhibiting NO production (open circles). This figure illustrates that the carotid body was less sensitive to after L-NAME. For the control response, ND increased to half of the maximum ND when the tissue was 35 Torr, and at a lower tissue (22 Torr) after L-NAME (dashed lines in inset). Average results from tissue and consumption measurements from 10 perfused cat carotid body experiments are summarized in Table 1, with statistical comparisons (paired t-test) Control measurements were compared to the last LN AME measurement in each experiment. The data are also illustrated in Fig. 4, with the single oxidase fit through each data set. The estimated Michaelis-Menten parameters are listed in Table 1 for each curve fit.
342
343
(inset of Fig. 4) was shifted to the right, illustrating that the carotid body was more
sensitive to with SNP. The shifted kinetics of the disappearance rate (higher , lower was consistently seen in 4 carotid body experiments with SNP. In carotid bodies where SNP was administered after L-NAME, there was an increase in tissue and a decrease in ND, consistent with vasodilation and greater flow through the preparation.
4.
DISCUSSION Our studies are consistent with the hypothesis that NO plays a role as an
sensor in the carotid body. We demonstrated that the increase in neural activity with excitation after inhibiting NO synthase with L-NAME seen previously (Prabhakar et al., 1993, Chugh et al., 1994, Wang et al., 1994, 1995) is due to more hypoxic
conditions in the carotid body, and the increase in tissue with NO donors can account for the decrease in neural activity. The mean fall in tissue after NOS inhibition was 50% below the control level in our study. This decrease is in part due to an increase in consumption, although the exact contribution is difficult to determine due to the strongly respiration of the carotid body. We found changes in both (an overall decrease) and (a lower value), which increased consumption above control. This is illustrated in Fig. 4, where the single oxidase curve is shifted to the left of the control curve. After L-NAME, the
initial rate of consumption was 7.1% higher than the control rate at the same tissue (37.4 Torr). This suggests that there was an overall reduction in perfusate flow by approximately 43% after inhibiting NOS. Therefore, vasoconstriction appears to account for most of the drop in tissue . Based on this analysis, we conclude that the vascular effect of NO is more dominant than the metabolic effect in the perfused cat carotid body. From our single oxidase analysis of the disappearance curves before and after L-NAME, we did see a consistent leftward shift in the concentration dependent consumption for individual experiments. However, we found an overall lower after L-NAME instead of an increase as reported in other studies (Boveris et al., 1999, Clementi et al., 1999, Nishikawa et al., 1996, Shen et al., 1995). We found that the maximum consumption rate was 18% lower, and the Michaelis-Menten constant was 52% of control after LNAME. There was considerable variation in values in different carotid body experiments as well as difficulties in analyzing curves that started at lower tissue levels. It is possible that after L-NAME could have been underestimated. Perhaps a better evaluation of might have been made by increasing in the perfusate after L-NAME, to compensate for the reduction in flow. If in fact, was lower, then one possible explanation is that this reflects a reduction in used by NOS to produce NO. Although the decrease in requires further investigation, our experimental results are consistent with an
sensor role of NO.
In further support of this concept, we found that the NO donor (SNP) consistently caused changes in the opposite direction (decreased , increased and enhanced sensitivity). This result is also consistent with the hypothesis that NO
acts as an sensor. The fact that there were opposite changes in sensitivity (ie., the relationship between ND and tissue for both L-NAME and SNP may reflect a third mechanism, through direct effects of NO on ion channels. This 344
potential mechanism needs further investigation, using agents to modify specific ion
channels before varying tissue NO levels. Basal tissue NO levels in the perfused cat carotid body could be high enough to account for the unusually high for normal cat carotid body consumption, but further experiments are needed to confirm whether this level is typical. In vivo studies are also needed to determine what normal endogenous NO levels are when hemoglobin is present. Tissue NO values in the hemoglobin-free perfused carotid bodies might be much higher than in vivo tissue NO levels. Our NO microsensor measurements show that it takes some time for complete inhibition of NOS activity and for tissue NO levels to reach zero after perfusing with L-NAME. Therefore, it is likely that tissue NO levels were not at minimum levels for many of the disappearance measurements, especially during perfusion with the lower LNAME concentration. To fully interpret our experimental data, we would need to know what the tissue NO level was prior to each disappearance measurement. We did observe time-dependent changes in kinetics (progressive decrease in ) after beginning perfusion with L-NAME, which probably reflects the slow decrease in tissue NO. The interaction between NO and is further complicated by the finding that NO production from isolated NOS enzymes is also dependent on . Purified neuronal NOS is reported by Abu-Soud et al. (1996) to have an extremely high for ~ (~ 280 Torr). It may be relevant that, in an earlier in vivo microelectrode study of chronically denerated cat carotid bodies, Buerk et al. (1989b) found an increase in consumption and lower than measured for normal innervated controls. The effect was greater in carotid bodies studied 3 days after denervation than in carotid bodies studied 2 days after denervation. It is reasonable to assume that neuronal sources of NO production were progressively eliminated in the denervated carotid body as the neurons degenerated. The resulting
decrease in tissue NO could account for the increase in consumption and shift in kinetics (lower ) compared to the innervated carotid body with normal endogenous NO levels.
If nNOS has the same strong properties in vivo, acute hypoxia might cause a decrease in NO production. However, the activity of constitutive NOS isoforms depends on levels. Clementi et al. (1999) speculate that acute hypoxia could increase tissue NO due to increased influx as cells depolarize. Chronic hypoxia has been found to decrease NOS activity in the rat carotid body (Prabhakar et al., 1993). If NO production is reduced with low then there
might be relatively less inhibition of respiration, which would tend to counteract the NO-mediated respiratory control system proposed by Clementi et al. (1999). Interactions with hemoglobin further complicate this issue. Stamler et al. (1997)
report evidence that NO or a related vasoactive species reversibly bound to hemoglobin can be released from red blood cells when tissue
levels are low.
Kosaka and Seiyama (1996) report that NO can shift the oxyhemoglobin curve to the right, which could improve delivery to tissues. The effect of NO on carotid body respiration needs to be more fully characterized, and more complete models that include NO metabolism need to be developed. While the single oxidase model may not be the best kinetic model to analyze disappearance data from the carotid body, the model may be suitable if an empirical relationship for the effects of NO on and can be found. 345
Previously, we proposed metabolic models for the carotid body using more than one oxidase (Nair et al., 1986, Buerk et al., 1989a, 1989b). It is possible that the of nNOS could be incorporated using a two oxidase model, although its contribution to the overall utilization of might be very small. Another reaction, the auto-oxidation of NO by , would also need to be included, although this term might also be neglible compared to the oxidative metabolism component. This modeling approach may be unnecessary if the effects of NO can be included in a simpler single oxidase model. It is clear that tissue NO levels are needed to fully interpret our data. Ideally, both tissue NO and should be measured along with chemosensory responses to hypoxia and other chemostimulants. This information would be vital to developing a better understanding of the role of NO as an sensor in the carotid body. In summary, endogenous tissue NO concentrations in the intact carotid body can influence sensing through at least three mechanisms: (1) regulation of vascular tone, blood flow and delivery, (2) inhibition of consumption, and (3) inhibition of L-type channels and possibly other ion channels that control influx and neurotransmitter release. All three of these mechanisms are consistent our experimental observations, and suggest that NO has an important role in
sensing by the carotid body. Further studies are needed to establish what the endogenous tissue NO levels are in vivo under normal conditions, and how changes in tissue NO levels can modulate chemosensory responses to hypoxia and other stimuli.
ACKNOWLEDGEMENTS This research was supported by HL 43413 from NIH.
REFERENCES Abu-Soud, H.M., Rousseau, D.L., and Stuehr, D.J., 1996, Nitric oxide binding to the heme of neuronal nitric-oxide synthase links its activity to changes in oxygen tension. J.
Biol. Chem. 271: 32515-32518. Boveris, A., Costa, L.E., Cadenas, E., and Poderoso, J.J., 1999, Regulation of mitochondrial respiration by adenosine diphosphate, oxygen, and nitric oxide. Meth. Enzymol. 301: 188-198. Brown, G.C., and Cooper, C.E., 1994, Nanomolar concentrations of nitric oxide reversibly
inhibit synaptosomal respiration by competing with oxygen at cytochrome oxidase. FEBS Lett. 356: 295-298.
Buerk, D.G., Itturiaga, R., and Lahiri, S., 1994, Testing the metabolic hypothesis of
chemoreception in the cat carotid body in vitro. J. Appl. Physiol. 76: 1317-1323.
Buerk, D.G., and Nair, P., 1993, and changes in cortex and hippocampus of aging gerbil brain. J. Appl. Physiol. 74: 1723-1728. Buerk, D.G., Nair, P.K., and Whalen, W.J., 1989a, Two-cytochrome model for carotid body
and chemosensitivity changes after hemorrhage. J. Appl. Physiol. 67: 60-66. Buerk, D.G., Nair, P.K., and Whalen, W.J., 1989b, Evidence for second metabolic pathway for from measurements in denervated cat carotid body. J. Appl. Physiol. 67: 1578-1584.
Buerk, D.G., Riva, C.E., and Cranstoun, S.D., 1996, Nitric oxide has a vasodilatory role in
cat optic nerve head during flicker stimuli. Microvas. Res. 52: 13-26.
346
Chugh, D.K., Katayama, M., Mokashi, A., Bebout, D.E., Ray, D.K., and Lahiri, S., 1994, Nitric oxide-related inhibition of carotid chemosensory nerve activity in the cat. Resp. Physiol. 97: 147-156. Cleeter, M.J.W., Cooper, J.M., Darley-Usmar, V.M., Moncada, S., and Schapira, A.H., 1994, Reversible inhibition of cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain, by nitric oxide. FEBS Lett. 345: 50-54. Clementi, E., Brown, G.C., Foxwell, N., and Moncada, S., 1999, On the mechanism by which vascular endothelial cells regulate their oxygen consumption. Proc. Natl. Acad. Sci. 96: 1559-1562. Grimes, P.A., Mokashi, A., Stone, R., and Lahiri, S., 1995, Nitric oxide synthase in autonomic innervation of the cat carotid body. J. Autonom. Nerv. Sys. 54: 80-86. Hohler, B., Mayer, B., and Kummer, W., 1994, Nitric oxide synthase in the rat carotid body and carotid sinus. Cell & Tissue Res. 276: 559-564. Kosaka, H., and Seiyama, A., 1996, Physiological role of nitric oxide as an enhancer of
oxygen transfer from erythrocytes to tissues. Biochem. Biophys. Res. Commun. 218: 749-752. Lahiri, S., and Buerk, D.G., 1998, Vascular and metabolic effects of nitric oxide synthase inhibition evaluated by tissue measurements in carotid body. In: Oxygen Transport to Tissue XX(A.G. Hudetz and D.F. Bruley, eds.), Plenum Press, N.Y., pp. 455-460. Nair, P.K., Buerk, D.G., and Whalen, W.J., 1986, Cat carotid body oxygen metabolism and chemoreception described by a two cytochrome model. Am. J. Physiol. 250: H202-
H207.
Nair, P.K., Buerk, D.G., and Halsey, J.H. Jr., 1987, Comparisons of oxygen metabolism and
tissue in cortex and hippocampus of gerbil brain. Stroke 18: 616-622. Prabhakar, N.R., Kumar, G.K., Chang, C.H., Agani, F.H., and Haxhiu, M.A., 1993, Nitric oxide in the sensory function of the carotid body. Brain Res. 625: 16-22. Schweizer, M., and Richter, C., 1994, Nitric oxide potently and reversibly deenergizes
mitochondria at low oxygen tension. Biochem. Biophys. Res. Commun. 204: 169175.
Shen, W., Hintze, T.H., and Wolin, M.S., 1995, Nitric oxide: An important signaling mechanism between vascular endothelium and parenchymal cells in the regulation of oxygen consumption. Circulation 92: 3505-3512. Stamler, J.S., Jia, L., Eu, J.P., McMahon, T.J., Demchenko, I.T., Bonaventura, J., Genert, K. and Piantadosi, C.A., 1997, Blood flow regulation by S-nitrosohemoglobin in the physiological oxygen gradient. Science 276: 2034-2037. Summers, B.A., Overholt, J.L., and Prabhakar, N.R., 1999, Nitric oxide inhibits L-type
current in glomus cells of the rabbit carotid body via a cGMP-independent mechanism. J. Neurophysiol. 81: 1449-1457.
Wang, Z-Z., Bredt, D.S., Snyder, S.J., Fidone, S.J., and Stensaas, L.J., 1993, Neurons synthesizing nitric oxide innervate the mammalian carotid body. J. Comp. Neurol. 336: 419-432.
Wang, Z-Z., Stensaas, L.J., Bredt, D.S., Dinger, B., and Fidone, S.J., 1994, Localization and actions of nitric oxide in the cat carotid body. Neurosci. 60: 275-286. Wang, Z-Z., Stensaas, L.J., Bredt, D.S., Dinger, B., and Fidone, S.J., 1995, Nitric oxide mediates chemoreceptor inhibition in the cat carotid body. Neurosci. 65: 217-229. Whalen, W.J., Riley, J., and Nair, P., 1967, A microelectrode for measuring intracellular . J. Appl. Physiol. 23: 798-801.
347
This page intentionally left blank.
CAROTID BODY GAP JUNCTIONS: SECRETION OF TRANSMITTERS AND POSSIBLE ELECTRIC COUPLING BETWEEN GLOMUS CELLS AND NERVE TERMINALS
C. Eyzaguirre Department of Physiology, University of Utah School of Medicine, Research Park, Salt Lake City, UT 84108
1.
ABSTRACT
It is proposed that intercellular coupling between glomus cells and carotid nerve terminals form an integral part of the chemoreceptor process. Coupling is possible because gap junctions occur between these elements. At rest, most glomus cells would be coupled. Stimuli uncouple (or reduce coupling) most glomus cells that extrude their contents toward the nerve terminals. However, other glomus cells do not secrete but recharge and intercellular coupling increases. These phenomena would allow for sustained chemoreceptor activity during prolonged stimulation. Coupling between glomus and sustentacular cells may explain why the behavior of glomus cells in the intact carotid body and when clustered in cultures (when their sustentacular envelope is preserved) is different from that of isolated cells where sustentacular cells are destroyed. The presence of electric synapses between glomus cells and nerve terminals may explain the poor performance of synaptic blockers on natural (hypoxia, hypercapnia, acidity) carotid body stimulation.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
349
2.
INTRODUCTION
Many animal cells are connected (coupled) by gap junctions that allow intercellular flow of ions and small molecules. This is possible because the junctions are cribriform possessing multiple pores surrounded by proteins (connexins) forming intercellular channels. These channels open (more permeant) or close (less permeant) depending on the physiological conditions of the cells at rest and during stimulation. Intercellular channel opening or closing is produced by twisting of the connexins surrounding the pore. Many neurons in the CNS of vertebrates, endocrine and exocrine glands follow this pattern, as well as type I and, possibly, type II cells in the carotid body. Secretion elicited by a specific stimulus is accompanied by changes in intercellular coupling that may increase or decrease, depending on the type of cell or its physiological conditions (for references, see Bennett & Spray, 1985). Glomus (type I) cells are secreting elements emptying their contents toward the carotid nerve terminals and surrounding vasculature. Secretion increases during stimulation and this phenomenon is accompanied by changes in intercellular coupling, which decreases (uncoupling) in most (70-80%) instances. However, it is important that 20-30% of the cells become more tightly coupled (Monti-Bloch et al., 1993; Abudara & Eyzaguirre, 1998). It is hypothesized that uncoupled cells are secreting while the others are recharging, both groups working as a push-pull pump. In this fashion, the carotid body is capable of prolonged secretory activity because its cells alternate between the release and accumulation of materials probably used as transmitters or modulators (Eyzaguirre & Abudara, 1995,1996,1999).
3.
RESULTS AND DISCUSSION
In addition to coupling between glomus cells, recent morphological evidence has shown gap junctions between type II (sustentacular) cells and between type I and type II cells (Abudara et al., 1999). This suggests exchange of materials between different cellular elements of the carotid body that may influence the overall secretory process. Furthermore, some gap junctions have been found between glomus cells and carotid nerve terminals (Kondo & Iwasa, 1996). If these junctions occur frequently, the poor performance of specific synaptic blockers on natural stimulation (hypoxia, hypercapnia, acidity) could be explained. Figure 1 is a schematic diagram depicting the functional morphology of carotid body glomus cells (GC), sustentacular cells (SC) and nerve terminals
350
351
(NT) through which nerve fibers (NF) innervate glomus cells. The diagram also describes that the carotid body is a polymodal receptor responding to
multiple stimuli (hypoxia, hypercapnia, acidity, temperature, flow and drugs). In addition, glomus cells contain and release multiple transmitters (ACh,
catecholamines - especially dopamine - neuropeptides and other less well
studied substances. What is important in this discussion is that dye and electric coupling between glomus cells, via gap junctions (filled circles), has been described morphologically and physiologically. However, this is not the
full story since gap junctions occur between sustentacular cells and between
glomus and sustentacular cells. Recent morphological studies by Kondo &
Iwasa (1996) have shown gap junctions between glomus cells and carotid nerve terminals (checkered circles). Connexin 43 (CX43) has been identified to occur between glomus cells and between glomus and adjacent (not identified, but presumably sustentacular) cells (Abudara et al., 1999) shown by the checkered circles.
The diagram suggests that glomus cells are communicated with each other, that there is communication between glomus and sustentacular cells, and importantly, there may be communications between glomus cells and carotid nerve terminals.
In all cases, we may have exchange of materials and
currents between the coupled elements. These multiple couplings are probably important in the final result of carotid body stimulation, an increase
in the frequency of carotid nerve discharges (trace above NF) produced by nerve ending (terminal) depolarization (open arrows from NT).
Also,
coupling between glomus cells may explain the variable responses (depolarization or hyperpolarization, lower left traces connected by the open arrows from GC) intracellularly recorded from glomus cells. Coupling between glomus cells. In recent articles, we have proposed that
the variable responses of glomus cells to stimulation (depolarization or hyperpolarization) are an integral part of the mechanisms involved in transmitter secretion by these structures (Eyzaguirre & Abudara, 1995, 1996, 1999). It is generally accepted that a secreting glomus cell undergoes
depolarization during stimulation (Weiss & Donnelly, 1996). We have added the concept that secretion is accompanied by uncoupling (or reduced coupling) of glomus cells as occurs in exocrine organs. We also think that glomus cells cannot extrude all they have when a stimulus is applied because a reserve must be available for sustained activity during prolonged stimulation. [You cannot sell at once all you have in a store and expect to satisfy customers that come in later !] And, it is well known that during intense and prolonged stimulation, the carotid nerve is capable of sustained discharges for a very long time. Thus, cells that are not secreting (hyperpolarized) are recharging
352
for further action and this is accompanied by increased intercellular coupling. Changes in membrane potential of glomus cells are concomitant with changes in coupling but do not cause it. One needs extreme changes in glomus cell membrane potential to affect intercellular coupling and this does not happen (Abudara & Eyzaguirre, 1998; Eyzaguirre & Abudara, 1999). Coupling between glomus and sustentacular cells. Gap junctions between these elements have been described only morphologically (Abudara et al., 1999). These findings are a bit unusual since homologous coupling is the rule in vertebrates whereas heterologous coupling has been described only in coelenterates (Dunlap et al., 1987). Glomus cells originate from the neural crest, thus they were neurons at one time during development. Sustentacular cells seem to belong to the glia or Schwann cell family (Kondo et al., 1982).
In the nervous system, coupling between neurons and glia has not been found (Spray et al., 1999). However, heterologous coupling between glomus and sustentacular cells may play a role in carotid body function. We have
repeatedly found in cultures that the behavior of clustered glomus cells (where the sustentacular envelopes are preserved) is significantly different to that of isolated cells devoid of this envelope. For instance, during hypoxia (1-61 torr) induced by Na-dithionite, intracellular pH clearly decreased in isolated cells whereas this effect was not clear in clustered cells. Similarly, 80% of clustered cells depolarized whereas 60% of isolated cells hyperpolarized (Pang & Eyzaguirre, 1992, 1993). Similar levels of hypoxia did not change significantly the intracellular of intact carotid bodies (Oyama et al., 1986) and of clustered glomus cells whereas decreased considerably in isolated cells (Zhang et al., 1995). These experiments show that there is some form of communication between glomus and sustentacular cells, which could be through the gap junctions recently described. Furthermore, they emphasize the need to study sustentacular cells in detail since they are not a mere envelope but contribute importantly to cell function in the carotid body. This is not surprising since extensive studies on the properties of glia in the CNS have shown how important these cells are in neuronal functions (for references, see Abbott, 1991). However, it must be emphasized that glial cells affect the neurons without being coupled, only across intercellular spaces. Perhaps, the carotid body complex (glomus and sustentacular cells) is closer to what happens in invertebrates where there is coupling between receptor cells and their envelopes (Dunlap et al., 1987). Coupling between glomus cells and carotid nerve terminals. McDonald
(1981) and Verna (1979, 1997) have thoroughly described the chemical junctions between glomus cells and carotid nerve terminals. It is generally agreed that synaptic vesicles (in the presynaptic site in other junctions) occur
353
frequently in the glomus cells although these vesicles have also been described in the nerve terminals. Furthermore, McDonald has shown that these synapses appear polarized from glomus cell to ending, from ending to glomus cell and some are bidirectional. Thus, these junctions are not typically or exclusively centripetal or centrifugal. Because of the finding that synaptic vesicles occur in the nerve terminals Biscoe (1971) proposed that the nerve terminals impinging on glomus cells were from efferent fibers, and that the true sensory nerve terminals were loosely spaced endings in the carotid body tissue described by De Koch (1954). This idea was radically different from De Castro’s (1928) observations who sectioned the carotid nerve, and all nerve endings (stained with methylene blue) in the carotid body disappeared. However, this did not happen when he sectioned the intracranial dorsal roots of the petrosal ganglion. His conclusion was that the commonly observed nerve terminals were sensory. However, De Castro’s findings were later confirmed by Hess & Zapata (1972) and many others, leading to our present acceptance that the nerve terminals impinging on glomus cells are sensory. Furthermore, when the nerves are not in contact with the carotid body, the organ is removed or made non-functional by ischemia, there is no chemoreceptive response to different stimuli (for references see Eyzaguirre
& Zapata, 1982, 1984). These findings have given support to the idea that the primary receptor site in the carotid body is located in the glomus cells who activate the nerve endings by releasing transmitters toward the synaptic clefts, The fly in the ointment is that synaptic blockers are quite ineffective in blocking the released transmitters. Based on the morphological evidence of Kondo & Iwasa (1996) we have recently proposed that there is electric coupling between glomus cells and carotid nerve terminals. For the moment, this concept is entirely speculative since there is no physiological evidence in favor or against it. However, it is a nice way to get around the well known inability of specific synaptic blockers to block the effects of natural stimulation even when these agents are very effective in blocking the discharge induced by applied transmitters. We have assumed that these electric junctions are closed at rest but open during stimulation permitting flow of currents from the glomus cells toward the nerve terminals. Thus, the blockers become ineffective. Naturally, this idea needs experimental verification. First, it is necessary to determine how frequent these junctions are. This could be accomplished by using specific antibodies for different connexins. Second, it is necessary to obtain physiological evidence to establish that electric communications really exist. If this can be established, the hypothesis would be proven. If one cannot find good physiological and morphological evidence about numbers or functionality of
354
electric synapses between these structures there is an alternative explanation for the lack of efficacy of synaptic blockers. It is possible that the primary site for chemoreception would be the nerve endings. The chemicals released by the glomus cells would be modulators, and not transmitters in a strict sense, as proposed by Zapata (1982, 1997). Either one of these alternatives, electric coupling between glomus cells and nerve terminals or direct effect of stimuli on the nerve terminals, would accommodate the problems presented by synaptic blockers. However, there are problems related to a direct role of nerve endings in chemoreception. As shown in Fig. 1, the carotid body chemoreceptors are polymodal responding to many stimuli. Sensory receptors are usually unimodal responding preferentially to one mode of stimulation, mechanical, visual, temperature, flow. etc., This mean that the nerve ending membrane is specifically depolarized only by one of the stimuli. Polymodality is a complex phenomenon since the nerve endings are depolarized by several stimuli. We do not know how this is accomplished in the carotid body, but it has been one reason why many hypotheses of chemoreception have implicated preneural elements. Since the chemoreceptor unit consists of a carotid nerve fiber innervating 10-20 glomus cells (Eyzaguirre & Gallego, 1975), it is difficult to conceive that different agents activate only some endings and not others. Thus, assuming electric coupling between glomus cells and nerve terminals is a simpler, and therefore better, explanation. However, one cannot ignore the trophic properties of glomus cells which
might condition or transform a nerve terminal to become polymodal and respond to many stimuli. Little is known about trophic properties of glomus cells (Eyzaguirre & Zapata, 1982) except that they are capable of converting, however imperfectly, the properties of muscle spindle terminals in the tenuissimus muscle of the cat. In a normal situation, the spindle afferent terminals respond exclusively to mechanical stimulation. However, when the carotid body is transplanted to this muscle, to be innervated by the spindle afferent fibers, the carotid body-spindle afferent preparation also responds to the usual chemoreceptor stimuli such as hypoxia and hypercapnia (MontiBloch et al., 1983). Thus, it is possible (although not proven) that glomus cells may condition the apposed nerve terminals to respond to many, sometimes unrelated, stimuli.
REFERENCES Abbott, NJ. (ed), 1991, Glial-Neuronal Interactions. N.Y. Acad. Sci., vol. 633. Abudara, V., and Eyzaguirre, C., 1998, Modulation of junctional conductance between rat carotid body glomus cells by hypoxia, cAMP and acidity. Brain Res. 792: 114-125.
355
Abudara, V., Garcés, G., and Sáez, J.C., 1999, Cells of the carotid body express connexin43,
which is upregulated by cAMP. Brain Res. (submitted). Alcayage, J., and Eyzaguirre, C., 1990, Electrophysiological evidence for the reconstitution of chemosensory units in co-cultures of carotid body and nodose ganglion neurons. Brain Res. 534: 234-328. Bennett, M.V.L., and Spray, D.C. (eds.), 1985, Gap Junctions. Cold Spring Harbor Laboratory. Biscoe, T.J., 1971, Carotid body: Structure and function. Physiol. Rev. 51: 421-495.
De Castro, F., 1928, Sur la structure et l'innervation du sinus carotidien de l'homme et des mammifères. Nouveaux faits sur l'innervation et la fonction du glomus caroticum. Études anatomiques et physiologiques. Trab. Lab. Invest. Biol. Univ. Madrid 25: 331-380. De Koch, L.L., 1954, The intraglomerular tissue of the carotid body. Acta. Anat. 21: 101-116. Dunlap, K., Takeda, K., and Brehm, P., 1987, Activation of a calcium-dependent photoprotein by chemical signalling through gap junctions. Nature 325: 60-62. Eyzaguirre, C., and Gallego, A., 1975, An examination of de Castro’s original slides. In The Peripheral Arterial Chemoreceptors (M.J. Purves, ed.), Cambridge University Press, pp.
1-23. Eyzaguirre, C., and Zapata, P., 1982, Trophic interactions between sensory nerves and their preneural elements. Arch. Biol. Med. Exper. 15: 219-228. Eyzaguirre, C., and Zapata, P., 1984, Perspectives in carotid body research. J. Appl. Physiol. 57: 931-957.
Eyzaguirre, C., and Abudara, V., 1995, Possible role of coupling between glomus cells in carotid body chemoreception. Biol. Signals 4: 263-270.
Eyzaguirre, C., and Abudara, V., 1996, Reflections on the carotid nerve sensory discharge and coupling between glomus cells. Adv. Exp. Med. Biol. 410: 159-168. Eyzaguirre, C., and Abudara, V., 1999, Carotid body glomus cells: chemical secretion and
transmission (modulation?) across cell-nerve ending junctions. Resp. Physiol. 115: 135149. Hayashida, Y., Koyano, H., and Eyzaguirre, C., 1980, An intracellular study of chemosensory fibers and endings. J. Neurophysiol. 44: 1077-1088. Hess, A., and Zapata, P., 1972, Innervation of the cat carotid body: normal and experimental studies. Fed. Proc. 31: 1365-1382.
Kondo, H., Iwanga, T., and Nakajima, T., 1982, Immunocytochemical study on the localization of neuron-specific enolase and S-100 protein in the carotid body of rats. Cell Tiss. Res. 227: 291-295.
Kondo, H., and Iwasa, H., 1996, Re-examination of the carotid body ultrastructure with special attention to the intercellular membrane apposition. Adv. Exp. Med. Biol. 410: 45-50. McDonald, D.M., 1981, Peripheral chemoreceptors: structure-function relationships of the carotid body. In Lung Biology in Health and Disease. Regulation of Breathing, vol. 17 (T.F. Hornbein and C. Lenfant, eds.), Marcel Decker, New York, pp. 105-319. Monti-Bloch, L., Stensaas, L.J., and Eyzaguirre, C., 1983, Carotid body grafts induce chemosensitivity in muscle nerve fibers of the cat. Brain Res. 270: 77-92. Monti-Bloch, L., Abudara, V., and Eyzaguirre, C., 1993, Electrical communication between glomus cells of the rat carotid body. Brain Res. 622: 119-131. Oyama, Y., Walker, J.W., and Eyzaguirre, C., 1986, Intracellular potassium activity, potassium equilibrium potential and membrane potential of carotid body glomus cells.
Brain Res. 381:405-408. Pang, L., and Eyzaguirre, C., 1992, Different effects of hypoxia on the membrane potential and input resistance of isolated and clustered carotid body glomus cells. Brain Res. 575: 167173. Pang, L., and Eyzaguirre, C., 1993, Hypoxia affects differently the intracellular pH of
clustered and isolated glomus cells of the rat carotid body. Brain Res. 623: 349-355.
356
Spray, D.C., Scemes, E., and Rozenthal, R., 1999, Cell-cell communication via gap junctions. In Fundamental Neuroscience (M.J. Zigmond, F.E. Bloom, S.C. Landis, J.L. Roberts and L.R. Squire, eds.), Academic Press, New York, pp. 117-343. Verna, V., 1979, Ultrastructure of the carotid body in the mammals. Int. Rev. Cytol. 60: 271330. Verna, A., 1997, The mammalian carotid body: Morphological data. In The Carotid Body Chemoreceptors (C. Gonzalez, ed.), Springer-Landes, Austin, TX, pp. 1-29. Weiss, N., and Donnelly, D.F., 1996, Depolarization is a critical event in hypoxia-induced
glomus cell secretion. Adv. Exp. Med. Biol. 410: 181-187. Zapata, P., 1982, Arterial chemoreceptors: searching for transmitter and modulator substances. In Trends in Autonomic Pharmacology, vol. 2 (S. Kalsner, ed.), Urban & Schwartzenberg, Baltimore, pp. 343-361. Zapata, P., 1997, Chemosensory activity in the carotid nerve: Effects of physiological variables. In The Carotid Body Chemoreceptors (C. Gonzalez, ed.), Springer-Landes, Austin, TX, pp. 97-117.
Zhang, X.Q., Pang, L., and Eyzaguirre, C., 1995, Effects of hypoxia on the intracellular of clustered and isolated glomus cells of mice and rats. Brain Res. 676: 413-420. Zhong, H., Zhang, M., and Nurse, C.A., 1997, Synapse formation and hypoxic signalling in co-cultures of rat petrosal neurones and carotid body type I cells. J. Physiol., London 503: 599-612.
357
This page intentionally left blank.
SHORT- AND LONG-TERM REGULATION OF RAT CAROTID BODY GAP JUNCTIONS BY cAMP. IDENTIFICATION OF CONNEXIN43, A GAP JUNCTION SUBUNIT
1 1
Verónica Abudara, 2Carlos Eyzaguirre and 3Juan C. Sáez
Departamento de Fisiologa, Facultad de Medicina, Universidad de la República, Montevideo, Uruguay. 2Department of Physiology, University of Utah School of Medicine, Research Park, Salt Lake City, UT 84108, USA. 3Departamento de Ciencias Fisiológicas, Facultad de Ciencias Biológicas, Pontificia Universidad Católica de Chile, Santiago, Chile
1.
ABSTRACT
Intact and cultured carotid bodies (CBs) of the rat were used in this study. Applications of membrane-permeant db-cAMP to cultured carotid bodies increased electric coupling between most glomus cells (increasing junctional conductance) probably by opening preformed intercellular channels. This a short-term effect of the nucleotide, increasing gating between glomus cells. When cultures and intact carotid bodies were treated with membrane-permeant 8Br-cAMP for 3 h or more (to increase cytosolic cAMP), there was enhanced gap junction formation and better dye spread between carotid body cells. Connexin43 (CX43) was identified by immunocytochemical methods as forming part of the intercellular channels between carotid body cells, and the expression of Cx43 increased by cAMP. This is a long-term effect, inducing the formation of gap junctions. Thus, cAMP had short and long-term effects on the intercellular junctions of the carotid body. Long-term formation of gap junctions may be important in modulating carotid body functions during
stimulation by chronic hypoxia.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri el al.
Kluwer Academic/Plenum Publishers, 2000
359
2.
INTRODUCTION
Electric coupling between glomus cells of the rat carotid body has been shown in the whole and sliced organs, and in cultures by dual current or voltage clamping (Monti-Bloch et al., 1993; Abudara & Eyzaguirre, 1994, 1998). Intercellular communications seemed to occur through gap junctions because coupling was reduced by conditions that block most gap junctions, such as intercellular acidification and elevated intracellular calcium (Monti-Bloch et al., 1993; Abudara & Eyzaguirre, 1994; Abudara, 1996). Moreover, gap junctions between different cell types of the organ have been morphologically identified in electron microscope studies (McDonald, 1981; Kondo & Iwasa, 1996). 2.1
Structural features of gap junctions
Gap Junctions, also called nexus or macula communicans, are membrane specializations containing intercellular channels. Analyses of isolated gap junctions by x-ray and optical diffraction studies have shown that each intercellular channel results from the association of two hemi-channels or connexons. Each connexon is provided by each of the adjacent cells, and is made up of six subunits, termed connexins (Cxs), arranged in hexagonal shape around an axis perpendicular to the plane of the plasma membrane (Makowski et al., 1977, 1988; Unwin & Zampighi, 1980). Cxs are encoded by a gene family and are named according to their molecular weight predicted by their respectively cloned DNA sequence (Beyer et al., 1989). Until the work of Abudara et al., (1999), there was no information about the identity of Cxs in the carotid body, as has been done in other tissues with immunocytochemical techniques, using specific Cx-antibodies (Bennett et al., 1991). 2.2
Functional and regulatory properties of gap junctions
Gap junction channels allow the passage of ions and small molecules (up to 1.2 kDa), such as and cyclic nucleotides (Bennett et al., 1991; Pitts & Simms, 1977). The gap junction conductance is dynamically regulated to continuously adapt to different functional requirements. The regulatory mechanisms of gap junction conductance may act by affecting the functional state of preformed intercellular channels or changing the number of channels in the junction.
360
Stimulation of the rat carotid body by physiological stimuli (hypoxia, hypercapnia and acidity), and by neurotransmitters (dopamine and ACh, released from type I cells) decreased junctional conductance in approximately 70% of the cases whereas conductance increased in 30% of cell pairs (MontiBloch et al., 1993). Coupling changes occurred within minutes suggesting a dependence on gating processes. As to a possible mechanism for these effects several factors should be considered such as increased decreased and/or increased intracellular cAMP. It is well-known that increases in and in intracellular acidity uncouple glomus and other cells. However, we will focus on changes in cAMP in this presentation. Physiological stimuli such as low high and low pH, rapidly increase the cytosolic levels of cAMP in seconds to minutes in vitro (Delpiano & Acker, 1991; Pérez-Garcia et al., 1990; Wang et al., 1991a; Wang et al., 1991b), suggesting short-term involvement of this second messenger in chemoreception. In other tissues, increases in affect gap intercellular communications in the short and long terms. Short-term effects are mediated by gating mechanisms whereas long-term effects are produced by expression of regulatory mechanisms. At either level (short or long term), cAMP enhances or reduces intercellular communications depending on the cell type (Sáez et al., 1993). Thus, our efforts have been focussed on studying short and long-term effects of cAMP on carotid body gap junctions.
3.
RESULTS AND DISCUSSION
3.1
Short-term modulation of gap junctional conductance cAMP rapidly increase in cultures
Using dual voltage clamping in tissue cultures, we measured the junctional conductance (Gj) between carotid body cells and investigated the modulatory effect of cAMP on Gj (Fig. 1). The cultures were exposed to 1 mM dB-cAMP, a membrane-permeant form of cAMP. In most cell pairs, this treatment increased junctional conductance Gj within the first minute in sixteen coupled cells. The experiment illustrated in Fig. 1 shows the time course of Gj changes during an application of dB-cAMP. In this pair, dbcAMP more than doubled the control and the effect peaked in about 35 s, although it was transient. Of all the agents tested until now, cAMP has been the most consistent coupler in the carotid body (Abudara & Eyzaguirre, 1998).
361
362
3.2
Long-Term (3 h) treatment with cAMP increases dyecoupling between cultured cells
To test whether cAMP also induces long-term (hours or days) modulation of gap junction permeability, we treated seven days old carotid body cultures with 1 mM 8Br-cAMP, another membrane permeant derivative of cAMP, for 3 h (Abudara et al., 1999). Permeation across the gap junctions was assessed by microinjecting Lucifer yellow CH into one cell. The incidence of dye-coupling was evaluated as the percentage of cases showing diffusion of dye from the injected cell to at least to one contacting cell. In untreated preparations, the incidence of dye-coupling between carotid body cells was low After 3 h treatments with cAMP, some cells in the cultured monolayer became spherical and developed multiple arborizations radiating from the soma. The rest of the cells remained flat. The spherical cells were identified as glomus (type I) cells by using anti-tyrosine hydroxylase (TH) antibodies, since only these cells were TH positive (Abudara et al., 1999). The remaining flat cells have not been yet identified. Most of them could have been type II cells, although the possible presence of fibroblasts or endothelial cells has not been excluded. After 3 h exposures to 8Br-cAMP, many cells became dye coupled (Fig. 2A) and the incidence of dye-coupling increased significantly (to 73%) in both chemoreceptor and non-chemoreceptor cells. The cAMPinduced increase of intercellular coupling was inhibited by actinomycin D (5
mM), a blocker of mRNA synthesis, applied 15 min before 8Br-cAMP exposure, suggesting that the effect was transcription dependent. Occasionally,
we
observed
heterocoupling
(dye-coupling
between
chemoreceptor and non chemoreceptor cells), which agrees with previous reports showing gap junctions between type I and type II cells in thin section of the carotid body (Kondo & Iwasa, 1996). 3.3
CB cells express Cx43, which is upregulated by cAMP
There have been no reports characterizing the connexins in the carotid body, and this dearth has delayed progress in some aspects of gap junction
behavior in this organ. From the already identified Cxs in vertebrates, Cx43 is widely expressed in several tissues and by different cell types, including sensory neurons (Giblin & Christensen, 1997; Miragall et al., 1992; Miragall
363
et al., 1996; Spray et al., 1999). Accordingly, we decided to explore the presence and the cellular distribution of Cx43 in the rat carotid body (Abudara et al., 1999).
Immunofluorescence in 7 days old control cultures showed a faint staining in the cell bodies of chemoreceptor and non-chemoreceptor cells. After 3 h exposures to 1 mM 8Br-cAMP, punctate labeling appeared in areas of cell-cell contacts in spherical and flat cells, and in the radially directed processes (Fig. 2B). The cellular redistribution of Cx43 immunoreactivity induced by cAMP was prevented by treatment with actinomycin D (15 mM), applied 15 min before 8Br-cAMP. Cx43 was also detected in entire carotid bodies by Western blots in control conditions. Treatment with 8Br-cAMP (1 mM) for 3 h, increased the content and phosphorylation of Cx43, the P2 phosphorylated form being particularly influenced by cAMP.
364
3.4
Possible biological significance of cAMP induced
upregulation of CB gap junctions
Besides electric signals exchanged by gap junction channels, second messengers diffuse through them (Bevans et al., 1998) and promote biological responses in coupled cells (Bennett et al., 1991). In type I cells, cAMP induces cellular and molecular effects after treating carotid body cultures with cAMP permeant derivatives for 1-2 weeks. These effects include hypertrophy (Mills & Nurse, 1993), increases in whole cell capacitance, in channel (Stea et al., 1992, 1995) and tyrosine hydroxylase expressions (Czyzyk-Krzeska et al., 1992; Chen et al., 1995). It has been proposed that such effects underlay cellular adaptation and enhanced chemosensitivity during chronic hypoxia. Whether cAMP also promotes increased intercellular coupling, as an adaptive mechanism to long-term hypoxia, appears as an interesting possibility. Under this condition, gap junction channels would
provide additional pathways for intercellular traffic, favoring metabolic cooperation between glomus cells. The distributed substrates and precursors may be used to promote protein synthesis and cellular changes in less responsive cells. Nevertheless, it must be noted that cAMP actions on intercellular coupling occurred after a 3 h treatment. It remains to be shown if they are also observed after exposure to 8Br-cAMP for 2 weeks. As in other secretory systems, changes in intercellular coupling have been related to transmitter release. During chemoreception, type I cells release transmitters toward afferent terminals resulting in increased chemosensory activity (Fidone et al., 1982; Rigual et al., 1984; Shaw et al., 1990; Jackson & Nurse, 1997). During stimulation by hypoxia, acidity of hypercapnia, most glomus cells uncouple and release excitatory transmitters toward the sensory terminals enhancing the afferent discharge. The opposite is expected to occur during tighter coupling (Eyzaguirre & Abudara, 1995, 1996, 1999). According to our results, stimuli that elevate intracellular cAMP could determine that most coupled cells are available and ready to be uncoupled by an arriving stimulus. Under this condition, the quantities of released transmitters would be greater if the stimulus arrived during basal intracellular cAMP levels. This may be providing a mechanism to increase the gain of the receptors.
4.
SUMMARY AND CONCLUSIONS Intact and cultured carotid bodies of the rat were used.
365
1) Applications of membrane-permeant db-cAMP to cultured carotid bodies increased electric coupling between most glomus cells (increasing junctional conductance) probably by opening preformed intercellular channels. This is a short-term effect of the nucleotide, increasing gating between glomus cells. 2) When cultures and intact carotid bodies were treated with membranepermeant 8Br-cAMP for 3 h or more (to increase cytosolic cAMP), there were enhanced gap junction formation and increased dye spread between carotid body cells.
3) Connexin43 (Cx43) was identified by Western blots and immunocytochemical methods, the latter shows that Cx43 formed part of intercellular channels between carotid body cells. The expression of Cx43 increased by cAMP. This is a long-term effect, inducing the formation of gap junctions. Conditions that promote a sustained (3 h or more) elevation of cytosolic cAMP enhance gap junctional communication between cells of the carotid body , associated with an upregulation of Cx43. 4) Thus, cAMP had short and long-term effects on the intercellular junctions of the carotid body. Long-term formation of gap junctions may be important in modulating carotid body functions during stimulation by chronic hypoxia.
The absence of reports characterizing connexins in the carotid body has partially delayed further progress concerning some aspects of the gap junction's behavior in this organ. From identified vertebrate Cxs, Cx43 is widely expressed in several tissues and by different cell types, including sensory neurons (Giblin and Christensen, 1997; Miragall et al., 1992; Miragall et al., 1996). Accordingly, we decided to explore the presence and the cellular distribution of the protein subunit Cx43 in the rat carotid body (Abudara et al., 1999). Indirect immunofluorescence in 7 day old control cultures showed a faint staining in cell bodies of chemoreceptor and nonchemoreceptor cells. After
3 h exposure to 1 mM 8BrcAMP, punctate labeling appeared at areas of cellcell contacts in both cell types and at radially directed chemoreceptor processes (Fig. 2B). The cellular redistribution of Cx43 immunoreactivity induced by cAMP was prevented by treatment with actinomycin D (15 mM), applied 15 min before 8BrcAMP (not shown). The protein subunit Cx43 was also detected in entire carotid bodies by Western blotting in control conditions. Treatment with 8BrcAMP (1 mM) for
366
3 h, increased the content and state of phosphorylation of Cx43 in whole organs. The P2 phosphorylated form of Cx43 was the most influenced by cAMP. ACKNOWLEDGEMENTS
This work was partially supported by SABRO, PEDECIBA and CSIC fellowships (to V.A.), FONDECYT grant 1990146 (to J.C.S.) and NIH grant NS 07936 (to C.E).
REFERENCES Abudara, V., 1996, Intercellular coupling and modulatory mechanisms in rat carotid body. Ph.D. Thesis, Universidad de la República Oriental del Uruguay. Abudara, V., and Eyzaguirre, C., 1994, Electrical coupling between cultured glomus cells of the rat carotid body: observations with current and voltage clamping. Brain Res. 664: 257265. Abudara, V., and Eyzaguirre, C., 1996, Effects of calcium on the electric coupling of carotid body glomus cells. Brain Res. 725: 125-131. Abudara, V., and Eyzaguirre, C., 1998, Modulation of junctional conductance between rat carotid body glomus cells by hypoxia, cAMP and acidity. Brain Res. 792: 114-125. Abudara, V., Garcés, G., and Sáez, J.C., 1999, Cells of the carotid body express connexin43 which is up-regulated by cAMP. Brain Res. (in press). Bennett, M.V.L., Bargiello, T.A., Barrio, L., Spray, D.C., Hertzberg, E.L., and Sáez, J.C., 1991, Gap junctions: new tools, new answers, new questions. Neuron 6: 305-320. Bevans, C.G., Kordel, M., Rhee, S.K., and Harris, A.L., 1998, Isoform composition of
connexin channels determines selectivity among second messengers and uncharged molecules. J. Biol. Chem. 273: 2808-2816. Beyer, E.C., Kistler, J., Paul, D.C., and Goodenough, D.A., 19879, Antisera directed against connexin43 reacts with a 43kD protein localized to gap junctions in myocardium and other tissues. J. Cell. Biol. 108: 595-605. Chen, J., Dinger, B., and Fidone, S.J., 1995, Second messenger regulation of tyrosine hydroxylase gene expression in rat carotid body. Biol. Signals 4: 277-285. Czyzyk-Krzeska, M.F., Bayliss, D.A., Lawson, E.E., and Millhorn, D.E., 1992, Regulation of tyrosine hydroxylase gene expression in the rat carotid body by hypoxia. J. Neurochem. 58: 1538-1546. Delpiano, M.A., and Acker, H., 1991, Hypoxia increases the cyclic AMP content of the cat carotid body in vitro. J. Neurochem. 57: 291-297.
Eyzaguirre, C., and Abudara, V., 1995, Possible role of coupling between glomus cells in carotid body chemoreception. Biol. Signals 4: 263-270. Eyzaguirre, C., and Abudara, V., 1996, Reflections on the carotid nerve discharge and coupling between glomus cells. Adv. Exp. Med. Biol. 410: 159-168. Eyzaguirre, C., and Abudara, V., 1999, Carotid body glomus cells: chemical secretion and transmission (modulation 7) across cell-nerve ending junctions. Resp. Physiol. 115: 135149. Fidone, S., Gonzalez, C., and Yoshizaki, K., 1982, Effects of low oxygen on the release of dopamine from the rabbit carotid body in vitro. J. Physiol. London 333: 93-110. Giblin, L.J., and Christensen, B.N., 1997, Connexin43 immunoreactivity in the catfish retina. Brain Res. 755: 146-50.
367
Jackson, A., and Nurse, C., 1997, Dopaminergic proeprties of cultured rat carotid body chemoreceptors grown in normoxic and hypoxic environments. J. Neurochem. 69: 645654. Kondo, I.L., and Iwasa, I.L., 1996, Re-examination of the carotid body ultrastructure with special attention to the intercellular membrane apposition. Adv. Exp. Med. Biol. 410: 4550.
Makowski, L., Caspar, D.L.D., Phillips, W.C., and Goodenough, D.A., 1977, Gap junction structure. II. Analysis of the x-ray diffraction data. J. Cell. Biol. 74: 629-645. Makowski, L., 1988, X-ray diffraction studies of gap junction structure. Adv. Cell. Biol. 2: 119-158. McDonald, D.M., 1981, Peripheral chemoreceptors: structure-function relationships of the carotid body. In Lung Biology in Health and Disease. Regulation of Breathing, vol. 17 (T.F. Hornbein and C. Lenfant, eds.), Marcel Dekker, New York, pp. 105-320. Mills, L., and Nurse, C., 1993, Chronic hypoxia in vitro increases volume of dissociated carotid body chemoreceptors. Neuroreport 4: 619-622. Miragall, E., Hwang, T.K., Traub, O., Hertzberg, E.L., and Dermietzel, R., 1992, Expression of connexins in the developing olfactory system of the mouse. J. Comp. Neurol. 325: 359378.
Miragall, E., Simbrgcr, E., and Dermietzel, R., 1996, Mitral and tufted cells of the mouse olfactory bulb possesses gap junctions and express connexin43 mRNA. Neurosci. Lett. 216: 199-202. Monti-Bloch, L., Abudara, V., and Eyzaguirre, C., 1993, Electrical communication between glomus cells of the rat carotid body. Brain Res. 622: 119-131.
Pérez-García, M.T., Almaraz, L., and González, C., 1990, Effects of different types of stimulation on cyclic AMP content in the rabbit carotid body: functional significance. J. Neurochem. 55: 1287-1293. Pitts, J.D., and Simms, J.W., 1977, Permeability of junctions between animal cells. Intercellular transfer of nucleotides but not macromolecules. Exp. Cell. Res. 104: 153163. Rigual, R., González, E., Fidone, S., and González, C., 1984, Effects of low pH on synthesis
and release of catecholamines in the cat carotid body in vitro. Brain Res. 309: 178-181. Sáez, J.C., Berthoud, V.M., Moreno, A.P. and Spray, D.C., 1993, Multiplicity of controls in differentiated and undifferentiated cells and possible functional implications. In Advances in Second Messenger and Phosphoprotein Research (S. Shernolikar and A.C. Nairn, eds.), Raven Press, New York, pp. 163-198. Spray, D.C., Scemes, E., and Rozental, R., 1999, Cell-cell communication via gap junctions. In Fundamental Neuroscience (M.J. Zigmond, F.E. Bloom, S.C. Landis, J.L. Roberts and L.R. Squire, eds), Academic Press, New York, 117-343. Stea, A., Jackson, A., Macintyre, L., and Nurse, C.A., 1995, Long-term modulation of inward currents in chemoreceptors by chronic hypoxia and cyclic AMP in vitro. J. Neurosci. 15: 2192-2202.
Stea, A., Jackson, A., and Nurse, C.A., 1992, Hypoxia and Ny, dibutyryladenosine 3',5'cyclic monophosphate, but not nerve growth factor, induce channels and hypertrophy in chromaffin-like arterial chemoreceptors. Proc. Natl. Acad. Sci. USA 89: 9469-9473. Shaw, K., Montagne, W., and Pallot, D.J., 1990, Biochemical studies on the release of catecholamines from the rat carotid body in vitro. In Arterial Chemoreception (C. Eyzaguirre, S. Fidone, R. Fitzgerald and D. McDonald, eds.), Springer-Verlag, New York, 87-91. Unwin, P.N.T., and Zampighi, G., 1980, Structure of the gap junction between communicating cells. Nature 283: 545-549.
368
Wang, W.-J., Cheng, G.-F., Yoshizaki, K., Dinger, B., and Fidone, S.J., 1991a, The role of cyclic AMP in chemoreception in the rabbit carotid body. Brain Res. 540: 96-104. Wang, Z.-Z., Stensaas, L.J., de Vente, J., Dinger, B., and Fidone, S.J., 1991b, Immunocytochemical localization of cAMP and cGMP in cells of the rat carotid body following natural and pharmacological stimulation. Histochemistry 96: 523-530.
369
This page intentionally left blank.
SUBCELLULAR LOCALIZATION AND FUNCTION OF B-TYPE CYTOCHROMES IN CAROTID BODY AND OTHER PARAGANGLIONIC CELLS Wolfgang Kummer, Brigitte Höhler, Anna Goldenberg and Bettina Lange Institute of Anatomy and Cell Biology, Justus-Liebig-University, Aulweg 123, 35385 Giessen, Germany
1. INTRODUCTION Paraganglia are collections of neural crest-derived neuroendocrine cells that serve as a general defense line against hypoxia (Kummer 1996). Hypoxia-induced effects include secretion of catecholamines (Taylor and Peers 1998) and increased transcription of the gene coding for the ratelimiting enzyme of catecholamine synthesis, tyrosine hydroxylase (TH; Czyzyk-Krzeska et al. 1994). The primary oxygen sensing molecule is not known, but consent exists that it is a heme protein. According to spectrophotometric measurements of the carotid body one candidate molecule is the cytochrome known from phagocytes or a closely related b-type cytochrome (Cross et al. 1990, Acker et al. 1992). Immunohistochemically, this cytochrome has been detected in the paraganglionic cells of the carotid body (Kummer and Acker 1995, Youngson et al. 1997). In phagocytes, cytochrome consists of a small (p22-phox) and a large subunit (gp91-phox), and is part of the multiprotein NADPH oxidase complex that generates massive amounts of and subsequent reactive oxygen species (ROS) in bacterial defense ("respiratory burst“). The hypothesis had been put forward that lowering in the carotid body and in a model cell line for paraganglionic cells – rat pheochromocytoma PC12 cells – results in decreased levels of ROS (Acker et al. 1992, Kroll and Czyzyk-Kreska 1998) due to diminished activity of the
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
371
NADPH oxidase complex (Acker et al. 1992), and that these reduced levels of ROS are the intracellular signal that finally leads to increased TH-gene transcription (Kroll and Czyzyk-Krzeska 1998) and generation of electric activity in the carotid sinus nerve. In order to test this hypothesis we asked three questions: 1. Do paraganglionic cells possess a functionally active cytochrome containing NADPH-oxidase complex? 2. Does hypoxia lead to a decrease in ROS production by PC 12 cells? 3. Is there a causal link between altered ROS production and increased THgene transcription in PC12 cells?
2.
CYTOCHROME AND NADPH OXIDASE IN PARAGANGLIONIC CELLS
In PC12 cells, the mRNAs for both cytochrome subunits, i. e. p22phox and gp91-phox, were detected by RT-PCR, and the corresponding proteins were detected by immunohistochemistry and Western blotting. Electronmicroscopical
immunohistochemistry
performed
on
ultrathin
cryosections of the guinea-pig adrenal medulla located the cytochrome at the secretory vesicles but not - in contrast to the situation found in phagocytes in the plasma membrane. Native gel electrophoresis and in-gelchemiluminescence revealed a superoxide-generating enzyme complex in the microsomal fraction of PC12 cells that requires NADPH and cannot be stimulated by NADH. When intact PC12 cells were exposed to phorbol-12myristate-13-acetate (PMA), a potent inducer of the "respiratory burst“ in phagocytes (Henderson and Chappell 1993), a 50-fold increase of superoxide production was recorded by lucigenin-enhanced chemiluminescence. However, production by stimulated PC12 cells amounted for approximately 1% of that generated by peritoneal macrophages treated identically.
3.
ROS-PRODUCTION BY PC12 CELLS UNDER HYPOXIA
ROS-production by PC12 cells under normoxic versus hypoxic conditions (5% and was measured by recording oxidation of dihydrorhodamine 123 (DHR) or dichlorofluoresceindiacetate (DCFDA) in individual cells by laser scanning microscopy. For this purpose, PC12 cells were grown on culture slides and exposed for 1 h to normoxia/hypoxia in the
372
presence of the indicators, followed by fixation with 4% paraformaldehyd still under specific gas conditions. Both DHR- and DCFDA-incubations revealed a highly significant increase in intracellular ROS-production under hypoxia. This increase could be effectively prevented by the intracellular superoxide scavenger,
manganese (III)-tetrakis (l-methyl-4-pyridyl)-porphyrin (MnTMPyP), whereas the NADPH oxidase inhibitor diphenyleneiodonium (DPI) slightly attenuated but not abolished the hypoxia-induced rise in ROS-production. Rotenone, an inhibitor of complex I of the mitochondrial respiratory chain, increased ROS-production under 20% but allowed no further rise induced
by hypoxia. Treatment of PC12 cells for 6 days with the inhibitor of translation of mitochondrially encoded proteins, thiamphenicol, abolished
the hypoxia-evoked increase in intracellular ROS-production.
4.
MODULATION OF HYPOXIA-INDUCED
INCREASED TH-GENE TRANSCRIPTION Exposure of PC12 cells to 5 %
mRNA, compared to 20%
for 6 h caused a twofold rise in TH-
measured densitometrically from Northern or
slot blots hybridized with a TH-mRNA specific probe. This rise is in the
same range as reported earlier by Kroll and Czyzyk-Krzeska. (1998) using PC 12 cell cultures at 50 % confluency. Neither the extracellular superoxide scavenger, superoxide dismutase, nor the intracellular superoxide scavenger,
MnTMPyP, had any influence on the hypoxia-induced rise in TH-mRNA. Application of DPI did not change the TH-mRNA levels under normoxic conditions but entirely prevented the hypoxia-induced increase. Rotenone, an inhibitor of complex I of the mitochondrial respiratory chain, led to a significant increase in TH-mRNA under normoxic conditions that equalled the hypoxia-induced rise in controls, but exposure to hypoxia did not further increase TH-mRNA in the presence of rotenone.
5.
CONCLUSION
PC 12 cells contain a functionally active, superoxide-generating cytochrome containing NADPH-oxidase complex. This oxidase, like that of phagocytes, responds to stimulation by PMA, but its maximal output amounts to only 1 % of that of stimulated macrophages. We have not obtained evidence for a continuous activity of this oxidase under normoxic conditions. Hypoxia induces a rise in intracellular ROS that are likely to originate from complex I of the mitochondrial respiratory chain, as indicated
373
by the susceptibility to depletion of mitochondrially encoded proteins by thiamphenicol treatment and the effect of rotenone. This increase in intracellular ROS during hypoxia parallels, but not induces TH-gene transcription in PC 12 cells, since effective scavenging of intracellular ROSproduction by MnTMPyP was accompanied by unaffected increase in THmRNA, and effective repression of hypoxia-induced TH-gene transcription by DPI was still accompanied by an increase in intracellular ROSproduction. Similarly, a hypoxia-evoked rise in mitochondrial ROSproduction has been recently reported in the human erythropoietin-producing hepatoma cell line, Hep3B, although in that non-neuronal cell line ROS originated from complex III (Chandel et al. 1998). In contrast to the present findings on hypoxic regulation of TH-gene transcription in PC12 cells, evidence for a direct involvement of ROS in hypoxia-induced gene transcription in that cell line has been obtained (Chandel et al. 1998). A striking difference between hypoxia-regulated genes in HepSB cells and PC12 cells is the major involvement of the transcription factor hypoxiainducible factor in Hep3B cells whereas TH-gene transcription in PC12 cells is largely regulated by EPAS-1. The differences between the present results obtained on PC 12 cells and those reported on Hep3B cells can be best explained by different susceptibilities of these transcription factors to oxidation by ROS, but this issue has to be addressed by direct investigation.
ACKNOWLEDGEMENT The work from our laboratory was supported by a grant from the DFG (Ku 688/4-2).
REFERENCES Acker, H., Bölling, B., Delpiano, M. A., Dufau, E., Görlach, A., and Holtermann, G., 1992, The meaning of generation in carotid body cells for chemoreception. J. Auton. Nerv. Syst. 41: 41-52.
Chandel, N. S., Maltepe, E., Goldwasser, E., Mathieu, C. E., Simon, M. C., and Schumacker, P. T., 1998, Mitochondrial reactive oxygen species trigger hypoxia-induced transcription. Proc. Natl. Acad. Sci. USA 95: 11715-11720. Cross, A. R., Henderson, L., Jones, O. T. G., Delpiano, M. A., Hentschel, J., and Acker, H., 1990, Involvement of an NAD(P)H oxidase as a sensor protein in teh rat carotid body. Brochem. J. 272: 743-747.
Czyzyk-Krzeska, M. F., Furnari, B. A., Lawson, E. E., and Millhorn, D. E., 1994, Hypoxia increases rate of transcription and stability of tyrosine hydroxylase mRNA in pheochromocytoma (PC12) cells. J. Biol. Chem. 269: 760-764.
374
Henderson, L. M., and Chappell, J. B., 1993, Dihydrorhodamin 123: a fluorescent probe for superoxide generation? Eur. J. Biochem. 217:272-280.
Kroll, S. L., and Czyzyk-Krzeska, M. F., 1998, Role of and heme-containing sensors in hypoxic regulation of tyrosine hydroxylase gene expression. Am. J. Physiol. 274: C167174. Kummer, W., 1996, Innervation of paraganglia. In Autonomic-endocrine interactions
(Unsicker, K., eds.) Harwood Academic Publishers, Chur., pp. 315-356. Kummer, W., and Acker, H., 1995, Immunohistochemical demonstration of four subunits of neutrophil NAD(P)H oxidase in type I cells of carotid body. J. Appl. Physiol. 78: 19041909.
Taylor, S. C., and Peers, C., 1998, Hypoxia evokes catecholamine secretion from rat pheochromocytoma PC-12 cells. Biochem. Biophys. Res. Commun. 248: 13-17.
Youngson, C., Nurse, C., Yeger, H., Curnette, J. T., Vollmer, C., Wong, V., and Cutz, E., 1997, Immunocytochemical localization of sensing protein (NADPH oxidase) in chemoreceptor cells. Microsc Res. Tech. 37: 101-106.
375
This page intentionally left blank.
ACETYLCHOLINE SENSITIVITY OF CAT PETROSAL GANGLION NEURONS 1,2
Machiko Shirahata, 1Yumiko Ishizawa, 1Maria Rudisill, Sham, 1Brian Schofield, and 1,3,4 Robert S. Fitzgerald
1,3
James S.K.
1
Departments of Environmental Health Sciences, 2Anesthesiology, 3Medicine, and Physiology, The Johns Hopkins University, 615 N. Wolfe Street, Baltimore, MD 21205, USA
4
Keywords:
culture, immunocytochemistry, inward current, membrane potential, neuronal
nicotinic acetylcholine receptor, neurotransmitter, outward current, patch clamp Abstract
We investigated if neuronal nicotinic acetylcholine receptors (nAChRs) are
localized in chemoreceptor afferent neurons in the cat petrosal ganglion (PG) and if acetylcholine (ACh) excites chemoreceptor afferent neurons. Immunocytochemistry revealed that a majority of PG neurons expressed subunits of neuronal nAChRs, and a part of them were tyrosine hydroxylase positive. Excitability of cultured PG neurons was studied with patch clamp techniques (whole cell configuration). ACh and nicotine evoked both inward and outward currents. The inward current was partially blocked by removal of extracellular calcium and by antagonists for (dihydro erythroidine) or nAChRs (methyllycaconitine). Outward current was blocked by 4-aminopyridine (4-AP) and sometimes by atropine. ACh-induced membrane potential changes were well correlated with ACh-induced currents. Depolarization and hyperpolarization occurred in response to ACh. Occasionally depolarization was followed by a train of action potentials. The results suggest that heterogeneous neuronal nAChRs are widely distributed in both chemoreceptor and other PG neurons. In some neurons nAChRs may be functionally coupled with outward channels. Further studies are required to determine whether chemoreceptor neurons have a distinct distribution +
pattern of nAChRs and K channels.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
377
1.
INTRODUCTION
Numerous dense-core and clear-core vesicles are present in glomus cells of the carotid body, and they contain various neuroagents including ACh. Previous studies have suggested that ACh is released in response to natural stimuli (Fitzgerald et al.1996, 1999), and that the activation of nAChRs is critically involved in excitatory neurotransmission of the cat carotid body (Eyzaguirre and Zapata 1968, Fitzgerald and Shirahata 1994, Fitzgerald et al. 1997, Landgren et al. 1952, Nishi and Eyzaguirre 1971). Recent studies in other neural tissues have advanced our understanding of neuronal nAChRs which differ from the nAChRs at the neuromuscular junction. To date eight neuronal (2-9) and three neuronal (2-4) subunits are known (McGehee and Role 1995). In this study we tested the following two hypotheses. (1) In the PG, neuronal nAChRs are localized on
chemoreceptor afferent neurons. (2) ACh excites chemoreceptor afferent neurons.
2.
MATERIALS AND METHODS
2.1
Preparation of Cats for Immunocytochemistry and Cell Culture
Cats were deeply anesthetized with ketamine (50 mg/kg, i.p.) and pentobarbital (50 mg/kg, i.v.). They were heparinized (2000 IU/kg) to prevent blood clots in the carotid body, then euthanized by pentobarbital (additional 50100 mg/kg, i.v.), and decapitated.
2.2
Cell Culture
PG neurons were cultured in a similar manner to the culture of glomus cells (Shirahata et al. 1994). Immediately after the decapitation the common carotid arteries were perfused with cold Leibovitz’s culture medium containing antibiotics. The PGs were excised and dissociated with collagenase and gentle
378
trituration. The cells were seeded in wells made of a round glass coverslip (bottom; 25 mm in diameter) and a plastic cylinder (side; 5 mm in diameter). Cells were cultured in a defined medium in a incubator (5% in air) for up to two weeks. The medium was changed twice a week. The basic nutrient solution was a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F12 medium supplemented with bovine serum albumin bovine transferrin bovine insulin sodium selenite (5 ng/ml), Lglutamine and 7s-nerve growth factor (100 ng/ml).
2.3
Immunocytochemistry
2.3.1
Preparation of Tissues and Cultured Cells
For fixation of PGs the common carotid artery was perfused with ice-cold 0.1 M phosphate buffered saline (PBS) followed by S.T.F. fixative (Streck Laboratories, Inc.). PGs were removed and postfixed in the same fixative at room temperature overnight. Tissues were cryoprotected with 30% sucrose, rapidly frozen, and stored at -80° C. They were sectioned with a cryostat, 8-12 µm, and mounted on poly-L-lysine coated slides. Cultured cells were fixed with S.T. F. for 15 min, and were permeabilized with methanol for 5 min.
2.3.2
Immunostaining
Endogenous peroxidase was quenched with 1% in PBS. Nonspecific bindings were blocked with normal serum (donkey or horse, 1:10) and casein. Endogenous biotin was blocked by avidin-biotin blocking kit (Vector). Tissues or cells were incubated with an appropriate primary antibody overnight at 4 °C (anti subunit, 1/1000; anti-tyrosine hydroxylase, 1/500) or room temperature (anti subunit, 1/600). Subsequently, a biotinylated secondary antibody against the primary antibody was applied for 1 hour at room temperature. Elite ABC (Vector) kits were used for peroxidase reaction, and SG (Vector) or 3-amino-9-ethylcarbazole was used as chromogens. Between each step tissues and cells were washed with PBS for 15 min. Purified normal IgG was used as negative control for primary antibodies. Primary antibodies
379
were obtained from Research Biochemicals Inc. (monoclonal and or Chemicon International Inc. (polyclonal anti-tyrosine hydroxylase).
2.4
)
Patch Clamp
The cell-containing well was placed in a recording chamber. The plastic cylinder was removed and cells were continuously perfused with Krebs solution (2 ml/min) equilibrated with 5% and various levels of The composition of Krebs was (mM): NaC1 120, KC1 5.4, and glucose 10, pH 7.4 with equilibrated with 5% A standard patch clamp technique with a whole cell configuration was used (Marty and Neher 1983). The composition of internal solutions was (mM): K gluconate 90, KC1 33, NaCl 10, EGTA 10, MgATP 5, HEPES 10, ACh was applied close to the patched cell through a fine capillary tube which was connected to the reservoir via an electrically controlled valve. A List EPC7 patch clamp amplifier (Adams and List Assoc.) amplifier (Axon Instruments, Inc.) was used to measure currents (voltage clamp mode) and membrane potentials (current clamp mode). A PC-based computer and pCLAMP software (Axon Instruments) were used for collecting and processing the data.
3.
RESULTS
3.1
Immunocytochemical Presentation of Neuronal nAChRs
subunits of neuronal nAChRs were found in many neurons in the tissue sections of PGs, and they were mainly seen in the cell body. subunits were also found in many neurons with both cell bodies and nerve fibers showing a strong signal. Glial cells did not have either a subunit. Double immunostaining for tyrosine hydroxylase (TH) and subunits revealed that most TH-positive neurons were also subunit positive. However, not all subunit-positive neurons were TH positive as shown before (Shirahata et al. 1998). This relationship was also true between subunit and tyrosine hydroxylase. That is, TH-positive neurons also showed a signal of subunit, but not all subunitpositive cells showed TH staining.
380
and subunits of neuronal nicotinic ACh receptors were found in cultured neurons (Fig. 1). As seen in tissue sections, subunits were only found in the cell body (Fig. 1B). subunits were seen in the cell body and the axon (Fig.1C).
3.2
ACh-induced Currents in PG Neurons
ACh induced various current patterns (Fig. 2). In some neurons, inward current was dominant, and in others outward current was prominent. A majority of neurons showed a combination of inward and outward currents. ACh-induced inward current showed characteristics of the current induced by the activation of neuronal nAChR. The perfusion of a specific blocker for nicotinic receptors, (Fig. 3A), significantly reduced ACh-induced inward current. Also, the perfusion with methyllycaconitine, a specific blocker of nicotinic receptors, partially inhibited the inward current (Fig. 3B). These results agree with the immunocytochemical presentation of and subunits in PG neurons. Further, removal of calcium from perfusate significantly reduced the inward current, which is consistent with the high permeability of neuronal nAChRs to calcium ions (Fig. 3C).
381
382
Nicotine mimicked the effect of ACh, evoking both inward and outward + currents. A K channel blocker, 4-aminopyridine (4-AP), inhibited outward component of ACh-induced currents (Fig.4). Atropine reduced outward current in some neurons.
3.3
ACh-induced Membrane Potential Changes in PG Neurons
Membrane potential changes induced by ACh were closely correlated with ACh-induced current. In some cells, in the course of depolarization a train of action potentials was evoked (Fig. 5).
4.
Discussion
The findings of this study are: (1) Cat PG neurons express neuronal nAChRs. (2) ACh induces various responses to PG neurons. subunits of neuronal nAChRs were widely distributed in the PG. Since part of these neurons also expressed tyrosine hydroxylase (a putative marker for carotid chemoreceptor neurons), neuronal nAChRs appear present in chemoreceptor neurons as well as other neurons.
383
384
Contrary to our expectations and the findings in rat PG neurons (Zhong and Nurse 1997), ACh and nicotine evoked complex responses in cat PG neurons. Inward, outward and combination of these currents were induced (Fig. 2). Calcium appeared to be a major current carrier for the ACh-induced inward current, because the removal of extracellular significantly reduced the inward current. The inward current was reduced by specific blockers for or neuronal nAChRs, suggesting that the current was via nAChRs containing and/or subunits. The results were consistent with our immunocytochemical data. Outward current was blocked by 4-AP, suggesting that ACh may activate outward channels. Since nicotine also induced outward current, this outward current may be different from muscarinic induced current. However, in some neurons atropine reduced outward current. Therefore, muscarinic receptor activation may contribute to the outward current in some cells. Activation of subunit-containing neuronal nAChRs appears to activate maxi-type activated channels in hair cells (Fuchs and Murrow 1992). Since nAChRs in PG neurons are very permeable to activation of these channels might be, in part, the underlying mechanisms of ACh-induced outward current in PG neurons. The function ofneuronal nAChRs in PG neurons is still unclear. subunitcontaining nAChRs were present mainly in cell bodies of PG neurons. Hence, these
subunit-containing nAChRs may not participate in neurotransmission
in the carotid body. On the other hand, subunit-containing nAChRs are present not only in the cell bodies of PG neurons but also in the axons. Further, subunit containing nerve endings envelope glomus cells (Shirahata et al 1998), suggesting these nAChRs may be involved in chemoreceptor neurotransmission. Recent electrophysiological studies suggest that activation of subunit-containing nAChRs induces action potentials and may participate in synaptic neurotransmission (Alkondon et al.1999, Fraizier et al.1998, Zhang et al. 1996). In cat PG neurons ACh depolarized or hyperpolarized the membrane. We speculate that if nAChRs are functionally coupled with outward channels, the effect of ACh is inhibitory, and hyperpolarization occurs. On the other hand, if nAChRs are not strongly coupled with outward channels, the ACh effect is excitatory. Depolarization and induction of action potentials occur. Chemoreceptor neurons might be the latter type of neuron. If so, the difference between our results and the data of Zhong and Nurse (1997) could be explained in the following manners. They harvested the region of PG adjacent to the exit of the glossopharyngeal nerve to enrich chemosensory neurons in culture. ACh mainly induced inward current. On the other hand, we harvested
385
the whole PG, resulting in a heterogenous population of PG neurons. In contrast to the rat PG, the distribution of chemoreceptor neurons is not established in the cat PG. Further studies are required to determine if chemoreceptor neurons show distinct distribution of nAChRs and channels, and hence ACh-induced response(s).
ACKNOWLEDGMENT This work was supported by NHLBI HL 50712 and NIEHS ES 03819.
REFERENCES Alkondon, M. Pereira E.F., Eisenberg, H.M. and Albuquerque, E.X., 1999, Choline and selective antagonists identify two subtypes of nicotinic acetylcholine receptors that modulate GABA release from C A1 interneurons in rat hippocampal slices. J. Neurosci. 19: 2693-2705. Eyzaguirre, C. and Zapata, P., 1968, The release of acetylcholine from carotid body tissues. Further study of the effects of acetylcholine and cholinergic blocking agents on the chemoreceptor discharge. J. Physiol. London 195:589-607. Fitzgerald, R.S. and Shirahata, M., 1994, Acetylcholine and carotid body excitation during hypoxia in the cat. J. Appl. Physiol. 76: 1566-1574. Fitzgerald, R.S. and Shirahata, M., 1996, Release of acetylcholine from the in vitro cat carotid body. Adv. Exp. Med. Biol., 410: 227-232. Fitzgerald, R.S., Shirahata, M. and Ide, T., 1997, Further cholinergic aspects of carotid body chemotransduction of hypoxia in cats.J. Appl. Physiol. 82: 819-827. Fitzgerald, R.S., Shirahata, M. And Wang, H.-Y. J., 1999, Acetylcholine release from cat carotid bodies. Brain Res., in press. Fraizier, C.J., Rollins, Y.D., Breese, C.R., Leonard, S., Freedman, R. and Dunwiddie, T.V., 1998, Acetylcholine activates an nicotinic current in rat hippocampal interneurons, but not pyramidal cells. J. Neurosci. 18: 1187-1195. Fuchs, P. and Murrow, B., 1992, Cholinergic inhibition of short (outer) hair cells of the chick’s cochlea. J. Neurosci. 12: 800-809. Landgren, S., Liljestrand, G. and Zotterman, Y., 1952, The effect of certain autonomic drugs on the action potentials of the sinus nerve. Ada Physiol. Scand. 26: 264-290. Marty, A. and Neher, E., 1883, Tight-seal whole-cell recording. ln:Single-channel recording (B. Sakmann and E. Neher, eds.), Plenum Publishing, New York, pp. 107-122. McGehee, D.S. and Role, L.W., 1995, Physiological diversity of nicotinic acetylcholine receptors expressed by vertebrate neurons. Annu. Rev. Physiol. 57: 521-546. Nishi, K. and Eyzaguirre, C., 1971, The action of some cholinergic blockers on carotid body chemoreceptors in vivo, Brain Res. 33: 37-56.
386
Shirahata, M., Ishizawa, Y., Rudisill, M., Schofield, B. and R.S. Fitzgerald., 1998, Presence of nicotinic acetylcholine receptors in cat carotid body afferent system. Brain Res. 814: 213-217. Shirahata, M., Schofield, B., Chin, B.Y. and Guilarte, T.R., 1994, Culture of arterial chemoreceptor cells from adult cats in defined media. Brain Res. 658:60-66.
Zhang, Z.W., Coggan, J.S. and Berg, D.K., 1996, Synaptic currents generated by neuronal acetylcholine receptors sensitive to alpha-bungarotoxin. Neuron 17: 1231-1240. Zhong, H. and Nurse, C. A., 1997, Nicotinic acetylcholine sensitivity of rat petrosal sensory neurons in dissociated cell culture. Brain Res 766: 153-161.
Zhong, H., Zhang, M. and Nurse, C.A., 1997, Synapse formation and hypoxic signaling in co-cultures of rat petrosal neurones and carotid body type 1 cells. J. Physiol. 503:599-612.
387
This page intentionally left blank.
RESPONSES OF PETROSAL GANGLION NEURONS IN VITRO TO HYPOXIC STIMULI AND PUTATIVE 1 TRANSMITTERS .
1J. Alcayaga, 1R. Varas, 1 J. Arroyo, 2R. Iturriaga and 2 P. Zapata 1
Laboratory of Neurobiology, Faculty of Sciences, University of Chile, Santiago, Chile Laboratory of Neurobiology, Catholic University of Chile, Santiago, Chile
2
1.
INTRODUCTION
The glossopharyngeal nerve conveys sensory information from mechano- and chemoreceptors of the posterior tongue, pharynx and carotid bifurcation. The somata of its sensory neurons are mainly located in the petrosal ganglion. Activation of its peripheral chemosensory endings in the carotid body and taste buds of circumvallate papillae is attributed to transmitters released from receptor cells (glomus and taste cells, respectively). The specificity of arterial chemoreceptors, as sensors for changing levels of in the blood, may be attributed to the presence of specific receptor cells, or differentiated sensory nerve endings. Interpretations of experiments distinguishing one element from the other, done by different authors, coincide that glomus cells are required for oxygen chemoreception (see Eyzaguirre & Zapata, 1984). However, the sensitivity to hypoxia was tested some time after performing the procedures used to separate them. Thus, to find out whether petrosal ganglion cells, acutely separated from glomus cells, respond to hypoxia deserves experimental testing. Since glomus cells are profusely innervated by sensory nerve fibers (De Castro, 1928), the idea of a junctional transmitter between both elements has led to the testing of several neurotransmitters. The most prominent putative transmitters, because of their roles at other synapses, have been
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
389
acetylcholine (ACh) and catecholamines. Thus, there is abundant information on their actions on the carotid body (see Zapata, 1997).
In many studies, the putative transmitter has been applied to the entire carotid body, either in situ or in vitro. However, this procedure does not indicate whether the action potentials, recorded from the carotid nerve, resulted from a direct action of the chemical agent on the sensory nerve endings or were secondary to an effect on the glomus cells, releasing chemicals toward the nerve endings. In fact, the intimate relationship between glomus cell and nerve ending membranes makes it impossible to stimulate separately one or the other. The first attempt was to separate both
elements by inducing degeneration of the nerve endings by sectioning the carotid nerve, followed by a period of time allowing nerve regeneration. These experiments showed that nicotine -a cholinergic agonist- lost its
excitatory effect on the carotid nerve immediately after nerve crush. Recovery occurred only when the regenerating nerve tips made contact with glomus cells (Zapata et al. 1976). Thus, it was possible that the cholinergic agonist was acting on the glomus cells or on the sensory nerve endings, trophically controlled to express ACh receptors. Other attempts to separate direct from indirect actions on primary sensory neurons consisted in obtaining separate tissue cultures of glomus and sensory ganglion cells, and to compare them with co-cultures of both cell types (e.g.: Alcayaga & Eyzaguirre, 1990; Zhong & Nurse, 1997; Zhong et al. 1997). But, again, at least 3 days elapsed before recording. The above considerations led us to test whether the perikarya of petrosal ganglion sensory neurons share the sensitivity to putative transmitters and hypoxic stimuli exhibited by their sensory endings at the carotid body level. It must be noted that the cat petrosal ganglion only has unipolar afferent neurons and it is -morphologically- devoid of synapses (Stensaas & Fidone, 1977). 2.
METHODS
For stimulation and recording, a two compartment superfusion chamber was used. Hanks' balanced salt solution, supplemented with 5 mM HEPES, pH 7.43 at 38°C and equilibrated with air, flowed through the lower compartment under a layer of paraffin oil in the upper compartment. The petrosal ganglion and its peripheral nerve branches were excised from pentobarbitone-anesthetized cats. The ganglion was placed in the saline where it was electrically stimulated through a pair of electrodes connected to a stimulator. The carotid nerve and the glossopharyngeal branch were placed on paired recording electrodes in the oil. The nerve impulse activity was
recorded, and the discharge frequency
390
respectively) was counted
(see Alcayaga et al. 1998). The viability of the preparation was tested by recording the compound action potentials of the nerves, evoked by electrical stimulation of the ganglion. Drugs dissolved in physiological saline were applied by microdispensers as boluses very close to the ganglion surface, except for antagonists that were added to the superfusion fluid. In another series, petrosal ganglion neurons were dissociated and maintained in culture in F-12 medium supplemented with horse and fetal bovine sera (10% and 10%, respectively) and NGF (15 ng/ml) for 5 to 12 days. Recordings were made in a chamber superfused with Hanks' balanced salt solution, supplemented with 5 mM HEPES and 4 mM Ganglion cells were impaled with glass microelectrodes filled with 3 M KCl (resistance and drugs were delivered close to the cell surfaces. 3.
RESULTS
Low levels of nerve impulse activity were recorded from the carotid nerve. Discharges were extremely low or absent in the glossopharyngeal branch (Alcayaga et al. 1998). Recording compound action potentials from both nerve branches, evoked by electrical stimulation of the petrosal ganglion, guaranteed that nerve conduction was preserved along these tracts. Whole-nerve recordings of the carotid nerve minimized individual fiber variability, and provided a representative profile of its fiber components (Fitzgerald & Osborne, 1987). However, they do not discriminate whether the elicited responses are carried by chemosensory or barosensory fibers. 3.1.
Hypoxic stimuli
Switching from a superfusion solution equilibrated with air to another
equilibrated with
supplemented with an
scavenger (glucose
oxidase 11.25 U/ml, catalase 39 U/ml), did not increase
even
when hypoxia lasted for one hour. Thus, hypoxia did not elicited carotid nerve activity from the somata of chemosensory neurons. Nevertheless, a 10 min hypoxic exposure produced no effects or small reduction of the excitatory responses induced by ACh and NaCN (Fig. 1), and effect which was reversible upon returning to superfusion with normoxic saline. When hypoxia lasted more than 30 min there was a progressive reduction in compound action potential amplitude evoked by electrical stimulation of the petrosal ganglion. In spite of the above, inhibitors of the electron transport chain were effective. Applications of NaCN increased (Fig. 1B) and in a dose-dependent manner. The glossopharyngeal branch showed lower sensitivity. The NaCN-induced maximal responses in the carotid nerve
391
lasted up to 15 min, whereas those evoked in the glossopharyngeal branch lasted less than 60 s. Sodium azide induced small and short-lasting responses in both nerves (Fig. 2A).
Applications of 2,4-dinitrophenol uncoupler of oxidative phosphorylation, had no significant effects on or However, high doses of this compound reduced the responses to stimulatory agents and electrically-evoked compound action potentials.
392
3.2.
Cholinergic agents
Acetylcholine applied to the petrosal ganglion produced dose-related increases in lasting 30-40 s (Fig. 1A), with little or no effect on The sensitivity to ACh was clearly enhanced by prior application of eserine. ACh-induced responses were reversibly blocked by mecamylamine and hexamethonium (Alcayaga et al. 1998; Zapata et al, 1999). Nicotine also evoked increases in Figure 3 shows a dose-response curve obtained from one experiment, where a minimal response was
produced by and maximal effects by 0.1 to 1 mg. These responses were similar to those evoked by equivalent doses of ACh, but of slower rising and decay times. Also, they produced a desensitization more prolonged than that induced by ACh. Nicotine had no effect on
Intracellular recordings of cultured petrosal ganglion neurons showed resting potentials of -62 to -40 mV. Electric stimulation evoked cell depolarization and action potentials. ACh (0.2-5 mM) depolarized two thirds of the neurons, leading to the generation of action potentials in some of them. These responses desensitized rapidly, and several minutes were necessary for recovery of the full response. 3.3.
Dopaminergic agents
Dopamine (DA) applied to the petrosal ganglion in boluses of from 1 ng to 5 mg had no effects on basal (Alcayaga et al. 1999b).
393
However, when applied shortly after NaCN, DA transiently reduced the prolonged increase in provoked by NaCN (unpublished). When DA was applied shortly before NaCN, the resultant response was partially or completely reversed. As reported elsewhere in this volume (Zapata et al,
1999), DA was also a modulatory agent on ACh-induced responses.
3.4.
Nitroxidergic manipulation
Superfusion with 10-50 sodium nitroprusside, a nitric oxide (NO) donor, was without effect on or but reduced the sensitivity to ACh applications, without modifying the maximal attained (Alcayaga et al, 1999a). Returning to normal superfusion increased the sensitivity of the preparation beyond control values. Superfusion with 1-2 mM N-alphanitro-L-arginine methyl ester (L-NAME), a NO synthetase inhibitor, slightly increased the ACh-induced responses (see also Iturriaga et al, 1999).
3.5.
Other putative transmitters
Adenosine tri-phosphate (ATP), and to a much lesser extent adenosine monophosphate (AMP), produced fast, dose-related increases in and lasting 30-40 s (Fig. 2B). These responses showed little or no temporal desensitization. Responses to ATP and ACh appeared to be independent, since there was no cross-desensitization. Carotid nerve responses were larger than those of the glossopharyngeal branch, and the dose necessary for one half-maximal response was about three-times larger for the glossopharyngeal branch (unpublished results). Superfusion with Reactive Blue 2, a receptor blocker, had little or no effect on the ATP-induced response, while larger doses produced non-specific reduction of ATP- and ACh-induced responses, as well as the amplitude of compound action potentials elicited by electrical stimulation of the ganglion (unpublished results). Serotonin and (GABA) had no effects on or even though doses as large as 5 mg were tested (Alcayaga et al, 1998). 4.
CONCLUSIONS
The above data suggest that petrosal ganglion neurons projecting to the carotid nerve are endowed with nicotinic ACh-receptors (nAChR) and nucleotide receptors, whose activation produces depolarization and increased frequency of discharges. DA receptors are also present on the perikarya, DA modulating the excitability of petrosal ganglion neurons. A similar effect is exerted by NO. Results also indicate that while petrosal
394
ganglion neurons are not excited by hypoxic hypoxia, metabolic inhibitors especially NaCN- activate them. Some petrosal ganglion neurons projecting through the glossopharyngeal branch present receptors, while nAChR are scanty or absent in these somata. The fact that nearly two thirds of cultured petrosal ganglion neurons responded to ACh while probably only less than 10% of them innervate the
carotid body (see Eyzaguirre & Zapata, 1984) merits some discussion. One possibility is that ACh receptors occur, as a general property, in petrosal
ganglion neurons, which is enhanced in neurons innervating the carotid body, especially at the sensory nerve ending level making synaptic contact with glomus cells. Thus, the number of ACh receptors in primary sensory neurons would be trophically controlled by the receptor targets. Another possibility is that the particular conditions of tissue culture favor the survival of those neurons which had previously innervated the carotid body glomus cells. Our recordings could not discriminate between chemosensory and
barosensory fibers in the carotid nerve. Also, the distribution of diameters (conduction velocities) of both types of fibers are partly superimposed (Fidone & Sato, 1969). Nevertheless, we can expect differences in the electrophysiological properties of the somata of these two types of sensory neurons. In fact, the action potentials produced in the perikarya of carotid barosensory and chemosensory neurons have different profiles (Belmonte & Gallego, 1983). Similarly, though the action potentials recorded from dorsal root ganglion neurons are related to the diameters and conduction velocities of their corresponding axons, the narrow ranges for each parameter within a given class are related to the receptor types of their peripheral terminals (Koerber et al. 1988).
ACKNOWLEDGEMENTS We thank Prof Carlos Eyzaguirre for his comments on this manuscript, and Mrs Carolina Larrain for her help in the preparation of this manuscript
and its illustrations. Work supported by grants 197-1013 and 198-0965 from the National Fund for Scientific and Technological Development (FONDECYT) of Chile. REFERENCES Alcayaga J & Eyzaguirre C (1990) Electrophysiological evidence for the reconstitution of chemosensory units in co-cultures of carotid body and nodose ganglion neurons. Brain Res 534: 324-328
395
Alcayaga J, Iturriaga R, Varas R, Arroyo J & Zapata P (1998) Selective activation of carotid
nerve fibers by acetylcholine applied to the cat petrosal ganglion in vitro. Brain Res 786: 47-54 Alcayaga J, Barrios M, Bustos F, Miranda G, Molina MJ & Iturriaga R (1999a) Modulatory effect of nitric oxide on acetylcholine-induced activation of cat petrosal ganglion neurons in vitro. Brain Res 825: 194-198 Alcayaga J, Varas R, Arroyo J, Iturriaga R & Zapata P ( 1999b) Dopamine modulates carotid nerve responses induced by acetylcholine on the cat petrosal ganglion in vitro. Brain Res [In press]
Belmonte C & Gallego R (1983) Membrane properties of cat sensory neurones with chemoreceptor and baroreceptor endings. J Physiol, London 342: 603-614 De Castro F (1928) Sur la structure et 1'innervation du sinus carotidien de l'homme et des mammifères. Nouveaux faits sur 1'innervation et la fonction du glomus carotidien. Études anatomiques et physiologiques. Trab Lab Invest Biol Univ Madrid 25: 331-380 Eyzaguirre C & Zapata P (1984) Perspectives in carotid body research. J Appl Physiol 57: 931-957 Fidone SJ & Sato A (1969) A study of chemoreceptor and baroreceptor A and C-fibres in the cat carotid nerve. J Physiol, London 205: 527-546 Fitzgerald RS & Osborne JL (1987) The chemoreception of hypoxia and hypercapnia: further evidence for a dual sensing mechanism. In: Ribeiro JA & Pallot DJ (eds) Chemoreceptors in Respiratory Control. London: Croom Helm, p 228-236
Iturriaga R, Villanueva S & Alcayaga J (1999) Nitric oxide modulation of carotid chemoreception. This volume, Koerber HR, Druzinsky RE & Mendell LM (1988) Properties of somata of spinal dorsal root
ganglion cells differ according to peripheral receptor innervated. J Neurophysiol 60: 1584-1596 Stensaas LJ & Fidone SJ (1977) An ultrastructural study of cat petrosal ganglia: a search for autonomic ganglion cells. Brain Res 124: 29-39 Zapata P (1997) Chemosensory activity in the carotid nerve: Effects of pharmacological
agents. In: Gonzalez C (ed) The Carotid Body Chemoreceptors. Berlin: SpringerVerlag. pp 119-146
Zapata P, Stensaas LJ & Eyzaguirre C (1976) Axon regeneration following a lesion of the carotid nerve: electrophysiological and ultrastructural observations. Brain Res 113: 235253 Zapata P, Larraín C, Iturriaga R, Alcayaga J & Eyzaguirre C (1999) Interactions between
acetylcholine and dopamine in chemoreception. This volume Zhong H & Nurse C (1997) Nicotinic acetylcholine sensitivity of rat petrosal sensory neurons in dissociated cell culture. Brain Res 766: 153-161 Zhong H, Zhang M, Nurse C (1997) Synapse formation and hypoxic signaling in co-cultures of rat petrosal neurones and carotid body type 1 cells. J Physiol, London 503: 599-612
396
THE METABOLIC HYPOTHESIS REVISITED
Charmaine Rozanov, Arijit Roy, Anil Mokashi, Shinobu Osanai, Peter Daudu, Bayard Storey, and Sukhamay Lahiri Department of Physiology, University of Pennsylvania School of Medicine, Philadelphia PA 19104-6085, U.S.A.
1.
INTRODUCTION
The resurgence of suggestions that point to the mitochondria as having a key role in oxygen sensing in the genetic and molecular basis of hypoxic chemosensitivity (Burke and Kwast, 1999, Hand, 1999) indicates that this is a good time to reconsider the concept of the mitochondrial basis for oxygen sensing in the carotid body (CB). The mitochondrion is the primary site for oxygen metabolism and thus is the largest consumer of oxygen in the cell. Therefore, it is a logical site for sensing cellular changes in oxygen (Zhu and Bunn, 1999). Also, the flux of electrons through the respiratory chain and cytochrome c oxidase is effected by oxygen
concentration in yeast and mammalian cells. In addition, the for oxygen binding to the cytochrome c oxidase is effected by oxygen concentration (Kwast et al., 1999). Thus, the respiratory chain in the mitochondria would certainly be a suitable candidate for housing the oxygen sensor. In this regard, carbon monoxide (CO) is a powerful tool for studying the involvement of cytochrome oxidase in oxygen sensing. It is a molecule that is a structural analog of oxygen and binds to the oxygen binding site of cytochrome oxidase (Wilson et al., 1994). It freely and quickly diffuses into the cell. Its binding affinity for cytochrome oxidase is less than that of and the bound CO is photodissociable (Warburg, 1949; Lahiri et al., 1993). This property makes it possible to obtain a photochemical action spectrum by determining changes in neural discharge (ND) of the carotid sinus nerve (CSN) from the isolated, perfused-superfused CB (Wilson et al., 1994)) in the presence of CO plus with light pluses of varying wavelength. For our
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
397
experiments we used a gaseous mixture containing showed optimum CO mediated chemoreceptor response.
2. 2.1
which
METHODS Carotid Sinus Nerve Discharge
An in vitro method of perfusing/superfusing the CB is used. Changes in the rate of discharge of the closely apposed CSN are recorded. Details of this procedure are recorded elsewhere (Roy et al., 1997). 2.2
Cytosolic
Using indo-1 AM as the fluoroprobe, changes in fluorescence ratios in CB glomus (isolated and clustered) are used to calculate increase in This procedure has been described earlier (Mokashi et al., 1998).
2.3
Buffers and Gas Combinations Used
A detailed description of the preparation of modified Tyrode buffer used in these experiments is in the cited paper (Rozanov et al., 1999). Partial pressure of CO is Torr and that of O2 is Torr.
3.
RESULTS
Fig. 1 shows a continuous recording of discharge of the CSN which represents the final output of the net events taking place in the CB glomus cells and the nerve endings apposed to it. With the introduction of CO there is an instantaneous increase in ND to over 500 imp/sec. White light reverses the CO effect on ND, and this effect is itself reversible as maximal ND in the presence of CO is observed on turning off the light. Figure 2 shows a study of the action spectra of CO mediated effects on ND. After correcting to equal intensity of light quanta at each wavelength (Wilson et al., 1994), greatest reversibility of CO effects was seen with light at wavelengths of 430 and 595 nm, the ratio of the reversibility effect for 430:595 being 6-7:1.
398
399
400
High CO significantly increases from base levels of 100 nM to an important event necessary for neurotransmitter release. Addition of 200 a voltage gated calcium channel (VGCC) blocker, does not inhibit the CO mediated increase in (Fig. 3) (Mokashi et al., 1998).
Fig. 4 shows that
in the superf usate itself does not influence
the fluorescence signal of indo-1 from isolated glomus cells when compared to control superfusate containing no
4.
DISCUSSION
High levels of CO significantly increase CSN discharge mimicking the response seen when oxygen is lowered to levels below 40 Torr in the C B perfusate. Light reverses the effect of high CO and brings ND down to baseline levels, an effect which itself is completely reversible (Fig.l). Therefore, the photoreversible effect on ND shows that the increase in CSN discharge stimulated by high CO is mediated by CO binding to an binding heme protein. Hemoglobin is washed out in the in vitro system that we are studying and so does not interfere in the in the determination of the CO photochemical action spectrum of the CB hemoprotein. In order to identify the specific heme protein that CO is binding to cause the CSN to increase its firing rate, we flashed lights of different wavelengths while
perfusing
the
CB
with
high
CO.
Two
maxima
of CO
photodissociation (i.e. greatest reversibility of ND) were seen with light of wavelengths 430 and 595 nm, the ratio of the effects at 430:595 nm being between 6-7:1. This is a highly specific characteristic of the dissociation of cytochrome (Wilson et al., 1994) and serves as a signature for the cytochrome complex. Since increase in is considered a key element in hypoxia mediated increase in ND, we decided to study the response to high CO CO stimulated increase in to These levels are significantly higher than that required for stimulating neurotransmitter release (Montoro et al., 1996). To check for the source of the increased we repeated the CO exposure in the presence of
which blocks voltage gated calcium channels (VGCC). CO induced rise was not blocked by this treatment. This suggests that CO triggers release from intracellular stores. At the ‘oxygen sensing’ meeting the point was raised that itself may cause increase in fluorescent readings with indo-1 which would give false indications of increase in We, therefore, repeated the studies and compared the changes in in the presence and absence of
shown in fig. 4,
under control conditions. As
by itself does not show an increase in indo-1
401
fluorescence over that of the baseline. Thus, the increase in that was seen with high CO in the presence of was entirely due to high CO. There has been a recent report, that shows an increase in fura-2 fluorescence with low levels of which does not occur with high levels of (Sorimachi et al., 1999). We did not find any report of the effect of on indo-1 fluorescence. The results shown in Fig. 4 indicate that there is no such effect. However, does depress ND stimulated by hypoxia and high levels of CO (Rozanov et al., 1999). Thus, we infer that high CO and hypoxia are the initial triggers to stimulate intracellular release and thereby empty intracellular pools leading to increase in Emptying of intracellular pools activates influx through VGCC which is necessary for maintenance of high levels of to cause neurotransmitter release and ND. A summary of some of the possible events that CO may initiate in a glomus cell is shown in fig. 5.
402
In this schematic diagram we see that high levels of CO may directly act on the membrane by binding to heme proteins there. CO may be directly hitting the intracellular stores to release As discussed in this paper, by binding to cytochrome in the mitochondria, CO may stimulate release of from intracellular pools directly due to close contacts of the mitochondria with the endoplasmic reticulum (Rizzuto et al., 1998). Other mechanisms have been suggested (Melamed-Book and Rahamimoff, 1998). It is our suggestion that the local reduction of ATP near the endoplasmic reticulum decreases uptake resulting in a net release of from the intracellular stores (Biscoe and Duchen, 1990; Mulligan et al., 1981). Emptying of these stores induces to enter through theory) (Dukes et al., 1997). Thus, the net effect is that CO may increase by tapping several sources. This results in enough of an increase in which would lead to vesicular fusion, neurotransmitter release and NO. The mitochondrial participation in this sequence of events supports the metabolic theory of oxygen sensing in the CB glomus cells.
5.
SUMMARY
High levels of CO are used to mimic the stimulatory response of the CSN initiated by hypoxia. Using light of different wavelengths we show that the stimulatory effects of high CO can be pinpointed to the cytochrome c oxidase in the mitochondrial respiratory chain. This supports the metabolic theory of oxygen sensing in the mitochondria.
ACKNOWLEDGEMENT Supported by T32 HL 07027-23 and R37 HL 43413-8
REFERENCES Biscoe, T.J. and Duchen, M.R., 1990, The cellular basis of transduction in carotid body chemoreceptors. Am.J. Physiol. 258:L271-L278.
Burke, P.V. and Kwast, K.E., 1999, Oxygen dependence of expression of cytochrome c and cytochrome c oxidase genes in S. cerevisiae. Abstract. Oxygen Sensing: Molecule to Man - International ISAC Meeting, June 24-28, Philadelphia, PA. Dukes, I.D., Roe, M.W., Worley I I I , J.F. and Philipson, L.H., 1997, Glucose-induced alterations in cytoplasmic involving the coupling of intracellular stores and plasma membrane ion channels. Current Opinion in Endocrinology and Diabetes 4:262-271.
403
Hand, S.C., 1999, Arrest of gene expression during anoxia in invertebrate embryos: evidence for a mitochondrial oxygen sensor. Abstract. Oxygen Sensing: Molecule to Man, International ISAC Meeting, June 24-28, Philadelphia, PA. Kwast, K . E . , Burke, P.V., Staahl, B.T. and Poyton, R.O., 1999, Oxygen sensing in yeast: Evidence for the involvement of the respiratory chain in regulating the transcription of a subset of hypoxic genes. Pmc. Natl. Acad. Sci. USA 96: 5446-5451.
L a h i r i , S., Itturiaga, R., Mokashi, A., Ray, O.K. and Chugh, D., 1993, CO reveals dual mechanisms of chemoreception in the cat carotid body. Resp. Physiol. 94: 227-240.
Lahiri, S., 1994, Chromophores in
chemoreception: The carotid body model. NIPS 9:
161-165 Melamed-Book, N. and Rahamimoff, R., 1998, The revival of the role of the mitochondrion in regulation of transmitter release. J. Physiol. 509: 2. Mokashi, A., Roy, A., Rozanov, C., Osanai, S., Storey, B.T. and Lahin, S., 1998, High Pco does not alter pHi but raises in cultured rat carotid body glomus cells in the absence
and presence of
Brain Rex. 803: 194-197
Montoro, R.J., Urena, J., Fernandez.-Chacon, R., Alvarez de Toledo, G. and Lopez-Barneo, J.,
1996, Oxygen sensing by ion channels and chemotransduction in single glomus cells. J Gen Physiol. 107: 133-143.
Mulligan, E., Lahiri, S. and Storey, B.T., 1981, Carotid body chemoreception and mitochondrial oxidativc phosphorylation. J. Appl. Physiol. 51:438-446 Roy, A., Rozanov, C., Iturriaga, A. Mokashi, A. and Lahiri, S., 1997, Acid sensing by carotid
body is inhibited by blockcrs of voltage-sensitive calcium channels. Brain Rex. 769: 396399. Rizzuto, R., Pinton, P. Carrington, W., Fay, F.S. Fogarty, K.E., Lifshitz, L.M., Tuft, R.A. and Pozzan, T., 1998, Close contacts with the endoplasmic reticulum as determinants of mitochondrial Ca2+ responses. Science 280: 1763-1766.
Rozanov, C., Roy. A., Mokashi, A., Wilson, D.F., Lahiri, S. and Acker, H., 1999, Chemosensory response to high Pco is blocked by cadmium, a voltage-sensitive calcium channel blocker. Brain Res 833: 1 0 1 - 1 0 7 .
Sorimachi, M., Yamagami. K., Rhee, J.-S., Ishibashi, H. and Akaike, N., 1999, Excitatory effect of Cd2+ on cat adrenal chromaffin cells. Brain Res. 832: 23-30. Warburg, O.H., 1949, Action of carbon monoxide on chemical processes in cells. In Heavy metal prosthetic groups and enzyme action, (translated by Alexander Lawson). Oxford at
the Clarendon Press, pp. 73-89.
Wilson, D.F., Mokashi, A., Chugh, D., Vinogradov, S., Osanai, S. and Lahiri, S., 1994, The primary oxygen sensor of the cat carotid body is cytochrome of the mitochondrial respiratory chain. FEBS Lett. 351: 370-374. Zhu, H. and Bunn, H.F., 1999, Oxygen sensing and signaling: impact on the regulation of physiologically important genes. Resp. Physiol. 115: 239-247.
404
EFFECT OF ADENOSINE ON CHEMOSENSITIVITY Functional, cellular and molecular studies
1 2
P.Kumar, 1A.F.Conway, 1C.Vandier, 1N.J.Marshall, 1J.Bruynseels and G.M.Matthews Department of Physiology and 2 Department of Surgery, The Medical School, University of
1
Birmingham, Birmingham B15 2TT, UK.
1.
INTRODUCTION The adult carotid body chemoreceptor response to hypercapnia is
augmented by hypoxia and gives rise to a characteristic ‘fan’ of stimulus-response curves. This is observed in vivo both in single (Lahiri & DeLaney, 1975) and multi-fibre chemoreceptor preparations (Fitzgerald & Parks, 1971) as well as in vitro (Pepper, Landauer & Kumar, 1995),
demonstrating the interaction to be an intrinsic property of the
chemoreceptor transducer. We have shown that this multiplicative interaction between hypoxia and hypercapnia is absent in neonatal rats (Pepper et al., 1995) where the sensitivity to hypoxia is essentially absent
and have suggested that the well-documented postnatal elevation in peripheral hypoxic chemosensitivity (e.g. Eden & Hanson, 1987) may have
part of its origin in the maturation of the site of stimulus interaction. We have therefore been interested in various substances that can mimic the ability of hypoxia to increase chemosensitivity and describe here the responses to exogenous adenosine.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
405
2.
METHODS AND RESULTS
2.1
In vitro Carotid Body
Carotid bodies were prepared for in vitro recording from afferents in the sinus nerve as described previously (Pepper et al., 1995). In brief, rats (adult weeks postnatal and neonatal days postnatal) were anaesthetised with 2-4% halothane in and both carotid bifurcations removed. Animals were then killed with overdose of anaesthetic and decapitation. The carotid body and sinus nerve was dissected free of connecting tissues and superfused with gassed, bicarbonate-buffered saline at 36-37°C. Single or few-fibre recordings of chemoafferent activity were made using glass suction electrodes. Fibres were designated as chemoreceptor on the basis of exponential responses to hypoxia (adults) or significant responses to hypercapnia (neonates). Basal steady discharge was higher in adults compared to neonates. Increasing in hyperoxia, increased single fibre chemodischarge significantly in both adults and neonates. Basal discharge and
sensitivity were increased (in a dose-dependent and reversible manner) by adenosine. The augmenting effect upon sensitivity of adenosine was found to ca. 1.5x greater in adults than neonates when absolute sensitivities were considered but, if data was normalised to basal levels, then neonatal
sensitivity to adenosine was ca. 2.8x greater than adult. Zero superfusates were prepared by replacing CaCl from solutions and replacing with and ImM EGTA. This abolished the chemoreceptor response to adenosine and virtually abolished basal discharge. Addition of or D600 (methoxyverapamil, ) in -containing superfusates also significantly reduced but to a lesser extent (by ca. 95% and 70% respectively) the chemoreceptor response to adenosine.
2.2
Reflex respiratory responses
The effect of adenosine upon reflex respiratory responses to were examined in anaesthetised body weight) adult, male rats using a Read rebreathing technique (Read, 1967) modified for use in small mammals. Respiration was measured as integrated tracheal airflow. Ventilation (tidal volume x frequency) was increased linearly by increasing and linear regression analysis was used to derive a sensitivity of . Although resting ventilation was decreased by femoral intravenous infusion of adenosine at sensitivity was
406
significantly increased to Bilateral carotid sinus nerve section reduced basal ventilation and did not affect sensitivity in control runs but did prevent the adenosine-mduced elevation in sensitivity seen prior to nerve section.
2.3
Type I cell currents
Isolated type I cells were prepared from adult rats as previously described (Vandier, Conway, Landauer & Kumar, 1999) and the whole-cell patch clamp configuration used to record currents. Mean cell capacitance was Control currents were outward and sustained. Increasing adenosine concentrations decreased outward currents (by up to ca. 35% at ) in a dose-dependent and reversible manner. The adenosine-sensitive component of the whole cell current was determined by subtraction and found to have an activation threshold near The inhibitory effect of adenosine was found to be voltage independent and reduced (by ca. 25%) but not abolished in free (+EGTA) solutions. 5mM 4-aminopyridine (4-AP) significantly reduced outward currents and also abolished the response to adenosine. In current clamp mode, adenosine was without effect upon the resting membrane potential. In a separate series of experiments using the adult in vitro carotid body preparation described above, the effect upon chemodischarge of 5mM 4-AP was examined. In all cases, 4-AP did not significantly alter the basal discharge in hyperoxia In the presence of 4-AP the exponential chemodischarge response to decreasing was retained but although this was right shifted at superfusate below ca. 200mmHg such that discharge at these lower _ levels was increased by 4-AP, this did not reach significance.
2.4
RT-PCR analysis
RNA was extracted from whole carotid bodies excised from adult weeks postnatal, n=10) and neonatal days, n=10) rats whilst under halothane anaesthesia. Primers for adenosine receptor subtypes were designed and mRNA extracted using conventional methods. Reverse transcription (RT) was used to convert mRNA to cDNA and subsequent polymerase chain reaction (PCR) and gel electrophoresis used to detect the presence of receptor. receptor subtype mRNA was found in adult carotid bodies but only was detectable in neonatal tissue. mRNA was not found at either age. In addition, adenosine deaminase mRNA was found only in adult tissue.
407
Preliminary experiments (n=3 fibres) were performed using the in vitro
carotid body preparation to determine the effect of the specific receptor antagonist, ZM241385 (Zeneca Pharmaceuticals), upon chemoafferent sensitivity. Adenosine increased chemosensitivity by as expected. ZM241385 significantly reduced sensitivity in the presence of adenosine to control levels. This effect was not easily reversed by wash.
3.
DISCUSSION These data confirm an excitatory effect of exogenous adenosine upon rat
carotid body chemosensory discharge as had been previously described in the cat both in vivo (McQueen & Ribeiro, 1981) and in vitro (Runold, C’hermack & Prabhakar, 1990). The use of in vitro preparations demonstrates
the action of adenosine to be direct upon chemotransduction and not via its well documented influences upon blood flow. In addition we have demonstrated that adenosine, like hypoxia, can augment carotid body sensitivity in vitro and that this effect can be translated into an observable interaction at the level of ventilation. The contribution of endogenous adenosine to hypoxia-induced discharge was not determined in this study. The results from the PCR study would lead us to expect adenosine to be acting through adenosine receptors and this is confirmed (at least for the adults) by the pharmacological block by ZM241385. This is in part, confirmatory of previous pharmacological studies on chemodischarge in vivo (McQueen & Ribeiro, 1986) as well as ventilatory studies (see Sebastiao & Ribeiro, 1996) and immunohistochemical studies (Weaver, 1993; KaelinLang, Lauterburg & Burgunder, 1998). An adenylate cyclase mediated increase in cAMP has been demonstrated following exogenous and endogenous increases in adenosine (Monteiro, Vera-Cruz & Silva e Sousa, 1996; Chen, Dinger & Fidone, 1997) and the elevation in cAMP induced by hypoxia (Wang, Cheng, Dinger & Fidone, 1989; Perez-Garcia, Almaraz & Gonzalez, 1990; Delpiano & Acker, 1991; Perez-Garcia, Almaraz & Gonzalez, 1991; Wang, Cheng, Yoshizaki, Dinger & Fidone, 1991) can be blocked or increased by adenosine antagonists and adenosine uptake inhibitors respectively.
An interesting and novel finding was that adenosine could increase
carotid body chemosensitivity in neonates as well as adults. This demonstrates that adenosine is at least equipotent in neonates as adults and can augment transduction at an age when the effect of hypoxia is
408
insignificant. The simplest explanation may be that adenosine and hypoxia sensing mechanisms share no commonality although the evidence cited above would argue otherwise. Another explanation may be that, whilst receptors for adenosine are expressed in neonates, hypoxia does not lead to the formation of sufficient endogenous adenosine for their stimulation. We have shown that the action of adenosine on chemodischarge is dependent and that much (although not all) of this elevation in intracellular
is derived from entry through voltage-dependent (L-type) Ca channels. This strongly suggests a pre-synaptic action of adenosine, acting on type I cells. Results from the patch clamp study however, fail to demonstrate any action of adenosine on resting membrane potential and thus the cause of the cell depolarisation required to open voltage-gated Ca channels is not known. In addition, 4-AP, whilst able to block the action of adenosine was also without effect on basal (hyperoxic) chemodischarge. It is possible that an
undetected action on so-called leak or background currents occurred (Buckler, 1997). It is well documented that both and chemotransduction have an absolute requirement for (Shirahata & Fitzgerald, 1991; Roy, Rozanov, R., Mokashi & Lahiri, 1997) and this points to a pre-synaptic action for both stimuli. In a previous study we reported that elevating extracellular
whilst increasing carotid body chemodischarge in vitro, was without effect upon carotid body chemosensitivity. This implies that interaction, whilst occurring presynaptically, may also be occurring prior to cell depolarisation.
4.
CONCLUSION In conclusion, we have shown that adenosine can decrease whole cell
outwards currents of type I cells and is capable of increasing chemodischarge in neonatal as well as adult carotid bodies and can augment carotid body chemosensitivity at both ages, thus distinguishing it from
hypoxia. This effect on
chemosensitivity can be observed at the level of
reflex respiratory responses and is most likely mediated pre-synaptically at receptors of type I cells.
ACKNOWLEDGEMENTS PK is a Lister Institute Research Fellow. We are grateful to the Wellcome Trust for support of this work.
409
REFERENCES B u c k l e r , K. .J. (1997). A novel oxygon-sensitive potassium current in rat carotid body type 1 cells. Journal Of Physiology 498, 649-662. Chen, .J., Dinger, B. & Fidone, S. J. (1997). cAMP production in rabbit carotid body: Role of adenosine. Journal Of Applied Physiology 82, 1771 -1775.
Delpiano, M. A. & Acker, H. ( 1 9 9 1 ) . Hypoxia increases the cyclic-AMP content of the cat carotid-body in vitro. Journal Of Neurochemistry 57, 291-297.
Eden, G J. & Hanson, M. A. (1987). Maturation of the respiratory response to acute hypoxia in the newborn rat. Journal of Physiology 392, 1 -9.
Fitzgerald, R. S. & Parks, D. C. (1971). Effect of hypoxia on carotid chemoreceptor response to carbon dioxide in cats. Respiration Physiology 12, 218-229.
KaelinLang, A., Lauterburg, T. & Burgunder, J. M. (1998). Expression of adenosine A2a receptor gene in rat dorsal root and autonomic ganglia. Neuroscience Letters 246, 21-24.
Lahiri, S. & DeLaney, R. G. (1975). Stimulus interaction in the responses of carotid body chemoreceptor single afferent fibers. Respiration Physiology 24, 249-266.
McQueen, D. S. & Ribeiro, J. A. (1981). Effect of adenosine on carotid chemoreceptor activity in the cat. British Journal Of Pharmacology 74, 129-136. McQueen, D. S. & Ribeiro. J. A. (1986). Pharmacological characterisation of the receptor involved in chemoexitation induced by adenosine. British Journal of Pharmacology 88, 615-620. Monteiro, K. C.. Vera-Cruz, P. & Silva e Sousa, M. A. (1996). Adenosine increases the cAMP content of the rat carotid body in vitro. Advances in Experimental Medicine and Biology 410, 299-303.
Pepper, D. R., Landauer, R. C. & Kumar, P. (1995). Postnatal development of interaction in the rat carotid body in vitro. Journal of Physiology 485, 531-541.
Perez-Garcia, M. T., Almaraz, L. & Gonzalez, C. (1990). Effects of different types of stimulation on cyclic-AMP content in the rabbit carotid body: functional significance. Journal of Neurochemislry 55, 1287-1293. Perez-Garcia, M. T., Almaraz., L. & Gonzalez, C. (1991). Cyclic-amp modulates differentially the release of dopamine induced by hypoxia and other stimuli and increases dopaminc synthesis in the rabbit carotid-body. Journal Of Neurochemistry 57, 1992-2000. Read, D. J. C. (1967). A clinical method for assessing the ventilatory response to carbon dioxide. Australasian Annals of Medicine 16, 20-32. Roy, A., Rozanov, C . , R., I., Mokashi, A. & Lahiri, S. (1997). Acid-sensing by carotid body is inhibitied by blockers of voltage-sensitive channels. Brain Research 769, 396-399.
Runold, M., Chermack, N. S. & Prabhakar, N. R. (1990). Effect of adenosine on isolated and superfused cat carotid-body activity. Neuroscience Letters 113, 111-114. Sebastiao, A. M. & Ribeiro, J. A. (1996). Adenosine A2 receptor-mediated excitatory actions on the nervous system. Progress in Neurobiology 48, 167-189.
Shirahata, M. & Fitzgerald, R. S. (1991). Dependency of hypoxic chemotransduction in cat carotid-body on voltage-gated calcium channels. Journal Of Applied Physiology 71, 10621069.
Vandier, C., Conway, A. F., Landauer, R. C. & Kumar, P. (1999). Presynaptic action of adenosine on a 4-aminopyridine sensitive current in the rat carotid body. Journal of Physiology 515, 419-429. Wang, W. J., Cheng, G. F., Dinger, B. G. & Fidone, S. J. (1989). Effects of hypoxia on cyclic-nucleotide formation in rabbit carotid-body invitro. Neuroscience Letters 105, 164168.
Wang, W. J., Cheng, G. F., Yoshizaki, K., Dinger, B. & Fidone, S. (1991). The role of cyclicA M P in chemoreception in the rabbit carotid-body. Brain Research 540, 96-104. Weaver, D. R. (1993). A2a adenosine receptor gene expression in developing rat brain. Molecular Brain Research 20, 3 13-327.
410
THE PRESENT STATUS OF THE MECHANICAL HYPOTHESIS FOR CHEMORECEPTOR STIMULATION Ashima Anand and A.S. Paintal DST Centre for Visceral Mechanisms, Vallabhbhai Patel Chest Institute, Delhi University,
Delhi-110007
S UMMARY
Reasons are given to show why the transmitter based hypothesis for the stimulation of chemoreceptors needs to be reviewed. On the other hand evidence is presented to show that chemoreceptors can be stimulated by various
mechanical stimuli and how the local
can be sensed by the type I I cell which
by getting mechanically deformed causes this cell to shrink. This shrinkage is
transmitted to the generator region of the nerve terminal thereby leading to the production of propagated impulses at the regenerative region thus making the whole process of generation of information about the local similar to the generation of sensory information by other sensory receptors.
1.
INTRODUCTION
At present there are two main hypotheses that attempt to account for the stimulation of chemoreceptors by hypoxia, the transmitter based hypothesis
(see papers in Zapata et al. 1996) and the mechanical distortion hypothesis (Paintal, 1967; Anand & Paintal, 1992). According to the first hypothesis it is hypothesized (e.g. see Buckler, 1996) that the depolarization of the type I cell by hypoxia, attributed to inhibition of potassium channels, causes the release of a transmitter by the type I cells which stimulates the sensory terminal of the chemosensory fibres of the carotid and aortic nerves. The larger the amount of transmitter, the greater the chemosensory discharge. According to this hypothesis it is presumed that the transmitter must act on the generator region of the sensory terminal resulting in the production of nerve impulses at the regenerative region which propagate centrally. However, it follows from the review by Hamill & McBride (1996) that the commonly postulated transmitter
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
411
substances and putative neurotransmitters such as acetylcholine cannot produce their effects through an action at the generator region, as this region is not sensitive to the usual transmitter substances such as Ach. The most important point that has been overlooked so far (Paintal, 1967; l968b; 1976a; Anand & Paintal, 1992) is, that according to the transmitter based hypothesis it must follow that large quantities of neurotransmitters must continue to be produced even after the cat has been killed by ventilating it with nitrogen. This is highly unlikely. In view of this conclusion we have reexamined the effects of certain mechanical stimuli on stimulating chemoreceptors.
2.
METHODS
Cats were anaesthetized either with chloralose or with sodium pdntobarbitone A catheter was inserted into the saphenous vein for injection of drugs and fluids. A cannula was inserted into the trachea through which the cat was ventilated with various gas mixtures with a respiratory pump. Impulses from chemoreceptors were recorded from slips of the aortic nerve just before it joined the vagus near the superior laryngeal
nerve. For this, a preamplifier (Tektronix type 122 or Iselworth type 102) was
used. Alternatively in the case of carotid chemoreceptors the carotid nerve was dissected as far away from the carotid body (see, Paintal 1968) as possible to help maintain the inner environment of the carotid body as close to its natural inner environment as in the case of the aortic bodies which were exposed to the intrathoracic environment only. For this reason aortic chemoreceptors were preferred for the study. The intrapleural pressure (IPP) was recorded with an intrathoracic needle.
Other details such as those relating to recording expanded impulses on vertical sweeps were similar to those described in earlier papers (e.g. Paintal, 1971; Anand & Paintal, 1980; 1988).
3.
RESULTS & DISCUSSION
We recorded impulses from many aortic chemoreceptors identified by the usual commonly used criteria i.e., that the irregular sparse activity in them, when the cat was ventilated with air, did not have either respiratory or cardiac rhythm while the cat was ventilated with air or a hypoxic mixture of gases. Therefore fibres that had a noticeable cardiac rhythm were discarded, to eliminate recording from carotid or aortic baroreceptors as, presumably, done by most chemoreceptorologists who have recorded from single units in the
past. We encountered one aortic chemoreceptor which we identified as usual i n i t i a l l y but which, for unknown reasons acquired a pulsatile rhythm at a later stage of the experiment. This receptor whose fibre was medullated (conduction velocity, as shown in Fig.l C was inactive while being ventilated 412
with air. After being ventilated with 4 % oxygen for 1½ min the activity (Fig. 1D) appeared but this was transient because its pulsatile activity disappeared shortly thereafter (Fig. IE). Such receptors as shown in Fig.l are, perhaps, not unusual because they have been encountered before and apparently discarded by certain other investigators (see Lee et al. 1964) without having taken note of the possibility, that a chemoreceptor was being stimulated by mechanical
events linked to the pressure pulse or the movements of the heart. The latter would not be involved in the case of carotid chemoreceptors but as shown in Figs.3&5, pressure pulses can stimulate chemoreceptors directly.
Indeed out of about ten filaments dissected out from aortic or carotid nerves in seven cats we recorded impulses from about twelve chemoreceptors that could be stimulated by application of mechanical stimuli either directly near the carotid body or indirectly by stimuli transmitted by pressure pulses through blood vessels or through changes in the intrathoracic pressure. From such observations (e.g. Figs. 1,2,3&5) we have gathered the impression that many chemoreceptors can be stimulated by local mechanical deformation, provided the mechanical stimuli are applied in a way suitable for the receptor concerned. 413
Assuming, that as a result of the above facts it is established that
chemoreceptors are can be stimulated by stimuli that distort them mechanically, it is now necessary to determine how, and in what way they are distorted, so that impulses are generated at chemoreceptors during hypoxia.
414
415
We may first consider the situation when the local is zero after circulatory arrest at a time when there is considerable activity in the chemoreceptors (Paintal, 1967) (Fig.4) How does this activity come about? During circulatory arrest intracellular fluid will move out into the extracellular space because of marked reduction of pressure. Presumably the cells, including the type II cell must shrink. Eyzaguirre et al (1983) concluded that the same happens when the osmolality of the fluid bathing the glomus which depolarizes the glomus cells is increased leading to stimulation of the chemoreceptors (see Fig. 7 in Gallego et al, 1979) (i.e. water moves out of the cell). This distortion of the type II cell arising out of the shrinkage of the cell could be transmitted to the nonmedullated portion of the sensory chemoreceptor fibre and this mechanical distortion (i.e. shrinkage) could produce the generator potential that leads to the production of the propagated impulse at the regenerative region of the nerve terminal. Such events could account for the chemoreceptor impulses during hypoxia.
416
Convincing evidence has already been provided (Anand & Paintal, 1990) to show that the arterial is not the stimulus for the chemoreceptors, but the local is.This depends on the oxygen availability, that is determined by the oxygen consumption mainly of the type I cell i.e. the metabolic cell (Fig. 6) on the one hand and the oxygen capacity of the blood on the other. The sensor for the local is assumed to be the type II cell (Paintal, 1967). If oxygen consumption by the metabolic cell is slowed by reducing the temperature then the speed of response of the chemoreceptors is slowed as shown in Fig.3 in Paintal, 1971. From the point of view of chemoreceptor stimulation it should be remembered that the atmospheric does not change naturally/nor does the oxygen capacity of the blood change physiologically. Therefore the only stimulus that can stimulate the chemoreceptors physiologically is fall in blood pressure (cardiac output) such as during postural changes in cardiac output and blood pressure. The events leading to the stimulation of chemoreceptors by a fall in blood pressure have been described already (Anand & Paintal, 1992) and it is possible that this fall in BP may be the major natural physiological stimulus for the chemoreceptors. From what is already known and described, it seems that the stimulation of chemoreceptors by mechanical distortion i.e. shrinkage of the type II cell leading to the production of the generator potential could be similar to the general sensory processes in various sensory receptors discussed and as pointed out already (Paintal, 1976b), it is likely that mechanical transmission of information of the outside world is a general phenomenon that needs to be recognized soon, in order that rapid advances in this field can take place.
REFERENCES Anand, A. & Paintal, A.S. (1980). Selective stimulation of the J receptors in the cat. J. of Physiol. 299: 553-572. Anand, A. & Paintal, A.S. (1988). The influence of the sympathetic outflow on aortic chemoreceptors of the cat during hypoxia and hypercapnia. J. Physiol. 395: 215-231. Anand, A. & Paintal, A.S. (1990). How real is the relation of arterial to chemoreceptor activity?. "In Arterial Chemoreceptors," eds. C. Eyzaguirre, S.J., Fidone, R.S., Fitzgerald, S. L a h i r i , & D.M. McDonald, eds., Springer-Verlag, New York pp 260-269. Buckler, K.J. (1996) Role of potassium channels in hypoxic chemoreception in rat carotid body lypc-l cells. In "Frontiers in Arterial Chemoreception." eds. P., Zapata, C. Eyzaguirre, & R.W. Torrance, Plenum press, New York, pp 83-87. Eyzaguirre, C., Monti-Block, L., Hyashida, Y. & Baron, M. (1983). Biophysics of the carotid body receptor complex. I n "Physiology of the Peripheral Arterial Chemoreceptors" ed. H. Acker, & R.G. Oreagan, Elsevier Science Publishers BV, Amsterdam, pp 60-87. H a m i l l , O.P. & McBride, Jr. D.W. (1996) The pharmacology of mechanogated membrane ion channels. Pharm.Rev. 48: 231-252.
417
Joels, N. & Neil, E . (1963). The excitation mechanism of the cartid body. Brit. Med. Bull. 19: 21-24. Landgren, S. & Neil, E. (1951). Chemoreceptor impulse activity following haemorrhage. Acta physiol. scand. 23: 158-167. Lee, K.D., Mayou, R.S. & Torrance, R.W. (1964). The effect of blood pressure upon chemoreceptor discharge to hypoxia, and the modification of this effect by the sympathetic adrenal system. Q. J. Exp. Physiol. 49: 171-183. P a i n t a l , A.S. (1967). Mechanism of stimulation of aortic chemoreceptors by natural stimuli and chemical substances. J. Physiol. 189: 63-84. Paintal, A.S. (1968a). The possible influence of the external environment on the responses of chemoreceptors In "Arterial Chemoreceptors", cd. R.W. Torrance, Oxford, Blackwell pp. 149-151. Paintal, A.S. (1968b). Some considerations relating to studies on chemoreceptor responses. In "Arterial Chemoreccptors," ed. R.W., Torrance, Oxford: Blackwell, pp. 253-260. Paintal, A.S. ( 1 9 7 1 ) . The responses of chemoreceptors at reduced temperatures. J. Physiol. 217: 1-18. Paintal, A.S. ( I 9 7 6 a ) . Mechanical transmission of sensory information at chemoreceptors. In "Morphology and Mechanisms of Chemoreceptors", ed. A.S., Paintal, Delhi, Vallabhabhai Patel Chest Institute pp. 121-129. Paintal, A.S. (1976b). Natural and paranatural stimulation of sensory receptors. In "Sensory Functions of the Skin," Wenner-Gren vol. 27: Y. Zotterman, Y. Pergamon Press, Oxford, pp 3-13. Zapata, P., E y a g u i r r e , C. & Torrance, R.W. (1996). "Frontiers in Arterial Chemoreception", Plenum Press, New York.
418
IDENTIFICATION OF AN OXYGEN-SENSITIVE POTASSIUM CHANNEL IN NEONATAL RAT CAROTID BODY TYPE I CELLS Beatrice A. Williams and Keith J. Buckler University Laboratory of Physiology, Parks Road, Oxford, OXI 3PT, U.K.
1.
INTRODUCTION
The type 1 cell of the carotid body is the principal peripheral sensor of blood pH, carbon dioxide and oxygen. A stimulus, such as a reduction in oxygen, elicits a rapid rise in intracellular calcium (Biscoe and Duchen, 1990), followed by neurosecretion. The rise in calcium has been shown to be a result of membrane depolarization and activation of voltage-gated calcium channels (Buckler and Vaughan-Jones, 1993, 1994). The closure of channels is believed to be responsible for membrane depolarization, and several voltage-gated channels have been identified in type I cells. In adult rabbit type I cells, Lopez-Lopez et al. (1989) reported a 40 pS voltage-gated channel. This channel was inhibited by both 5 mM tetraethylammonium (TEA) and 1 mM 4-aminopyridine (4-AP) and was shown to be sensitive even in excised patches (Ganfornina and Lopez-Barneo, 1991). In neonatal rat cells, a charybdotoxin-sensitive, type channel, having a conductance of 190 pS, in symmetrical was found to be (Peers, 1990; Wyatt and Peers, 1995). Although the effects of hypoxia on these channels are well substantiated, their role in chemotransduction is uncertain. TEA, 4-AP and charybodotoxin, which inhibit these currents, fail to excite the intact carotid body (Doyle and Donnelly, 1994; Cheng and Donnelly, 1995), or elevate intracellular calcium levels in isolated cells (Buckler, 1997). Furthermore,
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
419
both are voltage-gated and show little activity at potentials more negative to
More recently, another type of current has been identified, using perforated-patch whole-cell recording, in neonatal rat cells (Buckler, 1997). This current is carried principally by potassium ions, is voltage and time-independent, insensitive to 10 mM TEA, and 5 mM 4-AP, and has a graded sensitivity to oxygen. Inhibition of the current occurs at below 40 Torr-with a of 12 Torr. This corresponds well with the sensitivity of carotid sinus nerve discharge in intact carotid bodies (Lahiri et al., 1993), and with the sensitivity of intracellular calcium levels in isolated type I cells (Biscoe and Duchen, 1990, Buckler and Vaughan-Jones, 1994). In this paper, we describe an channel in neonatal rat type I cells which may be responsible for the sensitive whole-cell current described by Buckler (1997).
2.
METHODS
Type I cells were isolated from carotid bodies of neonatal rats, 11 to 16 days old. The cell isolation procedure was as described in Buckler and Vaughan-Jones (1993). Isolated cells were plated onto glass coverslips coated with poly-D-lysine and maintained in Hams F-12 culture medium (supplemented with 10% heat inactivated foetal calf serum, 100 U/ml penicillin, streptomycin and 84 U/l insulin), for up to 8 hours before use. Experiments were performed using the cell-attached and inside-out configuration of the patch-clamp technique. Data were acquired at 10kHz and filtered at 2kHz, using an Axopatch 200B amplifier, Digidata 1200 and pClamp software. Electrodes were made from Clarke borosilicate glass, coated with Sylgard (Dow Corning) and fire polished before use. Electrodes were between and seals were In the cell-attached patch, the potential across the membrane is the difference between the resting potential of the cell and the potential applied to the inside of the pipette Pipette potentials are reported for cellattached patches. Membrane potentials are reported for all other data. During seal formation and in cell-attached patches, cells were bathed in standard bicarbonate buffered Tyrode solution (mM): 117 NaCl, 4.5 KC1, 23 and 11 glucose, which was bubbled with 5% and 95% air. The extracellular pipette solution for both cellattached and inside-out patches contained EGTA, 10 HEPES, and 10 TEAC1, pH 7.4 with KOH. Final pipette concentration was 146 mM. To test the selectivity of the channel, NaCl
420
or NMDG was substituted for KC1 in the pipette. For testing anoxia on cellattached patches, the bath contained a modified calcium-free, bicarbonatebuffered Tyrode solution containing (mM): 100 KC1, 17 NaCl, 23 3.5 and 11 glucose and was bubbled with 5% and 95% air (control) or 95% (anoxia). Anoxic solutions also contained Inside-out intracellular solutions contained EGTA, 10 HEPES, 10 glucose, pH 7.2 with KOH. Final intracellular concentration was 152 mM. Experiments were conducted at 29°C to 32°C. Mean values are expressed
3.
RESULTS
In the cell-attached configuration, the most commonly observed channel was a flickering channel having a linear current-voltage relationship of slope pS and a reversal potential of mV pipette potential ( figure 1). In the inside-out configuration, the current-voltage relationship had a linear slope of The Goldman-Hodgkin-Katz (GHK) equation could be fitted to the inside-out data and gave a coefficient of and conductance at of 14.8 pS. Substituting NaCl for KC1 in the pipette lead to a shift in the reversal potential consistent with a selective channel. In the cell-attached configuration, the pipette reversal potential was shifted in the positive direction. With and in the pipette, the reversal potential was shifted to The reversal potential was obtained by linear regression of 3 to 9 points nearest the zero current point. There was no significant difference in the current-voltage relationship when NMDG, instead of was substituted for These results suggest that the channel is not significantly permeable. Channel activity (NP) was not time dependent, nor significantly voltage dependent within the physiological range of potentials. Outward currents, however, were more difficult to measure, having a much more variable amplitude. Above the open probability appeared to increase in both cell-attached and inside-out patches. We believe this may be due to the presence of a second outwardly rectifying channel. A few recordings had clearer outward currents suggesting fewer contaminating channels. Furthermore, channels open in the outward direction, of smaller amplitude, have been observed in the absence of inward currents. Attempts to completely separate the channels, however, have so far been unsuccessful.
421
422
All recordings were done in the presence of 10 mM TEA in the pipette. Removing TEA had no effect on the appearance of the single channels, although outward recordings contained more contaminating currents. This suggests that the channel has little sensitivity to extracellular TEA. Increasing free intracellular from 0.03 nM (control) to without changing intracellular had no significant effect on channel activity
The channel was clearly inhibited by anoxia in the cell-attached patch. Mean channel activity in anoxia was of that in control at 70 mV pipette potential. This amount of inhibition is consistent with that previously reported for whole-cell currents (Buckler, 1997).
4.
DISCUSSION
This report shows that a flicking : channel of 14 pS amplitude is present rat neonatal rat carotid body type I cells. This channel is insensitive to 10 mM TEA. Channel activity was not time dependent, and within the physiological range of voltages, channel activity was not significantly voltage dependent. The characteristics of this channel are distinct from those of other channels previously described. The results are consistent with the idea that this channel is responsible for the
current observed by Buckler (1997) in perforated patch
recordings. Evidence suggests it may be a member of the newly, described tandem-pore domain family.
ACKNOWLEDGEMENTS This work was supported by the British Heart Foundation.
REFERENCES Biscoe, T.J., and Duchen, M.R., 1990, Responses of type I cells dissociated from the rabbit
carotid body to hypoxia. J. Physiol. (Lond.) 428: 39-59. Buckler, K.J., and Vaughan-Jones, R.D., 1993, Effects of acid stimui on intracellular calcium in type I cells of the neonatal rat carotid body. Pflngers Archiv 425: 22-27.
Buckler, K.J., and Vaughan-Jones, R.D., 1994, Effects of hypoxia on membrane potential and i n t r a c e l l u l a r calcium in rat neonatal carotid body type I cells.J. Physiol. (Lond.) 476: 423428.
Buckler, K.J., 1997, A novel oxygen-sensitive potassium current in rat neonatal rat carotid body type I cells. J Physiol. (Lond.) 498: 649-662.
423
Cheng, P.M., and Donnelly, D.F., 1995, Relationship between changes of glomus cell current and neural response of rat carotid body. J. Neurophysiol. 74: 2077-2086. Doyle, T.P., and Donnelly, D.F.,1994, Effect of and channel blockade on baseline and anoxia-induced catecholamine release from rat carotid body. J.Appl Physiol. 77: 2606-2611. Duchcn, M.R., Caddy K.W., Kirby, G.C., Patterson D.L., Ponte J., and Biscoe, T.J., 1988,
Biophysical studies of the cellular elements of the rabbit carotid body. Neuroscience 26: 291-311. Ganfornina, M., and Lopez-Barneo, J., 1991, Single channels in membrane patches of arterial chemoreceptor cells are modulated by tension. Proc. Natl. Sci. USA 88: 29272930. L a h i r i , S., Rumsey, W.I.., Wilson, D.F., Iturriaga, R., 1993, Contribution of in vivo microvascular in the cat carotid body chemotransduction. J. Appl. Physiol. 75: 103543 Lopez-Lopez, G o n z a l e z , C., Urena, J., and Lopez-Barneo, J., 1989, Low selectively i n h i b i t s K channel activity in chemoreceptor cells of the mammalian carotid body. J. Gen. Physiol 93: 1001-1015. Peers, ('., 1990, Hypoxic suppression of currents in type I carotid body cells: selective effect on the curent. Neurosci. Letts. 119: 253-256.
Wyatt, C.N., and Peers, C., 1995,
channels in isolated type I cells of the
neonatal rat carotid body. J Physiol. (Lond.) 483: 559-565.
424
SIGNIFICANCE OF ROS IN OXYGEN CHEMORECEPTION IN THE CAROTID BODY CHEMORECEPTION Apparent Lack Of A Role For NADPH Oxidase A. Obeso, G. Sanz-Alfayate, M.T. Agapito,and C. Gonzalez Departamento de Bioquimica y Biologia Moleculary Fisiologia, IBGM-CSIC, Universidad de Valladolid, 47005 Valladolid, Spain
1.
INTRODUCTION
1.1
General Background on ROS
Free radicals are defined chemically as atoms or molecules having one or more unpaired electrons. In biological systems the most important are oxygen free radicals, and include the superoxide anion the hydroxyl radical lipid and other peroxyl radicals However, free radicals
form part of a greater group of molecules, frequently called reactive oxygen species (ROS), all of which are more strong oxidants than molecular oxygen. These include, in addition to hydrogen peroxide singlet oxygen lipid peroxide (LOOH) and hypochlorous acid (HOC1). It should be noted that and may in some circumstances act as reducing agents, and thereby we should avoid the term “oxidant” to refer to ROS. In recent years the discovery of the importance of nitric oxide in biological systems has
broadened the interest to include nitrogen centered free radicals and reactive nitrogen species (RNS) (Lander 1997). Free radicals and ROS are generated in normal cell metabolic processes. Normal oxygen reduction to water in the mitochondrial electron transport chain, oxidative reactions such as those involving cytochrome P450 and the NADPH oxidase catalyzing one electron reduction of oxygen to superoxide in leukocytes are probably the most relevant
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
425
physiological processes generating ROS. In addition, xanthine oxidase is a major source of ROS in episodes of ischaemia/reperfusion. The interest in free radicals, and for that matter for ROS, has been centered on their toxic effects. They are very reactive. Their reaction with lipids in the plasma membrane can lead to cell membrane destruction, and their reaction with proteins leads to inactivation or inhibition of their normal function. In addition, ROS produced in neutrophils and macrophages play a critical role in inflammation and host defense against microorganisms (Halliwell 1988, Punchard and Kelly 1996; Halliwell and Gutteridge 1999). The physiological origin of ROS and their potential devastating effects would explain, from a teleologieal stand point, the need for protection against these harmful molecules to assure cell survival. In fact cells are furnished with a great number of antioxidants and have developed specific enzymatic systems to dispose of ROS which include superoxide dismutases (SOD), catalase and peroxidases, especially glutathione peroxidase (Halliwell 1988, Halliwell and Gutteridge 1999). In recent years, however, the interest in ROS and RNS has gone beyond the physiopathological interest. ROS and RNS are considered by many researchers as intracellular messengers accomplishing truly physiological functions. In spite of the very short life of some of these molecules and their apparent indiscriminate reactivity, it has been proposed that ROS and RNS might act as true messengers in some very important cellular functions. A long list of physiological functions potentially controlled by ROS may be found in Lander (1997), Nakamura et al. (1997) and Halliwell and Gutteridge (1999). It is important to recall (see Lander, 1997), that in order to accept ROS as second messengers in a given cellular function it is needed to identify the extracellular signal(s) leading to activation of the ROS generating systems, the mechanisms of such activation, the targets of the ROS species and the cellular responses elicited by those effectors. A final word is needed at the conclusion of this general background, namely that cells that might use ROS as messengers needed to defend themselves against the potential harmful effects of these signals. It might be enough to recall that in many cell types there is a parallel activation/induction of the ROS generating systems and enzymes capable of defending themselves from the increased levels of reactive species. Restricting this consideration to eukaryotic cells, it should be emphasized that manganese-SOD, glutathione-S-transferase, thioredoxin/thioredoxin reductase and glucose-6-phosphate dehydrogenase have been described to be induced by ROS (Nakamura et al. 1997).
1.2
Sensing and Signaling. Putative Role of ROS
Oxygen sensing is a function that has probably evolved with the emerging of the currently atmosphere, and it is not unreasonable to
426
state that all living cells possess detection-reaction systems to adapt to perturbation in oxygen concentrations in their environment (Bunn and Poyton 1996). We shall restrict our consideration to eukaryotic cells in higher animals. Every mammalian cell is sensitive to alterations in the levels of normally encountered in their environment. Excess of is not a situation that nature normally creates. However, medical intervention can produce hyperoxic environments to cells. The excess of leads to increase in ROS. As mentioned above cells have a repertoire of antioxidant molecules and enzymes, susceptible of induction, that eventually allows them to cope with the hyperoxic stress (see above). The physiologically and physiopathologically relevant alteration in
levels is hypoxia, i.e., the decrease in in the cells environment. Talking of in hypoxia is a very complicated matter. While most extracellular signals act solely as messengers, having no function independent of their interaction with a receptor, central role in metabolic respiration might be dominant over its role in signaling via an (Bunn and Poyton 1996). This means that special attention must be paid to truly distinguish general cellular effects resulting from impairment of the metabolism in hypoxia from those effects arising from the detection of deficiency at the level of an and generated via a specific transduction cascade: both types of cellular effects or responses might be coincident, and thereby add, or in extreme hypoxia (or equivalent mitochondrial poisoning with they might oppose and cancel each other. When referring to higher animals, an alternative way of stating this concept, is to distinguish general sensitivity to hypoxia expressed by all cells, from sensitivity to hypoxia restricted to only a few cell types which are capable of generating adaptative responses directed to cope with the stress imposed by hypoxia in the entire organism. The cell types endowed with this specific sensitivity to hypoxia are carotid body (CB) chemoreceptor cells, erythropoietin producing cells and pulmonary artery smooth muscle cells (Gonzalez et al. 1995, Gonzalez 1998). These three cell types are involved in regulation loops aimed to restore availability to the entire organism. These three cell types have arterial thresholds of around 70-75 mmHg (Reeves et al. 1979), implying that they are activated to defeat body hypoxia even before there is a significant drop in blood oxygen content (adaptative character of the response). A second important property of these three cell types is that they remain active as long as hypoxia persists, and increasingly active as the intensity of hypoxia progress; this property contrasts with the behavior of most cells in which hypoxia tends to reduce to a minimum cell functions to assure cell survival, and implies that the three cell types under consideration must be furnished with metabolic machineries capable of supporting maximal function during hypoxia. Finally, and to emphasize the adaptative character of the responses they generate, these three cell types are
427
the ones that allow animals including humans to live for their entire life-span
and from generation to generation at low barometric pressures, where inspired is low and animals live permanently in hypoxia. This latter fact, coupled to the above mentioned threshold of the response for these three cell types, has determined that the specific sensitivity to hypoxia under consideration has also
been named sensitivity to physiological hypoxia (Gonzalez 1998). Although the present article is centered on chemoreceptor cells of the CB, it should be
clearly stated that ROS have been proposed to be involved in
sensing and
signaling in the three cell types endowed with sensitivity to physiological hypoxia (see Gonzalez 1998). Known facts about the low signaling in chemoreceptor cells include the presence in these cells of channels (Lopez-Lopez and Peers, 1997; Buckler, 1999) and the dependence of
the cells response to hypoxia on
entering from the extracellular space via
voltage-dependent channels (Obeso et al. 1992, Gonzalez et al. 1993). These facts have led to the proposal of a minimal schema for chemoreception at low (see Gonzalez et al., 1992, 1994) which is accepted by most researchers and depicted in Figure 1. There are, however, disagreements among researchers about specific aspects of each of the steps depicted in the schema. Restricting our considerations to the initial steps of the process, i.e., to the mechanisms of
sensing, it is possible to summarize current views as shown in Figure 2.
Some authors view sensing as a process independent of utilization by the cells implying that there should exist a discrete molecule acting as an in the very same manner that there exist receptors for hormones or neurotransmitters; two types of sensors have been proposed (Figure 2A). Other authors consider sensing linked to utilization, so that products or
428
byproducts of metabolism are the triggers of the chemoreception cascade depicted in Figure 1. Again two alternative possibilities have been proposed (Figure 2B). The first one, a decrease in ROS production due to a hypothetical slowing of the mitochondrial electron transport seems unlikely because in fact
chemoreceptor cells are activated by hypoxia and the rate of full oxidation of glucose by the CB (i.e., the rate of utilization) increases during hypoxia (Obeso et al., 1993; see Obeso et al. 1997). In the present work we have tested the second alternative in Figure 2B by studying the effects of different
inhibitors of NADPH oxidase on the release of neurotransmitters by chemoreceptor cells. If the proposal is correct it could be predicted that the inhibitors of the oxidase would mimic hypoxia, and therefore they should produce an increase in the release of neurotransmitters as hypoxia does. Another prediction would be that full pharmacological inhibition of the oxidase would occlude the response of chemoreceptor cells to hypoxia.
429
2.
MATERIAL AND METHODS
The study has been performed in intact CB isolated form adult rabbits. Catecholamine (CA) deposits in chemoreceptor cells were labeled by incubating the CBs with the natural precursor of those biogenic amines. Once CA deposits were labeled, the CBs were incubated in precursor-
free incubating solutions which were periodically collected and analyzed for their content of
The detailed description of the labeling procedure,
collection of the incubating solutions (samples) and analytical procedures have been described in detail in previous publications (Almaraz et al., 1986; Obeso et al., 1992). Specific details on the application of drugs and hypoxic stimulus and on sample collections will be given below in the Results section.
3.
RESULTS AND DISCUSSION As proposed by Acker and Xue (1995) and shown in Figure 2B, a
decrease in the production and levels of ROS due to the slowing of the activity of NADPH oxidase would be at the origin of the activation chemoreceptor cells
by hypoxia. As indicated in the Introduction, a prediction from the model is
that inhibitors of NADPH oxidase should produce activation of chemoreceptor cells by the same mechanisms hypoxia itself, e.g., they should induce a dependent release of (see Obeso et al., 1999). Figure 3 shows that out of the three NADPH oxidase inhibitors tested (diphenyleneiodonium, DPI, ; phenylarsine oxide, PAO, ; and, neopterin, ) at concentrations capable of fully or nearly fully inhibiting the enzyme, only DPI was able to activate the release of from the CB. These findings can be
interpreted in at least two different ways: one, that out of the three drugs tested only DPI is a real inhibitor of NADPH oxidase in the CB, and thereby it is the
only one capable of activating chemoreceptor cells mimicking hypoxia; and, two, the three drugs are inhibitors of NADPH oxidase and the ability of DPI to activate chemoreceptor cells is a side-effect, an action of DPI unrelated to NADPH oxidase inhibition. Although the three drugs used at the concentrations tested in the present study inhibit NADPH oxidase in full in several systems (e.g., Cross et al., 1990; Kojima et al., 1993; Le Cabec and Marindonneau-Parini., 1995), we performed a new group of experiments in which we tested the effects of the three inhibitors on the response to hypoxia. The rationale was: if DPI is the only effective inhibitor of NADPH oxidase it should be the only drug capable of occluding the response to hypoxia and neopterin and PAO should not affect
the response to hypoxia. The results shown in Table 1 indicate that this was not the case, none of the inhibitors affected the response to hypoxia, indicating that
430
431
the inhibition of NADPH oxidase is not related to chemoreception. These findings, in conjunction with those of Figure 3, strongly suggest that the activation of chemoreceptor cells produced by DPI is unrelated to its action as an inhibitor of NADPH oxidase, being therefore an spurious effect of the drug in chemoreceptor cells. Certainly, the findings presented here indicate that the presumable (Cross et al., 1990; see Acker and Xue 1995) decrease in ROS production due to inhibition of NADPH oxidase by hypoxia in chemoreceptor cells is not a critical mechanism in chemoreceptor cell activation. A decrease in ROS production due to a slowing of the respiratory chain during hypoxia is conceptually difficult to accept because chemoreceptor cells are activated in a non-adaptative manner by hypoxia, and the support of a sustained state of activation requires increased metabolic rates (Yarowsky and Ingvar, 1981). Consistent with these notions it has been observed that hypoxic stimulation of the CBs causes an ouabam-sensitive increase in the rate of glucose oxidation (Obeso et al., 1993; see Obeso et al., 1997), and as a consequence an increase, rather than a decrease of mitochondrial ROS production during hypoxia should be expected. In this regard, it should be noted that Höhler et al. (1999) have observed that hypoxia increases the levels of ROS in the neuroblastoma sensitive PC 12 cells. Therefore, the models of in CB chemoreceptor cells based on are difficult to maintain in their actual formulation (see Figure 2B). Following these considerations, we are forced to ask if the hypoxic situations activating the CB chemoreceptor cells in l i v i n g animals (corresponding to arterial in the range of 70 mmHg and clown to 25-30 mmHg) produce a sustained “reduced” status of the cells, and if so if the “reduced” status of the cells is relevant to decrease in the opening probability of channels. It is conceivable that some transient changes in the quotients take place during hypoxia in chemoreceptor cells as a mechanism contributing to generate the increased metabolic rate associated with the cell activation (see Obeso et al., 1997). In addition, it is well known that many types of channels change their gating properties as a function of the redox status of the preparation (for a review see Haddad and Jiang 1997), although not always in the correct direction for the hypothesis (Thuringer and Findlay 1997). In addition, we have recently shown that channel “reduction” and are not equivalent. In transient translection systems we have observed that while some reducing agents were able to regulate several kinetic properties of transient currents of shaker and Kv4.2 channels coexpressed with the regulatory subunit, only the coexpression system was sensitive to low (Pérez-Garcia et al., 1999). In conclusion, the present study shows that NADPH oxidase does not play a significant role in sensing in CB chemoreceptor cells. Previously published data and more recent findings presented in this Symposium tend to question a
432
role for ROS in sensing in the CB chemoreceptor cells. Finally, the notion of equivalence of “reduced” status of ion channels and regulation of their properties also seems to require to be revised.
ACKNOWLEDGEMENTS The present work has been supported by grants of the Spanish DGICYT (PB97/400) and of Junta de Castilla y León (VA08/99).
REFERENCES Acker, H., and Xue, D., 1995, Mechanisms of sensing in the carotid body in comparison with other O2-sensing cells. News Physiol. Sci. 10:211-215. Almaraz, L., Gonzalez., C., and Obeso, A., 1986, Effects of high potassium on the release of [3H]dopamine from the cat carotid body in vitro. J. Physiol. (Lond) 379: 293-307. Buckler, K., 1999, Background leak and oxygen sensing in carotid body type I cells. Respir. Physiol. 115:179-187. Bunn, H.F., and Poyton, R. O., 1996, Oxygen sensing and molecular adaptation to hypoxia. Phsiol. Rev. 76: 839-885. Cross, A.R., Henderson, L., Jones, O.T.G., Delpiano, M.A, Hentschel, J., Acker, H., 1990, Involvement on an NAD(P)H oxidase as a sensor protein in the rat carotid body. Biochem. J. 272: 743-747 Gonzalez, C., 1998, Sensitivity to physiologic hypoxia In: Oxygen regulation of ion channels and gene expression. (J. Lopez.-Barneo and E.K. Weir, eds.), Futura Publishing Co. Inc. Armonk.N.Y., pp. 321-336. Gonzalez, C., Almaray., L., Obeso, A., and Rigual, R., 1992, Oxygen and acid chemoreception in the carotid body chemoreceptors.Trends Neurosci 15: 146-153. Gonzalez, C., Almaraz, L., Obeso, A., and Rigual, R., 1994, Carotid body chemoreceptors: from natural stimuli to sensory discharges. Physiol. Rev. 74:829-898. Gonzalez, C., Lopez-Lopez, J.R., Obeso, A., Perez-Garcia, M.T., and Rocher, A., 1995, Cellular mechanisms of oxygen chcmoreception in the carotid body. Physiol. 102:137-147. Gonzalex., C., Lopez.-Lopez, J.R., Obeso, A., Rocher, A., and Garcia-Sancho, J., 1993, dynamics in chemoreceptor cells: an overview. Adv. Exp. Med. Biol. 337: 149-156. Haddad, G.G., and Jrang, C., 1997, O2-scnsing mechanisms in excitable cells: role of plasma membrane K+ channels. Annu Rev Physiol. 59:23-42. Halliwell, B., 1988, Oxygen redical sand tissue injury. Proceedings of an Upjohn Symposium Amer. Physiol. Soc., Bethesda, Maryland, USA. Halliwell, B., and Gutteridge, M.C., 1999, Free Radicals in Medicine and Biology Oxford University Press, Oxford, U.K. Höhler, B., Goldenberg, A., Lange, B., Möllcr, W., Tschöpe, M., and Kummer, W., 1999, Reactive oxygen species and their involvement in hypoxia regulated gene transcription in PC12 cells. Physiol.Res 48: S78. Kojima, S., Nomura, T., Icho, T., Kajiwara, Y., Kitabatake, K., and Kubota, K., 1993, Inhibitor effect of neopterin on NADPH-dependent superoxidc-generating oxidase of rat peritoneal macrophagcs. FEBS Lett. 329: 125-128.
433
Lander, H.M., 1997, An essential role for free radicals and derived species in signal transduction. FASEB J . 11: 1 1 8 - 1 2 4 . Le Cabec V., and Marindonneau-Parini, I., 1995, Complete and reversible inhibition of NADPH oxidase in human neutrophils by phenylarsine oxide at a step distal to membrane
translocations of the enzyme subunits. J Biol. Chem. 270:2067-2073. Lopez-Lopez, J.R., Peers, C., 1997, Electrical properties of chemoreceptor cells. In: The Carotid Body Chemoreceptors (C. Gonzalez, ed). Springer-Verlag, Heidelberg, Germany, pp.65-77. Nakamura, H., Nakamura, K., and Yodoi, J., 1997, Redox regulation of cellular activation. Annu. Rev. Immunol. 15:351-69
Obeso, A., Gomez-Niño, A., and Gonzalez, C., 1999, NADPH oxidase inhibition docs not
interfere with low transduction in rat and rabbit CB chemoreceptor cells. Am. J. Physiol. 276:C593-C601. Obeso, A., Gonzalez, C., Rigual, R., Dinger, B., and Fidone, S., 1993, Effect of low on glucose uptake in rabbit carotid body. J. Appl. Physiol. 74: 2387-2393. Obeso, A., Rocher, A., Fidone, S., and Gonzalez, C., 1992, The role of dihydropyridinesensitive channels in stimulus-evoked catecholamine release from chemoreceptor cells of the carotid body. Neuroscience 47: 463-472.
Obeso, A., Rocher, A., Herreros, B., and Gonzalez, C., 1997, Oxygen consumption and energy metabolism in the carotid body. In: The Carotid Body Chemoreceptors (C. Gonzalez, ed). Springer-Verlag, Heidelberg, Germany, pp.31-45. Perez-Garcia, M.T., Lopez-Lopez, J.R., and Gonzalez, C., 1999, subunit coexpression in HFK293 cells confers sensitivity to Kv4.2 but not to shaker channels. J. Gen. Physiol 113:897-907.
Punchard, N.A. and Kelly, F.J., 1996, Free Radicals. A practical approach. IRL Press- Oxford University Press. Oxford, UK, pp. 1-8. Reeves, J.T., Wagner, W.W., McMurtry, I.F., and Grover, R.F., 1979, Physiological effects of high altitude on the pulmonary circulation. In: Environmental Physiology III, edited by A.C. Guyton University Park Press, pp. 253-289. Thuringer, D. and Findlay, I., 1997, Contrasting effects of intracellular redox couples on the regulation of channels in isolated myocytes from rabbit pulmonary artery. J. Physiol. 500:583-592. Yarowsky, P., and Ingvar, O.H., 1981, Neuronal activity and energy metabolism. Fed. Proc. 40: 2353-2362.
434
ATP-DEPENDENT AND VOLTAGE-GATED CHANNELS IN ENDOTHELIAL CELLS OF BRAIN CAPILLARIES Effect of Hypoxia
Marco A. Delpiano Max-Planck-Institute for Molecular Physiology, Germany
11, 44227 Dortmund,
Key words: endothtelial cells, ion channels, hypoxia, patch-clamp, chemoreception.
1. INTRODUCTION The energy demand of mammalian cells in order to maintain life is closely related to the presence of molecular oxygen. Deficiency in oxygen delivery to tissue therefore activates protective mechanisms to restore the state of high order that characterises life. Endothclial cells, like many other cells of the cardiovascular system, play an important role in this complex machinery that prevent and protect cells of lack in oxygen supply. Capillary endothelial cells per se are able to sense changes in environmental The cellular permeability and ATPase activity of brain capillary endothelial cells is affected when exposed to low or chemically induced hypoxia, respectively (E. Dux et al., 1984; N. Kawai et al., 1996a). Since information is lacking concerning the participation of ion channels and membrane potential in brain capillary endothelial cells during hypoxia, the aim of this study was designed to investigate their ion channel properties and to see whether these channels are involved in the transductory pathway of the protective response to hypoxia, as already known in other cells like type I cells of the carotid body, smooth muscle cells and neuroepithelial cells of the lung (J. López-Barneo, 1996).
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al Kluwer Academic/Plenum Publishers, 2000
435
2. METHODS Single isolated rat brain capillary endothelial cells (BCECs) were superfused in a small volume chamber at a temperature of 35° C. Wholecell membrane currents were studied in voltage-clamp experiments with the patch-clamp technique by using the perforated nystatin whole-cell modus. Depolarising voltage pulses from a holding potential (Hp) of revealed outwardly rectifying currents that activated around They represent currents because: 1) they exhibited a tail current-voltage (I-V) relation reversed around 2) were recorded by replacing ions with and aspartate in the extracellular solution, and 3) were reversibly blocked by TEA (0.5-5mM), 4-AP (l-5mM), charybdotoxin (l-30nM) and the sulphonylurea derivatives tolbutamide (0.5-lmM) and glibenclamide The extracellular solution used in this study was (in mM): K-aspartate 5.6, glucose 5.5, HEPES 10, and To record ATP-dependent currents we used low extracellular and 10 mM EGTA in the pipette. The pipette solution was (in mM): KC1 50, EGTA 0.5, HEPES 10, and The current was recorded, as reported elsewhere (Delpiano and Altura, 1996), by using N-methyl-D-glucamine instead of and ions in bath and pipette
solutions, with a concentration of 10 mM
in the bath.
3. RESULTS AND DISCUSSION When single isolated BCECs are clamped at a holding potential of and stimulated by voltage pulses in voltage-clamp experiments, they exhibit outward and inward currents. As reported previously (Delpiano, 1994), the outwardly rectifying current is composed by different types of channels (voltage-activated, and ATP-dependent channels). Inward currents, elicited from a Hp of activated at around and had a bell-shaped I-V relationship with a peak maximum of about at a potential of They represent low-threshold voltage-gated currents (T-type). High voltage-gated currents sensitive to dihydropyridine are also present in BCECs but they exhibit a strong run-down and are very difficult to be maintained during the experiment. They activated around and had a peak maximum of at 0 mV. In this study we only report on T-type currents which are neither depressed nor activated by dihydropyridine agents but reversibly blocked by amiloride, and bepridril with an of 25, 32, and respectively. In earlier studies it was found that hypoxia activated
majority of BCECs (62 %), and that T-type
436
currents in the
currents were depressed by
low pH and metabolic inhibitors like cyanide and 2, 4-dinitrophenol but not by hypoxia (Delpiano, 1996). Here we present evidence that, on the one hand, currents may be the main contributor to the current activation and on the other hand, that T-type currents, when elicited in confluent BCECs instead of isolated cells can be mildly depressed by hypoxia.
As illustrated in Fig. 1, outward currents stimulated by a ramp pulse from to 100 mV and recorded with the perforated nystatin technique were, as expected, activated when bath was rapidly decreased from about 200 (control) to 12 torr (hypoxia). To avoid contamination with activated channels the ramp pulses were elicited by using high EGTA in the pipette (10 mM) and low concentration in the medium (0.8 mM) since BCECs also contain charybdotoxinsensitive channels. In this case, short application of glibenclamide during the hypoxic manoeuvre hampered the increase (Fig. 1). In other experiments we observed similar inhibition of the current activation when using 1 mM tolbutamide. The amplitude of the ramp pulse was similarly depressed as shown in Fig. 1. Conversely, when a control bath solution with 2.5 mM and 0.1 mM
437
EGTA in the pipette was used, we found in four experiments by using 1 mM TEA that although the steady-state current amplitude was depressed, this substance only blocked partially the activation induced by hypoxia (not shown). As shown in Fig. 2, T-type currents, not contaminated by or currents, were depressed when exposed to 2, 4 dinitrophenol (DNP) and low in a reversible fashion. In contrast to previous experiments where currents were investigated in isolated and resuspended cells after trypsina-
tion, this time low voltage-gated currents were recorded in confluent BCECs, 5 days after seeded on glass cover slips. We could find that currents were slightly depressed by hypoxia (bottom of Fig. 2). Probably trypsination interacts with some channel protein and hampers the response to hypoxia. This assumption is supported by the fact that currents need al least 3 to 5 days to be found in all BCECs after trypsination for a new passage. Apparently the response to cyanide and DNP seems not so sensitive to this treatment (Delpiano, 1966). Perhaps low and the metabolic stress produced
438
by cyanide and DNP challenge different pathways of the same transductory system. Keeping in mind that endothelial cells, specially those of capillaries,
are normally exposed to very low oxygen environment, it is not surprising to learn that they may exhibit a more sophisticated energy-regulatory system as compared to other cells since they contain an enzyme ATP synthase on their cell membrane (T. Moser, 1999), which was thought only to be present in mitochondria. This peculiarity of an extra energy source needs to be considered when explaining the sensitivity of and channels to hypoxia and metabolic blockers in these cells. Taken together, the activation of the and depression of the current shown in this study, which correlates very well with the hyperpolarization of the membrane potential observed in BCECs during hypoxia (unpublished), may play a key role in the compensatory vascular vasodilatation when endothelial cells are exposed to an acute metabolic stress. The reversible inhibition, of the activation during hypoxia caused by glibenclamide, hints to the participation of ATP-dependent channels in BCECs, as already known in smooth muscle cells (Daut et al., 1990), and suggests that ATP or ADP is the intracellular signal that initiates the chemosensory response. This, however, does not exclude intracellular ions as another signal pathway, since 1 mM TEA blocks partially the activation during hypoxia. Additionally, the behaviour of the current could also be related to an energy-dependent process where intracellular ions may be implicated. Previously we proposed the involvement of a calmoduline-dependent protein kinase which regulates T-type
channels inactivation by
a energy-dependent mechanism in adrenal glomerulosa cells (Lu et al., 1994). Nowadays this prospect is not unreasonable since recently the regulatory property of calmoduline upon activation and inactivation of channels has been established (Lee et al. 1999, Zühlke et al. 1999). Finally, the question of how channels of brain capillary endothelial cells contribute to cerebral vasodilatation and compensatory blood flow increase, observed under ischemia or acute hypoxia (Bereczki et al., 1993), could be attempted in a speculative approach. Assuming that ions represent the endothelium-derived hyperpolarizing factor (EDHF), as postulated by Edwards et al. (1998), one could imagine that activation of ATPdependent channels in BCECs may release ions that might hypolarize neighbour vascular smooth muscle cells, leading to vasorelaxation. Another mechanism could be related to a tonically released vasoconstrictor substance. When BCECs hyperpolarize, this release is decreased and a vasodilator effect predominates. Although more experimental work is needed to
elucidate the mechanism that may be involved, the presence of and channels in BCECs should contribute to a better understanding in the vascular regulation under hypoxia.
439
REFERENCES Bereczki, D., Wie, L., Otsuka, V., Acuff, K., Pettigrew, C., and Fenstermacher, J., 1993, Hypoxia increases velocity of blood flow through parenchymal microvascular system in
brain. J. Cereb. Blood Flow Metab. 13: 465-486. Daut, J., Maier-Rudolph, W., von Beckerath, N., Mehrke, G., Günther, K., and GoeddelMeinen, L., 1990, Hypoxic dilatation of coronary arteries is mediated by ATP-sensitive potassium channels. Science 247: 1341 -1344. Delpiano, M.A., 1994, Ionic currents on endothelial cells of rat brain capillaries. Adv. Kxp. Med. Biol. 360: 183-186. Delpiano, MA., 1996, Metabolic inhibitors affect the conductance of low voltage-activated calcium channels in brain endothelial cells. Adv. Exp. Med. Biol. 401: 109-113. Delpiano, M.A., and Altura, B.M., 1996, Modulatory effect of extracellular ions on and currents of capillary endothelial cells from rat brain. FEBS Letters 394: 335-339. Dux, E., Temesvari, P., Joo, F., Adam, G., Clementi, F., Dux, L., Hideg, J., and Hossmann, K.-A., 1984, The blood-brain barrier in hypoxia: Ultrastructural aspects and adenylate cyclase activity of brain capillaries. Neuroscience 12: 951-958. Edwards, G., Dora, K.A., Gardener, M.J., Garland, C.J., and Weston, A.H., 1998, is an endothelium-derived hyperpolarizing factor in rat arteries. Nature 396: 269-272. Kawai, N., McCarron, R.M., and Spatz, M., 1996a, Effect of hypoxia on cotransport in cultured brain capillary endothelial-cells of the rat. J. Neurochem. 66: 2572-2579. Lee, A., Scott, T.W., Gallagher, D., Li, B., Storm, D.R., Scheuer, T., and Catterall, W.A., 1999, /calmoduline binds to and modulates P/Q-type calcium channels. Nature 399: 155-159. López-Barneo, J., 1996, Oxygen.-sensing by ion channels and the regulation of cellular func-
tions. Trends Neurosci. 19: 435-440. Lu, H.K., Fern, R.J., and Barret, P.Q., 1994, activation of T-type channels by calmoduline-dependent protein kinase II. Am. J. Physiol. 267: F 1 8 3 - 1 8 9 . Moser, T.L., Stack, M.S., Asplin, I., Enghild, J.J., Hojrup, P., Everitt, L., Hubchak, S., Schnaper, H.W., and Pizzo, S.V., 1999, Angiostatin binds ATP synthase on the surface of human endothelial cells. Proc. Natl. Acad. Sci. USA 96: 2811-2816. Zühlke, R.D., Pitt, G.S., Deisseroth, K., Tsien, R.W., and Reuter. H., 1999. Calmoduline supports both inactivation and facilitation of L-type calcium channels. Nature 399: 159-162.
440
DIFFERENT DIFFERENT 1,2
MECHANISMS BY CHANNELS
Gabriel G. Haddad and
1
Huajun Liu
1
Departments of Pediatrics (Section of Respiratory Medicine) and 2Cellular and Molecular Physiology, Yale University School of Medicine, New Haven, CT, USA
1.
INTRODUCTION
Some of the most intriguing questions in modern biology are how do cells sense and respond to the lack of In particular, questions related to the central nervous system and to central neurons and how these cells sense the lack of have been very interesting, challenging and very significant from a clinical and biologic point of view. While it is clear that a number of parallel processes take place and a number of cascades of events occur when nerve cells are deprived of ionic homeostasis is of paramount importance in determining survival or injury of cells exposed to hypoxia. This ionic homeostasis is controlled by and large through biochemical processes, which regulate membrane exchangers, transporters and ion
channels. In this particular chapter, we focus on
channels, which seem to
be essential in governing the activity level of inside and outside cells. There are a number of reasons we concentrate on channels in this chapter. First, more than other ions, dictate the membrane potential of nerve cells and are therefore bound to affect excitability and energy
expenditure. Second, there are data to suggest that increased extracellular is important in inducing activation of mechanisms that lead to cell survival in cultured neurons (Murrell and Tolkovsky 1993, Yu et al. 1997 ). Third, it has recently been shown that efflux through certain specific channels leads to apoptosis and the prevention of this particular efflux
through
channel blockers leads to prevention of apoptosis (Yu et al.
1997), strongly suggesting that regulation is an important step within a cascade of events that determines cell fate.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
441
In this chapter, we detail some of our experiments on channels, and show that regulation is complex in nerve cells; changes may constitute some of the early sensing mechanisms, depend on a number of channels and a number of cytosolic and cytosol-independent factors. As an illustration of this complexity, we give 2 examples, each representing an important mechanism regulating channel activity.
2.
DEPRIVATION AND DEPENDENT CHANNELS
2.1
Channel Characterization
BY ATP-
These studies have been mostly done on nerve cells from the substantia nigra (SN) but also on neocortical cells of rodents and humans (Jiang et al. 1994, Jiang and Haddad 1997). Neurons from the SN were identified using morphologic, electrophysiologic and fluorescence techniques
(catecholamine-containing cells).
The
next step was to
characterize channels in these neurons. Of these channels, we focused on the ATP-dependent channels were fairly unique since their properties were fairly different from any one particular channel that was previously described (Ashcroft 1988, Takeno and Noma 1993). For example, these channels were not responsive to as the inward rectifier channels are. However, they were responsive to glibenclamide and ATP in that they were both inhibitory to the channel. In addition, these channels are voltage-sensitive, and have high conductance, in the range of 220-230 pS. Hence these channels are similar to the channels but they are inhibited by glibenclamide and ATP, which is unlike channels. Because of these electrophysiologic properties, we felt that these channels are hybrid, between and channels.
2.2
Effect of Hypoxia
One major reason for studying these channels is that they seem to be responsive to low They are not only responsive to hypoxia via cytosolic changes which generally change with hypoxia, such as pH, ATP, voltage and a variety of kinase activities, but also responsive to low in the excised membrane state, ie, directly (Jiang and Haddad 1994). The response of this channel to hypoxia is characterized temporally by
442
2 phases. The first, which occurs in a few minutes, is that of activation and an increase in This phase lasts in general for another few minutes before an inhibitory phase sets in. Subsequently, the channel is further inhibited as long as the channel is exposed to hypoxia. The major questions, clearly, are related to the mechanisms of activation and inhibition. These are most likely related to a number of factors and variables to which the channel is affected by during the hypoxic stress, whether through cytosolic changes or direct ones. The response to ATP was immediate, with the channel activity going to essentially zero if the concentration of ATP was over 0.5 mM (Kd=approximately 0.130). Whereas ADP had a moderate response as compared with ATP in terms of the open probability AMP-PNP, the non-hydrolyzable form of ATP had the same response as ATP. Also, we tested whether the ATP inhibition was related to the binding of ATP to by using MgATP, which has a higher affinity to ATP than and by saturating the medium with Interestingly, these same types of responses were also present in human neocortical neurons, which had a similar type of channel (Jiang and Haddad 1997). One important inhibitor with inward rectifier channels is their response to glibenclamide and tolbutamide. Although we do not believe that this channel is not an inward rectifier, it was certainly inhibited by both of these agents, the former in micromolar and the latter in mM concentrations (Jiang etal 1994) The effect of voltage was also interesting for this channel, as it interacted with concentration on the inside and outside of the channel. With increasing depolarization, the of the channel increased. However, with more physiologic concentration (rather than equimolar concentrations) on the outside, the activation of the channel was obtained at more hyperpolanzed membrane potential, indicating that the effect of on was even the more important when is in physiologic activities. In addition to via the effects of various cytosolic changes, these channels can sense low directly, after removing all cytosolic components, in the excised configuration. The or partial pressure of in the solution affected the of the channel: it inhibited it starting at a of about 20 Torr which is consistent with the partial pressure of in the interstitial space of the brain at a time when is starting to be lowered. The Kd for is about 10 Torr.
2.3
“Direct”
by Membrane Proteins
How is sensed by this channel or how inhibits channel activity “directly” is not clear. We have argued in the past that there are
443
possibly 3 scenarios: 1) Lowering level per se changes the conformation of the channel through a redox change of the channel itself. The idea here is that the level affects the interactions between the ball and chain at the Nterminus of the channel structure. 2) Hypoxia affects a membrane protein other than the channel, which, in turn, affects the activity of the channel itself. The idea here is that the structure of a protein, say a heme protein, changes its conformation and in so doing, it affects in turn the conformation of the channel itself. 3) In this scenario, hypoxia leads to a reduction in the release of oxidants which is the result of an oxidase reaction. Hence, the idea here is that an oxidase such as NADPH oxidase releases in small quantities locally and in the presence of this opens the channel itself. When is reduced, this level of is also reduced and the channel itself is inhibited. At present, all 3 scenarios are possible and none can be excluded in our system. However, the third possibility is unlikely since DPI, an inhibitor of NADPH oxidase, does not affect channel activity.
3.
SENSING BY CHANNELS IS CYTOSOL-DEPENDENT
potassium channels have been identified in various cell types, including central neurons, and are generally distinguished from other channels by their single channel conductance, calcium sensitivity, voltage dependence and unique pharmacological properties (Latorre et al. 1989). All channels are activated by an increase in intracellular concentration and some of them can also be modulated by other messenger systems (Reinhart et al. 991,1995, Bielefeldt et al. 1994). From a physiological point of view, channels are particularly interesting, since they may provide a link between second messenger systems and membrane conductance. Regulation of by tension has been demonstrated in cells from carotid body (Wyatt and Peers 1995, Lopez-Lopez et al. 1997), pulmonary smooth muscle (Park et al. 1995) and the adrenal gland (Thompson and Nurse 1998). channels respond to hypoxia in diverse ways. For example, channels from rabbit pulmonary artery smooth muscle cells are down regulated by hypoxia. Other studies, however, have shown that reduced oxygen tension increases the activity of in cat cerebral arterial smooth muscle cells despite unchanged (Gebremedhin et al.1994). This diversity of hypoxia effect may be contributed to the high variability of channels, which is related to different phosphorylation level, sensitivity, or a number of other factors. However, the exact mechanism of channel inhibition or
444
activation during hypoxia remains unclear, although some channels have been reported to be modulated by cellular redox state (Park et al.1995, DiChiara and Reinhart 1997, Wang et al.1997).
channels are fundamental regulators of neuronal excitability, participating a number of important aspects of neuronal function. Recent finding from our laboratory showed that large conductance potassium channels of neuronal plasmas membrane respond to a reduced microenvironmental oxygen in a cytosol-dependent manner (Liu et al. 1999). Qualitatively, this is similar to that of channels in carotid body cells and smooth muscle cells. In cell-attached patches of isolated neocortical neurons, we found that a low oxygen medium decreased single channel open probability markedly after a latency of 5-7 mm (Fig.l) and this hypoxic inhibition of channel activity is strongly voltage dependent (Fig.2). In general, low inhibited channel activity when the membrane potential was negative or slightly depolarized, and the inhibition was attenuated if the membrane was depolarized to potential more positive than This evidence suggests that hypoxia-induced inhibition of channel activity may have greater physiological significance at more negative membrane potentials in the neuronal response to hypoxia. In contrast to these finding in intact cell, we also found that neither single channel open probability nor amplitude was significantly affected by hypoxia in excised (inside-out)
445
patches (Fig.3). These results indicated that hypoxic inhibition of channel is not determined by a closely coupled, membrane-limited mechanism. Instead, it appears that cytosolic alterations are required for hypoxia-mediated events. These results are diametrically opposite to the results we obtained with the channels, ie, the latter channels were not only responsive to hypoxia in the cell-attached configuration but also in the excised mode, indicating that hypoxia affects various channels and here the same kind of channels in various ways. In other words, various channels can sense the lack of differently.
446
3.1
Potential Mechanisms of Hypoxia-induced Inhibition of Channels
The following question is raised then as to what are the possible cytosolic factors that mediated the hypoxia-induced event. Clearly, hypoxia is usually accompanied, if severe enough, by compensatory or pathophysiologic changes that could alter channel function and sensitivity. For example, hypoxia can produce a number of cytosolic changes that we and others have demonstrated in the past such as an increase in cytosolic concentration, and a drop in pH (Haddad and Jiang 1993). The question is what effect do all of these factors have on this individually and when they are all operating together. For instance, an increase in would be expected to activate the channel; however, we found that decreased its activity during hypoxia. Therefore, this situation can be very complex as these various factors that affect channel activity occur at different time after instituting hypoxia, have different time constants, and may have interactive effects on the channel such as pH and PKA. Furthermore, channel may have different sensitivities to factors such as during hypoxia or that the local concentration of in the vicinity of channel, may increase more slowly than elsewhere in the cell. In addition, little is known regarding possible increase in the local extracellular concentration due to the open of channels. Because of the potential complexity of the situation during hypoxia, it is imperative then to dissect the role of various alterations separately. At present, some of the well known alterations include: intracellular concentration of proton and nucleotides, protein phosphorylation and proteolytic enzyme activity, redox activity, and receptor modulation. 3.1.1
Intracellular
A variety of ion channels can be influenced by modest shifts in and might thereby modulate neuronal excitability, particularly under pathological condition (Chesler 1990). channels in mammalian central neurons are high sensitive to intracellular pH level. In mice neocortical neurons, we found that a reduction in pH on the cytosolic side can significantly inhibit channels open probability (Liu et al. 1999). Our data showing that intracellular acidification depresses channel openings at a given level, while an increase in counteracts this acidification-induced reduction in the opening probability indicates that protons and ions may compete for binding sites on the channel proteins (Laurido et al. 1991). Indeed, acidification caused a decrease in the
447
apparent sensitivity. The gating mechanism of this channel is therefore controlled not only by and membrane potential, but also by in neocortical cells. Previous studies have shown that hypoxia induces intracellular acidification in neurons (Cummins et al.1993, Fujiwara et al 1992), so it seems likely that binding, at least during hypoxia or ischemia, could decrease channel activity despite an increase in considered adequate for activation of the channel.
3.1.2
ATP, Phosphorylation
Although it has been shown that ATP can modulate the activity of some channel in rat brain (Lee et al 1995), we did not find in any significant effect of ATP on channel in our mice neocortical neurons (Liu et al 1999). Thus we exclude the possibility that ATP alone is involved in the hypoxia-induced inhibition of However, at least three types of kinases including PKA, PKC, and cGMP-dependent protein kinase have been reported to regulate channels through phosphorylation (Reinhart et al 1991, Minami et al.1993, Robertson et al 1993, Bielefeldt and Jackson 1994, Bringmann et al. 1997, Peers and Carpenter 1998). Using plasma membranes from rat brains, investigators have demonstrated channels can be either up regulated or down-regulated by PKA (Reinhart et al.1991). Data from our study indicated that phosphorylation by PKA can alter the sensitivity of the channel to and down-regulate their open state probability at physiological and relevant trans-membrane voltage despite unchanged (Liu et al. 1999). This channel may thus provide a link between different second messenger systems and the membrane properties of these neurons, particularly during hypoxia or ischemia. Since hypoxia is known to activate protein kinases (Haddad and Jiang 1993), it is possible that these may in turn decrease sensitivity and inhibit channel via phosphorylation. 3.1.3
Redox modulation
It has been shown that redox regulation could influence channel activation (DiChiara and Reinhart 1997, Wang et al. 1997). This may be especially important during low or metabolic states as the redox potential of the cell is altered. Of interest, it has been shown in both carotid body cell and pulmonary arterial myocytes that reductants such as GSH or DTT can mimic the effect of hypoxia on oxygen-regulated channels (Benot et al. 1993, Yuan et al 1994). Our results also demonstrated that channel in mice neocortical neurons can be modulated by changes in the redox environment (Liu et al.1999). The question is raised then as to
448
whether this agent also participates in the hypoxia-induced inhibition on channel activity. Apparently, it will probably depend on how the intracellular GSSG/GSH ratio is altered during hypoxia. However, data from previous studies did not show that there were significant changes in the redox environment during hypoxia in brain (Slivka et al. 1987), although redox potentials may be compartmentalized intracellularly or even intercellularly in a manner not readily revealed by gross tissue assays. More recently, it has been shown that the generation of oxygen radicals can influence the activity of a broad spectrum of channels (Duprat et al 1995). Hence, it might be more plausible that some of the hypoxia-induced effects observed in the oxygen-sensitive channels are due to changes in the production of oxygen radicals which modify the redox state of channel proteins. 3.1.4
Other possible mechanisms
Other potentially important factors are stress-activated proteolytic enzymes that may be involved in modulation of channel during hypoxia. However, application of trypsin and proteases to the intracellular side of patches was not found to affect channel activity in our experiments (Liu et al 1999). Thus, we doubt the involvement of this process in channel activation. Receptor modulation has also been important in hypoxia- or ischemia- induced release of endogenous transmitters or neurohormones, which might couple to receptors and modulate the channel activity. One substance known to be released in significant amount from ischemic brain is adenosine and there is ample evidence that adenosine could regulate several types of channels by activation of its receptors (Kleppisch and Nelson 1995, Kobayashi et al 1998). However, it is not clear whether adenosine modulates channel activity and further studies are needed in this area.
3.2
Functional Role of
Channel during Hypoxia
There are important questions that remain unanswered concerning the channel of central neurons vis-a-vis hypoxia. For example, what are the functional implications of the hypoxia-induced inhibition of the channels. This question would seem to be crucial since the frequency with which the channel was observed in the neocortex was high and since its conductance is large. In central neurons, channels have been implicated in the processes of spike repolarization and fast hyperpolarization following an action potential (Sah 1996). These processes can clearly have a major effect on neuronal activity, frequency of firing and
449
neurotransmitter release. Thus the hypoxia-induced inhibition of channel in central neurons, like in other tissues, may be involved in triggering membrane depolarization or in maintaining or accentuating it during hypoxia or ischemia. The depolarization during hypoxia leads to an elevation of intracellular free which, in turn, can be potentially important for a number of cellular functions, including neurotransmitter release and activation of second messenger pathways. On the other hand, overload can trigger a series of autotoxic cellular reactions and lead to the development of a vicious cycle with ultimate cell death. Therefore it seems likely that oxygen modulation of ion channels is not only involved in cellular adaptive responses to hypoxia, but also may participate in the pathophysiology of abnormal states.
4.
CONCLUSION Although considerable work has been performed on carotid bodies, sensing by channels and its importance extend beyond this organ. It
is clear that mechanisms of
sensing are present in many types of tissues
and channels and it is likely that sensing mechanisms can vary from cell type to cell type or from one organ to another. The challenge in the study of sensing mechanisms is to understand differences in sensing mechanisms, since this could be of paramount importance not only for appreciating cellular physiology and biology, but also for understanding the pathophysiology of cellular injury or survival during deprivation.
REFERENCES Ashcroft F . M . 1988. Adenosinc -triphosphate-sensitive potassium channels. Annu. Rev. Neurosci 1 1 : 9 7 - 1 1 8. Benut A., Ganfornina M.D., and Lopez-Barneo L. 1993. Potassium channel modulated by hypoxia and the redox status in glomus cells of the carotid body. In Ion flux in pulmonary vascular control (E.K. Weir, editor.), New York: Plenum Publishing Corp. 177-187 Bielefeldt K., and Jackson M.B. 1994 Phosphorylation and dephosphorylation modulate a channel in rat peptidergic nerve terminals. J. Physiol. 475:241-254. Bringmann A., Faude F., and Reichenbach A.. 1997. Mammalian retinal glial cells express large-conductance channels that are modulated by and pH and activated by protein kinase A. GLIA 19:311-323. Chesler M. 1990 Regulation and modulation of pH in nervous system. Prog. Neurobiol. 34:401-427. Cummins T.R., Levy D.A., and Haddad G.G. 1993. Effect of anoxia on intracellular pH in isolated newborn and mature rat hippocampal CAI neurons. Soc. for Neurosci. 19:1640.
450
DiChiara T.J., and Reinhart P.H. 1997. Redox modulation of hslo channel. J. Neurosci. 17: 4942-4955.
Duprat F., Guillemare E., Romey G., Fink M., Lesage F., Lazdunski M., Honore E. 1995. Susceptibility of cloned channels to reactive oxygen species. Proc. Natl. Acad. Sci. USA. 92:11796-11800. Fujiwara N., Abe T., Endoh H., Warashina A., and Shimoji K. 1992. Changes in intracellular pH of mouse hippocample slices responding to hypoxia and /or glucose depletion. Brain Res. 572:335-339. Gebremedhin D., Bonnet P., Greene A.S., England S.K., Rusch N.J., Lombard J.H., and Harder D.R. 1994. Hypoxia increases the activity of channels in cat cerebral artial muscle cell membranes. Pflügers Arch. 428:621-630. Haddad G.G., and Jiang C. 1993. deprivation in the central nervous system: on mechanisms of neuronal response, different sensitivity and injury. Prog, in Neurobiol. 40:277-318. Jiang C. and Haddad G.G. 1997. Modulation of channels by intracellular ATP in human Neocortical neurons. J. Neurophysiol. 77:93-103. Jiang C., and Haddad G.G. 1994. A direct mechanism for sensing low oxygen levels by central neurons. Proc. Natl. Acad. Sci. USA 91:7198-7201. Jiang C., Sigworth F.J., and Haddad G.G. 1994. Oxygen deprivation activated an ATPinhibitable channel in substantia nigra neurons. J. Neurosci. 14:5590-5602. Kleppisch T., and Nelson M.T. 1995. Adenosine activates ATP-sensitive potassium channels in arterial myocytes via receptors and cAMP-dependent protein kinase. Proc. Natl. Acad. Sci USA. 92:12441-45. Kobayashi S., Conforti L., Pun R.Y.K., and Millhorn D.E. 1998. Adenosine modulates hypoxia-induced responses in rat PC12 cells via the receptor. J. Physiol. 508: 95107. Latorre R., Oberhauser A., Labarca P., and Alvarez O. 1989. Varieties of calcium-activated potassium channels. Annu. Rev. Physiol. 51:385-399. Laurido C., Candia S., Wolff D., and Latorre R. 1991. Proton modulation a channel from rat skeletal muscle incorporated into planar bilayer. J. Gen. Physiol. 98:1025-1043. Lee K., Rowe I.C.M., and Ashford M.L.J. 1995. Characterization of an ATP-modulated larger conductance channel present in rat cortical neurones. J Physiol. 488:319-337. Liu H, Moczydlowski E., and Haddad G.G. 1999. O2 deprivation inhibits channels via cytosolic factors in mice neocortical neurons. J. Clin. Invest. 104(5):xxx-yy. (in press) Lopez-Lopez J.R., Gonzalez C., and Perez-Garcia M.T. 1997. Properties of ionic currents from isolated adult rat carotid body chemoreceptor cells: effect of hypoxia. J. Physiol. 499:429-41. Minami K., Fukuzawa K., and Nakaya Y. 1993. Protein kinase C inhibits the channel of cultured porcine coronary artery smooth muscle cells. Biochem. Biophys. Res. Commun. 190:263-269. Murrell R.D., and Tolkovsky A.M. 1993. Role of voltage-gated channels and intracellular in rat sympathetic neuron survival and function promoted by high and cyclic A M P in the presence or absence of NGF. Eur J Neurosci 5:1261. Park M.K., Lee S.H., Lee S.J., Ho W.K., and Earm Y.E. 1995. Different modulation of Caactivatcd K channels by the intracellular redox potential in pulmonary and ear arterial muscle cells of the rabbit. Pflüger Arch. 430:308-314.
451
Peers C., and Carpenter E. 1998. Inhibition of channels in rat carotid body type I cells by protein kinase C. J. Physiol. 512:743-750. Reinhart P.H., and Levitan I.B.. 1995. Kinase and phosphatase activities intimately associated with a reconstituted calcium-dependent potassium channel. J. Neurosci. 15:4572-4579. Reinhart P.H., Chung S., Martin B.L., Brautigan D.L., and Levitan I.B. 1991. Modulation of
calcium-activated potassium channels from rat brain by protein kinase A and phosphatase. J Neurosci. 11:1627-1635.
Robertson B.E., Schubert R., Hescheler J., and Nelson M.T. 1993. cGMP-dependent protein kinase activates Ca-activated K. channel in cerebral arterysmooth muscle cells. Am. J. Physiol. 265:C299-C303. Sah P. 1996. currents in neurones: type, physiological roles and modulation. Trends Neurosci. 19:150-154. Slivka A., Spina M.B., and Cohen G. 1987. Reduced and oxidized glutathione in human and monkey brain. Neurosci. Lett. 74:112-118. Takeno M. and Noma A. 1993. The ATP-scnsitive channel, frog. Neurobiol. 41:21-30. Thompson R.J., and Nurse C.A. 1998. Anoxia differentially modulates multiple currents and depolarizes neonatal rat adrenal chomaffin cells. J. Physiol. 512:421-434. Wang Z.W., Nara M., Wang Y.X., and Kotlifoff M.I. 1997. Rcdox regulation of large conductance channels in smooth muscle cells. J. Gen. Physiol. 110:3544. Wyatt C.N., and Peers C. 1995. channels in isolated type I cells of the
neonatal rat carotid body. J. Physiol. 483:559-565.
Yu S.P., Yeh C.H., Sensi S.L., Gwag B.L., Canroniero L.M.T., Farhangrari Z.S., Ying H.S., Tian M., Dugan L.L., Choi D.W. 1997. Mediation of neuronal apoptosis by enhancement of outward potassium current. Science 278:114-117.
Yuan X., Tod M.L., and Rubin L.J. 1994. Deoxyglucose and reduced glutathione mimic the effect of hypoxia on and conductances in pulmonary artery cells. Am. J. Physiol. 267:L52-63.
452
RESPONSE OF INTRACELLULAR pH TO ACUTE ANOXIA IN INDIVIDUAL NEURONS FROM CHEMOSENSITIVE AND NONCHEMOSENSITIVE REGIONS OF THE MEDULLA
Laura Chambers-Kersh, Nick A. Ritucci, Jay B. Dean , and Robert W. Putnam Department of Physiology and Biophysics, Wright State University School of Medicine, Dayton, OH 45435
Key words:
anoxia; hypoxia; chemoreception; intracellular pH; brainstem; neuron; Na/H
exchange
Abstract:
The effect of acute (10 minutes) exposure to anoxia on intracellular pH (pHi) in individual brainstem neurons, in slices from neonatal (P7 to Pll) rats, was studied using a fluorescence microscopy imaging technique. Neurons from 4 regions of the medulla were studied, two of which contained chemosensitive neurons (nucleus tractus solitarius, NTS, and ventrolateral medulla, VLM) and two regions which did not contain chemosensitive neurons (hypoglossal, Hyp, and inferior olivary, IO). Acute anoxia caused a rapid and maintained acidification of 0.1-0.3 pH unit that was not different in neurons from chemosensitive vs. nonchemosensitive regions. Blocking the contribution of exchange (NHE) to pH, regulation by exposing neurons to acute anoxia in the presence of the exchange inhibitor
amiloride (1 mM) did not affect the degree of acidification seen in neurons from the NTS and VLM region, but significantly increased acidification (to about 0.35 pH unit) in Hyp and IO neurons. In summary, anoxia-induced intracellular
acidification is not different between neurons from chemosensitive and nonchemosensitive regions, but NHE activity blunts acidification in neurons from the latter regions. These data suggest that neurons from chemosensitive areas might have a smaller acid load in response to anoxia than neurons from nonchemosensitive regions of the brainstem.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
453
1.
INTRODUCTION
Neurons are highly susceptible to hypoxia and anoxia (Haddad and Jiang, 1993). The degree to which neurons are damaged by reduced depends in part upon age, with neurons from younger animals able to survive longer than those from adults (Kass and Lipton, 1989; Haddad and Donnelly, 1990; Roberts and Chih, 1997), and in part upon the region of the brain, with brainstem neurons being more susceptible than cortical neurons (O’Reilly et al., 1995). Many brainstem neurons are involved in the control of respiration (Nattie, 1995) and thus might be expected to respond to reduced However, the major sensors that control respiration are peripheral and located within the carotid bodies (Eyzaguirre and Koyano, 1965; Wilson et al, 1998). In fact, exposure of central chemoreceptors to reduced is believed to result in respiratory depression, although this response is slower than the respiratory stimulation upon exposure of carotid bodies to reduced (Neubauer et al., 1990). The basis for neuronal damage in conditions of reduced is believed in part to result from the decrease in intracellular pH upon accumulation of acidic end products of anerobic metabolism (Nedergaard et al., 1991). A number of studies have examined the changes in upon hypoxia and anoxia in
neocortical neurons (e.g. O’Reilly et al., 1995), with particular attention to
hippocampal neurons (Roberts and Chih, 1997). However, very little is known about the response to reduced in brainstem neurons, especially with regard to changes in brainstem regions thought to be associated with respiratory control (LaManna et al., 1996). In this study, we use fluorescence imaging microscopy (Ritucci et al., 1996) to assess the response to acute anoxia of individual neurons from chemosensitive and nonchemosensitive regions of neonatal rat brainstem. A preliminary report of this work has been published (Chambers-Kersh et al., 1998).
2.
MATERIALS AND METHODS
2.1
Solutions
All slices were perfused with normal saline buffer (NSB) which contained (in mM): and 10 glucose. This solution was equilibrated with either gas (control) or (anoxia). NSB pH was adjusted to 7.48 at 37°C. Buffering power was measured with 15 mM or 20 mM Na propionate replacing NaCl isosmotically in the NSB buffer. To assess the recovery,
454
neurons were acidified by a brief exposure to NSB containing 60 mM and recovery from the acidification induced upon removal of (Boron and De Weer, 1976) was followed. Amiloride (gift of Merck) and DIDS (4,4’diisothiocyanostilbene-2,2’-disulfonic acid) were added to NSB to a final concentration of 1 mM and 0.5 mM, respectively, from stocks made in DMSO. The calibration solution contained (in mM): NMDG-HEPES (N-methyl-D-glucarnine-N-2-hydroxyethylpiperazine-N’-2-ethanesul-fonic acid), 25 K-HEPES, 10 glucose and 0.016 nigericin. Nigericin and DIDS were purchased from Sigma.
2.2
Brain Slices
Transverse brain slices ( ) from the medullary region of the brainstem of neonatal (P7-11) rats were made as previously described (Ritucci et al., 1996). Slices were cut slowly (requiring about 5 minutes per slice) on a Pelco series 101 vibratome into chilled buffer (equilibrated with 5% Slices were taken from the caudal region of the medulla from the obex to about 1-1.5 mm rostrally (Ritucci et al., 1997).
2.3
Measurement of
Intracellular pH was measured as previously described (Ritucci et al., 1996, 1997, 1998). Briefly, slices were incubated in of the acetoxymethyl ester form of the loaded with the pH-sensitive fluorescent dye, BCECF (2’,7’bis(carboxy-ethyl)-5(6)-carboxyfluorescein), by incubating them in of the acetoxymethyl ester form of the dye, BCECF-AM, for 15 min at 37° C. Slices were washed in BCECF-AM free medium (at room temperature) until used. Dye was loaded and slices were washed in the dark to reduce photobleaching. The slices were perfused at 37° C at a rate of about 2 ml/min. Dye-loaded neurons were excited alternately at 500 and 440 nm wavelength and the emitted fluorescence at 530 nm was collected every minute. A fluorescence ratio was determined and converted to intracellular pH using a calibration curve (Fig. 1C from Ritucci et al., 1997) obtained using the high technique (Thomas et al., 1979). Images of the fluorescent slices were collected as previously described (Ritucci et al., 1996) and only the large, intense spheres of fluorescence analyzed. We have previously shown that these large spheres correspond to intracellular fluorescence from neuronal cell bodies (Ritucci et al., 1996).
455
2.4
Measurement of Buffering Power
Recovery Mechanisms and
The buffering power of individual brainstem neurons was determined by measuring the change of induced by the addition of a weak acid (Na
propionate) or the removal of a weak base technique of Boron (1977).
The
according to the
pulse technique was used to acidify
brainstem neurons to between 6.8-6.9 and recovery estimated as the linear slope of the pH vs. time trace as returned towards normal. Slopes of recovery were also determined in the presence of amiloride (an inhibitor of the
exchanger) and the presence of DIDS (an inhibitor of
dependent pH regulating transporters).
2.5
Data Analysis
All values are reported as the mean one standard error of the mean (SEM). Student’s t-tests and ANOVA with Bonferroni multiple-comparison t-tests were used to determine statistical significance (level of significance
3.
RESULTS
3.1
Anoxia-Induced Acidification Exposure to anoxia for 10 minutes resulted in acidification of all neurons
studied from neonatal rat brainstem slices. Typical traces of the effect of anoxia on in neurons from the nonchemosensitive IO and Hyp regions are shown in
Figure 1 (thin traces). After a brief lag period, anoxia caused a rapid fall in to a new, lower steady state value. The fall in was significantly greater in Hyp neurons unit, n= 13) than in IO neurons unit, n=21). Upon return to normoxic (control) conditions, rapidly alkalinized back to its initial steady state value (Figure 1, thin traces). A similar pattern of anoxia-induced acidification was seen in neurons from
chemosensitive regions of the brainstem.
Following a brief lag period,
rapidly fell to a new, lower value in NTS and VLM neurons (Figure 2, thin traces). Acidification amounted to pH unit (n=19) and reached a
steady state in VLM neurons (Figure 2B). In contrast, continued to fall at a slow rate in the maintained presence of anoxia in NTS neurons and fell by pH unit (n=13) after 10 minutes of anoxia. Once again,
rapidly
alkalinized back towards its initial steady state value upon return to control, normoxic conditions (Figure 2, thin traces).
456
3.2
Recovery Mechanisms in Brainstem Neurons
The degree to which changes within a neuron during anoxia is a complex function which includes such factors as the activity of recovery transporters, the cellular buffering power, and the rate of metabolic acid production. To assess which recovery mechanisms are present, brainstem neurons were acidified to a of about 6.8-6.9 using the prepulse technique (Boron
and De Weer, 1976). The experiments were done in the presence of NSB, which contains
and can thus support
(Putnam and Roos, 1997). The rate of
transporters
recovery was determined as
recovered back towards its initial value from the acidification. This initial rate of recovery varied between 0.04-0.06 pH unit/minute in neurons from the 4 regions and was not different in neurons from chemosensitive vs. nonchemosensitive regions of the medulla (Figure 3A) or in the presence of DIDS. In the
presence of 1 mM amiloride, an inhibitor of
exchange (NHE), recovery
was completely abolished in neurons from all 4 brainstem regions (Figure 3A). These data indicate that all of the recovery from intracellular acidification is
mediated by NHE in neonatal brainstem neurons. The intrinsic buffering power
of neurons in the four brainstem regions
were determined by measuring the change in induced by addition of Na propionate or removal of as previously described (Ritucci et al., 1998). The calculated did not differ when measured by Na propionate addition or removal and so the values from each technique were averaged for the neurons from each area. The mean
for neurons from each region is shown in
457
Figure 3B. There was no significant difference among the buffering powers for neurons from the various brainstem regions and the average buffering power for all brainstem neurons was
3.3
Effect of Amiloride on Anoxia-Induced Acidification
To assess the role of pH regulating transporters in anoxia-induced acidification, the acidification was assessed in the presence of transport inhibitors. Since NHE was shown above to be the only transporter active in brainstem neurons, the response of was measured in the presence of 1 mM amiloride to eliminate any contribution from this exchanger. In neurons from the chemosensitive NTS and VLM regions, the degree of anoxia-induced acidification was the same in the presence of amiloride (Figure 2A and B, thick traces; Figure 4) and in its absence (Figure 2A and B, thin traces; Figure 4). In contrast, the presence of amiloride resulted in a significantly larger acidification in neurons from the nonchemosensitive IO and Hyp regions (Figure 1A and B, thick trace; Figure 4) compared to the acidification seen in these neurons in its absence (Figure 1A and B, thin trace; Figure 4). Thus, inhibition of NHE resulted in a signficant increase in anoxia-induced acidification in neurons from nonchemosensitive regions but no change in the acidification in neurons from chemosensitive regions.
4.
DISCUSSION
There are three main findings from this study. First, 10 minutes of anoxia results in a modest fall of (0.1-0.3 pH unit) in medullary neurons. Second,
458
459
the exchanger is able to blunt anoxia-induced acidification in neurons from nonchemosensitive regions of the medulla (IO and Hyp), but not in neurons from chemosensitive regions (NTS and VLM). Third, the apparent metabolic acid production in response to anoxia appears to be larger in neurons from nonchemosensitive, as compared to chemosensitive, regions of the medulla. Each of these findings will be discussed.
It is very likely that the neurons were exposed to near complete anoxia. Slices were placed directly onto the glass bottom of the superfusion chamber and cells within the first 50 of the bottom of the slice were studied (Ritucci et al., 1996). Therefore, any oxygen within the superfusion solution (equilibrated with would have to diffuse 200-250 through the slice to reach the neurons studied. Further, perfusion was maintained at a rapid rate, the superfusion solution was 3-4 mm deep, and a glass coverslip was placed over the top of the chamber. This should reduce the diffusion and accumulation of from room air into the superfusion solution. Finally, in measurements of made with polarographic microelectrodes placed 100 | from the surface of slices from neonatal rats, Jiang et al. (1991) showed that tension dropped to near 0 within 10-15 seconds of exposure to solutions equilibrated with 95% It is thus likely that our neurons experienced near anoxic conditions for most of the 10 minute period of exposure. Several previous studies have examined anoxia/hypoxia induced changes of pH, in neurons. In the cerebrum from adult rats, severe hypoxia or ischemia induced a change in (measured with NMR or microelectrodes) of 0.7-1.3 pH unit (Knopfel et al., 1998; Silver and Erecinska, 1990). Similar measurements in hippocampal slices revealed a smaller change (measured with fluorescent dyes), 0.3-0.4 pH unit (Roberts and Chih, 1997; Roberts et al., 1998). In adult
460
rats, brainstem neurons showed a fall of 0.2-0.4 pH unit (microelectrodes and neutral red) in response to moderate hypoxia (20-60 mm Hg) (Cowan and Martin, 1995; LaManna et al., 1996). In neonatal and fetal rats, severe hypoxia induces a change in cerebral neuronal (NMR) of between 0.3-0.7 pH unit (Espanol et al., 1998; O’Shaughnessy et al., 1991). No previous measurements of neuronal acidification have been made in brainstem neurons from neonatal rats to our knowledge. It is clear that our measured changes of of 0.1-0.3 pH unit in response to severe hypoxia/anoxia in neonatal brainstem neurons are among the smallest intracellular pH changes measured for any rat neurons in repsonse to a similar stress. These changes indicate that not only are neonates in general relatively protected from hypoxia/anoxia-induced changes, but brainstem neurons appear to be especially well protected. A part of the ability of brainstem neurons from neonatal rats to minimize acidification in response to anoxia is undoubtedly due to the high intrinsic buffering power in these cells, 46 mM/pH unit (Fig 3B) compared to buffering powers of 20 mM/pH unit for rat brain in general (Katsura et al., 1993). Additionally, brainstem neurons can minimize anoxia-induced acidification through the mediation of pH-regulating transporters. We have shown that the only membrane-bound transporter capable of alkalinizing brainstem neurons in the face of an acid load is the exchanger (Fig. 3 A; Ritucci et al., 1997).
In the present study, inhibition of the exchanger with amiloride increases the degree of acidification in neurons from Hyp and IO (Fig. 4), indicating that this exchanger does indeed normally function to minimize
anoxia-induced acidification in these neurons.
In contrast, anoxia-induced
acidification is unaffected by amiloride in neurons from the chemosensitive NTS and VLM regions (Fig. 4), indicating that NHE does not function to minimize anoxia-induced acidification in chemosensitive neurons. This different response of NHE in response to anoxia-induced acidification can be explained by our previous findings that the exchanger is far more sensitive to inhibition by extracellular acidification in neurons from chemosensitive regions than in those from nonchemosensitive regions (Ritucci et al., 1998). Thus, during anoxiainduced acidification, metabolic acids produced in the neurons leave the cells, resulting in an extracellular acidosis, which is apparently capable of inhibiting
the exchanger from NTS and VLM, but not Hyp and IO neurons. In Hyp and IO neurons, a steady state acidification is reached after 10 minutes of anoxia that probably represents a balance between continued metabolic acid production and acid efflux on the exchange. There are regional differences within the medulla in the degree of anoxiainduced acidification, with neurons from the IO showing the lowest degree of acidification and neurons from the NTS showing the greatest. However, these differences do not correlate with chemosensitivity, since VLM and Hyp neurons have nearly the same degree of anoxia-induced acidification (Fig. 4).
461
The degree of acidification is a complex function of the cellular buffering power, the contribution from pH-regulating transport systems, and the rate of metabolic acid production. The intrinsic buffering power does not differ among the 4 regions studied (Fig. 3B; Ritucci et al., 1998). The contribution from recovery systems can be largely removed by exposing neurons to anoxia in the presence of amiloride. Under such conditions the degree of acidification is a reflection of the metabolic acid load. We find that in the absence of exchange, neurons from the nonchemosensitive regions acidify significantly more than neurons from the chemosensitive regions (Fig. 4). This could indicate that neurons from chemosensitive brainstem regions either extrude metabolic acids more rapidly or have a lower metabolic acid production during anoxia than neurons from chemosensitive regions. One way in which chemosensitive neurons could have a lower metabolism during anoxia is if they did not respond to anoxia by increasing their firing rate or reached depolarization block very quickly compared to nonchemosensitive neurons. Previous studies have shown that Hyp neurons from neonatal rats respond to hypoxia with a modest depolarization and no increase in firing rate, but the depolarization was greater with longer times of exposure to hypoxia and presumably with greater degrees of deprivation (Haddad and Donnelly, 1990). In contrast, Ballanyi et al. (1994) found that anoxia resulted in hyperpolarization of chemosensitive neurons from VLM of neonatal rats. These data suggest that our hypothesis, that the membrane potential response differs in neurons from chemosensitive vs. nonchemosensitive neurons of neonatal rats, is plausible. We have recently initiated detailed studies of the response of chemosensitive and nonchemosensitive neurons to anoxia. We have been studying regulation in chemosensitive neurons to determine the role of changes of as an intracellular signal of hypercapnia in chemosensitive neurons (Ritucci et al., 1996, 1997, 1998). We observe that these chemosensitive neurons exhibit a similar degree of acidification when exposed to hypercapnia or to anoxia. If the neuronal response of to these two stimuli differ, this would be evidence that other intracellular signals, in addition to cellular acidification, are required to increase the firing rate of chemosensitive neurons in response to hypercapnia. Recently, it has been suggested that a region of the rostral pole of the ventrolateral reticular nucleus contain sensitive neurons that largely mediate the central response to reduced levels of (Golanov and Reis, 1996). These neurons were not contained in any of the regions we studied, but it would be of interest to determine the and response of these neurons to anoxia.
462
ACKNOWLEDGMENTS We thank Phyllis Douglas for technical assistance. This work was supported by NIH Grants HL-56683 (JBD and RWP) and HL-46308 (JBD), AHA Undergraduate Student Research Fellowship MV-97-06-U (LCK), and the WSU Biomedical Sciences PhD Program (NAR).
REFERENCES Ballanyi, K., Voelker, A., and Richter, D.W., 1994, Anoxia induced functional inactivation of neonatal respiratory neurones in vitro. Neuroreport 6: 165-168. Boron, W.F., 1977, Intracellular pH transients in giant barnacle muscle fibers. Amer. J. Physiol. 233:C61-C73. Boron, W.F., and De Weer, P., 1976, Intracellular pH transients in squid giant axons caused by and metabolic inhibitors, J. Gen. Physiol. 67:91-112. Chambers-Kersh, L., Ritucci, N.A., Dean, J.B., and Putnam, R.W., 1998, Effect of anoxia on intracellular pH in neurons from chemosensitive and non-chemosensitive regions of medullary brainstem slices. FASEB J. 12: A755. Cowan, A.I., and Martin, R.L., 1995, Simultaneous measurement of pH and membrane potential in rat dorsal vagal motoneurons during normoxia and hypoxia: A comparison in bicarbonate and HEPES buffers. J. Neurophysiol. 74: 2713-2721. Espanol, M.T., Litt, L., Hasegawa, K., Chang, L.-H., Macdonald, J.M., Gregory, G., James, T.L., and Chan, P.H., 1998, Fructose-1,6-bisphosphate preserves adenosine triphosphate but not intracellular pH during hypoxia in respiring neonatal rat brain slices. Anesthesiol 88: 461-472. Eyzaguirre, C., and Koyano, H., 1965, Effects of hypoxia, hypercapnia and pH on the chemoreceptor activity of the carotid body in vitro. J. Physiol. 178: 385-409. Golanov, E.V., and Reis, D.J., 1996, Contribution of oxygen-sensitive neurons of the rostral ventrolateral medulla to hypoxic vasodilatation in the rat. J. Physiol. 495: 201-216. Haddad, G.G., and Donnelly, D.F., 1990, deprivation induces a major depolarization in brain stem neurons in the adult but not in the neonatal rat. J. Physiol. 429: 411-428. Iladdad, G.G., and Jiang, C., 1993, deprivation in the central nervous system: on mechanisms of neural response, differential sensitivity and injury. Prog. Neurobiol. 40: 277-318. Jiang, C., Agulian. S., and Haddad, G.G., 1991, tension in adult and neonatal brain slices under several experimental conditions. Brain Res. 568: 159-164. Kass, I.S., and Lipton, P., 1989, Protection of hippocampal slices from young rats against anoxic transmission damage is due to better maintenance of ATP. J. Physiol. 413: 1-11. Katsura, K..-I., Mellergård, P., Theander, S., Ouyang, Y.-B., and Siesjö, B.K., 1993, Buffer capacity of rat cortical tissue as well as of cultured neurons and astrocytes. Brain Res 618: 283-294. Knopfel, T., Tozzi, A., Pisani, A., Calabresi, P., and Bernardi, G., 1998, Hypoxic and hypoglycaemic changes of intracellular pH in cerebral cortical pyramidal neurones. Neuroreport 9: 1447-1450. La Manna, J.C., Haxhiu, M.A., Kutina-Nelson, K.L., Pundik, S., Erokwu, B., Yeh, E.R., Lust, W.D., and Cherniack, N.S., 1996, Decreased energy metabolism in brain stem during central respiratory depression in response to hypoxia. J. Appl. Physiol. 81:1772-1777.
463
Nattie, E.E., 1995, Central Chemoreception. In Regulation of Breathing (J.A. Dempsey and A.I.
Pack, eds.), Marcel Dekker, New York, pp. 473-501. Nedcrgaard, M., Goldman, S.A., Desai, S., and Pulsinelli, W.A., 1991, Acid-induced death in neurons and glia. J. Neurosci. 11:2489-2497. Neubauer, J.A., Melton, J.E., and Edelman, N.H., 1990, Modulation of respiration during brain hypoxia. J. Appl. Physiol. 68: 441-451. O’Reilly, J.P., Jiang, C., and Haddad. G . G . , 1995, Major differences in response to graded hypoxia between hypoglossal and neocortical neurons. Brain Res. 683: 179-186.
O’Shaughnessy, C.T., Lythgoe, D.J., Butcher, S.P., Kendall, L., Wood, B., and Steward, M.C., 1991, Effects of hypoxia on fetal rat brain metabolism studied in utero by speetroscopy. Brain Res. 551: 334-337. Putnam, R.W., and Roos, A., 1997, Intracellular pH. In Handbook of Physiology: Cell Physiology
(J. Hoffman and J. Jamieson, eds.), Oxford Univer. Press, New York, pp. 389-440. Ritucci, N.A., Erlichman, J.S., Dean, J.B., and Putnam, R.W., 1996, A fluorescence technique to measure intracellular pH of single neurons in brainstem slices. J. Neurosci. Meth. 68: 149-163.
Ritucci, N.A., Dean, J.B., and Putnam, R. W., 1997, Intracellular pH response to hypercapnia in neurons from chemosensitive areas of the medulla. Amer. J. Physiol. 273: R433-R441. Ritucci, N.A., Chambers-Kersh, L., Dean, J.B., and Putnam, R.W., 1998, Intracellular pH regulation in neurons from chemosensitive and nonchemosensitive areas of the medulla. Amer. J. Physiol. 275: R1152-R1163. Roberts, E.L. Jr., and Chih, C.-P., 1997, The influence of age on pH regulation in hippocampal slices before, during, and after anoxia. J. Cerebral Blood Flow Metab. 17:560-566. Roberts, E.L. Jr., He, J., and Chih, C.-P., 1998, The influence of glucose on intracellular and
extracellular pH in rat hippocampal slices during and after anoxia. Brain Res. 783: 44-50. Silver, I.A., and Erecinska, M., 1990, Intracellular and extracellular changes of
in hypoxia
and ischemia in rat brain in vivo. J. Gen. Physiol. 95: 837-866. Thomas, J.A., Buchsbaum, R.N., Zimniak, A., and Racker, E., 1979, Intracellular pH measurements in Ehrlich ascites tumor cells utilizing spectroscopic probes generated in situ. Biochemistry 81: 2210-2218
Wilson, D.F., Laughhn, K..M., Rozanov, C., Mokashi, A. Vinogradov, S.A., Lahiri, S., Koch, C.J., and Evans, S.M., 1998, Tissue oxygen sensing and the carotid body. Adv. Exper. Med. Biol. 454: 447-454.
464
HYPERBARIC OXYGEN DEPOLARIZES SOLITARY COMPLEX NEURONS IN TISSUE SLICES OF RAT MEDULLA OBLONGATA
Daniel K. Mulkey, Richard A. Henderson, Departments of Phystology and Biophysics, and Dayton, OH 45435 U.S.A.
Key words:
1
and Jay B. Dean
Community Health, Wright State University,
dorsal motor nucleus, hyperbaric pressure, nucleus traetus solitarius, oxygen toxicity, oxygen free radicals, membrane potential, brain slice
Abstract: Hyperbaric oxygen atmospheres absolute (ATA) pressure is toxic to the mammalian CNS due to excessive free radical production. No study has ever determined the effects of ATA of on the membrane potential and firing rate of neurons in the mammalian brainstem. Likewise, no study has ever determined the effects of ATA pressure per se on brainstem neurons. Accordingly, we initiated intracellular recordings at 1 .ATA in solitary complex neurons in slices (300 of rat caudal medulla oblongata that were maintained inside a 72 liter hyperbaric chamber. H e l i u m , which is inert and without narcotic effect at moderate levels of hyperbaria, was used to hydrostatically compress the submerged brain slice to determine the effects of pressure per se. Tissue oxygen tension and extracellular pH were also measured d u r i n g exposure to hyperbaric gases. Six of 19 neurons were affected by hyperburic helium; 5 cells were depolarized and 1 cell was hyperpolanzcd. Input resistance either increased or decreased When control perfusatc was switched to perfusate saturated with (balance ATA; 2-18 minutes of exposure) in a separate pressure vessel, 8 of 13 neurons were depolarized and 5 neurons were insensitive. In the 8 neurons, either increased decreased or was unchanged . Three of 8 neurons depolarized by were also depolarized by hyperbaric helium, usually with an additional change in We conclude that hydrostatic (helium) pressure and independently increase excitability in certain solitary complex neurons. We hypothesize that these responses contribute, in part, to neural events that either precede or occur during CNS toxicity.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
465
1.
INTRODUCTION
Intermittent breathing of at barometric pressures of 1.5 to 3 atmospheres absolute (ATA) is used clinically to help "resolve certain recalcitrant, expensive, or otherwise hopeless medical problems" (Camporesi, 1996). Breathing high concentrations of oxygen at hyperbaric pressure (i.e., hyperbanc oxygen, however, also hastens the onset of toxicity in tissues such as the lung, retina and central nervous system. In particular, breathing ATA increases the likelihood of toxicity in the mammalian central nervous system (mCNS). Oxygen toxicity of the mCNS is ultimately manifested as grand mal type seizures, and is most often encountered in hyperbaric medicine (Jam, 1996) and diving medicine (Butler and Thalmann, 1986; Clark and Thorn, 1997). Oxygen toxicity is attributed to increased production of reactive oxygen species (ROS) at high levels of inspired oxygen pressure which overwhelm the endogenous antioxidant defences of the body (Torbati et al., 1992). Oxygen free radical damage to cell membranes and proteins is thought to alter neuronal excitability, and therefore, neuronal function (King and Parmentier, 1983). No electrophysiologic study, however, has determined the effects of on membrane potential and spontaneous firing rate of neurons in the mCNS. The purpose of our study was to determine the effects of on neurons in the solitary complex (SC) of the dorsal medulla oblongata in rat, and to differentiate the effects of increased from those of pressure per se. The SC was investigated for two reasons; certain neurons exhibit chemosensitivity to changes in and at 1 ATA (Cowan and Martin, 1992; Dean et al., 1990), and we hypothesized that hyperbaric gases, likewise, would modulate neuronal activity. In addition, the SC is an important cardiorespiratory control area (Feldman and Ellenberger, 1988), and symptoms manifested before and during toxicity include several abnormal cardiorespiratory responses (Simon and Torbati, 1982; Torbati et al., 1989).
2.
MATERIALS AND METHODS
2.1
Brain Slices Brain slices, cut at 300 µm intervals in the transverse plane from the cau-
dal medulla oblongata, were prepared from juvenile and adult SpragueDawley rats of both sexes as previously described (Dean et al., 1990). Control artificial cerebrospinal fluid (aCSF) was composed of (in mM) 125
466
NaCl, 5.0 KC1, 1.3 26 1.24 and 10 glucose (300 mosM). The brain slice chamber was modified from the design of Dean and Boulant (1988). A brain slice was supported between two taut nylon meshes, submerged in mm of aCSF in a plexiglass chamber (Fig 1, C). The and pH of the aCSF were set at 1 ATA using gas mixture this was our normobanc control aCSF (Fig 1, left tank). The continuous flow of control aCSF to the brain slice prevented any significant change in tissue and extracellular due to off gassing. In addition, tissue and did not change during helium compression since the hyperbaric chamber atmosphere, which was initially flushed with helium at 1 ATA, contained no additional sources of and (Fig 2).
2.2
Electrophysiological Methods
Intracellular recordings were made with an Axoclamp 2A amplifier; the headstage of the Axoclamp 2A ) is pressure insensitive over the range of ambient pressures used in our study. The Axoclamp 2A headstage mounted directly to an electric microdrive (Marzhauser-Wetzlar DC3K). Microelectrodes were filled with 3 M potassium acetate tip resistance). A silver-silver chloride wire was used as the lead and the reference electrode was a glass capillary tube filled with 2% agar-potassium solution; this same reference was also used for the and electrodes (see below). Cells used in this study had a stable resting of at least -40mV and an action potential that overshot 0 mV (Dean et al., 1990). was passed through a window discriminator/rate meter to separate spontaneous action potentials from background noise so that firing rate could be quantified in 10 second bins. All signals were recorded on magnetic tape, strip chart recorder, and pCLAMP/Digidata 1200 data acquisition system. Control values for all variables were compared to those measured during experimental intervention in each cell by means of unpaired t-tests.
2.3
and
Electrodes
was measured in a brain slice using a needle electrode that consists of a platinum wire (Medwire PT3T), proton selective glass (Clark Electromedical Instruments, PH100-15), and the same reference electrode that was used for measuring and The tip had an outer diameter of Our electrode design was modified from that of Baumgartl et al. (1976). The electrode was connected to the ME 2 headstage of the Axoclamp-2A electrodes had a voltage response of-58 mV/pH unit over a range of 6-8 pH units. Tissue was measured with a
467
polarographic needle electrode (Fatt, 1976). The electrode tip had an outer diameter of and connected (along with the reference electrode) to a polarographic amplifier (A-M Systems Model 1900). Each electrode was calibrated using 21% and 95% Both electrodes were positioned by remote control with an electrical motorized microdrive once the hyperbaric chamber was sealed.
2.4
Hyperbaric Chamber and Pressure Protocols
A 72 liter hyperbaric chamber (maximum working pressure = 67.3 ATA) was used for intracellular recording in rat brainstem slices during uninterrupted compression and decompression (Fig 1, A; Dean and Mulkey, 1998). Control aCSF, warmed to 37°C in a water bath and equilibrated with control gas mixture at 1 ATA, was pumped to the brain slice (2 ml/min) using a high pressure liquid chromatography pump (Fig 1, left tank). aCSF temperature was maintained at 37°C at the slice using a servo-controlled thermoelectric/baffle assembly. Once the hyperbaric chamber was sealed, the microelectrode was advanced through the tissue slice at 4-6 intervals by remote control. Once a cell was impaled at 1 ATA and control data acquired, pressure was increased at a rate of 1-2 atmospheres/minute using 100% helium to a
468
maximum pressure of 2.6-4 ATA. Helium is inert and has no narcotic effect on cells (Taylor, 1987), thus it is used to hydrostatically compress the tissue hath and in vitro tissue preparation to determine the effects of pressure per se on neural activity (Etzion and Grossman, 1999; Fagni et al., 1987; Southan and Wann, 1996; Tarasiuk and Grossman, 1991). To test for the effects of a 1 liter hyperbaric pressure cylinder (Fig 1, B) was filled with control aCSF and compressed to a total pressure of 2.63.5 ATA with to produce a final of 2.5-3.4 ATA (Fig 1, far right tank). The pressure cylinder (B) was prepared in advance to allow sufficient time for equilibration of the aCSF with the hyperbaric gas mixture. With the main hyperbaric chamber (A) compressed to ATA with helium, control aCSF (0.95 ATA was switched over to hyperoxic aCSF A small positive pressure gradient from the sample cylinder atmospheres gauge) to the main hyperbaric chamber maintained a constant flow of hyperbaric oxygenated medium to the brain slice. After 218 minutes of the perfusate was switched back to control aCSF (0.95 ATA and several more minutes of data were collected before decompression back to 1 ATA.
3.
RESULTS
3.1
Stability of
and
Measurements
Nineteen neurons were impaled at 1 ATA total pressure resting input resistance, and exposed to a total of 69 helium compressions, ranging from 2.6-4 ATA. Thirteen of 19 neurons were also tested with Our first measurements of tissue and in the submerged brain slice preparation showed that the effects of helium compression (pressure per se) could be studied independently of increased Fig 2 shows that both tissue and were essentially unchanged from normobaric control levels during helium compression to 3 ATA. When control aCSF was changed to aCSF equilibrated with 3 ATA of in the pressure cylinder, tissue measured deep into the slice, increased from 190 to 450 mm Hg. There was also a small acidification sunit) during which was likely due to a small increase in and/or metabolic activity in the slice (see below, Fig 4). Tissue at 1 ATA was 7.27 at beneath the surface of the brain slice.
469
3.2
Hyperbaric Helium
Nineteen neurons in the SC were subjected to 1-43 minutes of hydrostatic compression with helium to 2.6-4 ATA. Fig 3 shows an intracellular recording of for a neuron in the nucleus tractus solitarius that was compressed to 4 ATA, which decreased depolarized the cell, and increased firing rate. Decompression to 1 ATA reversed these effects of pressure on and firing rate back towards normobaric levels. Three additional helium compressions to 3 ATA gave similar results for this same neuron (not
shown). Altogether, 6 of 19 neurons tested were responsive to 2.6-4 ATA of helium at constant and Of these 6 neurons, 5 were depolarized, as in Fig. 3, by hyperbaric helium and increased their firing rate. Measurement of in 4 baro-excited neurons showed that either decreased ) or increased ) during compression. In the sixth baro-responsive neuron, decreased, the cell was hyperpolarized, and firing rate decreased during compression. Fourteen other neurons tested in the SC were unaffected by ATA hyperbaric helium.
3.3
Hyperbaric Oxygen
Thirteen neurons in the SC were tested with Fig 4 shows an example of a neuron in the nucleus tractus solitarius that was first exposed to 3 ATA of helium, which caused a small decrease in and transiently increased firing rate. While at 3 ATA, control aCSF was switched to hyperoxic aCSF, which further decreased and depolarized the cell, producing an additional increase in firing rate. Restoring control aCSF at 3 ATA reversed the effects of Likewise, decompression to 1 ATA increased back
470
towards normobaric control level. Altogether, 8 of 13 neurons tested in the SC were depolarized by Changes in were variable between SC neurons; either decreased ( " neurons), increased ( neurons), or was unchanged ( neuron). Of the 8 neurons depolarized by 3 neurons were also depolarized by hyperbaric helium. In two of these cases, decreased with hyperbaric helium and increased with In the third cell, decreased with both hyperbaric helium and (Fig 4).
4.
DISCUSSION
There are three main findings in our study. First, it is technically feasible to maintain an intracellular recording of a neuron in a brainstem slice from the mCNS, and also to measure tissue and while changing ambient pressure over a physiological range. Our findings show that the effects of
471
hydrostatic compression with 100% helium _ _ . ATA helium) can be differentiated from ATA Second, brief exposure to increases neuronal excitability in many neurons of the SC. Third, 2.64 ATA hydrostatic (helium) pressure alters neuronal activity in the SC independently from To our knowledge, these are the first measurements of and firing rate in neurons of the mCNS during exposure to and moderate levels of hyperbaric helium.
4.1
Neuronal Sensitivity to
Oxygen toxicity of the mCNS is the primary limiting factor in US Navy closed circuit oxygen scuba diving operations (Butler and Thalmann, 1986).
Likewise, the primary limiting factor in
472
medicine is
toxicity of the
mCNS (Jain, 1996). forms ROS that can damage cell membranes, nucleus and DNA, enzymatic systems, and other cellular constituents. Normally, the body has antioxidant systems that inactivate ROS to less toxic forms via several enzymatic mechanisms and non-enzymatic quenchers (Jain, 1996). While toxicity is relatively rare in hyperbaric medicine, the potential for toxicity in every patient has determined current protocols used in therapy (Camporesi, 1996). Moreover, the use of in certain acute medical emergencies is necessarily limited because of the threat of toxicity. Certainly a better understanding of the neural events that precede toxicity, over a range of levels, would help us to understand the events that predispose a patient or diver to toxicity, and the cellular mechanisms by which ROS alter neural function. Our findings show that in the SC, which is an important cardiorespiratory control area, 61% of the neurons tested are depolarized after only 1-2 minutes of exposure to ATA of While all neurons were stimulated, at least two different cellular mechanisms may be involved based on our measurements of membrane conductance. The most common response, however, was decreased membrane conductance and depolarization, suggesting reduced potassium and/or chloride conductance during exposure to The different responses demonstrated by SC neurons exposed to hyperoxia may reflect the functional diversity of the neurons comprising this region; e.g. chemoreceptors, respiratory neurons, cardiovascular neurons, and interneurons, to name a few (Dean et al., 1990; Feldman and Ellenberger, 1988).
In most cases, the excitatory effect of was due solely to and not to hydrostatic compression since hyperbaric helium did not alter neuronal activity; however, as discussed below, some neurons did exhibit a separate excitatory response to hydrostatic pressure. In cases where both hyperbaric helium and depolarized the same neuron (3 of 8 cells), the change in was in opposite directions (2 of 3 cells). This indicates that different cellular mechanisms are involved in mediating barosensitivity to pressure and high in some medullary neurons. Our future experiments will attempt to further distinguish these different populations of sensitive neurons according to their morphology, repetitive firing mechanisms and neurotransmitters. Brain slice experiments typically employ a normobaric hyperoxic gas mixture to drive into brain tissue devoid of blood flow, as in this study. While the outermost layers of tissue are hyperoxic at 1 ATA, the inner layers will have a lower due to limited diffusion of (Bingmann and Kolde, 1982; this study). Thus, SC neurons at different depths within the slice were exposed to different levels of at 1-3 ATA. We have not yet determined the tissue profile for medullary slices
473
under control and conditions. Regardless of any regional differences in local tissue our findings show that increasing during hyperbaria, to levels that are known to increase the level of ROS and to produce seizures (Torbati et al., 1976, 1992), resulted in depolarization and increased firing in many SC neurons. Whether increased neuronal excitability represents the neural events that precede toxicity, or the neural events that occur during toxicity (i.e. seizures and abnormal cardiorespiratory activity), remains to be determined. Additional experiments, in which the level of and duration of exposure to are varied, will help resolve the temporal characteristics of the responsiveness of SC neurons to high dose
4.2
Neuronal Barosensitivity to Hyperbaric Helium
Our findings also showed that excitability in a specific group of SC neurons is affected by hydrostatic pressure. Typically, membrane conductance increased (decreased concomitantly with depolarization and increased firing rate, suggesting an increase in sodium and/or calcium conductance. This hypothesis, however, will need to be studied more rigorously. The majority of studies of the mCNS, using a variety of electrophysiologic techniques, have shown that extremely large levels of compression, ranging from 100-200 ATA, affect neural activity (Etzion and Grossman, 1999; Fagni et al., 1987; Southan and Wann, 1996; Tarasiuk and Grossman, 1991). Our findings, however, indicate that only 2.6-4 ATA also affects neural activity, at least in certain SC neurons. The lack of barosensitivity in the majority of neurons tested underscores the fact that barosensitivity in the SC is not a generalized phenomenon, but rather, represents a specific electrophysiological response that is unique to certain neurons. Neuronal barosensitivity to moderate levels of hydrostatic pressure could conceivably be important in some, as yet unknown, neurophysiological adaptive response to hydrostatic compression. Moreover, neuronal barosensitivity could contribute to the proposed, albeit controversial, long-term cumulative effects of repeated exposure to hyperbaria (Greer, 1997).
CONCLUSIONS It is technically feasible to record intracellularly from rat medullary neurons in tissue slices during exposure to and hyperbaric pressure. Both high and hydrostatic pressure affect neurons in the SC, typically by depolarization and increased firing rate. Presumably the excitatory effects of are due to increased production of ROS. The cellular site for neuronal barosensitivity is unknown. All neurons tested in the SC, however, are not
474
affected by and hyperbaric pressure. Future studies using these techniques will help identify the cellular mechanisms by which and hydrostatic pressure cause physiological and pathological changes in neurological function. Electrophysiological research may also help to prove or disprove some of the more controversial therapeutic uses of such as in treatment of traumatic brain injury, stroke, and other miscellaneous nervous system problems (Jain, 1996).
ACKNOWLEDGMENTS Funding for the development, testing and use of the hyperbaric chamber was provided in part by Wright State University School of Medicine and College of Science and Mathematics, and included the following sources: NIH Biomedical Research Support Grant; Research Initiation Grant; Research Challenge; Kettering Fund (Alpha Program); and Dr. P.K. Lauf, Department of Physiology and Biophysics. Materials and animals were supported in part by NIH R29 HL46308, NIH R01 HL56683, Kettering Hyperbaric and Wound Care, and Medical Multiplex Inc (JBD).
REFERENCES Baumgartl, H.T., Shigemitsu, D.W., and Lubbers, D. W., 1976, Micro-needle electrodes to measure ion activities in biological tissues. Naturwissenschaften 63: 40-41. Bingmann, D., and Kolde, G., 1982, in hippocampal slices of the guinea pig. Exper. Brain Res. 48: 89-96. Butler, F.K., and Thalmann, E.D., 1986, Central nervous system oxygen toxicity in closed circuit scuba divers I I . Undersea Biomed. Res. 13: 193-223. Camporesi, M.D., 1996, Hyperbaric oxygen therapy: a committee report. Kensington, Maryland: Undersea and Hyperbaric Medical Society, pp. 73.
Clark, J.M., and Thom, S.R., 1997, Toxicity of oxygen, carbon dioxide, and carbon monoxide. I n : Bove and Davis’ Diving Medicine 3rd edition (A.A. Bove, ed.), W.B. Saunders, Philadelphia, p. 131-145. Cowan, A.I., and Martin, R.L., 1992, Ionic basis of membrane potential changes induced by anoxia in rat dorsal vagal motoneurones. J. Physiol. (Lond.) 455: 89-109. Dean, J.B., Bayliss, D.A., Erickson, J.T., Lawing, W.L., and Millhorn, D.E., 1990, Depolarization and stimulation of neurons in nucleus tractus solitarii by carbon dioxide docs not require chemical synaptic input. Neuroscience 36: 207-216. Dean, J.B., Boulant, J.A., 1988, A dienccphalic slice preparation and chamber for studying
neuronal thermosensitivity. J. Neurosci. Meth. 23: 225-232. Dean, J.B., and Mulkey, D.K., 1998, A pressure chamber design for intraccllular recording from neurons in rat brainstem tissue slices during compression and decompression. Undersea and Hyperbaric Med. 25: 20.
475
Etzion, Y., and Grossman, Y., 1999, Spontaneous Na+ and Ca2+ spike firing of cerebellar Purkinje neurons at high pressure. Pflug. Arch. 437: 276-284. Fagni, L., Zinebi, F., and Hugon, M., 1987, Evoked potential changes in rat hippocampal slices under helium pressure. Exper. Brain Res. 65: 513-519. Fatt, I . , 1976, Measurement of oxygen tension in tissue and microbiological suspensions. In: Polarographic Oxygen Sensors, ( I . Fatt, ed.), CRC Press, p. 63-96.
Feldman, J.L., and Ellenbcrger, H.H., 1988, Central coordination of respiratory and cardiovascular control in mammals. Ann Rev. Physiol. 50: 593-606. Greer, H.D., 1997, Neurologic consequences. In: Bove and Davis’ Diving Medicine 3rd edition (A.A. Bove, ed.), W.B. Saunders, Philadelphia, p. 258-269. J a i n , K.K., 1996, Textbook of Hyperbaric Medicine (K.K. Jain, ed.), Hogrefe and Huber Publishers, Inc., Seattle, pp. 546. K i n g , G.L., and Parmentier, J.L., 1983, Oxygen toxicity of hippocampal tissue in vitro. Brain Res. 260: 139-142.
Simon, A.J., and Torbati. D., 1982, Effects of hyperbaric oxygen on heart, brain and lung functions in rat. Undersea Biomed. Res. 9: 263-275.
Southan, A.P., and Wann, K.T., 1996, Effects of high helium pressure on intracellular and field potential responses in the CA1 region of the in vitro rat hippocampus. Euro. J. Neurosci. 8: 2571-2581, 1996.
Tarasiuk, A., and Grossman, Y., 1991, High pressure reduces pH sensitivity of respiratory center in isolated rat brainstcm. Resp. Physiol. 86: 369-379. Taylor, C.D., 1987, Solubility properties of oxygen and helium in hyperbaric systems and the
influence of high pressure oxy-helium upon bacterial growth, metabolism, and viability.
I n : Current Perspectives in High Pressure Biology (H.W. Jannasch, and R.E. Marquis, eds.), Academic Press, London, p. 1 1 1-128. Torbati, D., Church, D.F., Keller, J.M., and Pryor, W.A., 1992, Free radical generation in the brain precedes hyperbaric oxygen-induced convulsions. Free Rad. Biol. Med. 13: 101-106. Torbati, D., Mokashi, A., and Lahiri, S., 1989, Effects of acute hyperbaric oxygcnation on respiratory control in cats. J. Appl. Physiol. 67: 2351-2356. Torbati, D., Parolla, D., and Lavy, S., 1976, Changes in the electrical activity and of the rat's brain under high oxygen pressure. Exper. Neurol 50: 439-447.
476
CHRONIC HYPOXIA INDUCES CHANGES IN THE CENTRAL NERVOUS SYSTEM PROCESSING OF ARTERIAL CHEMORECEPTOR INPUT
M.R. DWINELL, K.A. HUEY,AND F.L. POWELL Dept. of Medicine, University of California San Diego, La Jolla, CA 92093-0623
Abstract:
Chronic hypoxia increases the hypoxic ventilatory response (HVR) in awake rats and the phrenic nerve response to carotid sinus nerve stimulation in anesthetized rats. An increased sensitivity of the arterial chemoreceptors contributes to the increase in the HVR, but changes in the CNS processing of afferent information from arterial chemoreceptors are also involved. Adult male Sprague-Dawlcy rats were exposed to 0-7 days of hypobaric hypoxia Ventilation was measured in rats exposed to 0, 2 and 7 days of hypoxia using whole-body plethysmography. Ventilation increased after 2 days and remained elevated after 7 days of hypoxia. Following dopamine receptor blockade in the CNS, frequency significantly decreased after 0 and 7 days of hypoxia, but did not change significantly after 2 days of hypoxia. In anesthetized rats, the phrenic nerve response to carotid sinus nerve stimulation was reduced following systemic blockade in control rats and those exposed to 7 days of hypoxia. After 2 days of hypoxia, there was no effect of blocking systemic To determine whether changes in m R N A precede physiological changes, competitive RT-PCR was used to quantify mRNA in micropunches from the nucleus tractus solitarius (NTS) in normoxic and chronically hypoxic rats. In hypoxia, mRNA in the caudal NTS initially increased (6-12 hours) and then decreased below control levels (24 hours - 7 days). These results show that chronic hypoxia causes time-dependent changes in that could result in changes in the ventilatory response to hypoxia.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
477
1.
INTRODUCTION Ventilatory acclimatization to hypoxia results in a time-dependent increase in ventilation and decrease in arterial in humans as well as many animal species including rats (Dempsey and Forster, 1982). In awake rats, which follow a similar time course to humans for acclimatization (Olson and Dempsey, 1978), chronic hypoxia increases the hypoxic ventilatory response (HVR) (Aaron and Powell, 1993). The
increase in the HVR can involve an increase in the sensitivity of the carotid bodies, an increase in the central nervous system (CNS) translation of peripheral chemoreceptor input, or a combination of both depending on the duration of hypoxic exposure. An increase in carotid sinus nerve activity has been shown in goats after 4 hr of hypoxia demonstrating that increased hypoxic sensitivity of the carotid bodies contributes to ventilatory acclimatization (Nielsen et al., 1988). Recently, we showed that 7 days of chronic hypoxia significantly increased the phrenic nerve response to carotid sinus nerve stimulation in anesthetized rats, and we called this an increase in the “CNS gain of the HVR” (Dwinell and Powell, 1999). Therefore, multiple sites may be involved in the time-dependent increase in ventilation observed during prolonged exposure to hypoxia.
In response to hypoxia, dopamine (DA) is released from carotid body
glomus cells (Donnelly, 1993; Donnelly, 1996) and dopaminergic neurons in the nucleus tractus solitarius (NTS) (Goiny et al., 1991) and may modulate the HVR. Peripherally, dopamine receptors inhibit carotid sinus nerve activity. Peripheral blockade with domperidone increased carotid sinus nerve activity (Tatsumi et al., 1995). Centrally, blockade significantly decreases ventilation for a given level of arterial chemoreceptor activity (Smatresk et al., 1983) implying that central facilitate the HVR. The role that potential time-dependent changes in may play in
ventilatory acclimatization to hypoxia remain unknown. Experiments in
cats indicate that decreased inhibition of carotid body contributes to an increase in the HVR of cats after 2 days of hypoxia (Tatsumi et al, 1995). However, effects of longer hypoxic exposures and the role of in the CNS are unknown. In these experiments, we measured the effects of blockade in the CNS on ventilatory responses to arterial chemoreceptors in rats exposed to 0, 2 and 7 days of hypoxia. We also measured the levels of mRNA at various times during chronic exposure to hypoxia in the caudal NTS, the site of the primary synapse from the peripheral chemoreceptors.
478
2.
METHODS Adult male Harlan Sprague-Dawley were exposed to 0-7 days of hypobaric hypoxia
2.1
Awake ventilatory measurements
Ventilation was measured in awake rats ( following 0, 2 and 7 days of hypobaric hypoxia using continuous flow barometric pletliysmography. Respiratory frequency (fR) was measured directly from pressure changes while VI and tidal volume (V T ) was calculated from the VI induced pressure changes. VT was calibrated using 1 ml pulses injected into the plethysmograph at a rate similar to fR. Poikilocapnic HVRs were measured by lowering from 0.30 to 0.10 with and without blockade. Haloperidol (0.2 mg/kg), a systemic D 2 R antagonist, was given following peripheral blockade (domperidone 1 mg/kg. i.v.).
2.2
Anesthetized neurophysiologic measurements
Rats ( at each time point) exposed to 0, 2 or 7 days of hypobaric hypoxia were anesthetized with isoflurane initially and switched to urcthane (1.6 g/kg, i.v.) while ventilated with Femoral arterial and venous catheters were inserted for arterial blood pressure measurement, arterial gas sampling and intravenous fluid injection. The left carotid sinus nerve and left phrenic nerves were isolated using a dorsal approach. The nerves were cut and placed on bipolar platinum hook electrodes and placed in mineral oil. The phrenic nerve was preamplified (Grass P5 series), filtered, rectified and integrated using a moving time averager (MA-821, CWE, Inc., to acquire a moving average of peak nerve activity. The ventilator was set to maintain Torr above the threshold for phrenic nerve activity. Phrenic burst frequency (fR), peak amplitude of integrated phrenic activity and their product neural minute activity) were averaged over ten burst recorded immediately before stimulation, during the first ten burst of 45 second stimulation and during the final ten bursts of the 45 sec stimulation. The carotid sinus nerve was stimulated at 0.5, 1, 2, 5, 8, 11, 14, 17 and 20 Hz (3 times threshold, 0.2 msec duration) for 45 sec with 4 min between each stimulation. The carotid sinus nerve was restimulated using the same frequencies following systemic blockade (Haloperidol, 100 ; i.v.).
479
2.3
mRNA in NTS
Adult, male Sprague-Dawley rats were exposed to 0, 6, 12, 24, 48 and 168 hours of hypobaric hypoxia The animals were
anesthetized (pentobarbital, 50 mg/kg, i.p.) and the brain was removed and frozen in isopentane on dry ice. A 1-mm thick section from the brainstem caudal to the calamus was obtained and frozen on the sectioning blade with liquid nitrogen. 20-gauge hypodermic tubing was used to obtain bilateral punches of the caudal NTS. Competitive RT-PCR was used to quantify mRNA in NTS micropunches (Durgam et al., 1998).
3.
RESULTS
3.1
Awake ventilatory measurements Ventilation increased significantly following 2 days of hypoxia and
remained at that level following 7 days of hypoxia. VI increased on day 0 from ml/min/kg in to ml/min/kg in VI increased in to ml/min/kg and ml/min/kg on days 2 and 7, respectively. Although ventilation plateaued at 2 days of hypoxia, the mechanisms involved in the increased HVR may not be the same after 2 and 7 days of hypoxia. The fR response to CNS blockade in acute hypoxia varied with the duration of hypoxic exposure (Fig. 1).
480
3.2
Anesthetized neurophysiological measurements
Phrenic nerve activity increases with increasing carotid sinus nerve activity as previously reported (Dwinell and Powell, 1999). Haloperidol reduced phrenic burst frequency under control conditions and during all levels of stimulation in normoxic rats (Fig. 2A). After two days of hypoxia, there is no effect of haloperidol administration on the phrenic burst frequency response to carotid sinus nerve stimulation (Fig. 2B). However, after 7 days of hypoxia, the effect returns and reduces phrenic burst frequency during all levels of stimulation (Fig. 2C). These changes in burst frequency were not significant unlike the significant increase in the relationship between carotid sinus nerve stimulation frequency and phrenic nerve burst frequency previously observed with chronic hypoxia (Dwinell and Powell, 1999).
3.3
mRNA in NTS
To determine if changes in mRNA precede physiological changes, RT-PCR was used to quantify mRNA for isoforms in micropunches from the caudal NTS. The normoxic rats were used as control and all values were normalized to control. Initially mRNA increased above control values, but decreased below control levels as the hypoxic exposure continued (Table 1).
481
4.
DISCUSSION
The results from these experiments demonstrate that chronic exposure to hypoxia causes changes in in the CNS that influence ventilation and the HVR during ventilatory acclimatization to hypoxia. Ventilation is increased after 2 days of hypoxia and remains at that level after 7 days, indicating that acclimatization is complete after 2 days in rats. In addition, arterial between 2 and 7 days is constant (unpublished observations) providing further evidence that ventilatory acclimatization is complete. Although ventilatory acclimatization to hypoxia appears to be complete by 2 days, different mechanisms may be involved in the ventilatory output at the different time points. The CNS gain of the HVR increases with time (Dwmell and Powell, 1999) and the present study suggests that DA may be involved, although it is not the primary mechanism responsible for the increase in the HVR In the CNS, the caudal NTS is the primary site for synapses from the carotid body chemoreceptors (Housley and Sinclair, 1988; Vardhan et al., 1993). DA neurons and have been localized in the NTS (Kalia et al., 1985; Yokoyama et al., 1994). Based on several previous studies, CNS DA appears to have a facilatory effect on ventilation. Increases in ventilation and frequency were reported in anesthetized rats receiving a agonist, apomorphine, in the cerebral ventricles (Hedner et al., 1991). We hypothesized that an enhanced effect of CNS DA on ventilation during chronic exposure to hypoxia contributes to the increased CNS gain of the HVR. However, this was disproved after 2 days of hypoxia, when the facilatory effect of on the CNS gain of the HVR was reduced (Figs. 1 & 2). Hence, other factors (e.g. increased arterial chemoreeeptor sensitivity to must explain an increase in the HVR after 2 days of hypoxia. After 7 days of hypoxia, the facilatory effect of in the CNS returns and could thereby contribute to the sustained increase in ventilation when the inhibitory effect of on the carotid bodies returns (Huey and Powell, 1998). The time-course of changes in mRNA in the NTS with varying durations of hypoxia do not parallel the changes in phrenic nerve activity
482
and ventilation with blockade, suggesting the involvement of other mechanisms (e.g. mRNA stability, protein, signal transduction). The exact molecular mechanisms for changes in modulation of the CNS gain of the HVR after different lengths of hypoxic exposures remain to be determined. These results demonstrate that significant changes in mechanisms can occur despite constant ventilation, making the choice of duration of hypoxic exposure very important in studies investigating the mechanisms of ventilatory acclimatization to hypoxia.
ACKNOWLEDGEMENTS This work was supported by National Heart, Lung and Blood Institute Grants HL-17731 and HL-07212.
REFERENCES Aaron, E.A. and F.L. Powell. Effect of chronic hypoxia on hypoxic ventilatory response in awake rats. J. Appl. Physiol. 74: 1635-1640. 1993. Dempsey, J.A. and H.V. Forster. Mediation of ventilatory adaptations. Physiol. Rev. 62:262346, 1982. Donnelly, D.F. Electrochemical detection c a t e c h o l a m i n e release from rat carotid body in vitro. J. Appl. Physiol. 74:2330-2337, 1993. Donnelly, D.F. Chemoreceptor nerve excitation may not be proportional to catecholamine secretion. J. Appl. Physiol. 81: 57-664, 1996 Durgam, V.R. and S.W. Mifflin. Comparative analysis of multiple receptor subunit mRNA in micropunches obtained from different brain regions using a competitive RT-PCR method. J . Neurosci. Method . 84:33-40, 1998. Dwinell, M.R. and F.L. Powell. Chronic hypoxia enhances the phrenic response to arterial chemoreceptor stimulation in anesthetized rats. J. Appl. Physiol. In press, 1999. Goiny, M., H. Lagercrantz, M. Srinivasan, U. Ungerstedt and Y. Yamamoto. Hypoxiamediated in vivo release of dopamine in the nucleus tractus solitarii of rabbits. J. Appl. Physiol. 70:2395-2400, 1991. Hedner, J., T. Hedner, J. Jonason and D. Lundberg. Evidence for a dopamine interaction with the central respiratory control system in the rat. J. Neurochem. 57:1992-2000, 1991. Housley, G.D. and J.D. Sinclair. Localization by kainic acid lesions of neurones transmitting the carotid chemoreceptor stimulus for respiration in rat. J. Physiol. (Lond.). 406:99-114. Huey, K.A. and F.L. Powell. Time-dependent changes in dopamine D2 receptor modulation of carotid body output with chronic hypoxia. Society for Neuroscience Abstracts, p. 375, 1998. Kalia, M., K. Fuxe and M. Goldstein. Rat medulla oblongata. II. Dopaminergic, noradrenergic (A 1 and A2) and adrenergic neurons, nerve fibers, and presumptive terminal processes. J. Comp. Neurol. 233:308-332, 1985. Nielsen, A.M., G.E. Bisgard and E.H. Vidruk. Carotid chemoreceptor activity during acute and sustained hypoxia in goats. J. Appl. Physiol. 65:1796-1802, 1988.
483
Olson, E.B., Jr. and J.A. Dempsey. Rat as a model for human like ventilatory adaptation to
chronic hypoxia. J. Appl. Physiol. 44:763-769, 1978. Smatresk, N.J., M. Pokorski and S. Lahiri. Opposing effects of dopaminc receptor blockade on ventilation and carotid chemoreceptor activity. J. Appl. Physiol. 54:1567-1573, 1983. Tatsumi, K., C.K. Pickett and J.V. Weil. Possible role of dopaminc in ventilatory acclimatization to high altitude. Respir. Physiol, 99:63-73, 1995.
Vardhan, A., A. Kachroo and H.N. Sapru. Excitatory amino acid receptors in commissural nucleus of the NTS mediate carotid chemoreceptor responses. Am. J. Physiol. 264:R4150, 1993. Yokoyama, C . , H. Okamura, T. Nakajima, J. Taguchi and Y. Ibata. Autroradiographic distribution of
dopamine 1994.
484
a high-affinity and selective antagonist ligand for the
receptor group, in the rat brain and spinal cord. Brain Res. 662:127-133,
ACETYLCHOLINE IS RELEASED FROM IN VITRO CAT CAROTID BODIES DURING HYPOXIC STIMULATION
R.S. FITZGERALD, M. SHIRAHATA, H-Y.WANG Departments of Environmental Health Sciences, Physiology, Medicine, and Anesthesiology/ Critical Care Medicine, The Johns Hopkins Medical Instituions, Baltimore, MD, 21205 USA
Abstract:
1.
Previous pharmacological, immunocytochemical, electrophysiological, and microfluorometric studies have suggested that acetylcholine (ACh) is a critically important excitatory transmitter in the chemotransduction of hypoxia by the cat carotid body (CB). With the use of HPLC this study shows that the in vitro cat CB releases ACh under normoxic conditions; this release is increased when the CB is challenged with hypoxia. The preliminary observation that greater amounts of ACh are liberated in the presence of gallamine and AFDX116 suggests the presence of functioning M2 muscarinic receptors on the glomus cells of the CB.
INTRODUCTION
Several early studies suggested that ACh was an excitatory neurotransmitter in the carotid body and quite possibly released during an hypoxic challenge (von Euler et al. 1939, Landgren et al. 1952, Liljestrand 1954). However, not all agreed (Douglas 1953, Douglas 1954, Heymans and Neil 1958, Joels and Neil 1968, Moe et al. 1948). In the 1960s and 1970s Eyzaguirre and his colleagues (Eyzaguirre et al. 1965, Eyzaguirre and Zapata 1968, Nishi and Eyzaguirre 1971) again presented evidence supportive of an excitatory role for ACh in normal CB chemotransduction.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
485
But once again, not all agreed (Docherty and McQueen 1979, McQueen 1977, Sampson 1971). We have recently re-investigated the possibility with a series of pharmacological studies using blockers against putative cholinergic receptors. Immunocytochemical techniques have subsequently confirmed the presence of neuronal nicotinic receptors (Ishizawa et al. 1996, Shirahata et al. 1998), and others have demonstrated the presence of muscarinic receptors with (Dinger et al. 1986, Hirano et al. 1992). With the use of patch clamp and microfluorometric techniques we have demonstrated that the application of ACh with and without cholinergic blockers changes membrane voltages, currents, and intracellular calcium in cultured glomus cells and in cell bodies cultured from the petrosal ganglion. Though previous investigators have measured the amount of ACh present in the cat CB (Eyzaguirre et al. 1965, Fidone et al. 1976, Gual and Marsal 1987, Jones 1975), the release of ACh from the CBs of cats has not been measured. Further, the interaction of the specific cholinergic receptors on that release has not been explored. This overview presents evidence supportive of the “Cholinergic Hypothesis” which postulates that ACh is essential for the CB chemotransduction of hypoxia into increased neural activity proceeding from the CB to nucleus tractus solitarius. This neural input stimulates a wide array of respiratory, cardiovascular, endocrine, and renal systemic reflex responses.
2.
METHODS
For the pharmacological experiments cats were anesthetized. The area of the right CB was surgically exposed. A loop catheter was inserted and fitted with a stopcock so that intermittent infusions of hypoxic Krebs Ringer bicarbonate solutions (KRB) could be made between periods when the cat was perfusing its own CB with its own arterial blood. The lingual artery was fitted with an outflow catheter having a variable resistance while the external artery rostral to that was fitted with a snare. When an infusion from waterjacketed syringes was to be made, the snares on the common and external carotid arteries were drawn tight stopping arterial blood flow to the area, the stopcock turned, and the infusion made. Hence, the infusate went selectively only to the CB area with escape of the KRB via the lingual artery and venous outflow of the CB. These methods are presented in detail elsewhere (Fitzgerald and Shirahata 1994, Fitzgerald et al. 1997). For the HPLC experiments CBs were removed from deeply anesthetized cats, cleaned, treated with anticholinesterases while being incubated in KRB over 30 - 60 minutes of recovery. Subsequently the incubating CBs were exposed to various concentrations of for three 10 minute periods,
486
or one 25 minute period in KRB containing neostigmine. The incubation medium was filtered and either measured immediately or stored at until measurement. A Bioanalytical System High Performance Liquid Chromatograph was used. The procedures are detailed elsewhere (Fitzgerald et al. 1999).
3.
RESULTS
Figure 1 gives the first example of a pharmacological study. A cocktail of nicotinic and muscarinic blockers was used to reduce the neural response to hypoxic KRB. The response at the lower concentrations mecamylamine; atropine) was significantly depressed. The higher concentration of blockers (402 mecamylamine; 942 atropine) depressed the response to hypoxic KRB significantly more. Though the concentration of blockers in the perfusing syringe was high, it seems unlikely that these concentrations were acting at the C B after only 30s of perfusion. The first 7 - 12s of the perfusion was required to flush the dead space of the stopcock-catheter perfusion apparatus along with filling the arterial volumes leading up to the C B .
Mecamylamine alone also reduces the neural response to hypoxic KRB. The results of three different doses, (open bars are blocker-free hypoxic K R B ) are seen in Figure 2. The two highest concentrations generate significant depressions.
487
Given the results with atropine, we next attempted to determine if Ml muscarinic receptors could be distinguished from M2 muscarinic receptors. In a ganglion the postsynaptic M2 receptor is responsible for the slow inhibitory postsynaptic potential (sIPSP); the Ml receptor, the slow excitatory postsynaptic potential (sEPSP). Including gallamine, the M2 antagonist, in the hypoxic KRB would inhibit the sIPSP, making the postsynaptic neuron more excitable. Hence, we should see a bigger response to the hypoxic KRB. Blocking the Ml receptor with pirenzepine would block the sEPSP, making the postsynaptic neuron less excitable.
488
However, presynaptic M2 muscarinic receptors in many cholinergic systems serve to inhibit the further release of ACh, a type of negative feedback control. If the glomus cells contain M2 receptors and they function in this manner, then more ACh would be released and a larger response could be expected. Figure 4 shows the results of a double perfusion technique. That is, perfusion #1 always contained hypoxic KRB only. Perfusion #1 was followed immediately by perfusion #2 by rapidly turning a stopcock. Perfusion #2 contained either hypoxic KRB free of an antagonist, or hypoxic KRB containing gallamine or pirenzepine The figure strongly suggests that there are Ml and M2 muscarinic receptors in the cat CB, and they can be inhibited with impact on the neural response to hypoxic KRB. However, it is not clear from these data whether the receptors are presynaptic, postsynaptic, or both.
Extensive pharmacological data like that above strongly suggest that in the cat CB there is an essential cholinergic process involved in the neural response to hypoxic KRB. We have reported elsewhere (Ishizawa et al. 1996, Shirahata et al. 1998), the results of our immunocytochemical studies. In brief we have identified subunit containing, and subunit containing neuronal nicotinic receptors in the CB afferent system (glomus cell, Hering’s nerve, and the petrosal ganglion). These studies provided a second line of evidence that cholinergic processes were important in the chemotransduction of hypoxia. One of the critical criteria needed to establish a compound as a neurotransmitter is the fact that it is released in the locus of neurotransmission. Recently we have been measuring the release of ACh from in vitro CBs. Figure 5 summarizes the results of some of these studies. Paired CBs were incubated at 37°C in KRB and bubbled with various gas
489
mixtures -normoxia; _ hypocapnic hypoxia; - normocapnic hypoxia; | - hypercapnic hypoxia). The CBs were incubated for three 10 min periods. The KRB was removed, filtered centrifuged, and either analyzed immediately with HPLC or stored at -80°C for later analysis. An equal volume of KRB was inserted into the incubation tube for the subsequent 10 min interval. The three bars above each gas mixture in figure
5 represent the results from the three time intervals, 0-10 min, 10-20 min, and 20-30 min. The amounts of ACh released during the three time periods of the three hypoxic challenges are significantly greater than the amounts released during normoxia. The data show that ACh is released during normoxia, that hypoxia provokes a significantly larger release, and that the amount released does not decrease over the course of 30 minutes.
We are currently pursuing the possibility that at least part of the results shown in Figure 4 is the result of the released ACh acting on glomus cell M2 autoreceptors. As mentioned above, inhibiting an M2 autoreceptor on the glomus cell would be expected to yield a greater amount of ACh. Figure 6 shows the results of incubating paired CBs for 25 min before (PRE), during ( I N T R A ) , and after (POST) including 100 AFDX116. It is clear once again that hypoxia releases more ACh than does normoxia. Under normoxic conditions the release of ACh in the presence of the M2 blockers is greater than either before or after the blockers were present. During hypoxia the release of ACh during the administration of the blockers is only slightly higher than the release during hypoxia before the inclusion of the blockers, but is considerably elevated over the post blocker hypoxic release. We have recently observed that gallamine produced
490
the same result (data not shown). progress.
4.
But these latter studies are still in
DISCUSSION
The above data clearly suggests that a very essential cholinergic component is central to the chemotransduction of hypoxia in the CB of the cat. There were other studies supportive of and consistent with the above data. For example, when we perfused the cat CB in situ with hemicholinium-3, a well-known inhibitor of the fast choline uptake system
in many cholinergic processes, for 10 min, and then perfused the CB with hypoxic KRB, the response was significantly less than when the 10 min perfusion contained only KRB. Using pharmacological agents preventing the packaging of ACh into vesicles or the binding of these vesicles to the appropriate cell membrane for subsequent release into the extracellular fluid (in this case the “synapse” between glomus cell and apposed sensory nerve ending) also reduced the response to hypoxic KRB significantly below the control. All of the pharmacological experiments have been consistent. And these have been fortified by the identification of some neuronal nicotinic receptors. Heartened by the identification of these receptors and the work of Dinger and his colleagues (Dinger et al. 1986, Hirano et al. 1992), demonstrating the presence of muscarinic receptors in the CB, we have shown that applying cholinergic agonists and antagonists to glomus cells or to cells taken from the petrosal ganglion (the locus of the somae for the sensory fibers in the carotid body abutting onto the glomus cells) both membrane currents and voltages can be changed and intracellular calcium concentration can be influenced by cholinergic agonists (Shirahata et al. 1997). These changes can be reduced by the application of nicotinic antagonists like
491
mecamylamine,
and methyllycaconitine (Shirahata
et al. this volume). We feel that this compilation of data from several different disciplines is internally consistent, and points unmistakeably to an important cholinergic process in the CB’s chemotransduction of hypoxia...at least in the cat.
It may appear that the concentrations of our blockers - mecamylamine, atropine, gallamine, and pirenzepine - are excessive, and may well be creating “non-specific” inhibitions. This is possibly the case. An allied observation has been offered, namely that exogenously delivered antagonists
are able to block exogenously delivered agonists, but do not block the response to a physiological stimulus like hypoxia. We would reply that in response to hypoxic KRB gallamine did not inhibit the neural activity, but rather enhanced it, consistent with the concept that it was blocking an M2 “inhibitory” receptor somewhere in the CB chemotransductive apparatus. As mentioned above, we doubt that the concentrations we knew to be in
the perfusing syringes (and which are reported here) are actually the concentrations at the CB’s synapses between glomus cells and abutting sensory fibers when the significant depressions in neural activity first appear; i.e., after only 15 - 30s. Further, it is now well-known that
endogenously released neurotransmitters from the presynaptic component can reach concentrations of in the synaptic cleft within both the central and peripheral nervous systems (Udgaonkar and Hess 1986, Nishi et al. 1967, Clements 1996). Though these concentrations may be present in the cleft for only microseconds, this is long enough for them to bind to the appropriate receptors and have their physiological effect. It would seem, therefore, if an appropriately high concentration of the relevant blocker had not been exogenously applied and was not present in the CB, one should not anticipate a significant reduction in the normal response to a physiological stimulus such as hypoxia. In Figure 5 there appears to be a tendency for a greater release of ACh during the hypocapnic hypoxic stimulus than during the other forms of hypoxic stimuli. It is not statistically significant, but it did occur in the majority of experiments. This could be somewhat puzzling for any who have recorded in situ the CB’s neural response to normocapnic hypoxemia subsequently modified to become hypocapnic hypoxemia. The neural response unfailingly decreases. How does one reconcile a decrease in neural activity during hypocapnic hypoxemia with an increased release of ACh during hypocapnic hypoxia? We suggest that this may be the influence of pH upon both presynaptic and postsynaptic cholinergic receptors. The pH of the incubation medium during hypocapnic hypoxia was 7.85. Nicotinic
receptors - apparently as a function of their subunit composition - are
varyingly sensitive to pH; e.g. their channel kinetics. Mean channel open
492
time of Torpedo receptors expressed in Xenopus oocytes was maximal at neutral pH and decreased at both acidic and alkaline pH (Li and McNamee 1992, Palma et al. 1991). If the postsynaptic or subunit containing neuronal nicotinic receptors on the sensory fibers in the CB were inhibited by an alkalotic environment, then the neural activity would be reduced. Several types of muscarinic receptors are also affected by pH. In some, acidosis increases the ACh-activated inward current. To our knowledge the effect of alkalosis has not been reported. But if alkalosis inhibits the putative M2 inhibitory receptor on the glomus cell by inhibiting an inward current or by some other mechanism and this M2 receptor functions like presynaptic M2 receptors in other cholinergic systems, then the pH effect could explain why there appears to be an increased release of ACh during hypocapnic hypoxia. These possibilities await further investigation.
ACKNOWLEDGEMENT This work was supported by NHLBI grant HL 50712.
REFERENCES Clements, J., 1996, Transmitter time course in the synaptic cleft: its role in central synaptic function. Trends Neurosci. 19:163-172.
Dinger, B., Hiruno, T. and Fidone, S.J., 1986, Autoradiographic localization of muscarinic receptors in rabbit carotid body, Brain Res. 367: 328-331.
Docherty, R.J. and McQueen, D.S., 1979, The effects of acetylcholine and dopamine on carotid chemosensory activity in the rabbit. J. Physiol. Lond. 288: 411-423. Douglas, W.W., 1953, The effect of a ganglion-blocking drug, hexamethonium, on the response of the cat’s carotid body. J. Physiol. Lond. 118: 373-383. Douglas. W.W., 1954, Is there chemical transmission at chemoreceptors? Pharmacol. Rev. 6: 81-83.
von Euler, U.S., Liljestrand, G. and Zotterman, Y., 1939, The excitation mechanism on the chemoreceptors of the carotid body. Skand. Arch. Physiol. 83: 132-152. Eyzaguirre, C, Koyano, H. and Taylor, J.R., 1965, Presence of acetylcholine and transmitter release from carotid body chemoreceptors. J. Physiol. Lond. 178: 463-475. Eyzaguirre, C. and Zapata, P., 1968, The release of acetylcholine from the carotid body
tissues. Further study on the effects of acetylcholine and cholinergic blocking agents on the chemosensory discharge. J. Physiol. Lond. 195:589-607. Fidone, S.J., Weintraub, S.T. and Stavinoha, W.B., 1976, Acetylcholine content of normal and denervated cat carotid bodies measured by pyrolysis gas chromatography/ mass fragmentometry. J. Neurochem. 26: 1047-1049.
Fitzgerald, R.S. and Shirahata, M.,1994, Acetycholine and carotid body excitation during hypoxia in the cat. J. Appl. Physiol. 76:1566-1574. Fitzgerald, R.S., Shirahata, M. and Ide, T., 1997, Further cholinergic aspects of carotid body
chemotransduction of hypoxia in the cat. J. Appl. Physiol. 82: 829-898.
493
Fitzgerald, R.S., Shirahata, M. and Wang, H-Y., 1999, Acetylcholine release from cat carotid bodies, Brain Res. 841:53-61. Gual, A. and Marsal, J., 1987, Application of the chemiluminescent method to carotid body for detecting choline and acetylcholine. In: Chemoreceptors in Respiratory Control (J.A. Ribeiro and D.J. Pallot, eds.), Croom Helm Ltd., London and Sydney, pp. 108-113. Heymans, C. and N e i l , E., 1958, Reflexogenic Areas oj the Cardiovascular System, Churchill, London, p. 1 9 1 .
Hirano, T., Dinger, B., Yoshizaki, K., González, C. and Fidone, S., 1992, Nicotinic versus muscarinic binding sites in cat and rabbit carotid body Biol. Signals 1: 143-149. Ishizawa, Y., Fitzgerald, R.S., Shirahata, M., Schofield, B., 1996, Localization of nicotinic acetylcholine receptors in cat and petrosal ganglion. Adv. Exp. Med. Biol. 410: 253-256. Joels, N. and N e i l , E . , 1968, The idea of a sensory transmitter. In: Arterial Chemoreceptors
(R.W. Torrance, ed.), Blackwell Scientific Publications, Oxford and Edinburgh, pp. 153178.
Jones, J.V., 1975, Localization and quantities of carotid body enzymes: their relevance to the cholinergic transmitter hypothesis. In: The Peripheral Arterial Chemoreceptors (M.J. Purves, ed.), Cambridge University Press, London and New York, pp.143-144. Landgren, S., Liljestrand, G. and Zotterman, Y., 1952, The effects of certain autonomic drugs on the action potential of the sinus nerve. Acta Physiol. Scand. 26: 264-290. Li, L. and McNamee, M.G., 1992, Modulation of nicotinic acetylcholine receptor channel by pH: a difference in pH sensitivity of Torpedo and mouse receptors expressed in Xenopus oocytes. Cell. Mol. Neurobiol. 12: 83-93. Liljestrand, G., 1954, The problem of transmission at chemoreceptors. Pharmacol. Rev. 6:7376.
McQuecn, D.S., 1977, A quantitative study of the effects of cholinergic drugs on carotid chemoreceptors in the cat. J. Physiol. Lond. 273: 515-532. Moe, G., Capo, L. and Peralta, B., 1948, Action of tetraethylammonium on chemoreceptor and stretch receptor mechanism. Am. J. Physiol. 153: 601-605.
Nishi, K. and Eyzaguirre, C., 1971, The action of some cholinergic blockers on carotid body chemoreceptors in vivo. Brain Res. 33: 37-56. N i s h i , S., Soeda, H. and Koketsu, K., 1967, Release of acetylcholine from sympathetic
preganglionic nerve terminals. J. Neurophysiol. 30: 114-134. Palma, A., Li, L.,Chen, X., Pappone, P. and McNamee, M.G., 1991, Effects of pH on acetycholine receptor function. J. Membr. Biol. 120:67-73.
Sampson, S.R., 1971, Effects of mecamylamine in responses of carotid body chemoreceptors in vivo to physiological and pharmacological stimuli. J. Physiol. Lond. 212: 655-666. Shirahata, M., Fitzgerald, R.S. and Sham, J.S.K., 1997, Acetylcholine increases intracellular calcium of aterial chemoreceptor cells from adult cats. J. Neurophysiol. 78: 2388-2395. Shirahata, M., Ishizawa, Y., Rudisill, M., Schofield, B. and Fitzgerald, R.S., 1998, Presence of nicotinic acetylcholine receptors in cat carotid body afferent system, Brain Res. 814: 213-217.
Shirahata, M. Ishizawa, Y., Rudisill, M., Sham, J.S.K., Schofield, B. and Fitzgerald, R.S., 1999, Acetylcholine sensitivity of cat petrosal ganglion neurons. This volume. Udgaonkar, J. and Hess, G., 1986, Acetylcholine receptor kinetics: chemical kinetics. J. Membr. Biol. 93: 93-109.
494
INTERACTIONS BETWEEN ACETYLCHOLINE AND DOPAMINE IN CHEMORECEPTION 1 .
P. Zapata, 1C. Larraín, 1R. Iturriaga, 2J.Alcayaga and 1,3C. Eyzaguirre
1
Laboratory of Neurobiology, Catholic University of Chile, Santiago, Chile
2
Laboratory of Neurobiology, Faculty of Sciences, University of Chile, Santiago, Chile Visiting Professor from Department of Physiology, University of Utah School of Medicine,
3
Salt Lake City, UT, USA
1.
INTRODUCTION
In the carotid body, glomus (type I) cells make extensive synaptic contacts with chemosensory nerve endings, where nerve impulses are generated and
conducted in the carotid (sinus) nerve. There is abundant evidence that, in the absence of glomus cells, carotid nerve endings are unable to detect changes in the chemical composition of the blood. This prompted the idea that chemical stimuli act upon glomus cells, which in turn release transmitters that determine the impulse frequency in the chemosensory nerve fibers. Relevant to information transfer between glomus cells and chemosensory endings is the presence of reciprocal synapses between both elements (McDonald, 1981; Verna, 1979). Also, one should consider the electrotonic and metabolic coupling between neighbor glomus cells (Eyzaguirre & Abudara, 1995), possible centrifugal control over receptor cells (O'Regan, 1977), the presence of ganglion cells in the carotid bodies of some species (Kondo, 1976) and participation of sustentacular cells, partially wrapping receptor-neural contacts (Hess & Zapata, 1972; Pang & Eyzaguirre, 1993). The possibility also exists that some stimuli may act not only upon glomus cells,
but also on sensory nerve endings, whose characteristics may be trophically modified by their prolonged contact with glomus cells (discussion in Eyzaguirre & Zapata, 1982; Monti-Bloch et al. 1983). We will discuss below updated information relevant to possible roles played by acetylcholine and dopamine, and their interactions, at the level of information transfer between glomus cells and primary chemosensory neurons innervating the carotid body.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
K l u w e r Academic/Plenum Publishers, 2000
495
Acetylcholine (ACh). It is known that: 1) The carotid body parenchyma contains ACh, its synthesizing enzyme (choline acetyltransferase), its degrading enzyme (acetylcholinesterase) and a high-affinity incorporation system lor the precursor choline (see Eyzaguirre & Zapata, 1984); 2) ACh is released from the carotid body in situ (Metz, 1969) and in vitro (Eyzaguirre & Zapata, 1968b; Fitzgerald & Shirahata, 1996), as well as from cultured glomus cells (Shirahata et al. 1996); 3) ACh produces dose-dependent chemosensory excitation of carotid bodies both in situ and in vitro, an effect blocked by the nicotinic antagonists mecamylamine, hexamethonium and curare. However, the chemosensory nerve responses to natural stimuli are depressed but not eliminated when these blockers are given alone (see Zapata, 1997); 4) The dose-response curve for the chemo-excitatory effects induced by ACh on carotid bodies superfused in vitro is displaced to the left nearly 1,000-fold by pretreatment with eserine (Eyzaguirre & Zapata, 1968b), pointing to a large enzymatic activity of acetylcholinesterase within carotid body tissue. Dopamine (DA). There is experimental evidence that: 1) Glomus cells synthesize, store, release and reuptake DA; 2) DA released from the carotid body increases during chemosensory excitation; 3) The synthesis and storage of DA in carotid bodies are enhanced under chronic chemosensory excitation; 4) Applications of exogenous DA transiently inhibit the chemosensory activity recorded from carotid bodies in situ with intact circulation, as well as those superfused in vitro (except in the rabbit), an inhibitory effect which is blocked by dopaminergic antagonists; 5) Administration of exogenous DA in high doses -as well as of adrenaline and noradrenaline- may provoke chemosensory excitation in carotid bodies in situ, temporarily associated with changes in local blood flow, both being blocked by adrenergic antagonists. This effect is not observed in carotid bodies superfused in vitro, where flow is controlled by the observer; 6) After desensitization with repeated applications of DA or treatment with blockers, high doses of exogenous DA applied to carotid bodies superfused in vitro may induce chemosensory excitation, although with longer delay and duration than those of the inhibitory effects previously described; 7) The DA-induced early inhibition and delayed excitation may coexist in the same preparations in vitro and in situ; 8) Applications of D1 or blockers, as well as or adrenergic antagonists, do not interfere with chemosensory excitation evoked by hypoxia, hypercapnia, cyanide, nicotine or flow interruption, in both in situ and in vitro preparations; 9) Administration of antagonists enhances the chemosensory activity recorded from carotid bodies in situ and in vitro; 10) A slow intra-arterial infusion of DA, which depresses the basal chemosensory activity of carotid bodies in situ, also reduces the chemosensory responses evoked by low doses of cyanide. However, it enhances the responses to high doses of cyanide; 11) Simultaneous administration of DA and cyanide -in adequate doses to superfused carotid
496
bodies in vitro- suppresses or reduces the excitatory effects of the latter agent (lor references see Zapata, 1997). The contradictory proposals of DA being an excitatory or inhibitory transmitter between glomus cells and sensory nerve endings, based on some isolated observations, are not sustained when reviewing in full context the above-mentioned observations. 2.
EFFECTS OF ACETYLCHOLINE CAROTID BODIES IN SITU
AND
DOPAMINE
ON
Intracarotid injections of ACh in cats are followed by brief but intense increase in chemosensory discharge frequency (fx) (McQueen, 1977; Zapata & Eyzaguirre, 1985). Intravenous administration of ACh is avoided because of its pronounced cardiovascular effects, mostly mediated by muscarinic ACh receptors, making preferable the use of pure nicotinic agonists. A sigmoidal dose-response curve for increases in fx in the carotid nerve of normal carotid bodies was obtained with nicotine (given iv) in doses from 1 to However, regenerating chemosensory nerve endings that had not contacted glomus cells were totally unresponsive to nicotine (Zapata et al, 1976). Intracarotid injections of DA 100 ng or more, as well as iv injections above 100 ng/kg, decreased fx in the cat carotid nerve (Llados & Zapata, 1978; also Docherty & McQueen, 1978). This effect was reproducible without desensitization upon exposure to repeated injections. A maintained chemodepressant effect was produced by DA infused iv at (Zapata & Zuazo, 1980). Cross-circulation between both carotids is practically absent in the neck of the cat. Thus, intracarotid injection of drugs should be initially concentrated in the ipsilateral carotid circulation and later diluted systemically by recirculation before reaching the contralateral carotid. Furthermore, the blood levels of injected DA are halved by uptake during its passage through the lung circulation (Bryan-Lluka & O'Donnell, 1992). Therefore, we decided to infuse DA into one common carotid (by retrograde cannulation of the thyroid artery), expecting a marked difference in the chemosensory responses recorded simultaneously from both carotid nerves. The depression of chemosensory responses to small doses of DA, given in boluses, was indeed smaller and delayed at the contralateral side. Nevertheless, the sustained effects of intracarotid infusions of DA were similar in both carotid nerves, since DA doses eliciting minimal and maximal effects on fx are close to one order of magnitude. Thus, our attempt to study the effects of intracarotid infusion of DA on the chemo-excitation induced by NaCN and nicotine given iv, while using the contralateral side as control, was not entirely successful.
497
3.
DRUG INTERACTIONS IN CAROTID BODIES IN VITRO
Recordings were made from cat carotid nerves in vitro during superfusion of the carotid bodies with modified Tyrode´s solution equilibrated with 20100% The DA oxidation current was simultaneously recorded by chronoamperometry with carbon-fiber microelectrodes, inserted into the carotid body (Iturriaga et al. 1996). Intrastream injections of ACh and nicotine induced dose-dependent fast increases in fx in all preparations, associated in half of them with slow release of endogenous DA from carotid body tissues. When ACh or nicotine induced a measurable efflux of DA, further administration of larger doses of these agents produced larger increases in fx but a lower or undetectable DA efflux. Here we confirm a previous report (Zapata, 1975) that initial applications of DA most commonly decrease the basal fx of carotid bodies superfused with normoxic saline. Since desensitization occurs rapidly it is difficult to observe the inhibitory effects of exogenous DA when the carotid bodies are subsequently superfused with hypoxic saline, a condition that may induce release of endogenous DA from carotid body tissues (Iturriaga et al, 1996). However, when carotid bodies were simultaneously perfused and superfused in
vitro, intraluminal administration of DA consistently and repeatedly reduced the basal fx under normoxia and markedly reduced the chemosensory excitation evoked by hypoxia (unpublished observations). Thus, perfused in
vitro preparations behave similarly to in situ preparations, where the chemodepressant effects of DA have been consistently and repeatedly observed
(Llados & Zapata, 1978). We have no explanation for the rapid DA desensitization occurring only in carotid body preparations superfused in vitro. When DA was applied shortly before (30 s) or simultaneously with ACh or nicotine, the maximally evoked fxs were smaller than those induced by these agents when given alone (Fig. 1). Chemo-excitations evoked by larger doses of ACh or nicotine were reduced by larger doses of DA. The release of DA from carotid body tissues induced by nicotine was clearly enhanced and much faster when the preparation had been loaded with DA. Repeating the nicotine injections, without further DA loading, resulted in progressively smaller and slower DA effluxes, until their disappearance. At the same time, the chemo-excitatory effects of nicotine persisted (unpublished observations). 4.
INTERACTIONS IN PETROSAL GANGLIA IN VITRO
The sensory fibers of the carotid nerve, as well as those of other branches of the glossopharyngeal nerve, have their perikarya mostly in the petrosal
498
ganglion. Intracellular recordings from petrosal neurons showed that neurons whose processes innervated the carotid body had action potentials of configurations different from neurons associated with barosensory fibers innervating the carotid sinus (Belmonte & Gallego, 1983). These findings are in line with recent observations (Gold et al. 1996; Reichling et al. 1997) that support the idea that sensory neurons share some physiological and pharmacological properties with their peripheral nerve terminals. This should not be surprising since the protein components of transducing elements and/or chemical receptors, anchored in the membrane of the peripheral endings of sensory neurones are conveyed to these sites by fast axoplasmic transport from their respective somata (Koschorke et al. 1994). Thus, one may expect that transducer and receptor elements would also be found in the perikaryal presence of ACh and DA receptors in petrosal ganglion somata. Petrosal ganglia were excised along with the peripheral branches of the glossopharyngeal nerves. The ganglia were pinned to the bottom of a chamber, superfused with Hanks' balanced salt solution and covered with a layer of mineral oil. The glossopharyngeal nerve branches were lifted into the oil for recording.
499
Applications of ACh to the ganglion consistently generated hursts of action potentials conducted along the carotid nerve (Alcayaga et al,
1998). Only a few spikes were occasionally recorded from the glossopharyngeal branch, in response to the largest doses. The carotid nerve responses to ACh were dose-dependent, the higher doses inducing transient desensitization. When neostigmine was previously added to the superfusate, the dose-response curve to ACh shifted to the left, the being displaced by more than one order of magnitude (Fig. 2).
Application of nicotine to the petrosal ganglion also evoked dose-dependent excitatory responses in the carotid nerve. The responses to ACh were reversibly antagonized by adding hexamethonium to the superfusate. Mecamylamine produced a more marked and prolonged block of the ACh responses. In contrast with the above, applications of DA (from 1 ng to 5 mg) to the petrosal ganglion did not evoke bursts of impulses in the carotid nerve or in the glossopharyngeal branch. Furthermore, DA did not change the low frequency of spontaneous discharges commonly recorded from the carotid nerve (Alcayaga et al. 1999a). More recently, we have observed that the prolonged and high frequency burst of carotid nerve impulses induced by NaCN applied to the ganglion (see Alcayaga et al. 1999b) may be reduced and shortened by applying DA shortly after NaCN.
500
Figure 3 shows that when DA was applied 30 s before ACh, the response to
ACh changed: low doses of DA enhanced the subsequent responses to ACh,
while the high doses of DA depressed the responses to ACh (Alcayaga et al,
1999a). The depressant effect of DA on ACh responses was partially antagonized by adding spiroperone to the superfusate. Our results showed that the response to ACh of petrosal ganglion neurons projecting through the carotid nerve was modulated by DA acting on receptors located in the neuron somata. Thus, the dopaminergic modulation of cholinosensitivity was shared by the membranes of peripheral endings and perikarya of primary sensory neurons involved in arterial chemoreception. 5.
CONCLUSIONS
Most of the data reported above, and the emphasis of the following conclusions, relate to the cat carotid body. They can be extended to other mammalian species (see Zapata, 1997), except for the rabbit carotid body whose chemosensory activity is depressed in situ and in vitro by muscarinic actions of ACh and depressed in situ but enhanced in vitro by DA (Docherty & McQueen, 1979; Monti-Bloch & Eyzaguirre, 1980).
501
Results presented in this paper confirm that ACh is an excitatory agent for chemosensory neurons. DA mostly inhibits basal chemosensory activity during normoxia and modulates the excitatory responses evoked by ACh, nicotine, NaCN or hypoxia. Although DA is released from the carotid body upon stimulation by these agents, such release is not the excitatory link between glomus cells and chemosensory endings, but rather part of a modulatory mechanism. Concerning a cholinergic mechanism in chemotransmission the following is
pertinent. One argument against the involvement of cholinergic transmission in chemoreception was the finding that specific binding sites were mainly located in glomus cells (Chen et al. 1981; Dinger et al, 1981), leading to the idea that ACh receptors were absent in chemosensory neurons. This assumption is not supported by the effects of ACh on petrosal ganglion neurons and their reversal by mecamylamine, here reported. Even in the case of nicotine-induced DA release from the carotid body, fully reversible by mecamylamine, this is only halved by (Obeso et al. 1997). Therefore, at least two types of nicotinic ACh receptors are present in the chemoreceptor system. However, the main argument against the cholinergic hypothesis of chemoreception is the observation that chemosensory responses
to natural stimuli are not eliminated by cholinergic blockers (see Eyzaguirre & Zapata, 1984). Nevertheless, mecamylamine reduced the sensory responses to acidity and hypoxia of carotid bodies superfused in vitro (Eyzaguirre & Zapata, 1968a). There are discrepant reports on the effects of mecamylamine upon chemosensory responses studied in situ (Nishi & Eyzaguirre, 1971; Sampson, 1971). More recently, Fitzgerald and Shirahata (1994) have found that intracarotid perfusion with a mixture of mecamylamine, and atropine transiently reduced the chemosensory response to nicotine and hypoxic stimulation. It is conceivable that ACh is not "the" excitatory transmitter but "an" excitatory transmitter which contributes with other cotransmitters to the transfer of information between glomus cells and sensory nerve endings. One reason why the well documented increase in DA release during
chemoreceptor stimulation (see Gonzalez et al. 1994) is not essential for glomus cell to chemosensory nerve transmission is that DA release is not parallel in time with chemosensory excitation. Also, DA release consistently declines in response to repetitive chemoreceptor stimulation whereas chemosensory excitation continues (Buerk et al. 1998; Donnelly, 1996; Iturriaga et al. 1996). DA may modulate the chemosensory responses to ACh. This assertion is based on the affects of both agents on petrosal ganglion neurons. Applications of ACh and NaCN to these cells increase carotid nerve activity, an effect that is partially reversed by DA. It could be due to a nonspecific depressant effect of DA. However, the potentiating effect of low doses of DA on responses to A C h (Alcayaga et al. 1999a) appears to be very specific. 502
Twenty-two years ago, one of us suggested that DA could act as
physiological "modulator" of chemosensory activity (Zapata, 1977). The concept of a modulatory function at the synaptic level is not yet well defined. There is consensus on characterizing a modulatory agent as an endogenous substance that is not required for transmission of excitation from pre- to post-
synaptic elements, but that modifies the efficiency of such transmission. Modulation may be exerted on presynaptic and/or postsynaptic structures. The mechanisms involved are probably multiple. They may potentiate the release of the excitatory transmitter, modify its reuptake, change the rate of its enzymatic
degradation at the synaptic cleft, change its binding to postsynaptic receptors, the rate of functioning of second messengers, the probabilities of opening and closing of channels operated by the transmitter, etc. Thus, it has been found that DA modulates glutamatergic synaptic transmission in the parabrachial nucleus, primarily by activation of presynaptic receptors but secondarily via presynaptic receptors (Chen et al. 1999). However, the cellular or molecular characterization of these mechanisms is not proof or requisite of modulation, since this is referred to an integrative physiological process, to become apparent only by joint participation of the elements contributing to the chemoreceptor process. ACKNOWLEDGEMENTS
Work supported by grant 197-1013 from the National Fund for Scientific and Technological Development (FONDECYT) of Chile.
REFERENCES Alcayaga J, Iturriaga R, Varas R, Arroyo J & Zupata P (1998) Selective activation of carotid nerve fibers by acetylcholine applied to the cat petrosal ganglion in vitro. Brain Res 786: 47-54 Alcayaga J, Varas R, Arroyo J, Iturriaga R & Zapata P (1999a) Dopamine modulates carotid nerve responses induced by acetylcholine on the cat petrosal ganglion in vitro. Brain Res [In press] Alcayaga J, Varas R, Arroyo J, Iturriaga R & Zapata P (1999b) Responses of petrosal ganglion neurons in vitro to putative transmitters and hypoxic stimuli. [This volume] Belmonte C & Gallego R (1983) Membrane properties of cat sensory neurones with chemoreceptor and baroreceptor endings. J Physiol, London 342: 603-614 Bryan-Lluka LJ & O'Donnell SR (1992) Dopamine and adrenaline, but not isoprenaline, ar substrates for uptake and metabolism in isolated perfused lungs of rats. NaunynSchmiedeberg's Arch Pharmacol 346: 20-26
Buerk DG, Osanai S, Mokashi A & Lahiri S (1998) Dopamine, sensory discharge, and stimulus interaction with and in cat carotid body. J Appl Physiol 85: 1719-1726 Chen I-L, Mascorro JA, Yates RD (1981) Autoradiographic localization of b i n d i n g sites in the carotid body of the rat. Cell Tiss Res 219: 609-61 8
Chen X, Kombian SB, Zidichouski JA & Pittman QJ (1999) Dopamine depresses glutamatergic synaptic transmission in the rat parabrachial nucleus in vitro. Neuroscience 90: 457-468
503
Dinger B, González C , Yoshizaki K, Fidone S ( 1 9 8 1 ) Alpha-bungarotoxin binding in cat carotid body. Brain Res 205: 187-193 Docherty R.J & McQueen DS (1978) I n h i b i t o r y action of dopamine on cat carotid chemoreceptors. J Physiol, London 279: 425-436
Docherty RJ & McQueen DS (1979) The effects of acetylcholine and dopamine on carotid chemosensory activity in the rabbit. J Physiol, London 288: 411-423 Donnelly DF (1996) Chemoreceptor nerve excitation may not be proportional to catecholamine secretion. J Appl Physiol 8 1 : 657-664
Eyzaguirre C & Abudara V (1995) Possible role of coupling between glomus cells in carotid body chemoreception. Biol Signals 4: 263-270 Eyzaguirre C & Zapata P (1968a) Pharmacology of pH effects on carotid body chemoreceptors in vitro. J Physiol, London 195: 557-588 Eyzaguirre C & Zapata P (1968b) The release of acetylcholine from carotid body tissues. Further study on the effects of acetylcholine and cholinergic blocking agents on the chemosensory discharge. J Physiol, London 195: 589-607 Eyzaguirre C & Zapata P (1982) Trophic interactions between sensory nerves and their pren e u r a l elements. Arch Biol Med Exp 15: 219-228
Eyzaguirre C & Zapata P (1984) Perspectives in carotid body research. J Appl Physiol 57: 931-957 Fitzgerald RS & Shirahata M (1994) Acetylcholine and carotid body excitation during hypoxia in the cat. J Appl Physiol 76: 1566-1574
Fitzgerald RS & Shirahata M (1996) Release of acetylcholine from the in vitro cat carotid body. Adv Exp Med Biol 410: 227-232
Gold MS, Dastmalchi S & Levine JD (1996) Co-expression of nociccptor properties in dorsal root ganglion neurons from the adult rat in vitro. Neuroscience 71: 265-275 Gonzalez C , Almaraz L, Obeso A & Rigual R (1994) Carotid body chemoreceptors: from n a t u r a l s t i m u l i to sensory discharges. Physiol Rev 74: 829-898
Hess A & Zapata P (1972) I n n e r v a t i o n of the cat carotid body: Normal and experimental studies. Fed Proc 3 1 : 1365-1382
lturriaga R, Alcayaga J & Zapata P (1996) Dissociation of hypoxia-induced chemosensory responses and catecholamine efflux in cat carotid body superfused in vitro. J Physiol,
London 497: 551-564 Kondo H ( 1 9 7 6 ) I n n e r v a t i o n of the carotid body of the adult rat. Cell Tiss Res 173: 1-15 Koschorke GM, Meyer RA & Campbell JN (1994) Cellular components necessary for mechanoelectrical transduction are conveyed to primary afferent terminals by fast axonal transport. Brain Res 641: 99-104 Llados F & Zapata P (1978) Effects of dopamine analogues and antagonists on carotid body chemosensors in situ. J Physiol, London 274: 487-499 McDonald DM ( 1 9 8 1 ) Peripheral chemoreceptors: structure-function relationships of the carotid body. I n : Hornbein TF (ed) Regulation of Breathing. NY: Marcel Dekker. pp 105319 McQucen DS (1977) A quantitative study of the effects of cholinergic drugs on chemoreceptors in the cut. J Physiol, London 273: 515-532 Metz B (1969) Release of acetylcholine from the carotid body by hypoxia and hypoxia plus hypercapnia. Respir Physiol 6: 386-394
Monti-Bloch L & Eyzaguirre C (1980) A comparative physiological and pharmacological study of cat and rabbit carotid body chemoreceptors. Brain Res 193: 449-470 Monti-Bloch L, Stensaas LJ, Eyzaguirre C (1983) Carotid body grafts induce chemosensitivity in muscle nerve fibers of the cat. Brain Res 270: 77-92 N i s h i K & Eyzaguirre C ( 1 9 7 1 ) The action of some cholinergic blockers on carotid body chemoreceptors in vitro. Brain Res 33: 37-56
504
Obeso A, Gómez-Niño MA, Almaraz L, Dinger B, Fidone S, González C (1997) Evidence for two types of nicotinic receptors in the cat carotid body chemoreceptor cells. Brain Res 754: 298-302 O'Regan RG (1977) Control of carotid body chemoreceptors by autonomic nerves. Irish J Med Sci 146: 199-205 Pang L, Eyzaguirre C (1993) Hypoxia affects differently the intracellular pH of clustered and isolated glomus cells of the rut carotid body. Brain Res 623: 349-355 Reichling DB, Barratt L & Levine JD (1997) Heat-induced cobalt entry: an assay for heat transduction in cultured rat dorsal root ganglion neurons. Neuroscience 77: 291-294 Sampson SR ( 1 9 7 1 ) Effects of mecamylamine on responses of carotid body chemoreceptors in vivo to physiological and pharmacological stimuli. J Physiol, London 212: 655-666 Shirahata M, Ishizawa Y, Igarashi A & Fitzgerald RS (1996) Release of acetylcholine from cultured cat and pig glomus cells. Adv Exp Med Biol 410: 233-237 Verna A (1979) Ultrastructure of the carotid body in mammals. I n t l Rev Cytol 60: 271-330 Zapata P (1975) Effects of dopamine on carotid chemo- and baroreceptors in vitro. J Physiol, London 244 235-251 Zapata P (1977) Modulatory role of dopamine on arterial chemoreceptors. Adv Biochem Psychopharmacol 16: 291-298
Zapata P (1997) Chemosensory activity in the carotid nerve: Effects of pharmacological agents. I n : Gonzalez. C (ed) The Carotid Body Chemoreceptors. Berlin: Springer-Verlag. pp 119-146 Zapata P & Eyzaguirre C (1985) Bioelectric potentials in the carotid body. Brain Res 33 1: 3950 Zapata P & Zuazo A (1980) Respiratory effects of dopamine-induced i n h i b i t i o n of chemosensory inflow. Respir Physiol 40: 79-92 Zapata P, Stensaas LJ & Eyzaguirre C (1976) Axon regeneration following a lesion of the
carotid nerve: electrophysiological and ultrastructural observations. Brain Res 113: 235-
253
505
This page intentionally left blank.
INTERACTION BETWEEN CATECHOLAMINES AND NEUROPEPTIDES IN THE CAROTID BODY: EVIDENCE FOR DOPAMINE MODULATION OF NEUTRAL ENDOPEPTIDASE ACTIVITY
Ganesh K. Kumar, Eui K. Oh, and Myeong-Seon Lee Department of Biochemistry, Case Western Reserve University, Cleveland, OH 44106-4935 USA
Key words:
Dopamine, chemoreceptor, neprilysin, neuropeptide metabolism
Abstract:
Carotid body (CB) contains multiple neurochemicals that include catecholamines (CA) and neuropeptides. They are involved in the modulation of sensory response of the carotid body. Based on observations from the central nervous system, we hypothesized that CA modulates neuropeptide
metabolism in CB. To test our hypothesis, fetal calf carotid body model was
used. Immunocytochemical analysis showed that fetal calf carotid body expresses both tyrosine hydroxylase, and neutral endopeptidase-like immunoreactivity. To assess the effect of CA, thin slices of fetal calf carotid body were incubated with of dopamine (DA) at 37°C for 1 hour. As an index of neuropeptide metabolism, the activity of neutral endopeptidase (NEP), a major degrading enzyme of neuropeptides in CB was determined in the membrane-enriched and soluble fractions of the carotid body. CBs incubated with medium lacking DA served as control. On average, NEP activities of the membrane-enriched, and soluble fractions of the untreated CB were and pmole per hour per mg of CB respectively. At concentrations less than DA enhanced NEP activity of the membrane fraction whereas inhibition of NEP was observed in the soluble fraction At concentrations DA inhibited NEP activity of the two fractions.
When CBs were incubated with DA in the presence of
sodium dithionite, an oxygen scavenger, DA, even at higher concentrations, stimulated NEP activity of the membrane-enriched fraction. The above results demonstrate that DA modulates neuropeptide metabolism in CB via a nonreceptor-mediated mechanism involving a direct interaction with NEP.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
507
1.
INTRODUCTION
Carotid body from diverse species expresses a wide variety of neurochemicals including dopamine (DA), and neuropeptides. Several studies have documented that the neuropeptide substance P not only increases the sensory discharge of the carotid body but also potentiates the response of the carotid body to hypoxia (for reviews see Fidone & Gonzalez, 1986; Prabhakar, 1994). Previously, we have demonstrated that carotid body expresses the enzyme, neutral endopeptidase (NEP; E.C.3.4.24.11) that is involved in the hydrolysis of substance P (Kumar et al., 1990; Kumar, 1997). In the carotid body, NEP exists in two distinct molecular forms: a novel soluble form and a conventional membrane-bound form (Kumar, 1997). More importantly, close carotid body administration of phosphoramidon, an inhibitor of NEP, markedly potentiated the hypoxic response of the carotid body whereas the hypercapnic response was unaffected (Kumar et al., 1990). These observations led to the view that NEP is involved in the modulation of the sensory response of the carotid body to hypoxia. What is more interesting is the observation that the activity of NEP is regulated by hypoxia. For instance, short-term hypoxia decreased whereas prolonged
hypoxia increased NEP activity (Kumar et al., 1994). The cellular factors that are associated with this dual modulation of NEP activity in the carotid body during hypoxia remain to be identified.
A possible involvement of dopamine in the regulation of NEP activity in rat brain has been suggested by the studies of Waters et al. (1995, 1996 & 1997). These authors found that chronic or subchronic administration of apomorphine, a dopamine receptor-2 agonist, significantly reduced neuropeptide levels in certain regions of rat brain with a concomitant increase in the activity of enzymes involved in the metabolism of neuropeptides. Therefore, in the present investigation, using a fetal calf carotid body model we tested the hypothesis that dopamine may modulate NEP activity in the carotid body. We assessed the effect of exogenous dopamine on the activity of NEP in the carotid body in vitro. Our results showed that fetal calf carotid body exhibits several morphological features that are similar to those seen in carotid bodies from other species. Immunocytochemical analysis demonstrated that tyrosine hydroxylase, the rate-limiting enzyme in catecholamine biosynthesis and neutral endopeptidase, one of the major neuropeptide-degrading enzymes are expressed in the fetal calf carotid body. Exogenous dopamine modulated NEP activity of the carotid body in a dual fashion; inhibition of NEP activity under conditions that favour its auto-oxidation and enzyme activation under hypoxic condition.
508
2.
METHODS
2.1
Tissue preparation
Fetal calf carotid bifurcations were obtained from the slaughterhouse. Carotid bodies, located at the base of the common carotid artery around the bifurcation region, were dissected out and cleaned off the surrounding connective tissue elements. Freshly isolated carotid bodies were used for the biochemical experiments.
2.2
Immunohistochemistry
Carotid bodies were immersed in a fixative solution (4% paraformaldehyde in 0.1 M PBS) for 24 h at 4°C. After a brief washing in PBS, the specimen were transferred to 30% sucrose in PBS at 4°C for 24 h. The specimen were cut serially at on a cryostat, and mounted in four series on ploy-L-lysine coated slides. Sections were processed for immunohistochemistry according to the avidin-biotin conjugation (ABC) method. They were exposed to a fresh 0.5 % solution of hydrogen peroxide in methanol for 15 min at 25°C to inhibit endogenous peroxidase activity. After washing in several changes of 0.3% Triton X-100 in 0.1 M phosphatebuffered saline (PBS) the sections were blocked with avidin and biotin each
for 15 min and rinsed with PBS. The sections were incubated with the primary antibody overnight at room temperature. For the analysis of tyrosine hydroxylase (TH), a polyclonal antibody from Pel-Freez was used with dilution of 1:500. NEP-like immunoreactivity was analyzed using a polyclonal antibody, raised in rabbit against bovine NEP purified from bovine kidney cortex (1:500). Subsequently, the sections were rinsed with PBS and incubated with suitable secondary antibody for 60 min. Sections following PBS rinsing were stained with streptavidin-Texas Red. The sections were viewed using a Nikon fluorescence microscope (Eclipse E600) and images were recorded using the computer software program SPOT (Diagnostic Instrument). Few sections were also stained with HematoxylinEosin to assess the overall morphology of the fetal calf carotid body.
2.3
Incubation of intact carotid body with dopamine
Carotid bodies were incubated with dopamine (in the concentration range in 50 mM Tris-HCl buffer, pH 7.4 at 37°C for 1 hour. In few
509
experiments, 1 mM sodium dithionite was added to the incubation medium that minimizes auto-oxidation of dopamine. Carotid bodies incubated with either buffer alone or buffer containing 1 mM sodium dithionite served as controls. Following incubation, the carotid bodies were washed with buffer three times and homogenized using a glass homogenizer. Both soluble and membrane-enriched fractions of individual carotid body were prepared by differential centrifugation. NEP activity of the two fractions were determined using the procedure as described below.
2.4
Assay of NEP
NEP activity was measured by fluorometry using aminopeptidase M in a coupled-enzyme assay as described previously (Kumar, 1997). A synthetic peptide substrate, glutaryl-ala-ala-phe-4-methoxy-2-naphthylamide was used. The enzyme activity was determined under conditions where hydrolysis of substrate is proportional to enzyme concentration and incubation time. The specificity of enzyme activity measured in the assay was verified by analysis of the activity in the presence of of phosphoramidon. NEP activity is expressed in picomoles of product formed per hour per mg of carotid body.
2.5
Data analysis
NEP activity was expressed as mean Statistical significance was evaluated by a paired t-test. “P” values less than 0.05 were considered significant.
3.
RESULTS AND DISCUSSION
3.1
Overall morphology
The fetal calf carotid body is relatively larger than the tissue obtained from other mature species. On average, the wet weight of a single fetal calf carotid body was The morphological feature of the calf carotid
510
511
body was examined by staining the sections with Hematoxylin-Eoisin and the photomicrograph of a section is shown in Fig. 1. There are numerous cell clusters scattered in the connective tissue along with blood vessels and extensive network of nerve fibers. The size of the cell clusters is considerably large and within each cluster the cells are packed tightly. Over all, the morphology of the fetal calf carotid body resembles the features of
carotid body described in other species (McDonald, 1981; Fidone and Gonzalez, 1986).
3.2
Tyrosine hydroxylase (TH)-like immunoreactivity
Intense immunoreactivity for TH was seen in the cytoplasm of round or oval shaped cells of the fetal calf carotid body (Fig. 2). These cells also showed positive immunoreactivity for chromogranin A (data not shown). TH immunoreactive cells were seen often as clusters and were located near blood vessels. The fact that TH-IR positive cells also express chromogranin
A suggests that these cells are similar to type I cells of the mature carotid body. These observations also suggest that catecholamine biosynthetic machinery is functional in the fetal calf carotid body.
512
3.3
Neutral endopeptidase (NEP)-like immunoreactivity
With NEP polyclonal antibody, a punctate-type labeling was seen in various cell clusters (Fig. 3) that showed positive TH-like immunoreactivity (Fig. 2). In general, NEP-like immunoreactivity was seen close to the cellular membrane in the extra-cellular space. Occasionally, some immunoreactivity was also seen in the epithelial cells lining the blood vessels. Biochemical analysis of the cell-free extract showed significant NEP activity both in the soluble and membrane-enriched fractions of the calf carotid body. Taken together, the above results provide evidence for the functional expression of NEP in the fetal calf carotid body.
3.4
Effects of exogenous dopamine on NEP activity
Incubation of the whole carotid body with a freshly prepared solution of dopamine differentially affected the activities of soluble NEP (sNEP) and membrane-bound NEP (mNEP) respectively. As shown in Table 1, low concentrations of stimulated the activity of mNEP
513
whereas sNEP activity was inhibited However, at higher concentrations DA inhibited mNEP in a dose-dependent manner.
It is likely that under physiological conditions, DA may undergo autooxidation reactions wherein the amount of auto-oxidation product(s) in the reaction medium is dependent on the concentration of DA and/or the presence of divalent metal ions. While DA by itself is stimulatory to enzyme activity its auto-oxidation derivative(s) may inhibit the activity of mNEP. We tested this possibility by determining NEP activity of the carotid body pre-incubated with solutions of DA containing 1 mM sodium dithionite. Sodium dithionite is a potent reducing agent and minimizes the formation of auto-oxidation products of DA. In the presence of sodium dithionite, DA, even at higher concentrations increased mNEP activity of the carotid body (Table 1). Taken together, the above results support the notion
that DA, in its native form, activates mNEP whereas its auto-oxidation derivative(s) inhibits mNEP. However, sodium dithionite did not prevent DA-induced inhibition of sNEP suggesting that auto-oxidation derivative(s) of DA is not associated with the inhibition of sNEP of the carotid body. Two auto-oxidation pathways for DA have been proposed (Graham, 1978; Smythies and Galzigna, 1998) in which 6-hydroxydopamine and dopamine o-quinone respectively were formed as the initial oxidation products. In a series of subsequent oxidation reactions, they are further converted into dihydroxyindole and indole quinone derivatives. It remains to be determined which one of the auto-oxidation products of DA is involved in the inhibition of mNEP activity of the carotid body. In summary, we showed that exogenous DA, in its non-oxidized form, increases NEP activity of the carotid body and especially the membranebound form of the enzyme. However, DA treatment of the carotid body resulted in the inhibition of the soluble NEP form. Under condition that favors its auto-oxidation, DA inhibited the activity of mNEP of the carotid
514
body. Our results provide evidence that DA can influence peptide metabolism in the carotid body by affecting the activity of NEP, a major peptide hydrolyzing enzyme in the chemoreceptor tissue. Thus, DA-NEP interaction constitutes one of the mechanisms by which dopaminergic compounds modulate the response of neuropeptides both in the central and peripheral nervous system.
4.
ACKNOWLEDGEMENT
This study was supported by grant from National Institutes of Health HL46462.
5.
REFERENCES
Fidone, S. J. and Gonzalez, C. (1986). Initiation and control of chemoreceptor activity in the
carotid body. In N. S. Cherniack and J. G. Widdicombe (Eds.), Handbook of Physiology. Section 3: The Respiratory System, Bethesda, American Physiological Society, Vol. II, pp. 267-312. Graham, D. G. (1978). Oxidative pathways for catecholamines in the genesis of neuromelanin and cytotoxic quinones. Mol. Pharmacol. 14: 633-643. Kumar, G. K., Runold, M, Ghai, R. D., Cherniack, N. S. & Prabhakar, N. R. (1990). Occurrence of neutral endopeptidase activity in the cat carotid body and its significance in chemoreception. Brain Res. 517: 341-343.
Kumar, G. K.., Prabhakar, N. R., Strohl, K. P., Thomas, A., and Cragg, P.A. (1994). Low dependency of neutral endopeptidase and acetylcholinesterase activities of the rat carotid body. Adv. Exp. Med. Biol. 360: 217-220.
Kumar, G. K. (1997). Peptidases of the peripheral chemoreceptors: biochemical, immunological, in vitro hydrolytic studies and electron microscopic analysis of neutral
endopeptidase-like activity of the carotid body. Brain Res. 748: 39-50.
McDonald, D. M. (1981). Peripheral chemoreceptors: structure-function relationships in the carotid body. In T. F. Hornbein (Ed.), Regulation of Breathing, Part I, Marcel Deckker, New York, pp. 105-319. Prabhakar, N. R. Neurotransmitters in the carotid body. Adv. Exp. Med. Biol. 360: 57-69, 1994. Smythies, J. and Galzigna, L. (1998). The oxidative metabolism of catecholamines in the brain: a review. Biochim. Biophys. Acta 1380: 159-162.
Waters, S. M., Konkoy, C. S., and Davis, T. P. (1995) Neuropeptide metabolism on intact, regional brain slices: Effect of dopaminergic agents on substance P, cholecystokinin and met-enkephalin degradation. J Pharmacol Exp Ther 274, 783-789. Waters, S. M., Konkoy, C. S., and Davis, T. P. (1996) Haloperidol and apomorphine differentially affect neuropeptidase activity. J Pharmacol Exp Ther 277, 113-20.
Waters, S. M., Rounseville, M. P., and Davis, T. P. (1997) Effect of dopaminergic drugs on processing and degradative neuropeptidase mRNA in rat frontal cortex and caudateputamen. Brain Res 754, 28-34.
515
This page intentionally left blank.
PHARMACOLOGICAL EFFECTS OF ENDOTHELIN IN RAT CAROTID BODY Activation of Second Messenger Pathways and Potentiation of Chemoreceptor Activity
J. Chen, L. He, B. Dinger, and S. Fidone Department of Physiology, University of Utah School of Medicine, Salt Lake City, UT 84108
1.
INTRODUCTION
Endothelins (ETs) are a unique family of 21 amino acid vasoconstrictor peptides which are present in the endothelial cells of most vascular beds. However, ETs are also present in numerous other cell types including airway epithelial cells and neurons in the peripheral and central nervous system (see Simonson & Dunn, 1990; Rubanyi & Polokoff, 1994 for review). In addition, using immunocytochemical techniques, we recently demonstrated the presence of ET in chemosensory type I cells of the rat carotid body (He et al., 1996). In various other tissues, the actions of ET have been shown to involve specific and receptors, each of which have different affinities for the three known ET isoforms, ET-1, ET-2 and ET-3. ET receptors are G-protein coupled, and tissue specific responses are mediated by phospholipase C (PLC) and phospholipase as well as adenylate cyclase (AC). The potent vasoconstrictor effects of ET are mediated by receptors coupled to PLC, but in some vascular beds receptors initiate vasodilation and systemic hypotension via the release of nitric oxide (Eddahibi et al., 1993; Rubanyi & Polokoff, 1994).
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
517
Using autoradiographic techniques, McQueen et al. (1995) were the first to demonstrate that receptors are associated with the carotid body vasculature, as well as lobules of type I and type II cells. This group also made the salient observation that intravenous administration of ET-1 stimulates respiratory minute volume, an effect which is blocked by the specific antagonist, FR139317. It was also shown that the stimulatory effects of ET-1 were abolished following bilateral transection of the carotid sinus nerves (CSN), and moreover, that the vascular injection of ET-1 excited CSN chemoafferent nerve fibers. Although these findings strongly implicated the carotid body in respiratory stimulation elicited by ET, McQueen et al. (1995) concluded that data gathered from in vivo preparations could not distinguish between changes in carotid body blood flow versus direct effects of ET-1 on the sensory apparatus (i.e., type I cells).
In the present study, we have evaluated the effects of ET-1, and a specific antagonist, BQ-123, on CSN activity recorded from rat carotid body/CSN preparations superfused in vitro, where vascular effects are absent. In addition, we have investigated the effects of ET-1 on cyclic AMP (cAMP) and inositol phosphate second messenger production in the chemosensory tissue. Our data indicate that ET-1 potentiates hypoxia-evoked chemoreceptor activity, an effect which may involve a classical second messenger signaling cascade in type I cells.
2. 2.1
METHODS Electrophysiological Recording of Carotid Sinus Nerve (CSN) Activity
Under ketamine/xylazine (10 mg/100 g; 0.9 mg/100 g) anaesthesia, and with the aid of a dissecting microscope, the carotid bifucations containing the carotid bodies were located and removed from adult rats and placed in a lucite chamber containing modified Tyrode solution at 0-4 °C sodium glutamate 42; HEPES buffer, 5; glucose, 5.6; Each carotid body along with its attached nerve was carefully removed from the artery and cleaned of surrounding connective tissue, and the preparation was then placed in a conventional superfusion chamber where the carotid body was continuously superfused (up to 4 h) with modified Tyrode solution maintained at 37 °C and equilibrated with a selected gas mixture. The CSN was positioned in the tip of a glass suction electrode for monopolar recording of
518
chemoreceptor activity. The bath was grounded with a wire, and neural activity was led to an AC-coupled preamplifier, filtered and transferred to a window discriminator and a frequency to voltage converter. Signals were processed by an AD/DA converter for display of frequency histograms on a PC computer monitor. 2.2
Cyclic AMP Immunocytochemistry
Carotid bodies were incubated in vitro for 10 min in superfusate equilibrated with and containing either Tissues were fixed in ice-cold phosphate buffered 4% paraformaldehyde (2 h), rinsed in PBS and stored in 20% sucrose/PBS (1 h). Frozen sections were exposed to avidin-biotin preblocking reagents (Vector), incubated overnight in primary antisera to cyclic AMP (Fitzgerald, Inc.), then rinsed in PBS. Incubation proceeded at room temperature in avidin-biotinylated HRP complex, reacted with DAB and (see Wang et al., 1991b for details).
2.3
Inositol Phosphate Accumulation in Prelabeled Carotid Bodies Carotid body wet weights were determined on a Cahn electrobalance
equipped with a humidified chamber. The tissues were then placed in glass
mini-vials for a 30 min preincubation in 1 ml of -Tyrode's solution at 37°C in a water-bath shaker. This solution was replaced with Tyrode containing of inositol for 60 min to label
polyphosphoinositides. Following incorporation, the carotid bodies were thoroughly washed for 60 min at 37 °C in two changes of Tyrode's solution containing 5 mM unlabeled myo-inositol and 10 mM LiCl. Incubation proceeded as specified in the Results in solutions which included 10 mM LiCl. Incubations were terminated in a mixture of chloroform/methanol (1:2 by volume), allowed to stand for 15 min and homogenized in a glass-glass homogenizer. Following the addition of 1 ml chloroform and 0.5 ml water, the tubes were vortexed and phases separated by centrifugation. An aliquot (1.4 ml) of the upper phase was removed and subjected to a stream of for 5 min to remove any traces of chloroform. The volumes were adjusted to 3.0 ml with water and the samples added to
columns of (formate form). The columns were washed with 10 ml of water, 15 ml of sodium tetraborate (5 mM) plus sodium formate (60 mM) and finally the labeled inositol phosphates were eluted with 1.0 M
519
ammonium formate/0.1 M formic acid and a 0.8 ml aliquot removed for determination of in a Packard model 1500 scintillation spectrometer.
3.
RESULTS
3.1
Effect of ET-1 on Carotid Sinus Nerve (CSN) Activity
Figure 1 (left panel) presents four superimposed traces of integrated CSN activity recorded from an in vitro preparation. Basal nerve activity was established at a bath _ of 450 Torr. Switching to solution equilibrated with air resulted in a highly reproducible decrease in bath to 120 Torr, represented by the single record. This moderate level of hypoxia evoked a rapid increase in CSN activity, followed by a maintained high level of discharge (see trace labeled 'control'). Restoring bath to 450 Torr elicited a rapid fall in nerve activity to basal levels. The introduction of 1.0 ET-1 into the bath for 4.5 min at 450 Torr did not alter basal nerve activity. However, in the presence of ET-1 the nerve activity evoked by hypoxia was substantially increased. This potentiation of
520
the evoked nerve activity was blocked in the presence of a saturating concentration of the specific antagonist, BQ-123 Finally, after washing the preparation for several min the response to hypoxia returned to control (pre-drug) levels (i.e., 'recovery' in Fig. 1). The right panel of Figure 1 summarizes data from six experiments. In the presence of the hypoxia-evoked nerve activity was increased by an average of 38% and this effect was significantly blocked by BQ-123.
3.2
Effect of ET-1 on Cyclic AMP (cAMP) Immunostaining
Figure 2A shows basal levels of cAMP immunoreactivity in rat carotid body following incubation in vitro in Locke solution (see Wang et al., 1991b) equilibrated with Detectable levels of cAMP were found in cells with morphological features typical of type I chemosensory cells. However, under these non-stimulus (normoxic or hyperoxic) conditions, the staining intensity varied widely, including many unstained cells, whereas stained cells displayed light to medium brown reaction product in their cytoplasm. A 10 min incubation in ET-1 produced substantially higher levels of cAMP in the carotid body. In these preparations (Fig. 2B), virtually all type I cells displayed medium to dark brown reaction product. Other cellular elements in the tissue (e.g., type II cells, myelinated axons, endothelial cells, connective tissue) were not stained.
521
3.3
Effect of ET-1 on Inositol Phosphate in the Carotid Body
Generation
Figure 3 shows levels in rat carotid bodies incubated for 10 min in solutions equilibrated with Basal levels of were elevated approximately 5-fold in the presence of and this effect was partially blocked in the presence of Exposure to superfusate equilibrated with a moderate hypoxic stimulus, did not significantly alter basal levels in the chemosensory tissue (data not shown).
4.
DISCUSSION
The chemo-excitatory properties of ET were first documented by McQueen and his colleagues (1995). The present findings confirm the excitatory nature of ET, but in addition, an important difference can be distinguished between our results, obtained from in vitro superfused preparations, versus the earlier data recorded in vivo. In normoxic (air breathing) rats, close intra-arterial injection of ET-1 increased chemoafferent nerve activity (McQueen et al., 1995). However, the present experiments demonstrate that ET-1 applied to in vitro superfused carotid bodies potentiates the response to hypoxia, but it does not alter the basal CSN discharge rate. Although other explanations cannot be ruled out, it is possible that excitation elicited in vivo is initiated by the potent vasoconstrictor properties of this peptide. The hypoxia consequent
522
to reduced blood flow may then further enhance the response via the direct effects of ET-1 on type I cells. The inability of ET-1 to increase basal nerve activity may at first seem inconsistent with the elevated cAMP and levels elicited by the peptide in solutions equilibrated with However, these findings are consonant with earlier reports that basal CSN discharge rates remain stable in the presence of forskolin and atriopeptin III, agents which promote high levels of
cAMP and cGMP, respectively, in type I cells (Perez-Garcia et al., 1990; Wang et al., 1991a; Wang et al., 1991b; Wang et al., 1993). Increased levels of cyclic nucleotide and inositol phosphate second messengers are of course known to activate specific protein kinases. In the case of the cAMP/protein kinase A (PKA) cascade, earlier studies in other tissues have identified the protein forming voltage-sensitive as a primary target (Armstrong & Eckert, 1987; Armstrong & Eckert, 1987; Ono & Fozzard, 1992). Importantly, phosphorylation of this protein increases single channel conductance. In the normoxic carotid body, when the voltagedependent channels are closed, such a change would not be expected to elicit excitation. However, during hypoxia the phosphorylated channels may give rise to greater and increased transmitter release from type I cells. Indeed, we have confirmed in the rabbit carotid body that ET-1 augments voltage-activated inward current in type I cells, while potentiating the release of catecholamines from these cells (Chen et al., in press). At this time little is known about the potential involvement of in the chemoresponse. Although ET-1 elevates levels in the carotid body, this response is not mimicked by hypoxia. Nor does the application of ET-1 increase basal levels in dissociated rabbit type I cells (Chen et al., in press). Thus, the well-known release of from internal stores, a signature effect of increased levels, is not apparent in type I cells treated with ET-1. Consequently, ETA-receptors coupled to PLC may not be present in type I cells, and moreover, the effects of ET-1 on levels in the carotid body might occur in the abundance of other cell types present in this organ, including the type II cells ensheathing type I cells, smooth muscle cells and fibroblasts.
In summary, ET-1 elevates the levels of and cAMP in carotid bodies superfused in vitro. Immunocytochemical techniques localize the increase in cAMP to type I cells. Basal nerve activity is not altered by ET-1, but CSN activity evoked by hypoxia is significantly elevated in the presence of the peptide, an effect which is blocked by the specific antagonist, BQ-123. Although these data demonstrate interesting pharmacological effects
523
of ET, the physiological role of the endogenous peptide in carotid body
function is yet to be determined. Interestingly, chronic exposure to hypoxia leads to increased plasma levels of ET peptides and up-regulation of ET gene
expression in the lung (Li et al., 1994). Furthermore, an important role for ET has been demonstrated in this tissue, where receptor
antagonists have been shown to prevent the tissue remodeling and reshaping as well as the development of pulmonary hypertension during sustained exposure to low ambient
(Bonvallet et al., 1994; Chen et al., 1995). In
view of the presence of ET in type I cells and its potent pharmacological effects, this highly unique peptide might be equally important in mediating the well-documented changes which occur in the morphology and chemosensitivity of the carotid body during chronic hypoxia.
ACKNOWLEDGMENT Supported by USPHS grants NS12636 and NS07938. REFERENCES
Armstrong, D., and Eckert, R., 1987, Voltage-activated calcium channels that must be phosphorylated to respond to membrane depolarization. Proc. Natl. Acad. Sci. USA 84: 2518-2522. Bonvallet, S.T., Zamora, M.R., Hasunuma, K., Sato, K., Hanasato, N., Anderson, D., and Stelzner, T.J., 1994, BQ123, an antagonist, attenuates hypoxic pulmonary hypertension in rats. Am. J. Physiol. 266(35): H1327-H1331. Chen, J., He, L., Dinger, B., and Fidone, S. (in press), Cellular mechanisms involved in rabbit
carotid body excitation elicited by endothelin peptides. Resp. Physiol.
Chen, S.-J., Chen, Y.-F., Meng, Q.C., Durand, J., Dicarlo, V.S., and Oparil, S., 1995, Endothelin-receptor antagonist bosentan prevents and reverses hypoxic pulmonary
hypertension in rats. J. Appl. Physiol. 79(6): 2122-2131. Eddahibi, S., Springall, D., Mannan, M., Carville, C., Chabrier, P.-E., Levame, M., Raffestin, B., Polak, J., and Adnot, S., 1993, Dilator effect of endothelins in pulmonary circulation: chanes associated with chronic hypoxia. Am. J. Physiol. 265(9): L571-L580. He, L., Chen, J., Dinger, B., Stensaas, L., and Fidone, S., 1996, Endothelin modulates chemoreceptor cell function in mammalian carotid body. In Frontiers in Arterial Chemoreception (P. Zapata, C. Eyzaguirre and R.W. Torrance, eds.), Plenum Press,
New York, pp.305-311.
Li, H., Chen, S.-J., Chen, Y.-F., Meng, Q.C., Durand, J., Oparil, S., and Elton, T.S., 1994, Enhanced endothelin-1 and endothelin receptor gene expression in chronic hypoxia. J.
Appl. Physiol. 77(3): 1451-1459. McQueen, D.S., Dashwood, M.R., Cobb, V.J., Bond, S.M., Marr, C.G., and Spyer, K.M., 1995, Endothelin and rat carotid body: autoradiographic and functional pharmacological
studies. J. Auton. Nerv. Syst. 53(2-3): 115-125. Ono, K., and Fozzard, H.A., 1992, Phosphorylation restores activity of L-type calcium channels after rundown in inside-out patches from rabbit cardiac cells. J. Physiol. 454: 673-688.
524
Perez-Garcia, M.T., Almaraz, L., and Gonzalez, C., 1990, Effects of different types of stimulation on cyclic AMP content in the rabbit carotid body: functional significance. J. Neurochem. 55: 1287-1293. Rubanyi, G.M., and Polokoff, M.A., 1994, Endothelins: Molecular biology, biochemistry, pharmacology, physiology and pathophysiology. Pharmacol. Rev. 46: 325-415, 1994. Simonson, M.S., and Dunn, M.J., 1990, Cellular signaling by peptides of the endothelin gene
family. FASEB J. 4: 2989-3000. Wang, W.-J., Cheng, G.-F., Yoshizaki, K., Dinger, B., and Fidone, S., 1991a, The role of
cyclic AMP in chemoreception in the rabbit carotid body. Brain Res. 540: 96-104. Wang, W.-J., He, L., Chen, J., Dinger, B., and Fidone, S., 1993, Mechanisms underlying chemoreceptor inhibition induced by atrial natriuretic peptide in rabbit carotid body. J. Physiol. 460:427-441. Wang, Z.-Z., Stensaas, L.J., de Vente, J., Dinger, B., and Fidone, S.J., 1991b,
Immunocytochemical localization of cAMP and cGMP in cells of the rat carotid body following natural and pharmacological stimulation. Histochem. 96: 523-530.
525
This page intentionally left blank.
OXYGEN AND ACID CHEMORECEPTION BY PHEOCHROMOCYTOMA (PC12) CELLS
S.C. Taylor and C. Peers Institute for Cardiovascular Research, University of Leeds, LS2 9JT, U.K.
1.
INTRODUCTION
The clonal pheochromocytoma cell line PC 12, derived from rat adrenal chromaffin tissue, has proved to be a useful model for studying the effects of hypoxia on gene expression (Czyzyk-Krzeska et al., 1994; Millhorn et al. 1997; Beitner-Johnson et al. 1998; Beitner-Johnson and Millhorn, 1998). More recently, studies have shown that PC 12 cells are also a model chemoreceptor system: acute hypoxia inhibits specific channels in these cells, causing membrane depolarization and a subsequent rise of (Zhu et al. 1996; Conforti and Millhorn, 1997). These effects are remarkably similar to the actions of acute hypoxia in isolated type I cells of the carotid body (Peers and Buckler, 1995; Peers, 1997). An important step in chemoreception and transduction by the carotid body is the release of neurotransmitters (predominantly catecholamines; CAs) from type I cells (Gonzalez et al. 1994), yet direct demonstrations of hypoxia-evoked release of CAs from isolated type I cells are severely limited (Urena et al. 1994; Montoro et al. 1996), and reports of CA release evoked by other physiological stimuli - particularly acidosis - are completely lacking at present. Since the electrophysiological responses of PC12 cells to
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
527
hypoxia compare so well with those of type I cells, we have investigated directly the effects of hypoxia and acidosis to evoke quantal CA release from individual PC 12 cells using amperometric techniques. 2.
MATERIALS AND METHODS
PC-12 cells were cultured in RPMI 1640 culture medium supplemented with 20% fetal calf serum and 1% penicillin/ streptomycin in a humidified atmosphere of air as previously described (Taylor and Peers, 1998; 1999). Each experimental day, cells were plated onto poly-L-lysine coated coverslips and allowed to adhere for approximately 1h. Fragments of coverslip were then transferred to a recording chamber which was continually perfused under gravity (flow rate l-2ml / min) with a control solution composed of (in mM): NaCl 135, KC1 5, Hepes 5, and glucose 10 (pH 7.4, osmolarity
adjusted to ca. 300mOsm with sucrose, 21-24°C). solutions contained 1mM EGTA and no added Hypoxic solutions were obtained by continually bubbling one or more of the reservoirs supplying the recording chamber with as required. Reservoirs were pre-equilibrated with for at least 30min before being applied to cells. Carbon fiber microelectrodes were positioned adjacent to individual PC 12 cells and were polarized to to allow oxidation of released CA. Resulting currents were recorded using an Axopatch 200A amplifier (with extended voltage range), filtered at 1kHz and digitised at 2kHz before storage on computer. All acquisition was performed using a Digidata 1200 interface and Fetchex software from the pClamp 6.0.3 suite (Axon Instruments). CA secretion was apparent as discrete spike-like events, each corresponding to the released contents of a single vesicle of CA (Wightman et al., 1991). Quantification of release was achieved by counting spikes using Mini Analysis Program (Synaptosoft Inc., Leonia, N.J., USA). This allowed visual inspection of each event so that artefacts (due, for example, to solution switches) could be rejected from analysis. Results are presented as individual examples or means standard error of the mean and statistical comparisons were made using an unpaired Student’s t-test. 528
3.
RESULTS
3.1
Hypoxia-evoked CA secretion from PC12 cells
Figure 1A shows a representative secretory response of an individual PC 12 cell to acute hypoxia. As the perfusate decreases, occasional spike-like exocytotic events are observed, and when the final bath level approaches a low, stable level the frequency of appearance of these events is increased. To quantify the extent of secretion as a function of the frequency of exocytotic events was determined over a 1min period, 90s after exchange of perfusate to one containing the desired level of hypoxia. Figure 1B plots this relationship, which, interestingly, is reminiscent of the relationship between hypoxia and carotid body afferent chemosensory nerve discharge (reviewed by Gonzalez et al., 1994). Results of experiments designed to investigate the dependency of the secretory response to hypoxia in PC12 cells are shown in Figure 2. During hypoxia, secretion was completely inhibited by either removal of extracellular (Figure 2A, representative of 8 cells tested), or by bath application of the non-selective inhibitor of voltagegated channels, representative of 7 cells tested). These results indicate that hypoxia-evoked catecholamine secretion is entirely dependent on influx through voltage-gated channels. 3.2
Acid-evoked CA secretion from PC12 cells
As detailed above, carotid body type I cells are also sensors and transducers of acidic / hypercapnic stimuli. We investigated whether the same was true of PC12 cells i.e. whether acidosis could, like hypoxia, evoke catecholamine secretion. Under normoxic conditions at a control of 7.4, no exocytotic events were detected (e.g. Figure 3 A, representative of over 100 cells). However, when was reduced to 7.2, 7.0 or 6.8, exocytosis was observed in a graded manner (Figure 3A). Quantification of acid-evoked secretion from PC12 cells is shown in Figure 3B. Figure 4 illustrates the observations that acid-evoked secretion was, like hypoxia-evoked secretion, completely abolished by either
529
530
removal of extracellular (Figure 4A, representative of 6 cells examined) or by bath application of representative of 7 cells examined). These findings indicated that acidevoked secretion was entirely dependent on
influx through
voltage-gated channels. There is compelling evidence in rat type I carotid body cells that reduced evokes rises of by causing marked intracellular acidification (Buckler and Vaughan-Jones, 1993; 1994a). Therefore, to examine whether acid-evoked CA release from PC12 cells was mediated by intracellular acidosis, we examined the effects of Napropionate, the salt of a weak acid which causes selective intracellular acidification when bath-applied (see e.g. Peers and Green, 1991). 10mM propionate consistently e.g. Figure 4C) evoked CA release from PC12 cells, suggesting that the ability of lowered to evoke release was due to intracellular acidification. 4.
DISCUSSION
The present report indicates that PC12 cells respond to acute hypoxia in a manner that compares with with responses observed in type I carotid body cells. Thus, hypoxia evoked quantal CA secretion in a 531
532
533
graded manner (Figure 1) and this was entirely dependent on influx through voltage-gated channels (Figure 2). Since PC12 cells do not secrete CAs under normoxic conditions at 7.4, hypoxia must activate influx through voltage-gated channels by causing membrane depolarization. Membrane depolarization and a subsequent rise of has been directly demonstrated using patchclamp recordings (Zhu et al., 1996) from individual PC12 cells, and the present study extends these earlier observations by indicating that the rise of is sufficient (and indeed necessary) to evoke CA release. Since such similar observations have been made in isolated type I carotid body cells (Buckler and Vaughan-Jones, 1994b; Wyatt and Peers, 1995) the present study indicates that PC12 cells act as an excellent model system to explore in further detail the mechanisms underlying oxygen chemoreception. The cellular events underlying acidic / hypercapnic chemoreception in the carotid body are less well defined, and conflicting reports have been published. In type I cells isolated from the rat carotid body, acid chemoreception appears very similar to oxygen sensing: acidic stimuli have been shown to inhibit channels by inducing intracellular acidification (Buckler et al., 1991; Peers and Green, 1991). This in turn causes membrane depolarization, activation of voltage-gated channels and hence influx which presumably evokes neurosecretion (Buckler and Vaughan-Jones, 1993; 1994a). In contrast to these findings, studies in the rabbit carotid body indicate that acidic stimuli cause intracellular acidosis which in turn stimulates Na-H exchange. Activity of this transporter leads to intracellular accumulation of which is sufficient to reverse the activity of Na-Ca exchange, and so enters type I cells to trigger secretion via this transporter (Rigual et al., 1991; Rocher et al., 1991). The present findings strongly suggest that PC12 cells act as acid chemoreceptors via a mechanism which compares well to acid chemoreception by rat, but not rabbit, type I cells. Thus, CA release from PC12 cells in response to an acid challenge was entirely dependent on influx through voltage-gated channels (Figure 4A,B) and was likely due to intracellular acidification (Figure 4C). The similarities between rat type I carotid body cell responses and those reported here for PC 12 cells is perhaps unsurprising, since PC 12 cells are derived from chromaffin tissue of the rat. What is surprising, though, is that such diverse mechanisms appear to exist between
534
species to serve the same physiological role i.e. acid chemoreception. Such species differences are not unprecedented, though: the nature of the oxygen-sensitive channel(s) is/are different in rat compared with rabbit type I cells (see Peers, 1997), and indeed is different again in PC12 cells (Conforti and Millhorn, 1997). Futhermore, the specific subtype of channel responsible for mediating influx may vary between cell types: in rat and rabbit type I cells, L-type channels exert the greatest influence on stimulus-evoked CA release (Gonzalez et al., 1994; Hatton and Peers, 1997), whereas our previous study has indicated that N-type channels are of primary importance (Taylor and Peers, 1998). In summary, the present study establishes the PC12 cell as a model system for studying acid and oxygen sensing. Given the ease of use of a continuous cell line (as compared with primary carotid body cell cultures), PC12 cells are likely to prove a useful model in which to investigate cellular and molecular mechanisms of chemoreception. ACKNOWLEDGEMENTS
This work was supported by the British Heart Foundation and a University of Leeds School of Medicine Studentship.
REFERENCES Beitner-Johnson D., Leibold J. and Millhorn D. E., 1998, Hypoxia regulates the cAMP- and signaling systems in PC12 cells. Biochem Biophys Res Comm 242: 61-66. Beitner-Johnson D. and Millhorn D. E., 1998, Hypoxia induces phosphorylation of the cyclic AMP response element-binding protein by a novel signaling mechanism. J Biol Chem 273: 19834-19839. Buckler, K.J. and Vaughan-Jones, R.D., 1993. Effects of acidic stimuli on intracellular calcium in isolated type I cells of the neonatal rat carotid body. Pflugers Archiv 425: 22-27. Buckler, K.J. and Vaughan-Jones, R.D., 1994a, Effects of hypercapnia on membrane potential and intracellular calcium in rat carotid body type I cells. J
Physiol 478: 157-171. Buckler, K.J. and Vaughan-Jones, R.D., 1994b, Effects of hypoxia on membrane
potential and intracellular calcium in rat neonatal carotid body type I cells. J
Physiol 476: 423-428.
535
Buckler, K.J., Vaughan-Jones, R.D., Peers, C., Lagadic-Gossmann, D. and Nye, P.C.G., 1991, Effects of extracellular pH, and on intracellular pH in isolated
type I cells of the neonatal rat carotid body. J Physiol 444: 703-721.
Conforti L. and Millhorn D. E., 1997, Selective inhibition of a slow-inactivating voltage-dependent channel in rat PC12 cells by hypoxia. J Physiol 502: 293-305. Czyzyk-Krzeska, M.F., Furnari, B.A., Lawson, E.E. and Millhorn, D.E., 1994, Hypoxia increases rate of transcription and stability of tyrosine hydroxylase mRNA in pheochromocytoma (PC12) cells. J Biol Chem 269: 760-764. Gonzalez C., Almaraz L., Obeso A. and Rigual R., 1994, Carotid body chemoreceptors: from natural stimuli to sensory discharges. Physiol Rev 74: 829-898. Hatton, C.J. and Peers, C., 1997, Electrochemical detection of quantal secretory events from isolated rat type I carotid body cells. Exp Physiol 82, 415-418. Millhorn D. E., Raymond R., Conforti L., Zhu W., Beitner-Johnson D., Filisko T., Genter M. B., Kobayashi S. and Peng M., 1997, Regulation of gene expression for tyrosine hydroxylase in oxygen sensitive cells by hypoxia. Kidney Int 51: 527-535. Montoro R. J., Urena J., Fernandez-Chacon R., Alvarez de Toledo G. and LopezBarneo J., 1996, Oxygen sensing by ion channels and chemotransduction in single glomus cells. J Gen Physiol 107: 133-143. Peers C., 1997, Oxygen-sensitive ion channels. Trends Pharmacol Sci 18: 405408. Peers C. and Buckler K. J., 1995, Transduction of chemostimuli by the type I carotid body cell. J Memb Biol 144: 1-9. Peers, C. & Green, F.K., 1991, Inhibition of currents by intracellular acidosis in isolated type I cells of the neonatal rat carotid body. J Physiol 437: 589-602. Rigual, R., Lopez-Lopez, J.R. & Gonzalez, C., 1991, Release of dopamine and chemoreceptor discharge induced by low pH and high stimulation of the cat carotid body. J Physiol 433: 519-531. Rocher, A., Obeso, A., Gonzalez, C. & Herreros, B., 1991, Ionic mechanisms for the transduction of acidic stimuli in rabbit carotid body glomus cells. J Physiol 433: 533-548. Taylor, S.C. and Peers, C., 1998, Hypoxia evokes catecholamine secretion from rat pheochromocytoma PC12 cells. Biochem Biophys Res Comm 248: 13-17. Taylor, S.C. and Peers, C., 1999, Chronic hypoxia enhances the secretory response of rat pheochromocytoma (PC-12) cells to acute hypoxia. J Physiol 514: 483-
491.
Urena J., Fernandez-Chacon R., Benot A. R., Alvarez de Toledo G. A. and LopezBarneo J., 1994, Hypoxia induces voltage-dependent entry and quantal dopamine secretion in carotid body glomus cells. Proc Natl Acad Sci U SA 91: 10208-10211.
536
Wightman, R.M., Jankowski, J.A., Kennedy, R.T., Kwagoe, K.T., Schroeder, T.J.,
Leszczyszyn, D.J., Near, J.A., Diliberto, E.J. Jr. and Viveros, O.H., 1991, Temporally resolved catecholamine spikes correspond to single vesicle release
from individual chromaffin cells. Proc Natl Acad Sci, USA 88: 10754-10758. Wyatt, C.N. and Peers, C., 1995, channels in isolated type I cells of the neonatal rat carotid body. J Physiol 483: 559-565. Zhu W. H., Conforti L., Czyzyk-Krzeska M. F. and Millhorn D. E., 1996, Membrane depolarization in PC-12 cells during hypoxia is regulated by an current. Am J Physiol 271: C658-C665.
537
This page intentionally left blank.
POSTNATAL CHANGES IN CARDIOVASCULAR REGULATION DURING HYPOXIA PHYLLIS M. GOOTMAN AND NORMAN GOOTMAN Department of Physiology and Pharmacology, State University of New York, Health Science
Center at Brooklyn, Brooklyn, New York
1.
INTRODUCTION
Hypoxia continues to be implicated as a possible trigger for the Sudden Infant Death Syndrome (Saugstadt & Rogrum, 1995). Using a swine model of the developing infant, we have conducted many types of experiments that
reveal the possible role of altered cardiovascular control in the etiology of SIDS (Gootman et al., 1996). Short-term hypoxia leads to age-related depression of cardiovascular responses to brainstem medullary stimulation (Gootman et al., 1981), increases in heart rate and peripheral vascular
resistances (Gootman et al., 1990), and increases in efferent cervical and splanchnic sympathetic discharge (Hundley & Gootman, 1999). In order to provide cardiovascular data that would be the basis for future examination of hypoxia-induced early gene (c-fos) activation in brainstem neurons (cf. Sica et al., 1998,1999), prolonged exposure to hypoxia was employed in this paper.
2.
METHODS
Experiments employing our standard methodology (e.g., Gootman et al., 1986,1990) were conducted in Yorkshire swine, aged 2-4 days 2 weeks
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
539
and 2 months These ages were selected on the basis of findings in our previous experiments on short-term hypoxia (Gootman et al. 1990). Anesthesia was induced with age-adjusted doses of i.p. sodium pentobarbital: 15, 20, and 30 mg/kg in 2-4 day, 2 week and 2 month olds, respectively. Supplemental doses were administered i.v. as needed. In order to quantitate the cardiovascular components of the responses to hypoxic stress, cardiorespiratory interactions were avoided by artificial ventilation and paralysis with decamethonium. Body temperatures were monitored continuously and maintained between 38-39° by a servo-controlled
heating system. The right atrium was catheterized via the external jugular vein for continuous infusion of 5% dextrose in order to maintain hydration and for the injection of supplemental pentobarbital. The abdominal aorta was catheterized via the right femoral artery for blood pressure (AoP) registration and for samples for arterial blood gas composition, pH, and _ saturation by Radiometer Blood Gas Analyzer and Instrumentation Lab. CO-Oximeter, respectively. Total blood lactate concentration (mmol/1) was measured by the method developed by Yellow Springs Instrument Co. The left ventricle was catheterized via the left common carotid artery; left ventricular pressure was measured and the first derivative of intraventricular pressure ( LV dP/dt) obtained electronically. The renal and superior mesenteric arteries were exposed retroperitoneally through a left flank dissection following removal of the lower two ribs. Non-cannulating electromagnetic flow transducers (Gould Statham) were placed around the left renal (Ren) and superior mesenteric (Mes) arteries. Zero flows were determined in situ by the distal occlusion technique. Flow (F) transducers were calibrated in vitro. AoP, LV dP/dt max, RenF, and MesF were continuously recorded on a dynograph (Sensormedics).
2.1
Protocol
Following completion of all surgery and instrumentation, the animals were allowed to stabilize while ventilated with a gas mixture of and to maintain arterial blood gases and pH within normal ranges for each age group of swine, as in our previous studies (Gootman et al. 1986,1990). Each age group of piglets was utilized for two experimental protocols: normoxia (N) and moderate hypoxia (MH). The latter protocol included a 20 min prehypoxia control period and a period of MH induced by decreasing the % inspired while increasing the % inspired to an arterial a degree of hypoxia that depresses cardiovascular responses to medullary stimulation (Gootman et al. 1981). Hypoxia was maintained for 60 min to allow time for a change in c-fos expression (Sica et al. 1998). After the one hr MH exposure,
540
the gas mixture was returned to its control combination and the animals followed for a 60 mm recovery period. For the age matched controls (N), normoxia was maintained throughout the experiments of the same duration as the MH experiments. Arterial blood gases, pH, and hemoglobin, total blood lactate and cardiovascular parameters were measured at the start and end of pre-MH control period, at 20 and 60 min after MH was achieved, and at the 20 and 60 min time intervals in the recovery period. In the age-matched controls (N), measurements were made at the corresponding time periods.
2.2
Data Analysis
Cardiovascular function was evaluated as in our earlier studies (Gootman et al., 1986,1990) from the heart rate, mean AoP, LV dP/dt max, mean RenF and MesF and their vascular resistances (R). Changes in LV dP/dt max were taken to indicate changes in ventricular contractility (De Burgh Daly & Jones, 1998). Ren and Mes R were calculated as the ratio of mean AoP to mean Ren or Mes F and expressed in peripheral resistance units (PRU). Mean baseline values (Table 1.) of each parameter measured at the end of the 20 min control period were compared in order to establish whether animals used for the 2 protocols in a given age group were from the same statistical population. Mean values of arterial blood gas composition, Hemoglobin, pH and total lactate obtained at each sampling time after the control period were compared to the mean baseline values at the end of the control period in order to show the effects of N and MH on these variables at each age. Because of expected age-dependent differences in baseline values for cardiovascular function (see Table 1), these data were normalized as percent baseline values in each animal to show the changes during protocols N and MH at each age. All comparisons were made by ANOVA and Newman-Keuls post hoc tests and the null hypothesis for a 2-tailed distribution was rejected at
3.
RESULTS
The mean values of arterial blood and Hemoglobin during the time course of each protocol are presented in Figure 1. Since pH, and total lactate concentration were unchanged during N or MH in all age groups, these data are not shown. Regardless of age or level, pH ranged in all piglets between 7.38 and 7.42. The _ ranged from torr and total blood lactate ranged from _ _ at all ages without significant changes during N or MH. During N there were no significant
541
542
changes in arterial in the three age groups. The lowered levels of and hemoglobin during MH were similar for the three age groups, were achieved within 2-4 mm, and were stable during the 20 to 60 min exposure. Both and hemoglobin returned to control levels within 20 min after terminating MH. The changes in heart rate, mean AoP and LV dP/dt max during MH are presented in Figure 2. These cardiovascular parameters remained stable during
MN. During MH, heart rate increased significantly throughout the protocol and during recovery in 2 wk and 2 mo old piglets but only at the 60 min interval in
the 2-4 days old. Mean AoP increased significantly in the two older groups during MH; in the 2-4 days old there was only a trend towards an increase during MH. Maximal LV dP/dt increased in the two older groups and remained elevated during recovery.
543
Ren and Mes vasculatures presented with differing patterns to MH as shown in Figure 3. Ren R fell significantly over 60 mm in the 2 mo old piglets under N. On the other hand, at 20 min of MH there was a significant increase in Ren R in the 2wk and 2 mo olds. MesR increased at 20 min under MH in
the 2-4 day and 2 wk old piglets and continued to increase further by 60 min in the 2 wk olds. However, there was no significant change in Mes R during MH in the 2 mo olds.
544
545
4.
DISCUSSION
Control levels of arterial and hemoglobin (Figure 1) and were equivalent at all ages, so that the hypoxia protocol was conducted from the same baseline blood gas composition. Although a stable degree of hypoxia (low arterial was produced at all ages, the arterial hemoglobin was brought to a lower level during MH in two week and two mo old swine (70%) than in 2-4 day old swine (80%) because of the very different contour of the oxygen-hemoglobin equilibrium curves of blood from piglets at different postnatal ages (Delivoria-Papadopoulos et al., 1974). Baseline cardiovascular data obtained in pentobarbital-anesthetized swine (Table 1) exhibited an age dependency similar to that observed in halothane- or saffan-anesthetized swine (Gootman et al., 1986,1990). The lack of significant heart rate, blood pressure and ventricular contractile responses to MH in the youngest swine (Figure 2) indicates their immaturity. Since the response to hypoxia with controlled ventilation is a bradycardia (Teitel, 1996; Marshall, 1998), the tachycardia in the older animals indicates that maturation is still in progress. The increased blood pressure during MH in the oldest animals (Figure 2) was partly due to vasoconstriction in the renal and mesenteric arterial circulations (Figure 3). These age-related peripheral vascular effects are also characteristic of responses to stimulation of baroreceptors and cardiopulmonary receptors in swine (Gootman et al., 1986; Gootman, 1991). We previously reported on the cardiovascular responses to 20 min exposure to hypoxia (Gootman et al. 1990). A decrease in to 60 torr in the earlier experiments elicited an increase in heart rate that was significant only in the 2 mo old group. On the other hand, AoP declined significantly at 2-4 days and 2 weeks of age while increasing at 2 mos. In our earlier paper we presented the effects of hypoxia on spontaneous sympathetic activity, reporting greater respiratory modulation of sympathetic efferent activity with a shift in the frequency spectrum to lower frequencies. Upon recovery from hypoxia, the discharge returned to the higher frequency range. We have recently reported that there is also a loss of coherence between sympathetic outflows in neonates in the presence of hypoxia (Hundley & Gootman, 1999). The results presented in this paper indicate significant increases in heart rate at all ages by 60 min (Figure 1) along with a significant increase in mean AoP in both 2 wk and 2 mo old piglets. In addition, we extend our findings to include LV dP/dt max which revealed a significant positive inotropic effect in both 2 wk and 2 mo old piglets (Figure 2). Furthermore, we now report a significant increase in Ren R in both 2 wk and 2 mo olds at 20 min and a significant increase in Mes R at both 20 and 60 min in the 2 week old piglets. In fetal lamb and adult mammals with ventilation controlled, the heart rate response is usually bradycardia
546
(Teitel, 1996, Marshall, 1998); we obtained an increase by 60 min with the older groups attaining greater changes from baseline than did the 2-4 day olds (Figure 2). Since our animals were artificially ventilated, the question arises as to possible mechanism(s) for the increase in heart rate. Given our earlier finding of increased sympathetic activity with increased respiratory modulation, it is possible that the brainstem respiratory pattern generator is directly stimulating sympathetic outflow leading to an increase in heart rate as well as overriding any baroreceptor inhibition due to the 10% increase in aortic pressure. In addition, it has been reported that brainstem inspiratory neurons exert an inhibitory effect on cardiac vagal neurons (Gilbey et al. 1984; Marshall, 1998). Given the increased modulation of sympathetic activity during hypoxia, it is reasonable to assume, therefore, greater inhibition of vagal premotor neurons, resulting in a tachycardia. Finally, Marshall's excellent review (1998) summarizes the role of chemoreceptor stimulation in eliciting the alerting response of which tachycardia is part of this patterned response. A major factor in the responses of the youngest animals is hypoxic depression of those brainstem regions concerned with autonomic outflow. Direct electrical stimulation of either medullary or hypothalamic centers involved in cardiovascular regulation elicits smaller arterial blood pressure and flow changes in neonates during hypoxia than during normoxia, but not in older animals (Gootman et al., 1981). Another factor is the maturation of the chemoreceptors themselves. There is evidence for a period of quiescence after birth until chemoreceptors are reset from the normal fetal hypoxic environment to the neonatal normoxic environment (Gootman, 1991; Teitel, 1996). Furthermore, maturation of the capability for central nervous system integration of stimuli from combinations of afferents (Gootman, 1991) could account for a greater effect of hypoxia when accompanied by an elevation of arterial pressure. Another factor is the postnatal maturation of peripheral autonomic control of regional circulations (Gootman, 1991). We have recently found that sympathetic activity recorded from cervical sympathetic and splanchnic nerves (regulating regional blood flows) is increased during hypoxia; however, the activity patterns indicate failure within the brainstem rhythm generating networks such that their activity were no longer linked (loss of coherence); the nerves no longer showed integrated patterns of activity but discharged independently.
ACKNOWLEDGMENTS This study was supported in part by grants from the NIH (HL-20864 and HD-29831). The authors would like to thank Nancy M. Buckley, M.D. for her critical help with the manuscript.
547
REFERENCES deBurgh Daly M, Jones JFX. Respiratory modulation of carotid and aortic baroreflex left ventricular inotropic responses in the cat. J Physiol 1998;509:895-907 Delivoria-Papadopoulos M, Martens RJ, Forster RE ( I I ) , Oski FA. Postnatal changes in oxygen-hemoglobin affinity and erythrocyte 2,3-diphosphoglycerate in piglets. Pediat Res 1974;8:64-66. Gilbey IMP, Jordan D, Richter DW, Spyer KM Synaptic mechanisms involved in the
inspiratory modulation of vagal cardio-inhibitory neurones in the cat. J Physiol 1984;356:65-78
Gootman PM, Buckley BJ, DiRusso SM, Gootman N, Yao AC, Pierce PE, Griswold PG, Epstein MD, Cohen HL, Nudel DB. Age-related responses to stimulation of cardiopulmonary receptors in swine. Am J Physiol 1986;251:H748-H755 Gootman PM, Gootman N, Buckley BJ, Peterson BJ, Steele AM, Sica AL, Gandhi MR. "Effects of hypoxia in developing swine." In Chemoreceptors and Chemoreceptor
Reflexes. H. Acker, A. Trebski, R.G. O'Regan, eds. New York, NY: Plenum Press, 1990. Gootman PM, Gootman N, Sica AL. A neuro-cardiac theory for Sudden Infant Death Syndrome: Role of the autonomic nervous system. J SIDS Infant Mortal 1996;1: 169-182. Gootman PM, Gootman N, Turlapaty P, Yao AC, Buckley BJ, Altura, BM. "Autonomic
nervous system regulation of cardiovascular function in neonates." In Ciba Symposium Foundation #83 Development of the the Autonomic Nervous System, G. Burnstock, ed. New York, NY:Pitman Medical Ltd. New York, 1981.
Hundley BW, Gootman, PM. Effects of hypoxia on sympathetic (SYMP) outflow in developing piglets: implications for SIDS. 1999 SIDS Alliance Conference; April 9-11; Atlanta, GA. Marshall J M . Chemoreceptors and cardiovascular control in acute and chronic systemic
hypoxia. Braz J Med Biol Res 1998;31:863-888. Saugstad OD, Rognum TO. "Docs hypoxia precede death in SIDS victims? In Sudden Infant Death Syndrome. New Trends in the Nineties, Torliev Ole Rognum, ed. Oslo, Norway: Scandinavian University Press, 1995. Sica AL, Gootman PM, Ingenito S, Anwar M, Ruggiero DA. Age-related expression of c-fos
in the solitary tract nucleus (NTS) after Sica AL, Gootman PM, Ruggiero DA
stimulation. Neurosci Abst 1998;24:627 expression of c-fos in the nucleus of the
solitary tract and the area postrema of developing swine. Brain Res 1999; in press. Teitel DF Fetal chemoreception: a developing story. Reprod Fertil Dev 1996;8:471-482.
548
EXPRESSION AND LOCALIZATION OF A2a and Al-ADENOSINE RECEPTOR GENES IN THE RAT CAROTID BODY AND PETROSAL GANGLIA A2a and A1-adenosine receptor mRNAs in the rat carotid body E. B. GAUDA Department of Pediatrics, John Hopkins Medical School, Baltimore, Maryland 21287-3200
1.
INTRODUCTION
Peripheral chemoreceptors in the carotid body sense changes in arterial oxygen, carbon dioxide tension and pH and play a critical role in modulating ventilation. Substantial efforts have been made trying to delineate mechanisms
that
underlie
oxygen
sensing,
chemotransduction
and
chemotransmission in the carotid body. Although upstream events leading to depolarization of Type 1 cell are not completely understood, it is generally accepted that depolarization of Type 1 cells leads to exocytotic release of neurotransmitters and neuromodulators. Released neurotransmitters then bind to autoreceptors on Type 1 cells and postsynaptic receptors on the carotid sinus nerve. The summation of release and binding of excitatory and inhibitory neurotransmitters determines the magnitude of the afferent output from the carotid body (for review see, Gonzalez et al. 1994, Fidone et al. 1988). Dopamine and adenosine are two major neuromodulators released from the carotid body during exposure to hypoxia (Gonzalez et al.1994). Data from physiologic and pharmacologic experiments in several species suggest that dopamine through binding to the D2 dopamine receptor is an inhibitory neuromodulator (Iturriaga et al.1994) while adenosine through binding to the A2a-adenosine receptor is excitatory (McQueen et al. 1983, Runold et al. 1990). We (Gauda et al.1996) and others (Czyzyk-Krzeska et
al. 1992) have previously shown that D2-dopamine receptor mRNAs are
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
549
present in the rat carotid body and in the petrosal ganglia. The petrosal ganglia contain the cell bodies for the carotid sinus nerve. To further characterize the possible role of adenosine in hypoxic chemotransmission, in this study, we determined the cellular distribution of the A2a-adenosine receptors and A1-adenosine receptors mRNAs in the carotid body. We compared the distribution of adenosine receptor mRNA and of the mRNA encoding tyrosine hydroxylase (TH), the rate limiting enzyme for dopamine synthesis.
2.
METHODS
Tissues were taken from Sprague-Dawley rats on postnatal days 0, 5, 15 and 22 (n=5, each age). All animals were briefly anesthetized with 3% methoxyflurane and decapitated. The bifurcation of the carotid artery with the carotid body, superior cervical, nodose and petrosal ganglia were quickly removed en bloc, placed in embedding media (Fisher), and quick frozen on dry ice. The right and left tissue blocs were removed from the animals within 5 mins of decapitation. The tissues were stored at -70°C until further processing.
2.1
In situ Hybridization Tissue blocs were cut in
sections on a cryostat. Sections were
thaw-mounted onto gelatin-chrome, alum-subbed slides. Slides were then post-fixed in 4% paraformaldehyde, acetylated in fresh 0.25% acetic anhydride in 0.1 M triethanolamme, dehydrated in ascending series of alcohols, delipidated in chloroform, and then rehydrated in a descending series of alcohols. Slides were air dried and then stored at -20°C. Antisense ribonucleotide probes were used for detection of mRNAs for A2a and A1- adenosine receptors and tyrosine hydroxylase.
The
antisense probes were constructed from complementary DNAs (cDNA) for each of these genes by in vitro transcription. The cDNAs for the A2a, A1adenosine receptors and TH were complementary to 100-426 (Fink et al. 1992) , 396-842 (Reppert et al. 1991) and 1120-1488 (Grima et al.. 1985) base pairs of the rat genes, respectively. The clones used for in vitro
550
transcription of A2a and A1 adenosine ribonucleotide probes were kindly provided by Drs. David R. Weaver and Steven M. Reppert. Simultaneously hybridized coronal brain sections were used as controls to determine the specificity of the TH, A2a-adenosine and A1adenosine receptor probes. Uniformly these control slides demonstrated the known pattern of gene expression for the TH, A2a and A1-adenosine receptor genes in the nigrostriatal and striatal brain sections. Probes were labeled with dpm of labeled probe was added to of hybridization buffer (50% formamide,300mM NaCl, 20 mM Tris HCL, pH 7.5, 1 mM EDTA, 10% dextran sulfate, 1x salmon sperm DNA, yeast total RNA (Type and then applied to slides containing 8-10 sections per slide. Hybridization was performed at 55°C overnight. The slides were washed in 1xSSC (0.15 M sodium choloride/0.015 M sodium citrate, pH 7.2) at room temperature. After treatment with RNAase A (20mg/ml), slides were washed at 60°C in 0.2xSSC, rinsed in deionized water and air dried. Slides were then dipped in Kodak photographic emulsion, dried and exposed in the dark at -20°C for 4-8 weeks. After exposure, the slides were thawed at room temperature and developed with Dektol (Kodak, NY) couterstained with thionin and coverslips applied with Permount. To determine co-localization in the carotid body of tyrosine hydroxylase mRNA with A2a-adenosine receptor mRNA, double-labeled in situ hybridization was performed as previously described (Gauda et al. 1996, (Gauda et al. 1998). Antisense ribonucleotide probes for TH mRNA were labeled by in vitro transcription using digoxigenin -UTP while A2-adenosine receptor probe was labeled with Subsequent hybridization and washing steps were performed as outlined above. Visualization of the TH mRNA hybridization signal was performed with high affinity antidigoxigenin antibodies conjugated to alkaline phosphatase which catalyzes the formation of a chromogen from nitroblue tetrazolium (NBT) and 5bromo-4-chloro-3-indolyl phosphatase (BCIP). Slides were then dipped in photographic emulsion (Amersham), exposed for 4-6 weeks and developed as outlined above.
2.2
Data Analysis
Slides were qualitatively analyzed for the presence or absence of silver grains over cells in the carotid body and caudal (inferior) and rostral (superior) petrosal ganglia.
551
552
3.
RESULTS
The carotid body was easily identified on tissue sections (Figure 1A). Identification of the petrosal ganglion was determined as described by Finley et al. (1992). The boundary between the petrosal ganglion and nodose ganglion was defined by a plane running perpendicular to the long axes of the ganglia at the level of the origin of the glosspharyngeal nerve. The petrosal ganglia were further identified by determining the pattern of localization of clusters of ganglion cells expressing tyrosine hydroxylase mRNA on serial sections. The distribution of ganglion cells expressing TH mRNA is the same as it is for cells expressing TH immunoreactivity (Finley et al. 1992). The hybridization signal for A2a-adenosine receptor mRNA was intense in the carotid body (Figure 1B and 2) and was co-localized with practically all cells expressing TH mRNA (Figure 2). Petrosal ganglion cells also expressed A2a-adenosine (Figure 3A) and A1-adenosine receptor mRNAs (Figure 3B and 4B). However, more cells expressed A1-adenosine receptor in the petrosal ganglion than A2a-adenosine receptor mRNA (Figure 3A and B). In contrast, a hybridization signal for A1-adenosine receptor mRNA was not detected in the carotid body (Figure 4A). The pattern of gene expression in the carotid body and petrosal ganglion was the same for all animals at all ages studied.
553
554
555
4.
DISCUSSION
Using in situ hybridization histochemistry, this study shows that in the maturing rat, A2a-adenosine receptor mRNA is extensively expressed in the carotid body while the A1-adenosine receptor mRNA is not. In addition, A2a-adenosine receptor and TH mRNA are co-localized in the same cells in the carotid body. Lastly, A2a- adenosine receptor mRNAs are expressed in fewer cells in the petrosal ganglion than A1-adenosine receptor mRNAs. Thus, in peripheral arterial chemoreceptors, mRNA encoding excitatory adenosine receptors (A2a) is located on the presynaptic side while mRNA encoding the inhibitory adenosine receptor (A1) are most abundantly expressed on the postsynaptic side during postnatal development. Hypoxia is associated with increase blood and tissue levels of adenosine which mediate neuronal activity and blood flow throughout the body. As reviewed by Fredholm et al. (1994), adenosine actions on neurons in the central and peripheral nervous system are mediated by receptors that have been divided into A1, A2 and A3 according to agonist and antagonist properties and their actions on adenylate cyclase. A1-receptor activation inhibits while A2 -receptor activation stimulates adenylate cyclase. The A2 subclass of adenosine receptors have been further subdivided in to highaffinity A2a and low-affinity A2b receptors (for review, see Fredholm et al. 1994). In catecholaminergic neurons, stimulation of A1 - adenosine receptors inhibit cAMP levels and decreases dopamine release. In contrast, stimulation of A2a receptors in catecholaminergic containing neurons increases cAMP levels and increases dopamine release (for review see, Ferre et al. 1992). Although an increase in dopamine release has not been demonstrated in the carotid body in response to adenosine, adenosine and A2a-adenosine receptor agonists increase cAMP levels in the carotid body in vitro (Chen et al. 1997, Monteiro et al. 1996). We have shown here that the mRNA encoding the excitatory A2a-adenosine receptor is present in the carotid body and co-localized with TH-mRNA. Immunoreactivity for the A2a-adenosine receptor using a monoclonal antibody is also present in the carotid body (data not shown). In vivo and in vitro experiments using a superfused carotid body preparation have shown augmentation of carotid sinus nerve discharge in response to exogenously administered adenosine (Runold et al. 1990). The data presented here show that although A2a-adenosine receptor mRNA is present in petrosal ganglion cells, the hybridization signal for the inhibitory
A1-adenosine receptor is intense. The interpretation of these data is limited by the inability to determine whether the A1-adenosine receptor protein is expressed on afferent nerve terminals or Type 1 cells in the carotid body.
556
Only 10% of neurons in the petrosal ganglion contain TH, 90% of these TH neurons have fibers which project in the carotid sinus nerve of which 85% terminate in the carotid body (Finley et al. 1992). The region of the petrosal ganglion that contained clusters of ganglion cells that expressed TH mRNA on serial sections of was used to identify ganglion cells most likely to have fibers which termininate in the carotid body. Because of limited intensity of digoxigenin signal for TH in petrosal ganglion neurons, it cannot be determined if A2a or A1-adenosine receptor mRNA are colocalized with TH mRNAs in the petrosal ganglion. These experiments are being repeated with an amplication technique for the digoxigenin hybridization signal. Nevertheless, because numerous cells in the petrosal ganglion express A1-adenosine receptor mRNA, it is plausible that A1adenosine receptors might be involved in modulating chemoreceptor activity. Adenosine might have a dual role in carotid body chemotransmission, augmenting further transmitter release from Type 1 cells and perhaps attenuating carotid sinus nerve activity during hypoxia. Binding of adenosine to presynaptic A2a-adenosine receptors stimulates the release of dopamine and acetylcholine in synaptosomes (Kirkpatrick et al. 1993). A2a-adensosine receptors might have a similar role in Type 1 cells by modulating release of other neurotransmitters during hypoxia. In summary, our data support physiological and pharmacological experiments showing that adenosine receptors are involved in chemotransmission of the hypoxic response in peripheral arterial
chemoreceptors. Using in situ hybridization
histochemistry, we
have
localized A2a-receptor mRNA to Type 1 cells and both A2a and A1 mRNA in the petrosal ganglion cells. Although the augmentation of carotid sinus nerve discharge may be secondary to adenosine binding to pre and postsynaptic A2a-adenosine receptors, the possible role of inhibitory A1adenosine receptors on carotid sinus nerve fibers should be determined.
ACKNOWLEDGEMENTS This work was supported by the NHLBI (HL03365-04). The author would like to thank Patrice Kerr for her excellent technical help, Drs. David R. Weaver and Steven M. Reppert at Harvard Medical School for providing the A2a and A1-adenosine receptor clones, and Edward Lawson for critiquing the manuscript.
557
REFERENCES (Chen, J., B. Dinger and S. J. Fidone. cAMP production in rabbit carotid body: role of adenosine. J. Appl Physiol. 82(6): 1771-1775, 1997. Czyzyk-Krzeska, M. F., E. E. Lawson, and D. E. Millhorn. Expression of D2 dopamine receptor mRNA in the arterial chemoreceptor afferent pathway. J. Autonomic Nervous Svstem 41: 31-40, 1992. Ferre, S., K. Fuxe, G. Von Euler, B. Johansson, and B. B. Fredholm. Adenosine-dopaminc interactions in the brain. Neuroscience 51: 501-512, 1992. Fidone, S. J., C. Gonzalez, B. G. Dinger, and G. R. Hanson. Mechanism of chemotransmission in the mammalian carotid body. Prog Brain Res 169-179, 1988. Fink, J. S., D. R. Weaver, S. A. Rivkees, R. A. Peterfreund, A. E. Pollack, E. M. Adler, and S. M. Reppert. Molecular cloning of the rat adenosine receptor: selective co-expression with dopamine receptors in rat striatum. Molecular Brain Research 14: 186-195, 1992. Finley, J C. W. and D. M. Katz. The central organization of carotid body afferent projections to the brainstem of the rat. Brain Research 572: 108-116, 1992. Fredholm, B.B., M. P. Abbracchio, G. Burnstock, J.W. Daly, T.K. Harden, K.A. Jacobson., P. Leff and M. Williams. Nomenclature and classification of purinoceptors. Pharmacol. Rev. 46: 143-156, 1994. Gauda, E. B., O. S. Bamford, and C. R. Gerfen. Developmental expression of tyrosine hydroxylase, D2-dopamine receptor and substance P genes in the carotid body of the rat. Neuroscience 75: 969-977, 1996. Gauda, E. B., F. J. Northington, and O. S. Bamford. Lack of induction of substance P gene expression by hypoxia and absence of neurokinin 1-receptor mRNAs in the rat carotid body Autonomic Nervous System 74: 100-108, 1998. Gonzalez, C., B. G. Dinger, and S. J. Fidone. Mechanisms of carotid chemoreception. In: Regulation of Breathing, edited by J. A. Dempsey and A.I. Pack. Marcel Deckker, Inc. 1994, p. 391-470. Grima B., A. Lanouroux, L. Blanot, N.F. Biguet and J. Mallet. Complete coding sequence of rat tyrosine hydroxylase mRNA. Proc. Natl. Acad. Sci. U.S.A. 82, 617-621. Iturriaga, R., C. Larrain, and P. Zapata. Effects of dopaminergic blockade upon carotid chemosensory activity and its hypoxic-induced excitation. Brain Res 663: 145-154, 1994. Kirkpatrick, K. A. and P. J. Richardson. Adenosine receptor-mediated modulation of acetylcholine release from rat striatal synaptosomes. Br. J. Pharmacol 110: 949-954, 1993. McQueen, D. S. and J. A. Ribeiro. On the specificity and type of receptor involved in carotid body chemoreceptor activation by adenosine in the cat. Br. J. Pharmac 80: 347-354, 1983. Monteiro, E. C., P. Vera-Cruz, T. C. Monteiro, and M. A. Silva E Sousa. Adenosine increases the cAMP content of the rat carotid body in vitro. In: Frontiers in arterial chemoreception, edited by P. Zapata, C. Eyzaguirre, and R. W. Torrance. New York and London: Plenum Press, 1996, p. 299-304. Reppert, S. M., D. R. Weaver, J. H. Stehle, and S. A. Rivkees. Molecular cloning and characterization of a rat A 1 -adenosine receptor that is widely expressed in brain and spinal cord. Mol. Endocrinol. 5: 1037-1048, 1991. Runold, M., N. S. Cherniack, and N. R. Prabhakar. Effect of adenosine on isolated and superfused cat carotid body activity. Neuroscience Letters 113: 111-114, 1990.
558
SEROTONIN AND THE HYPOXIC VENTILATORY RESPONSE IN AWAKE GOATS
J.K. Herman, K.D. O'Halloran, and G.E. Bisgard Dept. of Comparative Biosciences, University of Wisconsin, Madison, Wisconsin 53706 USA
Key words:
1.
acclimatization, methysergide, 8-OH DPAT, Ketanserin, mammal
INTRODUCTION
Long-term exposure to hypoxia induces a time-dependent increase in ventilation that is termed ventilatory acclimatization to hypoxia
(VAH). The time course of this increase in ventilation varies greatly across species but in the goat it occurs over a period of 4-6 h (Bisgard and Neubauer 1995). In the goat, this process is not only dependent on intact carotid bodies (CB; Smith et al. 1986), but also on the progressive increase in CB output that occurs with prolonged hypoxic but not hypercapnic stimulation (Bisgard et al. 1986; Nielsen et al 1988). However, a portion of the facilitated ventilatory output that occurs during VAH may also arise via modulation of respiratory
motor output within the central nervous system, thereby increasing the efficacy of carotid afferent translation. The serotonergic nervous system has been suggested to play an important role in the modulation and facilitation of many rhythmic spinal motor neuronal events (Jacobs and Fornal 1997) including those involved in respiration (McCrimmon et al. 1995). For example, episodic isocapnic hypoxia elicits a serotonin (5-HT) dependent long-term facilitation (LTF) of ventilation following the hypoxic exposure (Millhorn et al. 1980, Bach and Mitchell 1996). The similarity between this LTF and the
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
559
persistent hyperventilation following acclimatization has led to the suggestion that the mechanisms involved in LTF may also play a role in VAH (Millhorn et al. 1980). Serotonin has been reported in the CB of the goat (Engwall et al. 1989), and is reported to induce excitation and inhibition of carotid sinus chemosensitive afferent discharge in both the cat (Kirby and McQueen 1984) and the dog (Bisgard et al. 1979). Therefore we hypothesized that 5-HT may play an important role in the manifestation of VAH, either in the facilitation of carotid body output or in the modulation of the respiratory motor output within the central nervous system.
2.
METHODS
2.1
Animal preparation
Adult female goats (mean body weight were used in this study. After initial anesthetic induction thiopental IV), the goats were maintained under general anesthesia (halothane, nitrous oxide and oxygen) while one common carotid artery was translocated to a subcutaneous position to facilitate the insertion of an arterial catheter. Following the surgery, during a minimum 2-wk-recovery period, each goat was trained to stand quietly in a stanchion while wearing a facemask. One day prior to the study, an arterial catheter was inserted into the translocated carotid artery for anaerobic blood sampling and blood pressure measurement. A venous catheter was also placed in an external jugular vein for IV drug administration.
2.2
Measurements
Ventilatory data were collected with a tightly fitting facemask attached to a low resistance unidirectional breathing valve (Hans Rudolph, no. 2700). Expired gases were collected in a spirometer (120 1) from which expired minute ventilation could be measured throughout the experimental protocol. Inspired airflow was measured using a pneumotachograph (T-2, Fleisch) which was electronically integrated to give inspired tidal volume An analyzer (Applied Electrochemistry, was used to monitor the
560
concentration of in the inspired gases. Inspired and expired levels were measured from a port in the facemask using a analyzer (PM-20, Anarad). End-tidal systemic arterial blood pressure, inspired and were recorded using the Windaq data acquisition system (DATAQ Instruments, Akron OH). Each variable was collected at 50 – 100 and data were collected continuously over the entire experimental protocol. Only the ventilatory and cardiovascular variables measured at times corresponding to blood gas measurements are presented. Arterial blood pressure and blood gas samples were obtained via a catheter in the carotid loop. Arterial blood samples were analyzed for arterial and respectively) by blood gas analyzer (ABL 500, Radiometer). A rectal thermistor probe was used for measurement of body temperature to correct blood gas measurements for temperature.
2.3
Protocol
The goats were allowed approximately 20-30 min to adapt to the breathing circuit. Once stable baseline variables were established, 30 min of control respiratory, cardiovascular and blood gas variables were collected. At the end of this period, the goats were given either the broad-spectrum serotonergic antagonist, methysergide maleate (1 the specific receptor antagonist ketanserin the receptor agonist, 8hydroxy-2-(di-n-propylamino)tetralin (8-OH DPAT; 0.1 IV; N = 5) or vehicle (12-14 ml saline IV). Following the drug or saline administration an additional 30-min of baseline variables were collected. At the end of this second control period, the inspired gas mixture was adjusted until a stable level of hypoxia was achieved ( of torr for all groups). Inspired was added and continuously adjusted to maintain isocapnic to the post-injection baseline The goats were maintained at this isocapnic level for 2 h. Arterial blood samples were taken at a minimum of every 15min to ensure minimal arterial blood gas fluctuations. Each goat served as its own control and a minimum of two weeks was allowed before the goat was re-tested with the opposite injection (drug or
561
saline). The ketanserin and methysergide protocols were conducted on the same goats and a minimum of 1 month was allowed following the methysergide treatment prior to the start of the ketanserin protocol. The 8-OH DPAT protocol was conducted on a separate group of goats.
2.4
Drugs
All drug concentrations were determined using the salt weight and then dissolved in 12 – 14 ml saline before being slowly administered (approximately 2-min infusion IV for methysergide and ketanserin, 30-min infusion IV for 8-OH DPAT).
2.5
Statistical analysis
Expired minute ventilation, respiratory frequency heart rate and mean arterial blood pressure (MAP) were collected immediately preceding blood gas measurements during the experimental protocol. The variables reported are the average of 2-5 blood gas measurements taken during the baseline and at specific time points during hypoxia. Two-way, repeated-measures ANOVA were used to test for significant differences among the different time points and between drug treatments. Post-hoc analysis using a paired T-test was used where indicated by a significant ANOVA. All statistical tests were performed using Statistica (StatSoft, version 4.5). The level of significance was set at All data are presented as means 1 S.E.
3.
RESULTS
Saline injections did not alter any arterial blood gas variable (Fig. 1A-C). Methysergide administration induced a slight but nonsignificant increase in and a significant fall in pHa without altering Ketanserin administration did not alter any arterial blood gas variable. Infusions of 8-OH DPAT did not significantly alter any blood gas variable. Lowering the inspired tension
562
significantly lowered the in all goats. The was successfully maintained isocapnic to the post-injection control level for each group. The methysergide treated goats tended to have a slightly lower pHa than did the other groups but this was only significantly different from the saline response at the post-injection and 30 min time point. Acute hypoxia significantly increased pHa at the 30 min time point in the 8-OH DPAT group but did not alter or Saline injections did not induce any change in normoxic ventilation. Lowering the inspired tension induced a significant increase in above baseline in all goats regardless of protocol (Figs. 2,3,4). This increase was due to changes in both f and Similarly, sustained isocapnic hypoxia induced a time-dependent increase in in each protocol. The at 2 h of hypoxia was significantly larger than at the 30 min time point. This time-dependent increase in was due to changes in both f and The increase in fH during hypoxia was not different between the saline and drug groups. Sustained hypoxia did not induce time-dependent changes in in any group. Neither the drugs nor hypoxic exposure altered MAP.
3.1
Methysergide
Despite a slight increase in and a fall in pHa, methysergide did not alter baseline normoxic (Fig. 2). The 30 min and 1 h percent change in was significantly elevated above the corresponding time points in the saline treated goats (Fig. 2). This increased was primarily due to a larger hypoxia induced increase in f in the methysergide treated goats over the saline treated goats. The percent change in increased significantly above the acute hypoxic response by the second h of hypoxia (Fig. 2) but this time point was no longer significantly different from the saline treated goats.
3.2
Ketanserin
Ketanserin did not alter baseline ventilation but did induce a significant increase in f H . At no time point did the percent change in for the ketanserin treated goats differ from the saline treated goats (Fig. 3).
563
564
565
3.3
8-OH DPAT
Infusing 8-OH DPAT induced a significant percent change in during normoxia that was due entirely to a significant elevation in f (Fig. 4), as was not changed. There was no significant interaction between 8-OH DPAT and hypoxic exposure as the difference in magnitude of between the saline and 8-OH DPAT in normoxia was maintained as the animals were exposed to hypoxia (Fig. 4).
4.
DISCUSSION
The present study demonstrates that 5-HT plays a modulatory role in the ventilatory response to acute hypoxia. This modulatory role appears to be in inhibiting the magnitude of ventilation associated with hypoxic drive without necessarily contributing to the manifestation of VAH since continued to increase with sustained hypoxia. Methysergide administration resulted in a greatly augmented acute hypoxic ventilatory response. Methysergide has been reported to be a broad-spectrum 5-HT antagonist that also has some agonist properties at the receptors (Silberstein 1998). Therefore the 566
response that was seen may have occurred via methysergide acting at one 5-HT receptor type or may have arisen through the interactions of multiple 5-HT receptors. One purpose of the present study was to better elucidate the receptor types that were involved in this augmented acute hypoxic response. Preliminary work in our laboratory has indicated the presence of the receptor in the carotid body of the goat (unpublished observations). Furthermore, in cats, a portion of the 5-HT induced inhibition of the CB chemosensitive afferents is sensitive to blockade of the receptor subtypes (Kirby and McQueen 1984) suggesting perhaps that blockade of these receptors may have contributed to the augmented hypoxic VE. However, in the present study, ketanserin administration did not result in any difference in the hypoxic ventilatory response, failing to support a major role for these receptor subtypes. The main contributor of the augmented acute VE following methysergide was a significant increase in f. Stimulation of the receptors has been shown to increase respiratory drive (Shepheard et al. 1990) and decrease inspiratory time (Lalley et al. 1994) resulting in
567
increases in respiratory rate (Gillis et al. 1989; Edwards et al. 1990). This is similar to what was found in the present study with the administration of the agonist, 8-OH DPAT. During normoxia, infusions of 8-OH DPAT resulted in an almost doubling of f without altering VT. The results of this study are very similar to the results of Olson (1987) in which rats were acclimatized to hypoxia following 5HT depletion. In the Olson (1987) study, 5-HT depletion resulted in an increase in normoxic ventilation and this difference between the treated and control rats was maintained throughout hypoxia. In the present study, the difference in normoxic V E between the 8-OH DPAT treated goats and those that received saline was maintained when the goats were exposed to hypoxia indicating that there was no interaction between stimulation and hypoxic drive. The similarities between the 5-HT depleted rats (Olson 1987) and the present study suggest that respiratory output is under tonic inhibition by 5-HT. The receptor has been reported to be an autoreceptor on the serotonergic raphe neurons (Hoyer et al. 1994) and 8-OH DPAT administration greatly reduces the activity of these neurons (Bjorvatn, 1998). This would reduce 5-HT release at the axon terminals and potentially give similar mechanisms between 5-HT depletion and 5-HT autoreceptor stimulation. The results of the methysergide and 8-OH DPAT studies were similar following the 1 h time point suggesting that this component of the response was mediated by receptor stimulation. In conclusion, the augmented acute hypoxic response induced by methysergide could not be mimicked by more selective 5-HT receptor blockade or stimulation and therefore most likely was the result of methysergide interacting at multiple 5-HT receptor subtypes.
ACKNOWLEDGEMENTS The authors would like to thank Gordon Johnson for his excellent technical assistance. Supported by NIH grants HL 15473, HL07654, and HL10069.
5.
REFERENCES
Bach, K.B., and Mitchell, G.S., 1996, Hypoxia-induced long-term facilitation of respiratory activity is serotonin dependent. Respir. Physiol. 104: 251-260. Bisgard, G.E. and Neubauer, J.A., 1995. Peripheral and central effects of hypoxia. In Regulation of Breathing; edited by J.A. Dempsey and A.I. Pack. Second edition. Vol. 79. pp. 617-668.
568
Bisgard, G.E., Mitchell, R.A., and Herbert, D.A., 1979, Effects of dopamine, norepinephrine and 5-hydroxytryptamine on the carotid body of the dog. Respir. Physiol. 37: 61-80.
Bisgard, G.E., Busch, M.A., Daristotle, L., Bressenbrugge, A. and Forster, H.V., 1986, Carotid body hypercapnia does not elicit ventilatory acclimatization in goats. Respir. Physiol. 65:113-125. Bjorvatn, B., Fornal, C.A., Martin, F.J., Metzler, C.W., and Jacobs, B.L., 1998, The 5-HT1A receptor antagonist p-MPPI blocks 5-HT1A autoreceptors and increases dorsal raphe unit activity in awake cats. Eur. J. Pharmacol. 356:167-178. Edwards, E., Whitaker-Azmitia, P.M., and Harkins, K., 1990, and agonists play a differential role on the respiratory frequency in rats. Neuropsychopharmocology 3(2): 129-136.
Engwall, M.J.A., Olson Jr., E.B., and Bisgard, G.E., 1989, Carotid body amine levels in goats exposed to hypoxia or hypercapnia. Neurosci. Lett. 107, 221-226. Gillis, R.A., Hill, K.J., Kirby, J.S., Quest, J.A., Hamosh, P., Norman, W.P., and Kellar, K.J., 1989, Effect of activation of central nervous system serotonin 1A receptors on cardiorespiratory function. J. Pharmacol. Exp. Ther. 248(2):851-857. Hoyer, D., Clarke, D.E., Fozard, J.R., Hartig, P.R., Martin, G.R., Mylecharane, E.J., Saxena, P.R., and Humphrey, P.P. A., 1994, VII. International union of pharmacology classification of receptors for 5-Hydroxytryptamine (Serotonin). Pharmacol. Rev. 46(2): 157-203. Jacobs, B.L., and Fornal, C.A., 1997, Serotonin and motor activity. Curr. Opin. Neurobiol. 7(6): 820-825. Kirby, G.C. and McQueen, D.S., 1984, Effects of antagonists MDL 72222 and ketanserin on response of cat carotid body chemoreceptors to 5-hydroxytryptamine. Br. J. Pharmacol. 83: 259-269. Lalley, P.M., Bischoff, A.-M., and Richter, D.W., 1994, Serotonin 1 A-receptor activation suppresses respiratory apneusis in the cat. Neurosci. Lett. 172: 59-62. McCrimmon, D.R., Mitchell, G.S. and Dekin, M.S. 1995. Glutamate, GABA, and serotonin in ventilatory control. In Regulation of Breathing, edited by J.A. Dempsey and A.I. Pack.
Second edition. Vol. 79. pp. 151-218. Millhorn, D.E., Eldridge, F.L., and Waldrop, T.G., 1980, Prolonged stimulation of respiration by endogenous central serotonin. Respir. Physiol. 42: 171-188. Nielsen, A.M., Bisgard, G.E. and Vidruk, E.H., 1988, Carotid chemoreceptor activity during acute and sustained hypoxia in goats. J. Appl. Physiol. 65: 1796-1802. Olson Jr, E.B., 1987, Ventilatory adaptation to hypoxia occurs in serotonin-depleted rats. Respir. Physiol. 69: 227-235. Shepheard, S.L., Jordan, D. and Ramage, A.G., 1990, Actions of 8-OH DPAT on sympathetic and respiratory drives, blood pressure and heart rate in the rabbit. Eur. J. Pharmacol. 186(23):267-272. Silberstein, S.D., 1998, Methysergide. Cephalalgia. 18: 421-435.
Smith, C.A., Bisgard, G.E., Nielsen, A.M., Daristotle, L., Kressin, N.S., Forster, H.V. and Dempsey. J.A., 1986, Carotid bodies are required for ventilatory acclimatization to chronic hypoxia. J. Appl. Physiol. 60:1003-1010.
569
This page intentionally left blank.
Peripheral Chemosensitivity in Mutant Mice Deficient in Nitric Oxide Synthase David D. Kline and Nanduri R. Prabhakar Department of Physiology and Biophysics, Schoool of Medicine, Case Western Reserve University, Cleveland OH 44106
Key words:
Carotid body, Nitric Oxide Synthase, Mice
Abstract:
Nitric oxide (NO) is endogenously generated from two constitutively expressed nitric oxide synthase (NOS) isoforms, i.e., neuronal (NOS-1) and endothelial (NOS-3). Both isoforms are localized within the carotid body. Previous studies have shown endogenously generated NO modulates carotid
body activity. In the present study, we examined the relative contribution of NO generated by NOS-1 and NOS-3 in respiratory reflexes arising from the
carotid body. Experiments were performed on mutant mice deficient in NOS-1 or NOS-3. Wild-type (WT) mice, which contained both isoforms, served as controls. Respiration was monitored in unanesthetized mice by plethysmography. In anaesthetized mice, efferent phrenic nerve activity was monitored as index of breathing. We examined the effects of hypoxia cyanide and brief hyperoxia (Dejour’s test) on respiration. In NOS-1 mutant mice, the ventilatory response to hypoxia were significantly augmented, compared to wild-type (WT) mice. By contrast, NOS-3 mutant mice displayed significantly blunted respiratory responses to hypoxia
compared to WT controls. The responses to cyanide were augmented in NOS1; whereas they were blunted in NOS-3 mutant mice. Respiratory depression in response to brief hyperoxia was more pronounced in NOS-1, while it was nearly absent in NOS-3 mutant mice. These results demonstrate that NO produced by the neuronal and endothelial NOS isoforms have different modulatory roles in carotid body chemosensitivity.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
571
1.
INTRODUCTION
Nitric oxide (NO) is a gas molecule generated by the enzyme NO synthase (NOS). Over the last few years, numerous reports have suggested that NO is involved in many physiological processes, including the modulation of breathing during hypoxia (see Prabhakar, 1999 for references). Previous studies have documented the presence of NOS in the carotid bodies, the major sensory organs that detect changes in arterial oxygen. (Prabhakar et al. 1993). In the chemoreceptor tissue, NOS is localized primarily in the nerve fibers innervating the glomus tissue, and to some extent the blood vessels (Prabhakar et al. 1993, Wang et al. 1993, Hohler et al. 1994). Inhibitors of NOS augment, whereas NO donors attenuate, carotid body activity (Prabhakar et al. 1993, Wang et al. 1993, Chugh et al. 1994). Moreover, NOS inhibitors augment the carotid body sensory discharge during hypoxia (Wang et al. 1994). Physiological studies have shown that inhibitors of NOS enhance the respiratory responses to hypoxia, which appear to be due, in part, to actions within the carotid body (Gozal et al. 1996b). Taken together, these observations suggest that endogenously generated NO acts as an inhibitory chemical messenger in the carotid body. Three isoforms of NOS have been characterized, neuronal (NOS-1), inducible (NOS-2) and endothelial (NOS-3) (for references see Moncada et al, 1991). Of the three isoforms, NOS-1 and 3 are constitutively expressed and are responsible for basal generation of NO. However, much of the information on the role of NO in the modulation of peripheral chemosensitivity has come from studies using NOS inhibitors, which cannot distinguish between the constitutive NOS isoforms. Therefore, to determine the modulatory role of NO generated from NOS-1 and NOS-3 on carotid body activity, we examined the respiratory responses to carotid body stimuli in transgenic mice deficient in either NOS-1 or NOS-3.
2.
METHODS
Experiments were performed on age matched wild-type (Wt), NOS-1 and NOS-3 mutant mice of either sex. The average weights of the animals were as follows: Wt mice mutant mice and NOS-3 mutant mice Mutant mice were obtained from Dr. P.L. Huang (Huang et al. 1993 and 1995). Hybrids of the 129/SV and C57BL/6 strains of mice, the parental strains of the mutant mice, were used as wild-type (Wt) controls.
572
2.1
Respiratory Responses to Hypoxia
In unanesthetized animals, respiration was monitored by whole body plethysmograph as described previously (Kline et al. 1998). Briefly, animals were placed in a 600 ml Lucite chamber containing an inlet port for the administration of test gases. Animals were placed in the plethysmograph chamber containing aspen bedding and allowed to acclimate to the environment for 60 minutes while room air flowed through the chamber. The animal chamber, as well as a reference chamber, was connected to a high gain differential pressure transducer. As the animal breathed, small changes in pressure were converted to a signal representing tidal volume (Bartlett & Tenney, 1970). The respiratory signals were amplified and recorded on a strip chart recorder. The signals were also stored in a computer with respiratory acquisition software for analysis off-line. Minute ventilation ( respiratory rate × tidal volume) was analyzed over each gas challenge (see below). All measurements were made between 9:00 AM and 1:00 PM. In anesthetized animals, mice were anesthetized with intraperitoneal injections of urethane as described previously (Kline et al. 1998). Integrated phrenic nerve activity was monitored as an index of central respiratory output. For this purpose, the phrenic nerve was isolated unilaterally at the level of the C3 and C4 spinal segments. The nerve was cut distally and placed on bipolar stainless steel electrodes. The electrical activity was filtered (band pass 0.3-1.0 kHz), amplified and passed through Paynter filters (time constant 100 ms; CWE, Inc.) to obtain a moving average signal. The animals were allowed to breathe spontaneously and core body temperature was monitored by a rectal thermistor probe and maintained by a heating pad. Minute neural respiration (M.N.R., respiratory rate × amplitude of integrated phrenic nerve discharge) was analyzed over each gas challenge. In both unanesthetized and anethetized procedures, animals were challenged with varying levels of inspired Mice were exposed to 100% and 12% balanced nitrogen. Each gas challenge was given for five minutes. The protocols were repeated three times in each animal, with a 20 minute interval between each protocol.
2.2
Assessment of Peripheral Chemosensitivity
Peripheral chemosensitivity was assessed by monitoring the respiratory responses to a) systemic administration of sodium cyanide-a potent stimulant of the carotid body and b) brief hyperoxia (Dejours test). For this purpose, animals were anesthetized, as described above. A femoral artery catheter was used to monitor arterial blood pressure while systemic administration of
573
fluids and/or drugs was accomplished through a femoral vein catheter. Animals were allowed to breathe spontaneously.
The effects of intravenous administration of sodium cyanide (NaCN, Fisher Scientific Co.) on respiration were examined while the animals breathed room air. The dose of cyanide was The volume of the injectate was of saline (0.9% NaCl). This dose was based on the dose response curve reported by us previously (Kline et al, 1998). The same volume of saline without cyanide served as controls. Stock solutions of cyanide were prepared fresh before each experiment. Respiratory rate was measured one minute prior, and one minute immediately after the injection of NaCN. The following protocols were used to monitor the effects of brief hyperoxia on respiration (Dejours, 1962). Baseline respiration was recorded while animals breathed 21 or (see results). was added to the inspired air for 20 seconds. Respiratory rate was analyzed for 20 seconds during baseline and during the last 15 seconds of hyperoxia. Analysis of respiratory rate during the initial 5 seconds of hyperoxia was excluded because of the dead space of the tubing.
2.3
Results
2.3.1
Respiratory Responses to Hypoxia
The effects of two levels of inspired oxygen were examined unanesthetized mice. In response to (from ), all three groups of mice significantly increased minute ventilation primarily through increases in respiratory rate. In NOS-1 mutant mice, the augmentation of respiration was significantly greater compared to Wt mice ( Figure 1A). By contrast, the increase in VE in NOS-3 mutant mice was significantly less than Wt mice ( Figure 1 A). Similar results were observed in anesthetized mice, i.e., NOS-1 mutant mice exhibited augmented, whereas NOS-3 mutant mice displayed blunted, respiratory responses to hypoxia, compared to Wt mice. Arterial blood gases were similar among all groups of mice. Baseline arterial blood pressure was higher in NOS-3 mutant mice, compared to Wt mice. However, changes in arterial BP during hypoxia were similar among Wt, NOS-1 mutant and NOS-3 mutant mice.
574
575
2.3.2
Evidence for Altered Carotid body Sensitivity
As NO is inhibitory to carotid body activity, the altered respiratory responses to hypoxia may in part be due to changes in peripheral chemosensitivity. In order to assess this possibility, the following experiments were performed on anesthetized mice. The effects of systemic administration of cyanide a potent stimulant of the carotid body, on breathing was examined in Wt, NOS-1 and NOS-3 mutant mice ( in each group). Systemic administration of cyanide induced a dramatic augmentation of respiration in Wt and NOS-1 mutant mice, but not in NOS-3 mutant mice. NOS-1 mutant mice increased respiratory rate significantly greater than Wt mice (Figure 1B). On the other hand, cyanide-induced respiratory stimulation was significantly less in NOS-3 mutant mice, compared to Wt mice (Figure 1B). Intravenous saline injection did not significantly affect respiration in any group of mice. Sectioning of the carotid sinus nerves abolished cyanide induced respiratory responses, suggesting the involvement of the carotid bodies (Kline et al, 1998). The magnitude of respiratory decrease in response to hyperoxia is commonly used as an index of peripheral chemoreceptor sensitivity (Dejours, 1962). If carotid body sensitivity is altered in the mutant mice, it should be reflected in the magnitude of decrease in the respiratory rate during brief hyperoxia. In one series of experiments, the respiratory responses of Wt and NOS-1 mutant mice to brief hyperoxia were examined while the animals inspired As can be seen in Figure 1C, the magnitude of decrease in respiratory rate was significantly greater in NOS-1 mutant mice compared to Wt mice. In another series of studies, the respiratory responses of Wt and NOS-3 mutant mice to brief hyperoxia were examined while the animals inspired Breathing during was used as baseline in this series due to the lack of a significant respiratory stimulation by (from ) in NOS-3 mutant mice. As shown in Figure 1D, the respiratory rate response to brief hyperoxia was significantly attenuated in NOS-3 mutant mice compared to Wt mice.
3.
DISCUSSION
The results of the present study demonstrate that NOS-1 mutant mice exhibit augmented respiratory responses to hypoxia. In addition, peripheral chemosensitivity is enhanced in these mice, as evidenced by greater increases in respiration to intravenous NaCN, as well as a greater reduction in respiration during brief hyperoxia. On the other hand, to our surprise,
576
NOS-3 mutant mice displayed blunted respiratory responses to hypoxia, as well as reduced peripheral chemosensitivity. It is well established that NOS-1 is present in the carotid body nerve fibers and that NO is inhibitory to chemoreceptor activity (see Prabhakar 1999 for review). Since the NOS-1 mutant mice lack the NOS-1 protein, it is expected that within the carotid body, NO generated from this isoform will be reduced, which might have lead to augmented carotid body sensitivity. The enhanced respiratory responses to brief hyperoxia and cyanide provide evidence for such a conclusion. Gozal et al. (1996a) has reported that in rats the respiratory responses to cyanide were unaffected following administration of a putative NOS-1 blocker, whereas a nonspecific NOS inhibitor, which does not discriminate between the NOS-1 and NOS-3 isoforms, potentiated the cyanide response. Based on these observations, these authors concluded that NO generated from NOS-3, rather than NOS-1, inhibits carotid body activity. It may be that the relative contribution of NOS-1 derived NO may vary from rats to mice or that the effect of acute blockade of NOS-1 differs from chronic deficiency of the NOS-1 protein. There are a number of pathways NO produced from NOS-1 may modulate carotid body activity. One such mechanism is through the modulation of intracellular calcium levels of the glomus cells, which are important in the chemoreception process. For example, Summers et al. (1999) has provided evidence that NO directly inhibits currents in a voltage-independent manner in carotid body glomus cells. We have also
reported that NO mobilizes internal stores in glomus cells (Prabhakar 1999). Moreover, NO may activate the enzyme guanylyl cyclase, thereby increasing cytosolic cGMP levels within the glomus cells, which may subsequently reduce chemosensitivity. (Prabhaker et al. 1993, Wang et al. 1994). There may be other potential mechanisms, however, which remain to
be explored. In contrast to NOS-1 mutant mice, NOS-3 mutant mice exhibited a clear attenuation of the respiratory responses to hypoxia as well as blunted peripheral chemosensitivity. Previous studies have reported that NOS is located within the carotid body vasculature (Wang et al. 1993). Furthermore, we have shown that in NOS-3 mutant mice, these animals lack the NOS-3 protein within the carotid body vasculature (unpublished observations). Therefore, NO produced from NOS-3 is expected to be significantly reduced in NOS-3 mutant mice, compared to Wt mice. What may have contributed to the apparent attenuation of peripheral
chemosensitivity in these mice? NOS-3 mutant mice have higher blood pressure, presumably since birth, than their wild-type controls (Huang et al 1995). It has been reported that during prolonged hypertension, the carotid body response to hypoxia is attenuated (Przybylski et al. 1982). This blunted
577
carotid body sensitivity has been attributed to diminished blood supply to the chemoreceptor tissue and reduced tissue (Przybylski et al. 1982). A similar blunting of the hypoxic ventilatory response has been reported in hypertensive humans (Tafil-Kalwe et al. 1989), as well as in chronically hypoxic rats and cats (Barer et al. 1972, Tatsumi et al. 1991). Therefore, it is possible that chronic reduction of NO produced by NOS-3 might have resulted in a sustained reduction in blood flow to the carotid body, and rendering it insensitive to hypoxia. Wyatt et al. (1995) has explored the potential mechanisms for the blunted responses in chronically hypoxic animals. These investigators have reported that the glomus cells of neonatal rats born and reared in a hypoxic environment do not depolarize at a which can depolarize glomus cells of normoxic rats. This lack of response was attributed to a decrease in the expression of channels, which can influence the resting membrane potential. Whether similar alterations in channel proteins or other cellular mechanisms are associated with the reduced hypoxic sensing of the carotid body in NOS-3 mutant mice, however, remains to be investigated.
4.
CONCLUSION
In summary, in the present study using mutant mice deficient in NOS-1 or NOS-3, we have demonstrated that NO produced by the neuronal and endothelial NOS isoforms have different modulatory roles in carotid body chemosensitivity. NO produced by NOS-1 inhibits carotid body activity primarily through actions on the chemoreceptor glomus cells and nerve fibers. On the other hand, NO generated from NOS-3 modulates peripheral chemosensitivity via regulation of vascular tone and local tissue However, the cellular mechanism of NO’s actions in the carotid body appear complex and require further study. These studies support the idea that NO generated by NOS-1 and NOS-3 is an important physiological modulator of carotid body activity.
ACKNOWLEDGMENTS We would like to thank Dr. Paul L. Huang for providing the NOS-1 and NOS-3 mutant mice. This work was supported by grants from the National Institutes of Health, Heart, Lung and Blood Institute. HL-25830.
578
REFERENCES Barer GR, Edwards C & Jolly AI. (1972). Changes in the ventilatory response to hypoxia and carotid body size in chronically hypoxic rats. J. Physiol. (Lond). 221:27P-28P.
Bartlett D & Tenney SM. (1970). Control of breathing in experimental anemia. Resp. Physiol 10:384-395. Chugh DK, Katayama M, Mokashi A, Bebout DE, Ray DK, & Lahiri S. (1994). Nitric oxide related inhibition of carotid chemosensory nerve activity in the cat. Resp. Physiol. 97:147156.
Dejours P. (1962). Chemoreceptors in breathing. Physiol. Rev. 42:335-358. Gozal D, Gozal E, Gozal YM & Littwin SM. (1996a). Nitric oxide synthase isoforms and peripheral chemoreceptor stimulation in conscious rats. NeuroReport. 7:1145-1148.
Gozal D, Torres JE, Gozal YM & Littwin SM. (1996b). Effect of nitric oxide synthase
inhibition on cardiorespiratory responses in the conscious rat. J. Appl. Physiol. 81:20682077. Hohler B, Mayer B & Kummer W. (1994). Nitric oxide synthase in the rats carotid body and
carotid sinus. Cell Tissue Res. 276:559-564.
Huang PL, Dawson TM, Bredt DS, Snyder SH & Fishman MC. (1993). Targeted disruption of the neuronal nitric oxide synthase gene. Cell. 75:1273-1286. Huang PL, Huang Z, Mashimo H, Bloch KD, Moskowitz MA, & Fishman MC. (1995). Hypertension in mice lacking the gene for endothelial nitric oxide synthase. Nature. 377:239-242. Kline DD, Yang T, Huang PL & Prabhakar NR. (1998). Altered respiratory responses to hypoxia in mutant mice deficient in neuronal nitric oxide synthase. J. Physiol (Lond). 511:273-287.
Moncada SR, Palmer MJ & Higgs RA. (1991). Nitric oxide: physiology, pathophysiology and
pharmacology. Pharmacol. Rev. 43:109-142. Prabhakar NR, Kumar GK, Chang CH, Agani FH & Haxhiu MA. (1993). Nitric oxide in the sensory function of the carotid body. Brain Res. 625: 16-22.
Prabhakar NR. (1999). NO and CO as second messengers in oxygen sensing in the carotid
body. Resp. Physiol. 15(2):47-54. Przybylski J, Trezbski A, Czyzewski T & Jodokowski J. (1982). Responses to hyperoxia, hypoxia, hypercapnia and almitrine in spontaneously hypertensive rats. Bull. Eur. Physiopath Resp. 18 (suppl. 4): 145-154. Summers BA, Overholt JL & Prabhakar NR. (1999). Nitric oxide inhibits currents in glomus cells of the rabbit carotid body via cGMP-independent mechanism. J. Neurophysiol. 81:1449-1457.
Tafil-Kalwe M, Raschke F, Kubil A, Stoohs R & von Wichert P. (1989). Attenuation of augmented ventilatory response to hypoxia in essential hypertension in the course of aging. Respiration. 56:154-160.
Tatsumi K, Pickett CK & Weil JV. (1991). Attenuated carotid body hypoxic sensitivity after prolonged hypoxic exposure. J. Appl. Physiol. 70(2):748-755. Wang ZZ, Bredt DS, Fidone SJ & Stensaas LJ. (1993). Neurons synthesizing nitric oxide innervate the mammalian carotid body. J. Comp. Neurol. 336:419-432. Wang ZZ, Stensaas LJ, Bredt DS, Dinger B & Fidone SJ. (1994). Localization and actions of nitric oxide in the cat carotid body. Neuroscience. 60: 275-286. Wyatt CN, Wright C, Bee D, & Peers C. (1995). currents in carotid body chemoreceptor cells from normoxic and chronically hypoxic rats and their roles in hypoxic chemotransduction. Proc. Natl. Acad. Sci. USA. 92; 295-299
579
This page intentionally left blank.
DOPAMINERGIC EXCITATION IN GOAT CAROTID BODY MAY BE MEDIATED BY SEROTONIN RECEPTORS K.D. O'Halloran, J.K. Herman, P.L. Janssen,and G.E. Bisgard Department of Comparative Biosciences, University of Wisconsin, Madison, WI 53706, USA
Key words:
1.
peripheral chemoreceptors,
receptors, MDL72222
INTRODUCTION Dopamine (DA) is a prominent neurotransmitter that is found in
relatively large quantities in type I cells of the carotid body (CB) of different mammals (Engwall et al. 1989; Gonzalez et al. 1994). The
role of DA in CB function has been studied extensively yet it remains controversial (Gonzalez et al. 1994; Bisgard and Neubauer 1995). There is strong evidence indicating that DA has a modulatory role that is inhibitory to the chemosensory activity of the CB. Thus, exogenous administration of DA inhibits CB discharge in dogs (Bisgard et al 1979), cats (Black et al. 1972; Zapata 1975; Llados and Zapata 1978; Nishino and Lahiri 1981; Okajima and Nishi 1981), rabbits (Docherty and McQueen 1979), rats (Cardenas and Zapata 1981) and goats (Bisgard et al. 1997). Consistent with these observations exogenous DA depresses ventilation in animals (Black et al. 1972; Zapata and Zuazo 1980; Cardenas and Zapata 1981; Nishino and Lahiri 1981; Kressin et al. 1986; Janssen et al. 1998; O’Halloran et al. 1998) and human subjects (Welsh et al. 1978) whereas peripheral DA-receptor blockade stimulates ventilation and CB neural activity (Zapata and Torrealba 1984; Kressin et al. 1986; Janssen et al. 1998) and attenuates
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
581
the inhibitory effect of DA administration (Zapata and Torrealba 1984; Janssen et al. 1998). Excitatory effects of DA are less readily demonstrated but there is the suggestion that DA could have an excitatory role in CB function as it is well known to be released from CB type I cells during physiological stimulation (Gonzalez et al. 1994) and excitatory effects of DA have been observed in some CB preparations (Black et al. 1972; Zapata 1975; Llados and Zapata 1978; Okajima and Nishi 1981; Zapata and Torrealba 1984). These findings support the hypothesis that there are low-affinity excitatory receptors for DA in the CB (Llados and Zapata 1978; Gonzalez et al. 1994). We have recently shown that intracarotid injection of DA invariably inhibits CB afferent discharge in anesthetized goats in a dose-dependent manner (Bisgard et al. 1997). Furthermore, a brief burst of high frequency (10-40 Hz) stimulation commonly occurs in pauci-fiber CB chemoafferent discharge recordings with bolus intracarotid injections in the higher dose range (10.0-50.0 The burst is always followed by inhibition of activity (Bisgard et al. 1997). We sought to determine if a receptor-mediated mechanism was responsible for the excitatory effect. We hypothesized that if the excitatory activity could be diminished by selective receptor antagonist(s) this would support the view that there are excitatory receptors for DA in the CB. Our data provide preliminary evidence suggesting that the DA-induced excitation is mediated by serotonin (5-HT) type 3 receptors.
2.
METHODS
2.1
Experimental preparation
Adult female and castrated male goats of mixed breed were used for this study. After induction of anesthesia with intravenous (iv) thiopental sodium (15-20 mg/kg) for intubation, animals were placed in dorsal recumbency under a thermostatically controlled heating
blanket to maintain normal body temperature (38-40°C). Anesthesia was maintained with -chloralose given iv (10-15 mg/kg/hr). Femoral arterial and venous catheters were implanted for monitoring systemic arterial blood pressure and for drug administration respectively. Arterial blood samples were drawn anaerobically into heparinized syringes and immediately analyzed for arterial and Lactated Ringer solution was infused (100 ml/hr iv) continuously
582
throughout the experiment to help maintain fluid balance and arterial blood pressure. Sodium bicarbonate was administered iv as necessary. Arterial blood samples were obtained at 30 min intervals during isolation and preparation of carotid sinus nerve (CSN) fibers for recording. The CSN was isolated through a ventral midline incision in the neck and was cut at its junction with the glossopharyngeal nerve. The CSN was positioned on a dissecting platform and submerged in mineral oil to prevent desiccation. An 18 gauge catheter was positioned in the common carotid artery upstream from the CB for close intraarterial delivery of DA. To prevent disruption of the preparation the goats were paralyzed with pancuronium (2 mg iv; 1mg hourly) and mechanically ventilated. Small strands were teased from the desheathed nerve and placed on a unipolar platinum recording electrode. Nerve activity was amplified and visualized on a storage oscilloscope and polygraph chart recorder and the signal was passed through a window discriminator to a rate meter and audio monitor. The raw nerve signal, window output and arterial blood pressure signal were recorded on FM tape and/or digitized and processed using the WINDAQ data acquisition system (Dataq Instruments, Akron, OH). Chemoreceptor discharges were identified according to the following criteria: 1) a brisk and significant increase in mean
frequency of discharge during hypoxia and/or 2) a significant increase
in activity in response to intracarotid injection of sodium cyanide (500 Single or few-fiber preparations in which spikes could clearly be distinguished and counted separately with the window discriminator were used. To verify that spikes represented the activity of a single fiber a storage oscilloscope was used to observe the characteristic shapes of the action potentials.
2.2
Protocol
On identifying a chemoreceptor unit, chemoreceptor discharge frequency was recorded and arterial blood was sampled to ensure normoxic normocapnic conditions. Drugs were given after stable neural activity was recorded for several minutes. Intracarotid bolus injections of were tested in randomized order. The dead space of the manifold system was Drugs were delivered via 1ml boluses into the dead space of the catheter and flushed with 3ml of 0.9% NaCl. DA bolus injections were repeated 5
583
min following systemic administration of selective dopaminergic, adrenergic and serotonergic receptor subtype antagonists (up to 4 antagonists per goat, see Drugs). Arterial blood gases were sampled frequently to ensure maintenance of blood-gas and acid-base homeostasis during mechanical ventilation.
2.3
Drugs
All drugs were prepared on the day of each experiment. Doses of all drugs were calculated on the basis of salt weight. DA HC1 was dissolved in sterile saline (0.9% NaCl) to obtain a stock solution of 10 mg/ml which was further diluted in NaCl for intracarotid administration. SCH23390 ( antagonist), UH232 ( antagonist), L745,870 ( antagonist) and haloperidol (DA antagonist) were dissolved in ethanol. Domperidone ( antagonist) was dissolved in 5% lactic acid. Propranolol ( adrenergic antagonist), phentolamine ( adrenergic antagonist) and D-tubocurarine (nicotinic antagonist) were dissolved in sterile water. MDL 72222 ( antagonist) was dissolved in DMSO.
3.
RESULTS
Exogenous administration of DA in doses consistently produced dose-dependent inhibition of CSN chemoafferent activity while in the high dose range _ DA injections caused a dose-dependent burst of CSN activity that was followed by inhibition (Fig. 1). In 20 out of 25 fibers at a burst was elicited at a mean maximum discharge frequency of 39.5 Hz (control = 2.3 Hz) with a mean burst duration of 0.6 sec. An excitatory burst was observed in 14 out of 14 fibers at . _ _ DA with a mean maximum discharge frequency of 64.6 Hz (control = 2.4 Hz) and a burst duration lasting 0.9 sec. This excitatory effect was not blocked by selective DA or receptor antagonists or haloperidol (Table 1). Nor was it prevented by or -adrenergic antagonists (Table 1). However, in 3 out of 3 goats the DA-induced excitation was blocked by the receptor antagonist MDL72222. This agent also blocked or attenuated the excitatory burst induced by 5-HT (0.1and the excitatory burst induced by the receptor agonist phenylbiguanide We have also found that Dtubocurarine blocks the DA-induced, but not the 5-HT-induced, burst of excitation.
584
585
4.
DISCUSSION
The main findings of the present study are as follows: 1) Intracarotid bolus injections of DA cause dosedependent inhibition of CSN chemoafferent activity, 2) DA receptor blockade significantly attenuates the inhibitory effects of DA administration, 3) Intracarotid bolus injections of DA cause a dose-dependent burst of excitation of CB chemoafferent activity that is followed by inhibition, 4) DA receptor antagonists do not block DA-induced CB excitation. However, all of these agents increase basal chemoafferent discharge frequency and 5) The excitatory burst produced by exogenous DA administration can be blocked by the receptor antagonist MDL72222. Exogenous DA administration elicits both excitatory and inhibitory effects on CB chemosensory activity in the goat. The inhibitory action of DA on goat CB chemoreceptors is entirely consistent with findings in other animal species and with the depressant effects of DA on ventilation in animals and humans (Bisgard and Neubauer 1995; Gonzalez et al. 1994). Consistent with previous studies (Zapata and Torrealba 1984; Janssen et al. 1998) the inhibitory effect of DA was substantially attenuated following DA blockade with domperidone. The transient excitation of carotid chemosensory activity observed following high dose DA administration in the goat is reminiscent of previous observations in the dog (Bisgard et al. 1979). Excitatory effects of DA on ventilation have been described in dogs (Black et al. 1972) and humans (Welsh et al. 1978) and in the cat CB in vitro (Zapata 1975). Furthermore, it has been shown that DA-receptor blockade with domperidone (Zapata and Torrealba 1984) or other DA
586
antagonists (Zapata 1975; Llados and Zapata 1978; Okajima and Nishi 1981) reverses DA-induced inhibition to excitation. These studies have led to the suggestion that there may be low-affinity excitatory receptors for DA in the CB (Llados and Zapata 1978; Gonzalez et al 1994). We hypothesized that if the DA-induced excitatory burst of CB chemoafferent activity could be blocked by selective receptor antagonist(s) this finding would support the view that there are excitatory receptors for DA in the CB. The failure of dopaminergic antagonists to diminish DA-induced excitation does not support the presence of excitatory DA receptors in the CB of the goat. However, the present data suggest that the DA-induced excitation in the goat CB is mediated by receptors. This observation is compatible with findings in other tissues that DA can be an agonist at receptors (Neijt et al. 1986). Similar to previous observations in the dog (Bisgard et al. 1979) the DA-induced excitation was also blocked by D-tubocurarine. Though this is suggestive of an action at nicotinic acetylcholine receptors it may also reflect an action at receptors since D-tubocurarine has been shown to be an antagonist at receptors (Mair et al. 1998).
5.
CONCLUSION
Dopaminergic excitation in goat CB may be mediated by receptor stimulation. The functional significance of this observation remains to be tested.
ACKNOWLEDGEMENTS We thank Gordon Johnson for excellent technical assistance. This work was supported by NIH Grants HL15473, HL07654 and HL10069.
REFERENCES Bisgard, G.E., Janssen, P.L., and Dwinell, M.R., 1997, Excitatory and inhibitory effects of dopamine in the carotid body of goats (Abstract). Am. J. Respir. Crit. Care Med. 155: A297. Bisgard, G.E., Mitchell, R.A., and Herbert, D.A., 1979, Effects of dopamine, norepinephrine and 5-hydroxytryptamine on the carotid body of the dog. Respir. Physiol. 37:61 -80.
587
Bisgard, G.E., and Neubauer, J.A., 1995, Peripheral and central effects of hypoxia on control of ventilation. In Regulation of Breathing (J. Dempsey and A. Pack, eds.), Second Edition, Vol. 79, Dekker, New York, pp. 616-668.
Black, A.M.S., Comroe, Jr., J.H., and Jacobs, L., 1972, Species difference in carotid body response of cat and dog to dopamine and serotonin. Am. J. Physiol. 223: 1097-1102. Cardenas, H., and Zapata, P., 1981, Dopamine-induced ventilatory depression in the rat, mediated by carotid nerve afferents. Neurosci. Lett. 24: 29-33. Docherty, R.J., and McQueen, D.S., 1979, The effects of acetylcholine and dopamine on carotid chemosensory activity in the rabbit. J. Physiol. (Lond.) 288: 411-423. Engwall, M.J.A., Olson, Jr., E.B., and Bisgard, G.E., 1989, Carotid body amine level in goats exposed to hypoxia or hypercapnia. Neurosci. Lett. 107: 221-226. Gonzalez,, C., Almaraz, L., Obeso, A., and Rigual, R., 1994, Carotid body chemoreceptors: from natural stimuli to sensory discharges. Physiol. Rev. 74: 829-898. Janssen, P.L., O’Halloran, K.D., Pizarro, J., Dwinell, M.R., and Bisgard, G.E., 1998, Carotid body dopaminergic mechanisms are functional after acclimatization to hypoxia in goats. Respir. Physiol. 111:25-32. Kressin, N.A., Nielsen, A.M., Laravuso, R., and Bisgard, G.E., 1986, Domperidone-induced potentiation of ventilatory responses in awake goats. Respir. Physiol 65: 169-180.
Llados, F., and Zapata, P., 1978, Effects of dopamine analogues and antagonists on carotid body chemosensors in situ. J. Physiol. (Lond.) 274: 487-499. Mair, I.D., Lambert, J.J., Yang, J., Dempster, J., and Peters, J.A., 1998, Pharmacological characterization of rat 5-hydroxytryptamine type 3 receptor subunit (r5-HT3A(b)) expressed in Xenopus laevis oocytes. Br. J. Pharmacol. 124: 1667-1674.
Neijt, H.C., Viverberg, H.P., Van den Bercken, J., 1986, The dopamine response in mouse
neuroblastoma cells is mediated by serotonin
receptors. Eur. J Pharmacol. 127:
271-274. Nishino, T., and Lahiri, S., 1981, Effects of dopamine on chemoreflexes in breathing. J. Appl. Physiol. 50: 892-897.
O’Halloran, K.D., Janssen, P.L., and Bisgard, G.E., 1998, Dopaminergic modulation of respiratory motor output in peripherally chemodenervated goats. J. Appl. Physiol. 85: 946-954. Okajima, Y., and Nishi, K., 1981, Analysis of inhibitory and excitatory actions of dopamine
on chemoreceptor discharges of the carotid body of cats in vivo. Jpn. J. Physiol. 31: 695704. Welsh, M.J., Heistad, D.D., and Abboud, F.M., 1978, Depression of ventilation by dopamine in man. J. Clin. Invest. 61: 708-713. Zapata, P., 1975, Effects of dopamine on carotid chemo- and baroreceptors in vitro. J. Physiol. (Lond.) 244: 235-251.
Zapata, P., and Torrealba, F., 1984, Blockade of dopamine-induced chemosensory inhibition by domperidone. Neurosci. Lett. 51: 359-364. Zapata, P., and Zuazo, A., 1980, Respiratory effects of dopamine-induced inhibition of chemosensory inflow. Respir. Physiol. 40: 79-92.
588
AUGMENTATION OF CALCIUM CURRENT BY HYPOXIA IN CAROTID BODY GLOMUS CELLS
B.A. Summers, J.L. Overholt, and N.R. Prabhakar Department of Physiology and Biophysics; School of Medicine: Case Western Reserve University; Cleveland, Ohio 44106; USA
Abstract:
Several lines of evidence indicate that transduction of the hypoxic stimulus at
the carotid body involves an increase in cytosohc via activation of voltage-gated channels in the glomus cells. However, reported responses to hypoxia include either no effect on or i n h i b i t i o n of
current in
glomus cells. The apparent discrepancy between the effects of hypoxia on and
channel activity prompted us to re-examine the effects of low
oxygen on currents in glomus cells. Experiments were performed on freshly dissociated glomus cells from rabbit carotid bodies. channel activity was monitored using the whole-cell configuration of the patch clamp
technique with
as the charge carrier.
Hypoxia
augmented the current by 24% (at 0 mV). This augmentation was seen in a but not in a HEPES buffered extracellular solution. However, when the extracellular of a HEPES buffered solution is lowered from 7.4 to 7.0, then the current in glomus cells is augmented by hypoxia by 20%. Nisoldipine, an L-type channel blocker prevented augmentation of the current by hypoxia. On the other hand, an N- and Ptype channel blocker M V I I C ) did not prevent the augmentation of the current by hypoxia. Protein kinase C (PKC) inhibitors, staurosporine (100 n M ) and bisindolylmaleimide prevented augmentation by hypoxia. Okadaic acid (100 nM), an i n h i b i t o r of
serine/threonine phosphatases also prevented augmentation of
current by
hypoxia; whereas, norokadaone, an inactive analog of okadaic acid, had no
effect. These results suggest that hypoxia augments type
current through L-
channels via a PKC and/or phosphatase-sensitive pathways.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
589
1.
INTRODUCTION
The carotid bodies are the principal sensory organs that detect changes in arterial oxygen. Currently, it is believed that glomus cells, which are in synaptic apposition with sensory nerve endings, are the initial sites of sensory transduction. Several lines of evidence indicate that the transduction mechanism(s) for hypoxia involves a membrane depolarization, promoting influx through voltage-gated channels, leading to a rise in
cytosolic , and subsequent release of neurotransmitter(s). It is well established that cytosolic increases in response to hypoxia (Biscoe and Duchen 1990; Urena et al. 1994, Bright et al. 1996), and that entry through voltage-gated channels in glomus cells is important for transduction of the hypoxic stimulus at the carotid body. Therefore, it is of considerable importance to understand whether and how hypoxia regulates channel activity in glomus cells. However, several investigators have reported that hypoxia has either no effect on (Lopez-Barneo et al. 1988) or inhibits (Montoro et al. 1996) current in glomus cells in a HEPES buffered solution. Various investigators have reported that bicarbonate significantly improves the response of the in vitro carotid body preparation to hypoxia when compared to responses in HEPES (Iturriaga and Lahiri 1991; Shirahata and Fitzgerald 1991). The apparent discrepancy between the effects of hypoxia on channel activity prompted us to re-examine the effects of low oxygen on currents in glomus cells under bicarbonate buffered conditions. Our hypothesis is that hypoxia may affect one or more high voltage-activated channel types in glomus cells using a buffered extracellular solution (a physiological, relevant buffer). To test this possibility, in this study, we monitored the effects of hypoxia on the macroscopic current in glomus cells isolated from rabbit carotid bodies.
2.
METHODS
2.1
General Procedures
Experiments were performed on glomus cells freshly isolated from the carotid bodies of adult rabbits euthanized with Individual glomus cells were dissociated enzymatically using trypsin and collagenase as described previously (Overholt and Prabhakar 1997). Cells were maintained at 37°C in a incubator and were used within 36 hours. All experiments were
590
performed at room temperature. Glomus cells were identified using electrophysiological characterization as described previously (Overholt and Prabhakar 1997; Summers et al. 1999).
2.2
Isolation of
Current
current was monitored using the whole-cell configuration of the patch clamp technique (Hamill et al. 1981). Pipettes were made from borosilicate glass capillary tubing and had resistances of Currents were recorded using an Axopatch 200B voltage clamp amplifier, filtered at 5 kHz and sampled at a frequency of 28.6 kHz using an IBM compatible computer with a Digidata 1200 interface and pCLAMP software (Axon Instruments). Currents were not leak subtracted. Current-voltage (I-V) relations were elicited from a holding potential of using 25 ms steps (5 seconds between steps) to test potentials over a range of to in 10 mV increments. Current at each potential was measured as the average over a 2.5 ms span at the end of the 25 ms step. current was isolated by using and intra and extracellular solutions. The intracellular solution had the following composition (mM): CsCl (115), TEA-C1 (20), MgATP (5), TrisGTP (0.2), EGTA (5), phosphocreatine (10), N-2-hydroxyethylpiperazine-N’-2-ethanesulfomc acid (HEPES, 5), and the pH was adjusted to 7.2 with CsOH. The HEPES buffered extracellular solution had an osmolarity of 300 mOs and contained (mM): N-methyl-D-glucamine chloride (NMGC1, 140), CsCl (5.4), (10), HEPES (10) glucose (11), and the pH was adjusted to 7.4 with CsOH. The buffered extracellular solution had an osmolarity of 296 mOs and contained (mM): NMGC1 (120), CsCl (4.8), glucose (11), and the pH was adjusted to 7.4 by continuously bubbling with 5% The extracellular solution was changed using a fast-flow apparatus consisting of a linear array of borosilicate glass tubes (Overholt and Prabhakar 1997). In these experiments, we used as the charge carrier. Rundown of current and the effects of drugs were monitored using a wash protocol (25 ms step to 0 mV, 10 seconds between steps). The effects of drug agents were compensated for rundown using a linear regression of the current decrease during the wash protocol in the absence of test compounds. Cells in which rundown was excessive or did not appear linear were excluded from the analysis. For comparison of I-V relations, current at each potential was normalized to the maximum value recorded during the control I-V relation in individual cells (usually 0 mV).
591
2.3
Solutions
buffered extracellular solutions were made normoxic or hypoxic by continuously bubbling the solution with either and respectively. HEPES buffered extracellular solutions were made normoxic or hypoxic by continuously bubbling the solution with either respectively. The in the superfusion medium was routinely monitored with a blood gas analyzer (Laboratory Instruments) and found to be between 35-40 mmHg for hypoxic solutions and 148 mmHg for normoxic solutions.
2.4
Data Analysis
All values are presented as mean standard error. Statistical significance was determined by a paired t-test or a one-way analysis of variance (ANOVA), with Tukey’s post hoc test where appropriate. P values less than 0.05 were considered significant.
3.
RESULTS
3.1
Comparison of the Effects of Hypoxia on the Current in a versus a HEPES Buffered Extracellular Solution
Figure 1A compares the effect of hypoxia on glomus cell current in a versus a HEPES buffered extracellular solution. It is obvious from these traces that hypoxia augmented the amplitude of the current only in the presence of bicarbonate. Figure 1B shows the average, percent augmentation of the current by hypoxia at 0 mV in the presence of bicarbonate versus HEPES. On average, the current was significantly augmented by hypoxia when using a buffered extracellular solution (24% at 0 mV; paired-t test), but not when using a HEPES buffered extracellular solution (2% at 0 mV; paired-t test). These experiments demonstrate that, under these conditions, hypoxia augments current only when using a buffered extracellular solution. It has been reported that switching from a HEPES to a bicarbonate buffered extracellular solution causes intracellular acidification in glomus cells (Buckler et al. 1991). Therefore, we tested if the more alkaline found in glomus cells bathed in a HEPES buffered extracellular solution could mask the effects of hypoxia on the current. To test this possibility, we adjusted the pH of the HEPES buffered extracellular solution to 7.0 using 1 N HCL. At pH 7.0 in a HEPES buffered external solution, hypoxia significantly augmented the current by 20% at 0 mV 592
593
paired-t test), which is similar to the augmentation seen in a bicarbonate buffered solution. The time course and the magnitude of the response also resembled that seen in a buffered external solution. These results thus demonstrate that hypoxia can augment current even in a HEPES buffered extracellular solution provided that the of that buffer is made more acidic.
3.2
Hypoxia-induced augmentation of the Current is prevented by an L-type Channel Antagonist
We have previously reported that current in rabbit glomus cells is conducted by four different types of voltage-dependent channels including L, P/Q, N and a resistant channel (Overholt and Prabhakar 1997). Therefore, we tested whether hypoxia affects a particular channel type. The effect of hypoxia on the current was tested in the presence of nisoldipine an L-type channel blocker. As expected, nisoldipine by itself blocked a portion of the basal current (28%). More importantly, hypoxia had no significant effect on the
current in the
presence of nisoldipine when compared to the augmentation in the absence
of nisoldipine. On the other hand, MVIIC, which blocks both N- and P- type currents did not prevent the augmentation of the current by hypoxia. These results suggest that hypoxia augments the current conducted by L-type, but not N- or P-type
3.3
channels.
Mechanism(s) of augmentation of the by Hypoxia
Current
Recent evidence indicates that hypoxia stimulates activity of phospholipase C in the carotid body implying the generation of inositol triphosphate and diacylglycerol, a natural activator of PKC (Pokorski and Stroznajder 1993). To test the possible involvement of PKC, we examined the effects of two PKC inhibitors, namely staurosporine (100 nM Stro) and bisindolylmaleimide on the current during hypoxia. In the presence of PKC inhibitors, hypoxia did not augment the current. Since BIM is a specific PKC inhibitor of isoforms of PKC, we tested if these isoforms are present and activated by hypoxia in glomus cells using indirect immunofluorescence. Our preliminary data indicate that immuno-reactivity was in the glomus cells and like immuno-reactivity was found exclusively in the vasculature. More importantly, hypoxia caused a translocation of from the cytosol to the
594
plasma membrane. These results indicate that is present in the glomus tissue and can be activated by hypoxia. We also tested if a phosphatase is involved in the hypoxia-induced augmentation of the current in glomus cells. We found that the serine/threonine phosphatase inhibitor, okadaic acid (100 nM Oka), prevented the augmentation of the current by hypoxia. Furthermore, 1norokadaone (100 nM Norok), an inactive analog of okadaic acid, had no effect on the hypoxia-induced augmentation of the current. These results suggest that hypoxia may augment current in glomus cells by activating a phosphatase.
4.
DISCUSSION
4.1
Hypoxia Responses in a buffered versus a HEPES buffered Extracellular Solution: Influence of pH
It can be seen from our results that hypoxia reversibly augments the current recorded in a buffered extracellular solution in glomus cells of rabbit carotid bodies. The onset of the effects were rapid, occurring within seconds after application of hypoxia and reversible. However, the present results are in disagreement with those reported by others who found inhibition of currents by hypoxia in rabbit glomus cells (Montoro et al. 1996). This discrepancy is not due to species-related differences because rabbit glomus cells were utilized in both studies. It is possible that the discrepancy between the two studies is due to the use of
different experimental conditions. For instance, previous studies applied hypoxia in a HEPES buffered extracellular solution, whereas we applied hypoxia in a buffered extracellular solution. Several studies have recently demonstrated that without tissues and cells respond differently, or even oppositely to those in the presence of (Thomas 1989; Shirahata and Fitzgerald 1991). For example, catecholamine secretion in the carotid body is considerably enhanced by the presence of bicarbonate as compared to bicarbonate-free solution for the same hypoxic stimulus (Paniesello and Donnelly 1998). Furthermore, several investigators have reported that the presence of significantly improved the response to hypoxia in the in vitro carotid body preparation as opposed to responses in HEPES (Iturriaga and Lahiri 1991; Shirahata and Fitzgerald 1991). influx through voltage-gated channels is necessary for chemotransduction at the carotid body. Therefore,
595
it is possible that augmentation of the
current by hypoxia in bicarbonate
solutions plays a role in the improved responsiveness of the glomus cells. On the other hand, we found no effect of hypoxia on current when using a HEPES buffered extracellular solution at pH 7.4. These results are consistent with those reported by other investigators who found no effect of hypoxia on the current in a HEPES buffered medium (Lopez-Barneo et al. 1988; Hescheler et al. 1989; Peers 1990). However, Montoro and colleagues reported that hypoxia inhibited current in glomus cells (1996). Why is there no inhibitory effect by hypoxia on the current in a HEPES buffered extracellular solution? It is possible that the degree of hypoxia applied to the glomus cells could account for the difference. In this study, we applied a moderate level of hypoxia (40 mmHg); whereas Montoro and colleagues applied a more severe level of hypoxia (10-20
mmHg, 1996). In addition, it has been reported that the intracellular pH is significantly higher in HEPES buffered media than in a physiological bicarbonate buffered media (Thomas 1989; Buckler et al. 1991). Therefore, it is possible that the lack of an effect of hypoxia in HEPES buffered extracellular solution could be due to a secondary effect of HEPES on pH. This difference in pH, may affect channel gating as suggested for L- and Ntype channels (Tombaugh and Somjen 1997). This idea is supported by our finding that hypoxia is able to augment current in a more acidic HEPES buffered extracellular solution This augmentation by hypoxia of the current is similar to that seen in the presence of bicarbonate. These observations indicate that HEPES itself does not influence the effect of hypoxia on the current in glomus cells. Rather, it is a secondary effect of HEPES on in glomus cells that can influence channel activity, and thus mask the effect of hypoxia on the current in glomus cells.
4.2
Hypoxia augmentation is Primarily confined to Ltype Channels It is evident from recent studies that rabbit glomus cells express
multiple types of
channels (Overholt and Prabhakar 1997). Our data
indicates that the effects of hypoxia are confined to L-type channels in glomus cells. These results are similar to those reported for L-type current in smooth muscle (Franco-Obregon and Lopez-Barneo 1996). Most importantly, the L-type current has been shown to be involved in hypoxiainduced neurotransmitter release from glomus cells (Obeso et al. 1992). Therefore, these data suggest that augmentation of the L-type current in
596
glomus cells by hypoxia may play a functional role in neurotransmitter release during a hypoxic stimulus at the carotid body.
4.3
PKC and Serine/threonine Phosphatase Pathways Both PKC and serine/threonine protein phosphatases have been shown to
be targets for redox modulation in a variety of cell types (Kass et al. 1989; Gopalakrishna and Anderson 1989; Nemani et al. 1993). Based on these observations, we performed several experiments to test whether PKC and/or
a serine/threonine protein phosphatase are involved in the hypoxia-mediated augmentation of the current in glomus cells. Our results suggest that a PKC/phosphatase-sensitive pathway may be involved in the hypoxiainduced augmentation of the current. Since, PKC inhibitors (staurosporme and BIM), prevented the augmentation of the current by hypoxia, and is present in glomus cells and is translocated from the cytosol to the plasma membrane during hypoxia. Additionally, a protein phosphatase inhibitor (okadaic acid) prevented the hypoxia response on the current. However, the isozymes of serine/threonine protein phosphatases present in glomus cells are not known. Therefore, a closer characterization of what isoforms of serine/threonine phosphatases might be activated during hypoxia will need further examination. Further studies, however, are needed to define how hypoxia modulates the phosphorylation and/or dephosphorylation states of the channels in glomus cells.
5.
SUMMARY
In summary, previous studies have shown that increases in response to hypoxia and this response depends upon entry through voltage-activated channels. In this study, we re-examined the effects of low oxygen on the current using a more physiological condition Our results demonstrate that hypoxia augments current when using a buffered extracellular solution and this
augmentation is primarily confined to L-type PKC/phosphatase-sensitive pathway.
current via a
ACKNOWLEDGMENTS This work was supported by a National Institute of Health grant HL25830 and B.A. Summers was supported by the training grant T32HL07653.
597
REFERENCES Biscoe, T.J. and Duchen, M.R. Responses of type I cells dissociated from the rabbit carotid body to hypoxia. J Phyxiol. Lond. 428:39-59, 1990.
Bright, G.R., Agani, F.H., Haque, U., Overholt, J.L., and Prabhakar, N.R. Heterogeneity in cytosolic calcium responses to hypoxia in carotid body cells. Brain Research 706:297302, 1996.
Buckler, K.J., Vaughan-Jones, R.D., Peers, C., and Nye, P.C.G. Intracellular pH and its regulation in isolated type I carotid body cells of the neonatal rat. Journal of Physiology 436:107-129, 1991.
Franco-Obregon, A. and Lopez-Barneo, J. Differential oxygen sensitivity of calcium channels in rabbit smooth muscle cells of conduit and resistance pulmonary arteries. Journal of Physiology 491:511-518, 1996. Gopalakrishna, R. and Anderson, W.B and phospholipid-independent activation of protein kinase C by selective oxidative modification of the regulatory domain. Proc. Natl. Acad. Sci. U.S.A. 86:6758-6762, 1989. Hammil, O.P., Marty, A., Neher, E., Sakmann, B., and Sigworth, F.J. Improved patch-clamp
techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch 391:85-100,1981.
Hescheler, J., Delpiano, M.A., Acker, H., and Pietruschka, F. Ionic currents in type I cells of the rabbit carotid body measured by voltage-clamp experiments and the effect of hypoxia. Brain Res. 486: 79-88, 1989.
Iturriaga, R. and Lahiri, S. Carotid body chemoreception in the absence and presence of HCO3-, Brain Res. 568: 253-260, 1991.
Kass, G.E.N., Duddy, S.K., and Orrenius, S. Activation of hepatocyte protein kinase C by redox-cycling quinones. Biochem J. 260:499-507, 1989.
Lopez-Barneo, J , Lopez-Lopez, J.R., Urena, J., and Gonzalez, C. Chemotransduction in the carotid body: current modulated by in type 1 chemoreceptor cells. Science 241: 580-582, 1988. Montoro, R.J., Urena, J., Fernandez.-Chacon, R., Alvarez de Toledo, G., and Lopez-Barneo, J.
Oxygen sensing by ion channels and chemotransduction in single glomus cells. J. Gen.Physiol.107:133-143, 1996.
Nemani, R. and Lee, E.Y.C. Reactivity of sulfhydryl groups of the catalytic subunits of rabbit skeletal muscle protein phosphatases 1 and 2A. Arch. Biochem. Biopliys. 300:24-29, 1993.
Obeso, A., Rocher, A., Fidone, S., and Gonzalez, C. The role of dihydropyridine-sensitive channels in stimulus- evoked catecholamine release from chemoreceptor cells of the carotid body. Neuroscience 47:463-472, 1992.
Overholt, J.L. and Prabhakar, N.R.
current in rabbit carotid body glomus cells is
conducted by m u l t i p l e types of high-voltage-activated
channels.
Journal of
Neurop/iysioloxy 78:2467-2474, 1997.
Panisello, J . M . and Donnelly, D.F. Chemotransduction by carotid body chemoreceptors is dependent on bicarbonate currents. Respir. Physiol. 112:265-281, 1998.
Peers, C. Hypoxic suppression of the
currents in type I carotid body cells: selective effect on
current. Neurosci. Lett. 119: 253-256, 1990.
Pokorski, M. and Strosznajder, R.
of phospholipase C in the cat carotid
body. Adv. Exp. Med. Biol. 337:191-195, 1993. Shirahata, M. and Fitzgerald, R.S. The presence of is essential for hypoxic chemotransduction in the in vivo perfused carotid body. Brain Res. 545: 297-300, 1991.
598
Summers, B.A., Overholt, J.L., and Prabhakar, N.R. Nitric oxide inhibits L-type current in glomus cells of the rabbit carotid body via a cGMP-independcnt mechanism. Journal of Neurophysiology 81:1449-1457, 1999. Thomas, R.C. Bicarbonate and response. Nature 337: 601, 1989. Tombaugh, G.C. and Somjen, G.G. Differential sensitivity to intracellular pH among h i g h and low- threshold currents in isolated rat CA1 neurons. Journal of Neurophysiology 77:639-653,1997.
Urena, J., Fcrnandex Chacon, R., Benot, A.R., Alvarez de Toledo, G.A., and Lopez Barneo, J. Hypoxia induces voltage-dependent entry and quantal dopamine secretion in carotid body glomus cells. Proc. Natl. Acad. Sci. U.S.A. 91:10208-10211, 1994.
599
This page intentionally left blank.
IN DEVELOPING RAT ADRENAL CHROMAFFIN CELLS Roger J. Thompson and Colin A. Nurse Department of Biology, McMaster University, Hamilton, Ontario, Canada L8S 4KI
1.
INTRODUCTION
In the perinatal period, adrenomedullary chromaffm cells (AMC) mediate a rise in plasma catecholamine (CA) that is vital for the animal’s ability to survive stressors, eg. hypoxia (Slotkin and Seidler, 1988). Seidler and Slotkin (1985) observed that CA levels in the adrenal medulla decreased following exposure of the neonatal rat to hypoxia and occurred at a time when sympathetic innervation to the medulla was largely immature. This CA secretion was independent of the nervous system since it persisted in the presence of blockers of nicotinic acetylcholine receptors (nAChR). However, following maturation of the sympathetic innervation to the medulla after birth in the rat), the hypoxia-induced CA secretion becomes sensitive to nAChR blockers, suggesting it was mediated via the nervous system. Furthermore, surgical denervation of the medulla in mature rats caused a return of the ‘non-neurogenic’ hypoxia-sensing response by AMC (Seidler and Slotkin, 1986). These results suggest that rat AMC may sense hypoxia directly in the neonatal period, but this mechanism is lost postnatally, following maturation of the sympathetic innervation. In order to test directly whether AMC express in an agedependent manner, we carried out a series of experiments on isolated cells in short-term culture. In particular, we investigated whether AMC contained sensitive membrane properties analogous to those in the well-characterized receptors (type 1 cells) in the carotid body, and whether acute hypoxia stimulated CA secretion as detected by HPLC, or by carbon fibre amperometry
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
601
(see Thompson et al., 1997; Thompson and Nurse, 1998). In the type 1 cell, hypoxia causes a reversible suppression of outward current, mediated by channels in the rat (Peers, 1990) and delayed rectifier-type channels in the rabbit (Lopez-Lopez et al., 1989). In addition, hypoxia induces membrane depolarization which appears to involve inhibition of a voltage-insensitive, background conductance in rat type 1 cells (Buckler, 1997). Though these membrane properties are thought to promote entry following depolarization, and neurosecretion from type 1 cells (Lopez-Barneo, 1996), details of the transduction steps are still controversial (Lahiri, 1994; Buckler and Vaughan-Jones, 1998). Therefore, it was of interest to determine if similar membrane mechanisms mediate the hypoxia-induced CA secretion from the neonatal rat adrenal medulla, and whether such mechanisms are developmentally regulated.
2.
EXPERIMENTAL PROCEDURES
2.1
Cultures
Primary cultures enriched in rat neonatal, i.e. postnatal (P) day 1-2 (P1-P2) or juvenile (P14-P21) AMC were prepared as described previously (Thompson et al., 1997). For cultures of embryonic (E17-E18) AMC, timed pregnant Wistar rats were anaesthetized by Fluothane inhalation and killed by cervical dislocation. When allowed to reach term, pups were usually born on Embryos were quickly removed from the abdomen and placed in L-15 medium, containing 30% glucose and 1% penicillin/streptomycin. Adrenal glands were dissected from the embryo and cultures enriched in AMC were prepared as described previously for postnatal pups (Thompson et al., 1997). Cultures were maintained for 1-2 days before use. Data were compared using either a paired or independent Students t-test, with level of significance set at All data are presented as mean s.e.m.
2.2
Electrophysiology
All voltage-clamp recordings were performed using the nystatin perforatedpatch technique as previously described (Thompson and Nurse, 1998). Junction potentials were cancelled at the beginning of each experiment. The extracellular recording solution contained MgCl, 2; glucose, 10; HEPES, 10 at pH 7.4. The pipette solution contained (mM): potassium gluconate, 95; KC1, 35; NaCl, 5; CaCl, 2; HEPES, 10 at pH
602
7.2. Recordings were obtained at room temperature using an Axopatch-lD patch clamp amplifier equipped with a feedback resistor,Digidata 1200 A-D converter and pClamp software, version 6.0.3 (Axon Instruments). Unless indicated otherwise, anoxic stimuli were used and prepared by equilibrating the perfusate with 100% and then adding 0.5 mM Na dithionite. Solutions were perfused under gravity and simultaneously removed by suction from the recording chamber
2.3
Carbon fibre amperometry
Catecholamine secretion was monitored using single carbon-fibre microelectrodes, prepared according to a modification of the procedure of Zhou and Misler (1995). Briefly, a single carbon-fibre was inserted into a glass capillary tube (type 7052, Corning) and pulled on a horizontal microelectrode puller. The fibre was trimmed, sealed with epoxylite resin and heat cured overnight at 100 °C. Electrical connection between the fibre and silver wire in the electrode holder was obtained with the aid of conductive silver paint. The electrode was connected to a standard patch-clamp headstage and polarized to a potential of 600 mV, i.e, above the oxidation potential for catecholamines. After stabilization of the baseline the electrode was positioned near a small cluster of AMC. Extracellular solutions were the same as those described above, except that Na dithionite was omitted from the hypoxic solution since it interfered with the electrochemical signal. The of the hypoxic solution (in the absence of dithionite) ranged from 0-5 torr in the recording chamber as measured with a dark-style
3.
AGE-DEPENDENCE OF OXYGEN-SENSING MECHANISMS IN RAT CHROMAFFIN CELLS Using the perforated-patch configuration of whole-cell recording, the
anoxic sensitivity of rat adrenal chromaffin cells (AMC) was tested. Figure 1A shows the effects of anoxia on outward currents recorded from AMC elicited by a voltage step to from a holding potential of
Anoxia reduced outward current density in P1-2 AMC from a control (normoxic) value of see also Thompson and Nurse, 1998). After reperfusion with a normoxic solution, outward current density recovered to a value not significantly different from the initial control.
603
604
Anoxia also reduced outward current density in 9 of 11 AMC isolated from embryonic (E17-18) pups; for a similar voltage step to outward current density was in control (normoxic) solution, pA/pF during anoxia following recovery in normoxia. These results suggest that currents are present in the majority of AMC during late fetal and early postnatal life. Further, as illustrated in the current-voltage plots (Fig 1B), the sensitivity of outward currents to anoxia occurs over a broad voltage range In contrast to the above results on embryos and neonates, anoxia had no significant effect on outward currents in AMC isolated from juvenile (P14-21) rats (see Thompson et al., 1997). A typical example from a P14 AMC is shown in Fig 1A (right traces) for a voltage step to the corresponding I-V relationship for this cell before, during, and after anoxia is shown in Fig 1B (right). An additional index of hypoxic sensitivity was obtained in current clamp recordings of membrane potential. Typically, anoxia evoked a membrane depolarization of 10-15 mV in neonatal AMC, but had no significant effect on the resting potential of juvenile AMC (Thompson et al., 1997). Preliminary studies on E17-18 AMC suggest that anoxia also evokes a depolarization, or receptor potential similar to neonatal cells. In two El7-18 AMC tested, anoxia caused a reversible depolarization of These results are consistent with the notion that anoxic sensitivity in rat chromaffin cells is present before birth, but disappears postnatally as the sympathetic innervation matures.
4.
COMPARISON OF OUTWARD CURRENT DENSITY IN EMBRYONIC AND NEONATAL AMC
As discussed above, the normoxic outward current density, calculated for a voltage step from to was significantly smaller in El7-18 AMC compared to neonatal (P1-2) AMC It appeared this difference was not simply related to differences in cell size, since measurements of input capacitance (which is proportional to surface area) indicated no significant difference between the two age groups; El7-18 AMC had a mean input capacitance of compared to 5.8 for neonatal AMC. These data suggest that fewer active voltage-dependent channels are present in E17-18 AMC relative to P1-2 AMC. Exposure of neonatal or adult AMC to a free bathing solution results in a reduction of outward current to 25-40% of control, indicating that a major component of the outward current is dependent (Neely and Lingle, 1992;
605
Thompson and Nurse, 1998). Preliminary studies on El7-18 AMC suggest that functional channels are absent or weakly expressed, since in bathing solution outward current density was not significantly affected in 6 of 9 cells tested. Therefore it is possible that the reduced outward current density seen in K17-18 AMC is due to a low density of functional channels, though this point requires validation with the use of more specific blockers of
5.
AMPEROMETRIC DETERMINATION OF CATECHOLAMINE RELEASE FROM NEONATAL AMC
We previously reported that catecholamine (CA) release, as monitored by HPLC, was enhanced by hypoxia in a dose-dependent manner in neonatal but not juvenile AMC (Thompson et al., 1997). This hypoxia-induced CA release from chromaffin cells can also be monitored in real time using carbon fibre microelectrodes (Mojet et al., 1998). Fig 2A shows an amperometric recording of CA release from a small cluster of neonatal AMC under basal (normoxic) conditions (top trace), during exposure to hypoxia (middle trace), and after recovery in normoxia (lower trace). Note that the CA spike frequency and amplitude, as well as the baseline current, are reversibly increased following
606
exposure to severe hypoxia Similar results were obtained in 5 of 8 cells treated in this way. Though it is evident from Fig 2A that CA spike frequency was augmented during hypoxia, an independent estimate of secretion can be obtained from the integrated area under the amperometric spike records (see LopezBarneo, 1996). Fig 2B illustrates that hypoxia dramatically increases over a 60 second interval, and that the effects are reversible (data obtained from the cell in Fig 2A).
6.
DISCUSSION
In this report, we contrasted the effects of severe hypoxia or anoxia on rat adrenal chromaffin cells (AMC) isolated at three different ages. While anoxia suppressed currents and depolarized both neonatal and embryonic AMC, it was ineffective when applied to juvenile AMC (see however, Inoue et al., 1998; Mochizuki-Oda et al., 1997). In late embryonic (El7-18) AMC, which appear to lack a mature compliment of channels, hypoxic suppression of outward current may be mediated mainly through closure of delayed rectifier type channels. Preliminary experiments on El7-18 AMC suggest that currents, which represent one of at least three currents in neonatal cells (Thompson and Nurse, 1998), are either absent or present at low density. Thus, even though most El7-18 AMC are sensitive to hypoxia, the full compliment of sensitive currents appears to develop over the last 4-5 days of gestation. In a recent study, hypoxic sensitivity was also observed in AMC isolated from fetal sheep, suggesting that the property is not species dependent (Rychov et al., 1999). We previously proposed that a glibenclamide-sensitive current was activated by anoxia in neonatal AMC(Thompson and Nurse, 1998; see however, Mochizuki-Oda et al., 1997), but it remains to be determined whether this mechanism is also present in El718 AMC.
7.
PHYSIOLOGICAL IMPLICATIONS OF SENSING MECHANISMS IN AMC
Catecholamine release from rat adrenal chromaffin cells (AMC) during periods of perinatal hypoxic stress is thought to be essential for proper transition to extrauterine life. This circulating CA acts on in the lung to cause fluid absorption and surfactant secretion, and on a receptors to slow heart rate (Slotkin and Seidler, 1988). Recent studies have demonstrated that rat chromaffin cells transiently express mechanisms for sensing tension in the perinatal period (Thompson and Nurse, 1998; Mojet et al., 1997). In the
607
present report, we obtained preliminary evidence for at least partial expression of mechanisms in AMC at late fetal stages (El7-18), when channel expression is still developing.
ACKNOWLEDGEMENTS This work was supported b the Natural Science and Engineering Research Council of Canada (NSERC) and the Heart and Stroke Foundation of Ontario.
REFERENCES Buckler, K.J. (1997). A novel oxygen-sensitive potassium current in rat carotid body type 1 cells. J Physiol. 450:33-61.
Buckler, K . J . and Vaughan-Jones, R.D. (1998). Effects of mitochondrial uncouplers on intracellular calcium, pH and membrane potential in rat carotid body type 1 cells. J. Physiol. 513:819-833.
Inoue, M. Fujishiro, N, and Imanaga, I. (1998). Hypoxia and cyanide induce depolarization and catccholamme release in dispersed guinea-pig chromaffin cells. J. Pliysiol. 507:807-
818.
Lahiri, S. (1994). Carotid body chemoreception: mechanisms and dynamic protection against apnoea. Biol. Neonate 65:134-139.
Lagercrantz, H. and Slotkin, T.A. (1996). The stress of being born. Sci. Amer. 254:100-107. Lopez.-Barneo, J. (1996). Oxygen-sensing by ion channels and regulation of cellular functions. TINS 19:435-440.
Lopez.-Lopez, J., Gonzalez., C., Urena, J. and Lopez-Barneo, J. (1989). Low selectively i n h i b i t s K channel activity in chemorcceptor cells of the mammalian carotid body. J. Gen. Physiol. 93:1001-1015.
Mochizuki-Oda, N., Takeuchi, Y., Matsumura, K., Oosawa, Y., and Watanabe, Y. (1997). Hypoxia-induced catecholamine release and intracellular
increase via suppression of
K + channels in cultured rat adrenal chromaffin cells. J. Neurochem. 69:377-387. Mojet, M.A., Mills, E., and Duchen, MR. (1997). Hypoxia-induced catecholamine secretion in isolated newborn rat adrenal chromaffin cells is mimicked by inhibition of mitochondrial respiration. J. Physiol. 504:175-189. Neely, A. and Lingle, C.J. (1992). Two components of calcium-activated potassium current in rat adrenal chromaffin cells. J. Physiol. 453:97-131.
Peers, C. (1990). Hypoxic suppression of -currents in type 1 carotid body cells: Selective effect on the -activated -current. Neurosci. Lett. 119:253-256. Rychov, G.Y., Adams, M.B., McMillen, I.C., and Roberts, M.L. (1999). Oxygen-sensing mechanisms are present in the chromaffin cells of the sheep adrenal medulla before birth.
J. Physiol 509: 887-893 Seidler, F.J., and Slotkin, T.A. (1985). Adrenomedullary function in the neonatal rat: responses to acute hypoxia. J. Physiol. 385:1-16. Seidler, F.J. and Slotkin, T.A. (1986). Ontogeny of adrenomedullary responses to hypoxia and hypoglycaemia: Role of splanchnic innervation. Brain. Res. Bull. 16:11-14.
608
Slotkin, T.A. and Seidler, F.J. (1988). Adrenomedullary catecholamine release in the fetus and newborn: secretory mechanisms and their role in stress and survival. J. Develop. Physiol. 10:1-16. Thompson, R.J., Jackson, A., and Nurse, C.A. (1997). Developmental loss of hypoxic chemosensitivity in rat adrenomedullary chromaffin cells. J. Physiol 498:503-510. Thompson, R.J. and Nurse, C.A. (1998) Anoxia differentially regulates multiple currents and depolarizes rat neonatal adrenal chromaffin cells. J. Physiol. 512:421-434. Zhou, Z. and Misler, S. (1995). Action potential-induced quantal secretion of catccholamines from rat adrenal chromaffin cells. J. Biol. Chem. 270:3498-3505.
609
This page intentionally left blank.
SENSING BY MODEL AIRWAY CHEMORECEPTORS Hypoxic inhibition of channels in HI46 cells 1,2 1
Ita O’Kelly, 2Chris Peers,and 1Paul J Kemp
Division of Physiology, School of Biomedical Sciences and Institute for Cardiovascular Research, Worsley Medical and Dental Building, University of Leeds, Leeds LS2 9JT, UK
1.
INTRODUCTION
The pulmonary circulation must respond rapidly to hypoxia in order to optimise the delivery of to metabolising tissues. It does this primarily by diverting blood to better-ventilated parts of the lung (ventilation-perfusion matching). Morphological and functional studies have established neuroepithelial bodies (NEBs) of the lung as key elements in this homeostatic process (see (Cutz, 1997) for recent review). Furthermore, their prominence in neonatal lungs (Cutz et al., 1984) and the association of pathological conditions such as apnoea of prematurity and sudden infant death syndrome with NEB cell hyperplasia (Gillan et al., 1989) strongly suggest that NEBs are involved in both the initiation of breathing at birth and cardiorespiratory control postnatally. NEB cells are discrete clusters of cells located throughout the airways (Cutz, 1997). They lie in contact with the airway lumen and are also in extremely close proximity to pulmonary capillaries (Lauweryns and Cokeleare, 1973; Sorokin and Hoyt, 1989). They evoke appropriate vascular responses by: a) initiating afferent information to the respiratory centres (Lauweryns and VanLommel, 1987) and; b) releasing peptides and amine modulators into the local pulmonary circulation in hypoxia
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
611
(Lauweryns and Cokeleare, 1973). There is compelling evidence to show they respond to airway hypoxia as opposed to hypoxaemia (Lauweryns et al., 1978), and therefore act in concert with carotid body/aortic arch chemoreceptors (which sense levels in arterial blood) and pulmonary smooth muscle cells (which possess intrinsic sensitivity (Weir and Archer, 1995)). Knowledge of the cellular and molecular mechanisms underlying hypoxic transduction by NEB cells is still extremely limited. However, there is a slowly accumulating body of evidence to suggest that there are major fundamental similarities between in NEB and carotid body cells (Youngson et al., 1993; Youngson et al., 1994). Thus, using NEB cells isolated from fetal rabbit lung, voltagegated channels have been characterised and a selective, reversible inhibition of a component of the current by acute hypoxia has been recently described (Youngson et al., 1993; Youngson et al., 1994). Although this work has recently been elegantly repeated in situ using lung slices (Fu et al., 1999), these
preparations are still inappropriate for molecular studies. Since our ultimate aims are to clone the channel and define rigorously the transduction pathway linking airway hypoxia to transmitter release, we reasoned that an immortalized cell line which mimics the known properties and responses of native NEB cells would first have to be established. Small cell lung carcinoma cells (SCLC) are likely to originate from the same population of committed pulmonary neuroendocrine precursor cells that give rise to NEB cells (Gazdar et al., 1988). SCLC and NEB cells share numerous features including the presence of 5-HT, and voltage-gated ion channels. (Pancrazio et al., 1989) suggesting that SCLC cells might represent a model for airway chemoreceptors. In the present study, therefore, we have characterised the electrophysiological properties of one SCLC cell line, NC1-H146, and investigated whether these cells might act as sensors in a manner comparable to acutely isolated NEB cells.
2.
METHODS
H-146 cells were maintained in RPM1 1640 culture medium (containing L-glutamine) supplemented with 10% fetal calf serum, 2%
612
sodium pyruvate and 2% penicillin/ and incubated at 37°C in a humidified atmosphere of 5%CO2/95% air. For patch-clamp studies, the standard pipette solution contained (in mM): 10 NaCl, 117 KC1, 2 10 N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid
(HEPES), 11 ethylene
N’-
tetraacetic acid (EGTA), Standard bath solution contained (in mM): 135 NaCl, 5 KC1, 1.2 10 D-glucose; pH 7.4. Solutions were made hypoxic, where appropriate, by bubbling with for at least 30 minutes. was measured (at the cell) using a polarized (-800 mV) carbon fibre electrode; under hypoxic conditions ranged from 15 to 20 mmHg for the experiments reported. Cells were allowed to adhere at 37°C for 1h to poly-L-lysine coated coverslips before experiments were carried out Pipettes had resisitances of To evoke ionic currents in H-146 cells, two voltage protocols were used: a) I-V step protocol: increments = 10 mV from –100 to +60 mV, step duration = 50 ms, b) Ramp protocol: In fast current-clamp solutions were the same as those used in the voltage-clamp. 3.
RESULTS
3.1
Characterization of whole-cell currents in H146 cells
Fig. 1A shows a representative family of whole-cell currents evoked in H146 cells by the I-V protocol. The currents had two main characteristics: in response to step depolarizations, rapidly activating, transient inward currents followed by sustained outward currents. The mean current-density versus voltage relationships for these two currents (Fig. 1B) shows that the inward currents were maximal at 0mV. Bath application of 1 tetrodotoxin (TTX) significantly reduced the inward currents by e.g. Fig. reduced inward currents by (e.g. Fig. . Thus, inward currents arose due to activation of voltage-gated and channels.
613
614
Outward currents were activated at voltage steps positive to and were blocked in a concentration-dependent manner by bath application of TEA (Fig 2A), 4-AP (Fig. 2B) and quinidine (fig. 2C) with calculated values of (Fig 2E), respectively, mM and There was a small TEA-resistant and larger 4-AP-resistant component of the current whilst quinidine completely abolished the current. In addition, significantly depressed the outward currents to of control values Fig. 2D), suggesting that a significant proportion of the outward current was attributable to current flow through channels. 3.2
Effect of hypoxia on ionic currents in H-146 cells
Hypoxia caused a sustained and reversible inhibition of the outward currents at all test potentials. Hypoxic inhibition of K+ currents was observed using both step and ramp protocols. Employing the step protocol, hypoxia induced a significant inhibition of Maximal inhibition occurred within 3 minutes and was reversed upon removal of hypoxia within 2 minutes. Inward currents were unaffected by hypoxia. 3.3
Dissection of the
current
Hypoxia, in the presence of , produced a significant inhibition of outward currents which was similar in magnitude (i.e. of control currents; ) to that seen in the absence of (Fig. 3B). This supports the hypothesis that hypoxia inhibits a insensitive current in H-146 cells. A maximally effective concentration of 4-AP failed to abrogate the rapid inhibitory effect of hypoxia on the currents (Fig. 3C). The observation that the reduction in absolute current density was similar to the value seen in the absence of 4-AP, together with the fact that hypoxia was unable to cause inhbition in the presence 1mM quinidine (data not shown), indicates that the hypoxia-sensitive current in H146 cells is quinidinesensitive but 4-AP resistant. Reduction of from 7.4 to 6.5 did not significantly suppress the currents (Fig. 3D). Mean current density at was
615
616
and at Furthermore, raising the in current density demonstrate that the cells are not regulated by
3.4
was back to 7.4 caused no significant change These data channels in H146
Effects on membrane potential
The mean resting membrane potential of H-146 cells was found to be under normoxic conditions. Hypoxia reversibly depolarized all cells tested by Depolarization was also consistently observed during bath application of maximal concentrations of either TEA (Fig 4A) or 4-AP (Fig. 4B). Furthermore, and consistent with the voltage-clamp data (Fig. 1), 1 mM quinidine abolished the hypoxic response (Fig. 4C). 617
618
4.
DISCUSSION
We have identified the presence of voltage-gated and channels in H146 cells. Inward currents were attributable to activation of both and channels (see also O'Kelly et al., 1998). Outward currents were also present in H146 cells, indicating that this SCLC cell line has an array of voltage-gated ion channels expected from cells of neuroendocrine origin. Although channel subtypes have been investigated in detail in SCLC cells (Codignola et al., 1993; Sher et al., 1990; Speirs et al., 1993), little is known of the properties of the outward currents in these cells. Through bath application of we have identified and components of the whole-cell current. currents could be fully inhibited by quinidine, but components of the current were resistant to TEA and 4-AP. Importantly, hypoxic inhibition of currents was still apparent in the presence of maximal concentrations of 4-AP (Fig. 3) and hypoxia was able to depolarize cells in the presence of these blockers. These findings lead to the conclusion that the sensitive component of the whole cell current is quinidine-sensitive but 4-AP and TEA resistant. Whether such mild depolarizations are sufficient to activate voltage-gated entry (this depends on how close to the resting membrane potential the threshold for significant channel activation lies) has still to be determined. However, in rat glomus cells, depolarizations of similar magnitude cause dramatic voltage-gated entry (Buckler and Vaughan-Jones, 1994). In the carotid body, different classes of channel have been shown to be (Peers, 1997) and molecular identification of these sub-classes of channel will be required before a more complete understanding of the mechanisms underlying channel inhibition by hypoxia can be achieved. The O2-sensitive channel recorded in H146 cells influences membrane potential and has a pharmacological profile similar to some members of the newly emerging gene family of TWIK-related leak channels (Arrighi et al., 1998; Duprat et al., 1997; Fink et al., 1996; Fink et al., 1998). This has led us to propose that a TWIK-related channel may underly the hypoxic inhibition which we observe in these cells. Recently, therefore, we have used RT-PCR with primers to the 3’ untranslated regions of TWIK-related channels and have shown
619
that TASK mRNA is differentially expressed (O'Kelly et al., 1999), suggesting that the current may be closely related to, or even identical to TASK. However, the H146 channel is insensitive to changes in Thus, it appears that the current in H-146 cells resembles TWIK-1 in terms of its pharmacological profile but TASK from the PCR studies. It is, therefore, possible that we have identified an channel that is structurally very similar to TASK, but does not display the sensitivity to reported for this cloned channel when expressed in Xenopus oocytes or COS cells (Duprat et al., 1997). In support of the notion that the channel may be related closely to TASK, we have also shown that H146 cells express the mRNA of a potential splice variant (O'Kelly et al., 1999). This presents the intriguing possibility that H146 cells differentially express this variant which confers novel functional characteristics. In summary, this SCLC line, like NEB cells, possesses voltagegated channels, and a component of the current which is reversibly inhibited by hypoxia. The channel is quinidine-sensitive, resistant to blockade by 4AP and weakly TEA-sensitive. It contributes to the cell resting membrane potential and its inhibition gives rise to cell depolarization. Furthermore, our molecular and pharmacological studies suggest that the channel may be a novel, isoform of TASK. Our findings show that the major functional feature of NEB cells (an oxygen-sensitive channel) is present in this cell line and we suggest, that H146 cells represent a useful model system for
investigating in detail the cellular and molecular mechanisms underlying oxygen sensing by airway chemoreceptors.
REFERENCES Arrighi, I., Lesage, F., Scimeca, J.C., Carle, G.F., and Barhanin, J., 1998, Structure, chromosome localization, and tissue distribution of the mouse TWIK channel gene. FEBS Lett. 425, 310-316. Buckler, K.J. and Vaughan-Jones, R.D., 1994, Effects of hypoxia on membrane potential and intracellular calcium in rat neonatal carotid body type I cells. J.Physiol. 476, 423-428.
Codignola, A., Tarroni, P., Clementi, F., Pollo, A., Lavallo, M, Carbone, E., and Sher, E., 1993, Calcium channel subtypes controlling serotonin release from human small cell lung carcinoma cell lines. J.Biol. Chem. 268, 26240-26247.
620
Cutz, E., 1997, Introduction to pulmonary neuroendocrine cell system, structurefunction correlations. Microsc. Res. Tech. 37, 1-3. Cutz, E., Gillan, J.E., and Track, N.S., 1984, Pulmonary endocrine cells in the developing human lung and during neonatal adaptation. In: The endocrine lung in health and disease, 210-231. Edited by Becker, K.L. and Gazdar, A.F., Philadelphia, Saunders,W.B. Duprat, F., Lesage, F, Fink, M., Reyes, R., Heurteaux, C., and Lazdunski, M., 1997, TASK, a human background channel to sense external pH variations near physiological pH. EMBO J. 16, 5464-5471. Fink, M., Duprat, F., Lesage, F., Reyes, R., Romey, G., Heurteaux, C., and Lazdunski, M., 1996, Cloning, functional expression and brain localization of a novel unconventional outward rectifier channel. EMBO J. 15, 6854-6862. Fink, M., Lesage, F., Duprat, F., Heurteaux, C., Reyes, R., Fosset, M., and Lazdunski, M., 1998, A neuronal two P domain channel stimulated by arachidonic acid and polyunsatuarated fatty acids. EMBO J. 17, 3297-3308. Fu, X.W., Nurse, C., Wang, Y.T., and Cutz, E., 1999, Selective modulation of membrane currents by hypoxia in intact airway chemoreceptors from neonatal rabbit. J.Physiol. 514, 139-150. Gazdar, A.F., Helman, L.J., Israel, M.A., Russell, E.K., Linnoila, R.I., Mulshine, J.L., Schuller, H.M., and Park, J.G., 1988, Expression of neuro-endocrine cell markers L-DOPA decarboxylase, chromogranin-a, and dense core granules in human-tumors of endocrine and nonendocrine origin. Cancer Res. 48, 40784082. Gillan, J.E., Curran, C., O'Rielly, E., Cahalane, S.F., and Unwin, A.R., 1989, Abnormal patterns of pulmonary neuroendocrine cells in victims of Sudden Infant Death Syndrome. Paediatrics 84, 828-834. Lauweryns, J.M. and Cokeleare, M., 1973, Hypoxia sensitive neuroepitlielial bodies intrapulmonary secretory neuroreceptors, modulated by CNS. Z.Zellforsch 145, 521-540. Lauweryns, J. M., Cokeleare, M., Lerut, T., and Theunynck, P., 1978, Crosscirculation studies on the influence of hypoxia and hypoxaemia on neuroepithelial bodies in young rabbits. Cell.Tiss.Res. 193, 373-386. Lauweryns, J.M. and VanLommel, A., 1987, Ultra structure of nerve endings and synaptic junctions in rabbit intrapulmonary neuroepithelial bodies. J.Anat. 151, 65-65. O'Kelly, I., Peers, C., and Kemp, P. J., 1998, Oxygen-sensitive channels in neuroepithelial body-derived small cell carcinoma cells of the human lung. Am.J.Physiol. 275, L709-L716. O'Kelly, I., Stephens, R. H., Peers, C, and Kemp, P. J., 1999, Potential identification of the current in a human neuroepithelial body-derived cell line. Am. J.Physiol. 276, L96-L104.
Pancrazio, J.J., Viglione, M.P., Tabbara, I.A., and Kim, Y.I., 1989, Voltagedependent ion channels in small cell lung cancer cells. Cancer Res. 49, 59015906. Peers, C., 1997, Oxygen-sensitive ion channels. TIPS 18, 405-408. Slier, E., Pandiella, A., and dementi, F., 1990, Voltage-operated calcium channels in small-cell lung-carcinoma cell-lines - pharmacological, functional, and immunological properties. Cancer Res. 50, 3892-3896.
621
Sorokin, S.P. and Hoyt, R.F., 1989, Neuroepithelial bodies and solitary smallgranule endocrine cells. In: Lung cell biology , 191-344. Edited by Massaro, D., Marcel Dekker, NY. Speirs, V., Bienkowski, E., Wong, V., and Cutz, E., 1993, Paracrine effects of bombesin/gastrin-releasing peptide and other growth factors on pulmonary neuroendocrine cells in vitro. Anat.Rec. 236, 53-61. Weir, E.K. and Archer, S. L., 1995, The mechanism of acute hypoxic pulmonary vasoconstriction - the tale of 2 channels. FASEB J. 9, 183-189. Youngson, C., Nurse, C., Yeger, H., and Cutz, E., 1994, Characterization of membrane currents in pulmonary neuroepithelial bodies: hypoxia-sensitive airway chemoreceptors. In: Arterial Chemoreceptors. Cell to System, 179-182. Edited by O'Regan, R.G., Nolan, P., McQueen, D.S., and Paterson, D.J., New York & London, Plenum Press. Youngson, C., Nurse, C., Yeger, H., and Cutz, E., 1993, Oxygen sensing in airway chemoreceptors. Nature 365, 153-155.
622
MORPHOLOGICAL ADAPTATION OF THE PEPTIDERGIC INNERVATION TO CHRONIC HYPOXIA IN THE RAT CAROTID BODY
1
H. Matsuda, 2T. Kusakabe, 3Y. Hayashida, 4 F.L. Powell, 5 M.H. Ellisman, T. Kawakami, and 7T. Takenaka
6
1
Department of Otorhinolaryngology Department of Anatomy 7 Department of Physiology Yokohama City University School of Medicine, Yokohama 236-0004, Japan 2
3
Department of Systems Physiology University of Occupational and Environmental Health, Kitakyushu 807-8555, Japan 4 Department of Medicine and 5
Department of Neurosciences
University of California San Diego, La Jolla, CA 92093, USA 6 Department of Physiology
Kitasato University School of Medicine, Sagamihara 228-8555, Japan
1.
INTRODUCTION
The carotid bodies are enlarged in rats exposed to chronic hypoxia, and the glomus cells also increased in number and volume (Heath et al., 1973; Barer et al., 1976; Laider & Kay, I975a, Pequignot et al, 1984). As a result of enlargement, the carotid bodies show a spongy appearance with increased vascularization, bearing remarkable similarity to the carotid body of the normal amphibian (Kusakabe et al., 1993), which normally has a low arterial tension On this basis, we suggested that these morphological changes may, in part, depend on (Kusakabe et al, 1993).
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
623
Here we use the chronically hypoxic carotid body as a model to explore physiological roles of the peptidergic innervation in the carotid body. In mammals and amphibians, several kinds of regulatory neuropeptides, such as substance P (SP), calcitonin gene-related peptide (CGRP), vasoactive intestinal polypeptide (VIP), neuropeptide Y (NPY), galanin, somatostatin and others, have been demonstrated in the nerve fibers distributed in the parenchyma of the carotid body (Lundberg et al., 1979; Wharton et al., 1980; Jacobowitz & Helke, 1980; Kendo et al, 1986; Kondo & Yamamoto, 1986; Kusakabe et al, 1991, 1993, 1994, 1995a, b). In the present study, we compared the abundance and distribution of different four regulatory peptides, SP, CGRP, VIP, and NPY immunoreactive nerve fibers between the carotid body of normoxic and chronically hypoxic rats.
2.
MATERIALS AND METHODS
Rats were placed in an air-tight acrylic chamber, and a hypoxic gas mixture was flowed into the chamber. This hypoxic condition has been confirmed to be isocapnic to the rats in our previous study (Hayashida, et al, 1996). Seven rats were exposed chronically in this chamber for three months with food and water available ad lib. Control seven rats were housed for three months in the same chamber ventilated by air at flow rate of 20 L/min. The animals were perfused with 0.1M heparinized phosphate buffer saline (PBS), followed by freshly prepared Zamboni's fixative solution. The carotid bodies were cut serially at on a cryostat, and mounted in four series on poly-L-lysine coated slides. All experiments with animals were performed in accord with "Guiding Principles for the Care and Use of Animals in the Fields of Physiological Sciences" published by the
Physiological Society of Japan. The sections were processed for immunohistochemistry according to the peroxidase-antiperoxidase (PAP) method as described previously (Kusakabe et al, 1991). In brief, the sections were incubated at 4°C overnight with the primary antisera against the following neuropeptides: SP (1:1500; Cambridge), CGRP (1:1500; Cambridge), VIP (1:2000; Incstar), and NPY (1:2000; Incstar). After rinsing in several changes of PBS, the sections were transferred for 2 h to anti-rabbit IgG (1:200; Organo Technica). Next the sections were rinsed with several changes of PBS, transferred for 2 h to rabbit PAP (1:200; Jackson). The peroxidase activity was
demonstrated with 3,3’ L-diaminobenzidine. Some sections were also stained with hematoxylin eosin for general histology.
624
The density of immunoreactive fibers in the carotid bodies was quantified as the number of varicosities. The value per u n i t area of parenchyma, excluding the area of vascular lumen, were expressed as Statistical comparisons between the control and
experimental values were determined using the Student's t-test.
3.
RESULTS
In the sections stained with hematoxylin and eosin, the carotid body of the chronically hypoxic rat was found to be enlarged several fold in comparison with that of normoxic control rats (Figs. 1 A, B). The enlarged carotid bodies contained expanded small arteries, arterioles, and capillaries to show a maze-like structure (Fig. 1 B).
Immunoreactivity of SP, CGRP, VIP, and NPY was recognized in
the nerve fibers distributed throughout the parenchyma of the carotid body (Figs. 2A-5A).
They appeared as thin processes with many varicosities.
NPY-immunoreactive varicose fibers were more numerous than SP-, CGRP-, and
VIP-immunoreactive fibers.
Most immunoreactive
fibers were
625
626
associated with the vasculature and some fibers were observed to surround the clusters of glomus cells. No glomus cells with the immunoreactivity of these four neuropeptides were observed in the normoxic carotid body. The mean density of varicosities in these neuropeptide-containing fibers per unit area was and respectively (Fig. 6). As shown in the normoxic carotid body, parenchymal NPYimmunoreactive varicose fibers (Fig. 5B) were more numerous than SP (Fig. 2B), CGRP (Fig. 3B), and VIP immunoreactive varicose fibers (Fig. 4B) in the chronically hypoxic carotid body. These peptidergic fibers, and especially VIP fibers, were mainly associated with the enlarged vasculatures. When the mean density of varicosities per unit area was compared between the normoxic and chronically hypoxic carotid bodies, the density of VIP fibers was significantly increased from to although that of NPY fibers was unchanged (Fig. 6). The mean density of SP and CGRP fibers per unit area was significantly decreased from and from to respectively (Fig. 6). The mean density of VIP fibers per unit area in the chronically hypoxic carotid body was 1.80 (22.56/12.54) times higher than that of VIP fibers in the normoxic carotid body, and the mean density of SP and CGRP fibers per unit area was 0.35 (2.24/6.47) and 0.47 (6.70/14.32) times higher than that of SP and CGRP fibers, respectively. SP and CGRP fibers did not increase in absolute number with carotid body hypertrophy, but VIP and NPY fibers did. No glomus cells with the immunoreactivity of these four neuropeptides were observed in the chronically hypoxic carotid body.
627
4. DISCUSSION It is well known that chronic hypoxic exposure can alter respiratory reflexes (Vizek et al, 1987). At least a part of the increase in ventilation with chronic hypoxia can be explained by changes in the afferent component of ventilatory chemoreflexes, specifically in the carotid body arterial chemoreceptors (Barnard et al, 1987; Nielsen et al, 1988; West et al, 1987). In the mammalian carotid body, the physiological role of SP, CGRP, VIP, and NPY on the chemosensory mechanisms is not completely understood. On the other hand, these four neuropeptides examined in this study are thought to have vasodilatory or vasoconstrictory effects (Hallberg & Pernow, 1975; Samnegard et al, 1978; Wilson et al, 1981; Edvinsson et al, 1983; Brain et al, 1985 ; Heistad et al, 1980) in addition to a sensory role. Therefore, it is possible that they are mainly concerned in the vascular regulation of the carotid body rather than in the modulation to the chemosensory mechanisms. In the present study, the density per unit area of VIP-containing fibers was significantly increased in the chronically hypoxic rat carotid body, although the density of SP and CGRP was decreased and that of NPY was unchanged. We believe that at least part of vascular expansion in the chronically hypoxic rat carotid body may depend on the vasodilatory effect of VIP. As a result of the vascular enlargement, the blood flow in the chronically hypoxic rat carotid body is increased. This may suggest that VIP fibers around the blood vessels are indirectly involved in chemosensory mechanisms by controlling local carotid body circulation. In conclusion, altered peptidergic innervation in the chronically hypoxic carotid body is one of the features of hypoxic adaptation, and this may supplementary depend on the modulation of the chemosensory mechanisms.
5.
ACKNOWLEDGEMENTS
The present work was supported by grants-in-aid 08670028 and 09670022 from the Ministry of Education, Science and Culture, Japan, and from the National Institute of Health National Center for Research Resource RR 0150 and HL 07731.
6.
REFERENCES
Barer GR, Edwards C, & Jolly Al (1976) Changes in the carotid body and the ventilatory response to hypoxia in chronically hypoxic rats. Clinic Sci 50: 311-313
628
Barnard P, Andronikoui S, Pokorsk M, Smatreski N, Mokash A, & Lahiri S (1987) Time-dependent effect of hypoxia on carotid body chemosensory function. J Appl Physiol 63: 685-691 Brain SD, Williams TJ, Tippins JR, Moris HR, & MacIntyre I (1985) Calcitonin
gene-related peptide is a potent vasodilator. Nature (Lond) 313: 54-56 Edvinsson L, Emson P, McCulloch J, Teramoto K & Uddman R (1983) Neuropeptide Y: cerebrovascular innervation and vasomotor effects in the cat.
Neurosci Lett 43: 79-84
Hallberg D & Pernow B (1975) Effect of substance P on various vascular beds in the dog. Acta Physiol Scand 93: 277-285
Hayashida Y, Hirakawa H, Nakamura T & Maeda M (1996) Chemoreceptors in autonomic responses to hypoxia in conscious rats. Adv Exp Med Biol 410:439-442 Heath D, Edwards C, Winson M & Smith P (1973) Effects on the right ventricle, pulmonary vasculature, and carotid bodies of the rat of exposure to, and recovery from, simulated high altitude. Thorax 28: 24-28 Heistad DD, Marcus Ml, Said SI & Gross PM (1980) Effect of acetylcholine and vasoactive intestinal peptide on cerebral blood flow. Am J Physiol 238: H73-H80 Jacobowitz DM & Helke CJ (1980) Localization of substance P immunoreactive nerves in the carotid body. Brain Res Bull 5:195-197 Kondo H & Yamamoto M (1988) Occurrence, ontogeny, ultrastructure and some plasticity of CGRP (calcitonin gene-related peptide)-immunoreactive nerves in the carotid body of rats. Brain Res 473: 283-293 Kondo H, Kuramoto H & Fujita T (1986) Neuropeptide tyrosine-like immunoreactive nerve fibers in the carotid body chemoreceptor of rats. Brain Res 372: 353-356 KusakabeT, Anglade P & Tsuji S (1991) Localization of substance P, CGRP, VIP, neuropeptide Y, and somatostatin immunoreactive nerve fibers in the carotid labyrinths of some amphibian species. Histochemistry 96: 255-260 Kusakabe T, Powell FL & Ellisman MH (1993) Ultrastructure of the glomus cells in the carotid body of chronically hypoxic rats: with special reference to the similarity of amphibian glomus cells. Anat Rec 237:220-227 Kusakabe T, Kawakami T & Takenaka T (1994) Coexistence of substance P, neuropeptide Y, VIP, and CGRP in the nerve fibers of the carotid labyrinth of the bullfrog, Rana catesbeiana: a double-labelling immunofluorescence study in combination with alternative consecutive sections. Cell Tissue Res 276: 91-97 Kusakabe T, Kawakami T & Takenaka T (1995) Peptidergic innervation in the amphibian carotid labyrinth. Histol Histopathol 10:185-202 Kusakabe T, Kawakami T, Tanabe Y, Fujii S, Bando Y & Takenaka T (1993) Coexistence of substance P and calcitonin gene-related peptide in the nerve fibers of the carotid labyrinth of the bullfrog, Rana catesbeiana. Brain Res 603: 153-156 Kusakabe T, Kawakami T, Ono M, Hori H & Takenaka T (1995) Distribution of
galanin-immunoreactive nerve fibers in the carotid labyrinth of the bullfrog,
Rana catesbeiana: comparison with substance P-immunoreactive fibers. Tissue Res 281:63-67
Cell
629
Laider P & Kay JM (1075) A quantitative morphological study of the carotid bodies of rats living at a simulated altitude of 4300 meters. J Pathol 117: 183-191. Lundberg JM & Häkfelt T (1983) Coexistence of peptides and classical neurotransmitters. Trends Neurosci 6: 325-333 Nielsen AM, Bisgard GE & Vidruk EH (1988) Carotid chemoreceptor activity during acute and sustained hypoxia in goats. J Appl Physiol 65: 1796-1802 Pequignot JM, Hellström S & Johansson C (1984) Intact and sympathectmized
carotid body of long-term hypoxic rats: A morphometric ultrastructural study. J Neurocytol
13:481-493
Samnegard H, Thulin L, Tyden G, Johansson C, Muhrberg O & Björklund C (1978) Effect of synthetic substance P on internal carotid artery blood flow in man. Acta Physiol Scand 104:492-495 Vizek M, Pickett CK & Weil JV (1978) Increased carotid body hypoxic sensitivity during acclimatization to hypobaric hypoxia. J Appl Physiol 63: 24032410 West N H , Topor ZL & Van Vliet BN (1987) Hypoxemic threshold for lung ventilation in the toad. Respir Physiol 70: 377-390 Wharton J, Polak JM, Pearse AGE, McGregor GP, Bryant MG, Bloom SR, Emson PC, Bisgard GE & Will JA (1980) Enkephalin-, VIP- and substance P-like
immunoreactivity in the carotid body. Nature 284:269-271 Wilson DA, O'Neil JT, Saido SI & Traystman RJ (1981) Vasoactive intestinal polypeptide and canine cerebral circulation.
630
Circ Res
48: 138-148
CONTINUOUS, BUT NOT EPISODIC HYPOXIA, INDUCES CREB PHOSPHORYLATION IN RAT CAROTID BODY TYPE I CELLS Z.-Y. Wang, T. L. Baker, I. M. Keith, G. S. Mitchell, and G. E. Bisgard Department of Comparative Biosciences, University of Wisconsin, Madison, WI 53706
1.
INTRODUCTION
The CB sensitivity to hypoxia is increased following sustained, long-term hypoxia such as in ventilatory acclimatization to high altitude (Bisgard 1994). The mechanisms underlying the cellular responses and adaptation to hypoxia are poorly understood. It is assumed that a major component of this
adaptation is regulation of gene expression. cAMP response element-binding protein (CREB) is a nuclear protein. CREB is activated upon phosphorylation at Ser133 and modulates the transcription of genes with cAMP response elements (CRE) in their promoters (Ginty 1997). Recently, it has been shown that hypoxia induces phosphorylation of CREB at Ser133 in cultured PC 12 cells (Beitner-Johnson and Millhorn 1998), which are similar to the CB type I cells in several important characteristics related to oxygen-dependent gene regulation.
It has been shown that intermittent hypoxia elicits long-term facilitation (LTF), a sustained increase in ventilation (or phrenic nerve activity in anesthetized rats) lasting for more than one hour after the last hypoxic episode (Bach and Mitchell 1996). LTF is a serotonin-dependent mechanism that is mediated in the CNS (Kinkead et al. 1998). In contrast, continuous hypoxia of the same cumulative duration does not cause LTF (Baker and Mitchell 1999). We examined whether continuous and intermittent hypoxia
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
631
play different roles in regulating CREB phosphorylation and function in CB type I cells.
2.
METHODS
Adult male rats (Harlan Sprague Dawley, Madison, WI) were urethaneanesthetized, vagotomized, paralyzed and artificially ventilated. Rats were treated following the same protocol used for previous physiological studies (Bach and Mitchell 1996). Briefly, one group of animals was exposed to three, three min episodes of isocapnic hypoxia separated by five min of hyperoxia In contrast, a second group of rats was exposed to nine min of continuous isocapnic hypoxia. Also, a third group of rats served as control; these rats were treated in the same way, but had no hypoxia exposure. The rats were then deeply anesthetized and perfused with 4 % paraformadehyde, and CBs were collected and kept in Bouin’s fixative for 4 hr. The tissues were paraffin-embedded and sectioned at For immunocytochemistry, deparaffinized sections were treated with 0.3 % Triton-X-100 for 30 min and background was blocked with 10 % normal goat serum. Sections were then incubated overnight at 4 °C with a highly purified, specific anti-phospho CREB (pCREB) antibody (1:1000 dilution; Upstate Biotechnology, NY). After rinsing in phosphate buffered saline, the sections were incubated with rodamine-conjugated goat anti-rabbit IgG (1:200; Sigma, USA) for 90 min, followed by rinsing and coverslipping using an anti-fading solution (Molecular Probes, Netherlands).
3.
RESULTS
pCREB-like immunoreactivity (-LI) was detected in CB of 5 of the 6 rats treated with continuous hypoxia. The immunoreactivity was restricted to the nucleus of type I cells (Fig. 1a), whereas no pCREB-LI was seen in the cytoplasm of these cells. Moreover, pCREB-LI was not detected in any of the 6 rats treated with intermittent hypoxia (Fig. 1b) or in the 5 normoxic control rats (not shown).
4.
DISCUSSION
Our results suggest that short durations of sustained hypoxia stimulates CB type I cells, as shown by the presence of phosphorylated CREB, and that intermittent hypoxia does not have this effect. Thus, continuous and
632
633
intermittent hypoxia seem to play different roles in regulating ventilatory responses. It appears that intermittent hypoxia is likely to induce a plasticity in the CNS while continuous hypoxia may mainly initiate a CB-mediated mechanism.
It is well known that hypoxia causes CB type I cells to depolarize and
release the catecholamine transmitter dopamine. In addition, the activity and expression of tyrosine hydroxylase (TH), the rate-limiting enzyme in the
biosynthesis of dopamine, is enhanced in the type I cells by hypoxia (Czyzyk-Krzeska et al 1992). As shown before, hypoxia increases cAMP levels in the CB type I cells (Wang et al 1991) and the TH gene contains a CRE in its promoter region (Fung et al 1992). We thus speculate that hypoxia may induce increased levels of intracellular cAMP, which in turn causes the phosphorylation of CREB. Upon phosphorylation, pCREB activates expression of several genes, including TH, which may set the stage for increased CB sensitivity to hypoxia. Several protein kinases, including protein kinase A, calcium/calmodulindependent protein kinase-I, -II, and -IV, protein kinase C, MAPKAP kinase-
and
have been known to mediate phophorylation of CREB (Beitner-
Johnson and Millhorn 1998). Strikingly, the hypoxia-induced phosphorylation of CREB in PC 12 cells is not mediated by any of the pathways mentioned above, indicating that there is a novel signaling pathway which mediates the phophorylation of CREB in PC 12 cells (Beitner-Johnson and Millhorn 1998). Whether this novel signaling pathway also occurs in CB type I cells remains to be identified. It is quite possible that activation of different signaling pathways may account for the differences in sensitivity of cells to either continuous hypoxia or intermittent hypoxia.
CONCLUSION Our findings suggest that sustained hypoxia is more likely than episodic hypoxia to cause CREB phosphorylation and, thus, is more likely to initiate type I cell gene expression leading to increased CB sensitivity to hypoxia.
ACKNOWLEDGEMENTS This study was supported by grants from National Institutes of Health (HL15743, 53319, 36780 and 07654).
634
REFERENCES Bach, K. B., and Mitchell, G.S., 1996, Hypoxia-induced long-term facilitation of respiratory activity is serotonin dependent. Respir. Physiol. 104: 251-260. Baker, T.L., and Mitchell, G. S., 1999, Episodic hypoxia, but not continuous hypoxia, leads to long term facilitation of phrenic nerve activity in rats. FASEB J. 13: 164.7. Beitner-Johnson, D., and Millhorn, D. E., 1998, Hypoxia induces phosphorylation of the
cyclic AMP response element-binding protein by a novel signaling mechanism. J. Bio. Chem. 273: 19834-9.
Bisgard, G. E., 1994, The role of arterial chemoreceptors in ventilatory acclimatization to hypoxia. In Arterial Chemoreceptors: Cell to System (R. O’Regan, P. Nolan, D. McQueen and D. Paterson, eds.), Plenum Press, pp. 109-122.
(Czyzyk-Krzeska, M. F., Bayliss, D. A., Lawson, E. E., and Millhorn, D. E., 1992, Regulation of tyrosine hydroxylase gene expression in the rat carotid body by hypoxia. J. Neurochem. 58: 1538-1546. Fung, B. P., Yoon, S. O., and Chikaraishi, D. M., 1992, Sequences that direct rat tyrosine hydroxylase gene expression. J. Neurochem. 58:2044-52. Ginty, D. D., 1997, Calcium regulation of gene expression: isn’t that spatial? Neuron 18:1836. Kinkead, R., Zhan, W.-Z., Prakash, Y. S., Bach, K. B., Sieck, G. C., and Mitchell, G. S.,
1998, Cervical dorsal rhizotomy enhances serotonergic innervation of phrentic motoneurons and serotonin-dependent long-term facilitation of respiratory motor output in ruts. J. Neurosci. 18:8436-8443. Wang, Z.-Z., Stensaas, L. J.. de Vente, J., Dinger, B., and Fidone, S. J., 1991,
Immunocytochemical localization of cAMP and cGMP in cells of the rat carotid body following natural and pharmacological stimulation. Histochcmistry 96:523-530.
635
This page intentionally left blank.
INTRACELLULAR
OF THE CAROTID BODY
D.F. Wilson 1 , S.M. Evans2, C. Rozanov3, A. Roy3, C.J. Koch2, K.M. Laughlin 2 , and S. Lahiri
Depts. of 1Biochemistry and Biophysics, of 2Radiation Oncology, and 3Physiology, Medical School, University of Pennsylvania, Philadelphia, PA 19104
1.
INTRODUCTION The carotid body originates from the neural crest during embryonic
development and one of the best known oxygen sensory tissues of the body. It has been extensively studied, in part because it has a well defined function in regulating the respiratory rate and in part because the afferent nerve can be readily isolated and the chemosensory activity measured. In the carotid body, the primary sensor has been shown to be mitochondrial oxidative phosphorylation, through the reaction of oxygen with cytochrome c oxidase (Wilson et al. 1994; Wilson et al, this proceedings). This has raised questions concerning the mechanism(s) of the oxygen pressures at which oxygen sensing occurs. The oxygen dependence of the cytochrome c oxidase reaction of mitochondria has been the subject of controversy, with reports that it is oxygen concentration dependent only below about 1 mm Hg (Chance, 1988) or that it is oxygen dependent at 30 mm Hg and below (Wilson et al. 1979). Thus, in order to understand oxygen sensing by the carotid body it is important to know the oxygen pressure in the cells of the carotid body.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
637
2.
RESULTS
2.1
Carotid body oxygenation as measured by oxygen electrodes
The first measurements of oxygen pressure in the carotid body were made using oxygen electrodes, notably by Whalen and colleagues (Whalen and Nair, 1977; 1983; Buerk et al. 1989) and by Acker and colleagues (Acker and Lubbers, 1977; Acker, 1989). Oxygen electrodes, depending on the size, provide information on individual points in the interstitial space as influenced by the adjacent blood vessels. The values reported by the two groups were quite different. Walen and coworkers reported values in the interior of the tissue of (Whalen and Nair, 1977; 1983) while Buerk et al. (1989) reported even higher values of These high values contrast sharply with those of Acker and colleagues who reported values in the range of 0 to 15 mm Hg. The extreme range of values, from near zero to near arterial oxygen levels, do not provide an adequate basis tor discussing the oxygen dependence of the oxygen sensor system.
2.2
Oxygen measurements in the carotid body using phosphorescence quenching
In an effort to resolve the question of the oxygen pressure in the carotid body, the oxygen pressures in the blood of the microvasculature was measured using oxygen dependent quenching of phosphorescence (Lahiri et al., 1993). The phosphorescence lifetime measurements indicated that, in the cat carotid body in vivo, the mean oxygen pressures in the microvasculature were when the arterial oxygen pressure was about 115 mm Hg. This fell to about 40 mm Hg when the arterial oxygen pressures were decreased to about 90 mm Hg (low normal). Both oxygen extraction and the resulting vascular oxygen pressures were similar to those found, for example, in brain cortex (Silver, 1977; Lubbers, 1994; Olano et al. 1995). The oxygen pressures measured by phosphorescence quenching were more consistent with those of Whalen and Nair (1977; 1983) as the extravascular oxygen pressures might be expected to be below those in the microcirculation by 5-10 mm Hg. The diffusion induced oxygen pressure difference between the blood and the sensory cells is tissue specific, however, because it is dependent on the diffusion distance and the rate of cellular oxygen consumption, and these remain to be established.
638
2.3
Oxygen measurement in the carotid body by binding of EF5
The measurements by oxygen electrodes and phosphorescence quenching (two independent methods) were suggestive, but still did not provide a clear
consensus as to the correct value for the oxygen pressure in the tissue of the carotid body. It was, therefore, important to use a third independent method for oxygen measurements in the carotid body in an effort to establish the range of oxygen pressures at which oxygen was sensed by the tissue. Evans and coworkers (see Wilson et al. 1998) applied the oxygen dependent binding of a nitroimidazole, EF5 (see Laughlin et al, 1996; Koch et al, 1997) to the carotid body of rats. To measure the oxygenation of the carotid body in rats, rats were treated with whole body concentrations of approximately EF5 and maintained for 3 hours in a chamber at either normoxia or 10% oxygen. During this period the EF5 accumulates in the tissue in an oxygen dependent manner, more accumulating at lower oxygen levels. The rats were then anesthetized, removed from the chamber, and the carotid bifurcation with the carotid body rapidly removed and frozen. The distributions of the bound EF5 were imaged after staining with a fluorescence labeled monoclonal antibody (see Laughin et al. 1996). In separate experiments, the carotid bodies were removed from control animals, cut into small pieces and incubated in vitro with EF5 in media equilibrated with 0.1% oxygen for three hours at 37°. These tissue cubes were analyzed for EF5 binding and the regions of the images with maximal intensity were used as a measure of the EF5 binding capacity at zero oxygen. The EF5 binding ratios for each pixel of the carotid body images were calculated and then converted to oxygen pressure using calibration curves obtained with suspensions of two cell types, 9L glioma and Chinese Hamster fibroblast cells (see Koch et al, 1997). The calibrations for the two cell lines were very similar). Maps of oxygen distribution within the carotid body calculated from EF5 binding show rather uniform oxygen levels throughout, with no evidence of local regions of hypoxia. Regions of interest designed to cover most of the carotid body area (usually more than 50,000 pixels) in the oxygen maps show a mean oxygen pressure of 21.7 mm Hg and minimum observable values were about 7.4 mm Hg. When the oxygen pressures were measured along lines drawn through the carotid body (Figure 1) there was no evidence for large local variability in the oxygen pressures. Thus, over the measurement times used in these experiments the mean oxygen pressures within the carotid body there are no specialized regions of relatively low oxygen pressures.
639
These oxygen pressure values are quite similar to those reported for other tissues, such as brain, of anesthetized animals using micro oxygen electrodes. Typical of the reported oxygen measurements for the brain, for example, are mean values of 23.3 mm Hg (Lubbers et al. 1994) and 22 mm Hg (Silver, 1975).
3.
DISCUSSION
It is important to establish the oxygen pressure at which the sensory activity occurs. The oxygen pressures in the cells of the carotid body reported in this communication, measured by binding of EF5, show mean values of 27 mm Hg. This value is consistent with the tissue oxygen pressures reported by Whalen and Nair (1977; 1983) of 42 mm Hg and with the intravascular oxygen pressures of 40 to 52 mm Hg reported by Lahiri et al (1993). Agreement of three independent methods for oxygen measurement make it likely that the abnormally low tissue oxygen pressures reported by Acker and coworkers (Acker and Lubbers, 1977; Acker 1989) were somehow in error. We conclude that the oxygen pressures in cells of the
640
carotid body are very similar to those reported for tissues such as brain cortex (Silver, 1975; Lubbers et al. 1994). Intermediate oxygen pressures in the microvessels of the carotid body suggests that oxygen sensing is associated with normal vascular oxygen levels and not with specialized vasculature which resulted in either abnormally low flow (tissue hypoxia) or abnormally high flow (tissue oxygenation near arterial). The afferent oxygen neural activity of the carotid body is essentially independent of the systemic blood pressure throughout the physiological range. That is, the activity has essentially the same dependence on arterial oxygen pressure whether the systemic blood pressure is 144 mm Hg or 70 mm Hg. Thus, the vasculature of the carotid body is designed to prevent changes in systemic blood pressure from altering the oxygen pressure in the sensory tissue. Alterations in systemic blood pressure, in the absence of compensating changes in vascular resistance, would be expected alter the blood flow (and thereby the oxygen pressure) in the sensory tissue. Lahiri et al.(1993) measured the oxygen pressures in the blood plama of the microvessels of cat carotid bodies in vivo as a function of systemic blood pressure. Phosphor was added to the blood and
phosphorescence lifetime imaging used to determine the distribution of oxygen pressures (for method details see Vanderkooi et al. 1987; Rumsey et al. 1994; Wilson et al. 1988; 1991; Shonat et al. 1992; Vinogradov et al, 1996). During controlled hemorrhagic hypotension and reperfusion the internal oxygen pressure was observed to be independent of systemic blood pressure until the latter fell below about 50 mm Hg. Thus, as in auto regulation in the brain, the internal vasculature compensates for changes in systemic blood pressure such as to maintain a constant blood flow through the microvessels. Katayama et al. (1994) reported that treatment of the isolated perfused
carotid body with L-nitro-arginine methyl ester (L-NAME) resulted in increased afferent activity under normoxic conditions and this was reversed
by sodium nitroprusside, an NO generator. This suggests that NO is a vasodilator for the vessels of the carotid body and decreased NO resulted in increased afferent activity due to vasoconstriction induced tissue hypoxia ( C h u g h et al. 1994). Thus, NO may play a key role in vascular autoregulation in the carotid body. On the other hand, NO is an inhibitor of cytochrome c oxidase that is competitive with respect to oxygen. It has been suggested that under physiological conditions the NO concentration is high enough to significantly raise the oxygen pressure at which mitochondrial oxidative phosphorylation becomes dependent on oxygen pressure. The observed changes were, however; opposite to those expected if there were significant inhibition of cytochrome oxidase by NO, because inhibition of
641
NO synthase increased afferent activity (decreases oxygen response) and providing external NO afferent activity (increased oxygen response). Sensing of the oxygen pressure by mitochondrial oxidative phosphorylation is almost certainly communicated first to the cellular energy state, expressed as [ATP]/[ADP][Pi], since previous measurements have shown that both uncouplers of oxidative phosphorylation and inhibitors of the respiratory chain can cause similar increases in afferent activity. Both these agents cause decrease in the cellular metabolic energy state but have opposite effects on the level of reduction of the pyridine nucleotides. This suggests the first step of the "second messenger" system is the cellular energy state. This does not require a significant change in ATP concentration, since the free ADP concentration is less than 1% of that of the ATP. Thus a decrease of only 1% of the ATP levels could theoretically double the ADP concentration and, through equilibrium of adenylate kinase: or: the AMP levels would increase by 4 fold. Thus, large alterations in metabolite levels in cellular energy metabolism occur before there is significant decrease in the levels of ATP. The next step in the metabolic signaling pathway may be an increase in the intracellular concentration. Evidence has been presented that this is an important part of the sensory system (see for example, Buckler and Vaughan-Jones, 1994; Biscoe and Duchen, 1990), and increased Ca2+ is usually a prerequisite for neurotransmitter release. It is clear, however, that the signal transmission pathway and the mechanism(s) for coupling the initial oxygen sensing event to increased nerve activity remain speculative and there is much more work to be done.
4.
CONCLUSION
Several different methods for measuring oxygen, each providing a different “measure” of the oxygen pressure, have been applied to the carotid body. These include oxygen electrodes, oxygen dependent quenching of phosphorescence, and binding of a nitroimidazole, EF5. The oxygen pressures in the internal vessels are substantially less than in the arteries as arterial oxygen pressures are decreased. Thus, tissue metabolism extracts a substantial fraction of the oxygen in the blood. The mean values at arterial normoxia are similar to those in the capillary bed of the brain cortex, from 35 to 50 mm Hg. Oxygen measurements by the distribution of EF5 show that the intracellular oxygen pressures in the rat carotid body near 30 mm Hg
642
at arterial normoxia, also similar to brain tissue. In summary, current data indicate the normal intracellular oxygen pressures of the carotid body are near 30-35 mm Hg.
ACKNOWLEDGEMENTS Supported by grants HL-60100 and CA-74062.
REFERENCES Acker, H. (1989) Chemoreception in arterial chemoreceptors. Ann. Rev. Physiol. 5 1 : 835844. Acker, H., and D.W. Lubbers, (1977) Relationship between local flow, tissue and total flow of the cat carotid body. In "Chemoreception in the Carotid Body", H. Acker, S.
Fidone, D. Pallot, C. Eyzaguirre, D.W. Lubbers, and L.W. Mm Hgance, eds.) SpringerVerlag, Berlin, Germany, pp. 271-278. Biscoe, T.J. and M.L Duchen (1990) Monitoring by the carotid chemoreceptor. News in Physiol. Sci. 5: 229-233.
Buckler, K.J., and R.D. Vaughan-Jones, (1994) Effects of hypoxia on membrane potential and intracellular calcium in rat neonatal carotid body type I cells. J. Physiol. London, 476: 423-428. Buerk, D.G., P.K. Nair, and W.J. Whalen (1989) Two cytochrome metabolic model for carotid body PtiO2 and chemosensitivity changes after hemorrhage. J. Appl. Physiol. 67: 60-68.
Chance, B. (1988) Early reduction of cytochrome c in hypoxia. FEBS Letters 226:343-346. Chugh, D.K., M. Katyama, A. Mokashi, D.E. Bebout, D.K. Ray, and S. Lahiri (1994) Nitric
oxide releases inhibition of carotid chemosensory nerve activity in the cat. Respir. Physiol. 97: 142-156. Katayuma, M., D.K. Chugh, A. Mokushi, D.K. Ray, D.E. Bebout, and S. Lahiri (1994) NO
mimics in the carotid body chemoreception. In Arterial chemoreceptors: Cell to System. (R.G. O'Regan, P.Nolan, D.S. McQueen, and D.J. Paterson, eds.) Plenum, New York, pp. 225-227. Koch, C.J., E.M. Lord, I.M. Shapiro, R.I. Clyman, and S.M. Evans (1997) Imaging hypoxia and blood flow in normal tissue. Adv. Exptl. Med. Biol. 428: 595-603. Lahiri, S., W.L. Rumsey, D.F. Wilson, and R. Iturriaga, (1993) Contribution of in vivo microvascular in the cat carotid body chemotransduction. J. Appl Physiol 75(3): 1035-1043. Laughlin, K.M., S.M. Evans, E.M. Lord, and C.J. Koch, (1996) Biodistribution of EF5 [2-(2-
nitro-IH-imidazole-1yl)-N-(2,2,3,3,3-pentafluoropropyl)acetamide] in BALB/c mice bearing EMT6 tumors: implications for oxygen measurements in normal and tumor tissues. J. Pharmacol. Exptl. Therapeut. 277: 1049-1057. Lubbers, D.W., H. Baumgäirtl, and W. Zimelka, (1994) Heterogeneity and stability of local distribution within brain tissue. In Oxygen Transport to Tissue XV (P. Vaupel, R. Zander, and D.F. Bruley, eds.) Plenum Press, NY, pp.567-574.
643
Olano, M., D. Song, S. Murphy, D.F. Wilson, and A. Pastuszko, (1995) Relationships of
dopamine, cortical oxygen pressure, and hydroxyl radicals in brain of newborn piglets during hypoxia and posthypoxic recovery. J. Neurochem. 1205-1212. Rumsey, W.L., M. Pawlowski, N. Lejavardi, and D.F. Wilson, (1994) Oxygen pressure distribution in the heart in vivo and evaluation of the ischemic "border zone”. Am. J Physiol. 266: HI676-1680.
Shonat, R.D., D.F. Wilson, C.E. Riva, and M. Pawlowski, (1992) Oxygen distribution in the retinal and choroidal vessels of the cat as measured by a new phosphorescence imaging method. Applied Optics 33: 3711-3718. Silver, I.A (1975) Tissue responses to hypoxia, shock and stroke. Adv. Exptl Med. Biol. 75,. 325-333. Vanderkooi, J.M., G. Maniara, T.J. Green, and D.F. Wilson. (1987) An optical method for measurement of dioxygen concentration based on quenching of phosphorescence. J. Biol. Chem. 262: 5476-5482. Vinogradov, S.A., L.-W. Lo, W.T. Jenkins, S.M. Evans, C. Koch, and D.F. Wilson, (1996) Non invasive imaging of the distribution of oxygen in tissue in vivo using near infra-red phosphors. Biophys. J. 70, 1609-1617.
Whalen, W.J. and P. Nair, (1977) Factors affecting consumption of the cat carotid body. I n "Chemoreception in the Carotid Body", (H. Acker, S. Fidone, D. Pallot, C. Eyzaguirre, D.W. Lubbers, and R.W. Mm Hgance, eds.) Springer-Verlag, Berlin, Germany. pp 271278. Whalen, W.J. and P. Nair, (1983) Oxidative metabolism and tissue of the carotid body. In: Physiology of the Arterial Perpheral Chemoreceptors, (H. Acker and R.G. O'Regan, eds.) Amsterdam, Elsevier, pp.117-132.
Wilson, D.F., M. Erecinska, C. Drown, and I.A. Silver, I.A. (1979) The Oxygen Dependence of Cellular Energy Metabolism. Arch. Biochem. Biophys. 485-493. Wilson, D.F., Laughlin, K.M., Rozanov, C., Mokashi, A., Vinogradov, S.A., Lahiri, S., Koch
C.J., and Evans, S.M. (1998) Tissue oxygen sensing and the carotid body. Adv. Exptl. Med. Biol. 454: 447-454, 1998.
Wilson, D.F., W.L. Rumsey, T.J. Green, and J.M. Vanderkooi. (1988) The oxygen dependence of mitochondrial oxidative phosphorylation measured by a new optical method for measuring oxygen concentration. J. Biol. Chem. 263: 2712-2718. Wilson, D.F., A. Mokashi, D. Chugh, S.A. Vinogradov, S. Osanai, and S. Lahiri, (1994) The primary oxygen sensor of the cat carotid body is cytochrome of the mitochondrial respiratory chain. FEBS Letters, 351, 37-374.
644
REDOX-BASED INHIBITION OF
CHANNEL /
CURRENT IS NOT RELATED TO HYPOXIC
CHEMOSENSORY RESPONSES IN RAT CAROTID BODY Arijit Roy, Charmaine Rozanov, Anil Mokashi and Sukhamay Lahiri Department of Physiology, University of Pennsylvania School of Medicine, Philadelphia, PA 19104-6085, USA
1.
INTRODUCTION
Findings to-date are incomplete and controversial as to how hypoxia is sensed by the carotid body. According to various authors the primary sensor could be the channel (Lopez-Barneo et al., 1988) or the heme-linked Cytochrome P-450 (Hatton and Peers, 1996) or NADPH oxidase (Acker et al., 1989) or the mitochondrial electron transport chain (Anichcov and Belen’kii, 1963; Duchen and Biscoe, 1992; Mulligan et al., 1981; Wilson et al., 1994). Keeping channel as the center of interest, recently various workers have proposed the idea of redox modulation of channel in the carotid body (CB) (Benot et al., 1993; Acker, 1994; LopezBarneo, et al., 1998) and pulmonary artery smooth muscle cells (PASMC) (Archer, et al., 1993) mimicking the effect of hypoxia on the oxygenregulated channels. It has been reported that voltage-dependent potassium channels contain amino acid residues, particularly cysteine which contribute to the gating behavior of channels by cycling between the reduced form, cysteine (Cys-SH) and the oxidized form cystine (Cys-S-S-Cys), based on the redox status of the cells (Ruppersberg, et al., 1991). Reducton or oxidation of sulphydryl groups on amino acid residues causes conformational changes in the channels and this would lead to closing or opening of the channels (Ruppersberg, et al., 1991). Further, it has been reported that hypoxia causes decrease production of ROS (Archer et al., 1993), leading to NADPH/NADP+ ratio increase. NADPH then reduces GSSG to GSH in a reaction catalysed by glutathione reductase Thus, hypoxia increases the ratio of
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
645
GSH/GSSG (Archer et al., 1986, Acker et al., 1992) and causes a reduced redox status of the cytosol and inhibits channels. Accordingly, channels are opened during normoxia and closed during hypoxia. In vitro application of reductants such as GSH (reduced glutathione) & DTT (dithiothreitol) inhibit channels, mimicking the effect of hypoxia; conversely oxidants, such as GSSG (oxidised glutathione), DTNB, activate channels (Yuan, et al., 1994; Lopez-Barneo et al., 1998). Moreover, the Shaker B channels, which are representative of the Kvl family of the voltage – dependent channels, contain cysteine residues that mediate the redox regulation of the channels and the changes produce by redox agents in Shaker and the channels are considered to be similar to those upon exposure of glomus cells to hypoxia (PerezGarcia, 1998). This is how hypoxia and oxidants/reductants can act on the channels through cytosolic redox based mechanism. The concept of redox modulation of channels is also involved to other oxygen sensors which are associated with the generation of ROS in the vicinity of the target molecules of the channel. These sensors are specific membrane bound oxidases namely, NADPH oxidase (Acker, et al., 1989) or the cytochrome P-450 oxidase (Hatton and Peers, 1996; Yuan et al., 1995). Besides, the plasma membrane oxidases the mitochondrial electron transport chain (ETC) is also a major source of ROS (Boveris et al., 1972; Turrens et al., 1985) and may play a critical role in modulating the channels (Acker, 1994; Archer, et al. 1993; Peers, 1997; Lahin & Acker, 1999).
The purpose of our present study was to assess whether redox based inhibition of the channels did correspond to carotid chemosensory excitation. We tested this hypothesis by recording (in vitro) CSN activities, which is regarded as the final manifestation of the CB chemotransduction cascade, using redox modulating agents, namely: (1) reductants GSH (reduced glutathione) and DTT (dithiothreitol), (2) imidazole antimycotic cytochrome P-450 inhibitors miconazole and clotrimazole. We restricted our study to assess the role of glomus cell plasma membrane sensors in redox modulation. Hence, no experimental effort was made to assess the contribution of mitochondrial ETC in modulating the channels.
2.
MATERIALS AND METHODS
Carotid bodies (CB) of five male adult rats (Sprague & Dawely) anaesthetized with sodium pentobarbitone (80-100 mg/kg body wt. initially, i.p.) were used. The whole CB in vitro, was used to monitor chemosensory discharge as a reliable index of chemoreception. CBs, attached to the common carotid artery bifurcations, were sequentially removed for studies in a perfusion -superfusion system, as described elsewhere (Roy, A. et al., 1997). Briefly, the whole carotid sinus nerve activity was recorded using a
646
platinum electrode with a differential amplifier, a notch filter and an electronic amplitude discriminator. Spikes were counted every half second by a frequency meter and displayed as analog signals on polygraph and as digital signals on a printer. The neural activities were also sampled on-line by a computer (Gateway EV700 with National Instruments PCI-MIO-16XE50 hardware) running customized Biobench NI-DAQ software (National Instruments Co.). The composition of the basic perfusate, the modified Tyrode with was (in mM) : sodium glutamate, 5.0 glucose, 5.0 HEPES and dextran 4g/L (mol. wt. 74,200). was adjusted to 7.4. Basal CSN activity was recorded during perfusion (by gravity) of the CB with control normoxic solution which was prepared from buffer equilibrated by bubbling with compressed gas containing 5% CO2 &
The hypoxic solutions (control and experimental) were prepared from 100% and saturated solutions made in same buffer and mixed in proportion to get the required hypoxic levels The temperature of all the solutions were maintained at Experimental CSN activities were recorded using normoxic and hypoxic solutions containing GSH (5 mM), DTT (5 mM), Miconazole and Clotrimazole The CBs were perfused and superfused initially (in vitro) with control normoxic solutions followed by hypoxia and then switched back to normoxia. This was followed by pre-perfusing the CBs with experimental normoxic solutions containing different redox compounds for 1-3 min and then perfusing with the respective experimental hypoxic solutions. The chemosensory activities were expressed as impulses per 0.5 second (imp/0.5 sec).
3.
RESULTS AND DISCUSSION
3.1
Effects of reductants on CSN activity (in vitro)
GSH: Figure 1A shows a representation of the CSN activity during in vitro perfusion of the CB with the reductant GSH. Basal chemosensory response was started with normoxia (248 imp/0.5s), followed by hypoxia which stimulated the neural activity to 634 imp/0.5s. Perfusion of CB with 5 mM GSHduring normoxia caused inhibition of CSN activity (181 imp/0.5s) below basal level and hypoxia stimulated it to 546 imp/0.5s. In spite of having same and also room for further stimulation, the hypoxic response with GSH was not maximum compared to control. Also, hypoxic inhibition
647
of the CSN activity with GSH was mainly due to decrease in basal neural response with GSH.
DTT: In a separate experiment, as shown in figure 1B, perfusion with another reductant DTT showed no detectable change in CSN activities during normoxia and hypoxia compared to respective controls. The steady state C S N responses during perfusion of the CBs with normoxia and hypoxia were 187 & 780 imp/0.5s respectively. Perfusion with 5 mM DTT did not change the normoxic and hypoxic CSN responses, which were 182 & 784
imp/0.5s respectively.
The above studies demonstrate that redox modulations of current by reductants GSH and DTT were unable to cause stimulation of CSN activity during normoxia.
3.2
Effects of Cytochrome P- 450 inhibitors on CSN activity (in vitro)
Miconazole: Perfusion of the CB with imidazole antimycotic P-450 inhibitor miconazole did not cause any dose and time dependent increase in CSN activities. Figure 1C shows exposure to of miconazole during normoxia caused inhibition of the CSN activities to 163 imp/0.5s compared to control (244 imp/0.5s). Hypoxic response was also diminished in presence of miconazole; Clotrimazole: Another P-450 inhibitor clotrimazole also caused inhibition of the basal neural responses with no apparent change in hypoxic chemosensory activities compared to control. Figure 1D shows the initial control normoxic (211 imp/0.5s) and hypoxic (733 imp/0.5s) responses without the drug. This is followed by perfusion with clotrimazole which caused a drop in the basal normoxic response (183 imp/0.5s) but hypoxic response remained uninhibited (739 imp/0.5s).
The above studies evidently show that hypoxic response was not mimicked by cytochrome P-450 inhibitors during normoxia. Hence redox modulation of channel through this system also did not comply with the hypothesis.
648
649
Lopez-Barneo et al.(1998) by patch clamp technique have demonstrated in rabbit glomus cells that hypoxia leads to a marked reduction in K+ channel activity and this effect was mimicked by reductants GSH and DTT during normoxia. Their data suggest that direct modulation of the channel by could be exerted through the regulation of the redox status of the channel molecule. Similarly in PASMC, hypoxia and sulfhydryl reagent (GSH also blocked the channels (Yuan et al., 1994). Also, redox modulation of channels through inhibition of Cytochrome P-450 showed a similar response like the reductants. Hatton and Peers (1996) have shown that cytochrome P-450 inhibitors miconazole and clotrimazole inhibited channels in rat type I cells and provided evidence that hypoxic inhibition of currents is mediated in part by cytochrome P-450. A similar view was reported by Yuan et al.(1995) in PASMC that P-450 system may play a role in the regulation of pulmonary vascular tone to the alteration of cellular redox status through a common pathway of channel activity. Recent works by Donnelley (1997), Osanai et al.(1997), Lahin et al. (1998) and Roy et al. (1998) have questioned the importance of classical channel as sensor, because blocking agents (eg. 4-AP, TEA, charybtoxin, low of the channels as found in the patch clamp studies (Lopez-Lopez et al., 1993; Chou and Shirahata, 1996; Hatton et al., 1997; Wyatt and Peers, 1995) on isolated type I cells failed to mimic the hypoxic chemosensory excitation of the whole CB. Hence, classical channels may not be related to hypoxic chemosensory activity. Our present findings are also in accordance with the above observation from the point of view C B sensory activity which is based on redox based modulation of channel. In our present communication we have dealt with modulation of the channels with reductants and with cytochrome P-450 inhibitors. In our first attempt we used two reductants GSH and DTT exogenously to simulate the effects of hypoxia on CSN activity. Considering that GSH and DTT reduce the amino acid residues of channel protein molecules and inhibit the channels, one would expect stimulation of CSN activity during normoxia. Moreover, hypoxia shouldn’t cause any further increase in neural response; because hypoxia no longer would affect channels that are already blocked by GSH and DTT. On the contrary GSH (5 mM) caused inhibition of the CSN activity during normoxia and could not mimic the hypoxic response, which was stimulated. DTP (5 mM) didn’t affect the normoxic neural activity and hypoxic response was also intact. There are no data available regarding the effects of GSH or DTT on glomus cell membrane potential and intracellular If GSH and DTT are blocking the same channel as observed with 4-AP and TEA, presumably they may not affect the resting membrane potential and intracellular calcium. Because, Buckler (1997) have shown that channel inhibitors TEA and 4-AP did not affect resting
650
membrane potential and basal intracellular level while anoxia caused marked increase in both. Therefore, it is possible that GSH and DTT may not stimulate the CSN activity inspite of reducing the channel protein molecules. In another set of experiments, we reported the effects of cytochrome P450 inhibitors miconazole and clotrimazole. Hatton and Peers (1996) showed that miconazole and clotrimazole inhibited as well as currents. They observed maximum inhibition of current at 3 min exposure to of miconazole. Moreover, the inhibitory effects of miconazole on current were significantly reversed by hypoxia and hypoxic inhibition of current prevented further inhibition in presence of the drug. These findings never matched with our sensory activity. First of all, manifestation of hypoxic stimulation of sensory activity took few seconds and reached a steady state response within a minute. Secondly, instead of stimulation both miconazole and clotrimazole inhibited the basal neural activity during normoxia and hypoxia stimulated the CSN discharge (Figs. 1C & D). These observations complicate the interpretation. If hypoxia causes less generation of ROS, channel inhibition and stimulates CSN activity, then inhibitors of cytochrome P-450, affecting ROS generation and inhibiting channel, would cause the same effect on CSN activity. Hatton and Peers (1996) also interpreted that hypoxia acting at P-450 caused a conformational change which prevented miconazole from binding as a result there was no further inhibition of the current by miconazole. If so, then miconazole should also prevent hypoxic inhibition of
hypoxia caused partial reversal of
4.
current but instead
current.
CONCLUSION
Reducing agents GSH & DTT and cytochrome P-450 inhibitors miconazole & clotrimazole, have been shown to inhibit channels by modulating the redox state of the carotid body glomus cells, mimicking the effects of hypoxia. But neither of these agents could stimulate the carotid chemosensory activity (in vitro) during normoxia and moreover hypoxic response was still evident. The probable reasons are: (1) the coupling of hypoxia to channel inhibition by redox modulation is not important to produce carotid chemosensory excitation, (2) though the channels are inhibited by the reductants and cytochrome P-450 inhibitors during normoxia, the sensor (unidentified) is not sensing low oxygen pressure and hence could be in the oxy-state (quiescent) and therefore couldn’t cause chemosensory excitation, (3) whereas, during hypoxia the sensor is
651
in the deoxy-sate (activated) and that ultimately could increase CSN discharge; this unique oxygen sensing mechanism is not influenced by classical channel inhibition or any conformation change of the channel molecules.
ACKNOWLEDGMENTS Supported in part by grants HL-43413-10, HL-50180-05 & T32HL-0702724.
REFERENCES Acker, H. 1994. Mechanism and meaning of cellular oxygen sensing in the organism. Respir. Physiol., 95:1-10.
Acker, H. Bolling, B., Delpiano, M.A., Dufau, E., Gorlach, A. and Holtermann, G., 1992. The meaning of generation in carotid body cells for chemoreception. J. Auton. Nerv. Syst. 41 :41-52. Acker,H. Dufau,H., Huber, J. and Sylvester, D. 1989. Indications to an NAD(P)H oxidase as a possible sensor in the rat carotid body.FEBS Lett. 256 : 75-78. Anichcov, S.V. and Belen’kii, M.L. 1963. Pharmacology of the carotid body chemoreccptors, Macmillan Publishing, NY. Archer, S.L., Huang, J., Henry, T., Peterson, D. and Weir, E.K. 1993. A redox-based sensor in rat pulmonary vasculature. Circ. Res. 73 : 1 1 0 0 - 1 1 1 2 .
Archer, S.L., W i l l , J. and Weir, E. 1986. Redox status in the control of pulmonary vascular tone. Herz, 1 1 : 127-141.
Benot, A.R., Ganfornina, M.D. and Lopez-Barneo, J. 1993. Potassium channel modulated by hypoxia and the redox status in glomus cells of the carotid body. In Ion Flux in Pulmonary Vascular Control (E.K. Weir et al., eds.), Plenum Press, New York, pp177-187. Buckler, K.J. 1997. A novel oxygen-sensitive potassium current in rat carotid body type I cells. J. Physiol., 498 :649-662. Bysani, G . K . , Kennedy, T.P., Ky, N., Rao, N.V. Blaze, C.A. and Hoidal, J.R. 1990. Role of cytochrome P-450 in reperfusion i n j u r y of the rabbit lung. J. Clin. Invest. 86 : 14341441. C h o u , C-L. and Shirahata, M. 1996. Two types of voltage-gated potassium channels in carotid body cells of adult cats. Brain Res. 742 :34-42.
Donelley, D.F. 1997. Are oxygen dependent
channels essential for carotid body chemo-
transduction? Respir. Physiol., 1 1 0 : 2 1 1 - 2 1 8 .
Duchen, M.R. and Biscoe, T.J. 1992. Mitochondrial function in type I cells isolated from rabbit arterial chemoreceptors. J. Physiol. 450 : 13-31.
Hatton, C . J . and Peers, C. 1996. Effects of cytochrome P-450 inhibitors on ionic currents in isolated rat type I carotid body cells. Am. J. Physiol. 271 : C85-C92. Hatton, C.J., Carpenter, E., Pepper, D.R., Kumar, P. and Peers, C. 1997. Developmental changes in isolated rat type I carotid body cell hypoxia. J. Physiol. 501: 49-58. Lahiri, S., Roy, A., Rozanov, C. and Mokashi, A. 1998.
currents and their modulation bby
current modulated by cells in rat carotid body is not a chemosensor. Brain Res. 794 : 162-165.
652
in type I
Lahiri, S. and Acker H. 1999. Redox-dependent binding to heme protein controls Po2 – sensitive chemoreceptor discharge of the rat carotid body. Respir. Physiol. 1 1 5 : 169-
177.
Lopez-Barneo, J., Lopez-Lopez, J.R., Urena, J., Gonzalez, C. 1988. Chemotransduction in the carotid body : current modulated by in type I cells. Science 242 : 580-582.
Lopez-Barneo, J., Montoro, R., Ortega-Saenz, P. and Urena, J. 1998. Oxygen-regulated ion channels : Functional roles and mechanisms. In Oxygen Regulation of Ion Channels and Gene Expression (J. Lopez-Barneo and E.K. Weir, eds), Futura Publishing
Company, Inc., Armonk, NY, pp 127-144. Lopez-Lopez, J.R., DeLuis, D.A. and Gonzalez, C. 1993. Properties of a transient
in chemoreceptor cells of rabbit carotid body. 460 : 15-32.
current
Osanai, S.. Buerk, D.G., Mokashi, A., Chugh, D.K. and Lahiri, S. 1997. Cat carotid body chemosensory discharge (in vitro) is insensitive to charybtoxin. 747 : 324-327.
Peers, C. 1997. Oxygen sensitive ion channels. Trends Pharmacol. Sci. 18:405-408.
Pere-Garcia, M.T., Lopez-Lopez, J.R. and Gonzalez, C. 1998. subunits can modulate the sensitivity to hypoxia of heterologously expressed voltage-gated channels in a
subfamily-specific manner. J. Physiol. 509P : 36P. Post, J., Weir, E., Archer, S. and Hume, J. 1993. Redox regulation of channels and hypoxic pulmonary vasoconstriction. In Ion Flux in Pulmonary Vascular Control, (E.K. Weir, J.R. Hume and J.T. Reeves, eds.), Plenum Press, NY., 189-204. Roy, A., Rozanov, C., Buerk, D.G., Mokashi, A. and Lahiri, S. 1998. Suppression of glomus cell conductance by 4-aminopyridine is not related to dopamine releaase and chemosensory discharge from carotid body. Brain Res. 785 :228-235. Roy, A., Rozanov, C., Itturiaga, R., Mokashi, A. and Lahiri, S. 1997. Acid-sensing by carotid
body is inhibited by blockers of voltage-sensitive calcium channels. Brain Res. 769 :
396-399. Ruppersberg, J.P.M., Stocker, O. Pongs, S.H., Heinemann, R.F. and Koenen, M. 1991. Regulation of fast inactivation of cloned mammalian channels by cysteine oxidation. Nature 352 : 711-714.
Wilson, D.F., Mokashi, A., Chugh, D., Vinogradov, S., Osanai, S. and Lahiri, S. 1994. The primary oxygen sensor of cat carotid body is cytochrome of the mitocondrial respiratory chain. FEBS Lett. 351 : 370-374. Wyatt, C.N. and Peers, C. 1995. channels in isolated type I cells of the neonatal rat carotid body. J. Physiol. 483 : 559-565. Yuan, X-J., Mary,L.T., Lewis, J.R. and Blaustein, M.P. 1994. Deoxyglucose and reduced glutathione mimic effects of hypoxia on and conductances in pumonary
artery cells. Am. J. Physiol. 267 : L52-L63.
Yuan, X-J., Mary,L.T., Lewis, J.R. and Blaustein, M.P. 1995. Inhibition of cytochrome P-450 reduces voltage-gated currents in pulmonary arterial myocytes. Am. J. Physiol. 268 : C259-C270.
653
This page intentionally left blank.
EFFECTS OF 2,4-DINITROPHENOL (DNP) ON THE RELATIONSHIP BETWEEN THE CHEMOSENSORY ACTIVITIES OF THE RAT CAROTID BODY AND THE INTRACELLULAR CALCIUM OF GLOMUS CELLS Peter A. Daudu*, Charmaine Rozanov, Arijit Roy, Anil Mokashi, and Sukhamay Lahiri Department of Physiology, University of Pennsylvania School of Medicine, Philadelphia, PA
19104-6085. USA
SUMMARY: To test the hypothesis that the uncoupler 2,4-dinitrophenol (DNP) increases equally well, independent of we studied the effects of DNP on and carotid sinus nerve (CSN) activity of rat carotid body (CB). CSN activity was measured in CB perfused and superfused with hypocapnic and normocapnic Tyrode solutions, of glomus (type I cells) was assessed by supervision techniques under identical conditions as for CSN recording experiments. The results indicate that
DNP increased
of type I cells as well as CSN activity at both
although alkalosis diminished these responses. Given that w i l l change with DNP did not make any additional change, although changed.
We conclude that DNP effects were due to relationship between
1.
change alone, and the
and CSN activity are internally consistent.
INTRODUCTION
Recently Buckler and Vaughan-Jones (1998) reported that in neonatal rat carotid body type I cells, DNP increased at of 7.4 to the same extent as at 7.7. The lack of a difference in at the two different levels of was surprising because of the expected change in as was changed in type I cells of the carotid body (Buckler and
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
655
Vaughan-Jones, 1993; Wilding et al., 1992; Mokashi et al., 1995). Thus, an increase of should have increased and consequently the response. Also, increase of should have decreased the CSN activity (e.g., Lahiri et al., 1996). One way of testing this was to measure the effect of DNP on the chemosensory activities at two different along with of glomus cells. Our hypothesis was that an increasing from 7.4 to 7.8 should have decreased and CSN activity, but the DNP effects were to increase the without modifying the pHi further. That is, the relationship between and CSN activity would be consistent.
2.
METHODS
The details of CB perfusion procedures with buffer have been described (Roy et al., 1998). Briefly, Charles River laboratory white rats (250-300 g) were anaesthetized with pentobarbital sodium, USP (80 100 mg/Kg of body weight, i.p.). The CB for perfusion experiments were mounted on a platinum electrode with intact CSN and submerged in paraffin oil. Each perfusion-superfusion experiment consisted of an initial stop-flow,
followed by control normoxic solution before and after the experimental solution.
The method for
measurements have been described (Mokashi et
al., 1998). The cells were pre-loaded with the fluorescent probe, Indo-1 AM
(Molecular Probes, Inc.) by incubating in a solution for 1 h at 25° C. It should be noted that the data for the CB perfusion experiments are based on the results of 4 or more observations; whereas those for measurements are based on 7 observations. In each case however, the t-test analysis was used and the experimental group mean values that differed from corresponding control mean values at were considered to be significant.
3.
RESULTS
Figure 1 depicts changes. The initial value of which averaged at the start of superfusion with normocapnic Tyrode solution was reduced to nM when the superfusion solution was made hypocapnic The levels were significantly increased to 253 nM in the presence of
DNP. However, the magnitude of DNP-induced increase (of 102 nM) observed during superfusion with hypocapnic solution
considerably lower.
656
was
657
Recordings of CSN discharge rates during one of the perfusion/superfusion with Tyrode solutions in the presence and absence of DNP are shown in Figure 2. During perfusion/superfusion with the normocapnic Tyrode solution alone the discharge rate ranged between 97 and 196 impulses/0.5 sec. Upon switching to the hypocapnic solution, the discharge rate was suppressed to between 30 and 90 impulses/0.5 sec. With the re-introduction of the normocapnic solution, the rate of discharge also returned to the original higher rate. Subsequently, in the next perfusion solution (normoxic normocapnic solution, with DNP introduced, the discharge rate was more than doubled. The steady-state mean and CSN discharge rates under the different experimental treatments are summarized in Table 1. At of 7.42, DNP stimulation of CSN activity was even greater. DNP also increased the at normal (7.42), but at of 7.80 the increase was relatively small. Thus, alkalosis diminished both and CSN activity, but the relationship between and CSN activity were internally consistent (Figure 3). The effects of DNP were not to change the while it changed the DNP-induced changes in and CSN discharge rate were lower under hypocapnia; at pH 7.42 the effect was shifted upward and was considerably higher. The relationship between the two variables with and without DNP were internally consistent. Table 1. Mean for presence and absence of
conditions, respectively.
4.
of type I cells (n = 7), and CSN discharge rates (n = 4) in DNP at the of 7.42 (normocapnic) or 7.80 (hypocapnic)
P < 0.05 (versus respective control)
DISCUSSION
The objective of the present study was to test the hypothesis that DNP increases of type I cells and the chemosensory activity of the rat CB equally, without further change of pHi. As summarized in Table 1, hypocapnic Tyrode buffer alone (pH0 7.80, without DNP) showed an overall
658
suppressive effect on both, the chemosensory activity and Additionally, the results clearly show that at DNP has excitatory effects on the chemosensory activity of the CB. These results are consistent with the data that have been reported in the literature for effect of alkalinization and of uncouplers such as DNP (Roy et al.,1997; Rocher et al.,1991; Eyzaguirre et al.,1989; Mulligan and Lahiri,1981). Taken together these results revealed that hypocapnia, DNP-induced changes in CSN discharge rates and in of type I cells were considerably lower compared to those changes observed in these parameters under normocapnia Table 1). This indicates that DNP effects on were achieved without further change of pH. However, DNP itself did not significantly add hut it increased as it is evident from Figure 3.
The exact mechanism of the excitatory effect of DNP on the CB has been very controversial. However, two working hypotheses have been proposed. In one hypothesis (Rocher et al., 1991), DNP is thought to function as a protonophor which enables it to make the cells reach equilibrium when falls to 6.48 (Roos and Born, 19981). The other hypothesis is that as a mitochondrial uncoupler, DNP induces membrane depolarization as a result of elevated The present results support the hypothesis that DNP did not behave as a protonophor; rather that the excitatory effect of DNP may be mediated through its mitochondrial uncoupling process as indicated by the elevation of (Figure 3). Overall, these results support the view that DNP-induced increases in of rat CB glomus cells and its excitatory
659
effects on CSN chemosensory activity may be related to its uncoupling characteristics resulting in elevation of cytosolic probably from both the mitochondrial store and extracellular sources (Duchen and Biscoe, 1992; Buckler and Vaughan-Jones, 1998). This in turn, caused the increase in chemosensory discharge rates in response to the elevated of glomus. Thus, these results agree with those reported by Buckler and Vaughan-Jones (1998) but, they differ in terms of change with change. This is consistent with and CSN activity change without additional changes due to DNP.
ACKNOWLEDGMENTS Supported by NIH grant T-32 HL 07027*, R01-HL 50180 and R37HL43413.
REFERENCES Buckler KJ and Vaughan-Jones RD 1998. Effects of mitochondrial uncouplers on intracellular calcium, pH and membrane potential in rat carotid body type I cells. J Physiol 513.3:819-833.
Eyzaguirre C, Monti-Bloch L, Baron M, Hayashida Y, and Woodbury JW. 1989. Changes in glomus cell membrane properties in response to stimulants and depressants of CSN discharge. Brain Research 477:265-279. Eyzaguirre C and Koyano H. 1965. Effects of hypoxia, hypercapnia, and on the chemoreceptor activity of the CB in vitro. J Physiol. 178:385-409. Fitzgerald R and Lahiri S. 1986. Reflex response to chemoreceptor stimulation. In: Handbook of Physiology. Section 3(the respiratory system Vol. 2) Fishman A..P. Ed . Am Physiological Society 1986, pp.313-1400. Gonzalez C, Almaraz L, Obeso A and Rigual R. 1994. Carotid body chemoreceptors: from natural s t i m u l i to sensory discharges. Physiol Rev 74(#4):829-898. Joels N and N e i l E. 1968. The idea of a sensory transmitter. In: Arterial Chemoreceptors, edited by R.W. Torrance. Oxford: Blackwell, 1968, p. 153-178. Kaila K, Mattsson K, Voipio J. 1989. Fall in and increase in resting tension induced by a mitochondrial uncoupling agent in crayfish muscle. J Physiol 408:271-293. L a h i r i S Iturriaga R, Mokashi A, Botre F, Chugh D, and Osanai S. 1996. Adaptation to
hypercapnia vs intracellular pH in cat carotid body : Responses in vitro. J Appl. Physiol. 80(4):1990-1099. Mokashi A, Ray D, Botre F, Katayama M, Osanai S and Lahiri S. 1995. Effect of hypoxia on intracellular of glomus cells cultured from rat carotid bodies. J Appl. Physiol. 78(5): 1875-1881. M u l l i g a n E and Lahiri S. 1981. Dependence of carotid chemoreceptor stimulation by metabolic agents on Pa o2 and Pa co2 . J Appl Physiol: Respirat. Environ. Exercise Physiol. 50(4):884-89l.
660
Obeso A, Almaraz L and Gonzalez C. 1985. Correlation between adenosine triphosphate levels, dopamine release and electrical activity in the CB: support for the metabolic hypothesis of chemoreception. Brain Res 348:64-68 Rocher A, Obeso A, Gonzalez C and Herreros B. 1991. Ionic mechanisms for the transduction of acidic stimuli in rabbit carotid body glomus cells. J. Physiol 433:533-548. Roy A, Rozanov C, Iturriaga R, Mokashi A, Lahiri S. 1997. Acid-sensing by carotid body is inhibited by blockers of voltage-sensitive Ca2+ channels. Brain Res. 769:396-399. Shirahata M, Andronikou S and Lahiri S. 1987. Differential effects of Oligomycin on carotid chemoreceptor responses to and in the cat. J Appl Physiol 63(5):2084-2092. Slater EC. 1967. Application of inhibitors and uncouplers for a study of oxidative phosphorylation. Methods Enzymology 10:48-57. W i l d i n g TJ, Cheng B, and Roos A. 1992. PH regulation in adult rat carotid body glomus cell. J. Gen. Physiol. 100:593-608.
661
This page intentionally left blank.
ESTIMATION OF CHEMOSENSITIVITY FROM THE CAROTID BODY IN HUMANS Tanaka M.,2Masuda A.,3Kobayashi T, and 4 Honda Y. 1 Miyazaki Pref. Nursing Univ., 2School of Allied Med. Sci., Tokyo Med. & Dental Univ., 3Dept. Hygiene, Fukushima Med. Univ. and 4Dept. Physiol, Chiba Univ., Japan 1
1.
INTRODUCTION
Based on the discoveries of carotid body chemosensitivities, Heymans and his colleagues (1930) initially claimed that all blood gas stimulations, i.e. elicit ventilatory excitation via the peripheral chemoreceptors. However, Comroe and Schmidt (1938) reported in the anesthetized dog that ventilatory response to was only slightly depressed after carotid sinus denervation. They further gave the animal gas mixture, measured the respiratory response of the whole animal, then collected arterial blood at the height of hyperpnea and perfused it through the isolated carotid bodies of the same animal. The magnitude of ventilatory augmentation, thus obtained, was far less than that obtained of the whole animal. Heymans and Neil summarized evidences on this point in 1958 that most of the investigators do not consider any more that Heyman’s viewpoint is correct (cited from Comroe’ Review, 1964). Because ventilatory response is sensitive to anesthesia and exhibits species difference, the role of chemosensitivity played by the carotid body in awake humans may deserve to be investigated.
2.
MATERIALS AND METHODS
We measured ventilatory response curves in control (C) and carotid body (CB)-resected patients. The difference between both groups
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
663
was considered to represent the chemosensitivity of the CB. Patients were further subdivided into bi- and unilateral CB resection (defined BR and UR, respectively). Six BR, 7 UR and 5 C patients were examined. They underwent surgery for a treatment of intractable bronchial asthma. The present examination was conducted two to three decades after operation while the patient were practically asymptomatic. Their pulmonary functions were normal in VC and blood pH but slightly impaired in and blood Therefore, C patients were chosen so as to match in age and the pulmonary function of CB- resected patients. ventilation response curve was determined by a steady state method. Initially, the resting was elevated 2-3 mmHg from the resting level for several min, then was further elevated by 2-3 mmHg and lasted several min. The last 1 min period in this exposure duration was used to obtain and This procedure was repeated 3-4 times with consecutively 3-4 mmHg elevation in Thus, from all VE plots obtained from above 3-4 runs, steady state ventilation response curve was calculated and its slope was defined S. In each subject, the response curve was determined in slight and moderate hypoxia above 200 and 60 mmHg, respectivily). S obtained from BR, UR and C was defined and , respectively.
3.
RESULTS
As shown in Table 1, the mean and were 65and 75 % of respectively, whereas these values were 62 and 80 % of the in moderate
hypoxia. Thus, roughly speaking, chemosensitivity was lost to the extent of 20 and 40% after uni- and bilateral CB resection, respectively. Fig. 1 also illustrates the magnitude of ventilation response slopes in three patient groups, together with the actual recording of the ventilatory responses in one BR patient.
4.
DISCUSSION
We found that the slope of CO2-ventilation response curves were depressed in graded step with increasing the number of carotid body resected. Thus, 20 to 40% depression in chemosensitivity was estimated after CB resection. Studies similar to ours were conducted on the patients with carotid endarterectomy by Wade et al. (1970). They
664
Table 1. Slope of ventilation response curve in patients with biand unilateral carotid body resection and control patients
ventilation response slope in patients with bilateral carotid body resection.
ventilation response slope in patients with unilateral carotid body resection. ventilation response slope in patients with matched pulmonary function.
Values are
To express % magnitude, values of the control patients are
taken as 100%.
n: number of patients in each group.
665
666
compared the steady state ventilation response curve before and 3-38 days after surgery. Unfortunately, quantitative values for the response slope were not presented. However, judging from the response curves illustrated in their figures, the post-operative response slope was moderately diminished, practically unchanged and slightly elevated in 3, 2 and 2 patients, respectively when examined under hyperoxic condition above 200mmHg). On the other hand, these distributions were 5, 1 and 1 patients, respectively, under hypoxic condition 60mmHg). Interestingly, the chemosensitivity showed no definite change after unilateral carotid end arterectomy. This was in contrast with our results obtained chronically CB-denervated patients. Therefore, the results from acute CB-denervation appear more inconsistent than the chronic one. In 1973, Edelman et al. tried to assess peripheral chemosensitivity by the transient method. Five healthy subjects administered single breath of 6 to 20% gas mixtures many times and peak against the biggest ventilation within 15 sec following the single breath was plotted. Mean ventilation slope thus obtained was 33% of the whole body response slope. Transient vs, steady state method used by Edelman et al. and ours involve different advantage and disadvantage, respectively. In the transient method, magnitude of CB excitation in response to transient stimulation was directly determined whereas our steady state method compared the control and CB-resected patients. Since these patient groups were consisted of different individuals, our estimation may be suffered by inter-individual variation. On the other hand, effect of CB stimulation has been demonstrated to be phase locking response, i. e. ventilation is effectively augmented only during inspiratory period. This was first discovered in cats by Band (1970) and confirmed also to be the case in healthy humans (Chen and Honda, 1992). Since peak blood induced by single breathing can not be expected to invariably and fully stimulate the CB due to variable lung to CB circulatory delay, transient ventilatory response assessed by Edelman et al. may be the matter of inconsistent response. They also observed that one of 5 subjects exhibited same ventilatory slope in both transient and steady state method, so that excluded from the experimental data. Taken together, despite excluding the carotid body, both those of Edelman et al. and ours indicated that about 30% of the whole body chemosensitivity is shared by the CB. Finally, since our BR and UR patients were tested response after two to three decades from the surgery, one might argue that CB function may have recovered to some extent during long postoperative periods, as reported in cats by Smith and Mill (1980) and in ponies by Bisgard et al. 667
668
(1980). If this is the case, CB chemosensitivity might have overestimated in our study. However, we previously tested the CB ventilatory chemosenseitivity in the BR patient by inhaling the amount of vital capacity gas mixture with high and low or combined both (single VC breath test). As shown in Fig. 2, CB chemosensitivity detected by this
method were severely depressed by the same extent in both acute and chronic CB resection (Honda, 1993). Therefore restoration of CB chemosensitivity seems unlikely in our patients.
15.
CONCLUSION
About 1/3 of induced hyperventilation was estimated to be induced from the carotid body activity in awake humans.
REFERENECE Band, D. M., Cameron, I. R. and Semple, S. J. I., 1970, The effect on respiration of abrupt changes in carotid artery and in the cat. J. Physiol. 211:479-494. Bisgard, G. E., Forster, H. V. and Klein, J. P., 1980, Recovery of peripheral chemoreceptor function after denervation in ponies., J. Appl. Physiol. 49: 964-970.
Chen, K. D. and Honda, Y., 1992, Evidence for phase-locking response to hypoxia in peripheral chemoreceptor activity in man. Jpn. J. Physiol. 42: 705-710. Comroe, J. H. Jr. and Schmidt, C. F., 1938, The part played by reflexes from the carotid body in the chemical regulation of respiration in the dog. Am. J. Physiol. 121: 75-97. Comroe, J. H. Jr., The peripheral chemoreceptors. In Handbook of Physiology, Section 3 Vol. 1 Respiration, 1964, Am. Phyiol. Soc., Washington, D.C. pp557-583. Edelman, N. H., Epstein, P.E., Lahiri, S. and Cherniack , N. S., 1973, Ventilatory response to transient hypoxia and hypercapnia in man. Respir. Physiol. 17: 302-314. Heymans, C., Bouckaert, J.J., and Dautreband, L., 1930, Sinus carotiden et reflexes respiratories. II. Influences respiratoires reflexes de 1’ acidose, de l’alcalose de l’anhydride carbonique, de 1’ion hydrogene et de 1’anoxemie. Sinus carotidien et echanges respiratoires dans les poumons et au de la des poumons. Arch. Intern. Pharmacodyn. 39: 400-450.
669
Honda, Y., 1993, Ventilatory activities in humans vs some other mammals after carotid body resection. Funktionanaluse biologischer Systeme 23: 313-317. Smith, P. G. and Mills, E. 1980, Respiration of reflex ventilatory response to hypoxia after removal of carotid bodies in the cat. Neurosci. 5: 573-580. Wade, J. G., Larson, C. P. Jr., Hickey, R. F., Ehrenfeld, W. K. and Severinghaus, J. W., 1970, Effect of carotid endarterectomy on carotid chemoreceptor and baroreceptor function in man.
J. Med. 282: 823-829
670
New. Engl.
ADENOSINE-DOPAMINE INTERACTIONS AND VENTILATION MEDIATED THROUGH CAROTID BODY CHEMORECEPTORS Emília C. Monteiro and 1J. Alexandre Ribeiro Department of Pharmacology, Faculty of Medical Sciences, New University of Lisbon, 1
Laboratory of Neurosciences, Faculty of Medicine, University of Lisbon, Lisbon, Portugal
1.
INTRODUCTION
Interactions between adenosine and the dopaminergic system were initially described by Green et al. (1982). They observed that the injection of adenosine agonists into the rat neostriatum after administration of the dopamine agonist, apomorphine, induced turning behaviour similar to that observed after lesioning of the dopaminergic nigrostriatal pathway. More direct evidence for the functional relevance of the interaction was provided by the observation that the ability of agonists to inhibit acetylcholine release in the striatum was reduced after activation of receptors (Jin et al., 1993). It is worth noting that the receptormediated inhibition of dopamine release is not significantly altered by activation of striatal receptors (Jin et al., 1993). The link between the and receptors is also supported by the results of in situ hybridisation and morphological studies, which suggest that receptors are colocalised in the striatum. As with dopamine receptors (Gerfen et al., 1990), receptor mRNA is strongly expressed in GABAergic-enkephalin striatopallidal neurones (Schiffmann et al., 1991). In 1983, Ribeiro and McQueen described that adenosine enhances the inhibitory effect of dopamine on carotid body chemosensory receptors. This effect was interpreted as a consequence of adenosine receptor activation sensitising the dopamine receptors of the chemosensory nerve terminals. It is well accepted that dopamine is a major neurotransmitter in the function of carotid body chemosensory activity ( e.g. Gonzalez et al., 1994) and it has also been proposed since 1981 that adenosine increases cat carotid
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
671
body chemoreceptor activity (McQueen and Ribeiro, 1981) through activation of adenosine receptors (McQueen and Ribeiro, 1986). Also in the rat, determining carotid body chemoreceptor activity through measurements of ventilation, these excitatory actions of adenosine have been observed (Monteiro and Ribeiro, 1987), and even that this adenosine receptor has pharmacological characteristics of an adenosine receptor (Monteiro and Ribeiro, 1991). Studies on adenosine receptor gene expression at the carotid body revealed that there is an intense adenosine receptor mRNA in the carotid bodies of fetal and adult rats (Weaver, 1993),
supporting that this receptor has a major role in the adenosine excitatory effect on carotid body chemoreceptor activity. If has been recently advanced that adenosine could exert a crucial modulatory role in the activation of receptors for several neurotransmitters and/or neuromodulators such as the nicotinic auto-facilitatory receptors present in the rat motor nerve terminals (Correia-de-Sá and Ribeiro, 1994a), the receptors for the calcitonin gene related peptide (CGRP) (Correia-de-Sá and Ribeiro, 1994b) as well as for other transmitters (see e.g. Ribeiro, 1999).
1.1
Aims
The present work was undertaken to know whether adenosine could modify the effect of dopamine as well as if dopamine modifies the action of adenosine on spontaneous ventilation, in the absence and during common carotid occlusions.
2.
METHODS
Experiments were performed on Wistar rats weighing approximately 400g, anaesthetized with sodium pentobarbitone (60 mg/Kg, i.p.) supplemented i.v. (right femoral vein) as required during the experiments. The animals were maintained in accordance with the European Union directives (Portuguese law The trachea was cannulated and spontaneous ventilation was monitored by a pneumotachometer (Hugo Sachs Elektronik, HSE 378) connected to a differential transducer (HSE validyne type). Respiratory airflow (V) was obtained by means of a bridge coupler (HSE 570) connected to the differential transducer. Respiratory frequency (f) and tidal volume were obtained from a respiratory rate coupler (HSE 568) and from an integrator coupler (HSE 572) respectively, triggered by V. The respiratory parameters f and V were recorded continuously on a HSE oscillographic thermo-
672
recorder Mark VII-C3. Respiratory minute volume was calculated as the product of Arterial blood pressure (BP) was monitored by means of a catheter (VYGON 160-10) introduced into the right femoral artery connected to an Isotec (HSE) pressure transducer. BP was recorded continuously on a HSE oscillographic thermo-recorder Mark VII-C1, by means of an amplifier HSE 570. In some experiments heart rate (HR) was obtained using a cardiotachometer coupler (Sanborn 350-3400 A) triggered by the pressure pulse and recorded continuously on a Hewlett Packard 7700 recorder. All the animals were bilaterally vagotomized before starting the experimental protocols. Drug administration. Intracarotid (i.c.) injections/infusions of drugs were made through a steriflex catheter (Vygon 160-07) introduced via the right external carotid artery with its tip positioned into the common carotid artery just below the bifurcation. Intravenous injections/infusions of drugs were made into the right jugular vein. Drug bolus injections were made in a volume of 0.1 ml and washed in with 0.2 ml 0.9% w/v aqueous sodium chloride (saline) warmed solution. The intervals between drug injections will be at least 5 min. Drug infusions were made using a Treonic IP5 digital perfusion pump at a rate of 0.5 ml/min for 3 min and injections of test drugs were performed at the beginning of the 2nd min. Bilateral common carotid occlusions (CCOs). Both common carotid arteries were dissected approximately 1 cm below the bifurcation, and the bilateral arterial lumen was occluded by pulling simultaneously a surgical silk placed around each common carotid artery at this level, taking care to avoid stretching the carotid bifurcation. Experimental protocols in the absence of ischaemia. In a group of rats, three cumulative and consecutive dose-response curves for the effects of dopamine (i.v.) were obtained during saline (control and post-control curves) and test drugs i.c. infusions. In another group of experiments, two cumulative and consecutive dose-response curves for the effects of i.c. injections of adenosine were performed: one before and the other starting 5 mm after i.v. injection of domperidone. Experimental protocols during of 5, 10 and 15 s were performed in the beginning of the third minute of drug infusions with intervals of at least 5 min. The respiratory effects induced by were obtained during i.c. infusions of test drugs or their vehicles (saline). Statistical analysis. Results are expressed as mean values SEM. Student's paired t-test was used to compare the respiratory and cardiovascular parameters before and after each test drug administration. Probability values corresponding to or less, were considered statistically significant.
673
Drugs Drugs were prepared in 0.9% w/v aqueous sodium chloride (saline) solution except for domperidone which was made up in a 10%. HC1 0.01N/saline solution. The drugs used were: sodium pentobarbitone (Abbott, Chicago, IL, USA), adenosine and dopamine (Sigma, St. Louis, MO, USA), l,3-dipropyl-8(p-sulfophenyl)xanthine(DPSPX) and domperidone (RBI, Wayland, MA, USA).
3.
RESULTS
Effects of dopamine in the presence of adenosine The effects of i.v. bolus injections of dopamine (100 nmol) on f, HR and BP of a rat, in the absence and in the presence of i.c. infusions of adenosine (10 nmol/min) are illustrated in Figure 1. Dopamine inhibited both and f and caused an increase in BP and HR. Adenosine, infused i.c. in the dose of 10 nmol/min, caused no apparent effects on both respiratory and cardiovascular parameters but facilitated the inhibitory effect of dopamine on and f (Fig. 1). The inhibitory effect caused by dopamine on f and was not observed after bilateral section of the carotid sinus nerve (not shown).
674
The effects on
obtained in five experiments are quantified in Figure 2.
Dose-response curves for the effects of dopamine (1-100 nmol, i.v.), on respiratory minute volume were performed in the absence and in the presence of adenosine (10 nmol/min), infused i.c. The inhibitory effect caused by dopamine on was reproducible when three cumulative doseresponse curves were performed in the same rat (Fig. 2 left panel). A shift to the left on the dose-response curve for the effects of dopamine on was observed when dopamine was injected in the presence of i.c. infusion of adenosine (10 nmol/min, n=4). The increases in BP and HR caused by i.v. bolus injections of dopamine (10-100 nmol) were also quantified in the absence and during adenosine (10 nmol/min) i.c. infusions. No apparent differences between the effects of dopamine on BP before and during adenosine were found. In the experiments (n=4) where adenosine (10 nmol/min) was infused i.c. during
675
the second dose-response curve for dopamine, the increases in BP obtained respectively for doses of dopamine of 10, 30 and 100 nmol were, in the absence of adenosine, and and during adenosine, and In control experiments (n=2) two cumulative and consecutive doseresponse curves for dopamine (10-100nmol, i.v.) were both performed during i.c. infusion of saline, and the increases in BP observed, respectively for doses of dopamine of 10, 30 and 100 nmol, were 7%; 9% and 37% for the first curve and 7.5%; 11.5% and 22% for the second curve. Increases in HR were also detected with high (100 nmol) doses of dopamine. In three experiments the average increase in HR caused by 100 nmol of dopamine i.v. was beats/min and was different Student’s paired t-test) from the increase observed in the presence of adenosine.
Effects of dopamine in the presence of an adenosine receptor antagonist 1,3-dipropyl-8-(p-sulfophenyl)xanthine (DPSPX)
In this group of experiments injections of dopamine were performed during i.c. infusion of an adenosine receptor antagonist, DPSPX. DPSPX was used, since it antagonises the excitatory effects on respiration caused by common carotid occlusions (CCO) (Monteiro and Ribeiro, 1989a), and the excitatory effect on respiration of substances that increase the levels of endogenous adenosine (Monteiro and Ribeiro, 1989b). DPSPX is a potent water soluble antagonist for adenosine receptors, is almost devoid of central stimulant properties, and penetrates poorly into cells (Daly et al., 1985). The effects of i.v. bolus injections of dopamine (100 nmol) in a rat before and during i.c. infusion of DPSPX (100 nmol/min, i.c.) on f, HR and BP are shown in Fig.3A. In the experiment shown (Fig.3A) the adenosine antagonist, DPSPX, reduces the inhibitory effect of dopamine on f and From the dose-response curves (Fig.3B) for the effects of cumulative i.v. bolus injections of dopamine (l-100nmol) on (n=3) it is also apparent that DPSPX shifted to the right the dose-response curve for dopamine on In the experiment illustrated in Fig. 3A, DPSPX, apparently, enhances the increase caused by dopamine (100 nmol i.v.) on HR and BP. However, when data on BP and HR were averaged (n=4), no significant differences were detected. The percentage increase in BP obtained (n=4) with 10; 30 and 100 nmol of dopamine were respectively and during saline i.c. infusions and and during DPSPX i.c. infusion. BP values before dopamine injection, respectively during saline and adenosine infusion were and
676
The HR increases (beats/min) obtained (n=4) with 30 and 100 nmol of dopamine were respectively beats/min and beats/mm during saline i.c. infusion and beats/mm and beats/mm during DPSPX (100 nmol/min) i.c. infusions. HR values immediately before dopamine injections during saline and DPSPX infusions were beats/min and beats/min.
Effects of exogenous adenosine in the presence of domperidone
These experiments were performed in order to investigate whether the excitatory effect of adenosine on ventilation was modified by blockade of dopamine receptors. Dose-response curves for the effects of i.c. bolus injections of adenosine (0.1-100 nmol) on were obtained in six rats (Fig.4). Two cumulative and consecutive dose-response curves for adenosine were performed in each rat: one before and the other starting 5 min after the i.v. injection of domperidone Domperidone was used as a dopamine receptor antagonist devoid of central effects.
677
As expected, adenosine by itself (0.1-100nmol, i.c.), caused excitatory
effects on due to increases in both and f (Fig.4). In the dose of 100 nmol, adenosine increased by (Fig.4), which is consistent with the values obtained previously (Monteiro and Ribeiro, 1987). Domperidone shifted to the right the dose response curve for adenosine on (Fig. 4). All the increases in caused by adenosine in the presence of domperidone were consistently less pronounced, although only the differences between the effects caused by 1 and 100 nmol of adenosine
achieved statistical significance (Fig.4). The maximal effect caused by adenosine (100 nmol) on in the presence of domperidone was (n=6) (Fig. 4). Domperidone by itself caused an increase of in which is maximal after its injection. This excitatory effect is short lasting, disappearing during the second min after domperidone administration. Dopamine was administered at the end of the experiment to test the efficacy of domperidone. Dopamine (30 nmol, i.v.), injected before domperidone pre-treatment caused an inhibitory effect on after domperidone administration the same dose of dopamine caused almost no effect on decrease, n=8). The shift to the right observed in the dose response curve for the effects of adenosine on was not observed when two cumulative and consecutive dose-response curves for adenosine were performed in the absence of domperidone.
678
Effects of DPSPX and domperidone during common carotid occlusions
As previously described (Monteiro and Ribeiro, 1989a) bilateral occlusions of the common carotid artery (CCO) during short periods (5,10 and 15s), cause excitatory effects on and f (Fig.5).
These effects are almost totally abolished by bilateral section of the carotid sinus nerves (Monteiro and Ribeiro, 1989a). In Fig.5 are illustrated the effects of CCO in a rat, pre-treated with the dopamine receptor antagonist, domperidone (Fig.5b e c) during i.c. infusion of
DPSPX an adenosine receptor antagonist (Fig.5 c). ). The effects on
and f
caused by CCO during DPSPX i.c. infusions (Fig. 5 c) were less pronounced
than the similar effects obtained during saline i.c. infusion (Fig. 5 b) in the animal pre-treated with domperidone. In Fig.6 are represented data obtained from five experiments; it is apparent that DPSPX (100 nmol/min) decreased (27%, 12.5% and 33% of effect on respectively for CCO periods of 5, 10 and 15s) the excitatory effect induced by CCO on
in the rats pre-treated with domperidone
This effect of DPSPX was also observed in animals nontreated with domperidone (Monteiro and Ribeiro, 1989b), though the effect of DPSPX was consistently higher (37%, 26% and 42% of effect on
679
respectively for CCO periods of 5, 10 and 15s) than in the domperidone pre-
treatcd rats. Domperidone (100 nmol/Kg i.v.) by itself modified (see Fig.5a and b) the
excitatory effect on
680
caused by CCO during i.c. saline infusions.
animals. Blockade of dopamine receptor with domperidone caused a slight but consistent and statistically significant increase in the excitatory effect of CCO on (Fig.7).
4.
DISCUSSION
The changes in the inhibitory effect of dopamine on ventilation mediated by carotid body chemoreceptors caused by intracarotid infusion of adenosine or its antagonist, DPSPX, together with the modifications operated by antagonizing the dopamine receptor with domperidone on the excitatory response of ventilation to adenosine, is highly suggestive that interactions between adenosine and dopamine receptors occur at the carotid body chemoreceptors. Also in ischemic conditions, where levels of endogenous adenosine are greatly enhanced, dopamine receptor antagonism is attenuated by blocking adenosine receptors, suggesting that receptor interactions are involved in increasing ventilation during ischemia. These effects are not centrally mediated since neither adenosine, nor the adenosine antagonist, DPSPX, andthedopamine antagonist domperidone, cross the blood brain barrier. This interaction adenosine/dopamine probably occurs at the carotid body, since adenosine, which has a very short (10 s) half life, infused in a small dose close to the carotid bifurcation, only achieved significant concentrations at this level; the excitatory effects of adenosine and the
inhibitory effects of dopamine on ventilation were abolished after bilateral section of the carotid sinus nerve; the excitatory effect on ventilation induced by short periods of ischemia is prevented by bilateral section of the carotid sinus nerves. The increases in BP and HR caused by dopamine were in some animals slightly enhanced by adenosine but without achieving statistical significance. These cardiovascular effects of dopamine were not abolished by carotid sinus nerve section, suggesting that adenosine, infused i.c, did not modify the effects of dopamine in the vessels and/or the heart. The adenosine receptor involved in the excitatory action of this nucleoside on chemoreceptor activation of ventilation is an adenosine receptor (McQueen and Ribeiro, 1986; Ribeiro and Monteiro, 1991) of high affinity named (e.g. Monteiro and Ribeiro, 1991), it is likely that the presently described interaction is a consequence of an interaction. The way this receptor-receptor interactions occurs is not a result of the excitatory action of adenosine inhibiting an inhibitory action of dopamine on ventilation, but the enhancement obtained when both receptors are activated suggest other possibilities. In PC 12 cells, an sensitive
681
pheochromocytoma cell line, adenosine potentiates ATP-evoked dopamine release. However, this potentiation is achieved via a pertussis-sensitive and cAMP independent mechanism (Koizumi et al., 1994). Both adenosine and dopamine inhibit currents in PC 12 cells (Conforti et al., 1999). The inhibitory effect of dopamine is independent of protein kinase A and appears to be mediated by Gi/o proteins that couple the
receptor to the
channel (Conforti et al., 1999). The inhibitory effect of adenosine stimulation on current is mediated by cAMP-PKA pathway (Conforti et al., 1999). homeostasis during hypoxia appears to be under the negative control of feedback pathways that are stimulated by both dopamine and adenosine released during hypoxia. Although the effect of both transmitters is inhibition of the hypoxia-induced increase in intracellular free via inhibition of voltage-dependent channels, different signal pathways appear to be involved (Conforti et al., 1999). Interactions between receptors and dopamine receptors have also been shown in the isolated rat nodose ganglion. Neither nor the other high affinity subtypes of adenosine receptors, modify the reponse to
dopamine (Lawrence et al., 1997). A major mechanism (see Fuxe et al., 1998) for direct intramembrane and receptor interactions may involve the formation of
and
heterodimers, leading to
allosteric changes that alter receptor affinity as well as G-protein coupling, and thus the efficacy to control the target proteins in the membranes. Fuxe et al., (1998) also speculated that multiple receptor-receptor interactions within membranes may lead to the formation of receptor clusters, which may be responsible for the storage of information, i.e., memory traces, in the membranes. Alterations of receptor binding after receptor activation have also been observed in a mouse fibroblast cell line co-transfected with (dog) receptor cDNA and (D2L human) receptor cDNA (Dasgupta et al., 1996). These transfection studies apparently did not involve adenylate cyclase, thus suggesting a possible intramembrane interaction (Dasgupta et al., 1996). In summary, these receptor interactions could occur as direct receptor-receptor interaction and/or through receptor mediated transducing mechanisms and beyond; the ability of adenosine modulation at interreceptor level reinforces the role of adenosine as a neuromodulatorhomeostatic substance at the carotid body level.
ACKNOWLEDGEMENTS We acknowledge Mrs. Fatima Pinto with the word processing of the manuscript.
682
REFERENCES Conforti, L., Kobayashi, S., Beitner-Johnson, D., Conrad, P.W., Freeman, T., Milhorn, D.E., 1999, Regulation of gene expression and secretory functions in oxygen-sensing pheochromocytoma cells. Respiration Physiology 115: 249-260. Correia-de-Sá, P., Ribeiro, J.A., 1994a, Tonic adenosine receptor activation modulates nicotinic autoreceptor function at the rat neuromuscular junction. Eur. J.Pharmacol. 271: 349-355. Correia-de-Sá, P., Ribeiro, J.A., 1994b, Potentiation by tonic
adenosine receptor
activation of CGRP-facilitated [3H]-acetylcholine release from rat motor nerve endings. By . J. Pharmacol. 111: 582-588. Daly, J.W., Padgett, W., Shamin, M.T., Buttts-Lamb, P., and Waters, J., 1985, l,3-dialkyl-8(p-sulfophenyl) xanthines: potent water-soluble antagonists for -adenosine receptors. J. Med. Chem. 28: 487-492.
Dasgupta, S., Ferré, S., Koll, B., Hendlung, P., Finnman, U.B., Ahlberg, S., Arenas, E., Fredholm, B.B., Fuxe, K., 1996, Adenosine receptors modulate the binding characteristics of dopamine in stably cotransfected fibroblast cells. Eur. J. Pharmacol. 316: 325-331. Fuxe, K., Ferré, S., Zoli, M., Agnati, L.F., 1998, Integrated events in central dopamine
transmission as analyzed at multiple levels. Evidence for na intramembrane adenosine and adenosine ganglia. Brain Res. Rev. 26: 258-273.
receptor interactions in the basal
Gerfen, C.R., Engber, T.M., Mahan, L.C., Susel, Z., Chase, T.N., Mosma, F.J.Jr., Sibley, D.R., 1990, dopamine receptor regulated gene expression of striatonigral and striaopallidal neurons. Science 250: 1429-1432.
Gonzalez, I., Almaraz., L., Obeso, A., and Rigual, R., 1994, Carotid body chemoreceptors: from natural stimuli to sensory discharges. Physiol. Rev. 74: 829-898. Green, R.D., Proudfit, H.K., Yeung, S.-M.H., 1982, Modulation of striatal dopaminergic function by local injection of 5'-N-ethylcarboxamide adenosine. Science 218: 58-61.
J i n , S., Johansson, B., Fredholm, B.B., 1993, Effects of adenosine
receptor
activation on electrically evoked dopamine and acetylcholine release from rat striatal slices. J. Pharmacol. Exp. Ther. 267: 801-808.
K o i z u m i , S., Watano, T., Nakazawa, K., and Inoue, K., 1994, Potentiation by adenosine of ATP-evoked dopamine release via a pertussis toxin-sensitive mechanism in rat phaeochromocytoma PC12 cells. Br. J. Pharmacol. 112: 992-997.
Lawrence, A.J., Krstew, E., Jarrott, B., 1997, Adenosine-dopamine receptor interactions in the
isolated rat nodose ganglion but not in membranes of dorsal vagal complex. NaunynSchmiedeberg's Arch. Pharmacol. 355: 303-308. McQueen, D.S, and Ribeiro, J.A., 1981, Effect of adenosine on carotid chemoreceptor activity in the cat. Br. J. Pharmac. 74: 129-136. McQueen, D.S, and Ribeiro, J.A., 1986, Pharmacological characterisation of the receptor involved in chemoexcitation induced by adenosine. Br. J. Pharmac. 88: 615-620. Monteiro, E.C., and Ribeiro, J.A., 1987, Ventilatory effects of adenosine mediated by carotid body chemoreceptors in the rat. Naunyn-Schmiedebargs's Arch Pharmacol. 335: 143-148. Monteiro, E.C., and Ribeiro, J.A., 1989a, Inhibition by l,3-dipropyl-8(p-sulfophenyl)xanthine of the respiratory stimulation induced by common carotid acclusion in rats. Life Sciences 45: 939-945. Monteiro, E.C., and Ribeiro, J.A., 1989b, Adenosine deaminase and adenosine uptake inhibitions facilitate ventilation in rats. Naunyn-Schmiedebargs's Arch Pharmacol. 340: 230-238.
683
Monteiro, E.C , and Ribeiro, J.A., 1991, Characterization of the receptor involved in the excitatory action of adenosine on respiration through carotid body chemosensors. XXI Meeting of the Portuguese Soc. Pharmacol.
Ribeiro, J.A., 1999, Adenosine
receptor interactions with receptors for other
neurotransmitters and neuromodulators. Eur. J. Pharmacol. 375: 101-113
Ribeiro, J.A., and Monteiro, E.C., 1991, On the adenosine receptor involved in the excitatory action of adenosine on respiration: antagonist profile. Nucleosides and Nucleotides 10: 945-953.
Ribeiro, J.A., and McQueen, D.S., 1983, On the Neuromuscular Depression and Carotid Chemoreceptor Activation Caused by Adenosine. In Physiology and Pharmacology of Adenosine Derivatives (J.W. Daly, Y. Kuroda, J.W. Phillis, H. Shimizu and M. Ui, eds) Raven Press, New York, pp. 179-188. Schiffmann, S.N., Jacobs, O., Vanderhaeghen, J.-J., 1991, Striatal restricted adenosine receptor (DRC8) is expressed by enkephalin but not by substance P neurons: an in situ hybridization histochemistry study. J. Neurochem. 57: 1062-1067.
Weaver, D.R., 1993,
adenosine receptor gene expression in developing rat brain.
Molecular Brain Research 20: 313-327.
684
CAROTID BODY NO-CO INTERACTION AND CHRONIC HYPOXIA Di Giulio C., Grilli A., Ciocca I., Macri M.A., Daniele F., Sabatino G., Cacchio M., De Lutiis M.A., Da Porto R., Di Natale F., and Felaco M. Department of Biomedical Sciences, Anatomy and Neonatology. School of Medicine University of Chieti, Italy
1.
INTRODUCTION
Carotid Body (CB) is a sensory neuroepithelial organ which regulates ventilation variations resulting from changes in blood and pH, so affecting gateway of respiratory neurons in the brainstem (Bisgard et al., 1995). Chronic hypoxia stimulates erythropoiesis, enlarges CB in humans and animals, and increases CB catecholamine content (Dalmaz et al., 1987). Cell response to chronic hypoxia involves changes in DNA-protein interaction, leading to gene expression alterations (Poyton, 1999). Particularly, vascular smooth muscle cells up-regulate hemeoxygenases-1 gene expression, resulting in increased production of Carbon Monoxide (Brian et al., 1994). The majority of CO is produced by hemeoxygenases 1 and 2 (HO-1) (HO-2) which cleaves the heme rings into CO and biliverdin (Suematsu et al., 1996). Hemeoxygenase-1 is induced by heme. It is highly concentrated in the spleen and liver, where it is responsible for destruction of heme deriving from red blood cells. Instead, heme oxygenase-2 is not inducible and it is distributed throughout the body and particularly in the nervous system (Verma et al., 1993). Like nitric oxide (NO), CO functions as an intracellular signaling molecule in a variety of biological systems. Also, CO seems to play a role in regulating the production of growth factors. Moreover, CO seems to increase cGMP production, so modulating CB sensitivity. Furthermore, CO has been shown to be important in neural signal transduction and may have endothelialderived relaxing activity (Weber et al., 1994). Indeed, simultaneous measurements of tissue dopamine and neural discharges from CB sinus nerves result in dopamine increase during excitation by CO (Buerk et al., 1997). Prabhakar (1999) reported an inhibitory sensory activity for HO-2 in the CB. Aim of the present work was to evaluate the effects of chronic hypoxia on HO-1 in the CB. Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers. 2000
685
2.
METHODS
Two groups of adult Wistar rats (weight 200-250 g) were used in the present study. One group was kept in room air and served as control. The other was kept in a Plexiglas chamber for 12 days in chronic hypoxia inspired oxygen). Chamber temperature and CO2 were kept in physiological ranges. Surgical procedures were carried out under Nembutal anesthesia (40 mg\kg ip) and aseptic conditions. Immunohistochemistry for HO 1 was used to quantify the reaction from heme to CO. Carotid bodies (CB) were removed from anesthetized rats and immersed (overnight) in ice-cold paraformaldeyde in 0,1 M phosphate buffered saline (PBS). Tissues were then rinsed in 15% sucrose PBS (1h) and stored at 4 °C in sucrose PBS (2h). Ten micrometer thick sections were cut using a cryomicrotome (Reichert-Jung Frigocut 2800), thaw-mounted on to microscope slides, fixed by immersion in acetone at 4°C for 5 mm and air-dried. Slides were stored at 4°C until use. For immunohistochemical staining of HO1, slides were preincubated in PBS for 5 min. and then with a rabbit polyclonal antibody to HO1 (E.C. 1.14.99.3; HO-1; heat shock protein 32 [hsp 32]). [The antiserum was] raised to a synthetic peptide corresponding to aminoacid residues of the human HO-1 protein (Affiniti Res. Prod. Ltd), which was diluted 1:100 in PBS and applied for 30 mm. at 37°C. Slides were then washed twice in PBS for 5 min. and in tris-HCl buffer, pH 7,6 for 10 min. A second peroxidaseconiugated antibody gout antirabbit IgG was added for 10 mm. and slides were again washed in PBS. The peroxidase label was developed using diaminobenzidine (DAB) dissolved in imidazole buffer, pH 7,6 for 6-10 min, washed in tris-HCl buffer, and dehydrated. Slides from staining procedures were mounted using glycerine, cover-slipped and photographed using a Leitz Dialux microscope. CBs densitometric analyses were carried out randomly, using a Sony Video Camera in connection with a Quantimet 500 Plus (Leica) determining the gray levels of intensity using ISO (transmission density standard Kodak CAT 152 3406) as standard.
3.
RESULTS AND DISCUSSION
The distribution of hemeoxygenases was studied. Fig. 1 and 2 show an example of HO-1 distribution in a control carotid body and in the carotid body after chronic hypoxia. Immunohistochemistry for HO-1 showed that: CB synthesize CO, hemeoxygenase-1 is present in CB, hemeoxygenase-1 activity increases during chronic hypoxia.
686
687
I I
!
688
Since CO activates guanylyl cyclase activity raising intracellular cGMP levels in normoxia, it could play a crucial role in regulating HO-1 during hypoxia (Lahiri et al., 1994). CO is a mediator of cell communication in CB. Activation of guanylate cyclase by CO depends on the presence of heme which forms a complex with CO. CO shows the ability to bind with the hemebinding protein, which has been implicated in the chromophore theory of chemoreception. CO can be formed by distinct constitutive and inducible forms. Because CO has been implicated as a neural messenger, hypoxia acutely increases the chemosensory discharge. Since aim of this study was to evaluate whether HO-1 is influenced by chronic hypoxia, we found that HO-1 protein is present in glomus cells of rat carotid body. Morita et al. (1997) showed that hypoxia induces HO-2 and produces CO to modulate expression of growth factors. Prabhakar et al. (1995) showed that acute hypoxia lowers CO formation, so contributing to increase in chemosensory discharge in CB. During chronic hypoxia, the behavior of HO-1 could be stimulated rather than inhibited. Therefore, acute and chronic hypoxia effect should be different, i.e. the long-term effect must initiate after acute stimuli. However, later, the response can change from inhibition to excitation. CO could represent the trigger for maintaining a basal firing of CB, thus balancing homeostasis. In this scenario, oxygen supply regulates the relation between neurotramitter release and CB chemodischarge. Prabhakar (1999) postulated that in normoxia CO maintains low levels of CB sensory discharge. In physiological conditions, oxygen may promote a certain amount of oxidative stress in glomus cells, so interfering with CO release. Acute hypoxia could inhibit HO-1, due to the reduced availability of During chronic hypoxia, HO-1 stimulation could partly explain chemoreceptor adaptation. If we consider that during chronic hypoxia NO and CO increase the level of cGMP and that both show an inhibitory effect on the chemosensory discharge, the increase in CB HO-1 may play a role in ventilatory homeostatic adaptation. Since chronic hypoxia stimulates nitric oxide synthase (Di Giulio et al., 1998) and tyrosine hydroxylase, nitrergic-dopaminergic and CO systems could be modulated by oxygen. However, further studies are necessary to elucidate link between all these systems.
REFERENCES Bisgard GE & Forster H (1995) Ventilatory responses to acute and chronic hypoxia. Handbook of Physiolgy: Environmental Physiology New York: Oxford University Press. pp 1207-39. Brian JE, Heistad DD & Faraci FM (1994) Effect of carbon monoxide on rabbit cerebral arteries. Stroke 25: 639-644. Buerk DG, Chugh DK, Osanai S, Mokashi A & Lahiri S (1997) Dopamine increases in cat carotid body during excitation by carbon monoxide: implications for a chromophore theory of chemoreception. J Auton Nerv Syst 67:130-136.
689
Dalmaz Y, Pequignot JM, Collet- Emard JM, Tavitian E & Peyrin L (1997) Sustained
enhancement of the catecholamine dynamics in rat carotid bodies, adrenals, sympathetic ganglia and target organs under long-term moderate hypoxia. Biomed Biochim Acta 46: 899902. Di Giulio C, Grilli A, De Lutiis MA, Di Natale F, Sabatino G & Felaco M (1998) Does chronic hypoxia increase rat carotid body nitric oxide? Comparative Biochemistry and Physiology 120A: 243-247 Lahiri S, Ray DK, Chugh D, Iturriaga R & Mokashi A (1994) CO-binding chromophores in oxygen chemoreception in the carotid body. In: O'Regan R et al (eds) Arterial Chemoreceptors: Cell to System. New York: Plenum Press. pp 149-153. Maulik N, Engelman DT,Watanabe M, Engelman RM, Rousou JA, Flack III JE, Deaton DW, Gorbunov NV, Elsayed NM, Kagan VE & Das DK (1996) Nitric oxide/Carbon monoxide. Circulation 94:398-406. MoritaT, Mitsialis SA, Koike H, Liu Y & Kourembanas S (1997) Carbon monoxide controls the proliferation of hypoxic vascular smooth muscle cells. The Journal of Biological Chemistry 272:32804-32809. Poyton RO (1999) Models for oxygen sensing in yeast: implications for oxygen-reculated gene expression in higher eucaryotes. Respiration Physiology 1 1 5 : 1 1 9 - 1 3 3 . Prabhakar NR, Dinerman JL, Agani FH & Snyder SH (1995) Carbon monoxide: A role in carotid body chemoreception. Neurobiology 92:1994-1997. Prabhakar NR (1999) NO and CO as second messengers in oxygen sensing in the carotid body. Respiration Physiology 115:161-168 Suematsu M,Wakabayashi Y & Ishimura Y (1996) Gaseous monoxide: a new class of microvascular regulator in the liver. Cardiovascular Research 32:679-686. Verma A. Hirsch DJ, Glatt CE, Ronnett GV & Snyder SH (1993) Carbon Monoxide: A putative neural messenger. Science 259:381-384 Weber CM, Eke BC & Maines MD( 1994) Corticosterone regulates Heme Oxygenase-2 and NO Syntase transcription and protein Expression in rat brain. Journal of Neurochemistry 63:953962.
690
INTERPLAY BETWEEN THE CYTOSOLIC INCREASE AND POTENTIAL CHANGES IN GLOMUS CELLS IN RESPONSE TO CHEMICAL STIMULI
Yoshiaki HAYASHIDA 1 , Katsuaki YOSHIZAKI2, Tatsumi KUSAKABE 3 Department of Systems Physiology, University of Occupational and Environmental Health, Yahatanishi, Kitakyushu 807-8555: 2Physiology and Chemistry Section, Akita University College of Allied Medical Science, Hondo, Akita 010-8543; 3Department of Anatomy, Yokohama City University, School of Medicine, Fukuura, Kanazawa, Yokohama 236-0004,
JAPAN
1. INTRODUCTION It is generally known that the carotid body gives rise to afferent discharges in response to changes in the chemical environment of the carotid artery. However, the detailed mechanism of the chemoreception remains unclear. There have been conflicting reports on cytosolic during carotid body stimulation; several studies have shown an increase in (Buckler and Vaughan-Jones, 1994; Duchen and Biscoe, 1992; Shirahata et al., 1997), while another showed a decrease under identical conditions (Donnelly and Kholwadwala, 1992). There is also no evidence regarding whether or not the changes in cytosolic during chemical stimulation occur uniformly in the carotid body glomerulus. Furthermore, there are also controversial results on voltage responses of glomus cells obtained in intracellular studies; many have reported the depolarization of glomus cells (Buckler and Vaughan-Jones 1994, Hayashida and Eyzaguirre 1979), while another showed hyperpolarization (Duchen and Biscoe 1992), when natural or chemical stimuli were applied. Figure 1 shows depolarization (a; -42mV of resting membrane potential) and hyperpolarization (b; -43mV of resting membrane potential) independent of the resting membrane potentials in two different glomus cells. Figure l(c) shows an interesting record in another glomus cell (resting membrane
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
691
potential; -69 mV). This cell first hyperpolarized by 12 mV for 2 min at an early phase after the administration sodium cyanide (NaCN), and then produced 4 depolarizations (amplitude; 20-38 mV, duration; 2 sec) during the recovery phase. Buckler and Vaughan-Jones (1994) have shown that anoxia-induced membrane depolarization coincided with an increase in by the simultaneous recording of both variables. However, it is not known whether changes when glomus cells hyperpolarize. Therefore, the purpose of this study was to examine how changes in cytosolic are linked to voltage changes in glomus cells induced by chemical stimulation.
2. METHODS Young Wistar rat (200g body weight) was anesthetized by pentobarbital sodium (50 mg/Kg, ip). Carotid bodies were excised and treated with collagenase (3mg/ml) at 37°C for min. Special care was taken to preserve intact clusters of glomus cells as much as possible during
692
mechanical fragmentation under a dissecting microscope. Clusters of glomus cells in culture medium were plated on coverglasses coated with poly-L-lysine (0.1mg/ml), and cultured in a incubator at 37 °C for 4 to 7 days. The culture medium was an ' essential medium (MEM; Gibco, USA) supplemented with fetal bovine serum (Gibco), 6.0 mg/ml of glucose, 50 penicillin G (Sigma, USA), 50 streptomycin (Sigma), 0.1 of nerve growth factor (Sigma) and 2.2 g/1 (pH 7.4). Glomus cells were loaded with fura-2 by incubation in 1 ml of culture medium containing 5-10 of the acetoxymethyl ester form of fura-2 (fura-2 AM; dissolved in dimethyl sulphoxide as a 1 mM stock solution) and 2 of non-cytotoxic detergent, Cremophor EL (Sigma), for 30 min at 37°C. Clusters of glomus cells grown on a coverglass were set in a chamber (0.5 ml) and superfused continuously with modified Krebs solution gassed by air and consisting of (mM) NaCl, 111; sodium glutamate, 14.7; 2576; KC1, 4.7; 2.2; _ 1.1; glucose, 5.6; pH 7.4 at pressure of the control solution; mmHg). The rate of superfusion was 0.8 m1/min, at which the solution in the chamber was completely replaced in half-time of 10s. A 30-min period was allowed for de-estenfication of fura-2 AM before the beginning of the experiments. Fura-2 fluorescence from each glomus cell with excitation at 340/380 nm was recorded at an interval of 1 s with an intensified video camera system (Attofluor RV, Carl Zeiss, Germany) attached to an inverted microscope (Axiovert 135; Carl Zeiss). The ratio (R380/340) of fura-2 fluorescence excited at 380 nm to that at 340 nm was converted to the absolute value of using a calibration curve of fluorescent intensities versus measured directly. One mM or 0.1 mM of either acetylcholine (ACh) or NaCN dissolved in superfusion solution was administered upstream into the perfusion system. Hypoxia was produced by switching the control solution to that gassed by nitrogen partial pressure; mmHg). -free solution was prepared by simply omitting and adjusting the osmolarity by altering
3. RESULTS 3.1. Effects of lowered
on
in glomus cells
Glomus cells responded to hypoxia with either an increase or a decrease in as shown in Fig. 2. The respective responses of 10 glomus cells to hypoxia were averaged in each recording. In these clusters, fewer glomus cells responded with an increase in than with a decrease No site-specificity was observed with regard to the responses of
693
glomus cells. Adjacent cells, to which the cell responded with an increase in
did not always respond to hypoxia with an increase in
3.2. Effects of ACh and NaCN on removal on the response
in glomus cells and
Figure 2 shows the effects of ACh and NaCN on in glomus cells. The respective responses of 10 glomus cells to ACh or NaCN were averaged in each recording. ACh and NaCN increased in glomus cells, dose-dependently. However, of the glomus cells examined did not respond to either of the chemical stimuli. Either ACh or NaCN increased in glomus cells under superfusion
with
free solution, although the magnitude of the increase in
was significantly less than that under the control solution ( and of the control, respectively).
4. DISCUSSION This is the first report that hypoxia induced either an increase or a decrease in in glomus cells. Our result partly agrees with other studies that did
not show both an increase and a decrease in
but rather either of
these responses. Possible reasons are that we did not use single glomus cells, but rather clusters of glomus cells that were grown for 4 to 7 days on a
coverglass, and that we simultaneously examined the responses of 10 to 20 glomus cells in each experiment.
This study also demonstrated that ACh and NaCN mostly increased in glomus type I cells and maintained
694
of the amplitude of this
response under the removal of The increase in induced by ACh and NaCN (Biscoe et al., 1989; Sato et al., 1991) has been reported previously. These results suggest that intracellular free may be produced partly by the intracellular binding of in response to chemical stimulation, independent of voltage changes, as in the process of Ca-induced Ca release reported by Kuba (1980). These data also suggest that glomus type I cells with an increase in may hyperpolarize during this process via potassium influx through the activation of calcium-dependent potassium channels (Nohmi et al., 1992; Yoshizaki et al., 1995). A model of intercellular and cell-to-fiber chemo-transduction is proposed in Fig. 3, which takes into account the electrical events and changes in glomus cells in response to hypoxia, ACh and NaCN observed in this study. Light-gray glomus cells represent hyperpolarization, while three dark-gray cells represent depolarization. Gap junctions and reciprocal synapses are depicted as important structures for interaction among glomus cells and afferent terminals. Afferent nerve fibers 1 and 2 produce no discharge, since the glomus cells apposed by their terminals do not depolarize, but rather hyperpolarize. Arrows the direction of the conduction of action potentials along afferent nerve fibers 3 and 4. Abudara and Eyzaguirre (1996; 1998) suggested that changes in junctional-conductance
695
and/or cAMP may play an important role in chemoreception, rather than acidity, hyperpolarization or depolarization. A further study is necessary to elucidate what triggers chemo-transduction mechanism.
5. REFERENCES Abudura V. and Eyzaguirre C. (1996) Effects of hypoxia on the intracellular channel activity of cultured glomus cells. Adv. Exp. Med. Biol. 410, 151-158. Abudara V. and Eyzaguirre C. (1998) Modulation of junctional conductance between rat carotid body glomus cells by hypoxia, cAMP and acidity. Brain Res. 792, 114-125. Biscoe T. J., Duhen M. R., Eisner D. A., O’Neill S. C. and Valdeolmillos M. (1989) Measurements of intracellular in dissociated type I cells of the rabbit carotid body. J. Physiol. (London) 416, 421-434. Buckler, K . J . and Vaughan-Jones, R. D. (1994) Effects of hypoxia on membrane potential and intracellular calcium in rat neonatal carotid body type I cells. J. Physiol. (London) 476, 423-428. Donnelly, D. F. and Kholwadwala, D. (1992) Hypoxia decreases intracellular calcium in adult rat carotid body glomus cells. J. Neurophysiol. 67, 1543-1551. Duchen, M R. and Biscoe, T. J. (1992) Relative mitochondrial membrane potential and in type I cells isolated from the rabbit carotid body. J. Physiol. (London)
450, 33-62. Hayashida, Y. and Eyzaguirre, C. (1979) Voltage noise of carotid body type I cells. Brain Res. 167, 189-194. Kuba, K. (1980) Release of calcium ion linked to the activation of potassium conductance in a caffeine-treated sympathetic neurone. J. Physiol. (London) 298, 251-269. Nohmi, M., Hua, S-Y, Kuba, K., and Yoshizaki, K. (1992) Characterization of pools involved in C a response and oscillation in cultured rabbit otic ganglion cell. Jpn. J. Physiol. 42, S132
Sato, M., Ikeda, K., Yoshizaki, K. and Koyano, H. (1991) Response of cytosolic calcium to anoxia and cyanide in cultured glomus cells of newborn rabbit carotid body. Brain Res. 551,327-330. Shirahata, M., Fitzgerald, R. S. and Sham, J. S. K. (1997) Acetylcholine increases intracellular calcium of arterial chemoreceptor cells of adult cats. J. Neurophysiol. 78, 2388-2395. Yoshizaki, K., Hoshino, T., Sato, M., Koyano, H., Nohmi, M., Hua, S-Y. and Kuba, K, (1995) induced release and its activation in response to a single action potential in rabbit otic ganglion cells. J. Physiol. (Lond) 486: 177-187
696
CHARACTERISTICS OF CAROTID BODY CHEMOSENSITIVITY IN THE MOUSE Baseline Studies for Future Experiments with Knockout Animals
L. He, J. Chen, B. Dinger, and S. Fidone Department of Physiology, University of Utah School of Medicine, Salt Lake City, UT 84108
1.
INTRODUCTION
The cellular mechanisms underlying chemotransduction and chemotransmission in the carotid body have been the subject of intense scrutiny in recent years. In respect to the initial chemotransduction process, competing hypothetical models present multiple alternative mechanisms involving, among others, 1), a variety of sensitive potassium channels, 2), a mitochondrial cytochrome oxidase and 3), a form of NADPH oxidase commonly found in neutrophils (see Gonzalez et al., 1994; Gonzalez et al., 1995 for review). As for chemotransmission between the chemosensory cells and their afferent nerve endings, numerous neurochemical and pharmacological studies have examined conflicting views of this process, particularly with respect to the roles played by dopamine, acetylcholine and substance P (see Gonzalez et al., 1995; Prabhakar, 1994).
Knockout mice have proven to be valuable tools for the study of a host of biological problems, including the sensory transduction processes in another chemoreceptor organ, the olfactory epithelium. In these latter chemoreceptors, results obtained from different research groups using conventional
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
697
neurochemical and physiological techniques supported opposite conclusions
regarding the importance of cyclic AMP versus inositol 1,4,5-triphosphate
production in odorant signal transduction. These uncertainties were largely resolved, however, by evaluating the ability of a panel of odorants to depolarize olfactory neurons from mice lacking the normal cyclic nucleotide-
gated ion channel. Likewise, the involvement of the of in olfactory signal transduction was confirmed in knockout mice lacking this protein (see Picciotto & Wickman, 1998).
Numerous strains of knockout mice have been produced which might have great value for the study of chemotransduction and chemotransmission in the
carotid body. These include mice lacking a variety of ion channels (e.g., potassium channels, Zhou et al., 1998), components of second messenger systems (e.g., adenylate and guanylate cyclases, Lopez et al., 1995; Storm
et al., 1998), neurotransmitters (e.g., tachykinins, Zimmer et al., 1998; atrial natriuretic peptide [ANP], Melo et al., 1998 and endothelins [ET], Morita et al., 1998) and neurotransmitter receptors (e.g., acetylcholine and subunits, Orr-Urtreger et al., 1997; Missias et al., 1997 and tachykinin NK1
receptors, Ahluwalia et al., 1998). Despite the obvious advantages of this experimental approach, studies of the carotid body in knockout mice are
uncommon (but see Kline et al., 1998), presumably because the small size of
the chemosensory organ and its nerve in this species renders difficult many
of the usual techniques for gathering neurochemical and electrophysiological
data.
In the current study, we have attempted to optimize micro-techniques that we currently apply to the rat carotid body preparation, in order to obtain reproducible electrophysiological recordings from the mouse CSN. In addition, we have used immunocytochemical staining procedures in frozen
sections of the mouse carotid body to assess the presence of various neurotransmitters in type I cells. In order to provide a comparative reference, data from the mouse is presented along with data obtained in rat preparations using similar techniques.
2.
METHODS
2.1
Immunocytochemistry
Carotid bodies were surgically removed from anesthetized (Ketamine, 10 mg/100 g plus Xylazine, 0.9 mg/100 g i.m.) adult mice and immediately
698
immersed in ice-cold 4% paraformaldehyde in 0.1 M phosphate buffered saline (PBS; pH 7.4). Following fixation for 1 hr, the surface of each carotid body was darkened with a concentrated solution of colloidal india ink. This procedure greatly improved the visibility of the organs during subsequent washing and sectioning. The carotid bodies were equilibrated for 1 hr with a solution of cold 20% sucrose in 0.1 M PBS and then embedded in OCT at -20°C. Sectioning each mouse carotid body yielded 17-20 useful specimens containing type I cells for staining. Details of the immunocytochemical staining procedures have been published (Wang et al., 1991). 2.2
Electrophysiological Recording of Carotid Sinus Nerve (CSN) Activity
Under ketamine/xylazine anesthesia, and with the aid of a dissecting microscope the carotid bifurcations containing the carotid bodies were located and removed from adult mice and placed in a lucite chamber containing 100% equilibrated modified Tyrode solution at 0-4°C (in mM: NaCl, 112; KC1, 4.7; 2.2; 1.1; sodium glutamate, 42; HEPES buffer, 5; glucose, 5.6; Each carotid body along with its attached nerve was carefully removed from the artery and cleaned of surrounding connective tissue, and the preparation was then placed in a conventional superfusion chamber where the carotid body was continuously superfused (up to 4 h) with
modified Tyrode solution maintained at 37 °C and equilibrated with a selected gas mixture. The CSN was positioned in the tip of a glass suction electrode for monopolar recording of chemoreceptor activity. The bath was grounded with a wire, and neural activity was led to an AC-coupled preamplifier, filtered and transferred to a window discriminator and a frequency to voltage converter. Signals were processed by an AD/DA converter for display of frequency histograms on a PC computer monitor.
3.
RESULTS
3.1
Immunocytochemistry
As in the rat and other species, the mouse carotid body is located near the bifurcation of the common carotid artery, usually in close association with the internal carotid branch. The relative size of the carotid body in these two species is proportionate to body mass, indicating that the wet weight of the mouse chemosensory organ is less than Immunocytochemical staining
699
for tyrosine hydroxylase (TH) in the mouse carotid body revealed cells with a variety of immunoreactive properties, including dark, medium and lightly stained cells (Fig. 1A). Some cells with morphological characteristics typical of type I glomus cells were unstained by the TH antibody. In stained cells, brown reaction product was limited to the cytoplasm, revealing diameter cells with an ovoid to ellipsoid shape. The large nuclei of these cells were not stained. In rat carotid bodies processed for TH immunoreactivity (Fig. 1B), similar features were present, including cells displaying a wide range of staining intensities. The number of TH-positive cells in cross-sections of the rat carotid body was substantially greater (4-5X) than the incidence of type I cells present in the mouse, a finding which correlates with the respective size of the chemosensory organs in these species. Type I cells in the mouse carotid body were also immunopositive (not shown) for atrial natriuretic peptide (ANP), and endothelin (ET), vasoactive agents which we previously demonstrated in rat type cells (Stensaas et al., 1991; He et al., 1996).
3.2
Carotid Sinus Nerve (CSN) Activity
Using the suction electrode technique described in Methods, the mean basal discharge rate in rat preparations was imp/sec with a range of 4 to 13 imp.sec. In mouse, the mean basal discharge was somewhat
higher at imp/sec, ranging from 7 to 23. This elevated recorded activity may be due to greater ohmic resistance in the smaller tipped electrode used in the mouse preparation. Figure 2 shows representative responses evoked in rat and mouse preparations by lowering bath to 120 Torr. This moderate stimulus elicited rapid increases in nerve activity that were sustained
700
throughout the stimulus period. Nerve activity promptly fell to pre-stimulus discharge rates upon re-establishing the to 450 Torr. The mean stimulus evoked activity (minus basal activity) calculated over the course of the low stimulus was imp/sec in rat and imp/sec in mouse preparations. The introduction of nicotine also elicited a rapid rise in neural activity in both rat and mouse preparations, but unlike the response to hypoxia, the high level of activity was not maintained and the response quickly declined in the continued presence of the drug (Fig. 3). The response
701
returned to basal levels during the first 1-2 min of drug washout. We have previously observed a similar rapid adaptation to nicotine in rabbit carotid body preparations (Chen et al., 1999), a phenomenon consistent with desensitization of nicotinic cholinergic receptors. The mean discharge evoked by the 1 min exposure to nicotine was in rat, and imp/sec in mouse preparations.
4.
DISCUSSION
Despite constraints imposed by the small size of the mouse carotid body and CSN, we have found that immunocytochemical and electrophysiological (chemoreceptor nerve activity) data can be routinely and reliably obtained from this preparation. Our immunocytochemical results suggest that mouse and rat type I cells are comparable with respect to size, shape and range of staining properties for TH, the rate-limiting enzyme for catecholamine synthesis. In addition, mouse chemosensory cells appear to contain ANP and ET, vasoregulatory peptides also present in the rat carotid body (Stensaas et al., 1991; He et al., 1996). These and other immunocytochemical features
of the mouse carotid body will provide essential baseline information in future studies of genetically altered animals.
In studies of specific gene knockouts, it may be particularly useful to collect information about neural activity in response to selected chemoreceptor stimuli. The assessment of CSN activity is not only essential for demonstrating the existence of an integrated functional organ, nerve recordings in certain genetically altered animals may provide the most compelling test of a hypothesis. For example, in knockout animals lacking a specific neurotransmitter receptor (e.g., 7 subunit of the nicotinic cholinergic receptor; tachykinin NK1 receptor), recording of CSN activity could be decisive in elucidating the role of specific neuroactive agents in chemotransmission. Likewise, assessments of neural output would be highly desirable following the knockout of certain genes hypothesized to be involved in chemotransduction (e.g., NADPH oxidase, see Acker, 1994).
In summary, the feasibility of obtaining immunocytochemical data, along with routine assessments of chemoreceptor nerve discharge, enhance the utility of the mouse carotid body preparation to test specific hypotheses. Previous studies have demonstrated the use of dissociated mouse type I cells (Zhang et al., 1995), suggesting additional possibilities for patch-clamp and -imaging experiments in genetically altered preparations. Future
702
experiments employing carotid body preparations from transgenic and knockout mice should elucidate the role of selected molecular entities in chemotransduction and chemotransmission.
ACKNOWLEDGEMENT Supported by USPHS grants NS12636 and NS07938.
REFERENCES Acker, H., 1994, Mechanisms and meaning of cellular oxygen sensing in the organism. Respir.
Physiol. 95(1): 1-10. Ahluwalia, A., DeFelipe, C., O’Brien, J., Hunt, S.P., and Perretti, M., 1998, Impaired IL-lbeta-induced neutrophil accumulation in tachykinin NK1 receptor knockout mice. Br.
J. Pharmacol. 124(6): 1013-1015. Chen, J., He, L., Dinger, B., and Fidone, S., 1999, Stimulus specific signaling pathways in rabbit carotid body chemoreceptors. Neurosci. (in press). Gonzalez, C., Almaraz, L., Obeso, A., and Rigual, R., 1994, Carotid body chemoreceptors: from natural stimuli to sensory discharges. Physiol. Rev. 74: 829-898. Gonzalez, C., Dinger, B.G., and Fidone, S.J., 1995, Mechanisms of carotid body chemoreception. In Regulation of Breathing (J.A. Dempsey and A.I. Pack, eds.), Marcel
Dekker, Inc., New York, pp. 391-471. He, L., Chen, J., Dinger, B., Stensaas, L., and Fidone, 1996, S. Endothelin modulates chemoreceptor cell function in mammalian carotid body. In Frontiers in Arterial Chemoreception (P. Zapata P, C. Eyzaguirre and R.W. Torrance RW, eds.), Plenum
Press, New York, pp. 305-311. Kline, D.D., Yang, T., Huang, P.L., and Prabhakar, N.R., 1998, Altered respiratory
responses to hypoxia in mutant mice deficient in neuronal nitric oxide synthase. J. Physiol. 511.1: 273-287. Lopez, M.J., Wong, S.K., Kishimoto, I., Dubois, S., Mach, V., Friesen, J., Garbers, D.L., and Beuve, A., 1995, Salt-resistant hypertension in mice lacking the guanylyl cyclase-A
receptor for atrial natriuretic peptide. Nature 378(6552): 65-68. Melo, L.G., Veress, A.T., Chong, C.K., Pang, S.C., Flynn, T.G., and Sonnenberg, H., 1998,
Salt-sensitive hypertension in ANP knockout mice: potential role of abnormal plasma
renin activity. Am. J. Physiol. 274(1 Pt 2): R255-261. Missias, A.C., Mudd, J., Cunningham, J.M., Steinbach, J.H., Merlie, J.P., and Sanes, J.R., 1997, Deficient development and maintenance of postsynaptic specializations in mutant
mice lacking an ‘adult’ acetylcholine receptor subunit. Development 124(24): 5075-5086.
Morita, H., Kurihara, H., Kurihara, Y., Shindo, T., Kuwaki, T., Kumada, M., and Yazaki, Y., 1998, Systemic and renal response to salt loading in endothelin-1 knockout mice. J. Cardiovasc. Pharmacol. 31 Suppl 1: S557-S560. Orr-Urtreger, A., Goldner, F.M., Saeki, M., Lorenzo, I., Goldberg, L., DeBiasi, M., Dani, J.A., Patrick, J.W., and Beaudet, A.L., 1997, Mice deficient in the alpha7 neuronal
nicotinic acetylcholine receptor lack alpha-bungarotoxin binding sites and hippocampal
fast nicotinic currents. J. Neurosci. 17(2): 9165-9171. Picciotto, M.R., and Wickman, K., 1998, Using knockout and transgenic mice to study neurophysiology and behavior. Physiol. Rev. 78(4): 1131-1163.
703
Prabhakar, N.R., 1994, Neurotransmitters in the carotid body. Adv. Exp. Med. Biol. 360: 57-70. Stensaas, L.J., Wang, Z.-Z., Dinger, B., & Fidone, S. (1991). Alteration of atrial natriuretic peptide (ANP) immunostaining in the rat carotid body evoked by hypoxia. Soc. Neurosci. Abstr. 17: 118. Storm, D.R., Hansel, C., Hacker, B., Parent, A., and Linden, D.J., 1998, Impaired cerebellar long-term potentiation in type I adenylyl cyclase mutant mice. Neuron 20(6): 1199-1210. Wang, Z.-Z., He, L., Stensaas, L.J., Dinger, B.G., and Fidone, S.J., 1991, Localization and in vitro actions of atrial natriuretic peptide in the cat carotid body. J. Appl. Physiol. 70(2): 942-946. Zhang, X.-Q., Pang, L., and Eyzaguirre, C., 1995, Effects of hypoxia on the intracellular of clustered and isolated glomus cells of mice and rats. Brain Res. 676: 413-420. Zhou, L., Zhang, C.L., Messing, A., and Chiu, S.Y., 1998, Temperature-sensitive neuromuscular transmission in Kv1.1 null mice: role of potassium channels under the myelin sheath in young nerves. J. Neurosci. 18(18): 7200-7215. Zimmer, A., Zimmer, A.M., Baffi, J., Usdin, T., Reynolds, K., Konig, M., Palkovits, M., and Mezey, E., 1998, Hypoalgesia in mice with a targeted deletion of the tachykinin 1 gene. Proc. Natl. Acad. Sci. USA 95(5): 2630-2635.
704
ROLE OF SUBSTANCE P IN NEUTRAL ENDOPEPTIDASE MODULATION OF HYPOXIC RESPONSE OF THE CAROTID BODY
Ganesh K. Kumar a , Yu Ru-Kou b , Jeffrey L. Overholtb, and Nanduri R. Prabhakar b Departments of Biochemistrya and Physiology & Biophysicsb , School of Medicine, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106, USA
Abstract:
Carotid body expresses neutral endopeptidase (NEP)-like enzyme activity and phosphoramidon, an inhibitor of NEP augments sensory response of the
carotid body to hypoxia (Kumar et al., 1990). NEP hydrolyzes substance P (SP) and methionine enkephalin (Met-ENK) in the nervous system. In the present study, we determined whether NEP hydrolyzes Met-ENK and SP in the carotid body and whether these peptides contribute to the phosphoramidoninduced potentiation of the sensory response to hypoxia. Experiments were performed on carotid bodies excised from anaesthetized adult cats. HPLC analysis showed that both SP and Met-ENK were hydrolyzed by the carotid body. Phosphoramidon markedly inhibited SP but had only
marginal effect on Met-ENK hydrolysis (-15%). Sensory responses of the carotid body in vitro to hypoxia and SP ( 1 0 nmoles) were potentiated by phosphoramidon by ~ 80% and ~ 275% respectively
SP-receptor antagonist abolished phosphoramidon-induced potentiation of the sensory response to hypoxia as well as to SP. These results demonstrate that SP is a preferred substrate for NEP in the carotid body and SP plays a major role in the potentiation of the hypoxic response of the carotid body by phosphoramidon.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
705
1.
INTRODUCTION
Neutral endopeptidase (NEP) is involved in the hydrolysis of various neuropeptides in the nervous system (Erdos and Skidgel, 1989; Roques et
al., 1993). Previously, we showed that carotid bodies express NEP-like enzyme activity and NEP-like immunoreactivity is localized to the extracellular space in close proximity to glomus cells (Kumar, et al., 1990, 1994; Kumar, 1997). Administration of phosphoramidon, an inhibitor of NEP, close to the carotid body, augmented the sensory response to hypoxia but not to hypercapnia (Kumar et al., 1990). These results support the view that NEP modulates the activity of the carotid body in response to hypoxia,
by altering the hydrolysis of one or more of the neuropeptides present in the chemoreceptor tissue. However, the identity of the peptide(s) involved in this response remains to be established. Mammalian carotid bodies contain several classes of neuropeptides including methionine enkephalin (Met-ENK) and substance P (for reviews see Fidone and Gonzalez, 1986; Prabhakar, 1994). In the central nervous system, NEP is involved in the hydrolysis of Met-ENK as well as SP. Both Met-ENK and SP are present in glomus cells as well as in nerve fibers (Fidone and Gonzalez, 1986; Prabhakar, 1994), close to the localization of N E P in the chemoreceptor tissue (Kumar, 1997). Physiological studies have shown that both ENK and SP may exert both excitatory and inhibitory effects on the sensory activity of the carotid body (Prabhakar et al., 1989; Monti-Bloch & Eyzaguirre, 1985). In the present study, we determined whether ENK and/or SP are involved in the potentiation of the sensory response of the carotid body to hypoxia following phosphoramidon. Our results showed that both Met-ENK and SP are hydrolyzed by the carotid body and phosphoramidon specifically inhibited SP but not Met-ENK hydrolysis. In an in vitro carotid body preparation, phosphoramidon potentiated the sensory response to hypoxia as well as to SP and these effects could be abolished by SP-receptor antagonist.
2.
2.1
MATERIALS AND METHODS
General preparation of the animals
Experiments were performed on adult cats of either sex, anaesthetized with pentobarbital sodium (35-45 mg/kg; I.P). Heparin (1000 units/kg) was administered intravenously prior to carotid body removal. Both the common
706
and external carotid arteries were ligated and the carotid bodies along with the sinus nerve were excised and placed in ice-cold Krebs-Ringer solution pre-equilibrated with 100%
2.2
Measurement of peptide hydrolysis in carotid bodies
Thin slices of carotid bodies were incubated in 0.1 M Tris-HCl buffer, pH 7.4 containing either SP (40 nmoles) or Met-ENK (60 nmoles) at 37°C with and without phosphoramidon Fifty microliters of the reaction medium were removed every 15 min and added to of 0.2 % (V/V) trifluoroacetic acid to terminate the reaction. Peptide hydrolysis was monitored by reverse phase HPLC analysis as described previously (Kumar, 1997). The concentrations of peptides were determined from standard curves generated using known concentrations of Met-ENK and SP. At the end of the experiment, tissue slices were homogenized in 0.1 M Tris-HCl buffer, pH 7.4 containing 0.1% (V/V) Triton X-100 and the protein concentration was determined by colloidal-gold procedure using bovine serum albumin as the standard (Stoscheck, 1987).
2.3
Recording of sensory discharge from carotid bodies in vitro
Sensory discharge from carotid bodies in vitro was recorded using the procedures as described previously (Prabhakar et al., 1993). Briefly, the carotid body along with the sinus nerve was placed in a lucite chamber and superfused with medium having the following composition (mM): NaCl (110), KCl (5), (0.5), (2.2), sucrose (54), glucose (5.5), HEPES (5), pH 7.4 (Prabhakar et al., 1993). The temperature of the superfusing medium in the chamber was 36 + 1°C and the rate of superfusion was 3 ml/min. The chamber containing the carotid body was sealed with a lid to minimize exposure to atmospheric air. Gas impermeable tubing was used to connect the chamber containing the carotid body to the reservoirs containing the superfusion solution. The superfusion medium was equilibrated with either 100% (hyperoxia) or with 10% balanced with (hypoxia). The electrical activity from thin filaments, dissected from the sinus nerve, was recorded (1-3 active units) with a platinum-iridium electrode and an A-C amplifier (Grass Instruments; Model Pr 121). Discharge frequency of the action potentials was counted using a rate meter (Winston Rad II). Chemoreceptor activity was averaged over one minute during controls (preceding hypoxic challenge or SP administration) and during the peak
707
activity following hypoxic or SP challenge. The changes in chemoreceptor activity were expressed as delta impulses/sec, (i.e., test – control).
2.4
Experimental protocols
2.4.1
Effects of phosphoramidon on the hydrolysis of SP and MetENK
In a given experiment, two carotid bodies were harvested and basal hydrolysis of either SP or Met-ENK was monitored in one and the effect of phosphoramidon was tested in the other carotid body. The rates of SP and Met-ENK hydrolysis were expressed in picomoles of peptide hydrolyzed per hour per mg protein.
2.4.2
Effects of phosphoramidon on sensory response to hypoxia
Basal sensory discharge of the isolated carotid body was monitored for five minutes while superfusion with medium equilibrated with 100% (control medium; hyperoxia; mmHg). Then, carotid bodies were challenged with medium equilibrated with 10% balanced with (hypoxia; mmHg) for 5 min followed by return to the control medium. The protocols were repeated while superfusing carotid bodies with phosphoramidon
2.4.3
Effects of SP on carotid body activity before and after phosphoramidon
The protocols were the same as described in protocol 2.4.2, except that the carotid bodies were challenged with 10 nmoles of SP in 0.2 ml medium over a period of 20 seconds. Results obtained with same volume of the superfusion medium served as controls.
2.4.4
Effects of SP-receptor antagonist
In another series of experiments, first we analyzed the effects of phosphoramidon on the carotid body responses to hypoxia (
708
mmHg) and SP (10 nmoles). Thereafter, the protocols were repeated after spantide a peptidyl SP receptor antagonist.
2.5
Data analysis
Average results are expressed as Statistical significance was evaluated by a paired t-test or by repeated-measures of analysis of variance (ANOVA) and by Tukey’s test. “P” values less than 0.05 were considered significant.
3.
RESULTS AND DISCUSSION
3.1
Effects of phosphoramidon on the hydrolysis of SP and Met-ENK in the carotid body
HPLC analysis showed that SP eluted at 23.8 min whereas Met-ENK at 17.4 min. Incubation with thin slices of carotid body for 1 h resulted in the hydrolysis of SP with the formation of SP (1-7), SP (1-8), and other shorter SP fragments. Met-ENK was also hydrolyzed by the carotid body to Met-
ENK (2-5) and Met-ENK (3-5) fragments respectively. In the presence of 400 phosphoramidon, the hydrolysis of SP was reduced by whereas Met-ENK hydrolysis was only marginally affected Higher concentration of phosphoramidon showed no further inhibition of Met-ENK hydrolysis in 3 additional carotid bodies tested. These
observations demonstrate that SP hydrolysis, but not Met-ENK hydrolysis, is significantly inhibited by phosphoramidon. Several lines of evidence suggest that phosphoramidon specifically inhibits NEP-like enzymes in many tissues (Erdos and Skidgel, 1989; Roques et al., 1993) including the carotid body (Kumar, 1997). Although both SP and ENK are hydrolyzed by the carotid body, much to our surprise, phosphoramidon markedly inhibited the hydrolysis of SP whereas Met-ENK hydrolysis was only marginally affected This lack of effect of phosphoramidon on Met-ENK was not due to a sub-maximal concentration since doubling the concentration had no further effect. Rather, other metallopeptidases are likely to be involved in the hydrolysis of MetENK in the chemoreceptor tissue. These observations suggest that, in the carotid body, NEP is involved in the degradation of SP, but plays only a minor role in the degradation of Met-ENK.
709
3.2
Effects of phosphoramidon on the sensory response of the carotid body to hypoxia in vitro
For these experiments, we used an in vitro carotid body preparation. Phosphoramidon caused a transient increase (lasting for 1 min) in the basal discharge during hyperoxia ( mmHg) in 4 of the 12 experiments. However, on average there was no consistent effect of phosphoramidon on the basal activity of the carotid body (control, versus after phosphoramidon, imp/sec; In response to hypoxia, the sensory discharge frequency increased by imp/sec In the presence of phosphoramidon, the response to hypoxia was increased by 80% ( imp/sec; ). These results demonstrate that phosphoramidon augments the sensory response of the carotid body to hypoxia in vitro, similar to that seen in in vivo carotid bodies as reported previously (Kumar et al., 1990). The in vitro carotid body preparation avoids possible problems with effects of phosphoramidon on the cardiovascular system. The fact that phosphoramidon augments the sensory
response of the in vitro carotid body demonstrates that this effect is due to a direct action on the carotid body, rather than to secondary effects on blood flow that may occur under in vivo conditions.
3.3
Effects of phosphoramidon on carotid body sensory response to exogenous administration of SP
In the following experiment, we tested whether SP contributes to the potentiation of the sensory response to hypoxia by phosphoramidon. In control experiments, 10 nmoles of SP significantly stimulated the sensory discharge, whereas doses less than 10 nmoles, had no significant effect. Phosphoramidon significantly potentiated the sensory response to 10 nmoles of SP These results demonstrate that the stimulatory effects of SP on carotid body activity were potentiated by phosphoramidon in a manner similar to that seen with hypoxia. It is conceivable that phosphoramidon, by blocking the degradation of SP by NEP in the carotid body, elevates the endogenous SP level. The decreased hydrolysis facilitates the sustained action of SP, thereby enhancing SP-induced responses in the chemoreceptor tissue. The proposed role of NEP in the modulation of SP responses in the carotid body is further supported by the observations that inhibitors of NEP augmented SP-induced
710
tracheal and iris sphincter contractions (Anderson et al., 1990; Sekizawa et al., 1987).
3.4
Effects of SP-receptor antagonists on phosphoramidon-induced augmentation of the sensory responses to hypoxia and SP
In the next series of experiments, we assessed the role of neurokinin receptors in phosphoramidon-induced potentiation of SP and hypoxic response of the carotid body. Specifically, we examined the effects of spantide, a peptidyl SP receptor antagonist, on chemoreceptor responses to hypoxia ( mmHg) and to 10 nmoles of SP in the presence of phosphoramidon in six carotid bodies. In the presence of phosphoramidon, hypoxia increased the sensory discharge by imp/sec, whereas in presence of spantide the increase was only imp/sec (81% reduction; ). As expected, spantide also inhibited the stimulatory effects of SP on the carotid body. In the presence of phosphoramidon, SP (10 nmoles) increased the sensory discharge by imp/sec, whereas in the presence of spantide the increase was only imp/sec , We have previously showed that neurokinin-1 (NK-1) receptors mediate excitatory actions of SP in the cat carotid body (Prabhakar et al., 1990). Dashwood et al. (1990) reported that NK-1 receptors are present in the cat carotid body and that chronic ablation of the carotid sinus nerve up-regulated NK-1 receptors. The locations of NK-1 receptors in the carotid body, however, remain to be investigated. Taken together, these results provide evidence that SP is the major neuropeptide involved in the potentiation of the hypoxic response of the carotid body by phosphoramidon and further suggest that the effects of the peptide are mediated by NK-1 receptors. In summary, results presented in this study support the notion that NEP modulates carotid body activity by maintaining low endogenous levels of excitatory peptides. The fact that spantide attenuated or abolished the phosphoramidon-induced augmentation of the responses of the carotid body to both SP and hypoxia suggests the involvement of SP and neurokinin receptors in this response. Stimulation of the carotid body by NEP inhibitors could have profound effects on both the cardiovascular and respiratory systems.
711
4.
ACKNOWLEDGMENTS
The authors are grateful to Hui-ping Cao for her technical assistance. This study was supported by National Heart, Lung, and Blood Institute HL28530 (NRP), and HL-46462 (GKK).
5.
REFERENCES
ANDERSON, J. A., B. MALFROY, N. R. RICHARD, L. KULLERSTRAND, C. LUCAS,
AND P. S. BINDER. Substance P contracts the human iris sphincter: possible modulation by endogenous enkephalinase. Regulatory Peptides 29: 49-58, 1990. DASHWOOD, M.R., D. S. McQUEEN, D. S. De BURG DALY, K. M. SPYER, AND Y. EVRARD. Autoradiographic studies on the effects of chronic unilateral sectioning of a
carotid sinus nerve on 5-HT and SP binding sites in the carotid body and NTS. In: Chemoreceptors and Chemoreceptor Reflexes, edited by H. Acker, A. Trezebski and R.G. O’Regan. New York: Plenum Press, 1990, p. 305-310. ERDOS, E. G., AND R. A. SKIDGEL. Neutral endopeptidase 24.11 (enkephalinase) and related regulators of peptide hormones. FASEB J. 3: 145-151, 1989.
FIDONE, S. J., AND C. GONZALEZ. Initiation and control of chemoreceptor activity in the carotid body. In: Handbook of Physiology, Section 3: The Respiratory System, edited by N.
S. Cherniack and J. G. Widdicombe, 1986: Vol. II, Part 1, p. 247-312. KUMAR, G. K. Peptidases of the peripheral chemoreceptors: biochemical, immunological, in vitro hydrolytic studies and electron microscopic analysis of neutral endopeptidase-like activity of the carotid body. Brain Res. 748: 39-50, 1997. KUMAR, G. K., M. RUNOLD, R. D. GHAI, N. S. CHERNIACK, AND N. R. PRABHAKAR. Occurrence of neutral endopeptidase activity in the cat carotid body and its significance in chemoreception. Brain Res. 517: 341-343, 1990. KUMAR, G. K., N. R. PRABHAKAR, K. P. STROHL, A. THOMAS, AND P. A. CRAGG.
Low
dependency of neutral endopeptidase and acetylcholinesterase activities of the rat
carotid body. Adv. Exp. Med. Biol. 360: 217-220, 1994.
MONTI-BLOCH, L., AND C. EYZAGUIRRE. Effects of methionine-enkephalin and substance P on the chemosensory discharge of the cat carotid body. Brain Res. 338: 297307, 1985. PRABHAKAR, N. R. Neurotransmitters in the carotid body. Adv. Exp. Med. Biol. 360: 57-69, 1994. PRABHAKAR, N. R., S. LANDIS, G. K. KUMAR, D. M. KILPATRICK, N. S.
CHERNICK, AND S. E. LEEMAN. Substance P and neurokinin A in the cat carotid body: localization, exogenous effects and changes in content in response to arterial
Brain
Res. 481:205-214, 1989. PRABHAKAR, N. R., Yu.-R. KOU, AND M. RUNOLD. Chemoreceptor responses to substance P, physalemin, and eledoisn: evidence for neurokinin-1 receptors in the cat carotid body. Neurosci. Lett. 120: 183-186, 1990.
712
PRABHAKAR, N. R., H. CAO, J. A. EOWE I I I , AND R. M. SNIDER. Selective inhibition of the carotid body sensory response to hypoxia by the substance P receptor antagonist CP-96345. Proc. Natl. Acad. Sci. (USA) 90: 10041-10045, 1993. ROQUES, B. P., F. NOBLE, V. DAUGE, M.-C. FOURNIE-ZALUSKI, AND A. BEAUMONT. Neutral endopeptidase 24.11: Structure, inhibition, and experimental and clinical pharmacology. Pharmacological Rev. 45: 88-146, 1993. SEKIZAWA, K., J. TAMAOKI, J. A. NADEL, AND D. B. BORSON. Enkephalinase inhibitor potentiates substance P and electrically induced contraction in ferret trachea. J. Appl. Physiol. 63: 1401-1405, 1987. STOSCHECK, C. M. Protein assay sensitive at nanogram levels. Anal. Biochem. 160: 301305, 1987.
713
This page intentionally left blank.
EFFECT OF BARIUM ON RAT CAROTID BODY GLOMUS CELL AND CAROTID CHEMOSENSORY RESPONSE
A. Mokashi, A. Roy, C. Rozanov, P. Daudu, and S. Lahiri Department of Physiology, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104-6085, U.S.A.
1.
INTRODUCTION
Carotid body chemosensory activity is significantly increased in response to hypoxia and hypercapnia. The glomus cells in the carotid body (CB) have been indicated as the primary site for chemoreception (for review see Gonzalez et al., 1994). Earlier reports have shown that a decrease in of superfusate buffer results in increased in rabbit CB glomus cell (Biscoe et al., 1989). However the source of increase is debated (Buckler and Vaughn-Jones, 1994; Duchen and Biscoe, 1992). In a related study, Lopez-Barneo (1996) has shown a correlation between cytosolic calcium change and dopamine release from single glomus cell of rabbit CB during exposure to hypoxia. The general consensus was that glomus cell depolarization due to hypoxia was followed by entry which led to increased activity of CSN. The alternative hypothesis was release from intracellular store due to mitochondrial membrane depolarization during hypoxia and thus to an increased CSN activity (Duchen and Biscoe, 1992). Recent studies have shown that application of 3 mM causes an increase in carotid sinus nerve (CSN) activity of a superfused rat CB, the magnitude of which is similar to the anoxic response (Donnelly,1997). CB glomus cell membrane depolarization was also observed during whole cell current-voltage
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
715
measurements with buffer containing 5 mM (Buckler, 1999). Both reports did not rule out a possibility that administration can initiate release from intracellular store. Barium has been recognized as a divalent cation that competes with calcium i to enter adrenal chromaffin cells via voltage gated calcium channels to cause catecholamine secretion as well ATP release (Heldman et al.,1989). This report also shows that and interact by separate pathways to initiate secretion in cultured chromaffin cells. Barium, as a secretogauge, is indicated to be the primary cause of secretion from the synapse of the sympathetic ganglion (Przywara et al., 1993). Both and have been proposed to act by a common pathway to simulate exocytosis in pituitary cells (van der Merwe et al.,1990). Thus course and site of action by is unclear in chromaffin cells. Since has hypoxia-like effect (Donnelly, 1997) and it causes cell membrane depolarization (Buckler, 1999), we hypothesized that may have an effect similar to in CB. In this report we investigated the effect of on CB glomus cell and CSN activity. For the purpose of comparison we studied effect of hypoxia on CSN activity in normal . containing buffer that was followed by effect. Previously we titrated the CSN activity with free buffer and found that EGTA abolished the CSN activity. We tested the effect of with this solution on of glomus cells and CSN activity of CB. We found that ,in the absence of stimulated increase in cells and associated increase in CSN activity.
2.
METHODS
Measurements- Rat CB’s (4-5) were surgically removed and glomus cells were dissociated and plated as described before (Mokashi et al., 1998). Briefly CBs were digested for 25-30 mm in and -free buffer containing 2 mg/ml collagenase. The digested tissues were transferred to a growth medium (Ham F-12) that contained penicillin, streptomycin (10,000 units/100 ml, ml respectively) and 10% fetal bovine serum. After trituration of the CB with a fire polished pipette in 1 ml of growth medium, cells were plated on 18 mm coverslips and were placed in petridishes. In order to establish full recovery from enzymatic digestion and trituration procedure, the cells were kept undisturbed for 48 h in a humidified incubator with 5% and balance air at 37° C. Intracellular calcium measurements in buffer were made after the cells were loaded with sensitive fluorescent probe (Indo-1AM). The excitation was set at 340 nm. Emissions at 405 nm and 495 nm were measured along with the ratio (405
716
nm/495 nm) with use of photomultiplier tubes. The output current was measured on an analog and a digital recorder. The measurements at normal condition Torr, Torr and were done with normal buffer in the absence and presence of 3 mM Similar measurements were also made with calcium-free buffer
containing 20 Torr and
EGTA during normoxia
Torr,
CSN Measurements- CSN activity was measured from perfused/ superfused rat CB as described before (Roy et al.,1999). Perfusate and superfusate buffer was introduced by gravity at a constant pressure of 80 Torr and temperature was maintained at 37°C throughout the experimental procedure. The effluent of the perfusion chamber was removed by continuous suction. The whole CSN was desheathed and placed on a
platinum electrode with mineral oil for electrical isolation. Electrical output
from the nerve was connected to a bridge preamplifier and continuous analog recording along with digital rate meter was done with a series of amplifiers and a window-discriminator. After the hypoxia test and stop-flow (ischemia) response, CSN response at steady state during normoxia/ normocapnia Torr, Torr and was
recorded in the absence and presence of 3 mM
and 5 mM
similar steady-state CSN response was also recorded with containing 20 EGTA in the absence and presence of 5 mM
3.
A
free buffer
RESULTS
With 3 mM in normal calcium buffer increased from 90 nM to nM under normoxic and normocapnic condition (Fig. 1 A). A response study with 3 mM and 5 mM in a calciumfree buffer containing 20 EGTA resulted in increase from nM to nM (3 mM ) and nM (5 mM in four separate observations. These observations are shown in Fig.1B. A typical example of CSN responses in a perfused/ superfused CB is
shown in Figs. 2A and 2B. After a hypoxia test
=30 Torr), the effect of 3
mM and 5 mM in buffer during normoxia Torr) and normocapnia Torr) resulted in an increased CSN activity. This confirmed earlier observation of Donnelly(1997). Response to 5 mM
in a
free buffer that contained 20 .
EGTA is shown in Fig.2B.
Despite a significant reduction in CSN base level activity in the absence of extracellular calcium, a slow increase in CSN response was observed with 5 mM
717
718
719
A combined observation of these CSN responses is shown in Figs. 3A and 3B. C S N activity (expressed as % of maximal response) increased from 18 to and During perfusion/superfusion with free buffer containing EGTA, baseline CSN activity declined under normoxic and normocapnic control condition. However, with 5 mM in the same buffer CSN activity increased from to in 4 separate observations under similar conditions.
4.
DISCUSSION
Calcium is a crucial cation and secondary messenger in its diversity of functions. Calcium-initiated molecular mechanisms at the intracellular level are expressed by ion transport and neurotransmitter release (for review see Muallen, 1990).Thus increase either due to influx or/and release from internal calcium stores is a crucial step in secretion process. During voltage-clamp studies, external application of 1 mM (in the presence of depolarized the cells from -51 mV to -15 mV, thus promoting entry of through channels (Ruden et al. 1993). This results in an increased release from intracellular calcium stores and catecholamine secretion (amperometric method). The increases in level due to were in the range of in the presence and absence calcium. Earlier report (Douglas and Rubin, 1964) indicated that stimulatory action of on catecholamine secretion is independent of influx of in the adrenal medullary cells and thus considered to be mediated by the displacement of with from intracellular store sites. However Forsberg and Pollard (1988) indicated that enters the adrenal chromaffin cells via both voltagegated and receptor-gated calcium channels to cause a concomitant release of catecholamines and ATP in an exocytosis manner. Thus supporting a hypothesis that intracellular events leading to stimulated secretion may coincide with mediated excocytotic secretion. In a similar related study of sympathetic neurons, increases were also observed due to in a Indo-1 AM ratiometric method (Przywara et al.1993). They suggested that elevation of [ free medium indicates that displaces from intracellular stores. Electrophysiological studies related to background channel current shows that 5 mM depolarizes glomus cell membrane as it inhibits current(Buckler, 1999). This induced depolarization of cell membrane enhances opening of voltage-gated channels to increase influx of in the cells with a normal containing buffer. However may also enter the cytoplasm, in a competitive manner, as indicated in the
720
chromaffin cells and can cause release from intracellular stores to increase level (see later discussion). We extended our studies on the role of in the absence of in these cells and its related effect on CSN activity. With Ca-free buffer containing EGTA, we observed a small decrease in as well CSN activity under control condition (before treatment). In the absence of calcium influx, CSN activity declined but increased both and CSN response with this buffer (Fig.2B and 3B). Since increased cytosolic with a buffer containing and EGTA, we concluded that the source of this calcium increases is intracellular stores. Recently we observed a similar increase in due t o 3 m M in the presence of 10 mM EGTA with calcium-free buffer. The increases in \ due to are similar in the absence and presence of However, CSN increases are significantly diminished with calcium-free buffer. This discrepancy between and CSN activity is noteworthy. We think that intracellular calcium stores of glomus cells (mitochondria and/or ER) may contain significant amount ( range) of as suggested in most of the excitable cells (Muallen,1990). However it has been reported that CSN activity is sustained only with additional continued influx of (Rozanov et al.1999). A disruption of such cellular process (communication) in the. absence of or presence of calcium channel blocker results in a significant decrease of CSN activity. In order to identify the effect
of
induced background
fluorescence in these measurements we used the potassium salt of Indo-1 probe in cuvettes. We tested the effect of 3 mM and 5mM on fluorescence change in HEPES buffer solution containing 1 g/ml penta potassium salt (cell impermeable) in cell-free medium with 100 nM, 500 nM and 1 mM The changes in fluorescence ratio (R) due to alone in these buffers were significantly small suggesting that increases in fluorescence are essentially due to calcium increases in the cytosolic environment. These observations are similar to those reported in sympathetic neurons (Przywara,et al,.1993). can evoke secretion by a combination of two separate effects in glomus cells. It can cause cell membrane depolarization by inhibiting channel and thus enhancing influx to initiate increased CSN activity in normal buffer. Alternatively, it can also enter the cells via voltage-gated and receptor-gated calcium channels as it has been suggested in chromaffin cells. The presence of in the cytoplasm induces (1) release of catecholamines (effect similar to calcium) and (2) release of ATP to displace from internal stores (Forsberg and Pollard, 1988). Thus effect can result in an increased release of leading to an increase in CSN activity.
721
5.
CONCLUSION
Our results show that causes release from calcium stores in glomus cells. This increase in calcium results in an increased CSN response under normoxic and normocapnic condition.
ACKNOWLEDGMENTS This work is supported by NIH grant HL- 43413-10.
REFERENCES Biscoe, T.J., Duchen,M.R., Eisner, D.A., O'Neil, S.C.,Valdeomillos,M. 1989. Measurements of intracellular in dissociated type I cells of rabbit carotid body. J. Physiol.416:421-434. Buckler,K.J., Vaughan-Jones,R.D. 1994. Effects of hypoxia on membrane potential and cellular calcium in rat carotid body type I cells. J.Physiol.496:423-428. Buckler K.J. 1999. Background leak currents and oxygen sensing in carotid body type I cells. Respir. Physiol. 115:179-187. Donnelly,D.F.I997. Are oxygen dependent channels essential for carotid body chemotransduction? Respir. Physiol. 110:211-218. Douglas, W.W., Rubin,R.P. 1964. Stimulant action of barium on the adrenal medulla. Nature 203:305-307
Duchen,M.R., Biscoe,T.J. 1992. Relative mitochondrial membrane potential and I cells isolated from rabbit carotid body. 450:33-62.
in type
Gonzalez,C., L.Almaraz, A.Obeso, R.Rigual. 1994, Carotid body chemoreceptors: from natural s t i m u l i to sensory discharges, Physiol Rev. 74:829-897. Heldman,E., Levine,M., Raveha,L., Pollard,H.,1989. Barium ions enter chromaffin cells voltagedependent calcium channels and induce secretion by a mechanism independent of calcium. J.Biol.Chem. 266:7914-7920.
Lopez-Barneo, 1996, Oxygen sensing by ion channels and regulation of cellular functions. TINS 19:435-440.
Mokashi,A., Roy,A., Rozanov,C., Osanai,S., Storey,B.T., Lahiri,S. 1998, High Pco does not alter
pH i , but raises
in cultured rat carotid body cells in the absence and presence of
Brain Res. 803:194-197. Muallen,S. 1990, Calcium transport by resting and stimulated cells, In Intracellular calcium regulation (F.Bonner,ed.), Wiley-Liss, New York, pp.349-380.
Przywara,D.A., Chowdhary,P.S, Bhave,S.V., Wakade,T.D., and Wakade,A.R.1993. Barium induced exocytosis is due to internal calcium release and blockade of calcium efflux. Proc. Natl. Acad. Sci. USA. 90:557-561.
Roy,A., Rozanov,C., Iturriaga,R., Mokashi.A., Lahiri,S.1997. Acid-sensing by carotid body is inhibited by blockers of voltage-sensitive
channels. Brain Res.769:396-399.
Rozanov, C.,Roy, A.,Mokashi,A.,Wilson,D.F.,Lahiri,S.,Acker,H. 1999. Chemosensory response to high Pco is blocked by calcium channel blocker. Brain Res. 833:101-107. Ruden,L., Garcia,A.G., Lopez,M.G.1993. The mechanism of induced exocytosis from single chromaffin single chromaffin cells. FEBS Lett. 336:48-52. van der Merwe,P.A., Millar,R.P., Davidson,J.S. 1990.Calcium stimulates lutenizing-hormone
( l u t r o p i n ) exocytosis by a mechanism independent of protein kinase C. Biochem. J. 268:493498.
722
A DUAL ACID-INFLUX TRANSPORT SYSTEM IN THE CAROTID BODY TYPE I CELL Acid influx in carotid body type I cells
Ke-Li Tsai, Richard D. Vaughan-Jones,and Keith J. Buckler University Laboratory of Physiology, Parks Road, Oxford OX1 3PT, UK
1.
and
INTRODUCTION The carotid body is the principal chemosensor for arterial pH,
(O’Regan et al. 1982). In response to changes of pH, and in arterial blood, it relays electrical feedback signals to the respiratory
centre in the medulla, thereby modulating the depth and frequency of breathing (Gray, 1968; Black et al. 1971). It has been established that the type I cells of the carotid body play a major role in chemoreception (Gonzalez et al. 1994; Lopez-Barneo, 1996). The present study focuses on aspects of pH and sensing in carotid body type I cells. One model of pH and sensing is as follows: (i) Acidosis inhibits channels in the membrane producing depolarization which, in turn, activates voltage-gated channels permitting influx. (ii) The rise of intracellular concentration stimulates secretion of neurotransmitter from the cell. (iii) This secretion activates adjacent nerve endings, leading to excitation of the carotid sinus nerve (Buckler & Vaughan-Jones, 1994; Peers & Buckler, 1995). While details of the steps preceding type I cell membrane depolarisation are still lacking, some studies suggest that intracellular acidification may
play an important role, at least in the early stages of the transduction
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
723
cascade (Buckler & Vaughan-Jones, 1993). Changes in internal pH in response to an extracellular acid challenge are unusually large in the type-1 cell such that the change in is 60% or more of any change in Moreover these changes occur within a few minutes (or within seconds for a hypercapnic acidosis). Thus type I cells can detect changes of very effectively, by means of changes in . Although three types of acid equivalent transporter: exchanger, dependent transporter and exchanger, have been identified in type I cells (Buckler et. al 1991b), how these mechanisms determine the relationship between and ,, is not yet clear. The aim of this study is to identify the mechanisms responsible for mediating acid influx.
2.
MATERIALS AND METHODS
2.1
Cell isolation
Carotid body type I cells were isolated as described previously (Buckler et al. 199la). Carotid artery bifurcations were dissected from neonatal Sprague-Dawley rats (10 to 15 days old), anaesthetized with 4% halothane in oxygen, and placed into cold phosphate-buffered saline containing and The carotid bodies were removed from the carotid artery and enzymatically dissociated with collagenase and trypsin. The dispersed cells were then placed onto poly-L-lysine-coated cover slips. Finally, cells were maintained in HAMs-F12 culture medium (supplemented with foetal calf serum) in a 5% incubator at 37°C for 2-12 hrs before being used for experiments.
2.2
Solutions
free HEPES-buffered standard Tyrode solution contained (in mM): NaCl, 140; KC1, 4.5; 1; 2,5; glucose, 11; and HEPES, 20; pH was adjusted to 7.4 at 37°C. For pH 6.4 free solution, HEPES was replaced with PIPES and pH was adjusted to 6.4 at 37°C. The standard buffered Tyrode solution contained (in mM): NaCl, 117; KCl, 4.5; 23; 2.5; glucose, 11; and was equilibrated with 5% air; the final pH was around 7.45 at 37°C. In pH 6.4 buffered solution was reduced to 2.3 mM and NaCl increased to 137.7 mM.
724
In chloride-free, -buffered Tyrode solution, all chloride salts were substituted by an equivalent concentration of gluconate salts except for Ca-gluconate which was raised to 12 mM to compensate for calcium
binding to gluconate. Sodium-free,
-buffered Tyrode solution contained 140 mM
NMDG in place of sodium.
2.3
Measurement of intracellular pH
Intracellular pH was measured at 37°C using the pH-sensitive, single-excitation dual-emission fluorescent dye, carboxyseminapthorhodafluor-1 (SNARF; Molecular Probes). Cells were loaded with of the acetoxymethyl ester of SNARF-1 for 10-15 min. SNARF-loaded cells were then placed in a superfusion chamber mounted on the stage of inverted
microscope designed for fluorescence was excited at
epifluorescence measurements. and measured at
SNARF and
These two signals were recorded at 0.5 kHz onto the hard disk of a computer. Finally, was calculated from the emission ratio (R, the ratio of emission fluorescence at 590 nm to that at 640 nm) according to the following equation: Mean values of were determined in calibration experiments with nigericin (Thomas et al. 1979; Richmond & Vaughan-Jones, 1997).
2.4
Analyses of net acid fluxes
Net acid influx 1981):
was calculated from the equation (Roos & Boron,
where represents total hydrogen ion buffering capacity in the cells, in turn, is the sum of (intrinsic buffering power) and -induced buffering power). was estimated from the empirical equation (Buckler et al. 1991b): was determined by the following equation (Roos & Boron 1981):
2.5
Statistics
Average values are all expressed as and the number of experiments, n. Significance was assessed with paired student’s t-test, taking
725
a P value of 0.05 (control and test responses were obtained from the same cell).
3.
RESULTS
3.1
Relationship between pH0 and pHi
Fig. 1 shows a typical response of pHi in a type-1 cell when exposed to an extracellular acidosis. The cell was first superfused with 23 mM buffered Tyrode solutions (equilibrated with 5% and then subjected to a strong isocapnic acid challenge In response to this acid challenge there was a rapid fall of pH i. Upon returning to normal Tyrode solution recovered to its resting level The steady-state fall of upon reducing was pH unit (n=4). Thus the sensitivity of to is such that a 1.0 pH unit fall of lowers pH, by over 0.5 units. During the early stage of this acidification, the net acid influx (J,,) was equivalent to mequiv (measured at ).
3.2
of acid loading
In Fig. 1B, a cell was again subjected to an isocapnic acid challenge (as above) in solution. The cell was then superfused with a HEPES-buffered Tyrode solution and subjected to a second acid challenge (pH 0 6.4) under free conditions. A comparison of the acid influx rates in response to the two acid challenges revealed an initial net acid influx (J H ) of mequiv in solution but only mequiv in HEPES-buffered solution (n = 5; Acid influx rates were measured at the same under both conditions. Compared with the net acid influx observed in -buffered solution, only 19% remained in HEPES-buffered solution (note that the intracellular buffering capacity of cells bathed in buffered solution is much larger than for those bathed in nominally free HEPES-buffered Tyrode solution; see legend to Fig 1). This result indicates that almost 80% of the acid loading process under physiological conditions is
726
727
3.3
dependence of acid loading
In many cells exchangers have been reported to mediate acid influx (e.g. Vaughan-Jones, 1979; Alper, 1991). Since a exchange has previously been described in type-1 cells it seemed to be a likely candidate for the dependent acid influx described above. To find out whether a such a mechanism does indeed mediate the acid influx in type-1 cells we repeated the acid challenge experiment in buffered Cl -free solution. In the absence of external ions we found that the rate of fall in response to an external acidosis was greatly reduced from mequiv mequiv measured at the same i.e. only 30% of the control rate ( significant difference). Thus 70% of total acid influx in buffered solution is dependent.
728
3.4
dependent acid loading requires
Acid influx rate was also measured in the presence and absence of under -free conditions. The acid influx rate in HEPES-buffered
perfusate was mequiv
mequiv
for control, and
free conditions,
measured at
). Although there seems to be a slightly slower flux rate under
free
condition, the difference was not statistically significant, suggesting there is little dependent acid influx in the absence of Furthermore, by measuring acid influx rates in buffered free solution and in HEPES-buffered solution (containing ) in the same type I cell, we were able to compare directly the independent acid influx with the independent acid influx. There was no significant difference between these two fluxes ( mequiv and mequiv
respectively at
).
Taking these results together, we conclude that (i) the main acid loading mechanism is a exchange, and that this contributes more than 70% of the total acid influx into the type I cell during an acid challenge, (ii) the residual acid influx is independent of both and
3.5
dependency of acid loading
A previous study has suggested that dependent transporter may be expressed in type I cells (Buckler et. al., 1991a). It is therefore conceivable that this transporter might also be involved in the acid loading process. However, in the absence of (replaced by N-methyl-D-
glucamine), there was no significant change in the acid influx rate
measured during isocapnic acidosis The net acid influx in response to a pH 6.4 acid challenge in the presence and in the absence of was mequiv and mequiv respectively ( , no significant difference; net fluxes measured at buffered media). Therefore dependent transporters are not involved in the acid loading process.
4.
DISCUSSION
The of the carotid body type I cell is very sensitive to a fall of In this study, we observed a value of 0.54, which compares with a previously reported ratio of around 0.6 (Buckler et al 1991b). This sensitivity is exceptionally high when compared with lower
729
values of observed in many other tissues including cardiac cells (Vaughan-Jones, 1986) and some smooth muscle cells (Aickin, 1984), although Austin & Wray (1993) have reported a larger ratio in rat mesenteric vessel smooth muscle. The present study now clarifies the mechanisms responsible for the fall of type-1 cell during an extracellular acid challenge. Our data indicate that a dependent and dependent mechanism produces more than 70% of net acid influx (Fig. l&2). This acid influx is independent. We propose that it is mediated by a exchanger. This may be the same transporter that has been shown previously to mediate changes following changes in extracellular concentration (Buckler et al. 1991a). In addition to the anion exchanger, there is evidence for a second parallel pathway which is responsible for the residual of acid influx. This second pathway appears to be independent of both and (note that in the absence of i.e. in HEPES buffered media, this pathway constitutes the principal mechanism for acid influx into the type I cell). The nature of this pathway remains to be elucidated. It could either be an (or OH) permeable channel or a novel acid-equivalent ion-carrier.
730
We found no evidence for any significant dependent but independent acid influx (less than 10%) which suggests that permeable anion channels (e.g. Stea & Nurse 1989) do not play a significant role in mediating acid influx. In addition, the lack of any detectable dependent acid influx in the absence of suggests that
exchange plays no significant role in mediating acid influx. Fig.3 summarises our conclusions regarding the acid influx pathways in the type-1 cell. There are two main pathways activated by an isocapnic acid challenge: a exchanger, and an activated mechanism. Since the exchange is responsible for most of the acid influx in
response to extracellular acidosis it may also play an important role in defining the steady state relationship between and In order to understand more fully the cause of the steep relationship between and however, further studies are required on the kinetics not only of the acid influx pathways indicated in Fig.3 but also on the acid efflux pathways previously described in this cell type (Buckler et al 199la). Finally, we have no information concerning which of the many anion exchange isoforms are responsible for the exchange demonstrated in the present work (at least three different isoforms have been identified in various tissues, Alper, 1991). Identification of the exchanger at the molecular level may help to elucidate its properties and likely role in regulation in this tissue.
ACKNOWLEDGEMENT This work was supported by the Medical Research Council (K.J.B), the British Heart Foundation (R.D.V-J, K.J.B.) and an Overseas Research Scholarship (K-L.T).
REFERENCES Aickin, C. C., 1984, Direct movement of intracellular pH and buffering power in smooth muscle cell of Guinea-pig vas deferens. J. Physiol. 349: 517-585. Alper, S. L., 1991, The band 3-related anion exchanger (AE) gene family. Annual. Rev. Physiol. 53: 549-564. Aronson, P., 1985, Kinetic properties of the plasma membrane exchanger. Ann. Rev. Physiol. 47: 545-560.
Austin, C., and Wray, S., 1993, Extracellular pH signals affect rat vascular tone by rapid transduction into intracellular pH changes. J. Physiol. 466: 1-8.
Black, A. M. S., McCloskey, D. I., and Torrance, R. W., 1971, The responses of carotid body chemoreceptors in the cat to sudden changes of hypercapnic and hypoxic stimuli. Resp. Physiol. 13: 36-49.
731
Buckler, K. J., Vaughan-Jones, R. D., Peers, C., and Nye, P.C.G., 199la, Intracellular pH and
its regulation in isolated type I carotid body cells of the neonatal rat. J. Physiol. 436: 107129. Buckler, K. J., Vaughan-Jones, R. D., Peers, C., and Nye, P.C.G., (1991b) Effects of
extracellular pH,
and
on intracellular pH in isolated type I cells of the neonatal
rat carotid body. J. Physiol. 444: 703-721.
Buckler, K. J., and Vaughan-Jones, R. D., 1993, Effects of acidic stimuli on intracellular calcium in isolated type I cells of the neonatal rat carotid body. Pflug. Arch. 425: 22-27.
Buckler, K. J., and Vaughan-Jones, R. D., 1994, Effects of hypercapnia on membrane potential and intracellular calcium in rat carotid body type 1 cells. J. Physiol. 487: 157171. Gonzalez, C., Almaraz, L., Obeso, A. and Rigual, R. 1994, Carotid body chemoreceptor: from natural stimuli to sensory discharges. Physiol. Rev. 74: 82-898. Gray B. A., 1968, Response of the perfused carotid body to changes in pH and Resp. Physiol. 4: 229-245. Lopez-Barneo, J., 1996, Oxygen-sensing by ion channels and the regulation of cellular functions. Trends. Neurosci. 19: 435-440. R. G., 1982, Role of peripheral chemoreceptors and central chemosensitivity in the regulation of respiration and circulation. J. Exp. Biol. 100: 23-40. Peers, C., and Buckler, K. J., 1995, Transduction of chemostimuli by the type I carotid body cell. J. Mem. Biol. 144: 1-9. Richmond, P.H., and Vaughan-Jones, R. D., 1997, Assessment of evidence for
exchange in isolated type-I cells of neonatal rat carotid body. Pflug. Arch. 434: 429-437. Roos, A., and Boron, W.F., 1981, Intracellular pH. Physiol. Rev. 61: 296-434.
Stea, A., and Nurse, C. A., 1989, Chloride channels in cultured glomus cells of the rat carotid body. Am. J. Physiol. 257 (Cell Physiol. 26): C174-C181.
Thomas, J. A., Bushsbaum, R. N., and Racker, E., 1979, Intracellular pH measurements in Ehrlich Ascites tumor cells untilising spectroscopic probes generated in situ. Biochemistry 18: 2210-2218.
Vaughan-Jones, R. D., 1979, Regulation of chloride in quiescent sheep heart Purkinje fibres studied using intracellular chloride and pH-sensitive micro-electrodes. J. Physiol. 295: 111-137. Vaughan-Jones, R. D., 1986, An investigation of chloride-bicarbonate exchange in the sheep cardiac Purkinje fibre. J. Physiol. 379: 377-406.
732
L-DOPA AND HIGH OXYGEN INFLUENCE RELEASE OF CATECHOLAMINES FROM THE CAT CAROTID BODY
Hay-Yan Jack Wang, Machiko Shirahata, and Robert S. Fitzgerald Department of Environmental Health Sciences,Anesthesiology, Medicine, and Physiology, The Johns Hopkins University, 615 N Wolfe Street, Baltimore, MD 21205, USA
Abstract:
Current modelling of carotid body (CB) chemotransduction postulates an essential role for neurotransmitters, including dopamine (DA).
Catecholamines (CA) released from incubated/superfused cat CBs has often been reported to diminish rapidly over the course of the exposure. The purpose of the first set of experiments was to determine the effects of including L-dihydroxyphenylalanine (L-DOPA), the immediate precursor to DA, in the incubation medium. CBs were removed from deeply anesthetized
cats, cleaned of connective tissue, and placed in separate incubation tubes
containing Krebs Ringer Bicarbonate solution (KRB) at 37°C. One tube
contained
M L-DOPA.
normoxic gas mixture
Both tubes were bubbled for 2 hr with a This was followed immediately by a
30-minute exposure to a hypoxic gas mixture
The mean
amounts of DA, dihydroxyphenylacetic acid (DOPAC), homovanillic acid (HVA) and norepinephrine (NE) released during 30 min exposures were always greater when L-DOPA was present. The use of gas mixture like the above normoxic gas mixture in incubation studies has often been considered quasi-hypoxic. Hence, in a second set of experiments we tested the effect of high oxygen mixture All other features of these experiments were the same as the above. The high oxygen environment correlated with lower DA release suggesting a reduced excitation/inhibition. The subsequent exposure to hypoxia, however, provoked a much larger release of DA and NE. The data demonstrate the substantial effect of oxygen on the release of CAs and the apparent need of a DA precursor like L-DOPA to allow detection of the changes in CA release from the CBs upon exposure to a hypoxic stimulus.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
733
1.
INTRODUCTION
Most current models of the CB’s chemotransduction of hypoxia or hypercapnia postulate a role for the neurotransmitters contained in the CB’s glomus cells. Designating which are excitatory and which inhibitory is currently under study. But the CAs are the most abundant in all species studied. Their behavior has been studied extensively. Several reports show that the amount of catecholamines released from CBs superfused or incubated in either a normoxic or hypoxic medium diminishes rather rapidly (Donnelly, 1995, 1996; Iturriaga et al., 1996). This depletion could affect the ability of the CB to chemotransduce, and/or have an impact on the release of the CB’s other neurotransmitters. There could be more than one reason for the disappearance of the CAs; e.g., a depletion of the CA pools, the viability of the CB’s entire metabolic machinery. We hypothesized that the phenomenon of disappearance could be abolished or greatly attenuated by the inclusion of an appropriate dopamine precursor. That is, the metabolic processes of the CB remained intact, but the addition of a precursor was needed for the long-term detection of DA and its metabolites.
2.
MATERIALS AND METHODS
2.1
Animal Preparation
Young adult cats of either sex were used in these experiments. Each animal was anesthetized with ketamine (100 mg/kg, i.p.), then heparinized (2000 IU/kg) to avoid blood clotting in the CB. The cat was subsequently sacrificed by additional pentobarbital injection (50-100 mg/kg, i.v.), then decapitated.
2.2
Carotid Body Handling
Carotid arteries rostral to the decapitating incision were perfused with 5 ml Kreb’s Ringer Bicarbonate solution (KRB; contains 112 mM NaCl, 4.7 mM KCl, 2.2 mM 1.1 mM 11 mM glucose) to remove blood remaining in the vasculature. The carotid artery bifurcations were quickly excised and placed in 10 ml ice-cold KRB. The surrounding connective tissue was rapidly removed under dissecting microscope. Each CB was then placed into KRB containing
734
L-DOPA. The fluid was bubbled with the normoxic gas mixture or the high oxygen mixture for 30 minutes, allowing the CBs to recover from surgery.
2.3
Carotid Body in vitro Incubation
The incubation fluid of one CB was replaced by fresh KRB containing L-DOPA after the initial 30 mm. post-surgical recovery incubation. The other CB received fresh KRB. Both CBs were simultaneously exposed to the normoxic gas mixture or the high oxygen mixture. The incubation fluid was collected and replaced by the same volume of fresh incubation fluid every 15 minutes. After the initial 150minute normoxic exposure, both CBs were then exposed to the hypoxic gas mixture for 30 minutes to determine its effect on CA release.
2.4
Sample Preparation and HPLC Analysis
Each sample was mixed with an antioxidant solution in the volume ratio of 4:1 (sample: antioxidant solution; Thorré et al. 1997), and stored in a –80 °C freezer for HPLC analysis. The CA content was determined with a high performance liquid chromatography-electrochemical (HPLC-EC) detection system which consisted of a PHASE II ODS-3 column ( MF-6213; Bioanalytical System Inc.), an amperometric detector (LC-4C; Bioanalytical System Inc.), a solvent delivery pump (PM-80; Bioanalytical System Inc.) and a thin-layer amperometric cell with glassy carbon working electrode. The operating potential of the electrochemical detector was set V vs an Ag-AgCl reference electrode. The mobile phase contained 100 mM sodium acetate; 20 mM citric acid; 2.0 mM sodium 1-octanesulfonate; 0.1 mM EDTA; and 1 mM dibutylamine. The pH was adjusted to 3.1 with 85% phosphoric acid (LC-grade, Fisher Scientific). 1.5% volume of this mobile phase was replaced by equal volume of LC-grade methanol (Fisher Scientific). The other 1.75% of this mobile phase was replaced by equal volume of LC-grade N,N-dimethylacetamide (Sigma-Aldrich) (modified from Thorré et al. 1997). Mobile phase flow was 0.9 ml/mm. A injection loop was used throughout all measurements. The CA external standards (NE, DOPAC, DA, and HVA; all purchased from Sigma Chemical Co.) were made in antioxidant mixture and stored in a –80°C freezer according to Thorré et al. (1997).
735
3.
RESULTS
3.1
Catecholamine External Standards HPLC-EC
Chromatography
Figure 1 shows the chromatograph of CA external standards. Each peak represents the response to one picomole of the designated CA species. In this example, NE was eluted out at a peak retention time of 106.8 sec., DOPAC 197.0 sec., DA 249.6 sec., HVA 377.4 sec. All CAs of interest can be completely separated from each other by this chromatographic method.
3.2
The Influence of L-DOPA on Carotid Body Catecholamine Release in Normoxic Gas Mixture
Figure 2 shows a typical chromatograph of CAs released from a CB under the effect of L-DOPA when exposed to the normoxic gas mixture. The release of CA was easily detectable and quantifiable under this condition. Each CA species of interest was eluted out with a peak retention time that was virtually identical to that of the standard. Figure 3 demonstrates a sample chromatograph of CAs released from the contralateral CB of Fig. 2. This CB was incubated in the identical gas mixture but without L-DOPA. The amount of CA released was largely reduced, or completely absent (NE). Table 1 shows the CA release from six paired CBs exposed to the normoxic gas mixture. In the presence of L-DOPA, the CBs maintained their CA release capability throughout the 2-hour incubation period, and responded to the subsequent 30-minute hypoxic gas challenge. The total amount of CAs released during the hypoxic gas mixture challenge was approximately 131% and 105% of that released during the final and during the first 30-minute normoxic gas mixture incubation, respectively. The total amount of NE plus DA released in this hypoxic gas challenge was 292.4% of the same neurotransmitters released in the final 30-minute incubation, and was about only 80% of total NE and DA released during the initial 30minute normoxic gas mixture incubation. During the final 30-minute normoxic gas mixture incubation, the total amount of CAs released equaled 80% of the release during the initial 30-minute incubation. In the absence of L-DOPA, CB’s release of CAs decayed rapidly. The total amount of CAs released in the first 30 minutes was only 36.3% of that from the corresponding L-DOPA group. The total amount of CAs released in the final 30 minutes equaled only 6% of the initial 30-minute release. The subsequent 30 minutes hypoxic gas mixture challenge didn’t promote any significant amount of DA or NE release.
736
737
738
3.3
The Influence of L-DOPA on Carotid Body Catecholamine Release in High Oxygen Gas Mixture
Incubation media collected from paired CBs exposed to high oxygen mixture generated chromatographs that were qualitatively essentially identical to those of the samples collected from the normoxic gas mixture incubation. Quantitatively, however, the amounts were much less over the two hours of exposure. Table 2 shows the CA release from the high oxygen gas mixture incubation in the presence and absence of L-DOPA. In the presence of L-DOPA, the total amount of CAs released during the last 30 minutes of incubation turned out to be 69% of the initial 30-mmute release. The total amount of CAs released in the subsequent 30-mmute hypoxic gas mixture was 194% of the first 30-mmute of high oxygen exposure, and 281%, of the last 30 minutes of high oxygen exposure. The total of NE plus DA released during this hypoxic gas mixture was 7.91 picomole/20 approximately 158 times more than the last 30 minutes of high oxygen mixture exposure, and 10 times more than the initial 30 minutes of high oxygen mixture exposure. In the presence of L-DOPA, the CAs released in high oxygen mixture were mostly DOPAC and HVA, the metabolites of DA. NE and DA released were minimal or absent after the first 30 minutes incubation. In the absence of L-DOPA, the total amount of CAs released from the CBs within the first 30 minutes incubation was only 55.6% of that of the corresponding L-DOPA treated group, and diminished rapidly. The last 30 minutes of high oxygen mixture incubation promoted the amount of CAs release that equaled only 4.5% of initial 30-minute release. The following
30 minutes hypoxic gas mixture exposure released about 4 times as much total CAs as were released during the 30 minutes preceding the hypoxic gas mixture exposure. However, this release was only 20% of that from the first 30-minute high oxygen incubation.
739
4.
DISCUSSION
Without the CA precursor L-DOPA, CAs released from the in vitro CBs in both the normoxic gas mixture and high oxygen mixture groups decayed significantly over the two-hour incubation. The CBs were also unable to release CAs in the subsequent hypoxic gas mixture challenge. This result is similar to the observations by Donnelly (1995, 1996) and Iturriaga et al. (1996) who reported a rapid decay of CA release from the in vitro CB over repetitive hypoxic challenges. We were able to reverse this rapid decay and the subsequent hypoxic unresponsiveness by including L-DOPA in the incubation media. Such results suggest that the decay of CA observed by Donnelly and by Iturriaga might be due to a shortage of CA precursor in the in vitro preparation, or the absence of high affinity dopamine uptake system on the carotid body glomus cells (Gonzalez et al., 1987), or both. In the presence of L-DOPA, the CA release still slowly decayed over the two-hour incubation period. The total CAs released during the last 30 minutes of the two-hour exposure were 80% (normoxic gas mixture) and 69% (high oxygen mixture) of the initial 30-minute release. The reasons for this relatively slow decay are presently unclear. Perhaps the CA synthesis requires some substance contained in the plasma but not in KRB. Perhaps efferent traffic normally present in the carotid sinus nerve serves a trophic purpose in the synthesis of glomus cell CAs. It may be attributed to the rundown of catecholamine synthesis machinery, or the modification of the neurotransmitter release mechanisms. Nonetheless, in order to establish a more feasible in vitro preparation with which to investigate the neurotransmitter interaction mediating carotid body chemosensory transduction from the acute preparation, the inclusion of a catecholamine precursor in the environment seems advisable. Under the influence of L-DOPA, CBs in the normoxic gas mixture always released a larger amount of NE and DA than the CBs in the high oxygen group. But the following 30 minutes hypoxic challenge promoted the largest amount of NE and DA release in both groups. In the normoxic group the sum of NE plus DA released was 7.32 picomoles/20 in the high oxygen group, 7.91 picomoles/20 This suggests that when receiving LDOPA as the precursor the in vitro CB; regardless of the preceding environment, in response to the hypoxic challenges will release the same amount of these two CAs. To establish this possibility a dose-response study with varying levels of hypoxia would be required. Since neural activity from the CB is decreased under hyperoxic condition, our data might suggest that DA is the excitatory neurotransmitter. However, it is possible to consider DA as an inhibitory or modulatory neurotransmitter with some other agent being responsible for the excitation
740
of the CB. Under hyperoxic conditions when neural output is low due, perhaps, to a decrease in the levels of the excitatory agent, there is less need for the modulatory influence of DA. Fidone and Gonzalez (1982) explored the synthesis of CAs in the in vitro rabbit CB by incorporating different CA precursors. They observed that with increasing doses of either tyrosine or L-DOPA, the CBs produced increasing amount of CA. They also observed that CA production increased with increasing times of exposure to the precursors. But L-DOPA produced larger amounts of CAs over time than did an equal dose of tyrosine. Detailed comparison of their study with ours would be risky because the species were different and the design of the two studies was different. But what is clear is that the presence of a CA precursor seems to allow for the continued production of CAs, whereas CA production seems to be thwarted in the absence of a precursor. Additionally different precursors seem to have different quantitative effects on CA production. These fascinating observations await further exploration and interpretation before the mechanisms of chemotransduction in the CB can be fully understood.
ACKNOWLEDGEMENT This work was supported by NHLBI HL 50712.
REFERENCES Donnelly, D.F., 1995, Does catecholamine secretion mediate the hypoxia-induced increase in nerve activity? Biol. Signals 4: 304-309. Donnelly, D.F., 1996, Chemoreceptor nerve excitation may not be proportional to catecholamine secretion. J. Appl. Physiol. 81(2): 657-664. Fidone, S., and Gonzalez, C., 1981, Catecholamine synthesis in rabbit carotid body in vitro. J. Physiol. (Lond.) 333: 69-79. Gonzalez, C., Almaraz, L., Obeso, A., and Rigual, R., 1994, Carotid body chemoreceptors: From natural stimuli to sensory discharges. Physiol. Rev. 74 (4): 829-898. Gonzalez, C., Dinger, B.C., and Fidone, S.J., 1995, Mechanisms of carotid body chemoreception. in Regulation of Breathing 2 nd. Ed. (ed.: J. A. Dempsey, and A. I. Pack): 391-471, Marcel Dekker, Inc.. Gonzalez, E., Rigual, R., Fidone, S.J., and Gonzalez, C., 1987, Mechanisms for termination of the action of dopaminc in carotid body chemoreceptors. J. Auton. Nerv. Syst. 18: 249-259. Iturriaga, R., Alcayaga, J., and Zapata, P., 1996, Dissociation of hypoxia-induced chemosensory responses and catecholamine efflux in cat carotid body superfused in vitro. J. Physiol. (Lond.) 497 (2): 55 1-564. Thorré, K., Pravda, M., Sarre, S., Ebinger, G., and Michotte, Y., 1997, New antioxidant mixture for long term stability of serotonin, dopaminc and their metabolites in automated microbore liquid chromatography with dual electrochemical detection. J. Chromatogr. B 694: 297-303.
741
This page intentionally left blank
EFFECTS OF A DOPAMINE AGONIST ON CYTOSOLIC CHANGES INDUCED BY HYPOXIA IN RAT GLOMUS CELLS
Katsuaki
Hideki
and Yoshiaki
of Physiology and Chemistry,
of Physical Therapy, Akita
University College of Allied Medical Science, Akita 010-8543, Japan, of Systems Physiology, University of Occupational and Environmental Health, Yahata, Kitakyushu 807-8555, Japan
1.
INTRODUCTION
Lever and Boyd (1957) observed dense-cored vesicles in the glomus cells of the carotid body by electron microscopy. Chiocchio, et al. (1966) and Dearnaley et al. (1968) recognized the vesicles histochemically as catecholamines by fluorimetric assay. Fidone et al. (1982a, b) reported that the glomus cells increase their synthesis of catecholamines such as dopamine (DA) and release DA when stimulated by hypoxia. Donnelley (1995) and Sun and Reis (1994) discussed the role of dopamine in the carotid body, and concluded that catecholamines could not explain the increase in afferent nerve activity. Recently, Jackson and Nurse (1998, 1997) compared levels of extracellular DA in cultured oxygen-sensitive glomus cells exposed to normoxia chronic hypoxia or chronic nicotine under normoxia, and considered the role of DA. The consensus of many investigators is that DA modulates chemoreception, although the precise mechanisms are not known. On the other hand, intracellular must have an important role in chemotransduction as a second messenger and in the release of substances from cells. Therefore, it would be interesting to examine the effects of DA or its agonists on changes in cytosolic
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. KluwerAcademic/Plenum Publishers, 2000
743
induced by chemical stimuli, since cytosolic plays a key role in the secretory and chemoreceptive functions of glomus cells. We studied the effects of a DA agonist, tyramine (TA), on changes induced by hypoxia, acetylcholine (Ach), cyanide (CN), caffeine and Bay K 8644 in cultured rat glomus cells and discuss here the role of TA.
2.
METHODS
Carotid bodies were isolated from Wistar rats (10-22 weeks old) that were anesthetized with 25% urethane (4 ml/kg body weight, intraperitoneally). The organs were prepared for removal of encapsulating connective tissue in a modified Krebs solution (a physiological solution in mM: NaCl 112, KC1 4.7, 1.1, sodium-glutamate 42, HEPES buffer 5, glucose 7.2; pH 7.4). Cleaned carotid bodies were incubated in a culture medium containing 3 mg/ml collagenase for 30 to 60 mm at 37°C to loosen the tissue of the carotid bodies. The culture medium was minimum essential medium (MEM; Gibco, USA) supplemented with 10% fetal bovine serum (Gibco), 6.0 mg/ml glucose, penicillin G (Sigma, USA), streptomycin (Sigma), nerve growth factor (Sigma), and 2.2 g/1 (pH 6.8-7.2). After washing with culture medium, special care was taken to preserve clusters of glomus cells intact during mechanical fragmentation under a dissecting microscope. Clusters in culture medium were plated on coverglasses coated with poly-L-lysine (0.1 mg/ml) and cultured in a incubator at 37°C, for 4 - 7 days. Each cluster included 5 - 1 0 glomus cells. Glomus cells were loaded with fura-2 by incubation in 1 ml of culture medium containing 5 acetoxymethyl ester fura-2 (fura-2 AM; dissolved in dimethyl sulfoxide as a 1 mM stock solution) and of non-cytotoxic detergent, Cremophor EL (Sigma), for 30 mm at 37°C. Cultured clusters loaded with fura-2 were transferred to the stage of a microscopic fluorimeter (Attofluor RV; Carl Zeiss, Germany / Attofluor, USA). Cultured clusters were perfused continuously with physiological solution gassed by air and 5% at a constant temperature of 37°C. The flow rate of the superfusate was 0.8 ml/mm. Fluorescent images with excitation at 340 and 380 nm were recorded at 1 s interval with an intensified video camera. The ratio of intensity at 380 nm to that at 340 nm was converted to the absolute value of using a calibration curve between fluorescence intensities and measured directly (described in detail by Yoshizaki, et al. 1995). We examined the effect of 1 mM DA and 1 mM of TA. The oxygen tension in the perfusion solution was approximately 38 mmHg during
744
hypoxia (produced by switching the control solution to a solution gassed by nitrogen) and 160 mmHg during the control, as measured by an acid-base/gas analyzer (ABL-30, Radiometer/Copenhagen, Sweden). One mM Ach (a neurotransmitter), 0.1 mM NaCN (a cellular respiration inhibitor), 1 mM caffeine (a Ca-induced Ca release activator), 10 nM Bay K 8644 (a slow Ca channel opener) dissolved in superfusion solution, or a high concentration (18 mM) of potassium, were administered upstream into the pcrfusion system.
3.
RESULTS
3.1
Effects of 1 stimulants on
change
Glomus cells were classified into 3 groups according to whether increased, decreased, or did not change in response to hypoxia. Some pairs of adjacent cells responded reciprocally from each other. All applied stimulants increased level of Figure 1 shows typical patterns of changes.
3.2
Effects of tyramine on stimulants
change induced by
745
When the perfusion solution was replaced with the solution that contained 1 mM TA, the resting level of increased slightly in most of the glomus cells examined. TA inhibited the increase induced by hypoxia in some glomus cells (Fig. 2A), but facilitated the decrease induced by hypoxia in other cells (Fig. 2B). When applied TA to changes induced by acetylcholine, NaCN and high concentration of potassium, there were three different types of glomus cells which showed the change was either facilitated, or inhibited or not changed.
746
Figure 3 shows that TA facilitated the slow elevation of induced by Bay K 8644, a slow Ca channel activator, and inhibited the increase in induced by caffeine, an activator of Ca-induced Ca release from cytosolic Ca stores (Yoshizaki et al. 1995). These findings of TA effects were summarized in Table 1.
4.
DISCUSSION
Using cultured clusters of glomus cells, we showed in this study that TA as an agonist of DA acts variously on changes induced by several stimuli, and that some of pairs of adjacent glomus cells showed opposite responses to TA action on change induced by acetylcholine, NaCN, and a high concentration of potassium. The consensus of many investigators (e.g. Jackson and Nurse 1998; Basson et al. 1997; Hsiao et al. 1989; Leitner and Roumy 1986; Fidone et al. 1982) is that DA modulates chemoreception but is not a neurotransmitter, because DA application does not significantly facilitate nerve activity. However, some mechanisms of DA modulation are still not known in detail. The increase in resulting from caffeine application indicates the existence of cytosolic Ca stores in glomus cells. Furthermore, the increase induced by Bay K 8644 means that the increase is partly brought about through slow Ca channels on the glomus cell membrane, because Obeso et al. (1992) reported that glomus cells possess slow and voltage-dependent Ca channels. In addition, Hayashida et al. (1999) showed that ACh and NaCN mostly increased in glomus type 1 cells and maintained 50% of the amplitude of this response with the removal of From the present results and those of Hayashida’, we consider that a increase in glomus cells may be brought about by two modes: Ca entry through slow and voltage-sensitive Ca channels (Obeso et al. 1992), and Ca release from cytosolic Ca store activated by free increase through the Ca channels (Ca-induced Ca release, Yoshizaki et al. 1995). TA inhibited the increase induced by caffeine and facilitated the increase induced by Bay K 8644. Thus, TA action may inhibit Ca release from cytosolic Ca stores and may enhance voltage-dependent Ca influx from extracellular sites through slow Ca channels. Glomus cells either
747
increased or decreased their in response to hypoxia. TA inhibited the increase induced by hypoxia, but facilitated the decrease in induced by hypoxia. These results suggest that TA may inhibit Ca-induced Ca release from cytosolic Ca stores or inhibit voltage-dependent Ca influx from extracellular sites, and may enhance Ca storage in the cytoplasm or Ca efflux to extracellular sites.
REFERENCES Basson, H., Bairam, A., Cottet, E. J. M., Pequignot, J. M. and Marchal, F. 1997.
Carotid body dopamine content and release by short-term hypoxia: effect of haloperidol and alpha methyl paratyrosine. Arch. Physiol. Biochem. 105, 3-9. Chiocchio, S. R., Biscardi, A. M. and Tramezzani, J. H. 1966, Catecholamines in the carotid body of the cat. Nature (London) 212, 834-835. Dearnaley, D. P., F i l l e n z , M. and Woods, R. I. 1968, The identification of dopamine in the rabbits’ carotid body. Proc. R. Soc. London Ser. B 170, 195-203. D o n n e l l y , D.F. 1995, Docs catecholamine secretion mediate the hypoxia-induced
increase in nerve activity? Biol. Signals. 4, 304-9. Fidone, S., Gonzalez, C. and Yoshizaki, K. 1982, Effects of hypoxia on catecholamine synthesis in rabbit carotid body in vitro. J. Physiol. London, 333, 81-91.
Fidone, S., Gonzalez, C. and Yoshizaki, K. 1982, Effects of low oxygen on the release of dopaminc from the rabbit carotid body in vitro. J. Physiol. London, 333, 92-1 10.
Hayashida, Y., Yoshizaki, K. and Kusakabe, T. 1999, Interplay between the cytosolic Ca2+ increase and potential changes in glomus cells in response to chemical s t i m u l i . In Arterial Chemoreceptors. Oxygen Sensing-From Human To Man, Plenum, London, UK (in press). Hsiao, C., Lahiri, S. and Mokashi, A. 1989, Peripheral and central dopamine receptors
in respiratory control. Respir. Physiol. 76, 327-336.
Jackson, A. and Nurse, C. A. 1998, Role of acetylcholine receptors and dopamine transporter in regulation of extracellular dopamine in rat carotid body cultures
grown in chronic hypoxia or nicotine. J. Neurochem. 70, 653-662. Jackson, A. and Nurse, C. A. 1997, Dopaminergic properties of cultured rat carotid body c h e m o r e c e p t o r s g r o w n i n n o r m o x i c and h y p o x i c e n v i r o n m e n t s . J . Neurochem. 69, 645-654. L e i t n e r , L. M. and R o u m y , M. 1986, Chemoreceptor response to h y p o x i a and
h y p e r c a p n i a in catecholamine depleted rabbit and cat carotid bodies in vitro. Pflugers, Arch. 406, 419-423
Obeso, A., Rocher, A., Fidone, S. and Gonzalez, C. 1992, The role of dihydropyridine-sensitivc Ca2+ channels in stimulus-evoked catecholamine release
from chemoreceptor cells of the carotid body. Neuroscience, 47, 463-72 Sun, M. K. and Reis, D. J. 1994, Dopamine or transmitter release from rat carotid body may not be essential to hypoxic chemoreception. Am. J. Physiol. 267, R1632-1639.
Yoshizaki, K., Hoshino, T., Sato, M., Koyano, H., Nohmi, M., Hua, S-Y. and Kuba, K. 1995, induced release and its activation in response to a single Action potential in rabbit otic ganglion cells. J Physiol (London) 486: 177-187.
748
CAROTID CHEMORECEPTORS PARTICIPATION IN BRAIN GLUCOSE REGULATION Role of arginine-vasopressin 1,2Sergio A. Montero, 1Alexander Yarkov, and 1Ramón Alvarez-Buylla 1Centro Universitario de Investigaciones Biomédicas, Universidad de Colima, 2Facultad de Medicina, Universidad de Colima, Colima, Col., México
1.
INTRODUCTION
In previous studies we suggested that carotid body receptors (CBR) participate in glucose homeostasis (Alvarez-Buylla and Alvarez-Buylla, 1994). One of the most striking effects of the carotid chemoreceptor stimulation with cyanide (NaCN) is a rapid hyperglycemic reflex with glucose retention by the brain (Alvarez-Buylla et al., 1996). Pituitary and adrenals, two glands involved in glucose homeostasis, participate in the efferent pathway of this reflex (Alvarez-Buylla, 1997). Surgical removal of the neurohypophysis but not the anterior hypophysis abolishes the hyperglycemic reflex initiated in the CBR. Some of these efferent effects may be mediated through the direct action of neurohypophysial hormones on liver and adrenals. It has become progressively apparent that, in addition to its antidiuretic and vasopressor effects, vasopressin (AVP) also displays a powerful glycogenolytic action on the liver (Hems et al., 1978; Morel et al., 1992) and modulates glucose metabolism when the organism is under stress (Wideman and Murphy, 1993). Although AVP is widely distributed throughout the central nervous system (CNS) (Ostrowski et al., 1994), and it is known to act as an excitatory transmitter (Jakab et al., 1991), the effect of AVP on cerebral glucose homeostasis has not been documented. Importantly, carotid sinus perfusion with deoxygenated blood (Share and Levy, 1966) or following bilateral carotid occlusion (Harris, 1979), results in an increase in AVP levels in plasma. Carotid body receptor
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
749
signals arising via the glossopharyngeal nerve are initially processed in the CNS at the level of the nucleus of the tractus solitarious (NTS) (Finley and Katz, 1992), and vassopressinergic axons of hypothalamic neurons (parvocellular nucleus) terminate in the NTS (Swanson and Kuypers, 1980). Therefore, AVP in the NTS may also have a regulatory effect on the hyperglycemic reflex initiated in the CBR, by modulating information arising from these receptors. We now explore whether the AVP participates on the hyperglycemic reflex previously described, and further analyze the effects of agonists and antagonists to AVP receptors within the NTS on glucose retention by the brain
2.
METHODS
2.1
Animals and Surgical Procedures Experiments were performed on Wistar rats (280-300 g weight)
fasted for 12 h. Anesthesia was induced by intraperitoneal administration of sodium pentobarbital (3 mg/100 g). Under this condition no pain responses were observed, but the eye palpebral reflex was present. Respiration and body temperature were artificially controlled. To obtain blood samples, in the first series of experiments catheters were inserted into the femoral artery and jugular sinus via the external jugular vein; in the second series of experiments the catheters were inserted into the abdominal aorta via the femoral artery and the jugular sinus via the external jugular vein. The correct placement of the catheters was verified at the end of each experiment during autopsy. Neurohypophysectomies (NHYPOX) were performed by a parapharyngeal technique previously described (AlvarezBuylla, 1997), the experiments were done 1 week after the operation. In the first series of experiments the circulation of the carotid body was isolated from general circulation during injections of cyanide (NaCN)
in NHYPOX and normal rats (Alvarez-Buylla and Alvarez-Buylla, 1988).
In NHYPOX rats the injections of AVP (15 pmol/100 g) were made in the jugular sinus as a bolus. In normal rats when the cisterna magna was chosen for centrally administration of GABA in 0.4 mL saline during 20 min -20 µL/min) , the rat was positioned on a plastic platform to obtain a 90 degree angle beween the head and the neck, and to further introduce an injection cannula as previously described (Hudson et al., 1994). Briefly, a micromanipulator holding a 23-gauge "butterfly" needle was attached to a syringe pump for infusions (Baby Bee, BAS, Indiana, USA), to slowly penetrate the atlanto-occipital membrane and enter the cerebellomedullary cistern. The correct position was verified at the end of each experiment by the flow of cerebrospinal fluid (CSF) which entered the tubing. In normal
750
rats the coeliac trunk was chosen for administration of AVP-A (2.5 nmol/100 g in 0.4 mL saline during 20 mininto the liver territory, a catheter was introduced into the thoracic aorta, via the abdominal aorta, above the coeliac trunk (Guarner and Alvarez-Buylla, 1991). The time of experimental substances injections was considered as (indicated as an arrow in the figures). At blood collection time 0.15 mL of blood from catheters was collected at two basal values, and three experimental values after the injections in the first series of experiments or at six experimental values in the second series (fig 1).
2.1.1
Microinjections into NTS
The dorsal surface of the rat skull was exposed. After making an occipital craniotomy, the head was fixed in a stereotaxic apparatus. A glass
751
micropipette (50-60 diameter tip), prepared from a capillary glass tube (Microcaps, external diameter of 0.7 mm), was inserted into the left NTS using coordinates according to the atlas of Paxinos and Watson (1986). All the injections were performed with a special microsyringe (0.1-5 in a volume of 200 nL during 20-30 sec. At the end of each experiment methylene blue (1 %, same volume) was injected into the NTS using the same micropipette, after that the rat was
killed with a bolus dose of sodium pentobarbital (50 mg/kg) and the brain was removed for further histological verification of the injection place (Bures et al., 1983) (Fig 1).
2.2
Drugs
The drugs used were: Sodium cyanide (NaCN); Aminobutyric Acid (GABA, Sigma Chemical Co., St. Louis MO, USA); [Arg8]-vasopressin (AVP, Sigma Chemical Co., St. Louis MO, USA); mer-captocyclopentamethylene (VP1antagonist, Sigma Chemical Co., St. Louis MO, USA). In control experiments artificial cerebrospinal fluid (aCSF) (Mitchell and Owens, 1996) was injected.
2.3
Analytical Methods
Glucose concentration in blood samples was measured by the glucose-oxidase method (Beckman Autoanalyzer, Fullerton CA, USA) in milligrams per deciliter units. Glucose retention by the brain was recorded by measuring arterio-venous glucose (a-v) difference across the brain and the data are presented in percentage from the basal level in the blood determined 4 min before CBR stimulation in the first series; and 5 min before drugs injection into NTS in the second series. The data are expressed as the statistical comparisons were performed using Student’s ttest and analysis of variance (ANOVA).
2.4
Experimental Protocol
Animals were subjected to one of the following procedures: (a) chemoreceptor stimulation of the carotid body with NaCN in NHYPOX rats after AVP or saline injection into the jugular sinus; (b) constant infusion of GABA or saline into the cisterna magna and CBR stimulation with NaCN in normal rats; (c) constant infusion of AVP-A or saline into the coeliac trunk and CBR stimulation with NaCN in normal rats; (d) aCSF injections into the NTS as control in normal rats; (e) AVP injections (dose -
752
response curves) into the NTS in normal rats; (f) AVP-A injections into the NTS (dose-response curves) in normal rats; (g) combined injections of AVP-A and AVP into the NTS in normal rats.
3.
RESULTS
3.1
Chemoreceptor Stimulation and AVP
To test whether the AVP is the effector hormone in the hyperglycemic reflex with brain glucose retention, AVP (15 pmol/100g) was injected as a bolus into the jugular sinus 4 min before to CBR stimulation with NaCN in NHYPOX rats. In these conditions, the CBR stimulation caused an increase in blood glucose concentrations, but the arterial glucose reached a higher value than glucose concentration in venous blood. When this effect was expressed as a-v differences a maximum increase was observed 4 min after CBR stimulation preceded by AVP injection indicating an increase in glucose retention by the brain. This effect was maintained up to 16 min (Fig. 2A). Control experiments in which injections of saline instead of AVP were made showed no hyperglycemia in response to CBR stimulation. To study whether central vasopressinergic neurons participate in these reflexes, we stimulate CBR with NaCN simultaneously with an infusion of GABA [300 mL saline during 20 min (20 in the cisterna magna of normal rats. In these conditions, CBR stimulation caused an increase in arterial and venous blood glucose concentrations, but glucose in the jugular venous blood increased first and reached a higher value compared with its basal level. When this effect was expressed as a-v differences, this is, as brain glucose retention, a decrease was observed at 4 and 8 min (Fig. 2B), indicating that GABA inhibited the glucose retention previously evoked by CBR stimulation with NaCN. The requirement of the hepatic receptors to AVP for the hyperglycemic reflex with glucose retention by the brain initiated by NaCN was confirmed with normal rats that received an infusion of AVP-A [2.5 nmol/100 g in 0.4 mL saline during 20 min into the coeliac trunk simultaneously with CBR stimulation In these animals hyperglycemic response to NaCN was abolished as compared with control rats in which only an infusion of saline was made. After AVP-A the anoxic stimulus significantly decreased the retention of glucose by the brain at 4, 8 and 16 min postinjection (Fig. 2C).
753
3.2
AVP and AVP-A Injections into the NTS. Dosedependent Effect
AVP injected into the NTS elicited an immediate increase in arterial and venous blood glucose concentrations and brain glucose retention. These effects were dose-dependent, exhibiting saturation kinetics behaviour, typical of receptor-mediated effects. When AVP in a dose of 40 pmol was injected, the responses for hyperglycemic effects were maximal, they were already present at mm after the injection and persisted up to min, but the effects on brain glucose retention were not significant (Fig. 3C). By the other hand, the maximal effects to increase brain glucose retention were obtained when a dose of 10 pmol was injected, and this effect was statistically significant at 10 and 20 mm (Fig. 3B). In the experiments with injections of AVP in a dose of 2.5 no significant effects occured neither in glucose concentration, nor in BGR (Fig. 3A and 3C). An antagonist for V l a of AVP receptors (AVP-A) injected into the NTS elicited a small increase in arterial and venous blood glucose concentrations but the changes observed were not statistically significant. It is important to mention that the increases observed, although not significant, were higher in venous blood than in arterial blood. The injection of an AVP antagonist 200 pmol elicited a small decrease in brain glucose retention starting 20 min afer the injection (Fig. 3D and 3E).
754
3.3
AVP Injections into the NTS Preceded by AVP-A injection
The receptor nature of AVP effect above observed was confirmed with combined injections of AVP and AVP-A into the NTS. Argininevasopressin 10 pmol injection, which alone elicited maximal effects in brain glucose retention, was injected into the NTS 10 mins after the injection of its antagonist (AVP-A 200 pmol), in these conditions a decrease of the glucose retention by the brain was observed, instead of the increase
755
obtained with the AVP alone. No significant changes were observed neither in arterial blood glucose concentrations nor in venous glucose concentration, in contrast with the increases observed when AVP was injected alone. When the whole curves were compared the differences were statistically different (ANOVA) (Fig. 4).
4.
DISCUSSION
The data presented here indicate that AVP is centrally and endogenously involved in the hyperglycemia and glucose retention by the brain in response to CBR stimulation. Alvarez-Buylla and Alvarez-Buylla (1994) have previously shown that the CNS mediates a rapid and transient increase in blood glucose in response to CBR stimulation in anesthetized rats. Results from the first series of experiments in NHYPOX rats showed
that AVP participates in the hyperglycemic response after CBR stimulation with NaCN with an increase in glucose retention by the brain due to an increase in arterial blood glucose concentration above the increase observed in venous glucose concentration. Neurohypophysectomized rats, despite the lack of endogenous production of this hormone, but with exogenous AVP presented the reflex in a similar way as control rats after anoxic stimulus
(Alvarez-Buylla and Alvarez-Buylla, 1988; Montero, 1993) (Fig. 2). The same dose of AVP, without CBR stimulation, does not elicit significant results on glucose levels in arterial or venous blood (Montero, 1993;
756
Alvarez-Buylla and Alvarez-Buylla, 1988).
Rofe & Williamson (1983)
have also shown an increase in arterial glucose levels after AVP injections.
The surgical approach to selectively remove the neurohypophysis, permits us to assure the completeness of gland removal. In order to avoid the known regenerative capacity of the secretory terminals in the
neurohypophysis (Costero and Alvarez-Buylla, 1975; Kawamoto and Kawashima, 1987), these experiments were done 1 week after the operation. Dogterom et al. (1977) showed an important decrease in AVP levels 4 weeks after the hypophysectomy in rats. Our results also show that GABA infusion into the cisterna inhibited the glucose retention by the brain after CBR stimulation. Interestingly, after the anoxic stimulus the BGR decreased during the first min instead of increasing. There are several reports on the inhibitor effect of GABA upon vasopressinergic neurons (Brennan et al., 1984). The delayed effect observed on brain glucose retention is consistent with the time for GABA estimulation to produce
glutamate (an exciting neurotrasmitter) whose effect is opposite to GABA (Beverly et al., 1995; Specter et al., 1996). The AVP secretion by the
neurohypophysis with low affinity receptors to GABA (Zingg et al., 1979; Palacios et al., 1981) could also favour the delayed secretion observed in our
experiments after CBR stimulation. Nevertheless with our experimental
design we could not assure that injection of GABA into the cisterna selectively block AVP production by hypothalamic neurons. When CBR stimulation was made after infusing a V1a receptor antagonist (AVP-A) into the coeliac trunk to block the peripheral action of AVP, the hyperglycemic reflex was abolished as well as brain glucose retention. The hepatic receptors to AVP are Vla type and are responsible of
liver glucogenolytic action (Hems et al., 1978). These results sustain our hypothesis that, at least in part, there is a direct action of AVP on the liver to promote glucose secretion after cyanide stimulation.
The results obtained in the second series of experiments indicate that
an arise of AVP concentration in NTS increases both blood glucose concentration and brain glucose retention. This effect is presumable evoked by the activation of AVP receptors. Previous studies support the existence of AVP’ergic neuron system in glucose homeostasis (Ochi et al., 1994; Chun et al., 1998). Vasopressin hormone seems to be unique in both as a mediator
closely related with glucose homeostasis and in affecting the hepatocytes
(Jard et al., 1988), pancreas (Dunning et al., 1982) and adrenal medulla (Grazzini et al., 1996) when is released as a neurohypophyseal
hormone.
Although many works describe the excitatory effect of AVP
(Kow and Pfaff, 1987; Raggenbass et al., 1988; Ochi et al., 1994), a recent
study supports the hypothesis of the inhibitory suprachiasmatic AVP role in hypothalamo-adrenocorticotrophic axis in the rat (Gomez et al., 1997). The
marked effects of combined AVP-A and AVP injections in the NTS observed in our experiments (Fig. 4) support the receptor nature of AVP, in
757
fact, pre-administered AVP-A for 10 min reduced the AVP effect observed without AVP-A (Fig. 3A). From the results obtained when a direct injection of AVP antagonist was made into NTS we infer that glucose concentration in venous blood increased as a result of a decrease in brain glucose retention, when a dose of 200 pmol of AVP-A was used (Fig. 3E). The observed effects are likely to be related with AVP and AVP-A participation on special mechanisms responsible for brain glucose regulation which seem to be independent of glucose changes in blood. In summary, experiments presented here identify the AVP as an important hormone for the hyperglycemic reflex initiated by NaCN stimulation of the CBR acting on hepatic receptors and on adrenal medulla to modify glucose retention by the brain. These results further suggest that AVP’ergic system of hypothalamus plays an excitatory role via both the hypothalamus and NTS, as effector mediator in glucose homeostasis, and in particular on glucose retention by the brain.
ACKNOWLEDGEMENTS We thank Elena Roces de Alvarez-Buylla from Dep. de Fisiología, Biofísica y Neurociencias CINVESTAV, Mex.D.F. for technical help and revision of the manuscript. This project was supported by the Consejo Nacional de Ciencia y Tecnologia, México P019CCOL-904045. Dr. A. Yarkov is recipient of a "Cátedra Patrimonial" CONACYT 970075-R99.
REFERENCES Alvarez-Buylla R and Alvarez-Buylla E (1988) Carotid sinus receptors participate in glucose homeostasis . Respir Physiol 72:347-360. Alvarez-Buylla R, Alvarez-Buylla dc ER (1994) Changes in blood glucose concentration in the carotid body modify brain glucose retention. In: Arterial Chemoreceptors: Cell to System, O'Rcgun R, Nolan P, McQueen DS, Paterson DJ eds) pp. 293-296. New York: Plenum Press. Alvarez-Buylla R, Huberman A, Montero S, Roces de Alvarez-Buylla E (1996) Functional activation of cerebral glucose uptake after carotid body stimulation. In: Frontiers in Arterial Chemoreccption, Zapata P, Eyzaguirre C, Torrance R eds) pp. 411-420. New York: Plenum Press. Alvarez-Buylla R, Alvarez-Buylla E, Mendoza H, Montero S, Alvarez-Buylla A (1997) P i t u i t a r y and adrenals are requerid for hyperglycemic reflex initiated by stimulation of CBR w i t h cyanide. Am J Physiol 272:R392-R399. Beverly JL, Beverly MF and Meguid MM (1995) Alterations in extracellular GABA in the ventral hypothalamus of rats in response to acute glucoprivation. Am J Physiol 269:11741178.
758
Brennan TJ, Morris M and Haywood JR (1984) GABA agonists i n h i b i t the vasopressindependent pressor effects of central angiotensin I I . Neuroendocrinol 39:429-436. Bures J, Buresova O, Huston JP (1983) Tecniques and basic experiments for the study of brain and behavior. Amsterdan, New York: Elsevier. Chun S-J, Niijima A, Nagai N and Nagai K (1998) Effect of bilateral lesions of the suprachiasmatic nucleus on hyperglycemia caused by 2-deoxy-D-glucose and vosoactive intestinal peptide in rats. Brain Res 809:165-174. Costero I and Alvarez-Buylla R (1975) Histological study of the operative zone in dogs with gland grafts in the sella turcica. Acta Physiol Latinoam 24:89-98. Dogterom J, Van Wimersma Greidanus TJB and Swaab DF (1977) Evidence for the release of vasopressin and oxytocin into cerebrospinal fluid: measurements in plasma and CSF of intact and hypophysectomized rats. Neuroendocrinol 24:108. D u n n i n g BE, Moltz JH and Fawcett CP (1982) The effects of oxytocin and vasopressin on release of i n s u l i n and glucagon from pancreatic islets in vitro. Neuroendocrinol 4:89-93. Finley JCW and Katz DM (1992) The central organization of carotid body afferent projections to the brainstem of the rat. Brain Res 572:108-116. Gomez F, Chapleur M, Fernette B, Burlet C, Nicolas J-P and Burlet A (1997) Arginine vasopressin (AVP) depletion in neurons of the suprachiasmatic nuclei affects the AVP content of the paraventricular neurons and stimulates adrenocorticotrophic hormone release. J Neurosci Res 50:565-574. G r a z z i n i E, Lodboerer AM, Pérez.-Martin A, Joubert D and Guillon G (1996) Molecular and functional characterization of vasopressin receptor in rat adrenal medulla. Endocrinol. 137:3906-3914. Guarner V and Alvarez-Buylla R (1991) Changes in brain glucose retention produced by the stimulation of an insulin-sensitive reflexogenic zone in rats. J Auton Nerv Syst 34:89-94. Harris MC (1979) Effects of chemoreceptors and baroreceptors stimulation on the discharge of hypothalamic supraoptic neurones in rat. J Endocrinol 82:115-125. Hems DA, Rodrigues LM and Whitton PD (1978) Rapid stimulation by vasopressin, oxytocin and angiotensin I I of glycogen degradation in hepatocyte suspensions. Biochem J 172:311-317. Hudson LC, Hughes CS, Bold-Fletcher NO and Vaden SL (1994) Cerebrospinal fluid collection in rats: modification of a previous technique. Lab Anim Sci 44:358-361. Jakab RL, Naftolin F and Leranth C ( 1 9 9 1 ) Convergent vasopressinergic and hippocampal input onto somatospiny neurons of the rat lateral septal area. Neurosci 40:413-421. Jard S, Elands J, Schmidt A and Barberis C (1988) Vasopressin and oxytocin receptors: an overview. Prog Endocrinol 2 : 1 1 8 3 - 1 1 8 8 . Kawamoto K and Kawashima S (1987) Regeneration of neurohypophyseal hormoneproducing neurons in hypophysectomized immature rats. Brain Res 422:106-117. Kow L-M and Pfaff DW (1987) Responses of ventromedial hypothalamic neurons in vitro to norepinephrine: dependence on dose and receptor type. Brain Res 413:220-228. M i t c h e l l DH and Owens B (1996) Replacement therapy: arginine vasopressin (AVP), growth hormone (GH) cortisol, thyroxine, testosterone and estrogen. J Neurosci Nurs 28:140-154. Montero, S. (1993). Participación de los receptores senocarotideos en la regulatión de glucosa y su retención encefalica en rats. Fac. de Medicina, U. de C., Colima, México. Tesis de Maestría. Morel A, O'Carroll AM, Brownstein MJ and Lolait SJ (1992) Molecular cloning and expression of a rat V l a arginine vasopressin receptor. Nature 356:523-526. Ochi M, Koizumi S, Shibata S and Watanabe S (1994) A facilitatory role of vasopressin in hypoxia / hypoglycemia-induced impairment of dopamine release from rat striatal slices. Brain Res 633:91-96.
759
Ostrowski NL, Lolait.S.J. and Young WS (1994) Cellular localization of vasopressin V l a receptor messenger ribonucleic acid in adult male rat brain, pineal, and brain vasculature. Endocrinol 1 3 5 : 1 5 1 1 - 1 5 2 8 .
Palacios JM, Wamsley JK. and Kuhar MJ (1981) High affinity GABA receptors: Autoradiographic localization . Brain Res 222:285-307. Paxinos G, Watson C (1986) The Rat Brain in Stereotaxic Coordinates. New York: Academic Press. Raggenbass M, Dubois-Dauphin M, Tribollet E and Dreifuss JJ (1988) Direct excitatory action of vasopressin in the lateral septum of the rat brain. Brain Res 459:60-69. Rofe AM and Williamson DH (1983) Metabolic effects of vasopressin infusion in the starved rat. Biochem J 212:231-239. Share L and Levy MN (1966) Effect of carotid chemoreceptor stimulation on plasma antidiuretic hormone titer Am J Physiol 210:157-161. Specter SE, Horwitz BA and Beverly L (1996) Basal and glucoprivic-induced changes in extracellular GABA in the ventral hypothalamus of zucker rats. Am J Physiol 271:388392. Swanson LW and Kuypers HG (1980) The paraventricular nucleus of the hypothalamus: cytoarchitectonic subdivisions and organization of projections to the pituitary, dorsal vagal complex, and spinal cord as demostrated by retrograde fluorescence double-labeling methods. J Comp Neurol 194:555-70. Wideman CH and M u r p h y HM (1993) Modulatory effects of vasopressin on glucose and protein metabolism during food-restriction stress. Peptides 14:259-261. Z i n g g HH, Bacrtschi AJ
and Dreifuss JJ (1979) Action of
hypothalamo -neurohypophysial axons . Brain Res 171:453-459.
760
g-aminobutyric acid on
NITRIC OXIDE MODULATION OF CAROTID CHEMORECEPTION
1
Rodrigo Iturriaga, 1Sandra Villanueva, and 2 Julio Alcayaga
Laboratories of Neurobiology. Faculty of Biological Sciences, P. Catholic University of Chile and 2Faculty of Sciences, University of Chile, Santiago, Chile
1.
PHARMACOLOGY AND PHYSIOLOGY OF NITRIC OXIDE IN THE CAROTID BODY
In response to hypoxia, the glomus cells of the carotid body (CB) are expected to release an excitatory transmitter which in turn initiates the chemosensory discharge in the nerve terminals of the petrosal ganglion chemosensory neurons (Eyzaguirre & Zapata 1984). In addition to excitatory transmitters, other molecules produced within the CB may modulate chemoreceptor activity. Recently, it was advanced that gaseous molecules like carbon monoxide (in low concentration) and nitric oxide (NO) act as modulatory inhibitors of chemosensory responses induced by hypuxichypoxia (Chugh et al. 1994, Prabhakar et al. 1993, Wang et al. 1994, 1995). In fact, the administration of the NO precursor L-arginine and NO donors reduced chemosensory responses to hypoxia in the cat CB perfused or superfused in vitro (Katayama et al. 1994, Wang et al. 1994). On the other hand, inhibition of nitric oxide synthase enzyme (NOS) increased basal chemosensory discharges (Chugh et al. 1994, Prabhakar et al. 1993, Wang et al. 1994, 1995) and enhanced chemosensory responses to hypoxic-hypoxia in vitro (Wang et al. 1994, 1995). NO synthase (NOS) immunoreactiviry has been found in the CB and in the petrosal ganglion. In the cat CB, NOS immunoreactivity is present in nerve plexus innervating CB blood vessels and encircling glomus cells, but
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
761
not in glomus cells and type II cells, or smooth muscle cells (Grimes et al. 1994, Wang et al. 1994, 1995). Wang et al. (1994) proposed that NO released from parasympathetic neurons located in the CB mediates vasodilatation, while NO released from carotid sinus nerve C-fibres produces a retrograde inhibition of the glomus cell activity. This idea is supported by the observations that in the cat CB, NOS-immunoreactive nerve terminals associated with blood vessels are unaffected by carotid sinus nerve section and the removal of the superior cervical ganglion, while the section of the carotid nerve selectively eliminated the NOS-immunoreactive nerve terminals encircling glomus cells (Wang et al. 1994). Administration of the NOS inhibitor, nitro-L-arginine methyl ester (L-NAME), produced a larger increase of basal in the cat CB perfused in vitro, than in the superfused preparation, where vascular effects are absent (Wang et al. 1995). Consequently, part of the effect of NO on hypoxic chemoreception appears to be vascularly mediated, presumably by increasing the cGMP content in smooth muscle cells. In fact, Prabhakar et al (1993) found that cGMP levels were lower in the CB tissue treated with NOS inhibitors than in the untreated CBs, suggesting that the actions of NO are coupled to cGMP. Wang et al.(1995) proposed that the NO effect is also mediated by an increase of
cGMP in glomus cell, because prolonged
electrical stimulation of C-fibres of the carotid sinus nerve increased cGMP
levels in glomus cells, effect that was prevented by L-NAME. However, it is not clear how could the increased NO and cGMP reduce the excitability of the glomus cells, because cGMP and the NO donor S-nitroso-Nacetylpenicillamine (SNAP) did not modify the dependent currents in rat glomus cells (Hatton & Peers, 1996). Recently, Summers et al.(1999) reported that NO donors inhibit L-type currents in glomus cell of rabbit CB through a cGMP-independent mechanism.
2.
NITRIC OXIDE IS A WIDE INHIBITORY MODULATOR OF CAROTID BODY CHEMORECEPTION
Administration of L-arginine and NO donors clearly reduced the CB chemosensory responses to hypoxic-hypoxia, while NOS inhibitors enhanced these responses. Therefore, chemosensory responses to low are modified by NO, but other responses (i.e., nicotine, cyanide, stop flow) may be independent of NO production in the CB. Accordingly, we studied the effects of pharmacological manipulation of NO on chemosensory responses induced by various stimuli in the cat CB in situ and in vitro. Here,
762
we will review and update our experimental results to illustrate the role played by NO in CB chemoreception. In situ, we found that the infusion of SNP (0.25 to 5 mg/kg/h) reduced cat chemosensory responses to NaCN in a dose dependent manner. (Alcayaga et al. 1997). Contrary to that observed in vitro, the administration of SNP in situ increased the frequency of carotid chemosensory discharges This unexpected effect cannot be attributed to changes in respiratory gases due to SNP-induced modifications of ventilation, since the increased induced by SNP persisted when cats were paralysed and artificially ventilated to keep end tidal constant at Torr (Iturriaga et al. 1998). Our results also showed dissociation between the increased basal and low arterial pressure after SNP, because basal remained elevated while arterial pressure gradually recovered. A major difference between CB preparations in vitro and in situ is the presence in the latter of large amounts of endothelium and vascular smooth muscle tissue, required to activate SNP for releasing NO (Kowaluk et al. 1992). On the other hand, it is well known that SNP may release cyanide ions (Cole et al. 1987), which may mediate the increase. Cyanide can combine with thiosulfate to form the less toxic sodium thiocyanate (Cole et al. 1987) which is excreted. However, in our experiments, sodium thiosulfate had no effect on the increase in basal induced by SNP, suggesting that a possible release of cyanide from SNP is not involved in the SNP-induced basal increase. Finally, it is possible that NO or its metabolite peroxynitrite, may act as endogenous radicals on CB cells oxidative metabolism. In fact, large amounts of NO and peroxinitrite inhibit the electron transport chain and oxidative phosphorylation (Borutaite & Brown, 1996, Cassina & Radi, 1996).
In paralysed and artificially ventilated cats we found that L-NAME (50 mg/kg i.v.) increased basal and slightly potentiated chemosensory responses to NaCN and dopamine. SNP (1-2 mg/kg i.v.) increased basal and reduced the cyanide-induced increases of over baseline and the transient inhibitions induced by dopamine, but not those produced by hyperoxia (Iturriaga et al. 1998). In vitro, we found that supervision with Tyrode supplemented with SNP did not raise basal but reversibly reduced the chemosensory responses elicited by large doses of NaCN and nicotine (Alcayaga et al, 1997). To test the effect of NO donors on the reactivity and sensitivity of chemosensory responses induced by several doses of nicotine, we used a perfused preparation of the cat CB in vitro. Figure 1 shows the effects of 140 SNAP on the chemosensory responses induced by several doses of nicotine in one cat CB perfused in vitro. During perfusion with Tyrode containing SNAP, basal was reduced and the amplitude of chemosensory responses evoked by nicotine was markedly reduced (Fig. 1B).
763
764
Our results indicate that besides the well known inhibitory effect of NO
on chemosensory responses to low
NO also modulates the
chemosensory response to other chemosensory stimuli. Thus, the proposed
NO-mediated inhibition of hypoxic chemoreception due to reduced glomus cell activity or secondary to vasodilatation may also participate in the modulation of other non-hypoxic stimuli. 3.
EFFECTS OF NO GAS ON CAROTID CHEMORECEPTION
The role-played by NO in CB chemoreception has been revealed by the use of pharmacological tools (ie. L-arginine, NO donors and NOS inhibitors). To our knowledge, the use of NO gas has not been tested yet. The major problem to use NO gas is that NO rapidly reacts with to form To avoid this problem, we used hypoxic Tyrode equilibrated with NO gas. To prepare the hypoxic solution containing NO, 4 ml of hypoxic Tyrode (5% in 95% Torr) was mixed with 4 ml of NO gas (25 ppm in ) in a glass syringe for about 3-4 min. Control hypoxic Tyrode was
left for 3-4 min in the syringe. NO was measured by chemiluminescence
using a NO analyser Siever 220 (Boulder CO, USA).
Figure 2A shows the effect of two injections of 1 ml of Tyrode containing
26 nM NO gas into the perfusate line during steady-state chemoreceptor excitation induced by hypoxia. NO transiently reduced chemoreceptor excitation induced by hypoxia. On the contrary, injection of 2 ml of control
hypoxic Tyrode produced a modest reduction of
due to a reduced
temperature of the Tyrode.
4.
PHARMACOLOGY AND PHYSIOLOGY OF NO IN THE PETROSAL GANGLION
In the cat petrosal ganglion, Wang et al. (1994) reported the presence of NOS immunoreactivity in a population of neurons which innervates the CB. Wang et al. (1994) found that most of these fibres in the carotid nerve arises from small diameter neurons located in the core of the petrosal
ganglion. These fibres constitute a small population
of the axons of
the cat carotid nerve and correspond to C-fibres. On the other hand, the cat
petrosal ganglion presents a similar NOS activity -measured as formation- to the intact CB and about 5 times larger than that observed in the CB after the section of the carotid nerve (Wang et al. 1994).
Thus, NO is produced not only in the sensory nerve terminals within the CB, but also in perikarya of the petrosal ganglion neurons. Therefore, it
765
is possible that NO may also modulate the activity of the chemosensory neurons. Since we found (Alcayaga et al. 1998) that a population of petrosal neurons projecting through the carotid nerve is selectively activated by acetylcholine ( A C h ) , we (Alcayaga et al. 1999) studied the effects of SNP and L-NAME, on the responses evoked in the carotid nerve by ACh applied to the petrosal ganglion superfused in vitro with saline solutions. ACh (11000 µg increased the frequency of discharges recorded from the carotid nerve in a dose-dependent manner. SNP reduced the sensitivity and amplitude of the response to ACh, although the maximal response appears less affected. L-NAME (1-2 mM) slightly increased the sensitivity of the ACh-induced responses, effect that persisted after L-NAME withdrawal. Figure 3 shows the effects of SNP on the carotid nerve response elicited by ACh applied to one petrosal ganglion. SNP reduced the carotid nerve response evoked by The response was recovered upon the withdrawal of SNP from the superfusion medium. These results show that NO may modulate the activity of a population of sensory neurons of the cat petrosal ganglion activated by ACh. This observation suggests that chemosensory information carried by primary sensory neurons may be locally modulated within the petrosal ganglia. Thus, NO may play a role as a local modulator in this autonomic primary sensory ganglion.
766
5.
CONCLUSION
Present results show that besides the well known inhibitory effect of NO on hypoxic chemoreception, NO is a broad modulator of CB chemoreception. Thus, the proposed NO-mediated inhibition of hypoxic chemoreception due to reduced glomus cell activity or secondary to vasodilatation, may also participate in the modulation of other non-hypoxic stimuli. Our results indicate that NO also modulate the generation and/or conduction of action potentials induced by ACh in petrosal sensory neurons projecting through the carotid nerve. ACKNOWLEDGEMENTS
This work was supported by grant 198-0965 from the National Fund for Scientific and Technological Development of Chile (FONDECYT). We would like to thank Mrs. Carolina Larraín for her assistance in the preparation of this manuscript. REFERENCES Alcayaga, J., Iturriaga, R., Ramirez, J., Readi, R., Quezada, C., and Salinas, S., 1997, Cat carotid body chemosensory responses to non-hypoxic stimuli are inhibited by sodium
nitroprusside both in situ and in vitro. Brain Res. 767 : 384-387.
Alcayaga, J., Iturriaga, R., Varas, R., Arroyo, J., and Zapata, P. 1998, Carotid nerve fibres are selective activated by acetylcholine applied to the cat petrosal ganglion in vitro, Brain
Res. 799: 27-35. Alcayaga, J., Barrios, M., Busies, F., Miranda, G., Molina M.V., and Iturriaga, R., 1999, Modulatory effect of n i t r i c oxide on acctylcholine-induced activation of cat petrosal ganglion neurons in vitro, Brain Res. 825: 194-198.
Borutaite, B., and Brown, C.G., 1996, Rapid reduction of nitric oxide by mitochondria, and reversible i n h i b i t i o n of mitochondrial respiration by nitric oxide, Biochem. J. 315: 295299.
Cassina, A., and Radi, R., 1996,
Differential inhibitory action of nitric oxide and
peroxynitrite on mitochondrial electron transport. Arch. Biochem. Biophys. 328: 309-316.
Cole, P.V., and Vesey, C.J., 1987, Sodium thiosulfate decreases blood cyanide concentration after the infusion of sodium nitroprusside. Br.: J. Anaesthesial. 59: 531 -535. Chugh, D.K., Katayama, M., Mokashi, A., Debout, D.E., Ray, D.K., and Lahiri, S., 1994, N i t r i c oxide-related inhibition of carotid chemosensory activity in the cat. Resp Physiol. 97: 147-156.
Eyzaguirre, C . , and Zapata, P., Physiol. 57: 931-957.
1984, Perspectives in carotid body research. J. Appl.
Grimes, P.A., Lahiri, S., Stone, R., Mokashi, A., and Chugh, D., 1994, Nitric oxide synthase occurs in neurons and nerve fibres of the carotid body. Adv. Exp Med. Biol. 360: 221-
224.
Haton, C. J., and Peers, C . , 1996, Hypoxic inhibition of K+ currents in isolated rat type I carotid body cells: Evidence against the involvement of cyclic nucleotides, Pflügers
Arch. 433: 129-135.
767
Iturriaga, R., Alcayaga, J., and Rey, S., 1998, Sodium nitroprusside blocks the cat carotid chemosensory inhibition induced by dopamine, but not that by hyperoxia. Brain Res. 799: 26-34.
Katayama, K., Chugh, D.K.., Mokashi, A., Ray, D.K., Bebout, D.E., and Lahiri, S., 1994, NO mimics in the carotid body chemoreception. Adv. Exp. Med. Biol. 360: 225-227. Kowaluk, E., Seth, E., and Fung, H., 1992, Metabolic activation of sodium nitroprusside to nitric oxide in vascular smooth muscle. J. Pharm. Exp. Ther. 262: 916-922. Prabhakar, N.R., Kumar, G.K., Chang, C.H., Agani, F.H., and Haxhiu, M.A., 1993, Nitric oxide in the sensory function of the carotid body. Brain Res. 625: 16-22.
Summers, B.A., Overholt J.L., and Prabhakar, N.R., 1999, Nitric oxide inhibits L-Type Ca 2+ current in glonius cells of the rabbit carotid body via a cGMP-independent mechanism. J. Neurophysiol. 81:1449-1457.
Wang, Z.Z., Stensaas, L.J., Bredt, D.S., Dinger, B., and Fidone S.J., 1994, Localization and actions of nitric oxide in the cat carotid body. Neuroscience. 60: 275-286.
Wang, Z.Z.,
Stensaas, L.J.,, Dinger, B., and Fidone, S.J., 1995, Nitric oxide mediates
chemoreceptor inhibition in the cat carotid body. Neuroscience. 65: 217-229.
768
and Respiration in Exercising Human Muscle The Regulation of Oxidative Phosphorylation in Vivo
Thomas Jue1, Youngran Chung, Paul Mole 2 , Tuan Khan Tran, Ulrike Kreutzer, Napapon Sailasuta 3 , and Ralph Hurd 3 1
Department of Biological Chemistry and 2 Department of Exercise Science, UC Davis, Davis, CA 95616-8635: 3GE Medical Systems, Inc., Fremont, CA
1.
INTRODUCTION
The regulation of oxygen transport to the mitochondria in exercising muscle is a key issue in biology, since oxygen demand can increase dramatically from the resting state. As the oxygen consumption
increases, a coordinate set of controls must enhance the oxygen delivery from the lung to the cell. As approaches its maximum rate convection, diffusion or enzymatic activity must also become limiting. Identifying the rate- determining step is then a central issue (Sutton, 1992). In particular many researchers have postulated a limiting step in transport from the capillary to the mitochondria (Hoppeler and Lindstedt, 1985; Stainsby, 1989; Wagner, 1995; Roca et al. 1989; Hogan, Bebout and Wagner, 1993). Such limitation bears directly on the ability of the working muscle in healthy individuals to increase its oxygen uptake and is often ascribed to either a central or a peripheral mechanism (Sutton, 1992). The central mechanism regulates the systemic increase in oxygen delivery to the muscle through blood flow enhancement through the capillaries. The peripheral mechanism ascribes the limitation to the diffusion of oxygen
from hemoglobin (Hb) to the mitochondria and the metabolic regulation of oxidative phosphorylation. Proponents of a central mechanism point out a tight correlation between and blood flow (Q), while others have countered that such a mechanism cannot account for the large residual
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
769
venous at (Wagner, 1991; Hogan et al. 1989; Hogan, Bebout and Wagner, 1991; Hogan, Bebout and Wagner, 1993). According to the latter group’s view, convective control is only secondary to diffusion control. Quite clearly the mechanism of regulation is still under intense debate. Although the gradient plays a key role in both mechanisms, the diffusion model emphasizes the gradient from the capillary to the mitochondria as the driving force of transport. Analyzing the role of gradients, however, requires a measurement of the mean end capillary and the cellular Because detecting the intracellular has posed a formidable experimental hurdle, many studies have simply assumed that the mitochondrial is approximately zero. The assumption, however, is contrary to the findings of Honig et al. (1984), in which cryosection analysis of muscle tissue reveals that even though the intracellular is quite low, it does actually decrease with exercise intensity (Honig et al. 1984). The observation implies that the cell can modulate its gradient, consistent with a predominant role of myoglobin (Mb) in facilitating transport to the mitochondria (Wittenberg, 1970; Gayeski and Honig, 1988). The intracellular during exercise is then a key variable in helping to determine the regulatory mechanism of in exercising muscle. In addition the intracellular response during exercise can help clarify the hypothesis that oxygen supply limits If the critical in the cell is less than approximately 2.9 mm Hg (Mb p50 at 39°C), then the at the mitochondria is estimated to be at the Km of the cytochrome oxidase activity (Wilson et al. 1977; Antonini and Brunori, 1971). The cellular oxygen supply can then limit the aerobic capacity of working muscles without metabolic limitation, which can then modulate the phosphorylation potential and redox state (Wittenberg, J.B.Wittenberg and P.R.B. Caldwell, 1975; Connett R.J. et al. 1990). However, if the critical intracellular is well above 2.9 mm Hg, then cytochrome oxidase is saturated with even at suggesting that oxygen alone is not modulating mitochondrial respiration (McArdle, Katch and Katch, 1996). Finally, if the intracellular level falls as rises, it would imply that the supply alone is not limiting respiration. Although near infra red spectroscopy (NIRS) methods can measure the oxygenated and deoxygenated states of Mb and Hb, the discrimination between Mb and Hb is not always clear (Jobsis, 1977). Some recent experiments suggest that the NIRS signals originate predominantly from Hb and reflect then only the vascular (Wilson et al. 1989; Seiyama, Hazeki and Tamura, 1988). In recent years 1H NMR has presented an alternative approach to measure the intracellular with the myoglobin signals, first in
770
myocardium and subsequently in skeletal muscle (Jue and S. Anderson, 1990; Kreutzer and T. Jue, 1991; Wang, E.A. Noyszewski and J.S. Leigh, 1990). The initial study has shown that Mb in skeletal muscle desaturates rapidly to 51% and 60% of control under normoxic and hypoxic exercise conditions.
However, Mb desaturation does not vary in proportion to
increased work output (Richardson et al. 1995). The results are quite provocative. Indeed our study of the relationship between work output and Mb desaturation in a plantar flexion exercise protocol, which is less prone to motional artifact than the reported quadricep exercise, indicates that Mb does desaturate in proportion to work output or As work increases, so also does the deoxy Mb signal intensity. A linear relationship is formed between and deoxy Mb signal intensity. Concomitantly, the PCr level drops, while Pi concentration rises. These results are consistent with the NIRS analysis and indicate that the cellular supply by itself is not regulating under these experimental conditions.
2.
METHODS AND MATERIAL
2.1
Experimental Design
The protocol for this study was reviewed and approved by the Human Subjects Welfare Committee of the university. Four young adult men (Table 1) were recruited from the student body of the university. All were untrained volunteers, who gave written consent to participate in this study. They were informed of the procedures, requirements and risks. Each subject attended the laboratory several times to practice plantar flexion exercise and to become familiar with breathing through the respiratory apparatus. During this time, the exercise intensity was adjusted so that the subject could reach peak uptake Two sessions were required to complete this study. Session I was conducted in the Human Performance laboratory and involved characterizing each subject’s body composition, steady state oxygen consumption at several intensities of plantar flexion exercise, and for plantar flexion exercise. A fiberglass (ScotchCast, 3M, Inc.) cast was made from the subject’s lower leg from below the knee to the ankle. The cast was used as another means to calibrate the percent desaturation of the deoxymyoglobin signal and to estimate the lower leg volume, which was then used to normalize the net change in Session II was performed at the NMR Research Facility at GE Medical Systems, Inc. (Fremont, CA) and involved duplicate protocols for plantar flexion exercise for determination
771
of metabolic phosphates by and deoxymyoglobm by Both protocols corresponded to the protocol performed in Session I.
2.2
Body Composition
Air displacement plethysmography was employed to determine body composition with the BOD POD instrument (LMI, Inc., Concord, CA). The method has been described in detail elsewhere (McCrory et al. 1995). Each subject was weighed to the nearest gram, and the height was measured to the nearest cm. The raw body volume was determined in duplicate and averaged. Next, thoracic gas volume was then measured in the BOD POD. Body density was calculated as the ratio, body mass/corrected body volume. Percent body fat was then calculated from body density using the Siri formula (Sin, 1961).
2.3
Plantar Flexion Ergometer
The same ergometer was employed to assess the mechanical power, energy transfer rate by whole-body indirect calorimetry, the muscle concentrations of Pi, PCr, ATP and intracellular pH by and deoxymyoglobin by during plantar flexion exercise of the calf muscles. The ergometer consists of a three-sided box with dimensions of 25.4 cm W x 25.4 cm H x 91.4 cm L with a foot pedal on an axle at one end and a moveable back plate at the other end of the box. An aluminum bar served as an end stop for the pedal arc during plantar flexion exercise. Latex rubber tubing (1.3 cm diameter and 34.3 cm length) with a Hooke's constant of 31.12 N/cm length change was attached to the back plate and the axle of the foot pedal. Resistance to plantar flexion can be varied by the number of tubes used and/or by changing the stretch of tubing between the axle and back plate. Mechanical work of plantar flexion involved moving the pedal against a specified resistance through an arc of 3.8 cm. The pedal movement was controlled by stops for forward and reverse movements with plantar flexion and relaxation. In this study, power was incremented by varying the contraction frequency from 30 to 70 contractions/mm (0.5 - 1.17 Hz) with the resistance and plantar flexion arc held constant. Contraction frequency was not measured but was controlled by requiring the subject to follow a metronome beat, with verbal assistance from a technician for added control. The technician monitored the exercise protocol, which required the subject to push the pedal until it stops at the aluminum bar. Subjects practiced the exercise procedures several times prior to the experiments in order to minimize any learning effect.
772
2.4
Steady State and Peak Exercise
for Plantar Flexion
Each subject performed 3 to 5 intensities of plantar flexion exercise of the dominant leg, each for 3 minutes with a 5 minute recovery period after
each bout. Energy expenditure was determined continuously by indirect calorimetry. The sequence was as follows: After resting for 10 minutes in a supine position, the subject breathed for 5 minutes through a mouthpiece and tubing connected to a SensorMedics metabolic cart (Model 2900) for breath-by-breath measurements of resting oxygen consumption and carbon dioxide production Then the subject performed a series of 3 to 5 exercise bouts at progressively higher intensities by varying the frequency from 30 to 70 contractions/min (0.5 to 1.17 Hz) on the foot ergometer, with the resistance held constant. Each bout lasted 3 minutes and was followed by 5 minutes of rest. The calculated mean value during the last 30 seconds of each bout was used to characterize the and respiratory exchange ratio (RER) for the bout. Following a rest period of 10 to 15 minutes, the subject’s peak was determined by hold the resistance constant and progressively increasing the contraction frequency each minute until the subject could no long maintain the required cadence. were determined throughout the test as described above. was averaged over each 15s interval. The highest was designated as the subject’s peak
2.5
NMR
NMR measurements were performed on a 1m bore diameter GE Signa scanner at 1.5 T. (63.86 MHz) NMR signal acquisition utilized a body coil transmit/surface coil (5 inch diameter) receive configuration. Magnetic field shimming used a three-point Dixon method to improve the field homogeneity, yielding a water linewidth approximately 40 Hz (Schneider and Glover, 1991). A selective excitation pulse sequence was optimized to
excite the deoxy-Mb and deoxy- Hb His-F8 signals, approximately 4.6 kHz from the water resonance (Morris and Freeman, 1978). Numerical simulation and experimental data verified that the experimental pulse length of 800 had a full width at half maximum excitation of 2 kHz. At an offset of 800 Hz or 13 ppm from the excitation maximum, the pulse power dropped by 25%. Each data block comprised of 200 transients or 45s signal averaging time. The repetition time was 160 ms. The spectral width was 16 kHz, and the data block size was 512. All spectra were referenced to the water signal as 4.65 ppm at 35°C, which in turn was calibrated against TSP as 0 ppm.
773
(25.85 MHz) NMR signal acquisition utilized a conforming flexible coil, which wrapped around the leg. A 50 mm slice was selected and then excited with a self-re focused 45° radio frequency pulse. The effective echo time was set at 2.5 msec (Lim et al. 1994). The other acquisition parameters were as follows: spectral width, 2.5 kHz; data points, 2048 data points; acquisition time, 820 msec; recycle time, 2s. Each NMR spectrum consisted of 50 transients and required a total acquisition time of 140s. All spectra were apodized with a 15 Hz exponential function and referenced to PCr as 0 ppm. The percent myoglobin desaturation was obtained in the following ways: After the final exercise bout, a pressure cuff above the knee was inflated to 240 mm Hg to occlude the blood flow. Within 5 min, the deoxy Mb signal reached a steady state level, which was then considered as 100% desaturated. Data were imported from the Signa system to a Sun Sparc2 workstation and processed using GE Omega 6.0 software package. All spectra were zero filled to 2k and apodized using a 50 Hz Gaussianexponential function. All spectra were baseline corrected and referenced to water at 4.65 ppm at 35°C.
2.6
Near Infra Red Spectroscopy (NIRS)
NIRS measurements were made using a continuous-light source dualwavelength spectrometer with a pair of colored LED as light sources and a photo diode detector (HEO100, Omron, Japan) (46). This system used two wavelengths on either side of the oxy/deoxy-Hb/Mb isobestic point. All wavelengths aside from 760 and 850 nm were filtered out. The probe was
wrapped around the leg muscle with a Velcro strap and was engineered for a photon depth penetration of 2-3 cm. Because oxygen ligated heme groups of Mb/Hb have a greater absorbance at 850 nm than at 760 nm, while the corresponding deoxy heme groups have greater absorbance at 760 nm than at 850, the difference signal between 760 and 850nm reflects the relative changes in saturation (Mancini et al. 1994; Seiyama, Hazeki and Tamura, 1988; Jobsis, 1977). The relative scale was calibrated against the difference signal observed when the muscle was at rest and at steady state after 15min thigh occlusion at 250 mm Hg, which corresponds to 0% and 100% Mb/Hb deoxygenation, respectively.
2.7
Statistical Analysis
Values reported are given as the error of the mean (SEM). Least squares regression and correlation analyses were performed
774
for net deoxyMb, PCr, Pi, ATP, pH relationships with plantar flexion power output for each individual using SigmaStat (ver. 1, Jandel Scientific, San Raphael, CA). The mean slope coefficient and pooled standard error estimate (SEE) of regression for each relationship was used for power analysis. Statistical significance was accepted at with power The power of these tests was 0.9 or greater for
3.
RESULTS
A representative example of a stack plot of NMR deoxy Mb for subject A is illustrated in Fig. 1. Spectrum A shows no detectable deoxy Mb at rest where Mb presumably is fully saturated with oxygen. Spectra 1B, 1C, and 1D show that the magnitude of the deoxy Mb peak grows with power outputs of 9.4, 11.5 and 14.7 watts, respectively. Within 5 minutes of recovery from exercise at 14.7 watts, the deoxy Mb signal disappears into the noise, Fig. 1E, indicating that Mb has become saturated with oxygen.
The steady state ATP, PCr, Pi and intracellular pH results at rest and with variations in exercise intensity are presented in Fig. 2. Muscle ATP does not changed relative to rest when power output is varied from 7.8 to 15.1 watts for plantar flexion exercise. In contrast, muscle PCr decreases,
775
while Pi increases linearly with power output (Fig. 2B-2D). PCr falls to 33% and Pi rises to 81% of the resting PCr level at the highest intensity of exercise, which elicits peak ATP level remains constant throughout the exercise protocol, while PCr falls 4.5 percent per watt output. Pi increases with exercise at a rate of 4.1 percent per work output.
As exercise intensity increases, the also increases linearly. Since the net uptake of and ml/min/100 ml leg volume lor the last two power outputs of and watts are not significantly different ( paired t-test), these values are averaged to yield a net peak of This peak satisfies the criterion for maximum for leg muscles performing plantar flexion exercise. The relationship between the deoxy Mb signal intensity and power output as well as net is presented in fig 3. A distinct linear relationship exists between the percent Mb desaturation and power output (Fig. 3A) and between percent Mb desaturation and net (Fig. 3B). Mb desaturates progressively as work output or increases. At peak Mb desaturates to 48.4%. A similar relationship is apparent with PCr. As Mb desaturates, the PCr level falls linearly as does pH (data not shown).
776
777
4.
DISCUSSION
4.1
Resting State Intracellular
The proximal histidyl signal of deoxy Mb reflects the degree of tissue oxygenation during rest and exercise. At rest, no signal is detected, while during exercise the signal appears. Given the excellent signal to noise of the deoxy Mb peak under the normalization condition of the cuffed leg spectra, a 10-20% deoxy Mb saturation would certainly reveal an observable signal above the noise. Since none is detected, even after the addition of several reference spectra (data not shown), the resting of skeletal muscle must be sufficient to saturate which reflects a resting cellular torr (given a Mb p50 of 2.9 at 39°C) and is consistent with muscle cryosection data (Gayeski, R.J.Connett and C.R.Honig, 1987; (iayeski and Honig, 1988).
4.2
Mb Desaturation with Work Output
As muscle work output increases, flux must also increase to match the enhanced as governed phenomenologically by Pick’s law of diffusion
where is the lumped conductance for diffusion transport in tissue and and are the partial pressures of at the capillary and at the mitochondria, respectively . As work intensity increases, the cellular declines, as reflected by Mb desaturation, and therefore enhances the gradient driving force for flux (Gayeski and Honig, 1988). Even though has increased, the intracellular has actually fallen, consistent Honig’s observation and hypothesis (1984). As the work output varies from watts, Mb desaturates from to Both the and work output form linear relationships with Mb desaturation. These results are in contrast with a previous NMR report, which shows that Mb desaturates rapidly to a constant 51% under exercise intensity above 50% of (Richardson et al. 1995). Below 50% of a dubious experimental point is slightly lower than 50% and suggests the presence of a linear response region at low work output. In the present study, the exercise protocol also elicits oxygen consumption that
778
spans the range above 50% of At the highest level of exercise performance, the subjects reach peak oxygen consumption. The observed pH and Pi/PCr change also supports the interpretation that our subjects are exercising above 50% Previous studies on human gastrocnemius muscle have reported values ranging from 1.3 to 4.1 during maximal exercise (Barstow et al. 1994). At the highest work output, the present study reports a Pi/PCr of 2.4. At the highest work output of 15 watts, the cellular pH is Because calf muscle has heterogeneous fibers, the pH values during exercise can range from 6.2 to 7.1 (Morikawa et al. 1994). The pH observation during exercise is consistent with a high work output.
4.3
DIFFUSIONAL CONDUCTANCE
Since the Mb is desaturating as exercise intensity increases, the diffusion equation (equation 1) would imply that gradient from the capillary to the cell is indeed modulating delivery to match the To determine the specific relationship requires the assessment of the as a function of exercise intensity. Even though the present study has utilized whole body both theoretical and empirical studies have shown that the kinetics of consumption of working muscle is reflected in the pulmonary in Phases 2 (metabolic) and 3 (steady state) (Barstow and Mole, 1987). A number of other studies has demonstrated that the increase in leg consumption accounts for more than 57% (ranging from 57 to 93%) of the increment in whole body during leg exercise (Ahlborg et al. 1974) The experimentally determined from exercise level 1 to 3 is 7 ml/min/100 ml leg volume, whereas the rises from 31.4 (40 - 8.6) to 36.1 (40 - 3.9) torr, assuming a constant mean end capillary of 40 torr. Even though the has increased by a factor of 2, the has only increased by a factor of 1.15. If the mean end capillary is 13 torr, then the is now altered to 4.4 (13-8.6) and 8.1 (13-3.9), respectively. The change would imply that the gradient is sufficient to match the enhanced oxygen consumption and that can be relatively constant. Since is a lumped constant, which includes aggregate capillary surface area and capillary to cell distance, a relatively constant would diminish the contribution of diffusion controlled regulation of flux during exercise.Nevertheless is multifactorial and non-linear. Relatively small changes can enhance flux (Federspiel and Popel, 1986). The extent of modulation is unclear from the present experimental data, since in part, the NMR observes only a spatially averaged signal and cannot discriminate any heterogeneity, which can complicate the interpretation (Piiper and Haab, 1991). The specific heterogeneity in
779
question, is also difficult to assess, since at present no definitive measurements can resolve the heterogeneity contribution in exercising muscle. Researchers have argued reasonably against any significant contribution, which is an underlying assumption in the above analysis (Richardson et al. 1995).
4.4
DETERMINANT OF RESPIRATION DURING
EXERCISE Even with the modulation of not appear to be sufficient to meet the
delivery, the oxygen supply does demand during exercise without
metabolic adaptation. Since oxidative phosphorylation also depends upon the phosphorylation potential or charge, redox state, ADP, and carbon substrate availability, the associated metabolite levels can also regulate respiration. Indeed as increases, the 31P PCr signal declines, while the Pi signal increases. The Pi/PCr ratio, which reflects the ADP concentration, shifts from from 0.19 to 2.4 and is consistent with the linear relationship between percent peak power vs. ADP (Barstow et al. 1994). Although the gradient increases with exercise intensity and therefore enhances the driving force for transport, the intracellular nevertheless drops. An additional diffusion route to the mitochondria, such as Mb facilitated diffusion, may become increasingly significant. Even the enhanced driving force for flux, however, does not preclude an apparent ADP dependent stimulation of respiration nor any modulation from the lumped conductance factor, which includes unloading and aggregate capillary surface area. Nevertheless, respiratory control does not appear to depend solely on delivery or supply.
5.
CONCLUSION
In exercising skeletal muscle, the enhanced with increased work output correlates linearly with desaturation. As increases Mb desaturation also increases, reflecting a fall in the cellular At peak Mb is desaturated by 48%. The linear relationship between and Mb desaturation supports the notion that the gradient from the vasculature to the cell enhances the flux. Despite the increased flux, PCr level still falls, reflecting a rise in ADP. The results indicate that the regulation of involves both an gradient and metabolic control. However, the cellular supply alone is not regulating
780
ACKNOWLEDGMENTS We gratefully acknowledge the funding from NIH GM 57355 and the assistance of Tyrone Jue, Douglas Bank, and Suleiman Osman.
REFERENCES Ahlborg, G., Felig, P., Hagenfeldt, L., Hendler, R. and Wahren, J., 1974, Substrate turnover during prolonged exercise in man: Splanchnic and leg metabolism of glucose, free fatty acids, and amino acids. J.Clin.Invest. 53: 1080-1090. Antonini, E. and Brunori, M., 1971, Hemoglobin and Myoglobin in Their Reactions with Ligands. Elsevier/North Holland, Amsterdam.
Barstow, T.J., Buchthal, S.D., Zanconato, S. and Cooper, D.M., 1994, Changes in potential controllers of human skeletal muscle respiration during incremental calf exercise. J.Appl.Physiol. 77: 2169-2176. Barstow, T.J. and Mole, P.A., 1987, Simulation of pulmonary uptake during exercise
transients in humans. J.Appl.Physiol. 63: 2253-2261. Barstow, T., Buchthal, S., Zanconato, S. and Cooper, D., 1994, Changes in potential controllers of human skeletal muscle respiration during incremental calf exercise. J.Appl.Physiol. 77: 2169-2176.
Connett R.J., C.R.Honig, T.E.J.Gayeski and G.A.Brooks, 1990, Defining hypoxia: a systems view of , glycolysis, energetics, and intracellular J.Appl.Physiol. 68: 833-842. Federspiel, A. and Popel, A.s., 1986, A theoretical analysis of the effect of the particulatc nature of blood on oxygen release in capillaries. Microvasc.Res. 32: 164-189. Gayeski, T.E.J. and Honig, C.R., 1988, Intracellular
in long axis of i n d i v i d u a l fibers in
working dog gracilis muscle. American Journal of Physiology 254: H 1 1 7 9 - H 1 1 8 6 . Gayeski, T.E.J. R.J.Connett and C.R.Honig, 1987, Minimum intracellular for maximum cytochrome turnover in red muscle in situ. Am.J.Physiol. 252: H906-H915.
Hogan, M.C., Bebout, D.E. and Wagner, P.D., 1991, Effect of increased Hb-O2 on VO2 max at constant O2 delivery in dog muscle in situ. J.Appl.Physiol. 70: 2656-2662.
Hogan, M.C., Bebout, D.E. and Wagner, P.D., 1993, Effect of blood flow reduction on maximal O2 uptake in canine gastrocnemius muscle in situ. J.Appl.Physiol. 74: 17421747.
Hogan, M.C., Bebout, D.E. and Wagner, P.D., 1993, Effect of blood flow reduction on maximal O2 uptake in canine gastrocnemius muscle in situ. Journal of Applied Physiology 74: 1742-1747. Hogan, M.C., Roca, J., West, J.B. and Wagner, P.D., 1989, Dissociation of maximal O2 delivery in canine gastrocnemius in situ. J.Appl.Physiol. 66: 1919-1926.
Honig, C.R., Gayeski, T.E., Federspiel, A., Clark, A. and Clark, P., 1984, Muscle O2 gradients from hemoglobin to cytochrome: new concepts, new complexities. Adv.Exp.Med. Biol. 169: 23-28. Hoppeler, H. and Lindstedt, S.L., 1985, Malleability of skeletal muscle in overcoming limitations: structural elements. J.Exp.Biol. 115: 355-364.
Jobsis, F.F., 1977, Noninvasive, infrared monitoring of cerebral and myocardial oxygen sufficiency and circulatory parameters. Science 198: 1264-1267. Jue, T. and S.Anderson, 1990, observation of tissue myoglobin: an indicator of intracellular oxygenation in vivo. Magn.Reson.Med. 13: 525-528.
781
Kreutzer, U. and T.Jue, 1991,
-nuclear magnetic resonance deoxymyoglobin signal as an
indicator of intracellular oxygenation in myocardium. Am.J.Physiol. 261: H2091-H2097. Lim, K.O., Pauly, J., Webb, P., Hurd, R. and Macovski, A., 1994, Short TE phosphorus spectroscopy using a spin-echo pulse. Magn.Reson.Med. 32: 98-103. Mancini, D.M., Wilson, J.R., Bolinger, L., Li, H., Kendrick, K., Chance, B. and Leigh, J.S., 1994, In Vivo Magnetic Resonance Spectroscopy Measurement of Deoxymyoglobin During Exercise in Patients With Heart Failure - Demonstration of Abnormal Muscle Metabolism Despite Adequate Oxygenation. Circulation 90: 500-508.
McArdle, W.E., Katch, F.I. and Katch, V.L., 1996, Exercise Physiology: Energy, Nutrition, and Human Performance. Williams & Wilkens, Baltimore. McCrory, M.A., T.Gomez., E.Bernauer and P.A.Molé, 1995, Evaluation of a new air
displacement plethysmograph for measuring human body composition. Med.Sci. Sports Exerc 27- 1686-1691. Morikawa, S., Inubushi, T., Kito, K. and Tabata, R., 1994, Imaging of phosphoenergetic state and intracellular pH in human calf muscles after exercise by N M R spectroscopy. Magn.Reson Imaging 12: 1121-1126. Morris, G.A. and Freeman, R., 1978, Selective Excitation in Fourier Transform Nuclear Magnetic Resonance. J.Magn.Reson. 29: 433-462.
Piiper, J. and Haab, P., 1991, Oxygen supply and uptake in tissue models with unequal distribution of blood flow and shunt. Respiratory Physiology 84: 261-271.
Richardson, R.S., E.A.Noyszewski, K.F.Kendrick, J.S.Leigh and P.D.Wagner, 1995, Myoglobin desaturation during exercise. J.Clin.Invest. 96: 1916-1926. Roca, J., Hogan, M C, Story, D., Bebout, D.E., Haab, P., Gonzalez, R., Ueno, O. and Wagner, P.D., 1989, Evidence for tissue diffusion limitation of VO2 max in normal humans. J.Appl Physiol. 67: 291-299. Schncider, E. and Glover, G.H., 1991, Rapid in vivo proton shimming. Magn.Reson.Med. 18: 335-347. Seiyama, A., Hazeki, O. and Tamura, M., 1988, Noninvasive quantitative analysis of blood
oxygenation in the rat skeletal muscle. J.Biochem. 103: 419-424. Siri, W.E., 1961, Body composition from fluid spaces and density: analysis of methods. In Techniques for measuring body composition (J. Brozek and A. Henschel, eds.), NAS/NRC, Washington, D.C., p. 223.
Stainsby, W.N., 1989, Oxidation/reduction state of cytochrome oxidase during repetitive contractions. J.Appl.Physiol. 67: 2158-2162.
Sutton, J.R., 1992, VO 2max -- new concepts on an old theme. Med.Sci.Sports Exerc. 24: 2629. Sutton, J.R., 1992, VO 2max -- new concepts on an old theme. Med.Sci.Sports Exerc. 24: 2629.
Wagner, P.D., 1991, Central and peripheral aspects of oxygen transport and adaptations with exercise. Sports Medicine 1 1 : 133-142.
Wagner, P.D., 1995, Muscle
transport and
dependent control of metabolism.
Med.Sci.Sports Exerc. 27: 47-53.
Wang, Z., E.A.Noyszewski and J.S.Leigh, 1990, In vivo MRS measurement of deoxymyoglobin in human forearms. Magn.Reson.Med. 14: 562-567. Wilson, D.F., Erecinska, M., Drown, C. and Silver, I.A., 1977, Effect of oxygen tension on cellular energetics. Am.J.Physiol. 233: C135-C140. Wilson, J.R., Mancini, D.M., McCully, K., Feraro, N., Lanoce, V. and Chance, B., 1989, Noninvasive detection of skeletal muscle underperfusion with near-infrared spectroscopy in patients with heart failure. Circulation 80: 1668-1674.
782
Wittenberg, B.A., J.B.Wittenberg and P.R.B.Caldwell, 1975, Role of myoglobin in the oxygen supply to red skeletal muscle. J.Biol.Chem. 9038-9043. Wittenberg, J.B., 1970, Myoglobin-facilitated oxygen diffusion: Role of myoglobin in oxygen entry into muscle. Physiological Review 50: 559-636.
783
This page intentionally left blank.
PH
SENSITIVITY IN THE ISOLATED CNS OF NEWBORN MOUSE
Claudia D. Infante and Jaime Eugenin Laboratory of Neural Systems, Department of Biological Sciences, University of Santiago of
Chile, Casilla 40, Correo 33, Santiago, Chile
1.
INTRODUCTION
A relative recent approach to study the effects of activation of central chemoreceptors on respiration has been the development of isolated CNS preparations from new-born opossum and rat (Eugenin and Nicholls, 1997; Kawai et al., 1996; Harada et al., 1985; Monteau et al., 1990). In these preparations, fictive respiration can be recorded from the cervical roots that originate the phrenic nerve, while central structures are maintained under controlled conditions. In the neonatal opossum in vitro, chemical stimulation of the lower brainstem increased the amplitude and the frequency of fictive respiration, while, in the neonatal rat, chemical stimulation produced different patterns of responses: changes in frequency (Issa and Remmers, 1992; Okada et al., 1993), changes in amplitude (Monteau et al., 1990) or changes in both, frequency and amplitude (Harada et al., 1985). In order to know whether other species present different pattern of respiratory responses to pH stimulation, we studied the effects of low pH superfusion of the lower brainstem in the recently described neonatal mouse brainstem-spinal cord preparation (Hilaire et al., 1997).
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al.
Kluwer Academic/Plenum Publishers, 2000
785
2.
METHODS
New-born CD1 mice (0-2 days old) were anaesthetised by cooling and their CNS were dissected out and transferred to a recording chamber of 1 ml
in volume. The CNS was superfused at continues flow of 0.6 to 1.2 ml with BME (Basal Medium Eagle´s, Gibco) equilibrated with O2:CO2 (95%: 5%, pH 7.35-7.40). Spontaneous activity from C3-C5 ventral roots was recorded with glass suction electrodes at room temperature (18-23 °C). Electrical signals were amplified by low-noise differential amplifier (Grass, model P55B), integrated by full-wave rectifier, displayed on an oscilloscope (Hitachi, VC 6041), saved on an FM tape recorder (HP, model 3968) at a sampling frequency DC-18 kHz, and analysed with a PowerLab 410 AD system. The pH of the brainstem superfusion medium (7.1, 7.4, and 7.6) was selectively changed by gassing BME in presence of different final concentrations of bicarbonate (13, 26, and 40 mM, respectively). Amplitude of fictive respiration was estimated from the peak value of the integrated ventral root activity Instantaneous respiratory frequency was measured from the reciprocal value of the period between two consecutive inspirations. Ventral root activity was regular and stable for at
least 3 minutes before switching the pH of lower brainstem superfusion.
3.
RESULTS
Fictive respiration recorded from C3-C5 ventral roots during superfusion with BME pH 7.4 (basal conditions) consisted of a burst of action potentials of 500-800 ms of duration, appearing at a regular frequency about
786
The inspiratory burst of action potentials describe a decrementing pattern, similar to that observed in the brainstem-spinal cord preparation of neonatal rat (Smith et al., 1990). Switching the superfusion medium from BME pH 7.4 to BME pH 7.1 increased the frequency of fictive respiration and decreased its amplitude (Fig. 1). As illustrated in Fig.1, no change in the decrementing pattern of the burst of action potentials was observed. With chemical stimulation respiratory frequency increased in 50% and the amplitude decreased in 27% In contrast, switching the superfusion medium from pH 7.4 to 7.6 decreased the frequency in 46%, but did not modify the amplitude of fictive respiration (Fig.2).
4.
DISCUSSION
The results confirm that in the isolated CNS of new-born mouse, as in other mammals, fictive respiration is modulated by central chemoreceptors of the brainstem. They also suggest that the frequency and the amplitude modulations induced by central chemical stimulation are exerted by its selective actions on different structures or different mechanisms in charge of depth and timing of respiration. Furthermore, the respiratory pattern elicited by chemical stimulation in the isolated CNS of the neonatal mouse suggests excitatory influences on the structures in charge of the timing and inhibitory
787
influences on those structures responsible for the depth of respiration. The absence of peripheral inputs, like vagal mechanoreceptors, likely is responsible for the slow resting frequency and decrementing pattern of ventral root activity as shown for the neonatal rat in vitro (Smith et al., 1990). Whether this absence of peripheral inputs contributes to the pattern of respiratory responses to chemical stimulation is an open question.
ACKNOWLEDGMENTS We want to thank to Dr. G. Méndez for opportunely provide us with neonates. This work was supported by grants FONDECYT # 1980819 and DICYT- USACH # 029743EL.
REFERENCES Eugenin, J., and Nicholls, J. G., 1997, Chemosensory and cholinergic stimulation of fictive respiration in isolated CNS of neonatal opossum. J. Physiol. 501: 425-437.
Harada, Y., Kuno, M., and Wang, Y. Z., 1985, Differential effects of carbon dioxide and pH on central chemoreceptors in the rat in vitro. J. Physiol. 368: 679-693. Hilaire, G., Bou C., and Monteau, R., 1997, Rostral ventrolateral medulla and respiratory rhythmogenesis in mice. Neurosci. Letters 224: 13-16. Issa, F. G., and Remmers, J. E., 1992, Identification of a subsurface area in the ventral medulla sensitive to local changes in PCO2. J. Appl. Physiol. 72: 439-446. Kawai, A., Ballantyne, D., Muckenhoff, K, and Scheid, P., 1996, Chemosensitive medullary neurones in the brainstem-spinal cord preparation of the neonatal rat. J. Physiol. 492: 277292. Monteau, R., Morin, D., and Hilaire, G., 1990, Acetylcholine and central chemosensitivity: in vitro study in the newborn rat. Respir. Physiol. 81: 241-254. Okada, Y., Mückenhoff, K, and Scheid, P., 1993, Hypercapnia and medullary neurons in the isolated brain stem-spinal cord of the rat. Respir. Physiol. 93: 327-236.
Smith, J. C., Greer, J. J., Liu, G., and Feldman, J. L., 1990, Neural mechanisms generating
respiratory pattern in mammalian brain stem-spinal cord in vitro 1. Spatiotemporal patterns
of motor and medullary neuron activity. J. Neurophysiol. 64: 1149-1169.
788
AORTIC BODY CHEMOREFLEX OF THE ANAESTHETIZED RAT Electrophysiological, morphological, and reflex studies
James F.X. Jones Department of Human Anatomy & Physiology, University College Dublin, Earlsfort Terrace, Dublin 2, Ireland
1.
INTRODUCTION
In the anaesthetized rat, the respiratory response to right atrial injection of phenylbiguanide (PBG) is biphasic. Following injection of PBG there is an initial short latency depression of phrenic neural activity and then
an increase in amplitude and frequency of the phrenic signal. The first response is a component of the pulmonary chemoreflex. The origin of the second response is obscure. Since the rat has been shown recently to possess aortic body chemoreceptors sensitive to PBG (Brophy, Ford, Carey & Jones 1999), the question arises whether PBG evokes an aortic body chemoreflex in the rat. This is controversial because the aortic bodies of the rat are still viewed as insignificant or non-functioning from a whole systems point of view (Kongo, Yamamoto, Kobayashi & Nosaka, 1999).
2.
METHODS
Male Sprague Dawley rats were anaesthetized, artificially ventilated and surgically prepared with interruption of the following chemoreceptor afferent pathways: bilateral section of the carotid sinus nerves, vagi, and the superior laryngeal nerves. A phrenic neurogram was integrated and served as an index of central respiratory activity. A triple lumen catheter was pre-filled with saline, cyanide (1mg
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
789
) and PBG
and inserted into the superior vena cava. The
injections were carried out in the following order saline, PBG, sodium cyanide and almitrine bimesylate (Vectarion) ( via the femoral vein). Both aortic nerves were cut and the injections repeated again in the same order. Single and pauci-fibre recordings of chemoreceptor afferents were obtained from the right aortic nerve using a suction electrode technique and aortic glomus tissue was visualised using formaldehyde-induced fluorescence (see Brophy et al. 1999 for more detail).
3.
RESULTS The initial arterial blood gas values were: pH, haematocrit,
Before aortic nerve section, PBG
evoked the following
cardiorespiratory changes: blood pressure rose slightly from to mmHg, heart rate increased from to beats per minute and phrenic frequency increased significantly from 23 to bursts per minute ( ANOVA and Tukey-Kramer post hoc test) and phrenic amplitude increased by an average of 46% (Figure 1). In contrast, the injection of saline or cyanide did not significantly change either the amplitude or frequency of the phrenic neurogram (although cyanide produced marked respiratory stimulation before the carotid sinus nerves were cut). Injection of almitrine bimesylate (Vectarion) ( via the
femoral vein) was tested in four animals, and was found to significantly
increase phrenic frequency from to bursts per minute and phrenic amplitude by an average of 32%. After the aortic buffer nerves were cut, blood pressure rose to mmHg and heart rate increased to b.p.m.. The PBG evoked
phrenic amplitude increases were abolished in 3/5 animals and the changes were less than 5% in the other two. The phrenic frequency change was less and no longer statistically significant: to bursts per minute.
Following section of the aortic nerves the effects of almitrine on both respiratory frequency and amplitude were abolished. Single fibre recording of aortic nerve afferents confirmed that almitrine was a potent stimulant of rat aortic chemoreceptors. Further simultaneous electrophysiological recordings demonstrated that the latency to activation of aortic chemosensory afferents by PBG was closely coincident with the activation of phrenic motoneurones.
790
791
4.
CONCLUSION
The results show that PBG and almitrine can evoke an aortic body chemoreflex in the anaesthetized rat. Cyanide however has little or no effect on respiration under the experimental conditions described in these studies.
The lack of cyanide evoked hyperpnoea by the aortic bodies may be due to the fact that the blood of the animals in this study was hyperoxic. This idea is in accord with data obtained from single fibre recording of aortic chemoreceptors, which show marked dependency of cyanide excitation. Since cyanide evoked hyperpnoea is readily demonstrable in a rat
with intact carotid sinus nerves even under hyperoxic conditions, it is speculated that the dependency of cyanide excitation of the aortic bodies is much greater than that of the carotid bodies. The results of this study help to partly explain why the reflex effects of the rat aortic bodies
have been missed hitherto. Values are means
S.E.M. unless otherwise stated.
ACKNOWLEDGEMENTS The support of the Wellcome Trust is gratefully acknowledged.
REFERENCES Brophy, S., Ford, T.W., Carey, M. & Jones, J.F.X., 1999, Activity of aortic chemoreceptors in
the anaesthetized rat. J Physiol. 514.3: 821-828. Kongo, M., Yamamoto, R., Kobayashi, M. & Nosaka, S., 1999, Hypoxia inhibits baroreflex vagal bradycardia via a central action in anaesthetized rats. Exp. Physiol., 84: 47-56
792
CHANGES IN THE PEPTIDERGIC INNERVATION OF THE RAT CAROTID BODY A MONTH AFTER THE TERMINATION OF CHRONIC HYPOXIA 1
T. Kusakabe, 2 Y. Hayashida, 3 H . Matsuda, 4T. Kawakami, and 5 T. Takenaka
1
Department of Anatomy Department of Otorhinolaryngology and 5 Department of Physiology Yokohama City University School of Medicine, Yokohama 236-0004, Japan 2 Department of Systems Physiology University of Occupational and Environmental Health, Kitakyushu 807-8555, Japan 4 Department of Physiology Kitasato University School of Medicine, Sagamihara 228-8555, Japan 3
1. INTRODUCTION The carotid bodies are enlarged by several fold in rats exposed to chronic hypoxia; their volume increases and endothelial cells multiply (Barer et al. 1976; Heath et al. 1973; Laider and Kay 1975a, b). Recently, we examined the peptidergic innervation in the carotid body of the rats exposed to chronically isocapnic hypoxia (Kusakabe et al. 1998). The density of substance P (SP) and calcitonin gene-related peptide (CGRP) immunoreactive fibers in the chronically hypoxic carotid body decreased significantly to under 50%, the density of vasoactive intestinal polypeptide (VIP) immunoreactive fibers increased significantly 1.80 times, and the density of neuropeptide Y (NPY) immunoreactive fibers was unchanged in comparison with the controls. These findings suggest that altered peptidergic innervation of the chronically hypoxic carotid body is one feature of hypoxic adaptation, which may involve modulation of chemosensory mechanisms by modification of carotid body circulation. As far as we are aware, however, there are no immunohistochemical studies on the peptidergic innervation in the carotid body during deacclimatization after chronic hypoxia is terminated. In the present study, the distribution and abundance of neuropeptide-
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
793
containing nerve fibers were examined in the rat carotid body a month after the termination of chronic hypoxia.
2. MATERIALS AND METHODS Rats were placed in an air-tight acrylic chamber with two holes. One hole was used to deliver a hypoxic gas mixture (10% in total 20 L/min) into the chamber. The flow of gas mixture was regulated by a multiflowmeter and the and the levels within the box were monitored with a gas analyzer (Respina 1 H26, NEC San-ei, Japan). The second hole was used to flush out the gas mixture. This hypoxic condition has been confirmed to be hypocapnic to the rats in our previous study (Hayashida et al, 1996). Rats were exposed chronically in this chamber for three months with
food and water available ad lib. Control rats were housed for three months in
the same chamber ventilated by air at the same flow rate. Some rats were returned to the normoxic atmosphere after 3 months of chronically hypoxic exposure.
The animals were perfused with 0.1M heparinized phosphate buffer saline (PBS), followed by freshly prepared Zamboni's fixative solution (0.2%
picric acid and 4% paraformaldehyde in 0.1M PBS). The carotid bodies were cut serially at on a cryostat, and mounted in four series on poly-Llysine coated slides. All experiments with animals were performed in accord with "Guiding Principles for the Care and Use of Animals in the Fields of Physiological Sciences" published by the Physiological Society of Japan. The sections were processed for immunohistochemistry according to the peroxidase-antiperoxidase (PAP) method as described previously (Kusakabe et al. 1991). In brief, the sections were incubated at 4°C overnight with the primary antisera against the following neuropeptides: SP (1:1500; Cambridge), CGRP (1:1500; Cambridge), V1P (1:2000; Incstar), and NPY (1:2000; Incstar). After rinsing in several changes of PBS, the sections were transferred for 2 h to anti-rabbit IgG (1:200; Organo Technica). Next, the
sections were rinsed with several changes of PBS, transferred for 2 h to rabbit PAP (1:200; Jackson). The peroxidase activity was demonstrated with 3,3’-
diaminobenzidine. Some sections were also stained with hematoxylin eosin for general histology. The density of immunoreactive fibers in the carotid bodies was represent as the number of varicosities. In the sections through around the center of the carotid body, the area of the parenchyma of the carotid body was measured with a computer and image processor on 50 sections taken from fourteen normoxic carotid bodies and 50 sections taken from fourteen
chronically hypoxic carotid bodies of each of the seven animals examined, and the number of varicosities was counted. The value per unit area of parenchyma, excluding the area of vascular lumen, were expressed as mean ± SD (n=50). Statistical comparisons between the control and experimental values were determined using Student's t-test.
794
3. RESULTS In the sections through around the center of the carotid body, the diameter of the chronically hypocapnic hypoxic carotid bodies was several
folds greater than the control carotid bodies (Figs. 1A, B). The enlarged carotid bodies contained expanded vasculatures (Fig. 1B). The carotid bodies one month after the termination of chronic hypoxia were diminished in size, although their diameter remained larger than the controls (Fig. 1C). The expanded vasculature returned to the normoxic state (Fig. 1C).
Immunoreactivity of SP, CGRP, VIP, and NPY was recognized in
the nerve fibers distributed throughout the parenchyma of the carotid body
(Figs. 2A-5A), as recently reported by Kusakabe et al. (1998). They appeared as thin processes with many varicosities. In the chronic hypocapnic hypoxic carotid body, these peptidergic fibers, and especially VIP and NPY fibers, were mainly associated with enlarged vasculature (Figs. 2B-5B). When the mean density of varicosities
per unit area was compared between the normoxic and chronically hypoxic carotid bodies, the density of VIP fibers was significantly
increased from
to
although that of NPY fibers was
unchanged (Fig. 6). The density of SP and CGRP fibers was significantly
decreased from to and from to respectively (Fig. 6). In the carotid body one month after the termination of chronically hypocapnic hypoxia, the relative abundance of NPY fibers tended to be increased although that of SP, CGRP, and VIP fibers were similar to those in the chronically hypoxic carotid body (Figs. 2C-5C). When the mean density of varicosities were compared in the same way between the chronically hypoxic carotid body and the carotid body one month after the termination of 795
796
chronic hypoxia, the mean density of NPY fibers was significantly increased from to and the density of SP, CGRP, and V I P was not changed (Fig. 6).
4. DISCUSSION Heath et al (1973) have showed that the morbid anatomical changes in the carotid body of the rats exposed for 5 weeks to a barometric pressure of 380mmHg, equivalent to a simulated altitude of 5500m above sea level, are almost totally reversible at 5 weeks after the removal of hypoxic stimulation. Also in this study one month after the termination of chronic hypoxia, the expanded vasculature in the chronically hypoxic carotid body has already returned to the normoxic state, although the carotid body was still larger than in the normoxic controls. From this finding, we can not conclude when the deacclimatized structural changes start. To clarify this, it is necessary to perform further observations in various periods after the termination of hypoxic exposure. On the other hand, the present study demonstrated, for the first time, the deacclimatized changes in the distribution of neuropeptide-containing nerve fibers in the rat carotid body after the termination of chronic hypoxia. The density of NPY fibers significantly increased, although that of SP,
797
CGRP, and V I P fibers remained in the state it was in during chronic hypoxia. More recently, we speculated that at least part of vascular expansion in the chronically hypoxic rat carotid body may depend on the vasodilatory effect of V I P (Kusakabe et al, 1998). In various mammals NPY is thought to have a vasoconstrictory effect (Lundberg et al, 1982; Edvinsson et al, 1983; Brain et al, 1985). Additionally we speculate that at least part of vascular constriction in the rat carotid body a month after the termination of chronic hypoxia may depend on the vasoconstrictory effect of NPY. A possible role of the peptidergic innervation during both adaptation to hypoxia and deacclimatization to normoxia is schematically summarized in Figure 7.
5. ACKNOWLEDGEMENTS We are grateful to Prof. Frank L. Powell of the Department of Medicine, University of California San Diego, School of Medicine, for his help in editing the manuscript. The present work was supported by grants-inaid 08670028 and 09670022 from the Ministry of Education, Science and Culture, Japan.
6. REFERENCES Barer GR, Edwards C, & Jolly Al (1976) Changes in the carotid body and the ventilatory response to hypoxia in chronically hypoxic rats. Clinic Sci 50: 311-313 Brain SD, Williams TJ, Tippins JR, Moris HR, & MacIntyre I (1985) Calcitonin gene-related peptide is a potent vasodilator. Nature (Lond) 313: 54-56
798
Hayashida Y, Hirakawa H, Nakamura T & Maeda M (1996) Chemoreceptors in autonomic responses to hypoxia in conscious rats. Adv Exp Med Biol 410:439-442 Heath D, Edwards C, Winson M & Smith P (1973) Effects on the right ventricle, pulmonary vasculature, and carotid bodies of the rat of exposure to, and recovery from, simulated high altitude. Thorax 28: 24-28 Kusakabe T, Anglade P & Tsuji S (1991) Localization of substance P, CGRP, VIP, neuropeptide Y, and somatostatin immunoreactive nerve fibers in the carotid labyrinths of some amphibian species. Histochemistry 96: 255-260 Kusakabe T, Hayashida Y, Matsuda H, Gono Y, Powell FL, Ellisman MH, Kawakami T & Takenaka T (1998) Hypoxic adaptation of the peptidergic innervation in the rat carotid body. Brain Res 806: 165-174 Laider P & Kay JM (1975) A quantitative morphological study of the carotid bodies of rats living at a simulated altitude of 4300 meters. J Pathol 117: 183-191 Laider P & Kay JM (1975) The effect of chronic hypoxia on the number and nuclear diameter of type I cells in the carotid bodies of rats. Am J Pathol 79: 311-320 Lundberg JM , Terenis L, Hökfelt T, Martling CR, Tatemoto K, Mutt V, Polak J, Bloom S, & Goldstein M, (1982) Neuropeptide Y (NPY)-like immunoreactivity in peripheral noradrenergic neurons and effects of NPY on sympathetic function, Acta Physiol. Scand. 116: 477-480
799
This page intentionally left blank.
CAROTID BODIES AND THE SIGH REFLEX IN THE CONSCIOUS AND ANAESTHETISED GUINEA-PIG
Daryl O. Schwenke and Patricia A. Cragg Department of Physiology, University of Otago Medical School, Dunedin, New Zealand
1.
INTRODUCTION
During normal breathing there is a tendency, over time, for the under ventilated regions of the lung to partially collapse (atelectasis) causing a decrease in lung compliance and hence an imbalance in the ventilation/perfusion ratio. Normal breathing is periodically interrupted by a breath 2-3 times larger than a normal tidal breath. This 'sigh reflex', also known as the ‘augmented breath’, spontaneously re-inflates the collapsed regions of the lung, elevating lung compliance and ultimately restoring the ventilation/perfusion ratio, which is crucial for maintaining a normal partial pressure for arterial oxygen and carbon dioxide
1.1
Frequency and Amplitude of Sighs
A sigh consists of an inspiratory and expiratory phase. The inspiratory phase can be subdivided into two distinctly different phases (Bendixen et al., 1964; Takeda & Matsumoto, 1997). Phase 1 has an inspiratory pattern
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
801
identical to the breaths immediately preceding the sigh. Phase 2 has a greater inspiratory trajectory, is approximately twice the size of phase 1 and begins at the peak of phase 1 (i.e. at the peak of an otherwise normal breath). The expiratory phase of a sigh is monophasic, has a greater flow rate than a normal expiration (Szereda-Przestaszewska et al., 1992) and is prolonged by a short apneic period (Davies & Roumy, 1982). The breaths immediately following a sigh are more rapid and shallow compared to the pre-sigh breaths (Szereda-Przestaszewska et al., 1992).
1.2
Inputs for the Generation of the Sigh
The vagal afferents from the rapidly adapting lung stretch receptors (a.k.a. lung irritant receptors) are the primary receptors that provoke the sigh reflex (Katagiri et al., 1998) and are stimulated primarily by a decrease in dynamic lung compliance (Matsumoto et al., 1997). Bilateral vagotomy has been shown to abolish sighs in the rabbit (Matsumoto et al., 1997) and dog (vagal cooling; Bowes et al., 1983). In the rat, however, investigators have
reported that the sigh reflex reappears 2-3 hours post-vagotomy (Galland, 1984; Marshall & Metcalfe, 1988).
The carotid bodies (the primary peripheral chemoreceptors that elicit increases in ventilation during hypoxia and, to a lesser extent, hypercapnia) have been implicated in facilitating sigh frequency (Glogowska et al., 1972; Cherniack et al., 1981; Widdicombe, 1982; Marshall, 1987). Although both hypoxia and hypercapnia provoke the sigh, it has been reported in the cat (Cherniack et al., 1981) and rat (Galland & Cragg, 1985) that hypoxia is the more potent stimulus. The available literature on the
effect of carotid body denervation (CBD) on spontaneous and provoked sighs is limited to the rat, in which CBD was shown to reduce the frequency and amplitude of spontaneous sighs, abolish the increase in sigh frequency during hypoxia, but not alter the frequency of sighs provoked by hypercapnia (Galland & Cragg, 1985). To date the sigh reflex (spontaneous or provoked) has not been investigated in the guinea-pig.
1.3
Ventilatory Responses to Hypoxia and Hypercapnia
The ‘typical’ breathing response to hypoxia is an increase in ventilation due to the detection of hypoxia by the carotid bodies. In contrast
802
to other mammals, the hypoxic ventilatory response of the guinea-pig is blunted and not altered by CBD (Cragg & Schwenke, 1996). Hypercapnia, on the other hand, is detected by both the peripheral and central chemoreceptors and the carotid bodies of the guinea-pig are involved, as in other mammals, in of the ventilatory response (Schwenke, 1995).
1.4
Effects of Anaesthesia
It is commonly known that anaesthesia can depress respiratory parameters by depressing central cardiorespiratory control centers. Some investigators have reported that the frequency of sighs is directly proportional to the breathing frequency (Coleridge & Coleridge, 1986). Consequently, anaesthesia can reduce, or abolish, the frequency of sighs (spontaneous and provoked), depending on the depth of respiratory depression. However, many studies investigating the sigh reflex have used anaesthetised preparations and, despite a reduction in sigh frequency, the characteristics of the sigh reflex are considered not to be compromised by anaesthesia.
1.5
Aim
As CBD does not affect the ventilatory response to hypoxia in the guinea-pig, we hypothesised that CBD (1) would not reduce the frequency of spontaneous sighs, (2) would not abolish hypoxia-provoked sighs and (3)
would not have any influence on hypercapnia-provoked sighs. Additionally, given that the guinea-pig has a poor breathing response to hypoxia, we hypothesised that increases in sigh frequency during hypoxia would be negligible. As anaesthesia is known to depress cardiorespiratory variables, we aimed to also investigate the sigh reflex in conscious, carotid body intact, guinea-pigs. This would substantiate the breathing data obtained after pentobarbitone anaesthesia, and prior to CBD.
2.
METHODS
Experiments were conducted on 30 Hartley strain, female, guineapigs (Cavia porcellus) with a mean age and weight of 100 days and 680 g, respectively.
803
2.1
Conscious Guinea-Pigs
The whole body plethysmography technique was utilised to continuously measure tidal volume and breathing frequency. Body plethysmography consisted of placing an animal inside an air-tight perspex chamber (plethysmograph; 3.8 L) which was incorporated in a unidirectional
flow circuit. Test gases (or air) were heated (to about 27°C) and humidified, and then delivered into the plethysmograph which was heated to — the thermoneutral zone of guinea-pigs. The time required to fully change the gas composition of the chamber from air to a test gas was
approximately 60 s. Pressure changes within the plethsymograph,
corresponding to inspiration and expiration, were detected by a differential pressure transducer, converted from analog to digital by a MacLab/8s, and displayed on a Power Macintosh 7220/200. Over 4 days ( h per session), 12 guinea-pigs were trained to sit restfully within the plethysmograph before being subjected to the protocol described below. Training consisted of subjecting guinea-pigs, over consecutive days, to air (day 1) and test gases (day 2, 3 and 4). After training, guinea-pigs were subjected, randomly, to the following protocol in one session: (i) air for 30 min (ii) hypoxia for 5 min, followed by 10 mm of air breathing to recover, and (iii) hypercapnia for 10 min, followed by 10 min of air breathing to recover.
2.2
Anaesthetised Guinea-Pigs
Pentobarbitone anaesthesia was achieved with an initial i.p. dose of 30 mg/kg, and maintained with supplementary i.v. doses of 15-30 mg/kg/h. Body temperature was constantly maintained at 39°C with a thermostatically controlled heated pad. Cannulation of the trachea permitted continuous monitoring of the tidal gases and with a Perkin-Elmer mass spectrometer. Cannulation of the femoral artery allowed continuous monitoring of arterial blood pressure, whereas cannulation of the femoral vein permitted periodic administration of anaesthetic. Following surgery, guinea-pigs were placed supine within a plethysmograph with all cannulae exteriorised, including the tracheal cannula, such that guinea-pigs breathed from outside the plethysmograph. Gases were delivered across the end of the tracheal cannula via a ‘T-piece’ type of tubing.
804
Guinea-pigs were divided into two subgroups of 9: ( i ) Group 1 were exposed to air for 30 min followed by hypoxia for 5 min; ( i i ) Group 2 were exposed to air for 30 min followed by hypercapnia (8% for 10 min. For each group of guinea-pigs, the tests were repeated following CBD, which was achieved by bilateral sectioning of the glossopharyngeal nerves (IX cranial nerves). Data were collected and analysed, for conscious and both groups of anaesthetised guinea-pigs, during air breathing, hypoxia and hypercapnia: (i) 5-10 breaths immediately preceding a sigh (pre-sigh breaths), (ii) the sigh, (iii) 5 breaths immediately following a sigh (post-sigh breaths), and (iv) the frequency of sighs. Data are presented as Comparisons were made before and after anaesthesia, and before and after CBD by using twoway ANOVA. Post hoc comparisons were made by using Student’s paired ttest with the Bonferroni-Dunn correction for multiple comparisons, was considered significant.
3.
3.1
RESULTS
Air Breathing
Pentobarbitone anaesthesia reduced the frequency of spontaneous sighs from every 4 min (0.25/min) to every 7 min (0.14/min). This was directly correlated with a 35% reduction in breathing frequency (Table 1; ). CBD further reduced the frequency of spontaneous sighs to every 13 min (0.07/min), but did not alter breathing frequency. The amplitude of the sigh, and both inspiratory phases, were unaltered by either anaesthesia or CBD. Phase 2 was approximately 2 to 3 times the size of phase 1 (Table 1). The reduction in breathing frequency, caused by anaesthesia, was due to an increase in the inspiratory time and to a greater extent, the expiratory time (Table 2). Despite a prolongation of in phase 1 of the sigh caused by anaesthesia, the phase and the sigh were unaltered by anaesthesia, or CBD. Post-sigh breaths for conscious guinea-pigs were smaller in amplitude (25% reduction) than pre-sigh breaths although frequency was
805
806
unchanged (Table 1). Under anaesthesia, post-sigh breaths were more rapid (44% taster) due to shorter and (Table 2), but in contrast was
unchanged. CBD did not change the characteristics of post-sigh breaths. Breathing returned to normal (i.e. pre-sigh) frequency and in all guinea-pigs.
3.2
within 8-10 s
Hypoxia
As predicted, the magnitude of the breathing response to hypoxia for guinea-pigs in the present study was comprised of a small and frequency increase (both regardless of anaesthesia or CBD. However, hypoxia also provoked a large increase in sigh frequency in conscious guinea-pigs ( 1 every 1.5 min). Anaesthesia significantly reduced the sigh frequency during hypoxia (1 every 2.3 min), although the percentage increase in sigh frequency above the air baseline was unaltered. In contrast to our hypothesis, CBD further reduced the frequency of hypoxia-provoked sighs, despite the fact that CBD did not significantly change the breathing response to hypoxia. The amplitude of the sighs was unaltered by hypoxia, anaesthesia or CBD. Observed increases in phase 1 amplitude were small and often insignificant (except for anaesthetised guinea-pigs), such that phase 2 remained approximately 2-3 times the size of phase 1 during hypoxia for all
groups of guinea-pigs (Table 1).
The sigh TI and T E were reduced by hypoxia only in the conscious group of guinea-pigs by 10% and 22%, respectively (Table 2) the same (and only) group that showed a significant increase in breathing frequency during hypoxia. Post-sigh breaths during hypoxia were consistently more frequent (significant for anaesthetised guinea-pigs), mainly due to a shorter and shallow (significant for conscious and anaesthetised guinea-pigs), compared to pre-sigh breaths (Tables 1 & 2).
3.3
Hypercapnia
Hypercapnia produced a significant increase in the frequency of sighs in all guinea-pigs (Table 1). Anaesthesia reduced both the frequency of hypercapnia-provoked sighs and the percentage increase in sigh
frequency above the air baseline (120% cf. 230%). This correlated with the
40% increase in breathing frequency in anaesthetised guinea-pigs compared
807
808
with the 60% increase in conscious guinea-pigs. CBD did not significantly alter the frequency of hypercapnia-provoked sighs, but did cause a small, but significant reduction in the breathing frequency response to hypercapnia (Table 1). The amplitude of the sighs were unaltered by hypercapnia, anaesthesia or CBD. Hypercapnia, in all groups of guinea-pigs, consistently caused a 130%-140% increase in the pre-sigh and sigh phase 1 and as the total sigh amplitude was unaltered, phase 2 amplitude consistently decreased Hypercapnia decreased the and of the sigh in similar proportions in the conscious guinea-pig (Table 2). Decreases in and were not as great under anaesthesia (36% and 26% decrease, respectively), which correlated with the anaesthetic-induced reduction in breathing frequency. CBD did not change the or the magnitude of decrease in caused by hypercapnia (31% decrease). The hypercapniainduced reduction in was insignificant and, therefore, differed from the anaesthetised, carotid body intact, guinea-pigs Post-sigh breaths were consistently more rapid, compared to presigh breaths, although significance was never achieved (Table 1). The postsigh was slightly smaller than the pre-sigh for conscious and anaesthetised guinea-pigs (NS), although post-sigh breaths following CBD were marginally larger (NS) than pre-sigh
4.
DISCUSSION
4.1
Anaesthesia
The guinea-pig has been described as one of the most difficult (if not the most difficult) small animal species in which to achieve safe and effective anaesthesia (Hoar, 1969; Green et al., 1981; Brown et al, 1989; Flecknell, 1996). Sodium pentobarbitone, used in the present study, has been, and still is, one of the most common anaesthetic drugs used for the guinea-pig. This laboratory elected to use pentobarbitone sodium for anaesthetising guinea-pigs (30 mg/kg) based on previous experiences regarding the ease and effectiveness of the drug in the rat (45 mg/kg). Despite a depressed baseline breathing, Schwenke (1995) reported that the amplitude of the breathing responses to hypoxia and hypercapnia in the guinea-pig in the conscious state were unaltered by pentobarbitone anaesthesia.
809
4.2
Spontaneous Sighs
A comparative study by McCutcheon (1953) showed that the frequency of sighs is inversely proportional to body mass. This relates to the fact that small animals are more susceptible to atelectasis and, thus, need to sigh more frequently than larger animals. The frequency of spontaneous sighs for the conscious ( every 4 min) and anaesthetised ( every 7 min) guinea-pig in the present study concurs with the wide range reported in the literature for similar sized animals such as rats, cats and rabbits (Glogowska el al., 1972; Galland and Cragg, 1985; Marshall & Metcalfe, 1986; Marshall & Metcalfe, 1988; Matsumoto et al., 1997; Takeda & Matsumoto, 1997). Larger animals, such as humans spontaneously sigh about once every 15-20 min (McCutcheon, 1953; Goodman & Kestin, 1992). Post-sigh breaths are often more frequent and smaller than pre-sigh breaths, as reported in the present study. A review by Coleridge & Coleridge (1986) reported that the large lung inflation during a sigh not only stimulates the slowly adapting lung stretch receptors to induce an apneic period immediately following the sigh, but also stimulates the pulmonary and bronchial C-fibres — “Stimulation of these nonmyelinated afferent fibres (by lung inflation) causes rapid shallow breathing”.
4.3
Hypoxia-Provoked Sighs
Hypoxia is a known respiratory stimulant which causes, in most mammals, a reflex increase in ventilation. In the anaesthetised rat, increases in sigh frequency are directly correlated to the severity of hypoxia (Galland & Cragg, 1985; Marshall & Metcalfe, 1988). The frequency of hypoxiaprovoked sighs in the guinea-pig (0.67/min and 0.43/min for conscious and anaesthetised, respectively) were lower than that reported for the anaesthetised rat ( Galland & Cragg, 1985; Marshall & Metcalfe, 1988). This is attributable to firstly, size difference — the rats (300-400 g)
were of a smaller size than the guinea-pig (680 g); and secondly, the ventilatory response of the rat to 8% O2 is considerably larger (90%-100% increase) than that of the guinea-pig (30% increase). Although all of the underlying factors that govern the increase in sigh frequency during hypoxia are not known, Marshall & Metcalfe (1988) suggested that sigh frequency is correlated with the breathing frequency. Lung irritant receptors can be stimulated by an increase in the velocity of air flow and thus by respiratory stimulants (Widdicombe, 1982; Coleridge &
810
Coleridge, 1986). Hypoxia could, thus, increase sigh frequency through the
effect of increasing breathing frequency. In the present study, however, hypoxia caused a large increase in sigh frequency without causing a large increase in breathing frequency. Why the carotid bodies of the guinea-pig respond to hypoxia to
facilitate sigh frequency, yet have no influence on ventilation, is not clear. There is the possibility that two respiratory regions within the medulla exist to separately control eupnea and the generation of sighs, as proposed by St John (1990). If this were feasible, then the carotid body afferents may bifurcate into the ‘eupnea’ centre and the ‘sigh generation’ centre. Hypoxia is known to promote the accumulation of inhibitory neuromodulators within the medulla that cause a secondary decline in ventilation in some mammals
— the so-called ventilatory roll-off (Bisgard & Neubauer, 1995). We postulate that, in the guinea-pig, only the ‘eupnea’ centre would be susceptible to these inhibitory neuromodulators during hypoxia, and that the ‘sigh generation’ centre would be unaffected since the neurons that generate a sigh differ from other respiratory neurons (Romaniuk et al., 1989; Orem & Trotter, 1993). Consequently, hypoxia would cause an increase in sigh frequency without altering breathing.
4.4
Hypercapnia-Provoked Sighs As a respiratory stimulant, hypercapnia exerts most of its effect by
stimulating the central chemoreceptors. The frequency of hypercapniaprovoked sighs in the current study (0.83/min and 0.31/min for conscious and anaesthetised, respectively) was similar to that reported for the anaesthetised rat (0.54/min; Galland & Cragg, 1985). Despite the size and species difference, the ventilatory response of the guinea-pig to hypercapnia
is, in contrast to hypoxia, slightly more accentuated than that of the rat (Cragg & Schwenke, 1996). Galland & Cragg (1985) reported that the
central chemoreceptors in the rat were solely responsible for facilitating the frequency of sighs during hypercapnia, evident since sigh frequency was not
altered by CBD. Similarly, the present study has shown in the guinea-pig that CBD does not alter the facilitation of sigh frequency during hypercapnia. Therefore, we would assume that, as the central chemoreceptors are the predominant receptors for ventilatory responses to hypercapnia, they are also solely responsible for facilitating the frequency of hypercapnia-provoked sighs. The mechanisms by which the central chemoreceptors govern the increase in sigh frequency is not yet understood.
811
5.
REFERENCES
Bendixen H H , Smith GM & Mead J (1964). Pattern of ventilation in young adults. J. Appl Physiol 19: 195-198.
Bisgard GE & Neubauer JA (1995). Peripheral and central effects of hypoxia. In Regulation
of
Breathing (Dempsey, J.A., Pack, A.I. eds), vol. 79. Lung Biology in Health & Disease
New York, Dekker, pp. 617-667.
Bowes G, Andrey SM, Kozar LF & Phillipson EA (1983). Carotid chemoreceptor regulation of expiratory duration, J. Appl. Physiol: Resp Env. & Exer. Physiol. 54: 1195-1201. Brown JN, Thorne PR & Nuttall AL (1989). Blood pressure and other physiological responses in awake and anaesthetized guinea pigs. Lab. Anim. Sci 39: 142-148. Cherniack NS, von Euler C, Glogowska M & Homma I (1981). Characteristics and rate of occurrence of spontaneous and provoked augmented breaths. Acta Physiol. Scand 1 1 1 : 349-360. Coleridge HM & Coleridge JCG (1986). Reflexes evoked from the tracheobronchial tree and lungs. In Handbook of Physiology (Geige, S.R ed.), The respiratory system, vol. 2, American Physiological Society, pp. 395-427.
Cragg PA & Schwenke DO (1996). Role of the carotid bodies in the guinea-pig. In Frontiers
in Arterial Chemoreception (Zapata P., Eyzaguirre C., Torrance R.W., eds.) Plenum
Press, New York and London, pp. 377-381. Davies A & Roumy M (1982). The effect of transient stimulation of lung irritant receptors on the pattern of breathing in rabbits. J. Physiol. 324: 389-401.
F l e c k n e l l P (1996). Laboratory Animal Anaesthesia: A Practical Introduction for Research Workers and Technicians. 2nd edn. London; San Diego; Academic Press. Galland BC (1984). Thesis BSc (Hons) The augmented breath. University of Otago, New Zealand.
Galland BC & Cragg, PA. (1985). Effect of carotid body denervation or vagotomy on the spontaneous and provoked sigh in the anaesthetised rat. Proc. Univ. Otago Med. Sch 63: 17-18. Glogowska M, Richardson PS, Widdicombe JG & Winning AJ (1972). The role of the vagus nerves, peripheral chemoreccptors and other afferent pathways in the genesis of augmented breaths in cats and rabbits. Respir. Physiol. 16: 179-196.
Goodman N W & Kestin 1G (1992). Sighs and their effect on the breathing of patients anaesthetized with infusions of propofol. Brit. J. Anaes. 68: 48-53. Green CJ, Knight J, Precious S & Simpkin S (1981). Ketaminc alone and combined with diazepam or xylazine in laboratory animals: a 10 year experience. Lab. Anim. 15: 163170. Hoar RM (1969). Anesthesia in the guinea pig. Fed. Proc. 28: 1517-1521. Katagiri H, Katagiri M, Kieser TM & Easton PA (1998). Diaphragm function during sighs in awake dogs after laparotomy. Am. J. Resp. & Crit C. Med. 157: 1085-1092. Marshall JM (1987). Analysis of cardiovascular responses evoked following changes in
peripheral chemoreceptor activity in the rat. J. Physiol. 394: 393-414. Marshall JM & Metcalfe JD (1986). The effects of blockade of pulmonary stretch receptors by sulpur dioxide on the cardiovascular system of the rat in normoxia and hypoxia. J. Physiol 382: 53P.
Marshall JM & Metcalfe JD (1988). Cardiovascular changes associated with augmented breaths in normoxia and hypoxia in the rat. J. Physiol. 400: 15-27.
Matsumoto S, Takeda M, Saiki C, Takahashi T & Ojima K (1997). Effects of vagal and carotid chemoreceptor afferents on the frequency and pattern of spontaneous augmented breaths in rabbits. Lung 175: 175-186.
McCutcheon FH (1953). Atmospheric respiration and the complex cycles in mammalian breathing patterns. J Cell. and Comp. Physiol. 37: 447-476.
812
Orem J & Trotter RH (1993). Medullary respiratory neuronal activity during augmented breaths in intact unanesthetized cats. J. Appl. Physiol. 74: 761-769.
Romaniuk JR, Be WK, Karczewski WA & Malinowska M (1989). Augmented breath provoked by lung inflation in cat. Acta Neuro. Exp. 49: 57-71. Schwenke DO (1995). Thesis MSc The ventilatory and metabolic responses of the anaesthetised guinea-pig to hypoxia and hypercapnia before and after carotid body denervation. University of Otago, New Zealand. St John WM & Knuth KV (1990). Neurogenesis, control, and funtional significance of gasping. J. Appl. Physiol 64: 1305-1315.
Szereda-Przestaszewska M, Jakus J, Stransky A & Barani H (1992). Characteristics of augmented breaths provoked by almitrine bismesylate in cats. Exp. Physiol. 77: 109-117. Takeda M & Matsumoto S (1997). Discharge patterns of dorsal and ventral respiratory group neurons during spontaneous augmented breaths observed in pentobarbital anesthetized rats, Brain Res. 749: 95-100.
Widdicombe JG (1982). Pulmonary and respiratory tract receptors. J. Exp Biol. 100: 41-57.
813
This page intentionally left blank.
IMMUNOHISTOCHEMICAL STUDY OF THE CAROTID BODY DURING HIBERNATION Kazuo Ohtomo1, Kohko Fukuhara2, and Katsuaki Yoshizaki 3 1
Department of Anatomy and Biology, Akita University College of Allied Medical Science, 1-1-1, Hondo, Akita 010-8543 Japan; 2 Department of Anatomy, Akita University School of Medicine, 1-1-1 , Hondo, Akita 010-8 5 4 3, Japan; 3Department of Physiology and Chemistry, Akita University College of Allied Medical Science ,1-1-1, Hondo, Akita 010-8543 Japan
1.
INTRODUCTION
Hibernation represents a physiological adaptation to the severe environment that is established during winter. In hibernating animals, vital signs such as respiration, heart rate and body temperature are markedly decreased and the depression of respiration and heart rate in particular could result in hibernation. These changes are controlled by the hypothalamus, which contains various neuropeptides that may be involved in the physiological regulation of hibernation. Furthermore, the carotid body which is an arterial chemosensory organ regulates respiration, and its parenchymal cells contain several neuropeptides. Therefore, it would be of interest to identify differences in the physiological state and in the distribution of several neuropeptides between hibernating and non-hibernating animals. We examined immunohistochemically the distribution of several neuropeptides in the carotid bodies of two mammalian species (chipmunks and bats) to study its role in hibernation, focusing on differences in vital signs between the hibernation and non-hibernation period. Seasonal changes in the distribution of the immunoreactivity of numerous peptides in the central nervous system have been reported (Dark et al., 1990; Nurnberger et al., 1995) and immunohistochemical studies have also demonstrated the existence of several peptides in the carotid body (Wharton, et al., 1980; Kobayashi et al., 1983; Kusakabe, et al., 1991;
Oxygen Sensing: Molecule to Man, edited by S. L a h i r i et al.
Kluwer Academic/Plenum Publishers, 2000
815
Oomoriet al., 1994; Ponect et al., 1994; Wang et al.,1998). Furthermore, immunohistochemical studies of the carotid body have been performed under a number of different experimental physiological conditions (Poncet et al., 1994; Kusakabe et al., 1998a,b). However, seasonal changes in the pattern of immunolabeling of peptides in the carotid body have yet to be described.
2.
MATERIALS AND METHODS
Twenty adult male chipmunks (Tamias sibiricus aciaticus) and ten adult male horeseshoe bat (Rhinlophus ferrumequinum) were used. The ten chipmunks were housed individually with free access to food and water, and were exposed to a 12h light/12h dark photoperiod. The room temperature was gradually reduced from 20°C to 8°C over a 2- month period, and kept at during the hibernation phase. The ten bats were captured in their habitat, according to the legal regulations stipulated in Japan. Four chipmunks with a mean body weight of 80 g were used for measurement of respiratory rate, heart rate, body temperature (Tb) and blood gases. Blood was obtained directly from the heart of hibernators before fixation. Blood gases were measured with the aid of an acid-base/gas analyzer (ABL30, Radiometer Copenhagen, Sweden). Change in respiratory rate during the course of arousal from hibernation (i.e. during rewarming) was measured by attaching a strain gauge (D-FAE-5-512 T11, Minebea Co., Japan), which was connected to an amplifier (AS 1201, NEC, Japan) to the chest of the hibernating chipmunks. Changes in heat rate during the course of arousal from hibernation was measured in the form of an electrocardiogram, recorded via a dipolar lead with two electrodes, one attached to a foreleg, the other to a hindleg. Tb was measured indirectly from inside of the animals’ ear by an infrared-beam type thermometer (circle thermo SK-8100, Sato keiryoki, Japan). The vital signs were recorded on both a DAT tape recorder (PC208Ax, Sony, Japan) and a pen recorder.
2.1
Tissue preparation for immunohistochemistry
Non-hibernating animals were anesthetized with an intraperitoneal injection of sodium pentobarbital (50 mg/kg). Hibernating animals were perfused under low temperature anesthesia. The carotid bodies of 20 chipmunks and 10 bats were subjected immunohistochemical investigation using specific antibodies against several neuropeptides. For fixation, these animals were perfused through the heart with cold 4% paraformaldehyde and
816
0.2% picric acid in 0.1M phosphate buffered saline (PBS, pH 7.4). The carotid bodies were removed and post-fixed over-night in the same fixative. Both paraffin-embedded sections ( thick) and frozen sections ( thick) were cut and then immunostained using the peroxidase-antiperoxidase technique, and observed with the aid of light microscopy.
2.2
Immunohistochemical procedure
After quenching endogenous peroxidase activity by incubating the sections with 0.3% sections were incubated with antibodies to either methionin-enkepharin(Met-Enk), glutamate, tyrosine hydroxylase (TH), vasoactive intestinal peptide (VIP) or acid (GABA) diluted (1:2,000) in a solution of 1% bovine serum albumin in 10 mM sodium phosphate buffered saline (pH 7.4) at room temperature for 1 day and then incubated with goat anti-rabbit IgG (l:200;Dako) in 10 mM PBS (pH 7.4) at room temperature for 2 h. They were then incubated with a rabbit peroxidase-antiperoxidase complex (l:200;Dako) in 10 mM PBS (pH 7.4) at room temperature for 2 h. Each incubation was carried out in a wet chamber. After each incubation, the sections were rinsed (3x10 min each) with l0mM PBS (pH 7.4). The bound peroxidase was visualized by incubating the sections with 0.05% 3,3’-diaminobenzidine tetrahydrochroride (Sigma, U.S.A.) in 50 mM Tris HC1 buffer (pH 7.5) containing 0.01 % , at room temperature for 10 min (Graham and Karnovsky (1966). The sections were dehydrated through a graded ethanol series (50%-100%), and then mounted in Peramount (Fisher, U.S.A.).
2.3
Electron microscopic observation
After perfusion, the carotid bodies were removed from the animals and then post-fixed for 1 h in 1 % osmium tetroxide, dehydrated in a graded ethanol (50%-100%), and then embedded Epon resin. After polymerization, semithin ( thick) sections were cut with glass knives on an LKB ultramicrotome and then stained with a hot aqueous solution of 0.5% toluidine blue. The center of the carotid body was selected by observing and photographing the sections with the aid of a light microscope with a camera attached. The selected sections were re-embedded and thin sections (60-80 nm) were cut with a diamond knife. These thin sections were collected onto copper grids (100 mesh), stained with saturated alcoholic uranyl acetate and lead citrate, and then observed with a JEOL 1200 EX electron microscope (Japan).
817
3.
RESULTS
3.1
Physiological aspects Blood gases were measured for only one animal, because the blood
flow of the other animals was too low to obtain enough blood for the measurement. The temperature-corrected arterial oxygen pressure of the chipmunk during hibernation was very low (119.4 mmHg) compared with the non-hibernation measurement (150 mmHg).
3.2
Changes in respiratory rate and heart rate during the course of arousal from hibernation
The lowest respiratory rates and the lowest heart rates were approximately 33 breaths/min and 42 beats/min at respectively increasing with Tb to give final values of 216 breaths/min and 420 beats/min at
respectively, within 40-45
min at an environmental
temperature of 10.0 °C.
3.3
Immunohistochemical aspects
TH-immunoreactivity in the carotid body of the chipmunks was localized in the glomus cells and in numerous nerve fibers. In hibernating
animals, many intense immunoreactive glomus cells were scattered all over the parenchyma of the carotid bodies (Fig. 1). The immunoreactive materials were found in the cytoplasm, but the nucleus was free from immunoreaction. There was a very large number of TH-immunoreactive nerve fibers with many varicosities in the carotid bodies of hibernating chipmunks. Met-Enk-immunoreactive glomus cells were distributed throughout the entire carotid body in both animals (chipmunks and bats). In hibernating animals, the glomus cells were larger than those of non-hibernating animals and immunoreactive materials filled the cytoplasm of these cells (Fig. 2). The numerous varicosities of the VIP-immunoreactive nerve fibers that are associated with blood vessels increased in number, extending into the carotid bodies of the hibernating animals. During hibernation,GABA-immunoreactive glomus cells were more intensely stained compared with those in the non-hibernating animals.
818
3.4
Electron microscopy aspects
The fine structure of the glomus cells of the bat carotid body was observed. An abundance of smooth surfaced and granular endoplasmic reticulum and various specific granules were scattered in the cytoplasm of the glomus cells.
819
4.
DISCUSSION
The respiration rate and heart rate of the hibernating animals were less than one-tenth of those of non-hibernating animals. In the process of transition from hibernation to arousal, the respiration and heart rates sometimes became irregular and sometimes rhythmic, and began to increase slowly and gradually, with repeating irregularity and rhythmicity of the vital signs. The respiratory rate increased linearly from 33 to 216 breaths/min, whereas the heart rate increased exponentially from 42 to 420 breaths/min within 40-45 min. A similar observation was reported for the western juming mouse during arousal from hibernation (Cranford, 1982) and for the Estruscan shrew rewarming from torpor (Fons et al., 1997). Approaching the level of arousal, Tb rose the animal shivering from time to time during this period, there was a characteristic prolongation of the interval of respiration when the heart beat interval was prolonged. The present study has shown that cytoplasmic volume in the glomus cells and the size of the varicosities of the nerve fibers in the carotid body during the hibernation was significantly increased, although enlargement of
the blood vessels was not observed as in the hypoxic carotid body (Kusakabe et al., 1998a,b). As demonstrated by the application of antisera against some peptides and amino acids, the resulting immunoreactivities were observed predominantly in the glomus cells and nerve fibers of the carotid bodies in the hibernating animals. The enlarged glomus cells showed intense immunoreactivity to almost all of the antibodies studied. These findings are similar to those described for the chronically hypoxic carotid body (Kusakabe et al., 1998a,b).
The results of previous studies have suggested that hypoxia induces functional changes in the carotid body and that these functional regulation are mediated by changes in neurotransmitter levels in the glomus cells (Wang et al., 1998). The present study has demonstrated that during hibernation there is a functional change in the enlarged glomus cells. Furthermore, the movement of intensely immunoreactive glomus cells into the carotid body during hibernation suggests that they are regulated by changes in the level of some peptides. The alteration in the size of varicosities in the nerve fibers that are associated with blood vessels is also suggestive of such a regulatory system. Since there are few reports on the presence of GABA in the carotid body, the role of GABA in this organ remains to be established (Oomichi et al., 1994). However, it is well known that GABA affects the actions of various other neurotransmitters. In the present study, we have shown that the abundance of GABA-immunoreactive materials in the glomus cells is increased in hibernating animals. This finding suggests that GABA has an
820
inhibitory effect on the secretion of peptides from the glomus cells. Levels of peptides such as TH, Met-Enk and VIP also increase during hibernation.
REFERENCES C r a n f o r d , J. A. 1983, Body temperature, heart rate and oxygen consumption of normothermic and heterothermic western jumping mice (Zapus princeps). Comp Biochem. Physiol. 74, 595- 599.
Dark, J.. K i l d u f f , T. S., Heller, H., Licht, P. and Zucker,I. 1990, Suprachiasmatic nuclei influence hibernation rhythmus of golden- mantled ground squirrels. Brain Res.509, 111-118. Fons, R., Sender, S., Peters, T. and Jurgens, K. D. 1997, Rates of rewarming, heart and respiratory rates and their significance for oxygen transport during arousal from torpor in the smallest mammal, the etruscan shrew Suncus etruscus. J. Exp. Biol. 200, 1451-1458. Graham, R.C. and Karnovsky, M.J. 1966, The early stages of injected horseradish peroxidase in the proximal tubules on mouse kidney: Ultrastructural cytochemistry by a new technique. J. Histochem. Cytochem., 14, 291-302. Kobayashi, S. Uchida, T., Ohhashi, T., Fujita, T., Nakao, K., Yoshimasa, T., Mochizuki, T., Yanaihara, N. and Verhofstad, A. J. 1983, Immunocytochemical demonstration of the co-storage of noradrenaline with met-enkephaline-arg6-phe7and met-enkephalinearg6-gly7leu 8 in the carotid body chief cells of the dog. Arch. Histol. Jap. 46, 713-722. Kusakabe, T., Anglade, P. and Tsuji, S. 1991, Localization of substance P, CGPR, VIP, neuroptide Y, and somatosutatin immunoreactive nerve fibers in the carotid labyrinths of some amphibian species. Histochemistry 96, 255-260. Kusakabe, T. Matsuda, H., Harada, Y., Hayashida, Y., Gono, Y., Kawakami,. T. and Takenaka, T. 1998a, Changes in the distribution of nitric oxide synthase immunoreactive
nerve fibers in the chronically hypoxic rat carotid body. Brain Res. 795,292-296. Kusakabe, T., Hayashida, Y., Matsuds, H., Gono, Y., Powell, F.L., Ellisman, M.H., Kawakami, T. and Takenaka, T. 1998b, Hypoxic adaptation of the peptidergic innervation
in the rat carotid body. Brain Res. 806, 165-174. Nurnberger, F. 1995, The neuroendocrine system in hibernating mammals: present knowledge and open questions. Cell Tissue Res. 281,391-412. Oomori, Y., Nakaya, K., Tanaka, H., luchi H., Ishikawa, K., Sato, Y. and Ono, K. 1994, immunohistochemical and histochemical evidence for the presence of noradrenaline, serotonin and gamma-aminobutyric acid in chief cells of the mouse carotid body. Cell
Tissue Res. 278, 249-254.
Ponect, L., Denoroy, L., Darmaz, Y., Pequignot, J-M and Jouvet, M. 1994, Chronic hypoxia
affects peripheral and central vasoactivc intestinal peptide-like immunoreactivity in the rat. Neurosci. Lett. 176, 1-4. Wang, Z.-Z., Dinger, B., Fidon. S. J. and Stensaas, L. J. 1998, Changes in tyrosine
hydroxylase and substance P immunoreactivity in the cat carotid body following chronic hypoxia and denervation. Neuroscience 83, 1273-1281.
Wharton, J., Polak, J. M., Pearse, A. G. E., McGregor, G. P., Bryant, M.
Emson, P. C., Bisgard, G. E. and Will, J. A.
G., Bloom, S. R.,
1980, Enkephalin-, VIP- and substance
P-like immunoreactivity in the carotid body. Nature 284, 269-271.
821
This page intentionally left blank.
NEUROCHEMICAL REORGANIZATION OF CHEMOREFLEX PATHWAY AFTER CAROTID BODY DENERVATION IN RATS J.C. R OUX , J. P EYRONNET , O. P ASCUAL , Y. D A L M A Z
AND
J.M PEQUIGNOT
Laboratoire de Physiologie des Régulations Métaboliques, Cellulaires et Moléculaires, UMR
CNRS 5578, Faculté de Médecine, 8 avenue Rockefeller, 69 373 Lyon cedex 08, France
1.
INTRODUCTION
Rat carotid bodies are generally considered as the main component initiating the hypoxic ventilatory response (HVR). Bilateral transection of the carotid sinus nerve (CSNT) abolishes HVR (Sapru & Krieger, 1977). However studies have shown that the immediate loss of HVR is followed by a progressive restoration of HVR within the following weeks (Martin-Body et al. 1985; Martin-Body et al. 1986). Although the mechanism involved in HVR recovery is still unclear, neuroanatomical studies by Majumdar et al (1983) provided evidence that in cat initial degeneration of the central carotid sinus nerve terminals was followed by a renewed central sprouting in nucleus tractus solitarius (NTS). Rat afferent chemosensory fibres project to discrete areas of the medulla oblongata, mainly to the caudal part of the NTS (Housley et al. 1987, Finley & Katz, 1992). It is worthnoting that the dorsal respiratory groups is closely associated with catecholaminergic neurones which belong to the cell group. There is growing evidence that medullary catecholaminergic neurones participate in the chemoreflex responses to systemic hypoxia (Guyenet et al. 1993; Bianchi et al. 1995). The and cells are excited by hypoxic stimulation of peripheral chemoreceptors and are involved in central respiratory modulation (Coles & Dick, 1996, Guyenet et al. 1993). However, to date there is no evidence that the neural activity of central structures involved in respiratory regulation is affected by chemosensory recovery following CSNT. We defined if the HVR recovery following irreversible bilateral carotid sinus nerve transection (CSNT), was associated with changes in neurochemical activity of medullary catecholaminergic cell groups implicated in chemoreflex pathway.
Oxygen Sensing: Molecule to Man, edited by S. Lahiri et al. Kluwer Academic/Plenum Publishers, 2000
823
2.
METHODS
Experiments were performed on male Sprague-Dawley rats (240260g, IFFA CREDO, France). All animals were anesthetized by intraperitoneal Avertin (1ml/l00g body weight of 1.4% tribromoethanol) injection. The first group (sham, ) was operated but not chemodenervated. The second group was subjected to CSNT The two carotid sinus nerves were transected at the point of branching from the glossopharyngeal nerve and at the cranial pole of the carotid body. Ventilation was measured in awake unrestrained rats 2 days, 6 days, 10 days and 45 days, respectively after chemodenervation using barometric plethysmographs described by Bartlett & Tenney (1970).Temperature, and levels inside the animal chamber were continuously monitored. The inlet and outlet tubes of the animal chamber were closed and pressure fluctuations related to breathing were recorded with a differential pressure transducer (Celesco, California). When the rat was quiet, minute ventilation was calculated from breath-by-breath by computer, analysis of the spirogram was expressed in ml The hypoxic test (10% and 90% ) was performed one minute after the 10 % level was reached inside the chamber. HVR is calculated as the difference between values of the first minute of hypoxia compared normoxia. TH activity can be used as a marker of the rate of catecholamine synthesis. In vivo TH activity was estimated by measuring L-DOPA accumulation after inhibition of L-ammo acid decarboxylase by NSD 1015 (3-hydroxybenzylhydrazine dichloride: Sigma) (Carlsson et al. 1972). NSD 1015 was injected intraperitoneally (100 mg of body weight) 10 min before sacrifice. TH activity was expressed in picomoles of L-DOPA formed in 10 mm and per pair of structures. Two different groups of rats were sacrificed by cervical dislocation at 15 or 90 days after the CSNT. The brain was rapidly removed, frozen (-80 °C) and cut into serial coronal slices 480 µm thickness. The noradrenergic cell groups the cluster of noradrenergic and adrenergic cell groups (caudal subset) and (rostral subset) were punched out (diameter of the needle 0.7 mm) according to the dissection procedure described by Palkovits & Brownstein (1988).
3.
RESULTS
3.1
Hypoxic Ventilatory Response Recovery
HVR was strongly reduced in the CSNT rats 2 days after the surgery (Tab. 1). Thereafter a gradual HVR recovery was observed within the weeks following the surgery. At 1 minute of the hypoxic exposure, the CSNT rats
824
exhibited a lesser HVR compared to sham, -64% after 2 days, -37% after 6 days, and -27% after 10 days following surgery. At 45 days the CSNT rats recovered the same HVR level than the shams. Moreover, the CSNT rats displayed an increase of HVR between 2 and 45 days (+101%) following chemodenervation.
3.2
Neurochemical Reorganization
CSNT elicited a decrease in TH activity in the (-35%) and A6 (-35%) brainstem cell groups 15 days after surgery (Figure. 1). After 90 days, the CSNT group displayed a higher TH activity in (+129%), A 5 (+216%), and (+79%) cell groups compared to sham levels. No difference between the CSNT and sham rats was observed in at each age after surgery. 4.
DISCUSSION
Two days after surgery, a strong reduction of HVR was observed in CSNT rats. This result is in agreement with previous studies (Sapru & Krieger, 1977; Cardenas & Zapata, 1983) showing that the carotid bodies are the main peripheral chemoreceptors in the rat. The CSNT rats recovered a similar HVR to the sham rats within 45 days following surgery as previously observed by Martin-Body et al.(1985). To measure TH activity we chose two time points, the early one 15 days after CSNT, and 90 days after CSNT, i.e., after complete HVR recovery and putative central reorganization. Fifteen days after surgery, CSNT produced a decrease in and brainstem cell groups. A reduced TH activity in could be due to degeneration of the carotid sinus nerve terminals as seen in the cat after carotid body denervation (Majumdar et al. 1983). (Locus ) involved in arousal and behavioural activity is 825
known to be affected by environmental modifications (Valentino et al 1993)
and its connections with the NTS may explain the decrease of TH activity. In contrast, 90 days after surgery the ventilatory restoration was associated with an increased TH activity in the cell groups of the CSNT rats.
The short- to long-term evolution of TH activity after CSNT can be considered as a neuronal marker of central reorganization leading to the HVR recovery for at least three reasons: i/ the TH changes are restricted to
medullary cell groups involved in the chemoreflex pathway, i.e., 826
subset, and (Guyenet et al 1993; Schmitt et al. 1994). Worthnoting is the lack of TH alteration in subset (rostral dorsomedial medulla), catecholaminergic areas involved in central integration of barosentive inputs or control of sympathetic baroreflex responses, ii/ noradrenaline in the caudal dorsomedial medulla and caudal ventrolateral medulla has been recognized to play an inhibitory role in the neuromodulation of ventilatory control and chemoreflex pathway (Bianchi et al. 1995), iii/ reverse changes in catecholaminergic neuronal activity were observed in CSNT rats before and after HVR restoration: a level of TH activity lower than in sham was associated with the early period of ventilatory recovery, whereas a high TH activity was a feature of CSNT rats after ventilatory restoration. In summary, the present data indicate a progressive and profound reorganization of the HVR pattern after irreversible interruption of the carotid sinus afferent pathway, which was associated with changes in the neurochemical activity of medullary catecholaminergic cell groups involved in the chemoreceptor pathway. ACKNOWLEDGEMENTS This study was supported by CNRS (UMR CNRS 5578) and by Région Rhône-Alpes (grant “Souffrance et Maturation neuronale”). J.C. Roux held a fellowship from the Région Rhône-Alpes. We gratefully acknowledge Jerome Zobel for his technical assistance. REFERENCES Bartlett, D.,Jr. & Tenney, S. M, 1970, Control of breathing in experimental anaemia. Respiration Physiology 10, 384-395. Bianchi, A. L., Denavit-Saubie, M. & Champagnat, J., 1995, Central control of breathing in mammals: neuronal circuitry, membrane properties, and neurotransmitters. Physiological Reviews. 75, 1-45. Cardenas, H. & Zapata, P., 1983, Ventilatory reflexes originated from carotid and extracarotid chemoreceptors in rats. American Journal of Physiology. 244, R119-25. Carlsson, A., Davis, J. N., Kehr, W., Lindqvist, M. & Atack, C. V., 1972, Simultaneous measurement of tyrosine and tryptophan hydroxylase activities in brain in vivo using an i n h i b i t o r of the aromatic amino acid decarboxylase. Naunyn-Schmiedebergs Archives Of Pharmacology. 275, 153-168. Coles, S. K. & Dick, T. E., 1996, Neurones in the ventrolateral pons are required for posthypoxic frequency decline in rats. Journal of Physiology. 497, 79-94. Finley, J. C. & Katz, D. M., 1992, The central organisation of carotid body afferent projections to the brainstem of the rat. Brain Research. 572, 108-116. Guyenet, P. G., Koshiya, N., Huangfu, D., Verberne, A. J. & Riley, T. A., 1993, Central respiratory control of A5 and A6 pontine noradrenergic neurons. American Journal of Physiology. 264, R1035-44.
827
Housley, G. D., Martin-Body, R. L, Dawson, N. J. & Sinclair, J. D., 1987, Brain stem projections of the glossopharyngeal nerve and its carotid sinus branch in the rat. Neuroscience 22, 237-250. Majumdar, S., Mills, E. & Smith, P. G., 1983, Degenerative and regenerative changes in central projections of glossopharyngeal and vagal sensory neurons after peripheral axotomy in cats: a structural basis for central reorganization of arterial chemoreflex pathways. Neuroscience 10, 841-849.
Martin-Body, R. L., Robson, G. J. & Sinclair, J. D., 1985, Respiratory effects of sectioning the
carotid sinus glossopharyngeal and abdominal vagal nerves in the awake rat. Journal of Physiology. 361, 35-45. Martin-Body, R. L., Robson, G. J. & Sinclair, J. D., 1986, Restoration of hypoxic respiratory
responses in the awake rat after carotid body denervation by sinus nerve section. Journal of Physiology. 380, 61-73. Palkovits M. & Brownstein M.J., 1988, Maps and Guide to Microdissection of the Rat Brain. Amsterdam: Elsevier.
Sapru, H. N. & Krieger, A. J., 1977, Carotid and aortic chemoreceptor function in the rat. Journal of Applied Physiology. 42, 344-348.
Schmitt, P., Soulier, V., Pequignot, J. M., Pujol, J. F. & Denavit-Saubie, M., 1994, Ventilatory
acclimatization to chronic hypoxia: relationship to noradrenaline metabolism in the rat solitary complex. Journal of Physiology. 477, 331-337.
Valentino, R. J., Foote, S. L. & Page, M. E., 1993, The locus coeruleus as a site for integrating
corticotropin-releasing factor and noradrenergic mediation of stress responses. Annals Of The New York Academy Of Sciences. 697, I 73-188.
828
SUBJECT INDEX Acetylcholine Release from carotid body, normoxia and hypoxia, 490 Interaction with dopamine in carotid body, 499 Acid-influx
Carotid body
pH 7.45, 724, 727, 728
HEPES buffer, pH 7.4, 724, 728 Adenosine-dopamine Domperidone, 677 DPSPX, 676 Ventilation, 678, 680
Adenosine receptor genes, mRNA Carotid body, 552 Dopamine, 552, 557 Hybridization signal, petrosal ganglion, 552, 554 Tyrosine hydroxylase mRNA, 551, 557 Adrenal chromaffin cells Amperometry, 603 Developmental, K- current 608, 604
sensitivity, 602 electrode, 603
Outward current density, 605 Airway chemoreceptors 614 H 146 cells, 613, 615 HEPES, pH 7.4, 612 Hypoxia, 612, 618 Inward currents, 614 Membrane potential, 618 NEB, 612 Outward currents, 614 TEA, 4-AP, quinidine, 616 TTX, 614
Voltage-gated ion channels, 612 Aortic body Phenyldiguanide, 791 Reflex effects, 791 Apoptosis Cardiac cells, 161 Chronic hypoxia, 162 Ischemia, repetitive, 163 Glocolytic enzymes, 163, 164 HIF-1 regulation, 165 Redox dependence, 168
Brain, mouse Central chemoreceptors, 787
829
pH sensitivity, 786
Carotid body
Adenosine receptor, 407 Adenosine sensitivity, 408 current, 590, 591 400
block of
effects, 401
HEPES, 595
Cytochrome c oxidase, 397 Denervation, 823 Glomus cells, 589 channels in neurons, 443-450 channel, 421-423; effect of pH, 447; effect of ATP, 448 Mechanical stimulation, 417 Metabolic hypothesis, 397 Neurochemicals, 825, 827 Oxygen free radicals, 425
Phosphatase, 597 Ventilatory response, 824 Recovery, 824
Carotid chemoreceptors Brain glucose, 753, 754, 756
NaCN, hyperglycemia, 755 NTS and vasopressin, 756
Catecholamines, rundown Chromatography, 736 Hypoxia, hyperoxia, 740 L-DOPA, 739
Chemoreception
Glomus cells vs. nerve terminals, 355 Immunocytochemistry, 627, 797
Chronic hypoxia Carotid body, 625, 795, 796, 797 Carotid sinus nerve stimulation, 481 Deacclimatizations, 794 Dopamine receptor in nucleus tractus solitarius, 481-482 Effect of dopamine receptor blockade on ventilation, 480 SP, CGRP, VIP, NPN, 627 Immunocytochemistry, 627
Communication
Effects of hypoxia, hypercapnia and acidity, 354
Chemical, 354
Coupling between glomus cells, 352
Coupling between glomus cells and nerve terminal, 352 Electrical, 354 Gap junction, 353 In vitro clusters, 352 In vivo clusters, 352
830
CO sensing, 17, 18, 685 Cytochromes
372
Cytochrome c oxidase, 337, 343, 642 Cytochrome P-450, 648, 649 Hypoxic effects on Hep 3b and PC 12 cells, 374
Inhibition of channel, 646 Measurement done with DHR and DCFDA, 372, 373 NADPH oxidase, 372, 646 Reductants, GSH, DTT, 647, 651 Redox-based, 648, 651 ROS production under hypoxia, 372 TH-gene transcription under hypoxia, 373 Dopamine Chemoreceptor, 507 CSN, 583, 585, 449 Immunocytochemistry, 507 Neuropeptide, 507
Neutral endopeptidase, 508, 510 Serotonin receptor, 581, 587 Substance P, 508 Tyrosine hydroxylase, 507
Dopamine-NEP interaction CAMP, 518 CSN, 518, 521
Edonthelin, 517
Inositol phosphate, 518
Endogenous CO, 685 Endogenous NO
Metabolic model, 346 NOS inhibitor, 338 Increased CSN discharge, 341
Increased uptake, 343 Decreased CSN discharge, 342
Endopeptidase
Carotid body, 706, 708 CSN discharge augmentation, 707, 709, 711
Hypoxic response, 706 Met-Enk, 706 Phosphorylation, 710 SP, SP-receptor, 705, 706 Endothelium of brain capillaries channels, 437 Hypoxia, 437
channels, 438
831
Evolution Hypoxia tolerance, 26 Diving physiology, 26 conservative character, 28 Brain and heart, 28, 29
High altitude, 30 Performance and tolerance, 30, 33 Phylogenetic tree, 34 Molecular evolution, 36, 37 Exercise in humans ATP, ADP, PCR, 774,775
Cellular
780
Diffusional conductance, 779 Near-IRS, 774 NMR, 773, 775, 776 780
Gap junctions Connexin 43, 366
c-AMP effects
Increased electrical coupling, 361, 362, 365 Regulatory features, 360
Structural features, 360
Synaptic blocker, 349, 354
Glomus Cell 718, 719, 722
Calcium, 691,743, 655, 657
Caffeine effects, 744
Calcium store, 721 CSN, 657
CSN response, 718, 719
DNP, 657 Hypoxia effects, 694, 745, 747 NaCN, Ach, high 692, 744 Tyramine, 743, 745, 747
HERG-like, 241, 247 [Ca2+]i, 242,243, 246 Delayed rectifier-like K + currents, 243
Dofetilide (DOF), 241,244 Ether-a-gogo-related gene, 242, 245
Glomus cells, 241 HERG-like (HL), 241, 242,243, 244, 245, 246, 247 Intracellular Ca2+, 242
Isolated glomus cells, 242 K+ current, 241, 242, 244, 245, 246 Resting membrane potential in glomus cells, 247
Reactive oxygen species (ROS), 247 RMP, 241 SIDS, 247
832
HIF-1 ARNT, 275, 276, 278, 279,280, 281
chimeric animals, 279,280 colony forming units (CPU), 276, 277, 278, 279, 281 erythrocyte (E), 276, 278 279
glucose transporters, 275 granulocyte erythrocyte megakaryocyte macrophage, 276 granulocyte macrophage (GM), 276, 278 hematopoietic consequences, 275 hematopoietic progenitors, 276, 277, 278, 279, 280,282 HIF-1, 275, 276, 281, 282 HIF-1, 275 macrophage (M), 276, 278
transferrin, 275
VEGF, 275, 276,281, 282
HIF-1a ARNT expression, 89, 90
HIF-1a expression, 92
Immunofluorescence, 93, 94 Nuclear compartment, 92
High altitude adaptation Duration, 46 Palconotgenic, 46 Linguistic, 46 Genetic, 47 Geographic, 47 Ventilation, 48, 50
Pulmonary arterial pressure, 49, 51 Chronic mountain sickness, 52 Intrauterine oxygenation, 52 Birth weight, 54, 55 Neonatal oxygenation, 57 Humans Carotid body, 664 Hyperoxia, 666 Hypoxia, 666
Ventilation, 668
Hybernation
Body temperature, 820 Carotid body, 816
Electron microscopy, 817, 819
Glomus cell volume, 820 Immunohistochemistry, 817, 818 Hyperbaric helium Effect on neuron firing rate, 471-474
833
Hyperbaric Effect on neuron firing rate, 472-474 Hyperoxia C-fos and AP-1, 104 PC 12 cells, 103 ERK and p38, 105
Ras and Src, 106
Voltage-gated CaMK, 107
channel, 107
CREB, 107 Hypoxia
Cardiac
DTT, 212, 213, 214 HEK 293, 210, 211, 212,213
Human cardiac L-type Ca2+, 209 K+ channels, 209, 212,216 L-type Ca2+ channels, 209, 212, 213, 217
Methanethiosulphonate (MTS), 212 MTSEA, 212, 213, 214, 215, 217
Na+ channels PCMBS, 212, 214, 215, 217 Thiol groups, 212
Type I cells, 209 Vascular smooth muscle Ca2+, 209 Continuous, 632 CREB, 631,634
CREB phosphorylation, 147, 150 CREB regulation, 143, 145
Embryogenesis, 124 Episodic, 632 EPO, mRNA, 116
Gene regulation, 131
Genomic model, mouse, 77 HACK, 151 HIF-1, 123
Induction, 111 Model, 146
Overexpression, 127 PC12 cells, 132, 143, 144 Membrane depolarization, 133 Cytosolic 134, 135 Adenosine, 140 Pulmonary hypertension, 125 Regulation of mRNA, 111 TH gene, 132 TH, mRNA stability, 114 Tidal volume, frequency response, 79, 80, 82 VEGF, 126 VEGF, mRNA stability, 112
Ventilatory response, 75
834
Intracellular pH Chemosensitive/non chemosensitivc neurons, 460-462 Effect of anoxia: neurons, 456-462 Na/H exchange, 457-462 Knock-out Mouse CSN, 699, 701 Hypoxic, 700
Mechanisms
acute responses, 304, 309 ATP, 303, 304, 305, 306
chemoreceptor cells, 306 chronic responses, 305, 309
cytochrome c oxidase, 308 FixJ, 306 FixL, 306 hemoproteins, 306 HERG K+ channels
HIF-1, 305, 306, 307, 308
K+ channel activity, 305, 308 mitochondrial DNA, 308 mitochondrial electron transport chain (ETC), 308 mRNA, 306 NADPH, 307, 308
neuroepithelial body cells, 308 O2 homeostasis, 303, 304 O2-sensitive K+ channels, 305, 306
oxidative phosphorylation, 303 oxygen sensitive cells, 305 PAS, 307
PO2, 305 ROS 308 Somatic cell genetics, 309
Mitogen-and Stress-Activated
cardiac myocytes, 298 catecholaminergic, 294 c-fos, 294 c-Jun N-terminal kinase (JNK), 297, 298 CREB, 294
dopamine, 294 in vitro, 294
ischemia, 297, 298
MAPK, 293, 294, 298, 300, 301 mRNA, 294
norepinephrine, 294 O2 sensitive cell, 294
p38 family, 293, 295, 297, 301 p38, 293, 296, 297, 299, 300 PC12 cells, 293, 294, 295, 296, 297, 298, 299, 301 SAPK, 293, 294, 301
835
Nerve traffic to carotid body Muscarinic receptors, 487-489 Nicotinic receptors, 487-489
Nitric Oxide Genes
AP-1, 285, 287, 289, 291
Catecholamine synthesis, 285 Catecholamines, 289
c-fos, 285, 286, 287, 288, 289, 290, 291 HIF-1, 285, 289, 290
Immediate early gene, 285, 286 Late response genes (LRGS) mRNA’s, 287, 288, 289, 291
Nitric oxide (NO), 285, 286, 287, 289, 291 NOS, 286
PC12 cells, 285, 288, 289
Spermine nitric oxide (SNO), 285, 287. 288, 290 SRE cis-elements, 290, 291 tyrosine hydroxylase (TH), 285, 286, 287, 288, 289 VEGF, 286
NO
CSN inhibition, 762 NOS mutant mice, 571, 578
Peripheral chemoreceptor, 573, 576 Petrosal ganglion, 766 Ach stimulation, 766, 767 Respiration, 574, 575 NO-CO interaction
Carotid body, 655
Chronic hypoxia, 688 HO-1,687
NO sensing
Decreased CSN discharge, 340 Decreased tone of blood vessels, 338 Increased cGMP, 338 Inhibition L-type channels, 338 Inhibited uptake during hypoxia, 337, 338
Sensing PC-12 cells
529, 531 Carbon fiber microelectrodes, 528 Exocytosis, 530
Hypoxia, 535 pHo efect, 532 channels, 534 Inhibition by acid, 534 Hypoxia, 535 Vascular resistance, 545 Ventilation, 546
836
Petrosal ganglion
Acetylcholine sensitivity, 372, 381 Cholinergic, 392 Cyanide, 392 Dopaminergic, 393 Effects of acetylcholine on discharge, 500 Effects of dopamine on discharge, 501 Hypoxia, 391 Nitroxidergic, 394 Patch-clamp, 384
Plasticity and multiplicity CO-effects, 17, 18 Cytochrome c oxidase, 18 Dopamine release, not effected by light, 20 Action spectra, 17, 18
Developmental, 13 Environmental, 14 Hypoxia, 15
Hyperoxia, 15 Blunted response, 15 Reversal, 15 Carotid body, 15, 16, 19 Yeast, 16, 18, 19 Postnatal
Heart rate, 544, 546 Hb 543
Hypoxia, 540, 543 Left ventricular function, 544, 546
Pulmonary 4-aminopyridine (4-AP), 219 4-AP, 226, 227 ATP, 230, 231 [Ca2+]I, 221 Ca2+ channels, 219, 220
Carotid and aortic bodies, 222
CGD mice, 233 Charybdotoxin (CTX), 226,227
Cytochrome P-450,231 224, 226,227,229
Endothelin receptors, 220 Energy depletion, 230 Glyburide, 226 Gp9Iphox, 232
HPV, 220, 221, 223, 224, 226, 230, 231
Hypoxic pulmonary vasoconstriction (HPV), 219 K+ channels 219, 220, 221, 222, 224, 226, 228, 230
channels, 221 Kv Channels, 219, 220, 222, 224, 226, 229, 231 Kvl.5, 229 Kv2.1, 229
NADPH oxidase, 220
Mitochondrial O2-sonsor, 233
837
NADPH oxidase, 231, 232 P22phox, 232 P47phox 232 P67phox, 232 Nitric oxide synthase (NOS), 220 O2-responsive K+ channels, 222 Quinine, 226, 227 Redox based sensors in PASMCs, 225 Redox modulation, 230 Reducing agents, 230 Shab family, 229 Shaker family, 229 TEA, 270 Xenopus oocytes, 265, 272 ROS
Hep 3B cells, 154 VEGF, EPO, heme oxygenase, 153, 155, 157 HlF-1, 153 Signal, 154 155 Cytochrome 156 NADPH oxidase, 155 Serotonin Hypoxia, acclimatization, 559, 568 Ketanserin, 562 Methyergide, 563 Ventilation, 559, 565 Sigh reflex Carotid body, denervation, 804 Response to hypoxia, hypercapnia, 807 Tibetan and Andean Ventilation, resting, 65 Hypoxic response, 66-68 Oxygen saturation, 68 Hemoglobin concentration, 70 Functional consequences. 72, 73 Tissue absorption spectra, 261 afferent activity, 259, 262 atmungsferment, 261 carbon monoxide (CO), 260, 261, 262, 263 carotid body, 259, 260, 262, 263 cytochrome a3, 261, 263 heme oxidase, 261 metabolic hypothesis, 260 mitochondrial oxidative phosphorylation, 259, 260 oxygen sensor, 259, 260, 263 photochemical action spectra, 261, 262
838
637,638 AMP, ADP, ATP, 642 EF5, 639
Intracellular, carotid body, 638 L-NAME, 641 Phosphorescence quenching, 638
Torrance, Bob
Arterial Chemoreceptors, 2 Aspinwall, Margaret, 4 Fitzgerald, Mabel, 5 Haldane Centenary Symposium, 1 Hanson, Mark, 9 Kumar, Prem, 9 Michele, C.C., 1 Oxford University, 1 Prolegomena, 2 St. John’s College, 1
Torrance, Margaret, 2 Wates Foundation Symposium
Zapata, Patricio & Carolina, 7 Yeast
Aerobic genes, 183 Aerobiosis, 199
CAMP-dependent protein kinase, 198 Carbon metabolism, 198 Carbon source, 198
Crosstalk, 177, 179 Cytochrome c, 197, 206 Cytochrome c oxidase, 179, 197, 206 Heme precursor coproporphyrinogen III, 199 Heme l3, 206 Hemoprotein O2 sensor, 205 High molecular weight complex (HMC), 204 Hypoxic genes, 179-189
Metabolic regulation, 311, 316
Mitochondrial-nuclear, 179, 181 signal transduction, 319, 322 Oxygen-regulated, 178 Oxygen sensing, 177, 179
Phosphagen research, 312, 314 Redox, 205 Repression Heme regulation, 186 Oxygen dependent, 185 RNA polymerase II, 198 ROX1, 199, 202, 203, 205
Trans-acting factors that regulate gene expression, 199
Ubiquinole-cytochrome c reductase (complex III), 205 Upstream activation sequence, 203
839