Mussels: Anatomy, Habitat and Environmental Impact (Fish, Fishing and Fisheries)

FISH, FISHING AND FISHERIES

MUSSELS: ANATOMY, HABITAT AND ENVIRONMENTAL IMPACT No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in rendering legal, medical or any other professional services.

FISH, FISHING AND FISHERIES Additional books in this series can be found on Nova‘s website under the Series tab.

Additional E-books in this series can be found on Nova‘s website under the E-books tab.

FISH, FISHING AND FISHERIES

MUSSELS: ANATOMY, HABITAT AND ENVIRONMENTAL IMPACT

LAUREN E. MCGEVIN EDITOR

Nova Science Publishers, Inc. New York

Copyright ©2011 by Nova Science Publishers, Inc. All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical photocopying, recording or otherwise without the written permission of the Publisher. For permission to use material from this book please contact us: Telephone 631-231-7269; Fax 631-231-8175 Web Site: http://www.novapublishers.com NOTICE TO THE READER The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained in this book. The Publisher shall not be liable for any special, consequential, or exemplary damages resulting, in whole or in part, from the readers‘ use of, or reliance upon, this material. Any parts of this book based on government reports are so indicated and copyright is claimed for those parts to the extent applicable to compilations of such works. Independent verification should be sought for any data, advice or recommendations contained in this book. In addition, no responsibility is assumed by the publisher for any injury and/or damage to persons or property arising from any methods, products, instructions, ideas or otherwise contained in this publication. This publication is designed to provide accurate and authoritative information with regard to the subject matter covered herein. It is sold with the clear understanding that the Publisher is not engaged in rendering legal or any other professional services. If legal or any other expert assistance is required, the services of a competent person should be sought. FROM A DECLARATION OF PARTICIPANTS JOINTLY ADOPTED BY A COMMITTEE OF THE AMERICAN BAR ASSOCIATION AND A COMMITTEE OF PUBLISHERS. Additional color graphics may be available in the e-book version of this book. LIBRARY OF CONGRESS CATALOGING-IN-PUBLICATION DATA Mussels : anatomy, habitat and environmental impact / editor, Lauren E. McGevin. p. cm. Includes index. ISBN 978-1-61122-149-7 (eBook) 1. Mussels. 2. Mussels--Effect of water pollution on. 3. Indicators (Biology) I. McGevin, Lauren E. QL430.6.M876 2010 594'.4--dc22 2010036147

Published by Nova Science Publishers, Inc.  New York

CONTENTS Preface Chapter 1

Chapter 2

Chapter 3

Chapter 4

Chapter 5

ix Inter-Site Differences and Seasonal Patterns of Fatty Acid Profiles in Green-Lipped Mussels Perna Viridis in A Subtropical Eutrophic Harbour and Its Vicinity S. G. Cheung and P. K. S. Shin Environmental Impact of Anthropogenic Activities: The Use of Mussels as a Reliable Tool for Monitoring Marine Pollution Stefanos Dailianis The Experience of the Mussel Sector in Galicia: The Natural, Institutional and Economic Environment Gonzalo Caballero-Miguez, Manuel Varela-Lafuente and Marcos Pérez-Pérez Translational Control of Gene Expression in the Mussel Mytilus Galloprovincialis: The Impact of Cellular Stress on Protein Synthesis, the Ribosomal Stalk and the Protein Kinase CK2 Activity S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou, R. M. Kolaiti, A. Baier and R. Szyszka MAP Kinase Signaling Pathway: A Potential Biomarker of Environmental Pollution in the Mussel Mytilus Galloprovincialis A. Châtel and B. Hamer

Chapter 6

Mussel Glue and Its Prospects in Biotechnology Veronika Hahn and Annett Mikolasch

Chapter 7

Molecular Determinants in Mussels as Biomarkers for Environmental Stress Sutin Kingtong and Tavan Janvilisri

1

43

73

97

129 145

173

vi

Contents

Chapter 8

Integrated Impact Assessment of Mussels Health Jocelyne Hellou and François Gagné

Chapter 9

Ecotoxicological Genetic Studies on the GreenLipped Mussel Perna Viridis in Malaysia C. K. Yap and S.G. Tan

Chapter 10

Environmental Impact to Mussels‘ Metabolism Jordan T. Nechev

Chapter 11

Combining Stable Isotopes and Biochemical Markers to Assess Organic Contamination in Transplanted Mussels Mytilus Galloprovincialis S. Deudero, A. Box, A. Sureda, J. Tintoré and S. Tejada

Chapter 12

Environmental Impact Assessment of Mussels Caught in Mediterranean Sea, Italy Monia Perugini and Pierina Visciano

Chapter 13

Competition for Space and Food Among Blue Mussels Daisuke Kitazawa

Chapter 14

Production and Shelf Life of Mussel Meat Powder Flavor Vanessa Martins da Silva, Kil Jin Park and Míriam Dupas Hubinger

197

221 245

263

285 303

337

Chapter 15

Life Cycle Assessment of Mussel Culture Diego Iribarren María Teresa Moreira and Gumersindo Feijoo

Chapter 16

Mussels as a Tool in Metal Pollution Biomonitoring – Current Status and Perspectives Joanna Przytarska and Adam Sokołowski

379

Sclerochronology – Mussels as Bookkeepers of Aquatic Environment Samuli Helama

395

Chapter 17

Chapter 18

Chapter 19

Marine Biotoxins and Blue Mussel: One of the Most Troublesome Species During Harmful Algal Blooms Paulo Vale Immunotoxicity of Environmental Chemicals in the Pearl Forming Mussel of India- A Review Sajal Ray, Mitali Ray, Sudipta Chakraborty and Suman Mukherjee

357

413

429

Contents Chapter 20

Chapter 21

Anticoagulant and Carbohydrate Induced Interference of Aggregation of Mussel Haemocyte Under Azadirachtin Exposure Suman Mukherjee, Mitali Ray and Sajal Ray The Origin of Populations of Dreissena Polymorpha Near the North-Eastern Boundary of Its Distribution Area I. S. Voroshilova, V. S. Artamonova and V. N. Yakovlev

vii

441

453

Chapter 22

Unionidae Freshwater Mussel Anatomy Diana Badiu, Rafael Luque and Ovidiu Teren

469

Chapter 23

The Cytogenetics of Mytilus Mussels Andrés Martínez-Lage and Ana M. González-Tizón

485

Chapter 24

A New Approach in Biomonitoring Freshwater Ecosystems Based on the Genetic Status of the Bioindicator Dreissena Polymorpha Godila Thomas, Göran I. V. Klobučar, Alfred Seitz and Eva Maria Griebeler

Chapter 25 Index

Mussels: Their Common Enemies and Adaptive Defenses Devapriya Chattopadhyay

495

503 521

PREFACE The common name mussel is used for members of several families of clams or bivalvia mollusca, from saltwater and freshwater habitats. These groups have in common a shell whose outline is elongated and asymmetrical compared with other edible clams, which are often more or less rounded or oval. This book presents current research in the study of mussels and their anatomy, habitat and their environmental impact. Some of the topics discussed herein include the use of mussels as a reliable tool for monitoring marine pollution; mussel glue and its use in biotechnology; environmental impact to mussels' metabolism; the competition for space and food among Blue Mussels; the life cycle assessment of mussel culture; Unionidae freshwater mussel anatomy; and the cytogenics of Mytilus mussels. Chapter 1 - Fatty acid profiles of total particulate matters (TPMs) in water and greenlipped mussels Perna viridis were studied for one year in the eutrophic Victoria Harbour, Hong Kong and its vicinity. Bimonthly sampling of TPMs and P. viridis were conducted at four sites inside the harbour, namely Tsim Sha Tsui (TST), North Point (NP), Kwun Tong (KT) and Central (C) and two references sites outside of the harbour, namely Peng Chau (PC) and Tung Lung Chau (TLC). Levels of saturated fatty acids (SFAs) 16:0 and 18:0 in TPMs, signatures of marine detritus, bacteria and nano-zooplankton, were higher at reference sites than at harbour sites. In contrast, levels of monounsaturated fatty acids (MUFAs) 18:1n9 and 18:1n7 and polyunsaturated fatty acid (PUFA) 18:2n6 were higher in Victoria Harbour than at reference sites. These suggested that the waters in Victoria Harbour contained relatively high amounts of marine fungi and bacteria, reflecting the poor water quality within the harbour proper. The gonad and soma of mussels from the six sites exhibited similar inter-site differences and seasonal changes in fatty acid profiles. The fatty acid profiles of mussels were affected by their diets, which, in turn, depended on the composition of TPMs in the water column. For inter-site differences, levels of SFAs 16:0 and 18:0, which are indicative of presence of marine detritus, were significantly higher at TLC and PC than C, TST and NP, whereas amounts of MUFAs 18:1n9, 20:1n9 and PUFA 18:2n6, which are indicative of presence of zooplankton and marine fungi, were higher at the harbour sites than the reference sites. For seasonal changes, levels of SFAs 14:0, 16:0 and 18:0 were generally higher in summer than winter whereas levels of MUFA 18:1n9 and PUFA 18:2n6 were higher in winter than summer. The fatty acid profiles of TPMs in the water samples were positively correlated with those of gonad and soma of mussels. This further reflected that the fatty acid profiles of mussels were affected by their food sources. Temperature and chlorophyll a in the water

x

Lauren E. McGevin

samples were positively correlated with the fatty acid profiles of TPMs. Levels of PUFAs 20:5n3 and 20:6n3 in TPMs, which are important for reproduction of mussels, were not correlated with those in the gonad and soma. The present findings suggested that these fatty acids tended to be affected by the reproductive period of the mussels rather than by their diets. Chapter 2 - The current chapter is focused on a) the general anatomy and morphological characteristics of mussels (fresh water and saltwater species), b) the effect of both abiotic (temperature, salinity, congestion, pollution, air-exposure, food availability, etc.) and biotic (age, soft-body weight, reproductive cycle, predators, etc.) environmental factors on mussel behavior and physiology, c) the role of filter-feeding mussels as sensitive marker for assessing human-derived environmental impacts and d) the important ecological and environmental role of mussels, with emphasis to saltwater mussels, as reliable tool for monitoring the aquatic environment health status. Specifically, the role of mussels for monitoring aquatic environment is of great interest, since the presence of human-derived inorganic and organic pollutants into the water could affect environmental health status. The good knowledge of their physiology and behavior, as well as their study in cellular, genetic and biochemical level, are important parameters which reinforces the role of mussels as Bioindicators of the marine environment. Moreover, Biomarkers (general- and specific stress as well as genotoxicity), which represent biochemical, cellular,, genotoxical, physiological or behavioral variation that can be measured in mussels, providing evidence of exposure to and/or effects of, one or more chemical pollutants being present into the water, were briefly mentioned, in order to emphasize the use of mussels as bioindicators in a lot well-documented monitoring studies, as a result of the continuously anthropogenic-induced impacts on the environmental health status. Chapter 3 - The Galician coast is the natural environment in which more than 95% of Spanish mussel production occurs. Galicia is a Spanish region located in the far NorthWestern corner of the Iberian Peninsula and its coastline is 1200 km long. In this coastline there are a series of estuaries or bays (also referred to as ―rías‖) that are actually ancient drowned river valleys that were taken over by the sea. Mussels are farmed in the coastal inlets of Galicia by means of a floating raft culture. The Galician mussel sector is based on nearly 3300 installed floating rafts in the five "rías" (Vigo, Pontevedra, Arousa, Muros, Ares). These ría waters are blessed with an extraordinary quality for the farming of mussels due to their warmth and the high amount of nutrients which they contain. Moreover, the rías are ocean areas that are protected from severe weather conditions, which is why the mussel farms are resistant to the changing maritime weather. The Galician mussel production has surpassed 200,000 tonnes annually. Consequently, we are talking about one of the largest mussel producers in the world, and the sector directly generates more than 8000 jobs and incorporates 1000 aquaculture support vessels. This chapter studies the conditions, environment and characteristics of mussel production in the Galician Floating raft culture. This is an updated analysis of the physical, institutional and economic elements of the Galician mussel sector. Chapter 4 - The mussels of the genus Mytilus live in eutrophic seas. Due to their ability to absorb food by filtration and to concentrate both organic and inorganic pollutants, mussels have been extensively used as bioindicators. The exposure to heavy metals often causes sublethal changes, such as abnormalities in DNA replication and transcription, alterations in the pattern of protein expression, changes in other biochemical pathways, and subcellular

Preface

xi

injuries. Cellular stress caused by environmental contamination has been shown to cause spatial and seasonal variability in global protein synthesis in M. galloprovincialis. Most regulation of protein synthesis occurs at the initiation phase of translation. Nevertheless, it was found that the variation of ribosome efficiency at initiating protein synthesis under stress is not proportional to the polysome content, a fact suggesting that additional regulation may occur at other phases of peptide chain elongation. For instance, the ribosomal stalk, composed of a pentameric complex P0(P1/P2)2, is an important structural element of the large subunit which is involved in the ribosome-mediated stimulation of translation factor-dependent GTP hydrolysis. The phosphorylation of P1, and P2 proteins and changes of their content in the stalk may control protein synthesis by influencing initiation and elongation factors, and thereby may affect the translation of individual mRNAs. Protein kinase CK2, a Ser/Thr kinase composed of α and/or α΄ catalytic subunits and a dimer of regulatory  subunit, is involved in cell differentiation, proliferation and tumorgenesis of higher eukaryotes Experimental evidence suggests that CK2 is responsible for modification of the ribosomal stalk proteins and other components of the translational machinery in mussels. Therefore, relationships between protein synthesis alterations, ribosomal stalk function and protein kinase CK2 expression and activity in response to environmental stress is a promising field for exploration in marine invertebrates. Chapter 5 - In the present study, the effects of environmental pollutants have been investigated in the Mediterranean mussel Mytilus galloprovincialis as sentinel species. For the purpose of detecting water contamination in the early stages, biomarkers of effect and exposure must be studied. Most specifically, proteins of intracellular signaling pathways appear to be very interesting targets as their conservation through evolution is maintained and since their modulation via environmental relevant levels of chemical contaminants is an indicating sign of stress for bivalves. Genes encoding the Mitogen-Activated Protein Kinases (MAPKs) in M. galloprovicialis confirmed high homology with those of other vertebrates and invertebrates. Further, mussels were exposed to various model agents: tributyltin, hydrogen peroxide and water soluble fraction of diesel fuel and the activation/phosphorylation of the MAPKs p38, JNK and ERK were evaluated by a new developed ELISA assay. The authors results clearly indicated that pollutants generated different MAPK phosphorylation induction patterns. All the results converge towards the fact that proteins of intracellular signaling pathway could be very promising biomarkers of marine pollution within the mussel M. galloprovincialis. Chapter 6 - The glue of mussels is a remarkable material which has the ability to fix the animals onto organic and inorganic surfaces in aqueous environments. This material consists largely of mussel adhesive proteins (MAPs). The structure of MAPs from a number of different marine invertebrates including mussels has been investigated over the course of the last decades. One common feature of many MAPs studied is the high content of the amino acid 3,4-dihydroxy-L-phenylalanine (DOPA). The DOPA residues are thought to play a key role in the chemisorption of the polymers to substrates underwater and to the formation of covalent cross-links within the adhesive. However, though studies on the adherence of MAPs have described adhesions, oxidations and cross-linking reaction pathways for peptidyl DOPA and DOPA ortho-quinone (oxidation product of DOPA) there remain considerable uncertainties concerning the ways in which different marine mussel species carry out the curing process, and all of the mechanisms described to date are largely hypothetical. To gain a more comprehensive insight of these processes, synthetic DOPA-containing polypeptides

xi Lauren E. McGevin i have been used to experimentally identify the functions and reactions of the amino acids which are active in the chemistry of the MAPs. These studies demonstrate that the adhesion and cross-linking capabilities of mussel adhesive proteins can be successfully reproduced using synthetic materials. The possible applications of these findings in biotechnology are virtually unlimited. Thus synthetic MAPs may be used for medical adhesives in surgery, ophthalmology or dentistry, as well as for enzyme, cell, and tissue immobilization, and as anticorrosives, and metal scavengers. For the design of potential biomaterials it is necessary to understand (i) the reaction of MAPs especially DOPA with organic or inorganic substances; (ii) the chemical structure of the reaction products and (iii) the role of possible catalysts such as, for example, oxidizing enzymes which may support the cross-linking and curing processes. These crucial factors for the synthesis of biomedical or industrial biomaterials will be highlighted in this chapter. Chapter 7 - Mussels comprise members of several families including clams and bivalvia mollusca from both marine and freshwater habitats. They are distributed worldwide and are implicated as bio-indicators for environmental stress. These animals are exposed to a variety of pollutants of industrial, agricultural and urban origin. The accumulation of several anthropogenic agents in their tissues suggests that they possess mechanisms that allow them to cope with the toxic effects of these contaminants. Besides pollutant uptake, this paper presents an overview of the significance of the use of molecular biomarkers in mussels as diagnostic and prognostic tools for marine and freshwater pollution monitoring. Biomarkers complement the information of the direct chemical characterization of different types of contaminants. This review focuses on several types of biomarkers classified according to their functional roles in normal tissues, their respective expression following the exposure to harmful contaminants and their relevant physiological aspects in term of response to environmental stress. Evidence from both experimental laboratory conditions as well as field studies will be taken into account in a perspective of a multi-biomarker approach to assess environmental changes. Chapter 8 - This chapter describes how the ―Mussel Watch‖ concept proposed by Goldberg in 1975 to assess and monitor the state of the water column has evolved over the past few decades. Definitions with specific examples are provided to illustrate the range of chemicals analysed in international programs interested in the presence of persistent organic pollutants, priority pollutants and emerging contaminants. Although the latter organic molecules are generally analyzed in the inflow and outflow of sewage treatment plants, they are also actively researched for potential risk needing attention in aquatic organisms. The measurement of effects going from the biochemical to the population level affecting reproduction is discussed in detail. Examples of studies measuring the depletion or enhancement of enzymatic activities are provided along with explanations on the type of stress linked to the toxic effects. The latest publications dealing with impact assessment encompassing chemical and environmental stresses highlight the complexity of the variables integrated by bivalves in response to changes in their habitat. The future of these investigations is in combining knowledge generated from ―curiosity based‖ and ―solution oriented‖ research that uses chemical and biomarker measurements to determine the sustainability of aquatic ecosystems. Chapter 9 - The present paper reviews all the studies done on genetics and heavy metal ecotoxicology focussing on the green-lipped mussel Perna viridis from Malaysia. Based on the findings reported in 10 publications on the above topics, the genetic differentiation in P.

xii i viridis populations could be explained as being due to geographical factors, physical barriers and heavy metal contamination. All the studies were done using allozymes and DNA microsatellite markers. The results based on both the biochemical and the molecular markers were comparable and almost similar in their genetic distances and FST values. The genetic distances indicate that the mussel populations from Peninsular Malaysia are conspecific populations while the FST values show a moderate genetic differentiation based on Wright's (1978) F-statistics. All the genetic variation parameters strongly support the use of P. viridis as a good biomonitor in the coastal waters of Peninsular Malaysia since the various geographical populations in the region belong to the same species. Without knowledge of the genetic structure of the mussel populations, the biomonitor species is chosen solely based on its morphological characters which could be confusing. Therefore, biochemical and molecular studies are needed to validate the genetic similarity of the chosen biomonitor. From another point of view, based on hierarchical F-statistics and cluster analysis, the physical barrier that blocked the gene flow (through the pelagic larvae swimmers) of P. viridis, and a distinct heavy metal contamination in a polluted population were identified as being the two main causal agents for the genetic differentiation of P. viridis populations, indicating that environmentally induced selection had occurred. All these conclusions could only be drawn when both the genetic and the ecotoxicological information were put together. If the aim of ecotoxicological genetics research on marine invertebrates is to determine whether anthropogenic chemicals are able to damage the DNA sufficiently to alter the population dynamics in ecosystems (Depledge, 1998), then the biomonitoring and monitoring work should be regarded as being as equally important as the biochemical and molecular level study on the biomonitor species itself. It was only together with the availability of information on the anthropogenic chemical levels in the biomonitor and its environmental habitat that the deviation from the Hardy Weinberg Equilibrium observed in the polluted mussel population could be meaningfully interpreted. By taking the biomonitor P. viridis as a model, ecotoxicological genetics should be a focal research area in order to protect the valuable living natural resources in the coastal waters of Malaysia. Chapter 10 - Mussels' attract scientific attention due to two main reasons – they are excellent seafood being source of n-3 polyunsaturated fatty acids, and they are sensitive bioindicators for the environmental conditions. Metabolic changes in mussels are due to their developmental phase, environmental conditions and pollution stress. They could be result of stress induced degradation processes as well as to changes leading to a better adaptation towards the harmful environment. The lipid cell membranes are important for this adaptation, since one of the effects of the stress impact is to perturb the physical properties of the cell membranes by changing their chemical composition and biophysical organization. In such a case the adequate response of the cells would be a series of biochemical modifications and rearrangements of lipophilic compounds (phospholipids, sterols) in the cell membranes, in order to recover their initial organization. Chemical composition and enzymatic activities of mussels from different areas are discussed. Impact of temperature, food availability, salinity, pollution (including metals and persistent organic pollutants) to the mussels‘ biochemistry, also resulted in significant changes in metabolites. Oxidative stress could also take place in marine bivalves under a series of environmental adverse conditions. Chapter 11 - Marine pollution and water quality are evaluated on direct measurements of the abiotic variables and also on bioaccumulation measurements of chemical contaminants in marine organisms. Measuring the same biomarkers in different localities simultaneously gives Preface

xi Lauren E. McGevin v information about the pollution states and provides a better comprehension of the mechanistic model of action of environmental pollutants on the organisms. The use of biomarkers to evaluate stressful situations is widely extended in bivalves. In the current work, organic compound concentrations (dichlorodiphenyltrichloroethane isomers, dioxins, PCBs and PAHs), antioxidant biomarkers (malondialdehyde, catalase, glutathione peroxidase, superoxide dismutase and glutathione reductase) and isotopic composition (15N and 13C) were measured in the digestive gland and gill tissues of the mussel Mytilus galloprovincialis in coastal waters of the Balearic Islands (Western Mediterranean) in order to assess pollution levels in these waters. The highest concentrations of PAHs corresponded to naphthalene, acenaphthylene, fluorene and phenanthrene, with the harbours of Santa Eulàlia and Eïvissa having the highest levels of PAHs. Oxidative stress and biomarkers are used as indicators of pollution exposure, showing that pollution can not evidence exposure effects, while the antioxidant responses can change with time. In the current work, the existence of pollution was indicated by the positive correlation between the concentrations of the lighter PCBs in the digestive gland of the mussels and catalase and glutathione reductase enzyme activities. Gills showed a correlation between the lighter PCBs and superoxide dismutase activity, indicating the bioaccumulation of these organic compounds. Carbon and nitrogen isotopic signatures showed a clear trend for differences in tissue distribution among the studied localities, with the digestive gland being more enriched in carbon and nitrogen than the gills. PCA for biomarkers also showed that tissues responded differently at sampling stations. The presence of pollutants could be the responsible for the changes described in the isotopic composition and in the antioxidant defences of the mussel M. galloprovincialis in waters of the Balearic Islands. The correlations between organic pollutants and the isotopic composition and biomarkers in M. galloprovincialis suggest that these measures could represent a good proxy for evaluation of contamination, additional to the chemical characterisation. Chapter 12 - Human activities and atmospheric pollution impact coastal ecosystems at different rate in the world. The oceans contain a wide range of animal species that are harvested for human consumption. It is estimated that more than 2 billion people world-wide depend on protein from seas and coastal habitats, yet it is into this environment that anthropogenic pollutants often accumulate. Contamination of seafood is inevitable. The word ―mussel‖ is frequently used to name the edible bivalves of the marine family Mytilidae, most of which live on exposed shores in the intertidal zone, attached by means of their strong byssal threads to a firm substrate. Mussels are stationary filter feeders that filter large quantities of seawater, keeping in this way large amounts of pollutants, and constitute a source of contaminants for marine organisms that feed on them. As they accumulate pollutants (polycyclic aromatic hydrocarbons, PAHs, polychlorobiphenyls, PCBs, organochlorine compounds, OCs) efficiently, they can be used in water monitoring programs. Similarly to other invertebrates mussels show a slow metabolic rate and consequently a slow xenobiotic biotransformation. Mussels filter suspended matter from the water column and deposit it as feces and pseudofeces. The food of mussels consists of particulate organic matter and other microscopic sea creatures which are free-floating in seawater. Organic matter is produced in the water column (phytoplankton) and the waves are very important for the availability of this food because they cause turbulence and keep organic matter in suspension. Mussels serve as an important food source for a wide range of organisms (e.g., starfish, eider ducks, some predatory marine gastropods and oystercatchers) and are also eaten by humans. As a matter of fact they contribute to the PCBs, PAHs and OCs intake in human being.

Preface

xv

The species Mytilus galloprovincialis is a very abundant organism in the Mediterranean Sea. This is a mostly enclosed sea that has limited exchange of deep water with outer oceans and where the water circulation is dominated by salinity and temperature differences rather than winds. It covers an approximate area of 2.5 million km2 but its connection to the Atlantic Ocean is only 14 km wide. In The authors studies toxic pollutants were detected at different rates in mussels caught from Adriatic and Tyrrhenian Sea in the last years and compared with the levels found in other seas as reported in literature. Chapter 13 - A multi-layer structure of blue mussels, Mytilus galloprovincialis, was analyzed by in situ investigation and numerical modeling. Blue mussels usually colonize the surfaces of coastal rocks, artificial structures, and the ropes for aquaculture. They filter the ambient waters to ingest particulate organic matter and to obtain oxygen. Their feeding and respiratory activities cause changes in material cycle. However, the effects of blue mussels on material cycle cannot be easily predicted. Blue mussels colonize several layers of the substrate and subsequently compete for space and food among them. Some of the mussels are pushed to the inner layer of a mussel bed and undergo starvation due to their unfavorable position. They do not contribute to the food-ingestion and oxygen-consumption rates of the mussel bed. In this chapter, a multi-layer structure of blue mussels was analyzed by measuring the oxygen-consumption rates of the mussel bed and by investigating the relationship between the growth of an individual mussel and its position in the mussel bed. Then, an individual-based model was developed to describe the dynamics of blue mussels under competition for space and food. The model consists of a physiological growth submodel and a competition submodel. This model was applied to blue mussels adhering to artificial structures in Tokyo Bay in Japan. The authors observed that the individual-based model could reproduce the in situ observations and elucidate the multi-layer structure of blue mussels. Chapter 14 - Aquaculture has consistently increased and it is expected to overtake capture production of food fish supply in the near future (~2020 or 2030). Bivalves usually refer to groups of species like oysters, clams, cockles, mussels and scallops that have been contributing to this growth. Flavor is considered as a high value product and, specifically, good quality seafood flavors are in high demand. As a common industrial practice, the natural seafood flavors are reformulated by adding other ingredients and artificial flavors for specific desired characteristics. Such flavors are being used in seafood sauces, chowders, soups, bisques, instant noodles, snacks and surimi seafoods. The present chapter focuses on the seafood flavor production by some methods, especially, enzymatic hydrolysis due to some advantages such as high yield, good quality with less off-flavor production and control of flavor characteristics through variation of enzyme reactions. Mussel meat was chosen due to this unique taste, high quality of raw material, which ensures good quality flavor, and also the low fatty content that avoids the susceptibility to lipid oxidation. Flavors are preferably used in the powder form, both for processing convenience as well as end use, and this allows the reduction of shipping costs and increases their stability. Microencapsulation is a useful tool in protection of the integrity of food ingredients used as flavors, from oxygen, water or light. Spray drying is the most commonly used technique for the production of dry flavorings and this process converts a liquid flavor into a free flowing powder which is stabler, easier to handle and incorporate into a dry food system. The addition of carrier agents has been used to reduce stickiness, increase stability during storage and trap volatile flavor constituents inside the droplets. Therefore, the production of mussel meat flavor powder by enzymatic hydrolysis

x Lauren E. McGevin vi and spray drying, using gum Arabic, and the determination of its shelf life in terms of sorption isotherms, glass transition temperature, morphology and volatile losses are described and discussed in this chapter. Chapter 15 - The application of Life Cycle Assessment (LCA) for the environmental analysis of mussel culture was considered through the study of the main production areas in Galicia (NW Spain). Inventory data came from interviews and surveys from a set of vessels accounting for the production of more than 7,000 tonnes of mussels cultured in rafts. In addition, physico-chemical characterization of wastewater from the vessels was performed. Abiotic resources depletion, global warming, ecotoxicity, human toxicity, acidification, ozone layer depletion, photochemical oxidant formation, and eutrophication were the impact categories included. Characterization results for each of the categories revealed the importance of taking into account not only the operational issues, but also the capital goods. The consumption of diesel for the vessel arose as the main contributor to potential environmental impacts, along with energy demand and iron production linked to capital goods. Furthermore, an analysis with four different scenarios was carried out, highlighting the importance of studying capital goods in greater detail. Additionally, a toxicity/ecotoxicity analysis was performed, proving a lack of consensus when characterizing toxicity and ecotoxicity potentials. Finally, mussel aquaculture was compared to mussel capture, finding that mussel aquaculture may present a higher potential environmental impact for farmed mussels due to the involvement of a number of operational inputs and outputs without correspondence in current data for mussel capture. Chapter 16 - The dynamics and range of environmental changes that have been observed recently in many coastal and estuarine regions highlight the importance of monitoring for the understanding of these alterations to ecosystems. Of particular relevance are issues which concern the loss of biodiversity, pollution, water quality, sustainable development, and climate change and their potential impact on marine biota. High quality, long-term monitoring programmes have been developed in recent decades to determine current contamination status against which future changes can be assessed (Oldfield and Dearing, 2003; Simcik, 2005; Batzias et al., 2006). In practice, monitoring pollutants is a very complex task, and it comprises an important element of the global observation system. The Mussel Watch Program was created with the aim of determining current metal status in coastal environments as an efficient tool to monitor environmental trace metal levels. The Mussel Watch Program has been implemented in many countries worldwide including the United States, the United Kingdom, France, Hong Kong, and Australia. Pollutant contamination and that of trace metals in particular, has been an environmental issue in many countries for decades, and there is still a need to assess the bioavailability and toxicity of metals in many water basins. This aspect is extremely important not only for estimating the environmental risk of metal contamination to marine fauna and flora, but also the potential effect of metals on humans. Despite trace metals being natural elements in the marine environment, they pose very serious concerns for seafood safety and various aspects of the tourism industry (Wang and Rainbow; 2008). The contamination of the coastal and estuarine areas can be assessed using biological monitors (biomonitors) which accumulate organic and non-organic compounds in their tissues at concentrations which are proportional to the ambient bioavailability (Philips and Rainbow, 1994; e Silva et al., 2006). Therefore, a single biomonitor provides information on the availability and accumulation of a particular compound, and it can be used to assess the

xvi i environmental status of this compound on a local scale (e Silva et al., 2006). The choice of a biological monitor depends on the characteristics of the study area and the objectives of the monitoring program (Resh, 2008). Mussels or other bivalves are commonly exploited for biomonitoring aquatic metal pollution because of their specific biological features relative to other organisms. Bivalves, including oysters, mussels and clams, have been used as biomonitors for evaluating metal pollution in marine water basins for nearly seventy years (Zhou et al., 2008). Bivalves have played an essential role in developing observational methods to detect the potential impact of contaminants on ecosystems over long periods of time, and the importance of biomonitoring programs is now unquestionable. Chapter 17 - Growth of several aquatic organisms is recorded in their hard parts. The skeleton of mussels (akin to clams, corals and brachiopods) is known to portray an array of shell growth increments. Investigations delving into the anatomy of these annuli have proven that the most discernible of them are often exhibiting annual periodicity. In other words, an increment is layered once a year. Rigorous examination of these increments is most commonly called as sclerochronology. Essentially, the sclerochronological approaches all benefit from the meticulous comparison and matching of shell growth increment records between several individuals. This procedure, called as sclerochronological crossdating, relies on growth increment widths and ensures that no increment is falsely added or missing in the resulting chronology. Apart from crossdating, the sclerochronological studies may benefit from the procedures of detrending and pre-whitening. Many environmental factors significantly influence the thickness variability of the increments. Both detrending and prewhitening enable capturing the internally driven growth variability and to isolate the growth variations caused by external factors. Correlation analysis can be used to find out those environmental variables potentially influencing the shell growth variability. Mussels are thus keeping the book of environmental history. Sclerochronologists with skill of crossdating and other methods of time-series analysis are benefitted by increased ability to read these books. Chapter 18 - Marine biotoxins are produced by a few species of microalgae, mostly dinoflagellates. These biotoxins are produced in abnormal quantities during blooms of these microalgae and are accumulated mainly in filter-feeding organisms, such as bivalves. Bivalves are the major vectors of human poisonings in temperate waters. In tropical waters more complex food web interactions lead to the accumulation and bioamplification along the food chain of reef fishes of the toxins causing ciguatera fish poisoning (CFP). Marine biotoxins cause gastrointestinal and/or neurological symptoms. In some of these syndromes the symptoms are short lived, while for instance in CFP symptoms may persist for months. In rare cases, severe intoxications might prove fatal, such as extreme cases of paralytic shellfish poisoning (PSP). In order to prevent human intoxications with contaminated bivalves, phytoplankton and flesh testing analysis are carried out routinely in producing areas. These monitoring programmes follow established food safety laws that allow the interdiction of harvesting activity in the bivalve producing areas. These banning periods impose a socio-economical burden in all those directly or indirectly involved in bivalve trading (Franco, 2005). The periods may last from days to months. In some cases, depending on the bivalve species, particular retention of the toxins might occur year-round. For just a few of these extreme cases some strategies have been found, namely industrial processing might allow continuous bivalve harvest. In Europe, two Preface

x Lauren E. McGevin vi ii exceptions allowing harvest when toxin levels are above the regulatory levels in force are permitted under the current legislation (European Commission, 1996; 2002). Heat treatment followed by evisceration and canning is used today in Spain to deal with the persistent contamination with PSP toxins of the giant cockle Acanthocardia tuberculata (Berenguer et al., 1993), while fresh scallop‘s, Pecten maximus or Pecten jacobaeus, evisceration deals with the persistence of amnesic shellfish poisoning (ASP) toxins in the digestive glands (Salgado et al., 2003). However, evisceration is amenable only to large sized and hard body species, such as these two. Various in vivo methods for accelerating the detoxification process have been tried in the past, particularly for PSP toxins. They include thermal and osmotic stress, electric shocks, decrease in pH, and chlorination (Shumway et al., 1995). None of these methods, however, has proved effective. A review of recent EU projects on detoxification shows either with added algal food or not, depuration takes too many days to be of any use to the bivalve industry (Lassus et al., 2007). The aquaculture sector relies then mainly in natural decontamination processes, taking place in estuarine and lagunar areas after the toxin-producing microalge bloom decays. The decay is species-dependent. In the case of the widely cultivated species in Europe, the blue mussel, scientific data points that it is amongst the most toxic species and presents the longest harvest restriction periods, although some exceptions are known, as those mentioned above. Data accumulated after several years studying Portuguese bivalves will be reviewed to illustrate this point. Following recommendations of a working group organised by the Community Reference Laboratory for Marine Biotoxins on sampling plans (EU-CRL, 2001), the Portuguese programme for biotoxins was refined in 2002 to better incorporate the concept of indicator species – the species that has the highest rate of toxin accumulation. For lagunar and estuarine areas both blue mussels (Mytilus galloprovincialis) and common cockles (Cerastoderma edule) were chosen as weekly indicators. Not a single species, but two were chosen. This outcomes of previous experience showing mussels could reach higher toxin levels than cockle, clams or oysters, and also took longer time to return to safe levels in order to reopen producing areas. If a regulatory decision had to be made based solely on toxin levels in mussel, exploitation of other commercial species would suffer unnecessary closures (Figure 1). As mussels retain toxins longer than other species, when new blooms of toxic microalgae take place, they tend to surpass first the regulatory levels, as toxins ingested add up to the toxin burden already present in the tissues. When the bloom ends, in comparison for example with cockles, toxin levels in mussels might remain above the regulatory levels for several weeks (Figure 1). Detailed data on the main occurring toxins will be next reviewed, and mechanisms underlying the physiological responses will be discussed. Chapter 19 - Mollusca comprises of a wide ranging invertebrate Phylum with nearly 100,000 number of living species. Mussels are aquatic bivalves distributed in diverse types of waterbodies of India. Internal visceral organs of mussels are located between the muscular foot and calcareous hard shell. Pair of valves enclose the soft body parts and are attached with adductor muscle. The space between the membranous mantle and soft visceral mass constitutes mantle cavity harbouring the gill. Gill is the chief respiratory organ of mussel which actively participates in the process of filter feeding. During filtration of the water column, the freshwater mussels are capable of filtering a large volume of water. While

Preface

xix

filtering the water for the purpose of food procurement, mussels create characteristic regional current in its aquatic environment. This movement of water mass in the form of current interferes with the important process of distribution of dissolved particulates and gases. Many of these particulates are of nutritional, metabolic and toxicological importance and the dissolved gases include oxygen, carbon dioxide etc. Filter feeding activity of mussel thus influences various physiological activities of the other inhabitants of water by influencing their nutritional, immunological and toxicological status. Coexistence and perpetuation of aquatic flora and fauna of the freshwater environment is a result of successful evolutionary process where the mussels play a key role. Successful perpetuation and reproductive activity of mussel depend on biosafe propagation of the species in its toxin-free habitat. Physiological defence of mussel mostly depends on its highly evolved immunological system. Molluscan immunity is chiefly dependent on the activity of the circulating haemocytes or blood cells. In Lamellidens marginalis, the information on blood cell is limited with reference to the toxicity of common environmental contaminants. Gradual shrinkage and contamination of habitat by environmental contaminants appear to be a serious threat to the freshwater mussel. Various agrotoxins and metalloid toxin like arsenic are reported as major toxins which affect the immunological status of L. marginalis. Chapter 20 - Lamellidens marginalis (Mollusca; Bivalvia; Eulamellibranchiata) is a freshwater edible mussel distributed in the wetland of different districts of WestBengal, India. Natural habitat of the species is under risk of contamination by multineeem, a newly introduced azadirachtin (limonoid) based pesticide.Blood or haemolymph of L. marginalis contains haemocytes, capable of performing diverse physiological functions. Haemocytes, the circulating blood cells are considered as immunoreactive agent capable of performing phagocytosis, nonself adhesion and aggregation. Magnitude of haemocyte aggregation was studied in depth under the exposure of 0.006, 0.03, 0.06 and 0.03 ppm of azadirachtin for varied span of exposure. Azadirachtin exposure yields decrease of haemocyte aggregation against a control level of aggregation of 34.21%. In the dynamic ecosystem of freshwater, the inhabitants participate in the struggle of niche occupation for survival and existence. Situation often leads to a state of acute predation and fight among animals. As a result, the animals experience physical wounding and loss of body fluid. Aggregation of haemocyte at wound site prevents the loss of blood and entry of microorganism and considered as an immunological response. Magnitude of hemocyte aggregation of mussel was screened under the experimental exposure of EDTA and mannose at different concentrations. Study was aimed to screen the effect of chelating agent and sugars on aggregation. For all the chemicals screened, a drastic increase in the occurrence of free cells were reported which is suggestive to role of these agents in the physiological process of haemocyte aggregation. Moreover, exposure to azadirachtin may lead to gradual loss of blood cell homeostasis of freshwater mussel distributed in its natural habitat. Continuous exposure to toxic azadirachtin may lead to a population decline of freshwater mussel and loss of biodiversity in the freshwater ecosystem of India. Chapter 21 - The expansion of the zebra mussel, Dreissena polymorpha, is observing during at least two hundred years. It has increased the speed at the end of the twentieth century. Adaptation of these species to new natural conditions beyond bounds of ecological optimum is interesting in evolutionary aspect. However, populations of the northern boundaries of the present range, which are the most essential in this respect, practically are not studied until now.

x x

Lauren E. McGevin

For studies of microevolution processes the phylogeographic methods with application of mitochondrial DNA analysis are widely used. Haplotype diversity of the mtDNA locus, encoding cytochrome c oxidase subunit I for D. polymorpha is learned across the large part of its distribution area, however the previous investigations have no included the boundary populations of the north-eastern regions. Samples of the zebra mussels located at 580 – 640 N were studied in The authors investigation. Two of Caspian haplotypes have been found here, that supported the assumption about the spread of the zebra mussel into the northern area from Caspian Sea. The results of The authors work supply the general pattern of gene geography of D. polymorpha, and suggested to possible existence of secondary sources of the zebra mussel spread beyond the bounds of Ponto-Caspian region. Chapter 22 - Freshwater mussels of the family Unionidae, also known as naiads, have inhabited fresh waters around the world for the past 400 million years. The presence of these unique mussels ensures our water quality and helps support the worldwide pearl industry. Yet their continued survival is by no means certain, due to overharvesting, environmental degradation and the rapid spread of exotic mussel species. Most research related to mussels has dwelt on different topics as fine-scale, intradrainage distribution patterns and life history traits relevant to applied conservation and propagation issues but there are only a few reports on anatomy studies. This chapter provides baseline reference material regarding the anatomy of Unionidae freshwater mussels, focusing in particular on the subfamily Unioninae with the aim to improve the knowledge in mussels of professional biologists and amateur naturalists as well as their preservation. Chapter 23 - Mussels within the genus Mytilus are one of the most thoroughly studied marine molluscs at both the ecological and physiological levels. A great number of studies on morphology, morphometry, proteins and DNA markers have been performed, but origin and taxonomy of this genus still remains unclear. Based on these studies, different authors recognised the existence of different species, semi-species or subspecies within this genus. For example, according to McDonald et al. (1991) these are five taxa: M. edulis, M. galloprovincialis, M. trossulus, M. californianus and M. coruscus, and Gosling (1992) includes M. (edulis) desolationis as a subspecies of M. edulis. Data from different mitochondrial and nuclear DNA markers have revealed strong biogeographic and phylogenetic relationships among M. edulis, M. galloprovincialis and M. trossulus -these three forming the M. edulis complex- (Varvio et al. 1988; Koehn 1991; McDonald et al. 1991; Rawson and Hilbish, 1998; Quesada et al. 1998; Martinez-Lage et al. 2002; Riginos and McDonald 2003; Riginos and Cunningham 2005; Pereira Silva and Skibinski 2009). According to Blot et al. (1988) and Gérard et al. (2008) M. desolationis seems to be a ―semispecies in the super-species Mytilus edulis complex‖, whereas M. californianus and M. coruscus constitute two separate species as shown by the results obtained from the 18S ribosomal DNA (Kenchington et al. 1995), mitochondrial DNA (Hilbish et al. 2000), and satellite DNA Apa I (Martínez-Lage et al. 2002, 2005) analyses. Chapter 24 - Evolutionary toxicology investigates population genetic effects caused by environmental contamination. Toxicant inputs of increasing industry, agriculture and fast growing cities have severely modified freshwater ecosystems. These anthropogenic stressors are expected to influence population genetic patterns by causing mortalities, so that, e.g., a recent reduction in genetic diversity would be indicative of deteriorating environmental

Preface

xxi

conditions. The amount of genetic diversity can therefore be applied as a biomarker for the condition of freshwater ecosystems in a biomonitoring system. The zebra mussel is a common bioindicator for passive as well as active biomonitoring of freshwater ecosystems. Here, the authors suggest a novel approach to establish the genetic status of zebra mussel populations as an independent indicator of environmental condition. In this strategy, the well-established techniques of comet assay, micronucleus test and microsatellite analysis are combined to assess the health of freshwater habitats. Chapter 25 - are bivalves that are variously adapted for relatively immobile nature. They are characterized by the presence of short byssal threads attached close to exposed surface of hard substrates. Majority of them occur in intertidal areas, although some of them have occasionally been reported from deep water. Because of their relatively immobile nature and ubiquitous presence in the littoral and shallow sublittoral waters, they have been commonly targeted by their natural enemies. The natural enemies of mussels can be categorized in four main groups. The first group consists of predators like fish, crabs, birds, starfish and snails. Fish, crabs and birds just peel or crush the hard shell. Starfish uses whole body consumption. Predatory snails drill holes in the hard shell and consume the soft tissue; this kind of predation can be identified postmortem. Predation could be responsible for up to 50% of the mortality of a mussel population. The severity of predation generally is size and locality selective. Often the smaller size class of mussels takes the heaviest hit. The second groups of natural enemies are the competitors, fighting for similar food and space such as barnacles, crepidula, tunicates. These competitions could be severe enough to drive entire mussel population to the brink of extinction. However, these competitors are often serving as prey items for the same predators that prey upon mussels. In those scenarios, these competitors often render a positive feedback on the mussels by sharing the predation stress. The third group is the shell destroyers such as demosponges, polychaete. They are known to damage the calcitic shells of mussels by boring them. These boreholes are different from predatory drillholes as they are generally non-lethal. However, those boreholes damage the structural integrity of the shell and eventually lead them to disintegration by wave action. The fourth group of natural enemies are the parasites such as mytilicola, pinnotheres. These parasites often cause significant damage to the vital organs affecting respiration, filtration, ventilation and digestion. Although primarily these natural enemies render negative effect on mussel population, the overall interaction is very complicated and often produces positive effects locally.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 1

INTER-SITE DIFFERENCES AND SEASONAL PATTERNS OF FATTY ACID PROFILES IN GREEN-LIPPED MUSSELS PERNA VIRIDIS IN A SUBTROPICAL EUTROPHIC HARBOUR AND ITS VICINITY S. G. Cheung1,2 and P. K. S. Shin1,2 1

Department of Biology and Chemistry, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong 2 State Key Laboratory in Marine Pollution, City University of Hong Kong, Tat Chee Avenue, Kowloon, Hong Kong

ABSTRACT Fatty acid profiles of total particulate matters (TPMs) in water and green-lipped mussels Perna viridis were studied for one year in the eutrophic Victoria Harbour, Hong Kong and its vicinity. Bimonthly sampling of TPMs and P. viridis were conducted at four sites inside the harbour, namely Tsim Sha Tsui (TST), North Point (NP), Kwun Tong (KT) and Central (C) and two references sites outside of the harbour, namely Peng Chau (PC) and Tung Lung Chau (TLC). Levels of saturated fatty acids (SFAs) 16:0 and 18:0 in TPMs, signatures of marine detritus, bacteria and nano-zooplankton, were higher at reference sites than at harbour sites. In contrast, levels of monounsaturated fatty acids (MUFAs) 18:1n9 and 18:1n7 and polyunsaturated fatty acid (PUFA) 18:2n6 were higher in Victoria Harbour than at reference sites. These suggested that the waters in Victoria Harbour contained relatively high amounts of marine fungi and bacteria, reflecting the poor water quality within the harbour proper. The gonad and soma of mussels from the six sites exhibited similar intersite differences and seasonal changes in fatty acid profiles. The fatty acid profiles of mussels were affected by their diets, which, in turn, depended on the composition of TPMs in the water column. For inter-site differences, levels of SFAs 16:0 and 18:0, 

Email: [email protected]

2

S. G. Cheung and P. K. S. Shin which are indicative of presence of marine detritus, were significantly higher at TLC and PC than C, TST and NP, whereas amounts of MUFAs 18:1n9, 20:1n9 and PUFA 18:2n6, which are indicative of presence of zooplankton and marine fungi, were higher at the harbour sites than the reference sites. For seasonal changes, levels of SFAs 14:0, 16:0 and 18:0 were generally higher in summer than winter whereas levels of MUFA 18:1n9 and PUFA 18:2n6 were higher in winter than summer. The fatty acid profiles of TPMs in the water samples were positively correlated with those of gonad and soma of mussels. This further reflected that the fatty acid profiles of mussels were affected by their food sources. Temperature and chlorophyll a in the water samples were positively correlated with the fatty acid profiles of TPMs. Levels of PUFAs 20:5n3 and 20:6n3 in TPMs, which are important for reproduction of mussels, were not correlated with those in the gonad and soma. The present findings suggested that these fatty acids tended to be affected by the reproductive period of the mussels rather than by their diets.

INTRODUCTION Lipids are important to the marine environment because of their significant constitution to the total carbon flux through the trophic levels (Lee et al. 1971, Sargent et al. 1977, Reuss and Poulsen 2002). They are a compact and concentrated form of energy storage for plants and animals and constitute a source of essential nutrients, vitamins and chemical messengers (Napolitano et al. 1997). Fatty acids constitute the main part of the lipids in marine organisms. Many biologically important fatty acids, such as some polyunsaturated fatty acids (PUFAs), particularly eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), are only synthesized de novo by phytoplankton (Pohl and Zurheide 1979, Sargent and Whittle 1981, Desvilettes et al. 1997, Napolitano et al. 1997, Reuss and Poulsen 2002). They are synthesized at the lower trophic levels and remain unchanged, or stay in a recognizable form, when transferred to higher trophic levels (Napolitano et al. 1997, Reuss and Poulsen 2002). Thus, fatty acids can be useful markers to indicate the trophic relationship among marine organisms and trace the food source through multiple food web linkages. On the other hand, fatty acid markers are able to compensate the shortcomings of traditional stomach analyses. Since the food items in the gut are usually difficult to identify and quantitatively biased due to differential digestion rates of soft and hard parts, fatty acid markers can provide supplementary information to indicate whether the food is assimilated into the tissue of the organisms (Dalsgaard et al. 2003). Fatty acid markers can also be used to determine the dominance of particular groups of organisms, as well as the interaction among trophic groups (Dalsgaard et al. 2003). In most studies, data showed that the saturated fatty acids (SFA) 14:0 and 16:0 constitute the major components of the fatty acid pool of most algal classes (Reuss and Poulsen 2002). High concentrations of saturated fatty acid (SFA) 14:0, monounsaturated fatty acid (MUFA) 16:1n7, 16 carbon-chain PUFAs and 20:5n3 are characteristically measured in diatom-dominated communities. High levels of 18 carbon-chain and 22:6n3 are consistent within dinoflagellate-dominated communities. Calanoid copepods have considerable amounts of MUFA and monounsaturated fatty alcohols with 20 and 22 carbon atoms. In addition to indicating trophic relationships, fatty acids can be markers to reflect the quality of lipid materials in the environment (Brazão et al. 2003). Fatty acid compositions in the water column are shown to vary under a succession of species within a natural plankton community (Dalsgaard et al. 2003). For instance, when there is a shift in a plankton

Inter-Site Differences and Seasonal Patterns…

3

community from the dominance of diatoms to flagellates, 16:1/16:0 ratio in the water column tends to decrease and 18:4/18:1 ratio increase. Thus, fatty acids can be used to indicate the seasonal patterns of plankton communities in the marine environment (Dalsgaard et al. 2003). Green-lipped mussel Perna viridis is a tropical and subtropical species distributed widely in the Indo-Pacific (Siddall 1980, Wong and Cheung 2003a). They usually form dense populations (35,000 individuals m-2) on a variety of structures including vessels, fish rafts, buoys and any hard substrates (NIMPIS 2002). In Hong Kong, Perna viridis is commonly found from oceanic to estuarine waters (Wong and Cheung 2003b). They are dominant in the subtidal region with high densities recorded from Victoria Harbour (246 individuals m-2) and Tolo Harbour (> 1,000 individuals m-2) (Huang et al. 1985, Wong and Cheung 2003b). P. viridis is an efficient filter feeder, feeding on phytoplankton, small zooplankton and other organic materials. They can usually be found in a habitat with salinity in the range of 18–33‰ and temperature in a range of 11–32ºC. P. viridis generally spawns twice a year, between early spring and late autumn. Fertilized eggs develop into larvae and remain in the water column for two weeks before settling as juveniles. Sexual maturity usually occurs while the shell length is about 15–30 mm, corresponding to two to three months of age. The life of P. viridis is about two to three years. Their growth rates are influenced by environmental factors such as temperature, food availability and water movement. First year growth rates vary between locations. In Hong Kong, the first year growth rate is 47 mm year-1. Mussels can be a bioindicator because they are sedentary and can accumulate, tolerate and concentrate contaminants from the environment. They always occur in wide and stable populations and hence can be sampled repeatedly in different seasons. Moreover, responses such as growth, reproduction and energetics in green-lipped mussels have been reported to be largely controlled by environmental factors (Lee 1986, Cheung 1991). Thus, mussels can be a good indicator of changes in the environment. P. viridis has been used as a bioindicator to detect the level of trace metals and organochlorines (Phillips and Yim 1981; Phillips 1985; Phillips and Rainbow 1988, Bayen et al. 2004), PAHs (Xu et al. 1999) and the effect of hypoxia in the marine environment (Wu and Lam 1997). Victoria Harbour lies between the most heavily urbanized area of the Kowloon Peninsula and the northern shore of Hong Kong Island (Yung et al. 1999). It is a major tidal channel with strong current flushings and has long been utilized for disposal of sewage effluent. In the past, wastewater was discharged into the harbour only after a simple screening process. It resulted in poor water quality with high nutrients and sewage bacteria (HKEPD 2004). Before 1997, there were 12 outfalls from 11 sewage screening plants, which discharge about 1.5 million M3 of screened effluent into Victoria Harbour per day (HKEPD 1997). In 2001, the Harbour Area Treatment Scheme (HATS) was fully implemented to treat sewage and improve the water quality in Victoria Harbour. In the first stage of HATS, the sewage from Kowloon and north eastern parts of Hong Kong Island was transferred to a central sewage treatment works for chemical treatment before being discharged into the western approaches of Victoria Harbour. The water quality in eastern Victoria Harbour sharply improved in 2004 (HKEPD 2004). In 2004, the dissolved oxygen increased (5.3–6.0 mg l-1) and could meet the standard (4 mg l-1). The level of E. coli was lower (480–630 cfu ml-1), compared to the previous year, and almost met the standard for secondary contact in recreational areas (600 cfu ml-1). The levels of nitrate, phosphate and ammonia were also markedly reduced. The aims of the present study were to investigate the inter-site difference and seasonal change of the fatty acid profiles of total particulate matters (TPMs) in the waters and in the

4

S. G. Cheung and P. K. S. Shin

gonad and soma of green-lipped mussels in Victoria Harbour and reference sites. Since TPMs in the water are a food source for the mussels, the impact of the TPMs to the fatty acid profiles of the gonad and soma of green-lipped mussels was assessed.

MATERIALS AND METHODS Sample Collection During each campling, twenty individuals of the green-lipped mussel Perna viridis with shell length of 65–85 mm were collected from four locations at Tsim Sha Tsui (TST), North Point (NP), Kwun Tong (KT), Central (C) in Victoria Harbour and two reference sites outside the harbour at Peng Chau (PC) and Tung Lung Chau (TLC) (Figure 1). At the same time, 20 litres of seawater were also collected from each site. The sampling occurred from September 2004 to July 2005 and was conducted every two months. After collection, the feeding and digestive system of Perna viridis were cleared in filtered seawater until no faeces was produced. The mussels were then put into a freezer at -20ºC, to await further analysis.

Figure 1. The six sampling locations in Victoria Harbour.

Inter-Site Differences and Seasonal Patterns…

5

Measurement of Physical and Chemical Factors of Water Samples At each site, temperature, dissolve oxygen, pH and salinity of the water were measured during each visit. One litre of water was collected at sub-surface (0.5 m below surface) for determination of chlorophyll a concentration, according to the method from Eaton et al. (1995). Three 60 ml bottles of water were also sampled to determine the level of ammonia, nitrate (NO3-) and phosphate (PO43-) concentrations, according to the method from Eaton et al. (1995).

Fatty Acid Analysis Preparation of Water Samples Fifteen litres of water were collected at each sampling location and divided into three aliquots so that five litres of water formed one replicate sample. The water was filtered through ashed glass fibre filter paper, with 0.6 µm pore size and 90 mm diameter. The suspended particulate matters in the water were collected on the filter paper. The remains on the filter paper were used for lipid extraction after filtration. Preparation of Mussel Samples The shells of Perna viridis were removed and all soft tissue was rinsed with water to remove byssal threads and salts. Twenty mussels were pooled together. The tissues of 20 mussels were separated into gonad and somatic tissues (remaining tissues). The tissues were dried in an oven at 45ºC for 72 hours. The gonado-somatic index (GSI) was calculated according to the following equation: GSI = (dried weight of gonad / dried weight of whole tissue) x 100% All the dried tissues were ground into fine particles and used for fatty acid analysis.

Lipid Extraction and Quantification For total lipid extraction, around 200 mg of dry tissue of each tissue part were used following a slightly modified method according to Bligh and Dyer (Bligh and Dyer 1959). Lipid was extracted by 5 ml 2:1 chloroform-methanol solvent mixture (v/v) overnight. The mixed crude extract was then washed with 0.04% CaCl2 solution (0.2 of the crude extract‘s volume) so that a top aqueous and a bottom organic layer were formed. These two layers were separated by centrifugation. The upper aqueous layer was removed. Five ml of petroleum ether was added and dried with a stream of nitrogen and the extract was further dried overnight in a vacuum desiccator for the determination of total lipids. Fatty acid Analysis and Quantification Fatty acid methyl esters (FAMEs) of total lipids were also determined following a modified method of Bligh and Dyer (1959). 2.5 ml of 2% sulphuric acid (H2SO4) in methanol was added to the lipid extract and the solution was incubated in an oven at 80ºC for two hours. After cooling, 1 ml distilled water and 2 ml petroleum ether were added to the tube and

6

S. G. Cheung and P. K. S. Shin

mixed with a vortex. The upper organic layer was transferred to a vial and dried using a nitrogen stream with a very slow flow rate to keep from blowing the FAMEs away. Then FAMEs were analyzed using an Agilent 5890 series GC-FID with an autosampler and DB225-MS capillary column (30 m, 0.25 mm internal diameter, 0.20 m film thickness). Authentic methylated fatty acid standards were purchased from Sigma and Supelco. Methyl nonadecanoate (19:0) was used as an internal standard. Standard FAMEs (Supelco) solution (20–240 ppm) was also prepared and 15 ppm internal standard was added. Therefore, for each standard FAME, a calibration curve between the peak area of this specific FAME and the peak area of the internal standard was established in order to calculate the concentration of the FAMEs in the lipid extract. The operating conditions for the GC-FID were as follows: split-injection mode was used with injector being held at 230ºC. Initial temperature was 50ºC for two minutes, then from 50ºC to 210ºC at 4ºC min-1, where the temperature was held at 210ºC for an additional 50 minutes. The detector was held at 230ºC and helium was used as the carrier gas with a flow rate of 1 ml min-1. A sample of 2 l was injected into the GC-FID for each analysis.

Statistical Analyses Data on the fatty acid profiles of TPMs in the waters, as well as the gonads and somatic tissue of green-lipped mussels were used to calculate the mean percentage of Bray-Curtis similarity among different samplings from the various sites (Bray and Curtis 1957). Significant differences among sites, or seasonal variations, were also tested by analysis of similarity (ANOSIM) from the software PRIMER (Clarke and Warwick 2001). Based on the similarity values, hierarchical cluster analyses using the group-average sorting method were performed to show inter-site differences and seasonal changes in fatty acid profiles of TPMs and the gonad and soma of mussels in Victoria Harbour and the reference sites. Repeatedmeasures Multivariate Analysis of Variance (MANOVA) with Tukey test for multiple comparisons were used to compare the differences in the percentages of individual fatty acids of TPMs in waters and the gonad and soma of mussels collected from Victoria Harbour and reference sites. Data were arcsin square root transformed prior to analysis to conform to data normality (Zar 1996). Correlations between fatty acid profiles in TPMs and mussels, as well as the physico-chemical parameters, were tested by Pearson correlation analysis. All statistical analyses were performed with the software SPSS 12.0 for Windows (SPSS Inc. 2002) and PRIMER 5.0 (Clarke and Warwick 2001).

RESULTS Physico-Chemical Parameters of Waters in Victoria Harbour and Reference Sites Figure 2 shows temporal variations in water temperature at the six sampling sites. The trend was similar among all the sites, with temperatures decreasing gradually from September 2004 to their lowest values in March 2005. After March 2005, temperatures increased to a

Inter-Site Differences and Seasonal Patterns…

7

maximum in July. Lower dissolved oxygen levels were obtained at NP and KT, while higher levels were obtained at the reference sites, PC and TLC (Figure 3) where the temporal variation of dissolved oxygen levels was the smallest (6.6–7.6 mg l-1). For pH, no temporal variation was observed with higher values being obtained at the reference sites (8.1–8.6) than sites in Victoria Harbour (7.6–8.4). For salinity, lower values were obtained in the summer, from May through July (21–35 ‰), as compared with other seasons (30–37 ‰) (Figure 4).

Figure 2. Temperature (ºC) of waters collected from reference sites (PC and TLC) and Victoria Harbour. PC: Peng Chau, C: Central, TST: Tsim Sha Tsui, KT: Kwun Tong, TLC: Tung Lung Chau.

Figure 3. Concentration of dissolved oxygen (mg l-1) in waters collected from reference sites (PC and TLC) and Victoria Harbour. PC: Peng Chau, C: Central, TST: Tsim Sha Tsui, KT: Kwun Tong, TLC: Tung Lung Chau.

S. G. Cheung and P. K. S. Shin

8

Figure 4. Salinity (‰) of waters collected from reference sites (PC and TLC) and Victoria Harbour. PC: Peng Chau, C: Central, TST: Tsim Sha Tsui, KT: Kwun Tong, TLC: Tung Lung Chau.

Table 1. Multiple comparisons of repeated-measures MANOVA for physico-chemical parameters of waters from Victoria Harbour and references sites. Letter „a‟ represents the highest concentration of each fatty acid. The same letter means that no significant difference existed between the sites (p > 0.05). PC: Peng Chau, TLC: Tung Lung Chau, C: Central, TST: Tsim Sha Tsim, NP: North Point, KT: Kwun Tong; mm/yy represents month/year (e.g., 09/04 = September 2004) Wilk‘s λ

p-value

Multiple comparison

Chlorophyll a

0.00

< 0.001

KTa PCb TLCc TSTd NPe Cf

Ammonia

0.01

< 0.001

KTa Cb NPbc TSTc PCd TLCe

Nitrate

0.06

< 0.001

KTa PCb TSTb Cb NPb TLCb

Phosphate

0.03

< 0.001

KTa TSTb Cb NPb PCbc TLCc

Chlorophyll a

0.00

< 0.001

07/05a 09/04b 11/04c 01/05d 05/05d 03/05d

Ammonia

0.00

< 0.001

07/05a 09/04b 11/04c 01/05d 05/05d 03/05d

Nitrate

0.02

< 0.001

05/05a 07/05a 03/05b 01/05b 11/04b 09/04b

Phosphate

0.01

< 0.001

01/05a 11/04a 05/05ab 07/05ab 09/04b 03/05b

Physico-chemical parameters Inter-site difference

Seasonal change

Inter-Site Differences and Seasonal Patterns…

9

Figure 5 shows the chlorophyll concentration and Figure 6 the nutrient contents at the study sites. Inter-site differences in chlorophyll a and nutrient contents were observed, with highest values being obtained from KT and the lowest from TLC, except for chlorophyll a (Table 1). For seasonal differences, the concentrations of chlorophyll a and ammonia were the highest in July but the lowest in January, March and May. The concentration of nitrate was the highest in the summer (May through July), whereas the concentration of phosphate was the highest in the winter (January and November).

Figure 5. Concentration of chlorophyll a (mg m-3) in waters collected from reference sites (PC and TLC) and Victoria Harbour (Mean ± 1SD, n = 3). PC: Peng Chau, C: Central, TST: Tsim Sha Tsui, KT: Kwun Tong, TLC: Tung Lung Chau.

Fatty Acid Profiles of Total Particulate Matters in Waters from Victoria Harbour and Reference Sites Tables 2–7 show the fatty acid profiles of TPMs in waters collected from the reference sites and Victoria Harbour from September 2004 to July 2005. In general, the fatty acid profile of TPMs in waters from Victoria Harbour and reference sites during the sampling period was mainly composed of SFA (23–75 % for C, TST, NP and KT; 27–88% for PC and TLC). The main SFAs in waters were 16:0 and 18:0. PUFAs were present in moderate level (9– 56% for C, TST, NP and KT; 5–64% for PC and TLC). The main PUFAs were 18:2n6, 18:3n3, 20:5n3 and 22:6n3. MUFAs (9–43% for C, TST, NP and KT; 2–28% for PC and TLC) were present at minimum levels and mainly dominated by 16:1n7 and 18:1n9.

10

S. G. Cheung and P. K. S. Shin

Figure 6. Concentration of ammonia, nitrate and phosphate (ppm) in waters collected from reference sites (PC and TLC) and Victoria Harbour (Mean ± 1SD, n = 3). PC: Peng Chau, C: Central, TST: Tsim Sha Tsui, KT: Kwun Tong, TLC: Tung Lung Chau.

Inter-Site Differences and Seasonal Patterns…

11

Table 2. Fatty acid profiles (%) of total particulate matters in waters from Peng Chau (Mean ± 1SD; n = 3). SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid; ND: not detected Fatty acids

09/04

11/04

01/05

03/05

05/05

07/05

14:0

2.63 ± 0.42

1.06 ± 0.92

ND

ND

ND

ND

15:0

ND

ND

ND

3.25 ± 0.32

ND

ND

16:0

29.64 ± 1.83

27.64 ± 1.83

18.92 ± 0.64

23.95 ± 4.03

14.98 ± 0.88

39.31 ± 2.03

17:0

1.03 ± 0.13

2.41 ± 0.28

ND

1.30 ± 0.05

2.99 ± 0.37

ND

18:0

51.07 ± 2.60

31.26 ± 0.55

7.64 ± 3.26

31.28 ± 2.09

16.99 ± 1.61

17.52 ± 4.78

20:0

3.33 ± 0.31

ND

ND

ND

13.78 ± 0.29

ND

SFA

87.7 ± 1.23

62.37 ± 2.51

26.56 ± 2.70

58.49 ± 5.90

48.75 ± 2.75

56.83 ± 5.96

15:1

ND

ND

ND

ND

ND

ND

16:1n7

1.70 ± 0.48

0.73 ± 0.38

2.42 ± 1.05

0.00

4.05 ± 0.07

14.66 ± 2.48

18:1n9

4.59 ± 0.76

3.14 ± 0.59

5.30 ± 0.42

2.32 ± 0.50

3.67 ± 0.03

10.17 ± 2.04

18:1n7

0.86 ± 0.26

ND

1.93 ± 0.08

ND

ND

3.43 ± 0.26

20:1n9

ND

ND

ND

4.03 ± 1.62

ND

ND

MUFA

7.15 ± 1.43

3.88 ± 0.53

9.65 ± 1.50

6.36 ± 2.01

7.72 ± 0.10

28.27 ± 4.71

18:2n6

1.90 ± 0.76

10.60 ± 0.51

11.50 ± 1.33

8.05 ± 1.22

0.00

3.98 ± 1.52

18:3n3

1.34 ± 0.22

16.67 ± 2.48

13.88 ± 2.75

15.59 ± 1.53

10.95 ± 1.46

10.91 ± 0.27

20:2

ND

ND

ND

ND

ND

ND

20:3n3

ND

ND

ND

ND

ND

ND

20:3n6

ND

ND

ND

ND

14.40 ± 0.52

ND

20:5n3

1.90 ± 0.19

6.47 ± 0.75

26.26 ± 0.65

10.21 ± 1.26

18.18 ± 0.91

ND

22:6n3

ND

ND

12.15 ± 1.70

ND

ND

ND

PUFA

5.15 ± 0.62

33.75 ± 2.99

63.79 ± 1.87

33.85 ± 3.96

43.53 ± 2.84

14.90 ± 1.30

S. G. Cheung and P. K. S. Shin

12

Table 3. Fatty acid profiles (%) of total particulate matters in waters from Tung Lung Chau (Mean ± 1SD; n = 3). SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid; ND: not detected Fatty acids

09/04

11/04

01/05

03/05

05/05

07/05

14:0

1.22 ± 0.50

3.52 ± 0.38

ND

ND

1.08 ± 0.89

3.40 ± 2.48

15:0

ND

ND

ND

1.44 ± 0.99

ND

ND

16:0

31.16 ± 0.98

31.98 ± 1.48

26.57 ± 3.47

26.91 ± 0.78

17.87 ± 1.36

21.11 ± 1.41

17:0

0.66 ± 0.14

0.10 ± 0.12

ND

2.14 ± 0.23

0.99 ± 1.71

ND

18:0

37.89 ± 4.33

55.74 ± 4.02

21.61 ± 2.72

34.87 ± 2.03

19.09 ± 0.89

8.13 ± 1.42

20:0

4.09 ± 0.56

ND

ND

ND

ND

12.09 ± 0.75

SFA

75.01 ± 3.23

92.24 ± 2.26

48.18 ± 5.18

65.36 ± 2.97

39.02 ± 4.00

44.73 ± 1.29

15:1

ND

ND

ND

ND

ND

ND

16:1n7

0.19 ± 0.18

0.25 ± 0.29

ND

ND

7.03 ± 0.88

13.52 ± 1.99

18:1n9

4.34 ± 0.44

1.51 ± 0.16

9.75 ± 1.28

4.07 ± 0.20

1.99 ± 0.56

3.41 ± 0.80

18:1n7

0.84 ± 0.11

ND

ND

1.04 ± 0.11

1.19 ± 0.23

2.06 ± 0.17

20:1n9

ND

ND

ND

ND

ND

ND

MUFA

5.37 ± 0.69

1.76 ± 0.31

9.75 ± 1.28

5.11 ± 0.09

10.21 ± 1.50

18.99 ± 1.67

18:2n6

2.59 ± 0.42

2.26 ± 1.07

21.19 ± 3.50

11.56 ± 1.92

0.00

0.39 ± 0.06

18:3n3

2.02 ± 0.24

3.75 ± 1.16

20.87 ± 0.78

17.98 ± 2.14

9.11 ± 3.54

3.65 ± 0.42

20:2

ND

ND

ND

ND

ND

ND

20:3n3

ND

ND

ND

ND

ND

ND

20:3n6

ND

ND

ND

ND

16.43 ± 2.78

0.00

20:5n3

2.38 ± 0.49

ND

ND

ND

25.22 ± 3.08

32.25 ± 0.63

22:6n3

12.64 ± 3.10

ND

ND

ND

ND

ND

PUFA

19.63 ± 2.55

6.01 ± 2.16

42.07 ± 3.90

29.54 ± 2.98

50.76 ± 5.50

36.28 ± 0.42

Inter-Site Differences and Seasonal Patterns…

13

Table 4. Fatty acid profiles (%) of total particulate matters in waters from Central (Mean ± 1SD; n = 3). SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid; ND: not detected Fatty acids

09/04

11/04

01/05

03/05

05/05

07/05

14:0

1.40 ± 1.03

1.21 ± 0.52

ND

ND

ND

ND

15:0

ND

ND

ND

ND

ND

ND

16:0

28.38 ± 1.17

20.69 ± 0.58

16.18 ± 0.93

25.61 ± 2.63

19.17 ± 1.29

29.25 ± 0.95

17:0

1.06 ± 0.27

2.42 ± 1.10

ND

ND

2.01 ± 0.19

ND

18:0

41.07 ± 3.41

23.65 ± 2.17

9.66 ± 1.35

30.91 ± 1.56

21.57 ± 1.32

18.17 ± 1.37

20:0

3.25 ± 0.49

ND

ND

ND

12.63 ± 0.83

ND

SFA

75.16 ± 2.50

47.97 ± 1.29

25.84 ± 2.16

56.52 ± 4.19

55.38 ± 1.63

47.42 ± 1.83

15:1

ND

ND

ND

1.51 ± 1.12

ND

ND

16:1n7

1.85 ± 0.38

1.72 ± 0.12

ND

0.30 ± 0.29

ND

9.65 ± 0.73

18:1n9

8.76 ± 1.85

10.43 ± 0.72

16.96 ± 0.55

11.12 ± 0.21

5.96 ± 0.86

10.66 ± 2.33

18:1n7

1.60 ± 0.34

0.92 ± 0.11

2.11 ± 0.18

1.66 ± 0.29

1.38 ± 0.07

1.94 ± 0.26

20:1n9

ND

2.33 ± 0.15

ND

ND

ND

ND

MUFA

12.21 ± 2.40

15.40 ± 0.81

19.06 ± 0.37

13.08 ± 0.03

8.84 ± 1.72

22.25 ± 1.78

18:2n6

5.32 ± 0.94

15.51 ± 3.60

17.34 ± 0.83

14.66 ± 1.75

5.06 ± 0.84

4.97 ± 2.46

18:3n3

1.16 ± 0.55

12.25 ± 0.61

6.46 ± 0.47

13.10 ± 1.23

11.45 ± 1.23

6.53 ± 0.66

20:2

ND

ND

ND

ND

ND

ND

20:3n3

ND

ND

ND

ND

ND

ND

20:3n6

ND

ND

ND

ND

19.27 ± 3.03

18.83 ± 3.70

20:5n3

2.20 ± 0.48

4.04 ± 0.34

18.79 ± 2.13

2.64 ± 4.57

ND

ND

22:6n3

3.96 ± 1.02

4.83 ± 0.70

12.51 ± 0.72

ND

ND

ND

PUFA

12.63 ± 2.68

36.63 ± 2.10

55.10 ± 2.53

30.40 ± 4.17

35.78 ± 2.19

30.33 ± 3.23

S. G. Cheung and P. K. S. Shin

14

Table 5. Fatty acid profiles (%) of total particulate matters in waters from Tsim Sha Tsui (Mean ± 1SD; n = 3). SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid; ND: not detected Fatty acids

09/04

11/04

01/05

03/05

05/05

07/05

14:0

1.20 ± 0.96

0.73 ± 0.12

ND

ND

ND

1.14 ± 1.97

15:0

ND

ND

ND

1.95 ± 1.41

ND

ND

16:0

29.38 ± 2.68

12.66 ± 0.10

13.75 ± 2.23

22.41 ± 0.96

18.24 ± 0.98

20.50 ± 1.85

17:0

0.88 ± 0.14

0.00

0.67 ± 0.11

1.42 ± 0.68

2.42 ± 1.49

0.00

18:0

41.88 ± 1.94

7.75 ± 0.26

4.97 ± 1.03

22.71 ± 2.56

20.58 ± 0.80

8.91 ± 2.13

20:0

3.71 ± 0.78

3.87 ± 0.52

7.62 ± 0.55

ND

13.02 ± 1.60

ND

SFA

73.34 ± 2.62

25.01 ± 0.58

27.00 ± 2.77

48.50 ± 2.79

54.27 ± 1.03

30.55 ± 2.01

15:1

ND

ND

ND

ND

ND

ND

16:1n7

1.46 ± 0.43

1.71 ± 0.12

ND

ND

3.91 ± 0.38

16.00 ± 3.19

18:1n9

10.63 ± 0.94

38.04 ± 0.46

30.78 ± 0.89

18.38 ± 1.57

7.25 ± 1.79

5.03 ± 2.00

18:1n7

1.46 ± 0.42

1.17 ± 0.02

ND

1.13 ± 0.06

1.58 ± 0.10

1.98 ± 0.25

20:1n9

ND

2.08 ± 0.42

2.81 ± 0.63

ND

ND

ND

MUFA

13.55 ± 1.33

43.01 ± 0.23

33.59 ± 1.49

19.51 ± 1.63

12.74 ± 1.77

23.01 ± 3.37

18:2n6

5.18 ± 1.65

24.48 ± 0.43

25.47 ± 0.38

16.12 ± 1.06

4.19 ± 0.87

1.32 ± 0.71

18:3n3

0.92 ± 0.20

6.60 ± 0.29

5.67 ± 0.28

8.93 ± 0.27

13.60 ± 2.10

4.85 ± 0.98

20:2

ND

ND

ND

ND

ND

ND

20:3n3

ND

ND

ND

ND

ND

ND

20:3n6

ND

ND

ND

ND

15.19 ± 1.82

ND

20:5n3

1.84 ± 0.40

ND

8.27 ± 0.72

6.95 ± 0.59

ND

40.27 ± 0.96

22:6n3

1.45 ± 0.34

ND

ND

ND

ND

ND

PUFA

9.40 ± 2.15

31.08 ± 0.72

39.41 ± 1.28

31.99 ± 1.43

32.97 ± 1.07

46.44 ± 1.88

Inter-Site Differences and Seasonal Patterns…

15

Table 6. Fatty acid profiles (%) of total particulate matters in waters from North Point (Mean ± 1SD; n = 3). SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid; ND: not detected Fatty acids

09/04

11/04

01/05

03/05

05/05

07/05

14:0

0.31 ± 0.29

0.60 ± 0.50

ND

0.02 ± 0.02

ND

0.73 ± 0.97

15:0

ND

ND

ND

ND

ND

ND

16:0

26.03 ± 0.45

23.62 ± 0.28

17.87 ± 1.63

20.73 ± 1.90

15.08 ± 0.24

21.31 ± 0.50

17:0

0.60 ± 0.06

ND

0.42 ± 0.73

ND

2.83 ± 2.28

ND

18:0

31.42 ± 1.65

23.07 ± 1.51

10.64 ± 1.82

21.79 ± 2.26

17.34 ± 1.71

10.38 ± 1.20

20:0

3.47 ± 0.49

5.24 ± 0.67

ND

ND

10.12 ± 2.84

ND

SFA

61.83 ± 1.24

52.53 ± 1.70

28.93 ± 0.21

42.54 ± 4.14

45.37 ± 0.94

32.42 ± 1.42

15:1

ND

ND

ND

ND

1.71 ± 0.28

ND

16:1n7

1.34 ± 0.17

2.90 ± 0.21

0.71 ± 0.64

0.85 ± 0.37

3.24 ± 0.42

13.48 ± 1.50

18:1n9

18.56 ± 0.95

15.07 ± 1.79

25.32 ± 2.82

18.63 ± 1.78

16.53 ± 2.90

6.42 ± 1.00

18:1n7

1.59 ± 0.06

2.18 ± 0.45

2.07 ± 0.13

1.31 ± 0.11

1.39 ± 0.06

3.17 ± 0.33

20:1n9

ND

ND

3.13 ± 0.81

2.52 ± 1.00

ND

ND

MUFA

21.49 ± 0.85

20.15 ± 1.60

31.23 ± 2.50

23.30 ± 0.97

22.87 ± 3.35

23.07 ± 2.53

18:2n6

11.33 ± 0.40

12.92 ± 0.53

23.72 ± 1.03

17.07 ± 1.57

9.26 ± 0.51

2.86 ± 0.88

18:3n3

1.45 ± 0.19

6.13 ± 0.21

5.69 ± 1.31

8.26 ± 0.30

8.73 ± 2.75

0.00

20:2

ND

ND

ND

ND

ND

ND

20:3n3

ND

ND

ND

ND

ND

ND

0:3n6

ND

ND

ND

ND

13.77 ± 0.40

ND

20:5n3

1.74 ± 0.28

4.28 ± 0.46

10.42 ± 2.11

5.68 ± 1.03

ND

41.65 ± 1.18

22:6n3

2.15 ± 0.46

3.99 ± 0.34

ND

3.15 ± 1.71

ND

ND

PUFA

14.53 ± 0.62

27.31 ± 0.21

39.83 ± 2.53

34.16 ± 3.41

31.76 ± 3.17

44.51 ± 2.01

S. G. Cheung and P. K. S. Shin

16

Table 7. Fatty acid profiles (%) of total particulate matters in waters from Kwun Tong (Mean ± 1SD; n = 3). SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid; ND: not detected Fatty acids

09/04

11/04

01/05

03/05

05/05

07/05

14:0

8.42 ± 0.14

1.99 ± 0.02

0.01 ± 0.01

ND

ND

5.43 ± 0.23

15:0

ND

ND

ND

ND

ND

ND

16:0

30.84 ± 0.26

19.87 ± 0.39

17.46 ± 0.40

25.68 ± 3.22

16.70 ± 1.21

13.78 ± 1.73

17:0

0.50 ± 0.06

0.55 ± 0.13

0.35 ± 0.50

1.66 ± 1.13

5.32 ± 0.81

0.00

18:0

23.46 ± 4.46

10.65 ± 1.90

5.29 ± 1.25

28.25 ± 1.54

19.90 ± 1.38

3.00 ± 0.61

20:0

4.07 ± 0.54

1.62 ± 0.11

ND

ND

10.13 ± 0.67

1.42 ± 2.46

SFA

67.30 ± 4.37

34.13 ± 2.19

23.11 ± 1.72

55.59 ± 1.27

52.05 ± 1.37

23.64 ± 3.94

15:1

ND

ND

ND

ND

3.16 ± 1.01

ND

16:1n7

12.02 ± 1.19

5.88 ± 0.26

7.64 ± 0.75

1.38 ± 1.28

3.30 ± 0.68

16.49 ± 1.37

18:1n9

5.37 ± 0.89

29.48 ± 2.00

27.37 ± 1.92

6.79 ± 1.67

7.49 ± 0.73

3.13 ± 0.82

18:1n7

1.40 ± 0.22

2.75 ± 0.20

3.29 ± 0.05

1.76 ± 0.66

1.74 ± 0.13

1.11 ± 0.05

20:1n9

ND

1.27 ± 0.08

2.02 ± 0.54

ND

ND

ND

MUFA

18.79 ± 2.20

39.38 ± 2.48

40.32 ± 1.91

9.93 ± 1.93

15.68 ± 0.76

20.72 ± 2.17

18:2n6

2.65 ± 0.25

17.37 ± 0.72

19.55 ± 1.25

11.62 ± 1.60

7.34 ± 1.80

0.86 ± 0.05

18:3n3

0.76 ± 0.14

2.89 ± 0.33

3.51 ± 0.84

13.29 ± 0.53

11.14 ± 0.85

1.43 ± 0.23

20:2

ND

ND

ND

ND

ND

ND

20:3n3

ND

ND

ND

ND

ND

ND

20:3n6

ND

ND

ND

ND

12.61 ± 0.86

ND

20:5n3

7.57 ± 1.71

2.26 ± 0.22

6.25 ± 0.19

9.56 ± 1.82

ND

24.92 ± 5.39

22:6n3

2.93 ± 0.54

3.42 ± 0.82

5.50 ± 1.75

ND

ND

28.43 ± 0.65

PUFA

13.90 ± 2.22

25.94 ± 0.35

34.81 ± 1.06

34.48 ± 2.80

31.08 ± 1.58

55.64 ± 5.10

Inter-Site Differences and Seasonal Patterns…

17

Inter-Site Difference and Seasonal Changes in Fatty Acid Profiles of Total Particulate Matters in Waters from Victoria Harbour and Reference Sites The results of analysis of similarity (ANOSIM) showed that there were significant intersite differences in the fatty acid profiles of TPMs in waters from the six sampling sites in Victoria Harbour and reference sites (Global test of ANOSIM, R = 0.972, p = 0.001). Similarly, the fatty acid profiles of TPMs in waters were also significantly different from each other (Global test of ANOSIM, R = 0.998, p = 0.001) among the six sampling months.

Figure 7. Similarity (%) of the fatty acid profiles of total particulate matters (TPM) in waters from Victoria Harbour and reference sites collected from September 2004 to July 2005. PC: Peng Chau, NP: North Point, KT: Kwun Tong, TST: Tsim Sha Tsui, C: Central, TLC: Tung Lung Chau; 09: Sept. 04, 11: Nov. 04, 01: Jan. 05, 03: Mar. 05, 05: May 05, 07: Jul. 05; W: TPMs in waters.

Hierarchical cluster analysis of the fatty acid profiles of TPMs in waters from Victoria Harbour and reference sites mainly separated the sampling period (September 2004 to July 2005) into four temporal groups at a similarity level of 60% (Figure 7). Group 1 comprised the fatty acid profiles of TPMs collected from PC, NP, TST and TLC in September 2004 and November 2004, and all sites in March 2005. Group 2 mainly contained all sites for May 2005 samplings. Group 3 mainly consisted of NP, KT, TST and C samples in January 2005. Group 4 largely comprised KT, TST, C and TLC samples in July 2005. Repeated-measures MANOVA were performed to find the overall inter-site and seasonal differences in each chosen fatty acid in TPMs from waters. For inter-site difference, the percentages of SFAs 15:0, 16:0 and 18:0, and PUFA 18:3n3 collected from reference sites (PC and TLC) were significantly higher than those from Victoria Harbour (C, TST, NP and KT) except 15:0 at TST, 16:0 at C and 18:3n3 at KT. The percentage of SFA 14:0 was significantly higher for KT and TLC. For SFA 20:0 and MUFA 20:1n9, the percentages were higher in Victoria Harbour than at the reference sites, except KT. For MUFAs 18:1n9 and 18:1n7 and PUFA 18:2n6, their percentages from the sites in Victoria Harbour were significantly higher than from the two reference sites. For MUFA 18:1n9 and PUFA 18:2n6, the percentages were significantly higher for TST and NP than C and KT. For MUFA 18:1n7, the percentages were significantly higher for NP and KT than C and TST. In KT, the percentages of MUFA 16:1n7 and PUFAs 20:5n3 and 22:6n3 were the highest among all the sampling sites. For seasonal difference, the percentages of SFAs 14:0, 16:0 and 18:0 were the highest in September 2004. For SFA 14:0, the percentage was the lowest in January, March and May

18

S. G. Cheung and P. K. S. Shin

2005. For SFA 16:0, the percentage was the lowest in January and May 2005. For SFA 18:0, the percentage was the lowest in January and July 2005. For SFA 17:0, the percentages were the highest in May 2005. For MUFA 16:1n7, the percentage was significantly higher in the summer period (May 2005 and July 2005) than in the winter months (November 2004, January 2005 and March 2005). In contrast, the percentages of MUFAs 18:1n9 and 20:1n9 and PUFA 18:2n6 were significantly higher in the winter months than in summer. For MUFA 18:1n7 and PUFAs 20:5n3 and 22:6n3, the percentages were significantly higher in January 2005 and July 2005 than in the other months. For PUFAs 20:2, 20:3n3 and 20:4n6, they were not detected in TPMs in waters from all sites.

Fatty Acid Profiles in Gonad of Green Mussels from Victoria Harbour and Reference Sites Tables 8–13 show the fatty acid profiles of the gonad and soma of mussels collected from Victoria Harbour and reference sites from September 2004 to July 2005. For reference sites PC (Table 8) and TLC (Table 9), the fatty acid profile of the gonads of the mussels was composed mainly of SFAs (30–49%) and PUFAs (32–54%). MUFAs were present at a lower level (14–19%) compared with SFAs and PUFAs. For Victoria Harbour (NP, KT, TST, C) (Tables 10-13), the fatty acid profile of the gonad was mainly comprised of PUFAs (39– 55%), followed by SFAs (22–41%) and MUFAs (18–29%). The main SFAs present were 14:0, 16:0 and 18:0, the major MUFAs were 16:1n7, 18:1n9 and 20:1n9, and the dominant PUFAs were 18:2n6, 20:4n6, 20:5n3 and 22:6n3.

Inter-Site Difference and Seasonal Changes in Fatty Acid Profiles in Gonad of Green Mussels from Victoria Harbour and Reference Sites Analysis of similarity (ANOSIM) was carried out to show the seasonal changes and intersite differences in the fatty profiles in gonad of green mussels in Victoria Harbour and reference sites. The results showed that there were significant inter-site differences in the fatty acid profiles in the gonad of green mussels from the six sampling sites in Victoria Harbour and reference sites (Global test of ANOSIM, R = 0.941, p = 0.001). The fatty acid profiles in gonad of mussels were also significantly different from each other (Global test of ANOSIM, R = 0.931, p = 0.001), among the six sampling months. Hierarchical cluster analysis of the fatty acid profiles of the gonads of the mussels separated the data into two groups and one standalone sample (January 2005 sample from North Point) at a similarity level of 79% (Figure 8). Group 1 comprised the fatty acid profiles of the gonad collected mostly from the reference sites (PC and TLC), together with KT and two TST samples in Victoria Harbour. Group 2 comprised mainly mussels collected from NP, TST and C in Victoria Harbour, together with one sample from KT (May 2005) and TLC (March 2005), respectively.

Table 8. Fatty acid profiles (%) of gonad and soma of mussels from Peng Chau (Mean ± 1SD; n = 3). SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid; ND: not detected

30.43 ± 0.40 1.39 ± 0.07 9.24 ± 0.32 ND

11/04 6.15 ± 0.53 0.20 ± 0.18 22.56 ± 2.39 1.06 ± 0.21 3.98 ± 1.47 ND

01/05 6.42 ± 0.63 0.13 ± 0.12 24.65 ± 1.16 1.34 ± 0.16 5.37 ± 0.10 ND

03/05 3.25 ± 0.35 0.09 ± 0.08 19.62 ± 0.88 1.35 ± 0.11 6.57 ± 0.48 ND

05/05 4.06 ± 0.31 0.20 ± 0.04 20.77 ± 1.00 1.24 ± 0.06 7.49 ± 0.71 ND

07/05 4.53 ± 0.29 0.33 ± 0.04 24.49 ± 0.45 1.33 ± 0.02 6.34 ± 0.16 ND

Soma 09/04 9.57 ± 0.50 0.25 ± 0.09 30.25 ± 0.96 1.52 ± 0.13 8.51 ± 0.65 ND

11/04 6.29 ± 1.05 0.25 ± 0.15 23.18 ± 3.39 1.26 ± 0.30 5.21 ± 0.78 ND

01/05 6.45 ± 0.40 0.02 ± 0.02 24.83 ± 0.26 1.53 ± 0.04 6.53 ± 0.29 ND

03/05 2.73 ± 0.45 0.15 ± 0.26 18.72 ± 0.95 1.59 ± 0.23 6.96 ± 0.72 ND

05/05 2.57 ± 0.34 0.03 ± 0.03 18.11 ± 1.13 1.54 ± 0.18 8.59 ± 1.03 ND

07/05 4.36 ± 0.70 0.09 ± 0.16 20.90 ± 1.13 1.34 ± 0.21 7.26 ± 0.73 ND

SFA

49.38 ± 0.93

33.95 ± 4.49

37.92 ± 2.07

30.89 ± 1.82

33.76 ± 1.40

37.02 ± 0.90

50.11 ± 0.66

36.19 ± 5.60

39.35 ± 0.57

30.16 ± 1.32

30.84 ± 1.91

33.95 ± 1.53

15:1

ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

16:1n7

13.97 ± 0.60 0.77 ± 0.10 2.04 ± 0.08 1.98 ± 0.12 18.76 ± 0.85

12.97 ± 1.12 0.67 ± 0.13 2.04 ± 0.15 2.35 ± 0.25 18.04 ± 0.93

11.58 ± 0.38 0.96 ± 0.04 1.89 ± 0.03 2.78 ± 0.31 17.20 ± 0.14

8.09 ± 0.43 1.17 ± 0.03 1.87 ± 0.01 4.47 ± 0.02 15.61 ± 0.42

8.26 ± 0.13 1.08 ± 0.10 1.83 ± 0.04 5.36 ± 0.19 16.53 ± 0.29

10.46 ± 0.19 1.19 ± 0.03 1.87 ± 0.05 4.24 ± 0.05 17.77 ± 0.12

16.44 ± 1.47 0.92 ± 0.04 2.04 ± 0.05 2.04 ± 0.26 21.43 ± 1.44

11.88 ± 1.54 0.90 ± 0.15 1.79 ± 0.21 2.43 ± 0.17 17.00 ± 2.04

12.00 ± 0.21 1.10 ± 0.08 1.85 ± 0.04 3.72 ± 0.59 18.68 ± 0.39

6.64 ± 0.93 1.37 ± 0.20 1.59 ± 0.17 5.26 ± 0.35 14.87 ± 0.50

6.90 ± 0.38 1.27 ± 0.13 1.63 ± 0.13 6.05 ± 0.38 15.85 ± 0.47

9.96 ± 0.53 1.35 ± 0.15 1.90 ± 0.14 4.86 ± 0.27 18.07 ± 0.43

Fatty acids 14:0 15:0 16:0 17:0 18:0 20:0

18:1n9 18:1n7 20:1n9 MUFA

Gonad 09/04 8.32 ± 0.46 ND

Table 8. (Continued)

20:2

Gonad 09/04 1.22 ± 0.28 0.65 ± 0.07 ND

20:3n3

ND

20:3n6

ND

1.39 ± 0.18 ND

20:4n6

3.33 ± 0.27 16.75 ± 0.74 9.91 ± 1.01 31.85 ± 1.15

4.71 ± 0.63 23.47 ± 1.90 14.98 ± 1.43 48.01 ± 4.06

Fatty acids 18:2n6 18:3n3

20:5n3 22:6n3 PUFA

11/04 1.71 ± 0.11 1.76 ± 0.17 ND

01/05 1.72 ± 0.11 1.49 ± 0.26 ND

05/05 1.96 ± 0.15 1.64 ± 0.37 ND

ND

03/05 1.70 ± 0.04 1.93 ± 0.28 1.48 ± 0.11 ND

ND

ND

ND

07/05 1.81 ± 0.08 1.93 ± 0.02 1.16 ± 0.10 1.40 ± 0.23 ND

3.64 ± 0.18 22.32 ± 1.02 15.70 ± 1.06 44.83 ± 2.58

3.76 ± 0.04 26.64 ± 1.17 18.00 ± 0.86 53.51 ± 2.23

3.20 ± 0.49 22.64 ± 0.42 20.27 ± 1.50 49.71 ± 1.35

3.83 ± 0.17 16.79 ± 0.45 18.30 ± 0.59 44.05 ± 1.12

ND

Soma 09/04 1.49 ± 0.08 0.61 ± 0.45 ND

11/04 1.82 ± 0.21 1.53 ± 0.14 ND

01/05 2.08 ± 0.13 1.64 ± 0.26 ND

ND

ND

ND 3.49 ± 0.11 14.53 ± 1.08 8.33 ± 1.38 28.46 ± 2.09

05/05 2.27 ± 0.13 1.57 ± 0.42 ND

ND

03/05 1.74 ± 0.08 1.92 ± 0.38 0.48 ± 0.84 ND

ND

ND

ND

ND

07/05 2.08 ± 0.40 1.79 ± 0.24 1.18 ± 0.22 0.39 ± 0.67 ND

4.54 ± 0.46 18.71 ± 1.86 13.84 ± 1.05 40.43 ± 3.55

3.70 ± 0.14 18.65 ± 0.53 15.90 ± 0.23 41.97 ± 0.45

4.33 ± 0.35 24.34 ± 0.54 22.16 ± 0.95 53.06 ± 1.21

5.29 ± 0.51 20.12 ± 0.76 24.07 ± 1.61 53.31 ± 2.38

5.16 ± 0.23 15.27 ± 0.70 22.11 ± 2.38 47.98 ± 1.96

ND

Table 9. Fatty acid profiles (%) of gonad and soma of mussels from Tung Lung Chau (Mean ± 1SD; n = 3). SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid; ND: not detected Gonad 09/04 4.87 ± 0.17 ND

11/04 3.05 ± 0.09 ND 21.08 ± 1.13 1.32 ± 0.13 5.04 ± 0.69 ND

01/05 4.36 ± 0.48 0.16 ± 0.14 23.72 ± 1.12 1.63 ± 0.04 5.47 ± 0.16 ND

03/05 1.93 ± 0.19 0.22 ± 0.06 22.18 ± 0.96 2.01 ± 0.16 7.36 ± 0.67 ND

05/05 3.82 ± 0.96 0.49 ± 0.32 19.61 ± 0.91 1.55 ± 0.15 6.58 ± 0.52 ND

07/05 4.81 ± 0.24 0.16 ± 0.14 19.21 ± 0.57 1.12 ± 0.01 7.81 ± 0.16 ND

Soma 09/04 4.73 ± 0.88 0.04 ± 0.06 26.39 ± 3.30 1.44 ± 0.19 7.98 ± 1.04 ND

29.46 ± 0.51 1.64 ± 0.20 9.09 ± 1.56 ND

SFA

45.08 ± 2.01

30.48 ± 1.99

35.35 ± 1.90

33.69 ± 1.98

32.04 ± 1.65

33.11 ± 0.91

15:1

ND

ND

ND

ND

ND

16:1n7

7.22 ± 0.55 1.41 ± 0.09 1.80 ± 0.12 3.98 ± 0.32 14.41 ± 0.47

7.78 ± 0.27 1.95 ± 0.07 1.82 ± 0.06 4.29 ± 0.17 15.84 ± 0.38

8.98 ± 0.31 1.99 ± 0.04 1.59 ± 0.04 3.92 ± 0.25 16.48 ± 0.07

5.16 ± 0.25 5.00 ± 0.05 1.51 ± 0.04 5.88 ± 0.11 17.55 ± 0.36

6.70 ± 0.68 1.77 ± 0.09 1.40 ± 0.07 5.80 ± 0.69 15.67 ± 0.37

Fatty acids 14:0 15:0 16:0 17:0 18:0 20:0

18:1n9 18:1n7 20:1n9 MUFA

11/04 2.18 ± 0.51 ND

01/05 2.30 ± 1.39 ND

03/05 ND ND

05/05 4.13 ± 1.43 ND

20.64 ± 0.79 1.86 ± 0.14 6.55 ± 0.68 ND

19.35 ± 0.05 1.84 ± 0.09 6.18 ± 0.25 ND

13.77 ± 1.90 2.12 ± 0.53 6.37 ± 0.84 ND

21.18 ± 3.98 1.87 ± 0.14 7.91 ± 0.33 ND

07/05 7.54 ± 0.97 0.25 ± 0.16 21.55 ± 1.13 1.41 ± 0.11 7.92 ± 0.33 ND

40.57 ± 5.30

31.23 ± 0.84

29.67 ± 1.07

22.26 ± 3.24

35.08 ± 5.07

38.66 ± 1.28

ND

ND

ND

ND

ND

ND

ND

9.36 ± 0.38 1.13 ± 0.03 2.25 ± 0.02 4.22 ± 0.18 16.96 ± 0.32

7.37 ± 0.81 1.68 ± 0.15 1.90 ± 0.17 4.04 ± 0.42 15.00 ± 1.44

6.39 ± 0.29 3.03 ± 0.17 1.47 ± 0.10 5.34 ± 0.28 16.23 ± 0.32

5.91 ± 0.04 2.80 ± 0.25 1.31 ± 0.04 5.14 ± 0.24 15.15 ± 0.32

1.58 ± 0.47 3.25 ± 0.42 0.89 ± 0.12 7.59 ± 0.39 13.32 ± 0.95

7.28 ± 1.97 2.09 ± 0.04 1.25 ± 0.01 5.67 ± 1.13 16.29 ± 0.89

13.61 ± 0.56 1.29 ± 0.13 2.21 ± 0.11 3.06 ± 0.09 20.17 ± 0.87

Table 9. (Continued) Gonad

Soma

Fatty acids

09/04

11/04

01/05

03/05

05/05

07/05

09/04

11/04

01/05

03/05

05/05

07/05

18:2n6

1.83 ± 0.17

2.57 ± 0.03

2.58 ± 0.13

4.06 ± 0.14

2.37 ± 0.04

1.64 ± 0.03

2.20 ± 0.16

3.70 ± 0.18

3.70 ± 0.20

4.11 ± 0.14

3.43 ± 0.15

1.99 ± 0.23

18:3n3

1.20 ± 0.38 ND

1.46 ± 0.06 ND

1.26 ± 0.05 ND

1.17 ± 0.18 ND

0.46 ± 0.01 ND

0.77 ± 0.16 ND

1.59 ± 0.33 ND

1.83 ± 0.28 ND

1.87 ± 0.25 ND

0.19 ± 0.32 ND

20:3n3

1.15 ± 0.06 1.56 ± 0.16 ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

20:3n6

ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

0.55 ± 0.13 0.98 ± 0.07 1.48 ± 0.11 ND

20:4n6

3.81 ± 0.03 13.82 ± 1.04 18.34 ± 1.31 40.51 ± 2.17

6.28 ± 0.44 19.19 ± 0.11 24.44 ± 1.91 53.68 ± 2.25

5.31 ± 0.37 19.47 ± 0.89 19.35 ± 0.50 48.18 ± 1.90

4.86 ± 0.08 16.08 ± 0.75 22.50 ± 1.08 48.76 ± 1.96

4.28 ± 0.62 18.80 ± 0.80 25.66 ± 0.82 52 29 ± 1.55

5.60 ± 0.08 26.36 ± 0.61 15.86 ± 0.61 54.15 ± 1.24

4.98 ± 0.54 17.40 ± 0.97 24.26 ± 0.89 49.62 ± 2.43

7.67 ± 0.46 15.38 ± 0.12 24.20 ± 0.37 52.54 ± 0.88

7.78 ± 0.27 15.89 ± 0.05 25.98 ± 0.35 55.17 ± 0.98

8.87 ± 0.38 14.60 ± 0.61 34.96 ± 2.76 64.42 ± 3.36

5.74 ± 0.97 14.47 ± 1.45 24.80 ± 3.88 48.63 ± 5.90

5.23 ± 0.23 18.69 ± 1.12 12.25 ± 1.18 41.17 ± 2.05

20:2

20:5n3 22:6n3 PUFA

Table 10. Fatty acid profiles (%) of gonad and soma of mussels from North Point (Mean ± 1SD; n = 3). SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid Gonad

Soma

Fatty acids

09/04

11/04

01/05

03/05

05/05

07/05

09/04

11/04

01/05

03/05

05/05

07/05

14:0

2.94 ± 0.47 ND

0.21 ± 0.13 0.02 ± 0.02 16.49 ± 0.48 1.01 ± 0.07 4.88 ± 0.24 ND 22.61 ± 0.81

1.99 ± 0.77 0.27 ± 0.43 17.33 ± 2.43 1.25 ± 0.08 6.10 ± 0.35 ND 26.93 ± 3.19

1.23 ± 1.00 0.18 ± 0.23 16.23 ± 3.03 1.25 ± 0.09 5.59 ± 0.61 ND 24.48 ± 3.98

3.06 ± 0.28 0.14 ± 0.09 16.21 ± 0.51 1.22 ± 0.13 5.57 ± 0.06 ND 26.20 ± 0.62

ND

0.01 ± 0.01 ND

0.56 ± 0.16 ND

ND

ND

0.04 ± 0.07 ND

3.37 ± 0.95 ND

23.92 ± 1.07 0.91 ± 0.12 4.03 ± 0.37 ND 31.80 ± 1.50

1.07 ± 0.59 0.02 ± 0.02 18.50 ± 0.18 0.85 ± 0.08 4.72 ± 0.42 ND 25.16 ± 0.11

17.62 ± 0.25 0.72 ± 0.17 2.23 ± 0.82 ND 20.58 ± 1.13

13.69 ± 1.87 0.59 ± 0.05 2.49 ± 0.78 ND 16.82 ± 2.74

13.84 ± 0.45 0.85 ± 0.08 3.94 ± 0.50 ND 18.65 ± 0.97

13.21 ± 1.09 1.81 ± 0.36 5.66 ± 0.22 ND 21.24 ± 1.22

12.05 ± 0.67 1.30 ± 0.12 5.79 ± 0.07 ND 19.15 ± 0.77

15.44 ± 1.33 ND

ND 5.88 ± 0.51 8.96 ± 0.36 1.60 ± 0.08 5.46 ± 0.50 21.90 ± 0.75

ND 3.81 ± 0.57 16.15 ± 0.12 1.36 ± 0.02 3.57 ± 0.33 24.88 ± 0.31

ND 2.34 ± 0.16 21.83 ± 0.19 1.29 ± 0.05 3.51 ± 0.17 28.97 ± 0.24

ND 4.11 ± 0.72 11.97 ± 0.31 1.41 ± 0.04 5.02 ± 0.74 22.51 ± 0.62

ND 2.58 ± 0.79 13.08 ± 0.44 1.22 ± 0.05 8.61 ± 0.87 25.50 ± 0.79

ND 5.74 ± 0.41 6.58 ± 0.18 1.58 ± 0.03 8.05 ± 0.32 21.95 ± 0.74

ND 2.46 ± 0.38 10.86 ± 0.07 1.69 ± 0.17 6.29 ± 0.82 21.30 ± 0.66

ND 2.49 ± 0.21 21.98 ± 0.59 1.20 ± 0.02 3.85 ± 0.49 29.52 ± 0.26

ND 1.95 ± 0.05 29.09 ± 0.27 1.24 ± 0.01 3.49 ± 0.11 35.77 ± 0.30

ND 2.29 ± 0.24 18.72 ± 2.11 1.28 ± 0.12 6.68 ± 0.78 28.97 ± 2.62

ND 1.46 ± 0.27 15.26 ± 0.66 1.24 ± 0.23 9.68 ± 1.02 27.64 ± 0.44

ND 5.97 ± 0.66 8.43 ± 0.25 1.23 ± 0.27 7.63 ± 0.84 23.25 ± 0.24

18:2n6

11.12 ± 0.38

18.05 ± 0.06

24.80 ± 0.42

13.39 ± 0.27

14.59 ± 0.47

9.43 ± 0.21

13.76 ± 0.42

24.46 ± 0.72

28.11 ± 0.87

16.54 ± 0.84

16.23 ± 1.07

12.27 ± 0.63

18:3n3

0.77 ± 0.05

1.11 ± 0.15

1.18 ± 0.13

0.22 ± 0.37

0.52 ± 0.13

0.71 ± 0.21

ND

2.26 ± 0.34

1.39 ± 0.10

0.96 ± 0.21

1.02 ± 0.24

0.78 ± 0.22

15:0 16:0 17:0 18:0 20:0 SFA

15:1 16:1n7 18:1n9 18:1n7 20:1n9 MUFA

ND

6.28 ± 0.18 ND 25.09 ± 2.26

Table 10. (Continued) Gonad

Soma

Fatty acids

09/04

11/04

01/05

03/05

05/05

07/05

09/04

11/04

01/05

03/05

05/05

07/05

20:2

1.56 ± 0.04 ND

ND

ND

ND

ND

ND

ND

2.06 ± 0.73 ND

ND

ND

1.81 ± 0.48 ND

ND

20:3n3

2.41 ± 0.15 ND

ND

ND

ND

ND

ND

1.85 ± 0.09 ND

20:3n6

ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

20:4n6

2.73 ± 0.19 14.79 ± 0.46 14.47 ± 1.81 46.30 ± 1.85

3.28 ± 0.19 11.91 ± 0.05 14.06 ± 0.34 49.96 ± 0.37

2.99 ± 0.06 8.60 ± 0.38 10.84 ± 0.74 48.41 ± 0.95

3.33 ± 0.28 16.04 ± 1.51 17.59 ± 1.40 50.57 ± 2.87

2.84 ± 0.61 11.50 ± 1.12 18.72 ± 5.77 50.03 ± 4.11

4.64 ± 0.96 17.56 ± 0.18 17.44 ± 0.76 51.85 ± 1.31

5.00 ± 0.19 13.25 ± 0.33 26.11 ± 0.97 58.13 ± 1.31

3.64 ± 0.64 8.92 ± 0.38 14.39 ± 0.81 53.67 ± 2.53

2.65 ± 0.11 4.81 ± 0.25 8.62 ± 0.04 44.19 ± 1.19

4.54 ± 0.97 11.05 ± 0.99 16.71 ± 1.77 49.79 ± 3.22

5.48 ± 0.20 9.82 ± 0.30 20.65 ± 1.24 53.22 ± 0.87

5.62 ± 0.59 14.13 ± 1.16 16.99 ± 1.18 51.65 ± 2.11

20:5n3 22:6n3 PUFA

Table 11. Fatty acid profiles (%) of gonad and soma of mussels from Kwun Tong (Mean ± 1SD; n = 3). SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid Gonad 09/04 5.58 ± 0.33 0.20 ± 0.12 28.23 ± 0.67 1.61 ± 0.28 5.53 ± 0.43 ND

11/04 4.80 ± 0.42 0.21 ± 0.18 23.30 ± 1.56 1.06 ± 0.08 4.08 ± 0.32 ND

01/05 4.51 ± 0.26 0.04 ± 0.05 21.37 ± 0.37 1.24 ± 0.08 4.43 ± 0.36 ND

03/05 4.21 ± 0.32 ND

SFA

41.16 ± 1.43

33.44 ± 2.48

15:1

ND

16:1n7

11.40 ± 0.08 2.03 ± 0.03 2.51 ± 0.07 3.92 ± 0.25 19.85 ± 0.19

Fatty acids 14:0 15:0 16:0 17:0 18:0 20:0

18:1n9 18:1n7 20:1n9 MUFA

11/04 3.05 ± 0.63 0.03 ± 0.05 21.51 ± 1.23 1.37 ± 0.14 4.69 ± 0.84 ND

01/05 4.09 ± 0.45 0.27 ± 0.15 22.83 ± 1.20 1.68 ± 0.10 6.04 ± 0.51 ND

03/05 0.98 ± 0.33 ND

21.12 ± 0.56 1.42 ± 0.13 5.81 ± 0.21 ND

Soma 09/04 5.36 ± 0.22 0.23 ± 0.03 28.89 ± 1.44 1.77 ± 0.11 6.65 ± 0.50 ND

24.56 ± 4.30

32.34 ± 0.78

42.89 ± 2.18

30.65 ± 2.82

ND

ND

ND

ND

10.01 ± 0.99 3.27 ± 0.08 2.34 ± 0.23 5.48 ± 0.05 21.11 ± 1.11

4.75 ± 2.84 4.36 ± 0.65 1.96 ± 0.38 9.48 ± 1.94 20.55 ±1.55

8.75 ± 0.40 2.49 ± 0.26 2.20 ± 0.04 4.87 ± 0.23 18.31 ± 0.63

11.44 ± 0.42 2.39 ± 0.11 2.41 ± 0.07 3.85 ± 0.22 20.09 ± 0.46

07/05 3.99 ± 0.46 ND

20.29 ± 2.43 1.93 ± 0.67 4.80 ± 0.24 ND

05/05 0.59 ± 1.02 0.07 ± 0.11 15.95 ± 3.25 1.58 ± 0.23 6.37 ± 1.05 ND

31.59 ± 0.65

31.23 ± 3.34

ND

ND

10.94 ± 0.35 1.93 ± 0.25 2.41 ± 0.06 3.87 ± 0.17 19.16 ± 0.44

11.28 ± 0.25 2.89 ± 0.05 2.50 ± 0.06 4.00 ± 0.35 20.68 ± 0.21

07/05 5.10 ± 0.14 ND

17.49 ± 0.56 1.77 ± 0.06 6.95 ± 0.51 ND

05/05 0.74 ± 1.12 0.10 ± 0.16 14.49 ± 2.91 0.37 ± 0.64 5.72 ± 1.11 ND

34.91 ± 2.15

27.18 ± 0.54

21.41 ± 4.07

33.98 ± 0.82

ND

ND

ND

ND

ND

9.45 ± 0.60 2.72 ± 0.14 2.35 ± 0.11 4.57 ± 0.25 19.09 ± 0.94

10.99 ± 0.39 3.71 ± 0.29 2.55 ± 0.12 5.30 ± 0.36 22.55 ± 0.53

6.42 ± 0.42 4.24 ± 0.11 2.48 ± 0.05 7.53 ± 0.45 20.67 ± 0.25

4.77 ± 3.63 5.55 ± 1.85 1.99 ± 0.56 8.94 ± 1.04 21.25 ± 1.65

10.44 ± 0.30 2.28 ± 0.93 1.90 ± 0.15 5.84 ± 1.04 20.46 ± 2.33

22.06 ± 1.54 0.43 ± 0.74 6.40 ± 0.02 ND

Table 11. (Continued)

20:3n3

Gonad 09/04 3.36 ± 0.09 1.00 ± 0.30 1.31 ± 0.05 ND

20:3n6

ND

11/04 3.75 ± 0.10 1.70 ± 0.10 1.84 ± 0.06 1.92 ± 0.10 ND

20:4n6

2.27 ± 0.31 17.66 ± 0.58 13.38 ± 1.63 38.99 ± 1.48

3.15 ± 0.40 19.97 ± 1.02 15.08 ± 1.16 47.40 ± 2.63

Fatty acids 18:2n6 18:3n3 20:2

20:5n3 22:6n3 PUFA

07/05 4.19 ± 0.13 0.97 ± 0.25 0.00

ND

05/05 6.32 ± 0.67 0.86 ± 0.19 1.74 ± 0.21 ND

ND

ND

ND

ND

Soma 09/04 3.93 ± 0.10 1.00 ± 0.01 1.32 ± 0.04 1.35 ± 0.06 ND

2.63 ± 0.14 23.53 ± 0.30 15.20 ± 0.57 47.73 ± 0.70

ND

5.48 ± 1.35 17.31 ± 4.05 23.18 ± 4.47 54.88 ± 5.66

3.76 ± 0.85 21.00 ± 1.19 19.42 ± 0.76 49.34 ± 1.15

2.67 ± 0.26 15.31 ± 0.96 11.45 ± 1.06 36.02 ± 2.32

01/05 4.96 ± 0.06 1.40 ± 0.30 ND

03/05 5.15 ± 0.34 0.62 ± 1.07 ND

ND

22.74 ± 1.22 19.15 ± 3.04 47.66 ± 4.45

ND

11/04 5.08 ± 0.33 2.07 ± 0.50 ND

01/05 5.52 ± 0.13 1.20 ± 0.28 ND

03/05 6.10 ± 0.12 0.00

ND

05/05 7.15 ± 1.81 1.20 ± 0.74 1.69 ± 0.21 ND

07/05 4.34 ± 2.36 1.35 ± 0.20 0.33 ± 0.56 ND

ND

ND

ND 5.12 ± 0.69 19.36 ± 1.10 18.63 ± 0.98 50.26 ± 2.55

ND

ND

ND

ND

3.15 ± 0.19 18.86 ± 1.07 13.81 ± 1.16 42.53 ± 2.40

4.62 ± 0.30 20.63 ± 0.41 20.80 ± 0.18 52.15 ± 0.51

4.98 ± 1.29 20.19 ± 1.82 22.13 ± 3.41 55.65 ± 5.56

4.07 ± 1.06 16.08 ± 1.26 19.39 ± 4.30 45.56 ± 3.08

ND

Table 12. Fatty acid profiles (%) of gonad and soma of mussels from Tsim Sha Tsui (Mean ± 1SD; n = 3). SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid Gonad

Soma

Fatty acids

09/04

11/04

01/05

03/05

05/05

07/05

09/04

11/04

01/05

03/05

05/05

07/05

14:0

5.56 ± 0.41 0.30 ± 0.04 28.05 ± 2.88 1.37 ± 0.13 6.17 ± 0.32 ND

4.43 ± 1.21 0.05 ± 0.05 22.10 ± 1.94 1.19 ± 0.18 4.32 ± 0.08 ND

2.84 ± 0.40 ND

0.93 ± 0.09 ND

4.91 ± 1.49 ND

1.04 ± 0.16 ND

0.26 ± 0.23 ND

20.22 ± 2.45 0.34 ± 0.58 6.10 ± 0.25 ND

20.91 ± 1.09 1.81 ± 0.90 4.73 ± 0.06 ND

15.96 ± 0.33 1.01 ± 0.08 4.15 ± 0.32 ND

11.17 ± 1.07 ND 4.49 ± 0.42 ND

1.44 ± 0.83 0.06 ± 0.09 16.40 ± 2.19 2.02 ± 0.38 6.97 ± 0.63 ND

3.64 ± 0.52 ND

14.28 ± 0.54 0.99 ± 0.77 5.31 ± 0.23 ND

9.27 ± 0.58 0.29 ± 0.01 32.14 ± 1.18 1.60 ± 0.10 8.42 ± 0.77 ND

3.04 ± 0.75 ND

19.31 ± 0.46 1.05 ± 0.12 4.52 ± 0.29 ND

1.79 ± 0.37 0.15 ± 0.02 15.31 ± 0.44 1.23 ± 0.03 5.77 ± 0.52 ND

SFA

41.44 ± 3.28

32.10 ± 3.12

27.73 ± 0.81

21.51 ± 0.87

24.24 ± 0.64

31.23 ± 3.76

51.72 ± 2.50

30.49 ± 2.62

22.15 ± 0.64

15.92 ± 1.31

26.88 ± 2.99

27.52 ± 2.76

15:1

ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

ND

16:1n7

7.84 ± 0.84 5.20 ± 0.22 1.55 ± 0.05 4.26 ± 0.54 18.85 ± 0.65

6.98 ± 0.69 5.83 ± 0.34 1.59 ± 0.15 4.58 ± 0.52 18.98 ± 0.61

5.13 ± 0.30 12.86 ± 0.26 1.47 ± 0.07 4.57 ± 0.05 24.04 ± 0.36

3.12 ± 0.15 13.46 ± 0.44 1.38 ± 0.02 6.19 ± 0.24 24.16 ± 0.35

3.27 ± 0.15 9.94 ± 0.32 1.28 ± 0.08 8.06 ± 0.27 22.56 ± 0.26

8.10 ± 1.72 3.89 ± 0.17 1.61 ± 0.08 7.08 ± 0.72 20.68 ± 1.44

16.43 ± 0.49 0.90 ± 0.08 2.02 ± 0.09 1.95 ± 0.34 21.30 ± 0.23

5.59 ± 0.56 7.49 ± 0.54 1.43 ± 0.10 5.80 ± 0.42 20.31 ± 0.58

3.15 ± 0.18 24.38 ± 1.67 1.35 ± 0.02 4.60 ± 0.25 33.48 ± 1.28

1.59 ± 0.38 22.90 ± 1.04 1.17 ± 0.17 6.83 ± 0.22 32.49 ± 1.41

2.71 ± 0.55 11.64 ± 0.31 1.19 ± 0.07 8.67 ± 0.60 24.20 ± 0.42

7.57 ± 1.22 5.31 ± 0.26 1.59 ± 0.08 7.64 ± 0.42 22.10 ± 0.71

15:0 16:0 17:0 18:0 20:0

18:1n9 18:1n7 20:1n9 MUFA

16.47 ± 2.17 1.28 ± 0.25 6.13 ± 0.62 ND

Table 12. (Continued)

20:3n3

Gonad 09/04 7.32 ± 0.37 0.90 ± 0.07 1.31 ± 0.07 ND

20:3n6

ND

ND

ND

ND

ND

ND

1.33 ± 0.29 ND

20:4n6

2.52 ± 0.25 13.33 ± 0.84 14.35 ± 3.00 39.72 ± 3.77

3.48 ± 0.47 17.68 ± 1.31 18.72 ± 1.33 48.93 ± 3.01

3.56 ± 0.11 14.02 ± 0.38 15.80 ± 0.24 48.23 ± 0.56

4.01 ± 0.38 15.99 ± 0.26 18.54 ± 0.50 54.34 ± 0.79

4.08 ± 0.30 14.73 ± 0.07 22.03 ± 0.76 52.42 ± 0.70

4.40 ± 0.58 18.90 ± 1.68 15.78 ± 2.57 47.75 ± 4.65

3.30 ± 0.24 13.00 ± 1.33 6.96 ± 0.78 26.98 ± 2.63

Fatty acids 18:2n6 18:3n3 20:2

20:5n3 22:6n3 PUFA

11/04 7.78 ± 0.37 1.27 ± 0.20 ND

01/05 13.59 ± 0.36 1.26 ± 0.07 ND ND

03/05 13.45 ± 0.33 0.85 ± 0.05 1.49 ± 0.13 ND

05/05 9.87 ± 0.45 0.78 ± 0.21 1.72 ± 0.26 ND

07/05 5.56 ± 0.34 0.39 ± 0.34 2.72 ± 0.41 ND

ND

Soma 09/04 1.42 ± 0.04 0.97 ± 0.03 ND

11/04 9.71 ± 0.46 1.03 ± 0.20 ND

01/05 19.12 ± 0.40 1.45 ± 0.23 ND

03/05 18.97 ± 0.57 1.49 ± 0.57 ND

ND

ND

ND 4.85 ± 1.13 13.89 ± 0.93 19.73 ± 1.10 49.20 ± 2.20

05/05 12.04 ± 0.24 0.00

ND

1.43 ± 0.07 ND

07/05 7.86 ± 0.49 1.22 ± 0.36 1.83 ± 0.33 ND

ND

ND

ND

ND

3.38 ± 0.13 8.25 ± 0.79 12.16 ± 1.21 44.36 ± 1.88

4.84 ± 0.58 8.62 ± 0.72 17.68 ± 2.64 51.59 ± 2.72

4.81 ± 1.28 10.54 ± 1.40 20.09 ± 0.50 48.91 ± 2.60

5.82 ± 0.78 16.19 ± 1.17 17.45 ± 2.00 50.38 ± 3.28

Table 13. Fatty acid profiles (%) of gonad and soma of mussels from Central (Mean ± 1SD; n = 3). SFA: saturated fatty acid; MUFA: monounsaturated fatty acid; PUFA: polyunsaturated fatty acid

Fatty acids 14:0 15:0 16:0 17:0 18:0 20:0 SFA 15:1 16:1n7 18:1n9 18:1n7 20:1n9 MUFA

Gonad 09/04 2.11 ± 0.09 ND 20.93 ± 1.78 1.22 ± 0.18 4.77 ± 0.77 ND

11/04 2.73 ± 0.21 0.08 ± 0.14 19.65 ± 0.89 1.07 ± 0.17 4.63 ± 0.57 ND

01/05 2.02 ± 0.04 0.20 ± 0.05 18.49 ± 0.42 1.19 ± 0.09 4.80 ± 0.39 ND

03/05 1.59 ± 0.93 0.46 ± 0.57 16.03 ± 3.20 1.20 ± 0.15 4.28 ± 1.82 ND

29.03 ± 2.80 ND

28.16 ± 1.89 ND

26.71 ± 0.95 ND

4.72 ± 0.19 7.14 ± 0.27 1.65 ± 0.08 6.58 ± 0.08 20.09 ± 0.52

5.67 ± 0.23 7.33 ± 0.17 1.49 ± 0.03 4.83 ± 0.48 19.32 ± 0.10

4.24 ± 0.05 14.04 ± 0.42 1.53 ± 0.04 4.52 ± 0.15 24.33 ± 0.31

Soma 09/04 0.47 ± 0.05 ND

11/04 1.60 ± 0.53 ND

01/05 0.42 ± 0.11 ND

17.88 ± 0.61 1.42 ± 0.03 5.31 ± 0.50 ND

19.57 ± 1.12 1.51 ± 0.03 5.23 ± 0.331 ND

9.97 ± 0.13 1.38 ± 0.18 3.94 ± 0.23 ND

25.31 ± 0.68 ND

25.08 ± 1.07 ND

27.91 ± 1.88 ND

5.86 ± 0.16 7.28 ± 0.22 1.57 ± 0.08 8.04 ± 0.28 22.75 ± 0.41

2.94 ± 0.08 8.15 ± 0.36 1.49 ± 0.06 7.26 ± 0.73 19.83 ± 1.11

4.47 ± 0.54 11.70 ± 0.08 1.51 ± 0.02 5.85 ± 0.45 23.53 ± 0.16

07/05 2.52 ± 0.15 0.14 ± 0.21 16.16 ± 0.58 1.15 ± 0.07 5.34 ± 0.08 ND

23.57 ± 3.07 ND

05/05 0.73 ± 0.05 0.11 ± 0.07 13.84 ± 0.39 1.31 ± 0.07 5.69 ± 0.17 2.08 ± 0.18 23.76 ± 0.62 ND

2.83 ± 0.42 12.51 ± 0.41 1.17 ± 0.15 5.38 ± 0.02 21.90 ± 0.09

2.32 ± 0.02 12.27 ± 0.33 1.26 ± 0.05 7.97 ± 0.11 23.81 ± 0.31

03/05 0.14 ± 0.08 0.09 ± 0.06 14.37 ± 1.06 1.58 ± 0.17 5.91 ± 0.23 ND

05/05 0.73 ± 0.59 ND 15.70 ± 2.22 1.54 ± 0.15 6.82 ± 0.23 ND

07/05 2.18 ± 0.12 0.29 ± 0.03 18.62 ± 0.05 1.61 ± 0.05 6.90 ± 0.15 ND

15.71 ± 0.39

22.10 ± 1.25 ND

24.80 ± 2.43 ND

29.60 ± 0.31 ND

2.81 ± 0.12 23.63 ± 0.57 1.69 ± 0.08 6.45 ± 0.02 34.58 ± 0.54

1.97 ± 0.25 22.06 ± 0.68 1.53 ± 0.04 6.45 ± 0.04 32.00 ± 0.91

1.93 ± 0.56 14.23 ± 0.65 1.15 ± 0.03 8.00 ± 0.83 25.32 ± 0.84

5.32 ± 0.21 9.10 ± 0.08 1.39 ± 0.02 7.44 ± 0.09 23.24 ± 0.04

Table 13. (Continued)

11/04 9.35 ± 0.39 1.14 ± 0.21 2.46 ± 0.32 ND

01/05 15.58 ± 0.33 1.33 ± 0.10 ND

03/05 13.51 ± 0.49 0.97 ± 0.18 ND

20:3n3

Gonad 09/04 9.88 ± 0.30 1.17 ± 0.11 2.27 ± 0.28 ND

ND

20:3n6

ND

ND

20:4n6

3.46 ± 0.19 14.64 ± 0.83 19.45 ± 0.98 48.61 ± 2.23

3.70 ± 0.17 17.00 ± 0.73 18.87 ± 0.82 52.52 ± 1.88

Fatty acids 18:2n6 18:3n3 20:2

20:5n3 22:6n3 PUFA

ND

05/05 13.37 ± 0.33 0.75 ± 0.13 1.60 ± 0.10 ND

07/05 9.91 ± 0.23 0.96 ± 0.20 2.08 ± 0.35 ND

Soma 09/04 11.20 ± 0.23 1.03 ± 0.51 2.35 ± 0.20 ND

ND

ND

ND

ND

ND

3.55 ± 0.09 13.45 ± 0.50 15.05 ± 0.92 48.96 ± 1.26

4.70 ± 1.23 15.69 ± 0.80 19.66 ± 1.73 54.54 ± 3.14

4.01 ± 0.12 12.41 ± 0.19 20.29 ± 0.06 50.83 ± 0.33

4.31 ± 0.38 14.62 ± 0.42 20.07 ± 0.44 51.95 ± 0.70

4.93 ± 0.08 12.19 ± 0.60 23.39 ± 0.61 55.09 ± 1.25

11/04 12.51 ± 0.24 1.11 ± 0.15 1.89 ± 0.16 ND

01/05 12.16 ± 0.33 ND

05/05 15.01 ± 0.28 ND

ND

03/05 19.69 ± 0.37 0.79 ± 0.35 ND

ND

ND

ND

ND

ND

ND

ND

07/05 11.49 ± 0.19 0.75 ± 0.09 1.65 ± 0.02 0.24 ± 0.42 ND

4.47 ± 0.24 11.81 ± 0.16 16.77 ± 1.75 48.57 ± 2.02

6.74 ± 0.34 10.38 ± 0.28 20.42 ± 1.46 49.71 ± 0.93

3.40 ± 0.55 8.41 ± 0.52 13.60 ± 1.54 45.90 ± 2.13

4.58± 1.13 9.85 ± 0.58 20.44 ± 1.56 49.88 ± 2.46

5.05 ± 0.10 12.20 ± 0.05 15.79 ± 0.65 47.16 ± 0.27

ND

Inter-Site Differences and Seasonal Patterns…

31

Figure 8. Similarity (%) of the fatty acid profiles of gonad of mussels from Victoria Harbour and reference sites collected from September 2004 to July 2005. PC: Peng Chau, NP: North Point, KT: Kwun Tong, TST: Tsim Sha Tsui, C: Central, TLC: Tung Lung Chau; 09: Sept. 04, 11: Nov. 04, 01: Jan. 05, 03: Mar. 05, 05: May 05, 07: Jul. 05; G: gonad.

Repeated-measures MANOVA were performed to find the overall inter-site and seasonal differences in each fatty acid in the gonads of the mussels. For inter-site differences, the percentages of SFAs 14:0 and 16:0 were the highest at PC and the lowest at NP and C. For SFA 18:0, the percentages at the reference sites (PC and TLC) were significantly higher than those at the other sites. For MUFAs 16:1n7 and 18:1n7 and PUFAs 18:3n3 and 20:5n3, the percentages at the reference sites were significantly higher than that in Victoria Harbour except for KT. For MUFAs 18:1n9 and 20:1n9 and PUFAs 18:2n6 and 20:2, the percentages in Victoria Harbour were significantly higher than those at the reference sites. For SFA 17:0 and PUFA 22:6n3, the percentage was the highest at TLC. SFA 20:0 was only present at C and PUFA 20:3n3 was present at PC and KT. PUFA 20:3n6 was absent in the gonads of mussels from all sites. For seasonal changes, the percentages of SFAs 14:0, 16:0 and 18:0 and MUFA 18:1n7 were the highest in September 2004 and they were relatively lower in March 2005 and May 2005. In contrast, the percentages of PUFA 22:6n3 were higher in March 2005 and May 2005 than in September 2004. For MUFA 18:1n9 and PUFA 18:2n6, the percentages in January 2005, March 2005 and May 2005 were higher than in September 2004, November 2004 and July 2005.

Fatty Acid Profiles in Soma of Green Mussels from Victoria Harbour and Reference Sites For PC (Table 8), the percentage of SFAs (36–50%) in soma was generally similar to or greater than that of PUFAs (28–42%) in September 2004, November 2004 and January 2005.

32

S. G. Cheung and P. K. S. Shin

In March, May and July 2005, the percentage of PUFAs (48–53%) was greater than that of SFAs (30–34%). The percentage of MUFA (15–21%) was the lowest among SFAs, MUFAs and PUFAs during the whole sampling time. For TLC (Table 9), the percentage of PUFAs (41–64%) was also greater than that of SFA (22–41%) and the percentage of MUFAs was the lowest among these fatty acids. For the sampling sites in Victoria Harbour (Tables 10-13), the percentage of PUFAs was higher (27–58%) than SFAs and MUFAs.

Inter-Site Difference and Seasonal Changes in the Fatty Acid Profiles in Soma of Green Mussels from Victoria Harbour and Reference Sites Analysis of similarity (ANOSIM) was carried out to show the seasonal changes and intersite differences in the fatty profiles in soma of green mussels in Victoria Harbour and reference sites. The results showed that there were significant inter-site differences in the fatty acid profiles from the six sampling sites in Victoria Harbour and reference sites (Global test of ANOSIM, R = 0.941, p = 0.001). On the other hand, the fatty acid levels were also significantly different from each other (Global test of ANOSIM, R = 0.915, p = 0.001) among the six sampling months. Hierarchical cluster analysis of the fatty acid profiles of soma showed similar separation to those of the gonads of the mussels. Two groups were separated (Figure 9). Group 1 comprised the fatty acid profiles of soma of mussels collected from the reference sites (PC and TLC) and KT in Victoria Harbour at a similarity level of 73%, together with one sample (September 2004) from TST. Group 2 contained samples from NP, TST and C in Victoria Harbour. Repeated-measures MANOVA were performed to find overall inter-site and seasonal differences in each fatty acid in the soma of the mussels. For inter-site difference, the percentages of SFAs 14:0 and 16:0, MUFA 16:1n7 and PUFA 20:5n3 at the reference sites (PC and TLC) were higher than those at the sites in Victoria Harbour (C, TST and NP), except the fatty acids for KT mussels and 14:0 at TST mussels. For SFA 18:0, the percentages at the reference sites (PC and TLC) were significantly higher than those at the other sites. For MUFA 18:1n7, the percentage was the highest at KT. For MUFA 18:1n9 and PUFA 18:2n6, the percentages in Victoria Harbour (C, TST, NP, KT) were significantly higher than at the reference sites. For PUFA 22:6n3, the percentage was the highest in TLC. For seasonal changes, the percentages of SFAs 14:0 and 16:0 and MUFAs 16:1n7 and 18:1n7 were the lowest in March 2005 and May 2005. For SFA 14:0 and MUFAs 16:1n7 and 18:1n7, the percentages were the highest in September 2004 and July 2005. In contrast, the percentages of PUFA 22:6n3 were the highest in March 2005 and May 2005 and significantly higher than those in September 2004 and July 2005. For MUFA 18:1n9 and PUFA 18:2n6, the percentages in the winter period (January 2005 through March 2005) were higher than those in the summer period (September 2004 through July 2005).

Inter-Site Differences and Seasonal Patterns…

33

Figure 9. Similarity (%) of the fatty acid profiles of somatic tissue of mussels from Victoria Harbour and reference sites collected from September 2004 to July 2005. PC: Peng Chau, NP: North Point, KT: Kwun Tong, TST: Tsim Sha Tsui, C: Central, TLC: Tung Lung Chau; 09: Sept. 04, 11: Nov. 04, 01: Jan. 05, 03: Mar. 05, 05: May 05, 07: Jul. 05; ST: somatic tissue.

Correlations between Fatty Acids Profiles of Total Particulate Matters in Waters and Fatty Acid Profiles of Mussels and Physico-chemical Parameters of Waters The fatty acid profiles of the gonads and somas of the mussels were significantly affected by their diets (Table 14). The level of SFAs 14:0 and 16:0, MUFAs 16:1n7 and 18:1n9 and PUFA 18:2n6 of TPMs in waters were positively correlated with those in both the gonads and the somas of the mussels. For SFA 18:0 and PUFA 20:5n3 of TPMs in waters, they were only positively correlated with those in the gonad. For MUFA 18:1n7, it was only positively correlated with those in the soma. The fatty acid profiles of TPMs in waters were also correlated with the physico-chemical parameters of the water column. SFA 14:0, MUFA 16:1n7 and PUFAs 20:5n3 and 22:6n3 in TPMs showed positive correlation with chlorophyll a, whereas SFA 18:0, MUFA 18:1n9 and PUFAs 18:2n6 and 18:3n3 showed negative correlation. SFA 14:0 and MUFA 16:1n7 were also positively correlated with temperature; however, a negative correlation was found with MUFA 20:1n9 and PUFAs 18:2n6 and 18:3n3. PUFA 20:5n3 was positively correlated with dissolved oxygen, whereas a negative correlation with MUFA 18:1n9 was found. PUFA 18:2n6 was positively correlated with salinity but a negative correlation was found with MUFA 16:1n7. MUFA 16:1n7 and PUFA 20:5n3 were also positively correlated with pH data, whereas a negative correlation was found with MUFA 18:1n9 and PUFA 18:2n6. MUFA 18:1n9 and PUFA 18:2n6 were positively correlated with ammonia. However, SFAs 16:0 and 18:0 were negatively correlated with nitrate. For phosphate, a positive correlation was found with MUFA 18:1n9, whereas a negative correlation was noted for SFA 18:0.

Table 14. Pearson correlation between individual fatty acids of total particulate matters in waters, and that of gonad and soma of mussels and physico-chemical parameters of waters collected from Victoria Harbour and reference sites. Only significant correlation with p-value is shown Fatty acid of TPMs SFA 14:0

Fatty acid of gonad

Fatty acid of soma

Temperatur e

Dissolved oxygen

Salinity

pH

Ammonia

Nitrate

Phosphate

Chlorophyll a

0.44 (<0.001) 0.44 (<0.001) 0.22 (0.03)

0.48 (<0.001) 0.36 (<0.001) -----

0.56 (<0.001) -----

-----

-----

-----

-----

-----

-----

-----

-----

-----

-----

-----

-----

-----

-----

-----

-----

-0.45 (0.01) -0.41 (0.01)

0.60 (<0.001) -----

-0.34 (0.04)

-0.38 (0.02)

-----

-0.65 (<0.001) -----

0.57 (<0.001) -0.43 (0.01)

-----

-----

-----

-----

0.40 (0.02)

-----

-----

0.54 (<0.01) -----

0.65 (<0.001) -0.34 (0.04)

-----

-----

-----

20:1n9

-----

0.45 (<0.001) 0.57 (<0.001) 0.20 (0.04) -----

0.65 (<0.001) -----

18:1n7

0.35 (<0.001) 0.55 (<0.001) -----

-0.39 (0.02)

-----

-----

-----

-----

-----

-----

-----

0.51 (<0.001) -----

0.51 (<0.001) -----

-----

0.47 (<0.01)

-0.46 (0.01)

-----

-----

-----

-----

-----

0.41 (0.01) -----

-----

-----

0.38 (<0.001) -----

-----

-0.65 (<0.001) -0.57 (<0.001) -----

0.35 (0.04)

-----

0.37 (0.03)

-----

-----

-----

-----

-----

-----

-----

-----

-----

-----

-----

-0.48 (<0.01) -0.43 (0.01) 0.52 (<0.01) 0.47 (<0.01)

16:0 18:0

MUFA 16:1n7 18:1n9

PUFA 18:2n6 18:3n3 20:5n3 22:6n3

-----

-0.47 (<0.01) -----

Inter-Site Differences and Seasonal Patterns…

35

DISCUSSION Inter-Site Differences of Fatty Acid Profiles of Total Particulate Matters, Gonad and Soma TPMs usually consist of phytoplankton, bacteria and sedimentary matter suspended from the seabed. Since the fatty acid profiles of such organic matter are specific, investigation of the fatty acid profiles of TPMs can reflect their composition. For marine invertebrates, the lipid levels tend to vary with the physical environment, the dietary state of the organisms and the annual reproductive cycle (Simpson 1982, Brazão et al. 2003). In this study, most of the fatty acids in gonads and somas were positively correlated with those in TPMs. This means that an increase in the percentages of individual fatty acids in TPMs causes an increase in the fatty acid levels in the mussels‘ tissues. The present findings revealed that the fatty acid profiles of mussels were greatly affected by their food composition, and the profiles of mussels can thus reflect their food sources and the composition of organic matters in the marine environment. The percentages of SFAs 16:0 and 18:0 in TPMs, which are mainly contributed by marine detritus, bacteria and nano-zooplankton (Freites et al. 2002), were higher at the reference sites (TLC and PC) than at the sites in Victoria Harbour. On the other hand, SFA 16:0 is also an important component of phytoplankton. This implied that that the water composition at TLC and PC was mainly influenced by marine organic matters and phytoplankton. For the gonads and somas of mussels, SFAs 16:0 and 18:0 were also higher than was found at the reference sites. This suggested that the mussels at reference sites did consume such marine organic detritus. In contrast, the percentages of MUFAs 18:1n9 and 18:1n7 and PUFA 18:2n6 were higher in Victoria Harbour than at reference sites. MUFA 18:1n9 and PUFA 18:2n6 are typical marker of marine fungi (Cooney et al. 1993), whereas MUFA 18:1n7 is a marker of bacteria (Meziane et al. 1997, Kharlamenko et al. 2001). These suggested that the waters in Victoria Harbour contained relatively high amounts of marine fungi and bacteria. On the other hand, the relatively high percentages of 18:1n9 and 18:2n6 in TPMs from TST and NP suggested that the waters of these sites contained high amounts of marine fungi, and the relatively high percentage of 18:1n7 in TPMs from NP and KT suggested that the waters of these sites contained high amounts of bacteria. From the present results, although the water quality in Victoria Harbour has been improving, the abundance of marine fungi and bacteria in Victoria Harbour reflected the relatively poor water quality within the harbour proper. For gonad and soma, MUFA 18:1n9 and PUFA 18:2n6 were also higher in mussels at Victoria Harbour. This reflected that mussels at Victoria Harbour were capable of consuming marine fungi. MUFA 18:1n7 in the soma of mussels at Victoria Harbour was also higher than those of mussels at reference sites, but different results were observed in the respective gonads. This can also be reflected from the results of the correlation tests (i.e., no correlation between 18:1n7 in TPMs and gonad, and positive correlation between 18:1n7 in TPMs and soma). In fact, the correlation between 18:1n7 in TPMs and soma was very weak (Pearson correlation = 0.20, p < 0.04). These results reflected that mussels may not be able to assimilate bacteria as a source of nutrition.

36

S. G. Cheung and P. K. S. Shin

In KT, the water composition was quite different from the other sites in Victoria Harbour. The percentages of MUFA 16:1n7 and PUFAs 20:5n3 and 22:6n3, which are general markers of phytoplankton, were relatively high in KT compared with those at other sites (Victoria Harbour and the other reference sites). The present findings imply that the phytoplankton concentrations at KT were high. In KT, the concentrations of nitrate and phosphate in waters were the highest among all the sampling sites. These conditions also favoured the growth of phytoplankton. On the other hand, the results of Pearson correlation showed that 16:1n7, 20:5n3 and 22:6n3 were positively correlated with chlorophyll a. This further proved that these fatty acids can reflect the food source from phytoplankton. Moreover, 16:1n7 and 20:5n3 have been reported to be markers of diatoms (Napolitano et al. 1997, Freites et al. 2002, Ruess and Pulsen 2002) and 22:6n3 marker of dinoflagellates (Meizane et al. 2006). This suggested that the waters in KT contained relatively high amounts of both diatoms and dinoflagellates, especially the latter (Percentage of 22:6n3, KT: 2–29%, C: 3–13%, TST: 1– 2%, NP: 2–4%). This can be further proved from the data of the annual mean density of phytoplankton obtained from the Environmental Protection Department (EPD) [Annual mean density of dinoflagellates, KT (at EPD monitoring site VM1): > 300 cells ml-1, the other sites in Victoria Harbour: 101–200 cells ml-1]. For the gonad and soma, the percentages of PUFA 20:5n3 was also the highest in mussels at KT. The percentage of MUFA 16:1n7 was also the second highest in mussels at KT, apart from those collected at PC. The present results revealed that mussels at KT consumed phytoplankton, which was mainly composed of diatoms and dinoflagellates. For PUFA 22:6n3, its level was the highest in the somas, but not in the gonads, of mussels at KT. This implied that the amount of PUFA 22:6n3 in mussels may be influenced by factors other than their diet. In fact, the fatty acid profiles of mussels can be affected by their reproductive cycles (Brazão et al. 2003, Morais et al. 2003). PUFAs are important for reproduction in mussels, especially PUFA 22:6n3, which can be an energy source or a source for constituting to the structural component in gonads (Brazão et al. 2003). Thus, the amount of PUFA 22:6n3 can be controlled by the reproductive period of mussels, apart from intake from their diets.

Seasonal Change in Fatty Acid Profiles of Total Particulate Matters, Gonad and Soma The percentages of SFAs 14:0, 16:0 and 18:0, which are contributed by marine detritus, were the highest in September 2004 and the lowest in January 2005, indicating that the detritus input was higher in the summer than in the winter. Terrestrial input is usually greater during the summer, owing to heavy rain runoff in Victoria Harbour, which, in turn, may increase the input of detritus in marine waters. Levels of SFAs 14:0, 16:0 and 18:0 in the gonads of mussels were also the highest in September 2004, except for 18:0. Such high SFA levels suggested that mussels tended to accumulate SFAs in their tissues when marine detritus was dominant in the water column. The percentages of SFA 18:0 in gonad and somatic tissue were the lowest in January 2005. For soma, the percentages of SFAs 14:0 and 16:0 were the lowest in March 2005. This showed that mussels tended to reserve SFAs 14:0 and 16:0 in soma and leaded to a slower decrease in these two fatty acids. For gonads, the percentage of SFA 18:0 was also the lowest in January 2005 but the percentages of SFAs 14:0 and 16:0

Inter-Site Differences and Seasonal Patterns…

37

were the lowest in May 2005. This implied that mussels tended to use their reserve of SFAs in the soma first, before utilizing those from the gonad. The percentage of MUFA 16:1n7, a marker of diatoms, was higher in the summer than in the winter, suggesting that the concentration of diatoms was high in the summer. This can also be revealed by the chlorophyll a data. The concentration of chlorophyll a was relatively high in September and July. This reflected that the concentration of phytoplankton was high during this period. For the gonad and soma, the percentage of MUFA 16:1n7 was also higher in summer, indicating that mussels consumed phytoplankton during the summer. The percentages of MUFA 18:1n9 and PUFA 18:2n6, markers of marine fungi, were higher in the winter period than in the summer period. In winter, the concentration of phytoplankton decreases (Chiu et al. 1994). In addition, growth of marine fungi can tolerate a wide range of temperature from 10 to 37ºC (Matsumoto 1994). Such high tolerance may allow marine fungi to be dominant in the winter period. For gonad and somatic tissue, the percentages of MUFA 18:1n9 and PUFA 18:2n6 were also higher in the winter period, implying that mussels did consume marine fungi in winter. For MUFA 20:1n9, which was a marker of zooplankton, the percentage was higher in the winter than in the summer. The population of zooplankton usually increases after the population of phytoplankton increases (Aziz et al. 2006). However, zooplankton will preferentially consume more fungi and bacteria, associated with decaying organic substances, over consuming phytoplankton directly (Tappin 2005). In winter, as marine fungi become dominant, phytoplankton could serve as a major food source for zooplankton, leading to its increase in population.

Correlations between Fatty Acids Profiles of Total Particulate Matters in Waters and Fatty Acid Profiles of Mussels and Physico-Chemical Parameters of Waters The fatty acid profile of TPMs in waters was correlated with the physico-chemical parameters of the waters. This further supported certain fatty acids as markers to indicate the presence of a specific group of plankton. Levels of SFA 14:0 and MUFA 16:1n7, markers of diatoms, were positively correlated with temperature and chlorophyll a. Warm seasons, with eutrophic conditions, would favour the growth of phytoplankton. Higher concentrations of chlorophyll a in waters also suggested that a higher abundance of phytoplankton could be present in the water column. Thus levels of SFA 14:0 and MUFA 16:1n7 were good markers for indicating the presence of diatoms (phytoplankton). The fatty acid profiles in gonad and soma of mussels were affected by their diets. Most of fatty acids in gonad and soma of mussels were positively correlated with those of TPMs. For gonad, however, MUFA 18:1n7 and PUFA 22:6n3 seemed not to show such a relationship. The percentages of MUFA 18:1n7 were very low in both TPMs and gonads. As mentioned before, it may be due to the low ability of assimilation of bacteria. Another possible reason is that MUFA 18:1n7 may not be a very important energy source for gonads of mussels. Hence, mussels tend to utilize less amount of this fatty acid during gonad development. As mussels may not require a high level of MUFA 18:1n7 in their tissues, they thus maintain a steady level of MUFA 18:1n7 in their bodies. For PUFA 22:6n3, the amount of this fatty acid in gonads varied irrespective of that in TPMs. One of the possible reasons is related to the

38

S. G. Cheung and P. K. S. Shin

reproductive cycles of mussels. Moreover, PUFA 22:6n3 can be a source for constituting structural component in gonads and affected by their reproductive cycle (Pazos et al. 2003). This can be reflected from the negative correlation between PUFA 22:6n3 and gonadosomatic index (GSI) of TLC mussels (Pearson correlation coefficient, r = -0.834, p = 0.04). The present findings implied that the percentage of 22:6n3 increased after spawning. It further supported PUFA 22:6n3 to be a structural component rather than an energy source. While the percentages of fatty acids for energy source decrease, the relative percentage of PUFA 22:6n3 for structural component increases. However, there is no such relationship for the mussels from other sites. This suggested that the dietary effect or other physical factors (e.g., temperature, dissolved oxygen, salinity etc.) may be greater than the reproductive effect on the fatty acid profiles of gonad of mussels from other sites. For soma, SFA 18:0, PUFAs 20:5n3 and 22:6n3 were not correlated with those in TPMs. SFAs 14:0, 16:0 and 18:0 are mainly contributed by the marine organic detritus (Freites et al. 2002). SFAs 14:0 and 16:0 are usually the constituents of phytoplankton which can be easily filtered and assimilated by mussels. However, SFA 18:0 may come from other organic detritus which is not suitable as food for mussels. The organic detritus from sewage may be too large in size for mussel filtration. Hence, mussels may not be able to derive nutrition from such detritus. For PUFAs 20:5n3 and 22:6n3, as mentioned before, these two fatty acids are important for reproduction. In addition, PUFAs 20:5n3 and 22:6n3 are also important components of membrane structure to maintain normal metabolic functions (Hendriks et al. 2003). Mussels may thus maintain these fatty acids at certain levels.

SUMMARY AND CONCLUSION Wastewater from both sides of Victoria Harbour was discharged directly into the harbour only after simple screening, resulting in poor water quality with high nutrients and sewage bacteria in few decades ago. In 2001, the implementation of Harbour Area Treatment Scheme (HATS) significantly improved the water quality in Victoria Harbour. However, the composition of TPMs (e.g., plankton community, detritus) and hence, the fatty acid profiles of mussels in Victoria Harbour differed from those at the reference sites, suggesting that different water qualities still existed between within and outside the harbour areas. The present findings showed that the gonad and soma of mussels from the six sites exhibited similar inter-site differences and seasonal changes in fatty acid profiles. The fatty acid profiles of mussels were affected by their diets, which, in turn, depended on the composition of TPMs in the water column. For inter-site differences, levels of SFAs 16:0 and 18:0, which are indicative of presence of marine detritus, were significantly higher at TLC and PC than C, TST and NP, whereas amounts of MUFAs 18:1n9, 20:1n9 and PUFA 18:2n6, which are indicative of presence of zooplankton and marine fungi, were higher at C, TST, NP and KT than TLC and PC. For seasonal changes, levels of SFAs 14:0, 16:0 and 18:0 were generally higher in warm months than in cool months. Levels of MUFA 18:1n9 and PUFA 18:2n6 were significantly higher in the cool, winter months than the hot, summer months. The fatty acid profiles of total particulate matters (TPMs) in the water samples were also positively correlated with those of gonad and soma of mussels, especially SFAs 14:0 and 16:0, MUFAs 16:1n7 and 18:1n9, and PUFA 18:2n6. This further reflected that the fatty acid

Inter-Site Differences and Seasonal Patterns…

39

profiles of mussels were affected by their food sources. Other physico-chemical parameters such as temperature and chlorophyll a in the water samples were positively correlated with the fatty acid profiles of TPMs. Levels of PUFAs 20:5n3 and 20:6n3 in TPMs, which are important for reproduction of mussels, were not correlated with those in gonad and somatic tissue. The present findings suggested that these fatty acids tended to be affected by the reproductive period of the mussels rather than by their diets.

REFERENCES Aziz, N. E. A., Gharib, S.M. and Dorgham, M.M. (2006). The interaction between phytoplankton and zooplankton in a Lake-Sea connection, Alexandria, Egypt. International Journal of Oceans and Oceanography, 1, 151-165. Bayen, S., Thomas, G., Lee, H. K. and Obbard, J. P. (2004). Organochlorine Pesticides and Heavy Metals in Green Mussel, Perna viridis in Singapore. Water, Air and Soil Pollution, 155, 103-116. Bligh, E. G. and Dyer, W. J. (1959). A rapid method of total lipid extraction and purification. Canadian Journal of Biochemistry and Physiology, 37, 911-917. Bray, J. R. and Curtis, J. T. (1957). An ordination of upland forest communities of Southern Wisconsin. Ecological Monographs 27: 325-349. Brazão, S., Morais, S., Boaventura, D., Re, P., Narico, L. and Hawkins, S. J. (2003). Spatial and temporal variation of the fatty acid composition of Patella spp. (Gastropoda: Prosobranchia) soft bodies and gonads. Comparative Biochemistry and Physiology, 136B, 425-41. Cheung, S. G. (1991). Energetics of transplanted populations of the Green-lipped mussel Perna viridis (Linnaeus) (Bivalve: Mytilacea) in Hong Kong: I: Growth condition and reproduction. Asian Marine Biology, 8, 117-131. Chiu, H. M. C., Hodgkiss, I. J. and Chan, B. S. S. (1994). Ecological studies of phytoplankton in Tai Tam Bay, Hong Kong. Hydrobiologia, 273, 81-94. Clarke, K. R. and Warwick, R. M. (2001). Changes in Marine Communities: An Approach to Statistical Analysis and Interpretation (2nd edition). PRIMER-R Ltd., Plymouth. Cooney, J. J., Doolittle, M. M., Grahl-Nielson, O., Haaland, I. M. and Kirk, P. M. (1993). Comparison of fatty acids of marine fungi using multivariate statistical analysis. Journal of Industrial Microbiology, 12(6), 373-378. Dalsgaard, J., St. John, M., Kattner, G., Müller-Navarra, D. and Hagen, W. (2003). Fatty acid tropic marker in the pelagic marine environment. Advance in Marine Biology, 46, 227347. Desvilettes, C. H., Bourdier, G., Amblard, C. H. and Barth, B. (1997). Use of fatty acids for the assessment of zooplankton grazing on bacteria, protozoans and microalgae. Freshwater Biology, 38, 629-637. Eaton, A. D., Clesceri, L. S. and Greenberg, A. E. (1995). Standard Methods for the Examination of Water and Wastewater. Washington D.C.: American Public Health Association, Inc. Freites, L., Labarta, U. and Fernandez-Reiriz, M. J. (2002). Evolution of fatty acid profiles of subtidal and rocky shore mussel seed (Mytilus galloprovincialis, Link.). Influence of

40

S. G. Cheung and P. K. S. Shin

environmental parameters. Journal of Experimental Marine Biology and Ecology, 268, 185-204. Hendriks, I. E., Duren, L. A. V. and Herman, P. M. J. (2003). Effect of dietary polyunsaturated fatty acids on reproductive output and larval growth of bivalves. Journal of Experimental Marine Biology and Ecology, 296, 199-213. HKEPD (1997). Annual Marine Water Quality Reports. Environmental Protection Department, Hong Kong SAR Government. HKEPD (2004). Annual Marine Water Quality Reports. Environmental Protection Department, Hong Kong SAR Government. Huang, Z. G., Lee, S. Y. and Mak, P. M. S. (1985). The distribution and population structure of Perna viridis (Bivalvia: Mytilacea) in Hong Kong waters. In B. Morton and D. Dudgeon (Eds.), Proceedings of Second International Workshop on Malacofauna of Hong Kong and Southern China (pp. 456-471). Hong Kong: Hong Kong University Press. Kharlamenko, V. I., Kiyashko, S. I., Lmbs, A. B. and Vyshkvartzev, D. I. (2001). Identification of food sources of invertebrates from the seagrass Zostera marina community using carbon and sulfur stable isotope ratio and fatty acid analyses. Marine Ecology Progress Series, 220, 113-117. Lee, R. F., Nevenze, J. C. and Paffenhöfer, G. A. (1971). Importance of wax esters and other lipids in the marine food chain: phytoplankton and copepods. Marine Chemistry, 51, 315324. Lee, S. Y. (1986). Growth and reproduction of the Green mussel Perna viridis (L.) (Bivalvia: Mytilacea) in contrasting environments in Hong Kong. Asian Marine Biology, 3, 111127. Matsumoto, N. (1994). Ecological adaptations of low temperature plant pathogenic fungi to diverse winter climates. Canadian Journal of Plant Pathology, 16, 237-240. Meziane, T., d‘Agata, F. and Lee, S. Y. (2006). Fate of mangrove organic matter along a subtropical estuary: small-scale exportation and contribution to the food of crab communities. Marine Ecology Progress Series, 312, 15-27. Meziane, T., Bodineau, L., Retiere, C. and Thoumelin, G. (1997). The use of lipid markers to define sources of organic matter in sediment and food web of the intertidal salt-marsh-flat ecosystem of Mont-Saint-Michel Bay, France. Journal of Sea Research, 38, 47-58. Morais, S., Boaventura, D., Narciso, L., Ré, P. and Hawkins, S. J. (2003). Gonad development and fatty acid composition of Patella depressa Pennant (Gastropoda: Prosobranchia) populations with different patterns of spatial distribution, in exposed and sheltered sites. Journal of Experimental Marine Biology and Ecology, 294, 61-80. Napolitano, G. E., Pollero, R. J., Gayoso, A. M., Macdonald, B. A. and Thompson, R. J. (1997). Fatty acids as trophic markers of phytoplankton blooms in the Bahia Blanca Estuary (Buenos Aires, Argentina) and in Trinity Bay (Newfoundland, Canada). Biochemical Systematics and Ecology, 25, 739-755. NIMPIS (2002). Marine pest information sheet: Asian green mussels Perna viridis. Australia: NIMPIS. Pazos, A. J., Sanchez, J. L., Roman, G., PerezParalle, M. L. and Abad, M. (2003). Seasonal changes in lipid classes and fatty acid composition in the digestive gland of Pecten maximus. Comparative Biochemistry and Physiology, 134B, 367-380.

Inter-Site Differences and Seasonal Patterns…

41

Phillips, D. J. H. (1985). Organochlorines and trace metals in green-lipped mussels Perna viridis from Hong Kong waters: a test of indicator ability. Marine Ecology Progress Series, 21, 251-258. Phillips, D. J. H. and Rainbow, P. S. (1988). Barnacles and mussels as biomonitors of trace elements: A comparative study. Marine Ecology Progress Series, 49, 83-93. Phillips, D. J. H. and Yim, Y. S. S. (1981). A comparative evaluation of oysters, mussels and sediment as indicators of trace metals in Hong Kong. Marine Ecology Progress Series, 6, 285-293. Pohl, P. and Zurheide, F. (1979). Fatty acids and lipids of marine algae and the control of their biosynthesis by environmental factors. In H. A. Hoppe, T. Levring and Y. Tanaka (Eds.), Marine Algae in Pharmaceutical Science (pp. 473-523). Berlin: Gruyter. Reuss, N. and Poulsen, L. K. (2002). Evaluation of fatty acids as biomarkers for a natural plankton community. A field study of a spring bloom and a post-bloom period off West Greenland. Marine Biology, 141, 423-434. Sargent, J. R., Gatten, R. R. and McIntosh, R. (1977). Wax esters in the marine environment – their occurrences, formation, transformation and ultimate fates. Marine Chemistry, 5, 573-584. Sargent, J. R. and Whittle, K. J. (1981). Lipids and hydrocarbons in the marine food web. In A. Longburst (Ed.), Analysis of Marine Ecosystems (pp. 491-533). London: Academic Press. Siddall, S. E. (1980). A clarification of the genus Perna (Mytilidae). Bulletin of Marine Science, 30, 858-870. Simpson, R. D. (1982). Reproduction and lipids in the Sub-Antarctic limpet Nacella (Patinigera) macquariensis Finlay, 1927. Journal of Experimental Marine Biology and Ecology, 56, 33-48. SPSS Inc. (2002). SPSS Base 11.5 User‟s Guide. SPSS Inc., Chicago, USA. Tappin, A. R. (2005). ―Growing – Ponds‖ Feeding Rainbow fishes. Retrieved 5 June, 2006 from the World Wide Web: http://members.optushome.com.au/chelmon/Growing.htm. Wong,W. H. and Cheung, S. G. (2003a). Seasonal variation in the feeding physiology and scope for growth of green mussels, Perna viridis (L.) in estuarine Ma Wan, Hong Kong. Journal of the Marine Biological Association of the United Kingdom, 83, 543-552. Wong, W. H. and Cheung, S. G. (2003b). Site-related differences in the feeding physiology of the green mussel Perna viridis: a reciprocal transplantation experiment. Marine Ecology Progress Series, 258, 147-159. Wu, R. S. S. and Lam, P. K. S. (1997). Glucose-6-phosphate dehydrogenase and lactate dehydrogenase in the green-lipped mussel (Perna viridis): possible biomarkers for hypoxia in the marine environment. Water Research, 31, 2797-2801. Xu, L., Zhang, G. J., Lam, P. K. S. and Richardson, B. (1999). Relationship between tissue concentrations of polycyclic aromatic hydrocarbons and DNA adducts in green-lipped mussels (Perna viridis). Ecotoxicology, 8, 73-82. Yung, Y. K., Yau, K., Wong, C. K., Chan, K. K., Yeung, I., Kueh, C. S. W. and Broom, M. J. (1999). Some observations on the changes of physico-chemical and biological factors in Victoria Harbour and vicinity, Hong Kong, 1988-1996. Marine Pollution Bulletin, 39, 315-325. Zar, J. H. (1996). Biostatistical Analysis (3rd Edition). New Jersey: Prentice Hall International Inc.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 2

ENVIRONMENTAL IMPACT OF ANTHROPOGENIC ACTIVITIES: THE USE OF MUSSELS AS A RELIABLE TOOL FOR MONITORING MARINE POLLUTION Stefanos Dailianis Section of Animal Biology, Department of Biology, School of Natural Sciences, University of Patras, GR-26500 Patras, Greece

ABSTRACT The current chapter is focused on a) the general anatomy and morphological characteristics of mussels (fresh water and saltwater species), b) the effect of both abiotic (temperature, salinity, congestion, pollution, air-exposure, food availability, etc.) and biotic (age, soft-body weight, reproductive cycle, predators, etc.) environmental factors on mussel behavior and physiology, c) the role of filter-feeding mussels as sensitive marker for assessing human-derived environmental impacts and d) the important ecological and environmental role of mussels, with emphasis to saltwater mussels, as reliable tool for monitoring the aquatic environment health status. Specifically, the role of mussels for monitoring aquatic environment is of great interest, since the presence of human-derived inorganic and organic pollutants into the water could affect environmental health status. The good knowledge of their physiology and behavior, as well as their study in cellular, genetic and biochemical level, are important parameters which reinforces the role of mussels as Bioindicators of the marine environment. Moreover, Biomarkers (general- and specific stress as well as genotoxicity), which represent biochemical, cellular,, genotoxical, physiological or behavioral variation that can be measured in mussels, providing evidence of exposure to and/or effects of, one or more chemical pollutants being present into the water, were briefly mentioned, in order to emphasize the use of mussels as bioindicators in a lot well-documented monitoring studies, as a result of the continuously anthropogenic-induced impacts on the environmental health status.



Tel-Fax: +3102610969213, email: [email protected]

Stefanos Dailianis

44

1. MUSSELS: GENERAL ANATOMY, HABITAT AND PHYSIOLOGY Mussels are members of several families of filter-feeding molluscs, whose habitat range from saltwater to freshwater. Freshwater mussels belong to the mollusk order Unionoida, a solely freshwater group and they inhabit lakes, ponds, rivers, creeks, canals, and similar habitats. Despite the fact that these freshwater species are not closely related to saltwater mussels and grouped in different subclass, similarities in appearance have been mentioned. Species belong to the family Unionidae, such as Unio pictorum, also known as the painter's mussel, are species of medium-sized freshwater mussel, being commonly present in rivers in Europe. Another species of freshwater mussels is the pearl mussel Margaritifera margaritifera, which belong to the family Margaritiferidae. This species is capable of making fine quality pearls (Hyman, 1967; Barnes, 1968; Morton, 1979). Another group of aquatic bivalve mollusc, belonging to the family Dreissenidae, is the zebra mussels Dreissena polymorpha. This species get its name from a striped pattern which is commonly seen on shells. They are usually about the size of a fingernail, but can grow to a maximum length of nearly two inches (5 cm). The shape of the shell is also somewhat variable. This species was originally native to the lakes of southeast Russia, but it has been accidentally introduced in many other areas, and has become an invasive species in many different countries. Despite the fact the zebra mussels are not related to previously mentioned groups, resembling many Mytilus species in shape, and live attached to rocks and other hard surfaces with the used of byssus, they are not at all closely related to the mytilids. Indeed, zebra mussels are much more closely related to the Veneridae, the genus clams they are classified with the Heterodonta, the taxonomic group which includes most of the bivalves commonly referred to as "clams". The word "mussel" is most frequently used to mean the edible bivalves of the marine family Mytilidae, most of which live on exposed shores in the intertidal zone and are of great interest since they are intensively fished and cultured worldwide for human consumption. Specifically, mussels are farmed in many areas of the world with the most common species cultured being the blue mussel, Mytilus edulis and the Mediterranean mussel M. galloprovincialis. The main producers of mussels are countries such as China (over 400.000 tons per year), Korea, Spain, The Netherlands, Denmark, France and New Zealand. Mussels of the genus Mytilus (Kingdom: Animalia, Phylum: Mollusca, Class: Bivalvia, Subclass: Pteriomorphia, Order: Lamellibranchia) are a group of filter-feeding bivalve molluscs, firstly appeared before 1-2 millions years. Genetic analysis of mussels revealed 9 different species of the genus Mytilus, spreading throughout the world, such as: 1. 2. 3. 4. 5. 6. 7. 8. 9.

M. edulis, (North hemisphere) M. galloprovincialis, (the common species in the Mediterranean Sea) M. trossulus, (coastal areas of North America, Pacific ocean) M. coruscus,(coastal areas of China and Japan) M. californianus, (coastal areas of North America, Pacific ocean) M. chilensis, (coastal areas of South America, Chile) M. platensis, (coastal areas of Argentina, South Atlantic ocean) M. planulatus, (coastal areas of Australia) M. desolationis, (coastal areas of Kerguelen Islands, Indic ocean).

Environmental Impact of Anthropogenic Activities

45

Specifically, Mytilus galloprovincialis, M. edulis, M. trossulus and M. californianus represent the most common species being studied so far (Figure 1).

Figure 1. Geographical distribution of the most common species Mytilus spp., according to morphologic and genetic analysis.

In most marine mussels the shell is longer than it is wide, being wedge-shaped or asymmetrical. The external color of the shell is often dark blue, blackish, or brown, while the interior is silvery and somewhat nacreous. The mussel's external shell is composed of two hinged halves or "valves". The valves are joined together on the outside by a ligament, and are closed when necessary by strong internal muscles. Mussel shells carry out a variety of functions, including support for soft tissues, protection from predators and protection against desiccation (Hyman, 1967; Barnes, 1968; Morton, 1979). The shell is made of three layers. In the pearly mussels there is an inner iridescent layer of nacre (mother-of-pearl) composed of calcium carbonate, which is continuously secreted by the mantle; the prismatic layer, a middle layer of chalky white crystals of calcium carbonate in a protein matrix; and the periostracum, an outer pigmented layer resembling a skin. The periostracum is composed of a protein called conchin, and its function is to protect the prismatic layer from abrasion and dissolution by acids (especially important in freshwater forms where the decay of leaf materials produces acids). The animal is enclosed by the large right and left mantle skirts (lobes) which line the inner surfaces of the two valves. The space between the two mantle skirts is the inhalant

46

Stefanos Dailianis

chamber of the mantle cavity, which is filled with seawater. The two skirts are connected dorsally to each other and are attached to the valves along the pallial line. The mantle skirts are thick, containing the gonads. The male mantle is creamy beige whereas that of females is reddish. Like most bivalves, mussels have a large organ called a foot. In freshwater mussels, the large, muscular, and generally hatchet-shaped foot is commonly used to pull the animal through the substrate (typically sand, gravel, or silt) in which it lies partially buried. This procedure is performed by repeatedly advancing the foot through the substrate, expanding the end so it serves as an anchor, and then pulling the rest of the animal with its shell forward. It also serves as a fleshy anchor when the animal is stationary. In marine mussels, the foot is smaller, tongue-like in shape, with a groove on the ventral surface which is continuous with the byssus pit. In this pit, a viscous secretion is exuded, entering the groove and hardening gradually upon contact with sea water, thus forming extremely tough, strong, elastic, byssus threads that secure the mussel to its substrate. Moreover, the byssus threads are used by mussels as a defensive measure, to tether predatory molluscs, such as dog whelks, that invade mussel beds, immobilizing them and thus starving them to death. Mussels and scallops have filibranch gills which are formed of the combined filaments attached to the central axis, holding together by ciliary interfilamentar junctions. The entire gill is a holobranch and includes the filaments on both sides of the axis. There is only one gill on the right and one on the left even though it may look to you as if there are two on each side. Each filament bears frontal cilia on its outer edge and lateral cilia on the flat surfaces facing adjacent filaments. The lateral cilia generate the feeding/respiratory current whereas the frontal cilia move food particles along the surface of the gill to the food grooves, thus representing the original condition of the lamellibranch gill. The eulamellibranch gills of most other bivalves, such as Mercenaria and Corbicula, are held together by solid, vascularized tissue junctions. The filaments of eulamellibranch gills have, in fact, grown together to form a continuous sheet perforated by small pores. The gills divide the mantle cavity into a ventral inhalant chamber and a dorsal exhalant chamber. Water enters the ventral edge of the shell, passes between gill filaments, enters suprabranchial chamber from the ventral inhalant siphon, proceeds posterioly and dorsally and finally flows back into the sea through the dorsal exhalant siphon. Although the gills are the most important, respiratory organs of mussels, the inner surfaces of the mantle skirts are also responsible for gas exchange but the chief respiratory surfaces are the plicate organs. Each of the two plicate organs is a longitudinal row of transverse folds of epithelium between the gill and the visceral mass. Gills are the principal organs of food capture and selection of materials. Food passes into the short esophagus and then into the stomach, covered by the liver (digestive gland system). Digestive cells are the main cell type in the digestive gland, which in turn are the main metabolic organ in molluscs. Lysosomes in digestive cells of molluscs are involved in the uptake and intracellular digestion of food material. Most of the digestive tract is embedded in the dorsal region of the foot and visceral mass. Extracellular digestion of food is followed by intracellular accumulation and digestion in the well-developed endolysosomal system of digestive cells. All species of the genus Mytilus are dioecious, but hermaphroditism (either protandrous or synchronous) is not excluded. Nuclear genetic material consists of 28 chromosomes, while

Environmental Impact of Anthropogenic Activities

47

there is evidence for the presence of sex chromosomes. It seems likely to suggest that mtDNA could play an important role in sex differentiation in mussels (Fisher and Skibinski, 1990). In fact, differences between Mytilus species, regarding the presence of different types of enzymes and expression of different mt-DNAs, conducted electrophoretically, reveals that local/geographical parameters could mediate gene expression. Moreover, environmental pollution could influence genetic incorporation of mussels‘ population. Heterozygoty in mussels seems to favour survival under environmental stress, occurred by heavy metals. Gametes are developed in germ follicles of mantle lobes, while germ tissue is actually emerged within visceral tissue of mussel‘s body. The development of germ follicles within the mantle lobes of mussels is revealed during early autumn and a new gametogenesis is performed. During spring, gametogenesis is reduced, while a significant enhancement is performed during summer. Sexual maturation in marine mussels is performed after the first year of their life, while significant alterations are revealed due to growth rate-mediated environmental factors. For example, violent detachment and handling, temperature and food availability could affect both gametogenesis and spawning processes. In marine mussels, fertilization occurs outside the body. Fertilization in seawater mussels, such as Mytilus edulis was carried out at temperatures between 5-22οC and salinity ranged from 15 to 40‰. In normal condition, embryogenesis is carried out at temperature ranged between 15 and 20οC and salinity ranged from 15-20‰ (at 15οC) to 20-25‰ (at 20οC), while maximum developmental ability was recorded at 30-35‰. In laboratory conditions, there is no embryonic development in larva of Mytilus galloprovincialis at 25οC. Fertilization of yellow-orange oocytes from male gametes (spermatozoa) is considered as a short-time process (Strathmann, 1987), depending on the environmental conditions and habitats and leads to the development of a free-swimming larva, named trochophore. Trochophore larva develops a velum like fold and becomes the characteristic molluscan veliger larva. The duration of trochophores‘ developmental period ranges between 1-4 weeks and depends on water temperature, salinity and food availability. Trochophores drift for three weeks to six months, before settling on a hard surface as a young mussel. Development of trochophore larva and metamorphosis is obtained during spring and early summer and characterized by larva ability to move slowly by means of attaching and detaching byssal threads to attain a better life position, in order adult mussels to be occurred. In fresh-water mussels, especially the members of genus Unio, a parasitic larva, called glochidium, was discharged into the water and encysted upon the skin or gills of fishes came in contact with. During a period of several weeks of parasitism, glochidia undergo metamorphosis into the adult. Planktonic organisms (diameter 3-5 μm) and other microscopic sea creatures which are free-floating in the seawater, are the main food during development of larva, while its daily food requirements are equivalent to 30-60% of its total weight. Larva mortality could reach at 99%, due to food deficiency, the presence of predators, such as fishes and other invertebrates (sea stars, such as Asterias rubens, gastropods in the family Muricidae, such as the dog whelk, Nucella lapillus) and environmental stress factors.

48

Stefanos Dailianis

1.1. Environmental Factors and Their Role in Mussels‟ Physiology and Behavior Physiology and behavior of mussels can be affected by various environmental factors that could lead to environmental stress, thus affecting growth rate, food uptake, reproductive cycle and homeostasis of mussels in general. Abiotic factors, such as salinity, temperature and airexposure of mussels could affect normal growth rates of bivalve molluscs and their response to various environmental stressors (Philips, 1976a,b; Cossa et al., 1979; Davies and Pirie, 1980). Bivalves posses great resistance to low temperatures due to the presence of anti-freeze proteins in their haemolymph, thus reinforcing tissue and cellular resistance against freeze during cold periods, such as winter (Kanwisher 1959; 1966; Williams, 1970; Aarset, 1982). On the other hand, temperatures higher than 29 οC could result in increased mortality of mussels. Exposure of mussels in air during tide, could affect their metabolic rate, increasing anaerobic metabolism, which in turn could lead to significant alterations of enzyme activity and concomitant changes of their physiological behavior. Moreover, mussels lived in water with time-dependent alterations in salinity, maintain different homeostatic mechanisms, in order to face with environmental changes occurred during their annual life. As a result, reduced rate of shell‘s opening is obtained, in order acute alterations of osmolarity to be prevented, thus maintaining cellular homeostasis. During this period, energy requirements of the organism are supplemented by anaerobic processes, while similar responses are observed during changes in pH levels, both in cellular level and physiological behavior of mussels (Philips, 1976; Davies and Pirie, 1980). High congestion of mussels could lead to increased levels of mortality, representing an important stress-mediated factor from mussels‘ populations. High competition between mussels increases their food demands and could lead to increased levels of water uptake through their gills, thus resulting in increase accumulation of non-self substances in their tissues, including toxins and pollutants. Furthermore, high congestion and competition are related with decrease of both shell length and body weight, probably due to the low rates of food uptake from mussels. Moreover, various biotic factors (such as age, soft-body weight and gametogenesis) could affect normal growth rate of mussels, as well as their response to environmental stress, occurred by pollutants (Philips, 1976; Cossa et al., 1979; Davies and Pirie, 1980). Moreover, sea stars, crabs and fishes represent natural predators of mussels, moderating their spreading geographical zone. Mussels are both aerobic and anaerobic organisms, but oxygen is the primarily source of energy, in order to cover their increased demands for energy (De Zwaan et al., 1992). The percentage of oxygen is depleted in their mitochondria, conjugating with catabolic processes. Despite the fact that glucose, triglycerides, free lipids and amino acids are the main types of energy source under aerobic metabolism, carbohydrates and lipids are considered as the main energy molecules, under anaerobic conditions.

Environmental Impact of Anthropogenic Activities

49

2. ENVIRONMENTAL IMPACT OF ANTHROPOGENIC ACTIVITIES: THE USE OF MUSSELS AS A RELIABLE TOOL FOR MONITORING MARINE POLLUTION The strong interaction among living organisms and the various spheres of the abiotic environment, such as atmosphere, hydrosphere and geosphere, are best described by cycles of matter that involve biological, chemical, and geological processes and phenomena. Such cycles are called biogeochemical cycles. Organisms participate in biogeochemical cycles, which describe the circulation of matter, particularly plant and animal nutrients, through ecosystems. An ecosystem consists of a variety of communities of organisms and their surrounding environment existing in a generally steady state. Ecosystems can be divided generally into terrestrial ecosystems, which are consisted of those that exist primarily on land, and aquatic ecosystems, which are composed of those that exist in water. There are many interconnections between terrestrial and aquatic ecosystems, and many ecosystems have both terrestrial and aquatic components. An important aspect of ecosystems is the flow of energy and materials between living organisms and the various spheres of the abiotic environment. Harmonic circulation of energy and materials among them is performed via natural processes, which have been developed during the pass of time. However, during their brief time on earth, humans have used their ingenuity and technology to cause enormous perturbations in these naturally occurring processes. Indeed, this has occurred to such a degree that it is now necessary to recognize a fifth sphere of the environment that is constructed and operated by humans, the anthrosphere. Industrial revolution performed in the last decades lead to the importance of monitoring ecosystems, in order to predict anthrosphere impacts both on ecological and organism level. Since, intricate relationships existed among organisms may be perturbed by the effects of toxicants being present in the ecosystem, it became it became discernible to the world society the need for establishing laws and strategies for preventing aquatic environment, especially marine ecosystems. The main source of marine chemicals are related to anthropogenic activities (land based discharges and atmospheric inputs) and natural sources as well. Various human-derived sources, such as industrial development, urbanization of coastal areas, the use of oil as the major energy compound, as well as the population explosion and overconsumption characterized the modern way of life, especially at developing countries, seem to go far towards to the degradation of aquatic ecosystems. The most of these chemicals are actually unknown for the aquatic organisms and commonly called as xenobiotics. Aquatic ecosystems receive more than 1500 new chemicals each year, which came into the vast amount of already known environmental pollutants (at least 100.000), being present in the water. Xenobiotics consist of either inorganic (heavy metals, metalloids) or organic (heavy metals, polycyclic aromatic hydrocarbons/PAHs, polychlorinated bifainyls/PCBs, persistent organic contaminants/POPs, dioxins, pesticides etc.) or organometallic materials, derived from anthropogenic activities, such as industry, agriculture, shipping, navigation and tourism. Examples of such naturally occurring toxicants are hydrogen sulfide from geothermal sources or heavy metals, such as lead, leached from minerals. Exposure of organisms to toxicants, being present into the water can be performed normally through direct contact of the organisms with contaminated water. Exposure to xenobiotics may alter the homeostasis (same-state status of equilibrium with surroundings) of

50

Stefanos Dailianis

individual organisms, leading to effects on populations of specific kinds of organisms, communities of organisms, and whole ecosystems. The organisms in aquatic ecosystems are largely confined to relatively small areas, although there are exceptions, such as salmon, which migrate over great distances to reproduce.

2.1. Mussels and Environmental Impacts Mussels, such as Mytilus spp. and other marine bivalves are euryhaline organisms, successfully adapted to tidal flow rates and being able to tolerate high levels of xenobiotics in their tissues (Livingstone, 19991). The good knowledge of their physiology and behavior, in combination with their study at least in cellular, genetic and biochemical level, could suggest them as a reliable tool for the scientists, in order to proceed to studies, relating with the effect of environmental impacts, such as pollutants, both on the environmental and organisms‘ status (Moore, 1985; Amiard et al., 1986; Cossa, 1989; Krishnakumar et al., 1994; Viarengo et al., 1997; Regoli, 1998; de Lafontaine et al., 2000). Moreover, the fact that mussels are exposed to both dissolved and participate forms of lipophilic contaminants, in combination with their low-cost and easily transport and acclimation in laboratory conditions, could suggest them as indicator organisms for pollutants in the marine environment (Goldberg, 1986; Bayne, 1989; Viarengo et al. 1997). Indeed, the use of mussels as sensitive markers or Bioindicators of trace metal or organic substances‘ contamination is considered as a useful tool for assessing defensive, genotoxic, clastogenic or even histopathological alterations as responses to enhanced pollution stress (e.g. Moore, 1985; Amiard et al., 1986; Cossa, 1989; Krishnakumar et al., 1994; Regoli and Orlando, 1994a,b; Viarengo et al., 1997; Regoli, 1998; de Lafontaine et al., 2000). Organisms used as Bioindicators are those, whose presence in a specific area indicates more or less well-defined environmental conditions (Biomonitoring). The precision with which we can specify the relationship between organism and its environment assign the ability of the organism as Bioindicator. The importance of mussels as Bioindicator organisms is reinforced by the fact that they are commonly present all over the world, without ability for migration, thus representing typical organisms of the environmental habitat in each case. Moreover, populations of mussels are generally constant, thus giving rise to repeated samplings, measurements and long-time monitoring of the aquatic environment. Furthermore, mussels are characterized by their ability to accumulate high levels of environmental contaminants in their tissues, due to the high filtration rates. Levels of enzymatic activity, such as cytochrome P450, which are related with the detoxification of organic contaminants (aromatic hydrocarbons, PCBs, etc.) in mussels‘ tissues are significantly lower, compared to those measured in tissues of fishes and crustaceans. Determination of contaminants in their tissues could give reliable data, concerning environmental pollution and contaminants‘ bioavailability within organisms, evidence that it is not clearly obvious when measurements are performed only in water body (Chemical monitoring). In addition, mussels can easily transferred and maintained in different areas, in order to give further data concerning the impact of environmental pollution between low- and heavily-polluted areas (NRC, 1980; Phillips, 1980; Widdows, 1985; Farrington et al., 1987).

Environmental Impact of Anthropogenic Activities

51

2.2. Caged Mussels in Monitoring Mussels, such as Mytilus sp., have been proved to be suitable sentinel organisms for biomonitoring coastal sea waters (Cajaraville et al., 2000), lagoons and estuaries (Nasci et al., 2002), especially due to the fact that they can be easily caged in adequate steel containers usually positioned 3-4 meters under the sea surface, thus reinforcing the monitoring of environmental pollution between low- and heavily-polluted areas (NRC, 1980; Phillips, 1980; Widdows, 1985; Farrington et al., 1987). Physiological parameters measured in caged mussels (for a period of 3-4 weeks) do not seem to be affected by differential changes in the reproductive cycle, although slight variations in temperature, food availability and salinity may take place at each site. In fact, physiological changes obtained in mussels could be a result of toxic effects of chemicals, being present in the water, after accumulation in their tissues. The advantage of using caged mussels in biomonitoring is related with the fact that it is easier to standardize the results obtained by measurements derived from the tissues of control individuals and individuals caged in polluted areas. Since harmful compounds may have a very different biological half-life in mussels (from days, i.e., copper and pesticides, to months and years, i.e., cadmium), (Viarengo et al., 1985a; Poremski and Wiandt, 2000), the relationship between biological effects and pollutant concentrations cannot be inferred utilizing wild animals. Moreover, partially storage as non-toxic forms of pollutants within cells of wild mussels, as well as different stages of gonadal maturity could result in differential measurements of contaminants in tissues of mussels (Koehler, 1989; Viarengo and Nott, 1993), thus indicating different biological responses and pollutant accumulation patterns in the various tissues. Integrations between wild mussels and caged mussels are commonly performed when long-term effects of pollutants are studied. In this case, mussel sampling should be carried out, taking in mind critical aspects of sampling, such as similar age and gonad developmental stages of mussels.

2.3. Biomarkers and Mussels Since marine mussels are commonly used as sentinel organisms for the detection of environmental pollution in coastal waters due to their capacity to accumulate several organic and inorganic contaminants (Livingstone, 1991), changes in simple biochemical and physiologic responses are useful for predicting the impact of pollutants on marine organisms. These responses are typical of a biomarker which is defined as ―A biochemical, cellular, physiological or behavioral variation that can be measured in tissue or body fluid samples or at the level of whole organisms that provides evidence of exposure to and/or effects of, one or more chemical pollutants (and/or radiations)‖ (Depledge, 1993). When challenged by an environmental stressor or a toxic insult, organisms such as mussels, may respond, resulting in observable structural and/or functional changes. The net result of exposure and toxicity is an effect (i.e. an endpoint), which is measurable in the case of a biomarker. The aim of using biomarkers is to relate toxic-chemical presence in the environment to effects on living organisms. The hazard that chemicals pose to organisms is related to the toxicity of the chemical involved, and the degree to which the organism has

Stefanos Dailianis

52

been exposed. Results of the biomarker responses should accurately reflect the differing status of the organism, thus providing a detailed picture of its health and also the status of the surrounding environment. Biomarkers include a variety of specific molecular, cellular and physiological responses, thus offering an effective ―early warning‖ system in biomonitoring of aquatic environments (Adams, 1990; McCarthy and Shugart 1990; Depledge et al., 1993; Depledge, 1994, 1999; UNEP, 1997; Ringwood et al., 1999; Moore et al., 2004a,b). The most used Biomarkers for monitoring environmental health status, utilizing bivalve molluscs, such as mussels are shown in Table 1. The suite of biomarkers must include: 1. biomarkers that are sensitive to stress at a molecular and a cellular level. These, being rapidly activated, should give early warning signals of toxic chemical effects on the animals. 2. biomarkers assessing pollutant damage at the tissue level. 3. biomarkers assessing stress at the organism level, giving indication of the potential survival capacity of the animals as well as their reproductive performance. These are essential to relate the effects of pollutants on individuals to the possible changes at the population level. It is noteworthy to pointed out that more than one biomarker is used to be monitored in order data to be useful to scientists for evaluating the specificity of the responses to natural or anthropogenic changes. Table 1. Biomarkers used for monitoring environmental health status, utilizing bivalves List of biomarkers General stress- biomarkers Lysosomal membrane stability Lysosomal lipofuscin content Lysosomal neutral lipid Peroxisomes proliferation

Effective environmental/ human-derived pollutants. Metal ions, asbestos, transuranics, PAHs, PCBs, heterocyclics, nanoparticles.

Total oxidant scavenging capacity Lipid peroxidation content Specific stress-biomarkers Acetylcholinesterase activity

Pro-oxidants (both inorganic, such as heavy metals and organic such as PAHs, PCBs etc.)

Metallothionein content

Heavy metals (Cu, Zn, Hg, Cd), prooxidants (organic aromatic compounds)

Genotoxicity-biomarkers Micronuclei DNA damage

Pesticides (organophosphates and carbamates), trace metals.

Genotoxic compounds (organic and inorganic substances, i.e., PAHs, trace metals, organochlorines, radionuclides, Benzo[a]pyrene etc).

Environmental Impact of Anthropogenic Activities

53

The important role of mussels as sensitive markers or Bioindicators for monitoring the aquatic environment is clearly demonstrated by the increased number of studies performed in different tissues of mussels, in the last decades (Figure 2).

Figure 2. Studies utilizing Biomarkers in mussels for monitoring environmental health status, during the last decades.

Indeed, tissues of mussels Mytilus sp. (especially species M. galloprovincialis and M. edulis), such as haemolymph, digestive gland, gills and mantle/gonad complex, as well as different cellular types and organelles, such as haemocytes, digestive gland and gill cells, are systematically used in studies both in field and in laboratory, in order to investigate the effect of different inorganic and organic pollutants, with the use of Biomarkers (Table 2). Since the presence of human-derived inorganic and organic pollutants into the water could affect various levels of organism homeostasis, the role of Biomarkers, commonly used in mussels, as well as their importance in monitoring aquatic health status is briefly mentioned above.

2.3.1. Lysosomes in Bivalves and Lysosomal Membrane Stability Lysosomes are of great importance in mussels‘ cells and a lot of studies have been focused on the investigation of their role as a target organelle for monitoring aquatic environment. In general, lysosomes are multi-functional cellular organelles, highly conserved present in almost all cells of eukaryotic organisms. They are surrounded by a semi-permeable membrane that contains numerous hydrolytic enzymes involved in a range of cellular processes including digestion, defense, and reproduction (Pipe, 1993). In fact, lysosomes participate in various cellular processes, such as the degradation of either redundant or damaged organelles, such as mitochondria and endoplasmic reticulum, or long-lived proteins as part of autophagic cellular turnover, thus taking part to the cellular economy (Klionsky and

Stefanos Dailianis

54

Emr, 2000) and the digestion of materials ingested by endocytosis and phagocytosis (i.e., intracellular digestion) (Moore et al., 2006a). Moreover, lysosomal autophagy provides a second line of defence against oxidative stress (Cuervo, 2004; Moore et al., 2006b), and the capability to effectively up-regulate this process is probably a significant factor contributing to the ability of some organisms to tolerate stressful and polluted environments. Table 2. Representative studies performed in different tissues (H: haemolymph and/or haemocytes; DG: digestive gland; G: gills; M/G: mantle/gonad complex) of mussels Mytilus sp. for predicting environmental health, with the use of biomarkers (MT: metallothioneins; LMS/NRR: lysosomal membrane stability/neutral red retention time; MN: micronucleous frequency; AChE: acetylcholinesterase; POX: peroxisomes; DNA damage, OSC: oxyradical capacity/ antioxidant enzymes Biomarker MT

Tissue WST, DG, G, H, M/G

LMS/NRR

H, G

Micronucleous

H, G

DNA damage

H, G, DG

POX

DG

OSC

H, G, DG

AChE

H, G, DG

MN

H, G

Field and laboratory studies Viarengo et al., 1985b, 1997, 1999; Bebianno and Langston, 1992; Kling et al., 1996; Roesijadi, 1996; Geret et al., 2003; Raftopoulou et al., 2006; Dailianis and Kaloyianni, 2007; George and Viarengo, 1985; Viarengo et al., 1985b; Knight et al., 1988; Moore, 1988; Kohler et al., 1992; Viarengo and Nott, 1993; Pisoni et al., 1992, 2002, 2004; Krishnakuman et al., 1994; Lowe et al., 1995; Cajaraville et al., 2000; Fernley et al., 2000; Domouhtsidou and Dimitriadis, 2001; Da Ros et al., 2002; Dailianis et al., 2003; Castro et al., 2004; Koehler, 2004; Moore et al., 2004b, 2006a; Einsporn et al., 2005; Dondero et al., 2006; Sciedek et al., 2006. Brunnetti et al., 1988; Majone et al., 1988, 1990; Scarpato et al., 1990; Bolognesi et al., 1996, 1999, 2004; Venier et al., 1997; Dailianis et al., 2003; Siu et al., 2004. Batel et al., 1999; Bolognesi et al., 1996, 1999, 2004, 2006; Jaksic and Batel, 2003; Pisoni et al., 2004; Siu et al., 2004; Dailianis et al., 2005; Tran et al., 2007. Orbea et al., 2002, 2002a; Cajaraville et al., 2003; Mi et al., 2005; Bilbao et al., 2006; Cajaraville and Ortiz-Zarragoitia, 2006; Orbea and Cajaraville, 2006. Ziegler, 1985; Viarengo et al., 1990; Regoli and Winston, 1999; Regoli, 2000; Gorbi et al., 2003; Gorbi and Regoli, 2003; Romeo et al., 2003a,b; Frenzilli et al., 2004; Dailianis et al., 2005; Kaloyianni et al., 2009. Bocquene et al., 1990, 1997; Dailianis et al., 2003; Valbonesi et al., 2003; Ringwood and Galloway, 2004. Marvin et al., 1994; Mersh and Beauvais, 1996, 1997; Dailianis et al., 2003.

In the field of aquatic toxicology lysosomes of mussels have attracted considerable attention in recent years because they were shown to be the target for a wide range of contaminants. Moreover, lysosomes are not species-specific and can be easily viewed both in blood and nucleated cells. In fact, lysosomes ability to enhance reactions which are involved in normal physiological responses, including augmented sequestration and autophagy of organelles, proteins and xenobiotics, is of great importance for monitoring the effects of nonself substances, being present into the water, on environmental health status (Klionsky and

Environmental Impact of Anthropogenic Activities

55

Emr, 2000; Moore, 2002; Cuervo, 2004). Indeed, these organelles are remarkable for the vast and diverse array of chemicals and pharmaceuticals that they can sequester and accumulate. These range from metal ions such as iron, copper and mercury, transuranics, asbestos, polycyclic aromatic hydrocarbons (PAHs), heterocyclics, anti-psychotic drugs and nanoparticles (De Duve et al., 1974; Nott and Moore, 1987; Moore, 1990, 2002; 2006; Rashid et al., 1991; Moore et al., 2004a,b; Panyam and Labhasetwar, 2003; Gould, 2004; Howard, 2004). Lysosomal functional integrity is a generic common target for environmental stressors in all eukaryotic organisms and its disturbance has been mechanistically linked with many aspects of pathology associated with toxicity (Köhler, 1990; Köhler et al., 2002, 2004; Cuervo, 2004; Moore et al., 2006a). For example, enhanced catabolic activity against xenobiotics pollutants is commonly related with the induction of adverse lysosomal reactions such as swelling, lipidosis (pathological accumulation of lipid), lipofuscinosis (pathological accumulation of age/stress pigment), and loss of membrane integrity (Moore, 1988; Köhler et al. 2002; Moore et al., 2006a, 2007). Metals such as copper, cadmium and mercury, as well as organic contaminants, such as polycyclic aromatic hydrocarbons (PAHs), organochlorines and polychlorinated biphenyls (PCBs) seem to induce functional and oxidative damage, such as lysosomal destabilization, peroxidation of membrane lipids and generation of lipofuscinosis in mussels (Viarengo et al., 1985b; Moore, 1990; Viarengo et al., 1992; Krishnakumar et al., 1994; Cajaraville et al., 2000; Köhler et al., 2002; Moore et al., 2006a,b). As a good indicator of contaminant-induced lysosomal membrane damage, lysosomal membrane stability used as biomarker in a number of field studies, using mussels (Lowe et al., 1995; Fernley et al., 2000; Castro et al., 2004; Moore et al., 2004a,b; Einsporn et al., 2005; Schiedek et al., 2006), oysters (Hauton et al., 2001; Ringwood et al., 2002), scallops (Hauton et al., 2001), limpets (Brown et al. 2004), and crabs (Wedderburn et al., 1998) from different climate zones, clearly reflects gradients of complex mixtures of chemicals in water and sediments, single pollution events and accidents and also serves for the discovery of new ―Hot Spots‖ of pollution (Moore et al., 1997, 1998a,b, 2004a; Broeg et al., 2002; Da Ros et al., 2002; Pisoni et al, 2004; Einsporn et al., 2005; Nicholson and Lam, 2005; Sturve et al., 2005; Barsiene et al., 2006; Bressling, 2006; Schiedek et al., 2006). Lysosomal responses, such as autophagy, have been shown to provide defence against oxidative stress induced by both organic and inorganic environmental pollutants. Oxidatively modified proteins and lipid degradation products, along with carbohydrates and metals accumulated in lysosomes as insoluble granules containing autofluorescent pigments, usually referred to as lipofuscins (George and Viarengo, 1985; Viarengo and Nott, 1993; Terman and Brunk, 2004). Lipofuscins represent an end point in the lipid peroxidation process and their accumulation is easily detectable in cells of stressed organisms. In fact, the accumulation of these pigments in the lysosome vacuolar system of digestive gland cells of molluscs represents the impact of oxidative stress, induced by environmental pollutants in cells and it is related to the level of membrane lipid peroxidation (Viarengo and Nott, 1993). During the exposure of mussels to pollutants, this biomarker typically shows a continuously increasing trend, which reaches a maximum level that is determined by the rate of secretion of lipofuscin-rich residual bodies into the external fluids (George and Viarengo, 1985; Viarengo and Nott, 1993). The use of lipofuscins as a cellular biomarker of oxidative stress seems to be more appropriate than the use of the malondialdehyde (MDA) or thiobarbituric acid (TBA) reactive compounds, since these reactive intermediate toxic

56

Stefanos Dailianis

metabolites of lipid peroxidation induced by oxidative stress (Knight et al., 1988), are rapidly degraded (Esterbauer, 1985).

2.3.2. Neutral Lipid Accumulation in Cells of Mussels Neutral lipids accumulate in the lysosomal vacuolar system, as a result of the disturbance of fatty acid metabolism occurred by pollutants (Lüllman-Rauch, 1979). A build-up of these substances in mussel digestive gland cells may be described as a form of lipidosis induced by toxic chemicals (Moore, 1988). Lipids (probably in form of droplets) are then internalised into the lysosomes by autophagic uptake. It is important to note that such increase in the lysosomal storage of neutral lipids may be related to an increase in the cytosolic lipids content or to a decrease in fatty acid processing. The lysosomal storage of neutral lipids in mussel digestive glands has been found to be a useful indicator of a change in the physiology of the cells (Koehler et al., 1992, 2002; Koehler, 2004). As with lipofuscins, the build-up of neutral lipids is a simple and low-cost biomarker used in many studies in order to estimate the effects of environmental impacts, using mussels as Bioindicator organisms (Moore, 1988; Dondero et al., 2006). 2.3.3. Oxidative Stress Biomarkers and Mussels In recent years, there is an increasing interest in studies of oxidative toxicity in aquatic organisms (Livingstone, 1998). Mussels have been used extensively as sensitive bioindicators for pollutants associated with the induction of reactive oxygen species (ROS) and oxidative damage (Frenzilli et al., 2004). Increased levels of ROS can occur intracellularly either via the straight forward activation of processes that lead to their synthesis or indirectly via the effect of pollutants on antioxidant enzymes (including superoxide dismutase, catalase, glutathione peroxidases, etc.) and scavengers (both hydrophilic such as GSH, ascorbate and MT, as well as lipophilic such as vitamin E and carotenoids), thus decreasing cell defences (Viarengo, 1989). Catalase, superoxide dismutase (SOD) and GSH transferase activities (GST) are often modified in response to cellular oxidative stress (Viarengo et al., 1988; Orbea et al., 2002a,b; Regoli et al., 2002; Geret et al., 2003; Orbea and Cajaraville, 2006) and have been used in laboratory studies and biomonitoring programmes for mussels (Romeo et al., 2003a,b). Catalase activity (EC 1.11.1.6) is considered as the primary defence against oxidative damage and has been studied in bivalve molluscs (Pellerin-Massicotte, 1997), due to its ability to convert hydrogen peroxide into water. The glutathione S-transferases (GSTs EC 2.5.1.18) are a group of phase II detoxifying enzymes (proteins with typical molecular masses of around 50 kDa, each composed of two polypeptide subunits) whose main function is to convert endogenous, and xenobiotic electrophilic compounds to water-soluble intermediates that may be eliminated. GSTs catalyze the transfer of the tripeptide glutathione to substrate containing a reactive electrophilic centre to form a polar S-glutathionylated reaction product (R-SG). Many of the compounds that induce GST are themselves substrates for these enzymes, or are metabolized (by cytochrome P-450 monooxygenases) to compounds that can serve as GST substrates (carbonyl-, peroxide-, and epoxide-containing metabolites produced within the cell by oxidative stress), suggesting that GST induction represents part of an adaptive response mechanism to chemical stress caused by electrophiles. GST is regulated by a structurally diverse range of xenobiotics and at least 100 chemicals, including organochlorine

Environmental Impact of Anthropogenic Activities

57

compounds, have been identified that induce GST activity in bivalve molluscs (Fitzpatrick et al., 1997; Hoarau et al., 2001, 2004). These enzymatic biomarkers have been proved to be suitable for monitoring the effects of pollutants on sentinel organisms, especially when their measurements in tissues of mussels are integrated with other biomarkers, such as the lysosomal membrane stability and lipofuscin accumulation assays, which help to correctly interpret the ―physiological meaning‖ of changes observed in antioxidative enzymatic activities. Similarly, the concentration of scavengers, such as GSH, can be utilized per se as a biomarker of oxidative stress in mussels. In this case, a decrease in GSH concentration is usually associated with the enhancement of peroxidation processes in the cell membrane (Ziegler, 1985; Viarengo et al., 1990). Since cells tend to maintain a constant level of reduced glutathione, this biomarker is considered not sufficiently sensitive and thus it is not utilized routinely in biomonitoring programs. On the other hand, it is important to point out that protein oxidation, often under investigation in proteomic studies, has been recently proposed as a biomarker of oxidative stress (Sheehan, 2006). Changes in the activity of the antioxidants present in cells provide information on organism responses to prooxidant pollutants. On the other hand, this is not sufficient to assess the overall efficiency of the antioxidant system. A measurement of the total oxyradical scavenging capacity (TOSC) may be utilized to quantify cellular resistance to different oxyradicals (Regoli and Winston, 1999; Regoli, 2000; Kaloyianni et al., 2009). TOSC provides therefore a useful indication of the contribution levels of oxidative stress to the pollutant induced alteration of the organisms‘ physiological status. This biomarker was recently employed both in laboratory and field studies (Gorbi and Regoli, 2003; Kaloyianni et al., 2009).

2.3.4. Peroxisome Proliferation and Mussels Peroxisomes are membrane-bound organelles involved in a range of cellular functions including lipid metabolism and ROS homeostasis (Mannaerts and Van Veldhoven, 1993; Singh, 1996). In mollusc cells these organelles contain antioxidant enzymes including catalase, SOD and glutathione peroxidase (GPX) (Dhaunsi et al., 1992; Singh, 1997; Orbea et al., 2000). When organisms are exposed to organic xenobiotics, an increase in volume and number of peroxisomes is observed. These changes are often associated to an increase of enzyme activities involved in fatty acid oxidation, such as acyl-Co A oxidase (AOX). Recent transplant studies have demonstrated that peroxisome proliferation is a rapid (i.e. two days) and reversible response to pollution by PAHs, PCBs and their derivatives in mussels (Cajaraville et al., 2003; Cajaraville and Ortiz- Zarragoitia, 2006; Orbea and Cajaraville, 2006). The fact that metals such as Cd (Orbea et al., 2002a) or Cu (Cajaraville and Ortiz-Zarragoitia, 2006) do not elicit peroxisome proliferation in mussels is believed to imply that this response is specific for organic xenobiotics. Moreover, new tools to assess peroxisome proliferation in mussels based on proteomic (Mi et al., 2005) and genomic (Bilbao et al., 2006) approaches have been developed. 2.3.5. Acetylcholinesterase Activity in Tissues of Mussels Pesticides enter waterways along with agricultural and urban waste, thus reaching estuaries and marine coastal waters. These toxic compounds are known to be hydrolyzed quite rapidly in the environment, their half-life being in the range of hours or days (Barron

58

Stefanos Dailianis

and Woodburn, 1995). In spite of this, because of the increase of pesticide concentrations found in the wild, there is a need for an evaluation of their potential toxic effects on organisms living in marine coastal environment. Cholinesterases (ChEs) represent a well-known class of serine hydrolases (Walker and Thompson, 1991) and have been found as polymorphic enzymes with different substrate preferences and sensitivities to pesticides in molluscs. Two forms of ChEs have been identified in Ostrea edulis and Mytilus spp., namely acetylcholinesterase (AChE, which preferentially hydrolyses acetyl esters such as acetylcholine) and butyrycholinesterase (BChE, which preferential acts on butyrylcholine and is thought to involve in detoxification of natural products) (Chang and Opperman, 1991; Massouliè et al., 1993; Bocquené et al., 1997), while AChE and propionylcholinesterase (PChE) have been found in Corbicula fluminea and O. edulis (Mora et al., 1999; Valbonesi et al., 2003). They are considered ubiquitous enzymes whose physiological function is to remove acetylcholine from synaptic clefts. Increasing use of organophosphate (OP) and carbamate pesticides (two classes of compounds that are well-known inhibitors of ChE activity even at very low concentrations) has posed the problem of the possible effects of these neurotoxic compounds on wildlife (Weiss, 1964; Bocquené et al., 1990; Sturm et al., 1999). AChE activity is extremely sensitive to neurotoxic pesticides and is commonly used as a sensitive biomarker for exposures to high concentrations of pesticides in the Mytilus sp. (and generally in molluscs). AChE activity determination is usually performed on the gills, the haemolymph and other tissues of mussels (Mora et al., 1999; Galloway et al., 2002; Rickwood and Galloway, 2004; Dailianis et al., 2003), O. edulis (Valbonesi et al., 2003) and Crassostrea gigas (Bocquené et al., 1997). The responsiveness of AChE to other chemicals such as heavy metals, detergents (Guilhermino et al., 1998) and algal toxins (Lehtonen et al., 2003) has been also acknowledged in mussels.

2.3.6. Metallothionein Content in Tissues of Mussels A number of studies is related with the ability of essential and non-essential heavy metal cations to cause toxic effects in mussel tissues (Amiard et al., 1986; Viarengo et al., 1990; Regoli and Orlando, 1994a,b; Regoli, 1998). Mechanisms of metal sequestration and detoxification include the bind of metal cations with sulphyhydryl (–SH) groups of metallothioneins (MTs) or their accumulation in membrane-limited granules, representing a general strategy for metal cation homeostasis. Metallothioneins (MT) are low molecular weight (about 6-8 kDa) cysteine-rich, cytoplasmic, metal-binding proteins, with a peculiar amino acid (characteristic distribution of cysteinyl residues such as: Cys-X-Cys, Cys-Cys, Cys-XY-Cys, where X and Y are amino acids different from cysteine) whose synthesis represents a specific response of the organisms from polluted populations or following exposure to metals such as Cd, Cu, Hg and Zn (Engel and Roesijadi, 1987; Viarengo, 1989; Viarengo et al., 1999a,b). Moreover, they display ROS scavenger activity as part of the antioxidant defence system of the cells (Sato and Bremner, 1993; Viarengo and Nott, 1993; Viarengo et al., 1999a), and act as regulators of the activity of Zn finger proteins in modulating gene expression (Zeng et al., 1991; Roesjadi et al., 1998). Assessing pollution using MTs has become of great interest in the marine environment, and MTs are seen as potential biomarkers of metal exposure in molluscs and other marine organisms (Roesijadi, 1992; Langston et al., 1998; Rotchell et al., 2001). MTs were found and quantified in various tissues of Mytilus galloprovincialis especially in the digestive gland and gills (see for example Bebianno and Langston, 1992; Viarengo et al., 1997). The

Environmental Impact of Anthropogenic Activities

59

properties and the nature of MT imply that these proteins‘ function includes elements of both, homeostasis and detoxification (Squibb and Cousins, 1974; Roesijadi, 1992; Viarengo and Nott, 1993). MTs have been identified into two groups in the Mytilidae family, such as the MT-10 and MT-20 forms (Lemoine et al. 2000). The MT-10 proteins play a role in the regulation of different essential or toxic metals, whereas MT-20 appears to be specific to Cd. Studies focusing on the structure of the promoters of MT genes in mussels indicated the presence of nucleotide sequences with a high homology to the AP1, GRE and MRE sequences previously identified in fish. Further studies using real-time Q-PCR utilizing specific probes for the MT10 and MT20 genes suggested that MT10 is a constitutively activated gene (activated mainly by Zn and Cu), while MT20 is expressed at low levels in control conditions (and is typically induced by Cd, Hg, to a lower extent by Cu, and minimally by Zn). The MT20 gene is also activated by the synthesis of oxyradicals (Dondero et al., 2005). Despite the fact that a number of studies indicated that MTs are induced directly by heavy metals but also indirectly by organic aromatic compounds, via the induction of oxidative stress in mussel cells (Kling et al., 1996; Dailianis and Kaloyianni, 2007), MT levels are utilized as an early indicator of the biological effects of heavy metals which represent an important source of pollution in the coastal areas of industrialized zones, (Roesijadi, 1996; Viarengo et al., 1999a), and it is recommended in MED POL III Programme as sensitive biomarker of marine environment contamination by heavy metals (Manual on the Biomarkers UNEP/MAP, Athens 1999).

2.3.7. Micronucleus Frequency in Tissues of Mussels Mussels are systematically used in the last decades as Bioindicators for pollutants, whose presence in the water could be linked with the induction of clastogenic and genotoxic damage in cells of aquatic organisms. Clastogenicity and genotoxicity of toxic compounds are monitored by the investigation of micronucleus (MN) frequency in cells of both fishes and mussels (Darzynkiewicz, 1993, 1994; Herbert and Hansen, 1998; Bresler et al., 1999). Micronucleus (MN) cell frequency demonstrates objectively the level of genotoxic damage in response to the presence of mutagenic substances. This biomarker shows a typically continuously increasing trend in animals exposed to increasing pollutant concentrations and/or times of exposure. Genotoxic biomarkers represent the primary event of the animal response after environmental exposure to toxic carcinogen and mutagenic compounds (UNEP/RAMOGE, 1999). Micronuclei are nuclear formations within cells, smaller than the main nuclear of the cell (diameter 1/3 to 1/7 or less in some occasions, depending on cellular type). Micronuclei appear when cells fail to incorporate complete or fragment chromosomes in the daughter nuclei during cell division. These are instead incorporated in small additional nuclei where they remain throughout the life of the cell. The presence of micronuclei is an indicator of chromatin breakage which may be caused by clastogens or spindle dysfunctions, ultimately caused by toxic compounds (Heddle et al., 1983; Carrano and Natarajan, 1988). The test consists in the scoring of cells containing one or more cytoplasmic micronuclei in addition to the main nucleus. This procedure is technically easier and more rapid than the analysis of chromosomal aberrations during metaphase. This is one of the reasons why this biomarker is widely utilized in biomonitoring programs.

60

Stefanos Dailianis

The MN test has been widely applied in wild and caged marine invertebrates (Majone et al., 1990; Scarpato et al., 1990; Bolognesi et al., 1999, 2004; Siu et al., 2004), as a sensitive indicator of chromosomal damage, in order to assess the genotoxic activity of various organic (Scarpato et al., 1990; Mersh et al., 1992; Marvin et al., 1994; Venier et al., 1997) or inorganic substances (Majone et al., 1988; Mersh and Pihan, 1993; Camusso et al., 1994; Bolognesi et al., 1999). The MN test has been evaluated in isolated mussel haemocytes (e.g. Majone et al., 1988; Mersh et al., 1996; Mersh and Beauvais, 1997; Bolognesi et al., 1999), as well as in isolated gill cells of marine molluscs (Brunetti et al., 1988; Scarpato et al., 1990) or even simultaneously in the earlier two cell types (Mersh et al., 1996; Venier et al., 1997). However, gill cells seem to be the best target tissue for micronuclei determination in caged as well as in free-roaming mussels. For example, caged mussels exposed to sea water polluted by aromatic hydrocarbons (such as the Petroleum Harbour in Genoa) displayed a continuous increase of micronuclei frequency in gill cells reaching a plateau after a month of caging (Bolognesi et al., 1996).

2.3.8. DNA Damage in Tissues of Mussels Marine pollutants produce multiple consequences at the organism, population and ecosystem levels, affecting organ function, reproductive status, species survival, population size and ultimately biodiversity. Among these, carcinogenic compounds are of particular interest, and tumours have indeed been described in mussels (Mix, 1986; Malins et al., 1988; Bolognesi, 1990; Gopal and Pathak, 1993). Except from MN frequency increase, the persistence of toxic compounds could result in increase genotoxicity, including alterations of the integrity of the DNA structure, either directly or through their metabolites (Shugart, 1995). DNA alterations induced by chemical and physical agents include single and double strand breakages, modified bases, DNA-DNA crosslinks, and DNA-protein crosslinks, induced either indirectly via interaction with oxygen radicals, or via the action of excision repair enzymes (Eastman and Barry, 1992; Speit and Hartmann, 1995). Among the methods usually adopted in biomonitoring programs to detect DNA damage, alkaline elution method, based on the evidence that the rate at which DNA single strand fragments pass through a membrane filter under alkaline conditions is related to the length of the DNA strand itself is widely used. This method has been successfully employed to evaluate genotoxic effects of pollutants in fish and mollusks exposed to chemical compounds (Dailianis et al., 2005; Bolognesi et al., 1996, 1999, 2004, 2006). Another technique is the COMET assay, now widely used to assess the genotoxic effects of pollutants. In this technique, individual cells (haemocytes, digestive gland cells and gills cells of mussels) are directly embedded in agarose, where the nuclear DNA is then electrophorized through the gel, in which the cleaved DNA fragments migrate away from the residual chromatin nucleosomal core structure. The DNA stained with a fluorescent dye shows a ―comet‖ in which the distance of DNA migration from the core (i.e. the comet tail length) reflects the level of double strand DNA breakage (Siu et al., 2004). A third method (micromethod assay) was hardly used in order to assess DNA strand breakages under alkaline conditions by measuring the rate at which a fluorescent dye is incorporated in the double stranded DNA (Batel et al., 1999). Experimental conditions, such as the time set for allowing the DNA to unfold and the pH of the denaturation media have to

Environmental Impact of Anthropogenic Activities

61

be established on the basis of the complexity of the DNA molecule, which differs considerably among different taxa (Jaksic and Batel, 2003).

CONCLUSION In conclusion, bivalve molluscs posses a critical thesis in aquatic environments, not only via their involvement as a key organism within trophic chain but as a useful sensitive marker for the monitoring of human-derived effects on the health status of the aquatic environment as well. The use of mussels as bioindicators organisms has been well-documented in monitoring studies all over the world, as a result of the continuously anthropogenic-induced impacts on the environmental health status. Moreover, biomarkers, such as those previous briefly mentioned, are considered as reliable tools for the monitoring of the marine environment in a lot of frameworks, especially the Mediterranean Action Plan of the United Nations Environment Program (UNEP/RAMOGE, 1999).

REFERENCES Aarset, A.V. (1982). Freezing tolerance in intertidal invertebrates (A review). Comp. Biochem. Physiol. 73A, 571–580. Adams, S.M. (1990). Status and use of biological indicators for evaluating the effects of stress on fish. Am. Fish. Soc. Symp. 8, 1-8. Amiard, J.C., Amiard-Triquet, C., Berthert, B., Metayer, C. (1986). Contribution to the ecotoxicological study of cadmium, lead, copper and zinc in the mussel Mytilus edulis. Mar. Biol. 90, 425-431. Barnes, R.D. (1968). Invertebrate Zoology. W.B. Saunders Company. Barron, M.G., Woodburn, K.B. (1995). Ecotoxicology of chlorpyrifos. Rev. Environ. Contam. Toxicol. 144, 1-93. Barsiene, J., Lehtonen, K.K., Köhler, A., Broeg, K., Vourinen, P.J., Lang, T., Pempkowiak, J., Syvokiené, J., Dedonyte, V., Rybakovas, A., Repecka, R., Vuontisjarvi, J., Kopecka, J. (2006). Biomarker responses in flounder (Platichthys flesus) and mussel (Mytilus edulis) in the Klaipéda- Butingé area (Baltic sea). Mar. Poll. Bull. 53, 406-421. Batel, R., Jakšic, Z., Bihari, N., Hamer, B., Fafandel, M., Chauvin, C., Schröder, C.H., Müller, W.E.G., Zahn, R.K. (1999). A microplate assay for DNA damage determination (Fast Micromethod) in cell suspensions and solid tissues. Anal. Biochem. 270, 195-200. Bayne, B.L. (1989). Measuring the biological effects of pollutants: the mussel watch approach. Wat. Sci. Tech. 21, 1089-1100. Bebianno, M.J. and Langston, W.J. (1992). Cadmium induction of metallothionein synthesis in Mytilus galloprovincialis. Comp. Biochem. Physiol. 103C (1), 79-85. Bilbao, E., de Cerio, O.D., Cajaraville, M.P., Cancio, I. (2006). Cloning and expression pattern of peroxisomal enzymes in the mussel Mytilus galloprovincialis and in the thicklip grey mullet Chelon labrosus: generation of new tools to study peroxisome proliferation. Mar. Environ. Res. 62S, 109-12.

62

Stefanos Dailianis

Bocquené, G., Galgani, F., Truquet, P. (1990). Characterization and assay conditions for use of AChE activity from several marine species in pollution monitoring. Mar. Environ. Res. 30, 75-89. Bocquené, G., Roig, A., Fournier, D. (1997). Cholinesterases from the common oyster (Crassostrea gigas). Evidence for the presence of a soluble acetylcholinesterase insensitive to organophosphate and carbamate inhibitors. FEBS Letters 407, 261-266. Bolognesi, C. (1990). Carcinogenic and mutagenic effects of pollutants in marine organisms: a review. In E. Grandjean (Ed), Carcinogenic, mutagenic, and teratogenic marine pollutants: impact on human healt and the environment (pp. 67-83). The Woodland, TX: Portfolio Publishing Company. Bolognesi, C., Frenzilli, G., Lasagna, C., Perrone, E., Roggieri, P. (2004). Genotoxicity biomarkers in Mytilus galloprovincialis: wild versus caged mussels. Mutat. Res. 552, 187-196. Bolognesi, C., Landini, E., Roggieri, P., Fabbri, R., Viarengo, A. (1999). Genotoxicity biomarkers in the assessment of heavy metal effects in mussels: experimental studies. Environ. Mol. Mutagen 33, 287-292. Bolognesi, C., Perrone, E., Roggieri, P., Pampanin, D., Sciutto, A. (2006). Assessment of micronuclei induction in peripheral erythrocytes of fish exposed to xenobiotics under controlled conditions. Aquat. Toxicol. 78, S93-98. Bolognesi, C., Rabboni, R., Roggeri, P. (1996). Genotoxicity biomarkers in M. galloprovincialis as indicators of marine pollutants. Comp. Biochem. Physiol. 113C, 319323. Bresler, V., Bissinger, V., Abelson, A., Dizer, H., Sturm, A., Kratke, R., Fishelson, L., Hansen, P.D. (1999). Marine molluscs and fish as biomarkers of pollution stress in littoral regions of the Red Sea, Mediterranean Sea and North Sea. Helg. Mar. Res. 53, 219–243. Bressling J. (2006). Natural and toxic stress indicator in blue mussel Mytilus edulis along an offshore-inshore gradient (Weser estuary). Master‘s Thesis, University of Oldenburg, pp.122. Broeg, K., Koehler, A., von Westernhagen, H. (2002). Disorder and recovery of environmental health monitored by means of lysosomal stability in liver of European flounder (Platichthys flesus L.). Mar. Environ. Res. 54, 569-573. Brown, R.J., Galloway, T.S., Lowe, D., Browne, M.A., Dissanayake, A., Jones, M.B., Depledge, M.H. (2004). Differential sensitivity in three marine invertebrate to copper assessed using multiple biomarkers. Aquat. Toxicol. 66, 267-278. Brunetti, R., Majone, F., Gola, I., Beltrame, C. (1988). The micronucleus test: examples and application to marine ecology. Mar. Ecol. Prog. Ser. 44, 65–68. Cajaraville, M.P., Bebianno, M.J., Blasco, J., Porte, C., Sarasquete, C., Viarengo, A. (2000). The use of biomarkers to assess the impact of pollution in coastal environments of the Iberian Peninsula. Sci. Total Environ. 247, 295-311. Cajaraville, M.P., Cancio, I., Ibabe, A., Orbea, A. (2003). Peroxisome proliferation as a biomarker in environmental pollution assessment. Microsc. Res. Tech. 61, 191-202. Cajaraville, M.P. and Ortiz-Zarragoitia, M. (2006). Specificity of the peroxisome proliferation response in mussels exposed to environmental pollutants. Aquat. Toxicol. 78, S117-23.

Environmental Impact of Anthropogenic Activities

63

Camusso, M., Balestrini, R., Muriano, F., Mariani, M. (1994). Use of freshwater mussel Dreissena polymorpha to assess trace metal pollution in the lower river Po (Italy). Chemosphere 29, 729–745. Carrano, A.V. and Natarajan, A.T. (1988). Consideration for populations monitoring using cytogenetic techniques. Mutat. Res. 204, 379-406. Castro M., Santos M.M., Monteiro, N.M., Vieira, N. (2004). Measuring lysosomal stability as an effective tool for marine coastal environmental monitoring. Mar. Environ. Res. 58 (25), 741-745. Chang, S. and Opperman, C.H. (1991). Characterization of acetylcholinesterase molecular form of the root-knot nematode, Meloidogyne. Mol. Biochem. Parasitol. 49, 205-214. Cossa, D. (1989). A review of the use of Mytilus spp. as quantitative indicators of cadmium and mercury contamination in coastal waters. Ocean Act. 12(4), 417-432. Cossa, D., Bourget, E., Piuze, J. (1979). Sexual maturation as a source of variation in the relationship between cadmium concentration and body weight of Mytilus edulis L. Mar. Poll. Bull. 10, 174-176. Cuervo, A.M. (2004). Autophagy: in sickness and in health. TRENDS in Cell Biology, 14, 70-77. Dailianis S., Domouhtsidou G.P., Raftopoulou E., Kaloyianni M., Dimitriadis V.K. (2003). Evaluation of neutral red retention assay, micronucleus test, acetylcholinesterase activity and a signal transduction molecule (cAMP) in tissues of Mytilus galloprovincialis (L.) in pollution monitoring. Mar. Environ. Res. 56, 443-470. Dailianis, S. and Kaloyianni, M. (2007). Role of cAMP in tissues of mussel Mytilus galloprovincialis as a potent Biomarker of cadmium in marine environments. Arch. Environ. Contam. Toxicol. 52, 371-378. Dailianis, S., Piperakis, S.M., Kaloyianni, M. (2005). Cadmium effects on ROS production and DNA damage via adrenergic receptors stimulation: role of Na+/H+ exchanger and PKC. Free Radic. Res. 39(10), 1059-1070. Da Ros, L., Meneghetti, F., Nasci, C. (2002). Field application of lysosomal destabilisation indices in the mussel Mytilus galloprovincialis: biomonitoring and transplantation in the Lagoon of Venice (north-east Italy). Mar. Environ. Res. 54, 817-822. Darzynkiewicz, Z. (1993). Mammalian cell-cycle analysis. In P. Fantes, and R. Brooks (Eds.), The cell cycle: a practical approach (pp. 45–68). Oxford: Oxford University Press. Darzynkiewicz, Z. (1994). Simultaneous analysis of cellular RNA and DNA content. Method Cell Biol. 41, 401–424. Davies, I.M. and Pirie, J.M. (1980). Evaluation of a mussel watch project for heavy metals in Scottish coastal waters. Mar. Biol. 57(2), 87-93. De Duve, C.T., De Barsy, B., Poole, A., Trouet, P., Tulkens, A.,Van Hoof, F. (1974). Lysosomotropic agents. Biochem. Pharmacol. 23, 2495–2531. De Lafontaine, Y., Gagne, F., Blaise, C., Costan, G., Gagnon, P., Chan, H.M. (2000). Biomarkers in zebra mussels (Dreissena polymorpha) for the assessment and monitoring of water quality of the St Lawrence River (Canada). Aquat. Toxicol. 50, 51-71. De Zwaan, A., Cortesi, P., Van Den Thillart, G., Brooks, S., Storey, K.B., Roos, J., Van Lieshout, G., Cattani, O., Vitali, G. (1992). Energy metabolism of bivalves at reduced oxygen tensions. Sci. Tot. Environ. S1029-S1039.

64

Stefanos Dailianis

Depledge, M.H. (1993). The rational basis for the use of biomarkers as ecotoxicological tools. In: Fossi, M.C., Leonzio, C. (Eds.), Nondestructive Biomarkers in Vertebrates (pp. 261– 285). Boca Raton: Lewis Publishers. Depledge, M.H. and Rainbow, P.S. (1990). Models of regulation and accumulation of trace metals in marine invertebrates (Mini review). Comp. Biochem. Physiol. 97C, 1-7. Dhaunsi, G.S., Gulati, S., Singh, A.K., Orak, J.K., Asayama, K., Singh, I. (1992). Demonstration of Cu, Zn superoxide dismutase in rat liver peroxisomes. Biochemical and immunochemical evidence. J. Biol. Chem. 267, 6870-6873. Domouhtsidou, G.P. and Dimitriadis, V.K. (2001). Lysosomal and lipid alterations in the digestive gland of mussels, Mytilus galloprovincialis (L.) as biomarkers of environmental stress. Environ. Pollut. 115, 123-137. Dondero, F., Dagnino, A., Jonsson, H., Capri, F., Gastaldi, L., Viarengo, A. (2006a). Assessing the occurrence of a stress syndrome in mussels (Mytilus edulis) using a combined biomarker/gene expression approach. Aquat. Toxicol. 78S, S13-S24. Dondero, F., Piacentini, L., Banni, M., Rebelo, M., Burlando, B., Viarengo, A. (2005). Quantitative PCR analysis of two molluscan metallothionein genes unveils differential expression and regulation. Gene 345, 259-270. Eastman A. and Barry, M.A. (1992). The origin of DNA breaks: a consequence of DNA damage. DNA repair or apoptosis? Cancer Invest. 10, 229-240. Einsporn, S., Broeg, K., Köhler, A. (2005). The Elbe flood 2002-toxic effects of transported contaminants in flatfish and mussel of the Wadden Sea. Mar. Pollut. Bull. 50, 423-429. Engel, D.W. and Roesijadi, G. (1987). Metallothioneins: a monitoring tool. In A.C.W.B. Vernberg, F.P. Thurberg and F.J. Vernberg (Eds.), Pollution Physiology of Estuarine Organisms (pp. 421-438), University of South Carolina Press, Columbia. Esterbauer, H. (1985). Lipid peroxidation products: formation, chemical properties and biological activities. In G. Pli, K.H. Cheeseman, M.U. Dianzani and T.F. Slater (Eds.), Free Radicals in Liver Injury (pp. 29-47). Oxford: IRL Press. Farrington, J.W., Davis, A.C., Tripp, B.W., Phelps, D.K., Galloway, W.B. (1987). ‗Mussel Watch‘-measurements of chemical pollutants in bivalves as one indicator of coastal environment quality. In T.P. Boyle (Ed.), New approaches to monitoring aquatic ecosystems (pp. 125-139), ASTM STP 940. Philadelphia: American Society for Testing and Materials. Fernley, P.W., Moore, M.N., Lowe, D.M., Donkin, P., Evans, S. (2000). Impact of the Sea Empress oil spill on lysosomal stability in mussel blood cells. Mar. Environ. Res. 50, 451-455. Fisher, C. and Skibinski, D.O.F. (1990). Sex-biased mitochondrial DNA heteroplasmy in the marine mussel Mytilus. Proc. R. Soc. Lond. B 242, 149–156. Fitzpatrick, P.J., O‘Halloran, J., Sheehan, D., Walsh, A.R. (1997). Assessment of a glutathione S transferase and related proteins in the gill and digestive gland of Mytilus edulis (L), as potential organic pollution biomarkers. Biomarkers 2, 51–56. Frenzilli, G., Bocchetti, R., Pagliarecci, M., Nigro, M., Annarumma, F., Scarcelli, V., Fattorini, D., Regoli, F. (2004). Time-course evaluation of ROS-mediated toxicity in mussels, Mytilus galloprovincialis, during a field translocation experiment. Mar. Environ. Res. 58, 609-613.

Environmental Impact of Anthropogenic Activities

65

Galloway, T.S., Millward, N., Browne, M.A., Depledge, M.H. (2002). Rapid assessment of organophosphorous/carbamate exposure in the bivalve mollusk Mytilus edulis using combined esterase activities as biomarker. Aquat. Toxicol. 61, 169-180. George, S.G. and Viarengo, A. (1985). A model for heavy metal homeostasis and detoxication in mussel. Mar. Pollut. Physiol. Recent advances, 125-143. Geret, F., Serafim, A., Bebianno, M.J. (2003). Antioxidant enzyme activities, metallothioneins and lipid peroxidation as biomarkers in Ruditapes decussatus? Ecotoxicology 12, 417-426. Goldberg, E.D. (1986). The mussel watch concept. Environ. Monitor. Assess. 7, 91-103. Gorbi, S. and Regoli, F. (2003). Review. Total Oxyradical Scavenging Capacity as an index of susceptibility to oxidative stress in marine organisms. Comment Toxicol. 9, 303-322. Gopal, K. and Pathak, S.P. (1993). Possible causes of outbreaks of fish diseases and mortality in polluted waters. J. Adv. Zool. 14, 53-60. Gould, P. (2004). Nanoparticles probe biosystems. Materials Today 7, 36-43. Guilhermino, L., Barros, B., Silva, M.C., Soares, A.M.V.M. (1998). Should the use of inhibition of cholinesterases as a specific biomarker for organophosphate and carbamate pesticides be questioned? Biomarkers 3, 157–163. Hauton, C., Hawkins, L.E, Hutchinson, S. (2001). Response of haemocyte lysosomes to bacterial inoculation in the oysters Ostrea edulis L. and Crassostrea gigas (Thunberg) and the scallop Pecten maximus (L.). Fish Shellfish Immunol. 11, 143-153. Heddle, J.A., Hite, M., Kirkhart, B., Mavoumin, K., Mac Gregor, J.T., Newell, G.T., Salamone, M.F. (1983). The induction of micronuclei as a measure of genotoxicity. A report of the U.S. Environmental Protection Agency Gene-Tox Program. Mutat. Res. 123, 61-118. Herbert, A. and Hansen, P. D. (1998). Genotoxicity in fish embryos. In Microscale testing in aquatic toxicology (pp. 491–505). Boca Raton: CRC Press. Hoarau, P., Gnassia-Barelli, M., Roméo, M., Girard, J.P. (2001). Differential induction of GST in the clam Ruditapes decussatus exposed to organic compounds. Environ. Toxicol. Chem. 20, 523-529. Hoarau, P., Garello, G., Gnassia-Barelli M., Roméo, M., Girard, J.P. (2004). Effect of three xenobiotic compounds on Glutathione S-Transferase in the clam Ruditapes decussatus. Aquat. Toxicol. 68, 87–94. Howard, V. (2004). Small particles – big problems. Internat. Lab News 34 (2), 28-29. Hyman, L.H. (1967). The Invertebrates: Mollusca I, McGraw-Hill, Book Company. Jaksic, Z. and Batel, R. (2003). DNA integrity determination in marine invertebrates by Fast Micromethod. Aquat. Toxicol. 65, 361-376. Kaloyianni, M., Dailianis, S., Chrisikopoulou , E., Zannou, A., Koutsogiannaki, S., Alamdari, D.H., Koliakos, G., Dimitriadis, V.K. (2009). Oxidative effects of inorganic and organic contaminants on haemolymph of mussels. Comp. Biochem. Physiol. 149C, 631-639. Kanwisher, J.W. (1959). Histology and metabolism of frozen intertidal animals. Biol. Bull 116, 258–264. Kanwisher, J.W. (1966). Freezing in intertidal animals. In H.T. Meryman (Ed.), Cryobiology (pp. 487-494). New York: Academic Press. Knight, J.A., Pieper, R.K., McClellan, L. (1988). Specificity of the thiobarbituric acid reaction: its use in studies of lipid peroxidation. Clin. Chem. 34, 2433–2438.

66

Stefanos Dailianis

Kling, P., Erkell, L.J., Kille, P., Olsson, P.E. (1996). Metallothionein induction in rainbow Trout Gonadal (RTG-2) cells during free radical exposure. Mar. Environ. Res. 42, 33-36. Klionsky, D.J. and Emr, S.D. (2000). Autophagy as a regulated pathway of cellular degradation. Science 290, 1717-1721. Koehler, A. (2004). Toxic injury and gender-specific hepatocellular carcinogenesis in flounder (Platichthys flesus (L.)). Aquat. Toxicol. 70, 257-276. Koehler, A. (1989). Cellular effects of environmental contamination in fish from the River Elbe and the North Sea. Responses to marine organisms to pollutants. Mar. Environ. Res. 28, 417-424. Koehler, A., Deisemann, H., Lauritzen, B. (1992). Histological and cytochemical indices of toxic injury in the liver of the dab Limanda limanda. Mar. Ecol. Prog. Ser. 91, 141-153. Köhler, A. (1990). Identification of contaminant-induced cellular and subcellular lesions in the liver of flounder (Platichthys flesus L.) caught at differently polluted estuaries. Aquat. Toxicol. 16, 271-294. Köhler, A., Alpermann, T., Lauritzen, B., Van Noorden, C.J.F. (2004). Clonal xenobiotics resistance during pollution-induced toxic injury and hepatocellular carcinogenesis in liver of female flounder. Acta Histochem 106, 155-170. Köhler, A., Wahl, E., Söffker, K. (2002). Functional and morphological changes of lysosomes as prognostic biomarkers of toxic liver injury in a marine flatfish (Platichthys flesus (L)). Environ. Toxicol. Chem. 21, 2434-2444. Krishnakumar, P.K., Casillas, E. and Varanasi, U. (1994). Effect of environmental contamination on the health of Mytilus edulis from Puget Sound, Washington: cytochemical measures of lysosomal responses in the digestive cells using automatic image analysis. Mar. Ecol. Prog. Ser. 106, 249-261. Langston, W.J., Bebianno, M.J., Burt, G.R. (1998). Metal handling strategies in molluscs. In W.J. Langston and M.J. Bebianno (Eds.), Metal Metabolism in aquatic Environments (pp. 219-283). London: Chapman and Hall. Lehtonen, K.K., Kankaanpää, H., Leiniö, S., Sipiä, V.O., Pflugmacher, S., Sandberg-Kilpi, E. (2003). Accumulation of nodularin-like compounds from the cyanobacterium Nodularia spumigena and changes in acetylcholinesterase activity in the clam Macoma balthica during short-term laboratory exposure. Aquat. Toxicol. 64, 461-476. Lemoine, S., Bigot, Y., Sellos, D., Cosson, R.P., Laulier, M. (2000). Metallothionein isoforms in Mytilus edulis (Mollusca, Bivalvia): complementary DNA characterization and quantification of expression in different organs after exposure to cadmium, zinc, and copper. Mar. Biotechnol. 2, 195-203. Livingstone, D. R. (1998). Organic xenobiotics in aquatic systems: quantitative and qualitative differences in biotransformation by invertebrates and fish. Comp. Biochem. Physiol. 120A, 43-49. Livingstone, D.R. (1991). Organic xenobiotic metabolism in marine invertebrates. In R. Gilles (Ed.), Advances in Comparative and Environmental Physiology (Vol. 7, pp. 45185). Berlin: Springer-Verlag. Lowe, D.M., Fossato, V.U., Depledge, M.H. (1995). Contaminant induced lysosomal membrane damage in blood cells of mussels M. galloprovincialis from the Venice Lagoon: an in vitro study. Mar. Ecol. Prog. Ser. 129, 189-196.

Environmental Impact of Anthropogenic Activities

67

Lüllman-Rauch, R. (1979). Drug-induced lysosomal storage disorders. In J.T. Dingle, P.J. Jacques, I.H. and Shaw (Eds.), Lysosomes in Biology and Pathology (Vol. 6, pp. 49-130). Amsterdam: North Holland Publishing Co. Majone, F., Beltrame, C., Brunetti, R. (1988). Frequencies of micronuclei detected on Mytilus galloprovincialis by different staining techniques after treatment with zinc chloride. Mutat. Res. 209, 131–134. Majone, F., Brunetti, R., Fumagalli, O., Gabriele, M., Levis, A.G. (1990). Induction of micronuclei by mitomycin C and colchicine in the marine mussel Mytilus galloprovincialis. Mutat. Res. 244, 147-151. Malins, D.C., McCain, B.B., Landahl, J.T., Myers, M.S., Krahn, M.M., Brown, D.W, Chan, S.L., Roubal, W.T. (1988). Neoplastic and others diseases in fish in relation to toxic chemicals: an overview. Aquat. Toxicol. 11, 43-67. Mannaerts, G.P. and Van Veldhoven, P.P. (1993). Metabolic pathways in mammalian peroxisomes. Biochimie 75, 147-158. Marvin, C.H., McCarry, B.E., Bryant, D.W. (1994). Determination and genotoxicity of polycyclic aromatic hydrocarbons isolated from Dreissena polymorpha (zebra mussels) sampled from Hamilton Harbour. J. Great Lakes Res. 20, 523–530. Massouliè, J., Pezzementi, L., Bon, S., Krejci, E., Valette, F.M. (1993). Molecular and cellular biology of cholinesterase. Prog. Neurobiol. 41, 31-91. McCarthy, J.F. and Shugart, L.R. (1990). Biomarkers of Environmental Contamination, pp. 3-457. Lewis Publishers, MI. Mersh, J. and Beauvais, M.N. (1997). The micronucleus assay in the zebra mussel, Dreissena polymorpha, to in situ monitor genotoxicity in freshwater environments. Mutat. Res. 393, 141–149. Mersh, J., Beauvais, M.N., Nagel, P. (1996). Induction of micronuclei in haemocytes and gill cells of zebra mussels, Dreissena polymorpha, exposed to clastogens. Mutat. Res. 371, 47–55. Mersh, J., Jeanjean, H., Spor, J.C., Pihan, J.C. (1992). The freshwater mussel Dreissena polymorpha as a bioindicator for trace metals, organochlorines and radionuclides. In D. Neumann, and H.A. Jenner (Eds.), The Zebra Mussel Dreissena polymorpha. Limnologie Aktuell (Vol. 4, pp. 227–244). Stuttgart: Gustav Fisher. Mersh, J. and Pihan, J.C. (1993). Simultaneous assessment of environmental impact on condition and trace metal availability in zebra mussels Dreissena polymorpha transplanted into the Wiltz River, Luxembourg. Comparison with the aquatic moss Fontinalis antipyretica. Arch. Environ. Contam. Toxicol. 25, 353–364. Mi, J., Orbea, A., Syme, N., Ahmed, M., Cajaraville, M.P., Cristobal, S. (2005). Peroxisomal proteomics, a new tool for risk assessment of peroxisome proliferating pollutants in the marine environment. Proteomics 5, 3954-3965. Mix, M.C. (1986). Cancerous disease in aquatic animals and their association with environmental pollutants: a critical literature review. Mar. Environ. Res. 20, 1-141. Morton, J.E. (1979). Molluscs, Hutchinson University Library of London. Moore, M.N. (2006). Do nanoparticles present ecotoxicological risks for the health of the aquatic environment? Environ. Internat. 32, 967-976. Moore, M.N. (2002). Biocomplexity: the post-genome challenge in ecotoxicology. Aquat. Toxicol. 59, 1-15.

68

Stefanos Dailianis

Moore, M.N. (1990). Lysosomal cytochemistry in marine environmental monitoring. Histochem. J. 22, 187-191. Moore, M.N. (1988). Cytochemical responses of the lysosomal system and NADPH ferrihemoprotein reductase in molluscs to environmental and experimental exposure to xenobiotics. Mar. Ecol. Prog. Ser. 46, 81-89. Moore, M.N. (1985). Cellular responses to pollutants. Mar. Pollut. Bull. 16, 134-139. Moore, M.N., Allen, J.I., McVeigh, A. (2006a). Environmental prognostics: an integrated model supporting lysosomal stress responses as predictive biomarkers of animal health status. Mar. Environ. Res. 61, 278–304. Moore, M.N., Allen, J.I., Somerfield, P.J. (2006b). Autophagy: role in surviving environmental stress. Mar. Environ. Res. 62, S420-S425. Moore, M.N., Depledge, M.H., Readman, J.W., Leonard, P. (2004a). An integrated biomarker based strategy for ecotoxicological evaluation of risk in environmental management. Mutat. Res. 552, 247-268. Moore, M.N, Lowe, D.M, Kohler, A. (2004b). Biological effects of contaminants: Measurements of lysosomal membrane stability. ICES Techniques in Marine Environmental Sciences (TIMES) No 36. ICES, Copenhagen. Moore, M.N., Lowe, D.M., Wedderburn, R.J., Wade, T., Balashov. G., Büyükgüngör, H., Daurova, Y., Denga, Y., Kostylev, E., Mihnea, P., Moncheva, S., Tabagari, S., Ciocan, C., Özkoc, H., Depledge, M. H. (1998a). International Mussel Watch (UNESCO/IOC) in the Black Sea: a pilot study for biological effects and contaminant residues. In S. Beşiktepe et al. (Eds.), Environmental degradation of the Black Sea, (pp. 273 – 289). Amsterdam: Kluwer Academic Publishers. Moore, M.N., Topping, G., Minhea, P.-E., Kiryanov, S. and Mikhailov, V. (1998b). Design of a monitoring programme for the Black Sea: contaminant levels and biological effects. In L. Mee and G. Topping (Eds.), Black Sea Pollution Assessment (pp. 293-299). New York: UN Publications. Moore, M.N., Viarengo, A., Donkin, P., Hawkins, A.J.S. (2007). Autophagic and lysosomal reactions to stress in the hepatopancreas of blue mussels. Aquat. Toxicol. 84, 80-91. Moore, M.N., Wade, T.L., Lowe, D.M., Wedderburn, R.J., Balashov, G., Büyükgüngör, H., Daurova, Y., Denga, Y., Kostylev, E., Mihnea, P., Moncheva, S., Tabagari, S., Ciocan, C., Özkoc, H., Depledge, M.H. (1997). The UNESCO/IOC ―Black Sea Mussel Watch Pilot Study‖: biological effects and contaminant residues. In L. Mee and G. Topping (Eds.), Black Sea Pollution Assessment (pp. 279-292). New York: UN Publications. Mora, P., Fournier, D., Narbonne, J-F. (1999). Cholinesterases from the marine mussels Mytilus galloprovincialis Lmk. and M. edulis L. and from the freshwater bivalve Corbicula fluminea Müller. Comp. Biochem. Physiol. C122, 353-361. Nasci, C., Nesto, N., Monteduro, RA., Da Ros, L. (2002). Field application of biochemical markers and a physiological index in the mussel, Mytilus galloprovincialis: transplantation and biomonitoring studies in the lagoon of Venice (NE Italy). Mar. Environ. Res. 54, 811-6. Nicholson, S. and Lam, P.K.S. (2005). Pollution monitoring in Southeast Asia using biomarkers in the mytilid mussel Perna viridis (Mytilidae: Bivalvia). Environ. Internat. 31, 121-132. Nott, J.A. and Moore, M.N. (1987). Effects of polycylic aromatic hydrocarbons on molluscan lysosomes and endoplasmic reticulum. Histochem J. 19, 357-368.

Environmental Impact of Anthropogenic Activities

69

NRC, 1980. The International Mussel Watch: Report of a Workshop. Washington DC, US National Academy of Sciences, National Research Council, Publications Office, pp. 248. Orbea, A. and Cajaraville, M.P. (2006). Peroxisome proliferation and antioxidant enzymes in transplanted mussels of four basque estuaries with different levels of polycyclic aromatic hydrocarbon and polychlorinated biphenyl pollution. Environ. Toxicol. Chem. 25, 16161626. Orbea, A., Fahimi, H.D., Cajaraville, M.P. (2000). Immunolocalization of four antioxidant enzymes in digestive glands of molluscs and crustaceans and fish liver. Histochem. Cell Biol. 114, 393-404. Orbea, A., Ortiz-Zarragoitia, M., Solè, M., Porte, C., Cajaraville, M.P. (2002a). Antioxidant enzymes and peroxisome proliferation in relation to contaminant body burdens of PHAs and PCBs in bivalve molluscs, crabs and fish from the Urdaibai and Plentzia estuaries (Bay of Biscay). Aquat. Toxicol. 58, 75-98. Orbea, A., Ortiz-Zarragoitia, M., Cajaraville, M.P. (2002b). Interactive effects of benzo(a)pyrene and cadmium and effects of di(2-ethylhexyl)phthalate on antioxidant and peroxisomal enzymes and peroxisomal volume density in the digestive gland of mussel Mytilus galloprovincialis Lmk. Biomarkers 7, 33-48. Panyam, J. and Labhasetwar, V. (2003). Biodegradable nanoparticles for drug and gene delivery to cells and tissues. Adv. Drug Delivery Rev. 55, 329-347. Pellerin-Massicotte, J. (1997). Influence of elevated temperature and air-exposure on MDA levels and catalase activities in digestive glands of the blue mussel (Mytilus edulis L.). J. Rech. Océanogr. 22, 91–98. Phillips, D.J.H. (1976a). The common mussel Mytilus edulis as an indicator of pollution by zinc, cadmium, lead and copper. II. Relationship of metals in the mussel to those discharged by industry. Mar. Biol. 38, 71-80. Phillips, D.J.H. (1976b). The common mussel Mytilus edulis as an indicator of pollution by zinc, cadmium, lead and copper. I. Effects of environmental variables on uptake of metals. Mar. Biol. 38, 59-69 Phillips, D.J.H. (1980). Quantitative aquatic biological indicators: Their use to monitor trace metal and organochlorine pollution. London: Applied Science Publishers Ltd. Pipe, R.K. (1993). The generation of reactive oxygen metabolites by the haemocytes of the mussel Mytilus edulis. Dev. Comp. Immunol. 16, 111-122. Pisoni, M., Cogotzi, L., Frigeri, A., Corsi, I., Bonacci, S., Iacocca, A., Lancini, L., Mastrototaro, F., Focardi, S., Svelto et al. (2004). DNA adducts, benzo(a)pyrene monooxygenase activity, and lysosomal membrane stability in Mytilus galloprovincialis from different areas in Taranto coastal waters (Italy). Environ. Res. 96, 163-175. Poremski, H.J. and Wiandt, S. (2000). OSPAR Programmes on hazardous substances dynamic selection and prioritisation procedure. GDCh. 17, 55-70. Raftopoulou, E., Dailianis, S., Dimitriadis, V., Kaloyianni, M. (2006). Introduction of cAMP and establishment of neutral lipids alterations as pollution Biomarkers using the mussel Mytilus galloprovincialis. Correlation with a battery of Biomarkers. Sci. Tot. Environ. 368, 597-614. Rashid, F., Horobin, R.W., Williams, M.A. (1991). Predicting the behaviour and selectivity of fluorescent probes for lysosomes and related structures by means of structure-activity models. Histochem. J. 23, 450-459.

70

Stefanos Dailianis

Regoli, F. (2000). Total oxyradical scavenging capacity (TOSC) in polluted and translocated mussels: a predictive biomarker of oxidative stress. Aquat. Toxicol. 50, 351-361. Regoli, F. (1998). Trace metals and antioxidant enzymes in gills and digestive gland of the Mediterranean mussel Mytilus galloprovincialis. Arch. Environ. Contam. Toxicol. 34, 4863. Regoli, F. and Orlando, E. (1994a). Seasonal variation of trace metal concentrations in the digestive gland of the mediterranean mussel Mytilus galloprovincialis: Comparison between a polluted and a non-polluted site. Arch. Environ. Contam. Toxicol. 27, 36-43. Regoli, F. and Orlando, E. (1994b). Accumulation and subcellular distribution of metals (Cu, Fe, Mn, Pb and Zn) in the mediterranean mussel Mytilus galloprovincialis during a field transplant experiment. Mar. Poll. Bull. 28(10), 592-600. Regoli, F., Pellegrini, D., Winston, G.W., Gorbi, S., Giuliani, S., Virno-Lamberti, C., Bompadre, S. (2002). Application of biomarkers for assessing the biological impact of dredged materials in the Mediterranean: the relationship between antioxidant responses and susceptibility to oxidative stress in the red mullet (Mullus barbatus). Mar. Pollut. Bull. 44, 912-922. Regoli, F. and Winston, G.W. (1999). Quantification of total oxidant scavenging capacity (TOSC) of antioxidants for peroxynitrite, peroxyl radicals and hydroxyl radicals. Toxicol. Appl. Pharmacol. 156, 96-105. Rickwood, C.J. and Galloway, T.S. (2004). Acetylcholinesterase inhibition as a biomarker of adverse effect a study of Mytilus edulis exposed to the priority pollutant chlorfenvinphos. Aquat. Toxicol. 67, 45-56. Ringwood, A.H., Hameedi, M.J., Lee, R.F., Brouwer, M., Peters, E.C., Scott, G.I., Luoma, S.N., Digiulio, R.T. (1999). Bivalve biomarker workshop: overview and discussion summaries. Biomarkers 4, 391–399. Ringwood, A.H., Hoguet, J., Keppler, C.J. (2002). Seasonal variation in lysosomal destabilization in oysters, Crassostrea virginica. Mar. Environ. Res. 54, 793-797. Roesijadi, G. (1992). Metallothioneins in metal regulation and toxicity in aquatic animals. Aquat. Toxicol. 22 (2), 81-114. Roesijadi, G. (1996). Metalothionein and its role in toxic metal regulation. Comp. Biochem. Physiol. 113C, 117-123. Roesijadi, G., Bogumil, R., Vašák, M., Kägi, J.H. (1998). Modulation of DNA binding of a tramtrack zinc finger peptide by the metallothionein-thionein conjugate pair. J. Biol. Chem. 273, 17425-17432. Romeo, M., Mourgaud, Y., Geffard, A., Gnassia-Barelli, M., Amiard, J.C., Budzinski, H. (2003a). Multimarker approach in transplanted mussels for evaluating water quality in Charentes, France, coast areas exposed to different anthropogenic conditions. Environ. Toxicol. 18, 295-305. Romeo, M., Hoarau, P., Garello, G., Gnassia-Barelli, M., Girard, J.P. (2003b). Mussel transplantation and biomarkers as useful tools for assessing water quality in the NW Mediterranean. Environ. Pollut. 122, 369-78. Rotchell, J.M., Clarke, K.R., Newton, L.C., Bird, D.J. (2001). Hepatic metallothionein as a biomarker for metal contamination: age effects and seasonal variation in European flounders (Pleuronectes flesus) from the Severn Estuary and Bristol Channel. Mar. Environ. Res. 52, 151-171.

Environmental Impact of Anthropogenic Activities

71

Sato, M. and Bremner, I. (1993). Oxygen free radicals and metallothionein. Free Radical. Biol. Med. 14, 325-337. Scarpato, R., Migliore, L., Alfinito-Cognetti, G., Barale, R. (1990). Induction of micronuclei in gill tissue of Mytilus galloprovincialis exposed to polluted marine waters. Mar. Pollut. Bull. 21, 74-80. Schiedek, D., Broeg, K., Barsiene, J., Lehtonen, K. K., Gercken, J., Pfeifer, S., Vuontisjärvi, H., Vuorinen, P. J., Köhler, A., Balk, L., Schneider, R. (2006). Biomarker responses and indication of contaminant effects in blue mussel (Mytilus edulis) and eelpout (Zoarces viviparus) from the western Baltic Sea. Mar. Pollut. Bull. 53, 387-405. Sheehan, D. (2006). Detection of redox-based modification in two-dimensional electrophoresis proteomic separations. Biochem. Biophys. Res. Commun. 349, 45-462. Shugart, L.R. (1995). Environmental genotoxicology. In G.M. Rand (Ed.), Fundamentals of Aquatic Toxicology: Effects, Environmental Fate, and Risk Assessment (pp. 405-422). Bristol: Taylor and Francis PA. Singh, I. (1996). Mammalian peroxisomes: metabolism of oxygen and reactive oxygen species. Ann. NY Acad. Sci. 804, 612-627. Singh, I. (1997). Biochemistry of peroxisomes in health and disease. Mol. Cell Biochem. 167, 1-29. Siu, W.H.L., Cao, J., Jack, R.W., Wu, R.S.S., Richardson, B.J., Xu, L., Lam, P.K.S. (2004). Application of the comet and micronucleus assays to the detection of B[a]P genotoxicity in haemocytes of the green–lipped mussel (Perna viridis). Aquat. Toxicol. 66, 381-392. Speit, G. and Hartmann, A. (1995). The contribution of excision repair to the DNA effects seen in the alkaline single cell gel test (comet assay). Mutagenesis 10, 555-559. Squibb, K.S. and Cousins, R.J. (1974). Control of cadmium-binding protein synthesis in rat liver. Environ. Physiol. Biochem. 4, 24-30. Strathmann, R.R. (1987). Larval feeding. In A.C. Giese, J.S. Pearse, V.B. Pearse (Eds.), Reproduction of marine invertebrates (Vol. 9, pp. 465-550). Blackwell: Palo Alto. Sturm, A., da Silva de Assis, H.C., Hansen, P.D. (1999). Cholinesterases of marine teleost fish: enzymological characterization and potential use in the monitoring of neurotoxic contamination. Mar. Environ. Res. 47, 389-398. Sturve, J., Balk, L., Berglund, A., Broeg, K., Böhmert, B., Koehler, A., Massey, S., Parkkonen, J., Savva, D., Stephensen, E., Förlin, L. (2005). Effects of dredging in Goteborg harbour assessed by biomarkers in eelpout (Zoarces viviparus). Environ. Toxicol. Chem. 24, 1951-1961. Terman, A. and Brunk, U.T. (2004). Lipofuscin. Int. J. Biochem. Cell Biol. 36, 1400-1404. Tran, D., Moody, A.J., Fisher, A.S., Foulkes, M.E., Jha, A.N. (2007). Protective effects of selenium on mercury-induced DNA damage in mussel haemocytes. Aquat. Toxicol. 84, 11-18. UNEP, (1997). The MED POL biomonitoring program concerning the effects of pollutants on marine organisms along the Mediterranean coasts. UNEP (OCA) MED WG 132/3 Athens Greece. UNEP/RAMOGE, (1999). Manual on the biomarkers recommended for the MED POL biomonitoring programme. UNEP, Athens. Valbonesi, P., Sartor, G., Fabbri, E. (2003). Characterization of cholinesterase activity in three bivalves inhabiting the North Adriatic sea and their possible use as sentinel organisms for biosurveillance programmes. Sci. Total Environ. 312, 79-88.

72

Stefanos Dailianis

Venier, P., Maron, S., Canova, S. (1997). Detection of micronuclei in gill cells and haemocytes of mussels exposed to benzo[a]pyrene. Mutat. Res. 390, 33–44. Viarengo, A. (1989). Heavy metals in marine invertebrates: mechanisms of regulation and toxicity at the cellular level. CRC Rev. Aquat. Sci. 1, 295-317. Viarengo, A., Burlando, B., Dondero, F., Marro, A., Fabbri, R. (1999a). Metallothionein as a tool in biomonitoring programmes. Biomarkers 4, 455-467. Viarengo, A., Burlando, B., Cavaletto, M., Marchi, B., Ponzano, E., Blasco, J. (1999b). Role of metallothionein against oxidative stress in the mussel (Mytilus galloprovincialis). Am. J. Physiol. 277, R1612-R1619. Viarengo, A., Canesi L., Pertica M., Mancinelli G., Orunesu M. (1988). Biochemical characterization of a copper-thionein involved in Cu accumulation in the lysosomes of the digestive gland of mussels exposed to the metal. Mar. Environ. Res. 24, 163-166. Viarengo, A., Canesi, L., Pertica, M., Poli, G., Moore, M.N., Orunesu, M. (1990). Heavy metal effects on lipid peroxidation in the tissues of Mytilus galloprovincialis Lam. Comp. Biochem. Physiol. 97C, 37-42. Viarengo, A., Moore, M.N., Pertica, M., Mancinelli, G., Zanicchi, G., Pipe, R.K. (1985b). Detoxification of copper in the cells of the digestive gland of mussel: the role of lysosomes and thioneins. Sci. Tot. Environ. 44, 135-145. Viarengo, A., Moore, M.N., Pertica, M., Mancinelli, G., Accomando, R. (1992). A simple procedure for evaluating the protein degradation rate in mussel (Mytilus galloprovincialis Lam.) tissues and its application in a study of phenanthrene effects on protein catabolism. Comp. Biochem. Physiol. 103B, 27-32. Viarengo, A. and Nott, J.A. (1993). Mechanisms of heavy metal cation homeostasis in marine invertebrates. Comp. Biochem. Physiol. 104C, 355-372. Viarengo, A., Palmero, S., Zanicchi, G., Capelli, R., Vaissiere, R., Orunesu, M. (1985a). Role of metallothioneins in Cu and Cd accumulation and elimination in the gill and digestive gland cells of Mytilus galloprovincialis Lam. Mar. Environ. Res. 16, 23-36. Viarengo, A., Ponzano, E., Dondero, F., Fabbri, R. (1997). A simple spectrophotometric method for metallothionein evaluation in marine organisms: an application to Mediterranean and Antarctic molluscs. Mar. Environ. Res. 44, 69–84. Wedderburn, J., Cheung, V., Bamber, S., Bloxham, M., Depledge, M.H. (1998). Biomarkers of biochemical and cellular stress in Carcinus maenas: An in situ field study. Mar. Environ. Res. 46, 321-324. Weiss, C.M. (1964). Detection of pesticides in water by biochemical assay. J. Water Pollut. Control Fed. 36, 240-253. Widdows, J. (1985). The effects of Stress and Pollution on Marine Animals. New York: Praeger Press. Williams, R.T. (1970). Freezing tolerance in Mytilus edulis. Comp. Biochem. Physiol. 35: 145–161. Zeng, J., Heuchel, R., Schaffner, W., Kägi, J.H. (1991). Thionein (apometallothionein) can modulate DNA binding and transcription activation by zinc finger containing factor Sp1. FEBS Lett. 279, 310-312. Ziegler, D.M. (1985). Role of reversible oxidation-reduction of enzyme thiols-disulphydes in metabolic regulation. Annu. Rev. Biochem. 54, 305.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 3

THE EXPERIENCE OF THE MUSSEL SECTOR IN GALICIA: THE NATURAL, INSTITUTIONAL AND ECONOMIC ENVIRONMENT Gonzalo Caballero-Miguez, Manuel Varela-Lafuente and Marcos Pérez-Pérez University of Vigo

ABSTRACT The Galician coast is the natural environment in which more than 95% of Spanish mussel production occurs. Galicia is a Spanish region located in the far North-Western corner of the Iberian Peninsula and its coastline is 1200 km long. In this coastline there are a series of estuaries or bays (also referred to as ―rías‖) that are actually ancient drowned river valleys that were taken over by the sea. Mussels are farmed in the coastal inlets of Galicia by means of a floating raft culture. The Galician mussel sector is based on nearly 3300 installed floating rafts in the five "rías" (Vigo, Pontevedra, Arousa, Muros, Ares). These ría waters are blessed with an extraordinary quality for the farming of mussels due to their warmth and the high amount of nutrients which they contain. Moreover, the rías are ocean areas that are protected from severe weather conditions, which is why the mussel farms are resistant to the changing maritime weather. The Galician mussel production has surpassed 200,000 tonnes annually. Consequently, we are talking about one of the largest mussel producers in the world, and the sector directly generates more than 8000 jobs and incorporates 1000 aquaculture support vessels. This chapter studies the conditions, environment and characteristics of mussel production in the Galician Floating raft culture. This is an updated analysis of the physical, institutional and economic elements of the Galician mussel sector.

INTRODUCTION Galicia is a region situated in the northwest of the Iberian Peninsula and has 1,200 kilometres of coastline, on which there are a series of estuaries (also referred to as ―rías‖) that

74

Gonzalo Caballero-Miguez, Manuel Varela-Lafuente, Marcos Pérez-Pérez

are actually ancient drowned river valleys which were taken over by the sea. The Galician Rías group together a series of factors that allow for the establishment of floating platforms of the production of mussels (Mytilus galloprovincialis) in this geographic area of the Atlantic Ocean. There are two factors that characterize this natural environment: A) These ría waters are blessed with an extraordinary quality for the farming of mussels due to their warmth and the high amount of nutrients which they contain. B) The rías are ocean areas that are protected from severe weather conditions, which is why the mussel farms are resistant to the changing maritime weather. Together with these two irreplaceable and non movable natural factors, we should also point out the existence of the mussel seed in the Galician coasts and the historic development in Galicia of a social community that is bound to the sea. This chapter analyzes the historical experience of the Galician floating raft culture, and we focus on three elements: the natural environment, the institutional rules and the economic characteristics. The next section will study the physical and natural environment of the Galician ―rías‖. Then, we will present the main historical, institutional and economic factors of the mussel sector in Galicia. This sector employs a floating raft culture (floating raft farm) technique and it is established on the coasts and estuaries of the Spanish region of Galicia, which is one of the leading producers of mussels in the world. When we study the mussel sector in Galicia, this chapter assumes the approach of the New Institutional Economics (NIE), built on the Coasean notion of transaction costs (Coase, 1937, 1960, Allen, 1991) and the Northian vision of institutions (North, 1990). For most of the 20th century, neoclassical economics did not consider institutions as a relevant factor (Eggertsson, 1990; Caballero, 2001). Nevertheless, in the last two decades of the 20th century, institutions were back on the agenda of leading research of economic science due to the NIE (Alston, 1996; Greif, 1998; Williamson, 2000; Aoki, 2001; Menard and Shirley, 2005). This program drew attention to the institutional structure of production, which implies a determined distribution of property rights, understood as rights that individuals have in order to make decisions dealing with assets, and the possibility to make transactions, which are property rights transfers between individuals. These transactions entail a set of costs that are a collection of resources that are used to establish, maintain and exchange property rights. The transaction process may be understood as a contract problem in which transaction costs are those that derive from the ex-ante subscription of a contract and its ex-post control and enforcement. In the neoclassical scenario of zero transaction costs, the parties would make those transactions that provide social benefits of efficiency, and the initial distribution of property rights would not affect production. However, the real economy is characterised by incomplete markets and property rights, and by the existence of positive transaction costs. In every society there are ―rules of the game‖ that determine the costs of transactions. The rules of the game, which are understood as the conceived or assimilated limitations made by man to give shape to human interaction, are the institutions. Institutions are the formal and informal rules that mould the behaviour of individuals and organizations, and institutions include the mechanisms of enforcement of the rules (North, 1990). Understanding economic performance requires the study of the institutional rules, and this is especially important for the case of the mussel sector, where property rights and institutions can be imperfect and incomplete.

The Experience of the Mussel Sector in Galicia

75

The Galician production of mussels has been studied from various perspectives and scientific disciplines, which has resulted in literature dealing with the study of biological, historical and economic matters. Caballero, Garza and Varela (2009) complimented the existing literature on the Galician mussel sector through a specialized study of the institutional foundations of this sector from the perspective of the NIE. This chapter reviews and amplifies the analysis of that paper. In this way, this chapter is based on Caballero et al (2009), but it makes a contribution to the analysis of the Galician mussel sector with a more detailed section on the physical and natural environment, the analysis of the recent experience of the governance of the sector (the PLADIMEGA experience) and a study about the new legal framework of the sector. In this sense, this paper rigorously studies the physical, institutional and economic factors of the mussel production sector in Galicia. The agenda of this chapter includes the following sections: the natural environment of the Galician ―rías‖, the historical evolution of the sector, the institutional foundations, the legal framework, the economic characteristics of the mussel sector and the structure of governance of the mussel production.

THE NATURAL ENVIRONMENT OF THE GALICIAN ESTUARIES The Galician coast is the natural environment in which more than 95% of Spanish mussel production occurs. Galicia is located in the far north-western corner of the Iberian peninsula and its coastline is 1200km long. The geographical position of this coastline, and especially the way in which it is distributed, make it one of the richest and most productive in the world, with a significant amount of phytoplankton which forms the basis for an ideal ecosystem for farming a multitude of sea species, while guaranteeing stable productivity. Galicia‘s coastline is sinuous, its most unique characteristic being the ―rias‖. A ria is a type of estuary in which rich nutrient deposits are collected during upwelling processes and in whose innermost parts, sheltered from storm activity, mussels and other species are farmed. This chapter explains the characteristics of the Galician rias and the factors which enable us to understand their high biological productivity. From a geological point of view, the Galician rias are fluvial valleys formed during the Alpine folding in the Tertiary Age and flooded by the sea during the Holocene, the last and present geological age of the Quaternary Period. During this interglacial period, which began after the end of the last glaciation around 12,000 years ago, the rise in temperature caused glaciers to melt and the sea to rise by some 120 metres, flooding large areas of land. The present make-up of the rias, geologically characterised as a type of ―flooded coast‖, is, therefore, the consequence of the sea flooding coastal river valleys, the estuaries of which were submerged, giving rise to the wide estuaries we see today. The Galician rias have a humid oceanic climate, with a tendency towards summer aridity in the ―Rias Bajas‖, or Lower Rias (the four southern-most rias). Winds blow north and northeasterly in summer and southeast and westerly in the winter. Rain measurements are qualitatively similar throughout the coastline. The annual rain distribution (a factor which influences the salinity of the sea) is more irregular, with maximum values between November and February and minimum values in July and August. Rainfall in the cold months is three times higher than that in the warm months.

76

Gonzalo Caballero-Miguez, Manuel Varela-Lafuente, Marcos Pérez-Pérez

The oceanographic characteristics of the rias are determined by the fact that they are estuaries, in which fresh water mixes with sea water. In all of the Galician rias there is an entry of fresh river water at their innermost part and sea water at their mouths. The water in the rias moves forming a two-layer circuit. The upper layer is fresh river water, around 5-15 metres thick, and it flows on the surface because it is less dense, and mixes with the salt water at it advances towards the mouth of the ria. The lower layer of sea water, more dense because its temperature is lower and it is saltier, enters from the sea bottom, completely compensating for the flow of water up to the surface. Heat from the sun, in the summer, and the entry of fresh river water, especially between October and May, create a lower density in the upper level. Between the outgoing water and the incoming denser water a continuous vertical mix occurs throughout the ria. This model of water circulation in the rias is called positive estuary circulation. The salinity or amount of salt in the water, expressed as the grams of salt there is in a kilo of water, has a typical value of 35 (ranging from 34-36) in the rias and all the oceans. The greater the salinity, the denser the water and its tendency to sink. Therefore, the salinity of the upper level is always lower than the level below. In the summer, on average, it is 35 at surface level and 35.8 at the bottom level. In the winter, the difference increases: sea surface salinity is 32 and sea bottom salinity 35.5. The temperature of the rias varies in a more complex way, influenced by the climatic wind patterns in Galicia, which gives rise to a vertical mixing of the surface water with the deep water. In the summer, the average sea surface temperature is 18ºC, while the temperature at the sea bottom is 13ºC. At the end of the autumn sea surface and bottom temperatures are the same, around 15ºC. The sea bottom temperature is therefore higher at the end of the autumn than in the summer. In the winter, it is usually 1ºC colder at surface level than at the bottom, where it is rarely lower than 14ºC. At the end of the winter, the temperatures of both layers are once again the same, around 13ºC; after that, the sea bottom temperature remains practically constant until October. Coastal upwelling is the oceanographic phenomenon which determines the important productivity of the rias. The cause of the upwelling of subsurface water is the deviation of marine currents as a result of the earth‘s rotation or the Coriolis effect. Therefore, when a marine current flows parallel to a coast situated to its left, the water is deviated out to sea (in the northern hemisphere) and has to be replaced by deep water, causing upwelling. This deep water, cold and rich in nutrients, is heated at the surface, reducing its density, and is transported laterally until the mass balance is re-established once more. But the effect that the wind has on the sea is fundamental to coastal upwelling. When a wind blows over the sea surface there is a friction which drags the surface water, which in turn drags the lower layer and so forth. Also because of the Coriolis effect, a wind which blows parallel to a coast situated to its left causes an upwelling of deep water proportional to the surface water mass moved laterally. All of the upwellings in the Iberian peninsula and northern Africa depend on the North Atlantic anticyclonic gyre, which on its eastern branch forms the North Atlantic current and then the Canary current. This great gyre depends on the trade winds and is, in consequence, subject to a seasonal variation which affects the upwellings.

The Experience of the Mussel Sector in Galicia

77

Source: Spanish National Research Council (CSIC). Figure 1. Coastal upwelling phenomenon.

The exceptional biological richness of the Galician rias is due to the coastal upwelling predominant in the summer, which provides nutrient salts to the sea bottom and frequently renews them. The production of phytoplankton, in the case of the Rias Bajas, is up to three times higher than that in ocean waters at similar latitudes (360 grams of carbon/m2), due to the abundance of nutrients, mainly nitrates. Coastal upwelling takes cold deep water to the surface (North Atlantic Central Water), three times richer in nitrates than the surface water (Coastal High Water) which it replaces when it is dragged away from the coast by the northerly winds which predominate in the summer. The wind circulates from North to South, creating a southerly current on the western Galician coast. The Coriolis effect causes this current to move out to the open sea, which in turn causes the cold bottom water to rise and enter into the rias, globally reducing the sea temperature. If the wind is strong and persistent, sea surface temperatures can even be lower than 16ºC at the height of the summer, when in the open sea temperatures can be higher than 20ºC. There are two seasonal upwellings off the Galician coast, one in March and another at the end of the summer. During the summer, the area of the upwellings moves northwards and, in the month of August, reaches Cape Ortegal, where it finds a boundary well marked by Cantabrian waters. This upwelling is notorious in Galicia and the upwelled water penetrates the rias causing the sea temperature to drop in August. Upwelling in the Galician rias boosts the ―fertilisation‖ effect of the rias by positive estuary circulation, which in itself concentrates nutrients, significantly influencing the salt cycle, mainly nitrates and phosphates, as while the water richest in nutrients which enters from the mouth of the rias moves towards their interior it rises towards the brighter area where the nutrients are assimilated and transformed into organic material by the phytoplankton through photosynthesis.

78

Gonzalo Caballero-Miguez, Manuel Varela-Lafuente, Marcos Pérez-Pérez

Source: CSIC. Figure 2. Typical oceanographic situation in the NW Iberian Peninsula in the summer. Upwelling of cold water rich in nutrients on the shelf.

As this plant material is dragged towards the opposite area by the surface layer of water it is transformed by the action of herbivores or aging, and falls as sediment, while the surface water exits the mouth of the ria, depleted of nutrient salts. During sedimentation, almost all of the particles are mineralised by bacterial action, causing an increase in the water concentration which penetrates the lower part and begins the biological cycle once more. In the winter, the climatic pattern is the opposite. The southerly winds, warm and humid, cause the water from the open sea, warm and saline and from the south (from a region to the east of the Azores) to accumulate on the coast, and they enter from the surface to the interior of the rias. The two-layer circuit inside the rias is inverted if the wind is persistent. The result is the opposite phenomenon to upwelling: the sinking on the coast of warm surface ocean waters (downwelling), poor in nutrients, which causes a reduction in the productivity of the rias. A biological factor present in the rias which affects the production of mussels and other species sporadically but significantly is the proliferation of toxic microalgae, in episodes known as red tides for the changes caused in the water coloration. Some microalgae produce toxins so strong that they can be harmful even at concentrations so low they do not discolour the water. Some thousands or even hundreds of cells per litre are sufficient to cause the filterfeeding bivalves (mussels, scallops, clams…) to have concentrations of toxins which make them a danger to health as they can be transmitted via the food chain. Microalgae can be classified by the type of toxins they produce or the syndrome they cause. The most important which appear in the Galician rias are the microalgae which produce paralytic toxins (PSP, Paralytic Shellfish Poisoning), such as Gymnodinium catenatum and Alexandrium minutum; the microalgae which produce diarrheogenic toxins (DSP, Diarrhetic Shellfish Poisoning), among which are the species of the Dinophysis genus, and, lastly, the microalgae which produce amnesic toxins (ASP, Amnesic Shellfish Poisoning), with species of the Pseudo-nitzschia genus.

The Experience of the Mussel Sector in Galicia

79

WINTER

Source: CSIC. Figure 3. Typical oceanic situation in the NW of the Iberian peninsula in the winter. Presence of warm water, poor in nutrients, on the shelf, transported towards the North via Portugal (Coastal Counter Current).

THE HISTORY OF THE MUSSEL SECTOR IN GALICIA At the beginning of the 20th century, rafts (floating raft cultures) of mussel cultivation were established on the Mediterranean coast, primarily in Barcelona. Nevertheless, at that time, the low demand for mussels in Galicia could be met with the mussel extraction from the rocks. There were a few previous attempts to cultivate mussels by other means such as the stake method, but it was not until 1946 when the first floating rafts were established in the Galician rías, which were modelled after the existing floating cultures in the Mediterranean. Therefore, a transition took place towards a floating raft system for mussel cultivation in Galicia. This section presents the history of the mussel sector in Galicia according to Caballero, Garza and Varela (2009). The gratifying results of this system of cultivation were soon popularized and transformed the floating raft system into an extensive growth mechanism of production. As a result, the increase in supply made it possible to meet a growing demand in the market for fresh mussels as well as meeting the demand for the canning industry. Since 1946 the number of floating raft farms in the Galician rías grew and ultimately numbered somewhere in the area of 3,300 rafts. In fact, at the beginning of the 1970s, Spain became the leading producer of mussels in the world.

Gonzalo Caballero-Miguez, Manuel Varela-Lafuente, Marcos Pérez-Pérez

80

Galician mussel production went from 48,000 tonnes in 1962 to 138,000 in 1972, and the number of raft cultures increased by 90% in this same period (Labarta, 2004). According to Fernández (2005), from 1960 to 1976 the average rate of growth for the number of rafts was around 7%, while the mussel production in Galicia grew between 7.2% and 8.1%. The fact is that there was a notable growth trend in the volume of raft culture production. The estimates of Durán et al. (1990) conclude that the production per raft farm went from 30 tonnes in 1946 to 56 tonnes in 1961, 60 tonnes in 1976, and again to 75 tonnes in 1991. The number of floating raft farms established in the Galician rías experienced growth from 1946 to 1976 (table 1). During this 30 year period, the public administration granted a great number of licenses to establish floating raft cultures, and although many of these licenses did not result in the actual establishment of floating raft farms, many other licenses were in fact used, and despite the accounting difficulty, all of the analysis carried out coincide with the growth of the sector, especially in the 1960s and 1970s. Table 1. Number of floating raft farms in Galicia YEAR 1946 1956 1960 1975 1997

Number of rafts 10 410 1,099 3,134 3,337

Source: Caballero, Garza and Varela (2009).

The development of the mussel cultivation sector in Galicia was stimulated, in the initial phase, by the existence of a noteworthy canning industry. In the period between 1946 and 1957, 1,100 licenses were granted for floating raft farms to a total of 250 people (although the licenses did not, in every case, ultimately result in the installation of rafts); 26% of these licenses granted went to businesses in the canning sector [9]. Afterwards, in the 1960s, the strong growth in raft cultures had a clear ―family capitalism‖ component, since there were many families linked to the fishing sector that integrated into the mussel sector. Floating raft Mussel cultivation is a very labour intensive activity (labour costs comprise about 75% of the operating expenses of the floating raft cultivation). The availability of labour was key for the development of the mussel sector. This population was able to balance their work with other production activities (such as agriculture and other fishing industry activities), and moreover, in the middle of the 20th century, people had difficulty finding work in the circumstances characterised by the sardine crisis as well as the difficulty of the canning industry. The fact is that many households in the areas of the rías found an important source of income from the cultivation of mussels. With respect to development and advances of the sector, the techniques of mussel cultivation employing the floating raft method were slowly being perfected based on different experiences during the second half of the 20th century. Since 1964 seafood processing plants begin to emerge that ultimately became an essential channel for bringing the mussels to the fresh seafood markets. At the same time, between 1975 and 1980, the sector experienced a notable mechanization process that facilitated and increased productivity. This process entailed the use of cranes and pulleys, the enlargement of

The Experience of the Mussel Sector in Galicia

81

boats and the introduction of the rope separating machine and the tubular net (Labarta, 2004; Caballero, Garza and Varela, 2009).

THE INSTITUTIONAL FOUNDATIONS OF THE GALICIAN FLOATING RAFT CULTURE The establishment of property rights dealing with the management, cultivation and extraction of resources at sea constitutes a way to increase efficiency against the tragedy of commons. Property rights are essential social institutions for combating the potential wealth losses associated with the common pool (Libecap, 2000; Ostrom, 1990). The provision of government infrastructure and service, such as sea titles and enforcement mechanisms (judiciary and police force), is socially costly and is provided over time as sea values rise. This section summarizes the paper by Caballero, Garza and Varela (2009). The problem with the regulation of free access resources and the depletion of these resources imply that, after reaching a critical juncture, it is impossible to increase production of the marine resources naturally. This is why the scientific and fishing community has been developing farming techniques in various sectors in order to increase production of fishing resources. The favourable conditions of the coastal waters of the Galician rías, the development of floating raft mussel cultivation methods (requiring minimal capital investment) and the availability of labour, lead to the possibilities of the development of mussel cultivation. However, this combination of natural, technological and productive conditions required an institutional structure that orchestrated production. With the granting of rights by the State, the sector was transformed from a scenario of a common pool to a more efficient system that allowed for the cultivation of mussels. Given the physical statements of the Galician ―rías‖, the deontological rules (Gardner and Ostrom, 1991) of establishing an organizational structure for the production of mussels were not too complex at the beginning. The establishment of institutions and property rights over tracts of sea in the Galician rías have resulted in a relatively cheap and easy activity. This activity does not imply great problems of information, due to the ease in which to observe and identify these maritime tracks of sea where the floating raft cultivation is set up. Control and enforcement costs are also not insurmountable. The costs of the institutional definition are compensated by the social benefits derived from their establishment. In this case, continuation of the commons is not efficient and the response is the assignment of more definite property rights to the resource, whereby only owners are granted access (North, 1990; Libecap, 2005). In the middle of the 20th century, when the demand for the establishment of floating raft cultivation rights begins to become prevalent, this institutional change results in a win-win situation. This avoided the emergence of distributive conflicts, and the granting of property rights also supposed an institutional change that favoured economic efficiency gains through the foundation of a system of mussel cultivation which is superior to the common pool phase. This experience provides a special opportunity to examine the emergence of rights structures, such in the case of economic frontiers on land (Libecap, 2000). The establishment of the rules of the game for the cultivation of mussels in the Galician rías was implemented by the State. In reaction to the demand by institutions that were allowed

82

Gonzalo Caballero-Miguez, Manuel Varela-Lafuente, Marcos Pérez-Pérez

to cultivate mussels in the rías, the Spanish State granted rights to establish floating raft farms of mussels for 30 years (1946-1976). During this period, the State Administration did not erect many hindrances in the license granting process for the setting up of floating raft farms. Between 1946 and 1959, somewhere in the neighbourhood of two thousand licenses were granted, and between 1959 and 1976 around 5,600 were granted. Only in 1964 were there 1,500 licenses granted and in 1965 a total of 570. In fact, in 1976 the State had granted somewhere in the order of 7,500 licenses (Fernández, 2005). The granting of licenses in order to establish floating raft farms are best understood considering two factors. On the one hand, the State granted licenses to establish floating rafts on par with the institutional demand. The system was similar to the mechanisms of appropriations on land by order of occupation: once a tract of ocean was granted to an applicant, and when the floating raft farm was made operational, the applicant ended up consolidating his rights over this mooring point. On the other hand, the granting of licenses scarcely required any cost for the applicant so that the application and the consequent granting of the license were essentially free. As a result, many of the licenses were not used afterwards due to the labour intensiveness of floating raft farming, while the price of mussels did not allow for sufficient returns. In addition, some of the 2,000 mooring points that were vacant in 1974 were very shallow and were in very open, exposed areas (Labrat, 2004). To sum it up, more than half of the licenses granted in 1976 were not used, and therefore, the number of actual rafts was around 3,300 for that year. It is therefore important to distinguish clearly between the number of licenses granted and the actual number of existing rafts. During the three decades of rapid growth of mussel cultivation, Spain was under the dictatorial regime and it was the Franquist State that took on the role of granting licenses for the establishment of floating raft farms. Its objective was stimulating the development of the mussel sector and overcoming the associated economic difficulties. Coinciding with the political transition to democracy, the State suspended the granting of new licenses in 1976. This situation implied a change in the role of the State regarding the granting of raft rights: Meanwhile, up until 1976 whosoever wished to establish a floating raft farm could do so with relative ease. Since that year, however, the State implemented a status quo on license granting and prohibited the establishments of new raft farms. Moreover, the Spanish political transition to democracy lead to the Constitution of 1978, that allowed for the gradual process of political decentralisation towards the Autonomous Communities (Spanish regions) in a de facto federal formula. This decentralisation entailed the relinquishing of many competencies to the autonomous governments in matters dealing with fishing and aquaculture (Caballero, Garza and Varela, 2007), and as a result, in the case of the fishing and agriculture industry, the regional government of Galicia (Xunta) was transformed into the competent political organ for floating raft mussel cultivation and adhered to the policy of not granting more licenses to set up more rafts. Since no more licenses were being granted for rafts as of 1976, the mussel sector could only base expansion on the increase in productivity and intense growth. As a result, the industry went from 170,000 tonnes in 1975-76 to 250,000 tonnes in 1986 based on mechanisation, learning by doing, improvements in floating rafts and by budding scientific research.

The Experience of the Mussel Sector in Galicia

83

Property rights refer to the sanctioned behavioural relations among economic agents in the use of valuables resources (Libecap, 2000). We can define property as the set of rights and obligations that can be exercised on resources along time (Scott, 1986). A type of response to the problem of open access is a hybrid of private ownership and state regulation, whereby individuals hold property rights, but the range of resource option is heavily constrained by regulatory restrictions. The regulation define how much of the resource can be extracted at any point in time, when it can be accessed, the types of investment that can be made, and the nature of allowable exchange Libecap, 2005). The public domain cannot be occupied privately without permission being granted by the State. Mussel cultivation activities on floating raft farms require an administrative license granted previously by the Ministry of Fishing of the Government of Galicia. The license implies the granting of a personal right, the right of use and exclusive exploitation of a tract of water in the public domain that is necessary to set up the hatchery and to cultivate mussels. The administrative grant indicates the surface area to be exploited (conditions of use, type of cultivation and authorized techniques) (González Laxe, 2003). The legal system of grants for the cultivation of mussels implies a system of property rights that is characterized in the following way (Caballero, Garza and Varela, 2009): 







The situation of exclusivity regarding access to the rafts and the cultivation of mussel extraction is guaranteed, in order to avoid the appropriation of labour and investment by other parties other than the license grantee. In this way, the raft has an owner and is not open to other parties. With respect to the transferability, transfer of title rights are accepted in the case of death of the license holder (mortis-causa), and the transfer between two living parties (inter-vivos) is also accepted with certain restriction, which is fundamentally that the new title holder is professionally dedicated to aquiculture or that he posses the necessary means to exploit the hatchery. The possibility of hiring a floating raft is not accepted, although in practice there do exist agreements between private parties. With respect to the period of time granted for exploitation, we should point out that the fishing law of Galicia of 1993 does consider the granting of a ten year period, with two possible and consecutive extensions of another ten years each. With respect to the choice of techniques and products to be cultivated on the rafts, the proposal for change must be authorized by the Ministry of Fishing, in accordance with the Ordinance of 18 April of 2001 dealing with modification or changes in location of mooring points and system changes, location and hatchery cultivation.

According to Libecap (2000), the ownership of an asset consists of three elements: a) the right to use the asset (usus), b) the right to appropriate the returns from the asset (usus fructus), c) the right to change its form, substance and location (abusus). The license granting system of mussel cultivation in Galicia verifies the two first types of rights, while the third type of right is limited and restricted by the rules and subject to the authorisation and control of the State. Regarding this matter, Schlager and Ostrom (1992) distinguish two types of property rights dealing with resources: operational-level property rights (access and withdrawal) and collective-choice property rights (management, exclusion, alienation). The system for granting license for floating raft cultivation in Galicia guarantees the access rights,

84

Gonzalo Caballero-Miguez, Manuel Varela-Lafuente, Marcos Pérez-Pérez

withdrawal and exclusion, whereas the rights of management and alienation are more restrictive. In conclusion, the system constitutes a property rights structure that has to do much more with private property than with the common pool system. The State and the set of laws favour the exclusivity and transferability of licenses as well as favouring private control of production.

THE LEGAL FRAMEWORK OF THE MUSSEL SECTOR IN GALICIA The rules of the sector are taken from the Royal Order of 1930 that regulated the installation of hatcheries and fish farms and the order of 16 December of 1953, BOE Nº 356, which modified the norms of conferment of floating hatchery licenses for the production of seafood, and it also regulated the exploitation of mollusc hatcheries and established the minimum requirements for applicants. The Decree 2559 of 30 November, 1961 approved a ―new rules and regulation concerning the exploitation of hatcheries situated in the Coastal areas‖, which established the regulations concerning the granting of licenses for the cultivation of molluscs in designated, established cultivation areas suitable for cultivation. This decree revised the norms of license granting, establishing the possibility to renew every 10 years and that the grant would expire if the hatchery were not put into operation within a two year timeframe. The Orders from the Ministry of Commerce of 1963 set in place a group of designated cultivation areas that organised a total of 4,750 points particularly for the establishment of raft cultivation: Order of 16 January (893 anchoring points), Order of 17 July (815), Order of 5 September (1,540) and 27 November (1,502). The Seafood Ordinance law (Law 59 of 30 June, 1969) implies a greater legislative expansion and includes a catalogue of legal figures for the cultivation of shellfish. This law regulates the establishment of shellfish harvesting in three subdivisions: a) it regulates the procedures for the granting of licenses and authorization; b) it regulates the fees of use for the licenses in the public domain; c) it approves the existence of special zones in the most suitable areas for cultivation. The latter aspect has been specified exclusively for the Galician case in the Plan of Shellfish Exploitation of Galicia (PEMERGAL, Decree 1238/70 of 30 April). The Ordinance of 31 May, 1976 (BOE Nº 113, p. 18131) established that during an extendable three years period ―no applications will be neither accepted nor processed for the granting of licenses for mooring floating hatcheries for the purpose of mussel cultivation‖ because of the ―obvious imbalance of the mussel market due to shrinking demand‖. The Ordinance of 13 March, 1981 (BOE Nº 142, p. 13644) dealing with ―the liberalisation of the mussel sector‖ opened up the possibility to grant new licenses, although, after assuming the responsibility, the Xunta regional government nonetheless did not grant any new licenses. The Spanish Marine Cultivation Law of 25 June of 1984 comprehensively organized the legislation of the marine cultivation sector, regulating both the mollusc and crustacean production regarding establishments in the public domain, and the marine cultivation on private property (fish farms and the like). Among other aspects of this law, it also regulates the procedures to assign grants or authorization for aquaculture.

The Experience of the Mussel Sector in Galicia

85

The Decree of reorganization of the designated aquiculture areas 197/1986, is the basis on which the restructuring of the aquiculture zones were reorganized. In 1986 the limits of the specifications for floating raft cultures were also established. In the last decade of the 20th century, the main legislation of the Autonomous Community of Galicia in matters relating to the fishing industry include the law 6/1991 addressing infringements for marine resource protection matters, law 6/1993 of the Galician Fishing Industry and law 9/1993 dealing with Fishing Guilds. Nevertheless, these legislative developments did not imply substantial changed in the institutional structure and of property rights for the cultivation of mussels. More specifically, the Galician Law of Fishing of 1993 constitutes the central component of the legal norms in force and was complemented by the regulations for marine hatchery cultivation in Galician waters (Decree 406/1996 of 7 November) and of various ordinances such as the Ordinance of 18 April of 2001 addressing the relocation of mooring points and changes in hatcheries. Nevertheless, the legal framework was modified in 2008 and later in 2009, in two different ways. Law 11/2008, of 3 December, on Galician fisheries, promoted by the two-party government formed by the Socialist Party of Galicia (PSdG) and the Galician National Block (BNG), was approved on 25 November 2008 by the members of the Galician Parliament, which the Popular Party (PP) voted against, committing itself to ―abolishing it within the first 100 days of government‖ if elected, as subsequently happened. The text redrafted five laws, which were abolished: the 1993 Fisheries Law, the law on fishermen‘s associations, the law on the creation of the Coastguard Service, the law that gave rise to the Technological Institute for Environmental Control and the law on protection and sanctions. Marine aquaculture is regulated in Title V, On marine aquaculture, articles 44-72. Chapter III Fishing licenses in the maritime zones (articles 57-65), recognises the authority of the competent Regional Ministry to grant a fishing license to individuals or companies to carry out aquaculture in a maritime zone, including the instalment of mussel rafts. Mussel raft licences are one of the novelties of the Fisheries Law. They are granted for a maximum period of ten years, which can be extended for further 10-year periods up to a maximum of 30, if the license holder so requests. The Law includes a license system via public bid, under the principles of fair competition, transparency, publicity, equality and fairness. Fishing licenses in the maritime fishing zones are granted via this system in which certain circumstances are taken into consideration, such as having been the holder of a license to practise marine aquaculture in the maritime zone in the same sub-sector, having previously fished with a license of this kind, experience in the activity and adaptation to technical, health and environmental criteria that are determined. Some ―bateeiros‖ (mussel raft owners) were unhappy with the clauses, as they requested that ―the historic rights of the bateeiros be guaranteed‖, that is, that measures to ensure that a producer could keep his mussel raft in spite of the fact that at the end of the 30-year period a new public bid would take place were established, as Fisheries required. The licenses for the first mussel rafts will start to run out in 2018, and then it will be necessary to put the licenses up for public bid, in such a way that a bateeiro could lose his mussel raft. In the bid a series of scales would be established to give priority to the mussel farmers who compete for a mussel raft, thus reducing the possibilities of non-sector individuals, preventing multinationals or businessmen with no experience in mitiliculture from gaining access to farms. Even so, some

86

Gonzalo Caballero-Miguez, Manuel Varela-Lafuente, Marcos Pérez-Pérez

producers would want the clauses to include specific conditions which would give the advantage to the person who already holds the license, meaning that a bateeiro could keep his farm once the 30-year period has run out. The Popular Party group in the Galician Parliament presented 85 partial amendments to the Fisheries bill when it was being debated. They claimed, among other things, that it did not guarantee the future of the mussel sector. When the PPdeG came to preside the Xunta de Galicia in March 2009, they revoked the Fisheries Law enacted by the two-party government and, while modifying it, they prorogued the 1993 Fisheries Law by several months. Finally, they enacted Law 6/2009, of 11 December, modifying Law 11/2008, of 3 December, on Galician fisheries. The text includes the modification of the calculation of the period the mussel raft license is granted for in order to guarantee the sector a certain continuance in activity. The mussel raft licenses would ―start from scratch‖, as it were, meaning that the time periods for the licenses would begin when the new Fisheries Law came into effect, effectively giving them a new thirty-year life span. Article 62 is therefore modified and article 62 (b) is incorporated. Different mussel sector leaders had requested legal reports which confirmed the legality of starting from scratch. These contemplate the possibility of renewing licenses without the need for a public bid, even granting them directly for the maximum term contemplated by law, that is, 30 years, without having to renew them every ten years. The Galician Mussel Regulatory Council asked Professor José Luis Meilán Gil, who formed a part of the committee which accepted the draft bill of the previous government, to draw up a report. His report confirms that starting from scratch is indeed possible: ―With regard to licenses in existence at the time the new law comes into force, said law could foresee a transient resolution which would enable such licenses to start from scratch, that is, they would automatically become new licenses. This would, therefore, not involve a license extension, but a new license‖. Concerning the question of the public bid, ―such as the legal regulations are, it would not be impossible to grant licenses without a previous and formal public bid, as the principles of fair competition can be ensured in other ways‖. By way of example, he quotes Law 2/2007 on Maritime Fishing in the Region of Murcia, which establishes that licenses ―will be granted discretionally or on the basis of objective assessments in cases of fair competition, by order of the regional minister‖. The law firm González-Mariñas, in A Coruña, also drew up a report for mussel producers. In this case, they refer to the risk the bateeiros run if they have to go to a public bid as ―once a license is extinct, anyone can come forward and bid for the corresponding mussel raft license‖, that is, there is no guarantee that a license holder will continue to hold such license after the bid is held. Insofar as the possibility of starting from scratch, that is an option that Galician law contemplates, on account, as the Regional Ministry for the Sea intended, of ―social or economic policy matters‖. Therefore, a further 30-year life span could be given to current mussel raft owners ―in order to give the license holders time to reorganise their activity and pay off their investment‖; this new time period is even considered appropriate to make the mussel sector stronger in the face of competition.

The Experience of the Mussel Sector in Galicia

87

Further to this, the new Fisheries Law includes the possibility of granting new licenses, as it points out that in order to grant authorisations other factors will have to be taken into account, including ―factors which influence the suitability of farming, such as primary production, depth, water quality, degree of exposure to waves and currents, and others‖, so ―other more suitable areas with a view to reducing farming time and increasing the profitability of the mussel rafts could be sought‖. The modifications to Law 11/2008, of 3 December, on Galician fisheries, which refer to mussel bed licenses, are as follows:  -Lines 1, 2 and 3 of article 62 are thus drafted as follows: 1. 2.

3.



The procedures for granting activity licenses will be governed by the principles of objectivity, fairness, publicity, fair competition and transparency. The Regional Ministry responsible for aquaculture, after the report by the organisations representing the corresponding marine aquaculture sub-sector, will convene a public bid to grant licenses in accordance with what is foreseen in the following lines. The exception of what is established in article 62 (b), in cases where licenses expire, the Regional Ministry responsible for aquaculture will convene a public bid for the same type of farming the expired license specified

-Article 62 (b) is added, and is as follows:

Article 62 (b). Granting a license when the previous one has expired. 1.

2.

3.

In the event a license were to expire, the procedure by which a new license is granted will involve filing a request for the corresponding new license with the Regional Ministry responsible for aquaculture, which will be accompanied by a design project for the installation and running of the marine farm requested. Once the request has been admitted for processing, the Regional Ministry responsible for aquaculture will open a public information period which will last for one month, indicating the name of the applicant, the type of installation and its location. After the information stage, the Regional Ministry will make its decision as to the request, having heard from all the applicants, basing its defining criteria on the experience of the applicants in the sub-sector and their economic dependence on the activity.

In the event there were a number of different applicants, the procedure to grant the license will be based on what is established in the Law‘s article no. 62. 4.

In the event a license were to be granted, the Regional Ministry will make the applicant an offer as to the conditions under which said license is indeed granted, giving the applicant a 15-day period in which to accept. Once this period has expired, if nothing has been heard from the applicant, or said applicant has decided not to accept the conditions offered, the procedure will be declared ended, the applicant having turned down the offer.

Gonzalo Caballero-Miguez, Manuel Varela-Lafuente, Marcos Pérez-Pérez

88 5.

In the event the conditions were accepted within such time period, the Regional Ministry responsible for aquaculture will make a discretionary decision on the granting of the license within the term of once year from the beginning of the procedure. Once this term has expired, if the decision were not drawn up and notified, it would be understood to be denied».

THE MUSSEL SECTOR IN GALICIA: AN ECONOMIC APPROACH Mussel cultivation has developed in five Galician Rías: Vigo, Pontevedra, Arousa, AresBetanzos, and Muros-Noia. The system that has been employed is the floating platform or the floating raft farm that floats in the rías which contrast with other traditional systems of production such as stake cultivation employed in France or the beach mussel farming in Holland. In this way, Galicia has produced ―sea colonization‖ via the establishment of floating rafts on which a group of ropes are suspended where the mussels cultivate. The rafts are floating mussel farms that are usually configured in a rectangular shape and made of wooden eucalyptus trusses that are bound together, of which ropes are suspended for the cultivation. The rafts keep afloat thanks to a system of floating devices (ball cocks) which are also bound by chains to a block of concrete resting on the sea floor. These rafts have a maximum surface area of about 500 square meters and a maximum of 500 ropes with a length no longer than 12 meters long for the cultivation of mussels (Caballero, Garza and Varela, 2009). The mussel farmers collect the mussel seed from the coastal rocks. Afterwards, the seeds are intertwined into the mussel cultivation ropes through nets and these ―mussel cultivation ropes‖ are hung from the rafts for about 4 to 6 months. After this period of time, these ropes are brought back up to the surface and are unbound into other ropes which contain a less dense mussel concentration in order for the mussels to grow and fatten. The new ropes are left in the sea for another year so that the mussels may obtain the adequate size for commercialisation. In this way, the mussels can be cultivated in 17 months, while in the rest of Europe a timeframe of at least twice that is necessary. The Galician mussel production has surpassed 200,000 tonnes annually, which has been constant during the past few years (table 2). Consequently, we are talking about the second largest mussel producer in the world, second only to China. Nevertheless, we must point out that the world rate of growth of mussel production has been greater than the rate of growth in the Galician sector, which implies that the importance of Galicia, with respect to world mussel production, has decreased. The institutional foundations for the production of mussels in the Galician rías since the last quarter of the 20th century has set up a scenario of institutional equilibrium, in which there has not been any new licenses granted for floating raft cultures and in which a winning coalition has been organized that maintains the status quo. The Galician mussel sector is based on nearly 3,300 installed rafts in the five rías. Furthermore, it directly generates more than 8,000 jobs and incorporates 1,000 aquiculture support vessels. The estimated first-wholesale mussel value is in the order of 114 million Euros. In addition to the production activity, the mussel sector in Galicia entails backward and forward linkages in the production chain. In this way, the mussel sector is arranged in a

The Experience of the Mussel Sector in Galicia

89

cluster that incorporates at least four secondary sectors: Supplier companies (8 million Euros of turnover, 540 jobs), purification/processing plants (87 million Euros of turnover, 400 jobs), mussel cooking and processing plants (48 million Euros, 500 jobs) and canning companies (66 million Euros, 900 jobs). Collectively the cluster of mussel related enterprises turns over 340 million Euros annually and employs 10,500 people (Franco, 2006). The rafts have a maximum permissible area of 500m2 of which between 300 and 500 ropes of 12 meters in length are suspended. This translates into about 60 to 90 tonnes of mussels produced annually by raft, depending on the area. It is also important to mention that this cultivation system is labour intensive. With respect to the distribution of the mussel cultivation rafts in the Galician rías, about 70% of the rafts are situated in the Ría of Arousa, where there are currently about 36 mussel aquiculture zones. On the other hand, the rías of Vigo and Pontevedra contain 14.32% and 10.36% respectively, while the rías of the Rías Altas situated more to the north (Muros-Noia and Ares-Betanzos) have only 3.53% and 3.08% (table 3). Table 2. World and Galician Production of mussel cultivation YEAR

World Production (Tonnes) 1,115,189 1,337,772 1,446,032 1,370,957 1,445,001 1,634,280 1,712,635 1,770,356 1,795,779

1997 1998 1999 2000 2001 2002 2003 2004 2005

Galician Production (Tonnes) 224,919 250,743 258,869 244,128 242,833 256,627 246,956 292,316 205,256

%Galician Production/ World Production 20.16% 18.74% 17.90% 17.80% 16.81% 15.70% 14.42% 16.51% 11.42%

Source: Caballero, Garza and Varela (2009).

Table 3. Distribution of cultivation zones and mussel rafts by ría RIA (Estuary) Ares-Betanzos Muros-Noia Arousa Pontevedra Vigo

Number of mussel cultivation zones 2 4 36 7 14

Number of rafts

Percentage of rafts per ría

103 118 2,292 346 478

3.08% 3.53% 68.68% 10.36% 14.32%

Source: Caballero, Garza and Varela (2009).

With respect to the final destination of the Galician mussels, 65% of the total commercialised production is destined for the canning and freezing industry. Meanwhile, 35% is destined for the fresh-consumption market. Nevertheless, the higher prices obtained for fresh mussels results in a higher turnover for this type of product which represents between 50% to 60% of the total turnover of the sector, depending on the particular year.

90

Gonzalo Caballero-Miguez, Manuel Varela-Lafuente, Marcos Pérez-Pérez

As a result, the mussel harvest represents roughly 60% of the Galician landings for fresh product and therefore represents somewhere in the order of 23% of the total Spanish fish production. The bulk of the Galician mussel production is destined for the consumption in the Spanish market. Spain is also a net exporter of mussels, while it imports around 8,000 to 9,000 tonnes of product, it exports around 28,000 tonnes (of which 22,000 tonnes are fresh product, 5,000 tonnes are frozen and 1,500 tonnes are canned) (Caballero, Garza and Varela, 2009).

THE GOVERNANCE: THE FAILURE OF “SOMEGA” CO-MANAGEMENT, THE ORGANIZATIONAL STRUCTURE OF THE SECTOR AND THE RECENT EXPERIENCE OF “PLADIMEGA” Already in the middle of the 20th Century, regarding the organisational structure of the mussel sector, there were signs that an atomised production was being confronted with a demand controlled by a more limited number of agents. In this way, the ―oligarchy of demand‖ explains how, in spite of the increase in demand, the price paid to the producers tended to be suppressed in real terms. This sector has depended on the commercialising actors. In about the middle of the 1970s, the public sector tried to modify this situation by creating an association where the users and government representatives both participated. The experience constituted an attempt of co-management (Jentoft, 1998). In 1974 The Society for the Industrial Development of Galicia (with a majoritarian participation from the National Institute of Industry that was a public sector agency) and the Savings Banks created the Society of Mussel Producers of Galicia (Sociedad Mejillonera de Galicia-SOMEGA) whose aim it was to change the conditions of mussel commercialization and to influence prices. SOMEGA assumed activities related to the extraction, cultivation, processing, canning (packaging), industrialisation and commercialisation of mussels, and furthermore, incorporated 618 owners/businessmen (―bateeiros‖) from the mussel sector as stock holders. The fact is that this attempt initiated from the public sector was not successful, and in a span of three years the financial situation of SOMEGA was critical. Public policy through this association could not prevail in a sustainable way. This is why the co-management method failed as a quasi-organisational formula of the mussel production sector in Galicia. Since then, the public sector has refrained from involving itself so directly in the organisation and commercialization of the sector. The sector is greatly atomised with respect to administrative licenses, with a very disconnected property structure in which the property average is 1.35 rafts per title holder (Labarta, 2004). The majority of rafts are the property of family businesses with a low level of concentration, and in the Ría of Arousa, the average is about 1.15 rafts per title holder (Caballero, Garza and Varela, 2009). The smallholding characterised a sector which was able to employ advanced methods of production, yet within an underdeveloped commercialised system in that sector. The decree of 1962 and the growing number of purifying plants being set up, ended up transforming this

The Experience of the Mussel Sector in Galicia

91

phase of the process into the key of the commercialization phase. However, the role of funnel of the purifying plants was not able to counter the lack of strength in commercialisation. After the failure of the SOMEGA co-management experience, the only road left to the mussel producers to gain influence in the markets and the public sector was by forming associations. In a scenario where the legal barriers to entry limit the competition, associations of producers aim to adapt cartel strategies that fix prices and assign production caps for its members. In 1979, twenty two mussel producing associations joined to form the Federation of Mussel Producers of Galicia (FEPMEGA-Federación de Productores de Mejillón de Galicia) in order to establish prices and control quantities. The E.E.C. (European Economic Community) relinquished responsibilities and gave aid to the organisations of producers, resulting in the integration of FEPMEGA into the Organisation of Mussel Producers of Arousa (OPMAR-Organización de Productores de Mejillón de Arousa) in 1987. OPMAR carried out activities related to pricing and product policy, and sought to influence collections regulation. In 1996 OPMAR became OPMEGA (Organización de Productores de Mejillón de Galicia) that is currently the largest organization and is made up of 1,860 floating raft farms and 1,280 members. Other producer organizations include AGAME with 900 floating raft farms and the Federation of Arousa Norte with 600 floating rafts farms. Using different names and formulas, the mussel sector maintained a majority organization up to the present, incorporating around 70% of the total production in only a few years. These organisations tried to fix mussel prices along with the canning and processing industry and attempted to maintain the barriers of entry and to acquire financing. There also exists a group of firms that have integrated the production and commercialisation phase of fresh product, and have even integrated the transformation phase. Of the four cases representative of this situation, the most relevant is that of PROINSA, that joins 80 floating raft cultures. In the summer of 2008 the mussel sector was thrown into conflict, the result of wideranging differences of opinion between a majority group of producers who were trying to unify the sector and regularise prices in order to exit the crisis in which the activity was immersed, due to the drop in mussel price, and another group which favoured the free market. In August 2008 a group of producers created the Galician Mussel Distribution Platform (PLADIMEGA), which represented 70% of mussel farmers –some 2,200 rafts- and major sector organisations such as OPMEGA. The aim of this group was to restructure the activity by finding formulas which would allow them to compete in the markets with foreign mussels, guarantee the sale of all their production and unify sale prices. The problem lay in the mussels destined for industry (the cooking and canning industry), not in the product marketed fresh. But as the industry processes most of the production from the Galician rias, around 60% or 70%, this experience only created a huge crisis. Since 2005 the mussel processing industry had been in crisis, which led some companies to begin to replace the autochthonous molluscs with cheaper ones from Chile, New Zealand or China. Mussel production in Chilean waters, an initiative recently supported by the Galician Administration and part of the sector, has shot up in recent years, and has begun to enter Spain on a massive scale (7,500 tonnes in 2007, according to data provided by the Chilean Trade Ministry). The ―cocederos‖ (where the mussels are cooked) and canning plants started to replace the average-size mussel, which makes up 20% of mussel production, with

92

Gonzalo Caballero-Miguez, Manuel Varela-Lafuente, Marcos Pérez-Pérez

the Chilean mussel (called ―chorito‖), which can be processed at half the price thanks to its lower cost. The large and small Galician mussel, however, was selling without any problem. PLADIMEGA proposed to the buyers that it would incentivize the purchase of the autochthonous mollusc by giving away a total of 16 million kilos of medium-size mussels. This incentive, as well as encouraging consumption, would halt the entry of the Chilean product. It also suggested that the industry join PLADIMEGA, which was unsuccessful. The employers‘ association, ANFACO, saw the creation of PLADIMEGA as an attempt to put up prices, monopolise production and threaten the free market and fair competition. When these initiatives failed, PLADIMEGA called for stoppages in the unloading of mussels destined for industry as a form a pressure. However, the ―cocederos‖ placed orders for mussels from the associations VIRXE DO ROSARIO (Vilaxoán) and the AROUSA Y NORTE Federation of Mussel Farmers, the main critics of PLADIMEGA‘s initiative. This triggered a serious conflict which lasted throughout the summer, with quayside pressure group activity to prevent the mussels from being landed,; boats, cranes and rafts were sabotaged; assaults, the placement of explosive devices and other violent incidents occurred, which forced the Regional Fisheries Ministry to mediate in the conflict. In a meeting held at the Regional Fisheries Ministry in Santiago de Compostela, PLADIMEGA offered the representatives of ―AROUSA Y NORTE‖ and ―VIRXE DO ROSARIO‖ the possibility of creating a production table. This initiative would consist of distributing production in accordance with the weight or importance of each group within the sector. To do so, a mode of distribution would be created, called ―sole control‖, which would take responsibility for establishing daily percentages and adjustments. At the end of the week, the possible imbalances incurred by each group would be counted, and would have to be compensated for the following week. ―AROUSA Y NORTE‖ proposed an alternative marketing system, distribution according to size. Each mussel raft would have to sell part of its small mussel production, another part of its medium-size production and the same amount of the large mussel. PLADIMEGA opposed this solution as, in their opinion, it would harm the weaker producers. In September, the lack of agreement between the different associations led to an indefinite stoppage which affected 70% of production in Galicia. PLADIMEGA paralysed sale of the fresh product as well as that destined for industry. The canners responded by importing more Chilean mussels. The Regional Fisheries Ministry mediated in the conflict to reinitiate the dialogue between the mussel farmers and the producers, who refused to accept PLADIMEGA‘s conditions. After a conflict that lasted seven weeks, PLADIMEGA and AROUSA NORTE reached an agreement to land the fresh mussel, but not that for canning. The income of the owners or ―bateeiros‖ fell by 70% (22 million euros) during the time landings were interrupted. A week later, the ―bateeiros‖ began to land their product for industry once again. ANFACO denounced the ―bateeiro‖ sector for unilaterally increasing the prices of mussels for industry by between 8 and 20%. The Galician Association of Purification Plant Owners (AGADE) affirmed that the average price of the mollusc increased by about 30% once landings began again. The special mussel rose from an average of 0.90 euros to 1.11; the medium-size mussel from 0.60 to 0.75; and the small mussel from 0.40 euros to 0.65, up to 62%. AGADE sustained that, with these margins, it was impossible to be competitive. It affirmed that orders for the small, European mussels, whose preferential markets are Italy and

The Experience of the Mussel Sector in Galicia

93

France, had plummeted on account of the high prices. AROUSA NORTE proposed lowering the prices of the mussels destined for industry, but PLADIMEGA refused. In October, the AROUSA NORTE Federation broke the pact and reduced the manufacturing price, applying an 8% discount to the product they would sell, as they did on 1 August, when the sector began the stoppage. PLADIMEGA finally decided to accept AROUSA NORTE and ANFACO‘s agreement, and apply the 8% discount to companies in order to normalise the landings destined for industry. ANFACO resumed its Galician mussel campaign when all of the producers lowered their prices. In 1998, the European mussel was selling at 0.60 euros, dropping to 0.40 in 2008. PLADIMEGA tried to recover the former price and reintroduced prices of 0.60 euros for the Italian market. Increased competition in the Mediterranean led to a halt in sales and made it necessary to drop prices. In November, mussels heading for the Italian market touched 0.30 euros, the figure which marks the limit of profitability. In December, after four months in existence, PLADIMEGA announced that it was suspending its activity, its justification being the fall in mussel prices, something that the Platform had been trying to avoid but was unable to achieve, and it gave groups the freedom to sell at the price they wanted. The disappearance of PLADIMEGA led to a collapse of the mussel market and prices plummeted. The product being sent to Italy dropped to 0.28 euros, below profitability levels, and the discount for industrial use reached 20%. The Xunta drafted recommendations for the sector for establishing control of mussel landings, and set out a list of authorised ports where the molluscs can be landed. As such, it laid the basis for guaranteeing the traceability of the product while granting greater power to the Mussel Regulatory Council and opened the door to the self-control of the bateeiros.

CONCLUSION The experience of the mussel sector in Galicia is relevant for the understanding of the mussel sector around the world. Moreover, it is a very important economic sector in the Spanish aquaculture. This chapter has presented a broad set of elements that characterize the natural, institutional and economic environment of the Galician floating raft culture for the mussel production. Nevertheless, the establishment of a floating raft culture is carried out with imperfect property rights and it presents a series of negative external effects. Such effects include ecological and hydrographical effects as well as interaction with navigation. Among the ecological effects – that point out the risk of knocking the natural environment out of balance- we must point out that mussel production generates a large quantity of sediment in which there is considerable organic material that produces a layer of sludge sediment. Combined with this effect to the seafloor by the debris generated, there are other ecological effects such as competition with other pelagic (open ocean) fish, and the widening of the habitat of detritus species, banks of reproduction (in scarce species), the introduction of nonnative species (NNS) (algae, parasites) and the break up and disintegration of obsolete facilities and equipment. Some of these effects imply not only changes of marine species but also the generation of a new, differentiated biological micro system. In this sense, this type of

94

Gonzalo Caballero-Miguez, Manuel Varela-Lafuente, Marcos Pérez-Pérez

factors has to be incorporated in a balanced analysis of the experience of the mussel sector in Galicia, which has been a quite successful story but with some deficits. The updated analysis of the natural, institutional and economic foundations of mussel production in Galicia is of the utmost interest for three underlying reasons (Caballero et al., 2009). In the first place, for the players in the Galician sector, this chapter provides a multidisciplinary focus on the social sciences dealing with institutional, political, legal and economic matters that lead to a better understanding of the sector. In the second place, for the specialists in institutional analysis, this chapter sets forth a case analysis dealing with the relationships between institutions and economic organization, and therefore widening the applied empirical analysis base. In the third place, for the mussel producers in other parts of the world, the paper furnishes evidence and relevant knowledge for the elaboration of comparative analysis. Caballero et al. (2009) had advanced in these three ways, but this chapter has amplified and updated that previous analysis regarding to the physical environment, the governance experience of the sector and the new legal framework. In this sense, this chapter presents an interesting and updated view of the floating raft culture in the Galician mussel sector.

REFERENCES Alston, L. J. (1996): ―Empirical work in institutional economics: an overview‖, pp. 25-33, en Alston, L. J., T. Eggertsson y D. C. North (eds): Empirical Studies in Institutional Change. Cambridge University Press. Cambridge. Allen, D.W. (1991): ―What are transaction costs?‖, Research in Law and Economics, N. 14, pp. 1-18. Aoki, M. et al. (2001): Comparative Institutional Analysis. The MIT Press. Cambridge. Caballero, G. (2001): ―La Nueva Economía Institucional‖, Sistema, N. 156, pp. 59-86. Caballero, G. and M. D. Garza (2008): ―El cultivo del mejillón en Galicia: estructura institucional, caracterización económica y organización productiva‖, pp. 395-410, en González Laxe, F. (2008): Lecciones de Economía Pesquera. Editorial Netbiblo. A Coruña. Caballero, G.; Garza, M. D. and M. M. Varela (2007): ―Institutions and management of Fishing Resources: The Governance of the Galician Model‖, Annual Conference of the International Society for New Institutional Economics, Reykjavic. Caballero, G.; Garza, M. D. and M. M. Varela (2008): ―Institutions and Management of Fishing Resources: The governance of the Galician model‖, Ocean and Coastal Management, Vol. 51, N. 8-9, pp. 625-631. Caballero, G.; Garza, M. D. and M. Varela (2009): ―The institutional foundations of economic performance of mussel production: The Spanish case of the Galician floating raft culture‖, Marine Policy, Vol. 33, pp. 288-296. Carbajo, P. (2004): ―El milagro del mejillón‖, El País, 22-11-2004. Madrid. Coase, R. H. (1937): ―The Nature of the Firm‖, Economica , N. 4, pp. 386-405. Coase, R. H. (1960): ―The Problem of Social Cost‖, Journal of Law and Economics, V. 3, N. 1, pp. 1-44.

The Experience of the Mussel Sector in Galicia

95

Durán, C.; Acuña, R. and J. Santiago (1990): El mejillón: biología, cultivo y comercialización. Fundación Caixa Galicia. A Coruña. Eggertsson, T. (1990): Economic Behaviour and Institutions. Cambridge University Press. Cambridge. Fernández González, A. I. (2005): ―De la roca a la cuerda. Orígenes y desarrollo de la industria mejillonera en Galicia (1946-2005)‖, VIII Congreso de la Asociación Española de Historia Económica, Santiago de Compostela. Franco Leis, M. (2006): ―La miticultura en Galicia: una actividad de éxito y con futuro‖, Revista Galega de Economía, Vol. 15, N. 1. Gardner, R. and E. Ostrom (1991): ―Rules and games‖, Public Choice, 70, pp. 121-149. González Laxe, F. (1999): Desafíos estratégicos de la acuicultura marina en España. Productividad, competitividad y regulación. Instituto de Estudios Económicos de Galicia Pedro Barrié de la Maza. A Coruña. González Laxe, F. (2003): ―Los marcos normativos y la posición competitiva de los sistemas de cultivo de moluscos‖. Documento 5/2003. Instituto Universitario de Estudios Marítimos. A Coruña. González Laxe, F. (2006): ―Transferability of fishing rights: The Spanish case‖, Marine Policy, 30, pp. 379-388. Greif, A. (1998): ―Historical and Comparative Institutional Analysis‖, The American Economic Review, Vol. 88, N. 2, pp. 80-84. Hodgson, G. M. (1998): ―The Approach of Institutional Economics‖, Journal of Economic Literature, XXXVI, pp. 166-192. Jentoft, S. (1998): ―Social theory and fisheries co-managemet‖, Marine Policy, 22, pp. 423435. Jentoft, S. (2004): ―Institutions in fisheries: what they are, what they do, and how they change?‖, Marine Policy, 28, 137-149. Labarta, U. (1984): ―El paradigma del mejillón‖, El País, 20/07/84. Madrid. Labarta, U. (coord.) (2004): Bateeiros, mar, mejillón. Una perspectiva bioeconómica. Fundación Caixa Galicia. A Coruña. Libecap, G. (1989): Contracting for property rights. Cambridge University Press. New York. Libecap, G. (1999): ―Contracting for property rights‖, paper for ANDERSON, T. L. and F. S. McChesney: The Law and Economics of Property Rights. Libecap, G. (2005): ―State Regulation of Open Access, Common Pool Resources‖, pp. 545572, in Menard, C. and M. Shirley: Handbook of New Institutional Economics. Springer. Mackenzie, C. L. et al. (eds) (1997): The History, Present Condition and Future of the Molluscan Fisheries of North and Central America and Europe. U.S. Dep. Of Commerce. NOAA Technical Report 129. Seattle. Matthews, R. C. O. (1986): ―The Economics of Institutions and the Sources of Economic Growth‖, Economic Journal, N. 96, pp. 903-918. Menard, C. and M. Shirley (2005): Handbook of New Institutional Economics. Springer. North, D. C. (1981): Structure and Change in Economic History. W.W. Norton. North, D. C. (1990): Institutions, Institutional Change and Economic Performance. Cambridge University Press. Ostrom, E. (1990): Governing the commons. Cambridge University Press. Penas, E. (2000): Elementos para unha ordenación integral dos usos do medio litoral de Galicia. Xunta de Galicia.

96

Gonzalo Caballero-Miguez, Manuel Varela-Lafuente, Marcos Pérez-Pérez

Rodríguez Rodríguez, G. (2001): ―Análise dos inputs intermedios, primarios e da formación bruta de capital fixo no sector mitícola galego‖. Documeno de Traballo 10, Economía Aplicada. IDEGA. Rodríguez Rodríguez, G. (2003): ―La miticultura gallega desde la perspectiva de la economía social‖, Revista Galega de Economía, Vol. 12, N. 1, pp. 1-15. Schlager, E. and E. Ostrom (1992): ―Property rights Regimes and Natural Resources: A Conceptual Analysis‖, Land Economics, 68(3), pp. 249-262. Scott, A. D. (ed) (1986): Progress in Natural Resource Economics, Oxford, Oxford University Press. Williamson, O. E. (2000): ―The New Institutional Economics: Taking Stock, Looking Ahead‖, Journal of Economic Literature, Vol.38, pp. 595-613. Reviewed by María Dolores Garza (ERENEA, Research Group on Natural Resource Economics, University of Vigo, Spain).

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 4

TRANSLATIONAL CONTROL OF GENE EXPRESSION IN THE MUSSEL MYTILUS GALLOPROVINCIALIS: THE IMPACT OF CELLULAR STRESS ON PROTEIN SYNTHESIS, THE RIBOSOMAL STALK AND THE PROTEIN KINASE CK2 ACTIVITY S. Kouyanou-Koutsoukou1, D. L. Kalpaxis2, S. Pytharopoulou2, R. M. Kolaiti1, A. Baier3 and R. Szyszka3 1

Department of Genetics and Biotechnology, Faculty of Biology, University of Athens, Panepistimiopolis, 15701 Athens, Greece 2 Laboratory of Biochemistry, School of Medicine, University of Patras, University campus, 26504, Patras, Greece 3 Department of Molecular Biology, Institute of Biotechnology, The John Paul II Catholic University of Lublin, Krasnicka Av.102, 20-718 Lublin, Poland

ABSTRACT The mussels of the genus Mytilus live in eutrophic seas. Due to their ability to absorb food by filtration and to concentrate both organic and inorganic pollutants, mussels have been extensively used as bioindicators. The exposure to heavy metals often causes sublethal changes, such as abnormalities in DNA replication and transcription, alterations in the pattern of protein expression, changes in other biochemical pathways, and subcellular injuries. Cellular stress caused by environmental contamination has been shown to cause spatial and seasonal variability in global protein synthesis in M. galloprovincialis. Most regulation of protein synthesis occurs at the initiation phase of translation. Nevertheless, it was found that the variation of ribosome efficiency at initiating protein synthesis under stress is not proportional to the polysome content, a fact suggesting that additional regulation may occur at other phases of peptide chain elongation. For instance, the ribosomal stalk, composed of a pentameric complex P0(P1/P2)2, is an important structural element of the large subunit which is involved in

98

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al. the ribosome-mediated stimulation of translation factor-dependent GTP hydrolysis. The phosphorylation of P1, and P2 proteins and changes of their content in the stalk may control protein synthesis by influencing initiation and elongation factors, and thereby may affect the translation of individual mRNAs. Protein kinase CK2, a Ser/Thr kinase composed of α and/or α΄ catalytic subunits and a dimer of regulatory  subunit, is involved in cell differentiation, proliferation and tumorgenesis of higher eukaryotes Experimental evidence suggests that CK2 is responsible for modification of the ribosomal stalk proteins and other components of the translational machinery in mussels. Therefore, relationships between protein synthesis alterations, ribosomal stalk function and protein kinase CK2 expression and activity in response to environmental stress is a promising field for exploration in marine invertebrates.

1. INTRODUCTION The Mediterranean mussel Mytilus galloprovincialis is a marine bivalve mollusc, widely exploited as food and used in marine culture. Mussels like M. galloprovincialis, have been widely used as bioindicators of marine pollution in biological studies, as they survive in polluted as well as non polluted areas. They possess the ability of accumulating organic pollutants and heavy metals in their tissues (Barfield et al., 2001). Several reports on biomarker measurements have been published during the last years, like studies on metallothionein (MT) content and acetylcholinesterase (AChE) activity, which are used as a biomarker of heavy metal exposure and organophosphorus compounds or carbamate pesticides, respectively (Viarengo et al., 1999; Bocquené and Galgani 1991; Najimi et al., 1997; Hamza-Chaffai et al., 1998; Tsangaris et al., 2007; Kalpaxis et al., 2004; Pytharopoulou et al., 2006, 2008). An integrated study of altered antioxidant enzymes in M. galloprovincialis sampled in various areas of Galicia (NW Spain) has been recently reported (Vidal-Liñán et al., 2010), while other field studies have evaluated the oxidative effects of heavy metals, like Cu, Cr, Ni, Zn, Fe, Mn and 137Cs on M. galloprovincialis living in Greek coastal areas (Catsiki and Florou, 2006; Pytharopoulou et al., 2008). Pollutants may cause structural abnormalities in ribosomal RNA and ribosomal proteins, leading to severe effects on protein synthesis machinery, or may induce the expression of specific proteins that confer chemical or thermal resistance (Geret and Cosson, 2002; Cosson, 2000; Isani et al., 2000). Studies in mammals have shown that genotoxic and non genotoxic stress activate check points of translation, leading to inhibition of protein synthesis. This mechanism of suppression eventually protects against the deleterious effects of pollutants, by inducing apoptosis (Sheikh and Fornace, 1999). Similar effects have been also noticed in marine organisms, such as mussels (Morgan et al., 1999; Reddy et al., 1997; Kalpaxis et al., 2004, Pytharopoulou et al., 2006, 2008). Nevertheless, protein biosynthesis is also suppressed under low oxygen conditions in both hypoxia-sensitive organisms (e.g., mammals) and in anoxia-tolerant species (e.g., many lower vertebrates and invertebrates). An overall suppression of this ATP-dependent biosynthetic function supports energy conservation under oxygen-limiting conditions. This is accomplished via several mechanisms including phosphorylation-mediated inactivation of ribosomal initiation (e.g., eIF2α, eIF5) and elongation (e.g., eEF2) factors and polysome dissociation into monosomes. Despite the suppression of the global protein synthesis, however, some mRNAs continue to be actively translated, supporting the production of molecules helping organisms to survive, like

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

99

chaperones (Franzellitti et al., 2010). In addition to several other mechanisms, the ribosomal stalk, a lateral protuberance of the large ribosomal subunit, seems to be involved in the selection of specific mRNAs (Ballesta et al., 1999). Ribosomal P0 protein, a component of the pentameric P0(P1/P2)2 ribosomal stalk, is overexpressed at stress conditions (Kolaiti et al., 2009). On the other hand, P1/P2 proteins are phosphorylated in the ribosomes and their phosphorylation seems to be relevant to the stalk activity. P-proteins can be phosphorylated by protein kinase CK2, a pleiotropic Ser/Thr kinase with an anti-apoptotic role in the cell (Hasler et al., 1994; Szyszka, 1999). This review will discuss alterations in translation efficiency caused by pollution in the mussel M. galloprovincialis as well as changes in other components of the translational machinery, like the ribosomal stalk P0(P1/P2)2. The protein kinase CK2, responsible for the phosphorylation of ribosomal P-proteins, and its activity towards the phosphorylation of P1/P2 stalk proteins will be characterized. The ribosomal stalk and the protein kinase CK2 are studied for the first time in marine invertebrates. Data support the notion that their expression and activity strongly respond to heavy metals and may be exploited as biomarkers of environmental metal pollution.

2. THE IMPACT OF ENVIRONMENTAL STRESS ON PROTEIN SYNTHESIS IN M. GALLOPROVINCIALIS The impact of metal pollutants on protein synthesis of M. galloprovincialis has been evaluated in the framework of a UNEP/MAP/MED POL Biomonitoring programme. Specimens of M. galloprovincialis (5–7 cm shell length, 7–9 g soft tissue wet wt), never exposed to growth stimulants, were placed in bow nets and immersed at 3–10 m depth in a clean coastal region (reference area) and two marine stations along the Patraikos Gulf. This Gulf is located in Northern Peloponnese, Greece (Figure 1).

Figure 1. Map of Patraikos Gulf and Korinthiakos Gulf, showing the investigated sites.

10 0

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al.

Despite the fact that most of the industries have been transferred to other regions and a sewage treatment plan has been in operation for a couple of years, some pollution sources, like Glafkos River and a local harbour, continue polluting the Gulf. After exposure for 1 month, the caged mussels were collected and their soft parts were dissected into gills and digestive glands within 3h. Heavy metals in the surrounding waters and a battery of biomarkers in the digestive gland and gill cells isolated from caged mussels were assessed. In addition, the polysome content and the efficiency of ribosomes from digestive gland cells at initiating protein synthesis were estimated. Covering a 10-year period, the whole set of data suggests that downregulation of global protein synthesis is an important component of the cellular stress response and may be exploited to monitor biological effects of metal pollution.

2.1. Chemical Characterization of the Mussel Sampling Sites and Bioaccumulation of Metals in Digestive Gland Cells Station 1 (38o 12΄ 48" N, 21o 42´ 42" E) was in front of the estuaries of Glafkos River, which crosses several intensive agricultural areas and also receives domestic and industrial effluents. Station 2 ( 38o 39΄ 10΄΄ Ν, 21ο 40΄ 00΄΄ Ε) was in a less contaminated area, 20 km east of Patras town, with little organic pollution, but temporally enriched in Zn and Cr. Heavy metals in seawater and sediments, except for mercury, were measured by flameless atomic absorption spectrophotometry (AAS), according to Jan and Young (1978). Mercury was determined by the cold vapor AAS method (Freimann and Schmidt, 1984). Metals were also analyzed in a composite sample of digestive glands, excised from 10 mussel specimens and digested with nitric acid according to Stien X. (et al., 1998).

Figure 2. Cu concentration in mussel digestive glands from a reference area and two stations in Patraikos Gulf.

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

10 1 The concentrations of heavy metals in digestive glands were higher in mussels collected in Stations 1 and 2 than in the reference area. This implies that both stations represent areas polluted by metals. Heavy metal analysis of sediments and seawater from the same regions confirmed that Station 1 was massively polluted by Cu, Cd and Pb, while Station 2 was polluted by Zn and Cr. Nevertheless, aromatic hydrocarbons (PAHs) or organochlorine pesticides (OCPs) were never found in high concentrations at both stations. The degree of bioaccumulation varied among the tested metals, being higher for Cd, Cu, and Zn. In addition, bio-accumulation varied seasonally, often reaching the lowest values in autumn. A representative diagram of Cu accumulation in digestive glands of mussels during the last 10 years is shown in Figure 2.

2.2. Standard-Biomarker Determinations Metallothioneins are cysteine-rich proteins of low molecular weight, which accumulate in mussels at high levels, as a rapid response to metal pollution (Bolognesi et al., 1999; Cosson, 2000; Isani et al., 2000; Ivanković et al., 2005). Apart from their role in sequestration of essential or toxic metals, they are crucial in many other cellular pathways, such as scavenging of oxyradicals, inflammation, and resistance against infections (Amiard et al., 2006). In our study, metallothioneins were partially purified from digestive gland extracts and determined as described by Viarengo et al., (1997). Metallothionein content in digestive glands was less in samples from the reference area than that found in samples from Stations 1 and 2. Also, metallothionein content was found lower in mussels from Station 2 than that measured in specimens from Station 1, except for the first year (Figure 3).

Figure 3. Metallothionein content in mussel digestive glands from a reference area and two stations in Patraikos Gulf.

10 2

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al.

Generally, fluctuations in metallothioneins were statistically related to fluctuations in heavy metal content of mussel digestive glands, except for Zn and Cd in some rare cases. For instance, the correlation coefficient (R) between metallothionein content and Cu in digestive glands was found to vary within the value range 0.750 – 0.850 (P<0.01), regardless of the sampling site of mussels. Lysosomes in digestive cells of mussels have been considered as the principal subcellular sites accumulating inorganic and organic pollutants (Regoli, 1992; Bolognesi et al., 1999; Domouhtsidou et al., 2004). In turn, accumulation of inorganic and organic pollutants in lysosomes causes aberrations in lysosomal membrane integrity and release of hydrolytic enzymes into the cytosol. Therefore, lysosomal membrane destabilization has been recommended as the most rational biomarker of general stress in marine bivalves and is routinely used in Mussel Watch programmes. Lysosomal membrane stability assay was performed in 10-μm 10 μm thick cryostat sections of mussel digestive glands, according to Moore (1976). The method is based on the ability of AS-BI N-acetyl-β-D-glucosamidine in entering lysosomes preincubated at pH 4.5 and 37oC for a definite time, and reacting with the lysosomal enzyme N-acetyl-β-hexosamidinase. In the presence of a diazonium salt, this reaction leads to a final violet-colored product. The more destabilization of lysosomal membranes caused by metal pollutants, the shorter labilization period (LP) is required to produce maximal staining intensity. Following this approach, we monitored the spatial and seasonal variability in LP values of digestive glands in reference and contaminated mussels. The results are depicted in Figure 4.

Figure 4. LP values in mussel digestive glands from a reference area and two stations in Patraikos Gulf.

LP values in samples from Station 1 were always lower than those measured in samples from Station 2 or the reference area. Moreover, LP exhibited seasonal variability, probably related to the reproductive cycle of mussels. This biological function beginning in October,

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

10 3 results in severe lysosomal perturbations leading to unstable lysosomal membranes (Regoli, 1992). With some exceptions, LP values were significantly correlated to metallothionein content (R=0.924±0.025; P<0.01) and cytosolic metal concentrations. For instance, correlation analysis between the LP values and cytosolic Cu revealed a significant negative relation between these parameters (R=0.650±0.150; P<0.01).

Figure 5. Micronucleus frequency in mussel gills from a reference area and two stations in Patraikos Gulf.

The micronucleus assay is one of the most promising techniques to identify genetic alterations caused by clastogenic and aneugenic agents. Micronuclei are small, intracytoplasmic masses of chromatin resulting from chromosomal breakage or aneuploidy during cell division (Iarmarcovai et al., 2008). The test has been applied in several biomonitoring studies over the last decade (Scarpato et al., 1990; Bolognesi et al., 1999; Dailianis et al., 2003; Kalpaxis et al., 2004; Bolognesi et al., 2004; Pytharopoulou et al., 2008). Micronucleus frequency was measured in gill cells, as indicated by Bolognesi et al. (2004). The results are shown in Figure 5. Higher values of micronucleus frequency were recorded in gill cells of mussels transplanted to Station 1, compared to those measured in samples from Station 2 or the reference area, regardless of the collecting time. Generally, micronucleus frequency was lower in autumn than in other sampling seasons. Nevertheless, some exceptions of this rule are evident (Figure 5), and may be related to non-canonical climatic or metabolic changes modulating the bioavailability of pollutants and/or the efficiency of the cellular defense mechanisms. Despite seasonal variability, micronucleus frequency was negatively correlated with LP values (R=-0.910±0.026; P<0.01) and positively correlated with metallothionein content and cytosolic metal concentrations. For instance, correlation with Cu was R=0.903±0.077 (P<0.01).

10 4

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al.

2.3. Downregulation of Global Protein Synthesis by Pollutants When exposed to environmental stresses, organisms downregulate protein synthesis by storing inactive ribosomes, which recover when conditions improve. Active translation occurs on polysomes, i.e. multiple ribosomes moving along a strand of translated mRNA, whereas monosomes and ribosomal subunits are translationally silent. Therefore, an effective way to reveal responses to pollution stress is to measure the subpopulation of polysomes, which provides a relative estimate of mRNA loading onto actively translating polyribosomes (Larade and Storey, 2002; Kalpaxis et al., 2003, 2004; Pytharopoulou et al., 2006, 2008). Following this approach, ribosomes were isolated from the post mitochondrial supernatant of mussel digestive gland extracts (S30) and analyzed by sucrose gradient centrifugation, as described (Pytharopoulou et al., 2008). Briefly, digestive gland pools were homogenized in buffer A (20 mM Tris-HCl pH 7.6, 100 mM potassium acetate, 10 mM magnesium acetate, 0.5 mM EDTA, 58 μg/ml PMSF, 250 mM sucrose, 6 mM β-mercaptoethanol, and 200 μΜ cycloheximide), at 4oC. To obtain the sedimentation profile of ribosomal particles, 15 A260 units of the S30 fraction were loaded on a 10-40% linear sucrose gradient (10 ml) in buffer B (50 mM Tris-HCl pH 7.6, 100 mM potassium acetate, 5 mM magnesium acetate, and 200 μΜ cycloheximide), centrifuged at 37,000×g for 4 h at 4oC in a SW41 rotor (Beckman), and analyzed by optical scanning at 260 nm. Representative sedimentation profiles of ribosomal particles are shown in Figure 6. As illustrated in this figure, the isolated ribosomal material contains polysomes as well as 80S monomers and ribosomal subunits. Compared to profiles obtained from samples collected either from Station 2 or from the reference area, the polysome peak in extracts from Station 1 shifts towards a lower density, suggesting a disaggregation of polysomes to monosomes and ribosomal subunits. This was valid, regardless of the collecting campaign. Nevertheless, seasonal variations in polysome profile were observed for each station. Namely, the polysome content was lower in winter and summer than in either spring or autumn (Table 1). Changes in the level and composition of the environmental pollution seem to be the main reason of such variations. Nevertheless, other exogenous and endogenous factors must be regarded with caution. For instance, hypoxia and low temperature shift marine organisms to reduced translational rate (Larade and Storey, 2002; Fraser et al., 2002). On the other hand, increased temperature, which elevates in summer by 7oC, may be detrimental to cells proteinsynthesizing under conditions of food limitation (Kalpaxis et al., 2004). Moreover, degenerative processes occurring during the spawning season may also activate anabolic pathways, and subsequently translation rate. The latter hypothesis can also explain the fact that polysome content and LP values usually were not significantly correlated in autumn. On the contrary, polysome content was always found negatively correlated with micronucleus frequency, metallothionein content and certain metals (Cu and Hg). These correlations encourage the use of polysome content as a possible biomarker of exposure to metal pollutants. This test gains additional advantages from its low cost and employment of routine reagents. Nevertheless, the required expertise in isolating ribosomes imposes some limitations on its general application in biomonitoring studies. In addition, the seasonal variability observed in polysome content suggests that biotic and exogenous parameters must be regarded with caution in order to ensure reliable comparisons. Winter seems to be the most appropriate sampling season, despite the technical difficulties met in

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

10 5 collecting the mussels during this period. This is probably due to the fact that during winter mussels in this area are massively out of reproductive processes. Table1. Seasonal variations in the polysome proportion (%) in ribosomal material isolated from digestive gland cells of caged mussels from a reference area and two stations in Patraikos Gulf

a

WI, SP, SU and AU, winter, spring, summer and autumn sampling, respectively.

Protein synthesis can be regulated at all phases of the elongation cycle. As most regulation occurs at the initiation phase (Sonenberg and Hinnebusch, 2007), a model system was used to check the capacity of poly(U)-programmed ribosomes to form an initiator ribosomal complex. Briefly, ribosomes stripped of endogenous mRNAs and peptidyl and/or aminoacyl-tRNAs (run-off ribosomes), were prepared by incubating a ribosomal suspension (10 A260 units of ribosomes per ml) with 0.5 mM puromycin, at 30oC for 30 min (Pytharopoulou et al., 2008). Crude acetyl[3H]phenylalanyl-tRNA (Ac[3H]Phe-tRNA) charged with 15 pmol of [3H]Phe per A260 unit was prepared from yeast tRNA (Sigma), and

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al. 10 6 partially purified translation factors were isolated from digestive gland extracts, as described previously (Kalpaxis et al., 2003).

Figure 6. Sucrose gradient analysis of ribosomal material isolated from digestive gland cells of caged mussels collected from a reference area and two stations in Patraikos Gulf during the winter sampling of 2008.

To test the efficiency of ribosomes to initiate protein synthesis, run-off ribosomes (32 A260 units per ml) were incubated at 25oC for specified time intervals, with 13.4 A260 units/ml Ac[3H]Phe-tRNA in buffer 50 mM Tris-HCl pH 7.2 containing 0.6 mM spermine, 0.8 mM spermidine, 100 mM potassium acetate, 5 mM magnesium acetate, 0.4 mM GTP, 320 μg /ml poly(U), 400 μg/ml translation factors and 6 mM β-mercaptoethanol. The ternary ribosomal complex (Ac[3H]Phe-tRNA·poly(U)·ribosome) formed, was purified through adsorption on cellulose nitrate filters. The amount of the ternary complex formed was calculated by measuring the trapped radioactivity on the filters. Analysis of ribosomal capacity to initiate protein synthesis revealed marked deviations between weakly and highly contaminated samples (Figure 7, see also Kalpaxis et al, 2003, 2004). Therefore, it was reasonable to suggest that metal pollution stress may downregulate global protein synthesis by affecting the initiation step. Nevertheless, comparison of the efficiency of ribosomes at initiating protein synthesis and polysome content revealed that these two parameters vary not proportionally, a fact suggesting that additional translational checkpoints may occur at the elongation or termination phases. However, it should be mentioned that certain types of stress can induce the synthesis of specific proteins that are required for cell survival (Holcik and Sonenberg, 2005). Consistently, we found that metal pollution induce metallothioneins. Even, in the latter case, the global protein synthesis remains depressed. The molecular mechanism by which heavy metals affect protein synthesis may be direct, due to their ability to hydrolyze the phosphodiester bond of nucleic acids. Apart from this role, some metals can also act as stimulators or generators of reactive oxygen species (ROS) (Valavanidis et al., 2006; Winterbourn and Hampton, 2008).

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

10 7

Figure 7. Time course of Ac[3H]Phe-tRNA binding to M. galloprovincialis poly(U)-programmed ribosomes. The values of radioactivity have been corrected for the nonspecific binding. The data were obtained from mussels sampled during winter of 2008.

Many ROS are free radicals and, therefore, highly reactive and can oxidize other cellular substances, like proteins, lipids and nucleic acids. For instance, it has been demonstrated that ROS can oxidize mRNA or ribosomal RNA (rRNA). Subsequently, oxidative modification of mRNA or rRNA affects the translational process, leading to the production of less and/or defective proteins, a fact which detrimentally influences the cellular functions in several species (Honda et al., 2005; Mroczek and Kufel, 2008; Kong et al., 2008). On the other hand, certain heavy metals influence protein synthesis by altering the expression of translation factors in marine organisms (Storey and Storey, 2004; Le Bouffant et al., 2008) or other species (Olarewaju et al., 2004; Dunand-Sauthier, 2005; Martinkova et al., 2007; WhiteGilbertson et al., 2009). Moreover, ribosomal proteins can be subject to similar changes of expression by metals or oxidative insults, as detected in yeast (Mirzaei and Regnier, 2007) or in M. galloprovincialis (Kolaiti et al., 2009). In the following section, we will discuss how Cd2+ can regulate protein synthesis in mussels through this route.

3. THE RIBOSOMAL STALK OF THE MUSSEL M. GALLOPROVINCIALLIS AND ITS IMPLICATIONS IN PROTEIN SYNTHESIS 3.1. Structure and Function of the Ribosomal Stalk in Eukaryotic Ribosomes Recently, the new term ―Ribosomics‖ has emerged, which refers to the analysis of ribosomal components at the genomic/proteomic level and has been proven as a powerful tool for research on cellular mechanisms. An important part of the ribosome is the stalk, a highly flexible lateral structure of the large ribosomal subunit involved in the interaction of the elongation factors with the ribosome during protein synthesis, while changes in its

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al. 10 8 composition differentially affect the translation of various mRNAs (Mӧ ller and Maassen, 1986; Liljas, 1991). The bacterial stalk is a protein pentamer L10(L7/L12)2 (Diaconu et al., 2005), while the yeast stalk consists of P0(P1αP2β)(Ρ1β/Ρ1α) proteins (Gomez-Lorenzo et al., 2000). In higher eukaryotes, the stalk is formed as a P0(P1/P2)2 complex: P0 protein interacts with 28S rRNA at Thiostreptone Loop, or GTP center. P0 protein binds P1/P2 dimers to the ribosome. The C terminus of P-proteins is free to interact with elongation factors during protein synthesis (Gonzalo and Reboud, 2003). An exchange process takes place between the acidic P1/P2 proteins of the ribosomal stalk and a cytoplasmic pool of free P1 and P2 acidic proteins (Ballesta and Remacha, 1996; Ballesta et al., 2000; Guarinos et al., 2003). In human stalk, two heterodimers (P1/P2)2 are attached to the ribosome via P0. Human P1 and P2 proteins remain predominantly in the cytoplasm, while P0 protein is found in the cytoplasm and in the nucleus (Tchórzewski et al., 2000; Grela et al., 2008). Human P1/P2 proteins regulate the rate of cell proliferation: RNAi-mediated silencing of human P2 expression causes a reduction in the growth rate of the cells, by influencing the interaction between subunits, thus modulating cytoplasmic translation (Martinez-Azorin et al., 2008). Reversible phosphorylation of ribosomal P1/P2 proteins regulates the translational activity of ribosomes. In S. cerevisiae, the ribosomal P-proteins are phosphorylated by CK2 and their phosphorylation is inhibited by superoxide dismutase 1 (SOD1) (Zieliński et al., 2002; Abramczyk et al., 2003). Ribosomal P0 protein is overexpressed at stress and cancer (Chang et al., 2008). Also, P0 antibodies have been frequently found in Systemic Lupus Erythromatosus (SLE), thus implicating P0 protein in auto-immune diseases autoimmune (Kiss and Shoenfeld, 2007). The ribosomal P-proteins have been studied in many eukaryotic organisms, from yeast to human. P-proteins of the Mediterranean fly Ceratitis capitata and the silkworm Bombyx mori have been shown to effectively substitute in vivo for endogenous P-proteins of S. cerevisiae, although the growth rate of the later cells was somewhat reduced (Gagou et al., 2000, Kouyanou et al., 2003, Koumarianou et al., 2007). In this section, we present and discuss the molecular and biochemical characterization of ribosomal P-proteins, the phosphorylation of P1/P2 proteins and the expression of ribosomal phosphoprotein P0 in M. galloprovincialis exposed to normal and stress environmental conditions. In addition, the recombinant catalytic subunit CK2α and the regulatory subunit CK2β of M. galloprovincialis, isolated after expression in Escherichia coli, and their activity in phosphorylating purified recombinant P1/P2 stalk proteins are indicated. Finally, the inhibition effect of purified recombinant SOD1 on recombinant CK2α is also described.

3.2. The Ribosomal Stalk of M. galloprovincialis is Conserved Similarly to other eukaryotic organisms, the ribosomal stalk of the mussel M. galloprovincialis is composed of a bigger MgP0 protein (32kDa) and two smaller, acidic MgP1 and MgP2 proteins (14 kDa) (Kolaiti et al., 2009), which are found phosphorylated on the ribosomes (Figure 8). The amino acid sequences of both MgP1 and MgP2 proteins, as predicted from their cDNAs, are 112 amino acids long. After analyzing for conservative replacements, they show considerable similarity to their counterparts of other eukaryotic organisms.

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

10 9

Figure 8. The ribosomal stalk proteins, MgP1 and MgP2 of the mussel M. galloprovincialis, as revealed by Western blot analysis with the specific monoclonal antibody 3BH5, after isoelectrofocusing in the presence of ampholines pH 2.5-5.0.

Figure 9. Model structure of the ribosomal proteins MgP1(up) and MgP2 (down) of the mussel M. galloprovincialis. Structural feature P1 and P2 were made using HHpred protein structure homology modeling, presented by PyMOL v0.99 programme (Söding, 2005; Söding et al., 2005). For MgP1, 3A1Y (Naganuma et al., 2010), 2W1O (Lee et al., 2010), and 2ZKR (Chandramouli et al., 2008) and for MgP2, 2WLO (Lee et al., 2010), 3A1Y (Naganuma et al., 2010) and 2ZKR (Chandramouli et al., 2008) structures were used as template.

MgP1 protein shows 68% identity and 94% similarity with its counterpart in B. mori (Bm), 60% and 90%, respectively, with its counterpart in Rattus norvegicus (Rn), and 60% and 89% with its counterpart in Homo sapiens (Hs). MgP2 protein shows 58% identity and

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al. 11 0 93% similarity with its counterpart in B. mori (Bm), 62% and 93% with its counterpart in R. norvegicus (Rn) and 62% and 92% with its counterpart in H. sapiens (Hs). Both M. galloprovincialis P1 and P2 proteins contain the three conservative, characteristic functional domains of eukaryotic P1 and P2 proteins; a highly hydrophobic N-terminal domain, a central Ala/Pro/Gly-rich flexible hinge domain, and a highly acidic C-terminal domain, that is conserved among eukaryotic species and is believed to interact with eEF2 (Figure 9). The residues AESEESDDD of MgP1 and PESESDDD of MgP2, near the C-terminal end, are putative target sites by protein kinase CK2, similarly to other ribosomal P-proteins (Meggio and Pinna, 2003). Two conserved serines included in both C-terminal peptides may be susceptible to phosphorylation, in agreement with their homologues in higher eukaryotes. Analysis of MgP2 and MgP1 proteins by electrofocusing (Figure 8 and Kolaiti et al., 2009), reinforces this suggestion, as each protein was revealed as one group of three acidic bands reacting with the antibody 3BH5 (Vilella et al., 1991) and shifting to one band of more basic pH each, after treatment with alkaline phosphatase. The phosphorylated forms of MgP1 and MgP2 proteins can have a functional meaning, since in vitro ribosome reconstitution experiments in rat have shown that phosphorylation of both P1/P2 proteins plays a central role in the reactivation of ribosomal stalk (Vard et al., 1997). The amino acid sequence of MgP0 protein, as predicted from its cDNA, is 315 amino acids long. After examining for conservative replacements, MgP0 protein shows considerable similarity to its counterpart in other eukaryotic organisms; 70% identity and 88% similarity for B. mori (Bm), 70% and 89% for H. sapiens (Hs) and 70% and 89% for R. sylvatica (Rs). The structure of MgP0 protein (Figure 10, see also Kolaiti et al., 2009), is similar to most eukaryotic ribosomal P0 proteins.

Figure 10. Model structure of ribosomal protein MgP0. Structural feature P0 was made using HHpred protein structure homology modeling, presented by PyMOL v0.99 programme (Söding, 2005; Söding et al., 2005). 2ZKR (Chandramouli et al., 2008) 3A1Y (Naganuma et al., 2010), and 1VQ8 (Schmeing et al., 2005) structures were used as template.

Like L10 protein, it comprises a conservative N-terminal domain of the first 121 amino acids, which is probably the binding site to 28S rRNA (Santos and Ballesta, 2005). An Alarich hinge region near the C-terminus comprises the putative P1/P2 binding region (Hagiya et

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

11 1 al., 2005; Krokowski et al., 2006; Pérez-Fernández et al., 2005), while the highly conserved carboxyl sequence EESDDDMGFGLFD at the C-terminus is identical in most eukaryotic acidic ribosomal proteins (Wool et al., 1992; Santos and Ballesta, 1995). Residues EEESDDD (aa 302–308) of MgP0 comprise a putative phopsphorylation site by CK2 (Meggio and Pinna, 2003).

3.3. The Impact of Stress on the Expression of M. galloprovincialis MgP0 Protein Ribosomal P0 protein is overexpressed at stress and cancer and is involved in autoimmune diseases, as referred before. An increase in P0 expression has been also reported as a response in freezing or anoxia in the wood frog R. sylvatica (Wu and Storey, 2005), in human colon and hepatocellular carcinomas (Barnard et al., 1993; Kondoh et al., 1999), and in cellular proliferation in breast and liver carcinoma cells (Chang et al., 2008). Sorbitol seawater induces hyperosmotic stress, and cadmium is known to produce reactive oxygen species (ROS) (Galaris and Evangelou, 2002; Stohs and Bagchi, 1995). Exposure of mussels to sorbitol or to sorbitol and cadmium causes 201.2% over-expression in M. galloprovincialis MgP0, while cadmium alone results to a lower expression (101.65% increase, compared to control), as shown by western blot analysis (Kolaiti et al., 2009) and more recently, by semiquantitative RT-PCR (Figure 11). It is probable that the osmotic stress induced by sorbitol and the subsequent facilitated influx of cadmium may be responsible for the elevation of MgP0 expression. The eukaryotic ribosomal stalk P0(P1/P2)2 is responsible for ribosomal activity and protein synthesis, directly involved in the activity of multiple soluble translation factors (reviewed by Gonzalo and Reboud, 2003). Therefore, perturbations in the expression of P-proteins due to environmental or pathological reasons may have significant impact. As referred before, M. galloprovincialis responds to environmental stress by storing inactive ribosomes (Kalpaxis et al., 2004; Pytharopoulou et al., 2006; Storey and Storey, 2004). Thus, the correlation of MgP0 overexpression with this reported down-regulation of protein synthesis may reside in the involvement of accumulated cytoplasmic P0 in the binding of free P1/P2 proteins, affecting the composition of the stalk. It has been reported that P1/P2 depleted ribosomes significantly affect the expression of many proteins and chaperones in particular (Remacha et al., 1995). As referred in the case of the wood frog R. sylvatica, it is possible that enhanced P0 synthesis may alter the interactions between the P0(P1/P2)2 complex, the ribosome and the elongation factors, either by suppressing translation, or by promoting selective translation of internal ribosome entry sites (IRES)-containing transcripts, perhaps by helping to circumvent an inhibited eEF2 (Wu and Storey, 2005). An extraribosomal P0 protein function cannot be excluded either, as referred in human breast cancer cells, where P0 protein co-precipitated with GCIP tumour suppressor factor, resulting in oncogenesis (Chang et al., 2008). On the other hand, it is known that cells have the ability to metabolize syperoxide superoxide via the catalytic activity of the antioxidant enzyme SOD (Arslantas, 2002). For instance, digestive cells in M. galloprovincialis usually respond to cadmium or other heavy metals exposure by activation of antioxidant defence mechanisms, which protect them under such conditions (Viarengo et al., 1997, 1999). Also, it has, been reported that the antioxidant enzyme Superoxide Dismutase (SOD) acts as an inhibitor of CK2 in yeast (Zieliński et al.,

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al. 11 2 2002; Abramczyk et al., 2003). A similar function has been seen in M. galloprovincialis and is discussed below.

Figure 11. Semi-quantitative RT-PCR showing an increase of the level of MgP0 protein in gills of M.galloprovincialis, after exposure at stress conditions of cadmium, sorbitol and cadmium/sorbitol.

4. PROTEIN KINASE CK2 AND ITS INVOLVEMENT IN STRESS 4.1. Structure, Function and Regulation of CK2 CK2 is a constitutively active protein kinase, classified into the Ser/Thr kinase family. It is highly conserved and identified in many eukaryotes. CK2 is involved in a wide variety of cellular processes, e.g., cell cycle control, transcription, signal transduction, development, cell proliferation and survival (Litchfield, 2003; Filhol and Cochet, 2009). The physiological function of CK2 includes brain development and regulation of cytoskeleton protein interactions, control of mitosis and involvement in the cell shaping and polarization. Furthermore, a major role is related to cell proliferation and tumorigenesis. CK2 is known as a suppressor of apoptosis and is implicated in virus replication (Ahmad et al., 2008). CK2 holoenzyme has the shape of a butterfly, consisting of a dimer of regulatory subunits, to which 2 catalytic subunits are bound. The CK2α interface for CK2β binding is located at the outer surface of the anti-parallel β-sheet of the N-terminal domain, which is a highly conserved structure element in eukaryotic protein kinasesMost likely, CK2β may work as a platform which can bind not only CK2β CK2α, but also other homologous protein kinases. Interactions with other protein kinases, like Mos, A-Raf, CHK1 and CHK2, have been reported (Chen et al., 1997; Boldyreff and Issinger, 1997).

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

11 3 In yeast and humans, two well-characterized catalytic subunits (CK2α and CK2α΄) have been characterized. While the genome of yeast encodes two different regulatory subunits (CK2β and CK2β΄), in human the dimer is formed by two identical isoforms (CK2β) (Graham and Litchfield, 2000). Due to the simple cultivation and the potentialities in performing in vivo experiments, S. cerevisiae has become a model organism for CK2 investigations, regarding the influence of stress. In human tissues, alterations in CK2 level or activity have been implicated in a variety of human diseases (Gyenis and Litchfield, 2008). In transgenic mice, tumor promotion and oncogenic effect was measurable after overexpression of CK2. Knockout experiments in mice suggest that CK2α may compensate the role of CK2α΄, regarding viability; some defect, however, was detected in spermatogenesis (Xu et al., 1998). The failed attempt to produce CK2-knockout mice proves the essential role of this enzyme for cell survival (Buchou et al., 2003). Similar effects were observed in S. cerevisiae, when either gene of CK2α or CK2α΄ was blocked, but cells remained viable. However, knockout of both genes was lethal. Biochemical studies have shown that, following scanning of mRNA by the 43S preinitiation complex (40S•eIF3•Met-tRNAf•eIF2•GTP) and formation of the 48S initiation complex at the AUG codon of mRNA (40S•eIF3•AUG•Met-tRNAf•eIF2•GTP), eIF5 interacts with the initiation complex to promote hydrolysis of the bound GTP. Hydrolysis of GTP causes the release of eIF2•GDP and eIF3 from the 40S subunit, an event that is essential for the subsequent joining of the 60S ribosomal subunit to the 40S complex, to form the functional 80S initiation complex (80S•Met-tRNAf•mRNA) that is active in peptidyl transfer. CK2 phosphorylates eIF5 at two serine residues (sites at Ser387 and Ser388 near the Cterminus) both in vitro and in vivo (Figure 12) (Majumdar et al., 2002).

Figure 12.The involvement of protein kinase CK2 in the initiation of protein synthesis (see text for details).

11 4

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al.

As mentioned, CK2 plays an important role in cell cycle progression. Although its function in this process remains unclear, it is known to be required for the G1 and G2/M phase transitions in yeast. CK2 activity changes notably during cell cycle progression and increases within 3h of serum stimulation of quiescent cells. Phosphorylation of N-terminal sites of eIF5 perturbs synchronous progression of cells through S to M phase, resulting in a significant reduction in growth rate. Furthermore, the formation of mature eIF5/eIF2/eIF3 complex is reduced in these cells. These results show that CK2 may be involved in the regulation of cell cycle progression by associating with and phosphorylating a key molecule for translation initiation (Homma et al., 2005). Expression of eIF5 mutants that lack eIF5 phosphorylation sites leads to a significant reduction in the formation of the mature complex, in the growth rate, and the expression of cell cycle-regulated proteins. Also, a pool of CK2 translocates into the nuclear fraction, following its activation during the progression of the cell cycle (Homma and Homma, 2008). As referred above, ribosomal acidic P-proteins are phosphorylated when bound to the ribosome, but they are also found in a cytoplasmic pool of non-phosphorylated proteins. During translation, an exchange between proteins present on the ribosome and the cytoplasm takes place. This exchange seems to be due to an extension of P-protein phosphorylation and to changes in the stalk conformation and composition. These changes can affect expressions of specific proteins, by influencing the initiation and elongation factors and thereby the efficiency of ribosomes in translating individual mRNAs. Using a specific CK2 inhibitor, it was shown that free CK2α΄ is probably responsible for P-proteins phosphorylation in vivo (Abramczyk et al., 2003). In this respect, it should be noted that in yeast, the induction of Cu– Zn superoxide dismutase (SOD1) by stress factors is related with the inhibition of P-protein phosphorylation and CK2α΄ activity at stress conditions (see below). CK2 has been shown to regulate activity of the ribosome by phosphorylation of acidic ribosomal P-proteins of the large ribosomal subunit. Phosphorylation of acidic P-proteins and their exchange between ribosome and cytoplasm alters the conformation and composition of ribosomal stalk, a fact affecting the initiation and elongation factors binding and activity and, consequently, the expression of specific proteins. In S. cerevisiae, P-proteins phosphorylation is correlated with the growth phase of cells and activity of SOD1 (Zieliński et al., 2002). The action of this antioxidant enzyme reduces the CK2α΄ activity, competitively affecting the binding of P-proteins and 80S ribosome. Namely, a Ki values of 3.5 mM has been measured for yeast recombinant acidic ribosomal protein P2B and a value of 0.6 mM for 80S ribosomes (Abramczyk et al., 2003). SOD1 inhibitory effect was observed when free catalytic subunit was used. In contrast, no inhibitory effect was evident, when CK2 holoenzyme was tested. It was shown that the activity of yeast CK2α΄ depends on the growth phase of the cells and is high in logarithmic but low in diauxic shift phase cells. Interestingly, the mentioned changes in CK2α΄ activity were close related to the extent of phosphorylation of ribosomal P-proteins and the presence of the SOD1 protein. Based on these observations it was presumed that SOD1 protein may form a regulatory complex with CK2α΄. To confirm this presumption, pure CK2α΄ and SOD were centrifuged in a 10 – 40% glycerol gradient. Obtained results showed that CK2α΄ does interact with SOD1 to form a complex of of about 73 kDa which realizes its structure as CK2α΄ •(SOD1)2. In parallel control gradients, CK2α΄ sediments as a single protein of molecular weight of ~39 kDa, while SOD1 sediments as a dimeric protein of ~35 kDa.

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

11 5 Results obtained in yeast showed that under oxidative stress conditions, the activity of free CK2α΄ can be abolished by formation of an inactive complex with dimers of SOD1. One possible mechanism of regulation resembles the modulation of CK2α/α΄ activity by the regulatory CK2β subunit or the calmodulin regulatory mechanism of enzymes. Consistently,SOD1 protein contains an amino acid cluster similar to those present in CK2 substrates, as well as, to those present in regulatory CK2β subunit. Such so called pseudosubstrate sequences have been reported as autoinhibitory domains and are present in various protein kinases. Recently, we characterized the protein kinase CK2 in the mussel M. galloprovincialis. Applying several methods, like in-gel phosphorylation or Western Blot analysis, we showed undoubtedly the presence of CK2 in M. galloprovincialis. Using crude extract and a partially purified protein fraction from M. galloprovincialis gills, we detected differences between the putative CK2 fractions in various steps of the purification process. This is strong evidence that we separated free catalytic subunit and holoenzyme, similarly to the procedures applied before for S. cerevisiae. Afterwards, we cloned the genes for CK2α and CK2β (Kolaiti, et al., 2010). Putative CK2 activities were analyzed in the presence of several known modulators of the CK2 activities. These experiments showed the typical behavior of CK2α subunit, which differs from that of holoenzyme. MgCK2 utilizes GTP as phosphate donor, a well known feature of CK2, consistently with the substrate features of other CK2 kinases. Furthermore, in experiments using selective CK2 inhibitors, the IC50 value was about 1 µM for free catalytic subunit and holoenzyme. The stabilizing function of β subunit was revealed by performing experiments in the presence of NaCl. Free catalytic subunit was inhibited, but the activity of the holoenzyme was increased. This phenomenon has been already described by Bibby and Litchfield (2005). Similar results were obtained in the case of reconstituted human and maize holoenzymes α2β2 (Riera et al., 2001). CK2 activity is affected by the presence of polycations and polyanions. Polylysine activates the phosphorylating activity, whereas heparin inhibits CK2. Purified, recombinant SOD protein of M.galloprovincialis (Figure 13) acts also as a CK2 inhibitor.

Figure 13. Model structure of MgSOD. Structural feature SOD was made using HHpred protein structure homology modeling, presented by PyMOL v0.99 programme (Söding, 2005; Söding et al., 2005) and 1TO4 (Cardoso et al., 2004). 3F7L (Shin et al., 2009), 2C9V (Strange et al., 2006) and 3CE1 (Teh et al., 2008) structures were used as template.

11 6

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al.

Alignments of the predicted amino acid sequence of the CK2α and CK2β subunits of M. galloprovincialis with the corresponding sequences of H. sapiens (Hs) Drosophila melanogaster (Dm), B. mori (Bm), Ciona intestinalis (Ci) led to the conclusion that the primary structure of MgCK2α exhibits considerable similarity with the characteristic subdomains and the conserved features of a typical protein kinase CK2 (Figure 14). These features are listed as follows:

Figure 14. Model structure of MgCK2 catalytic subunit. Structural feature CK2 subunit was made using SWISS-MODEL Workspace for protein structure homology modeling (Arnold et al., 2006, Kopp and Schwede, 2004) and 1ds5D structure as template (Battistutta et al., 2000).

Figure 15. Model structure of mytilus CK2β regulatory subunit. Structural features of CK2β subunit was made using SWISS-MODEL Workspace for protein structure homology modeling (Arnold et al., 2006, Kopp and Schwede, 2004) and 3EED structure as template (Raaf et al., 2008).

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

11 7

1. The ATP binding motif, G44XGXXS49 2. One Lys-rich segment with aa sequence P70VKKKKIR77, responsible for recognition of substrate, nuclear localization (NLS) and interaction with hsp90 and heparin 3. Residues R153, D154 and H158, which are important elements of the catalytic loop 4. The conserved sequences D173WG175 and G197PE199, which are responsible for the formation of CK2α activation loop, and 5. the conservative residues R189, R193 and K196 of the C-terminal loop, which are responsible for the recognition of acidic residue at position n+1, in the phosphoracceptor sequence (Hanks and Quinn, 1991; Martel et al., 2001). The primary structure of MgCK2β subunit contains all the typical conserved features characteristic for CK2β subunits as follows (Figure 15): 1. Two main phosphorylation sites (S2S3SEE), 2. The Nopp140 interaction site (aa 5-20), 3. Two highly conserved amino acids (E20 to K33) which are used for the export of CK2 as an ectokinase, 4. One destruction box (aa 46-54), 5. The acidic loop responsible for down regulation of CK2 activity (aa 55-64), 6. Residues involved in interaction with cell cycle regulators p21 and p53 (aa 106-116, aa 124, 134, 141, 145-149, 152), 7. Dimer interface residues (aa 143-148), 8. One region containing CK2α binding residues (aa 187-192), 9. Residues responsible for binding A-Raf and Mos (aa 187-205), and 10. Four cysteine residues responsible for zinc finger formation (C109, C114, C137 \ and C140) involved in β, and 11. serine residues near the C terminus phosphoryated by p34cdc2 in vitro (Soderling, 1990; Litchfield et al., 1991; Boldyreff et al., 1993; Meggio et al., 1995; Kobe et al., 1997; Sarno et al., 1999; Bolanos-Garcia et al., 2006).

CONCLUSION Exposure of the mussel M. galloprovincialis to stress conditions results in down regulation of protein synthesis, as shown by polysome evaluation of speciments exposed to heavily polluted coastal areas of Patraikos gulf, Greece. This effect is accompanied by increases in metallotheionin (MT) content and micronucleus frequency as well as by destabilization of lysosomal membranes. On the other hand, exposure of mussels to metal stress causes overexpression of Rribosomal P0 protein. Other cellular stresses or pathological situations, like exposure at low temperatures or oncogenesis and autoimmune diseases, have been shown to cause increased expression of ribosomal P0 protein. This protein is an essential component of the stalk of the large ribosomal subunit, which interacts with two heterodimers of acidic P1/P2 ribosomal proteins and forms the pentameric protein stalk P0(P1/P2)2. Pproteins exist in multiple copies and are also found in the cytoplasm in the form of free molecules. Interestingly, an exchange between the ribosome-bound P1/P2 and a cytoplasmic

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al. 11 8 pool of these proteins has been shown (Zinker and Warner,1976). Due to the fact that lack of acidic ribosomal proteins P1A/B and P2A/B in yeast significantly affects the expression of many proteins and chaperones in particular (Remacha et al., 1995), it was suggested that the altered content of acidic P1/P2 proteins in ribosome changes its specificity toward different mRNAs. It also seems that increased levels of the ribosome-free P0 protein, accumulated upon its overexpression, may titrate a significant portion of P1/P2, thus creating a subpopulation of ribosomes that lacks these proteins. This, in turn, may alter the synthesis of transcriptional factors that regulate the expression of chaperones (Kryndushkin et al., 2002). Alternatively, differential translation of specific mRNAs may arise from differential P1 and P2 phosphorylation and subsequent alterations in the stalk structure (Remacha et al., 1995, Zambrano et al., 1997; Zieliński et al., 2002). Therefore, phosphorylation of P1, P2 proteins and their content in the stalk might regulate protein synthesis, affecting the efficiency of translation of individual mRNAs and therefore the expressions of specific proteins (Abramczyk et al., 2003; Ballesta and Remacha, 1996; Guarinos et al., 2003; Krokowski et al., 2007). P-proteins are phosphorylated in on serine residues located in the conserved Cterminal region by CK2, a cyclic AMP-independent kinase which can utilize either ATP or GTP (Ballesta et al., 1999, Zieliński et al., 2002). Combining the above information, we propose in this chapter a possible mechanism of the implication of CK2 and SOD in the phosphorylation of the ribosomal P-proteins and the influence of P0 overexpression in ribosomal activity (Fig 16).

Figure 16. Proposed mechanism of the implication of CK2 and SOD in the phosphorylation of the ribosomal P-proteins and possible role of P0 overexpression at stress conditions.

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

11 9 In conclusion, the isolation of protein kinase CK2 of the mussel M. galloprovincialis that phosphorylates these interesting ribosomal components, and its analysis under normal and stress conditions have strongly contributed to our understanding on the translational control of gene expression and will be an interesting field of research in the future.

REFERENCES Abramczyk, O., Zień, P., Zieliński, R., Pilecki, M., Hellman, U., and Szyszka, R. (2003). The protein kinase 60S is a free catalytic CK2a΄ subunit and forms an inactive complex with superoxide dismutase SOD1. Biochem. Biophys. Res. Commun. 307, 31–40. Ahmad, K. A., Wang, G., Unger, G., Slaton, J. and Ahmed, K. (2008). Protein kinase CK2 – A key suppressor of apoptosis. Adv. Enzyme Regul. 48, 179–187. Amiard, J.C., Amiard-Triquet, C., Barka, S., Pellerin, J., and Rainbow, P.S. (2006). Metallothioneins in aquatic invertebrates: their role in metal detoxification and their use as biomarkers. Aquat. Toxicol. 76, 160-202. Arnold, K., Bordoli, L., Kopp, J., and Schwede, T. (2006). The SWISS-MODEL workspace: a web-based environment for protein structure homology modelling. Bioinformatics. 22, 195-201. Arslantas, A. (2002). Development of Functional Models for a SOD. Met Based Drugs. 9, 918. Ballesta, J.P.G., and Remacha, M. (1996). The large ribosomal subunit stalk as a regulatory element of the eukaryotic translational machinery. Progr. Nucleic Acid Res. Mol. Biol., 55, 157–193. Ballesta, J.P.G., Rodriguez-Gabriel, M.A., Bou, G., Briones, E., Zambrano, R., and Remacha, M. (1999). Phosphorylation of the yeast ribosomal stalk. Functional effects and enzymes involved in the process, FEMS Microbiol. Rev. 23, 537–550. Ballesta, J. P. G., Guarinos, E., Zurdo, J., Parada, P., Nusspaumer, G., Lalioti, V. S., PérezFernández, J., and Remacha, M. Structure of the yeast ribosomal stalk. In: The Ribosome Structure, Function, Antibiotics and Cellular Interactions. Garrett, R., Douthwaite, S., Matheson, A., Liljas, A. Moore, P.B., and Noller, H.F. (eds). Washington, D.C.: American Society for Microbiology Press; 2000; 115–125. Barfield, M. L., Farris, J. L., and Black, M. C. (2001). Biomarker and bioaccumulation responses of Asian clams exposed to aqueous cadmium. J. Toxicol. Environ. Health. 63: 495-510. Barnard, G.F., Staniunas, R.J., Mori, M., Puder, M., Jessup, M.J., Steele, G.D. Jr., and Chen, L.B. (1993). Gastric and hepatocellular carcinomas do not overexpress the same ribosomal protein messenger RNAs as colonic carcinoma. Cancer Res. 53, 4048-52. Battistutta, R., Sarno, S., De Moliner, E., Marin, O., Issinger, O.G., Zanotti, G., Pinna, L.A. (2010). The crystal structure of the complex of Zea mays alpha subunit with a fragment of human beta subunitprovides the clue to the architecture of protein kinase CK2 holoenzyme. Eur. J. Biochem. 267, 5184-5190. Bibby, A. C. and Litchfield, D. W. (2005). The multiple personalities of the regulatory subunit of protein kinase CK2: CK2 dependent and CK2 independent roles reveal a secret identity for CK2b. Int. J. Biol. Sci. 1, 67–79.

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al. 12 0 Bocquené, G., and Galgani, F. (1991). Acetylcholinesterase activity in the common prawn (Palaemon serratus) contaminated by carbaryl and phosalone: choice of a method for detection of effects. Ecotoxicol Environ Saf. 22(3), 337-44. Bolanos-Garcia, V.M., Fernandez-Recio, J., Allende, J.E., and Blundell, T.L. (2006). Identifying interaction motifs in CK2beta--a ubiquitous kinase regulatory subunit. Trends Biochem. Sci. 31(12), 654-61. Boldyreff, B., James, P., Staudenmann, W. and Issinger, O.-G. (1993). Ser2 is the autophosphorylation site in the beta subunit from bicistronically expressed human casein kinase-2 and from native rat liver casein kinase-2 beta. Eur. J. Biochem. 218, 515-521 Boldyreff, B. and Issinger, O.-G. (1997). A-Raf kinase is a new interacting partner of protein kinase CK2 beta subunit. FEBS Lett. 403, 197-199. Bolognesi, C., Landini, E., Roggieri, P., Fabbri, R., and Viarengo, A. (1999). Genotoxicity biomarkers in the assessment of heavy metal effects in mussels: experimental studies. Environ. Mol. Mutagen. 33, 287-292. Bolognesi, C., Frenzilli, G., Lasagna, C., Perrore, E., and Roggieri, P. (2004). Genotoxicity biomarkers in Mytilus galloprovincialis: wild versus caged mussels. Mutat. Res. 552, 153-162. Buchou, T., Nernet, M., Blond, O., Jensen, H. H., Pointu, H., Olsen, B. B., Cochet, C., Issinger, O.-G. and Boldyreff, B. (2003). Disruption of the regulatory b subunit of protein kinase CK2 in mice leads to a cell-autonomous defect and early embryonic lethality. Mol. Cell Biol. 23, 908–915 Cardoso, R.M., Silva, C.H., Ulian de Araujo, A.P., Tanaka, T., Tanaka, M., and Garratt, R.C. (2004). Structure of the cytosolic Cu,Zn superoxide dismutase from Schistosoma mansoni. Acta Crystallogr., 60, 1569-1578. Catsiki, V.A., and Florou, H. (2006). Study on the behavior of the heavy metals Cu, Cr, Ni, Zn, Fe, Mn and 137Cs in an estuarine ecosystem using Mytilus galloprovincialis as a bioindicator species: the case of Thermaikos gulf, Greece. J Environ Radioact.86 (1),3144. Chandramouli, P., Topf, M., Menetret, J.F., Eswar, N., Cannone, J.J., Gutell, R.R., Sali, A., Akey, C.W. (2008). Structure of the mammalian 80S ribosome at 8.7 A resolution. Structure 16, 535-548 Chang, T.-W., Chen, C.-C., Chen, K.-Y., Su, J.-H., Chang, J.-H., and Chang, M.-C. (2008). Ribosomal phosphoprotein P0 interacts with GCIP and over expression of P0 is associated with cellular proliferation in breast and liver carcinoma cells. Oncogene 27, 332–338. Chen, M., Li, D., Krebs, E. G. and Cooper, J. A. (1997). The casein kinase II b subunit binds to Mos and inhibits Mos activity. Mol. Cell. Biol. 17, 1904-1912. Cosson, R.P. (2000). Bivalve metallothionein as a biomarker of aquatic ecosystem pollution by trace metals: limits and perspectives. Cell Mol Biol (Noisy-le-grand). 46(2), 295-309. Dailianis, S., Domouhtsidou, G.P., Raftopoulou, E., Kaloyianni, M., and Dimitriadis, V.K. (2003). Evaluation of neutral red retention assay, micronucleus test, acetylcholinesterase activity and a signal transduction molecule (cAMP) in tissues of Mytilus galloprovincialis (L), in pollution monitoring. Mar. Environ. Res. 56, 443-470. Diaconu, M., Kothe, U., Schlunzen, F., Fischer, N., Harms, J.M., Tonevitsky, A.G., Stark, H., Rodnina, M.V. and Wahl, M.C. (2005). Structural basis for the function of the ribosomal L7/12 stalk in factor binding and GTPase activation. Cell, 121, 991–1004

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

12 1 Domouhtsidou, G.P., Dailianis, S., Kaloyianni, M., and Dimitriadis, V.K. (2004). Lysosomal membrane stability and metallothionein content in Mytilus galloprovincialis (L), as biomarkers. Combination with trace metal concentrations. Mar. Pollut. Bull. 48, 572-586. Dunand- Sauthier, I., Walker, c.A., Narasimhan, J., Pearce, A.K., Wek, R.C., Humphrey, T.C., 2005. Stress-activated protein kinase pathway functions to support protein synthesis and translational adaptation in response to environmental stress in fission yeast. Eukaryot. Cell. 4(11):1785-93. Filhol, O., and Cochet, C. (2009) Cellular functions of Protein kinase CK2: A dynamic affair. Cell Mol Life Sci 66,1830-1839. Franzellitti, S., Buratti, S., Donnini, F. and Fabbri, E. (2010) Exposure of mussels to a poluted environment: Insights into the stress syndrome development. Comp. Biochem. Physiol. C Toxicol. Pharmacol., 152, 24-33. Fraser, K. P. P., Clarke, A., and Peck, L.S. (2002). Low-temperature protein metabolism: seasonal changes in protein synthesis and RNA dynamics in the Antarctic limpet Nacella concinna Strebel 1908. J. Exp. Biol. 205, 3077-3086. Freimann, P., and Schmidt, D. (1984). Determination of mercury in seawater by cold vapour atomic absorption spectrophotometry. Anal. Bioanal. Chem., 317, 792. Gagou, M.E., Rodriguez Gabriel, M.A., Ballesta, J.P., and Kouyanou, S. (2000) The ribosomal P-proteins of the medfly Ceratitis capitata form a heterogeneous stalk structure interacting with the endogenous P-proteins, in conditional P0-null strains of the yeast Saccharomyces cerevisiae, Nucleic Acids Res. 28, 736-43. Galaris, D., and Evangelou, A. (2002). The role of oxidative stress in mechanisms of metalinduced carcinogenesis. Crit. Rev. Oncol. Hematol. 42(1),93-103. Geret, F., and Cosson, R.P. (2002). Induction of specific isoforms of metallothionein in mussel tissues after exposure to cadmium or mercury. Arch. Environ. Contam. Toxicol. 42, 36–42. Gomez-Lorenzo, M.G., Spahn, C.M., Agrawal, R.K., Grassucci, R.A., Penczek, P., Chakraburtty, K., Ballesta, J.P., Lavandera, J.L., Garcia-Bustos, J.F., and Frank, J. (2000). Three-dimensional cryo-electron microscopy localization of EF2 in the Saccharomyces cerevisiae 80S ribosome at 17.5 A resolution. EMBO J. 19(11), 2710-8. Gonzalo, P., and Reboud, J. P. (2003). The puzzling lateral flexible stalk of the ribosome, Biol. Cell 95, 179-193. Grela, P., Sawa-Makarska, J., Gordiyenko, Y., Robinson, C. V., Grankowski, N., and Tchorzewski, M. (2008). Structural properties of the human acidic ribosomal P proteins forming the P1-P2 heterocomplex. J. Biochem. 143, 169–177. Guarinos, E., Santos, C., Sanchez, A., Qiu, D.Y., Remacha, M., and Ballesta, J.P. (2003). Tag-mediated fractionation of yeast ribosome populations proves the monomeric organization of the eukaryotic ribosomal stalk structure. Mol. Microbiol. 50, 703–712 11. Gyenis, L., and Litchfield, D.W. (2008). The emerging CK2 interactome: insights into the regulation and functions of CK2. Mol. Cell Biochem. 16(1-2),5-14. Hagiya, A., Naganuma T., Maki Y., Ohta J., Tohkairin Y., Shimizu T., Nomura T., Hachimori A., and Uchiumi T. (2005). A mode of assembly of P0, P1, and P2 proteins at the GTPase-associated center in animal ribosome: in vitro analyses with P0 truncation mutants. J. Biol. Chem. 280, 39193–39199.

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al. 12 2 Hamza-Chaffai, A., Roméo, M., Gnassia-Barelli, M., and El Abed, A. (1998). Effect of copper and lindane on some biomarkers measured in the clam Ruditapes decussatus. Bull Environ. Contam. Toxicol. 61(3), 397-404 Hanks, S.K., and Quinn, A.M. (1991). Protein kinase catalytic domain sequence database: identification of conserved features of primary structure and classification of family members. Methods Enzymol. 200, 38-62. Hasler, P., Brot, N., Weissbach, H., Danho, W., Blount, Y., Zhou, J.L., Elkon, K.B. (1994). The effect of phosphorylation and site-specific mutations in the immunodominant epitope of the human ribosomal P proteins. Clin. Immunol. Immunopathol. 72, 273-9. Holcik, M., and Sonenberg, N.(2005). Translational control in stress and apoptosis. Nat. Rev. Mol. Cell Biol. 6, 318-327. Homma MK, Wada I, Suzuki T, Yamaki J, Krebs EG, Homma Y. (2005). CK2 phosphorylation of eukaryotic translation initiation factor 5 potentiates cell cycle progression. Proc. Natl. Acad. Sci. USA. 102(43):15688-93. Homma, M.K., and Homma, Y. (2008). Cell cycle and activation of CK2. Mol Cell Biochem. 316(1-2):49-55. Honda, K., Smith, M.A., Zhu, X., Baus, D., Merrick, W.C., Tartakoff, A.M., Hattier, T., Harris, P.L., Siedlack, S.L., Fujioka, H., Liu, Q., Moreira, P.L., Miller, F.P., Nunomura, A., Shimohama, S., and Perry, G. (2005). Ribosomal Rna in Alzheimer disease is oxidized by bound redox- active iron. J. Biol. Chem. 280, 20978-20986. Iarmarcovai, G., Bonassi, S., Botta, A., Baan, R.A., and Orsiere, T. (2008). Genetic polymorphisms and micronucleus formation: A review of the literature. Mutat. Res. 658(3), 215-33. Isani, G., Andreani, G., Kindt, M., and Carpené, E. (2000). Metallothioneins (MTs) in marine mollusks. Cell Mol. Biol. 46, 311-330. Ivanković, D., Pavičić, J., Erk, M., Filipović-Marijić, V., and Raspor, B. (2005). Evaluation of the Mytilus galloprovincialis Lam. Digestive gland metallothionein as a biomarker in a long-term field study: Seasonal and spatial variability. Mar. Pollut. Bull. 50, 1303-1313. Jan, T.K., and Young, D.R. (1978). Determination of microgram amounts of some transition metals in seawater by methyl isobutyl ketone-nitric acid successive extraction and flameless atomic absorption spectrophotometry. Anal. Chem. 50, 1250-1253. Kalpaxis, D. L., Amarantos, I., Tsibouxi, A., and Papapetropoulou, M. (2003). Regulation of translation initiation in mussels (Mytilus galloprovincialis, Lam) following contamination stress. J. Toxicol. Environ. Health, Part A, 66, 481-494 Kalpaxis, D. L., Theos, C., Xaplanteri, M. A., Dinos, G. P., Catsiki, A. V., and Leotsinidis, M., (2004). Biomonitoring of Gulf of Patras, N. Peloponnesus, Greece. Application of a biomarker suite including evaluation of translation efficiency in Mytilus galloprovincialis cells, Environ. Res. 94, 211–220. Kiss E. and Shoenfeld Y. (2007). Are Anti-Ribosomal P Protein Antibodies Relevantin Systemic Lupus Erythematosus? Clinical Reviews in Allergy and Immunology, 32(1), 37– 46. Kobe, B., Heierhorst, J. and Kemp, B. E. (1997). Intrasteric regulation of protein kinases. Adv. Second Messenger Phosphoprotein Res. 31, 29-40 Kolaiti, R.M., Lucas, J.M., and Kouyanou-Koutsoukou, S. (2009). Molecular cloning of the ribosomal P-proteins MgP1, MgP2, MgP0 and superoxide dismutase (SOD) in the mussel Mytilus galloprovincialis and analysis of MgP0 at stress conditions. Gene 430, 77-85.

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

12 3 Kolaiti, R.-M., Baier, A., Szyszka, R., Kouyanou-Koutsoukou, S. (2010) Isolation of a CK2α Subunit and the Holoenzyme from the Mussel Mytilus galliprovincialis and Construction of the CK2α and CK2β cDNAs. Mar. Biotechnol.doi:10.1007/s10126-010-9321-z. Kondoh, N., Wakatsuki, T., Ryo, A., Hada, A., Aihara, T., Horiuchi, S., Goseki, N., Matsubara, O., Takenaka, K., Shichita, M., Tanaka, K., Shuda, M., and Yamamoto, M. (1999). Identification and characterization of genes associated with human hepatocellular carcinogenesis. Cancer Res. 59(19):4990-6. Kong, Q., Shan, X., Chang, Y., Tashiro, H., and Lin, C-L. (2008). RNA oxidation: A contributing factor or an epiphenomenon in the process of neurodegeneration. Free Racic. Res. 42, 773-777. Kopp, J., Schwede, T. (2004). The SWISS-MODEL Repository of annotated threedimensional protein structure homology models. Nucleic Acids Res.32, 230-234. Koumarianou, P., Marcos, A.G., Ballesta, J.P., and Kouyanou-Koutsoukou, S. (2007). In vivo analysis of the acidic ribosomal proteins BmP1 and BmP2 of the silkworm Bombyx mori in the yeast Saccharomyces cerevisiae, Gene. 388, 27-33. Kouyanou, S., Santos, C., Koliaraki, V., and Ballesta, J. P.G., (2003). Protein BmP0 from the silkworm Bombyx mori can be assembled and is functional in the Saccharomyces cerevisiae ribosomal stalk in the absence of the acidic P1 and P2 proteins, Gene 314, 173–179. Krokowski, D., Boguszewska, A., Abramczyk, D., Liljas, A., Tchorzewski, M., and Grankowski, N. (2006). Yeast ribosomal P0 protein has two separate binding sites for P1/P2 proteins. Mol. Microbiol. 60, 386–400 Krokowski, D., Tchorzewski, M., Boguszewska, A., McKay, A.R., Maslen, S.L., Robinson, C.V., and Grankowski, N. (2007). Elevated copy number of L-A virus in yeast mutant strains defective in ribosomal stalk. Biochem. Biophys. Res. Commun. 355: 575–580 Kryndushkin, D.S., Smirnov, V.N., Ter-Avanesyan, M.D., and Kushnirov, V.V. (2002). Increased Expression of Hsp40 Chaperones, Transcriptional Factors, and Ribosomal Protein Rpp0 Can Cure Yeast Prions. J. Biol. Chem. 277(26):23702-8. Larade, K., and Storey, K. B., 2002. Reversible suppression of protein synthesis in concert with polysome disaggregation during anoxia exposure in Littorina littorea. Mol. Cell. Biochem., 232, 121-127. Le Bouffant, R., Mulner-Lorillon, O., Morales, J., Cormier, P., and Bell, R., (2008). Chromium(III) triggers the DNA-damaged checkpoint of the cell cycle and induces a functional increase of 4E-BP. Chem. Res. Toxicol. 21, 542-549. Lee, K.M., Yu, C.W., Chan, D.S., Chiu, T.Y., Zhu, G., Sze, K.H., Shaw, P.C., Wong, K.B. (2010). Solution structure of the dimerization domain of ribosomal protein P2 provides insights for the structural organization of eukaryotic stalk. Nucleic Acids Res. Liljas, A. (1991). Comparative biochemistry and biophysics of ribosomal proteins. Int. Rev. Cytol. 124, 103-136 Litchfield, D. W., Lozeman, F. J., Cicirelli, M. F., Harrylock, M., Ericsson, L. H., Piening, C. J. and Krebs, E. G. (1991). Phosphorylation of the b subunit of casein kinase II in human A431 cells: identification of the autophosphorylation site and a site phosphorylated by p34cdc2. J. Biol. Chem. 266, 20380-20389 Litchfield, D. W. (2003). Protein kinase CK2: Structure, regulation and role in cellular decisions of life and death. Biochem. J. 369, 1–15.

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al. 12 4 Majumdar R, Bandyopadhyay A, Deng H, Maitra U. (2002). Phosphorylation of mammalian translation initiation factor 5 (eIF5) in vitro and in vivo. Nucleic Acids Res. 30(5):115462. Martel, V., Filhol, O., Nueda, A., Gerber, D., Benitez, M. J. and Cochet, C. (2001). Visualization and molecular analysis of nuclear import of protein kinase CK2 subunits in living cells. Mol. Cell. Biochem. 227, 81-90. Martinez-Azorin, F., Remacha, M., Ballesta, J.P. (2008). Functional characterization of ribosomal P1/P2 proteins in human cells. Biochem J.413, 527-34. Martinkova, M., Igarashi, J., and Shimizu, T. (2007). Eukaryotic initiation factor 2alpha kinase is a nitric oxide-responsive mercury sensor enzyme: potent inhibition of catalysis by the mercury cation and reversal by nitric oxide. FEBS Lett. 581(21),4109-14. Meggio, F., Boldyreff, B., Marin, O., Issinger, O.-G. and Pinna, L. A. (1995). Phosphorylation and activation of protein kinase CK2 by p34cdc2 are independent events. Eur. J. Biochem. 230, 1025-1031. Meggio, F. and Pinna, L. A. (2003). One-thousand-and-one substrates of protein kinase CK2? FASEB J. 17, 349–368. Mirzaei, H., and Regnier, F. (2007). Identification of yeast oxidized proteins: chromatographic top-down approach for identification of carbonylated, fragmented and cross-linked proteins in yeast. J. Chromatogr. A. 1141, 22-31. Möller, W., and Maassen, J.A. On the structure, function and dynamics of L7/12 from Escherichia coli ribosomes. In Structure, Function and Genetics of Ribosomes. Hardesty, B, and Kramer, G. (eds). New York: Springer-Verlag.; 1986; 309–325. Moore, M.N. (1976). Cytochemical demonstration of latency of lysosomal hydrolases in digestive cells of the common mussel, Mytilus edulis, and changes induced by thermal stress. Cell Tissue Res. 175, 279-287. Morgan, I. J., D` Cruz, L. M., Dockray, J. J., Linton, T. K., and Wood, C. M. (1999). The effects of elevated summer temperature and sublethal pollutants (ammonia, low pH) on protein turnover in the gill and liver of rainbow trout (Oncorhynchus mykiss) on a limited food ration. Comp. Biochem. Physiol. A 123, 43-53. Mroczek, S., and Kufel, J. (2008). Apoptotic signals induce specific degradation of ribosomal RNA in yeast. Nucleic Acids Res. 36(9), 2874-88. Naganuma, T., Nomura, N., Yao, M., Mochizuki, M., Uchiumi, T., Tanaka, I. (2010). Structural basis for translation factor recruitment to the eukaryotic/archaeal ribosomes. J. Biol. Chem. 285, 4747-4756 Najimi, S., Bouhaimi, A., Daubèze, M., Zekhnini, A., Pellerin, J., Narbonne, J.F., and Moukrim, A. (1997). Use of acetylcholinesterase in Perna perna and Mytilus galloprovincialis as a biomarker of pollution in Agadir Marine Bay (South of Morocco). Bull Environ. Contam. Toxicol. 58(6), 901-8. Olarewaju, O., Ortiz, P.A., Chowdhury, W.Q., Chatterjee, I., and Kinzy, T.G. (2004). The translation elongation factor eEFTB plays a role in the oxidative stress response pathway. RNA Biol. 1, 89-94. Pérez-Fernández , J., Remacha, M. and Ballesta, J.P.G. (2005). The acidic protein binding site is partially hidden in the free Saccharomyces cerevisiae ribosomal stalk protein P0. Biochemistry, 44, 5532–5540. Pytharopoulou, S., Kouvela, E.C., Sazakli, E., Leotsinidis, M., and Kalpaxis, D.L. (2006). Evaluation of the global protein synthesis in Mytilus galloprovincialis in marine pollution

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

12 5 monitoring. Seasonal variability and correlations with other biomarkers. Aquat. Toxicol. 80, 33-41. Pytharopoulou, S., Sazakli, E., Grintzalis, K., Georgiou, C.D., Leotsinidis, M., and Kalpaxis, D.L. (2008). Translational responses of Mytilus galloprovincialis to environmental pollution: integrating the responses to oxidative stress and other biomarker responses into a general stress index. Aquat. Toxicol. 89, 18-27. Raaf, J., Brunstein, E., Issinger, O.-G. and Niefind, K. (2008). The interaction of CK2a and CK2b, the subunits of protein kinase CK2, requires CK2b in a pre-formed conformation and is enthalpically driven. Protein Sci. 17, 2180–2186. Reddy, P.S., Tuberty, S.R., and Fingerman, M. (1997). Effects of cadmium and mercury on ovarian maturation in the red swamp crayfish, Procambarus clarkii. Ecotoxicol. Environ. Saf. 37(1),62-5. Riera, M., Peracchia, G., de Nadal, E., Ariño J., and Pages, M. (2001). Maize protein kinase CK2: regulation and functionality of three beta regulatory subunits. Plant J. 25, 365-374. Regoli, F. (1992). Lysosomal responses as sensitive stress index in biomonitoring heavy metal pollution. Mar. Ecol. Prog. Ser. 84, 63-69. Remacha, M., Jimenez-Diaz, A., Bermejo, B., Rodriguez-Gabriel, M. A., Guarinos, E., and Ballesta, J. P. (1995). Mol. Cell. Biol. 15, 4754–4762. Santos, C. and Ballesta, J.P.G. (1995). The highly conserved protein P0 carboxyl end is essential for ribosome activity only in the absence of proteins P1 and P2. J. Biol. Chem., 270, 20608–20614. Santos, C. and Ballesta, J.P.G. (2005). Characterization of the 26S rRNA-binding domain in Saccharomyces cerevisiae ribosomal stalk phosphoprotein P0. Mol. Microbiol., 58, 217– 226. Sarno S., Marin, O., Boschetti, M., Pagano, M.A., Meggio, F., and Pinna, L.A. (1999). Cooperative modulation of protein kinase CK2 by separate domains of its regulatory beta-subunit. Biochemistry 39, 2324- 2329. Scarpato, R., Migliore, L., Alfinito- Cognetti, G., and Barale, R. (1990). Induction of micronuclei in gill tissue of Mytilus galloprovincialis exposed to polluted marine waters. Mar. Pollut Bull. 21, 74-80. Schmeing, T.M., Huang, K.S., Kitchen, D.E., Strobel, S.A., Steitz, T.A. (2005). Structural insights into the roles of water and the 2' hydroxyl of the P site tRNA in the peptidyl transferase reaction. Mol. Cell 20, 437-448 Sheikh, M. S., and Fornace, Jr, A.J. (1999). Regulation of translation initiation following stress Oncogene 18, 6121-6128. Shin, D.S., Didonato, M., Barondeau, D.P., Hura, G.L., Hitomi, C., Berglund, J.A., Getzoff, E.D., Cary, S.C., and Tainer, J.A. (2009). Superoxide dismutase from the eukaryotic thermophile Alvinella pompejana: structures, stability, mechanism, and insights into amyotrophic lateral sclerosis. J. Mol. Biol. 385, 1534-1555 Soderling, T. R. (1990). Protein kinases. Regulation by auto inhibitory domains. J. Biol. Chem. 265, 1823-1826. Söding, J. (2005). Protein homology detection by HMM-HMM comparison. Bioinformatics 21, 951-960. Söding, J., Biegert, A., and Lupas, A.N. (2005). The HHpred interactive server for protein homology detection and structure prediction. Nucleic Acids Research 33, W244--W248 (Web Server issue). doi:10.1093/nar/gki40.

S. Kouyanou-Koutsoukou, D. L. Kalpaxis, S. Pytharopoulou et al. 12 6 Sonenberg, N, and Hinnebusch, A. G. (2007). New modes of translational control in development, behavior, and diseases. Mol. Cell 28, 721-729. Stien, X., Percic, P., Gnassia-Barelli, M., Roméo, M., and Lafaurie, M. (1998). Evaluation of biomarkers in caged fishes and mussels to assess the quality of waters in a bay of the NW Mediterranean Sea. Environ. Pollut. 99, 339-345. Stohs, S. J., and Bagchi, D. (1995). Oxidative mechanisms in the toxicity of metal ions. Free Radic. Biol. Med. 18, 321-336. Storey, K.B., and Storey, J.M. (2004). Metabolic rate depression in animals: transcriptional and translational controls. Biol. Rev. Camb. Philos. Soc. 79, 207-233. Strange, R.W., Antonyuk, S.V., Hough, M.A., Doucette, P.A., Valentine, J.S., and Hasnain, S.S. (2006). Variable metallation of human superoxide dismutase: atomic resolution crystal structures of Cu-Zn, Zn-Zn and as-isolated wild-type enzymes. J. Mol. Biol. 356, 1152 Szyszka, R. (1999).Protein kinases phosphorylating acidic ribosomal proteins from yeast cells. Folia Microbiol (Praha). 44(2),142-52. Tchorzewski, M., Boldyreff, B., Issinger, O., and Grankowski, N. (2000). Analysis of the protein-protein interactions between the human acidic ribosomal P-proteins: evaluation by the two hybrid system. Int. J. Biochem. Cell Biol. 32, 737–746 13. Teh, A.H., Kanamasa, S., Kajiwara, S., and Kumasaka, T. (2008). Structure of Cu/Zn superoxide dismutase from the heavy-metal-tolerant yeast Cryptococcus liquefaciens strain N6. Biochem. Biophys. Res. Commun. 374, 475-478 Tsangaris C, Papathanasiou E, Cotou E. (2007). Assessment of the impact of heavy metal pollution from a ferro-nickel smelting plant using biomarkers. Ecotoxicol. Environ. Saf. 66(2), 232-43. Valavanidis, A., Vlahogiani, T., Dassenakis, M., and Scoullos, M. (2006). Molecular biomarkers of oxidative stress in aquatic organisms in relation to toxic environmental pollutants. Ecotoxicol. Environ. Saf. 64, 178-189. Vard, C., Guillot, D., Bargis, P., Lavergne, J.P., and Reboud, J.P. (1997). A specific role for the phosphorylation of mammalian acidic ribosomal protein P2. J. Biol. Chem. 1997 Aug 8;272(32), 20259-62. Viarengo, A., Ponzano, E., Dondero, F., Fabbri, R. (1997). A simple spectrophotometric method for metallothionein evaluation in marine organisms: an application to Mediterranean and Antarctic molluscs. Mar. Environ. Res. 44, 69-84. Viarengo A, Burlando B, Cavaletto M, Marchi B, Ponzano E, Blasco J. (1999). Role of metallothionein against oxidative stress in the mussel Mytilus galloprovincialis. Am. J. Physiol. 277, 1612-9. Vidal-Liñán, L., Bellas, J., Campillo, J.A., and Beiras, R. (2010). Integrated use of antioxidant enzymes in mussels, Mytilus galloprovincialis, for monitoring pollution in highly productive coastal areas of Galicia (NW Spain). Chemosphere. 78(3), 265-72. Vilella, M.D., Remacha, M., Ortiz, B.L., Mendez, E., and Ballesta, J.P.G. (1991). Characterization of the yeast acidic ribosomal phosphoproteins using monoclonal antibodies. Proteins L44/L45 and L44′ have different functional roles. Eur. J. Biochem. 196, 407–414 White-Gilbertson, S., Kurtz, D. T., and Voelkel-Johnson, C. (2009). The role of protein synthesis on cell cycling and cancer. Mol. Oncol. 28, 1132-1141.

Translational Control of Gene Expression in the Mussel Mytilus Galloprovincials

12 7 Winterbourn, C.C., and Hampton, M.B. (2008). Thiol chemistry and specificity in redox signaling. Free Radic. Biol. Med. 45, 549-61. Wool, I.G., Glück, A., and Endo, Y. (1992). Ribotoxin recognition of ribosomal RNA and a proposal for the mechanism of translocation. Trends Biochem. Sci.17, 266-9. Wu, S., and Storey, K.B. (2005). Up-regulation of acidic ribosomal phosphoprotein P0 in response to freezing or anoxia in the freeze tolerant wood frog, Rana sylvatica. Cryobiology 50, 71–82. Xu, X., Rich, Jr, E.S. and Seldin, D.C. (1998). Murine protein kinase CK2a: cDNA and genomic cloning and chromosomal mapping. Genomics 48, 79-86. Zambrano, R., Briones, E., Remacha, M., and Ballesta, J. P. G. (1997) Phosphorylation of the acidic ribosomal P proteins in Saccharomyces cerevisiae: a reappraisal. Biochemistry 36, 14439–14446. Zieliński, R., Pilecki, M., Kubiński, K., Zień, P., Hellman, U., and Szyszka R., (2002). Inhibition of yeast ribosomal stalk phosphorylation by Cu-Zn superoxide dismutase. Biochem. Biophys. Res. Commun, 296, 1310-6. Zinker, S., and Warner, J.R. (1976). The ribosomal proteins of Saccharomyces cerevisiae: phosphorylated and exchangeable proteins, J. Biol. Chem. 251, 1799–1807.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN: 978-1-61761-763-8 Editors: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 5

MAP KINASE SIGNALING PATHWAY: A POTENTIAL BIOMARKER OF ENVIRONMENTAL POLLUTION IN THE MUSSEL MYTILUS GALLOPROVINCIALIS A. Châtel1,2 and B. Hamer3 1

EA 4326, Facteurs nerveux et structuration tissulaire, Institut de Synergie des Sciences et de la Santé, Brest cedex, France 2 Institut für Physiologische Chemie und Pathobiochemie, Johannes Gutenberg Universität, Mainz, Germany 3 Ruđer Bošković Institute, Center for Marine Research, Rovinj, Croatia

ABSTRACT In the present study, the effects of environmental pollutants have been investigated in the Mediterranean mussel Mytilus galloprovincialis as sentinel species. For the purpose of detecting water contamination in the early stages, biomarkers of effect and exposure must be studied. Most specifically, proteins of intracellular signaling pathways appear to be very interesting targets as their conservation through evolution is maintained and since their modulation via environmental relevant levels of chemical contaminants is an indicating sign of stress for bivalves. Genes encoding the Mitogen-Activated Protein Kinases (MAPKs) in M. galloprovicialis confirmed high homology with those of other vertebrates and invertebrates. Further, mussels were exposed to various model agents: tributyltin, hydrogen peroxide and water soluble fraction of diesel fuel and the activation/phosphorylation of the MAPKs p38, JNK and ERK were evaluated by a new developed ELISA assay. Our results clearly indicated that pollutants generated different MAPK phosphorylation induction patterns. All the results converge towards the fact that proteins of intracellular signaling pathway could be very promising biomarkers of marine pollution within the mussel M. galloprovincialis.

Keywords: Pollution, biomarker, MAP kinases, mussel, Mytilus galloprovincialis, tributyltin, diesel oil, hydrogen peroxide

130

A. Châtel and B. Hamer

1. INTRODUCTION Environmental pollution characterizes the main issue in contemporary society which main cause rests upon anthropogenic activities. Biomonitoring of coastal environment represents new challenging ideas from governments. In this context, one ―lookout species‖, the mussel Mytilus galloprovincialis, has been widely used in biomonitoring programs (Phillips, 1976; 1977; Phillips et al., 1980; 1986 ; 1994 ; Philips and Segar, 1986; Cossa, 1989; Regoli and Orlando, 1993; Ka Imoussi et al., 2001; Kljakovic Gaspic et al., 2002), as «Mussel Watch» first described by Goldberg (1975), in European MEDPOL (Gabrieldes, 1997), BIOMAR (Narbonne et al., 1999), and more recently for example Croatian national projects « Programmed biosynthesis and genotoxic risk assessment » (2006), « Ecotoxic effects of pollution on marine organisms » (2007-2008), «Biomineralisation processes in marine organisms» (2007), « Impact of pollution on programmed biosynthesis in marine invertebrates» (2008). Those invertebrates possess many advantages (Viarengo et al., 1991): their wide distribution in all world seas (Whitfield, 2001), a numerous presence along coasts and mariculture. Finally, these organisms can highly tolerate important level of pollution (as they are sessile filters feeders) and bioaccumulate large amount of xenobiotics. Pre-eminently, biomarkers of exposure and effect have been developed to find out relevant indicators of contamination. Moreover, laboratory studies have proved the interest of using proteins of the cell signaling pathway, including the whole mechanisms from the extracellular stimuli transduction to downstream cellular activities (Burlando et al., 2006). To do so, different biochemical processes were analyzed, as an example, the heat shock protein induction, the metallothionein synthesis and extensively DNA integrity (Pavicic et al., 1987; Bierkens et al., 1998; Viarengo et al., 1999; Schröder et al., 2000; Bihari et al., 2002; Jaksic and Batel, 2003 ; Hamer et al., 2004; 2009). Nonetheless, the main difficulty of using a biomarker is to correlate cause and effect connectedness; all the more, well-knowing that animals exposed to chemical pollution will be more sensitive to bacterial contamination, among others. Recent studies suggested a positive connection between pollutant bioaccumulation and mussel survival reduction in air (Hellou and Law, 2003; Bihari et al., 2007). Indeed, in situ, organisms are submitted to fluctuations of temperature, osmolarity and various pollutants, which concentration may change according to time and which combination can act or not in synergy in these organisms. Hence, it is necessary to take environmental factors in consideration and reproduce them in controlled conditions - laboratory studies to relate biological events to exposure ones (McCarthy and Shugart, 1990). Biomarkers used in biomonitoring programmes must be able to distinguish the impact of environmental factors and those originate from anthropogenic contaminants in marine organisms (Hylland, 2006).

MAP Kinase Signaling Pathway: …

131

2. INTEREST OF MAP KINASE SIGNALING PATHWAY AS BIOMARKER OF POLLUTION MAP kinases, some Ser/Thr-kinases, are highly conserved proteins through evolution (Böhm et al., 2002; Müller et al., 2002; Kyriakis and Avruch, 2001; Roux and Blenis, 2004) and are implicated in various physiological responses (Kyriakis and Avruch, 2001). Three MAPKs subfamilies have been identified in mammals: the extracellular regulated protein kinase (ERK), the c-Jun NH2-terminal kinases (JNK) and the p38-MAPK. Although ERKs are mainly involved in mediating anabolic processes such as cell division, growth and differentiation, JNKs and p38-MAPKs are generally associated with cellular response to diverse stresses and can be involved in either anti- or pro-apoptotic mechanisms, depending on their isoform and/or cell type (Roux and Blenis, 2004; Wada and Penninger, 2004). Despite the fact that mussels are of great interest for water quality assessment and that Invertebrates represent 95 % of animal kingdom species, only few sequences encoding proteins of the cell signaling pathways are known in mussels (Gueguen et al., 2003; Shida et al., 2003; Venier et al., 2003; Kim et Ausubel, 2005). Nevertheless, cell signaling proteins have been studied in molluscs only using antibodies and pharmacological inhibitors directed against mammalian proteins, confirming the high level of conservation of these molecules (Böhm et al., 2002; Müller et al., 2002; Graves et Krebs, 1999; Widman et al., 1999; Kyriakis et Avruch, 2001; Roux et Blenis, 2004). Recently, MAPKs functions have been scrutinized in different anatomical parts of M. galloprovincialis, especially in hemocytes and digestive gland (Canesi et al., 2001; 2002 a, b, c). Furthermore, p38 activation has been measured in mussels after exposure to bacterial infections (Canesi et al., 2001; 2002a; 2002b; 2002c; 2005), hypoxia, hyposmotic and hyperosmotic stress (Gaitanaki et al., 2003), growth factors (Canesi et al., 2001), heavy metals (Cu, Zn, Cd) (Burlando et al., 2006; Kefaloyianni et al., 2005) and to temperature variations (Kefaloyianni et al., 2005). Several environmental contaminants, called ―Endocrine Disrupting Chemicals‖ (EDC) (Witorsch, 2002) affect hemocytes function via signaling pathway modulation. So, polychlored bisphenyl (PCB) (Canesi et al., 2003), diethylstilbestrol (Canesi et al., 2004a; 2004b), bisphenol A (BPA) and nonylphenol induced MAPKs phosphorylation. In addition, a correlation has been corroborated between Hsp70/90 expression and MAPKs activation in bivalvia (Fabbri et al., 2008) as attested by Malagoli et al. (2004) who showed an activation of both proteins post mussel exposure to electromagnetic field. The objectives were first, to characterize genes encoding MAP kinases enzymes in the mussel M. galloprovincialis and then to analyze their differential activation after exposure to model environmental polutants. Ultimately, kinase phosphorylation rates were evaluated in mussels collected at sites along the eastern Adriatic coast, as a field study.

132

A. Châtel and B. Hamer

3. CHARACTERIZATION OF GENES ENCODING MAP KINASES IN THE MUSSEL M. GALLOPROVINCIALIS 3.1. JNK JNK partial 460 bp cDNA sequence (accession number GQ454914) was obtained from a M. galloprovincialis gill cDNA library using degenerated primers targeting on conserved domain. Amino acids sequence displayed below shows similarities with the bivalvia Aplysia californica_JNK (AAP42290.1) (86 %), with the sponge Suberites domuncula_JNK (Q966Y3.1) (73 %) and with vertebrates such as homo sapiens_MAPK8 (BAG70168.1) (82%) and Mus musculus_MAPK8 (EDL24856.1) (82 %). Partial sequence contains phosphorylation sites with TXY pattern (fig. 1).

Figure 1. Alignment of M. galloprovincialis JNK (Mytgal) protein sequence with its homologuous: Aplysia californica_JNK (Aplysia, AAP42290.1), Suberites domuncula_JNK (SUBDO, Q966Y3.1), homo sapiens_MAPK8 (Homo, BAG70168.1) and Mus musculus_MAPK8 (Mus, EDL24856.1). Identical amino acids (black), Phosphorylation sites (TXY) (box) and Protein kinase domain (underline).

3.2. ERK ERK partial cDNA sequence (accession number GQ454915) was also acquired employing degenerated primers. This 249 bp sequence depicted a 246 nt encoding region. As represented in figure 2, sequence revealed high similarity with ERK of H. sapiens and M. musculus. Both JNK and ERK genes of mussel M. galloprovincialis revealed high sequence homology with those of mammalian, and in both cases, the protein kinase domain was also conserved. This region is located upstream the TXY phosphorylated pattern which is important for MAP kinases phosphorylation/activation.

MAP Kinase Signaling Pathway: …

133

Figure 2. Alignment of ERK M. galloprovincialis (Mytgal) protein sequence with its homologuous: Hydra magnipapillata_ERK (Hydra, XP002159454) (74 %), Suberites domuncula_MAPK kinase protein (SUBDO, CAC80141) (53 %), Homo sapiens_MAPK7 variant transcript 5 (Homo, BAD92848) (73 %) and Mus musculus_MAPK7 (Mus, CAI24183) (73%). Identical amino acids (black), Phosphorylation sites (TXY) (box) and Protein kinase domain (underline).

Those data were abided by Müller et al. (2002) who affirmed that genes encoding MAP kinases enzymes were highly maintained throughout evolution and suggested that p38 and JNK could originate from a common ancestor gene.

4. EFFECT OF CHEMICALS ON MAP KINASES ACTIVATION An ELISA assay was newly developed for measurement of MAP kinases phosphorylation in the mussel M. galloprovincialis using commercial antibodies directed against phosphorylated and total forms of p38, JNK and ERK (Müller et al., 2009). As previously published (Châtel et al., 2010), mussels were collected in a mariculture facility in Croatia and pollutant used for laboratory experiments were chosen considering actual pollution treat (TBT, disel oil) in the Adriatic sea and model ROS generating agent (H2O2). Recent studies have shown the level of local contamination (harbours, marinas) by tributyltin (Gambaro et al., 2007), an organometallic compound used in antifouling paints (Strandenes, 2000; Diez et al., 2005; 2006; Song et al., 2005) and polycyclic aromatic hydrocarbons (PAHs) (Milivojevic et al., 2008), which is principally generated from fuel transport and oil spills (Erika, 1999; Prestige, 2002). Hence, mussels were exposed for 1 hour to those pollutants and then they were kept in sea water for recovery period (6, 24h).

4.1. Effect of H2O2 Exposure As a control, mussels were first exposed to H2O2 which is known to activate MAP kinases in mammalian (Zrouri et al., 2004). Results clearly indicate a p38 response after 1h exposure to 0.074 and 0.222 mM H2O2 concentrations (fig.3). Moreover, phosphorylated ERK levels were increased whatever concentration and time used. For both proteins, a same activation pattern was observed: activation after 1h exposure, then decline after 6h recovery

134

A. Châtel and B. Hamer

in sea water, next re-activation after 24h. Those results were in accordance with the work of Gaitanaki et al., (2003) and Carter et al., (2002), who carried out experiments on amphibian and M. galloprovincialis mantle cells. Withal, H2O2 did not significantly affect JNK activation in mussel. This data could be explained by the hypothesis of Masuda et al., (2003) that ERK activation could induce MAP kinase phosphatase 7 (MKP-7) phosphorylation, a JNK inhibitor. Hsp70 overexpression could also inhibit JNK via its direct binding to the kinase, as reported by Park and Liu (2001).

Figure 3. Effect of various hydrogen peroxide concentrations on MAPK activation in the mussel gills. Protein extracts from controls and H2O2-treated mussels were subjected to ELISA analysis using antibodies directed against the phosphorylated and the total forms of p38 (A), JNK (B) and ERK (C) MAPKs. Results are given as the percentage of phosphorylated MAPK compared to total form of the enzyme. (*) and (#), data significantly different compared to control.

MAP Kinase Signaling Pathway: …

135

4.2. Effect of Tributyltin Exposure Pertaining to TBT, doses of 11, 33 and 100 g/L enhanced p38 and JNK activation, with a maximum reached at 6h post recovery in running sea water (fig.4). Yet, these activations were not dose-dependent, as Aluoch et al. (2006) reported for human NK cells. Regarding Gaitanaki et al., (2004), these authors hypothesised that p38 substrates could be located in the cytoplasm cells rather than the nucleus of M. galloprovincialis mantle. Hence, MAP kinases could be re-activated by their substrate, explaining a high MAP kinases activity even though mussels during recovery period. Relating to ERK, no activation was detected with this substance and even a slight phosphorylation level slackening could additionally be noticed. This was as well observed for Ascidiae embrios exposed to TBT concentrations ranging from 0.1 to 0.5 M (Damiani et al., 2009).

Figure 4. Effect of various TBT concentrations on MAPK activation in mussel gills. Protein extracts from controls and TBT-treated mussels were subjected to ELISA analysis using antibodies directed against the phosphorylated and the total forms of p38 (A), JNK (B) and ERK (C) MAPKs. Results are given as the percentage of phosphorylated MAPK compared to total form of the enzyme. (*) and (+), data significantly different compared to control.

136

A. Châtel and B. Hamer

4.3. Effect of Polycyclic Aromatic Hydrocarbons (PAHs) Exposure by Diesel Oil Mussels in contact with PAHs elicited the activation/phosphorylation of both p38 and JNK. In addition, it could be noticed a p38 phosphorylation following 1h exposure to the compounds, in a dose-dependent manner (fig.5). However, PAHs toxicity varies according to their conformation. In human liver cells, benzo()(a)pyrene induced both p38 and ERK1/2 activation (Chen et al., 2003), while in mice, only JNK activation was perceived (Lei et al., 1998). Moreover, anthracene isomers have been shown to have an opposite effect on ERK1/2‘s response following their structure (Rummel et al., 1999). In hepatoma cells, PAHs products provoked p53 nucleus accumulation, caspase 3 activation and p38 and JNK phosphorylation (Landvik et al., 2007). Moreover, Chen et al. (2003) made the hypothesis that p38 would be implicated in apoptosis induced by benzo(a)pyrene seeing as a p38 inhibitor prevents caspase activation.

Figure 5. Effect of various concentrations of diesel oil (DO) water soluble fraction on MAPK activation within mussel gills. Protein extracts from controls and WSF-treated mussels were subjected to ELISA analysis using antibodies directed against the phosphorylated and the total forms of p38 (A), JNK (B) and ERK (C) MAPKs. Results are given as the percentage of phosphorylated MAPK compared to total form of the enzyme. (*) and (+), data significantly different compared to control.

MAP Kinase Signaling Pathway: …

137

5. EFFECTS OF ENVIRONMENTAL FACTORS ON MAP KINASE ACTIVATION In vivo laboratory experiments enabled to detect the effects of one or several pollutants‘ combination on animals but such studies had to be reinforced by in situ experiments to evaluate the environmental factors consequences on biological responses (Colosio et al., 2005; Galloway and Depledge, 2001). For that reason, since 1999, the WGBEC (Working Group on Biological Effects of Contaminants) had advised scientists to take into account temperature and salinity stress during biomarkers data interpretation. In this context, so as to evaluate the effects of environmental factors and pollution on MAP kinases activation, mussels were collected at 19 stations along the Adriatic coast (Croatia), during winter and summer period (Châtel et al., 2010) (fig.6).

Figure 6. Map with investigated sites of the eastern coastal area of Adriatic Sea.

138

A. Châtel and B. Hamer

Though salinity stays relatively constant in the open Adriatic sea (36.9 psu), but especially in intertidal and estuaries zones, and rainy periods can fluctuate (Hamer et al. 2010). Concerning water temperature, ranging from 10°C in winter to 27°C in summer, could be measured. Such differences, translated by stress sources, could impact response and biodiversity on cell, organism, and population levels (Nevo, 2001; Parsons, 2005). Temperature involvement is probable since results showed a higher p38 and JNK MAP kinases‘ activation in summer than in winter (fig.7, 8). Besides, thermal stress during sample collection, could also explain this fact. Anestis et al. (2007) assumed that MAP kinases‘ signaling pathway could be implicated in Hsp expression/regulation in M. edulis, as it has already been featured for mammalian models (Sheikh-Hamad et al., 1998; Rafiee et al., 2003).

Figure 7. Effect of sampling site factors during the winter season on MAPK phosphorylation in mussel gills. Protein extracts from controls and TBT-treated mussels were subjected to ELISA analysis using antibodies anti-p38 (A), JNK (B) and ERK (C).

Figure 8. Effect of sampling site factors during the summer season on MAPK phosphorylation in mussel gills. Protein extracts from controls and TBT-treated mussels were subjected to ELISA analysis using antibodies anti-p38 (A), JNK (B) and ERK (C).

Differential MAP kinases activation observed in the South part of the Adriatic sea, contingent on seasons, cannot only be explained by pollution which is limited in this region. Temperature and salinity variations probably represent a main part of this explanation. Additionally, p38 activation in response to hyposmotic stress has been extensively described in litterature (Hamer et al. 2009) and studied in yeast (Zhang et al., 2002), plants (Munnik and Meijer, 2001), fish (Fiol and Kultz, 2007) and mammalian (Chen and Gardner, 2002; Dahl et al., 2001; Xu et al., 2001).

MAP Kinase Signaling Pathway: …

139

In mussels collected in the North region, contamination sources were substantial and MAP kinases phosphorylated levels were consequently higher than in the South area and more elevated in summer than in winter. This outcome suggested that some chemicals like TBT and PAHs could really influence the cell signaling pathway studied.

CONCLUSION – LIMITS - PERSPECTIVES Human activities damage the environment via accidents and in a chronical way (Devauchelle, 2002). Ecotoxicology studies including biomonitoring programmes analyze pollutant effects on ecosystem at different levels: molecular, cellular, individual and population. In that context, indicators of water quality are various, ranging from structure to populations, ‘dynamic to molecular markers‘. One particularity of this study rested on the sampling place: the Adriatic Sea. It stands for an interesting environment, semi-closed, that authorities are currently trying to protect (source of cold water for Mediterranean bassin). Since several programmes are taking place to analyze and control pollution rate, animals which lives in this area represent experimental models of interest for the evaluation of biomarker relevancy and the correlation of fields data to laboratory ones. Second, the experimental conditions of an ELISA assay were defined to measure MAP kinase activation rate in the mussel M. galloprovincialis. This test has also been tested in the sponge S. domuncula and could be applied for all other marine bivalves‘ species. The only weakness was that only commercialized antibodies directed against mammalian MAP kinases were used for this technique. To our knowledge, no commercialized antibodies pointing marine invertebrate proteins do exist. It would be interesting to produce monoclonal antibodies targeting invertebrate MAP kinase proteins, to increase their binding specificity accordingly. With reference to results obtained in this study, p38 appears to be a promising biomarker of environmental pollution since this protein is activated in all conditions tested (Kefaloyianni et al., 2005 ; Burlando et al., 2006 ; Damiani et al., 2009 ; Fabbri et al., 2008). Also, p38 is not specific to a pollutant and is activated alike with environmental factors such as temperature and salinity. However, its activation could inquire about presence of environmental stresses or pollution by TBT and PAHs (diesel oil) at investigated sites. From in situ studies, it turned out to be necessary i) to evaluate, in controlled conditions, the impact of xenobiotics, alone or in association, on organism ; ii) to test time exposure, temperature, osmolarity to aim at recreating fields conditions. As a final conclusion, all the scientific and technical approaches introduced throughout this investigation only sign one tremendous begin and long road study for a very promising biological detection system for pollution expected for future. As seen during all the foregoing explanations, laboratory studies can not handle the full equation for biological organism forasmuch as many parameters such as stress differential, time exposure, and environmental factors inhere in living beings can not simply be all considered, making results interpretation from field studies much more complex than those obtained in controlled conditions.

140

A. Châtel and B. Hamer

REFERENCES Aluoch, A.O., Odman-Ghazi, S.O. and Whalen, M.M., 2006. Alteration of an essential NK cell signaling pathway by low doses of tributyltin in human natural killer cells. Toxicology 224(3): 229-37. Anestis, A., Lazou, A., Portner, H.O. and Michaelidis, B., 2007. Behavioral, metabolic, and molecular stress responses of marine bivalve Mytilus galloprovincialis during long-term acclimation at increasing ambient temperature. Am. J. Physiol. Regul. Integr. Comp. Physiol. 293, 911-921. Bierkens, J., de Perre, W.V. and Maes, J., 1998. Effect of different environmental variables on the synthesis of HSP70 in Raphidocelis subcapitata .Comp. Biochem. Physiol. C 120, 29-34. Bihari, N., Hamer, B., Jaksic, Z., Fafandel, M., Micic, M. and Batel, R., 2002. Application of alkaline elution, Fast Micromethod and flow cytometry in detection of marine contamination. Cell. Mol. Biol. (Noisy-le-grand). 48, 373-377. Bihari, N., Fafandel, M. and Piskur, V., 2007. Polycyclic aromatic hydrocarbons and ecotoxicological characterization of seawater, sediment, and mussel Mytilus galloprovincialis from the Gulf of Rijeka, the Adriatic Sea, Croatia. Arch. Environ. Contam. Toxicol. 52(3): 379-87. Böhm, M., Gamulin, V., Schröder, H.C. and Müller, W.E., 2002. Evolution of osmosensing signal transduction in Metazoa: stress-activated protein kinases p38 and JNK. Cell Tissue Res. 308, 431-438. Burlando, B., Berti, E. and Viarengo, A., 2006. Effects of seawater pollutants on protein tyrosine phosphorylation in mussel tissues. Aquat. Toxicol. 78, 79-85. Canesi, L., Betti, M., Ciacci, C. and Gallo, G., 2001. Insulin-like effect of zinc in mytilus digestive gland cells: modulation of tyrosine kinase-mediated cell signaling. Gen. Comp. Endocrinol. 122, 60-66. Canesi, L., Gallo, G., Gavioli, M. and Pruzzo, C., 2002a. Bacteria-hemocyte interactions and phagocytosis in marine bivalves. Microsc. Res. Tech. 57, 469-476. Canesi, L., Scarpato, A., Betti, M., Ciacci, C., Pruzzo, C. and Gallo, G., 2002b. Bacterial killing by Mytilus hemocyte monolayers as a model for investigating the signaling pathways involved in mussel immune defence. Mar. Environ. Res. 54, 547-551. Canesi, L., Scarpato, A., Betti, M., Ciacci, C., Pruzzo, C. and Gallo, G., 2002c. Bacterial killing by Mytilus hemocyte monolayers as a model for investigating the signaling pathways involved in mussel immune defence. Mar. Environ. Res. 54(3-5): 547-51. Canesi, L., Ciacci, C., Betti, M., Scarpato, A., Citterio, B., Pruzzo, C. and Gallo, G., 2003. Effects of PCB congeners on the immune function of Mytilus hemocytes: alterations of tyrosine kinase-mediated cell signaling. Aquat. Toxicol. 63, 293-306. Canesi, L., Ciacci, C., Betti, M., Lorusso, L.C., Marchi, B., Burattini, S., Falcieri, E., Gallo, G., 2004a. Rapid effects of 17beta-estradiol on cell signaling and function of Mytilus hemocytes. Gen. Comp. Endocrinol. 136, 58-71. Canesi, L., Lorusso, L.C., Ciacci, C., Betti, M., Zampini, M., Gallo, G., 2004b. Environmental estrogens can affect the function of mussel hemocytes through rapid modulation of kinase pathways. Gen. Comp. Endocrinol. 138, 58-69.

MAP Kinase Signaling Pathway: …

141

Canesi, L., Betti, M., Ciacci, C., Lorusso, L.C., Gallo, G. and Pruzzo, C., 2005. Interactions between Mytilus haemocytes and different strains of Escherichia coli and Vibrio cholerae O1 El Tor: role of kinase-mediated signalling. Cell. Microbiol. 7, 667-674. Carter, L.A., Tabor, M.B., Bonner, J.C. and Bonner, L.A., 2002. Mitogen-activated protein kinase activation by oxidative and bacterial stress in an amphibian cell culture model. Environ. Health Perspect. 110, 641-645. Châtel, A., Hamer, B., Talarmin, H., Dorange, G., Schröder, H.C. and Müller, W.E.G., 2010. Activation of MAP kinase signaling pathway in the mussel Mytilus galloprovincialis as biomarker of environmental pollution. Aquat.Toxicol. 96, 247-255 Chen, S. and Gardner, D.G., 2002. Osmoregulation of natriuretic peptide receptor signaling in inner medullary collecting duct. A requirement for p38 MAPK. J. Biol. Chem. 277(8): 6037-43. Chen, S., Nguyen, N., Tamura, K., Karin, M. and Tukey, R.H., 2003. The role of the Ah receptor and p38 in benzo[a]pyrene-7,8-dihydrodiol and benzo[a]pyrene-7,8-dihydrodiol9,10-epoxide-induced apoptosis. J. Biol. Chem. 278, 19526-19533. Colosio, C., Birindelli, S., Corsini, E., Galli, C.L. and Maroni, M., 2005. Low level exposure to chemicals and immune system. Toxicol. Appl. Pharmacol. 207(2 Suppl): 320-8. Cossa, D., 1989. A review of the use of Mytdus spp. as quantitative indicators of cadmium and mercury contamination in coastal waters. Oceanol. Acta. 12: 417-423. Dahl, S.C., Handler, J.S. and Kwon, H.M., 2001. Hypertonicity-induced phosphorylation and nuclear localization of the transcription factor TonEBP. Am. J. Physiol. Cell. Physiol. 280(2): C248-53. Damiani F., Gianguzza M., Dolcemascolo G., 2009. Effects of tributyltin chloride in ascidian embryos: modulation of kinase-mediated signalling pathways. I. S. J. 6, 87-94. Devauchelle, N., 2002. Bilan de santé des organismes et des écosystèmes marins. Bilan et prospectives – IFREMER : 43 p. Diez, S., Lacorte, S., Viana, P., Barcelo, D. and Bayona, J.M., 2005. Survey of organotin compounds in rivers and coastal environments in Portugal 1999-2000. Environ. Pollut. 136(3): 525-36. Diez, S., Jover, E., Albaiges, J., and Bayona, J.M., 2006. Occurrence and degradation of butyltins and wastewater marker compounds in sediments from Barcelona harbor, Spain. Environ. Int. 32(7): 858-65. Fabbri, E., Valbonesi, P., Franzellitti, S., 2008. HSP expression in bivalves. I.S.J. 5, 135-161. Fiol, D.F., Kultz, D., 2007. Osmotic stress sensing and signaling in fishes. F.E.B.S. J. 274, 5790-5798. Gabrieldes, G. (Ed.), 1997. The MED POL Biomonitoring Program Concerning the effects of Pollutants on Marine Organisms Along the Mediterranean Coasts. Gaitanaki, C., Kefaloyianni, E., Marmari, A. and Beis, I., 2004. Various stressors rapidly activate the p38-MAPK signaling pathway in Mytilus galloprovincialis (Lam.). Mol. Cell. Biochem. 260, 119-127. Gaitanaki, C., Konstantina, S., Chrysa, S. And Beis, I., 2003. Oxidative stress stimulates multiple MAPK signalling pathways and phosphorylation of the small HSP27 in the perfused amphibian heart. J. Exp. Biol. 206(Pt 16): 2759-69. Galloway, T.S. and Depledge, M.H., 2001. Immunotoxicity in invertebrates: measurement and ecotoxicological relevance. Ecotoxicology. 10(1): 5-23.

142

A. Châtel and B. Hamer

Gambaro, A., Manodori, L., Toscano, G., Contini, D., Donateo, A., Belosi, F., Prodi, F. and Cescon, P., 2007. Pahs and trace elements in PM(2.5) at the Venice Lagoon. Ann. Chim. 97(5-6): 343-58. Goldberg, E.D., 1975. Synthetic organohalides in the sea. Proc R Soc Lond B Biol Sci 189(1096): 277-89. Graves, J.D. and Krebs, E.G., 1999. Protein phosphorylation and signal transduction. Pharmacol. Ther. 82(2-3): 111-21. Gueguen, Y., Cadoret, J.P., Flament, D., Barreau-Roumiguiere, C., Girardot, A.L., Garnier, J., Hoareau, A., Bachere, E. and Escoubas, J.M., 2003. Immune gene discovery by expressed sequence tags generated from hemocytes of the bacteria-challenged oyster, Crassostrea gigas. Gene. 303: 139-45. Hamer B., Vucelic V., Jaksic Z., Pavicic-Hamer D., Chatel A., Wiens M., Batel R., 2009. Protein carbonyl groups in gills of the mussel Mytilus galloprovincialis as biomarker of oxidative stress. 14th ISTA Symposium, METZ. Hellou, J. and Law, R.J., 2003. Stress on stress response of wild mussels, Mytilus edulis and Mytilus trossulus, as an indicator of ecosystem health. Environ. Pollut.126, 407-416. Hylland, K., 2006. Biological effects in the management of chemicals in the marine environment. Mar. Pollut. Bull. 53(10-12): 614-9. Jaksic, Z. and Batel, R., 2003. DNA integrity determination in marine invertebrates by Fast Micromethod. Aquat. Toxicol. 65, 361-376. Ka Imoussi, A., Chafik, A., Mouzdahir, A. and Bakkas, S., 2001. The impact of industrial pollution on the Jorf Lasfar coastal zone (Morocco, Atlantic Ocean): the mussel as an indicator of metal concentration. Earth. Planet. Sci. Lett. 333: 337-341. Kefaloyianni, E., Gourgou, E., Ferle, V., Kotsakis, E., Gaitanaki, C., Beis, I., 2005. Acute thermal stress and various heavy metals induce tissue-specific pro- or anti-apoptotic events via the p38-MAPK signal transduction pathway in Mytilus galloprovincialis. (Lam.). J. Exp. Biol. 208, 4427-4436. Kim, D.H. and Ausubel, F.M., 2005. Evolutionary perspectives on innate immunity from the study of Caenorhabditis elegans. Curr. Opin. Immunol. 17(1): 4-10. Kljaković-Gašpić, Odţak, N., Zvonarić, T., Horvat, M. and Barić, A., 2002. Distribution of mercury and methyl mercury in tissues of transplanted mussels. 7th Zorana International Conference on Mercury as a Global Pollutant. Kyriakis, J.M. and Avruch, J., 2001. Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol. Rev. 81, 807-869. Landvik, N.E., Gorria, M., Arlt, V.M., Asare, N., Solhaug, A., Lagadic-Gossmann, D. and Holme, J.A., 2007. Effects of nitrated-polycyclic aromatic hydrocarbons and diesel exhaust particle extracts on cell signalling related to apoptosis: possible implications for their mutagenic and carcinogenic effects. Toxicology. 231(2-3): 159-74. Lei, W., Yu, R., Mandlekar, S. and Kong, A.N., 1998. Induction of apoptosis and activation of interleukin 1beta-converting enzyme/Ced-3 protease (caspase-3) and c-Jun NH2terminal kinase 1 by benzo(a)pyrene. Cancer Res. 58, 2102-2106. Lopez-Barea, J. and Pueyo, C., 1998. Mutagen content and metabolic activation of promutagens by molluscs as biomarkers of marine pollution. Mutat. Res. 399, 3-15. Malagoli, D., Lusvardi, M., Gobba, F., Ottaviani, E., 2004. 50 Hz magnetic fields activate mussel immunocyte p38 MAP kinase and induce HSP70 and 90. Comp. Biochem. Physiol. C. Toxicol. Pharmacol. 137, 75-79.

MAP Kinase Signaling Pathway: …

143

Masuda, K., Shima, H., Katagiri, C. and Kikuchi, K., 2003. Activation of ERK induces phosphorylation of MAPK phosphatase-7, a JNK specific phosphatase, at Ser-446. J. Biol. Chem. 278, 32448-32456. McCarthy, J.F., and Shugart L. R., 1990. Biomarkers of Environmental Contamination. Chelsea, Lewis, pp. 205-216. Milivojevič, T., Milačič, R. and Ščančar, J., 2008. A Survey of Organotin Compounds in the Northern Adriatic Sea. Water, Air, & Soil Pollution, Vol. 196, N° 1-4, p 211-224. Müller, W.E., Böhm, M., Grebenjuk, V.A., Skorokhod, A., Müller, I.M. and Gamulin, V., 2002. Conservation of the positions of metazoan introns from sponges to humans. Gene. 295, 299-309. Müller W.E.G, Custódio M.R., Wiens M., Zilberberg C., Châtel A., Müller I., Schröder H.C. Effect of bacterial infection on stem cell pattern in Porifera. Baruch, B; Valeria V. (Org.). Stem cells in marine organisms. Berlin: Springer, 2009, p. 1-28. Munnik, T. and Meijer, H.J., 2001. Osmotic stress activates distinct lipid and MAPK signalling pathways in plants. FEBS Lett. 498, 172-178. Narbonne, J.F., Daubèze, M., Clérandeau, C. and Garrigues, P., 1999. Scale classification based on biochemical markers in mussel application to pollution monitoring in European coasts. Biomarkers. 4 (6) : 415-424. Nevo, E., 2001. Evolution of genome-phenome diversity under environmental stress. Proc. Natl. Acad. Sci. U S A 98(11): 6233-40. Park, J. and Liu, A.Y., 2001. JNK phosphorylates the HSF1 transcriptional activation domain: role of JNK in the regulation of the heat shock response. J. Cell. Biochem. 82, 326-338. Parsons, P.A., 2005. Environments and evolution: interactions between stress, resource inadequacy and energetic efficiency. Biol. Rev. Camb. Philos. Soc. 80(4): 589-610. Pavicic, J., Skreblin, M., Raspor, B., Branica, M., Tusek-znidaric, M., Kregar, I. and Stegnar, P., 1987. Metal pollution assessment of the marine environment by determination of metal-binding proteins in Mytilus sp.Mar.Chem.22,235 ・48. Philips, D. J. H., 1977. The use of biological indicator organisms to monitor trace metal pollution in marine and estuarine environments. Rev. Environ. Pollut. 13: 281-317. Philips, D. J. H. and Segar, D. A., 1986. Use of indicators in monitoring conservative contaminants. Mar. Pollut. Bull. 17: 10-17. Philips, D.J.H. and Rainbow, P.S., 1994. Biomonitoring of trace aquatic contaminants. Environmental Management Series, Chapman & Hall, London, p. 371. Phillips, D.J.H., 1976 The common mussel Mytilus edulis as an indicator of pollution by zinc, cadmium, lead and copper. I. Effects of environmental variables on uptake of metals. Mar. Biol. 38:56-59 Phillips, G.R., Lenhart, T.E. and Gregory, R.W., 1980. Relation between trophic position and mercury accumulation among fishes from the Tongue River Reservoir, Montana. Environ. Res. 22(1): 73-80. Regoli, F. and Orlando, E., 1993. Mytilus galloprovincialis as a bioindicator of lead pollution: biological variables and cellular responses. Sci. Total Environ. 2: 1283-1292. Roux, P.P. and Blenis, J., 2004. ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol. Mol. Biol. Rev. 68, 320-344.

144

A. Châtel and B. Hamer

Rummel, A.M., Trosko, J.E., Wilson, M.R. and Upham, B.L., 1999. Polycyclic aromatic hydrocarbons with bay-like regions inhibited gap junctional intercellular communication and stimulated MAPK activity. Toxicol. Sci. 49, 232-240. Schröder, H.C., Batel, R., Hassanein, H.M., Lauenroth, S., Jenke, H., Simat, T., Steinhart, H. and Müller, W.E., 2000. Correlation between the level of the potential biomarker, heatshock protein, and the occurrence of DNA damage in the dab, Limanda limanda: a field study in the North Sea and the English Channel. Mar. Environ. Res. 49, 201-215. Sheikh-Hamad, D., Di Mari, J., Suki, W.N., Safirstein, R., Watts, B.A., 3rd and Rouse, D., 1998. p38 kinase activity is essential for osmotic induction of mRNAs for HSP70 and transporter for organic solute betaine in Madin-Darby canine kidney cells. J. Biol. Chem. 273, 1832-1837. Shida, K., Terajima, D., Uchino, R., Ikawa, S., Ikeda, M., Asano, K., Watanabe, T., Azumi, K., Nonaka, M., Satou, Y., Satoh, N., Satake, M., Kawazoe, Y. and Kasuya, A., 2003. Hemocytes of Ciona intestinalis express multiple genes involved in innate immune host defense. Biochem. Biophys. Res. Commun. 302(2): 207-18. Song, Y.C., Woo, J.H., Park, S.H. and Kim, I.S., 2005. A study on the treatment of antifouling paint waste from shipyard. Mar. Pollut. Bull. 51(8-12): 1048-53. Strandenes, S.P., 2000. The second order effects on commercial shipping of restrictions on the use of TBT. Sci. Total Environ. 258(1-2): 111-7. Venier, P., Pallavicini, A., De Nardi, B. and Lanfranchi, G., 2003. Towards a catalogue of genes transcribed in multiple tissues of Mytilus galloprovincialis. Gene 314: 29-40. Viarengo, A., Burlando, B., Cavaletto, M., Marchi, B., Ponzano, E. and Blasco, J., 1999. Role of metallothionein against oxidative stress Am. J. Physiol. 277(6 Pt 2):R1612-9. Whitfield, J., 2001. Behavioural ecology. Down on fungal farm. Nature 411(6837): 536. Widmann, C., Gibson, S., Jarpe, M.B. and Johnson, G.L., 1999. Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol. Rev. 79(1): 143-80. Witorsch, R.J., 2002. Endocrine disruptors: can biological effects and environmental risks be predicted? Regul. Toxicol. Pharmacol. 36(1): 118-30. Xu, D., Wang, L., Olson, J.E. and Lu, L., 2001. Asymmetrical response of p38 kinase activation to volume changes in primary rat astrocytes. Exp. Biol. Med. 226(10): 927-33. Zhang, Y., Lamm, R., Pillonel, C., Lam, S. and Xu, J.R., 2002. Osmoregulation and fungicide resistance: the Neurospora crassa os-2 gene encodes a HOG1 mitogen-activated protein kinase homologue. Appl. Environ. Microbiol. 68, 532-538. Zrouri, H., Le Goascogne, C., Li, W.W., Pierre, M. and Courtin, F., 2004. The role of MAP kinases in rapid gene induction after lesioning of the rat sciatic nerve. Eur J Neurosci 20(7): 1811-8.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 6

MUSSEL GLUE AND ITS PROSPECTS IN BIOTECHNOLOGY Veronika Hahn and Annett Mikolasch Institute of Microbiology, Ernst-Moritz-Arndt-University Greifswald, Friedrich-Ludwig-Jahn Straße 15, 17487 Greifswald, Germany

ABSTRACT The glue of mussels is a remarkable material which has the ability to fix the animals onto organic and inorganic surfaces in aqueous environments. This material consists largely of mussel adhesive proteins (MAPs). The structure of MAPs from a number of different marine invertebrates including mussels has been investigated over the course of the last decades. One common feature of many MAPs studied is the high content of the amino acid 3,4-dihydroxy-L-phenylalanine (DOPA). The DOPA residues are thought to play a key role in the chemisorption of the polymers to substrates underwater and to the formation of covalent cross-links within the adhesive. However, though studies on the adherence of MAPs have described adhesions, oxidations and cross-linking reaction pathways for peptidyl DOPA and DOPA ortho-quinone (oxidation product of DOPA) there remain considerable uncertainties concerning the ways in which different marine mussel species carry out the curing process, and all of the mechanisms described to date are largely hypothetical. To gain a more comprehensive insight of these processes, synthetic DOPA-containing polypeptides have been used to experimentally identify the functions and reactions of the amino acids which are active in the chemistry of the MAPs. These studies demonstrate that the adhesion and cross-linking capabilities of mussel adhesive proteins can be successfully reproduced using synthetic materials. The possible applications of these findings in biotechnology are virtually unlimited. Thus synthetic MAPs may be used for medical adhesives in surgery, ophthalmology or dentistry, as well as for enzyme, cell, and tissue immobilization, and as anticorrosives, and metal scavengers. For the design of potential biomaterials it is necessary to understand (i) the reaction of MAPs especially DOPA with organic or inorganic substances; (ii) the chemical structure of the reaction products and (iii) the role of possible catalysts such as, for 

Fax: ++49 3834 864202; Tel: ++49 3834 864229; E-mail: [email protected]

Veronika Hahn and Annett Mikolasch

146

example, oxidizing enzymes which may support the cross-linking and curing processes. These crucial factors for the synthesis of biomedical or industrial biomaterials will be highlighted in this chapter.

1. INTRODUCTION Marine mussels occur on wave-swept seashores. This turbulent and wet environment requires an adhesion mechanism which allows a rapid and permanent attachment on solid surfaces. Mussels attach by the formation of the byssus secreted by different glands of the foot (Brown 1952). In Mytilidae, the byssus is attached proximally by insertion of the stem root into the byssal retractor muscle and distally on the substrate with a bundle of threads (Brown 1952, Vreeland et al. 1998). In general, the byssus is formed of 40-100 threads (Waite 1992a). These tiny tendons are approximately 0.1 mm in diameter and have a length of 2-4 cm (Waite 1992a). On the substrate, the threads culminate in a plaque or disc-shaped portion with diameter of 2-3 mm (Benedict and Waite 1986). Different proteins are involved in the formation of the byssal threads and plaques which have structural, adhesive and/or protective functions.

2. THE FORMATION OF MUSSEL GLUE 2.1. Byssal Collagens Collagen is the major structural protein of the threads and three collagenous proteins have been characterized in Mytilus edulis as co-polymers (Qin and Waite 1995, 1998). The proximal collagen (Col-P) is distributed in the proximal region (region near to the animal) of the byssal thread (Figure 1). The precursor collagen (preCol-P) has a molecular mass of 95 kDa and consists of a central collagen domain flanked by elastin-like parts. The collagen and elastin-like domains provide for the tough and extensible proximal region of the thread (Qin and Waite 1995, Coyne et al. 1997). The distal collagen (Col-D) is localized predominantly in the distal region (region near to the substrate surface) of the thread. The precursor collagen (preCol-D) has a molecular mass of 97 kDa and consists of a collagen core flanked by silk-fibroin domains which allow extensibility (Qin and Waite 1995, Qin et al. 1997). Both types of collagen (Col-P and Col-D) are pepsin-resistant and are distributed in complementary gradients along the length of each byssal thread. Thus preCol-P decreases from the stem to the adhesive plaque whereas preCol-D increases (Qin and Waite 1995). This gradient is the reason for different extensibility and stiffness of the thread. The collagen in the distal region forms straight bundles whereas in the proximal region the fibers are coiled (Qin and Waite 1995). Thus the distal end is usually about 10 times stiffer than the proximal end which acts as a shock absorber with 160 percent extensibility (Coyne et al. 1997, Waite et al. 2002).

Mussel Glue and Its Prospects in Biotechnology

147

Sheath

pre-Collagen NG pre-Collagen P

Foot

Thread Collagen Anchor

Mefp-4 Mefp-2

Byssal Threads

Stem

Thread Distal

pre-Collagen D

Proximal

Mussel Attachment

Byssal Retractor Muscle

Plaque Foam Primer Layer

Mefp-3,-5 Substrate

Byssus

Byssal Plaques

Figure 1. Composition of the byssus of Mytilus edulis including proteins involved in the formation of the byssal threads (modified according to Silverman and Roberto 2007).

The third type of collagen in the byssal threads is the pepsin-resistant nongradient collagen (Col-NG) which has a molecular mass of 76 kDa and is thought to act as a mediator between proximal and distal collagen (Qin and Waite 1998). In contrast to preCol-P and -D, the precursor protein preCol-NG contains flanking domains that are similar to plant cell wall proteins (Qin and Waite 1998). The initial inter- and intramolecular stabilization of the three preCols is thought to be achieved by histidine-rich terminal domains, due to a metal binding function e.g. Zn2+ or cross-linking reactions (Qin et al. 1997, Qin and Waite 1998). In addition to the histidine-rich domains, tyrosine-rich terminal sequences have been demonstrated in the preCols (Qin and Waite 1995, 1998). These termini resemble other byssal protein precursors in which tyrosine is mostly co-translationally or post translationally modified to DOPA (Rzepecki et al. 1992). In fact DOPA has been shown also in preCol-D and may contribute to a cross-linking process (Qin and Waite 1995, Qin et al. 1997). In general the byssal thread synthesis is completed in two to five minutes and involves the formation, condensation, and coating of a milky solution in the ventral groove of the foot that serves as the mold before release (Waite 1992a). In addition to the collagen, a number of polyphenolic proteins are involved in the formation of the thread and these contribute to the adhesive function.

2.2. Byssal Proteins To date, five protein families which serve as precursors for natural adhesives have been identified in the most studied mussel Mytilus edulis (Papov et al. 1995, Waite and Qin 2001). These proteins are named "Mefp", Me for the organism, here the common blue mussel Mytilus edulis and fp for foot protein (Taylor et al. 1994a, Waite 1999). They are produced and stored in phenol and accessory glands in the mussel foot (Brown 1952, Smyth 1954, Rzepecki et al. 1992). All of these proteins contain DOPA (3,4-dihydroxy-L-phenylalanine; Table 1; Papov et al. 1995, Waite and Qin 2001) and numerous studies have confirmed that DOPA is responsible for the adhesion (Filupa et al. 1990, Hansen and Waite 1991, Yu et al. 1999, Lee et al. 2006a).

Veronika Hahn and Annett Mikolasch

148

Table 1. Comparison of the byssal proteins of Mytilus edulis1 Protein

mol% Dopa

Mass (kDa)

Repeat Unit (frequency) AKPSYPPTYK (75-80) AKPTYK (14)

Mefp-1

11

110

Mefp-2

2-3

42-47

EGF-motif (11)2

Mefp-3 Mefp-4 Mefp-5

20 3-4 27

6 70-80 9.5

none ?3 YK (8)

Reference Waite 1983, Waite et al. 1985, Filpula et al. 1990 Rzepecki et al. 1992, Inoue et al. 1995 Papov et al. 1995 Waite 1999 Waite and Qin 2001, Waite 2002

1

Mefp: Mytilus edulis foot protein. EGF: Epidermal Growth Factor. 3 Repititive sequences have not yet been confirmed. 2

Mefp-1 possesses a DOPA-content of 11 mol% (Waite 1983). The protein consists of tandemly repeated hexa- and decapeptide sequences containing different posttranslational modifications (Waite et al. 1985, Taylor et al. 1994a). The consensus decapeptide sequence is AKPSYP'P''TY''K in which P' represents 2,3-trans-3,4-cis-dihydroxyproline, P'' represents trans-4-hydroxyproline, and Y'' represents DOPA (Waite et al. 1985, Taylor et al. 1994a). The formation of DOPA is the result of an enzymatic hydroxylation of tyrosine residues (Figure 2; Brown 1952, Waite et al. 1985, Rzepecki et al. 1992). The high content of hydroxylated amino acid residues provides the first indication for an adhesive-related function of the protein and DOPA in particular is strongly involved in the adhesive process (Yu et al. 1999, Lee et al. 2006a). For this reason it was expected that Mefp1 has only adhesive properties, yet in fact it has a more protective than an adhesive function (Lin et al. 2007). Mefp-1 is primarily localized in the byssal threads where it forms a protective cuticle (Benedict and Waite 1986). The threads consist of a flexible collagenous core coated by the cured polyphenolic protein Mefp-1 (Benedict and Waite 1986, Sun and Waite 2005). In the course of the curing, or so-called quinone-tanning reaction. DOPA is oxidized to an ortho-quinone by catechol oxidase which is produced in an enzyme gland in the mussel foot (Smyth 1954, Waite 1990a). O

O Enzyme

HO NH2

OH

Tyrosine

OH

HO NH2

OH

DOPA

Figure 2. Enzymatic hydroxylation of tyrosine to DOPA.

In contrast to Mefp-1, the byssal protein Mefp-2 is found exclusively in the plaques, more precisely in the structural foam of the plaque. Mefp-2 constitutes 25-40% of the total plaque proteins and is thus the most abundant protein in the plaque (Rzepecki et al. 1992, Waite

Mussel Glue and Its Prospects in Biotechnology

149

1999). The DOPA content is 2-3 mol% and the DOPA residues lie primarily in the N- and Cterminal regions (Rzepecki et al. 1992, Inoue et al. 1995). Tandem, repetitive motifs similar to epidermal growth factor and a high cysteine content of 6-7 mol% suggest a stabilization role of the plaque matrix for the adhesive protein Mefp-2 (Rzepecki et al. 1992). Mefp-3 has a molecular mass of only 6 kDa. Despite the fact that Mefp-3 is the smallest plaque protein, it has the highest DOPA content of 20 mol% (Papov et al. 1995). The peptide motifs are non-repetitive and are dominated by glycine, asparagine, DOPA and arginine (Papov et al. 1995, Waite 1999). Thus in addition to DOPA, Mefp-3 is also arginine rich and most of these residues are modified to 4-hydroxy-L-arginine (Papov et al. 1995, Inoue et al. 1996). The co-occurrence of DOPA and 4-hydroxy-L-arginine in the peptide sequence suggests a special interaction between them. Though the peptide bond between DOPA and arginine is cleaved by trypsin, the DOPA and 4-hydroxy-L-arginine bond is not (Papov et al. 1995). It is possible that the formation of hydrogen bonds prevent the cleavage of the peptide bond through enzymes (Papov et al. 1995) and thus stabilizes and protects Mefp-3. Furthermore, DOPA is probably not the only amino acid to play a special role in the adhesion mechanism, since arginine and its hydroxylated derivative may also enhance attachment, e.g. through their hydrogen donor function (Papov et al. 1995). In contrast to Mefp-3 the plaque protein Mefp-4 has a low DOPA content of 3-4 mol% (Waite 1999) and it is thought that Mefp-4 contains tandem, repetitive tyrosine rich octapeptides (Waite 1999). Mefp-4 is localized in the junction between thread and plaque and, as shown in Mytilus californianus, serves there as a coupling agent (Zhao and Waite 2006a). Further studies have identified another MAP in Mytilus edulis (Waite and Qin 2001). Mefp-5 contain 27 mol% DOPA and in addition to the posttranslational hydroxylation of tyrosine to DOPA, there is also serine phosphorylation. In general, phosphoserines are parts of proteins such as statherin that bind calcareous materials (Oppenheim et al. 1982) suggesting that the phosphorylated serine Mefp-5 may be an adaption to the substrate (Waite and Qin 2001). As mentioned previously, DOPA has a particular role during adhesion and the higher the DOPA content, the stronger adhesion that results (Lee et al. 2006a, Yu and Deming 1998). Thus, it is not surprising that the proteins with the highest DOPA content and the lowest molecular mass - Mefp-3 and Mefp-5 - are predominant in the contact area between the plaque and the solid surface (Warner and Waite 1999, Waite and Qin 2001). In addition to the five foot proteins described for Mytilus edulis, another protein (Mcfp6) has been identified in Mytilus californianus (Zhao and Waite 2006b). This protein is small (11.6 kDa) and contains only 3-4 mol% DOPA. Mcfp-6 is thought to play a linking function between the proteins in the interior and those on the surface of the plaque. This linkage may be achieved between thiol groups of cysteine in Mcfp-6 (content: 5.5 mol%) and DOPA in Mfp-3 and -5 (Zhao and Waite 2006b).

2.3. Byssal Enzyme The participation of an enzyme in the adhesion mechanism was described already by Brown (1952). He incubated parts of the mussel foot and byssus with L-tyrosine. This resulted in the medium turning pink and then black when byssus but not when foot sections

150

Veronika Hahn and Annett Mikolasch

were used. Moreover cyanide and boiling of the byssus prevented a color reaction which speaks for a thermolabile enzyme that hydroxylated tyrosine to DOPA and oxidized DOPA to ortho-quinone. The quinones formed undergo a browning/curing/tanning reaction resulting in waterproof adhesives and varnishes (Waite 1990b). The questions are (i) if it is one or more than one enzyme which is involved in the hydroxylation and oxidation process and, in case of more than one enzyme (ii) what kind of enzyme catalyzes the hydroxylation of tyrosine and (iii) what kind of enzyme catalyzes the oxidation of DOPA or (iiii) could an enzyme with a previously unknown mechanism be involved? In principle five proteins could be involved in the adhesive processes. The first conceivable enzyme is the tyrosine hydroxylase (E.C. 1.14.16.2), also called 3-tyrosylhydroxylase or tyrosine 3-monooxygenase. This iron-dependent enzyme needs tetrahydrobiopterin as cofactor for the hydroxylation of L-tyrosine to DOPA (Almas et al. 1996, Haavik and Toska 1998). In humans the synthesized DOPA is a precursor for neurotransmitter like dopamine or adrenaline (Nagatsu 2006). For Mytilus edulis Waite et al. (1985) speculated that the hydroxylation of tyrosine was accomplished by a protein-specific 3-tyrosylhydroxylase. However, so far no tyrosine hydroxylase has been described for Mytilus spec.. Moreover Waite reported in 1992b that tyrosine hydroxylase cannot hydroxylate peptidyl-tyrosine which would be a crucial prerequisite for a participation in the adhesion mechanism. Three further types of catalysts which might be involved in mussel glue formation are the copper-containing proteins, tyrosinase, laccase and hemocyanin (Keilin and Mann 1939, Call and Mücke 1997, Eiken et al. 1999, Decker and Terwilliger 2000). The tyrosinase is able to catalyze an ortho-hydroxylation of monophenols like L-tyrosine (EC 1.14.18.1) "cresolase / monophenolase / monophenol monooxygenase function" and to oxidize ortho-diphenols like DOPA (EC 1.10.3.1) "catecholase / catechol oxidase / diphenol oxidase function" (Brown 1967, van Gelder et al. 1997, Halaouli et al. 2006). The laccase (EC 1.10.3.2) is able to oxidize ortho- as well as para-diphenols, the latter are not accessible for tyrosinase (Brown 1967, Tadesse et al. 2008, Mikolasch and Schauer 2009). Thus this enzyme is able to catalyze only the second reaction involved in the adhesion mechanism, the oxidation of DOPA to DOPA-quinone, whereas tyrosinase is able to catalyze the hydroxylation of L-tyrosine as well as the oxidation of DOPA. The existence of a polyphenol oxidase was shown by Smyth (1954) who carried out a histochemical analysis to demonstrate the activity of this enzyme in the "enzyme gland" which he had identified in the mussel foot. This work was confirmed by a later study of Waite (1985) who refers more precisely to a catechol oxidase whose substrate spectrum he characterized. The monophenols L-tyrosine and p-cresol were not oxidized by the isolated enzyme, whereas dihydroxylated aromatic compounds like DOPA or 4-methycatechol were oxidized (Waite 1985). The more efficient oxidation of di- and also trihydroxylated phenols by catechol oxidase compared with monophenols was also described by Hellio et al. (2000). In this study the relative activity towards the monophenol p-coumaric acid was 11.8% compared with that of DOPA. The activity towards tyrosine itself was not tested (Hellio et al. 2000). Tyrosinase and laccase contain binuclear copper (type 3; Solomon et al. 2001). This type 3 copper protein family includes hemocyanin which is an extracellular oxygen carrier in the hemolymph of mollusca as well as arthropoda (Mellema and Klug 1972, Lieb et al. 2001,

Mussel Glue and Its Prospects in Biotechnology

151

Solomon et al. 2001). The structural resemblances of the proteins suggest that hemocyanin may have a similar function as the enzymes tyrosinase and laccase. In fact hemocyanin is able to oxidize diphenols such as DOPA in molluscs and arthropods (Zlateva et al. 1996, 1998; Martinez-Alvarez et al. 2008), although the oxidation rate of diphenols is 50-100 times lower for hemocyanin than for tyrosinase (Beltramini et al. 1990). The copper active site of the tyrosinase is more accessible for a substrate than that of hemocyanin due to a direct coordination to the copper centre (Himmelwright et al. 1980, Beltramini et al. 1990, Solomon et al. 1994). In addition to this catechol oxidase function of hemocyanin, a monohydroxylating activity of tyrosine has been demonstrated in prawns (arthropoda) though not yet in molluscs (Adachi et al. 2001, Decker and Jaenicke 2004). The fifth conceivable protein is the peroxidase (E.C. 1.11.1.7). This enzyme usually contains heme as a prosthetic group and requires hydrogen peroxide for the oxidation of a substrate such as catechol to o-quinone (Stahmann and Spencer 1977, van Deurzen et al. 1997). In addition to the oxidation of diphenols, the hydroxylation of tyrosine resulting in DOPA was described in the presence of an electron donor (dihydroxyfumaric acid) and molecular oxygen (instead of peroxide) at approximately 0°C (Klibanov et al. 1981). All this taken together indicates that the participation of a peroxidase cannot be ruled out, although concrete evidence for it is missing. In summary, the enzymes which are most likely involved in the adhesive process are tyrosinase and laccase. This suggestion is supported by the copper dependence shown for isolated mussel enzymes (Waite 1990b, Vreeland et al. 1998). In the case of tyrosinase, the hydroxylation of tyrosine to DOPA and the oxidation of DOPA to DOPA-quinone is catalyzed by only one enzyme. This is supported by the fact that mushroom tyrosinase is able to hydroxylate tyrosine of synthetic peptides to DOPA (Marumo and Waite 1986). In contrast, the enzymes isolated by Waite (1985) and Hellio et al. (2000) show a preference for diphenols and their failure to oxidize tyrosine suggests that they are perhaps laccases. Both authors described various inhibitors for their enzymes including oxygen competitors (cyanide) or metal chelators (diethyldithiocarbamate) (Waite 1985, Hellio et al. 2000) both of which are typical inhibitors of metal-containing oxidases such as laccase and tyrosinase (Lehman et al. 1974, Leonowicz and Malinowska 1982, Kahn and Andrawis 1985, Beltramini et al. 1990, Laufer et al. 2006). Carbon monoxide, phenylhydrazine and 4-hexylresorcinol are inhibitors which permit discrimination between tyrosinase and laccase because they selectively inhibit the tyrosinase (Petroski et al. 1980, Bligny and Douce 1983, Dawley and Flurkey 1993). These compounds should be tested in future to clarify which of the two most probable enzymes is involved. Different groups currently study the mussel adhesive proteins and the enzyme(s) which are involved in the attachment, because this knowledge is needed not only for the synthesis of new adhesive biomaterials but also for the development of antifouling procedures to prevent attachment of mussels on ships and on other surfaces (Hellio et al. 2000, Zentz et al. 2002).

Veronika Hahn and Annett Mikolasch

152

3. ADHESION AND FLEXIBILITY MECHANISMS OF MAPS The precise interaction mechanisms of the Mfps, collagens, and byssal enzyme(s) is not clear at the moment (Silverman and Roberto 2007), but the strength of MAPs is ascribed to cross-links between polymer chains of the different adhesive proteins. Studies on adhesion mechanisms of MAPs have described adhesions, oxidations, and cross-linking reaction pathways for peptidyl DOPA and DOPA-quinone (2-amino-3-(3,4-dioxo-1-cyclohexa-1,5dienyl)-propanoic acid). Beside the formation of metal complexes and physical interactions, cross-linked biarylic products of DOPA or DOPA-quinone or inter chain amine/thiol crosslinked products of DOPA or DOPA-quinone with amino or thiol groups have been suggested to be involved and this has led to mechanistic hypotheses, some of which have been tested by various analytical procedures.

3.1. Formation of Metal Complexes and Metal Interactions The extreme adhesive potential of the MAPs has been explained on the one hand by the strong chelating power of DOPA (containing a catechol substructure) for metal ions such as iron (III), aluminium (III), and for metal oxides (Hansen and Waite 1991, Deming 1999, Xu et al. 2004, Dalsin et al. 2005, Holten-Andersen et al. 2009). The bonding mechanism of catechols on metals and metal oxides was elucidated from surface-enhanced Raman (Ooka and Garrell 2000), dispersive and Fourier transform infrared spectroscopy (McBride and Wesselink 1988), by polarographic and electronic absorption (Taylor et al. 1994b), and by potentiometric and electron spin resonance measurements (Avdeef et al. 1978). The catecholic oxygen atoms of DOPA coordinate to the metal or metal oxide surface. The formation of bidentate and binuclear complexes has been suggested (Figure 3; McBride and Wesselink 1988, Rodriguez et al. 1996, Zhao et al. 2006). The orientation of the DOPA residue on the surface is such that the plane of the aromatic ring is perpendicular or tilted with respect to the surface (Ooka and Garrell 2000). Furthermore, it was suggested that the peptides adsorb primarily through the deprotonated catecholate oxygen of the DOPA and also interact with the metal or metal oxide surfaces through one or both of the primary amine groups of α,ω-amino acids of the peptides. M M M

Chelation Bidentate complex

M

DOPA unit

M Binuclear complex

Figure 3. Chelation of catechol to metal or metal oxide (derived from McBride and Wesselink 1988, Waite 1990b, Rodriguez et al. 1996, Deming 1999, Ooka and Garrell 2000, Dalsin et al. 2005, Zhao et al. 2006).

Mussel Glue and Its Prospects in Biotechnology

153

Atomic force microscopy measurements of a single DOPA residue revealed strong and reversible noncovalent interactions between DOPA and Ti surfaces (Lee et al. 2006b). Although the interactions were completely reversible for one DOPA residue for thousands of break-reformation cycles, the reversibility would not be relevant for whole mussel adhesive proteins because multiple DOPA-surface interactions can cause extreme adhesive forces across the interface. However the reversibility can cause high flexibility of the adhesion plaque. Furthermore transition metals including Fe, Cu, Co, Zn, Ti, Mn, and V accumulate in the byssus of M. edulis (Pentreath 1973, Coombs and Keller 1981, Tateda and Koyanagi 1986, Coulon et al. 1987, Hansen and Waite 1991). These metals remain bound after extensive washing with 1N hydrochloric acid or 1N sodium hydroxide, suggesting strong binding of the metals in byssus (Coulon et al. 1987, Hansen and Waite 1991). The metal composition is thought to be highly variable and dependent on the chemistry of the water and the sediment surrounding the mussels (Holten-Andersen and Waite 2008). Spectrophotometric data led to the suggestion that intermolecular coordinations of iron(III) by peptides form bis(catecholato)iron(III) complexes (Taylor et al. 1994b) or tris(catecholato)iron(III) complexes (Sever et al. 2004, Harrington et al. 2010). The DOPA residues are proposed to coordinate iron(III) in a μ-oxo-bridged di-iron bis(catecholato)iron(III) complex at low DOPA-to-iron ratios which switches to a mononuclear tris(catecholato)iron(III) complex at high DOPA-to-iron ratios (Figure 4; Taylor et al. 1996). In general catechols can effectively chelate metals in mono-, bis- and triscomplexes of extreme stability (Avdeef et al. 1978, Pierpont and Buchanan 1981, Ohman and Sjoberg 1983, McBride and Wesselink 1988). Alternatively, catechol groups are thought to cooperatively adsorb to hydroxyapatite via divalent hydrogen bonds (Chirdon et al. 2003, Zhao et al. 2006).

-

Figure 4. Mussel adhesive metal-protein cross-links. Left: μ-oxo-bridged di-iron bis(catecholato)iron(III) complex at low DOPA-to-iron ratios; right: mononuclear tris(catecholato)iron(III) complex at high DOPA-to-iron ratios (derived from Taylor et al. 1996, Sever et al. 2004).

In addition a DOPA-rich protein and Fe3+ ions have been analyzed in granular cuticles of threads from different mussel species. In situ resonance Raman spectroscopic data demonstrated that the cuticle is a polymeric construction stabilized by

Veronika Hahn and Annett Mikolasch

154

tris(catecholato)iron(III) complexes (Harrington et al. 2010). These metal cross-links have a non-covalent and reversible nature and may play a key role in bringing the remarkable combination of both hardness and extensibility of granular cuticles. Though the amino acidmetal complexes, especially those containing DOPA or histidine as ligands, are less than half as strong as covalent bonds, they have the advantage that the chelates can be broken and regenerated across hundreds of cycles (Schmitt et al. 2000, Lee et al. 2006b). Furthermore electron paramagnetic resonance, infrared spectroscopic and penetration force data implicated iron and manganese ions(III) as the key reagents in protein cross-linking for generating adhesion (Monahan and Wilker 2003, 2004; Sever et al. 2004). The iron center in mussel plaques was proposed to cross-link three DOPA residues as illustrated in Figure 4. The tris(catecholato)iron(III) complex and oxygen may oxidize the protein generating a reactive organic free radical. Such radicals were demonstrated in adhesive plaques from live mussels and in iron-protein solids. The strong reactive properties of radical species may explain the reaction steps to organic cross-links as described below (section 3.2) or enable coupling to surfaces and the formation of adhesive bonds (Sever et al. 2004). In addition to the DOPA metal interactions, histidine and asparagine metal binding of the Mcfp-4 has also been described (Zhao and Waite 2006a). Mcfp-4 is a highly repetitive and asymmetric protein in which 84% of the total histidine is concentrated in the N-terminus of the protein while, in contrast, 84% of the asparagine is located in the C-terminus. The histidine-rich sequence in the N-terminal region of Mcfp-4 appears to have a particularly high binding capacity for copper at least under matrix assisted laser desorption/ionization – time of flight (MALDI-TOF) conditions, whereas the C-terminal repeat domain showed a preference for binding calcium ions. Mcfp-4 would thus seem to function as a macromolecular bifunctional linker in the plaque-thread junction (Figure 5).

NH

NH

NH

NH

N

N

Cu

Cu

N

N

N

N

Cu

Cu

N N

NH

NH

HN HN

Mcfp-4 C=O

Foam

Ca

O

O C=O

O=C

Mcfp-2

O=C

C=O

O

O Ca

Mcfp-4

Ca O C=O

O=C

O

Foam

Ca

O

O

C=O

Mcfp-2

Figure 5. Proposed model of the role of Mcfp-4: copper binding by the histidine-rich N-terminal region and calcium binding by the asparagine-rich C-terminal region of Mcfp-4 (derived from Zhao and Waite 2006a).

Mussel Glue and Its Prospects in Biotechnology

155

3.2. Formation of Dimeric Cross-Linked Products The dimeric cross-links have also been suggested to contribute to the extreme adhesive potential of the MAPs. For the formation of dimeric cross-linked products at least four reactants are necessary: (1) the catechol unit of MAP (DOPA unit), (2) catechol oxidase (e.g. tyrosinase or laccase) or oxidizing agent (e.g. tris(catecholato)iron(III) complex), (3) atmospheric oxygen (O2), and (4) a second MAP molecule for the cross-link (Figure 6; Waite 1990b). In the first step the DOPA unit is oxidized to ortho-quinone. Even though the enzyme, catechol oxidase, or the oxidizing agent only works in direction of oxidation, this reaction is nevertheless reversible because the energy barrier between quinones and catechols is not high (Aviram et al. 1982). Thus catechol (DOPA unit) can serve as a reductant of quinone to catechol and is thus at the same time itself oxidized to a quinone. Furthermore a catechol unit or a quinone unit can react with a catechol unit of a second MAP molecule to form biarylic cross-linked products or, alternatively, can react with a primary or secondary amino group or with a thiol group of a second MAP molecule forming amine or thiol crosslinked products.

+ DOPA unit - Quinone unit O

O

HN DOPA unit

OH

+

1/2 O2

OH

-

H2O

Catechol oxidase or Oxidizing agent

O HN

+ MAP molecule

O

Dimeric cross-linked product

Quinone unit

Figure 6. Formation of dimeric cross-linked products (derived from Waite 1990b).

3.2.1. Formation of Biarylic Cross-Linked Products Studies on the formation of biarylic cross-linked products of MAPs have so far unfortunately been based largely on analogy. A redox pair consisting of a DOPA unit and a quinone unit should react to two semiquinone radical units which can cross-link in many different ways. One type of products could be dimeric cross-linked biarylics (Figure 7; Waite 1990b, Deming 1999). A DOPA-quinone unit gives up one electron to another DOPA unit by reverse dismutation to produce two semiquinone radical units which cross-link to form a diDOPA unit (Haemers et al. 2003, Holten-Andersen and Waite 2008). On the one hand in situ analysis of peptidyl DOPA in mussel byssus showed no direct evidence for the formation of covalent linkages between or among tyrosine and DOPA rings in plaques or threads (Klug et al. 1996) and, no distinct Tyr-DOPA cross-links were detected by MALDI-TOF analyses of cross-linkings of DOPA-containing molecules to proteins (Liu et al. 2006). On the other hand rotational echo double resonance nuclear magnetic resonance (NMR) spectra provided the first evidence for the formation of DOPA- and quinone-derived cross-links in mussel byssal plaques (Figure 7, McDowell et al. 1999). 5,5‗-Didihydroxyphenylalanine cross-links were identified as the first biarylic cross-linked product

156

Veronika Hahn and Annett Mikolasch

of MAPs. Flow-stressed byssal plaques had significantly enhanced levels of such biarylic cross-links. The average concentration of these cross-links in byssal plaques is 1 per 1800 total protein amino acid residues. This low ratio may explain why the formation of biarylic cross-linked products is not detected in all experiments.

DOPA unit

Quinone unit

Semiquinone radical unit

DiDOPA cross-link 5,5'-Di-dihydroxyphenylalanine cross-link

DiDOPA quinone cross-link

Figure 7. Formation of the biarylic cross-linked product 5,5‗-di-dihydroxyphenylalanine and their further oxidation (derived from Waite 1990b, McDowell et al. 1999, Burzio and Waite 2000, HoltenAndersen and Waite 2008).

In vitro polymerization of mussel polyphenolic proteins catalyzed by mushroom tyrosinase suggested that cross-link formation is limited to the oxidized DOPA of the protein molecules (Burzio et al. 2000, Burzio and Waite 2000). When natural or synthetic variants of the decapeptide models of Mefp1 were subjected to oxidation by tyrosinase or periodate, DOPA was the only residue to suffer mass loss in all oxidized peptides. Moreover, using MALDI TOF, the oxidized decapeptides showed evidence of multimer formation and a mass loss of 6 Da per coupled pair of peptides. The results are consistent with biarylic cross-linking units of 5,5‗-di-dihydroxyphenylalanine followed by reoxidation to diDOPA quinone units (Figure 7; Burzio and Waite 2000).

3.2.2. Formation of Amine Cross-Linked Products Studies on the formation of amine cross-linked products of MAPs have been based largely on analogy. The first step in the formation of amine cross-linked products is the enzyme- or oxidizing-agent-catalyzed oxidation of the catechol unit of DOPA by oxygen resulting in the quinone unit as described above (Figure 6; Waite 1990b, Deming 1999). The

Mussel Glue and Its Prospects in Biotechnology

157

fact that DOPA quinone or the tautomer α,β-dehydroDOPA are products of DOPA oxidation was demonstrated in small peptides by NMR spectroscopy (Rzepecki et al. 1991, Rzepecki and Waite 1991). The next step in the reaction is expected to be an amination of the quinone unit by intermolecular Michael addition. This amination is affected by nucleophiles such as (1) the amino groups of amino acids, in particular the -amino group of lysine residues (Figure 8; Waite 1990b, Yamamoto et al. 1990, Burzio et al. 1997), (2) the imidazole ring nitrogen of histidine or (3) the complex guanidinium group of arginine (Yamamoto et al. 1997). Michael addition

1/2 O2

-

H2O Catechol oxidase

Quinone unit

Lysine unit

Amine cross-link unit

Amine cross-link quinone unit

Figure 8. Formation of amine cross-linked products (derived from Waite 1990b, Burzio et al. 1997, Liu et al. 2006, Mikolasch et al. 2010).

While the quinone unit formation is an identified result, solid-state NMR analysis of intact adhesive plaques from mussels labeled by L-[6-13C,6-15N]lysine suggested that the amino group of lysine does not form observable numbers of covalent cross-links (Holl et al. 1993). However, using solid-state NMR an adduct with direct covalent linkages between an imidazole ring nitrogen of protein histidyl residues and the 6-position of N-acetyldopamine in insect cuticle has been detected (Schaefer et al. 1987). Additionally, histidyl residues in cuticular proteins in insect skeletal systems served as nucleophiles and undergo Michael addition reaction with either the 5(ring)- or 7(ß)-carbon atom of laccase- or tyrosinaseproduced quinone intermediates of N-ß-alanyldopamine or 3,4-dihydroxyphenylethanol, resulting in 5- or 7-monoadducts and in 5,7-diadducts (Kramer et al. 2001). Furthermore mass spectrometry (MS) and NMR analyses showed that the -amino group of lysine is able to cross-link dihydroxylated aromatics such as 3,4-dihydroxyphenylpropionic acid. This is an ortho-dihydroxylated aromatic compound structurally related to DOPA but lacking the amino group (Mikolasch et al. 2010). Additionally, oligomer and polymer lysine-cross-linked products were obtained from dipeptides and oligopeptides containing lysine (Figure 9). This type of cross-linking of the -amino group has also been described for a peptidyl lysine with the modified side chain of a tyrosyl residue (DOPA unit; Wang et al. 1996). The cross-linked product has been designated lysine tyrosylquinone. In addition MALDI-TOF analyses of cross-links between DOPA-containing molecules and proteins identified the α-amino and εamino group of Lys, and the imidazole ring of His as functional groups capable of attacking DOPA via Michael addition mechanism (Liu et al. 2006). Atomic force microscopy (AFM) measurements of a single DOPA residue contacting an amine-modified Si surface showed covalent bond formation between DOPA and amines at the surface (Lee et al. 2006b). Because of these analogies, it is probable that the adhesion mechanisms of MAPs derive, at least in part, from Michael addition reaction which forms amine cross-links as suggested by Waite (1990b) and Burzio et al. (1997).

Veronika Hahn and Annett Mikolasch

158

NH

NH

NH

Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys NH

NH O R

NH

NH

O

R

NH

OH

O

OH R

OH

R

O

OH

NH

NH

Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys-Tyr-Lys NH

R

NH

NH OH OH

OH

OH R

R

OH

OH NH

NH

Figure 9. Model of a three-dimensional network resulting from the reaction of [Tyr-Lys]10 and 3,4dihydroxyphenylpropionic acid (R = CH2CH2COOH) (according to Mikolasch et al. 2010).

3.2.3. Formation of Thiol Cross-Linked Products In addition to amine cross-linked products, thiol cross-links of 2- and 5-ScycteinylDOPA, have been proposed by Burzio et al. (1997) and subsequently characterized from mussel byssi by MALDI-TOF analyses (Zhao and Waite 2005, Zhao and Waite 2006b). The cycteinyl residues served as nucleophiles and underwent Michael addition with ringcarbon atoms of DOPA quinone (Liu et al. 2006) resulting in thiol cross-linked products structural related to the amine cross-links (Figure 10). Michael addition

Quinone unit

Cysteine unit

Thiol cross-link unit

Figure 10. Formation of thiol cross-linked products (derived from Zhao and Waite 2005, Liu et al. 2006, Zhao and Waite 2006b).

Though thiol addition would be expected to be the fastest nucleophilic coupling with quinone intermediates (Sternson et al. 1973, Kato et al. 1986), cysteinyl-DOPA cross-links were detected only in trace amounts in the byssi (Zhao and Waite 2005, Zhao and Waite 2006b) and do not appear to be widely distributed (Holten-Andersen and Waite 2008).

Mussel Glue and Its Prospects in Biotechnology

159

In summary mussels may use different mechanisms to adhere to inorganic and organic surfaces. On inorganic surfaces, such as metals or metal oxides, the unoxidized DOPA can form metal/metal oxide cross-links which are non-covalent and reversible. In contrast, on organic surfaces, such as proteins, oxidized DOPA may bind via covalent biarylic, amine or thiol cross-links.

4. PROSPECTS IN BIOTECHNOLOGY 4.1. Synthetic MAPs and Their Application Possibilities The supply of MAPs for biotechnological research and for potential commercialized biotechnological products can be achieved either by extraction of the MAPs from natural sources or by the use of recombinant protein expression systems (for review see Silverman and Roberto 2007). The disadvantages of the first method are the quality of the protein obtained and the large amount of organisms required. For 1 g protein approximately 10.000 mussels are necessary (Hwang et al. 2007a, Lee et al. 2008). Nevertheless Mefp-1 has been isolated in this way. It is marketed as a mixture mainly of Mefp-1 and Mefp-2 under the name BD Cell-TakTM (Becton-Dickinson, Bedford, MA, USA), as an adhesive which promotes the improved attachment of cells and tissue in culture (Notter 1988, Hwang et al. 2007a, Cha et al. 2008, Lee et al. 2008). MAP isolation from recombinant expression systems also has disadvantages, particularly with respect to the proper posttranslational modification of the nascent protein. This can, however, in part be overcome, for example by the addition of a bacterial or mushroom tyrosinase to hydroxylate tyrosine to DOPA (Marumo and Waite 1986, Strausberg and Link 1990). The great advantage of recombinant systems is that they can in principle provide large amounts of adhesive proteins for biotechnological purposes. Experiments with large scale bioreactor cultures for the synthesis of Mefp-1 (Silverman and Roberto 2006, Lee et al. 2008) or of a fusion protein of peptide sequences from the foot proteins 1 and 5 of Mytilus galloprovincialis (Hwang et al. 2007b, 2008) have been carried out. Adhesion analysis showed that the fusion protein had a superior adhesive property compared with Cell-TakTM (Hwang et al. 2004). MAPs can be used not only to immobilize cells but also enzymes like glucose oxidase suggesting that they may have an important future in the production of biosensors (Saby and Luong 1998). The use of MAPs as adhesive in cell cultures or biosensors may be further extended in medical applications e.g. in dentistry, ophthalmology or surgery. The adhesive strength, low immunogenicity and biodegradability of the MAPs could provide a great benefit for the use in human or animal medicine (Burzio et al. 1997). One example for the in vivo use of MAPs in medicine has been described by Robin et al. (1988). Extracted MAP together with an oxidase as cross-linking agent was used to adhere ophthalmic tissue in rabbits. The researchers reported a supporting function of the MAPs during epikeratoplasty (Robin et al. 1988). A second example for an application in surgery is the prevention of seroma formation after surgical intervention such as mastectomy by MAPs (Chung et al. 2006). In this study CellTakTM was used in an in vivo rat mastectomy model and it was postulated that the adhesive could close so called "dead space" and thereby preventing drainage of tissue channels (Chung et al. 2006).

160

Veronika Hahn and Annett Mikolasch

In addition to the development of new adhesive materials with synthetic MAPs, the production of self-adhesive microencapsulated drug carriers becomes a possibility. Lim et al. (2010) developed a coacervation model with recombinant hybrid MAPs and hyaluronic acid which resulted in an increased adhesive strength. Moreover oil droplets were incorporated in the microencapsulated particles formed by the MAPs showing that the particles can be loaded with drugs dissolved in the oil (Lim et al. 2010). MAPs have also anticorrosive effects due to the complexation property of DOPA towards 3+ Fe and other metal ions (Monahan and Wilker 2003, Sever et al. 2004). This was confirmed by Hansen et al. (1995) who showed the enhanced resistance to corrosion of stainless steel coated with MAP. Additionally, DOPA copolymers together with silver nanoparticles resulted not only in anticorrosive but also antimicrobial property of the steel (Charlot et al. 2009). The development of nonfouling surfaces is another possibile application for MAPs. This is interesting not only for the protection of boats and ships but also for medical implants. For this DOPA or peptide sequences of MAPs are used to anchor poly(ethylene glycol) on surfaces (Dalsin et al. 2003). It was shown that the cell adhesion on such modified surfaces and thereby the fouling properties are markedly reduced. In addition to these direct applications of MAPs in biotechnology, there are some prospects derived from the byssal enzymes tyrosinase and laccase in connection with MAPs.

4.2. Enzymes for the Production of Biomimetic Glues The enzymes tyrosinase and laccase can be used not only for the investigation of the mechanisms of adhesion but also for the production of new biomaterials especially novel glues based on MAPs. For this purpose it is possible to use dihydroxylated monoaromatics like DOPA itself or dipeptides and polypeptides containing a large amount of tyrosine or DOPA together with either of the enzymes.

4.2.1. Tyrosinase In various studies mushroom tyrosinase was analyzed for its ability to oxidize and then cross-link polypeptides (Nagai and Yamamoto 1989, Yamamoto et al. 1990, Tatehata et al. 2000). Yamamoto et al. (1990) examined the bonding strength of a synthetic polypeptide containing tyrosine and lysine without and in the presence of tyrosinase. The tensile strength on iron in the reaction with the enzyme was approx. 23% higher compared with the reaction without tyrosinase. The authors interpreted this in the sense that the tyrosine is enzymatically hydroxylated and oxidzied to DOPA-quinone which than autocatalytically reacts in a Michael-type reaction with the free amino group of lysine. The role of tyrosine and lysine in the adhesion mechanism was also examined by Tatehata et al. (2000). In this study polydipeptides (Y-Lys)n (Y=Gly, Tyr) and polytripeptides (X-Tyr-Lys)n (X=Gly, Ala, Pro, Ser, Leu, Ile, Phe) were incubated with tyrosinase and the shear adhesive strength of the product of this reaction was examined. The experiments showed that the adhesive strength was dependent on the composition of the peptides as well as on their concentration. Thus the adhesive strength of the polydipeptide (Tyr-Lys)n was higher in comparison with the (GlyLys)n polydipeptide whereas it was similar to that of the polytripeptide (Gly-Tyr-Lys)n. Moreover the influence on adhesion of the third amino acid in the polytripeptides beside

Mussel Glue and Its Prospects in Biotechnology

161

tyrosine and lysine was negligible. Additionally the shear adhesive strength was increased approximately 43% as the concentration of the polytripeptide (Gly-Tyr-Lys)n was raised from 5 to 20 wt% (Tatehata et al. 2000). The results confirmed the special relevance of tyrosine and lysine during adhesion and this was also shown in experiments using the enzyme laccase.

4.2.2. Laccase In order to design potential biomaterials based on MAPs and on laccase-catalyzed aminations, cross-linking reactions between L-lysine or lysine-containing peptides and dihydroxylated aromatics were performed in the presence of laccase (Mikolasch et al. 2010). Generally, it was shown that free amino groups of amino acids like L-tryptophan or Lphenylalanine but also L-tyrosine, L-lysine, and glycine can react in a Michael-type reaction with dihydroxylated monoaromatics by use of laccase (Table 2; Manda 2006; Manda et al. 2006; Hahn et al. 2009a, 2009b; Mikolasch et al. 2010). Table 2. Examples of laccase-catalyzed derivatizations of amino acids, dipeptides and oligopeptides (This table is arranged in chronology of the references) Amino Acid L-Tryptophan L-Tyrosine; L-Cystein; L-Lysine Glycine

L-Phenylalanine

L-Phenylalanine

L-Tryptophan L-Tyrosine; L-Lysine; Ac-Lys-OH; Lys(Ac)-OH; H-Tyr-Lys-OH H-Tyr-Lys-OH Z-[Tyr-Lys]-OH; [Tyr-Lys]10

Laccase substrate 2,5-Dihydroxy-N(2-hydroxyethyl)-benzamide 2,5-Dihydroxy-N-(2-hydroxyethyl)benzamide; 2,5-Dihydroxybenzoic acid methyl ester 2,5-Dihydroxy-N-(2-hydroxyethyl)benzamide; 3,4-Dihydroxyphenylpropionic acid para-Hydroquinone; methylated para-Hydroquinones

2,5-Dihydroxyacteophenone; para-Hydroquinone; 2,3-Dimethyl-1,4-hydroquinone 2,5-Dihydroxyacteophenone 2,5-Dihydroxybenzoic acid methyl ester; para-Hydroquinone; 2,5-Dihydroxy-N-(2-hydroxyethyl)benzamide 3,4-Dihydroxyphenylpropionic acid 2,5-Dihydroxy-N-(2-hydroxyethyl)benzamide; 3,4-Dihydroxyphenylpropionic acid

Source of laccase Pycnoporus cinnabarinus Pycnoporus cinnabarinus; Myceliophthora thermophila from Novozymes

Reference Manda et al. 2006 Manda 2006

Pycnoporus cinnabarinus; Myceliophthora thermophila from Novozymes Pycnoporus cinnabarinus; Myceliophthora thermophila from Novozymes Pycnoporus cinnabarinus; Myceliophthora thermophila from Novozymes

Hahn et al. 2009a

Hahn et al. 2009b

Mikolasch et al. 2010

Veronika Hahn and Annett Mikolasch

162

O

OH

O

Laccase, O2

R1

HO NH2

H N

+ R3

R2 OH

L-Phenylalanine

R1

- 2 H2O

R2

O

O OH and

R3 O

R1 HO O

N H

H N

O OH

R3 O

2,5-Dihydroxyarens

Quinonoid dimeric cross-linked product

Quinonoid trimeric cross-linked product

R1 = H, CH3 R2 = H, CH3 R3 = H, CH3

R1 = H, CH3 R2 = H, CH3 R3 = H, CH3

R1 = H, CH3 R2 = R3 = H

Figure 11. Enzymatic derivatization of L-phenylalanine with 2,5-dihydroxy-arens and the resulting heteromolecular quinonoid dimers and trimers (Hahn et al. 2009a).

These reactions involved oxidation coupled with nuclear amination of laccase substrates which were para- or ortho-dihydroxylated monoaromatic compounds and resulted in the formation of heteromolecular quinonoid dimers and/or trimers (Figure 11: reaction of Lphenylalanine and different 2,5-dihydroxy-arens, Hahn et al. 2009a). The dimers consisted of one molecule of the oxidized laccase substrate and one molecule of the amino acid connected via a C-N bond. The trimers were formed of one molecule oxidized laccase substrate and two amino acid molecules (Michalek and Szarkowska 1959). Amino acids with one free amino group like L-phenylalanine have only the -amino group available for an amination on the laccase substrate and hence can produce only one dimer and one trimer, whereas L-lysine, which has both the - and the -amino group, can produce more products. Since the acid-base ionization/dissociation constants (pKa) of the amino group (9.2) is lower than that of the -amino group (10.3) the -amino group should react better than the -amino group. Nevertheless if both the - and the -amino group are able to react with the dihydroxylated compound, L-lysine can aminate twice to produce different dimers, trimers and oligomers. Thus the laccase-catalyzed reactions of 2,5-dihydroxy-arens and L-lysine resulted in the formation of two dimers with high reactivity and tendency to form higher molecular weight products. The N-derivatized L-lysine N-acetyllysine reacted to heteromolecular trimers (Figure 12A; Mikolasch et al. 2010) just like N-acetyllysine. This demonstrates that both the - and the -amino group of the amino acid lysine participates in the laccase-catalyzed C–N coupling reaction (Mikolasch et al. 2010). Furthermore the -amino group of lysine in dipeptides was also able to cross-link dihydroxylated aromatics forming dimers and trimers and presumably higher molecular weight products (Figure 12B; Mikolasch et al. 2010). Additionally, the reaction between an oligopeptide with the structure [Tyr-Lys]10 and dihydroxylated aromatics resulted in crosslinked polymer mixtures (see Figure 9). Hence, these enzymatic reactions may be suitable to cross-link proteins which contain large amounts of lysine and this may be important for developing new types of adhesives and biomaterials. In summary both tyrosinase and laccase possess the potential for the synthesis of new adhesive biomaterials, because intermolecular cross-linking among synthetic peptide molecules catalyzed by these oxidizing enzymes increased the adhesive capability on different surfaces (Yamamoto et al. 2000).

Mussel Glue and Its Prospects in Biotechnology A

163

O O 2 H2N

HN

OH OH

HN

R +

O N-Acetyllysine

H O N

HO Laccase, 3/2 O2

O

- 3 H2O

OH

R H N

O OH

O

HN

O Quinonoid trimeric cross-linked product

2,5-Dihydroxy-arens R = H, CONHCH2CH2OH

B HO

O NH2 O

O OH

OH

N H

O OH Laccase, O2

NH2 + OH

O

HO

NH2

- 2 H2O

O

OH H-Tyr-Lys-OH

3,4-Dihydroxyphenylpropionic acid

N H

OH H N OH OH

Quinonoid dimeric cross-linked product

Figure 12. Enzymatic derivatizations of peptides: A Heteromolecular quinonoid trimers of Nacetyllysine and 2,5-dihydroxy-arens (Mikolasch et al. 2010). B Heteromolecular quinonoid dimer of the dipeptide H-Tyr-Lys-OH and 3,4-dihydroxyphenylpropionic acid (Mikolasch et al. 2010).

CONCLUSION The adhesive process of mussels is a complex mechanism which comprises different proteins with various functions. Further studies are needed to verify the adhesion mechanism and the factors that are involved. The determination of the adhesive properties of biomimetic glues on the basis of MAPs is an additional step which will lead to the development of new adhesive materials for medical and industrial purposes.

ACKNOWLEDGMENTS We thank Sabine Schade for the preparation of figures. Robert Jack (Institute of Immunology, University of Greifswald) is gratefully acknowledged for help in preparing the manuscript.

REFERENCES Adachi, K., Hirata, T., Nagai, K. and Sakaguchi, M. (2001). Hemocyanin a most likely inducer of black spots in kuruma prawn Penaeus japonicus during storage. J. Food Sci., 66, 1130-1136.

164

Veronika Hahn and Annett Mikolasch

Almas, B., Haavik, J. and Flatmark, T. (1996). Characterization of a novel pterin intermediate formed in the catalytic cycle of tyrosine hydroxylase. Biochemical. J., 319, 947-951. Avdeef, A., Sofen, S. R., Bregante, T. L. and Raymond, K. N. (1978). Coordination chemistry of microbial iron transport compounds. 9. Stability constants for catechol models of enterobactin. J. Am. Chem. Soc., 100, 5362-5370. Aviram, A., Selden, P. E. and Ratner, M. A. (1982). Theoretical and experimental studies of hemiquinones and comments on their suitability for molecular information storage elements. In F. L. Carter (Ed.), Molecular electronic devices (pp. 5-17). New York: Marcel Dekker. Beltramini, M., Salvato, B., Santamaria, M. and Lerch, K. (1990). The Reaction of Cn- with the binuclear copper site of Neurospora tyrosinase - Its relevance for a comparison between tyrosinase and hemocyanin active sites. Biochim. Biophys. Acta, 1040, 365-372. Benedict, C. V. and Waite, J. H. (1986). Composition and ultrastructure of the byssus of Mytilus edulis. J. Morphol., 189, 261-270. Bligny, R. and Douce, R. (1983). Excretion of laccase by sycamore (Acer pseudoplatanus L.) cells. Purification and properties of the enzyme. Biochem. J., 209, 489-496. Brown, C. H. (1952). Some structural proteins of Mytilus edulis. Quart. J. Microscop. Sci., 93, 487-503. Brown, B. R. (1967). Biochemical aspects of oxidative coupling of phenols. Chapter 4. In W. J. Taylor, and A. R. Battersby (Eds.), Oxidative coupling of phenols (pp 167-201). New York: Marcel Dekker. Burzio, L. A., Burzio, V. A., Pardo, J. and Burzio, L. O. (2000). In vitro polymerization of mussel polyphenolic proteins catalyzed by mushroom tyrosinase. Comp. Biochem. Physiol. B Biochem. Mol. Biol., 126, 383-389. Burzio, L. A. and Waite, J. H. (2000). Cross-linking in adhesive quinoproteins: Studies with model decapeptides. Biochemistry, 39, 11147-11153. Burzio, L. O., Burzio, V. A., Silva, T., Burzio, L. A. and Pardo, J. (1997). Environmental bioadhesion: themes and applications. Curr. Opin. Biotechnol., 8, 309-312. Call, H. P. and Mücke, I. (1997). History, overview and applications of mediated lignolytic systems, especially laccase-mediator-systems (Lignozym®-process). J. Biotechnol., 53, 163-202. Cha, H. J., Dong, S. H., Seonghye, L. (2008). Development of bioadhesives from marine mussels. Biotechnol. J., 3, 631-638. Charlot, A., Sciannamea, V., Lenoir, S., Faure, E., Jerome, R., Jerome, C., van de Weerdt, C., Martial, J., Archambeau, C., Willet, N., Duwez, A. S., Fustin, C. A. and Detrembleur, C. (2009). All-in-one strategy for the fabrication of antimicrobial biomimetic films on stainless steel. J. Mater. Chem., 19, 4117-4125. Chirdon, W. M., O'Brien, W. J. and Robertson, R. E. (2003). Adsorption of catechol and comparative solutes on hydroxyapatite. J. Biomed. Mater. Res. B Appl. Biomater., 66, 532-538. Chung, T. L., Holton, L. H., Goldberg, N. H. and Silverman, R. P. (2006). Seroma prevention using Mytilus edulis protein in a rat mastectomy model. Breast J., 12, 442-445. Coombs, T. L. and Keller, P. J. (1981). Mytilus byssal threads as an environmental marker for metals. Aquat.Toxicol., 1, 291-300.

Mussel Glue and Its Prospects in Biotechnology

165

Coulon, J., Truchet, M. and Martoja, R. (1987). Chemical features of mussels (Mytilus edulis) in situ exposed to an effluent of the titanium dioxide industry. Ann. Inst. oceanogr., Paris, 63, 89-100. Coyne, K. J., Qin, X. X. and Waite, J. H. (1997). Extensible collagen in mussel byssus: A natural block copolymer. Science, 277, 1830-1832. Dalsin, J. L., Hu, B. H., Lee, B. P. and Messersmith, P. B. (2003). Mussel adhesive protein mimetic polymers for the preparation of nonfouling surfaces. J. Am. Chem. Soc., 125, 4253-4258. Dalsin, J. L., Lin, L. J., Tosatti, S., Voros, J., Textor, M. and Messersmith, P. B. (2005). Protein resistance of titanium oxide surfaces modified by biologically inspired mPEGDOPA. Langmuir, 21, 640-646. Dawley, R. M. and Flurkey, W. H. (1993). Differentiation of tyrosinase and laccase using 4hexyl-resorcinol, a tyrosinase inhibitor. Phytochemistry, 33, 281-284. Decker, H. and Jaenicke, E. (2004). Recent findings on phenoloxidase activity and antimicrobial activity of hemocyanins. Dev. Comp. Immunol., 28, 673-687. Decker, H. and Terwilliger, N. (2000). Cops and robbers: Putative evolution of copper oxygen-binding proteins. J. Exp. Biol., 203, 1777-1782. Deming, T. J. (1999). Mussel byssus and biomolecular materials. Curr. Opin. Chem. Biol., 3, 100-105. Eicken, C., Krebs, B. and Sacchettini, J. C. (1999). Catechol oxidase - structure and activity. Curr. Opin. Struct. Biol., 9, 677-683. Filpula, D. R., Lee, S. M., Link, R. P., Strausberg, S. L. and Strausberg, R. L. (1990). Structural and functional repetition in a marine mussel adhesive protein. Biotechnol. Prog., 6, 171-177. Haavik, J. and Toska, K. (1998). Tyrosine hydroxylase and Parkinson's disease. Mol. Neurobiol., 16, 285-309. Haemers, S., Koper, G. J. M. and Frens, G. (2003). Effect of oxidation rate on cross-linking of mussel adhesive proteins. Biomacromol., 4, 632-640. Hahn, V., Mikolasch, A., Manda, K., Gördes, D., Thurow, K. and Schauer, F. (2009a). Laccase-catalyzed carbon–nitrogen bond formation: Coupling and derivatization of unprotected L-phenylalanine with different para-hydroquinones. Amino Acids, 37, 315321. Hahn, V., Mikolasch, A., Manda, K., Gördes, D., Thurow, K. and Schauer, F. (2009b). Derivatization of amino acids by fungal laccases: Comparison of enzymatic and chemical methods. J. Mol. Catal. B: Enzym., 60, 76-81. Halaouli, S., Asther, M., Sigoillot, J. C., Hamdi, M. and Lomascolo, A. (2006). Fungal tyrosinases: new prospects in molecular characteristics, bioengineering and biotechnological applications. J. Appl. Microbiol., 100, 219-232. Hansen, D. C., Dexter, S. C. and Waite, J. H. (1995). The inhibition of corrosion of S30403 stainless-steel by a naturally occuring catecholic polymer. Corrosion Sci., 37, 1423-1441. Hansen, D. C. and Waite, J. H. (1991). Marine metal chelating proteins. Am. Chem. Soc. Symp. Ser., 444, 256-262. Harrington, M. J., Masic, A., Holten-Andersen, N., Waite, J. H. and Fratzl, P. (2010). Ironclad fibers: a metal-based biological strategy for hard flexible coatings. Science, 328, 216-220.

166

Veronika Hahn and Annett Mikolasch

Hellio, C., Bourgougnon, N. and Le Gal, Y. (2000). Phenoloxidase (EC 1.14.18.1) from the byssus gland of Mytilus edulis: Purification, partial characterization and application for screening products with potential antifouling activities. Biofouling, 16, 235-244. Himmelwright, R. S., Eickman, N. C., Lubien, C. D., Lerch, K. and Solomon, E. I. (1980). Chemical and spectroscopic studies of the binuclear copper active site of Neurospora tyrosinase - Comparision to hemocyanins. J. Am. Chem. Soc., 102, 7339-7344. Holl, S. M., Hansen, D., Waite, J. H. and Schaefer, J. (1993). Solid-state NMR analysis of cross-linking in mussel protein glue. Arch. Biochem. Biophys., 302, 255-258. Holten-Andersen, N., Mates, T. E., Toprak, M. S., Stucky, G. D., Zok, F. W. and Waite, J. H. (2009). Metals and the integrity of a biological coating: The cuticle of mussel byssus. Langmuir, 25, 3323-3326. Holten-Andersen, N. and Waite, J. H. (2008). Mussel-designed protective coatings for compliant substrates. J. Dent. Res., 87, 701-709. Hwang, D. S., Gim, Y., Kang, D. G., Kim, Y. K. and Cha, H. J. (2007a). Recombinant mussel adhesive protein Mgfp-5 as cell adhesion biomaterial. J. Biotechnol., 127, 727-735. Hwang, D. S., Gim, Y., Yoo, H. J. and Cha, H. J. (2007b). Practical recombinant hybrid mussel bloadhesive fp-151. Biomaterials, 28, 3560-3568. Hwang, D. S., Lim, S. and Cha, H. J. (2008). Smart hybrid mussel adhesive materials for cell and tissue engineering. Adv. Mater. Res., 47-50, 861-864. Hwang, D. S., Yoo, H. J., Jun, J. H., Moon, W. K. and Cha, H. J. (2004). Expression of functional recombinant mussel adhesive protein Mgfp-5 in Escherichia coli. Appl. Environ. Microbiol., 70, 3352-3359. Inoue, K., Takeuchi, Y., Miki, D. and Odo, S. (1995). Mussel adhesive plaque protein gene is a novel member of epidermal growth factor-like gene family. J. Biol. Chem., 270, 66986701. Inoue, K., Takeuchi, Y., Miki, D., Odo, S., Harayama, S. and Waite, J. H. (1996). Cloning, sequencing and sites of expression of genes for the hydroxyarginine-containing adhesiveplaque protein of the mussel Mytilus galloprovincialis. Eur. J. Biochem., 239, 172-176. Kahn, V. and Andrawis, A. (1985). Inhibition of mushroom tyrosinase by tropolone. Phytochemistry, 24, 905-908. Kato, T., Ito, S. and Fujita, K. (1986). Tyrosinase-catalyzed binding of 3,4dihydroxyphenylalanine with proteins through the sulfhydryl-group. Biochim. Biophys. Acta, 881, 415-421. Keilin, D. and Mann, T. (1939). Laccase, a blue copper-protein oxidase from the latex of Rhus succedanea. Nature, 143, 23-24. Klibanov, A. M., Berman, Z. and Alberti, B. N. (1981). Preparative hydroxylation of aromatic-compounds catalyzed by peroxidase. J. Am. Chem. Soc., 103, 6263-6264. Klug, C. A., Burzio, L. A., Waite, J. H. and Schaefer, J. (1996). In situ analysis of peptidyl DOPA in mussel byssus using rotational-echo double-resonance NMR. Arch. Biochem. Biophys., 333, 221-224. Kramer, K. J., Kanost, M. R., Hopkins, T. L., Jiang, H. B., Zhu, Y. C., Xu, R. D., Kerwin, J. L. and Turecek, F. (2001). Oxidative conjugation of catechols with proteins in insect skeletal systems. Tetrahedron, 57, 385-392. Laufer, Z., Beckett, R. P. and Minibayeva, F. V. (2006). Co-occurrence of the multicopper oxidases tyrosinase and laccase in lichens in sub-order Peltigerineae. Ann. Botany, 98, 1035-1042.

Mussel Glue and Its Prospects in Biotechnology

167

Lee, B. P., Chao, C. Y., Nunalee, F. N., Motan, E., Shull, K. R. and Messersmith, P. B. (2006a). Rapid gel formation and adhesion in photocurable and biodegradable block copolymers with high DOPA content. Macromol., 39, 1740-1748. Lee, H., Scherer, N. F. and Messersmith, P. B. (2006b). Single-molecule mechanics of mussel adhesion. Proc. Natl. Acad. Sci. U.S.A., 103, 12999-13003. Lee, S. J., Han, Y. H., Nam, B. H., Kim, Y. O. and Reeves, P. R. (2008). A novel expression system for recombinant marine mussel adhesive protein Mefp1 using a truncated OmpA signal peptide. Mol. Cells, 26, 34-40. Lehman, E., Harel, E. and Mayer, A. M. (1974). Copper content and other characteristics of purified peach laccase. Phytochemistry, 13, 1713-1717. Leonowicz, A. and Malinowska, M. (1982). Purification of the constitutive and inducible forms of laccase of the fungus Pholiota mutabilis by affinity-chromatography. Acta Biochim. Pol., 29, 219-226. Lieb, B., Altenhein, B., Markl, J., Vincent, A., van Olden, E., van Holde, K. E. and Miller, K. I. (2001). Structures of two molluscan hemocyanin genes: Significance for gene evolution. Proc. Natl. Acad. Sci. U.S.A., 98, 4546-4551. Lim, S., Choi, Y. S., Kang, D. G., Song, Y. H. and Cha, H. J. (2010). The adhesive properties of coacervated recombinant hybrid mussel adhesive proteins. Biomaterials, 31, 37153722. Lin, Q., Gourdon, D., Sun, C. J., Holten-Andersen, N., Anderson, T. H., Waite, J. H. and Israelachvili, J. N. (2007). Adhesion mechanisms of the mussel foot proteins mfp-1 and mfp-3. Proc. Natl. Acad. Sci. U.S.A., 104, 3782-3786. Liu, B., Burdine, L. and Kodadek, T. (2006). Chemistry of periodate-mediated cross-linking of 3,4-dihydroxylphenylalanine-containing molecules to proteins. J. Am. Chem. Soc., 128, 15228-15235. Manda, K. (2006). Biotransformation von Aminosäuren, Peptiden und dihydroxylierten Aromaten durch Laccasen aus Pilzen zur Herstellung von Hybridmolekülen. Dissertation. Mat.-Nat. Fakultät. E.-M.-Arndt-Universität Greifswald. Manda, K., Hammer, E., Mikolasch, A., Gördes, D., Thurow, K. and Schauer, F. (2006). Laccase-induced derivatization of unprotected amino acid L-tryptophan by coupling with p-hydroquinone 2,5-dihydroxy-N-(2-hydroxyethyl)-benzamide. Amino Acids., 31, 409419. Martinez-Alvarez, O., Gomez-Guillen, C. and Montero, P. (2008). Presence of hemocyanin with diphenoloxidase activity in deepwater pink shrimp (Parapenaeus longirostris) post mortem. Food Chem., 107, 1450-1460. Marumo, K. and Waite, J. H. (1986). Optimization of hydroxylation of tyrosine and tyrosinecontaining peptides by mushroom tyrosinase. Biochim. Biophys. Acta, 872, 98-103. McBride, M. B. and Wesselink, L. G. (1988). Chemisorption of catechol on gibbsite, boehmite, and noncrystalline alumina surfaces. Environ. Sci. Technol., 22, 703-708. McDowell, L. M., Burzio, L. A., Waite, J. H. and Schaefer, J. (1999). Rotational echo double resonance detection of cross-links formed in mussel byssus under high-flow stress. J. Biol. Chem., 274, 20293-20295. Mellema, J. E. and Klug, A. (1972). Quaternary structure of gastropod hemocyanin. Nature, 239, 146-150. Michalek, H., Szarkowska, L. (1959). The quinose-amino acid complexes and polyphenolase. Acta Biochim. Pol., 6, 399-409.

168

Veronika Hahn and Annett Mikolasch

Mikolasch, A., Hahn, V., Manda, K., Pump, J., Illas, N., Gördes, D., Lalk, M., Gesell Salazar, M., Hammer, E., Jülich, W. D., Rawer, S., Thurow, K., Lindequist, U. and Schauer, F. (2010). Laccase-catalyzed cross-linking of amino acids and peptides with dihydroxylated aromatic compounds. Amino Acids, DOI 10.1007/s00726-010-0488-4. Mikolasch, A. and Schauer, F. (2009). Fungal laccases as tools for the synthesis of new hybrid molecules and biomaterials. Appl. Microbiol. Biotechnol., 82, 605-624. Monahan, J. and Wilker, J. J. (2003). Specificity of metal ion cross-linking in marine mussel adhesives. Chem. Commun., (14), 1672-1673. Monahan, J. and Wilker, J. J. (2004). Cross-linking the protein precursor of marine mussel adhesives: Bulk measurements and reagents for curing. Langmuir, 20, 3724-3729. Nagai, A. and Yamamoto, H. (1989). Insolubilizing studies of water-soluble Poly(Lys Tyr) by tyrosinase. Bull. Chem. Soc. Jpn., 62, 2410-2412. Nagatsu, T. (2006). The catecholamine system in health and disease - Relation to tyrosine 3monooxygenase and other catecholamine-synthesizing enzymes. Proc. Jpn. Acad., Ser. B, 82, 388-415. Notter, M. F. D. (1988). Selective attachment of neural cells to specific substrates including cell-tak, a new cellular adhesive. Exp. Cell Res., 177, 237-246. Ohman, L. O. and Sjoberg, S. (1983). Equilibrium and structural studies of silicon(Iv) and aluminum(Iii) in aqueous-solution. 10. A potentiometric study of aluminum(Iii) pyrocatecholates and aluminum(Iii) hydroxo pyrocatecholates in 0.6M Na(Cl). Polyhedron, 2, 1329-1335. Ooka, A. A. and Garrell, R. L. (2000). Surface-enhanced Raman spectroscopy of DOPAcontaining peptides related to adhesive protein of marine mussel, Mytilus edulis. Biopolymers, 57, 92-102. Oppenheim, F. G., Offner, G. D. and Troxler, R. F. (1982). Phosphoproteins in the parotid saliva from the subhuman primate Macaca fascicularis - Isolation and characterization of a proline-rich phosphoglycoprotein and the complete covalent structure of a proline-rich phosphopeptide. J. Biol. Chem., 257, 9271-9282. Papov, V. V., Diamond, T. V., Biemann, K. and Waite, J. H. (1995). Hydroxyargininecontaining polyphenolic proteins in the adhesive plaques of the marine mussel Mytilus edulis. J. Biol. Chem., 270, 20183-20192. Pentreath, R. J. (1973). The accumulation from water of 65Zn, 54Mn, 58Co, and 59Fe by the mussel Mytilus edulis. J. Mar. Biol. Assoc. U.K., 53, 127-143. Petroski, R. J., Peczynska-Czoch, W. and Rosazza, J. P. (1980). Analysis, production, and isolation of an extracellular laccase from Polyporus anceps. Appl. Environ. Microbiol., 40, 1003-1006. Pierpont, C. G. and Buchanan, R. M. (1981). Transition-metal complexes of orthobenzoquinone, ortho-semiquinone, and catecholate ligands. Coord. Chem. Rev., 38, 4587. Qin, X. X., Coyne, K. J. and Waite, J. H. (1997). Tough tendons - Mussel byssus has collagen with silk-like domains. J. Biol. Chem., 272, 32623-32627. Qin, X. X. and Waite, J. H. (1995). Exotic collagen gradients in the byssus of the mussel Mytilus edulis. J. Exp. Biol., 198, 633-644. Qin, X. X. and Waite, J. H. (1998). A potential mediator of collagenous block copolymer gradients in mussel byssal threads. Proc. Natl. Acad. Sci. U.S.A., 95, 10517-10522.

Mussel Glue and Its Prospects in Biotechnology

169

Robin, J. B., Picciano, S. K., Salazar, J. and Benedict, C. (1988). Preliminary evaluation of the use of mussel adhesive protein in experimental epikeratoplasty. Arch. Ophthalmol., 106, 973-977. Rodriguez, R., Blesa, M. A. and Regazzoni, A. E. (1996). Surface complexation at the TiO2 (anatase) aqueous solution interface: Chemisorption of catechol. J. Colloid Interface Sci., 177, 122-131. Rzepecki, L. M., Hansen, K. M. and Waite, J. H. (1992). Characterization of a cystine-rich polyphenolic protein family from the blue mussel Mytilus edulis L. Biol. Bull., 183, 123137. Rzepecki, L. M., Nagafuchi, T. and Waite, J. H. (1991). Alpha, beta-dehydro-3,4dihydroxyphenylalanine derivatives - potential schlerotization intermediates in natural composite-materials. Arch. Biochem. Biophys., 285, 17-26. Rzepecki, L. M. and Waite, J. H. (1991). Alpha,beta-dehydro-3,4-bihydroxyphenylalanine derivatives - rate and mechanism of formation. Arch. Biochem. Biophys., 285, 27-36. Saby, C. and Luong, J. H. T. (1998). Mytilus edulis adhesive protein (MAP) as an enzyme immobilization matrix in the fabrication of enzyme-based electrodes. Electroanalysis, 10, 1193-1199. Schaefer, J., Kramer, K. J., Garbow, J. R., Jacob, G. S., Stejskal, E. O., Hopkins, T. L. and Speirs, R. D. (1987). Aromatic cross-links in insect cuticle - detection by solid-state C-13 and N-15 NMR. Science, 235, 1200-1204. Schmitt, L., Ludwig, M., Gaub, H. E. and Tampe,R. (2000). A metal-chelating microscopy tip as a new toolbox for single-molecule experiments by atomic force microscopy. Biophys. J., 78, 3275-3285. Sever, M. J., Weisser, J. T., Monahan, J., Srinivasan, S. and Wilker, J. J. (2004). Metalmediated cross-linking in the generation of a marine-mussel adhesive. Angew. Chem. Int. Ed., 43, 448-450. Silverman, H. G. and Roberto, F. F. (2006). Cloning and expression of recombinant adhesive protein Mefp-1 of the blue mussel, Mytilus edulis. US6987170B. Patent to Idaho National Laboratory. Silverman, H. G. and Roberto, F. F. (2007). Understanding marine mussel adhesion. Mar. Biotechnol., 9, 661-681. Smyth, J. D. (1954). A technique for the histochemical demonstration of polyphenol oxidase and its application to egg-shell formation in helminths and byssus formation in Mytilus. Quart. J. Microscop. Sci., 95, 139-152. Solomon, E. I., Chen, P., Metz, M., Lee, S.-K. and Palmer, A. E. (2001). Oxygen binding, activation, and reduction to water by copper proteins. Angew. Chem. Int. Ed., 40, 45704590. Solomon, E. I., Tuczek, F., Root, D. E. and Brown, C. A. (1994). Spectroscopy of binuclear dioxygen complexes. Chem. Rev., 94, 827-856. Stahmann, M. A. and Spencer, A. K. (1977). Deamination of protein lysyl epsilon-amino groups by peroxidase in vitro. Biopolymers, 16, 1299-1306. Sternson, A. W., McCreery, R., Feinberg, B. and Adams, R. N. (1973). Electrochemical studies of adrenergic neurotransmitters and related compounds. J. Electroanal. Chem., 46, 313-321. Strausberg, R. L. and Link, R. P. (1990). Protein-based medical adhesives. Trends Biotechnol., 8, 53-57.

170

Veronika Hahn and Annett Mikolasch

Sun, C. J. and Waite, J. H. (2005). Mapping chemical gradients within and along a fibrous structural tissue, mussel byssal threads. J. Biol. Chem., 280, 39332-39336. Tadesse, M. A., D'Annibale, A., Galli, C., Gentili, P. and Sergi, F. (2008) An assessment of the relative contributions of redox and steric issues to laccase specificity towards putative substrates. Org. Biomol. Chem., 6, 868-878. Tateda, Y. and Koyanagi, T. (1986). Accumulation of radionuclides by common mussel Mytilus edulis and purplish bifurcate mussel Septifer virgatus. Bull. Jpn. Soc. Sci. Fish., 52, 2019-2026. Tatehata, H., Mochizuki, A., Kawashima, T., Shuzo, Y. and Yamamoto, H. (2000). Model polypeptide of mussel adhesive protein. I. Synthesis and adhesive studies of sequential polypeptides (X-Tyr-Lys)n and (Y-Lys)n. J. Appl. Polym. Sci., 76, 929-937. Taylor, S. W., Chase, D. B., Emptage, M. H., Nelson, M. J. and Waite, J. H. (1996). Ferric ion complexes of a Dopa-containing adhesive protein from Mytilus edulis. Inorg. Chem., 35, 7572-7577. Taylor, S. W., Luther, G. W. and Waite, J. H. (1994b). Polarographic and spectrophotometric investigation of iron(III) complexation to 3,4-dihydroxyphenylalanine-containing peptides and proteins from Mytilus edulis. Inorg. Chem., 33, 5819-5824. Taylor, S. W., Waite, J. H., Ross, M. M., Shabanowitz, J. and Hunt, D. F. (1994a). Trans-2,3cis-3,4-dihydroxyproline, A new naturally-occurring amino-acid, is the 6Th residue in the tandemly repeated consensus decapeptides of an adhesive protein from Mytilus edulis. J. Am. Chem. Soc., 116, 10803-10804. van Deurzen, M. P. J., van Rantwijk, F. and Sheldon, R. A. (1997). Selective oxidations catalyzed by peroxidases. Tetrahedron, 53, 13183-13220. van Gelder, C. W. G., Flurkey, W. H. and Wichers, H. J. (1997). Sequence and structural features of plant and fungal tyrosinases. Phytochemistry, 45, 1309-1323. Vreeland, V., Waite, J. H. and Epstein, L. (1998). Polyphenols and oxidases in substratum adhesion by marine algae and mussels. J. Phycol., 34, 1-8. Waite, J. H. (1983) Evidence for a repeating 3,4-dihydroxyphenylalanine- and hydroxyproline-containing decapeptide in the adhesive protein of the mussel, Mytilus edulis L.. J. Biol. Chem., 258, 2911-2915. Waite, J. H. (1985). Catechol oxidase in the byssus of the common mussel, Mytilus edulis L. J. Mar. Biol. Assoc. U.K., 65, 359-371. Waite, J. H. (1990a). Marine adhesive proteins: natural composite thermosets. Int. J. Biol. Macromol., 12, 139-144. Waite, J. H. (1990b). The phylogeny and chemical diversity of quinone-tanned glues and varnishes. Comp. Biochem. Physiol., 97B(No.1), 19-29. Waite, J. H. (1992a). The formation of mussel byssus: anatomy of a natural manufacturing process. Results Probl. Cell Differ., 19, 27-54. Waite, J. H. (1992b). The Dopa Ephemera - A recurrent motif in invertebrates. Biol. Bull., 183, 178-184. Waite, J. H. (1999). Reverse engineering of bioadhesion in marine mussels. Ann. N.Y. Acad. Sci. 875, 301-309. Waite, J. H. (2002). Adhesion à la Moule. Integr. Comp. Biol., 42, 1172-1180. Waite, J. H., Housley, T. J. and Tanzer, M. L. (1985). Peptide repeats in a mussel glue protein: theme and variations. Biochemistry, 24, 5010-5014.

Mussel Glue and Its Prospects in Biotechnology

171

Waite, J. H. and Qin, X. X. (2001). Polyphosphoprotein from the adhesive pads of Mytilus edulis. Biochemistry, 40, 2887-2893. Wang, S. X., Mure, M., Medzihradszky, K. F., Burlingame, A. L., Brown, D. E., Dooley, D. M., Smith, A. J., Kagan, H. M. and Klinman, J. P. (1996). A crosslinked cofactor in lysyl oxidase: Redox function for amino acid side chains. Science, 273, 1078-1084. Warner, S. C. and Waite, J. H. (1999). Expression of multiple forms of an adhesive plaque protein in an individual mussel, Mytilus edulis. Mar. Biol., 134, 729-734. Xu, C. J., Xu, K. M., Gu, H. W., Zheng, R. K., Liu, H., Zhang, X. X., Guo, Z. H. and Xu, B. (2004). Dopamine as a robust anchor to immobilize functional molecules on the iron oxide shell of magnetic nanoparticles. J. Am. Chem. Soc., 126, 9938-9939. Yamamoto, H., Kuno, S., Nagai, A., Nishida, A., Yamauchi, S. and Ikeda, K. (1990). Insolubilizing and adhesive studies of water-soluble synthetic model proteins. Int. J. Biol. Macromol., 12, 305-310. Yamamoto, H., Ogawa, T. and Nishida, A. (1997). Studies on quinone cross-linking adhesion mechanism and preparation of antifouling surfaces toward the blue mussel. J. Mar. Biotechnol., 5, 133-136. Yamamoto, H., Sakai, Y. and Ohkawa, K. (2000). Synthesis and wettability characteristics of model adhesive protein sequences inspired by a marine mussel. Biomacromol., 1, 543551. Yu, M. and Deming, T. J. (1998). Synthetic polypeptide mimics of marine adhesives. Macromol., 31, 4739-4745. Yu, M. E., Hwang, J. Y. and Deming, T. J. (1999). Role of L-3,4-dihydroxyphenylalanine in mussel adhesive proteins. J. Am. Chem. Soc., 121, 5825-5826. Zentz, F., Hellio, C., Valla, A., de la Broise, D., Bremer, G. and Labia, R. (2002). Antifouling activities of N-substituted imides: Antimicrobial activities and inhibition of Mytilus edulis phenoloxidase. Mar. Biotechnol., 4, 431-440. Zhao, H., Robertson, N. B., Jewhurst, S. A. and Waite, J. H. (2006). Probing the adhesive footprints of Mytilus californianus byssus. J. Biol. Chem., 281, 11090-11096. Zhao, H. and Waite, J. H. (2005). Coating proteins: Structure and cross-linking in fp-1 from the green shell mussel Perna canaliculus. Biochemistry, 44, 15915-15923. Zhao, H. and Waite, J. H. (2006a). Proteins in load-bearing junctions: The histidine-rich metal-binding protein of mussel byssus. Biochemistry, 45, 14223-14231. Zhao, H. and Waite, J. H. (2006b). Linking adhesive and structural proteins in the attachment plaque of Mytilus californianus. J. Biol. Chem., 281, 26150-26158. Zlateva, T., di Muro, P., Salvato, B. and Beltramini, M. (1996). The o-diphenol oxidase activity of arthropod hemocyanin. FEBS Lett., 384, 251-254. Zlateva, T., Santagostini, L., Bubacco, L., Casella, L., Salvato, B. and Beltramini, M. (1998). Isolation of the met-derivative intermediate in the catalase-like activity of deoxygenated Octopus vulgaris hemocyanin. J. Inorg. Biochem., 72, 211-215.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 7

MOLECULAR DETERMINANTS IN MUSSELS AS BIOMARKERS FOR ENVIRONMENTAL STRESS Sutin Kingtong1 and Tavan Janvilisri2 1

Department of Biology, Faculty of Science, Burapha University, Chonburi 20131, Thailand 2 Department of Biology, Faculty of Science, Mahidol University, Bangkok 10400, Thailand

ABSTRACT Mussels comprise members of several families including clams and bivalvia mollusca from both marine and freshwater habitats. They are distributed worldwide and are implicated as bio-indicators for environmental stress. These animals are exposed to a variety of pollutants of industrial, agricultural and urban origin. The accumulation of several anthropogenic agents in their tissues suggests that they possess mechanisms that allow them to cope with the toxic effects of these contaminants. Besides pollutant uptake, this paper presents an overview of the significance of the use of molecular biomarkers in mussels as diagnostic and prognostic tools for marine and freshwater pollution monitoring. Biomarkers complement the information of the direct chemical characterization of different types of contaminants. This review focuses on several types of biomarkers classified according to their functional roles in normal tissues, their respective expression following the exposure to harmful contaminants and their relevant physiological aspects in term of response to environmental stress. Evidence from both experimental laboratory conditions as well as field studies will be taken into account in a perspective of a multi-biomarker approach to assess environmental changes.

INTRODUCTION Bivalve mussels are sessile organisms that live in the interface between sediment and water. They filter large volumes of water, including suspended materials and colloids; 

Corresponding author: Tel: +662-201-5478; Fax: +662-354-7161; Email: [email protected]

174

Sutin Kingtong and Tavan Janvilisri

therefore they are effective concentrators for toxic substances. They have the capacity to adapt and colonize extreme environments characterized by a wide range of physical conditions including temperature and salinity, and are extremely tolerant towards sudden alterations of both abiotic and biotic factors. Due to their wide geographical distribution, availability in the field, feasibility in aquaculture, suitability for transplanting experiments as well as their consistent responses developed following the exposure to chemical toxicants contaminated in the water bodies, both freshwater and marine mussels have been widely employed as model organisms to evaluate the adverse effects of contaminants in the aquatic environments in term of physiological, biochemical, genetic, and toxicological studies as well as pollution indicator species. The first systematic bio-monitoring program ‗Mussel Watch‘ was launched in the United States in the 1970s [1]. Over the past years, mussels have been the subject of the routine environmental bio-monitoring programs at the international level including the Assessment and Control of Pollution in the Mediterranean region (MED-POL) [2], the Biological Markers of Environmental Contamination in Marine Ecosystems (BIOMAR) [3], the North-East Atlantic Environment OSPAR convention of the European Community [4], the European Union Biological Effects of Environmental Pollution Program (BEEP) [5], and the RAMOGE agreement [6]. Substantial amounts of pollutants are entering the aquatic habitats worldwide, posing a critical environmental issue to several communities. The sustainability of water resources can only be achieved via monitoring the environmental quality of the aquatic media. Responses to the toxic effects of exposure to chemical contaminants by the bio-indicator organisms including mussels at the molecular, cellular and organismic levels have been widely used in environmental monitoring studies. As biomarker responses allow access to the effects of sublethal stress to bio-indicators, therefore, they can be predictive and anticipatory prior to irreversible impairment at the population and community levels. Thus, biomarkers exhibit the capability to diagnose causes and act as early warning alarms for ecosystem-level damage. Molecular determinants in mussels designate their corresponding functions at the lowest fundamental biological hierarchies; therefore they are more sensitive and responsive to stress exposure with respect to other types of biomarkers at higher biological hierarchies. Taking into account the importance and potential use of molecular determinants in mussels as biomarkers for environmental stress without exhaustively covering all available data in the literature, the present article will focus on a number of molecular biomarkers, which have been widely studied both in vitro and in vivo as well as in laboratory-based and field investigations.

1. ANTIOXIDANT ENZYMES In living organisms, free radicals and reactive oxygen species are usually produced and maintained in the process of redox homeostasis and can be used for advantageous biological effects [7]. However, an imbalance in homeostasis of free radicals and reactive oxygen species, which is induced by environmental toxicants, is responsible for oxidative stress and damage to lipids, proteins, and DNA in the cells [8]. According to the sensitivity in term of responsiveness of antioxidant enzymes to the environmental pollutants, they are extensively used as molecular biomarkers for environmental stress. The prominent antioxidant enzymes

Molecular Determinants in Mussels as Biomarkers for Environmental Stress

175

that have been extensively used as molecular biomarkers for stress response include superoxide dismutase (SOD, EC 1.15.1.1), catalase (CAT, EC 1.11.1.6), glutathione peroxidase (GSH-Px, EC 1.11.1.9), glutathione reductase (GR, EC 1.6.4.2) and the phase II biotransformation enzyme glutathione-S-transferase (GST, EC 2.5.1.18) [7]. SOD is a class of enzymes that catalyze the dismutation of superoxide radicals (O2•−), which are common byproducts of oxygen metabolism into hydrogen peroxide (H2O2) and oxygen. Depending on the metal cofactor, SOD enzymes are classified into three major families, which are (i) Cu/Zn type which binds both copper and zinc; (ii) Fe/Mn type which binds either iron or manganese; and (iii) Ni type which binds to nickel [9]. CAT is a heme-containing enzyme that catalyzes the conversion of H2O2 to water and oxygen [8]. CAT is commonly found in nearly all organisms and has been shown to be involved in the initial anti-oxidative mechanism, which plays an important role in antioxidant defense in aquatic invertebrates [10]. GSH-Px is a family of peroxidase enzymes that reduce lipid hydroperoxides to their corresponding alcohols and to reduce free hydrogen peroxide to water [11]. GR is an ancillary flavo-enzyme that reduces glutathione disulfide to the sulfhydryl form glutathione, which uses NADPH as electron donor. This catalytic cycle lowers the NADPH/NADP+ ratio that in turn should be maintained in the high level in order to prevent oxidative damage [12]. GST enzymes mediate the conjugation of reduced glutathione via a sulfhydryl group to electrophilic centers on a wide variety of substrates. This activity detoxifies endogenous compounds such as peroxidized lipids, as well as breakdown of xenobiotics [13]. A number of experimental studies reveal that the exposure of mussels to pollutants can elevate the level of certain antioxidant enzymes as a defense mechanism against toxic stress. The immunocytochemical localization of antioxidant enzymes, CAT, SOD in both the Cu/Zn and the Mn forms, and GSH-Px, was carried out in the blood cells and hemolymph of the blue mussel Mytilus edulis [14]. The results revealed that the Cu/Zn SOD antibody localized in association with the plasma membrane of the hyalinocytes. The granular hemocytes gave a positive reaction for all the antibodies investigated. Catalase was localized in small electrondense granules indicating that these granules are peroxisomes. Both forms of the SOD were associated with granules, with the labeling density generally lower for the Mn form. Results from both field and laboratory-based investigations have shown that the mussel antioxidant enzymes are sensitive to environmental stress that is associated with pollution and physical factors. The use of antioxidant enzymes as molecular biomarkers of environmental stress have been continuously reported in both freshwater and marine mussels. For example, Doyotte and coworkers [15] studied the expression of antioxidant enzymes in gills and digestive glands of the swollen river mussel Unio tumidus, after exposure to copper (30 µg/1) or/and thiram (100 µg/1) for three days. The results demonstrated that in both experimental exposures, the most sensitive parameters were the activity of selenium-dependent glutathione peroxidase, the reduction in glutathione levels and the GR activity. The responses of antioxidant parameters were overall greater in the gills than in the digestive glands of exposed mussels. Moreover, antioxidant enzymes in U. tumidus have also been used as biomarkers in assessment of pollution in aquatic sediments [16, 17]. Giarratano and others [18] followed the CAT activity in the digestive glands of M. edulis along with other biomarkers such as lipid peroxidation and condition index to access the water quality of coastal water Ushuaia Bay. Antioxidant enzyme biomarkers included GST, CAT, and GSH-Px in the Asian green mussel Perna viridis and the grooved carpet shell clam Ruditapes philippinarum have been used to access coastal waters in Hong Kong in association with their tissue concentrations of

176

Sutin Kingtong and Tavan Janvilisri

polycyclic aromatic hydrocarbons (PAHs), petroleum hydrocarbons, polychlorinated biphenyls (PCBs) and organochlorine pesticides [19]. After 14- and 28-days of field exposure, organochlorines and PCBs correlated significantly with CAT and GST in clam hepatopancreas and with CAT in mussel gill and hepatic tissues. However, multivariate statistical analyses revealed weak relationship between the site patterns for antioxidant responses and the contaminant gradients identified in body burden analysis. More recently, Vidal-Liñán and colleagues [20] investigated the potential use of several antioxidant enzymes in wild mussels M. galloprovincialis as biomarkers of marine pollution. The enzymatic activity levels of GST, GSH-Px and CAT were examined in gills and digestive glands. The results showed that mussels from the most polluted sites exhibited significantly greater GST activity compared to the control site during the sampling period, whereas, GSH-Px and CAT activities did not show any particular patterns. Moreover, trace metals, PAHs, PCBs and dichlorodiphenyltrichloroethane (DDT) contents in mussels at sampling sites showed strongly significant positive correlations with the GST activity. Therefore, the use of GST as a useful biomarker for long-term pollution monitoring in marine coastal ecosystems has been proposed. Although the use of antioxidants in assessment of water quality and bio-monitoring is generally performed, certain factors have been known to affect the expression of these enzymes. For instance, a study by Borkovic and colleagues on the activity of the antioxidant enzymes of M. galloprovincialis in Adriatic Sea revealed the seasonal-dependent activities of SOD, GR, GSH-Px and GST [21]. There have also been a number of reports that are in agreement with the seasonal variability of antioxidant enzymes and species-specific differences [22-24]. Moreover, responses might be affected by food availability, water temperature [25] and reproductive cycle [26]. Therefore, these influences should be taken into account for interpretation of bio-monitoring studies.

2. LIPID PEROXIDATION In living cells, lipid peroxidation involves a series of oxidative degradation of lipid components, especially polyunsaturated fatty acids (PUFA), which are sensitive to oxidative reactions by their double bonds. At the end of the chain reactions where lipid peroxidation takes place, lipid derivatives are easily decomposed into several reactive species including lipid alkoxyl radicals, aldehydes such as malondialdehyde (MDA), alkenes, lipid epoxies, and alcohol. Most of these products have been shown to be highly toxigenic and mutagenic [2729]. Prolonged exposures to environmental pollutants are capable of oxidative damage to cell membrane by increasing the rate of lipid peroxidation, thereby reducing the cell membrane permeability and integrity. The most common assay for the quantification of lipid peroxidation is the measurement of MDA level, since MDA is an intermediate product of lipid peroxidation. This assay is called a thiobarbituric acid relative substances test (TBARS). Thiobarbituric acid reacts with MDA to yield a fluorescent product, which can be measured by a high-performance liquid chromatography. Although MDA is rapidly degraded, measurement of MDA is still considered a relevant biomarker for lipid peroxidation in tissue sample preparations, especially for comparative purposes [30]. It is used as a non-enzymatic

Molecular Determinants in Mussels as Biomarkers for Environmental Stress

177

marker of oxidation of membrane phospholipids and has been considered as a relevant index for chemical damage induced by toxicants in mussels [31]. The level of lipid peroxidation, measured through MDA levels, in mussels is widely used as a biomarker for monitoring of environmental oxidative stress. The significant difference in the levels of lipid peroxidation has been observed in various types of tissue, revealing the tissue-specific manner of the activity. In the brown mussel P. perna, the lipid peroxidation in gills ranges from 4 to 15 nmol/g of tissue, whereas it ranges from 40 to 120 nmol/g of tissue in the digestive glands or mantles of P. perna and the mangrove mussel Mytella guyanensis under physiological conditions [32, 33]. The fact that the higher levels of PUFA are found in digestive gland and mantle tissues compared to gills [34] might partially explain the higher levels of lipid peroxidation observed between different tissues. The use of lipid peroxidation in mussels as an indicator for oxidative damage following environmental exposure is extensively monitored. In the zebra mussel Dreissena polymorpha, there is evidence for the up-regulation in lipid peroxidation following the exposure to inorganic and organic mercury, and Aroclor 1260 [35]. In P. perna, lipid peroxidation has been induced when they are exposed to sub-lethal doses of different metals [36, 37]. The significant induction of MDA level was observed when mussels exposed to cadmium (200 µg/l), copper (40 µg/l), and iron (500 µg/l) for 12, 120 and 120 hours, respectively [36]. P. perna mussels transplanted to contaminated sites in Santa Catharina Island, Brazil, also showed higher levels of lipid peroxidation in the mantle tissues than in the reference animals [38]. Similarly, M. guyanensis from polluted sites exhibited higher lipid peroxidation levels in the digestive gland than the reference mussels [32]. These results indicate that the measurement of the oxidative injury serves as a good marker for environmental pollution. However, the levels of lipid peroxidation are influenced by environmental factors and seasonal changes. Almeida and collaborators [33] reported that the aerial exposure of the brown mussel P. perna for 24 hours resulted in increased levels of lipid peroxidation in both the digestive glands and gills. Levels of lipid peroxidation had turned back to control values when re-submersed for 3 hours, suggesting that mussels are able to handle the oxidative stress caused by aerial exposure. Filho and coworkers [39] reported that seasonal changes could also alter the levels of lipid peroxidation in P. perna, mostly due to changes in the reproductive cycles. The higher lipid and carbohydrate mobilization besides protein synthesis has been reported during the reproductive season [40], resulting in increased lipid peroxidation levels at this season. In the other seasons, the levels of lipid peroxidation in this species seem to be very similar [39]. Other studies have also noted seasonal changes in lipid peroxidation levels and antioxidant status in mussel M. edulis [26, 41-43] and the hydrothermal vent mussel Bathymodiolus azoricus [44]. Altogether, the lipid peroxidation alone may not satisfactorily assess water pollution and the variability of lipid peroxidation due to other factors including seasonal changes must be taken into account in future studies on oxidative stress and related biomarkers in the environments.

3. DNA DAMAGE DNA damage in several aquatic animals including mussels has been associated with reduced growth, abnormal development and poor survival of embryos, larvae and adults [45].

178

Sutin Kingtong and Tavan Janvilisri

The impact of genotoxic compounds on the integrity of cellular DNA is one of the first events in organisms following the exposure to contaminants. Examples of DNA lesions caused by chemical and physical means include DNA adducts, base modifications, DNA strand breaks, and crosslinks between DNA-DNA and DNA-protein [46]. The genotoxicants can either (i) act directly on DNA such as alkylating agents, hydrogen peroxide, and certain herbicides [47]; (ii) pass through metabolic activation prior to DNA damages such as benzo(a)pyrene [48]; (iii) produce reactive oxygen species, thereby inducing DNA damage. Examples include quinines, aromatic nitro compounds and certain heavy metals [49]; (iv) disrupt DNA synthesis and repair such as ethidium bromide, cytosine arabinoside, aphidicolin, and heavy metals [50]; and (v) act through multiple mechanisms. For instance, mercury ions can bind to DNA, causing strand breaks and DNA-DNA crosslinks as well as inhibit DNA repair [51, 52]. Various methods have been developed for detecting DNA damage. DNA strand breaks, or downstream aberrations following DNA strand breaks, are commonly used to assess genotoxic impact in aquatic invertebrates. The micronucleus assay is based on chromosomal fragments, caused by abnormal mitotic spindle due to DNA damage, that are not incorporated into daughter nuclei after cell division. Such damage results in the production of a smaller nucleus or micronucleus outside the main nucleus [53]. Both hemocytes and gill cells in mussels are commonly used in the micronucleus assays. The induction of micronuclei has been shown in mussels following the exposure to heavy metals [54], an organochorine compound pentachlorophenol [55], the herbicide paraquat [56], pro-oxidant hydrogen peroxide (H2O2) and a mono-functional alkylating agent, ethyl methanesulfonate [57]. An increase in numbers of micronuclei in mussels are sensitive indicators of genotoxic contamination in the field since mortality rates usually remain unchanged [58, 59]. Another example includes the single cell gel electrophoresis or Comet assay. The Comet assay provides a simple, sensitive, and rapid tool for assessing DNA damage at the level of individual cells [60]. It has been widely used to investigate the impacts of environmental exposure to contaminants. This assay involves the immobilization of cells in a low-meltingpoint agarose suspension, cell lyses in neutral or alkaline conditions, and electrophoresis of the suspended lyses cells. This is followed by visual analysis with staining of DNA and calculating fluorescence to determine the extent of DNA damage. Parameters such as DNA tail length, DNA tail moments, percentage of DNA in tail, length/width DNA ratios, and empirical scores can be measured after cells exposed to DNA damaging chemicals compared with the control [61]. Cells from hemolymph, embryos, gills, digestive glands, and coelomocytes from mussels have been used for ecogenotixicity studies using the Comet assay. In vitro experiments have shown DNA strand breakages using the Comet assay in a dose-dependent fashion in digestive gland cells, hemocytes, and gill cells of M. edulis following the direct exposure to hydrogen peroxide and 3-chloro-4-(dichloromethyl)-5hydroxy-2[5H]-furanone, and the indirect exposure to benzo(a)pyrene, 1-nitropyrene, nitrofurantoin, and N-nitrosodimethylamine [62, 63]. The exposure of cells from digestive glands of the mussel U. tumidus to tannins and polyphenols in the in vitro Comet studies has also been carried out [64, 65]. Furthermore, the in vitro Comet assay with mussel cells has been optimized for the screening of potential genotoxic agents released into the marine environment [66]. Both field and laboratory-based in vivo experiments using the Comet assay have also been carried out in mussels. Different levels of DNA damage in M. edulis following chronic

Molecular Determinants in Mussels as Biomarkers for Environmental Stress

179

field and acute laboratory exposure to PAHs [67] and the oil spills with petroleum hydrocarbons have been shown [68-70]. The comet assay in mussels has been utilized to evaluate water contaminants. For example, the golden mussel Limnoperna fortune has been used as a bio-indicator for freshwater ecosystems due to its sensitivity to water contaminants [55]. The freshwater zebra mussel D. polymorpha has also been used in the genotoxicity test of water pollutants [71]. The vent mussel B. azoricuz also showed similar sensitivity to environmental toxicants compared to the coastal and freshwater mussels, thus could be used to study the genotoxicity of naturally contaminated deep-sea environments [72]. Although the guidelines for the in vitro as well as in vivo Comet assays have been formulated and accepted as the first-step screening assessment for DNA damage and repair by several organizations [73, 74], however the major drawback includes the variability of the Comet results due to its sensitivity, technical variability and interpretation of various laboratories, thus the comparison between different studies, even from the same laboratory, cannot be easily made. Therefore, the address of these issues must be warranted with inter-laboratory validation prior to its acceptance in the regulatory framework.

4. METALLOTHIONEINS Metallothioneins are low molecular weight of approximately 6-7 kDa cytosolic cysteinerich proteins, with no aromatic amino acid. Metallothioneins can be classified into three groups, based on the alignment of Cys-Cys, Cys-X-Cys and Cys-X-Y-Cys sequences in metallothioneins where X and Y represent amino acids other than cysteine [75]. The thiol groups (–SH) of cysteine residues enable metallothioneins to bind particular heavy metals. Their functions include (i) regulation of endogenous metals including copper and zinc; (ii) detoxification of excess harmful metals such as cadmium, mercury, and silver; (iii) acting as free radical scavengers; and (iv) molecular response to some general stress. Multiple isoforms of metallothioneins can be found in organisms. In mussels, metallothioneins exhibit more sequence similarity to vertebrate metallothioneins than those in invertebrates (except crustacean), therefore, the mussel metallothioneins are classified into class I metallothionein [76]. The recent classification of metallothioneins based on their phylogenetic relationship distinguishes Class I metallothioneins into 15 families and mollusk metallothioneins belong to the family 2 metallothionein [77]. In blue mussel M. edulis, two major metallothionein isoforms have been characterized and defined as MT10 and MT20 isoforms [78]. The MT10 isoform comprises four members of 72 amino acids of apparent molecular weight of approximately 10 kDa and MT20 isoform comprises four members of 71 amino acids of apparent molecular weight of 20 kDa [76]. The biological function(s) of metallothioneins are still a subject of debate. They are thought to play an important role in homeostasis of essential metals such as copper and zinc as they exhibit metal-binding capability, thereby act as essential metal stores ready to fulfill enzymatic and metabolic demands [79, 80]. Based on the experiments that revealed the association between the induction of metallothioneins and the enhancement of metal tolerance [79, 81-85], metallothioneins are also thought to involve in the detoxification of excess amount of both essential and non-essential metals including cadmium and mercury. In many species including mussels, induction of metallothionein synthesis by metal contaminants has

180

Sutin Kingtong and Tavan Janvilisri

been demonstrated, suggesting the potential use of metallothionein concentrations in organisms as biomarkers for metal exposure. Evaluation of metallothionein contents is currently part of a core suite of biomarkers recognized at the European level and is examined in the framework of biological effect quality assurance in monitoring programs (BEQUALM) [86]. Among the organisms used, bivalves in particular mussels, are considered to be the best choice for metallothionein determination because of their sensitivities to heavy metal exposure and the highly similarity between metallothioneins in bivalves and mammals which belong to Class I metallothionein. In biomarker aspect, the induction of mussel metallothioneins is widely used as molecular biomarkers in heavy metal monitoring program for decades, since they are sensitively induced by heavy metals. A large number of studies have been conducted particularly in marine mussels M. edulis, M. galloprovincialis, and the freshwater mussel D. polymorpha. The results have shown that mussel metallothioneins can be induced by various metals such as cadmium [78, 87-94], copper [80, 87-89, 92], zinc [89, 92], silver [95], manganese [89], nickel [92], iron [89], palladium [96], and vanadium [81]. The use of metallothioneins as a molecular biomarker has been validated in many in situ studies [97]. Even though there is a strong positive relationship between the expression levels of metallothioneins and the concentration of metals, metallothioneins can also be induced by other factors unrelated to metal contamination. Studies in M. galloprovincialis revealed that induction of metallothioneins were associated with hydrogen peroxide oxidative stress [98]. Seasonal changes can also affect mussel metallothionein expression [99, 100]. Therefore, fluctuations of metallothioneins caused by such factors have to be taken in to account for the use of metallothioneins as a molecular biomarker for metal pollution monitoring. The expression levels of metallothioneins are different in various organs of experimental models. In mussels, the highest metallothionein expression levels are generally found in digestive glands with the lesser extent in the gills and other tissues [97, 101]. Several authors have concluded that, in mussels (M. edulis or M. galloprovincialis), analysis of the digestive glands appears more relevant than that of the gills, thus, metallothionein analysis in the digestive glands has been recommended in the framework of the Mediterranean Action Plan [97].

5. CYTOCHROME P450 Cytochrome P450 monooxygenase enzymes (CYP) represent one of the major Phase I metabolism enzymes found in a diverse array of organisms including bacteria, plants, fungi, and animals. These enzymes are responsible for the oxidative metabolism of a plethora of substrates including endogenous molecules such as fatty acids, steroid hormones, eicosanoids, and pheromones [102], exogenous xenobiotics such as drugs, pesticides, PAHs, polychlorinated biphenyls, and dietary plant allochemicals [103]. P450-mediated reactions include hydroxylation, epoxidation, oxidative deamination, N-, O-, and S-dealkylations, and dehalogenation [104]. In general, these heme-thiolate enzymes are known for their monooxygenase activity, catalyzing the incorporation of one atom of dioxygen into the substrates, rendering the products more hydrophilic and presumably more excretable. P450 enzymes can be localized to the mitochondria (Class I) and/or the membrane of the endoplasmic reticulum (Class II), depending on their amino-terminal signal sequence. The

Molecular Determinants in Mussels as Biomarkers for Environmental Stress

181

physiological significance of P450 subcellular distribution remains to be answered but it has been suggested that their subcellular expression affects the catalytic competence of the enzymes in the way that Class I enzymes are responsible for endogenous substrates whereas Class II enzymes involve in detoxification of exogenous compounds. Although P450 enzymes provide the first line in metabolic elimination of lipophilic compounds, but in some cases, their products can be more toxic, mutagenic and/or carcinogenic [105]. P450-mediated activity and expression are found in various tissues and organs of marine invertebrates. Depending on the physiological function, P450s are selectively or differentially expressed in specific tissues. In mollusks, P450 is highly expressed in the digestive glands, with the lesser extent in hemolymph, gills, foot, and gonads [106]. P450 enzymes in mollusks including mussels have received considerable attention due to their relevance in ecotoxicology and applications in bio-monitoring of environmental toxicants. P450 systems in mussels have been shown to catalyze a number of reaction in vitro with exogenous substrates, however, the information on specific P450 enzymes involved for each substrate is still lacking. At present, only partial coding sequences of cytochrome P450 family 4 (CYP4) have been reported in the Mediterranean mussel M. galloprovincialis [107], the deep-water horse mussel Modiolus modiolus [108], and the fresh water mussel Unio tumidus (Chaty et al., unpublished data). Wootton and colleagues [109, 110] showed that the DNA probes designed from the vertebrate CYP1A, CYP3A, CYP4A, and CYP11A sequences were able to hybridize with mRNA from digestive glands of M. edulis and M. galloprovincialis. Using immunoassay, certain proteins extracted from digestive gland of the mussel M. edulis could be recognized by polyclonal anti-fish and anti-rat antibodies against CYP1A, CYP2B, CYP2E, CYP3A, and CYP4A [111]. However, the specificity of these antibodies has yet to be determined since members of these CYP families have not been identified in mussels. Although P450 mechanism and regulation in mussels is still poorly understood, there is a number of evidence showing the relationship between P450 and the environmental pollution. A study by Michel et al. [112] where the mussel M. galloprovincialis was exposed to phenobarbital, clofibrate, and 3-mythylchloanthrene, showed that the exposure to 3mythylchloanthrene elevated the digestive gland microsome total P450 enzymes, benzo(a)pyrene hydroxylase activity, and laurate hydroxylase while the exposure to phenobarbital only induced laurate hydroxylase and clofibrate did not affect those activities. The exposure of M. galloprovincialis to PCBs has also been found to increase the expression of CYP1A1-like proteins as determined by immunoassays, however, changes in the transcriptional level of the CYP1A1-like gene has not been observed [113]. A field study by Peters and co-workers revealed the differential regulation of multiple CYPs by comparing levels of CYP-immunoreactive proteins in digestive glands of indigenous and transplanted M. galloprovincialis from relatively clean and contaminated sites [114]. Their results suggested that the anti-CYP1A exhibited the greater specificity for a contaminant-inducible CYP form than the other CYP antibodies. The exposure to oil spillage has also shown to induce the CYP1A-like proteins in mussels from the sites having higher concentrations of PAHs [115, 116]. Both CYP contents and activities have been shown to vary in different seasons and isoform-specific seasonal variation of digestive glands has been demonstrated in M. edulis at the protein level for putative CYP1A- and CYP2E-like proteins [117], and at the mRNA level for putative CYP1A-, CYP3A- and CYP4A-like genes [110]. In the past decades, the levels of P450 expression and activity responsive to environmental contaminants have been measured in mussels. The P450 induction is likely to

182

Sutin Kingtong and Tavan Janvilisri

be a significant component of the physiological response leading to elimination of toxicants. Such approaches appear to be useful for monitoring xenobiotic exposure. However, at present, data are still preliminary and not extensive enough to allow comparison of the inducing efficiency of these xenobiotics, thus the biological information from these experiments is very limited. Results obtained using the immunological methods as well as sequence similarity need critical interpretation. More works include cloning and sequencing of the P450 genes in mussels are necessary to determine the functional relationship of mussel cytochrome P450 against individual xenobiotics as well as to raise specific antibodies for future studies.

6. MULTIXENOBIOTIC RESISTANCE PROTEINS The phenomenon of multixenobiotic resistance (MXR), which allows aquatic species to survive in their habitat despite high levels of anthropogenic pollutions or natural toxins, is shown to resemble the mechanism involved in multidrug resistance in cancer cells [118]. This mechanism is mediated through the ATP-binding cassette (ABC) transporters, which are ubiquitous transmembrane proteins that bind ATP and use the energy from its hydrolysis to translocate various molecules including lipids, amino acids, peptides, proteins, saccharides, lipopolysaccharides, and inorganic ions across biological membranes, a process pivotal for most aspects of cell physiology. These proteins also prevent the cellular accumulation of potentially harmful xenobiotics by active export of parental or metabolized forms of the compounds [119]. The most thoroughly investigated ABC family members in eukaryotic organisms, which are implicated in resistance to various xenobiotics, include ABCB1 (also known as multidrug resistance 1; MDR1 or P-glycoprotein; P-gp) [120], ABCC1 (also known as multidrug resistance-associated protein; MRP1) [121] and ABCG2 (also called breast cancer resistance protein; BCRP) [122-125]. Although the ABC multidrug transporters have been extensively studied in relation to cancer biology using highly selected drug-resistant cell lines and chemotherapeutic agents, less is known regarding to the MXR in wild populations of organisms [118]. At present, MXR has been detected by several techniques including immunological assays, measurement of transport activities, or genetic approaches in several tissues from various marine organisms covering taxa from sponges to fishes [118, 126-128]. The first ABC protein in aquatic animals was identified in the swan mussel Anodonta cygnea [129]. The presence of ABC multidrug transporters has been demonstrated in marine mussels M. galloprovincialis and M. edulis [126], as well as in freshwater species such as D. polymorpha [130] and U. pictorum [131]. Transport activity of the MXR proteins in M. galloprovincialis and D. polymorpha has been investigated in an extensive three-year study, where the accumulation or efflux rate of the MXR proteins‘ substrate rhodamine B was measured in the gills of the mussels [130]. The exposure laboratory-based experiments, using model inducers rhodamine 123 and water extract of Diesel oil, as well as in situ testing in real environmental conditions also revealed the significant positive association between the levels of MXR and pollution [130]. In the mussel M. edulis, enhanced expression of putative ABCB-subfamily mRNA has been observed in animals from highly polluted sites [132]. Furthermore, ABCB1like protein can be induced in mussel hemocytes following exposure to vincristine [133].

Molecular Determinants in Mussels as Biomarkers for Environmental Stress

183

Using a fluorescent dye assay, Galgani and co-workers [134] showed that four moderately hydrophobic pesticides including dachtal, chlorbeside, sulfallate, and pentachlorophenol, were able to disrupt the dye efflux from the gills of M. galloprovincialis, indicating their interaction with MXR transport system in this organism. Altogether, these data demonstrate that the function of ABC multidrug transporters in mussels confers effective protection against deleterious effects caused by the exposure to various organic toxic compounds. Although several lines of evidence suggest the usefulness of MXR as a tool in biomonitoring and provide a protocol for field experiments that enables to establish and use the level of ABC proteins‘ expression and activities as biomarkers for environmental stress, however, careful considerations are needed in order to interpret the findings. These include the use of a reference level of expression and activity [135]. It has been shown that the MXR activity can be drastically reduced to a very low level after a period of depuration and is inducible after a laboratory exposure, exhibiting a high induction potential and revealing the need for organisms to protect themselves against an environmental stress [136, 137]. The baseline level of MXR following a period of depuration in organisms that are not exposed to chemical stress from their environment can be used as a reference level; however, this condition is unlikely in natural habitats. Furthermore, the MXR proteins can be induced by (i) other heavy metals such as cadmium, zinc, inorganic mercury, and copper in the mussels M. galloprovincialis and D. polymorpha [130, 138]; (ii) natural factors that are not necessarily related to pollution, such as temperature [130, 138], endogenous substrates and metabolites [130]. Therefore, the use of ABC transporters in mussels as a biomarker for a specific compound may be limited. However, little is known about cellular mechanisms for pollution management by mussels in the marine environment. The implication of the MXR proteins would therefore be useful as a general index for environmental stress.

7. ENDOCRINE DISRUPTORS Endocrine disruptors are a heterogenous group of substances that interfere with the endocrine system and may adversely affect the physiological system, especially the reproductive functions in the organisms. They can either be natural or synthetic, including (i) steroidal estrogens such as estradiol, estrone, and mestranol [139]; (ii) non-steroidal synthetic estrogens such as nonylphenol, benzophenone, and bisphenol A [140]; (iii) phytoestrogens such as genistein [141]; (iv) pesticides such as endosulfan, DDT, and Alachlor [142]; (v) polychlorinated biphenyls such as Clophen A50, and Aroclor 122 [142]; (vi) plasticisers such as phthalates [143]; and (vii) heavy metals such as mercury, cadmium, and lead [142]. Many of these compounds can accumulate in different environment compartments including aquatic biota due to the lipophilic and persistent properties of most xenobiotic estrogens and their derivatives. The endocrine disruptors usually bind to intracellular estrogen receptors with the downstream transcriptional regulation of the target genes via ligand-inducible transcriptional factors. Although the effects of endocrine disruptors have been extensively studied, however, most of the works have been carried out in vertebrate systems. The information on the effects of endocrine disruptors in invertebrates is still limited due to the lack of basic endocrine physiology knowledge in invertebrates.

184

Sutin Kingtong and Tavan Janvilisri

A wide spectrum of potential biomarkers could be used to evaluate endocrine disruption in the aquatic environments, for instance, abnormal hormone titers, irregular gonad development, reduced gamate viability, changes in enzyme activities such as aromatases, and protein levels such as vitellogenin, zona radiata proteins and spiggin [144, 145]. Induction of vitellogenin (Vtg), the precursor of the egg-yolk proteins, in oviparous males or juveniles is a well-recognized effect of xeno-estrogenic contaminants [146] and has been used as biomarker in both laboratory and field studies. As Vtg is an estrogen-inducible protein, it is usually upregulated in sexually mature females, but its expression is lower in juveniles and not expressed in mature males. In bivalves, Vtg and Vtg-like proteins are synthesized in gonads [147, 148], however their regulation is not well understood even if estrogenic steroids seem to play a vital role. It has been shown in the freshwater mussel Elliptio complanata that a Vtglike protein level is elevated by estradiol injection [149, 150]. In addition, E. complanata injected with estradiol also showed increased expression of the putative Vtg-coding gene [149]. These results suggest that the estrogenic substances such as estradiol are important in the regulation of vitellogenesis in mussels. Many studies have been conducted to assess the endocrine disrupting chemicals in the aquatic environments by using the Vtg levels in mussels [151, 152]. Although several techniques including immunoassays and molecular approaches have been developed for determination of Vtg, however, due to the lack of specific antibodies for Vtg and Vtg-like proteins in mussels as well as limited information on the coding sequences for Vtg proteins, the measurement of phosphoproteins by the alkali-labile phosphate method has been widely used [151]. It has been demonstrated that M. galloprovincialis males collected during the reproductive period at three different sites located in the canals of the urban area of Venice historic centre exhibited significantly high levels of Vtg-like proteins in hemolymph, whereas females collected during the same period and sites did not display significant increases in Vtg-like protein levels [153]. These findings indicated that xeno-estrogens were present in the study sites and that males were more susceptible to the contaminants than females. In the field study of E. complanata, it has also been shown that coprostanol, a compound derived from the biohydrogenation of cholesterol, was able to induce Vtg-like proteins in the hemolymph and the gonad of both male and female mussels when they were exposed to increasing municipal effluent dilutions (0 to 50%) for 4 days at 15°C and the intensity of Vtg response in females was higher than in male mussels [150]. The results indicated that females were more sensitive to estrogens than males. In the same study, mussels were also placed in cages and submerged in the contaminated area for 62 days. The results revealed that Vtg-like protein levels in hemolymph were elevated, suggesting that the area might contain bio-available xeno-estrogens at the levels sufficient to induce Vtg in freshwater mussels [150]. A one-year study of transplanted E. complanata in major municipal sites showed significantly higher levels of Vtg in gonads compared to the control animals from the reference site [154]. The endocrine disrupting effect of municipal effluents has also been noted in D. polymorpha. Quinn and collaborators [155] reported that mussels exposed to the effluent in situ for 112 days during gametogenesis exhibited the high levels of Vtg-like proteins in both male and female mussels, indicating that endocrine disruption had occurred. Altogether, results from both laboratory and field investigations indicate that the Vtg level in mussels can be a suitable bio-indicator of endocrine disruption in freshwater environments.

Molecular Determinants in Mussels as Biomarkers for Environmental Stress

185

8. MULTI-BIOMARKER APPROACHES Although, there is an increasing body of evidence that indicates the contribution of the aforementioned molecular biomarkers in mussels to measure the levels of pollutants in contaminated environments, however most of the works have been focused on the effect of single environment factors only. In the realistic situations, the field mussels may be exposed to a complex mixture of effluents from urban, agricultural, and industrial sources as well as the variability in physical parameters. These factors can affect several biochemical and physiological responses via multiple pathways, therefore raising the concerns in the measurement of the level of biomarkers and interpretation of experimental results as they possibly act in an additive or even synergistic fashion. Thus, from an analytical point of view, the implication of an array of biomarkers can be more advantageous than the use of only a single biomarker and offers an effective early warning system in bio-monitoring of aquatic environments. For example, Damiens and others [156] measured the levels of GST, CAT, acetylcholine esterase, TBARS and metallothioneins in transplanted mussels M. galloprovincialis that were caged in different stations in the Mediterranean sea. They then utilized the algorithm of integrated biomarker response index [157] with the combination of pollutant concentrations in mussels. The comparison between the reference site and the copper- and PCB-contaminated sites could then be successfully visualized in the star plots [156]. It has also been shown that the use of multiple biomarkers can be applied to study the physical conditions such as salinity [158]. Recently, a two-tier approach for assessing the level of pollutant-induced stress syndrome in mussels has been proposed for wide-scaled bio-monitoring programs [159]. This methodology suggests the use of (i) Tier I, the relatively low-cost and very sensitive screening test including lysosomal membrane stability assays, micronucleus tests, and survival rates; and (ii) Tier II, the specific test for the sites identified in Tier I of possibility of being polluted, using a full set of biomarkers such as the levels of antioxidant enzymes, acetylcholine esterase, and metallothioneins. These data can then be integrated into a synthetic index, representing the trends in toxicant-induced biomarker alterations [159]. Furthermore, in the ‗-omics‘ era, several laboratories have made attempts to integrate the ‗omic‘ techniques into the field of environmental biomarkers. For example, Shepard and collaborators [160] utilized the proteome analysis to derive chemical-specific protein expression signatures in the mussel M. edulis that were exposed to copper, Aroclor 1248, and lowered salinity. The specificity of these protein signatures due to pollutant challenges shows promises in bio-indication, toxicity testing and in enabling us towards the identification of possible toxicity mechanisms.

CONCLUSION The growing awareness of aquatic pollution in the scientific communities as well as the public sections prompts us to the development of sensitive and precise biomarkers to assess contaminant impacts. Mussels have been proven to be suitable bio-indicator species for biomonitoring coastal seawaters, lagoons and estuaries. They can be studied both in vitro and in vivo conditions as well as both laboratory and field settings. Transplantation of mussels can

186

Sutin Kingtong and Tavan Janvilisri

also be carried out easily by caging them in adequate steel vessels usually positioned a few meters below the water surface, making it highly feasible to compare the results between the controls and the exposed groups. Molecular determinants in mussels described herein have been studied and applied as a very sensitive and effective ‗early warning‘ tools for the measurement of biological effects of pollutants in environmental quality assessment. Nevertheless, careful considerations are required in data integration and interpretation due to the fact that these molecular biomarkers may be affected by confounding factors within studied areas including salinity, seasonality, diet, sunlight exposure, temperature, as well as biological half-life and bioavailability of chemicals in the mussels. Several aspects of both conceptual and practical relevance need to be further explored and better elucidated. Future directions of investigative experiments should aim to (i) gain deeper understandings on the molecular and physiological functions of these biomarkers, (ii) screen additional potential toxicants using an existing panel of biomarkers, (iii) test these toxic agents at a range of environmentally realistic concentrations, (iv) validate the use of current biomarkers with the ‗baseline‘ or ‗reference‘ conditions, (v) develop innovative approaches including molecular signatures for the environmental stress response. To date advances in molecular biology in marine invertebrates alleviate many of the problems associated with biochemical, immunological, and physiological approaches to study these biomarkers in mussels. The field of biomarker research in marine invertebrates including mussels will undoubtedly be greatly expanded with far-reaching aims towards bio-monitoring environmental health.

ACKNOWLEDGMENTS The work in the laboratory of Tavan Janvilisri has been supported by a grant from Faculty of Science, Mahidol University, Thailand.

REFERENCES [1] [2]

[3] [4] [5]

[6]

Goldberg, E.D., The Mussel Watch- a first step in global marine monitoring. Mar. Pollut. Bull, 1975. 6: p. 111. Gabrieldes, G., ed. The MED POL biomonitoring program concerning the effects of pollutants in marine organisms along the Mediterranean coasts. Vol. 132/3. 1997, UNEP (OCA)/MED WG: Athens. Narbonne, J.F., et al., Scale of classfication based on biochemical markers in mussels: application to pollution monitoring in European coasts. Biomarkers, 1999. 4: p. 415-24. Tett, P., et al., Defining and detecting undesirable disturbance in the context of marine eutrophication. Mar. Pollut. Bull, 2007. 55(1-6): p. 282-97. Lehtonen, K.K., et al., The BEEP project in the Baltic Sea: overview of results and outline for a regional biological effects monitoring strategy. Mar. Pollut. Bull, 2006. 53(8-9): p. 523-37. Tambutte, S., et al., A biomonitoring program principality of Monaco Mar. Pollut., 1999. 584-6.

Molecular Determinants in Mussels as Biomarkers for Environmental Stress [7]

[8] [9] [10] [11] [12]

[13] [14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

187

Limon-Pacheco, J. and M.E. Gonsebatt, The role of antioxidants and antioxidant-related enzymes in protective responses to environmentally induced oxidative stress. Mutat. Res., 2009. 674(1-2): p. 137-47. Lesser, M.P., Oxidative stress in marine environments, biochemistry and physiological ecology. Ann. Rev. Physiol., 2006. 68: p. 253-78. Hassan, H.M., Biosynthesis and regulation of superoxide dismutases. Free Radic. Biol. Med., 1988. 5(5-6): p. 377-85. Bebianno, M.J., et al., Biomarkers in Ruditapes decussatus: a potential bioindicator species. Biomarkers, 2004. 9(4-5): p. 305-30. Margis, R., et al., Glutathione peroxidase family - an evolutionary overview. FEBS J., 2008. 275(15): p. 3959-70. Perham, R.N., N.S. Scrutton, and A. Berry, New enzymes for old: redesigning the coenzyme and substrate specificities of glutathione reductase. Bioessays, 1991. 13(10): p. 515-25. Blanchette, B., X. Feng, and B.R. Singh, Marine glutathione S-transferases. Mar Biotechnol (NY), 2007. 9(5): p. 513-42. Pipe, R.K., C. Porte, and D.R. Livingstone, Antioxidant enzymes associated with the blood cells and haemolymph of the mussel Mytilus edulis. Fish Shellfish Immunol., 1993. 3(3): p. 221-33. Doyotte, A., et al., Redox proteomics in the blue mussel Mytilus edulis-Carbonylation is not a pre-requisite for ubiquitination in acute free radical-mediated oxidative stress. Aquat. Toxicol., 1997. 39(2): p. 93-110. Cossu, C., et al., Antioxidant biomarkers in freshwater bivalves, Unio tumidus, in response to different contamination profiles of aquatic sediments. Ecotoxicol. Environ. Saf., 2000. 45(2): p. 106-21. Cossu, C., et al., Glutathione reductase, selenium-dependent glutathione peroxidase, glutathione levels, and lipid peroxidation in freshwater bivalves, Unio tumidus, as biomarkers of aquatic contamination in field studies. Ecotoxicol. Environ. Saf., 1997. 38(2): p. 122-31. Giarratano, E., C.A. Duarte, and O.A. Amin, Biomarkers and heavy metal bioaccumulation in mussels transplanted to coastal waters of the Beagle Channel. Ecotoxicol. Environ. Saf., 2010. 73(3): p. 270-9. De Luca-Abbott, S.B., et al., Field validation of antioxidant enzyme biomarkers in mussels (Perna viridis) and clams (Ruditapes philippinarum) transplanted in Hong Kong coastal waters. Mar. Pollut. Bull, 2005. 51(8-12): p. 694-707. Vidal-Linan, L., et al., Integrated use of antioxidant enzymes in mussels, Mytilus galloprovincialis, for monitoring pollution in highly productive coastal areas of Galicia (NW Spain). Chemosphere, 2010. 78(3): p. 265-72. Borkovic, S.S., et al., The activity of antioxidant defence enzymes in the mussel Mytilus galloprovincialis from the Adriatic Sea. Comp. Biochem. Physiol. C Toxicol. Pharmacol., 2005. 141(4): p. 366-74. Verlecar, X.N., K.B. Jena, and G.B. Chainy, Modulation of antioxidant defences in digestive gland of Perna viridis (L.), on mercury exposures. Chemosphere, 2008. 71(10): p. 1977-85. Manduzio, H., et al., Seasonal variations in antioxidant defences in blue mussels Mytilus edulis collected from a polluted area: major contributions in gills of an

188

[24]

[25]

[26]

[27]

[28] [29]

[30]

[31]

[32] [33]

[34]

[35]

[36]

[37] [38] [39]

Sutin Kingtong and Tavan Janvilisri inducible isoform of Cu/Zn-superoxide dismutase and of glutathione S-transferase. Aquat. Toxicol., 2004. 70(1): p. 83-93. Bocchetti, R., et al., Seasonal variations of exposure biomarkers, oxidative stress responses and cell damage in the clams, Tapes philippinarum, and mussels, Mytilus galloprovincialis, from Adriatic sea. Mar. Environ. Res., 2008. 66(1): p. 24-6. Niyogi, S., et al., Seasonal variation of antioxidant and biotransformation enzymes in barnacle, Balanus balanoides, and their relation with polyaromatic hydrocarbons. Mar. Environ. Res., 2001. 52(1): p. 13-26. Viarengo, A., et al., Seasonal variations in the antioxidant defence systems and lipid peroxidation of the digestive gland of mussels. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol., 1991. 110: p. 187-90. D‘Ischia, M., C. Constantini, and G. Prota, Lipofuscin-like pigments by autoxidation of polyunsaturated fatty acids in the presence of amine neuritransmitters: the role of malondialdehyde. Biochim. Biophys. Acta., 1996. 1290: p. 319-26. Esterbauer, H., P. Eckl, and A. Ortmer, Possible mutagens derived from lipid and lipid precursors. Mutat. Res. Rev. Genet. Toxicol., 1990. 238: p. 223-33. Valavanidis, A., et al., Molecular biomarkers of oxidative stress in aquatic organisms in relation to toxic environmental pollutants. Ecotoxicol. Environ. Saf., 2006. 46: p. 17889. Hermes-Lima, M., Oxygen in biology and biochemistry: role of free radicals. Functional Metabolism: Regulation and Adaptation, ed. K.B. Storey. 2004, Hobocken, New Jersey: John Wiley and Sons. Box, A., et al., Assessment of environmental pollution at Balearic Islands applying oxidative stress biomarkers in the mussel Mytilus galloprovincialis. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol., 2007. 146(4): p. 531-9. Torres, M.A., et al., Oxidative stress in the mussel Mytella guyanensis from polluted mangroves on Santa Catarina Island, Brazil. Mar. Pollut. Bull, 2002. 44: p. 923-32. Almeida, E.A., et al., Oxidative stress in digestive gland and gill of the brown mussel (Perna perna) exposed to air and re-submersed. J. Exp. Mar. Biol. Ecol., 2005. 318: p. 21-30. Ribera, D., et al., Responses of antioxidants and lipid peroxidation in mussels to oxidative damage exposure. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol., 1991. 100: p. 177-81. Faria, M., et al., Multi-biomarker responses in the freshwater mussel Dreissena polymorpha exposed to polychlorobiphenyls and metals. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol., 2009. 149: p. 281-8. Almeida, E.A., et al., Protective effect of phospholipid hydroperoxide glutathione peroxidase (PHGPx) against lipid peroxidation in mussels Perna perna exposed to different metals. Mar. Pollut. Bull, 2004. 49: p. 386-92. Viarengo, A., et al., Role of metallothionein against oxidative stress in the mussel Mytilus galloprovincialis. Am. J. Physiol., 1999. 277: p. R1612-9. Almeida, E.A., et al., DNA and lipid damage in the brown mussel Perna perna from a contaminated site. Bull Environ. Contam. Toxicol., 2003. 71: p. 270-5. Filho, D.W., et al., Seasonal changes in antioxidant defenses of the digestive gland of the brown mussel (Perna perna). Aquaculture, 2001. 203: p. 149-58.

Molecular Determinants in Mussels as Biomarkers for Environmental Stress

189

[40] Alves de Almeida, E., et al., Oxidative stress in Perna perna and other bivalves as indicators of environmental stress in the Brazilian marine environment: antioxidants, lipid peroxidation and DNA damage. Comp. Biochem. Physiol. A Mol. Integr. Physiol., 2007. 146(4): p. 588-600. [41] Power, A. and D. Sheehan, Seasonal variation in the antioxidant defence systems of gill and digestive gland of the blue mussel, Mytilus edulis. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol., 1996. 114: p. 99-103. [42] Vlahogianni, T., et al., Integrated use of biomarkers (superoxide dismutase, catalase and lipid peroxidation) in mussels Mytilus galloprovincialis for assessing heavy metals‘ pollution in coastal areas from the Saronikos Gulf of Greece. Mar. Pollut. Bull, 2007. 54: p. 1361-71. [43] Wilhelm, D., et al., Seasonal changes in antioxidant defenses of the digestive gland of the brown mussel (Perna perna). Aquaculture, 2001. 203: p. 149-58. [44] Company, R., et al., Effect of cadmium, copper and mercury on antioxidant enzyme activities and lipid peroxidation in the gills of the hydrothermal vent mussel Bathymodiolus azoricus. Mar. Environ. Res., 2004. 58(2-5): p. 377-81. [45] Steinert, S.A., DNA damage as bivalve biomarker and as an environmental assessment tool. Biomarkers, 1999. 4: p. 492-6. [46] Ohe, T., T. Watanabe, and K. Wakabayashi, Mutagens in surface waters: a review. Mutat. Res., 2004. 567(2-3): p. 109-49. [47] Turner, J.E. and J.M. Parry, The induction and repair of DNA damage in the mussel Mytilus edulis. Mar. Environ. Res., 1989. 28: p. 346-7. [48] Weisburger, E.K., Mechanisms of chemical carcinogenesis. Annu. Rev. Pharmacol. Toxicol., 1978. 18: p. 395-415. [49] DiGiulio, R.T., et al., Biochemical responses in aquatic animals: a review of determinants of oxidative stress. Environ. Toxicol. Chem., 1989. 8: p. 1103-23. [50] Keeney, S. and S. Linn, A critical review of permeabilized cell systems for studying mammalian DNA repair. Mutat. Res., 1990. 236(2-3): p. 239-52. [51] Cantoni, O., et al., Mechanism of HgCl2 cytotoxicity in cultured mammalian cells. Mol. Pharmacol., 1984. 26(2): p. 360-8. [52] Cantoni, O., et al., Characterization of DNA lesions produced by HgCl2 in cell culture systems. Chem. Biol. Interact., 1984. 49(1-2): p. 209-24. [53] Jenssen, D. and C. Ramel, The micronucleus test as part of a short-term mutagenicity test program for the prediction of carcinogenicity evaluated by 143 agents tested. Mutat. Res., 1980. 75(2): p. 191-202. [54] Bolognesi, C., et al., Genotoxicity biomarkers in the assessment of heavy metal effects in mussels: experimental studies. Environ. Mol. Mutagen, 1999. 33(4): p. 287-92. [55] Villela, I.V., et al., DNA damage and repair in haemolymph cells of golden mussel (Limnoperna fortunei) exposed to environmental contaminants. Mutation ResearchGenetic Toxicology and Enironmental Mutagenesis, 2006. 605(1-2): p. 78-86. [56] Mantecca, P., G. Vailati, and R. Bacchetta, Histological changes and micronucleus induction in the zebra mussel Dreissena polymorpha after paraquat exposure. Histol. Histopathol., 2006. 21(8): p. 829-40. [57] Stambuk, A., et al., Persistence of DNA damage in the freshwater mussel Unio pictorum upon exposure to ethyl methanesulphonate and hydrogen peroxide. Environ. Mol. Mutagen., 2008. 49(3): p. 217-25.

190

Sutin Kingtong and Tavan Janvilisri

[58] Brunetti, R., et al., The micronucleus test: examples and application to marine ecology. Marine Ecology Progress Series, 1988. 44: p. 65-8. [59] Stambuk, A., et al., Assessment of genotoxicity in polluted freshwaters using caged painter's mussel, Unio pictorum. Ecotoxicology, 2009. 18(4): p. 430-9. [60] Lee, R.F. and S. Steinert, Use of the single cell gel electrophoresis/comet assay for detecting DNA damage in aquatic (marine and freshwater) animals. Mutat. Res., 2003. 544(1): p. 43-64. [61] Frenzilli, G., M. Nigro, and B.P. Lyons, The Comet assay for the evaluation of genotoxic impact in aquatic environments. Mutat. Res., 2009. 681(1): p. 80-92. [62] Mitchelmore, C.L., et al., Detection of DNA strand breaks in isolated mussel (Mytilus edulis L. ) digestive gland cells using the "Comet" assay. Ecotoxicol. Environ. Saf., 1998. 41(1): p. 51-8. [63] Rank, J. and K. Jensen, Comet assay on gill cells and hemocytes from the blue mussel Mytilus edulis. Ecotoxicol. Environ. Saf., 2003. 54(3): p. 323-9. [64] Labieniec, M. and T. Gabryelak, Response of DNA, proteins and membrane bilayer in the digestive gland cells of freshwater mussel Unio tumidus to tannins exposure. Toxicol In Vitro, 2004. 18(6): p. 773-81. [65] Labieniec, M. and T. Gabryelak, Oxidatively modified proteins and DNA in digestive gland cells of the fresh-water mussel Unio tumidus in the presence of tannic acid and its derivatives. Mutat. Res., 2006. 603(1): p. 48-55. [66] Wilson, J.T., et al., Evaluation of the comet assay as a method for the detection of DNA damage in the cells of a marine invertebrate, Mytilus edulis L. (Mollusca: Pelecypoda). Mutat. Res., 1998. 399(1): p. 87-95. [67] Large, A.T., et al., Different levels of mussel (Mytilus edulis) DNA strand breaks following chronic field and acute laboratory exposure to polycyclic aromatic hydrocarbons. Mar. Environ. Res., 2002. 54(3-5): p. 493-7. [68] Hamouten, D., et al., Use of the Comet assay to assess DNA damage in hemocytes and digestive gland cells of mussels and clams exposed to water contaminated with petroleum hydrocarbons. Mar. Environ. Res., 2002. 54(3-5): p. 471-4. [69] Laffon, B., et al., Monitoring of the impact of Prestige oil spill on Mytilus galloprovincialis from Galician coast. Environ. Int., 2006. 32(3): p. 342-8. [70] Perez-Cadahia, B., et al., Evaluation of PAH bioaccumulation and DNA damage in mussels (Mytilus galloprovincialis) exposed to spilled Prestige crude oil. Comp. Biochem. Physiol. C Toxicol. Pharmacol., 2004. 138(4): p. 453-60. [71] Klobucar, G.I., et al., Application of the micronucleus and comet assays to mussel Dreissena polymorpha haemocytes for genotoxicity monitoring of freshwater environments. Aquat. Toxicol., 2003. 64(1): p. 15-23. [72] Dixon, D.R., A.M. Pruski, and L.R. Dixon, The effects of hydrostatic pressure change on DNA integrity in the hydrothermal-vent mussel Bathymodiolus azoricus: implications for future deep-sea mutagenicity studies. Mutat. Res., 2004. 552(1-2): p. 235-46. [73] Tice, R.R., et al., Single cell gel/comet assay: guidelines for in vitro and in vivo genetic toxicology testing. Environ. Mol. Mutagen, 2000. 35(3): p. 206-21. [74] Hartmann, A., et al., Recommendations for conducting the in vivo alkaline Comet assay. 4th International Comet Assay Workshop. Mutagenesis, 2003. 18(1): p. 45-51.

Molecular Determinants in Mussels as Biomarkers for Environmental Stress

191

[75] Kagi, J.H.R. and Y. Kojima, Chemistry and biochemistry of metallothioneins. Metallothionein II, ed. K. J.H.R. and Y. Kojima. 1987, Basel: Birkhauser. [76] Mackay, E.A., et al., Complete amino acid sequences of five dimeric and four monomeric forms of metallothionein from the edible mussel Mytilus edulis. Eur. J. Biochem., 1993. 218: p. 183-94. [77] Binz, P.A. and J.H.R. Kägi, Metallothionein: Molecular evolution and classification. Metallothionein IV, ed. C. Klaassen. 1999, Birkhäuser Verlag: Basel. [78] Frazier, J.M., Cadmium-binding proteins in the mussel, Mytilus edulis. Environ. Health Perspect., 1986. 65: p. 39-43. [79] Roesijadi, G., Metallothionein and its role in toxic metal regulation. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol., 1996. 113(2): p. 117-23. [80] Viarengo, A. and J.A. Nott, Mechanisms of heavy metal cation homeostasis in marine invertebrates. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol., 1983. 104(3): p. 355-72. [81] Amiard, J.C., R. Journel, and H. Bacheley, Influence of field and experimental exposure of mussels (Mytilus sp.) to nickel and vanadium on metallothionein concentration. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol., 2008. 147: p. 378-85. [82] Lecoeur, S., B. Videmann, and B. P., Evaluation of metallothionein as a biomarker of single and combined Cd/Cu exposure in Dreissena polymorpha. Environ. Res., 2004. 94: p. 184-91. [83] Pavicic, J., et al., Embryo-larval tolerance of Mytilus galloprovincialis, exposed to elevated seawater metal concentrations. I. Toxic effects of Cd, Zn and Hg in relation to the metallothionein level. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol., 1994. 107: p. 29-57. [84] Ritterhoff, J. and G.-P. Zauke, Potential role of metal-binding proteins in cadmium detoxification in Themisto libellula (Mandt) and Themisto abyssorum Boeck from the Greenland Sea. Mar. Environ. Res., 1998. 45(2): p. 179-191. [85] Wallace, W.G. and G.R. Lopez, Bioavailability of biologically sequestered cadmium and the implications of metal detoxication. Mar. Ecol. Progr. Ser., 1997. 147: p. 14957. [86] Mathiessen, P., Biological effects quality assurance in monitoring programs (BELQUALM), F.a.A.S.C. Centre for Environment, Editor. 2000: Remenbrance Avenue, Burham-on-Crouch, Essex CMO 8HA, UK. p. 24. [87] Bebianno, M.J. and W.J. Langston, Metallothionein induction in Mytilus edulis exposed to cadmium. Mar. Biol., 1991. 108: p. 91-6. [88] Bebianno, M.J. and L.M. Machado, Concentrations of metals and metallothioneins in Mytilus galloprovincialis along the south coast of Portugal. Mar. Pollut. Bull, 1997. 34(8): p. 666-71. [89] Dragun, Z., et al., Metal and metallothionein level in the heat-treated cytosol of gills of transplanted mussels Mytilus galloprovincialis Lmk. Environ. Int., 2004. 30(8): p. 1019-25. [90] Geffard, A., et al., Relationship between metal bioaccumulation and metallothionein levels in larvae of Mytilus galloprovincialis exposed to contaminated estuarine sediment elutriate. Mar. Ecol. Progr. Ser., 2002. 233: p. 131-42.

192

Sutin Kingtong and Tavan Janvilisri

[91] Isani, G., et al., Adenylate energy charge and metallothionein as stress indices in Mytilus galloprovincialis exposed to cadmium and anoxia. J. Mar. Biol. Ass UK, 1997. 77: p. 1187-97. [92] Mourgaud, Y., et al., Metallothionein concentration in the mussel Mytilus galloprovincialis as a biomarker of response to metal contamination: validation in the field. Biomarkers, 2002. 7(6): p. 479-90. [93] Raspor, B. and J. Pavicic, Induction of metallothionein-like proteins in the digestive gland of Mytilus galloprovincialis after a chronic exposure to the mixture of trace heavy metals. Chem. Spec. Bioavail., 1991. 3: p. 39-46. [94] Zorita, I., et al., Tissue- and cell-specific expression of metallothionein genes in cadmium- and copper-exposed mussels analyzed by in situ hybridization and RT–PCR. Toxicol. Appl. Pharmacol., 2007. 220(2): p. 186-96. [95] George, S.G., et al., Biochemical and ultrastructural observations of long-term silver accumulation in the mussel, Mytilus edulis. Mar. Environ. Res., 1986. 18: p. 255-65. [96] Frank, S.N., C. Singer, and B. Sures, Metallothionein (MT) response after chronic palladium exposure in the zebra mussel, Dreissena polymorpha. Environ. Res., 2008. 108(3): p. 309-14. [97] Amiard, J.C., et al., Metallothioneins in aquatic invertebrates: their role in metal detoxification and their use as biomarkers. Aquat. Toxicol., 2006. 76(2): p. 160-202. [98] Cavaletto, M., et al., Effect of hydrogen peroxide on antioxidant enzymes and metallothionein level in the digestive gland of Mytilus galloprovincialis. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol., 2002. 131(4): p. 447-55. [99] Templeton, D.M. and M.G. Cherian, Toxicological significance of metallothionein. Meth Enzymol, 1991. 205: p. 11-24. [100] Geffard, A., A.-T. C., and J. Amiard, Do seasonal changes affect metallothionein induction by metals in mussels, Mytilus edulis? Ecotoxicol. Environ. Saf., 2005. 61(2): p. 209-20. [101] Cosson, R.P., Bivalve metallothionein as a biomarker of aquatic ecosystem pollution by trace metals: limits and perspectives. Cell Mol. Biol. (Noisy-le-grand), 2000. 46(2): p. 295-309. [102] Werck-Reichhart, D. and R. Feyereisen, Cytochrome P450: a success story. Genome Biol., 2000. 1: p. 3003.1-3003.9. [103] Gonzalez, F.J., The molecular biology of cytochrome P450s. Pharmacol Rev, 1989(40): p. 243-88. [104] Mansuy, D., The great diversity of reactions catalysed by cytochrome P450. Comp. Biochem. Physiol. 1998. 121C: p. 5-14. [105] Stegeman, J.J. and J.J. Lech, Cytochrome P-450 monooxygenase systems in aquatic species: carcinogen metabolism and biomarkers for carcinogen and pollutant exposure. Environ. Health Perspect, 1991. 90: p. 101-9. [106] Livingstone, D.R., M.A. Kirchin, and A. Wiseman, Cytochrome P-450 and oxidative metabolism in molluscs. Xenobiotica, 1989. 19: p. 1041-42. [107] Snyder, M.J., Cytochrome P450 enzymes belonging to the CYP4 family from marine invertebrates. Biochem. Biophys. Res. Commun., 1998. 249(1): p. 187-90. [108] Veldhoen, N., et al., Gene expression profiling in the deep water horse mussel Modiolus modiolus (L.) located near a marine municipal wastewater outfall. Aquat. Toxicol., 2009. 93(2-3): p. 116-24.

Molecular Determinants in Mussels as Biomarkers for Environmental Stress

193

[109] Wootton, A.N., et al., Evidence for the existance of cytochrome P450 gene family (CYP1A, 3A, 4A, 11A) and modulation of gene expression (CYP1A) in the mussel Mytilus spp. Mar. Environ. Res., 1995. 39: p. 21-6. [110] Wootton, A., et al., Characterization of the presence and seasonal variation of a CYP1A-like enzyme in the digestive gland of the common mussel, Mytilus edulis. Mar. Environ. Res., 1996. 42: p. 297-301. [111] Peters, L.D., C. Nasci, and D.R. Livingstone, Immunochemical investigations of cytochrome P450 forms/epitopes (CYP1A, 2B, 2E, 3A and 4A) in digestive gland of Mytilus sp. Comp. Biochem. Physiol. C Pharmacol. Toxicol. Endocrinol., 1998. 121(13): p. 361-9. [112] Michel, X., et al., Benzo(a)pyrene hydroxylase activity in the marine mussel Mytilus galloprovincialis: a potential marker of contamination by polycyclic aromatic hydrocarbon-type compounds. Mar. Environ. Res., 1994. 38: p. 257-73. [113] Livingstone, D.R., et al., Apparent induction of a cytochrome P450 with immunological similarities to CYP1A in digestive gland of common mussel (Mytilus galloprovincialis L.) with exposure to 2,2',3,4,4',5'-hexachlorobiphenyl and arochlor 1254. Aquat. Toxicol., 1997. 38: p. 205-24. [114] Peters, L.D., C. Nasci, and D.R. Livingstone, Variation in levels of Cytochrome P4501A, 2B, 2E, 3A and 4A-immunoreactive proteins in digestive gland of indigenous and transplanted mussel Mytilus galloprovincialis in Venice lagoon Italy. Mar. Environ. Res., 1998. 46: p. 295-9. [115] Peters, L.D., et al., Development of cytochrome P450 as a biomarker of organic pollution in Mytilus sp.: field studies in United Kingdom ('Sea Empress' oil spill) and the Mediterranean Sea. Biomarkers, 1999. 4: p. 425-41. [116] Solé, M., et al., Effects of the 'Aegean Sea' oil spill on biotransformation enzymes, oxidative stress and DNA-adducts in digestive gland of the mussel (Mytilus edulis L.). Comp. Biochem. Physiol., 1996. 113C: p. 257-65. [117] Shaw, J.P., et al., Seasonal variation in mussel Mytilus edulis digestive gland cytochrome P450A- and 2E-immunoidentified protein levels and DNA strand breaks (Comet assay). Mar. Environ. Res., 2000. 50: p. 405-9. [118] Bard, S.M., Multixenobiotic resistance as a cellular defense mechanism in aquatic organisms. Aquat. Toxicol., 2000. 48(4): p. 357-389. [119] Wu, C.P., A.M. Calcagno, and S.V. Ambudkar, Reversal of ABC drug transportermediated multidrug resistance in cancer cells: evaluation of current strategies. Curr. Mol. Pharmacol., 2008. 1(2): p. 93-105. [120] Kimura, Y., et al., Mechanism of multidrug recognition by MDR1/ABCB1. Cancer Sci., 2007. 98(9): p. 1303-10. [121] Leslie, E.M., R.G. Deeley, and S.P. Cole, Toxicological relevance of the multidrug resistance protein 1, MRP1 (ABCC1) and related transporters. Toxicology, 2001. 167(1): p. 3-23. [122] Velamakanni, S., et al., ABCG transporters: structure, substrate specificities and physiological roles : a brief overview. J. Bioenerg. Biomembr., 2007. 39(5-6): p. 46571. [123] Janvilisri, T., et al., Arginine-482 is not essential for transport of antibiotics, primary bile acids and unconjugated sterols by the human breast cancer resistance protein (ABCG2). Biochem. J., 2005. 385(Pt 2): p. 419-26.

194

Sutin Kingtong and Tavan Janvilisri

[124] Cooray, H.C., et al., Interaction of the breast cancer resistance protein with plant polyphenols. Biochem. Biophys. Res. Commun., 2004. 317(1): p. 269-75. [125] Janvilisri, T., et al., Sterol transport by the human breast cancer resistance protein (ABCG2) expressed in Lactococcus lactis. J. Biol. Chem., 2003. 278(23): p. 20645-51. [126] Kurelec, B., The multixenobiotic resistance mechanism in aquatic organisms. Crit. Rev. Toxicol., 1992. 22(1): p. 23-43. [127] Smital, T. and B. Kurelec, The chemosensitizers of multixenobiotic resistance mechanism in aquatic invertebrates: a new class of pollutants. Mutat. Res., 1998. 399(1): p. 43-53. [128] Kingtong, S., Y. Chitramvong, and T. Janvilisri, ATP-binding cassette multidrug transporters in Indian-rock oyster Saccostrea forskali and their role in the export of an environmental organic pollutant tributyltin. Aquat. Toxicol., 2007. 85(2): p. 124-32. [129] Kurelec, B. and B. Pivcevic, Distinct glutathione-dependent enzyme activities and a verapamil-sensitive binding of xenobiotics in a fresh-water mussel Anodonta cygnea. Biochem. Biophys. Res. Commun., 1989. 164: p. 934-40. [130] Smital, T., R. Sauerborn, and B.K. Hackenberger, Inducibility of the P-glycoprotein transport activity in the marine mussel Mytilus galloprovincialis and the freshwater mussel Dreissena polymorpha. Aquat. Toxicol., 2003. 65(4): p. 443-65. [131] Zaja, R., et al., Haemolymph as compartment for efficient and non-destructive determination of P-glycoprotein (Pgp) mediated MXR activity in bivalves. Comp. Biochem. Physiol. C Toxicol. Pharmacol., 2006. 143(1): p. 103-12. [132] Minier, C., F. Akcha, and F. Galgani, P-glycoprotein expression in Crassostrea gigas and Mytilus edulis in polluted seawater. Comp. Biochem. Physiol. B, 1993. 106(4): p. 1029-36. [133] Minier, C. and M.N. Moore, Rhodamine B accumulation and MXR protein expression in mussel blood cells: effects of exposure to vincristine. Mar. Ecol. Progr. Ser., 1996. 142: p. 165-73. [134] Galgani, F., et al., Interaction of environmental xenobiotics with a multixenobiotic defense mechanism in the bay mussel Mytilus galloprovincialis from the coast of California. Environ. Toxicol. Chem., 1996. 15: p. 325-31. [135] Pain, S. and M. Parant, Identification of multixenobiotic defence mechanism (MXR) background activities in the freshwater bivalve Dreissena polymorpha as reference values for its use as biomarker in contaminated ecosystems. Chemosphere, 2007. 67(6): p. 1258-63. [136] Pain, S. and M. Parant, Response of multixenobiotic defence mechanism in Dreissena polymorpha exposed to environmental stress. Chemosphere, 2003. 52(7): p. 1105-13. [137] Parant, M. and S. Pain, Potential use of multixenobiotic defense mechanism (MXDM) in Dreissena polymorpha as a biomarker for the monitoring of freshwater pollution. Water Res., 2001. 35(15): p. 3743-8. [138] Minier, C., et al., Seasonal variation of MXR and stress proteins in the common mussel, Mytilus galloprovincialis. Aquat. Toxicol., 2000. 50(3): p. 167-176. [139] Desbrow, C., et al., Identification of estrogenic chemicals in STW effluent. : chemical fractionation and in vitro biological screening. Environ. Sci. Technol., 1998. 32: p. 1549-58.

Molecular Determinants in Mussels as Biomarkers for Environmental Stress

195

[140] Pojana, G., et al., Determination of natural and synthetic estrogenic compounds in coastal lagoon waters by HPLC-Electrospray-Mass Spectrometry. Int. J. Environ. Anal. Chem., 2004. 84: p. 717-27. [141] Safe, S.H. and K. Gaido, Phytoestrogens and anthropogenic estrogenic compounds. Environ. Toxicol. Chem, 1998. 7: p. 119-26. [142] DeRosa, C., et al., Environmental exposures that affect the endocrine system: public health implications. J. Toxicol. Environ. Health B Crit. Rev., 1998. 1(1): p. 3-26. [143] Harris, C.A., et al., The estrogenic activity of phthalate esters in vitro. Environ. Health Perspect, 1997. 105(8): p. 802-11. [144] Goksoyr, A., et al., Molecular/cellular processes and the impact on reproduction. Effects of pollution on fish, ed. A. Lawrence and K. Hemingway. 2003, Oxford: Blackwell Publishing. [145] Society, W.H.O.I.P.C., Global assessment of the state-of-the-science of endocrine disruptors. WHO/IPCS/EDC/02.2, ed. T. Damstra, et al. 2002, Geneva, Switzerland: World Health Organization. [146] Flouriot, G., et al., Influence of xenobiotics on rainbow trout liver estrogen receptor and vitellogenin gene expression. J. Mol. Endocrinol., 1995. 15(2): p. 143-51. [147] Li, Q., et al., Changes in vitellin during oogenesis and effect of estradiol 17-β on vitellogenesis in the Pacific oyster Crassostrea gigas. Invertebr. Reprod. Dev., 1998. 33: p. 87-9. [148] Matsumoto, T., et al., Molecular characterization of a cDNA encoding putative vitellogenin from the Pacific oyster Crassostrea gigas. Zool. Sci, 2003. 20: p. 37-42. [149] Gagné, F., C. André, and C. Blaise, Increased vitellogenin gene expression in the mussel Elliptio complanata exposed to estradiol-17β. Fresenius Environ Bull, 2005. 14: p. 861-6. [150] Gagné, F., et al., Evidence of coprostanol estrogenicity to the freshwater mussel Elliptio complanata. Environ. Pollut., 2001. 115: p. 97-106. [151] Marin, M.G. and V. Matozzo, Vitellogenin induction as a biomarker of exposure to estrogenic compounds in aquatic environments. Mar. Pollut. Bull, 2004. 48: p. 835-9. [152] Sumpter, J.P. and S. Jobling, Vitellogenesis as a biomarker for estrogenic contamination of the aquatic environment. Environ. Health Perspect, 1995. 103: p. 1738. [153] Pampanin, D.M., et al., Stress biomarkers and alkali-labile phosphate level in mussels (Mytilus galloprovincialis) collected in the urban area of Venice (Venice Lagoon, Italy). Environ. Pollut., 2005. 136: p. 103-7. [154] Blaise, C., et al., Experimentallyinduced feminisation of freshwater mussels after longterm exposure to a municipal effluent. Fresenius Environ. Bull, 2003. 12: p. 865-70. [155] Quinn, B., et al., The endocrine disrupting effect of municipal effluent on the zebra mussel (Dreissena polymorpha). Aquat. Toxicol., 2004. 66: p. 279-92. [156] Damiens, G., et al., Integrated biomarker response index as a useful tool for environmental assessment evaluated using transplanted mussels. Chemosphere, 2007. 66(3): p. 574-83. [157] Beliaeff, B. and T. Burgeot, Integrated biomarker response: a useful tool for ecological risk assessment. Environ. Toxicol. Chem., 2002. 21(6): p. 1316-22.

196

Sutin Kingtong and Tavan Janvilisri

[158] Hamer, B., et al., Effect of hypoosmotic stress by low salinity acclimation of Mediterranean mussels Mytilus galloprovincialis on biological parameters used for pollution assessment. Aquat. Toxicol., 2008. 89(3): p. 137-51. [159] Viarengo, A., et al., The use of biomarkers in biomonitoring: a 2-tier approach assessing the level of pollutant-induced stress syndrome in sentinel organisms. Comp. Biochem. Physiol. C Toxicol. Pharmacol., 2007. 146(3): p. 281-300. [160] Shepard, J.L., et al., Protein expression signatures identified in Mytilus edulis exposed to PCBs, copper and salinity stress. Mar. Environ. Res., 2000. 50(1-5): p. 337-40.

Reviewed by Weiwei Yan, Ph.D.; Associate Professor; College of Veterinary Medicine, Yangzhou University, People Republic of China

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 8

INTEGRATED IMPACT ASSESSMENT OF MUSSELS HEALTH Jocelyne Hellou1, 2, 3 and François Gagné4, 5, 6 1

Bedford Institute of Oceanography, Department of Fisheries and Oceans Dartmouth, Nova Scotia, Canada 2 Department of Chemistry, Dalhousie University Halifax, Nova Scotia, Canada 3 Department of Oceanography, Dalhousie University Halifax, Nova Scotia, Canada 4 Centre St-Laurent, Environnement Canada Montréal, Québec, Canada 5 Institut National de Recherche Scientifique Laval, Québec, Canada 6 Institut des Sciences de la Mer, Université du Québec à Rimouski Rimouski, Québec, Canada

ABSTRACT This chapter describes how the ―Mussel Watch‖ concept proposed by Goldberg in 1975 to assess and monitor the state of the water column has evolved over the past few decades. Definitions with specific examples are provided to illustrate the range of chemicals analysed in international programs interested in the presence of persistent organic pollutants, priority pollutants and emerging contaminants. Although the latter organic molecules are generally analyzed in the inflow and outflow of sewage treatment plants, they are also actively researched for potential risk needing attention in aquatic organisms. The measurement of effects going from the biochemical to the population level affecting reproduction is discussed in detail. Examples of studies measuring the depletion or enhancement of enzymatic activities are provided along with explanations on the type of stress linked to the toxic effects. The latest publications dealing with impact assessment encompassing chemical and environmental stresses highlight the complexity of the variables integrated by bivalves in response to changes in their habitat. The future of these investigations is in combining knowledge generated from ―curiosity based‖ and

198

Jocelyne Hellou and François Gagné ―solution oriented‖ research that uses chemical and biomarker measurements to determine the sustainability of aquatic ecosystems.

INTRODUCTION Marine and freshwater environments have been experiencing the effects of population expansion with increased anthropogenic input near shore where in many instances bivalves stand by as sentinel organisms. Because these invertebrates are available in many countries around the world, are easy to collect at low cost and are sessile, they have been used to reflect the state of contamination and resulting potential deleterious health effects due to human activities on inshore biota. Over the past four decades, bivalves have been collected to investigate the state of the water column using a diverse set of approaches increasing in complexity with time. Goldberg [1975] authored a landmark publication that is widely referred to as instigating the interest in using mussels to monitor the state of contamination of the oceans. Goldberg [1975] reviewed the earlier literature covering the bioaccumulation of organic contaminants and metals that motivated his call for action in adopting mussels for monitoring. Numerous field and laboratory studies regarding the use of mussels to assess aquatic environments have been undertaken since, along with the implementation of mussel watch programs. These investigations have been steadily expanding in scope. With time, the effects of contaminants on the health of the organisms became an additional subject of concern and research regarding biomarkers is also multiplying steadily. In the past decade, many field and laboratory investigations have integrated the use of biomarkers with bioaccumulation to help pinpoint cause-effects relationships when assessing environmental health. The changes associated with urbanization and population growth lead to increases in the impact of humans on the ecosystem and incorporate chemical contamination with associated stressors such as those due to climate and habitat changes.

REGULATIONS BEHIND ENVIRONMENTAL STUDIES WITH MUSSELS As described by Borja et al. [2008], legislations and regulations have been developed in Africa, Asia, Europe and North America to assess the state of the environment. The case of estuarine and coastal systems has been the focus of an international meeting, EcoSummit 2007-Ecological Complexity and Sustainability that generated this comprehensive review. The above summary and many other documents describe the Mussel Watch Project (MWP) initiated in the US in response to the requirements of the Clean Water Act, as an example of long-term monitoring. Since 1986, the MWP represented one component within the National Status and Trends (NST) program of the National Oceanic and Atmospheric Administration (NOAA). Many monitoring programs have also been started in Europe, Asia and Africa. The initial studies targeted priority pollutants.

Integrated Impact Assessment of Mussels Health

199

PRIORITY POLLUTANTS (PP) AND PERSISTENT ORGANIC POLLUTANTS (POP) Priority pollutant (PP) is a term that has been adopted to refer to contaminants high on the priority list for environmental analyses [Keith and Telliard, 1979], with well established and validated analytical methodologies. Persistent organic pollutants (POP) is another expression that has been commonly adopted to refer to chemicals that degrade very slowly or are continuously produced and introduced in the environment, accumulate in organisms and are toxic [Wania et al. 1998]. The synthetic chlorinated organic chemicals banned from production and use in Europe and North America because they are persistent, bioaccumulative and toxic [Mackay and Fraser, 2000] are also referred to as legacy chemicals. With the Stockholm Convention, the term ―dirty dozen‖ was applied to the organochlorines represented by the polychlorinated biphenyls (PCB), dioxins and furans, DDT, aldrin, dieldrin, endrin, chlordane, hexachlrobenzene, mirex, toxaphene and heptachlor that are listed for elimination or reduction by the United Nations [Kaiser and Eisenrich, 2000]. A group of POP and ubiquitous contaminants generated from combustion processes and present in fossil fuels is represented by the polycyclic aromatic hydrocarbons (PAH) and compounds (PAC). The latter term refers to PAH where one or more atoms are replaced by sulphur (S), nitrogen (N) or oxygen (O). PAH are PP and POP, while PAC are becoming of increasing interest because they are associated with PAH, are derived from the photooxidation or biodegradation of PAH and are minor components of fossil fuels [Beach et al. 2009 and 2010]. Although many metals are naturally present in the earth‘s crust, detectable in all soils and sediments, some are produced by mining and used for specific purposes related to industrial needs. Metal PP comprise arsenic (As), cadmium (Cd), copper (Cu), mercury (Hg) and lead (Pb), while other toxic elements of interest in monitoring studies include silver (Ag) and tin (Sn). A common property shared by POP is bioaccumulation. This is represented by a process whereby biota retain in their tissues the chemicals present in their surrounding environment. Bivalves take up these chemicals through passive diffusion during respiration where the passage of water soluble molecules occurs through the gills and by active transport resulting from the filtration of particle-bound lipophilic contaminants meant for ingestion and arriving in the digestive tract. In addition to this recognized fate of bioaccumulation, biotransformation can take place [Aasen et al. 2006]. The biotransformation of PAH occurs in mussels and can lead to DNA binding and damage [Akcha et al. 1999] and has been examined from an enzymatic and biochemical perspective. As well, atmospheric transformation rather than in situ biological transformation of DDT into DDE was shown to be the source of the latter transformation product detected in green mussels [Kwong et al. 2009]. Therefore, questions remain as to the chemical products produced by the transformation of reactive molecules such as PAH within bivalves. Laboratory-based and field investigations have demonstrated that PP are associated with toxicity, and this data has been used by many countries to generate statistically based air, biota, water, soil and sediment quality guidelines. Different terminology has been used and updated with time [Chapman et al. 1987; Long, 1992] in reference to the probability level (e.g. threshold effect level and probable effect level) that above such a concentration, there is

200

Jocelyne Hellou and François Gagné

x or y% probability of toxicity to occur (e.g. 25 and 50% probability, respectively). In Canada, Canadian Environmental Quality Guidelines are published by the Canadian Council of Ministers of the Environment (CCME). The latest updates were produced in 2010 and are available online. In the US, the Environmental Protection Agency (EPA) has published widely used guidelines for contaminants. In the EU, Oslo and Paris Convention for the Protection of the Marine Environment of the North East Atlantic (OSPAR) documentation covers the latest developments regarding how to rank environmental quality by relating measured concentrations of chemicals in comparison to ideal background levels. These publications are web-based and updated with the generation of new knowledge.

CHEMICALS ANALYZED IN MUSSELS The contaminants analyzed in mussels, oysters and zebra mussels, and studied by the USEPA include a series of 38 and more recently 65 PAH. Initially, these were equally divided between parental and alkylated derivates, and later in time, the alkylated homologues became predominant within the list. Parental compounds are more abundant in combustion sources, while the alkylated species predominate in fossil fuels [Neff, 1979]. In the case of PCB, 18 and now 51 congeners are targeted in analyses, along with the six DDT related compounds, four chlordane pesticides, two dieldrin derivatives, the tributyl- dibutyl- and monobutyltin (TBT, DBT and MBT) family, as well as 17 elements including As, Cd, Cu, Pb, Hg, nickel (Ni), Sn and zinc (Zn). The organotin derivatives are associated with the use of anti-foulant paints and share the properties of persistence, toxicity and bioaccumulation. A new class of chemicals of concern, the polybrominated diphenylethers (PBDE), used as flame retardants has also been added to the list of contaminants monitored in stored and more recently collected mussel samples. A major European effort was started in 1974 to monitor metals, organochlorines and PAH in mussels and oysters [Rodriguez y Baena and Thebault, 2006]. In 1996, radioisotopes were added to the monitored list of chemicals and include polonium (Po-210) that represents the radio-active isotope of lead and a by-product of phosphate fertilizers used in agriculture. In 2002, the Mediterranean Mussel Watch network was started and it includes the analysis of emerging contaminants (EC). EC refer to chemicals that were not previously the subject of investigations, and not to their actual novelty in terms of synthesis or use. EC are represented by a variety of organic chemicals covering a diverse range of structures present in pharmaceuticals and personal care products. Mussels have also been used for specific chemical surveys or assessments, such as to examine organochlorines in Asian countries [Monirith et al. 2003] or to detect polybrominated diphenyl ethers [Ramu et al. 2007]; to measure metals in Taiwan [Jeng et al. 2000] and in the Gulf of Greece [Zangrandi et al. 2005]. In Mobile Bay, Alabama, tributyltin and PAH were analyzed in bivalves [Peachy, 2003]. In 2006, the China Mussel Watch was carried out to analyse metals, organochlorines and total petroleum hydrocarbons [Cai et al. 2008]. These investigations revealed that mussels in polluted waterways are at risk given their tendency to accumulate many inorganic and organic contaminants. These contaminants represent one of the factors contributing to the global decline of native freshwater mussels [Douda, 2010].

Integrated Impact Assessment of Mussels Health

201

EMERGING CONTAMINANTS (EC) EC are represented by chemicals used in everyday life but that escaped attention in the past century because of their generally expected lower levels and lack of available analytical methods. EC are components present in products such as cosmetics, sunscreens, perfumes, shampoos, medication to treat human or animal diseases. They provide unique properties in the manufacture of products needed in cooking, cleaning, leisure activities and other materials. Some of these bioactive compounds used to increase the quality of life can have toxic properties when available to aquatic organisms and mussels [Liber et al. 1999; Gagné et al. 2006; Martin-Diaz et al. 2009]. EC became of greater concern when endocrine disrupting properties were discovered in animals living in proximity of sewage effluents [Jobling et al. 1998; Ternes, 2000]. Endocrine disruption results in the feminization of mussels and fish, with adverse effects on the endocrine system which are reflected in reproductive, developmental and behavioral endpoints [Snyder et al. 1999]. Endocrine disruption in invertebrates was the subject of a workshop organized in the Netherlands in 1998 and resulted in a book presenting the state of knowledge and future needs [DeFur et al. 1999]. The more potent identified EC are the female hormone 17β-estradiol and the active ingredient in the birth control pill, 17α-ethynylestradiol. EC have been detected in influents and effluents of sewage treatment plants and further away from discharges [Daughton and Ternes, 1999; Ternes, 2000; Robinson et al. 2009]. This area of research has been in exponential development with studies targeting the presence of newer classes of chemicals [Metcalfe et al. 2003, 2010; Scheurer et al. 2010]. EC cover a wide range of structures and solubility properties, while their concentration although generally in the ng/L range can reach up to the ug/L level [Fent et al. 2006]. Some EC are ionized, with either acidic or basic properties and determining their partitioning and fate in the abiotic environment and uptake by biota is ongoing. EC would accumulate in mussels in different proportions relative to their presence in water or particles, environmental distribution and concentration [Ramirez et al. 2009; Savanabhavan et al. 2009]. For example, the bioaccumulation of nonylphenol ethoxylates, plasticizers, and musk fragrances has been examined in bivalves [Gaterman et al. 1999; Gunther et al. 2001]. Now that reference materials are becoming available for their analyses, more monitoring will be taking place [Peck et al. 2007]. Another special class of EC consists of products from nanotechnology. Nanotechnology refers to materials with at least one dimension within 1-100nm and this size range is associated with novel physical and chemical properties. The diversity and complexity of these nanomaterials limits the development of a proper classification for nomenclature purposes [Helland et al. 2007]. In addition, a survey of industries involved in the production of nanomaterials revealed that 65% did not perform risk assessment of their products. Nanomaterials are thought to produce toxicity due to four fundamental properties [Gagné et al. 2008a] described as 1) the leaching of small molecules from the nanoparticles; 2) the nanoparticles size and form; 3) their surface area and reactivity, e.g. high energy electron conduction and photoelectric properties; 4) vectorisation. The latter term refers to the capacity of nanomaterials to act as carriers for other contaminants such as POP or metals. This property is actively exploited by the pharmaceutical industry for the production of enhanced drug delivery systems as well as for improved and targeted pharmacological effects. This new

202

Jocelyne Hellou and François Gagné

class of EC could also pose important health risks to resident filter feeders such as mussels. For example, Koehler et al. [2008] found that in mussel exposed to nanosized glass, a dramatic decrease of lysosomal membrane stability in gills and hepatopancreas was detected after 12hrs of exposure. This was accompanied by increased epithelial apoptosis with intracellular lipofuscin accumulation indicative of severe oxidative stress. Granulocyte phagocytosis activity and autophagy was also enhanced. This study suggests that nanomaterials, even when derived from ―inert‖ glass, could elicit strong inflammation/oxidative stress in mussels. Analyzing for these new chemicals involves developing and validating new methodologies and is a challenging task [Muir and Howard, 2006; Sheurer et al. 2010]. With the launch of the Commission on the registration, evaluation, authorization and restriction of chemical substances (REACH) in Europe in 2003, the presence, uptake and effect of previously overlooked molecules is being addressed in more detail with time [Gagné et al. 2001, 2005, 2006a and b]. The aim of the REACH program is to protect the environment and human health by being pro-active. It involves the detection of substances, determining if they are harmful and replacing them if alternatives are available.

UPTAKE MECHANISM Geographical and temporal trends of environmental quality are derived from bioaccumulation data involving bivalves (O‘Connor, 1996). In some locations, when field mussels are not available for the assessment of a specific site, caged mussels are introduced as a back up strategy [Salazar and Salazar, 1997; Blaise et al. 2003; Salazar et al. 2005]. Because accumulation results from the uptake of the water soluble and filtration of particle bound contaminants, the bivalves reflect the contaminants present in their immediate vicinity, i.e. the water column that they inhabit and the turbidity they experience due the suspension of sediments with available colloids [Axelman et al. 1999; Hellou et al. 2002, 2004]. This makes them ideal sentinel organisms for environmental chemistry and toxicology studies. Because of the close connection between bivalves and their environment, bioaccumulation will differ as a function of the location of the cages which could differ from the feral mussels. Field mussels are generally collected at the water line near shore, i.e. inter-tidal, while cages are usually sub-tidal, placed on a frame located at depth away from potential drainage from shore [Picardo et al. 2001]. The bioaccumulation and health state of the bivalves has been associated with additional exogenous physical conditions at the sampling sites. Variations in field bioaccumulation factors (BAF) can be due to changes in precipitation events transporting contaminants that lead to higher concentration in the aquatic environment in the fall relative to summer; to soil drainage or to the density of available food [Baumard et al. 1999]. For example, micro-algae were seen as a more important source of contaminants in winter relative to sediment particles, while water was a more important source in the summer [Pereira et al. 2004]. Another property affecting the bioavailability of ionic or metal contaminants is represented by pH. Temperature will also have an effect on the animals‘ physiology and this can in some cases affect bioaccumulation and biomarker results. For example, Gossiaux et al. [1998] observed higher uptake rates in zebra mussels exposed to increasing temperature from 4 to 200C for

Integrated Impact Assessment of Mussels Health

203

three out of four chemicals used in an exposure, i.e. hexachlorocyclohexane, pentachlorophenol and benzo(a)pyrene, but not with pyrene. Bivalves have the ability to adjust their filtration rates according to the environmental conditions where valve opening and closing was used as a biological sensor [Fdil et al. 2006]. Indeed, heavy metals such as Hg and Cu could significantly reduce valve opening in Mytilus galloprovincialis down to a complete closing when metal concentrations reached 50µg/L. The modulation in valve activity, a behavioural characteristic, could influence bioaccumulation when the level of contaminants threatens the health of the organisms. Bioaccumulation and toxic effects are also linked to endogenous parameters such as the age or size, sex and reproductive cycle of the sampled animals [Lobel et al. 1991; Tessier et al. 1996]. A study by Bruner et al. [1994] indicated that higher bioaccumulation factors were detected with increasing mussels‘ size. Because organic PP are lipophilic, increased bioaccumulation was also detected in pre-spawning mussels with higher lipid content than in the post-spawning animals with a lower level of lipids [Bruner et al. 1994; Hellou et al. 2003]. This elimination occurs along with a concomitant release of the contaminants in the gametes that takes place in addition to the natural excretion process [van Haren et al. 1994]. Taken together, endogenous and exogenous variables lead to seasonal differences in the mussels‘ body burden of contaminants [Hummel et al. 1990]. Therefore, these variables, plus sampling time have to be taken into consideration when comparing data and examining longterm trends in environmental quality assessments. The effects of pollution could be enhanced by the initiation of gametogenesis in feral Mya areneria clams found in locations receiving municipal waste water and in harbours [Gagné et al. 2007]. At polluted sites, clams undergoing gametogenesis were not ready to spawn, but gonadal cyclooxygenase activity was increased and significantly correlated with biomarkers of toxic stress, such as oxidative stress and DNA damage. A more practical aspect which varies between monitoring or assessment programs relates to the presence or absence of a step between the collection time and the freezing or processing of the animals. A depuration period between collection and analyses can take place. It has been demonstrated that chemicals concentrate first in the digestive gland of bivalves and a fraction will be excreted and another absorbed into other tissues with time [Decho and Luoma, 1996]. In the case of filter feeders with small body parts, analyzing whole animals is a practical approach and a depuration step will affect the bioaccumulation results [Lobel et al. 1991]. The presence or absence of a depuration step needs to be considered when comparing and interpreting results.

STEADY STATE, ACCUMULATION AND DEPURATION The time to reach near equilibrium between the level of contaminants in mussels and those in the surrounding aquatic environment depends on the dynamic nature of the location, animal species plus the hydrophobic properties of the chemicals. Non ionic lipophilic organic molecules with an octanol-water partition coefficient (Kow) log Kow<3 are available preferentially from the water soluble phase, while molecules with log Kow >6 are usually associated with suspended matter and taken up by filtration [McKim, 1994]. Chemicals with intermediate log Kow would be available from both pathways. Assuming a continuous

204

Jocelyne Hellou and François Gagné

presence of numerous contaminants, the more hydrophobic molecules would take longer to reach a steady state than the hydrophilic substances. An accumulation and depuration study was performed in Narragansett Bay, Rhode Island in 1982 [Pruell et al. 1986]. Blue mussels were shown to depurate tetracyclic PAH with a half-life between 12 and 30 days, while PCB were depurated with longer half-lives of 16 to 46 days. A decade later, a study of Baltic blue mussels demonstrated a negative relationship between uptake clearance rate and animals‘ body weight, with adjusted bioaccumulation factors for body mass increasing with the log Kow of the examined PCB congeners [Gilek et al. 1996]. A comparison between the fate of PCB and PBDE congeners with log Kow values between 5.67 and 7.39 was undertaken by Gustafsson et al. [1999]. It demonstrated relatively fast bioaccumulation of all compounds with 90% steady state expected to be reached between 18 and 85 days, but with some differences between the depuration rates of the two groups of contaminants. Although depuration rates decreased with higher hydrophobicity following first order kinetics for the PCB, the PBDE did not behave as expected leading to questions regarding their potential degradation, metabolism or absorption efficiency. In another study by Moy and Walday [1996], Mytilus edulis were exposed to one PAH, benzo(a)pyrene and one PCB congener 77 for 14 days and depuration lasted 30 days. Although both chemicals were accumulated following first order kinetics, steady state was not reached. Depuration was observed with the PAH, but not with the PCB. The bivalves were fed algae in the experiment and displayed a high variability in body burden. The difference between the depuration of the two compounds was proposed to be due to the metabolic transformation of the PAH facilitating its elimination. Thornsen et al. [2004] studied the elimination of a large series of PAH in the freshwater mussel Elliptio complanata and showed that the chemicals with log Kow <6 were eliminated with half lives between 3 and 16.5 days, similar to results published in earlier publications. The time to eliminate 95% of the body burden was between 11 and 71 days, longer for the more hydrophobic compounds. An experiment by DeKock [1983] examining the bioaccumulation of Cd and PCB in field transplanted blue mussels indicated that it can take up to 60 days for the former and 3 months for the latter chemicals to reach a steady state in terms of measured dry weight body burden. A study performed by Peven et al. [1996] covering the uptake and depuration of a series of PAH, PCB and DDT pesticides pointed out that concentrations tended to reach a steady state in uptake after 40-50 days and elimination after 68 days. However, the fingerprints of congeners varied between the one detected in the solid phase membrane device representative of seawater and that in animals. The type of particle, quality or nature of the organic carbon, such as algae during feeding or soot derived from an aluminum smelter also play a role in the accumulation and depuration process [Bruner et al. 1994; Bjork and Gilek, 1997; Gossiaux et al. 1998]. The diversity of parameters affecting the level of anthropogenic chemicals in bivalves has also been shown to play a role in investigations involving toxins and is briefly described below to point out important common aspects.

Integrated Impact Assessment of Mussels Health

205

TOXINS The fate of paralytic shellfish poisoning (PSP) in bivalves has been pursued by a number of investigators due to the serious health problems resulting from the consumption of shellfish exposed to harmful algal blooms. Lessons learned from the inter-comparison of bioaccumulation in various species and differences in toxic effects on aquatic organisms have been reviewed by Bricelj and Shumway [1998]. The blue mussels were described as rapid detoxifiers of the water soluble neurotoxins with a limited ability to metabolize the chemicals and with higher bioaccumulation capacity than other bivalves. It was explained that for this reason, Mytilus edulis are used to identify the source of toxins and in monitoring. They provide an early warning signal of bioaccumulation that would follow at a later time in other species and hence knowing the state of bioaccumulation of PSP in mussels can help to pursue preventive action. Many more complex angles of previously published studies were also discussed by the authors [Bricelj and Shumway, 1998]. The common point between toxins and contaminants regards their faster uptake compared to depuration rates that vary with structure, specific animal species and environmental characteristics, as well as the higher bioaccumulation in the visceral mass compared to the rest of tissues.

MODELING TO UNTANGLE COMPLEXITY A discussion of available models to determine bioaccumulation has been published by the US EPA in a document prepared for assessing sediment quality [EPA, 2000]. Models have been developed with different levels of complexity based on first order kinetics and the equilibrium partitioning approach, or from a more sophisticated food chain perspective. Modeling can be undertaken to predict bioaccumulation and replace a field based approach involving the collection and analysis of samples. Presently, modeling is referred to in order to explain the complexity behind the integration process that mussels perform in the aquatic environment. A number of parameters are needed to estimate bioaccumulation as outlined in the Morrison et al. [1996] model that applies to various types of invertebrates. The detailed model was generated to help predict bioaccumulation in filter feeders and was based on a field study of the bioaccumulation of PCB congeners. In this model, uptake included respiration and ingestion, while elimination considered metabolism and faecal excretion. The environmental properties required in the model comprised the particulate organic carbon content, the concentration of PCB in plankton and suspended solids representing the mussels‘ diet, the density of sediment, plankton and of the modeled organisms. The animals‘ properties were described by the lipid content and the PCB assimilation efficiency (from food and water), the fraction of ingested diet and the metabolic rate of the animals. When environmental properties are known for a location, and the physiology of a species of interest is available, the model can predict the bioaccumulation in various links of the food web and help in defining observed body burdens or the changes detected in long-term monitoring.

206

Jocelyne Hellou and François Gagné

Modeling could be especially useful when comparing the physiological parameters of a species collected at a more pristine site relative to a contaminated one, along with measured and predicted bioaccumulation for more conventional contaminants relative to EC.

SETTING THE CONTEXT OF IMPACTS DUE TO ENVIRONMENTAL STRESSORS Toxic effects can be studied at various levels of organisation and this topic has been elegantly described in a chapter by Hinton [1994]. Sub-lethal toxicity is used as an early warning signal of effects and is determined at the biochemical level of organisation. More pronounced toxicity can be reflected at the cellular level, moving on to tissue then organ, progressing to an individual, population, community and with the ecosystem level representing the worst case scenario. Such a situation would be indicated by the disappearance of a species or replacement of a sensitive one by a more resilient one [Hansen et al. 1999]. There are many biological indicators of toxicity or biomarkers that can be applied to determine either cumulative or specific effects [Monserrat et al. 2007]. The stressors are usually contaminants but also include other variables such as nutritional status, adaptation to thermal and habitat changes. Another feature of a biomarker is the ecological relevance when populations or communities are involved. Indeed, biomarkers not only provide information about the health status of individuals composing the population, but also an inferred knowledge towards their health status in terms of population integrity. The latter is perceived as an added value in environmental science and risk assessment.

TOXICITY EXPRESSED AT DIFFERENT LEVELS OF ORGANISATION Biochemicals based on metabolites or chemical composition could be used to diagnose the health status of an organism. They are represented by families of intrinsic biological products, i.e. lipids, carbohydrates, amino acids, co-factors and neuro-hormonal mediators which are measured as a total content of the whole soft tissue mass or of a particular organ. Some chemical markers are also more specific in nature, for example the level of serotonin and dopamine in freshwater mussels reflected hormonal changes and was associated with differing sex ratios near municipal effluents [Gagné et al. 2003]. Functional biochemistry deals with the expression and function of proteins, DNA/RNA metabolism and membranes including fundamental catalytic functions, i.e. enzymes, to ensure proper rates and equilibrium of the plethora of biochemical reactions that form the basis of life. For example, vitellogenin levels were analysed in freshwater mussels and clams to compare the sexual status or energy reserves of field animals by Gagné et al. [2001, 2002, 2003]. The ecological importance of the ratio of RNA to DNA has been reviewed by Chicaro and Chicaro [2008]. It is used to determine an environmental impact on the nutritional condition and tissue growth of organisms. Enzymatic studies can examine for example the induction or depletion of acetylcholinesterase indicative of neurotoxicity experienced by animals exposed to pesticides and metals, or changes in metallothionein levels associated

Integrated Impact Assessment of Mussels Health

207

with exposure to metals, or of cytochrome P450 that are involved in the biotransformation of planar aromatic molecules. Cellular toxicity can examine phagocytosis or lysosomal membrane stability [Moore et al. 2006], being indicative of an animal‘s immune response and cellular digestion processes, respectively. As with other markers discussed above, the immune system integrates exposure conditions involving contaminants, micro-organisms, and stress due to changes in temperature and pH. Histopathology would represent a higher and more definitive level of toxicity involving tissues. At the individual level of organisation, respiration and heart rate can be measured. These biomarkers were designed and used to infer impacts on survival, reproduction and growth in organisms facing contaminated environments. The endpoints of survival, reproduction and growth are indicative of effects that could resonate at the population level and of potentially more widespread effects in the ecosystem. Many studies combine a number of toxic endpoints in their investigations to better delineate the potential impact due to environmental exposure and sort out the effect of endogenous and exogenous variables on the measured response [Hellou and Law, 2003; Bocchetti and Rigoli, 2006; Raftopoulos et al. 2006; Osman et al. 2007]. As glimpsed from the above, there are cumulative indicators of health condition experienced by an animal and some more specific markers that can be related to a cause, such as metals affecting metallothionein levels. However, there is also a cascade of effects that progresses with exposure at a chronically contaminated site, while in a number of cases, there is also a multi-xenobiotic resistance or adaptation that can be developed [Kurelec, 1992; Devier et al. 2005]. Hence, multiple challenges are faced in untangling the potential biogenic or anthropogenic causes and effects associated with toxicity. A comprehensive set of biomarkers is needed to answer complex ecotoxicological questions given that organisms are often exposed to chemical mixtures and other stressors found in harbours and estuaries [e.g. Yeats et al. 2008].

LINK BETWEEN BIOMARKERS In previous studies with Mya arenaria clams, biomarkers were used to ascertain the organisms‘ health and understand changes at the population level [Amiard et al. 2006; Smolders et al. 2004; Gagné et al. 2008b]. The following biomarkers were able to predict changes at the population level associated with survival, growth and reproduction: metallothionein induction, immune-competence, cellular energy allocation (i.e., mitochondrial activity and energy reserves in cells or tissues) and vitellogenin. Contaminants acting as endocrine disruptors such as estrogens could bring about disruption of gametogenesis thereby decreasing or increasing egg yolk proteins at critical levels and compromising adequate embryonic growth and development [Gagné et al. 2003; Hellou et al. 2003]. In another investigation, clams exhibiting sustained phagocytosis and mitochondrial electron transport activity displayed poor condition (clam weight/shell length), low growth index and poor clam bed density [Gagné et al. 2008b]. In another case, the disruptive effects of pollution in cold and warmth-adapted clam populations were examined in an attempt to understand the interaction between climate adaptations and pollution stress [Gagné et al. 2009]. This work revealed that clam populations

208

Jocelyne Hellou and François Gagné

from warm-water sites and under no influence of anthropogenic activity contained less heavy metals (Ag, As, Cr, Hg and Ni) and had lower temperature-sensitive electron transport activity than clams from cold-water sites. The activity of malate dehydrogenase, a mediator between malate production in mitochondria and the production of co-factors for lipid synthesis in cells were also lower at warmth-adapted sites, which indicated that temperature brings about less energy to support lipid stores in clams‘ gonad tissues. The study also revealed that pollution increased temperature sensitivity of mitochondrial electron transport activity in clams in cold water, while temperature sensitivity in malate dehydrogenase was observed in clams from warm-water sites. Research aiming at understanding the interactions between pollution and temperature will help to better define the cumulative effects due to various environmental stressors in this time of global warming.

EFFECTS ASSOCIATED WITH CHEMICAL STRESSORS A unique example involving the development of a cumulative physiological biomarker, scope for growth (SFG) was undertaken by the Widdows‘ group in the UK. SFG reflects the health state of bivalves as indicated by measuring the combination of three parameters, i.e. respiration rate, clearance rate and food absorption efficiency [Widdows et al. 2002]. The interpretation of toxicity is based on a wealth of knowledge that was acquired by making a link between SFG and mussels‘ body burden that was established for >30 groups of contaminants [e.g. Widdows and Donkin, 1991; Widdows et al. 1995]. Quantitative structure activity relationships were used to pinpoint the role played by contaminants on measured SFG. Widdows et al. [2002] described one aspect in the development of investigations covering 38 sites on the coast of the Irish Sea. Mussels were analyzed for SFG and the bioaccumulation of PCB, PAH, DDT, linear alkylbenzenes, two chlorinated pesticides, tributyltin and ten metals. The contaminants were chosen because they are representative of material present in sewage effluents, a source of a tremendous variety of anthropogenic chemicals. An inverse relationship was displayed between SFG and the concentration of contaminants, but greater than could be explained by the analyzed compounds, where PAH accounted for 50-80% of the reduction in SFG. A freshwater study integrating chemistry and biochemical markers of toxicity is described by Binelli et al. [2006]. The authors analyzed POP covering 23 PCB congeners, 11 PAH, 6 DDT derivatives and additional pesticides along with acetylcholinesterase and etoxyresorufin-o-deethylase (EROD) activity in mussels collected from 25 sites in Italy. The induction or inhibition of enzyme activity was chosen because it is advantageous as an early warning marker. In the detailed discussion of the background in the literature, the authors point out the inverse U shaped response previously detected for EROD relative to exposure to increased levels of PCB and the importance of analyzing for the bioaccumulation of organic contaminants to interpret the observed activity. The two sets of results for biomarkers and chemical analyses were used individually or in combination to classify the sites into quality groups relative to control mussels from the Italian lakes. Since PAH were not abundant, while PCB and DDT were predominant, and chlorpyrifos oxon present at noticeable levels in some of the samples, these concentrations were relied on to generate quality criteria that were correlated with EROD activity. The inter-comparison of results also raised more questions on

Integrated Impact Assessment of Mussels Health

209

contaminants that were pursued in additional studies [e.g. Binelli et al. 2007; Binelli et al. 2009]. Many other investigations have integrated markers of exposure and effects in an attempt to better describe the impact of contamination on bivalves. Various approaches have been applied and depend on factors such as the amount of prior historical information available for sources or levels of contamination at a site, the goal of an investigation, the specialties between collaborators and available resources.

BIOMARKERS OF TOXICITY FOR POPULATION PROTECTION AND CONSERVATION Biomarkers also provide the opportunity to strengthen exposure-effects relationships by applying discoveries obtained in laboratory experiments to field situations where cumulative effects are likely to appear. For example, Pyganodon grandis mussel were transplanted in lakes contaminated with cadmium (Cd) from historical mining activities in an attempt to seek an association between the level of Cd in water, its bioavailability, Cd distribution within proteins in the cytosol and reduced survival [Perceval et al. 2006]. Lower mussel survival was associated with lower Cd sequestration by metallothionein-like proteins and with an accumulation of Cd in the high molecular weight proteins in the cytosol. In another study with marine mussels, the local population collected near a raw sewage effluent outflow and marine naval dockyards (a source of organotins) were more contaminated with PAH, coprostanol, Ag and total tin [Hellou et al. 2003]. There were twice more males than females, increased lipids in males compared to females, while the latter had delayed vitellogenin-like protein production which effects were consistent with the bioavailable contamination profile in mussels. These studies show the relationships between exposure to environmental contaminants, their occurrence in tissues and subsequent biological effects observed at a higher level of biological organization.

MOVING FORWARD–TOWARDS INTEGRATION AND UNDERSTANDING CUMULATIVE EFFECTS Current research activities are aiming to integrate chemical and biological effects data in an attempt to provide a more complete understanding of the impacts of pollution stress on feral organisms. When integrating these aspects, one quickly comes to realize that there is no such thing as a single exposure to a stressor. For example, in mussels, the entry of multiple contaminants from water and suspended materials is added to cyclic tides where intertidal mussels are exposed to air temperatures, this goes on during times of reproduction when major energy expenditures are required, and while combating invading microorganisms such as potentially pathogenic bacteria and algae. This example highlights the complexity of cumulative effects due to various environmental stressors towards the health status of a mussel population. This forces the risk assessment community to not only look at the inherent toxicity of a given chemical or classes of chemicals, but to understand the processes that are

210

Jocelyne Hellou and François Gagné

at play by including the thermal history, tidal regime of the local ecosystem, and the diversity of pollution such as industrial effluents, municipal effluents, harbour activity or boat traffic. To illustrate this, blue mussels collected near a major sewage effluent discharge were less resilient to survival in air than counterparts further away from the runoff [Hellou and Law, 2003; Hellou et al. 2006]. The mussels also had more oxidative stress and oxidative metabolism of xenobiotics and expended more energy as evidenced by increased mitochondrial electron transport activity [Yeats et al. 2008]. These air temperature-sensitive mussels also contained a variety of contaminants in their tissues (coprostanol, PAH, p‘pDDE, Ag, Cu, Fe and P) indicating that the exposure to sewage effluents was deleterious. Cumulative effects studies bring about the challenge of understanding impacts at a global scale. Most studies are fairly localized i.e., within an area usually under 100 km. Indeed, studies performed at a larger scale complicate the use of reference sites. Is there a global reference site on the planet? A reference is supposedly a site as close as possible or nearly identical to the site under consideration due to stress. This can sometimes be achieved without difficulty at a local scale but is nearly impossible when distances are reaching planetary scales. To illustrate this challenge, an extensive biomarker study with blue mussels was performed covering a distance of 11,000 km starting on the Pacific ocean at the north-west coast of Canada and ending at the North-West coast of France in the Seine estuary in the Atlantic [Gagné et al. 2008c]. Intertidal Mytilus edulis mussels were collected in June (within 2 weeks time), in four regions, each containing one local reference and two polluted sites. Mussels were analyzed using a comprehensive biomarker battery composed of 18 biomarkers including mussel condition, gonad development, oxidative stress, DNA damage, metal and organic metabolism. When considering only the reference sites from each of the regions, the distribution of the biomarker data deviated from normality most of the time (83 % of the time) highlighting the heterogeneity of the four references sites. Moreover, the discrimination factor, defined as the data spread (maximum – minimum values) divided by the standard deviation, reached most of the time the number of regions covered (4), indicating again that reference sites from each region were actually different from each other. However, three biomarkers were normally distributed albeit with discriminant factors of 3-4; these are lipid content of gonads, purine (DNA) salvage pathways and lipid peroxidation in digestive gland. Cellular energy expense as defined by mitochondrial electron transport activity were readily different at the four reference sites indicating that energy expenditure greatly varied between the less contaminated ―clean‖ sites and that other ―natural‖ factors were at play such as thermal history, habitat characteristics, tidal cycles, distance from shore and/or genetic traits. The cumulative effects of pollution on mussels collected at this scale revealed that mussels from polluted and warmer sites displayed a negative energy budget as estimated with the ratio of mitochondria electron transport activity/gonad lipids. This highlights the inherent difficulties of cumulative effects studies when distances reach global scales. Temporal trend surveys will add another level of complexity because temporal trends (i.e. natural variability) of the ―reference‖ site needs to be first understood to identify effects of other environmental stressors such as pollution and climate change. These difficulties limit attempts to integrate the biomarker data. However, in the mussel study described above, a biomarker index was calculated and included each of the reference sites. It revealed that one region was seemingly more affected (Seine estuary) than the others. This study was the first attempt to compare impacts of pollution at global scales in the Northern hemisphere.

Integrated Impact Assessment of Mussels Health

211

Another strategy consists of changing the reference vs polluted or stressed site design by defining a normal range of responses of a biomarker where responses outside a given interval of the biomarker response would indicate a potential problem. For example, metallothionein values in the range of 200-800 pmole/mg proteins are considered normal and values above 800 pmole/mg proteins represent a toxic exposure to divalent heavy metals. The limitation of this approach is that these intervals might be difficult to establish in the context of multiple environmental stressors. In the environment, organisms are seldom under a unique stressor but exposed to many contaminants at the same time. The toxic outcome will depend on the ―summation‖ or the accumulation of toxic stress.

CAGED BIVALVES In the absence of bivalves at a site, caged bivalves can be introduced to examine the fate and effects of contamination. Caging can also be used to examine the progress of uptake or effects over time [Frenzilli et al. 2004], or to compare a short-term response for transplanted mussels relative to a continuous exposure of native bivalves. An example from a recent study is described by Nigro et al. [2006]. Genotoxicity associated with DNA strand breaks was investigated along with lysosomal membrane alterations in mussels transplanted for a period of one month relative to native animals. Measurements of membrane integrity and DNA provided similar results in both sets of animals; however alterations of micronuclei frequency and lysosome diameter were observed in native samples only when compared to control and characterized as due to cumulative chronic exposure.

CONCLUSIONS As described in this review, Goldberg‘s [1975] recommendation to adopt bivalves as bioindicators to assess the quality of the water column in coastal and estuarine locations has been considered and expanded over the years. Even today, studies using bivalves are actively found in the literature: for example a Scopus search of bivalves in June 2010 found 15,330 references, where 948, 718 and 172 were associated with contamination, toxicity and both words, respectively. These studies started with the bioavailability of contaminants where biomarkers of effects were gradually included in the attempt to link chemical monitoring initiatives with biological effects assessments. In recent years, these investigations have evolved to include cumulative effects of environmental stressors by examining the interactions between contaminant tissue burdens and biomarkers of chronic stress (sub-lethal) with temperature (climate change), salinity (estuaries and changes in tidal regimes), eutrophication (anoxia and ammonia), the ability to protect against disease (immune system), nutritional status and reproduction. The current state of knowledge is in its infancy and we need to continue building our understanding of the cumulative effects of all the above mentioned environmental stressors on the health status of bivalves and the worldwide maintenance of populations. These studies will also permit environmental managers to use this resource in a durable manner. When our capacity to predict changes will increase,

212

Jocelyne Hellou and François Gagné

catastrophes can be prevented instead of responding after damage reaches the population which is usually too late to intervene. Knowledge empowers stakeholders involved in decision making. As stated by John D Barrow [1988] ―science is really founded on observations rather than upon facts, and so is a continually evolving structure.‖ Progress comes from a society that invests into the generation of ―curiosity based‖ and ―solution oriented‖ knowledge.

ACKNOWLEDGMENTS The authors acknowledge the support of the Department of Fisheries and Oceans (JH), Dalhousie University (JH), Environment Canada (FG), l‘Institut National de Recherches Scientifiques (FG), and l‘Institut des Sciences de la Mer (FG).

REFERENCES Akcha, F. Burgeot, T. Venier, P. and Narbonne, J.F. (1999). Relationship between kinetics of benzo[a]pyrene bioaccumulation and DNA binding in the mussels Mytilus galloprovincialis. Bulletin Environmental Contamination Toxicology, 62, 455-462. Amiard, J.C. Amiard-Triquet, C. Barka, S. Pellerin, J. and Rainbow, PS. (2006). Metallothioneins in aquatic invertebrates: their role in metal detoxification and their use as biomarkers. Aquatic Toxicology, 76, 160–202. Aasen, J.A. Hardstaff, W. Aune, T. and Quilliam, M.A. (2006). Discovery of fatty acid ester metabolites of spirolide toxins in mussels from Norway using liquid chromatography/tandem mass spectrometry. Rapid Communication Mass Spectometry, 20, 1531-1537. Axelman, J. Naes, K. Naf, C. and Broman B. (1999). Accumulation of polycyclic aromatic hydrocarbons in semi-permeable membrane devices and caged mussels (Mytilus edulis) in relation to water column phase distribution. Environmental Toxicology Chemistry, 18, 2454–2461. Barrow, JD. (1988). The world within the world. Oxford and Clarendon Press, US. 398pp. Baumard, P. Budinski, H. Garrigues, P. Dizer, H. and Hansen, P.D. (1999). Polycyclic aromatic hydrocarbons in recent sediments and mussels (Mytilus edulis) from the Western Baltic Sea: occurrence, bioavailability and season variations. Marine Environmental Research, 47, 17-47. Beach, D.G. Quilliam, M.A. and Hellou, J. (2009). Analysis of pyrene metabolites in marine snails by liquid chromatography using fluorescence and mass spectrometry detection. Journal Chromatograph,y 877B, 2142-2152. Beach, D.G. Quilliam, M.A. Rouleau, C. Croll, R.P. and Hellou, J. (2010). Bioaccumulation and Biotransformation of Pyrene and 1-Hydroxypyrene by the Marine Whelk Buccinum undatum. Environmental Toxicology Chemistry, 29, 779-788. Binelli, A. Richardi, F. Riva, C. and Provini, A. (2006). Integrated use of biomarkers and bioaccumulation data in zebra mussels (Dreissena polymorpha) for site specific quality assessments. Biomarkers, 11, 428-448.

Integrated Impact Assessment of Mussels Health

213

Binelli, A. Riva, C. and Provini, A. (2007). Biomarkers in zebra mussels for monitoring and quality assessment of Lake Maggiore (Italy). Biomarkers, 12, 349-368. Binelli, A., Parolini, M. Cogni, D. Pedriali, A. and Provini A. (2009). A multi-biomarker assessment of the impact of the antibacterial trimethoprim on the non-target organism Zebra mussel (Dreissena polymorpha). Comparative Biochemisttry Physiology C Toxicology Pharmacology, 150, 329-36. Bjork, M. and Gilek, M. (1997). Bioaccumulation kinetics of PCB 31, 49 and 153 in the blue mussel, Mytilus edulis, as a function of algal food concentration. Aquatic Toxicology, 38, 101-123. Blaise, C. Gagne, F. Salazar, M. Salazar, S. Trottier, S. and Hansen, P.D. (2003). Experimentally- induced feminisation of freshwater mussels after long-term exposure to a municipal effluents. Fresinius Environmental Bulletin, 12, 865-870. Bocchetti, R. and Rigoli, F. (2006). Seasonal variability of oxidative biomarkers, lysosomal parameters, metallothioneins and peroxisomal enzymes in Mediterranean mussel Mytilus galloprovincialis from Adriatic Sea. Chemosphere, 65, 913-921. Borja, A. Bricker, S.B. Dauer, D.M. Demetriades, N.T. Ferreira, J.G. Forbes, A.T. Hutchings, P. Jia, X. Kenchington, R. Marques, J.C. and Zhu, C. (2008). Overview of integrative tools and methods in assessing ecological integrity in estuarine and coastal systems worldwide. Marine Pollution Bulletin, 56, 1519-1537 Bricelj, V.M. and Shumway, S.E. (1998). Paralytic shellfish toxins in bivalve mollusks: occurrence, transfer kinetics, and biotransformation. Reviews Fisheries Science, 6, 315383. Bruner, K.A. Fisher, S.W. and Landrum, P.F. (1994). The role of zebra mussel, Dreissena polymorpha, in contaminant cycling: 1. The effect of body size and lipid content on the bioconcentration of PCBs and PAHs. Journal Great Lakes Research, 20, 725-734. Cai, W. X. Lin, Q. Li, C. and Gan, M. (2008). The application and development of the ―Mussel Watch‖ system in China. Bioinformatics Biomedical Engineering 2nd International Conference. pp 4512-4518. Chapman, P.M., Barrick, R.C., Neff, J.M. and Swartz, R.C. (1987). Four independent approaches to developing sediment quality criteria yield similar values for model contaminants. Environmental Toxicology Chemistry, 6, 723-725. Chicaro, M.A. and Chicaro, L. (2008). RNA:DNA ratio and other nucleic acid derived indices in marine ecology. International Journal Molecular Science, 9, 1453-1471. Daughton, C.G. and Ternes, T.A. (1999) Pharmaceuticals and personal care products in the environment: agents of subtle change? Environmental Health perspectives 107, 907-937. Decho, A.W. and Luoma, S.N. (1996). Flexible digestion strategies and trace metal assimilation in marine bivalves. Limnology Oceanography, 41, 568-572. DeFur, P.L. Crane, M. Ingersoll, C. Tattershsfield, L. Editors. (1999). Proceedings from the International SETAC (Society of Environmental Toxicology and Chemistry) Workshop on endocrine disruption in invertebrates: endocrinology, testing and assessment. The Netherlands: Noordwijkerhout; 1998; 303pp. DeKock, W.C. (1983). Accumulation of cadmium and polychlorinated biphenyls by Mytilus edulis transplanted from pristine water into pollution gradients. Canadian Journal Fisheries Aquatic Sciences, 40 Suppl. 2, 282-294. Devier, M.H. Augagneur, S. Budzinski, H. le Menach, K. Mora, P. Narbonne, J.F. and Guarrigues, P. (2005). One year monitoring survey of organic compounds (PAHs, PCBs,

214

Jocelyne Hellou and François Gagné

TBT), heavy metals and biomarkers in blue mussels from the Arcachon Bay, France. Journal Environmental Monitoring, 7, 224-240. Douda, K. (2010). Effects of nitrate nitrogen pollution on central European unionid bivalves revealed by distributional data and acute toxicity testing. Aquatic Conservation: Marine and Freshwater Ecosystems, 20, 189-197. EPA. (2000). Bioaccumulation testing and interpretation for the purpose of sediment quality assessment. Status and needs. Bioaccumulation analysis workshop. Washington, DC, USA. EPA-823-R-00-001. Fdil, M. A. Mouabad, A. Outzourhit, A. Benhra, A. Maarouf, A. and Pihan, J.C. (2006). Valve movement response of mussel Mytilus galloprovincialis to metals (Cu, Hg, Cd and Zn) and phosphate industry effluents from Moroccan Atlantic coast. Ecotoxicology, 15, 477-486. Fent, K. Weston, A.A. and Caminada, D. (2006). Ecotoxicology of human pharmaceuticals. Aquatic Toxicology, 76, 122-159. Frenzilli, G. Bocchetti, R. Pagliarecci, M. Nigro, M. Annarumma, F. Scarcelli, V. Fattorini, D. and Regoli, F. (2004). Time-course evaluation of ROS-mediated toxicity in mussels, Mytilus galloprovincialis, during a field tranlocation experiment. Marine Environmental Research, 58, 609-613. Gagné, F. Marcogliese, D.J. Blaise, C. and Gendron, A.D. (2001). Occurrence of compounds estrogenic to freshwater mussels in surface waters in an urban area. Environmental Toxicology, 16, 260-268. Gagné, F. Blaise, C. Pellerin, J. and Gauthier-Clerc, S. (2002). Alteration of the biochemical properties of female gonads and vitellins in the clam Mya arenaria at contaminated sites in the Saguenay Fjord. Marine Environmental Research, 53, 295-310. Gagné, F. and Blaise, C. (2003). Effects of municipal effluents on serotonin and dopamine levels in the freshwater mussel Elliptio complanata. Comparative Biochemical Physiology. C Toxicology Pharmacology, 136, 117-125. Gagné, F. Blaise, C. Pellerin, J. Pelletier, E. Douville, M. Gauthier-Clerc, S. and Viglino, L. (2003). Sex alteration in soft-shell clams (Mya arenaria) in an intertidal zone of the Saint Lawrence river (Quebéc, Canada). Comparative Biochemical Physiology C Toxicology Pharmacology, 134, 189-198. Gagné, F. André, C. and Blaise, C. (2005). Increased vitellogenin gene expression in the mussel Elliptio complanata exposed to estradiol-17β Fresenius Environmental Bulletin 14, 861-866. Gagné, F. Blaise, C. Fournier, M. and Hansen, P.D. (2006a). Effects of selected pharmaceutical products on phagocytic activity in Elliptio complanata mussels. Comparative Biochemistry Physiology, 143C, 179-186. Gagné, F. Eullaffroy, P. and Blaise, C. (2006b). Development of a competitive enzymatic immunoassay for carbamazepine in biological tissues. Fresenius Environmental Bulletin, 15, 1512-1516. Gagné, F. Blaise, C. Pellerin, J. and André, C. (2007). Neuroendocrine disruption in Mya areneria clam during gametogenesis at sites under pollution stress. Marine Environmental Research, 64, 87-107. Gagné, F. Gagnon, D. and Blaise, C. (2008a). Aquatic nanotechnology. A review. Research Trends (Current Topics in Toxicology) 4, 1-14.

Integrated Impact Assessment of Mussels Health

215

Gagné, F. Blaise, C. Pellerin, J. Fournier, M. Durand, M.J. and Talbot, A. (2008b). Relationships between intertidal clam population and health status of the soft-shell clam Mya arenaria in the St. Lawrence Estuary and Saguenay Fjord (Québec, Canada. Environment International, 34, 30–42. Gagné, F. Burgeot, T. Hellou, J. St-Jean, S. Farcy, E. and Blaise, C. (2008c). Spatial variations in biomarkers of Mytilus edulis mussels at four polluted regions spanning the Northern Hemisphere. Environmental Research, 107, 201-217. Gagné, F. André, C. Blaise, C. Pellerin, J. Sherry, J. and Talbot, A. (2009). An investigation on the disruptive effect of pollution in cold- and warm- adapted clam populations. Invertebrate Survival Journal, 6, 144-153. Gatermann R., Hellou J, Huhnerfuss H., Rimkus G. and Zitko V. (1999). Polycyclic and nitro musks in the environment: a comparison between Canadian and European aquatic biota samples. Chemosphere, 38, 3431-3441. Gilek, M. Bjork, M. and Naf, C. (1996). Influence of body size on the uptake, depuration and bioaccumulation of polychlorinated biphenyl congeners by Baltic Sea blue mussels. Marine Biology, 125, 499-510. Goldberg, E.D. (1975). The Mussel Watch: a first step in global marine monitoring. Marine Pollution Bulletin, 6, 111. Gossiaux, D.C. Landrum, P.F. and Fisher, S. (1998). The assimilation of contaminants from suspended sediment and algae by the zebra mussel, Dreissena polymorpha. Chemosphere, 36, 3181-3187. Gunther K., Dürbeck H.W., Kleist E., Thiele B., Prast H. and Schwuger M. (2001) Endocrine-disrupting nonylphenols: ultra-trace analysis and time-dependent trend in mussels from the German bight. Fresinius Journal Analytical Chemistry, 37, 782-786. Gustafson, K. Bjork, M. Burreau, S. and Gilek, M. (1999). Bioaccumulation kinetics of brominated flame retardants (polybrominated diphenylethers) in blue mussels (Mytilus edulis). Environmental Toxicology Chemistry, 18, 1218-1224. Hansen, J.A. Woodward, D.F. Little, E.E. DeLonay, A.J. and Bergman, H.L. (1999). Behavioral avoidance: Possible mechanism for explaining abundance and distribution of trout species in a metal-impacted river. Environmental Toxicology Chemistry, 18, 313317. Helland, A. Martin, S. Siegrist, M. Kastenholz, H. Wiek, A. and Scholz, A. 2007. Risjk assessment of engineered nanomaterials: a survey of industrial approaches. Environmental Science Technology, 42, 640-646. Hellou, J. Steller, S. Zitko, V. Leonard, J. King, T. Milligan, T. and Yeats, P. (2002). Distribution of PACs in surficial sediments and bioavailability to mussels, Mytilus edulis, of Halifax harbour. Marine Environmental Research, 53, 327-356. Hellou, J. Yeats, P. Steller, S. and Gagné, F. (2003). Chemical contaminants and biological indicators of mussel health during gametogenesis. Environmental Toxicology Chemistry, 22, 2080-2087. Hellou, J. and Law, R.J. (2003). Stress response of wild mussels, Mytilus edulis and Mytilus trossulus as an indicator of ecosystem health. Environmental Pollution, 126, 407-416. Hellou, J. Langille, M. Leonard, J. Steller, S. and Tremblay, D. (2004). Partitioning of polycyclic aromatic hydrocarbons between water and particles and bioaccumulation in mussels: a harbour case. Marine Environmental Research, 59, 101-117.

216

Jocelyne Hellou and François Gagné

Hellou, J. Fermaut, M. Leonard, J. and Li, W. (2006). Defining the bioaccumulation of PAC in mussels: considering time, distance and effects. International Journal Polycyclic Aromatic Compounds, 26, 1-7. Hinton (1994). Cells, cellular response and their markers in chronic toxicity. In: Aquatic toxicology-Molecular, biochemical and cellular perspectives. Malins, D.C. and Ostrander, G.K. Editors, Lewis Publishers, CRC Press, 207-239. Hummel, H. Bogaards, R.H. Niewenhuize, J. de Wolf, L. and Van Liere, J.M. (1990). Spatial and seasonal differences in the PCB content of mussel Mytilus edulis. Science Total Environment, 92,155-163 Jeng, M.-S. Jeng, W.-L. Hung, T.-C. Yeh, C.-Y. Tseng, R.-J. Meng, P.-J. and Han, B.-C. (2000). A review of Cu and other metals in various marine organisms in Taiwan, 199198. Environmental Pollution, 110, 207-215. Jobling, S. Nolan, M. Tyler, C.R. Brighty, G. and Sumpter, J.P. (1998). Widespread sexual disruption in wild fish. Environmental Science Technology, 32, 2498-2506. Kaiser, J. and Eisenrink, M. (2000). Environmental toxicology treaty takes a POP at the dirty dozen. Science, 290, 2053. Keith, L.H. and Telliard, W.A. (1979). Priority pollutants. I. A perspective view. Environmental Science Technology, 13, 416-423. Koehler, A. Marx, U. Broeg, K. Bahns, S. and Bressling, J. (2008). Effects of nanoparticles in Mytilus edulis gills and hepatopancres- A new threat to marine life? Marine Enviornmental Research, 66, 12-14. Kurelec, B. (1992). The multixenobiotic resistance mechanism in aquatic organisms. Critical Reviews Toxicology, 22, 23-43. Kwong, R.W.M. Yu, P.K.N. Lam, P.K.S. and Wang, W.-X. (2009). Biokinetics and biotransformation of DDTs in the marine green mussels Perna viridis. Aquatic Toxicology, 93, 196-204. Liber, K. Knuth, M.L. and Stay, F.S. (1999). An integrated evaluation of the persistence and effects of 4- nonylphenol in an experimental littoral ecosystem. Environmental Toxicology Chemistry, 18, 357-362. Lobel, P.B. Longerich, H.P. Jackson, S.E. and Belkhode, S.P. (1991). A major factor contributing to the high degree of unexplained variability of some elements concentrations in biological tissue: 27 elements in 5 organs of the mussel Mytilus as a model. Archives Environmental Contamination Toxicology, 21, 409-414. Long, E.R. (1992). Ranges in chemical concentrations in sediments associated with adverse biological effects. Marine Pollution Bulletin, 24, 38-45. Mackay, D. and Fraser, A. (2000). Bioaccumulation of Persistent Organic Chemicals: Mechanisms and Models. Environmental Pollution, 110, 375-391. Martin-Diaz, L. Franzellitti, S. Buratti, S. Valbonesi, P. Capuzzo, A. and Fabbri, E. (2009). Effects of environmental concentrations of the antiepileptic drug carbamazepine on biomarkers and cAMP-mediated cell signaling in the mussel Mytillus galloprovinciallis. Aquatic Toxicology, 94, 177-185. McKim, J.M. (1994). Physiological and biochemical mechanisms that regulate the accumulation and toxicity of environmental chemicals in fish. In: Bioavailability: physical, chemical and biological interactions. Hamelink, J.L. Landrum, P.F. Bergman, H.L. and Benson, W.H., Editors. Lewis Publishers, Boca Raton. 179-201.

Integrated Impact Assessment of Mussels Health

217

Metcalfe C.D. Koeng B.G. Bennie, D.T. Servos, M.R. Ternes, T.A. and Hirsch, R. (2003). Occurrence of neutral and acidic drugs in the effluent of Canadian sewage treatment plants. Environmental Toxicology Chemistry, 22, 2872-2880. Metcalfe, C.D. Chu, S. Judt, C. Li, H. Oakes, K.D. Servos, M.R. and Andrews, D.M. (2010). Antidepressants and their metabolites in municipal wastewater, and downstream exposure in an urban watershed. Environmental Toxicology Chemistry, 29, 79-89. Monirith, I. Ueno, D. Takahashi, S. Nakata, H., Sudaryano, A. Subramanian, A. Karrupiah, S. and Tanabe, S. (2003). Asia-Pacific mussel watch: monitoring contamination of persistent organochlorine compounds in coastal waters of Asian countries. Marine Pollution Bulletin, 46, 281-300. Monserrat, J.M. Martinez, P.E. Geracitano, L.A. Lund Amado, L. Martinez Gaspar Martins, C. Lopes Laes Pinho, G. Soares Chaves, I. Ferreira-Cravo, M. Ventura-Lima, J. and Bianchini, A. (2007). Pollution biomarkers in estuarine animals: critical review and new perspectives. Comparative Biochemistry Physiology, 146C, 221-234. Moore, M.N. Allen, J.I. McVeigh, A. and Shaw, J. (2006). Lysosomal and autophagic reactions as predictive indicators of environmental impact in aquatic animals. Autophagy, 2, 217-220. Morrison, H.A. Gobas, F.A.P.C. Lazar, R. and Haffner, G.D. (1996). Development and verification of a bioaccumulation model for organic contaminants in benthic invertebrates. Environmental Science Technology, 30, 3377-3384. Moy, F.E. and Walday, M. (1996). Accumulation and depuration of organic micro-pollutants in marine hard bottom organisms. Marine Pollution Bulletin, 33, 56-63. Muir, D and Howard, P.H. (2006). Are there other persistent organic pollutants? A challenge for environmental chemists. Environmental Science Technology, 40, 7157-7166. NOAA ref: http://ccma.nos.noaa.gov/publications/MWTwoDecades.pdf Neff, J.M. (1979). Polycyclic aromatic hydrocarbons in the aquatic environment: sources, fates and biological effects. Applied Science Publishers, London, 262 pages. Nigro, M. Falleni, A. Barga, I.D. Scarelli, V. Lucchesi, P. Ragoli, F. and Frensilli, G. (2006). Cellular biomarkers for monitoring estuarine environments: transplanted vs native mussels. Aquatic Toxicology, 77, 339-347. O‘Connor, T.P. (1996). Trends in chemical concentrations in mussels and oysters collected along the US coast from 1986 to 1993. Marine Environmental Research, 41, 183-200. Osman, A.M. Van den Heuvel, H. Van Noort, P.C.M. (2007). Differential responses of biomarkers in tissues of the freshwater mussel, Dreissena polymorpha, to the exposure of sediment extracts with different levels of contamination. Journal Applied Toxicology, 27, 51-59. Peachy, R.B.J. (2003). Tributyltin and polycyclic aromatic hydrocarbon levels in Mobile Bay, Alabama: a review. Marine Pollution Bulletin, 46, 1365-1371. Peck A.M. Kucklick, J.R. and Schantz, M.M. (2007). Synthetic musk fragrances in environmental standard reference materials. Analytical Bioanalytical Chemistry 387, 2381-2388 Pereira , P. Dias, E. Franca, S. Pereira, E. Carolino, M. and Vasconcelos, V. (2004) Accumulation and depuration of cyanobacterial paralytic shellfish toxins by the reshwater mussel Anodonta cygnea. Aquatic Toxicology, 68, 339-350.

218

Jocelyne Hellou and François Gagné

Perceval, O. Couillard, Y. Pinel-Alloul, B. and Campbell, P.G. (2006). Linking changes in subcellular cadmium distribution to growth and mortality rates in transplanted freshwater bivalves (Pyganodon grandis). Aquatic Toxicology, 79, 87–98. Peven, C.S. Uhler, P.D. and Querzoli, F.J. (1996). Caged mussels and semi permeable membrane devices as indicators of organic contaminant uptake in Dorchester and Duxbury Bay, Mass. Environmental Toxicology Chemistry, 15, 144-149. Picardo, M.T. Coradeghini, R. and Valerio, F. (2001). Polycyclic aromatic hydrocarbon pollution in native and caged mussels. Marine Pollution Bulletin, 42, 951-956. Pruell, R.J. Lake, J.L. Davis, W.R. and Quinn, J.G. (1986). Uptake and depuration of organic contaminants by blue mussels (Mytilus edulis) exposed to environmentally contaminated sediment. Marine Biology, 91, 497-507. Ramirez, A.J. Brain, R.A. Usenko, S. Mottaler, M.A. O‘Donnell, J.G. Stahl, L.L. Wathen, J.B. Snyder, B.D. Pitt, J.L. Perez-Hurtado, P. Dobbins, L.L. Brooks, B.W. and Chambliss, C.K. (2009). Occurrence of pharmaceuticals and personal care products in fish: results of a national pilot study in the United States. Environmental Toxicology Chemistry, 28, 2587-2597. Ramu, K. Kajiwara, N Sudaryanto, A. Isobe, T. Takahashi, S. Subramanian, A. Ueno, D. Zheng, G.J. Lam, P.K.S. Takada, H. Pauzi, P. Zakaria, M. Viet, P.H. Prudente, M.R. Tana, T.S. and Tanabe, S. (2007). Asian mussel watch program: contamination status of polybrominated diphenylethers and organochlorines in coastal waters of Asian countries. Environmental Science Technology, 41, 4580-4586. Raftopoulos, E.K. Dalianis, S. Dimitriadis, V.K. and Kaloyanni, M. (2006). Introduction of cAMP and establishement of neutral lipids alterations as pollution biomarkers using the mussel Mytilus galloprovincialis. Correlation with a battery of biomarkers. Science Tototal Environment, 368, 597-614. Robinson, B.J. Hui, J.P.M. Soo, E.C. and Hellou, J. (2009). Estrogenic compounds in seawater and sediments from Halifax Harbour, Nova Scotia, Canada. Environmental Toxicology Chemistry, 28, 18-25. Rodriguez y Baena, A.M. and Thiebault, H. (2006). CIESM Mediterranean mussel watch program phase II: towards an increased awareness of marine environmental and seafood quality. Marine Sciences and Public Health. Some major issues, Geneva, Switzerland. Salazar, M.H. and Salazar, S.M. (1997). Using caged bivalves to characterize exposure and effects associated with pulp and paper effluents. Water Science Technology, 35, 213-220. Salazar, M.H. Salazar, S.M. Burton, D.T. and Hall, Jr. L.W. (2005). An integrated case study for evaluating the impacts of an oil refinery effluent on aquatic biota in the Delaware River: bivalve bioavailability study. Human Ecological Risk Assessment, 11, 837-859. Saravanabhavan, G. Helleur, R. and Hellou, J. (2009). GC–MS/MS measurement of natural and synthetic estrogens in receiving waters and mussels close to a raw sewage ocean outfall. Chemosphere, 76, 1156-62 . Scheurer, M. Ramil, M. Metcalfe, C.D. Groh, S. and Ternes, T.A. (2010) The challenge of analyzing beta-blocker drugs in sludge and wastewater. Analytical Bioanalytical Chemistry, 396, 845-856. Smolders, R. Bervoet, L. De Coen, W. and Blust, R. (2004). Cellular energy allocation in zebra mussels exposed along a pollution gradient: linking cellular effects to higher levels of biological organization. Environmental Pollution, 129, 99-112.

Integrated Impact Assessment of Mussels Health

219

Snyder, S.A. Keith, T.L. Verbrugge, D.A. Snyder, E.M. Gross, T.S. Kannan, K. and Giesy, J.P. (1999). Analytical methods for detection of selected estrogenic compounds in aqueous mixtures. Environmental Science Technology, 33, 2814-2820. Ternes, T. 2000. Pharmaceuticals and metabolites as contaminants of the aquatic environment: an overview. Journal American Chemical Society, 219, 301–309. Tessier, L. Vaillancourt. G. and Pazdernik, L. (1996). Laboratory study of Cd and Hg uptake by two freshwater molluscs in relation to concentration, age and exposure time. Water Air Soil Pollution, 86, 347-357. Thornsen, W.A. Forestier, D. Sandifer, T. Lazaro, P.R. Cope, W.G. and Shea, D. (2004). Elimination rate constants of 46 polycyclic aromatic hydrocarbons in the unionid mussel, Elliptio complanata. Archives Environmental Toxicology Chemistry, 47, 332-340. van Haren, R.J.F. Schepers, H.E. and Kooijman, S.A.L.M. (1994). Dynamic energy budgets affect kinetic xenobiotics in the marine mussel Mytilus edulis. Chemosphere, 29, 163189. Wania, F. Pacyna, J.M. and Mackay, D. (1998). Global fate of persistent organic pollutants. Environmental Pollution, 102, 3-23. Widdows, J. and Doonkin, P. (1991). Role of physiological energetics in ecotoxicology. Comparative Biochemistry Physiology, 100C, 69–75. Widdows, J. Doonkin, P. Brinsley, M.D. Evans, S.V. Salkeld, P.N. Franklin, A. Law, R.J. and Waldock, M.J. 1995. Scope for growth and contaminant levels in North Sea mussels Mytilus edulis. Marine Ecology Progress Series, 127, 131–148. Widdows, J. Doonkin, P. Staff, F.J. Matthiessen, P. Law, R.J. Allen, Y.T. Thain, J.E. Allchin, C.R. and Jones, B.R. (2002). Measurement of stress effects (scope for growth) and contaminant levels in mussels (Mytilus edulis) collected from the Irish Sea. Marine Environmental Research, 53, 327-356. Yeast, P. Gagné, F. and Hellou, J. (2008). Body burden of contaminants and biological effects in mussels: an integrated approach. Environment International, 34, 254-264. Zangrandi, M. Catsiki, V.-A. and Avdis, O.L.V. (2005). The sensitivity of mussel-watch programmes to detect temporal trends in the bio-availability of metals. A case study of the Saronicos Gulf of Greece. Journal Environmental Monitoring, 7, 798-803.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 9

ECOTOXICOLOGICAL GENETIC STUDIES ON THE GREEN-LIPPED MUSSEL PERNA VIRIDIS IN MALAYSIA C. K. Yap1 and S.G. Tan2 1

Department of Biology, Faculty of Science Department of Cell and Molecular Biology, Faculty of Biotechnology and Biomolecular Science, Universiti Putra Malaysia, UPM 43400, Serdang, Selangor, Malaysia 2

ABSTRACT The present paper reviews all the studies done on genetics and heavy metal ecotoxicology focussing on the green-lipped mussel Perna viridis from Malaysia. Based on the findings reported in 10 publications on the above topics, the genetic differentiation in P. viridis populations could be explained as being due to geographical factors, physical barriers and heavy metal contamination. All the studies were done using allozymes and DNA microsatellite markers. The results based on both the biochemical and the molecular markers were comparable and almost similar in their genetic distances and FST values. The genetic distances indicate that the mussel populations from Peninsular Malaysia are conspecific populations while the FST values show a moderate genetic differentiation based on Wright's (1978) F-statistics. All the genetic variation parameters strongly support the use of P. viridis as a good biomonitor in the coastal waters of Peninsular Malaysia since the various geographical populations in the region belong to the same species. Without knowledge of the genetic structure of the mussel populations, the biomonitor species is chosen solely based on its morphological characters which could be confusing. Therefore, biochemical and molecular studies are needed to validate the genetic similarity of the chosen biomonitor. From another point of view, based on hierarchical F-statistics and cluster analysis, the physical barrier that blocked the gene flow (through the pelagic larvae swimmers) of P. viridis, and a distinct heavy metal contamination in a polluted population were identified as being the two main causal 

Corresponding authors: [email protected] (Yap C. K.), Tel: 603-89466616, Fax: 603-86567454

222

C. K. Yap and S.G. Tan agents for the genetic differentiation of P. viridis populations, indicating that environmentally induced selection had occurred. All these conclusions could only be drawn when both the genetic and the ecotoxicological information were put together. If the aim of ecotoxicological genetics research on marine invertebrates is to determine whether anthropogenic chemicals are able to damage the DNA sufficiently to alter the population dynamics in ecosystems (Depledge, 1998), then the biomonitoring and monitoring work should be regarded as being as equally important as the biochemical and molecular level study on the biomonitor species itself. It was only together with the availability of information on the anthropogenic chemical levels in the biomonitor and its environmental habitat that the deviation from the Hardy Weinberg Equilibrium observed in the polluted mussel population could be meaningfully interpreted. By taking the biomonitor P. viridis as a model, ecotoxicological genetics should be a focal research area in order to protect the valuable living natural resources in the coastal waters of Malaysia.

Keywords: Perna viridis, ecotoxicological genetics, metal levels, allozymes, DNA microsatellites.

BACKGROUND AND INTRODUCTION Ecotoxicology is a combination of two areas of study encompassing ecology and toxicology. In simple terms, an ecotoxicological study is the scientific study of the distribution and abundance of living organisms in relation it their living and non-living components, in the presence of a toxic chemical. In Malaysia, ecotoxicology is an area started in the early 1990s initiated by a few researchers. According to a review done by Shazili et al. (2006), aspects of metal toxicology in relation to speciation of metals in various environmental media, bioaccumulation and biomagnificaton have not been well studied in Malaysia due to the lack of scientists trained in ecotoxicology. On the other hand, the ecotoxicologist Ismail (2006) reviewed a set of intertidal mollusks in the west coast of Peninsular Malaysia for biomonitoring studies of heavy metals. The green-lipped mussel Perna viridis (Family: Mytilidae) (locally known as Kupang in Malaysia), is a local seafood delicacy besides being a potential biomonitor of pollution levels as part of the worldwide Mussel Watch program (Goldberg, 1986). It has been widely employed as a biomonitor of a variety of chemicals/pollutants including heavy metals (Yap et al., 2003a, 2006, 2009), polycyclic aromatic hydrocarbons and phenolic endocrine disrupting chemicals (Isobe et al., 2007), and butyltin (Sudaryanto et al., 2002) contamination in Malaysia. However, all of the above papers published hold an assumption that the mussels collected from Peninsular Malaysia are of a single species. It must be noted that the validity of a biomonitoring study employing a single species from different diverse geographical areas would be in doubt if the biomonitor were to differ significantly in genetic composition due to selection and adaptation to a variety environmental changes. Therefore, before it can be used as a valid biomonitor the population genetic structure of this species in Malaysia must be known (Tan and Yap, 2006). This verification can be done by using genetic studies ultilizing biochemical and molecular level markers.

Ecotoxicological Genetic Studies…

223

Figure 1. The sampling sites for Perna viridis in the coastal waters of Peninsular Malaysia (Details of the sampling sites follow those in Table 1).

In Malaysia, a total of 18 geographical populations of P. viridis, had been collected between 1998-2004, from the coastal waters of Peninsular Malaysia (Figure 1; Table 1). Their genetic structures were investigated by using allozymes (Yap et al., 2002a), Single Primer Amplification Reaction (SPAR) techniques, namely Random Amplified Polymorphic DNA (RAPD) (Chua et al., 2003a) and Random Amplified Microsatellites (RAMS) (also known as ISSR (Inter Simple Sequence Repeats) (Chua et al., 2003b) and single locus DNA microsatellite (Ong et al., 2009) markers. The relationships of all the mussel populations investigated were determined using UPGMA dendrograms based on Nei‘s (1978) genetic similarities for codominant markers (allozyme and single locus DNA microsatellite) and Nei and Li‘s (1979) genetic distances for dominant markers (RAPD and RAMs). Genetics generally focuses on the genetic constitution (or genotype) of organisms and the laws governing the transmission of this hereditary information, contained in the genes, from one generation to the next (Gosling, 1992). In fact, the electrophoretic technique makes it possible to compare allele frequencies and levels of genetic variability within and between different populations of a species (Gosling, 1992). Generally, there are two important measures of the genetic differentiation of two populations, 1) Genetic distance and 2) Wright‘s F-statistics (FST). The degree of genetic differentiation between different

C. K. Yap and S.G. Tan

224

geographical populations of a ‗so-called‘ single species can be quantified by using Nei‘s (1978) index of genetic distance or identity. Table 1. Sampling sites, sampling dates and description of the sampling sites of the green-lipped mussel Perna viridis in the coastal waters of Malaysia

C D

Sampling site Tg. Rhu, Langkawi, Kedah Kuala Terlang, Langkawi, Kedah Penang Bridge, Penang Pulau Aman, Penang

E F G H I J K L M N O P Q R

Bagan Tiang, Perak Pulau Ketam, Selangor Bagan Lalang, Selangor Anjung Batu, Malacca Telok Emas, Malacca Parit Jawa, Malacca Kuala Muar, Johore Pontian, Johore Tg. Kupang, Johore Pantai Lido, Johore Kg. Pasir Puteh, Johore Kuala Sg. Belungkor, Johore Kuala Pontian, Pahang Nenasi, Pahang

A B

Sampling date 10 April 2002 10 April 2002

Site description Recreational beach, aquaculture Recreational beach, aquaculture

09 Sep 1999; Nov 1999 Nov 1999; 11 Sep 1999; 09 April 2002 11 April 2002 June 2002 04 April 2000 22 Sep 1998 21 Jan 2000; 09-April 2004 09 April 2004 21 Jan 2000; Feb 2002 21 Jan 2000; 17-April 2002 19 Jan 2000 20 Jan 2000; 17-April 2002 19 Jan 2000, 17 April 2002 18 April 2002 8 April 2004 8 April 2004

Port, industry, urban Aquaculture Fish aquaculture in the offshore A recreational island Recreational beach, agriculture. Mussel aquaculture site Mussel aquaculture site A mussel stall A mussel stall Agriculture Port, aquaculture Port, industry, urban Port, industry, urban Pristine site Mussel aquaculture site A lighthouse in the offshore.

The Nei‘s (1978) index of genetic distances for different species reported in the literatures are presented in Table 2. By comparing the genetic distances of P. viridis from Malaysia, the values are lower than those considered as subspecies, and allopatric species. Hence, we classified our P. viridis populations based on genetic distances (both allozyme and DNA microsatellite data) as being conspecific. Since the introduction of the allozyme method in the mid 1960s it has been a standard practice to report Wright‘s measure of population subdivision, FST , for surveys of genetic variation. According to a review by Neigel (2002), Wright‘s original definition (Wright 1951) for FST is based on the inbreeding coefficient: the probability of alleles that are identical-bydescent (from an ancestral population) being combined in zygotes. This is the most fundamental definition of FST because inbreeding coefficients are defined simply by the pattern of mating. The use of FST as an indirect measure of gene flow is suggested by Wright‘s island model of population subdivisions (Slatkin 1985). Neigel (2002) argued that although gene flow should be estimated by more powerful approaches whenever practical, FST remains a useful measure of the average effects of gene flow and will continue to be used for comparative purposes. The ecotoxicological studies focused on four well-known anthropogenic metals namely Cd, Cu, Pb and Zn. When the genetic information is available, then the deviations from Hardy-Weinberg Equilibrium (HWE) (usually the deficiency of heterozygosity in mussels) are interpreted as being due to factors such as inbreeding, Wahlund effect, null alleles and aneuploidy (Zouros and Foltz 1984, Singh and Green 1984, Zouros et al. 1988).

Ecotoxicological Genetic Studies…

225

Table 2. Genetic distances (D) reported for different bivalve species and populations No.

Population

Technique

D

comment

Reference

Allozyme

No. of loci 16

1.

Mytilus edulis (U.K.) and M. galloprovincalis (Italy) Mytilus edulis from Hokkaido to Hiroshima, Japan Mytilus edulis (Denmark) and Southern African M. galloprovincialis Perna canaliculus from New Zealand

0.172

Allopatric species

Skibinski et al. (1980)

Allozyme

12

0.0-0.042

Allozyme

23

0.162

Possibility of a species complex Allopatric species

Yamanaka and Fujio (1981) Grant and Cherry (1985)

Allozyme

14

0.0040.166

Sin et al. (1990)

Mytilus edulis (North Sea) and M. trossulus (Baltic Sea) Mytilus edulis from the coast of California Oysters Crassostrea gigas and Crassostrea sikamea Perna viridis from the west coast of Peninsular Malaysia. Crassostrea gigas from China.

Allozyme

22

0.28

Adaptation to local environments Allopatric species

Allozyme

5

0.0230.475

existence of subspecies

Allozyme

5

0.440

Allopatric species

Sarver and Loudenslager (1991) Banks et al. (1994)

Allozyme

14

Conspecific population

Yap et al.(2002)

Polymorphic DNA microsatellite

7

0.0040.091 (0.048 ± 0.004) 0.516 to 0.646 (0.583)

Li et al. (2006)

10.

Clam Mactra veneriformis from Chinese coasts.

235

0.0110.099

11.

Perna viridis from the coastal waters of Peninsular Malaysia.

Inter-Simple Sequence Repeats (ISSR)-PCR markers DNA microsatellite markers

Geographically separated cultured populations An outcome of isolation of geographic distance.

19

0.007 to 0.079

Most likely are conspesific populations

Ong et al. (2009)

2.

3.

4.

5.

6.

7.

8.

9.

Vainola and Hvilsom (1991).

Hou et al. (2006)

However, knowledge on environmental variables such as water quality, pollutants (such as heavy metals) levels in the sediments and the biomonitor can potentially help us to understand the genetic differentiation or the HWE deviations better. The FST values can be used to determine the degree of genetic differentiation among populations of P. viridis. Informative values on the degrees of genetic differentiation can be seen in a review in Table 3.

C. K. Yap and S.G. Tan

226

Table 3. FST values reported for different molluscs species and populations. Comment is based on the degree of genetic differentiation as suggested by Wright (1978) No. 1.

Population Mussel Perna viridis.

2.

Between contaminated and intermediate contaminated populations of redbreast sunfish (Lepomis auritus). Five cultured oyster populations of Crassostrea gigas from China.

3.

4.

5.

6.

7.

Mussel ‗‗Bathymodiolus‘‘ childressi from Gulf of Mexico hydrocarbon seeps Clam Mactra veneriformis from Chinese coasts. Fish Cirrhinus mrigala (Indus, Ganges, Brahmaputra and Mahanadi Basins, India). Fish Cirrhinus mrigala (Indus, Ganges, Brahmaputra and Mahanadi Basins, India).

8.

Mytilus galloprovincialis from Galician Rias

9.

Freshwater pearl mussel (Hyriopsis cumingii).

10.

Between metal-contaminated and uncontaminated populations of gudgeon (Gobio gobio) Between metal-contaminated and]‘mn uncontaminated populations of gudgeon (Gobio gobio) Mussel Perna viridis.

11.

12.

Technique 14 polymorphic loci by allozyme randomly amplified polymorphicDNA (RAPD), 28 different primers. 7 polymorphic loci by DNA microsatellite markers Restriction fragment length polymorphism (RFLP) Inter-Simple Sequence Repeats (ISSR)-PCR markers 7 polymorphic allozyme loci

FST 0.149

Comment Moderate

Reference Yap et al.(2002) Theodorakis et al. (2006)

0.007

Little

0.0138– 0.0348

Little

Li et al. (2006)

0-0.0558

Littlemoderate

Carney et al. (2006)

0.0580.367

Moderatevery large

Hou et al. (2006)

0.020

Little

Chauhan et al. (2007)

7 polymorphic loci by DNA microsatellite markers 6 polymorphic loci by DNA microsatellite markers 8 polymorphic loci by DNA microsatellite markers 3 polymorphic allozyme loci

0.013

Little

Chauhan et al. (2007)

0.0122

Little

Diz et al. (2008)

0.0000.063

Moderate

Li et al. (2008)

0.09-0.16

Moderatelarge

Knapen et al. (2009)

6 polymorphic loci by DNA microsatellite markers 19 polymorphic loci by DNA microsatellite markers (10 populations)

0.0170.072

Littlemoderate

Knapen et al. (2009)

0.098

Moderate

Ong et al. (2009)

Note: According to Wright (1978), there are 4 qualitative guidelines for the interpretation of FST: 0-0.05 for little genetic differentiation, 0.05-0.15 for moderate genetic differentiation, 0.15-0.25 for large genetic differentiation and above 0.25 for very large genetic differentiation.

Based on the guidelines established by Wright (1978), our mean FST values based on allozyme data (Yap et al., 2002a) and DNA microsatellite data (Ong et al., 2009) are within the range for moderate genetic differentiation (Table 3), compared to moderate to large genetic differentiation for populations of gudgeon between contaminated and uncontaminated

Ecotoxicological Genetic Studies…

227

sites (Knapen et al., 2009). Our FST value is also within the range reported by other authors for several species including mussels, clams, fishes and oysters (Table 3). The lower FST value (0.098; Ong et al., 2009) found based on DNA microsatellite markers than that (0.149; Yap et al., 2002a) based on allozymes in P. viridis populations are also supported by the following reported studies. Knapen et al. (2009) found similar result based on three populations (two metal-contaminated and one reference site) of gudgeon (Gobio gobio). Their FST values calculated based on microsatellite data among the three populations in the Molse Nete River were about ten times lower than those based on allozyme data. Earlier, Lemaire et al. (2000) also concluded that based on microsatellite data, European sea bass populations were found to have lower FST values when compared to allozyme data which were considered as being non-neutral markers. Chauhan et al. (2007) reported low level of genetic differentiation among wild populations of the fish Cirrhinus mrigala collected from the Indus, Ganges, Brahmaputra and Mahanadi Basins, India), possibly due to their common ancestry in the prehistoric period and possible exchange of individuals between rivers in the different river basins. They reported the FST values based on allozyme and microsatellite data but without reporting the genetic distances for the fish populations. Hou et al. (2006) found a clear tendency for higher FST values and lower gene flow levels between the populations of Mactra veneriformis, with increasing geographical separation. Based on the FST and genetic distance, their results indicated that isolation by geographic distance played an important role in genetic differentiation of the populations. According to McDonald (1994), the variation in FST among loci and types of markers is considered to be a powerful method for examining whether natural selection is playing a major role in the amount of genetic divergence among populations. It is well accepted that if some types of markers are more strongly affected by selection than others, it is expected to find differences in the distribution of FST for different marker types. Under selective neutrality, all loci will be merely affected by the demographic properties of the populations such as density, birth rate, mortality rate, growth rate, distribution in time and space, agestructure and sex ratio. However, loci under natural selection may have a higher or smaller FST, depending upon the mode of selection. Specifically, directional selection which would explain the observed allozyme patterns, decreases genetic variation and increases FST estimates (Dhuyvetter et al., 2004; van Straalen and Timmermans, 2002).

POPULATIONS GENETICS OF PERNA VIRIDIS IN MALAYSIA Based on a comprehensive review by Tan and Yap (2006), the use of enzyme polymorphisms to study responses of aquatic organisms to environmental pollutants is just beginning in Malaysia. Yap et al. (2002a) used 14 allozyme loci to study populations of P. viridis from eight geographical sites in the Straits of Malacca. Moreover, reports by Chua et al. (2003a, 2003b) based on RAPD and RAM markers showed clustering of populations that differed from those derived from the use of allozyme marker data. Subsequently, Ong et al. (2005) reported the isolation of DNA microsatellite markers in P. viridis from Malaysia and following that, Ong et al. (2008) reported eleven novel polymorphic microsatellite DNA markers from P. viridis from Malaysian coastal waters. However, the most significant finding

228

C. K. Yap and S.G. Tan

was that reported by Ong et al. (2009) who verified the work done by Yap et al. (2002a) based on a more powerful marker system namely single locus DNA microsatellite markers. Detailed reviews for some of the reported studies are given in the following sections.

EVIDENCE SHOWING GEOGRAPHICAL FACTORS FOR GENETIC DIFFERENTIATION Perhaps, the first genetic information on P. viridis in Malaysia was reported by Yap et al. (2002a). They estimated the levels of genetic variation for eight different geographical populations (Penang Bridge, Pulau Aman, Bagan Lalang, Telok Emas, Sg. Muar, Tg. Kupang, Pantai Lido and Kg. Pasir Puteh) (See Figure 1 and Table 1) of P. viridis, collected from the waters off the west coast of Peninsular Malaysia, based on horizontal starch gel electrophoresis. They found 14 polymorphic loci namely -EST-1, -EST-4, -GPD-3, CGOT, GOT, GPI-2, IDH-1, IDH-2, LAP, MDH, ME, PEP-B, PGM-1 and PGM-2 out of 10 different enzymes. The observed mean heterozygosity ranged from 0.108 to 0.334, while the expected mean heterozygosity was from 0.133 to 0.301. The highest mean value for genetic distance (0.091) was found between the populations of Penang and Telok Emas while the lowest value for genetic distance (0.004) was found between the populations of Pantai Lido and Tanjung Kupang. The UPGMA dendrogram clustered on Nei‘s (1978) genetic similarities (Figure 2), based on 14 allozyme loci (Yap et al., 2002a), it clearly showed two major clusters including two populations from the northern part of Peninsular Malaysia namely Pulau Aman and Penang Bridge. The other major cluster contains the rest of the populations collected from central and southern parts of the peninsula. The groupings seemed to indicate differentiation of local populations. These results suggest that P. viridis has a tendency to split into a number of geographical populations regardless of larval dispersal as a potential agent of gene flow. The question of whether each of the populations sampled formed an isolated breeding unit or a species complex remained. However, the mean genetic distance (0.048  0.004) falls within the range of genetic distances between conspecific populations of mussels (0.0-0.14). F-statistics shows substantial inbreeding within populations (FIS) for PGM-2, LAP-1 and IDH-1. Overall, the degree of genetic differentiation among populations, as indicated by FST value (0.149) was moderate according to Wright's (1978) FST [FST values between 0.05 and 0.150 indicate moderate differentiation]. This study supported the use of the local mussel P. viridis as a good biomonitor for heavy metals in the west coast of Peninsular Malaysia. Yap et al. (2002a)‘s finding has also highlighted the benchmark and baseline of genetic distance values (0.004-0.091) and FST value (0.149) for future references. Recently, Ong et al. (2009) found genetic distance values (0.007 to 0.079) and FST value (0.098) based on 19 microsatellite loci, thus confirming the genetic differentiation of the 10 mussel populations as being ‗moderate‘. The dendrogram in Figure 3, based on the data from 28 RAPD polymorphic loci (Chua et al., 2003a) showed that the Pulau Aman and Tg. Rhu populations form a subcluster, indicating a northern mussel entity while the other subclusters are difficult to explain from the geographical and environmental points of view. However, it is assumed that the genetic relationships among the populations were associated with the transplantation of mussels from Johore to Langkawi for cultivation.

Ecotoxicological Genetic Studies…

229

Figure 2. An UPGMA dendogram of genetic relationships among eight mussel populations based on Nei‘s (1978) genetic similarity (Yap et al., 2002).

Figure 3. An UPGMA dendogram clustering of eight populations of Perna viridis, based on 28 random amplified polymorphic DNA (RAPD) polymorphic loci, based on Nei and Li‘s (1979) genetic distance index (Chua et al., 2003a).

230

C. K. Yap and S.G. Tan

Figure 4. An UPGMA dendrogram based on 28 random amplified polymorphic DNA (RAPD) polymorphic loci, on seven geographical populations of P. viridis from the coastal waters of Peinsular Malaysia, based on Nei and Li‘s (1979) genetic distance index (Chua et al., 2003b).

Later, Chua et al. (2003b) reported another dendrogram (Figure 4) based on the same RAPD markers on 7 populations but included new sites namely Anjung Batu, Muar and Pontian populations. The dendrogram is difficult to interpret except for the Sg. Belungkor population which is a clean remote and pristine site among all the mussel populations and it is clustered as a single entity, differently from the rest. However, the clustering pattern for the Bagan Tiang population this time is quite different from Figure 3. Chua et al. (2003b) reported an UPGMA dendrogram clustering of seven similar populations of P. viridis, based on 31 RAMs markers, based on Nei and Li‘s (1979) genetic distance, as shown in Figure 5. However, the clustering pattern is very different from that based on RAPD polymorphic loci, thus, making the interpretation even harder.

Figure 5. An UPGMA dendrogram based on 31 RAMs markers (ISSR- Inter Simple Sequence Repeat), on seven geographical populations of P. viridis from the coastal waters of Peinsular Malaysia, based on Nei and Li‘s (1979) genetic distance index (Chua et al., 2003b).

According to Ong et al. (2009), a total of 19 polymorphic microsatellite loci were used to analyse the levels of genetic variation for ten geographical populations (Pulau Aman, Tg. Rhu, Bagan Tiang, Pulau Ketam, Muar, Parit Jawa, Pantai Lido, Kg. Pasir Puteh, Kuala Pontian and Nenasi) (see Figure 1 and Table 1) of P. viridis collected from almost the whole of Peninsular Malaysia, including two sites from the east coast. Heterozygote deficiencies

Ecotoxicological Genetic Studies…

231

were observed across all the 10 populations. Based on allozymes, Yap et al. (2002a) found three loci (PGM-1, PGM-2, and IDH-1) which showed consistent deficiencies of heterozygotes while PGI-2, ME, LAP, and IDH-2 showed observed deficiencies of heterozygotes to a lesser extent. Therefore, overall allozyme loci showed deficiencies of heterozygotes, similar to that based on DNA microsatellite data. Several explanations have been offered such as inbreeding (particularly self-fertilization), the Wahlund effect, null alleles, and aneuploidy (Singh and Green 1984, Zouros and Foltz 1984, Zouros et al. 1988) to account for this phenomenon. Of these possible explanations, the Wahlund effect and inbreeding are the two most plausible agents for the observed deficiencies of heterozygosity in natural populations of mussels (Beaumont 1991). The Wahlund effect is observed when a sample comprises a mixture of individuals from two or more populations which differ in allele frequencies at a locus (Gosling, 1992). However, there are two factors which argued against inbreeding as the causative agent for the heterozygote deficit in natural populations of mussels (Gosling, 1992). First, the extended fertilization and an extended larval dispersal phase as the natural life cycle of marine mussels and second, the fact that heterozygote deficits were not observed at all loci which was true for EST-4, α-GPD-3, MDH, and PEP-B which showed consistent observed excesses of heterozygotes in P. viridis from the west coast of Peninsular Malaysia (Yap et al., 2002a).

Figure 6. An UPGMA dendogram of genetic relationships among ten populations of P. viridis based on Nei‘s (1978) unbiased genetic distance derived from 19 microsatellite loci (Ong et al., 2009).

The dendrogram in Figure 6 based on 19 microsatellite loci (Ong et al., 2009), clearly showed a subcluster containing three populations from the eastern part of the Johore Causeway while four populations located in the western part of the Johore Causeway formed another subcluster. The mussel of unknown source which was bought from a roadside at Parit Jawa was therefore assumed to have been harvested from the eastern part of the the Johore Causeway as evidenced in the dendrogram. Another major cluster containing Pulau Aman and Tg. Rhu, from the northern mussel populations was observed in the dendrogram. Still, the

C. K. Yap and S.G. Tan

232

genetic characterization of the populations revealed that local populations of P. viridis in Peninsular Malaysia were genetically similar enough to be used as a biomonitor for heavy metal contamination in the coastal waters of Peninsular Malaysia based on the low genetic distance and FST values, as mentioned earlier.

RELATIONSHIPS BETWEEN HEAVY METAL CONTAMINATION AND GENETIC DIFFERENTIATION IN PERNA VIRIDIS In Malaysia, when Yap et al. (2004) published an article in Environment International (2004: 30: 39-46) entitled ‗Allozyme polymorphisms and heavy metal levels in the greenlipped mussel Perna viridis (Linnaeus) collected from contaminated and uncontaminated sites in Malaysia‘, the genetic ecotoxicology area seems to become a new research area in Malaysia. A similar work but this time based on 19 microsatellite loci, Yap et al. (2010) confirmed the previous findings by Yap et al. (2004) which was based on allozyme data. They generally found that the genetic structure for the contaminated populations of P. viridis was different from relatively uncontaminated populations in Malaysia. It has frequently been suggested that changes in genetic structure could be used as an early indicator of contaminant-induced damage to a population (Schlueter et al., 1995; Gillespie and Guttman, 1999). To our knowledge, there are four papers published on ecotoxicological genetic studies particularly in P. viridis from Malaysia (Table 4). Heavy metal contamination in coastal waters can potentially modify the protein allozyme genetics of marine mussels from Malaysia. Particularly on P. viridis, Yap et al. (2004) reported the levels of allelic variation of the mussel species, collected from a contaminated site at Kg. Pasir Puteh and three uncontaminated sites at Bagan Lalang, Pantai Lido and Tg. Kupang, based on 14 polymorphic loci using horizontal starch gel electrophoresis. Metal contaminated samples, exhibited by high metal pollution index (MPI) based on sediment and mussels, showed the highest percentage of polymorphic loci (78.6 %) while those collected from environments with lower heavy metal levels, (low MPI) exhibited lower percentages of polymorphic loci (35.7-57.1 %). Table 4. Studies on the relationships between pollutants and genetic variability of biomonitors in Malaysia No. 1 2 3 4

Species Perna viridis (Four populations) P. viridis (Laboratory study) P. viridis (Five populations) P. viridis (Six populations)

Relationships Heavy metals (Cd, Cu, Hg, Pb and Zn) and 14 allozyme polymorphic loci Zn stress, and allozymes (GOT, EST and ME) Heavy metals (Cd, Cu, Pb and Zn) and four RAPD primers Heavy metals (Cd, Cu, Pb and Zn) and 19 DNA microstatellite polymorphic loci.

Reference Yap et al. (2004) Yap et al. (2007) Yap et al. (2007) Yap et al. (2010)

The population from the contaminated site showed the highest excess of heterozygosity (0.289) when compared to uncontaminated populations (0.108-0.149). Thus, it can be

Ecotoxicological Genetic Studies…

233

hypothesised that heterozygosity is associated with improved survivorship in polluted conditions. In support of this, Nevo et al. (1986) reported that for marine gastropods, broadniche, genetically rich (highly heterozygous) species display significantly higher survivorship than narrow-niche, genetically poor, congeneric species, after exposure to multiple inorganic and organic pollutants. Also, Hawkins et al. (1989a) found that in the blue mussel, Mytilus edulis, exposure to Cu in the laboratory caused genotype-dependent mortality. Those individuals expressing a higher degree of heterozygosity survived the longest. Survivorship was also associated with low protein turnover times. Kurelec (1993) referred to increased rates of protein turnover as one of the key features of the genotoxic disease syndrome. Small changes in protein turnover rate had been shown to have great significance for energy metabolism and fitness (Hawkins et al., 1989b). The most heterozygous individuals have the lowest protein turnover times and routine metabolic maintenance costs and hence, the greatest fitness (Depledge, 1994; 1996). In contrast, studies using fish from clean and heavy metal polluted sites indicated that heterozygosity was markedly reduced in polluted areas (Guttman, 1994). This is not consistent with the view that heterozygous individuals are more tolerant of pollutant exposure than homozygous individuals. Guttman (1994) suggested that the lower genetic diversity at polluted sites reflected selective pressures associated with exposure to heavy metals. Chemical exposure resulting in alterations in genetic structure and diversity in populations that persisted from one generation to the next, is clearly relevant to the study of ecotoxicological genetics. Based on the dendrogram in Figure 7, based on 14 allozyme loci in four populations, the metal-contaminated site at Kg. Pasir Puteh is clustered differently from the other three sites, indicating a contaminated condition which had presumably changed the genetic structure of this population. Harper-Arabie et al. (2004) reported that when the grass shrimp, Palaemonetes pugio, was exposed to Cr (VI) and to fluoranthene, they found that heterozygotes for the GPI allozyme survived longer and had less overall mortality than the homozygous MM genotype. Therefore, this would support our assumption that the metal-contaminated population at Kg. Pasir Puteh (Yap et al., 2002b, 2003b) which was found to possess alleles at PGM and PGI loci that could be selected or counter-selected for by the presence of heavy metals, could survive longer due to the protective effects of the PGM and PGI allozyme genotypes.

Figure 7. An UPGMA dendrogram of genetic relationships among four mussel populations based on Nei‘s (1978) identity values (Yap et al., 2004).

Yap et al. (2004) showed that there is a fitness advantage coupled to the presence of a specific allele. Indeed, PGM and PGI had the most abundant alleles in the contaminated

234

C. K. Yap and S.G. Tan

population. Yap et al. (2004)‘s finding is supported by Li et al. (2009) who suggested changes in genetic structure (GPI, PGM, LDH, and ME) as an early indicator for contaminant-induced damage to a population of Oxya chinensis. Li et al. (2009) reported a relationship between genetic variations and environmental Cr exposure by comparing the differential survival among allaozyme gennotypes of O. chinensis exposed to Cr (VI). The allozyme study was based on horizontal starch gel electrophoresis of four enzymes (GPI, PGM, LDH, and ME). Their study showed that Cr (VI) exposure of O. chinensis resulted in differential survivorship of individuals with different genotypes of LDH, GPI, PGM, and ME in O. chinensis under experimental conditions. Similarly, Yap et al. (2004) indicated that there was a genetic basis for tolerance in the P. viridis populations to acute concentrations of metals, and the possession of these alleles and genotypes could allow P. viridis to survive longer in a metal-contaminated environment, such as in Kg. Pasir Puteh. This observation based on allozyme loci in P. viridis populations from the coastal waters of Peninsular Malaysia could be indicative of selection in the contaminated populations (Yap et al., 2004). Based on a laboratory study, Yap and Tan (2007) reported that the changes in the enzymes GOT, EST and ME were due to Zn stress which was complemented by reductions of filtration rate and condition index, by using P. viridis as a test organism. However, their study needs further validation since it is not yet known for sure whether the enzymes GOT, EST and ME are inducing behavioural and other changes in P. viridis. This is because possible subtle interactions could occur between different environmental stresses. As Gillespie and Guttman (1993) concluded studies investigating allozymes have supported the theory that there is a genetic basis for tolerance to acute concentrations of contaminants. Furthermore, the continued usage of these markers has been identified as being relevant to the field of ecotoxicology (Gillespie and Guttman, 1999). Many of the laboratory exposures allow researchers to determine if there is a genetic basis for tolerance in the test species in a laboratory setting where potentially confounding factors such as nutritional status, water quality, and gene flow are controlled. A genetic basis for tolerance supports the possibility of contaminant induced selection in an actual field setting. Perhaps, one of the earliest work by Latvie and Nevo (1982) reported that enzyme polymorphisms in marine invertebrates may allow for adaptations to the toxic effects of Cu and Zn. In the 1980s, it has already been documented through electrophoretic studies that allozyme polymorphisms and heterogeneity of animal populations and species are affected by environmental stress (Nevo et al., 1986; Ben-Shlomo and Nevo, 1988). Therefore, the environmental stress approach will allow us to subject a polymorphic population to the stress and determine the differential fitness of allozyme variants. Based on the results of Yap and Tan (2007), the allozymes of P. viridis may therefore also presumably be affected by heavy metal stresses in the field. Later, Yap et al. (2007) reported the genetic diversity of the populations of the greenlipped mussel Perna viridis collected from a metal-contaminated site at Kg. Pasir Puteh and those from four relatively uncontaminated sites (reference sites), based on RAPD markers. Heavy metal levels (Cd, Cu, Pb, and Zn) were also measured in the soft tissues and byssus of the mussels from all the sites. Cluster analyses employing UPGMA based on the RAPD markers grouped the populations into two major clusters namely the Bagan Tiang, Pantai Lido, Pontian, and Kg. Pasir Puteh populations were in one cluster, while the Sg. Belungkor population clustered by itself, as presented in Figure 8. This indicated that the genetic diversity based on bands resulting from the use of all four RAPD primers in P. viridis did not indicate its potential use as a biomarker of heavy metal pollution in coastal waters.

Ecotoxicological Genetic Studies…

235

Figure 8. An UPGMA dendrogram of genetic relationship among five populations of Perna viridis based on markers produced by four RAPD primers, based on Nei and Li‘s (1979) genetic distance index (Yap et al., 2007).

However, based on a correlation analysis between a particular metal and a band resulting from a specific RAPD primer revealed some significant (P< 0.01) correlations between the primers and the heavy metal concentrations in the byssus and soft tissues. Thus, the correlation between a particular metal and the bands resulting from the use of a specific RAPD primer on P. viridis could be used as biomonitoring tool of heavy metal pollution. Hence, they suggested that further studies utilizing correlation tests between molecular genetic markers for example DNA microsatellites and pollution levels be done to investigate their usefulness as genetic biomarkers of pollution by using P. viridis. This should be done to further validate the use of P. viridis as a biomonitor. However, the interpretation of such a relationship should be exercised with caution due to the fact that a number of contaminants, both organic and inorganic, are found reported in the coastal and intertidal waters of Peninsular Malaysia. Hence, there is always much discussion and argument as to which contaminant(s) caused the variations in the genetic structures of biomonitors. Recently, in order to provide more evidence on the above mentioned relationship to understand the effects of metal contaminations on genetic variations of P. viridis, Yap et al. (2010) reported on the relationships of heavy metals and genetic variations based on DNA microsatellites between metal-contaminated and uncontaminated populations of P. viridis from Peninsular Malaysia. Based on a total of 19 polymorphic microsatellite loci in six geographical populations of P. viridis collected from coastal waters of Peninsular Malaysia, the genetic variations were determined. FST values revealed that the all six mussel populations were still categorized as being ―moderately genetically differentiated‖, based on Wright (1978)‘s FST. Cluster analysis revealed that three populations located in the western part of the Johore Causeway were differently clustered from the other three populations located in

236

C. K. Yap and S.G. Tan

the eastern part, as presented in Figure 9. Hierarchical F-statistics and cluster analysis indicated that (1) The Johore Causeway blocked the free flow of the pelagic larvae swimmers of P. viridis, and (2) a distinct heavy metal contamination in the Kg. Pasir Puteh population as evidenced in the metal data based on soft tissues of P. viridis and sediment samples, were the two main causal agents for the genetic differentiation of the P. viridis populations in this study.

Figure 9. An UPGMA dendrogram of genetic relationships among six mussel populations based on Nei‘s (1978) genetic similarity (Yap et al., 2010).

Knapen et al. (2009) investigated the genetic variation in the endangered natural populations of gudgeon (Gobio gobio) located in a pollution gradient of Cd and Zn, based on a microsatellite and allozyme analysis and they found that both microsatellite and allozyme loci do not necessarily behave as selectively neutral markers in polluted populations. Theodorakis et al. (2006) determined the genetic structure of redbreast sunfish (Lepomis auritus) exposed to pulp mill effluents using the randomly amplified polymorphic DNA (RAPD) technique. The contaminants present in the pulp and paper mill effluents include chlorinated phenols, dioxins, and other polyhalogenated aromatic hydrocarbons (PHAHs), resin acids, and polycyclic aromatic hydrocarbons (PAHs). They found that the level of genetic diversity was higher in the mill receiving effluent populations than in the reference populations.

SUBSTANTIAL LITERATURE TO SUPPORT ECOTOXICOLOGICAL GENETIC STUDIES IN MALAYSIA Ecotoxicological genetic is defined as: The study of chemical- or radiation-induced changes in the genetic material of natural biota. Changes may be direct alterations in genes and gene expression or selective effects of pollutants on gene frequencies (Anderson et al., 1994). While ecotoxicologists are interested in six detrimental outcomes of exposure to

Ecotoxicological Genetic Studies…

237

genotoxic substances: gamete loss due to cell death, embryo mortality (lethal mutations), abnormal development, neoplasia, heritable mutations which may cause increases or decreases in genetic diversity and changes in gene expression that affect Darwinian fitness (Anderson et al., 1994; Depledge, 1994), the field of ecotoxicological genetics is therefore very much related and of relevance. From the literature, more and more evidence is increasing to suggest that genetic polymorphism is linked to adaptation to specific environmental parameters (Koehn and Bayne, 1989; Gillespie and Guttman, 1999). Nevo (1990) found that population survival in conditions of environmental stress (chemical pollution) was related to selection of particular genotypes. Earlier, Gyllensten and Rydman (1985) suggested that the effects of pollutants on natural fish populations could not be properly assessed without knowledge of the genetic structure of the species in question. Currently, there are an increasing number of studies which explore the differences in population genetic structure in relation to pollution levels in mussels collected from locations with different environmental inputs (Gillespie and Guttman, 1993; Hummel and Patarnello, 1994; Gillespie and Guttman, 1999). The pollutants can affect the test organisms by two routes namely direct exposure and indirect uptake via the gut. If these involve different biochemical pathways then different loci and different genotypes might be affected (Beaumont and Toro, 1996). According to Gillespie and Guttman (1999), there are evidences that environmental chemical contaminants are associated with allozyme variation in field populations. Eggen et al. (2004) proposed that modern molecular and genetic tools should be applied to mechanistic studies in ecotoxicology. This again is very much related to what we have been doing all the while using P. viridis in Malaysia. Depledge (1996) evaluated the changes in heterozygosity and the evolution of genetically resistant populations following exposure to pollution in the context of ecotoxicological genetics. According to Shugart and Theodorakis (1996), an understanding of the processes and mechanisms operating at the genetic level should help identify the more complex changes at higher levels of organization (i.e., populations, communities, and ecosystems). Techniques in genetic ecotoxicology are now in a rapidly evolving state and reliable tools are available to address the complex issues of cause and effect. Application of these techniques, especially those in use in molecular biology and other related disciplines, should help in our understanding of the key biological mechanisms that regulate and limit the responses of organisms to genotoxic stresses. According to a review by Depledge (1998), the aim of genetic ecotoxicological research on marine invertebrates is to determine whether anthropogenic chemicals (and radiation) are able to damage the DNA sufficiently to alter the population dynamics and community structure of biota in ecosystems and to identify transgenerational effects that may be of special significance. Anthropogenic chemicals and radiations which alter or damage the genetic material of natural populations have been implicated as important causal factors of changes in both intraspecific and interspecific biodiversity (Anderson et al., 1994).

238

C. K. Yap and S.G. Tan

CONCLUSION The present review does point to the possibility of the evolution of resistant populations of P. viridis at polluted sites and this could arise as a result of selective pressures which favour some genotypes over others. This definitely falls within the realm of ecotoxicological genetics as it is an important mechanism by which the genetic constitution of a population may be altered. We proposed that ecotoxicological genetics research using P. viridis as a biomonitor is an important research area which can help protect and preserve the diverse valuable bioresources of the coastal waters of Malaysia.

REFERENCES Anderson, S., Sadinski, W., Shugart, L., Brussard, P., Depledge, M., Ford, T., Hose, J., Stegeman, J., Suk, W., Wirgin, I. and Wogan, G. (1994). Genetic and molecular toxicology: a research. framework, Environ. Health Perspect., 102(Suppl. 12), 3–8. Anderson, W. S. L. (1994). Linking genotoxic responses and reproductive success in ecotoxicology. Environ. Health Perspect., 102 (Suppl. 12), 9–12. Awadhesh N. Jha, Victoria V. Cheung, Michael E. Foulkes, Stephen J. Hill and Depledge, M. H. (2000). Detection of genotoxins in the marine environment: adoption and evaluation of an integrated approach using the embryo–larval stages of the marine mussel, Mytilus edulis. Mutation Res./Genetic Toxicol. Environ. Mutagenesis, 464, 213-228. Baker, J. (1982). Selective effects of insecticides on within-species variation: the lessons to be learnt when considering the environmental effects of pollutants. Agric. Ecosyst. Environ., 7, 187–198. Banks, M. A., McGoldrick, D. J., Borgeson, W. and Hedgecock, D. (1994). Gametic incompatibility and genetic divergence and kumamoto oysters, Crassostrea gigas and Crassostrea sikamea. Mol. Biol., 121, 127-135. Beaumont, A. R. (1991). Genetic studies of laboratory reared mussels, Mytilus edulis: Heterozygote deficiencies, heterozygosity and growth. Biol. J. Linn. Soc. 44: 273-285. Beaumont, A. R. and Toro, J. E. (1996). Allozyme genetics of Mytilus edulis subjected to copper and nutritive stress. J. Mar. Biol. Assoc. U. K., 76, 1061-1071. Belfiore, N. M. and Anderson, S. L. (2001). Effects of contaminants on genetic patterns in aquatic organisms: a review. Mutat. Res., 489, 97–122. Ben-Shlomo, R. and Nevo, E. (1988). Isozyme polymorphism as monitoring of marine environments: The interactive effect of cadmium and mercury pollution on the shrimp, Palaemon elegans. Mar. Pollut. Bull., 19, 314-317. Bickham, J. W., Sandhu, S., Hebert, P.D.N., Chikhi, L. and Athwal, R. (2000). Effects of chemical contaminants an genetic diversity in natural populations: implications for biomonitoring and ecotoxicology. Mutat. Res., 463, 33–51. Carney, S. L., Formica, M., I., Divatia, H., Nelson, K., Fisher, C. R. and Schaeffer, S. W. (2006). Population structure of the mussel ‗‗Bathymodiolus‘‘ childressi from Gulf of Mexico hydrocarbon seeps. Deep-Sea Res., 53, 1061–1072. Chauhan, T., Lal, K. K., Mohindra, V., Singh, R. V., Punia, P., Gopalakrishnan, A., Sharma, P. C. and Lakra, W. S. (2007). Evaluating genetic differentiation in wild populations of

Ecotoxicological Genetic Studies…

239

the Indian major carp, Cirrhinus mrigala (Hamilton–Buchanan, 1882): Evidence from allozyme and microsatellite markers. Aquaculture, 269, 35–149. Chua B. H., Yong S. Y., Teh C. H., Yap C. K., Tan S. G. and Ismail A. (2003a). Assessment of the population genetic structure of the green-lipped mussel, Perna viridis L. using random amplified polymorphic DNA (RAPD) and random amplified microsatellites (RAMs) markers. In From peas to chips: the globalization of genetics (ed. M. K. Thong), pp. 47–48. The Genetic Society of Malaysia, Bangi. Chua, B. H., Yong, S. H., Teh, C. H., Tan, S. G., Yap, C. K. and Ismail, A. (2003b). Population genetic structure of the green-lipped mussel Perna viridis (L.) as indicated by Randomly Amplified Polymorphic (RAPD) molecular markers. In: Aquatic Resource and Environmental Studies of the Straits of Malacca: Managing the Straits Through Science and Technology, Japar Sidik, B., A. Arshad, H. H. Zakaria and A. Kawamura, eds., MASDEC and JICA, UPM Malaysia, pp. 291-301. De Wolf, H., Blust, R. and Backeljau, T. (2004). The use of RAPD in ecotoxicology. Mutat. Res., 566, 249–262. Depledge, M. H. (1994). Genotypic toxicity: implications for individuals and populations. Environ. Health Perspect., 102 (Suppl. 12), 101–104. Depledge, M. H. (1996). Genetic ecotoxicology: an overview. J. Exp. Mar. Biol. Ecol. 200: 57–66. Depledge. M. H. (1998). The ecotoxicological significance of genotoxicity in marine invertebrates. Mutation Res. /Fund. Mol. Mechan. Mutagenesis, 399, 109-122. Dhuyvetter, H., Gaublomme, E. and Desender, K. (2004). Genetic differentiation and local adaptation in the salt-marsh beetle Pogonus chalceus: a comparison between allozyme and microsatellite loci. Mol. Ecol., 13, 1065–1074. Diz, A.P. and Presa, P. (2008). Regional patterns of microsatellite variation in Mytilus galloprovincialis from the Iberian Peninsula. Mar. Biol., 154, 277-286. Eggen, R., Behra, R., Burkhardt-Holm, P. and Escher, B. (2004). Challenges in Ecotoxicology. Environ. Sci. Tech., 1, 58-64. Gillespie, R. B. and Guttman, S. I. (1993). Correlation between water quality and frequencies of allozyme genotypes in spotfin shiner (Notropis spilopteris) populations. Environ. Pollut., 81, 147-150. Gillespie, R. B. and Guttman, S. I. (1999). Chemical-induced changes in the genetic structure of populations: Effects on allozymes. Pages 55-77 in V. E. Forbes, ed., Genetics and ecotoxicology. Taylor and Francis, New York. Goldberg, E. D. (1986). The Mussel Watch concept. Environmental Monitoring and Assessment, 7, 91-103. Gosling, E. M. (1992). Genetics of Mytilus. Pages 309-382 in E. M. Gosling (Ed.), The mussel Mytilus: Ecology, physiology, genetics and culture. Elsevier Press, Amsterdam. Grant, W. S. and Cherry, M. I. (1985). Mytilus galloprovincialis Lmk. in Southern Africa. J. Exp. Mar. Biol. Ecol., 90, 179-191. Guttman, S. I. (1994). Population genetic structure and ecotoxicology. Environ. Health. Perspect., 102 (Suppl.12), 97–100. Gyllensten, U. and Rydman, N. (1985). Pollution biomonitoring programs and the genetic structure of indicator species. Ambio, 14, 29-31.

240

C. K. Yap and S.G. Tan

Harper-Arabie, R. M., Wirth, E. F., Fulton, M. H., Scott, G. I. and Ross, F. E. (2004). Protective effects of allozyme genotype during chemical exposure in the grass shrimp, Palaemonetes pugio. Aquat. Toxicol., 70, 41–54. Hawkins, A.J.S., Rusin, J., Bayne, B. L. and Day, A. J. (1989a). The metabolic/physiological basis of genotype-dependent mortality during copper exposure in Mytilus edulis. Mar. Environ. Res., 28, 253–257. Hawkins, A. J. S., Bayne, B. L., Day, A. J., Rusin, J. and Worrall, C M. (1989b). Genotypedependent interrelations between energy metabolism, protein metabolism and fitness. Pages 283–292 in: J. S. Ryland and P.A. Tyler (Eds.), Reproduction, Genetics and Distribution of Marine Organisms, Fredensborg, Olsen and Olsen. Hou, L., Lü, H, Zou, Z., Bi, Z., Yan, D. and He, C. (2006). Genetic characterizations of Mactra veneriformis (Bivalve) along the Chinese coast using ISSR-PCR markers. Aquaculture, 261, 865–871. Hummel, H. and Patarnello, T. (1994). Genetic effects of pollutants on marine and estuarine invertebrates. Pages 425-434 in A. R. Beaumont, (Ed.), Genetics and evolution of aquatic organisms. Chapman and Hall, London. Ismail, A. (2006). The use of intertidal mollusks in the monitoring of heavy metals and organotin compounds in the west coast of Peninsular Malaysia. Coast. Mar. Sci., 30(1), 401-406. Isobe, T., Takada, H., Kanai, M., Tsutsumi, S. and Isobe, K. O., Boonyatumanond, R. and Zakaria, M. P. (2007). Distribution of polycylic aromatic hydrocarbons (PAHs) and phenolic endocrine disrupting chemicals in South and Southeast Asian mussels. Environ. Monitor. Assess., 135, 423-440. Johnson, R. L., Liang, Q. L., Milan, C. D. and Farris, J. L. (1998). Genetic diversity and cellulolytic activity among several species of unionid bivalves in Arkansas. J. Shellfish Res., 17, 1375-1382. Kimura, M. (1991). The neutral theory of molecular evolution: a review of recent evidence. Jpn. J. Genet., 66, 367–386. Knapen, D., DeWolf, H., Knaepken, G., Bervoets, L., Een, M., Blust, R. and Verheyen, E. (2009). Historical metal pollution in natural gudgeon populations: Inferences from allozyme, microsatellite and condition factor analysis. Aquat. Toxicol., 95, 17–26. Koehn, R. K. and Bayne, B. L. (1989). Towards a physiological and genetical understanding of the energetics of the stress response. Biol. J. Linn. Soc., 37, 157-171. Kurelec, B. (1993). The genotoxic disease syndrome. Mar. Environ. Res., 35, 341–348. Latvie, B. and Nevo, E. (1982). Heavy metals selection of phosphoglucose isomerase allozymes in marine gastropods. Mar. Biol., 71, 17-22. Lemaire, C., Allegrucci, G., Naciri, M., Bahri-Sfar, L., Kara, H. and Bonhomme, F. (2000). Do discrepancies between microsatellite and allozyme variation reveal differential selection between sea and lagoon in the sea bass (Dicentrarchus labrax)? Mol. Ecol., 9, 457–467. Li, J, Wang, G. and Bai, Z. (2008). Genetic variability in four wild and two farmed stocks of the Chinese freshwater pearl mussel (Hyriopsis cumingii) estimated by microsatellite DNA markers, Aquaculture, doi: 10.1016/j.aquaculture.2008.10.032. Li, L., Lu, F., Zhang, M., Guo, Y. and Ma, E. (2009). Different survival of chromiumexposed Oxya chinensis among allozyme genotypes. J. Environ. Sci., 21, 509–513.

Ecotoxicological Genetic Studies…

241

Li, Q., Yu, H. and Yu, R. (2006). Genetic variability assessed by microsatellites in cultured populations of the Pacific oyster (Crassostrea gigas) in China. Aquaculture, 259, 95–102. McDonald, J. H. (1994). Detecting natural selection by comparing geographical variation in protein and DNA polymorphisms. Pages 88–100 in B. Golding (Ed.), Non-Neutral Evolution: Theories and Molecular Data. Chapman and Hall, New York, USA. Murdoch, M. H. and Hebert, P.D.N. (1994). Mitochondrial DNA diversity of. brown bullhead from contaminated and relatively pristine sites in the Great Lakes. Environ. Toxicol. Chem., 13, 1281–1289. Nei M. (1978). Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics, 89, 583-590. Nei, M. and Li, W.H. (1979). Mathematical model for studying genetic variations in terms of restriction endonucleases. Proc. Nat. Acad. Sci. USA., 76, 5269-5273. Neigel, J. E. 2002). Is FST obsolete? Conser. Genetics, 3, 167–173. Nevo, E. (1990). Molecular evolutionary genetics of isozymes: Pattern, theory and application. Pages 701-742 in Z. I. Ogita and C. L. Markert, (Eds.), Isozymes: Structure, function and use in biology and medicine. Willey-Liss, New York. Nevo, E., Noy, R., Lavie, B., Beiles, A. and Muchtar, S. (1986). Genetic diversity and resistance to marine pollution. Biol. J. Linn. Soc., 29, 139–144. Ong, C. C., Tan, S. G. Yusoff, K. and Yap, C. K. (2005). Isolation of DNA microsatellite markers in the green-lipped mussel, Perna viridis. Pertanika J. Trop. Agric. Sci., 28(1), 79-85. Ong, C. C., Teh, C. H., Tan, S. G., Yusoff, K. and Yap, C. K. (2008). Eleven novel polymorphic microsatellite DNA markers from the green-lipped mussel, Perna viridis. Russian J. Genetics, 44(4), 498-500. Ong, C.C., Yusoff, K., Yap, C.K. and Tan, S.G. (2009). Genetic characterisation of Perna viridis in Peninsular Malaysia using microsatellite markers. J. Genetics, 88,153-163. Sarver, S. K. and Loudenslager, E. J. (1991). The genetics of California populations of the blue mussel: Further evidence for the existence of electrophoretically distinguishable species or subspecies. Biochem. Sys. Ecol., 19, 183-188. Sarver, S. K. and Foltz, D. W. (1993). Genetic population structure of a species‘ complex of blue mussels (Mytilus spp.). Mar. Biol., 117, 105-112. Shazili, N. A. M., Yunus, K., Ahmad, A. S., Abdullah, N. and Abd Rashid, M. K. (2006). Heavy metal pollution status in the Malaysian aquatic environment. Aquat. Ecosys. Health Manage., 9, 137–145. Shugart, L. R. and Theodorakis, C. W. (1996). Genetic ecotoxicology: The genotypic diversity approach. Comp. Biochem. Physiol. Part C: Pharmacol. Toxicol. Endocrinol., 113, 273-276. Sin, F. Y. T., Khoo, J. and Parker, G. R. (1990) Enzymes variation between littoral and sublittoral populations of the green-lipped mussel Perna canaliculus. Comp. Biochem. Physiol., 95B, 419-422. Singh, S. M. and Green, R. H. (1984). Excess of allozyme homozygosity in marine molluscs and its possible biological significance. Malacologia, 25, 569-581. Skibinski, D. O., Cross, T. F. and Ahmad, M. (1980). Electrophoretic investigation of systematic relationships in the marine mussels Modiolus modiolus L., Mytilus edulis L. and Mytilus galloprovincialis Lmk. (Mytilidae: Mollusca). Biol. J. Linn. Soc., 13, 65-73.

242

C. K. Yap and S.G. Tan

Skibinski, D. O. F., Beardmore, J. A. and Cross, T. F. (1983). Aspects of the population genetics of Mytilus (Mytilidae: Mollusca) in the British Isles. Biol. J. Linn. Soc., 19, 137183. Slatkin, M. (1985). Gene flow in natural populations. Ann. Rev. Ecol. Syst. 16: 393–430. Sudaryanto, A., S. Takahashi, I. Monirith, A. Ismail, M. Muchtar, J. Zheng, B. J. Richardson, A. Subramanian, M. Prudente, N. D. Hue and S. Tanabe. 2002. Asia-Pacific Mussel Watch: Monitoring of butyltin contamination in coastal waters of Asian developing countries. Environ. Toxicol. Chem., 21, 2119-2130. Tan, S. G. and Yap, C. K. (2006). Biochemical and molecular indicators in aquatic ecosystems: Current status and further applications in Malaysia. Aquat. Ecosys. Health Manage., 9, 227-236. Theodorakis, C. W., Elbl, T. and Shugart, L. R. (1999). Genetic ecotoxicology IV: survival and DNA strand breakage is dependent on genotype in radionuclide-exposed mosquitofish. Aquat. Toxicol., 45, 279-291. Theodorakis, C. W., Lee, K. L., Adams, S. M. and Law, C. B. (2006). Evidence of altered gene flow, mutation rate, and genetic diversity in redbreast sunfish from a pulp-millcontaminated river. Environ. Sci. Technol., 40, 377-386. Vainola, R. and Hvilsom, M. M. (1991). Genetic divergence and hybrid zone between Baltic and North Sea Mytilus populations (Mytilidae: Mollusca). Biol. J. Linn. Soc., 43, 127148. van Straalen, N. M. and Timmermans, M. J. T. N. (2002). Genetic variation in toxicantstressed populations: an evaluation of the ―genetic erosion‖ hypothesis. Hum. Ecol. Risk Assess., 8, 983–1002. Watt, W. B. (1994). Allozymes in evolutionary genetics: self-imposed burden or extraordinary tool? Genetics, 136, 11–16. Wright, S. (1951). The genetical structure of populations. Ann. Eugen., 15, 323–353. Wright, S. (1978). Evolution and the genetics of populations, vol. 4. Variability within and among natural populations. University of Chicago Press, Chicago. Wurgler, F. E. and Kramers, P. G. N. (1992). Environmental effects of genotoxins (ecogenotoxicology). Mutagenesis, 7, 321–327. Yamanaka, R. and Fujio, Y. (1984). Heterogeneity within and between geographical populations of the Bay Mussel, Mytilus edulis. Tohoku J. Agri. Res., 31, 74-84. Yap, C. K. and Tan, S. G. (2007). Changes of allozymes (GOT, EST and ME) of Perna viridis subjected to zinc stress: A laboratory study. J. Appl. Sci., 7(20), 3111-3114. Yap, C. K., Che Mohd Zaidi, C. B., Edward, F. B., Ismail, A. and Tan, S. G. (2009). Heavy metal concentrations (Ni, Pb, and Zn) in the green-lipped mussel, Perna viridis collected from the northern coastal waters of Peninsular Malaysia. J. Sustain. Sci. Manage., 4(1), 10-19. Yap, C. K., Chua, B. H, Teh, C. H., Tan, S. G. and Ismail, A. (2007). Primers of RAPD markers and heavy metal concentrations in Perna viridis (L.), collected from metalcontaminated and uncontaminated coastal waters: Are they correlated with each other ? Russian J. Genetics, 43(5), 544-550. Yap, C. K., Ismail, A. and Tan, S. G. (2003a). Background concentrations of Cd, Cu, Pb and Zn in the green-lipped mussel Perna viridis (Linnaeus) from Peninsular Malaysia. Mar. Pollut. Bull., 46, 1043-1048.

Ecotoxicological Genetic Studies…

243

Yap, C. K., Ismail, A. and Tan, S. G. (2003b). Cd and Zn in the straits of Malacca and intertidal sediments of the west coast of Peninsular Malaysia. Mar. Pollut. Bull. 46: 13481353. Yap, C. K., Ismail, A. Tan, S. G. and Omar, H. (2002b). Concentrations of Cu and Pb in the offshore and intertidal sediments of the west coast of Peninsular Malaysia. Environ. Int., 28, 467-497. Yap, C. K., Ismail, A., Edward, F. B., Tan, S. G. and Siraj, S. S. (2006). Use of different soft tissues of Perna viridis as biomonitors of bioavailability and contamination by heavy metals (Cd, Cu, Fe, Pb, Ni and Zn) in a semi-enclosed intertidal water, the Johore Straits. Toxicol. Environ. Chem., 88(4), 683 - 695. Yap, C. K., Tan, S. G., Ismail, A. and Omar, H. (2002a). Genetic variation of green-lipped mussel Perna viridis (Linnaeus) from the west coast of Peninsular Malaysia. Zool. Stud., 41(4), 376-387. Yap, C. K., Tan, S. G., Ismail, A. and Omar, H. (2004). Allozyme polymorphisms and heavy metal levels in the green-lipped mussel Perna viridis (Linnaeus) collected from contaminated and uncontaminated sites in Malaysia. Environ. Int., 30, 39-46. Yap, C.K., Cheng, W. H., Ong, C.C., Chong, C. M. and Tan, S.G. (2010). The heavy metal contamination and physical barrier are main causal agents for the genetic differentiation of Perna viridis populations in Peninsular Malaysia. Submitted to Ecotoxicol. Environ. Safety. Zouros, E. and Foltz, D. W. (1984). Possible explanation of heterozygote deficiency in bivalve molluscs. Malacologia, 25, 583-591. Zouros, E., Romero-Dorey, M. and Mallet, A. L. (1988). Heterozygosity and growth in marine bivalves: Further data and possible explanation. Evolution, 42, 1332-1341.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 10

ENVIRONMENTAL IMPACT TO MUSSELS‟ METABOLISM Jordan T. Nechev Institute of Organic Chemistry with Center of Phytochemistry, Bulgarian Academy of Sciences, 9 Acad G. Bonchev str., 1113-Sofia, Bulgaria.

ABSTRACT Mussels' attract scientific attention due to two main reasons – they are excellent seafood being source of n-3 polyunsaturated fatty acids, and they are sensitive bioindicators for the environmental conditions. Metabolic changes in mussels are due to their developmental phase, environmental conditions and pollution stress. They could be result of stress induced degradation processes as well as to changes leading to a better adaptation towards the harmful environment. The lipid cell membranes are important for this adaptation, since one of the effects of the stress impact is to perturb the physical properties of the cell membranes by changing their chemical composition and biophysical organization. In such a case the adequate response of the cells would be a series of biochemical modifications and rearrangements of lipophilic compounds (phospholipids, sterols) in the cell membranes, in order to recover their initial organization. Chemical composition and enzymatic activities of mussels from different areas are discussed. Impact of temperature, food availability, salinity, pollution (including metals and persistent organic pollutants) to the mussels‘ biochemistry, also resulted in significant changes in metabolites. Oxidative stress could also take place in marine bivalves under a series of environmental adverse conditions.

INTRODUCTION The significance of the study of the environmental impact to aquatic organisms‘ metabolites has been increasing recently, especially in those species, cultivated for human consumption. Thus farmed mussels are generally cleaner and larger than wild mussels, and many seafood lovers believe that they also taste richer and sweeter. Marine bivalves are

246

Jordan T. Nechev

excellent seafood and their nutritional values are undisputed. This is mostly due to the high content of Polyunsaturated Fatty Acids (PUFAs) they possess, and especially of ω-3 PUFAs. Marine mussels participate in basic ecological interactions, such as competition, herbivory, predation, decay, parasitism, and pollution. They occupy substantial positions in trophic chains as a source of feed for the vertebrate animals. The sessile way of life and the filter feeding habitats make bivalves more vulnerable to the environmental stress (Goldberg, 1975; Alves de Almeida et al., 2007). They need to survive not only the alterations due to seasonal fluctuations such as temperature, salinity, food availability, desiccation during low tides, pollution, but have to resist against the more mobile animals (Kennedy, 1976; Widdows et al., 1979; Guderley et al.,1994). In order to overcome these unfavorable conditions, mussels have developed a series of adaptations, including changes in metabolic rate, and activation or inhibition of alternative biochemical pathways. Van Gastel and Van Brummelen (1994) redefined the terms ‗biomarker‘, ‗bioindicator‘ and ‗ecological indicator‘, linking them to different levels of biological organization. They considered a biomarker as any biological response to an environmental chemical at the subindividual level, measured inside an organism or in its products (urine, faeces, hair, feathers, etc.), indicating a deviation from the normal status that cannot be detected in the intact organism. A bioindicator is defined as an organism giving information on the environmental conditions of its habitat by its presence or absence or by its behavior, and an ecological indicator is an ecosystem parameter, describing the structure and functioning of ecosystems (van der Oost et al., 2003). A number of metabolic changes in living organisms are due mainly to stress induced degradation processes as well as to changes leading to e better adaptation towards the harmful environment. The lipid cell membranes are important for this adaptation, because one of the effects of the stress impact is to perturb the physical properties of the cell membranes by altering their chemical composition and biophysical organization. In such a case the adequate cells‘ response would be a series of biochemical modifications of the lipophilic composition of the cell membranes in order to recover their initial organization. Invertebrates are extensively used for monitoring programs in freshwater (Gundacker, 2000), marine (al-Mafda et al., 1998; Frias-Espericueta et al., 1999), even Antarctic environment (Kahle and Zauke, 2002), due to their ability to concentrate pollutants up to several orders of magnitude above the ambient levels in water. The mussel Mytilus galloprovincialis has been widely used as a sentinel organism for pollution assessment in coastal areas and for biomonitoring of marine environments (Viarengo and Canesi, 1991; Pavičić et al., 1993; Cajaraville et al., 2000; Petrović et al., 2001; Petrović et al., 2004; Jakšić et al., 2005). Systematic monitoring was launched with the ―Mussel Watch‖ program in the US in the 1970s (Goldberg, 1975; Goldberg, 1986). The Program still goes on and defines status and trends for different pollutants - whereas metal pollution trends vary by site and region and are mixture of increasing and decreasing sites, organic pollutant trends show significant decreasing in most locations. More recently, mussels have been the subject of several European research programs, for example, MEDPOL (Gabrieldes, 1997) and BIOMAR (Narbonne et al., 1999). Mussels in their natural habitats do not undergo only one stress at a time. It may be unrealistic to assume that temperature, salinity and pollution are the only stresses that influence measured biomarkers and biotests. A combination of anthropogenic pollution and

Environmental Impact to Mussels‘ Metabolism

247

natural stressors results in several adverse effects occurring under in situ conditions, and their interpretation requires further research (Hamer et al., 2008). In biomonitoring studies, the use of a suite of biomarkers is more adequate than the use of a single biomarker to facilitate the comprehensive determination of organism health along natural marine environments (Cajaraville et al., 2000; Narbonne et al., 2005; Hylland et al., 2008). Thus, in recent years it is of utmost importance to integrate the biomarker responses into a certain stress index, for the correct evaluation of the health status of marine organisms (Cajaraville et al., 2000; Moore et al., 2006; Raftopoulou and Dimitriadis, 2010). For this purpose, simple indices have been proposed, such as health status index (Dagnino et al., 2007), lysosomal response index (Izagirre and Marigomez, 2009), integrated biomarker response (Beliaeff and Burgeot, 2002), allowing the classification of sampling sites according to pollution gradient (Narbonne et al., 1999; Chevre et al., 2003; Broeg et al., 2005; Raftopoulou and Dimitriadis, 2010).

TEMPERATURE Temperature is a major factor decisive to the latitudinal distribution of species. In ectothermic organisms, temperature is recognized as a pervasive factor affecting structures and functions at all levels of biological organization (Hochachka and Somero, 2002). Changes in environmental temperature directly influence the body temperature and cause alterations in biochemical, cellular and physiological rates, possibly affecting virtually every aspect of their biology. It is well demonstrated that temperature strongly affects growth rates and growth patterns of freshwater mussels (Negus, 1966; Tevesz and Carter, 1980; Hanson et al., 1988; Morris and Corkum, 1999). The mussel Mytilus galloprovincialis exhibits a maximum period of valve opening when acclimated to temperatures between 10–17°C. In contrast, warming to 24 °C caused mussels to keep their valves closed for longer (Anestis et al., 2007). Closing of the valves would restrict gas exchange, thus limiting aerobic metabolism. Under conditions of limiting oxygen, reductions (or cessations) of cardiac activity might be necessary. Similarly previous reports indicated that metabolic depression accompanies valve closure in bivalves (de Zwaan et al., 1980; Ortmann and Grieshaber, 2003). Temperature does not, however, only interfere with physiological processes through direct impact on catalytic rates but also by modulating regulatory processes. For example, in the freshwater mussel Pyganodon grandis, which is an efficient regulator of oxygen consumption (Lewis, 1984), the ability to maintain adequate respiration rate under declining dissolved oxygen concentrations is improved when temperature is reduced from 24.5°C to 16.5°C (Chen et al., 2001). In addition, temperature is an important factor controlling tolerance of mussels to hypoxia (Chen et al., 2001). Apart from the thermally induced hypoxia, it has been reported that global warming may accelerate the growth and distribution of pathogens and harmful algal blooms, thereby influencing diseases of aquatic organisms as well as human health (Harvell et al., 1999; IPCC, 2007). For example, the infection of bivalves by several protozoans seems to affect several physiological processes in their organs resulting in their dysfunction. Specifically, it may provoke high glycogen loses (emaciation and discoloration of the digestive gland) which leads to a

248

Jordan T. Nechev

cessation of growth and to a poor condition index (Figueras and Montes, 1988; Figueras et al., 1991; Robert et al., 1991). Metabolic enzyme activities are strongly affected by temperature; generally reaction rates are slower at low temperatures (Doucet-Beaupré et al., 2010). Ectotherms can respond, on both short-term and evolutionary time scales, to chronic temperature changes by quantitative and/or qualitative adjustments in enzyme activity. For example, enzyme activity may be altered by changing rates of transcription and enzyme concentration (Crawford and Powers, 1989; Crawford and Powers, 1992) or by expressing allozymes and isozymes with different thermal sensitivities (Lin and Somero, 1995; Fields and Somero, 1997), both of which reflect acclimation to ambient temperature and adaptation to thermally variable environments. Changes in enzyme activity, especially those related to the aerobic capacity of mitochondria, have been linked to shifts in thermal tolerance limits (Pörtner, 2002a; Pörtner, 2002b). Modification of mitochondrial numbers or cristae density may occur at low temperatures and contribute to metabolic compensation (St-Pierre et al., 1998). In all cases, this could lead to energetic homeostasis at the whole organism level within its window of thermal tolerance. The behavioral and physiological adjustments taking place in M. galloprovincialis when it is exposed for long term to 24°C are accompanied by corresponding metabolic adjustments. The decreased levels of pyruvate kinase (PK) activity in M. galloprovincialis acclimated to 24°C indicate a low glycolytic rate as well as low rates of pyruvate supply to aerobic metabolism and probably low rates of energy turnover under control conditions and during moderate warming. It implies an activation of anaerobic component of metabolism in mussels (de Vooys, 1980). Therefore, mussels conserve energy by utilizing anaerobic metabolism. This anaerobic metabolism also increases at low temperatures and some of the end products may be cryoprotectant (de Vooys and de Zwaan, 1978; de Vooys, 1991). M. galloprovincialis is remarkable among bivalves for its highly developed anoxia tolerance (Gaitanaki et al., 2004). The blue mussel Mytilus edulis from the Gulf of Maine, when exposed to higher seawater temperatures, showed a significant increase in the expression of heat shock proteins (HSP70) and activities of the antioxidant enzyme, superoxide dismutase (SOD) (Lesser et al., 2010). As indicated by the PK activity, another mussel - Modiolus barbatus maintains some aerobic capacity when acclimated to temperatures up to 24°C, while further warming probably caused metabolic depression and a shift from aerobic to anaerobic metabolism (Anestis et al., 2008). Thus, metabolic depression may be suitable to balance the temperature induced rise in energy demand (Anestis et al., 2010). In the marine mussel Bathymodiolus thermophilus such a general metabolic depression indicated strong decrease of mRNA expression for numerous genes, possibly due to maladaptation and cell disorders when temperature increased (Boutet et al., 2009). Despite the significant status of mussel species and the potential effect of global warming on northern aquatic habitats, thermal sensitivity of the metabolic apparatus of bivalves has received little attention. By examining the thermal sensitivity of 10 key metabolic enzymes and in situ growth rates of latitudinally separated populations (temperate and subarctic) of two closely-related Pyganodon species from northeastern North America, Doucet-Beaupré et al. (2010) provided the first insights into thermal sensitivity of key enzymes of energy and reactive oxygen species metabolism in relation to habitat localization and growth performance.

Environmental Impact to Mussels‘ Metabolism

249

The subarctic population of Pyganodon grandis displayed higher in situ growth rates than the temperate population of Pyganodon fragilis. The subarctic population of P. grandis had a lower mitochondrial capacity as expressed by citrate synthase and cytochrome c oxidase but displayed similar electron transport system and higher isocitrate dehydrogenase capacities. The results suggested that higher growth performance of the subarctic population of P. grandis is not associated with higher aerobic capacity. The high thermal sensitivity of mitochondrial enzymes in subarctic population of P. grandis might rather reflect enhanced stenothermy. The higher electron transport system/cytochrome c oxidase ratio for the subarctic P. grandis species than P. fragilis might affect mitochondrial regulation or reactive oxygen species production. Antioxidant enzymes displayed lower Q10 values suggesting thermal independence of antioxidant capacity. Lipid peroxidation, as expressed by MDA content, was significantly higher in marine mussels (0.11±0.05 mM/mg protein) compared to the freshwater mussels (Doucet-Beaupré et al., 2010). Lipids are main components of cell and tissue membranes and are the major energy source. They are substantial for the physiological processes and reflect the environmental conditions (De Moreno et al., 1980). The amount of PUFA reaches up to 49% of total fatty acids (FA), possessing icosapentaenoic (20:5 n−3) and docosahexaenoic (22:6 n−3) acids as major constituents. However, there are exceptions, like the Manila clam Tapes philippinarum, containing (n-3) FA in much lower concentrations (Kraffe et al., 2002). As a general rule, organisms, inhabiting colder waters contain more PUFA and long chain fatty acids, compared to those in warm seas. Adaptation to subzero temperatures may demand drastic changes to membrane composition. Changes in the physical properties of subzero water, such as pH, density, as well as the large impact of very low temperature on the kinetic properties of biological membranes may pose a significant challenge to the maintenance of membrane function. Gillis and Ballantyne (1999) examined two marine bivalves: the quahog, Mercenaria mercenaria, and the American oyster, Crassostrea virginica, after acclimation to 12°C and −1°C. Most of the acclimation response was due to changes in phospholipid fatty acids of gill mitochondrial membranes and concerned alterations in PUFA content (for C. virginica) and monoenoic fatty acids levels (for M. mercenaria). Sterols, being another essential group of components in cell and tissue‘s membranes, also could be used for environmental and ecotoxicological monitoring. For example, C26 sterols are typical of cold waters inhabitants, and are absent in organisms from tropic seas. According to the hypothesis of Milkova et al. (1980), the source of these sterols is probably a specific phytoplankton, which is widespread in cold waters.

FOOD AVAILABILITY Phytoplankton is the greatest food source for bivalve molluscs and is considered the principal source in marine trophic chains for linoleic (18:2 n−6), linolenic (18:3 n−3) and icosapentaenoic (20:5 n−3) PUFAs (Sargent, 1976). Furthermore, high levels of these fatty acids have been observed in larval and post-larval stages of various marine bivalve species nourished by microalgal diets characteristically rich in these fatty acids (Langdon and

250

Jordan T. Nechev

Waldock, 1981; Albentosa et al., 1994; Albentosa et al., 1999; Fernández-Reiriz et al., 1998; Fernández-Reiriz et al., 1999; Soudant et al., 1998; Labarta et al., 1999; Caers et al., 2000). An interesting feature within the PUFAs n−6 group is the significantly higher values presented by the arachidonic acid (20:4 n−6) in mussels during January when minimum phytoplanktonic food concentrations were registered. These levels probably arise from selective retention of the arachidonic acid for use in reproductive processes (Osada et al., 1989) or in the incorporation of the structural lipids of the eggs (Soudant et al., 1996). It is of significance to mention another group of metabolites: non-methylene-interrupted dienoic fatty acids, which are not present in the phytoplankton, but have been reported in scallops and many other species of molluscs (Bergé, and Barnathan, 2005). Thus, they are presumably synthesized by the molluscs.

SALINITY Each organism and any species has the capacity of adaptation, based on regulating processes, and once stress and/or toxic exposure passes the threshold of toxicity, irreversible attacks can lead to a pathological state, which results in a significant deterioration of the individual's performance and later can lead to the organism's death (Manduzio et al., 2005). When dealing with salinity, not only the concentration is important, but salts‘ content as well. Maximum variety of marine fauna reaches the salinity of 30-40, which is near the oceanic one (Berger, 1986). Any deviation out of these frames leads to a reduction of the number of species. While salinity is relatively constant in the open Adriatic Sea, for example, (36.96 ± 0.77), in intertidal zones and estuaries, close to under-sea fresh water springs and during rainy days in closed lagoons, salinity can vary significantly from 4 to 38 (Hamer et al., 2008). In the northern White Sea the salinity is about 10 on the surface, and increases up to 28-30 in depths (Fokina, 2007). Rainer et al. (1979) pointed, that on three estuarine mollusks, the mean energy demand for each species decreased by 17% or more, when salinity was reduced from 35 to 10. In general, all environmental factors apply in different extent depending on the precise mussel‘s location, whether it belongs to supralittoral, eulittoral and sublittoral zone. Changes in the main membrane constituents - phospholipids and cholesterol in Mytilus edulis depending on salinity, were observed by Fokina et al. (2007). M. galloprovincialis is an osmoconformer and maintains its tissue fluids isoosmotic with the surrounding media by mobilization and adjustment of the tissue fluid concentration of free amino acids (Bayne, 1986). However, mobilizing amino acids may result in protein loss, increased nitrogen excretion and reduced growth. Mytilus species are known to exhibit a defined behavior to reduced salinity, initially by closing its siphons to maintain the salinity of the water in its mantle cavity, which allows some gaseous exchange and therefore maintenance of a longer aerobic metabolism. Gaitanaki et al. (2004) investigated the activation in M. galloprovincialis of a particular mitogen-activated protein kinase (MAPK) – p38-MAPK, characterized as the principal stresskinase responsive to fluctuations in ambient osmolality and temperature (Somero and Yancey,

Environmental Impact to Mussels‘ Metabolism

251

1997; Lang et. al., 1998). Seawater salinities varying between 100–60% had no effect, whereas a salinity of 50% induced a significant phosphorylation. Furthermore, hypertonicity (120% seawater) resulted in a moderate kinase phosphorylation. Some authors reported no differences in FA content from marine and freshwater bivalves depending on salinity levels (Pollero et al, 1979; Pollero et al, 1981; Kashin, 1997) though announced, that regular adaptive response of the animals include alterations in the lipid profile. Glémet and Ballantyne (1995) founded how salinity exposure induced an increase in some of the negatively charged phospholipids. This response may be a mechanism to bind accumulated cations, which would otherwise interfere with intracellular metabolism.

OXIDATIVE STRESS Oxidative stress can take place in marine bivalves under a series of environmental adverse conditions. Bivalves have been proposed as good sentinel organisms in pollution monitoring studies through the analysis of biochemical biomarkers, and most of the biomarkers analyzed are those related to oxidative stress. However, it is very important to know how other environmental factors not associated to the presence of pollutants might affect these parameters. Alves de Almeida et al. (2007) proposed that studying of stress response, especially those related to oxidative stress (i.e. antioxidant defense systems, DNA damage and lipid peroxidation) in aquatic organisms could provide important information and could be used as tool for examining the environmental quality. In their investigations of Perna perna and other bivalves along Brazilian coast, they tracked the rate of cellular reactive oxygen and nitrogen species (ROS/RNS) generation in the organism, as described earlier by Storey (1996). The oxidation of DNA by ROS/RNS can produce strand breaks and a number of different modified DNA bases. DNA strand breaks represent a major class of oxidative damage to DNA under oxidative stress (Cadet et al., 1997). Antioxidant enzyme activities - those of catalase, superoxide dismutase, glutathione peroxidases, glutathione reductase, glutathione S-transferase and DT-diaphorase showed increased activity in gills of M. galloprovincialis at some sites along the Spanish Mediterranean coast, suffering from metal and organic pollution, which indicated a situation of oxidative stress (Fernández et al., 2010a). Evidence of oxidative stress was not reflected at physiological level by scope for growth. Although 2 years after oil spill polycyclic aromatic hydrocarbons (PAHs) bioaccumulated by mussels had decreased to background levels, biochemical parameters still showed signals of oxidative stress in mussels from this area (Fernández et al., 2010b). In other case, the golden mussel Limnoperna fortunei was used for biomonitoring of environmental pollution around Córdoba City, Argentina. After exposure to pollutants, served as biomarkers, antioxidant enzymes responded at the most polluted sampling site within 1 day showing increased activities lasting for 4 days (Contardo-Jara et al., 2009). Plasmalogens were reported for bivalve species inhabitting marine (Dembitsky and Vaskovsky, 1976; Dembitsky, 1979; Berdyshev, 1989; Kraffe et al., 2004; Kraffe et al., 2006), freshwater (Dembitsky et al., 1992; Dembitsky et al., 1993a), and brackish waters (Dembitsky et al., 1993b). Plasmalogens may also act as antioxidants, thus protecting cells from oxidative stress. Serving as structural component of mammalian and invertebrate cell

252

Jordan T. Nechev

membrane, they are widely distributed in excitable tissues, like heart and brain. Plasmalogens mediate dynamics of cell membrane, they provide storage of polyunsaturated fatty acids and can contribute to endogenous antioxidant activity (Brosche et al., 2007). Plasmalogens serve as a reservoir for second messengers and may be also involved in membrane fusion, ion transport, and cholesterol efflux (Hanuš et al., 2009).

POLLUTION Coastal and estuarine environments are subjected to several forms of disturbance, amongst which chemical pollution associated with industrial production and high levels of urbanisation are both of major concern. In this context, chemical monitoring programs have commonly used both marine organisms and sediment as matrices to identify chemical pollutants in these affected environments (Fernández et al., 2010a). Within such monitoring programs, mussels are the organisms most widely used as sentinels due to their sessile filter feeding character, ability to accumulate and tolerate high concentrations of pollutants, wide geographical distribution, ease of collection and abundance in coastal and estuarine waters (Goldberg, 1986). Physical and especially chemical analysis quantify pollutants in detail, but lack the ability to judge the impact of those on biota (Contardo-Jara et al., 2009a). Therefore, biomarkers, more precisely biochemical, physiological and histological reactions of organisms, were developed to assess the impact of environmental pollutants in terms of exposure and/or damage of organisms (Huggett et al., 1992; Lam and Gray, 2003; van der Oost et al., 2003). Aquatic organisms are highly susceptible to toxic effects from heavy metals (Pytharopoulou et al., 2008). Metallothioneins, a family of low molecular weight and cysteine-rich proteins which are capable of binding metals, constitute a molecular tool for mussels to sequestrate metals (Amiard et al., 2006; Monserrat et al., 2007). Apart from their role in homeostasis of essential metals, like Cu, Zn and Mn, and detoxification of toxic metals, like Cd, Hg and Ni, metallothioneins are crucial in many other cellular pathways, such as scavenging of oxyradicals, inflammation and infections (Coyle et al., 2002; Amiard et al., 2006). Although possessing direct role in aquatic organism metabolism, some metals can also act as stimulators or generators of reactive oxygen species (ROS). Many ROS are free radicals, such as superoxide, hydroxyl, nitric oxide and lipid peroxyl radicals. Due to their unpaired electrons, they are highly reactive and have the tendency to oxidize other cellular substances (Davies, 2005; Valavanidis et al., 2006; Winterbourn, 2008). Uncontrolled production of free radicals leads to a phenomenon known as oxidative stress. Since the discovery of the importance of oxidative stress, there has been an increased application of relative biomarkers in aquatic organisms, including measurement of specific antioxidant enzymes or total oxyradical scavenging capacity, biomarkers of protein oxidation and lipid peroxidation, and biomarkers of oxidative damage to nucleic acids (Valavanidis et al., 2006). Cytosolic Cr, Cu, and Mn are positively correlated with metallothionein content as well as with superoxide radical production, lipid peroxidation and micronucleus frequency in cells of M. galloprovincialis exposed in areas polluted by heavy metals (Pytharopoulou et al., 2008). In addition, these metals are negatively correlated with lysosomal membrane stability.

Environmental Impact to Mussels‘ Metabolism

253

Oxidative stress indices and protein synthesis efficiency are negatively correlated. However, the mechanism here is not purely understood and needs further investigation. Incubation with cobalt ions in different concentrations of Mytilus galloprovincialis from the Black Sea induced increased PUFAs levels in membrane lipids (Nechev et al., 2006). In the biosynthesis of sterols, cobalt ions appeared to inhibit the second phase of the C-24 alkylation, which resulted in decreased levels of C29-sterols. Authors succeeded to identify in M. galloprovincialis a series of minor sterols, including the new for the Black Sea invertebrates 24-methyl-cholesta-5,23-dien-3β-ol and 22,23-methylene-cholest-5-en-3β-ol, as well as other four short side chain sterols: preg-5-en-3β-ol; dinor-chol-5-en-3β-ol; dinorchola-5,20(22)-dien-3β-ol; and 24-nor-chol-5-en-3β-ol. The last four sterols were new for the phylum Mollusca and they were present only in the control sample, which was not treated with cobalt ions (Nechev et al., 2006). They could be considered for biomarkers concerning metal pollution, but further research is needed. The discharge of pharmaceuticals can affect reproductive behaviors of aquatic organisms and have important negative environmental effects (Fong and Molnar, 2008). Induction of spawning in biofouling pest species like zebra mussels (Dreissena polymorpha) and dark false mussels (Mytilopsis leucophaeata) could possibly increase the chances of successful fertilization by synchronizing spawning, and therefore enhance the spread of these exotic species. Furthermore, if spawning and parturition in native species is induced at the wrong time of the year, for example, when planktonic or benthic food for developing larvae and juveniles is limited, it could cause a higher percentage of early stage mortality. Several species of freshwater mussels (unionids) are endangered in North America due to habitat loss and smothering by exotic species like zebra mussels (Schloesser et al., 1996). This, combined with the recent finding that fluoxetine induces premature release of unionid glochidia (Heltsley et al., 2006) could have serious negative consequences for already endangered unionid populations (Fong and Molnar, 2008). Contardo-Jara et al., (2009b) reported for increased antioxidant enzymes‘ activity of an organism tolerant to pollution such as the zebra mussel D. polymorpha. It was treated with polychlorinated biphenyls (PCB), dichlorodiphenyltrichloroethane (DDT) and other pesticides, as well as contamination with metals. The results confirm the high sensitivity of gills, nevertheless enzymatic changes measured in whole mussel tissue provided the clearest results. PAH derive mainly from anthropogenic sources and are widely distributed in the environment, particularly around industrial and urban centers. PAH are formed as products of incomplete combustion of fossil fuels and other organic matter, and major sources include emissions from wood and coal burning, motor vehicles, power stations and refuse incinerators. PAH were detected in body burden of mussels, clams, and cockles, and mussels exceeded the threshold level recommended for the human consumption, proposed by the US Food Safety Administration for commercial exploitation of these organisms (Fernández-Tajes et al., 2010). The DNA damage, evaluated by the comet assay, showed a good relationship with the pollution load level, except for Mytilus galloprovincialis. The two cell types evaluated, hemocytes and gill cells, showed similar results. Consequently, the authors recommended the use of hemocytes, since they require less handling. The higher sensitivity of clams and cockles, compared to mussels, made them to propose the use of other species coupled with M. galloprovincialis for the optimal biomonitoring of polluted marine environments (Fernández-Tajes et al., 2010).

254

Jordan T. Nechev

Due to their hydrophobic properties, PAH, PCB and DDT are readily accumulated by aquatic organisms, and particularly by bivalve molluscs. Most results have demonstrated significant correlations between PAH and PCB accumulation and catalase activity in mussels (Cheung et al., 2001; De Luca-Abbott et al., 2005). There was also an increase in catalase activity in M. edulis and P. viridis exposed to PAHs and PCBs under laboratory conditions (Krishnakumar et al., 1997; and Richardson et al., 2008). Indeed, PCBs and PAHs are known to generate ROS after undergoing metabolisation processes (Livingstone, 2001). These results suggest that catalase activity reflects the spatial bioavailability of organic contaminants. Diesel fuel provoked changes in lipids of M. galloprovincialis, similar to those from metal pollution - increased PUFAs content, especially in phospholipids (Nechev et al., 2002). Pollution of Danube River seriously influenced lipid content and FA ratio in the freshwater mussel Pseudoanodonta complanata. Significant decrease of FA unsaturation was observed in samples from more polluted areas in the river (Stefanov et al., 1992; Stefanov et al., 1993). Pollution affected the phospholipid biosynthesis, inhibiting its last stage – the methylation of phosphatidylethanolamine and phosphatidylcholine. Since such effects are known to be caused by PCBs, the presence of the latter in the river should be proposed. Biocides still possess many uncertainties about their environmental parameters. The insufficiency of information about their impact to metabolic pathway of aquatic organisms makes difficult their environmental risk assessment. Yurchenko and Vaschenko (2010) indicated that spermatogenesis of the mussel Modiolus kurilensis is sensitive to environmental pollution. They provided evidence that the early spermatogenic cells, spermatozoa and somatic accessory cells are targets of environmental toxicants. Spermatogonia and spermatocytes seem to be more sensitive to pollution than spermatozoa. In general, marine pollution represents environmental stress-factor affecting mussel reproductive health through a decrease in the number of normal sperm cells.

CONCLUSION Although conditionally represented as distinct factors in this chapter, temperature, food availability, salinity, oxidative stress and pollution very frequently overlap and their impact is difficult to be described in a distinct form. However, it is undisputed that all of them could significantly change metabolic pathways in mussels. Mussels‘ welfare is of great importance not only because they are essential source of food. These benthic animals are one of the most relevant indicators for alterations in our environment. From the point sources of pollution, to the global warming – all anthropogenic interferences and natural disturbances have an adequate response in these unique aquatic organisms. Therefore, an interdisciplinary research in mussels‘ biochemical machinery is of urgent need.

REFERENCES Albentosa, M., Labarta, U., Pérez-Camacho, A., Fernández-Reiriz, J.M., 1994. Fatty acid composition of Venerupis pullastra spat fed on different microalgae diets. Comp. Biochem. Physiol. 108A, pp. 639–648.

Environmental Impact to Mussels‘ Metabolism

255

Albentosa, M., Fernández-Reiriz, J.M., Labarta, U., Pérez-Camacho, A., 1999. Effect of microalgal and inert diets on the growth performance and biochemical composition of Ruditapes decussatus seed: wheatgerm diets. J. Exp. Mar. Biol. Ecol. 232, pp. 23–37. Al-Mafda, H., M. Abdel-Moati, M., Al-Gimaly, F., 1998. Pinctada radiata (Pearl Oyster): A bioindicator for metal pollution monitoring in the Qatari waters (Arabian Gulf). Bull. Environm. Contam. Toxicol. 60(2), pp. 245-251. Alves de Almeida, E., Celso Dias Bainy, A., Paula de Melo Loureiro, A., Regina Martinez, G., Miyamoto, S., Onuki, J., Fujita Barbosa, L., Carrião Machado Garcia, C., Manso Prado, F., Eliza Ronsein, G., Alexandre Sigolo, C., Barbosa Brochini, C., Maria Gracioso Martins, A., Helena Gennari de Medeiros, M., Di Mascio, P., 2007. Oxidative stress in Perna perna and other bivalves as indicators of environmental stress in the Brazilian marine environment: Antioxidants, lipid peroxidation and DNA damage. Comp. Biochem. Physiol. A 146 (4), pp. 588-600. Amiard, J.-C., Amiard-Triquet, C., Barka, S., Pellerin, J., Rainbow, P.S., 2006. Metallothioneins in aquatic invertebrates: their role in metal detoxification and their use as biomarkers. Aquat. Toxicol. 76, pp. 106–202. Anestis, A., Lazou, A., Pörtner, H.O., Michaelidis, B., 2007. Behavioural, metabolic and molecular stress responses of marine bivalve Mytilus galloprovincialis during long-term acclimation at increasing ambient temperature. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 293, pp. R911–R921. Anestis, A., Pörtner, H.O., Lazou, A., Michaelidis, B., 2008. Metabolic and molecular stress responses of sublittoral bearded horse mussel Modiolus barbatus to warming sea water: Implications for vertical zonation. J. Experim. Biology 211(17), pp. 2889-2898. Anestis, A., Pörtner, H.O., Karagiannis, D., Angelidis, P., Staikou, A., Michaelidis, B., 2010. Response of Mytilus galloprovincialis (L.) to increasing seawater temperature and to marteliosis: Metabolic and physiological parameters. Comp. Biochem. Physiol. – A 156(1), pp. 57-66. Bayne, B.L. Measuring the effects of pollution at the cellular and organism level. In: G. Kullemberg, Editor, The Role of the Oceans as a Waste Disposal Option, Riedel, New York, NY (1986), pp. 617–634. Beliaeff, B. and Burgeot, T., 2002. Integrated biomarker response: a useful tool for ecological risk assessment. Environ. Toxicol. Chem. 21, pp. 1316–1322. Berdyshev, E.V., 1989. Fatty aldehydes of phosphatidylethanolamines of marine invertebrates. Khimiya Prirodnyh Soedinenii (USSR) 5, pp. 621–625 (in Russian). Bergé, J.P. and Barnathan, G., 2005. Fatty acids from lipids of marine organisms: molecular biodiversity, roles as biomarkers, biologically active compounds, and economical aspects. Adv. Biochem. Engin/Biotechnol. 96, pp. 49-125. Berger, V., 1986. Adaptation of marine mollusks to changess in environmental salinity. Nauka, pp. 214 (in russian). Boutet, I., Jollivet, D., Shillito, B., Moraga, D., Tanguy, A., 2009. Molecular identification of differentially regulated genes in the hydrothermal-vent species Bathymodiolus thermophilus and Paralvinella pandorae in response to temperature. BMC Genomics 10, art. no. 222. Broeg, K., Westernhagen, H.V., Zander, S., Körting, W., Koehler, A., 2005. The ―bioeffect assessment index‖ (BAI). A concept for the quantification of effects of marine pollution by an integrated biomarker approach. Mar. Pollut. Bull. 50 (5), pp. 495–503.

256

Jordan T. Nechev

Brosche, T., Brueckmann, M., Haase, K.K., Sieber, C., Bertsch, T., 2007. Decreased plasmalogen concentration as a surrogate marker of oxidative stress in patients presenting with acute coronary syndromes or supraventricular tachycardias. Clinical Chemistry and Laboratory Medicine 45, pp. 689–691. Cadet, J., Berger, M., Douki, T., Ravanat, J.L., 1997. Oxidative damage to DNA: formation, measurement, and biological significance. Rev. Physiol., Biochem. Pharmacol. 131, pp 1–87. Caers, M., Coutteau, P., Sorgeloos, P., 2000. Impact of starvation and of feeding algal and artificial diets on the lipid content and composition of juvenile oysters (Crassostrea gigas) and clams (Tapes phillippinarum). Mar. Biol. 136, pp. 891–899. Cajaraville, M.P., Bebianno, M.J., Blasco, J., Porte, C., Sarasquete, C., Viarengo, A., 2000. The use of biomarkers to assess the impact of pollution in coastal environments of the Iberian Peninsula: a practical approach. Sci. Total Environ. 247, pp. 295–311. Chen, L.Y., Heath, A.G., Neves, R.J., 2001. Comparison of oxygen consumption in freshwater mussels (Unionidae) from different habitats during declining dissolved oxygen concentration. Hydrobiologia 450, pp. 209–214. Cheung, C.C.C., Zheng, G.J., Li, A.M.Y., Richardson, B.J., Lam, P.K.S., 2001. Relationships between tissue concentrations of polycyclic aromatic hydrocarbons and antioxidative responses of marine mussels, Perna viridis. Aquat. Toxicol. 52, pp. 189–203. Chevre, N., Gagne, F., Blaise, C., 2003. Development of a biomarker-based index for assessing the ecotoxic potential of aquatic sites. Biomarkers 8(3–4), pp. 287–298. Contardo-Jara, V., Galanti, L.N., Amé, M.V., Monferrán, M.V., Wunderlin, D.A., Wiegand, C., 2009a. Biotransformation and antioxidant enzymes of Limnoperna fortunei detect site impact in watercourses of Córdoba, Argentina. Ecotoxicology and Environmental Safety 72 (7), pp. 1871-1880. Contardo-Jara, V., Krueger, A., Exner, H.-J., Wiegand, C., 2009b. Biotransformation and antioxidant enzymes of Dreissena polymorpha for detection of site impact in watercourses of Berlin. J. Environ. Monitor. 11 (6), pp. 1147-1156. Crawford, D.L. and Powers, D.A., 1989. Molecular basis of evolutionary adaptation at the lactate dehydrogenase-B locus in the fish Fundulus heteroclitus. Proc. Nat. Acad. Sci USA 86, pp. 9365–9369. Crawford, D.L. and Powers, D.A., 1992. Evolutionary adaptation to different thermal environments via transcriptional regulation. Mol. Biol. Evol. 9, pp. 806–813. Dagnino, A., Allen, J.I., Moore, M.N., Broeg, K., Canesi, L., Viarengo, A., 2007. Development of an expert system for the integration of biomarker responses in mussels into an animal health index. Biomarkers 12(2), pp. 155–172. Davies, M.J., 2005. The oxidative environment and protein damage. Biochim. Biophys. Acta 1703, pp. 93–109. De Luca-Abbott, S.B., Richardson, B.J., McClellan, K.E., Zheng, G.J., Martin, M., Lam, P.K.S., 2005. Field validation of antioxidant enzyme biomarkers in mussels (Perna viridis) and clams (Ruditapes philippinarum) transplanted in Hong Kong coastal waters. Mar. Pollut. Bull. 51, pp. 694–707. Dembitsky, V.M. and Vaskovsky, V.E., 1976. Distribution of plasmalogens in different phospholipid classes of marine invertebrates. Biologiya Morya (Vladivostok)5, pp. 68–72. Dembitsky, V.M., 1979. Plasmalogens in phospholipids of marine invertebrates. Biologiya Morya (Vladivostok) 5, pp. 86–90 (in Russian).

Environmental Impact to Mussels‘ Metabolism

257

Dembitsky, V.M., Kashin, A.G., Stefanov, K., 1992. Comparative investigation of phospholipids and fatty acids of freshwater molluscs from the Volga river basin. Comp. Biochem. Physiol. 102B, pp. 193–198. Dembitsky, V.M., Rezanka, T., Kashin, A.G., 1993a. Fatty acid and phospholipid compositions of freshwater molluscs Anadonta piscinalis and Limnaea fragilis from the river Volga. Comp. Biochem. Physiol. 105B, pp. 597–601. Dembitsky, V.M., Rezanka, T., Kashin, A.G., 1993b. Comparative examination of phospholipids and fatty acids from some Caspian invertebrates. Comp. Biochem. Physiol. 104B, pp. 617–622. De Moreno, J.E.A., Pollero, R.J., Moreno, V.J., Brenner, R.R., 1980. Lipids and fatty acids of the mussel (Mytilus platensis d'Orbigny) from South Atlantic waters. J. Exp. Mar. Biol. Ecol. 48, pp. 263–276. de Vooys, C.G.N. and de Zwaan, A.,1978. The rate of oxygen consumption and ammonia excretion by Mytilus edulis after various periods of exposure to air. Comp. Biochem. Physiol. 60, pp. 343–347. de Vooys, C.G.N., 1980. Anaerobic metabolism in sublittoral living Mytilus galloprovincialis Lam. in the Mediterranean. II. Partial adaptation of pyruvate kinase and phosphoenolpyruvate carboxykinase. Comp. Biochem. Physiol. B 65, pp. 513–518. de Vooys, C.G.N., 1991. Anaerobic metabolism in sublittoral living Mytilus galloprovincialis in the Mediterranean. IV. Role of amino acids in adaptation to low salinities during anaerobiosis and aerobiosis. Comp. Biochem. Physiol. A 100, pp. 423–431. de Zwaan, A., Thompson, R.J., Livingstone, D.R., 1980. Physiological and biochemical aspects of valve snap and valve closure in the giant scallop Plactopecten magellanicus. Biochemistry J. Comp. Physiol. 137, pp. 105–115. Doucet-Beaupré, H., Dubé, C., Breton, S., Pörtner, H.O., Blier, P.U., 2010. Thermal sensitivity of metabolic enzymes in subarctic and temperate freshwater mussels (Bivalvia: Unionoida). Journal of Thermal Biology 35(1), pp. 11-20. Fernández, B., Campillo, J.A., Martínez-Gómez, C., Benedicto, J., 2010a. Antioxidant responses in gills of mussel (Mytilus galloprovincialis) as biomarkers of environmental stress along the Spanish Mediterranean coast. Aquatic Toxicology 99 (2), pp. 186-197. Fernández, B., Albentosa, M., Viñas, L., Franco, A., González, J.J., Campillo, J.A., 2010b. Integrated assessment of water quality of the Costa da Morte (Galicia, NW Spain) by means of mussel chemical, biochemical and physiological parameters. Ecotoxicology 19 (4), pp. 735-750. Fernández-Reiriz, M.J., Labarta, U., Albentosa, M., Pérez-Camacho, A., 1998.Effect of microalgal diet and commercial Wheatgerm flours on the lipid profile of Ruditapes decussatus spat. Comp. Biochem. Physiol. 119B, pp. 369–377. Fernández-Reiriz, M.J., Labarta, U., Albentosa, M., Pérez-Camacho, A., 1999. Lipid profile and growth of the clam spat, Ruditapes decussatus (L), fed with microalgal diets and cornstarch. Comp. Biochem. Physiol. 124B, pp. 309–318. Fernández-Tajes, J., Flórez, F., Pereira, S., Rábade, T., Laffon, B., Méndez, J., 2010. Use of three bivalve species for biomonitoring a polluted estuarine environment. Environmental Monitoring and Assessment, (Article in Press), DOI: 10.1007/s10661-010-1634-x. Fields, P. and Somero, G., 1997. Amino acid sequence differences cannot fully explain interspecific variation in thermal sensitivities of gobiid fish A4-lactate dehydrogenases (A4-LDHs). J. Exp. Biol. 200, pp. 1839–1850.

258

Jordan T. Nechev

Figueras, A.J., Jardon, C.F., Caldas, J.R., 1991. Diseases and parasites of rafted mussels (Mytilus galloprovincialis Lmk): preliminary results. Aquaculture 99, pp. 17–33. Figueras, A.J. and Montes, J. Aber disease of edible oysters caused by Marteilia refringens. In: W.S. Fisher, Editor, Disease Processes in Marine Bivalve Molluscs. American Fisheries Society, Special Publication, USA (1988), pp. 38–46. Fokina, N.N., 2007. Lipid composition of the mussel Mytilus edulis L. from the White Sea. Dissertation. Institut of Biology, Karelian Research Centre, Russian Academy of Sciences, Petrozavodsk, Russian Federation. Fong, P.P. and Molnar, N., 2008. Norfluoxetine induces spawning and parturition in estuarine and freshwater bivalves. Bulletin of Environmental Contamination and Toxicology 81 (6), pp. 535-538. Frias-Espericueta, M., Ortiz-Arellano, M., Osuna-Lopez, J., Ronson-Paulin, J., 1999. Heavy metals in the rock oyster Crassostrea iridescens (Filibranchia: Ostreidae) from Mazatlan, Sinaloa, Mexico. Rev. boil. trop. 47, pp. 843-849. Gabrieldes, G. (Ed.), 1997. The MED POL Biomonitoring Program Concerning the Effects of Pollutants on Marine Organisms Along the Mediterranean Coasts. UNEP (OCA)/MED WG. 132/3. Athens. Gaitanaki, C.I., Kefaloyianni, E., Marmari, A., Beis, I., 2004. Various stressors rapidly activate the p38-MAPK signalling pathway in Mytilus galloprovincialis (Lam.). Mol. Cell. Biol. Biochem. 260, pp. 119–127. Gillis, T.E. and Ballantyne, J.S., 1999. Influences of Subzero Thermal Acclimation on Mitochondrial Membrane Composition of Temperate Zone Marine Bivalve Mollusks. Lipids 34, pp. 59–66. Glémet, H.C. and Ballantyne J.S., 1995. Influences of environmental salinity on the structure and function of gill mitochondrial membranes of an osmoconforming invertebrate. Crassostrea virginica. Marine Biology 121, pp. 673-684. Goldberg, E.D., 1975. The mussel watch: a first step in global marine monitoring. Mar. Pollut. Bull. 6, pp. 111–132. Goldberg, E., 1986. The mussel watch concept. Environ. Monit. Assess. 7, pp. 91–103. Coyle et al., 2002 Coyle, P., Philcox, J.C., Carey, L.C., Rofe, A.M., 2002. Metallothionein: the multipurpose protein. Cell. Mol. Life Sci. 59, pp. 627–647. Gundacker, C., 2000. Comparison of heavy metal bioaccumulation in freshwater mollusks of urban river habitats in Vienna. Environ. Pollut. 110, pp. 61-71. Guderley, H., Demers, A., Couture, P., 1994. Acclimatization of blue mussel (Mytilus edulis Linnaeus, 1758) to intertidal conditions: effects on mortality and gaping during air exposure. J. Shellfish Res. 13, pp. 379–385. Hanuš, L.O., Levitsky, D.O., Shkrob, I., Dembitsky, V.M., 2009. Plasmalogens, fatty acids and alkyl glyceryl ethers of marine and freshwater clams and mussels. Food Chemistry 116 (2), pp. 491-498. Hamer, B., Jakšić, Ţ., Pavičić-Hamer, D., Perić, L., Medaković, D., Ivanković, D., Pavičić, J., Zilberberg, C., Schröder, H.C., Müller, W.E.G., Smodlaka, N., Batel, R., 2008. Effect of hypoosmotic stress by low salinity acclimation of Mediterranean mussels Mytilus galloprovincialis on biological parameters used for pollution assessment. Aquatic Toxicology 89(3), pp. 137-151. Harvell, C.D., Kim, K., Burkholder, J.M., Colwell, R.R., Epstein, P.R., Grimes, D.J., Hofmann, E.E., Lipp, E.K., Osterhaus, A.D.M.E., Overstreet, R.M., Porter, J.W., Smith,

Environmental Impact to Mussels‘ Metabolism

259

G.W., Vasta, G.R., 1999. Emerging marine diseases—climate links and anthropogenic factors. Science 285, pp. 1505–1510. Hanson, J.M., Mackay, W.C., Prepas, E.E., 1988. The effect of water depth and density on the growth of a unionid clam. Freshwater Biol. 19, pp. 345–355. Heltsley, R., Cope, G.W., Bringolf, R., Eads, C., Shea, D., 2006. Prozac Elicits Spawning in Native Freshwater Mussels. Annual meeting. American Chemical Society San Francisco. Hochachka, P.W. and Somero, G.N. Biochemical Adaptation: Mechanism and Process in Physiological Evolution, Oxford University Press, Oxford (2002). Huggett, R.J., Kimerler, R.A., Mehrle, P.M., Bergman, H.L., Dickson, K.L., Fava, J.A., McCarhy, J.F., Parrish, R., Dorn, P.B., McFarland, V., Lahvis, G., 1992. Biomarkers: biochemical, physiological and histological markers of anthropogenic stress. In: R.J. Huggett, R.A. Kimerle, P.M. Mehrle and H.L. Bergman, Editors, Biomarkers, Lewis Publishers, Chelsea (1992). Hylland, K., Tollefsen, K.E., Ruus, A., Jonsson, G., Sundt, R.C., Sanni, S., Utvik, T.I.R., Johnsen, S., Nilssen, I., Pinturier, L., Balk, L., Barsiene, J., Marigomez, I., Feist, S.W., Borseth, J.F., 2008. Water column monitoring near oil installations in the North SEA 2001–2004. Mar. Pollut. Bull. 56, pp. 414–429. International Panel on Climate Change (IPCC, Climate Change) 2007: the physical science basis. In: S.D. Solomon, M. Qin, Z. Manning, M. Chen, K.B. Marquis, M. Averyt and H.L. Tignor, Editors, Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change, Cambridge University Press, Cambridge, United Kingdom (2007) 996 pp. Izagirre, U. and Marigomez, I., 2009. Lysosomal enlargement and lysosomal membrane destabilisation in mussel digestive cells measured by an integrative index. Environ. Pollut. 157, pp. 1544–1553. Jakšić, Ţ., Batel, R., Bihari, N., Mičić, M., Zahn, R.K., 2005. Adriatic coast as a microcosm for global genotoxic marine contamination — a long-term field study. Mar. Pollut. Bull. 50, pp. 1314–1327. Kahle, J. and G. Zauke, 2002. Bioaccumulation of trace metals in the copepod Calanoides acutus from the Weddell Sea (Antarctica): Comparison of two-compartment and hyperbolic toxicokinetic models. Aquatic Toxicol. 59, pp. 115-135. Kashin, A.G., 1997. Impact of environmental salinity on the lipid content of some water invertebrates. Dissertation, Samara, Russia (in russian). Kennedy, V.S., 1976. Desiccation, higher temperatures and upper intertidal limits of three species of sea mussels (Mollusca: Bivalvia) in New Zealand. Mar. Biol. 35, pp. 127–137. Kraffe, E., Soudant, P., Marty, Y., Kervarec, N., Jehan, P., 2002. Evidence of a 621 tetradocosahexaenoic cardiolipin in some marine bivalves. Lipids 37, pp. 507-514. Kraffe, E., Soudant, P., Marty, Y., 2004. Fatty acids of serine, ethanolamine and choline plasmalogens in some marine Bivalves. Lipids 39, pp. 59–66. Kraffe, E., Soudant, P., Marty, Y., 2006. Cis-4, 7, 10, trans-13–22:4 fatty acid distribution in phospholipids of pectinid species Aequipecten opercularis and Pecten maximus. Lipids 41, pp. 491–497. Krishnakumar, P.K., Casillas, E., Varanasi, U., 1997. Cytochemical responses in the digestive tissue of Mytilus edulis complex exposed to microencapsulated PAHs or PCBs. Comp. Biochem. Physiol. C 118, pp. 11–18.

260

Jordan T. Nechev

Labarta, U., Fernández-Reiriz, M.J., Pérez-Camacho, A., 1999. Dynamic of fatty acids in the larval development, metamorphosis and post-metamorphosis of Ostrea edulis (L.). Comp. Biochem. Physiol. 123A, pp. 249–254. Lam, P.K.S. and Gray, J.S., 2003. The use of biomarkers in environmental monitoring programmes. Mar. Pollut. Bull. 46, pp. 182–186. Lang, F., Busch, G.L., Ritter, M., Volkl, H., Waldegger, S., Gulbins, E., Haussinger, D., 1998. Functional significance of cell volume regulatory mechanisms. Phys. Rev. 78, pp. 247–306. Langdon, C.J. and M.J. Waldock, M.J., 1981. The effect of algal and artificial diets on the growth and fatty aci composition of Crassostrea gigas spat. J. Mar. Biol. Assoc. U. K. 61, pp. 441–448. Lesser, M.P., Bailey, M.A., Merselis, D.G., Morrison, J.R., 2010. Physiological response of the blue mussel Mytilus edulis to differences in food and temperature in the Gulf of Maine. Comp. Biochem. Physiol. A, DOI: 10.1016/j.cbpa.2010.04.012. Lewis, J.B., 1984. Comparative respiration in two species of freshwater unionid mussels (Bivalvia). Malacol. Rev. 17, pp. 101–102. Lin, J.J. and Somero, G., 1995. Thermal adaptation of cytoplasmic malate dehydrogenases of eastern Pacific barracuda (Sphyraena spp): the role of differential isoenzyme expression. J. Exp. Biol. 198, pp. 551–560. Livingstone, D.R., 2001. Contaminant-stimulated reactive oxygen species production and oxidative damage in aquatic organisms. Mar. Pollut. Bull. 42, pp. 656–666. Manduzio, H., Rocher, B., Durand, F., Galap, C., Leboulenger, F., 2005. The point about oxidative stress in mollusks. Invertebrate Survival J. 2, pp. 91–104. Milkova, Ts., Popov, S., Marekov, N., Andreev, St., 1980. Sterols from Black Sea invertebrates. I. Sterols from Scyphozoa and Anthozoa (Coelenterata). Comp. Biochem. Physiol. 67B, 633-638. Monserrat et al., 2007 Monserrat, J.M., Martinez, P.E., Geracitano, L.A., Amado, L.L., Martins, C.M., Pinho, G.L., Chaves, I. S., Ferreira-Cravo, M., Ventura-Lima, J., Bianchini, A., 2007. Pollution biomarkers in estuarine animals. Critical review and new perspectives. Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 146, pp. 221–234. Moore, M.N., Allen, J.I., McVeigh, A., 2006. Environmental prognostics: an integrated model supporting lysosomal stress responses as predictive biomarkers of animal health status. Mar. Environ. Res. 61(3), pp. 278–304. Morris, T.J. and Corkum, L.D., 1999. Unionid growth patterns in rivers of differing riparian vegetation. Freshwater Biol. 42, pp. 59–68. Narbonne, J.F., Daubeze, M., Clerandeau, C., Garrigues, P., 1999. Scale of classification based on biochemical markers in mussels: application to pollution monitoring in European coasts. Biomarkers 4, pp. 415–424. Narbonne, J.F., Aarab, N., Clerandeau, C., Daubeze, M., Narbonne, J., Champeau, O., Garrigues, P., 2005. Scale of classification based on biochemical markers in mussels: application to pollution monitoring in Mediterranean coasts and temporal trend. Biomarkers 10, pp. 58–71. Nechev, J.T., Khotimchenko, S.V., Ivanova, A.P., Stefanov, K.L., Dimitrova-Konaklieva, S.D., Andreev, S., Popov, S.S., 2002. Zeitschrift fur Naturforschung – C57 (3-4), pp. 339-343.

Environmental Impact to Mussels‘ Metabolism

261

Nechev, J., Stefanov, K., Popov, S., 2006. Effect of cobalt ions on the lipid and sterol metabolism in the marine invertebrates Mytilus galloprovincialis and Actinia equina. Comp. Biochem. Physiol. A 144, 112–118. Negus, C., 1966. A quantitative study of growth and production of unionid mussels in the River Thames at Reading. Anim. Ecol. 35, pp. 513–532. Ortmann, C. and Grieshaber, M.K., 2003. Energy metabolism and valve closure behaviour in the Asian clam Corbicula fluminea. J. Exp. Biol. 206, pp. 4167–4178. Osada, M., Nishikaea, T., Nomura, T., 1989. Involvement of prostaglandins in the spawning of the scallop, Patinopecten yessoensis. Comp. Biochem. Physiol. 94C, pp. 595–601. Pavičić, J., Raspor, B., Martinčić, D., 1993. Quantitative determination of metallothioneinlike proteins in mussels: methodological approach and field evaluation. Mar. Biol. 115, pp. 435–444. Petrović, S., Ozretić, B., Krajnović-Ozretić, M., Bobinac, D., 2001. Lysosomal membrane stability and metallothioneins in digestive gland of mussels (Mytilus galloprovincialis Lam.) as biomarkers in a field study. Mar. Pollut. Bull. 42, pp. 1373–1378. Petrović, S., Semenčić, L., Ozretić, B., Ozretić, M., 2004. Seasonal variations of physiological and cellular biomarkers and their use in the biomonitoring of north Adriatic coastal waters (Croatia). Mar. Pollut. Bull. 49, pp. 713–720. Pollero, R.J., Re, M.E., Brenner R.R., 1979. Seasonal changes of the lipids of the mollusc Chlamys tehuelcha. Comp. Biochem. Physiol. A 64 (2). рp. 257-263. Pollero, R.J., Brenner, R.R., Gros, E.G., 1981. Seasonal changes in lipid and fatty acid composition of the freshwater mollusk, Diplodom patagonicus. Lipids 16, pp. 109-113. Pörtner, H.O., 2002a. Physiological basis of temperature-dependent biogeography: trade-offs in muscle design and performance in polar ectotherms. J. Exp. Biol. 205, pp. 2217–2230. Pörtner, H.O., 2002b. Climate change and temperature dependent biogeography: systemic to molecular hierarchies of thermal tolerance in animals. Comp. Biochem. Physiol. A 132, pp. 739–761. Pytharopoulou, S., Sazakli, E., Grintzalis, K., Georgiou, C.D., Leotsinidis, M., Kalpaxis, D.L., 2008. Translational responses of Mytilus galloprovincialis to environmental pollution: Integrating the responses to oxidative stress and other biomarker responses into a general stress index. Aquatic Toxicology 89 (1), pp. 18-27. Raftopoulou, E.K and Dimitriadis, V.K., 2010. Assessment of the health status of mussels Mytilus galloprovincialis along Thermaikos Gulf (Northern Greece): An integrative biomarker approach using ecosystem health indices. Ecotoxicology and Environmental Safety, (Article in Press). doi:10.1016/j.ecoenv.2010.06.027. Rainer, S.F., Ivanovici, A.M., Wadley, V.A., 1979. Effect of reduced salinity on adenylate energy charge in three estuarine mollusks. Mar. Biol. 54, pp. 91–99. Richardson, B.J., Mak, E., Luca-Abbott, S.B., Martin, M., McClellan, K., Lam, P.K.S., 2008. Antioxidant responses to polycyclic aromatic hydrocarbons and organochlorine pesticides in green-lipped mussels (Perna viridis): do mussels ―integrate‖ biomarker responses?. Mar. Pollut. Bull. 57, pp. 503–514. Robert, R., Borel, M., Pichot, Y., Trut, G., 1991. Growth and mortality of the European oyster Ostrea edulis in the Bay of Arcachon (France). Aquat. Liv. Resour. 4, pp. 265– 274.

262

Jordan T. Nechev

Sargent, J.R.,1976. The structure, metabolism and function of lipids in marine organisms. In: D.C. Malin and J.R. Sargent, Editors, Biochemical and Biophysical Perspectives in Marine Biology, Academic Press, London (1976), pp. 149–176. Schloesser, D.W., Nalepa, T.F., Mackie, G.L., 1996. Zebra mussel infestation of unionid bivalves (unionidae) in North America. American Zoologist, 36 (3), pp. 300-310. Somero, G.N., Yancey, P.H. Osmolytes and cell volume regulation: Physiological and evolutionary principles. In: J.F. Hoffmann, J.D. Jamieson (eds). Handbook of Physiology, section 14, Cell Physiology. Oxford University Press, New York, 1997, pp 441–484. Soudant, P., Marty, Y., Moal, J., Masski, H., Samain, J.F., 1996. Fatty acids and egg quality in great scallop. Aquacult. Int. 4, pp. 191–200. Soudant, P., Marty, Y., Moal, J., Masski, H., Samain, J.F., 1998. Fatty acid composition of polar lipid classes during larval development of scallop Pecten maximus (L.). Comp. Biochem. Physiol. 121A, pp. 279–288. Stefanov, K., Kimenov, G., Popova, I., Pancheva, T., Metodiev, M., Andreev, St., Popov, S., 1992. Lipid and sterol changes in plants and invertebrates caused by environmental pollution. Bulgarian Chemical Communications 25 (3), 391-399. Stefanov, K., Budevska, B., Ivanov, O., Genov, N., Andreev, S., Popov, S., 1993. Lipid and amino acid changes in the mussel Pseudoanodonta complanata caused by water pollution. Comp. Biochem. Physiol. - C 105 (1), pp. 39-42. Storey, K.B., 1996. Oxidative stress: animal adaptations in nature. Braz. J. Med. Biol. Res. 29, pp. 1715–1733. St-Pierre, J., Charest, P.M., Guderley, H., 1998. Relative contribution of quantitative and qualitative changes in mitochondria to metabolic compensation during seasonal acclimatisation of rainbow trout Oncorhynchus mykiss. J. Exp. Biol. 201, pp. 2961–2970. Tevesz, M.J. and Carter, J.G. Environmental relationships of shell form and structure of Unionacean bivalves. In: D.C. Rhoads and R.A. Lutz, Editors, Skeletal growth of aquatic organisms: biological records of environmental change, Plenum Press, New York (1980), pp. 295–322. Valavanidis, A., Vlahogianni, T., Dassenakis, M., Scoullos, M., 2006. Molecular biomarkers of oxidative stress in aquatic organisms in relation to toxic environmental pollutants. Ecotoxicol. Environ. Saf. 64, pp. 178–189. van der Oost, R., Beyer, J., and Vermeulen, N.P.E., 2003. Fish bioaccumulation and biomarkers in environmental risk assessment: a review. Environ. Toxicol. Pharmacol. 13, pp. 57–149. Van Gestel, C.A.M. and Van Brummelen, T.C., 1996. Incorporation of the biomarker concept in ecotoxicology calls for a redefinition of terms. Ecotoxicology 5, pp. 217–225. Viarengo, A. and Canesi, L., 1991. Mussels as biological indicators of pollution. Aquaculture 94, pp. 225–243. Widdows, J., Bayne, B.L., Livingstone, D.R., Newell, R.I.E., Donkin, P., 1979. Physiological and biochemical responses of bivalve molluscs to exposure to air. Comp. Biochem. Physiol. A 62, pp. 301–308. Winterbourn, C.C., 2008. Reconciling the chemistry and biology of reactive oxygen species. Nat. Chem. Biol. 4, pp. 278–286. Yurchenko, O.V. and Vaschenko, M.A, 2010. Morphology of spermatogenic and accessory cells in the mussel Modiolus kurilensis under environmental pollution. Marine Environmental Research 70 (2), pp. 171-180.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 11

COMBINING STABLE ISOTOPES AND BIOCHEMICAL MARKERS TO ASSESS ORGANIC CONTAMINATION IN TRANSPLANTED MUSSELS MYTILUS GALLOPROVINCIALIS S. Deudero1, A. Box2, A. Sureda3, J. Tintoré4 and S. Tejada2 1

Centro Oceanográfico de Baleares, IEO, Muelle de Poniente s/n, 07015 Palma de Mallorca, Spain 2 Laboratory of Marine Biology. Department of Biology. University of Balearic Islands. Campus Universitari. Ctra. de Valldemossa s/n km. 7.5, 07022 Palma de Mallorca, Balearic Islands, Spain 3 Laboratori de Ciències de l‘Activitat Física, Departament de Biologia Fonamental i Ciències de la Salut, Universitat de les Illes Balears, Ctra. Valldemossa Km 7.5.E-07122-Palma de Mallorca, Illes Balears, Spain 4 IMEDEA (CSIC-UIB) Instituto Mediterráneo de Estudios Avanzados C/ Miquel Marqués, 21. 07190 Esporles, Illes Balears, Spain

ABSTRACT Marine pollution and water quality are evaluated on direct measurements of the abiotic variables and also on bioaccumulation measurements of chemical contaminants in marine organisms. Measuring the same biomarkers in different localities simultaneously gives information about the pollution states and provides a better comprehension of the mechanistic model of action of environmental pollutants on the organisms. The use of biomarkers to evaluate stressful situations is widely extended in bivalves. In the current work, organic compound concentrations (dichlorodiphenyltrichloroethane isomers, 

Corresponding author: [email protected] Tel: +34-971401561 Fax: +34-971404945

264

S. Deudero, A. Box, A. Sureda et al. dioxins, PCBs and PAHs), antioxidant biomarkers (malondialdehyde, catalase, glutathione peroxidase, superoxide dismutase and glutathione reductase) and isotopic composition (15N and 13C) were measured in the digestive gland and gill tissues of the mussel Mytilus galloprovincialis in coastal waters of the Balearic Islands (Western Mediterranean) in order to assess pollution levels in these waters. The highest concentrations of PAHs corresponded to naphthalene, acenaphthylene, fluorene and phenanthrene, with the harbours of Santa Eulàlia and Eïvissa having the highest levels of PAHs. Oxidative stress and biomarkers are used as indicators of pollution exposure, showing that pollution can not evidence exposure effects, while the antioxidant responses can change with time. In the current work, the existence of pollution was indicated by the positive correlation between the concentrations of the lighter PCBs in the digestive gland of the mussels and catalase and glutathione reductase enzyme activities. Gills showed a correlation between the lighter PCBs and superoxide dismutase activity, indicating the bioaccumulation of these organic compounds. Carbon and nitrogen isotopic signatures showed a clear trend for differences in tissue distribution among the studied localities, with the digestive gland being more enriched in carbon and nitrogen than the gills. PCA for biomarkers also showed that tissues responded differently at sampling stations. The presence of pollutants could be the responsible for the changes described in the isotopic composition and in the antioxidant defences of the mussel M. galloprovincialis in waters of the Balearic Islands. The correlations between organic pollutants and the isotopic composition and biomarkers in M. galloprovincialis suggest that these measures could represent a good proxy for evaluation of contamination, additional to the chemical characterisation.

Keywords: caging marine mussels; stable isotopes; biomarkers; organic pollution; PCBs; PAHs.

INTRODUCTION Marine pollution evaluation is based on direct measurements of the abiotic variable and also on bioaccumulation measurements of chemical contaminants in marine organisms (Chapman, 2007; Cope et al., 1996). Measurement of bioaccumulation is a proper approach for water quality assessment due to the biomagnification of pollutant concentrations in organisms (Langston and Spence, 1995; Mertens et al., 2005). The use of bivalves, mainly mussels, as a sentinel organism to detect pollutant concentrations is widespread (Box et al., 2007; De Luca-Abbott et al., 2005; Deudero et al., 2007a; Deudero et al., 2007b; Santovito et al., 2005) due to their capacity to accumulate organic and inorganic pollutants to a degree suitable for measurement (Catsiki and Florou, 2006), their low decontamination kinetics (Wang and Wang, 2006), easy collection (Cevik et al., 2008) and their dimensions, which provide the necessary tissue quantity for chemical analysis (Angelo et al., 2007). Mytilus galloprovincialis is an ideal sentinel organism in the Mediterranean because it is widespread throughout the basin (Andral et al., 2004; Kopp et al., 2005), it has a great capacity to filter the water column and it accumulates a wide range of pollutants in its tissues (Angelo et al., 2007). Caged M. galloprovincialis individuals, with the same origin and age, have been used to assess water quality (Andral et al., 2004; Romeo et al., 2003a; Romeo et al., 2003b),

Combining Stable Isotopes and Biochemical Markers…

265

avoiding genetic shifts between populations, without acclimation or genetic selection processes, and making it possible to control the source and the age of the samples. Organochlorine pollutants are synthetic lipophilic chemicals that were introduced globally to the environment from the 1950s (Niedan et al., 2003; Voldner and Li, 1995) and have accumulated in organisms‘ tissues due to their extremely stability and their resistance to degradation (Jan et al., 1998). Little information is available concerning the contamination levels of trace organics such as polychlorinated biphenyls (PCBs), polycyclic aromatic hydrocarbons (PAHs) and pesticides in marine biota from the oligotrophic waters of the Western Mediterranean (Deudero et al., 2007a), although they have been extensively used for decades in a wide range of agricultural (DDTs, BHC) and industrial applications (PCBs) (Niedan et al., 2003; Tacon et al., 1995). Their production and use have been decreased worldwide since the 1970s, and in most cases they are now totally banned, but substantial amounts remain in the ecosystem and are still being recycled by organisms, particularly marine organisms (Shahidul Islam and Tanaka, 2004). Previous studies have reported the biomagnification of contaminants into food webs by relating the contaminant concentrations to stable nitrogen isotope values (Riget et al., 2007). The use of stable isotope ratios of carbon, nitrogen and sulphur has been reported for tracing the organic material derived from sewage, showing that this material reaches the sea floor and enters the benthic food web (Van Dover et al., 1992). Indeed, all parameters that affect metabolism may affect isotopic processes directly linked to physiological processes (Walker et al., 1999), as the organisms assimilate stable isotopes through their food (McCue, 2008; Pinnegar and Polunin, 1999). The use of stable isotopes could be an effective approach for studying the effects of pollutants on food web dynamics (Fisher et al., 2001b; Watanabe et al., 2008). Carbon isotopic signatures could be useful for evaluating the primary food sources (e.g. macroalgae, seagrasses and phytoplankton) in marine systems and tracing food webs (Fry and Sherr, 1984; Lorrain et al., 2002), whereas nitrogen isotopic signatures allow the trophic level in aquatic food webs to be determined (Badalamenti et al., 2008; Post, 2002; Vander Zanden et al., 1997). Classically, marine and coastal production assessment has been performed via chemical analyses in order to determine the contaminant levels in waters. In addition to these chemical analyses and to isotopic studies, the use of different biomarkers has been more recently introduced in order to evaluate the effects of pollutants on organisms and to monitor coastal pollution (Orbea et al., 2006; Solé et al., 2000). Contaminants are usually complex mixtures that cause effects in the organisms that are difficult to evaluate by means of chemical analyses. For this reason, biomarkers allow an additional measure of the effects of pollutant exposure in the marine environment, as they try to counteract the reactive species produced by the toxicity of the contaminants. Different biomarkers can be used, but it is recommended to use a battery of biomarkers coupled with chemical analysis to gain a better understanding of the physiological responses to the pollution (Box et al., 2007; Solé et al., 2000). The main used biomarkers are those related with oxidative stress and reactive oxygen species detoxification (Livingstone, 2001; Sureda et al., 2006; Tsangaris et al., 2010). Cellular oxidative metabolism is a continuous source of reactive oxygen species (ROS), resulting from univalent reduction of O2, which can damage most cellular components. Cells contain a complex network of antioxidant defense that scavenge or prevent the generation of ROS, and repair or remove the damaged molecules (Elias et al., 1999). The antioxidant system involves

S. Deudero, A. Box, A. Sureda et al.

266

enzymes such as catalase (CAT), glutathione reductase (GR), glutathione peroxidase (GPx) and superoxide dismutase (SOD) that acts by detoxifying the ROS generated. It is well established that pollutants such as various pesticides (Sayeed et al., 2003) and metals (Almeida et al., 2002) increases the ROS production rate stimulating the protective mechanisms against ROS. The aims of this study were 1) to evaluate the pollution level of organic pollutants in the filtering bivalve Mytilus galloprovincialis around the Balearic Islands, 2) to compare levels of organic pollutants with those of stable isotope ratios and biomarker levels, 3) to evaluate the potential use of these techniques as complementary methodologies to classical chemical determinations and 4) to assess the effects of different pollutants on this marine mussel.

2. MATERIAL AND METHODS 2.1. Sampling Design The analysed mussels were harvested in the Sete region (South East France) under pristine conditions and were maintained in the Thau lagoon (France) for one week before transplantation. The batch was composed of caged mussels of the same genetic origin, age (18–24 months) and shell length (50 mm). During March 2005, Mytilus galloprovincialis were actively transplanted following the mooring methodology previously described (Andral et al., 2004). At each station, two mooring devices were deployed over depths ranging from 20 to 35 meters around the Balearic Islands. Each mooring device included of a rope with a sampling bag containing the M. galloprovincialis hanging on the rope at a constant depth of 6 metres from the sea surface. The use of these devices and election of sampling stations was estimated to cover the full area of the Balearic Island. The immersion period after transplantation was 3 months, allowing the adaptation of the mussels to the new environmental conditions (oligotrophic waters) and a response in the isotopic composition of their tissues (Holmer et al., 2007).

2.2. Sampling Location Eight sampling stations were selected surrounding the Balearic Islands based on a gradient of anthropogenic load and degree of human impact, as described elsewhere (Box et al., 2007; Deudero et al., 2009). The protected marine area of Santa Maria Bay (Cabrera) was selected as a pristine area; areas subject to human impact were sites in the vicinity of the harbours of Palma de Mallorca (Mallorca), Eïvissa (Eïvissa) and Ciutadella (Menorca); other locations with different degrees of human impact were Santa Eulàlia (Eïvissa), Cala d‘Or, Alcúdia (Mallorca), and Cala Trebelutja (Menorca) (Figure 1).

Combining Stable Isotopes and Biochemical Markers…

267

Figure 1. Eight sampling locations distributed in the Balearic Sea. The mussels Mytilus galloprovincialis were sampled by experienced scuba diving in March 2005.

2.3. Sample Collection and Processing Mussels Mytilus galloprovincialis were collected by experienced scuba divers and immediately brought on board. The same time period collection was established to avoid differences with season and/or temperature. After collection, mussels were cleaned of epiphytes and immediately frozen at –20 ºC until tissue extraction for chemical and isotopic analyses. M. galloprovincialis (n = 45; three samples for each location) were pre-processed according to standard procedures (Andral et al., 2004). Fresh and dry weight measurements of the whole organism and shell were performed for each mussel. Mussels were opened and flesh was scraped out of the shell with a stainless steel scalpel. Shells were dried at 60 ºC for 48 h before obtaining the dry weight. Flesh was weighed after freeze-drying.

2.4. Chemical Contaminant Determination Mussels used for pollutant determinations were analysed for the following compounds: dichlorodiphenyltrichloroethane isomers (p,p‘-DDE, p,p‘-DDD, p,p‘-DDT); dioxins; ten individual polychlorinated biphenyl (PCBs) congeners: (IUPAC#, 28, 31, 52, 101, 105, 118,

268

S. Deudero, A. Box, A. Sureda et al.

138, 153, 156 and 180); and the polycyclic aromatic hydrocarbons (PAHs) naphthalene, acenaphthylene, acenaphthene, fluorene, phenanthrene, anthracene, fluoranthene, pyrene, benzoanthracene, chrysene, benzo fluoranthene, and benzo pyrene. The chemical contaminants in the soft tissues of each mussel were analysed. DDT, DDD, DDE and PCBs were determined as follows: 5 g of freeze-dried sample was extracted by Pressurised Liquid Extraction, and then cleaned with sulphuric acid. Analyses were performed by gas phase capillary chromatography combined with an electron-capture detector (Luçon and Michel, 1986). PAHs were separated and quantified by means of High Performance Liquid Chromatography (HPLC) using a methanol–water gradient as the mobile phase and a fluorescence detector with programmable wavelength (Michel, 1983). Results are expressed in ng or µg of contaminant per gram of dry mussel flesh.

2.5. Stable Isotope Analyses Each mussel (n = 3 individuals per location) was dissected in order to separate the digestive gland and gills. All tissue samples were dried at 60 ºC for 24 hours and then were grounded to a fine powder using a mortar and pestle. Homogeneous dried powder (2 mg  0.1) from each tissue was placed in cadmium tin cups and then combusted for 15N and 13C stable isotope composition by continuous flow isotope ratio mass spectrometry (CF-IRMS) using a THERMO DELTA X-PLUS mass spectrometer. Two samples of an internal reference material were analysed after every eighth sample in order to recalibrate the system and compensate for drift over time. The reference material used for carbon and nitrogen stable isotope analysis was Bovine Liver Standard (1577b) (U.S. Department of Commerce, National Institute of Standards and Technology, Gaithersburg, MD 20899), respectively. The analytical precision was based on the standard deviations of internal standard replicates; these deviations were 0.10 ‰ and 0.09 ‰ for the BLS (Bovine Liver Standard) for δ13C and δ15N. Stable isotope abundances were measured by comparing the ratio of the most abundant isotopes (13C:12C and 15N:14N) in the sample with the international isotopic standards. Carbon and nitrogen stable isotopic ratios are expressed in  notation as parts per thousand (‰) deviations from the standards according to the following equation: δX = [(R sample/R reference)-1] x 103 where X is 13C or 15N and R is the corresponding 13C/ 12C or 15N/ 14N ratio.

2.6. Biomarker Analysis Eight mussels per station were dissected to separate the digestive gland and gills, and these tissues were homogenised in ten volumes of 100 mM Tris-HCl buffer pH 7.5. Homogenates were sonicated (2–3 s) and centrifuged at 9000 g at 4 ºC for 15 min (Manduzio et al., 2004). Supernatants, stored at –80ºC to avoid enzymatic degradation, were used for the enzymatic activities and malondialdehyde (MDA) determination, as a marker of lipid peroxiadtion. Catalase (CAT), glutathione peroxidase (GPx), superoxide dismutase (SOD)

Combining Stable Isotopes and Biochemical Markers…

269

and glutathione reductase (GR) antioxidant enzyme activities as well as MDA assay were determined with a Shimadzu UV-2100 spectrophotometer at 20 ºC. All performed assays were conducted in duplicate. Results were referred to the protein content of each sample (Biorad Protein Assay) using bovine albumin as the standard. CAT was measured following the method of Aebi (Aebi, 1984) based on the decomposition of H2O2. GPx was determined using an adaptation of the method of Flohé and Gunzler (Flohe and Gunzler, 1984) and GR was measured following an adaptation of Golberg and Spooner‘s method (Goldberg and Spooner, 1984). SOD was evaluated following the method described by McCord and Fridovich (McCord and Fridovich, 1969). The xanthine/xanthine oxidase system was used to generate the superoxide anion (O2-), which produced the reduction of cytochrome C. The SOD of the sample removed the O2- and inhibited the cytochrome C reduction. This cytochrome C was monitored at 550 nm. MDA, as a marker of lipid peroxidation, was analysed by a colorimetric assay kit (Calbiochem, San Diego, CA, USA) following the manufacturer‘s instructions.

2.7. Statistical Analysis Principal component analysis (PCA) was used to examine the relations among the organochlorines and PCB congener patterns and the isotopic content in the mussels for the studied locations. PCA also allowed the relationship between the contaminant patterns and the analysed biomarkers in the Mytilus galloprovincialis from the eight studied areas to be established. PCB congeners included in PCA were (IUPAC#) 28, 31, 52, 101, 105, 118, 138, 153, 156 and 180. In these analyses, PCB congeners were normalised by log (X + 1) to minimise the influence of the concentration-dependent information on the principal components axis. The correlation between chemical organic concentrations, biochemical markers and stable isotopes in each mussel was assessed with the Pearson correlation coefficient (Rho). The significance of the Rho statistic was assessed with a t-test and p<0.05 was considered significant. PCB concentrations under the detection limit were not included in the correlation. Statistical computations were carried out using the statistical packages PRIMER 6.0 (for the principal component analysis) and SPSS (v. 15.0 for Windows) (for the Spearman correlations) software. Some PCBs, DDT compounds, and dioxins were not analysed for Spearman correlations between chemical contaminants and biochemical responses of the mussels, since their concentrations were mainly under the detection limit. They were not included in the PCA representations for the same reason.

3. RESULTS 3.1. Mussel Organic Compound Concentrations The concentrations of the PCB congeners and PAH pollutants (expressed as µg kg-1 of dry mussel flesh) in the mussel Mytilus galloprovincialis at the eight different sampling stations (see Figure 1) are listed in Table 1.

270

S. Deudero, A. Box, A. Sureda et al.

Naphthalene, acenaphtene, fluorene and phenanthrene were the PAHs with the highest concentration. DDT compounds and dioxins were not included as their concentrations were under the detection limit.

Figure 2. Results of principal component analysis (PCA) showing mean scores of carbon and nitrogen (A) and the biomarkers (B) for the digestive gland and gill tissues of the mussel Mytilus galloprovincialis from eight different localities in the Balearic Islands. Values in brackets represent the percentage of variance explained by the PCA. Symbols: filled triangles symbolize digestive gland and open circles symbolize gills. MDA: Malondialdehyde, GPx: Glutathione peroxidase, GR: Glutathione reductase, CAT: Catalase, SOD: Superoxide dismutase.

Table 1. Mean concentration (µg kg-1 of dry weight) of PCBs and PAHs contaminants in the mussel Mytilus galloprovincialis from different localities of the Balearic Islands sampled during March of 2005.
CB 31

CB 52

CB 101

CB 105

CB118

CB138

CB153 CB156

CB180

Alcúdia

CB 28






1.40













1,20









Ciutadella 1.10










Eïvissa Palma Harbour Santa Eulàlia Cala Trebelutja

















1.70

4.00



1.70











1.50









PAHs

Naphtalene Acenaphtylene Acenaphtene

Fluorene

Phenanthrene

Anthracene Fluoranthene

Pyrene

Benzoanthracene

Chrysene

Alcúdia 7.00 Santa 13.00 Maria Cala d'Or 8.80



5.10

2.20






Benzo Benzo fluoranthene pyrene

2.90

6.50

3.00









1.30

6.60

3.60


1.10

1.20





Ciutadella 14.50


2.10

8.70

4.70


1.70

1.50





Eïvissa Palma Harbour Santa Eulàlia Cala Trebelutja

17.00



10.00

4.10


2.40

1.90

1.10

1.90

1.40


7.60


2.10

6.20

3.30


1.40

1.30





4.90


1.60

10.00

6.00


6.00

4.90

2.60

7.10

2.50

1.40

1.70


1.20

6.40

4.10


1.80

1.60





S. Deudero, A. Box, A. Sureda et al.

272

3.2. Antioxidant Biomarkers Table 2 shows biomarker activities in both studied tissues (digestive gland and gills) and between different locations (the ones considered as polluted areas: Palma Harbour, Eïvissa, Ciutadella and Alcúdia; and the ones considered as cleaned areas: Santa Maria, Cala d‘Or, Santa Eulàlia and Cala Trebelutja). Data represent the activity percentage considering the cleaned station Cabrera being the 100%. Significant differences (p<0.05) were found for catalase (CAT) and glutathione reductase (GR) activities between the different stations in both digestive gland and gills. Higher enzyme activities were determined in the locations with higher anthropogenic activities. Superoxide dismutase (SOD) activity was significantly higher in polluted stations when compared with cleaned stations, only in digestive gland. Glutathione peroxidase (GPx) activity showed significant higher activity only in Eïvissa harbour in gills tissue. Malondialdehide (MDA) concentration did not show significant differences between different locations (data not shown). Table 2. Antioxidant enzyme activities in digestive gland and gills of Mytilus galloprovincialis. Catalase (CAT), glutathione reductase (GR), Glutathione peroxidase (GPx) and superoxide dismutase (SOD) activities were determined in all the studied stations of the Balearic Islands in mussels sampled during March of 2005. Data represent the activity percentage considering the cleaned station Cabrera being the 100%.One-way ANOVA was used. Different letters indicate significant differences between stations, p<0.05. Values represent mean±S.E.M Activities

Digestive gland CAT GR

GPx

SOD

Alcúdia

295 ± 49

240 ± 33

121 ± 14

142 ± 13

Santa Maria

100 ± 7 a

100 ± 4 a

100 ± 16

100 ± 7 a

Cala d'Or

127 ± 22 a

126 ± 11 a

94 ± 11.1

98 ± 8.9 a

Ciutadella

235 ± 48

196 ± 18

135 ± 18

147 ± 15

Eïvissa

243 ± 42

203 ± 37

113 ± 13

163 ± 21

Palma Harbour

220 ± 56

219 ± 24

109 ± 12

135 ± 13

96.1 ± 4.4 a 102 ± 12

103 ± 6 a

Santa Eulàlia 109 ± 9 a Cala Trebelutja

97.2 ± 8.4 a 102 ± 5 a

92.8 ± 10.9 99.2 ± 5.8 a

Gills CAT 191 ± 18 c 100 ± 8a 106 ± 15 a 186 ± 21 c 203 ± 24 c 146 ± 16 b,c 108 ± 19 a 127 ± 17 a,b

GR 185 ± 20 100 ±8 a 109 ± 10 a 156 ± 16 173 ± 19 181 ± 32 98.8 ± 7.8 a 104 ± 7a

GPx 121 ± 8 100 ± 10 103 ± 15 112 ± 11 154 ± 24 a 109 ± 6 105 ± 11 109 ± 10

SOD 148 ±7 100 ±10 102 ± 14 146 ± 16 163 ± 20 137 ± 13 98.3 ± 9.8 109 ±9

3.3. Isotopic Composition and Antioxidant Defence System The resulting 2-D principal component analysis (PCA) showed a different trend of distribution in tissue distribution among the studied localities for carbon and nitrogen isotopic signatures (Figure 2A) and for biomarkers (Figure 2B). Taking into account the isotopic

Combining Stable Isotopes and Biochemical Markers…

273

signatures (Figure 2A), the first principal component, with an eigenvalue of 1.84, explained 92% of the variance with the first axis (PC1), whereas the second principal component (PC2) explained 8%, and thus PC1 and PC2 accounted for 100% of the total variance. The results show a different distribution between the digestive gland and gills, the former being more enriched in carbon and nitrogen, while the gills are distant from the eigenvalues. The PCA for biomarkers (Figure 2B) also showed a differential distribution in the tissues at the different sampling stations. The eigenvalues were larger than 3 for the first principal component (PC1) and higher than 0.6 for the second one (PC2), and both accounted for 86.1% of the variance (73.7% and 12.4%, respectively).

3.4. Isotopic Composition of the Mussels and Organic Compounds The PCA revealed the occurrence of regional differences in the relative contribution of the various PCB congeners to the total PCB load (Figure 3A). The first two principal components (PC1 and PC2) encompassed eigenvalues larger than 1.3 and accounted for 82% of the variance (49.2%, 32.8% respectively). Cala d‘Or and Cala Trebelutja had the highest levels of pollution as CB31 was accumulated in these zones. Similarly, Ciutadella and Santa Eulàlia had the highest levels of CB28, these being two of the lighter PCBs. On the other hand, Palma had high levels of two heavy PCBs (CB138 and CB153), while Eïvissa and Santa Maria Bay showed a spatial distribution far away from PCBs. In terms of the organic compounds, the PCA revealed the relative contribution of the different organochlorines (Figure 3B). The two principal components (PC1 and PC2) had eigenvalues larger than 1 and accounted for 81.5% of the variance (68.6% and 12.9%, respectively). The present results showed that Eïvissa was the station most impacted by PAHs, mainly by benzopyrene, while the other localities did not show any pollution by these pollutants.

3.4.1. Correlations with the Biomarkers The Pearson‘s correlation (Table 3) indicated that PCBs and PAHs were not correlated with MDA, a marker of lipid peroxidation, in either the digestive gland or gill tissues of the mussel Mytilus galloprovincialis. However, with regard to PCBs, a high correlation was found with the congener compounds CB31, CB138 and CB153 with significant positive coefficients when they were correlated with the CAT and the GR activities in both tissues. Significant coefficients appeared when these contaminants (CB31 and CB138) were correlated with SOD in gills, but not in the digestive gland. In terms of the organic compounds (Table 3), MDA did not show any correlation with the PAHs, either in the digestive gland or in gills. Similarly, GPx and SOD enzyme activities were not significantly correlated with the organic compounds in any tissue of the mussel, except for naphtalene and benzo pyrene that were correlated with gills. In contrast, several significant negative coefficients appeared when the PAHs were correlated with the GR activity, although these responses were basically presented in the digestive gland of the mussel. CAT activity was correlated with the naphthalene and acenaphthene compounds in both the digestive gland and gills of M. galloprovincialis.

274

S. Deudero, A. Box, A. Sureda et al.

Figure 3. Results of the principal component analysis showing mean scores of PCBs (A) and organochlorine compounds (B) for the mussel Mytilus galloprovincialis from the different studied localities. Values in brackets represent the percentage variance explained by the PCA.

3.4.2. Correlations with Carbon and Nitrogen Stable Isotopes Significant coefficients were found when PCBs were compared to the 13C and 15N mussel signatures (Table 3).

Table 3. Summary of Spearman rank correlation () and significant level for the different PCBs and PAHs and biochemical responses in both digestive gland (DG) and gills of the mussel Mytilus galloprovincialis. Differences were considered statistically significant when p<0.05. * indicates p<0.05, ** indicates p<0.01 and *** indicates p<0.001. n.c.= not calculated PCBs

CAT DG

Gills

CB31

0.282*

CB138 CB153 PAHS

Gills

GPx DG

Gills

-0.359** 0.304*

-0.316*

-0.126

-0.166

0.269* 0.089 CAT DG 0.271* n.c. 0.320**

0.370 0.163

0.441*** 0.024 0.278* -0.023 GPx Gills DG 0.198 0.197 n.c. n.c.

0.114 0.002

Gills 0.277* n.c.

0.593*** 0.347** GR DG 0.143 n.c.

-0.262*

-0.292*

-0.211

-0.226

-0.098

Fluorene

0.060

-0.017

-0.242

-0.087

0.142

0.010

0.042

Phenanthrene

-0.146

-0.225

-0.035

-0.070

-0.065 -0.148

Anthracene

n.c.

n.c.

-0.258* 0.421*** n.c. n.c.

n.c.

n.c.

n.c.

Fluoranthene

-0.137

-0.190

-0.311*

-0.205

-0.004

-0.088

-0.069 -0.184

Pyrene

-0.159

-0.211

-0.324**

-0.221

-0.024

-0.095

-0.082 -0.203

Benzoanthracene -0.148

-0.181

-0.282*

-0.201

0.010

-0.090

-0.079 -0.210

Chrysene

-0.171

-0.199

-0.295*

-0.216

-0.016

-0.095

-0.093 -0.222

Benzo fluoranthene

-0.096

-0.139

-0.249*

-0.166

0.063

-0.077

-0.048 -0.180

Benzo pyrene

-0.232

-0.246*

-0.323**

-0.252*

-0.088

-0.106

-0.131 -0.250*

Naphtalene Acenaphtylene Acenaphtene

GR DG

Gills 0.149 n.c.

SOD DG

MDA Gills DG -0.106 0.396*** 0.170 0.093 0.342** 0.206 0.016 0.183 0.111 SOD MDA DG Gills DG 0.133 0.312* 0.120 n.c. n.c. n.c. -0.167 -0.132 0.191 0.021

n.c.

0.040 0.051 n.c. 0.045 0.054 0.066 0.077 0.043 0.105

Gills

15N DG

Gills

0.389***

0.084

-0.189

0.060

0.308* 0.229 Gills -0.206 n.c.

0.754*** 0.682*** 15N DG -0.484*** n.c.

0.642*** 0.401***

Gills 0.056 n.c.

0.321** 0.203 13C DG 0.508*** n.c.

0.095

-0.065

0.327**

0.244

0.085

0.032

-0.085

0.512***

-0.494*** -0.618***

0.093

-0.362**

-0.301*

-0.297*

-0.313***

n.c.

n.c. 0.401*** 0.412***

n.c. 0.399***

n.c.

n.c.

-0.059

-0.237

-0.382**

-0.051

-0.227

-0.027

-0.297*

0.007

-0.252*

-0.101

-0.387**

0.106

-0.116

Gills 0.171 0.153 0.146

0.028 0.041 0.016 0.001 0.047 0.042

13C DG

-0.367** -0.386** -0.320** 0.429***

0.454*** 0.416*** 0.527*** -0.249*

Gills -0.576*** n.c.

276

S. Deudero, A. Box, A. Sureda, J. Tintoré et al.

These coefficients were positively correlated when the lighter PCBs were included in the analysis in both tissues of the mussel. In contrast, the heavier compounds were negatively correlated with carbon and nitrogen in the mussel tissues. Regarding the PAHs, significant negative coefficients appeared with the carbon in both digestive gland and gills of the mussel Mytilus galloprovincialis (Table 3). However, these correlations differed between the two tissues for naphthalene, acenaphthene, fluorene and phenanthrene compounds. In addition, there were significant negative coefficients for the 15N (Table 3) in both tissues of the mussel when compared to the naphtalene, fluorene and phenanthrene compounds. In the gills, nitrogen was correlated with benzoanthracene, chrysene and benzo fluoranthene with negative coefficients.

DISCUSSION Nowadays, the presence of pollutants in aquatic environments is an increasing problem and scientific approaches are being developed to control and assess levels of pollution in sentinel organisms (Andral et al., 2004). In fact, aquatic pollution control has been identified as an immediate need for sustained management and conservation of aquatic resources (Islam et al., 2004). The data available on organic concentrations in the waters of this area are quite scarce. The current work adds valuable data on the pollution concentrations in the Balearic Islands using caged Mytilus galloprovincialis, and these values are compared to stable isotope and biomarkers results as a reflection of the trophic contribution and the physiological responses resulting from pollution levels in order to understand the effects of pollutants on the organisms. The digestive gland and gills of the mussel Mytilus galloprovincialis were used to evaluate their isotopic composition and the antioxidant defence system in the presence of organic pollutants. The levels of PCB congeners from caged mussels in the Balearic coastal waters in the present study were lower than values previously recorded from Mallorca and Menorca (Deudero et al., 2007a). However, although levels of CB138 and CB153 were lower than previously reported values (Deudero et al., 2007a), they were still present at remarkable concentrations. The main sources of PCB inputs into the marine environment are related to atmospheric deposition, landfill leakages, incinerator emissions and harbour industries (Corsi et al., 2002; Green and Knutzen, 2003). Palma harbour is used for a significant amount of navigational and commercial activity, more than other harbours of the Balearic Islands (Triay Llopis, 2007). CB138 also presented high levels in Alcúdia Bay, probably due to the influence of residues from high agricultural activity moving through the wetlands of the Albufera. The use of DDT in the aquatic environment is still relevant, despite its ban, due to the massive use in the past around the world by the agricultural industry (Solé et al., 2000). DDTs were detected in previous studies in the Balearic Islands (Deudero et al., 2007a). In the present study, their level was under the detection limit at the eight studied stations, confirming that their use is being restricted. The most abundant organic pollutants found in caged Mytilus galloprovincialis were PAHs, especially naphthalene and fluorene, indicating that, nowadays, the bioaccumulation of

Combining Stable Isotopes and Biochemical Markers…

277

organic pollutants such as PAHs is important (Solé et al., 2000). Palma harbour, which had the most maritime traffic, was not the most PAH-polluted station; Santa Eulàlia bay and Eïvissa harbour were more affected by PAHs. This impact could be related to recreational maritime activities in these two areas, especially during the summer. The general trend observed at the eight studied stations was of low organic pollutant concentrations compared to other published data from different locations (Deudero et al., 2007b). In the current study, differences in the presence of contaminants along the locations were observed. It is remarkable that the stations with the highest PCB levels were not the same stations with the highest PAH levels; this difference could indicate the spatial variability of the contaminants. The characteristics of organic pollutants and their persistence in the environment lead to their bioaccumulation in fatty tissues. In marine organisms, uptake of these compounds occurs directly from the sea through the food chain (Perugini et al., 2004). Frequently, more than one specific pollutant is present in the sea and contaminant mixtures are evaluated (Box et al., 2007). To obtain an integrated pollution measure, new methodologies are being developed such as stable isotopes (Gustafson et al., 2007) and antioxidant status determination (Box et al., 2007; Orbea et al., 2006; Solé et al., 2000: Sureda et al. 2006, 2008). In the present study, isotopic composition and the antioxidant defence system were evaluated in the digestive gland and gills of the mussel Mytilus galloprovincialis and related to the organic pollutant concentrations. Due to the low organic pollutant levels found and differences in the pollutant concentrations among localities, it was difficult draw clear conclusions regarding the response of the isotopic values and antioxidant defence system to pollutant concentrations. However, the present work still shows important connexions between the isotopic signatures and pollutants in the tissues of M. galloprovincialis. Organisms assimilate carbon and nitrogen isotopic ratios in tissues from their food sources (Pinnegar and Polunin, 1999). Consequently, isotopic ratios are mostly used to study food webs, mainly using stable carbon and nitrogen isotopes (Fisher et al., 2001a; Lorrain et al., 2002; Pinnegar and Polunin, 2000). Stable isotopes can be also used to assess water quality (Gustafson et al., 2007), since they can indicate nutrient pollution in marine organisms (Costanzo et al., 2005; Fry, 2000; Jones and Jenkyns, 2001). It is important to take into account that parameters affected by the metabolism could affect fractionation processes in the different tissues of an organism. In fact, several studies have reported different fractionation patterns in several organisms (Pinnegar and Polunin, 2000; Gaston and Suthers, 2004; Sweeting et al., 2007), including the mussel Mytilus galloprovincialis, which showed significant differences in the isotopic composition of the digestive gland and gills (Deudero et al., 2008). Moreover, M. galloprovincialis has also exhibited differences related to 13C and 15 N isotopic composition between sampling stations with different contamination levels (Rogers, 2003), although this was in relation to eutrophication pollution. The present study also indicates differences in the isotopic composition of the analysed tissues (digestive gland and gills) of M. galloprovincialis between sampling stations, due to a different organic pollution degree. In a recent study on macroinvertebrates, stable isotopes were used as a new approach to knowledge about pollutants (Watanabe et al., 2008), confirming the potential value of this technique for assessing water quality. In the present study, significant correlations were found between pollutants and stable isotopes for both 13C and 15N in the digestive gland and gills, particularly for PCBs and PAHs. Moreover, Santa Eulàlia station was spatially correlated with the high amount of carbon and nitrogen, respectively, as

278

S. Deudero, A. Box, A. Sureda et al.

corroborated by the higher pollutant levels at this localities. This trend is not clear for Eïvissa, which also presented important amounts of organics pollutants, but not presented highest 13C and 15N. Despite the present results seems relevant for the stable isotopes and the correlations obtained (indicating interference in the trophic position of the organisms), the interpretation of the stable isotope signatures alone should be considered with caution (Fisk et al., 2002) and if it is possible it should include pollutants levels. Organic carbon content has been identified as a more appropriate compound for modelling accumulation of PCBs in phytoplankton, indicating that drastic changes in species composition can occur in polluted areas (Skoglund and Swackhamer, 2008), which could also be the case in our study area. In addition, spatial variation in the isotopic signal of fish tissues between contaminated and noncontaminated zones in the present study has previously been found (Gaston and Suthers, 2004). Antioxidant enzymes and markers of lipid peroxidation have been proposed as early indicators of the exposure to pollutants (Box et al., 2007; Solé et al., 2000), following this approach, biomarkers were applied in the current work. When attention was focused on spatial variability, the tissue distribution of biomarker activities was different, with Eïvissa (CAT, GPx and SOD), Trebelutja (SOD) and Alcúdia (GR) being the stations with the highest levels of antioxidant enzyme activity. In fact, several studies have used different biomarkers and oxidative stress as indicators of pollution exposure (Orbea et al., 2006; Solé et al., 2000), but several factors, different from organic compounds, could lead and increase the antioxidant levels as our results suggest. In the present work, the digestive gland of the mussels Mytilus galloprovincialis was the tissue with a clear correlation nearby to the high levels of carbon and nitrogen signatures and the antioxidant activities. This could be related to the fact that the digestive gland has a fast turnover that reflects short-term assimilation (Raikow and Hamilton, 2001) and it is the first reaction of the organism to the pollutants, whereas the gills have slower turnover, thus reflecting long-term assimilation (Raikow and Hamilton, 2001). In the present work, biomarkers showed a clearer response to PCBs than to PAHs. Positive correlations were found for both the digestive gland and gills, between PCBs and antioxidant biomarkers such as CAT, GR (for CB31, CB138 and CB 153) and SOD (CB 21 and C 131, only in gills). CAT catalyses the production of oxygen and water from H2O2 and high CAT activity has been demonstrated by high H2O2 production (van der Oost et al., 2003). Moreover, CAT activity responds to organochlorinated compounds and PAHs and it has been proposed as a biomarker of those (Porte et al., 2002b); additionally, in the current study, it was a biomarker of PCBs. A similar result was found in Mytilus edulis for CAT activity (Krishnakumar et al., 1997), reinforcing the fact that CAT is a good indicator of the PCB exposure. GSH plays a central role in the detoxification of ROS, since it is used by GPx and GST to maintain cellular homeostasis. These two enzymes use GSH to detoxify ROS intermediaries and produce GSSG. GR is an essential enzyme that reduces GSSG into GSH and therefore protects cells against oxidative damage (Box et al., 2007). In the present work, GR activity was related to the presence of PCBs. SOD is considered a good short-response biomarker of pollution (Nasci et al., 2002). The correlation found between PCBs and SOD activity in the gills of the mussel Mytilus galloprovincialis in the present work indicates that SOD may be more involved in PCB

Combining Stable Isotopes and Biochemical Markers…

279

detoxification in this tissue (as a short-response and more exposed tissue than the digestive gland). On the other hand, an increase in PAHs was not followed by an increased antioxidant response, even though several authors have obtained an enhanced antioxidant response to PAHs (Cossu et al., 2000; Porte et al., 2002a; Richardson et al., 2008; Solé et al., 1994). Our results may be explained by the low PAH concentrations, several of which were under the detection limit, leading to low variation in their concentrations. The enhanced antioxidant defence activation to PCBs but not to PAHs was found, suggesting that the Mytilus galloprovincialis individuals were affected more by PCBs than PAHs (Lee and Anderson, 2005). In summary, the presence of pollutants and the site characteristics are responsible, among other factors, for changes in isotopic composition and antioxidant defences in the mussel Mytilus galloprovincialis. However, there is a lack of toxicological data describing the real susceptibility of the species to the pollutants, making it difficult to draw a conclusion about the toxic impact of the pollutants in this organism. The current work provides additional information on the response to organic pollution using integrative multidisciplinary research to achieve a better evaluation of the toxicological effects on the mussel Mytilus galloprovincialis, and providing further support for the use of biomarkers to assess pollution. The correlations between organic pollutants and the isotopic composition and biomarkers in M. galloprovincialis suggest that these measures could represent a good proxy for evaluation of contamination, additional to the chemical characterisation. The knowledge derived from the study of pollution in seawater, together with traditional monitoring data, could be used in environmental protection and check in the future.

ACKNOWLEDGMENTS The authors thank M. Ribas (IUNICS) for the collaboration in isotopic analysis, D. March, P. Alós, and M. Cabanellas-Reboredo for mussel sample preparation, and IFREMER and the Nantes laboratory for the analytical determinations. This study was partly financed by the Interreg Medoc IIIB, UE Project:„Development d‟un réseau de surveillance de la qualité des eaux côtières par des biointégrateurs pour la protection durable de la Méditerranée Occidentale (MYTILOS)‟. A. Box, A. Sureda, and S. Tejada received a fellowship sponsored by the MYTILOS project Interreg Medoc IIIB. This study complies with the present Spanish law.

REFERENCES Aebi, H.E., 1984. Catalase. Methods in enzymatic analysis. pp 273–286. Almeida, J.A., Diniz, Y.S., Marques, S.F., Faine, L.A., Ribas, B.O., Burneiko, R.C., Novelli, E.L., 2002. The use of the oxidative stress responses as biomarkers in Nile tilapia (Oreochromis niloticus) exposed to in vivo cadmium contamination. Environ. Int. 27, 673–679.

280

S. Deudero, A. Box, A. Sureda et al.

Andral, B., Stanisiere, J.Y., Sauzade, D., Damier, E., Thebault, H., Galgani, F., Boissery, P., 2004. Monitoring chemical contamination levels in the Mediterranean based on the use of mussel caging. Mar. Pollut. Bull. 49, 704–712. Angelo, R.T., Cringan, M.S., Chamberlain, D.L., Stahl, A.J., Haslouer, S.G., Goodrich, C.A., 2007. Residual effects of lead and zinc mining on freshwater mussels in the Spring River Basin (Kansas, Missouri, and Oklahoma, USA). Sci. Total Environ. 384, 467–496. Badalamenti, F., Sweeting, C., Polunin, N., Pinnegar, J., D'Anna, G., Pipitone, C., 2008. Limited trophodynamics effects of trawling on three Mediterranean fishes. Mar. Biol. 154, 765–773. Box, A., Sureda, A., Galgani, F., Pons, A., Deudero, S., 2007. Assessment of environmental pollution at Balearic Islands applying oxidative stress biomarkers in the mussel Mytilus galloprovincialis. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 146, 531–539. Catsiki, V.A., Florou, H., 2006. Study on the behavior of the heavy metals Cu, Cr, Ni, Zn, Fe, Mn and 137Cs in an estuarine ecosystem using Mytilus galloprovincialis as a bioindicator species: the case of Thermaikos gulf, Greece. J. Environ. Radiactivity 86, 31–44. Cevik, U., Damla, N., Kobya, A.I., Bulut, V.N., Duran, C., Dalgic, G., Bozaci, R., 2008. Assessment of metal element concentrations in mussel (Mytilus galloprovincialis) in Eastern Black Sea, Turkey. J. Hazard Mater doi:10.1016/j.jhazmat.2008.03.010. Cope, W.G., Wiener, J.G., Steingraeber, M.T., 1996. Test system for exposing fish to resuspended, contaminated sediment. Environ. Pollut. 91, 177–182. Corsi, M., Mariottini, M., Menchi, V., Sensini, C., Balocchi, C., Focardi, S., 2002. Monitoring a marine coastal area: use of Mytilus galloprovincialis and Mullus barbatus as bioindicators. Mar. Ecol. 23, 138–153. Cossu, C., Doyotte, A., Babut, M., Exinger, A., Vasseur, P., 2000. Antioxidant biomarkers in freshwater bivalves, Unio tumidus, in response to different contamination profiles of aquatic sediments. Ecotoxicol. Environ. Saf. 45, 106–121. Costanzo, S.D., Udy, J., Longstaff, B., Jones, A., 2005. Using nitrogen stable isotope ratios (15N) of macroalgae to determine the effectiveness of sewage upgrades: changes in the extent of sewage plumes over four years in Moreton Bay, Australia. Mar. Pollut. Bull. 51, 212–217. Chapman, P.M., 2007. Determining when contamination is pollution — Weight of evidence determinations for sediments and effluents. Environ. Int. 33, 492–501. De Luca-Abbott, S.B., Richardson, B.J., McClellan, K.E., Zheng, G.J., Martin, M., Lam, P.K.S., 2005. Field validation of antioxidant enzyme biomarkers in mussels (Perna viridis) and clams (Ruditapes philippinarum) transplanted in Hong Kong coastal waters. Mar. Pollut. Bull. 51. 694–707. Deudero, S., Box, A., March, D., Valencia, J.M., Grau, A.M., Tintore, J., Calvo, M., Caixach, J., 2007a. Organic compounds temporal trends at some invertebrate species from the Balearics, Western Mediterranean. Chemosphere 68, 1650–1659. Deudero, S., Box, A., March, D., Valencia, J.M., Grau, A.M., Tintore, T., Benedicto, J., 2007b. Temporal trends of metals in benthic invertebrate species from the Balearic Islands, Western, Mediterranean. Mar. Pollut. Bull. 54, 1545–1558. Deudero, S., Cabanellas, M., Blanco, A., Tejada, S. (2009) Stable isotope fractionation in the digestive gland, muscle and gills tissues of the marine mussel Mytilus galloprovincialis. J. Exp. Mar. Bio. Ecol. 368, 181–188.

Combining Stable Isotopes and Biochemical Markers…

281

Elias, S.J., Arner, E.S., Zhong, L., Holmgren, A., 1999. In: Packer L (ed) Methods in enzymatic analysis. Oxidants and antioxidants. Vol 300. Academic, California, pp 226– 239. Fisher, S.J., Brown, M.L., Willis, D.W., 2001. Temporal food web variability in an upper Missouri River backwater: energy origination points and transfer mechanisms. Ecol. Freshw. Fish 10, 154–167. Fisk, A.T., Tittlemier, S.A., Pranschke, J.L., Norstrom, R.J., 2002. Using anthropogenic contaminants and stable isotopes to assess the feeding ecology of greenland sharks. Ecology 83, 2162–2172. Flohe, L., Gunzler, W.A., 1984. Assays of glutathione peroxidase. Methods Enzymol. 105, 114–121. Fry, B., 2000. Using stable isotopes to monitor watershed influences on aquatic trophodynamics. Can. J. Fish Aquat. Sci. 56, 2167–2171. Fry, B., Sherr, E.B., 1984. 13C measurements as indicators of carbon flow in marine and fresh-water ecosystems. Contr. Mar. Sci. 27, 13–47. Gaston, T.F., Suthers, I.M., 2004. Spatial variation in 13C and 15N of liver, muscle and bone in a rocky reef planktivorous fish: the relative contribution of sewage. J. Exp. Mar. Biol. Ecol. 304, 17–33. Goldberg, D.M., Spooner, R.J., 1984. Glutathione reductase. Methods in enzymatic analysis pp 258–265. Green, N.W., Knutzen, J., 2003. Organohalogens and metals in marine fish and mussels and some relationships to biological variables at reference localities in Norway. Mar. Pollut. Bull. 46, 362–374. Gustafson, L., Showers, W., Kwak, T., Levine, J., Stoskopf, M., 2007. Temporal and spatial variability in stable isotope compositions of a freshwater mussel: implications for biomonitoring and ecological studies. Oecologia 152, 140–150. Holmer, M., Marba, N., Diaz-Almela, E., Duarte, C.M., Tsapakis, M., Danovaro, R., 2007. Sedimentation of organic matter from fish farms in oligotrophic Mediterranean assessed through bulk and stable isotope (13C and 15N) analyses. Aquaculture 262, 268–280. Islam, M.S., Wahab, M.A., Tanaka, M., 2004. Seed supply for coastal brackishwater shrimp farming: environmental impacts and sustainability. Mar. Pollut. Bull. 48, 7–11. Jan, J., Vrecl, M., Pogacnik, A., Bavdek, S.V., 1998. Tissue distribution of planar and nonplanar chlorobiphenyls, 4,4'-DDE and hexachlorobenzene in sheep and lambs. Chemosphere 38, 2607–2612. Jones, C.E., Jenkyns, H.C., 2001. Seawater strontium isotopes, oceanic anoxic events, and seafloor hydrothermal activity in the Jurassic and Cretaceous. Am. J. Sci. 301, 112–149. Kopp, J., Cornette, F., Simonne, C., 2005. A comparison of growth and biochemical composition of Mytilus galloprovincialis (Lmk.) and Mytilus edulis (L.) on the West coast of Cotentin, Normandy, France 1999–2000. Aquacult. Int. 13, 237–340. Krishnakumar, P.K., Casillas, E., Varanasi, U., 1997. Cytochemical responses in the digestive tissue of Mytilus edulis complex exposed to microencapsulated PAHs or PCBs. Comp. Biochem. Physiol. Part C Pharmacol. Toxicol. Endocrinol. 118, 11–18. Langston, W.J., Spence, S.K., 1995. Biological factors involved in metal concentration observed in aquatic organisms. In: Tessier A TD, editors (ed) Metal speciation and bioavailability in aquatic systems. Wiley, Chichester, England, pp 407–478.

282

S. Deudero, A. Box, A. Sureda et al.

Lee, R.F., Anderson, J.W., 2005. Significance of cytochrome P450 system responses and levels of bile fluorescent aromatic compounds in marine wildlife following oil spills. Mar. Pollut. Bull. 50, 705–723. Livingstone, D.R., 2001. Contaminant-stimulated reactive oxygen species production and oxidative damage in aquatic organisms. Mar. Pollut. Bull. 42, 656-666. Lorrain, A., Paulet, Y.M., Chauvaud, L., Savoye, N., Donval, A., Saout, C., 2002. Differential 13C and 15N signatures among scallop tissues: implications for ecology and physiology. J. Exp. Mar. Biol. Ecol. 275, 47–61. Luçon, M., Michel, P., 1986. Dosage des PCB, pesticides er détermination de la quantité de matière extractible á l'hexane dans la chair de poisson. Rapport IFREMERDERO ––8605-MR:20. Manduzio, H., Monsinjon, T., Galap, C., Leboulenger, F., Rocher, W., 2004. Seasonal variations in antioxidant defences in blue mussels Mytilus edulis collected from a polluted area: major contributions in gills of an inducible isoform of Cu/Zn-superoxide dismutase and of glutathione S-transferase. Aquat. Toxicol. 70, 83–93. McCord, J.M., Fridovich, I., 1969. Superoxide dismutase. An enzymic function for erythrocuprein (hemocuprein). J. Biol. Chem. 244, 6049–6055. McCue, M.D., 2008. Endogenous and environmental factors influence the dietary fractionation of 13C and 15N in hissing cockroaches Gromphadorhina portentosa. Physiol. Biochem. Zool. 81, 14–24. Mertens, J., Luyssaert, S., Verheyen, K., 2005. Use and abuse of trace metal concentrations in plant tissue for biomonitoring and phytoextraction. Environ. Pollut. 138, 1–4. Michel, P., 1983. Dosage global des hydrocarbures aromatiques dans les organismes marins par CLHP-fluorescence. In: Aminot CE (ed) Aminot, Chaussepied (Ed),. CNEXO, BNDO/DOCUMENTATION, Brest, France, pp 337–346. Nasci, C., Nesto, N., Monteduro, R.A., Da Ros, L., 2002. Field application of biochemical markers and a physiological index in the mussel, Mytilus galloprovincialis: transplantation and biomonitoring studies in the lagoon of Venice (NE Italy). Mar. Environ. Res. 54, 811–816. Niedan, V.W., Keppler, F., Ahlsdorf, B., Schöler, H.F., 2003. De novo formation of organochlorines in a sewage treatment plant. Biogeochemistry 62, 277–287. Orbea, A., Garmendia, L., Marigómez, I., Cajaraville, M.P., 2006. Effects of the 'Prestige' oil spill on cellular biomarkers in intertidal mussels: results of the first year of studies. Mar. Ecol. Prog. Ser. 306, 177–189. Perugini, M., Lavaliere, M., Giammarino, A., Mazzone, P., Olivieri, V., Amorena, M., 2004. Levels of polychlorinated biphenyls and organochlorine pesticides in some edible marine organisms from the Central Adriatic Sea. Chemosphere 57, 391–400. Pinnegar, J.K., Polunin, N.V.C., 1999. Differential fractionation of 13C and 15N among fish tissues: implications for the study of trophic interactions. Funct. Ecol. 13, 225–231. Pinnegar, J.K., Polunin, N.V.C., 2000. Contributions of stable-isotope data to elucidating food webs of Mediterranean rocky littoral fishes. Oecologia 122, 399–409. Porte, C., Escartín, E., García de la Parra, L.M., Biosca, X., Albaigés, J., 2002. Assessment of coastal pollution by combined determination of chemical and biochemical markers in Mullus barbatus. Mar. Ecol. Prog. Ser. 235, 205–216.

Combining Stable Isotopes and Biochemical Markers…

283

Post, D.M., 2002. Using stable isotopes to estimate trophic position: Models, methods, and assumptions. Ecology 83, 703–718. Raikow, D.F., Hamilton, S.K., 2001. Bivalve diets in a midwestern U.S. stream: A stable isotope enrichment study. Limnology and Oceanography 46, 514–522. Richardson, B.J., Mak, E., De Luca-Abbott, S.B., Martin, M., McClellan, K., Lam, P.K., 2008. Antioxidant responses to polycyclic aromatic hydrocarbons and organochlorine pesticides in green-lipped mussels (Perna viridis): do mussels "integrate" biomarker responses? Mar. Pollut. Bull. 57, 503–514. Riget, F., Moller, P., Dietz, R., Nielsen, T.G., Asmund, G., Strand, J., Larsen, M.M., Hobson, K.A., 2007. Transfer of mercury in the marine food web of West Greenland. J. Environ. Monit. 9, 877–883. Rogers, K.M., 2003. Stable carbon and nitrogen isotope signatures indicate recovery of marine biota from sewage pollution at Moa Point, New Zealand. Mar. Pollut. Bull. 46, 821–827. Romeo, M., Hoarau, P., Garello, G., Gnassia-Barelli, M., Girard, J.P., 2003a. Mussel transplantation and biomarkers as useful tools for assessing water quality in the NW Mediterranean. Environ. Pollut. 122, 369–378. Romeo, M., Mourgaud, Y., Geffard, A., Gnassia-Barelli, M., Amiard, J.C., Budzinski, H., 2003b. Multimarker approach in transplanted mussels for evaluating water quality in Charentes, France, coast areas exposed to different anthropogenic conditions. Environ. Toxicol. 18, 295–305. Santovito, G., Piccinni, E., Cassini, A., Irato, P., Albergoni, V., 2005. Antioxidant responses of the Mediterranean mussel, Mytilus galloprovincialis, to environmental variability of dissolved oxygen. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 140, 321–329. Sayeed, I., Parvez, S., Pandey, S., Bin-Hafeez, B., Haque, R., Raisuddin, S., 2003. Oxidative stress biomarkers of exposure to deltamethrin in freshwater fish, Channa punctatus Bloch. Ecotoxicol. Environ. Saf. 56, 295–301. Shahidul Islam, M., Tanaka, M., 2004. Impacts of pollution on coastal and marine ecosystems including coastal and marine fisheries and approach for management: a review and synthesis. Mar. Pollut. Bull. 48, 624–649. Skoglund, R.S., Swackhamer, D.L., 2008. Evidence for the use of organic carbon as the sorbing matrix in the modeling of PCB accumulation in phytoplankton. Environ. sci. technol. 33, 1516–1519. Solé, M., Porte, C., Albaiges, J., 1994. Mixed-function oxygenase system components and antioxidant enzymes in different marine bivalves: its relation with contaminant body burdens. Aquat. toxicol. 30, 271–283. Solé, M., Porte, C., Barcelo, D., Albaiges, J., 2000. Bivalves residue analysis for the assessment of coastal pollution in the Ebro delta (NW Mediterranean). Mar. Pollut. Bull. 40, 746–753. Sureda, A., Box, A., Ensenyat, M., Alou, E., Tauler, P., Deudero, S., Pons, A., 2006. Enzymatic antioxidant response of a labrid fish (Coris julis) liver to environmental caulerpenyne. Comp. Biochem. and Physiol. 144, 191–196. Sureda, A., Box, A., Deudero, S., Pons, A., 2008. Reciprocal effects of caulerpenyne and intense herbivorism on the antioxidant response of Bittium reticulatum and Caulerpa taxifolia. Ecotoxicol. Environ. Safety. 72, 795–801.

284

S. Deudero, A. Box, A. Sureda et al.

Tacon, A.G.J., Phillips, M.J., Barg, U.C., 1995. Aquaculture feeds and the environment: the Asian experience. Water Sci. Technol. 31, 41–59. Triay Llopis, F., 2007. Memoria anual 2007 de la Autoridad Portuaria de Baleares. http://www.portsdebalears.com/15.php3?idioma=esp. Tsangaris, C., Kormas, K., Strogyloudi, E., Hatzianestis, I., Neofitou, C., Andral, B., Galgani, F., 2010. Multiple biomarkers of pollution effects in caged mussels on the Greek coastline. Comp. Biochem. Physiol. C Toxicol Pharmacol. 151, 369-378. van der Oost, R., Beyerb, J., Vermeulen, N.P.E., 2003. Fish bioaccumulation and biomarkers in environmental risk assessment: a review. Environ. Toxicol. Pharmacol. 13, 57–149. Van Dover, C., Grassle, J.F., Fry, B., Garritt, R.H., Starczak, V.R., 1992. Stable isotope evidence for entry of sewage-derived organic material into a deep-sea food web. Nature 360, 153–156. Vander Zanden, M.J., Cabana, G., Rasmussen, J.B., 1997. Comparing trophic position of freshwater fish calculated using stable nitrogen isotope ratios (15N) and literature dietary data. Can. J. Fish Aquat. Sci. 54, 1142–1158. Voldner, E.C., Li, Y.F., 1995. Global usage of selected persistent organochlorines. Sci. Total Environ. 160/161, 201–210. Walker, J.L., Potter, C.W., Macko, S.A., 1999. The diets of modern and historic bottlenose dolphin populations reflected through stable isotopes. Mar. Mamm. Sci. 15, 335–350. Wang, X., Wang, W.X., 2006. Bioaccumulation and transfer of benzo(a)pyrene in a simplified marine food chain. Mar. Ecol. Prog. Ser. 312, 101–111. Watanabe, K., Monaghan, M.T., Takemon, Y., Omura, T., 2008. Biodilution of heavy metals in a stream macroinvertebrate food web: evidence from stable isotope analysis. Sci. Total Environ. 394, 57–67.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 12

ENVIRONMENTAL IMPACT ASSESSMENT OF MUSSELS CAUGHT IN MEDITERRANEAN SEA, ITALY Monia Perugini and Pierina Visciano Department of Food Science, University of Teramo, Viale Crispi 212, 64100 Teramo, Italy

ABSTRACT Human activities and atmospheric pollution impact coastal ecosystems at different rate in the world. The oceans contain a wide range of animal species that are harvested for human consumption. It is estimated that more than 2 billion people world-wide depend on protein from seas and coastal habitats, yet it is into this environment that anthropogenic pollutants often accumulate. Contamination of seafood is inevitable. The word ―mussel‖ is frequently used to name the edible bivalves of the marine family Mytilidae, most of which live on exposed shores in the intertidal zone, attached by means of their strong byssal threads to a firm substrate. Mussels are stationary filter feeders that filter large quantities of seawater, keeping in this way large amounts of pollutants, and constitute a source of contaminants for marine organisms that feed on them. As they accumulate pollutants (polycyclic aromatic hydrocarbons, PAHs, polychlorobiphenyls, PCBs, organochlorine compounds, OCs) efficiently, they can be used in water monitoring programs. Similarly to other invertebrates mussels show a slow metabolic rate and consequently a slow xenobiotic biotransformation. Mussels filter suspended matter from the water column and deposit it as feces and pseudofeces. The food of mussels consists of particulate organic matter and other microscopic sea creatures which are free-floating in seawater. Organic matter is produced in the water column (phytoplankton) and the waves are very important for the availability of this food because they cause turbulence and keep organic matter in suspension. Mussels serve as an important food source for a wide range of organisms (e.g., starfish, eider ducks, some predatory marine gastropods and oystercatchers) and are also eaten by humans. As a matter of fact they contribute to the PCBs, PAHs and OCs intake in human being. The species Mytilus galloprovincialis is a very abundant organism in the Mediterranean Sea. This is a mostly enclosed sea that has limited exchange of deep water with outer oceans and where the water circulation is dominated by salinity and temperature differences rather than winds. It covers an approximate area of 2.5 million

286

Monia Perugini and Pierina Visciano km2 but its connection to the Atlantic Ocean is only 14 km wide. In our studies toxic pollutants were detected at different rates in mussels caught from Adriatic and Tyrrhenian Sea in the last years and compared with the levels found in other seas as reported in literature.

INTRODUCTION Contamination of coastal environment by chemical contaminants such as hydrocarbons, pesticides, heavy metals and various organic pollutants in dredged sediments and waste waters is a great environmental concern. The aquatic ecosystems are under permanent pressure of anthropogenic pollutants originating from various sources located at the catchment area, or at distant places, polluting the environment through the air. Many of the pollutants are toxic to aquatic organisms causing their lethal or sub-lethal deterioration. The toxic effect depends mainly on the type of the pollutant and on its concentration but it may be influenced by a number of variables, including exposure route, frequency, and duration. In most cases the concentrations are low, causing only sub-lethal or chronic diseases. The Mediterranean Sea - literally, the sea at the middle of the earth - connects Europe, Asia and Africa. Although it is part of the Atlantic Ocean, the Mediterranean is almost completely separated from the main body of the Atlantic at the Straits of Gibraltar. The Mediterranean Sea is a semi-enclosed basin covering an area of 2.5 million km2 and containing 3.7 million km3 of water. The average depth is around 1,500 meters. The water exchange time is of about 80 years and this slow turnover rate results in a high anthropogenic impact, making the Mediterranean very sensitive to the build-up of pollutants. In fact, this sea suffers from pollution from industry, agriculture and urban centers. Urbanization has been particularly growing along the coastline, to accommodate both permanent and temporal population, with the result of a substantial modification of the coast and adverse effects on the quality of the environment. Moreover the Mediterranean Sea is also polluted on a daily basis by sewage and chemical discharges from land. There is a large range of industrial activities located all along the coasts that regularly pump thousands of tons of toxic waste directly into the water. All these activities constitute sources of pollution through direct disposal, continental runoff and atmospheric transport (UNEP Chemicals, 2002). The presence of these pollution hot spots, located generally in semi-enclosed gulfs and bays near important harbours, big cities and industrial areas, is probably the major problem in the Mediterranean Sea (Zorita et al., 2008). Regarding only petroleum hydrocarbon pollution, between 1987 and the end of 1996 an estimated 22,223 tons of oil entered the Mediterranean Sea as the result of shipping incidents causing localized damage to the Mediterranean marine and coastal environment, and 250,000 tons of petroleum hydrocarbons are discharged per year due to shipping operations (UNEP Chemicals, 2002). Other chemicals such as polychlorinated biphenyls and derivates, pesticides and metals are also continuous sources of pollution. The pesticide lindane, occurs at a number of hotspots due to manufacturing wastes, stockpiles and historical usage. Over 200 tons of dichlorodiphenyltrichloroethane (DDTs) are still stockpiled in various countries, together with other organochlorine pesticides. The Mediterranean Sea is polluted from a multitude of sources that not only threaten marine ecosystems themselves, but also create a serious health risk in a nation as Italy where fish is an integral part of the diet and many people depend on the sea for a living. In order to

Environmental Impact Assessment of Mussels Caught in Mediterranean Sea…

287

monitor pollution levels and impacts on marine flora and fauna, large bio-monitoring programs have been developed. Due to their bio-ecological particularities and caging possibility, mussels are widely used in bio-monitoring. They have been employed worldwide since Goldberg in 1975 proposed the ‗‗Mussel Watch‘‘ concept, firstly for chemical monitoring but afterwards also for the assessment of biological effects of pollution (Zorita et al., 2008). This is a concerted effort to analyze the spatial and temporal trends of chemical contamination in the marine environment using mussels as bio-concentrators and indicator species. These sessile and filter-feeding organisms are very suitable as sentinels because they accumulate contaminants to a great extent and respond significantly to pollutant exposure (Cajaraville et al., 2000). They also tend to reside in regions where less hardy species can not survive. Thus, molluscs are an ideal invertebrate model system for aquatic, especially marine environmental monitoring and toxicology. Mussels may provide relevant data for assessing the biological impacts of environmental pollution in the Mediterranean Sea and they may serve as reliable early warning signals.

MUSSELS AS BIO-MONITORING MARINE ORGANISMS Mussels are reliable bio-indicators as they accumulate significant quantities of contaminants and show noticeable response to pollutant exposure. The large use of mussels as bio-indicators of marine pollution is due to some their important characteristics (Table 1). These bivalves are filter feeders, so they ingest particles from the water and absorb contaminants through their gills, and tend to concentrate any contaminants that may be present in the water. They are also sessile, so they track the pollution levels of a specific site, rather than moving around and accumulating an ―average‖ level. These organisms are cosmopolitan and easily collectible in coastal areas without significantly affecting their populations (Ortiz-Zarragoitia and Cajaraville, 2006) and the presence of ample soft tissue inside of the shell makes easier the chemical analysis. Moreover, analysis of bivalve tissue gives an indication of the bioavailable fraction of environmental contamination and of direct exposure to chemicals (Baumard et al., 1999a). Another advantage is the possibility to work with all the life history stages of mussels from cleaving eggs to sexually active adults (Blankenship et al., 1983). Also the reproductive processes (Painter, 1992) and morphological changes (Bauer et al., 1995) can be an indicator of bioaccumulation and/or biomagnifications of pollutants in mussels. The reproductive failure (Gibbs et al., 1991; Gibbs et al., 1990) and behavioral castration of some molluscs (Straw and Rittschof, 2004) in response to anthropogenic input support the use of molluskan models in environmental toxicology. Furthermore mussels, and bivalves in particular, possess a wide range of defences to prevent toxic effects of chemicals at the cellular level: (i) metallothioneins and multi xenobiotic resistance proteins that actively reduce cellular entrance of toxicants, (ii) detoxification and antioxidant systems allowing neutralization and elimination of parent compounds, metabolites and by-products and finally (iii) DNA repair and protein and lipid turnover which maintain cell integrity. Most of these processes are driven by inducible proteins whose expression and/or activity levels have been shown to be related to the cellular content of certain toxicants. For instance, numerous components of the detoxification and antioxidant systems in mollusc species have been shown to be specifically induced by metals

288

Monia Perugini and Pierina Visciano

or PAHs in controlled laboratory conditions (Rocher et al., 2006) or by complex mixture of pollutants in the field (Gowland et al., 2002) and hence are thought to be particularly suitable for pollution bio-monitoring. Table 1. Attributes of bivalves as sentinel organisms A correlation exists between the pollutant content of the organism and the average pollutant concentration in the surrounding habitat; contaminant concentration factors of many-fold (over seawater concentrations) are common. Bivalves are cosmopolitan, minimizing the inherent problems which arise when comparing data from markedly different species; this issue will be more important in tropical areas Bivalves have a reasonably high tolerance to many types of pollution and can exist in habitats contaminated within much of the known range of pollution Bivalves are sedentary generally and better representative of the study area than mobile species Bivalves often are abundant in relatively stable populations that can be sampled repeatedly throughout the study region Many bivalve species are sufficiently long-lived to allow the sampling of more than one yearclass, if desired Bivalves are often of a reasonable size, providing adequate tissue for analysis Bivalves are easy to sample and hardy enough to survive in the laboratory, allowing defecation before analysis (if desired) and laboratory studies of pollutant uptake Several bivalve species tolerate a range of salinity and other environmental conditions, making them hardy enough to be transplanted to other areas for experimentation Bivalves are generally metabolically passive to the contaminants in question and not alter the chemical after uptake; uptake by the organism provides an assessment of bioavailability from environmental compartments Bivalves are commercially valuable seafood and a measure of chemical contamination is of public health interest

The use of mussels as bio-monitors for the measurement of pollutants in the marine environment is well documented (O‘Connor, 1998) but there are some factors that can influence the results of contaminants monitoring programs. It is difficult to assess the accumulation of compounds at the surveyed sites especially when levels are very low; and spatial variations depend on the type of compounds present in the environment, i.e. lower chlorinated components are more rapidly metabolized and excreted than highly chlorinated biphenyls which can persist in the tissues. Similarly, low molecular weight PAHs have lower retention rates in organisms than high molecular weight compounds. Furthermore the lipid content affects the uptake of organic contaminants that are rapidly metabolized and depurated without major accumulation in the organism (Pruell et al., 1986). Mussel body condition can be influenced by food availability and nutrition, which also influences lipid content. Environmental factors such as organic carbon levels, contaminant interactions, varied tidal ranges, and temperature variations also affect the bioaccumulation of contaminants in mussels. In response to decreasing tissue weight as mussels starve, some elements are excreted, while others are not eliminated (Chou and Uthe, 1991). These factors may

Environmental Impact Assessment of Mussels Caught in Mediterranean Sea…

289

contribute to the high variability between sites and the lack of detection of spatial distribution, thus complicating the use of mussels for contaminants monitoring program. Mytilus galloprovincialis, also known as Mediterranean mussel, is a species of bivalve, in the family Mytilidae. It is a native species in the Mediterranean Sea, Black Sea and Adriatic Sea. It has succeeded in establishing itself at widely distributed points around the globe, with nearly all introductions occurring in temperate regions and at localities where there are large shipping ports (Branch and Steffani, 2004). Ship hull fouling and transport of ballast water have been implicated in its spread and its impact on native communities and native mussels as a number of studies and observations have been suggested (Robinson and Griffiths, 2002; Geller, 1999; Carlton, 1992). Mytilus galloprovincialis is dark blue or brown to almost black in colour. The two shells are equal and nearly quadrangular. The outside is black-violet coloured; on one side the rim of the shell ends with a pointed and slightly bent umbo while the other side is rounded, although shell shape varies by region. It also tends to grow larger, up to 15 cm, although typically only 5-8 cm. It is a filter-feeding bivalve that eats a wide range of planktotrophic organisms. This species prefers fast moving water that is free of sediment and thrives in regions where nutrient-rich upwelling occurs. It has high fecundity and spawns at the time of year with the highest water temperature. During the reproduction period males and females spawn simultaneously. Adult mussels spawn gametes, after which fertilization of an egg occurs. The egg undergoes gametogenesis, forming a larvae. The larva forms into a juvenile which settles and attaches itself using byssal threads after 2 to 4 weeks (Matson, 2000). Bioavailability and organisms physiology are the two important variables that have a major effect on chemical contaminant body burden. Of the environmental concentration, only the bio-available fraction can enter the organism. Physiological factors, including lipid levels and the rates of uptake and elimination (metabolism, diffusion and excretion), also determine contaminant body burden. The body burden of pollutants in mussels is determined by the balance between uptake and elimination. Uptake is controlled externally by the partitioning behavior of the contaminant between sediment, water and food and internally by the organism behavior and physiology. It is believed that the process of uptake of hydrophobic compounds is passive and controlled by diffusion pressure because of the differential between the environmental matrix and tissue concentration. The biological processes that can influence uptake include organism size, growth rate, membrane permeability ventilator rate, extraction efficiency, ingestion rate, gut residence time and osmoregulation. Some of these processes are intrinsic to a species, others are impacted by environmental factors such as temperature, oxygen content, pH and salinity (McKim, 1994). For example, Deslou-Paoli et al. observed that Mytilus edulis showed to have higher feeding rates at the end of winter and therefore the higher filtering rate in March induced a greater exposure to the PAHs in the water column (Deslou-Paoli et al., 1987). The same data were confirmed to Baumard et al. that observed higher concentrations of PAHs in mussels during sampling in March as compared to October (Baumard et al., 1999b). These studies confirm as the environmental factors, such as temperature, oxygen content, pH and salinity can also influence the uptake of PAHs by mussels due to their effect on the bioavailability of the compounds. In addition, changes in the organism behaviour, seasonal rhythms, nutritional quality and stress can also influence contaminants uptake. Again, environmental and physiological factors will affect the rate of elimination in mussels. Generally the elimination process can be accomplished by passive diffusion and by

290

Monia Perugini and Pierina Visciano

biotransformation. The first process occurs when pollutants external concentrations are lower than internal concentrations, favoring outward flux, while the enzymatic pathways convert hydrophobic parent compound to more polar metabolites, that can be more readily excreted by those taxa that posses a kidney-like organ (Juhasz and Naidu, 2000). All animals possess a suite of biotransformation enzymes, usually present in highest levels in the liver (vertebrates) or tissues associated with the processing of food (invertebrates). The main function of these enzymes is to convert hydrophobic lipid-soluble organic xenobiotics to water-soluble excretable metabolites (Livingstone, 1998). The rate of elimination may be affected by environmental factors such as temperature and salinity, and by physiological factors, including reproductive state, age, sex, stress and enzyme induction, in addition to such factors as route of uptake, chemical hydrophobicity and exposure store.

CONTAMINANTS TOXICITY AND HUMAN HEALTH Mankind has always been exposed to various toxic compounds, which as natural elements are present throughout the environment, in drinking water and in food. Their fate in marine organisms is considered to be species dependent. Generally metabolic capacity in edible aquatic species appears to be best developed in fish, intermediate in crustaceans and least in molluscs. Filtrating organisms such as mussels accumulate contaminants and present elimination rates much less than those observed in vertebrates. Mussels are common, highly visible, ecologically and commercially important on a global scale as food and as non-food resources. They are often chosen as good bio-indicators of pollution due to their ability to filter the water and accumulate pollutants in the marine area. In order to develop water quality criteria or fish consumption advisories, appropriate toxicity values for a chemical must be established. Moreover, for some chemicals present in fish and seafood the maximum tolerable levels have been established.

POLYCHLORINATED BIPHENYLS Polychlorinated biphenyls make up a group of 209 individual chlorinated biphenyl rings known as congeners. PCBs consist of a biphenyl (two benzene rings with a carbon to carbon bond between carbon 1 on one ring and carbon 1' on the second ring) with a varying number of chlorines. The toxicity of a PCB is dependent not only upon the number of chlorines present on the biphenyl structures, but the positions of the chlorines. This group of toxicants can be separated into two groups designated by the chlorine substitution of the ortho positions of the biphenyl ring. PCB congeners without chlorines in the ortho positions are called ―coplanar‖ or ―planar‖ or ―dioxin-like‖ because the two phenyl rings can assume a planar state. Chlorination of the ortho positions does not favor alignment of the phenyl rings; therefore the other class of PCB congeners is termed ―ortho-substituted‖ or ―non-coplanar‖. The planar or ―flat configuration‖ is particularly toxic. They constitute a family of environmental persistent pollutants of synthetic organic compounds that have mainly been used in electrical equipment as dielectric insulating media. The use of these compounds is now restricted, but because of their wide employ in the past

Environmental Impact Assessment of Mussels Caught in Mediterranean Sea…

291

and of their high stability in the environment they are so widely distributed that detectable levels can be found in marine organisms, from molluscs to fish. PCBs are extremely persistent in the environment and possess the ability to accumulate in the food chain. These compounds are highly insoluble in water and tend to accumulate in body fat. Human exposure is probably dominated by the accumulation through the food chain of the PCBs present in environmental reservoirs. PCBs exhibit a wide range of toxic effects. Coplanar PCBs have been implicated as developmental and immune system toxicants and are suspected carcinogens (Tilson and Kodavanti, 1998). Similar to dioxin, toxicity of coplanar PCBs (Safe et al., 1985) is thought to be primarily mediated via binding to aryl hydrocarbon receptor (AhR). Because AhR is a transcription factor, abnormal activation may disrupt cell function by altering the transcription of genes. The concept of toxic equivalency factors (TEFs) is based on the ability of a PCB to activate AhR. However, not all effects may be mediated by the AhR receptor, and PCBs do not alter estrogen concentrations to the same degree as other ligands of the AhR receptor such as PCDD and PCDF, possibly reflecting the reduced potency of PCBs to induce CYP1A1 and CYP1B1 (Wang et al., 2006). Examples of other actions of PCBs include diortho-substituted non-coplanar PCBs interfering with intracellular signal transduction dependent on calcium; this may lead to neurotoxicity (Simon et al., 2007). Ortho-PCBs may disrupt thyroid hormone transport by binding to transthyretin. Data on the occurrence of non dioxin-like PCB in food and feed have been reported in different ways for example as the sum of three PCB congeners (PCB 138, 153 and 180), as the sum of six PCB congeners (PCB 28, 52, 101, 138, 153, 180) often referred to as indicator PCB or as the sum of seven (sum of six indicator PCB plus PCB 118). These congeners are appropriate indicators for different PCB patterns in various sample matrices and are most suitable for a risk assessment. The sum of the six indicator PCB represents about 50% of total non dioxin-like PCB in food (EFSA Journal, 2005). From the 210 theoretically possible congeners of dioxin and furan, only those substituted in each of the 2-, 3-, 7- and 8-positions of the two aromatic rings are of toxicological concern. These 17 congeners exhibit a similar toxicological profile, with 2,3,7,8-tetrachlorodibenzo-pdioxin (2,3,7,8-TCDD) the most toxic congener (IARC, 1997). From the 209 theoretically possible PCB congeners, only 12 are considered to have dioxin-like toxicity since they can easily adopt a coplanar structure with the capability to bind to the Ah receptor, thus showing toxicological properties similar to dioxins (Safe, 1985). However, most dioxins are considerably more toxic than the PCBs, but the quantities of PCBs released to the environment are several times higher and they, thus, often show much higher levels in food and feed than dioxins. Each congener of dioxins or dioxin-like PCBs exhibits a different level of toxicity. In order to be able to sum up the toxicity of these different congeners, the concept of toxic equivalency factors (TEFs) has been introduced to facilitate risk assessment and regulatory control. This means that the analytical results relating to all 17 individual dioxin congeners and to the 12 dioxin-like PCB congeners are expressed in terms of a single quantifiable unit, the TCDD toxic equivalent concentration (TEQ). The presence of dioxins and dioxin-like PCBs is expressed as toxic equivalents after multiplication of congener-specific concentration levels with TEFs developed based on their relative toxicity compared to 2,3,7,8-TCDD.

292

Monia Perugini and Pierina Visciano

Dioxins and dioxin-like PCBs are fat soluble and tend to bio-accumulate in body fat, both in animals and humans, biomagnifying through the food chain. They are generally not taken up or absorbed by plants, with the exception of some members of the cucurbit family (White et al., 2005; Hülster et al., 1994), but may settle on the surfaces of the leaves. They can then enter the food chain when animals eat the contaminated leaves. In aquatic environments, fish and other marine animals can absorb dioxins and dioxin-like PCBs. International studies have concluded that around 95% of human exposure occurs through consumption of food of animal origin, with meat, dairy products and fish being the main sources (Gilman et al., 1991). Other ways of contamination are through breathing in air contaminated by dioxins and dioxin-like PCBs from smoke, factory or incinerator emissions or from uncontrolled hazardous waste sites. In 2001, Council Regulation (EC) No 2375/2001 established maximum levels for dioxins in meat and meat products, fish and fishery products, milk and dairy products, hen eggs and egg products, and oils and fat (EC, 2001). Directive 2002/32/EC of the European Parliament and of the Council (as amended by Commission Directive 2003/57/EC) established maximum levels for dioxins in feed materials of plant origin, minerals, binders, animal fat, and other products of animal origin, fish oil, fish meal, and compound feed, including fish feed (EC, 2002). In order to be able to sum up the toxicity of the different congeners of concern (the 17 dioxins and the 12 dioxin-like PCBs), Commission Regulation (EC) No 1881/2006 lays down the use of TEF to facilitate risk assessment and regulatory control (EC, 2006). The analytical results relating to all the individual dioxin, furan and dioxin-like PCB congeners should be expressed in terms of 2,3,7,8-TCDD toxic equivalents using the TEF values proposed by the World Health Organisation in 1998.

ORGANOCHLORINE PESTICIDES Organochlorine compounds do not have a common chemical structure, but they are insecticides composed primarily of carbon, hydrogen, and chlorine. DDT (dichlorodiphenyltrichloroethane) is a pesticide once widely used to control insects in agriculture and insects that carry diseases such as malaria. DDE (dichlorodiphenyldichloroethylene) and DDD (dichlorodiphenyldichloroethane) are chemicals similar to DDT that contaminate commercial DDT preparations. DDE has no commercial use. When we refer to DDT, we are generally referring to p,p‟-DDT, which was produced and used for its insecticidal properties. However, the DDT used as an insecticide, was composed of up to fourteen chemical compounds, of which only 65–80% was the active ingredient, p,p‟-DDT. The other components included 15–21% of the nearly inactive o,p‟DDT, up to 4% of p,p‟-DDD, and up to 1.5% of 1-(p-chlorophenyl)-2,2,2-trichloroethanol (Metcalf, 1995). DDT and its primary metabolites, DDE and DDD, are manufactured chemicals and are not known to occur naturally in the environment. DDT was banned in many countries in the 1970s in response to public concern and mounting scientific evidence linking DDT with damage to wildlife and its environmental persistence. It is, however, still used in some other areas of the world, most notably for controlling malaria. DDT was released to the environment during its production, formulation, and extensive use as a pesticide in agriculture

Environmental Impact Assessment of Mussels Caught in Mediterranean Sea…

293

and vector control applications. DDD was also used as a pesticide, but to a far lesser extent than was DDT. DDT and its metabolites are very persistent and bio-accumulate in the environment. DDT gets into the atmosphere as a result of spraying operations in areas of the world where it is still used or also enter the atmosphere through the volatilization of residues in soil and surface water. These chemicals will be deposited on land and in surface water as a result of dry and wet deposition. The process of volatilization and deposition may be repeated many times, and results in what has been referred to as a ‗global distillation‘ from warm source areas to cold polar regions. As a result, DDT and its metabolites are transported to the Arctic and Antarctic regions where they are found in the air, sediment, and snow and accumulate in biota. The dominant fate processes in the aquatic environment are volatilization and adsorption to biota, suspended particulate matter, and sediments. DDT, DDE, and DDD accumulate in fatty tissues, with tissue concentrations typically increasing with the trophic level of the organism. Human exposure to DDT is primarily through the diet. Potential mechanisms of DDT on humans are genotoxicity and endocrine disruption. DDT may have direct genotoxicity, but may also induce enzymes that produce other genotoxic intermediates and DNA adducts. The DDE acts as an antiandrogen (but not as an estrogen), o,p'-DDT, has weak estrogenic activity and p,p'-DDT, has little or no androgenic or estrogenic activity (Cohn et al., 2007).

POLYCYCLIC AROMATIC HYDROCARBONS The major routes of exposure of humans to polycyclic aromatic hydrocarbons are from food and to some extent from inhaled air. Food can be contaminated by: (i) environmental PAHs that are present in air, soil or water; (ii) industrial food processing methods; and (iii) home food preparation. PAHs have been detected in a variety of foods, notably vegetables as a result of the deposition of airborne PAHs, and in fish and mussels from contaminated waters (Nielsen et al., 1996; Edwards, 1983). PAHs can contaminate foods also during smoking processes and heating and drying processes that allow combustion products to come into direct contact with food. In addition, environmental pollution may cause contamination with PAH, in particular in fish and fishery products. The Scientific Committee on Food reviewed the presence and toxicity of PAHs in food and issued an opinion on 4 December 2002 (SCF, 2002). For fifteen compounds (benzo(a)anthracene, benzo(b)fluoranthene, benzo(j)fluoranthene, benzo(k) fluoranthene, benzo(ghi)perylene, benzo(a)pyrene, chrysene, cyclopenta(cd) pyrene, dibenzo(a,h)anthracene, dibenzo(a,e)pyrene, dibenzo(a,h)pyrene, dibenzo(a,i)pyrene, dibenzo(a,l)pyrene, indeno(1,2,3-cd)pyrene and 5-methylchrysene) it concluded that there was clear evidence of mutagenicity/genotoxicity in somatic cells in experimental animals in vivo. With the exception of benzo(ghi)perylene there had also clear carcinogenic effects in various types of bioassays in experimental animals. Although only benzo(a)pyrene has been adequately tested using dietary administration, SCF stated that these compounds may be regarded as potentially genotoxic and carcinogenic to humans and represent a priority group in the assessment of the risk of long-term adverse health effects following dietary intake of PAHs.

294

Monia Perugini and Pierina Visciano

Data from EU surveys indicate that the estimated maximum dietary exposure of adults to each of the most abundant PAHs such as anthracene, phenanthrene, fluoranthene and pyrene may be in the range of 60 – 80 ng/kg bw/day. The dietary exposure to the other PAHs, including the 15 PAHs nominated by the SCF, all but one considered to be both potentially genotoxic and carcinogenic for humans, would be one order of magnitude lower. Thus the estimated maximum daily intake of benzo(a)pyrene from food is approximately 6-8 ng/kg bw/day for a person weighing 70 kg. This estimated maximum daily intake is about 5-6 orders of magnitude lower than the daily doses observed to induce tumours in experimental animals. The SCF concluded that at these levels of intake non-carcinogenic effects are not to be expected and that the risk of heritable effects from dietary exposure to PAHs is low. However, in view of the non-threshold effects of genotoxic substances the levels of PAHs in foods should be reduced to as low as reasonably achievable. The SCF concluded that benzo(a)pyrene may be used as a marker of occurrence and effect of the carcinogenic PAHs in food, based on examinations of PAH profiles in food and on evaluation of a recent carcinogenicity study of coal tars in mice. A conservative assessment would imply that the carcinogenic potency of total PAH in foods would be 10 times that contributed by benzo(a)pyrene alone. The Committee however stressed that though it considers benzo(a)pyrene as a marker of carcinogenic PAH in food, chemical analyses should continue to collect data on the whole PAH profile in order to be able to evaluate the contamination of food commodities and any future change in the PAH profile. In order to protect public health, maximum levels are necessary for benzo(a)pyrene in certain foods containing fats and oils and in foods where smoking or drying processes might cause high levels of contamination. Maximum levels are also necessary in foods where environmental pollution may cause high levels of contamination, in particular in fish and fishery products, for example resulting from oil spills caused by shipping. Commission Regulation (EC) No 1881/2006 fixed the maximum limits for this compound in these foodstuffs (EC, 2006).

LEVELS OF CONTAMINANTS IN MYTILUS GALLOPROVINCIALIS CAUGHT IN DIFFERENT AREAS OF MEDITERRANEAN SEA In the last 10 year we have conducted some studies on the presence of PCBs (congener IUPAC 28, 52, 101, 118, 153 and 180) and OCs in the Adriatic Sea and we have used mussels as bio-indicators. We have selected these compounds because they were recommended by the European Union as indicators of PCB contamination. About the congeners distribution and trend we have compared the PCB mean values found in the year 2002 (Perugini et al., 2004) in samples of Mediterranean mussels (Mytilus galloprovincialis) with those found in the year 2004 (Perugini et al., 2006). For this comparison we have not considered the specific origin of samples that therefore came all from the Adriatic Sea. The PCBs pattern is shown in Figure 1. Both years are characterized by low levels of the heptachlorobiphenyls (PCB 180) and high levels of tritetrachlorobiphenyls (PCB 28 and 52). These results confirm that mussels are indicators of pollution in the water column and are enriched in lower chlorinated congeners which are uptaken directly from water. The comparison of PCB mean values found in 2002 with those

Environmental Impact Assessment of Mussels Caught in Mediterranean Sea…

295

found in 2004 shows an increase of total PCB concentrations. Analyzing the PCBs pattern it is possible to observe that in the year 2002 the penta, hexa and heptachlorobiphenyls showed higher levels than those found in 2004, whereas during these two years a decrease for these congeners was registered against an increase for the lower PCBs (28 and 52). This is probably due to the degradation phenomena that occur in the marine environment and that allow to high-chlorinated compounds to be transformed in low-chlorinated compounds. 2002

2004

100%

80%

60%

40%

20%

0% 180

153

138

118

101

52

28

Figure 1. Distribution pattern of PCBs congeners by number of chlorine atoms in mussels coming from the Central Adriatic Sea in two different years. Each congener refers to PCBs total.

Regarding to the origin of samples in the year 2002 the PCB concentrations were almost the double in mussels coming from Chioggia compared to ones found in mussels coming from Pescara (p < 0.05). It could probably be related to the Venice lagoon industrialization so that mussels were more exposed to pollution. Regarding to the seasonal effects a statistically significant difference (p < 0.05) between the two periods of sampling in the year 2004 was found only for the congeners 28, 101 and 153. No statistical difference (p < 0.05) was observed for the sum of all congeners. The highest PCB concentrations were found in mussels in summer (June-July), while the lowest PCB concentrations were found in winter (February–March). This could be related to the organisms spawning activity as the feeding activity and the lipid storage increase before the reproductive period. The redistribution of fat to different tissues and excretion of eggs during reproduction are an important mean of PCBs losses. In the same samples of mussels we have also quantified the OCs and, in particular, DDTs (p,p‟-DDT and o,p‘-DDT), p,p‟-DDE (dichlorodiphenyldichloroethylene) and p,p‟-DDD (dichlorodiphenyldichloroethane). DDTs and DDD were never detected in mussels collected in 2004, while in those collected in 2002 the highest OCs concentrations were found for p,p‟DDE followed by p,p‟- DDD, p,p‘-DDT and o,p‟-DDT (Figure 2).

Monia Perugini and Pierina Visciano

296

120

2002 2004

100 80 60 40 20 0 pp'-DDD

DDE

op-DDT

DDT

Figure 2. Distribution of OCs in mussels coming from the Central Adriatic Sea in two different years.

The DDTs concentrations were found in mussels coming from Chioggia (Venice lagoon) and their presence could be due to the low capacity of the plankton to metabolize DDT allowing a great accumulation of DDT in filtering organisms. In fact the OCs metabolic efficacy increases from invertebrates to fish. With regard to the geographical influence, differently from PCBs, no relation between OCs concentrations and geographical areas has been found (p > 0.05). It could be a consequence of the wide pollution by OCs in the Adriatic Sea. In both years the DDT/DDE ratio was lower than 1. It has previously been demonstrated that bioaccumulated DDT can be metabolized to DDE. In all mussels, independently from the geographical origin, the p,p‟-DDE concentrations were higher than those of DDTs. These data suggest that the marine contamination is not recent and confirm that, in these areas, these pesticides have not been used in agriculture after their ban. Regarding to the seasonal effects, similarly to PCBs, the highest concentrations of DDE in mussel collected in the year 2004 were found in summer (June-July), while the lowest concentrations (p < 0.01) were found in winter (February–March). We can not establish a seasonal trend for OCs but we can confirm that environmental factors such as salinity, temperature of water, pH or physiologic factors such as habitat, lipid content and feeding behavior, are significant aspects that influence pollutants store and pollutants elimination. The levels of some PAHs (fluorene, FL; phenanthrene, PHE; anthracene, AN; fluoranthene, FA; benzo(a)anthracene, BaA; chrysene, CHR; benzo(b)fluoranthene, BbFA, benzo(k)fluoranthene, BkFA) were detected in samples of Mediterranean mussel (Mytilus galloprovincialis) caught in Adriatic Sea (Perugini et al., 2007a). The highest concentrations were observed for the low molecular weight PAHs, except for BaA (Figure 3).

Environmental Impact Assessment of Mussels Caught in Mediterranean Sea…

297

18 16 14

ppb

12 10

Summer Winter

8 6 4 2 0 FL

PHE

AN

FA

BaA

CHR

BbFA

BkFA

Figure 3. Mean concentrations of different PAHs in mussels caught in Adriatic Sea.

45 40 35

ppb

30 25

Summer

20

Winter

15 10 5

IP

hi P Bg

P Ba hA D

Ba

Bk FA

FA Bb

HR C

Ba A

PY

FA

AN

0

Figure 4. Mean concentrations of different PAHs in mussels caught in Tyrrhenian Sea.

Samples of Mediterranean mussel (Mytilus galloprovincialis) caught in Tyrrhenian Sea (Perugini et al., 2007b) showed high PAH concentrations (Figure 4) of the following compounds: AN, FA, pyrene (PY), BaA, CHR, BbFA, BkFA, benzo(a)pyrene (BAP), dibenzo(a,h)anthracene (DBahA), benzo(ghi)perylene (BghiP), indeno(1,2,3-cd)pyrene (IP). A percentage of 35% showed values of BaP higher than the maximum residue limit, MRL (10 µg/kg wet weight) fixed by European Regulation 208/2005/EC (EC, 2005). This pattern of contamination could depend to the proximity of the sampling site to the filled-in area and to

298

Monia Perugini and Pierina Visciano

the presence of particularly contaminated sediments and materials dumped during land fill. A significant difference was found between seasons (p < 0.01). All samples collected in summer reported BaP values lower than the MRL, while 71.43% of mussels collected in winter exceeded this limit. Total PAH levels found in mussels collected in December were higher than those found in July with a particular congeners distribution. Independent from the season, PAHs composition pattern in mussels was dominated by the presence of PAHs with 4-rings (58%) followed from those with 5-rings (20%), 6-rings (11%) and 3-rings (10%).

CONCLUSION The results of these studies confirm the possibility of accumulation of pollutants in mussels and their use as bio-monitors in aquatic ecosystems. Contaminant data collected from a water body are often highly variable, reflecting environmental factors such as seasonal effects and localized sources or sediment methylation processes. Evaluating these data prior to developing site-specific or consumption advice is a complex process that may involve one or more approaches. Further study needs to be conducted on the suspended particle matter, atmosphere and biota organic pollutant contents, in order to identify the sources, behaviour and fate of these contaminants and make the risk assessment of these compounds on the ecosystems and human health.

REFERENCES Bauer, B., Fioroni, P., Ide, I., Liebe, S., Oehlmann, J., Stroben, E. and Watermann, B. (1995). TBT effects on the female genital system of littorina-littorea––a possible indicator of tributyltin pollution. Hydrobiologia, 309, 15–27. Baumard, P., Budzinski, H., Garrigues, P., Narbonne, J. F., Burgeot, T., Michel, X. and Bellocq, J. (1999a). Polycyclic aromatic hydrocarbon (PAH) burden of mussels (Mytilus sp.) in different marine environments in relation with sediment PAH contamination, and bioavailability. Marine Environmental Research, 47, 415-439. Baumard, P., Budzinski, H., Garrigues, P., Dizer, H. and Hansen, P. D. (1999b). Polycyclic aromatic hydrocarbons in recent sediments and mussels (Mytilus edulis) from Western Baltic Sea: occurrence, bioavailability and seasonal variations. Marine Environmental Research, 47, 17-47. Blankenship, J. E., Rock, M. K., Robbins, L. C., Livingston, C. A. and Lehman, H. K. (1983). Aspects of copulatory-behavior and peptide control of egg-laying in aplysia. Federation Proceedings, 42, 96–100. Branch, G. M. and Steffani, C. N. (2004). Can we predict the effects of alien species? A casehistory of the invasion of South Africa by Mytilus galloprovincialis (Lamarck). Journal of Experimental Marine Biology and Ecology, 300, 189-215. Cajaraville, M. P., Bebianno, M. J., Blasco, J., Porte, C., Sarasquete, C. and Viarengo, A. (2000). The use of biomarkers to assess the impact of pollution in coastal environments of the Iberian Peninsula: a practical approach. The Science of the Total Environment, 247, 201-212.

Environmental Impact Assessment of Mussels Caught in Mediterranean Sea…

299

Carlton, J. T. (1992). Introduced marine and estuarine mollusks of North America: an end-ofthe-20th-century perspective. Journal of Shellfish Research, 11 (2), 489-505. Chou, C. L. and Uthe, J. F. (1991). Effect of starvation on trace metal levels in blue mussels (Mytilus edulis). Bulletin of Environmental Contamination and Toxicology, 46, 473–478. Cohn, B. A., Wolff, M. S., Cirillo, P. M. and Sholtz, R. I. (2007). "DDT and breast cancer in young women: new data on the significance of age at exposure". Environmental Health Perspectives, 115 (10), 1406–1414. Deslou-Paoli, J. M., Sornin, J. M. and Heral, M. (1987). Variations saisonnières in situ de la production et de la composition des biodépots de trois mollusques estuariens (Mytilus edulis, Crassostrea gigas, Crepidula fornicata). Haliotis, 16, 233-245. Edwards, N. T. (1983). Polycyclic hydrocarbons (PAHs) in the terrestrial environment. A review. Journal of Environmental Quality, 12, 427-441. EC (2001). Council Regulation (EC) No 2375/2001 of 29 November 2001 amending Commission Regulation (EC) No 466/2001 setting maximum levels for certain contaminants in foodstuffs. Official Journal of the European Communities, L 321, 6/12/2001, 1-5. EC (2002). Directive 2002/32/EC of the European Parliament and of the Council of 7 May 2002 on undesirable substances animal feed. Official Journal of the European Communities, L 140, 30/05/2002, 10-21. EC (2005). Commission Regulation (EC) No 208/2005 of 4 February 2005 2001 amending Commission Regulation (EC) No 466/2001 as regards polycyclic aromatic hydrocarbons. Official Journal of the European Union, L 034, 08/02/2005, 3-5. EC (2006). Commission Regulation (EC) No 1881/2006 of 19 December 2006 setting maximum levels for certain contaminants in foodstuffs. Official Journal of the European Union, L 364, 20/12/2006, 5-24. EFSA Journal (2005). Opinion of the Scientific Panel on contaminants in the food chain on a request from the Commission related to the presence of non dioxin-like polychlorinated biphenyls (PCB) in feed and food, Question N° EFSA-Q-2003-114, 284, 1-137. Geller, J. B. (1999). Decline of a native mussel masked by sibling species invasion. Conservation Biology, 13 (3), 661-664. Gibbs, P. E., Bryan, G. W. and Pascoe, P. L. (1991). TBT-induced imposex in the dog whelk, nucella-lapillus––geographical uniformity of the response and effects. Marine Environmental Research, 32, 79–87. Gibbs, P. E., Bryan, G. W., Pascoe, P. L. and Burt, G. R. (1990). Reproductive abnormalities in female Ocenebra erinacea (Gastropoda) resulting from tributyltin-induced imposex. Journal of the Marine Biological Association of the United Kingdom, 70, 639–656. Gilman, A., Newhook, R. and Birmingham, B. (1991). Updated assessment of the exposure of Canadians to dioxins and furans. Chemosphere, 23, 1661-1667. Gowland, B. T. G., McIntosh, A. D., Davies, I. M., Moffat, C. F. and Webster, L. (2002). Implications of a field study regarding the relationship between polycyclic aromatic hydrocarbons and glutathione S-transferase activity in mussels. Marine Environmental Research, 54, 231–235. Hülster, A., Müller, J. F. and Marschner, H. (1994). Soil-plant transfer of polychlorinated dibenzo-p-dioxins and dibenzofurans to vegetables of the cucumber family (Cucurbitaceae). Environmental Science and Technology, 28, 1110-1115.

300

Monia Perugini and Pierina Visciano

IARC (1997). Monographs on the evaluation of carcinogenic risks to humans. Volume 69, Polychlorinated dibenzo-para-dioxins and polychlorinated dibenzofurans, Lyon, pp 33343. Juhasz, A. L. and Naidu R. (2000). Bioremediation of high molecular weight polycyclic aromatic hydrocarbons: a review of the microbial degradation of benzo(a)pyrene. International Biodeterioration and Biodegradation, 45, 57-88. Livingstone D. R. (1998). The fate of organic xenobiotics in aquatic ecosystems: quantitative and qualitative differences in biotransformation by invertebrates and fish. Comparative Biochemistry and Physiology, Part A, 120, 43-49. Matson, S. E. (2000). Hybridization of the mussels Mytilus trossulus and Mytilus galloprovincialis: larval growth, survival and early development. Masters Thesis University of Washington. McKim, J. M. (1994). Physiological and biochemical mechanisms that regulate the accumulation and toxicity of environmental chemicals in fish. In: Hamelink, J. L., Landrum, P. F., Bergman, H.L., Benson, W.H., (eds) Bioavailability: Physical, Chemical, and Biological Interactions. Lewis Publishers, Boca Raton, FL, pp 179-201. Metcalf, R. L. (1995). Insect Control Technology. In: Kroschwitz, J., Howe-Grant M., eds. Kirk-Othmer encyclopedia of chemical technology. Volume 14. New York, NY: John Wiley and Sons, Inc., 524-602. Nielsen, T., Jørgensen, H. E., Larsen, J. C. and Poulsen, M. (1996). City air pollution of polycyclic aromatic hydrocarbons and other mutagens: occurrence, sources and health effects. Science of the Total Environment, 189/190, 41-49. O‘Connor, T. P. (1998). Mussel Watch results from 1986 to 1996. Marine Pollution Bulletin, 37, 14–19. Ortiz-Zarragoitia, M., Cajaraville, M. P. (2006). Biomarkers of exposure and reproductionrelated effects in mussels exposed to endocrine disruptors. Archives of Environmental Contamination and Toxicology, 50, 361–369. Painter, S. D. (1992). Coordination of reproductive activity in Aplysia: Peptide neurohormones, neurotransmitters and pheromones encoded by the egg-laying hormone family of genes. The Biological Bulletin, 183, 165–172. Perugini, M., Cavaliere, M., Giammarino, A., Mazzone, P., Olivieri, V. and Amorena, M. (2004). Levels of polychlorinated biphenyls and organochlorine pesticides in some edile marine organisms from the medium Adriatic Sea. Chemosphere, 57, 391-400. Perugini, M., Giammarino, A., Olivieri, V., Di Nardo, W. and Amorena M. (2006). Assessment of edible marine species in the Adriatic Sea for contamination from polychlorinated biphenyls and organochlorine insecticides. Journal of Food Protection, 69, 5, 1144-1149. Perugini, M., Visciano, P., Giammarino, A., Manera, M., Di Nardo, W. and Amorena M. (2007a). Polycyclic aromatic hydrocarbons in marine organisms from the Adriatic Sea, Italy. Chemosphere, 66, 1904-1910. Perugini, M., Visciano, P., Manera, M., Turno, G., Lucisano, A. and Amorena M. (2007b). Polycyclic aromatic hydrocarbons in marine organisms from the gulf of Naples, Tyrrhenian Sea. Journal of Agricultural Food Chemistry, 55, 2049-2054. Pruell, R. J., Lake, J. L., Davis, W. R. and Quinn, J. G. (1986). Uptake and depuration of organic contaminants by blue mussels (Mytilus edulis) exposed to environmentally contaminated sediment. Marine Biology, 91, 497–507.

Environmental Impact Assessment of Mussels Caught in Mediterranean Sea…

301

Robinson, T. B. and Griffiths, C. L. (2002). Invasion of Langebaan Lagoon, South Africa, by Mytilus galloprovincialis: Effects on natural communities, African Zoology, 37, (2), 151158. Rocher, B., Le Goff, J., Peluhet, L., Briand, M., Manduzio, H., Gallois, J., Devier, M. H., Geffard, O., Gricourt, L., Augagneur, S., Budzinski, H., Pottier, D., André, V., Lebailly, P. and Cachot, J. (2006). Genotoxicant accumulation and cellular defence activation in bivalves chronically exposed to waterborne contaminants from the Seine River. Aquatic Toxicology, Volume 79, Issue 1, 65-77. Safe, S., Bandiera, S., Sawyer, T., Robertson, L., Safe, L., Parkinson, A., Thomas, P. E., Ryan, D. E., Reik, L. M. and Levin, W. (1985). PCBs: structure-function relationships and mechanism of action. Environmental Health Perspectives, 60, 47–56. SCF (2002). Opinion of the Scientific Committee on Food on the risks to human health of polycyclic aromatic hydrocarbons in food. SCF/CS/CNTM/PAH/29 Final. Brussels, Belgium, 1-84. Simon, T., Britt, J. K. and James, R. C. (2007). Development of a neurotoxic equivalence scheme of relative potency for assessing the risk of PCB mixtures. Regulatory toxicology and pharmacology, RTP 48, (2), 148–170. Straw, J. and Rittschof, D. (2004). Responses of mud snails from high and low imposex sites to sex pheromones. Marine Pollution Bulletin, 28, 1048–1054. Tilson, H. A. and Kodavanti, P. R. (1998). The neurotoxicity of polychlorinated biphenyls. Neurotoxicology, 19, 517–525. UNEP Chemicals (2002). Regionally Based Assessment of Persistent Toxic Substances. Mediterranean Regional Report. UNEP, Geneve, 148 pp. Wang, S. L., Chang, Y. C., Chao, H. R., Li, C. M., Li, L. A., Lin, L. Y. and Päpke, O. (2006). Body burdens of polychlorinated dibenzo-p-dioxins, dibenzofurans, and biphenyls and their relations to estrogen metabolism in pregnant women. Environmental Health Perspectives, 114, (5), 740-745. White, J. C., Parrish, Z. D., Isleyen, M., Gent, M. P., Iannucci-Berger, W., Eitzer, B. D., Kelsey, J. W. and Mattina, M. I. (2005). Influence of citric acid amendments on the availability of weathered PCBs to plant and earthworm species. International Journal of Phytoremediation, 8, 63-79. Zorita, I., Ortiz-Zarragoitia, M., Apraiz, I., Cancio, I., Orbea, A., Soto, M., Marigómez, I. and Cajaraville, M. P. (2008). Assessment of biological effects of environmental pollution along the NW Mediterranean Sea using mussels as sentinel organisms. Environmental Pollution, 153, (1), 157-168.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 13

COMPETITION FOR SPACE AND FOOD AMONG BLUE MUSSELS Daisuke Kitazawa Institute of Industrial Science, The University of Tokyo, Japan

ABSTRACT A multi-layer structure of blue mussels, Mytilus galloprovincialis, was analyzed by in situ investigation and numerical modeling. Blue mussels usually colonize the surfaces of coastal rocks, artificial structures, and the ropes for aquaculture. They filter the ambient waters to ingest particulate organic matter and to obtain oxygen. Their feeding and respiratory activities cause changes in material cycle. However, the effects of blue mussels on material cycle cannot be easily predicted. Blue mussels colonize several layers of the substrate and subsequently compete for space and food among them. Some of the mussels are pushed to the inner layer of a mussel bed and undergo starvation due to their unfavorable position. They do not contribute to the food-ingestion and oxygenconsumption rates of the mussel bed. In this chapter, a multi-layer structure of blue mussels was analyzed by measuring the oxygen-consumption rates of the mussel bed and by investigating the relationship between the growth of an individual mussel and its position in the mussel bed. Then, an individual-based model was developed to describe the dynamics of blue mussels under competition for space and food. The model consists of a physiological growth submodel and a competition submodel. This model was applied to blue mussels adhering to artificial structures in Tokyo Bay in Japan. We observed that the individual-based model could reproduce the in situ observations and elucidate the multi-layer structure of blue mussels.

INTRODUCTION A blue mussel, Mytilus galloprovincialis, is one of the common animals which adhere to the surface of coastal artificial structures such as jetties, piles, breakwaters, pontoons, and ships in the Temperate Zone [1]. Blue mussels cause many troubles for human activities, in addition to various impacts on the other marine organisms. They colonize water intake pipes,

304

Daisuke Kitazawa

Figure 1. Changes in material cycle caused by feeding and respiratory activities of the mussels on artificial structures such as floating platforms and wind farms.

restricting the water flow to power plants that rely on seawater [2]. They attach to hulls, propellers, or any item immersed in waters, which can be severely impacted by increased drag [3]. The surface of large platforms such as wind farms [4] and very large floating structures [5] provide habitats for blue mussels (Figure 1). They collect food by the filtering out suspended particles, use oxygen for respiration, and excrete feces and nutrients. Hence, they deplete the dissolved oxygen and increase the concentration of nutrients in the surrounding water [5]. The biodepositions of blue mussels fall to the sea bottom, where they cause anoxic conditions and undesirable changes in the benthic ecosystem [6]. Blue mussels increase the abundance of predators by attracting fish [7]. Similar problems were reported for a cultivation raft of blue mussels [8-16]. However, the effects of blue mussels on material cycle cannot be easily predicted. A mathematical model is one of the useful tools to assess the impacts of mussels on material cycle in a quantitative manner. The most common mathematical model of mussels is a biomass-based model that depends on Scope for Growth (SFG) concept [17-18]. The SFG concept is based on the energy balance of a mussel in steady state conditions. If the difference between gained and lost energies is positive, energy is available for growth and reproduction. In the other case, there is a weight loss due to the utilization of energy reserves [17]. The problem with this approach is that it does not discriminate the storage of reserved materials such as lipids and glycogen from structural materials [19]. Consequently, this approach does not discriminate between fed and starved mussels in a mussel bed. In general, mussels are usually attached on each other in several layers [20], with subsequent competition for food among them. Figure 2 shows the picture of a multi-layer structure of mussels around the estuary of Sumida River in Tokyo Bay in Japan. The competition undoubtedly leads to reduced availability of food for mussels that form the inner layers. Some of the mussels must be starved in the inner layers and does not contribute to food-ingestion and oxygenconsumption rates of the mussel bed. In order to improve the accuracy of the mathematical model, it should include modeling of a density effect and competition for space and food among mussels.

Competition for Space and Food among Blue Mussels

305

Figure 2. The picture of a multi-layer structure of mussels around the estuary of Sumida River in Tokyo Bay in Japan.

In the present study, in situ investigation is tried to understand a multi-layer structure of a mussel bed. The observed parameters are water quality, food-consumption and oxygenconsumption rates of mussels [21], and a multi-layer structure of the mussel bed [22]. Foodconsumption and oxygen-consumption rates are investigated for the mussels on flat substrata. The multi-layer structure is examined for the mussels on cylindrical substrata. Then an individual-based model is introduced to describe the dynamics of mussels as controlled by competition for space and food availability. The model consists of a physiological growth submodel based on Dynamic Energy Budget (DEB) model [23], and a competition submodel. DEB model distinguishes reserved materials from structural materials to discriminate between fed and starved mussels. The parameters of the physiological growth submodel are calibrated by using laboratory experiment data of mussels in various literatures. The competition submodel is described as a function of population density of mussels, and the parameters of the competition submodel are calibrated by observations of mussels growing on the artificial substrata suspended from a floating platform installed in the head of Tokyo Bay in Japan.

2. IN SITU INVESTIGATION 2.1. Location of Investigation Field investigation was carried out around a floating platform, which moors the training ship Shioji-maru of Tokyo University of Marine Science and Technology in the estuary of Sumida River in Japan (Figure 3). Sessile organisms adhered to seawalls and piles around the floating platform, and the most dominant species was a blue mussel Mytilus galloprovincialis.

2.2. Method The observed parameters were water quality, food-consumption and oxygen-consumption rates of the mussel bed, and a multi-layer structure of mussels on artificial substrata.

306

Daisuke Kitazawa

Figure 3. The location of in situ investigation and the arrangement of equipments and substrata for monitoring of water quality and examination of a multi-layer structure of mussels, respectively.

2.2.1. Water Quality Water quality was recorded continuously to obtain the boundary conditions for numerical simulation. The first recording of water quality was carried out from July 2002 to February 2003 and from June to August 2003. The measured parameters were water temperature, salinity, turbidity, the concentrations of chlorophyll a and dissolved oxygen. A memory water quality profiler (Sanyo Sokki Ltd.) and a compact memory chlorophyll meter (Alec Electric Corporation Ltd.) were suspended by ropes from the floating platform (Figure 3). The position of these meters was kept at 50cm below sea surface. The sensors of meters were cleaned every two weeks (every one week in summer) to prevent fouling by sessile organisms. At the same time, the recorded data were transferred from the memories in the meters to a computer. The second measurement of water quality was carried out from April 2005 to November 2006. Water temperature, salinity, dissolved oxygen concentration, and chlorophyll a concentration were recorded every 10 minutes by a compact memory temperature and conductivity meter (Compact-CT, Alec Electric Corporation Ltd.), a compact memory DO meter (Compact-DOW, Alec Electric Corporation Ltd.), and a compact memory chlorophyll meter (Compact-CT, Alec Electric Corporation Ltd.).

Competition for Space and Food among Blue Mussels

307

In addition to the above parameters, the concentrations of particulate organic matter (POM) and particulate inorganic matter (PIM) are used for a numerical model. POM is defined as the organic particles, the size of which is larger than 0.45 m. Their concentrations were estimated from the data monitored at Tsukuda Bridge and Reimei Bridge once a month during April 1998 and March 2005 (Figure 3). The ratios of chemical oxygen demand (COD) to total organic carbon (TOC), and of particulate organic carbon (POC) to dissolved organic carbon (DOC) were calculated from COD, TOC, and DOC monitored at Reimei Bridge. Then TOC and POC were estimated from the mean COD value measured at Tsukuda Bridge and Reimei Bridge. POM was calculated by dividing POC by 0.43 [24]. PIM is the difference between POM and the mean suspended solid (SS) at Tsukuda Bridge and Reimei Bridge. PIM is not a food for blue mussels but exerts large effects on their feeding activities.

2.2.2. Food-Consumption and Oxygen-Consumption Rates of Blue Mussels To collect the aggregation of blue mussels, several artificial substrata were suspended by using the net (Figure 4). Weights were attached to the top and bottom of the net to stabilize the substrata. Each net has three substrata made of polyvinyl chloride with 30 cm in diameter. Three sets of the net with three substrata were suspended by ropes from the floating platform, and the position of the center of substrata was kept at 50cm below sea surface. The net was raised on the floating platform every two weeks and mussels were sampled from one of the substrata. The mussels were immediately transported to the laboratory to examine wet weight and shell length of each mussel on the area of one-sixth of each substratum. The oxygen consumption rate of blue mussels was measured by using a bell jar with several sensors of measuring water quality (Figure 5). In this experiment, blue mussels on one of the substrata and the surrounding seawater were enclosed without air in the bell jar for 45 minutes. Water temperature, salinity, the concentrations of chlorophyll a and dissolved oxygen were measured every one minute just after the seawater was mixed well by a stirrer. The oxygen consumption rate was calculated based on the decrease in the concentration of dissolved oxygen in the first 10 minutes. The experiments were carried out several times during September and December in 2002 and during June and August in 2003.

Figure 4. Schematic representation of suspension of substrata made of polyvinyl chloride on the sidewall of the floating platform.

308

Daisuke Kitazawa

Figure 5. A bell jar with several sensors of measuring water quality for investigation of foodconsumption and oxygen-consumption rates of mussels (revised from [21]).

2.2.3. Multi-Layer Structure of Blue Mussels An acrylic plate of 20 cm and a nylon rope of 10 mm in diameter were suspended from the floating platform from April 2005 (Figure 6). The acrylic plates were connected by the nylon ropes, at the bottom of which weights were attached to stabilize the position of substrata. A multi-layer structure of blue mussels was measured according to the following steps. 1) The blue mussels on a acrylic plate of 100 cm2 were collected to examine the relationship between the size and the position of each mussel as a preliminary experiment. Then the blue mussels on a rope of 10 cm were collected for an actual experiment. The collected mussels were transported immediately to the laboratory. 2) The position of each mussel in a mussel bank was determined by a certain criterion. The detail of the criterion will be described later. 3) Waters on the surface of mussels were wiped up and the wet weight of each mussel was measured by an electronic balance. 4) The fresh body was taken away from the shells and dried for a day. The dry weight of each mussel was measured by an electronic balance. 5) The length of shells was measured by a scale. In the preliminary experiment, the distance of each mussel from the substrata was measured and compared with its size and dry weight. However, little relationship could not be found between the distance and the size or dry weight of each mussel. Hence the distance from the surface of a mussel bed was adopted as a criterion which determines the position of each mussel in the mussel bed. A mussel intakes seawater with food and oxygen from between the shells. It was assumed for the following analysis that 30% of the perimeter of a mussel is a gape of shells (Figure 7). However, further studies are needed to know where blue mussels intake waters by visualizing water current around shells.

Competition for Space and Food among Blue Mussels

309

The position of each mussel was categorized according to the gape of shells observed from the surface of the mussel bed.   

The 1st layer: The gape of shells completely comes out from the surface of the mussel bed. The 2nd layer: The gape of shells partly comes out from the surface of the mussel bed. The 3rd layer: The gape of shells is completely in the mussel bed.

Actually, each mussel was observed from the surface of the mussel bed and different colors were marked for the mussels in 1st and 2nd layers.

Figure 6. Schematic representation of suspension of substrata on the sidewall of the floating platform.

Figure 7. Definition of the gape of shells on the basis of observation from the surface of the mussel bed (revised from [22]).

310

Daisuke Kitazawa

2.3. Results 2.3.1. Water Quality Figure 8 shows the time histories of water temperature, salinity, and dissolved oxygen concentration from September 2002 to January 2003. Figure 9 represents the time histories of water temperature, salinity, and dissolved oxygen concentration from September 2005 to August 2006. Water temperature ranged between 10 and 28 oC in winter and summer, respectively. Time variability of salinity was based on tidal currents and salinity varied by 10 psu in a day during spring tide. The concentration of dissolved oxygen decreased in summer due to low solubility and oxygen consumption by bacterial decomposition of organic matters. Figure 10 shows the time variability of suspended solid (SS), particulate organic matter (POM), particulate inorganic matter (PIM), and chemical oxygen demand (COD) averaged during April 1998 and March 2005. The concentration of POM was relatively higher in June, while it was lower in January. The concentration of PIM was about 3 times as large as that of POM.

Figure 8. The time histories of water temperature, salinity, and dissolved oxygen concentration from July 2002 to January 2003.

Competition for Space and Food among Blue Mussels

311

Figure 9. The time histories of water temperature, salinity, and dissolved oxygen concentration from September 2005 to August 2006.

Figure 10. The time histories of the concentrations of suspended solid (SS), particulate organic matter (POM), particulate inorganic matter (PIM), and chemical oxygen demand (COD) averaged during April 1998 and March 2005.

312

Daisuke Kitazawa

Figure 11. The time histories of wet weight and population number of mussels on a substratum, and the mean wet weight and shell length of mussels.

Figure 12. The time variability of the concentrations of chlorophyll a and dissolved oxygen in the bell jar on October 28, 2002.

2.3.2. Growth, Food-Consumption, and Oxygen-Consumption Rates Figure 11 shows the time variability of wet weight and population number of mussels on substratum, and the mean wet weight and shell length of mussels. A blue mussel was the most dominant species a few months later, while the abundance of mussels was almost same as that of the other organisms such as barnacles at the beginning of the experiment. The growth of mussels was smaller caused by low salinity and dissolved oxygen concentration. The shell length of one-year mussel was smaller in the Japanese coastal seas [25-26] than that of the same mussels cultivated at the north-west coast of Spain: 3-4 cm/year [27]. Figure 12 shows one of the results of the changes in the concentrations of chlorophyll a and dissolved oxygen in the bell jar on October 28, 2002. Water temperature, salinity, and wet weight of sessile organisms were 19.7 oC, 20.7 psu, and 464.6 g, respectively. Both concentrations of chlorophyll a and dissolved oxygen decrease in the bell jar. The

Competition for Space and Food among Blue Mussels

313

consumption rates decreased after 10 minutes from the beginning of the experiment. The food-consumption and oxygen-consumption rates were calculated by using the changes in the concentrations in 10 minutes from the beginning of the experiment. Table 1 summarizes the mean consumption rates of chlorophyll a and dissolved oxygen in 10 minutes from the beginning of the experiment. Table 1. The decreasing rates of chlorophyll a (g g-1 day-1) and dissolved oxygen (mg g-1 day-1) per 1g (wet weight) of mussel averaged in 10 minutes from the beginning of the experiments

Date 4/Feb./2002 10/Sep./2002 4/Oct./2002 11/Oct./2002 28/Oct./2002 11/Nov./2002 2/Dec./2002

20/Dec./2002

6/June/2003 16/June/2003 23/June/2003

30/June/2003 28/July/2003 11/Aug./2003 29/Aug./2003

T (oC)

S (psu)

Chl-a (g L-1)

DO (mg L-1)

10.3 24.7 22.6 21.8 21.9 19.7 19.7 17.5 17.5 14.7 14.9 14.9 15.0 12.5 12.5 12.6 22.6 22.1 23.0 22.8 23.6 23.5 23.5 24.2 24.4 22.6 22.2 26.2 25.4 26.6 26.1

32.6 9.3 10.3 19.8 21.5 20.7 24.9 26.2 28.4 26.6 31.4 31.0 31.4 28.9 28.0 30.9 12.9 14.2 13.1 12.7 17.2 17.0 18.0 12.5 11.5 9.5 10.7 1.8 2.3 9.4 8.6

3.0 2.6 2.8 2.0 1.9 2.4 1.8 1.5 1.5 1.8 1.4 1.2 1.6 1.8 1.8 1.8 5.2 4.3 3.7 4.0 5.2 5.7 10.0 4.7 3.1 4.5 3.4 4.7 3.8 5.9 5.8

8.4 1.4 4.2 4.4 4.5 3.5 4.0 5.0 5.6 5.7 5.9 6.3 6.4 6.6 6.3 6.7 7.0 7.7 2.2 3.0 5.1 5.4 6.4 1.7 3.4 2.9 2.5 3.2 3.2 2.4 2.1

Wet weight (g) 1500.0 355.4 572.5 441.7 441.7 464.6 464.6 484.6 484.6 474.3 760.8 474.3 474.3 380.0 380.0 380.0 1500.0 1500.0 1760.0 1230.0 2030.0 1830.0 300.0 2130.0 1640.0 2270.0 2270.0 1980.0 1980.0 660.0 660.0

Decreasing rates Chl-a DO 3.98 1.75 0.00 3.70 1.15 1.15 3.79 5.95 4.60 7.85 8.62 6.43 4.24 9.00 4.19 2.84 3.45 4.56 4.16 2.14 2.67 3.93 2.77 5.42 5.54 4.28 3.62 4.88 3.62 2.20 6.13 2.52 8.21 2.67 3.55 5.62 1.15 1.39 1.65 3.45 6.21 5.96 10.74 6.43 5.32 8.98 4.99 1.76 0.00 4.33 0.90 1.79 0.58 1.87 0.85 0.72 0.00 1.48 0.00 5.34 0.00 4.53

T: Water Temperature, S: Salinity, Chl-a: Chlorophyll a, DO: Dissolved Oxygen.

The consumption rates were standardized by 1 g of wet weight of mussels. In general, the consumption rate of chlorophyll a is larger in summer due to high water temperature and high levels of chlorophyll a concentration. However, the consumption rate of chlorophyll a was

314

Daisuke Kitazawa

sometimes lower due to low salinity and dissolved oxygen concentration. The mussels ceased filtering out water if salinity was less than 15 psu. The same phenomenon was reported for Mytilus edulis [28-29]. A salinity change also caused a reduced oxygen consumption of mussels [30]. The minimum consumption rate of dissolved oxygen was 0.72 mg g-1 day-1, while the minimum consumption rate of chlorophyll a was zero. This is because oxygen was consumed by bacterial decomposition of organic matters and mussels do not cease their respiratory activities under the conditions of low salinity and dissolved oxygen concentration.

2.3.3. Multi-Layer Structure of the Mussel Bed A multi-layer structure was analyzed for blue mussels on a rope as a cylindrical substratum. Sessile organisms began settling on ropes in September 2005. Barnacles were dominant at the beginning, and then overwhelmed by blue mussels. Mytilus galloprovincialis was the most dominant species and occupied about 90% of all the sessile organisms on the basis of population number. As a preliminary experiment, the mussels on acrylic plates were collected on May 31 and on June 16, 2006. The mussels on ropes were collected on July 31, August 10, August 21, September 5, and November 6, 2006. Figure 13 shows the relationship between the shell length and the dry fresh weight of (a) all the mussels, (b) the mussels in May, (c) the mussels in July, and (d) the mussels in September. The dry fresh weight was proportional approximately to the third powered shell length. However the dry fresh weight was quite different for each mussel even in the same category of shell length. This shows that the mussels with the same shell length had a wide range of dry fresh weight, and include both fed and starved mussels. The dry weight of mussels was smaller in May due to the effect of spawning. Figure 14 represents the frequency distribution of population number of the mussels in each layer for each category of shell length on August 21, 2006. The mussels in the 3rd layer grew slower and the mean shell length was 7.2 mm. They seemed to cease growing and to survive by consuming reserved materials little by little by standard respiration. The mean shell length of mussels in the 2nd layer (17 mm) was smaller by 4.8 mm than that in the 1st layer (21.8 mm). If the other mussels settle on a mussel, it is difficult for the mussel to open shells to intake waters which include food and oxygen. However, the difference of growth between the 1st and 2nd layers was not significant. This is because the mussels in the 2nd layer were pushed to the inner layer just before the investigation date. Table 2 summarizes the population number per 10 cm of a rope and the estimated occupation area. An occupation area of a mussel (SA,j [m2]) was estimated by the length of shells (Lj [mm]) using the following relationship [31].

 0.55 L1j.44 106 Lj  10 SA, j   0.1587 L2j 106 Lj  10

(1)

The area of the rope was calculated as 31.4 cm2. The total occupation area of mussels was more than 31.4 cm2, so a multi-layer structure of mussels was formed on all the investigation dates. Assuming that only the mussels in the 1st layer were active, the ratio of active mussels to total mussels was 46-75%.

Competition for Space and Food among Blue Mussels

315

Figure 13. The relationship between the shell length and the dry fresh weight of (a) all the mussels, (b) the mussels in May,(c) the mussels in July, and (d) the mussels in September [22].

Figure 14. The frequency distribution of population number of the mussels in each layer for each category of shell length on August 21, 2006 [22].

Daisuke Kitazawa

316

Table 2. The population number of mussels in each layer and the area occupied by mussels (per 10 cm of the rope) Date 31 July

1st layer 147 49.4 74 58.7 133 108.5 161 121.5 108 80.4

10 Aug. 21 Aug. 5 Sep. 6 Nov.

2nd layer 49 13.8 41 20.9 72 37.7 53 40.5 110 45.6

3rd layer

13 4.8 13 1.3 16 1.8 15 1.6

Upper: population number (individuals). Lower: the area occupied by mussels (cm2).

3. NUMERICAL MODELING In this section, competition for space and food (CSF) among mussels is modeled for quantitative analysis. The biomass-based and individual-based models are compared for the mussels on a flat substratum. Then the individual-based model is applied to the mussels on a cylindrical substratum.

3.1. Biomass-Based Model In the SFG concept [17-18], the time variability of body weight of an individual mussel in terms of carbon can be described.

Wi  a Wi  b Wi t

(2)

where t is time, Wi (mgC) a body weight of an individual mussel in terms of carbon, a (day-1) the relative rate of energy gain by feeding, and b (day-1) the relative rate of energy loss by respiration. Let N (m-2) the population density of mussels, the time variability of total body weight of mussels can be written

Wt  aW  bW N

N

i

i1

i1

N

i

i1

i

The total body weight can be replaced by the biomass per unit area B (mgC m-2).

(3)

Competition for Space and Food among Blue Mussels

B  a  B b B t

317

(4)

In the present study, the energy loss process is divided into production of feces (Pfcsb), standard, routine, and active respirations (Psrsb, Prrsb, and Parsb) [32], and spawning (Pspnb) as shown in Figure 15.

B  P P P P P P t igsb fcsb srsb rrsb arsb spnb

(5)

where Pigsb (mgC day-1) denotes food ingestion. The terms except spawning in the right side of the equation (5) are formulated as a linear function of biomass, while a special function is used for spawning which occurs in particular seasons. However, the equation (5) does not include density effect, which consists of death and fall to sea bottom caused by competition among mussels. A density effect is usually formulated by adding another term which is proportional to the squared biomass.

B  Pigsb Pfcsb  Psrsb Prrsb Parsb PspnbPdthb t

(6)

where Pdthb (mgC day-1) is the decrease in the biomass of mussels due to the density effect. Table 3 shows modeling of each process in the equation (6) with several physiological parameters (Table 4) based on modeling of suspension-feeder [33]. The coefficient of the decrease in the biomass of mussels due to the density effect, dthb in Table 4, is a tuning parameter calibrated by the observed data. Actually, the fall of mussels is related to the drag caused by water current and their positions in a mussel bed [41].

Figure 15. Energy flow of a mussel in the biomass-based model.

Daisuke Kitazawa

318

Table 3. Modeling of each process in the biomass-based model [34] Process Modeling of Each Process (mgC day-1) Ingestion Pigsb  min Pfltb  CmgC, Pigsbm





Pigsbm igsbm B Pfltb   fltb  1  2  fTf  f Sf  f DO  B Kses 1  , Cses  CPOM  CPIM Kses  Cses E PF 2  PF GAIN PF , EGAIN  Pigsb  Pfcsb  Parsb  Prrsb, ELOSE  Psrsb EGAIN  ELOSE fTf  expTf T  S psf f Sf  psf S  S fpsf0   DO  f DO  min1, DO  DO S min   32 O2 DOS  T  22.41    273.15

100   T  273.15 ln O2  173.4292 249.6339   143.3483ln   T  273.15  100  T  273.15   T  273.15  21.8492   S 0.033096 0.014259   100     100  2 T  273.15   0.0017    100   CmgC  0.43 CPOM

  C  Pfcsb   fcsb  Pigsb,  fcsb 10.821 exp 5.01 POM  0.21   Cses   Respiration Psrsb  srsb  B Parsb  arsb Pigsb Prrsb  rrsb  fTr  f Sr  f DO  B fTr  expTf T  S psf f Sr  psf S  S fpsf0 Feces

Spawning Density effect

Pspnb  2  spnb Pdthb  spnb B2

54 5 52  t  Ds2





2

Competition for Space and Food among Blue Mussels

319

Table 4. Physiological parameters calibrated by the existing laboratory experiment data Parameter filtration rate maximum ingestion rate ratio of carbon to dry weight in particulate organic matter half saturation constant scaling factor of filtration limiting function ratio of active respiration routine respiration rate standard respiration rate coefficient of dissolved oxygen limitation temperature effect for filtration temperature effect for respiration salinity effect for filtration salinity effect for respiration day of spawning partitioning parameter ratio of maximum reserved materials density effect or fall of mussels

Biomass-based model 2.9 x 10-4 (fltb [m3 day-1]) 6.0 x 10-2 (igsmb [mgC day-1])

Individual-based model 1.56 x 10-5, 2.09 (flti [m3 day-1], flti [-]) 1.0 x 10-3, 2.54 (igsmi [mgC day-1], igsmi [-])

Source [35-36] [37] [24]

0.43 (CPOM [-]) 11300 (Kses [mg m-3])

[35] [33]

8 (PF [-]) [18]

0.16 (ars (-)) 1.7 x 10-3 (rrsb [day-1]) 8.3 x 10-3 (srsb [day-1])

2.0 x 10-3 (rrsi [day-1]) 1.0 x 10-2 (srsi [day-1])

[36] [36] [21]

0.5 (DOmin [-]) 0.02 (Tf [oC-1])

[38]

0.02 (Tr [oC-1])

[38]

15.5, 6.8 (Sf0 [psu], psf [-]) 12.0, 3.6 (Sr0 [psu], psr [-]) 1/May (Ds [day])

[21] [21]

-

0.85 (k [-]) 0.2 (WRM [-])

1.3 x 10-8 (dthb [1 mgC-1 day-1])

0.99985 (dthi,j [-])

[27] [39] [40] tuning parameter

3.2. Individual-Based Model In an individual-based model, mussels are divided into several groups based on how long they are starved in the inner layers of the mussel bed. Let Nj and Wj the population density and mean body weight in terms of carbon in the group j,

B  Wi  NjWj N

NL

i1

j1

(7)

320

Daisuke Kitazawa

where NL is the number of groups. The indicators of j=1, 2 to NL-1, and NL mean the groups of surface, inner, and dead mussels, respectively. The time variability of biomass of mussels can be described

N  B NL  Wj   N j Wj j  t t t  j1 

(8)

The individual-based model consists of the terms of time variations in mean body weight and population density for each group, which are formulated by a physiological growth and competition submodels, respectively.

3.2.1. Physiological Growth Submodel Figure 16 shows the physiological growth submodel on the basis of DEB model [23]. Body weight of a mussel is divided into three materials; reserved materials (WR,j (mgC)), structural materials (WS,j (mgC)), and gonadal materials (WG,j (mgC)). The total weight of a mussel can be described in terms of carbon.

Wj WR, j WS, j WG, j

(9)

Based on energy flow through a mussel body (Figure 16), a mussel filters the surrounding suspended particles, which consist of particulate organic and inorganic matters. Some of the particulate organic matters are excreted as feces, and the others are ingested and accumulated in the reserved materials. Some of the reserved materials are transported to structural and gonadal materials. Hence the time variability of the reserved materials can be written

WR, j  Pigsi, j  Pfcsi, j  Pcnsi, j t

(10)

where Pigsi,j, Pfcsi,j, and Pcnsi,j (mgC day-1) denote the ingestion of particulate organic matters, the production of feces, and the consumption of reserved materials, respectively.

Competition for Space and Food among Blue Mussels

321

Figure 16. Energy flow of a mussel in the individual-based model. Dynamic Energy Budget (DEB) is revised.

The fixed part,  (-), of the consumption of reserved materials is utilized for growth and maintenance of structural materials [39], which are closely connected to shell length. The relationship between structural materials and shell length can be described by the following allometric equation (re-calculated from [31]).

WS, j  0.0117 L2j.55

(11)

where Lj is shell length (mm). The difference between the organic matters transported to structural materials and the consumption for standard, routine, and active respirations is used for growth. The time variability of structural materials can be described

WS, j    Pcnsi, j  Psrsi, j  Prrsi, j  Parsi, j t

(12)

where Psrsi,j, Prrsi,j, and Parsi,j (mgC day-1) represent standard, routine, and active respirations, respectively. The remaining part, 1-, of the ingested particulate organic matters is transported to the gonadal materials and they are released in spawning seasons. The time variability of the gonadal materials can be written

WG, j  1  Pcnsi, j  Pspni, j t

(13)

where Pspni,j (mgC day-1) is spawning. In the same way as the biomass-based model, each process is formulated by a few equations (Table 5), which includes several physiological parameters (Table 4).

Daisuke Kitazawa

322

3.2.2. Competition Submodel The competition for space and food among mussels is modeled as a function of population density of mussels. The process of settlement of larvae is not taken into account. The population number N0 (individuals m-2), shell length L0 (mm), reserved materials WR0 (mgC), structural materials WS0 (mgC), and gonadal materials WG0 (mgC) are given as initial conditions.

N1  N0, L1  L0, WR,1 WR0, WS,1 WS0, WG,1 WG0

(14)

The mussels start growing and shell length, reserved, structural, and gonadal materials for each group are predicted by the physiological growth submodel. The growth of mussels leads to competition for space. An occupation area of a mussel (SA,j m2) with the shell length of Lj is calculated as described in Eq. (1). The total occupation area of mussels (STA m2) can be described.

STA  Nj SA, j NL

j1

(15)

The total occupation area of mussels is compared with the capacity area of the substratum (SC m2). In the case of a flat substratum, the capacity area is always 1 m2 (Figure 17). In the case of cylindrical substratum, the capacity area is expanding with the growth of mussels (Figure 18). The capacity area is calculated every time step on the basis of the mean shell length of mussels pushed to the inner layer. If the total occupation area of mussels exceeds the capacity area, the extra mussels are pushed to the inner layer. The time variability of population number in each group can be described.

S  S  N1 N2 SA  SC    A C  N1,   N1 t SC t SC

(16)

The shell length, reserved, structural, and gonadal materials of mussels in the 2nd group can be described as the mean values between the mussels in the 1st and 2nd groups.

Competition for Space and Food among Blue Mussels

323

Table 5. Modeling of each process in the individual-based model [34] Modeling of Each Process (mgC day-1) Ingestion

Pigsi, j  minPflti, j  CmgC, Pigsim, j  Pigsim, j  igsim Ljigsim

Pflti, j   flti  1  2  fTf  f Sf  f DO  Lj flti Kses 1  , Cses  CPOM  CPIM Kses  Cses E PF 2  PF GAIN PF , EGAIN  Pigsb  Pfcsb  Parsb  Prrsb, ELOSE  Psrsb EGAIN  ELOSE fTf  expTf T  S psf f Sf  psf S  S fpsf0   DO  f DO  min1, DO  DO S min   32 O2 DOS  T  22.41    273.15

Feces

100   T  273.15 ln O2  173.4292 249.6339   143.3483ln   T  273.15  100  T  273.15   T  273.15  21.8492   S 0.033096 0.014259   100     100  2 T  273.15   0.0017    100   CmgC  0.43 CPOM Pfcsi, j   fcsi  Pigsi, j









  Cses

 

 fcsb 10.821 exp 5.01 CPOM  0.21 Respiration

Psrsi, j  srsi  WS, j Parsi, j  arsi  Pigs, j Prrsi, j  rrsi  fTr  f Sr  f DO  WS, j fTr  expTf T  S psf f Sr  psf S  S fpsf0

Spawning

Pspni  2 spni, 

Fall of mussels

Pdthi, j  dthi, j  N1

54 2 5 52  t  Ds2





324

Daisuke Kitazawa

Figure 17. Competition for space among mussels on a flat substratum [34].

Figure 18. Competition for space among mussels on a cylindrical substratum [22].

Competition for Space and Food among Blue Mussels

SA  SC n n SA  SC n n  N1  L1  N2n  Ln2  N1 WR,1  N2n WRn,2 S S C C Ln21  , WRn,21  , SA  SC n SA  SC n n  N1  N2  N1  N2n SC SC SA  SC n n SA  SC n n  N1 WS,1  N2n WSn,2  N1 WG,1  N2n WGn,2 SC SC WSn,21  , WGn,21  SA  SC n SA  SC n  N1  N2n  N1  N2n SC SC

325

(17)

where n is time step. The mussels in the inner layers are divided into several groups based on how long they are starved in the inner layers of the mussel bed. A new group is produced every t days (Figure 19).

Nnj11  Nnj , Lnj11  Lnj , WRn,j11 WRn, j , WSn,j11 WSn, j , WGn,j11 WGn, j for2  j  NL (18) Production of a new layer will undoubtedly lead to food shortage and starvation for the mussels in the inner layer due to their unfavorable position. The inner mussels are assumed to cease food ingestion, routine, and active respirations, and to continue living by consuming the reserved materials only by standard respiration. The time variations in structural, reserved, and gonadal materials can be described.

WR, j  Bcnsi, j 2  j  NL1 t

(19)

WS, j    Bcnsi, j  Bsrsi, j 2  j  NL1 t

(20)

WG, j  1  Bcnsi, j  Bspni, j 2  j  NL1 t

(21)

When the reserved materials are exhausted, the mussels must die. The shells of dead mussels are assumed to remain in the inner layer of the mussel bed and contribute to the thickness of the bed. However, the fresh bodies of dead mussels are decomposed immediately by bacteria. This bacterial decomposition consumes oxygen and produces nutrients at the same time. The reserved, structural, and gonadal materials are set to be zero.

Daisuke Kitazawa

326

Figure 19. The relationship between a layer and a group in the competition submodel [22].

Finally the model should include the effect of fall of mussels to sea bottom. If some of the mussels in the surface layer of the mussel bed are assumed to fall to the sea bottom,

N1  Pdthi t

(22)

where Pdthi (individuals m-2) is the fall of mussels to the sea bottom. The coefficient included in this process is a tuning parameter calibrated by the observed data.

3.3. Results 3.3.1. Comparison of the Biomass-Based and Individual-Based Models The mathematical models were applied to the mussels growing on the flat substrata suspended from the floating platform anchored in the estuary of Sumida River. Numerical simulations were carried out for the period from September 2002 to August 2003. The initial biomass of mussels was set to be 236 gC m-2 for the biomass-based model. In the individualbased model, the initial shell length and population density of mussels were 5 mm and 300,000 individuals m-2, respectively, depending on the observation. The initial structural materials were automatically calculated as 0.87 mgC by the Eq. (11), and the initial gonadal materials were assumed to be 0 mgC since the mussels with the shell length of 5 mm were not still mature. The mussels were divided into 9 groups, which had the 9 levels of reserved materials from 10 to 90 percents of the maximum ones, since the mussel bed had several layers even at the initial condition. The total biomass of mussels in the individual-based model corresponded to that in the biomass-based model. The time records of water temperature, salinity, dissolved oxygen, particulate organic and inorganic matters were used as boundary conditions.

Competition for Space and Food among Blue Mussels

327

Figure 20. The time history of total weight of mussels observed and predicted by the biomass-based model.

Figure 20 compares the time histories of total weight of mussels in terms of carbon observed and predicted by the biomass-based model. The observed biomass began at 236 gC m-2, continued increasing with the growth of mussels, and reached about twice the initial value of biomass as indicated by circles. The parameter value of the density effect was calibrated to achieve a good agreement between the observed and predicted results as represented by a black solid line. The sudden drop of biomass in May corresponded to release of gonadal materials with spawning. However there are no available information on time variability of the biomass of mussels before and after spawning for validation of the model. The observed changes in total weight (Fig. 21 (a)), mean shell length (Fig. 21 (b)), and population number (Fig. 21 (c)) were compared with the predicted ones by the individualbased model. The oscillations in the predicted results were caused by decrease in the biomass of mussels which were starved to death in the inner layers. The number of mussels fallen to the sea bottom was calibrated by comparing the observed and predicted results of the population number (Fig. 21(c), Table 5). The decrease in mussels due to the density effect was attributed mainly to competition for space and food availability. The predicted mean shell length of all the mussels agreed well with the observation data as compared in Fig. 21(b). The mean shell length increased by 2 cm at an approximately constant rate in an year. The population number began at 300,000 individuals per square meters. It decreased rapidly with starved death of mussels in the inner layers of the mussel bed, and was less than 2000 individuals after an year. The growth rate of mussels was smaller than that of the same mussels cultivated at the north-west coast of Spain [27]. One of the reasons is the effect of low salinity and dissolved oxygen concentration as already mentioned above. Another reason of the slow growth rate is low food quality in the sea area. In general, the feeding behavior of mussels is based on the diverse nature of available food within natural environments, comprising a variable mixture of algal cells, detritus, and silt [42-43]. This may be because there is no physiological regulation of the filtration rate to food quality [24, 44].

328

Daisuke Kitazawa

Figure 21. The time history of (a) total weight of mussels, (b) mean shell length, and (c) total population number observed and predicted by the individual-based model.

Competition for Space and Food among Blue Mussels

329

Figure 22. The time history of the oxygen consumption rate of mussels standardized by their total weight in terms of carbon.

In the north-west coast of Spain, the mean concentrations of particulate organic and inorganic matters (POM and PIM, respectively) are both around 0.5 mg/l. In the studied sea area, the mean concentration of POM (around 1.3mg/l) is relatively higher. However the mean concentration of PIM (around 3.8mg/l) is much higher than that of POM. This is the reason why the growth of mussels is slower in the sea area. The contents of the particulate organic matters may also exert large effects on feeding activities of mussels [45-46]. Low growth rate of mussels is attributed not only to the environmental conditions but also to the limitations of space and food [47]. The opening of the shells is reduced by the pressure that the mussels exert on each other [48]. In the individual-based model, the shells of dead mussels were assumed to remain in the mussel bed. The number of layers continued increasing and the mussel bed had a multi-layer structure at the last of numerical simulation. However, most of them were dead mussels and the number of layers composed by live mussels decreased from the initial value of 1.6 to less than 1. The mussel bed finally had mono layer structure. Figure 22 shows the time history of the oxygen consumption rate of mussels standardized by their total weight in terms of carbon. The dots, gray, and black solid lines indicate observations, predictions by the biomass-based and individual-based models, respectively. The oxygen consumption rates ranged between 20 and 50 mg gC-1 day-1 except the higher values observed in June, 2003. The results predicted by the individual-based model ranged from 30-50 mg gC-1 day-1 except the smaller values in August, when the activities of mussels were affected by low levels of salinity. They show better agreement with observations than the results predicted by the biomass-based model. However the individual-based model overestimated the oxygen consumption rates especially in November and December of 2002. The higher values of the oxygen consumption rates observed in June of 2003 may be attributed to the effects of the decomposition of organic matters in the seawater or dead mussels [49]. The difference of the predicted oxygen consumption between the biomassbased and individual-based models was larger until April, 2003. The difference decreased after May since the mussel bed had almost mono-layer structure.

330

Daisuke Kitazawa

Figure 23. The time history of population number in each layer.

3.3.2. Application of the Individual-Based Model to the Mussels on a Cylindrical Substratum The individual-based model was applied to the mussels growing on the cylindrical substratum suspended from the floating platform anchored in the estuary of Sumida River. Numerical simulations were carried out for the period from September 2005 to February 2006. The initial shell length and population density of mussels were 1 mm and 5,000 individuals m-1, respectively, depending on the observation. The initial structural materials were automatically calculated by the Eq. (11), and the initial gonadal materials were assumed to be 0 mgC since the mussels with the shell length of 5 mm were not still mature. The time records of water temperature, salinity, dissolved oxygen, particulate organic and inorganic matters were used as boundary conditions. Figure 23 shows the comparison of observed and predicted population number. The total population number was 5,000 individuals m-1 until July 2006, and then decreased to 2,000 individuals m-1 in December. The 2nd layer was formed in May 2006, decreasing the population number in the 1st layer and increasing the population number in the 2nd layer. The mussels in the 2nd layer began to be starved to death two months after the multi-layer structure was formed. The number of layers was almost two, while the 3rd layer was formed for several days. The predicted result reproduced the decrease in the population number of mussels. The number of layers was one and two until and after May 2006, respectively. The number of groups increases during June and September due to fast growth of mussels. The mussels in the 2nd layer were finally divided into 20 groups. Figure 24 shows the comparison of the mean shell length of all the mussels and the mussels in each layer. Mussels do not grow until March 2006. The mean shell length increased from 5 mm to 20 mm during April and September. The predicted result agrees with the observed one, while the numerical model underestimated the change in the shell length of the mussels in the 2nd layer. The mussels in the 2nd layer were assumed to cease feeding in the individual-based model, however they may intake waters to grow if a part of the gape of the shells comes out from the mussel bed.

Competition for Space and Food among Blue Mussels

331

Figure 24. The time history of the mean shell length of the mussels in each layer.

Figure 25. The time variability of food-consumption and oxygen-consumption rates in the cases when all the mussels are assumed to be active and when the individual-based model is applied.

Figure 25 shows the time variability of food and oxygen consumption rates in the cases when all the mussels are assumed to be active and when the individual-based model is applied. When a multi-layer structure was taken into account, the food and oxygen consumption rates decreased by 20-30% in comparison with the case when all the mussels are assumed to be active. In the present model, the competition among different generations of mussels was not modeled. The younger mussels cannot compete with the adult mussels. They are starved to death even if they settle on the adult mussels. The adult mussels can clean their shells by their foot to avoid the settlement of the other sessile organisms on their shells [50]. Actually, settlement of the younger mussels was not observed in the studied area. Hence the assumption of no competition among different generations of mussels may be appropriate.

332

Daisuke Kitazawa

CONCLUSION A multi-layer structure of blue mussels, Mytilus galloprovincialis, was analyzed by in situ investigation and numerical modeling. The multi-layer structure of blue mussels was examined by measuring the oxygen-consumption rates of the mussel bed and by investigating the relationship between the growth of an individual mussel and its position in the mussel bed. Then, an individual-based model was developed to describe the dynamics of blue mussels under competition for space and food. As a result, the individual-based model could reproduce the in situ observations and elucidate the multi-layer structure of blue mussels. As future studies, the position of a mussel in the mussel bed should be specified more precisely. Then the definition of a gape of the shells should be revised by visualization of water current around the shells. It is useful to measure directly the food-consumption and oxygen-consumption rates of mussels on the flat and cylindrical substrata. As for the individual-based model, it is indispensable to model the settlement and fall of mussels for improvement of the accuracy of the model since these processes exert significant effects on material cycle around mussels.

ACKNOWLEDGMENTS A part of the present study was supported by Grant-in-Aid for Young Scientists (B) (15760602) of Japan Society for the Promotion of Science and the Fundamental Research Developing Association for Shipbuilding and Offshore (REDAS). The author thanks Prof. M. Fujino, Prof. S. Tabeta, Mr. T. Kato, and graduate students in The University of Tokyo for a lot of advices for the study. The author is indebted to workers in the training ship Shioji-maru of Tokyo University of Marine Science and Technology for kind support. The data of water quality in the estuary of Sumida River is provided by National Institute for Environmental Research.

REFERENCES [1] [2]

[3] [4]

[5]

Gosling, E. The mussel Mytilus: Ecology, physiology, genetics and culture; Elsevier: Amsterdam, The Netherlands, 1992. Rajagopal, S.; Van der Velde, G.; Van der Gaag, M.; Jenner, H. A. Factors influencing the upper temperature tolerances of three mussel species in a brackish water canal: Size, season and laboratory protocols. Biofouling, 21(2), 87-97, 2005. Townsin, R. L. The ship hull fouling penalty. Biofouling, 19, 9-15, 2003. Hiscock, K.; Tyler-Walters, H.; Jones H. High level environmental screening study for offshore wind farm developments –Marine habitats and species project. Report from the Marine Biological Association to the Department of Trade and Industry New and Renewable Energy Programme, 2002. Kitazawa, D.; Tabeta, S.; Fujino, M., Kato, T. Assessment of environmental variations caused by a very large floating structure in a semi-closed bay. Environmental Monitoring and Assessment, 165, 461-474, 2010.

Competition for Space and Food among Blue Mussels [6]

[7] [8] [9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

333

Lindegarth, M. Assemblages of animals around urban structures: testing hypotheses of patterns in sediments under boat-mooring pontoons. Marine Environmental Research, 51, 289-300, 2001. Davis, N.; VanBlaricom, G.R.; and Dayton, P.K. Man-made structures on marine sediments: effects on adjacent benthic communities. Marine Biology, 70, 295-303, 1982. Dahlback, B.; Gunnarsson, L. A. H. Sedimentation and sulfate reduction under a mussel culture. Marine Biology, 63, 269-275, 1981. Tenore, K. R.; Boyer, L. F.; Cal, R. M.; Corral, J.; Garcia-Fernandez, C.; Gonzalez, N.; Gonzalez-Gurriaran, E.; Hanson, R. B.; Iglesias, J.; Krom, M.; Lopez-Jamar, E.; McClain, J.; Pamatmat, M. M.; Perez, A.; Rhoads, D. C.; De Santiage, G.; Tietjen, J.; Westrich, J.; Windom, H.L. Coastal upwelling in the Rias Bajas, NW Spain: Contrasting the benthic regimes of the Rias de Arousa and de Muros. Journal of Marine Research, 40, 701-773, 1982. Grant, J.; Scott, D. B.; Pocklington, P.; Schafer, C.T., and Winters, G.V. A multidisciplinary approach to evaluating impacts of shellfish aquaculture on benthic communities. Estuaries, 18(1A), 124-144, 1995. Mazouni, N.; Gaertner, J. C.; Deslous-Paoli, J. M.; Landrein, S.; d‘Oedenberg, M. G. Nutrient and oxygen exchanges at the water-sediment interface in a shellfish farming lagoon (Thau, France). Journal of Experimental Marine Biology and Ecology, 205, 91113, 1996. De Casabianca, M. L.; Laugier, T.; Marinho-Soriano, E. Seasonal changes of nutrients in water and sediment in a Mediterranean lagoon with shellfish farming activity (Thau Lagoon, France). ICES Journal of Marine Science, 54, 905-916, 1997. Mirto, S.; La Rosa, T.; Danovaro, R.; Mazzola, A. Microbial and meiofaunal response to intensive mussel-farm biodeposition in coastal sediments of the western Mediterranean. Marine Pollution Bulletin, 40(3), 244-252, 2000. Chamberlain, J.; Fernandes, F.; Read, P.; Nickell, T. D.; Davies, I. M. Impacts of biodeposits from suspended mussel (Mytilus edulis L.) culture on the surrounding surficial sediments. ICES Journal of Marine Science, 58, 411-416, 2001. Souchu, P.; Vanquer, A.; Collos, Y.; Landrein, S.; Deslous-Paoli, J. M.; Bibent, B. Influence of shellfish farming activities on the biogeochemical composition of the water column in Thau lagoon. Marine Ecology Progress Series, 218, 141-152, 2001. McKinnon, L. J.; Parry, G. D.; Leporati, S. C.; Heislers, S.; Werner, G. F.; Gason, A. S. H.; Fabris, G.; O‘Mahony, N. The environmental effects of blue mussel (Mytilus edulis) aquaculture in Port Phillip Bay. Fisheries Victoria, Research Report Series No.1, 37, 2003. Bayne, B. L.; Newell, R. C. Physiological energetics of marine mollusks. In: Saleuddin A.S.M. and Wilbur K.M. The Mollusca 4, Physiology, part 1. Academic Press, New York, 407-515, 1983. Bayne, B. L.; Hawkins, A. J. S.; Navarro, E.; Iglesias, I. P. Effects of seston concentration on feeding, digestion and growth in the mussel Mytilus edulis. Marine Ecology Progress Series, Vol.55, 47-54, 1989. Van Haren, R. J. F.; Kooijman, S. A. L. M. Application of a dynamic energy budget model to Mytilus edulis (L.). Netherlands Journal of Sea Research, 31(2), 119-133, 1993.

334

Daisuke Kitazawa

[20] Camacho A. P.; Labarta, U.; Navarro, E. Energy balance of mussels Mytilus galloprovincialis: the effect of length and age. Marine Ecology Progress Series, 199, 149-158, 2000. [21] Kitazawa, D.; Tabeta, S.; Kinoshita, T.; Fujino, M.; Kato, T.; Sasaki, K.; Iume, T. Modelling of sessile organisms on a floating structure. Journal of the Japan Society of Naval Architects and Ocean Engineers, 195, 1-13, 2004 (in Japanese with English abstract). [22] Kitazawa, D.; Fujimoto, S. Field investigation and numerical analysis of multilayer structure of bivalves on cylindrical substrata. Journal of the Japanese Association for Coastal Zone Studies, 22(4), 63-75, 2010 (in Japanese with English abstract). [23] Kooijman S. A. L. M. Dynamic energy budgets in biological systems. Cambridge University Press, 350, 1993. [24] Clausen, I.; Riisgard, H. U. Growth, filtration and respiration in the mussel Mytilus edulis: No evidence for physiological regulation of the filter-pump to nutritional needs. Marine Ecology Progress Series, 141, 37-45, 1996. [25] Kajihara, T.; Ura, Y; Ito, N. The settlement, growth and mortality of mussel in the intertidal zone of Tokyo Bay. Bulletin of the Japanese Society of Scientific Fisheries, 44, 949-953, 1978 (in Japanese with English abstract). [26] Yamochi, S.; Ariyama, H.; Kusakabe, T.; Sano, M.; Nabeshima, Y.; Mutsutani, K.; Karasawa, T. Effects of a predominant sedentary organism of the coastal artificial structure on the eutrophication of the coastal area of Osaka Bay. Umi-no-kenkyu, 4(1), 9-18, 1995 (in Japanese with English abstract). [27] Villalba, A. Gametogenic cycle of cultured mussel, Mytilus galloprovincialis, in the bays of Galicia (N.W. Spain). Aquaculture, 130, 269-277, 1995. [28] Brenko, M. H.; Calabrese, A. The combined effects of salinity and temperature on larvae of the mussel Mytilus edulis. Marine Biology, 4, 224-226, 1969. [29] Almada-Villela, P. C. The effects of reduced salinity on the shell growth of small Mytilus edulis. Journal of the Marine Biological Association of the United Kingdom, 64, 171-182, 1984. [30] Bohle, B. Effects of adaptation to reduced salinity on filtration activity and growth of mussels (Mytilus edulis L.). Journal of the Experimental Marine Biology and Ecology, 10, 41-47, 1972. [31] Hosomi, A. Ecology of marine mussels. Sankai-do, 137, 1989 (in Japanese). [32] Thompson, R. J.; Bayne, B. L. Active metabolism associated with feeding in the mussel Mytilus edulis L., Journal of Experimental Marine Biology and Ecology, 9, 111-124, 1972. [33] Baretta, J.; Ruardij, P. Tidal flat estuaries, simulation and analysis of the Ems Estuary. Ecological Studies 71, Springer-Verlag, 353, 1988. [34] Kitazawa, D.; Tabeta, S.; Kato, T.; Ruardij, P. A comparative study of the biomassbased and individual-based models of blue mussels. Ecological Modelling, 215, 93-104, 2008. [35] Schulte, E. H. Influence of algal concentration and temperature on the filtration rate of Mytilus edulis. Marine Biology, 30, 331-341, 1975. [36] Babarro, J. M. F.; Fernandez-Reiriz, M. J.; Labarta, U. Growth of seed mussel (Mytilus galloprovincialis Lmk): Effects of environmental parameters and seed origin. Journal of Shellfish Research, 19, 187-193, 2000.

Competition for Space and Food among Blue Mussels

335

[37] Widdows, J.; Fieth, P.; Worrall, C. M. Relationships between seston, available food and feeding activity in the common mussel Mytilus edulis. Marine Biology, 50, 195-207, 1979. [38] Jorgensen, C. B.; Larsen, P. S.; Riisgard, H. U. Effects of temperature on the mussel pump. Marine Ecology Progress Series, 64, 89-97, 1990. [39] Bayne B. L.; Gabbott, P. A.; Widdows, J. Some effects of stress in the adult on the eggs and larvae of Mytilus edulis L., Journal of the Marine Biological Association of the United Kingdom, 55, 675-689, 1975. [40] Bayne, B. L.; Thompson, R.J. Some physiological consequence of keeping Mytilus edulis in the Laboratory. Helgolander wiss. Meeresunters., 20, 526-552, 1970. [41] Witman, J. D.; Suchanek, T. H. Mussels in flow: drag and dislodgement by epizoans. Marine Ecology Progress Series, 16, 259-268, 1984. [42] Bayne, B. L.; Igresias, J. I. P.; Hawkins, A. J. S.; Navarro, E.; Heral, M.; Deslous-Paoli, J. M. Feeding behavior of the mussel, Mytilus edulis: Responses to variations in quality and organic content of the seston. Journal of the Marine Biological Association of the United Kingdom, 73, 813-829, 1993. [43] Babarro, J. M. F.; Fernandez-Reiriz, M. J.; Labarta, U. In situ absorption efficiency processes for the cultured mussel Mytilus galloprovincialis in Ria de Arousa (northwest Spain). Journal of the Marine Biological Association of the United Kingdom, 83, 1059-1064, 2003. [44] Jorgensen C. B. Bivalve Filter Feeding Revisited. Marine Ecology Progress Series, 142, 287-302, 1996. [45] Robledo J. A. F.; Santarem, M. M.; Gonzalez, P.; Figueras, A. Seasonal variations in the biochemical composition of the serum of Mytilus galloprovincialis Lmk. and its relationship to the reproductive cycle and parasitic load. Aquaculture, 133, 311-322, 1995. [46] Navarro E.; Iglesias, J. I. P.; Camacho A. P.; Labarta, U. The effect of diets of phytoplankton and suspended bottom material on feeding and absorption of raft mussels (Mytilus galloprovincialis Lmk), Journal of Experimental Marine Biology and Ecology, 198, 175-189, 1996. [47] Frechette, M.; Lefaivre, D. Discriminating between food and space limitation in benthic suspension feeders using self-thinning relationships. Marine Ecology Progress Series, 65, 15-23, 1990. [48] Jorgensen, C. B.; Molenberg, F.; Sten-Knudsen, O. Nature of the relation between ventilation and oxygen consumption in filter feeders. Marine Ecology Progress Series, 28, 73-88, 1986. [49] Dankers, N.; Dame, R.; Kersting, K., The oxygen consumption of mussel beds in the Dutch Wadden Sea. - Scientia mar., 53, 473–476, 1989. [50] Theisen, B.F. Shell cleaning and deposit feeding in Mytilus edulis L. (Bivalvia). Ophelia, 10, 49-55, 1972.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 14

PRODUCTION AND SHELF LIFE OF MUSSEL MEAT POWDER FLAVOR Vanessa Martins da Silva1, Kil Jin Park2 and Míriam Dupas Hubinger1 1

Department of Food Engineering, School of Food Engineering, University of Campinas, P.O. Box 6121, 13083-862, Campinas, SP, Brazil 2 School of Agricultural Engineering, University of Campinas, 13081-970, Campinas, SP, Brazil

ABSTRACT Aquaculture has consistently increased and it is expected to overtake capture production of food fish supply in the near future (~2020 or 2030). Bivalves usually refer to groups of species like oysters, clams, cockles, mussels and scallops that have been contributing to this growth. Flavor is considered as a high value product and, specifically, good quality seafood flavors are in high demand. As a common industrial practice, the natural seafood flavors are reformulated by adding other ingredients and artificial flavors for specific desired characteristics. Such flavors are being used in seafood sauces, chowders, soups, bisques, instant noodles, snacks and surimi seafoods. The present chapter focuses on the seafood flavor production by some methods, especially, enzymatic hydrolysis due to some advantages such as high yield, good quality with less off-flavor production and control of flavor characteristics through variation of enzyme reactions. Mussel meat was chosen due to this unique taste, high quality of raw material, which ensures good quality flavor, and also the low fatty content that avoids the susceptibility to lipid oxidation. Flavors are preferably used in the powder form, both for processing convenience as well as end use, and this allows the reduction of shipping costs and increases their stability. Microencapsulation is a useful tool in protection of the integrity of food ingredients used as flavors, from oxygen, water or light. Spray drying is the most commonly used technique for the production of dry flavorings and this process converts a liquid flavor into a free flowing powder which is stabler, easier to handle and incorporate into a dry food system. The addition of carrier agents has been used to reduce stickiness, increase stability during storage and trap volatile flavor constituents inside the droplets. Therefore, the production of mussel meat flavor powder by enzymatic hydrolysis and

338

Vanessa Martins da Silva, Kil Jin Park and Míriam Dupas Hubinger spray drying, using gum Arabic, and the determination of its shelf life in terms of sorption isotherms, glass transition temperature, morphology and volatile losses are described and discussed in this chapter.

1. INTRODUCTION Aquaculture is the fastest growing animal food-producing sector and to outpace population growth, with per capita supply from aquaculture increasing from 0.7 kg in 1970 to 7.8 kg in 2006, has an average annual growth rate of 6.9 percent. It is set to overtake capture fisheries as a source of food fish. However, fish is very perishable and several chemical and biological changes take place immediately after capture. Therefore, the research and development of post-harvest systems for handling raw material are important to developing appropriate measures to increase its shelf life; reduce physical, sensory and nutritional losses; and preserve the quality and safety of the finished products (FAO, 2008). With issues such as safety and quality, aquaculture may have a potential advantage in providing raw material for higher-value processed products. Discards represent a significant proportion of global marine catches and are generally considered as waste. In the period of 1992 to 2001, yearly average discards were estimated to be 7.3 million tonnes (FAO, 2005). To meet the need of the seafood processing industry, an alternative to discarding these byproducts should be the recovery and alteration of the fish muscle proteins present for use in human or animal food. According to Kristinsson and Rasco (2000), by applying enzyme technology for protein recovery in fish processing, it is possible to produce a broad spectrum of food ingredients or industrial products for a wide range of applications as protein supplements, stabilizers in beverages, including the production of flavors. Flavor is considered as a high value product and, specifically, good quality seafood flavors are highly demanded. The flavor industry has four large food product areas: beverages, confectionary products, dairy products and culinary products (Perfurmer and Flavorist, 1999). Seafood flavors can be used in dry products flavorings as soups (containing flavor enhancers and natural or synthetic top notes), dry vegetables, ground spices, and herbs as well as encapsulated or plated spices serve as the foundation of the flavor systems; in sauces that are available in both liquid and dry forms; as flavorings in meat products include fresh, surimi-based products, semi-dried, dried, fermented, deep-frozen, and canned meats; in savory snack foods as chips and sticks; extruded products; crackers and pretzels and also in soft drinks as tomato juices (Reineccius, 2006). The advantages of enzymatic hydrolysis over other methods for seafood flavor production are high yield, good quality with less off-flavor generation, and control of flavor characteristics through variation of enzyme reactions. The extent of hydrolysis determines sensory quality and is dependent upon the specificity of protease, level of enzyme, water to substrate ratio, pH, and temperature (Ritchie and Mackie, 1982; Lee, 2007). Hydrolysates are highly perishable due to their high moisture and protein content; therefore, an additional process is necessary to improve their shelf lives. Spray drying is the most commonly used technique for the production of dry flavorings. An aqueous infeed material (water, carrier and flavor) is atomized into a stream of hot air. The atomized particles dry very rapidly, trapping volatile flavor constituents inside the droplets. The advantages of

Production and Shelf Life of Mussel Meat Powder Flavor

339

this method are the equipment high availability, the low process cost, the wide choice of carrier materials, the good retention of volatiles and the good stability of the finished flavoring (Reineccius, 1988).

2. FLAVOR PRODUCTION METHODS 2.1. General Aspects The definition of natural flavor in the US, which can be found in the Code of Federal Regulations (CFR), is: ―The term natural flavor or natural flavoring means the essential oil, oleoresin, essence or extractive, protein hydrolysate, distillate, or any product of roasting, heating, or enzymolysis, which contains the flavoring constituents derived from a spice, fruit or fruit juice, edible yeast, hulls, bark, bud, root, leaf, or similar plant material, meat, seafood, poultry, eggs, dairy products, or fermentation products thereof, whose significant function in food is imparting flavoring rather than nutrition‖. Seafoods have complex flavor systems comprised of equally important taste and aroma active components. The taste active constituents, which are generally non-volatile compounds, are free amino acids, nucleotides, sugars and minerals salts. The aroma characteristics of seafoods may be subdivided into those components contributing to fresh and/or cooked seafood flavor. Fresh seafood flavor is important to consumer acceptability of fresh seafood. Upon cooking, the flavor of seafoods changes dramatically. The termallyinduced changes result in cooked meaty aromas which are often species-specific. Maillard and Strecker degradation reactions play predominant roles in developing the meaty aroma of cooked seafood. Other reactions, such as lipid oxidation, give rise to many important desirable and undesirable aroma compounds (Shahidi and Cadwallader, 1997). Flavor defects called off-flavors are sensory attributes that are not associated with the typical aroma and taste of foods and beverages. Their generation in foods may result from oxidation, nonenzymatic browning, chemical reactions between food constituents, lightinduced reactions, or enzymatic pathways. Lipid-derived volatile compounds play an important role in many food flavors. These compounds contribute to the characteristic and desired note of a food but can also cause off-flavors depending on their concentrations compared to other sensorially relevant odorants (Mcgorrin, 2002). Generally, there are three basic process routes for making seafood flavors from fish and shellfish, namely, aqueous extraction, fermentation, and enzymatic hydrolysis.

2.2. Aqueous Extraction In this process the raw material is homogenized, cooked at atmospheric or elevated pressure and finally the raw extract is concentrated. The advantages of this process are the good quality flavor however the drawbacks are low yield, its dependency on cooking juice, and its high salt level upon concentration (Lee, 2007). This process was used to produce water-extracted flavors for lobster (Lee et al., 2001), shrimp (Cambero et al., 1998) and shrimp waste (Mandeville et al., 1992).

340

Vanessa Martins da Silva, Kil Jin Park and Míriam Dupas Hubinger

2.3. Fermentation Fermentation has been a traditional practice of producing fish sauce for soup and sauce applications, in Southeast and East Asian countries. To the raw material is added salt, as high as 30% to control the growth of any pathogenic microorganisms (Gildberg, 1993), there is a pH adjustment and is possible to add a starter culture, then the proteolytic digestion as well as the microbiological fermentation are carried out from 6-12 months; lowering pH and salt concentration take about 1-2 months. Finally the raw extract is filtrated to clarification of the product. The extract produced by low salt fermentation can be stabilized by concentration or dehydration and used as an umami-giving seafood flavor. Basically, this process involves enzymatic hydrolysis by endogenous enzymes with some level of flavor-producing microbial activity (Lee, 2007). There are several works that used this process to produce flavoring sauces from anchovy (Cha et. al, 1997; Kim et. al., 2004), skipjack tuna (Lee et. al, 1989; Cha and Cadwallader, 1998), tuna liver and mackerel (Aquerreta et al., 2001).

2.4. Enzymatic Hydrolysis Enzymatic hydrolysis is a process employed for the production of most commercial natural seafood flavor extracts. The raw stock is homogenized, pasteurized, the enzyme is added and the hydrolysis is carried out until specific degree of hydrolysis, then the enzyme is inactivated, the raw material is filtrated and concentrated or dehydrated (Lee, 2007). Most successful flavors produced by this process are made from squid (Lian et al., 2001), crab (Kim et al., 2006), shrimp (Simpson et al., 1998), lobster (Vieira et al., 2006) and crayfish (Baek and Cadwallader, 1995). Also available are flavors from various fish species such as tuna (Nilsang et al., 2005), bonito (Maehashi et al. 1999), salmon (Liaset et al., 2003), red hake (Imm and Lee, 1999) and mussel meat (Cha et al. 1998a, Cha et al. 1998b). Enzymatic hydrolysis was the process used to produce a mussel meat flavor (Silva et al., 2010). The flow diagram for protein hydrolysis is shown in Figure 1. In this chapter, hydrolysis process was studied according to a central composite experimental design to analyse the influence of the independent variables temperature (46-60 °C), enzyme:substrate ratio (0.48-5.52%) and pH (6.7-8.3) over the degree of hydrolysis (DH) and the protein recovery (PR). The mussel meat was ground and homogenized with distilled water (meat:water ratio, 1:2 w/w), using a manual blender, and heated to preselected temperatures. The pH was maintained using 1 N NaOH. Protamex was added to the mixture and the reaction was monitored according to the pH-stat method using an automatic Mettler Toledo T 50 titration unit (Schwerzenbach, Switzerland). The total time for hydrolysis was 3 h, then enzyme was inactivated by heating the solution up to 85°C for 10 min and the resulting solution was centrifuged at 3500 rpm or 1876 g (Beckman Coulter, Allegra 25R model, Fullerton, California, USA) for 20 min, to separate the lipid fraction from the hydrolysate. The optimization of the process was to obtain high values of degree of hydrolysis and protein recovery. Enzyme Protamex(Novo Nordisk, USA) was chosen due to its recognized capacity of producing non-bitter protein hydrolysates.

Production and Shelf Life of Mussel Meat Powder Flavor

341

Figure 1. Example of a flow diagram illustrating the steps for production of protein hydrolysate from mussel meat [adapted from Silva et al. (2010)].

In Figure 2, the hydrolysis kinetics of the hydrolysate is described, in the optimal conditions of enzymatic hydrolysis of mussel meat, using Protamex. Hydrolysis process is characterized by high initial reaction rates, when there are more active enzymes sites available for reaction and lower concentration of soluble peptides in competition with the substrate, consequently a great amount of bonds are broken. This is followed by decreases in the reaction rate until the stationary phase, where, apparently, hydrolysis no longer occurred. This profile could be associated to the presence of inhibition product by compounds formed during the hydrolysis and the action of soluble peptides, which act as an effective substrate competitor for the unhydrolyzed proteins, and also occurred a simultaneous deactivation of the enzyme (Guerard et al., 2002; Adler-Nissen, 1986; González-Tello et al., 1994). Kinetics analysis is primarily used to determine the mechanism of action of enzymes via a detailed study of the kinetics effect of substrate concentration, enzyme concentration, pH, temperature and inhibitors on reaction rate. Enzymatic hydrolysis of proteins is a complex process due to the existence of different peptide bonds and the different accessibility of these to enzymatic attack, which largely depends upon the concentration of proteins used as substrate (Whitaker, 2003; Moreno and Cuadrado, 1993).

342

Vanessa Martins da Silva, Kil Jin Park and Míriam Dupas Hubinger

Figure 2. Enzymatic hydrolysis curve for mussel meat hydrolysed with Protamex®, at reaction temperature of 51°C, pH value of 6.75 and enzyme:substrate ratio of 4.5g enzyme/100 g protein.

Figure 3 shows the relationship between the degree of hydrolysis and the protein recovery, for all the studied conditions. An increase in protein recovery was achieved by the growth of the degree of hydrolysis up to 25%. As protein recovery is an index of protein dissolution, if the proteolysis reaction rate decreases, then protein dissolution will decrease too, that is why protein recovery becomes constant in certain limits. Similar results with an increase in protein recovery achieved by increasing the degree of hydrolysis up to 30% were found by Kurozawa and others (2008), who studied the enzymatic hydrolysis of chicken breast meat, using Alcalase. Through the surface response methodology, the authors obtained values from 4.52% to 37.80% for degree of hydrolysis and from 34.56% to 91.82% for protein recovery. Diniz and Martin (1998) also observed an increase on protein recovery, for enzymatic hydrolysis of shark muscle protein, using Alcalase. The authors obtained values for degree of hydrolysis of 0, 15, 17.9, 18.6 and 18.9 for protein recoveries of 15.1, 58.2%, 71.1%, 76.1%, and 77%, respectively. De Holanda and Netto (2006) increased the value of degree of hydrolysis from 6% to 12%, in the enzymatic hydrolysis of shrimp processing waste, using Alcalase, and obtained values of protein recovery of 20% and 28%, respectively. In this chapter, protein recovery stabilized for degree of hydrolysis above 25%, showing no further dissolution of the mussel meat protein, however with a great cleavage of the soluble peptide bonds, as Figure 4 shows. The SDS-PAGE profiles of the mussel meat (columns 2 and 4) and hydrolysate (column 5) are shown in Figure 4. In column 2, several protein bands were identified in mussel meat as paramiosin (105 kDa), actin (45 kDa), tropomyosin (35 kDa), troponin - C (20 kDa) and light myosin chains 3 (15 kDa) (Porzio and Person 1977). According to Margulis and Pinaev (1976), the main components of mussel miofibrils are heavy myosin chain (200 kDa), paramiosin (105 kDa), actin (45 kDa), tropomyosin (30 to 39 kDa) and light myosin chain (16 kDa). In column 5, it can be seen that

Production and Shelf Life of Mussel Meat Powder Flavor

343

several protein bands were cleaved and therefore a decrease in intensity and number of bands is observed. The loss of most peptide fractions, as a result of this cleavage, resulted in light myosin chains 1 and 3 (25 and 15 kDa, respectively) and a diffuse band with peptides of molecular weight lower than 6.5 kDa.

Figure 3. Relationship between the degree of hydrolysis and the protein recovery, obtained for mussel meat hydrolyzed with Protamex, at different temperature, enzyme:substrate ratio and pH values [from Silva et al. (2010)].

26.6

myosin light chain - 1

17.0 myosin light chain - 3

14.4 6.5

3 4

5

Figure 4. Eletroforetic profile (SDS-PAGE) of mussel meat (columns 2 and 4) and hydrolysate (column 5). Columns 1 and 3 consist of high and low molecular weight markers, respectively [from Silva et al. (2010)].

The use of fish protein hydrolysate in the market is still low, mainly due to bitterness and other problems that are associated with certain peptides as well as oxidation and microbial related products formed during and after the process. Some studies have shown that bitterness and off-odors may not be just because of peptides in fish protein hydrolysate but also from lipid oxidation products (Kristinsson, 2008). A study on mackerel hydrolysis demonstrated that bitterness development was well correlated with increased lipid oxidation (Liu et al.,

344

Vanessa Martins da Silva, Kil Jin Park and Míriam Dupas Hubinger

2000). The relationship among the flavor-odor, peptide size and composition is a very complex one. It has been reported that limited hydrolysis leads to an increase on bitterness, while extensive hydrolysis produces less bitterness, and may in some cases produce a flavorenhancement effect similar to monosodium glutamate and related nucleotides. Basic peptides with lysine and asparagine as the C-terminal and second residue, respectively, and with leucine and glycine as the N-terminal residue, have been linked to bitterness. Imm and Lee (1999) reported that red hake hydrolyzed in small peptides gave a flavor-enhancement effect. Vieira et al. (1995) observed that extensive hydrolysis of lobster processing waste gave a product with high solubility and no bitterness. These last results occurred possibly due to the large amounts of free amino acids and flavor enhancing nucleotides which lobster is rich in. When applied singly, Flavorzyme generated a higher amount of free amino acids, higher hydrophilic to hydrophobic amino acid ratio, and less bitter short-chain peptides with a higher overall acceptability than any other enzyme systems evaluated. A similar monosodium glutamate-like effect was also reported when proteins in tuna cooking water were hydrolyzed (Chialing et al., 2000). Some authors studied the production of natural mussel flavorings by enzymatic hydrolysis, using Optimase (Cha et al. 1998a, Cha et al. 1998b) the major active compounds identified were the glutamic acid and the aspartic acid related to have sour taste. The problem of bitterness and off-flavor in general is a real one with fish protein hydrolysate and can greatly limit its use for both human and animal consumption. There are steps that can be taken to control bitterness during and after processing. Proper degree of hydrolysis can in part control bitterness, but choice of enzyme may in some cases be more important as some studies suggest. It is recommended to use an enzyme preparation with a balance of endo- and exopeptidase activities. There are certain commercial enzyme preparations available that reportedly produce hydrolysates with less bitterness, Flavorzyme (Novo Nordisk, USA) which is an exopeptidase and Protamex (Novo Nordisk, USA), in contrast to most other endoproteases, claimed to produce non-bitter protein hydrolysates (Lee, 2007). There are also certain postprocess steps that can be taken to reduce bitterness and offflavors. Shahidi et al. (1995) treated fish protein hydrolysate with activated carbon, which removed bitter peptides. Bitter fish protein hydrolysate may also be treated with certain enzymes (rich in exopeptidase activities) after processing to reduce bitterness (Kristinsson, 2008). In summary the methods for debittering of protein hydrolysates include selective separation such as treatment with activated carbon, extraction with alcohol, isoelectric precipitation, chromatography on silica gel, hydrophobic interaction chromatography, masking of bitter taste and enzymatic hydrolysis of bitter peptides (Saha and Hayashi, 2001). In this chapter, the total amino acid composition, presented in Table 1, showed that mussel meat and the protein hydrolysate presented high levels of glutamic acid, aspartic acid and tryptophan as their main components. On the whole, according to Tukey test, there were no significant (p > 0.05) differences between the mussel meat and the protein hydrolysate, except for glutamic acid, glicine and tryptofan, which were in higher concentration in mussel meat hydrolysate. Glutamic acid is a known flavor enhancer and is found in high abundance in various hydrolysates, such as protein vegetable hydrolysate, soysauce and mussel meat hydrolysate (Weir, 1986; Cha et al. 1998b). Most amino acids, especially basic amino acids, are known to be important aroma precursors that react with other compounds in Maillard reactions, important in the development of the characteristic mussel hydrolysate flavor.

Production and Shelf Life of Mussel Meat Powder Flavor

345

Table 1. Total amino acid composition (g/100g protein) of mussel meat and protein hydrolysate under optimum conditions Amino acid Aspartic acid Glutamic acid Serine Glycine Histidine Arginine Threonin Alanine Proline Tyrosine Valine Methionine1 Cysteine Isoleucine Leucine Phenylalanine2 Lysine Tryptophan Total

Mussel meat (g/100g protein)* 6.40 + 0.00a 7.93 + 0.01a 3.10 + 0.08a 4.62 + 0.04a 1.17 + 0.01a 5.10 + 0.03a 2.80 + 0.01a 3.10 + 0.03a 2.61 + 0.03a 2.39 + 0.31a 2.76 + 0.05a 3.12 + 0.04a 0.87 + 0.04a 2.48 + 0.01a 4.18 + 0.01a 4.69 + 0.02a 4.31 + 0.05a 4.78 + 0.22a 63.12 + 0.21

Protein hydrolysate (g/100g protein)* 6.72 + 0.11a 8.67 + 0.04b 3.07 + 0.03a 5.20 + 0.00b 1.21 + 0.04a 4.85 + 0.02a 2.91 + 0.05a 3.16 + 0.04a 2.62 + 0.04a 2.30 + 0.03a 2.70 + 0.01a 3.44 + 0.13a 1.07 + 0.21a 2.42 + 0.44a 4.26 + 0.08a 4.54 + 0.03a 4.48 + 0.03a 6.56 + 0.24b 66.76 + 0.17

*

Means of 2 determinations + standard deviations. Different letters are considered significantly different at the 5% level (p<0.05). 1 Methionine + cysteine. 2 Phenylalanine + tyrosine.

3. POWDER FLAVORS Flavor manufactures make use of a number of processes for the conversion of flavorings from liquid into solid form. Some reasons for that are improving handling, stabilization of volatile organic compounds to minimize losses, encapsulation of flavor, controlled flavor release, extend product shelf life and improve storage options, protect flavor from oxidation, create barrier between two or more incompatible ingredients or between the flavor and the ingredients in the food product. The main technologies for producing powdered flavor used by the industry are plating, spray drying, spray cooling, coacervation, melt extrusion and molecular encapsulation (Baines and Knights, 2005).

3.1. Microencapsulation by Spray Drying Microencapsulation of aroma and flavor ingredients is among the most important applications in food systems. Those ingredients contain high proportions of volatiles and their retention during the microencapsulation process is of critical importance.

346

Vanessa Martins da Silva, Kil Jin Park and Míriam Dupas Hubinger

Microencapsulation by spray drying is the most widely used technique for the production of dry flavorings. The initial step in spray drying a flavor is the selection of a suitable carrier (or encapsulating agent). The ability of acacia gums, carbohydrates, such as starches, maltodextrins, corn syrup solids to bind flavors is complemented by their diversity and widespread use in foods and makes them the preferred choice for encapsulation (Dziezak, 1988; Mutka and Nelson, 1988). In addition, these materials have properties, such as low viscosities at high solids contents and good solubility that are desirable in an encapsulating agent (Madene et al., 2006). Gums are used in microencapsulation for both their film forming and emulsion stabilization properties. Among all gums, acacia gum, generally called gum Arabic, which is a natural exudate from the trunk and branches of leguminous plants of the family Acacia (Thevenet, 1988), has excellent emulsification properties and thus is widely used. Gum Arabic is a polymer consisting of D-glucuronic acid, L-rhamnose, D-galactose, and Larabinose, with approximately 2% protein (Dickinson, 2003). The emulsification properties of the gum Arabic are attributed to the presence of this protein fraction (Dickinson, 2003) and is usually preferred because it produces stable emulsions with most oils over a wide pH range, and it also forms a visible film at the oil interface (Kenyon, 1995). Hydrolyzed starches offer the advantages of being relatively inexpensive (approximately one third of the modified starches price), bland in flavor, low in viscosity at high solids, and they may afford good protection against oxidation (depending on dextrose equivalent which range from about 2 to 36.5). Maltodextrins with dextrose equivalence between 10 and 20 fit in for use as wall material, they showed the highest retention of flavor because they could be dispersed in water up to 35.5% of the solution without haze formation (Raja et al., 1989). Maltodextrins provide good oxidative stability to encapsulated oil but exhibit poor emulsifying capacity, emulsion stability and low oil retention (Kenyon, 1995). Moreover, the maltodextrin concentration and the type of emulsifier have influenced the retention of emulsified flavors as ethyl butyrate during spray-drying (Yoshii et al., 2001). Modified starches have been chemically modified to incorporate lipophilic groups in their molecules. They provide excellent retention of volatiles during spray drying and can be used at a high infeed solids level (approaching 50%) and may afford outstanding emulsion stability. The high solids levels reduce the loss of encapsulated ingredients and increase spray dryer throughput (Shahidi and Han, 1993). The retention of flavor is governed by factors related to the chemical nature of the core, including its molecular weight, chemical functionality, polarity and relative volatility to the wall material properties and to the nature and the parameters of the encapsulation technology (Madene et al., 2006). There are some works with spray dried hydrolysates made from black tilapia (AbdulHamid et al., 2002), herring (Hoyle and Merritt, 2006), chicken breast (Kurozawa, 2009), cat fish skin (Yin et al., 2010) for nutritional purposes; they also have potential use as flavoring agents. Many studies have been carried out on the influence of wall materials composition and the operating conditions on the retention and controlled release of encapsulated flavors (Madene et al., 2006). Recently, flavors of oregano, citronella and marjoram were successfully encapsulated by spray-drying in wall systems of skimmed milk powder and whey protein concentrate (Baranauskiene et al., 2006). L-menthol/wall materials concentration of 1:4 ratio in the feed emulsion presented the highest retention of flavor and

Production and Shelf Life of Mussel Meat Powder Flavor

347

lowest flavor residue on the surface, using as wall materials maltodextrin and gum Arabic, at high solid content (Soottitantawat et al., 2005). The mussel protein hydrolysate powder was produced adding a concentration of 15 and 30% of gum Arabic directly to the protein hydrolysate, with magnetic stirring, until complete dissolution and then the solution was spray dried using a mini spray dryer, which was operated concurrently using a spray nozzle with an orifice of 1.2 mm diameter. The protein hydrolysate was fed into the drying chamber using a peristaltic pump. The inlet air temperature was set at 180°C and the feed mass flow rate, air compressed volumetric flow rate and pressure were 0.8 kg/h, 2.4 m3/h and 0.25 MPa, respectively.

4. SHELF LIFE OF MUSSEL PROTEIN HYDROLYSATE POWDER Wall deposition is a regular occurrence in laboratorial spray dryer. This may be caused by coarse droplets contacting the wall before sufficient drying has occurred, thermoplasticity of the product (low glass transition temperature), surface dusting on the wall due to surface geometry, roughness and electrostatic forces, and localized buildup as a result of poor insulation (heat loss) and condensation of humid air (Bhandari and Howes, 1999; Masters, 2002). Above all, stickiness due to thermoplasticity of the material is the major problem. The problems of stickiness during spray drying of sugar-rich and acid-rich foods such as fruit juices, honey, some starch derivatives (glucose syrups/maltodextrin at higher dextrose equivalent values), whey, sugars, and hydrolysates of proteins and sugars have been well recognized. During drying of these products, they may either remain as syrup or stick on the dryer chamber wall (Bhandari et al., 1997). So the addition of carrier agents, like maltodextrins and gums, has been used in the production of powders, to reduce the stickiness and wall deposition in spray drying. Moisture content or water activity has been considered as the principle factors which affect the physical and chemical stability of food powders. Studies on the glass transition property of materials have been providing more evidence that the stability of dehydrated systems can also be predicted by relating to the glass transition temperature of the system (Sablani et al., 2004, Medina-Vivanco et al., 2007, Tonon et al. 2009, Kurozawa et al., 2009). According to Figure 5, the glass transition temperature of pure mussel protein hydrolysate is -11.2°C, at aw = 0.432, and is in good agreement with the value reported for freeze-dried fish protein hydrolysate of -17.9°C at aw = 0.44 (Aguilera et al., 1993). Kurozawa et al. (2009) also observed a glass transition temperature value of -12.7°C, at aw = 0.432, for pure chicken meat hydrolysate powder. The low glass transition temperature of mussel protein hydrolysate was due to the presence of low molecular peptides resulted from enzymatic hydrolysis. Medina-Vivanco et al. (2007) obtained higher glass transition temperature for fresh tilapia fillets, 59.8°C at aw = 0.44, certainly due to the presence of high molecular weight food polymers, myofibrillar proteins, such as myosin and actin.

348

Vanessa Martins da Silva, Kil Jin Park and Míriam Dupas Hubinger

Figure 5. Relationship between the water activity at 25°C, water content and glass transition temperature of spray dried mussel meat hydrolysate protein: (a) without gum Arabic and (b) with 15% of gum Arabic and 30% of gum Arabic.

Production and Shelf Life of Mussel Meat Powder Flavor

349

As expected in this chapter, the addition of high concentration of carrier agents as gum Arabic, caused an increase on glass transition temperature of the powders from -11.2, for 24.1 and 47.7 °C, at aw = 0.432, for microcapsules produced with 15 and 30% of gum Arabic, respectively. Since the glass transition temperature climbs with increase in molecular weight, the addition of gum Arabic to the feed solution contributed significantly to powder stability, increasing the glass transition temperature of the powder, and consequently reducing the stickiness. Still in Figure 5, it can be seen the curves of sorption isotherm and glass transition temperature for mussel hydrolysate powder equilibrated under several humidity relatives. The critical storage conditions, the critical values of water activity (awc) and the moisture content (Xc), for mussel protein hydrolysate were found by sorption isotherms and Tg data, at the temperature of 25ºC. The values found were of awc = 0.26 and Xc = 0.06 g/g dry solids for pure hydrolysate, of awc = 0.52 and Xc = 0.10 g/g dry solids for hydrolysate with 15% gum Arabic, and awc = 0.52 and Xc = 0.10 g/g dry solids for hydrolysate with 30% of gum Arabic. This means that when the powder is stored at 25ºC, the maximum relative humidity to which it can be exposed is 26, 52 and 52% and its moisture content is of 6, 10 and 10%, for each formulation, respectively. Above these conditions the powder will suffer deteriorative changes such as structural collapse, stickiness and caking. Therefore, the addition of gum Arabic resulted in an increase in powder stability. Figure 6 shows the micrographs of pure mussel meat hydrolysate (Figure 6a) and produced with 15 and 30% of gum Arabic, Figures 6b and 6c, respectively. Morphology of particles showed liquid bridges inter-particles in pure hydrolysate due to the high hygroscopicity of the powder. Particles produced with 15% of carrier agent showed spherical shape, some with smooth surface and others with shrivelled one, increasing carrier concentration up to 30% caused an increase on size and the majority of particles presented a spherical shape with a shrivelled surface According to Rosenberg et al. (1985), dents were formed by particles shrinkage during drying and cooling and have an adverse effect on the flowing properties of powder particles; their formation is caused by a deficient film development during drying, due to the high viscosity of feed solution. A high amount of dents were observed in particles produced with 30% of gum Arabic, where higher viscosity of feed solution was observed. Volatile profile of flavors can be obtained through gas chromatography. Volatile profile of pure mussel meat hydrolysate powder and produced with 15 and 30% of gum Arabic was determined after headspace solid phase microextraction (HS-SPME) at 50°C for 45 min, using a polydimethylsiloxane-divinylbenzene (PDMS-DVB) fiber of 65 m thickness, (Supelco, Bellefont, Pennsylvania, USA). Then sample was injected in a gas chromatograph Varian Star 3600 CX coupled with mass spectrometer MS Saturn 2000 (Varian, Walnut Creek, EUA) (CG-MS). The samples were analyzed during storage at 25°C, for 0 and 120 days, as Figure 7 shows. In general, the compounds tentatively identified in mussel hydrolysate powder, shown in Figure 7, were common to other studies of volatile fraction of mussels (Yasuhara and Morita 1987; Cha et al. 1998b; Guen et al. 2000; Cros et al. 2005; Fuentes et al. 2008). Alcohols and hydrocarbons generally do not contribute to the overall flavor because of their high threshold. Ketones as 2-nonanone may have resulted from thermal oxidation/degradation of polyunsaturated fatty acids; Kubota et al. (1982) reported that carbonyl compounds, resulting mainly from lipid and amino acid degradation, gave a strong contribution to a seaweed-like odor to cooked krill.

350

Vanessa Martins da Silva, Kil Jin Park and Míriam Dupas Hubinger

Figure 6. Micrographs of pure mussel meat hydrolysate powder (a), produced with 15% of gum Arabic (b) and 30% gum Arabic (c) at the magnification of 2000x.

Aldehydes are known to play a major role in many food products and are reported to be impactant odorants in mussel flavor, due to their low detection thresholds. Hexanal is described as a green odor, according to Guen et al. (2000), when chromatography– olfactometry was applied.

Production and Shelf Life of Mussel Meat Powder Flavor

Figure 7. (Continued).

351

352

Vanessa Martins da Silva, Kil Jin Park and Míriam Dupas Hubinger

Figure 7. Volatile losses during of pure hydrolysate (A), 15% of gum Arabic (B), 30% of gum Arabic (C), time zero and after 120 days, of storage at 25°C: (1) Hexanal, (2) 2-Ethyl-1-hexanol, (3) Dimethylethylbenzene, (4) 2-Nonanone, (5) Tetradecane, (6) Pentadecane and (7) Heptadecane.

Production and Shelf Life of Mussel Meat Powder Flavor

353

These cromatograms indicate less volatile losses of powders produced with carrier agents, compared to pure mussel meat hydrolysate powder, confirming the effective protection of the flavor when microencapsulated by spray dryer. Moreover, visual observation showed that pure mussel meat hydrolysate powder collapsed, during storage at 25°C, in the 90th day, and the powders produced with 15% and 30% of gum Arabic presented higher physical stability, with no collapse, up to the 120th day of shelf life.

CONCLUSION Protein hydrolysis of mussel meat is an alternative solution to obtain flavors from mussel meat with high quality and less bitterness. Moreover, the microencapsulation, by spray drying, using carrier agents, as gum Arabic, increases the glass transition temperature of the mussel meat hydrolysate powder. The results of sorption isotherms, glass transition temperature, particles morphology and volatile profile provide a great increase on physical stability, a reduction of the stickiness and also a reduction of volatile losses during long storage periods.

ACKNOWLEDGMENTS The authors gratefully acknowledge Institute of Food Technologists for permission to reuse part of an article. The authors also gratefully acknowledge the financial support of Fundação de Amparo à Pesquisa do Estado de São Paulo (Fapesp), and Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq).

REFERENCES Abdul-Hamid, A.; Bakar, J.; Bee, G. H. Food Chemistry. 2002, vol 78, n. 1, 69–74. Adler-Nissen, J. Enzymatic hydrolysis of food protein; Elsevier Applied Science Publishers: London, UK, 1986; 427 p. Aguilera, J. M. Biotechnol. Progress. 1993, vol 9, n. 6, 651-654. Aquerreta, Y.; Astiasara, I; Bello, J. J. Sci. Food Agr. 2001, vol 82, 107-112. Baek, H. H.; Cadwallader, K. R. J. Food Sci. 1995, vol 60, n. 5, 929-935. Baines, D.; Knights. J. In Chemistry and Technology of Flavors and Fragrances; Rowe, D. J.; CRC Press: Boca Ratón, US, 2005, pp 274-303. Baranauskiene, R.; Venskutonis, P. R.; Dewettinck, K.; Verhe, R. Food Res. Int. 2006, vol 39, 413–425. Bhandari, B. R.; Datta, N.; Howes, T. Drying Technol. 1997, vol 15, 671–684. Bhandari, B. R.; Howes, T. J Food Eng. 1999, vol 40, 71–79. Cambero, M. I.; Jaramillo, C. J.; Ordonez, J. A.; Pereira- Lima, C. I.; García de Fernando, G. D. Z. Lebensm-Unters Forsch A. 1998, vol 206, 311-322.

354

Vanessa Martins da Silva, Kil Jin Park and Míriam Dupas Hubinger

CFR, Code of Federal Regulations, U.S. Government Printing Office, Available on http://www.access.gpo.gov. Cha, Y. J.; Cadwallader, K. R. J. Agric. Food Chem. 1998, vol 46, n. 3, 1123–1128. Cha, Y. J.; Chang Lee, G. H.; Cadwallader, K. R. In Flavor and Lipid Chemistry of Seafoods; Shahidi, F.; Cadwallader, K. R.; ACS Symposium Series 674; American Chemical Society: Washington, US, 1997; pp 131-147. Cha, Y; Kim, H; Jang, S. J. Food Sci. Nutr. 1998b, vol 3, 15-21. Cha, Y; Kim, H; Kim, E. J. Food Sci. Nutr. 1998a, vol 3, 10-4. ChiaLing, J., K. WenChing, C. L. Jao, W. C. Ko. Fish Sci. 2002, vol 68, 1344–1351. Cros, S.; Lignot, B.; Bourseau, P.; Jaouen, P.; Prost, C. J. Food Eng. 2005, vol 69, 425-36. de Holanda, H. D.; Netto, F. M. J. Food Sci. 2006, vol 71, C298-C303. Dickinson, E. Food Hydrocolloid. 2003, vol 17, 25–39. Diniz, F. M.; Martin, A. M. Food Sci. Technol. Int. 1998, vol 4, 91-98. Dziezak, J. D. Food Technol. 1988, vol 42, 136–151. FAO, Food and Agricultural Organization of the United NationsFood and Agricultural Organization Yearbook. World Review of Fisheries and Aquaculture, Fishery Statistics, Rome, Italy, 2008; pp 1-84. FAO. Food and Agricultural Organization of the United Nations. Discards in the world‘s marine fisheries. Rome, Italy, 2005; pp 1-22. Fuentes, A.; Fernández-Segovia, I.; Escriche, I.; Serra, J. A. Food Chem. 2008, vol 112, 295302. Gildberg, A. Process Biochem. 1993, vol 28, 1-15. González-Tello, P.; Camacho, F.; Jurado, E.; Páez, M. P.; Guadix, E. M. Biotechnol. Bioeng. 1994, vol 44, 523-28. Guen, S. L.; Prost, C.; Demaimay, M. J. Chromatogr. 2000, vol 896, 361-71. Guerard, F.; Guimas, L.; Binet, A. J. Molec Catal B: Enzym. 2002, vol 19-20, 489-98. Hoyle, N. T.; Merrit, J. H. J. Food Sci. 2006, vol 59, n. 1, 76-79. Imm, J. Y.; Lee, C. M. J. Agr. Food Chem. 1999, vol 47, 2360-2366, 1999. Kenyon, M. M. In Encapsulation and Controlled Release of Food Ingredients; Rish, S. J.; Reineccius, G. A.; ASC Symposium Series 590. American Chemical Society: Washington, US, 1995, pp 43–50. Kim, H. R.; Baek, H. H.; Meyers, S. P.; Cadwallader, K. R.; Godber, J. S. J. Food Sci. 2006, vol 59, 91-95. Kim, J. H.; Ahn, H. J.; Yook, H. S.; Kim, K. S.; Rhee, M. S.; Ryu, G. H.; Byun, M. W. Radiat. Phys. Chem. 2004, vol 69, 179–187. Kristinsson, H. G. In Marine Nutraceuticals and Functional Foods; Barrow, C. J.; Shahidi, F; CRC Press: New York, US, 2008, pp 229-241. Kristinsson, H. G.; Rasco, B. A. Crit. Rev. Food Sci. Nutr. 2000, vol 32, 1-39. Kubota, K.; Kobayashi, A.; Yamanishi, T. Agri. Biol. Chem. 1982, vol 46, 2835-2839. Kurozawa, L. E.; Park, K. J.; Hubinger, M. D. J. Food Eng. 2009, vol 91, 287-296. Kurozawa, L. E.; Park, K. J.; Hubinger, M. D. J. Food Sci. 2008, vol 73, C405-C412. Lee, C. M. In Maximising the value of marine by-products; Shahidi, F; Woodhead Publishing: Cambridge, UK, 2007, pp 304–327. Lee, E. H.; Lee, T. H.; Kim, J. S.; Ahn, C. B. Bull. Korean Fish. Soc. 1989, vol 22, 25-35. Lee, G. H.; Suriyaphan, O; Cadwallader, K. R. J. Agr. Food Chem. 2001, vol 49, 4324-4332. Lian, P.; Lee, C. H.; Park, E. J. Aquat. Food Product Technol. 2001, vol 10, n. 1, 19-32.

Production and Shelf Life of Mussel Meat Powder Flavor

355

Liaset, B.; Julshamn, K.; Espe, M. Process Biochem. 2003, vol 38, 1747-1759. Liu, C.; Morioka, K.; Itoh, Y.; Obatake, A. Fish. Sci. 2000, vol 66, 343–348. Madene, A.; Jacquot, M.; Scher, J.; Desobry, S. Int. J. Food Sci. Technol. 2006, vol 41, 1–21. Maehashi, K.; Matsuzaki, M.; Yamamoto, Y.; Udaka, S. Biosci. Biotechnol. Biochem. 1999, vol 63, n. 3, 555-559. Mandeville, S; Yaylayan, V.; Simpson, B. J. Agr. Food Chem. 1992, vol 40, 1275-1279. Margulis, B. A.; Pinaev, G. P. Comp. Biochem. Physiol. 1976, vol 55B, 189-94. Masters, K. Spray Drying in Practice. SprayDryConsult: Copenhagen, DK, 2002; pp. 39–62. McGorrin, R. J. In Foods Flavor, Fragrance and Odor Analysis; Marsili, R; Marcel Dekker: New York, US, 2002; pp 375-413. Medina-Vivanco, M.; Sobral, P. J. A., Sereno, A. M.; Hubinger, M. D. Int. J. Food Prop. 2007, vol 10, 791–805. Moreno, M. C. M; Cuadrado, V. F. Process Biochem., 1993, vol 28, 481-490. Mutka, J. R.; Nelson, D. B. Food Technol. 1988, vol 42, 154–157. Nilsang, S.; Lertsiri, S.; Suphantharika, M.; Assavanig, A. J. Food Eng. 2005, vol 70, 571– 578. Perfumer and Flavorist. Available on: http://www.perfumerflavorist.com/, 1999. Raja, K. C. M.; Sankarikutty, B.; Sreekumar, M.; Jayalekshmy, A.; Narayanan, C. S. Starch. 1989, vol 41, 298–303. Reineccius, G. A. Flavor Chemistry and Technology; Cap 14. Flavor Applications; 2nd ed; CRC Press: New York, US, 2006, pp 391-417. Reineccius, G. A. In Flavor Encapsulation; Rish, S. J.; Reineccius, G. A.; American Chemical Society: Washington, US, 1988; pp 55-66. Ritchie, A. H.; Mackie, I. M. Anim. Feed Sci. Technol. 1982, vol 7, 125-133. Rosenberg, M.; Kopelman, I. J.; Talmon Y. J. Food Sci. 1985, vol. 50, 139–144. Sablani, S. S.; Kasapis, S.; Rahman M. S.; Al-Jabri A.; Al-Habsi, N. Food Res. Int. 2004, vol 37, 915-924. Saha, B. C.; Hayashi, K. Biotechnol. Adv. 2001, vol 19, 355–370. Shahidi, F.; Cadwallader, K. R. In Flavor and Lipid Chemistry of Seafoods; Shahidi, F.; Cadwallader, K. R.; ACS Symposium Series 6741997; American Chemical Society: Washington, US, 1997, pp 1-8. Shahidi, F.; Han, X. Q. Crit. Rev. Food Sci. Nutr. 1993, vol 33, 501-547. Shahidi, F.; Han, X-Q.; Synowiecki, J. 1995. Food Chem. 1995, vol 53, 285–293. Silva, V. M.; Park, K. J.; Hubinger, M. D. J. Food Sci. 2010, vol 75, C36-42. Simpson, B. K.; Nayeri, G.; Yaylayan, V.; Ashie, I. N. A. Food Chem. 1998, vol 61, 131-138. Soottitantawat, A.; Takayama, K.; Okamura, K.; Muranaka, D.; Yoshii, H.; Furuta, T. Innov. Food Sci. Emerg. Technol. 2005b, vol 6, 163–170. Thevenet, F. In Flavor Encapsulation, Risch, S. J., G.A. Reineccius; American Chemical Society: Washington, US, 1988, pp 37-44. Tonon, R. V.; Baroni, A. F.; Brabet, C.; Gibert, O.; Pallet, D.; Hubinger, M. D. J. Food Eng. 2009, vol 92, 215-221. Vieira, G. H. F.; Martin, A. M.; Saker-Sampaio, S.; Sobreira-Rocha, C. A.; Gonçalves, R. C. F. In Food Flavors:Generation, Analysis, and Process Influence; Charalambous, G.; Elsevier Applied Science Publishers: New York, US, 1995; pp 1405-1415. Vieira, G. H. F.; Martin, A. M.; Sampaio, S. S.; Omar, S.; Gonçalves, R. C. F. J. Sci. Food Agr. 2006, vol 69, n. 1, 61-65.

356

Vanessa Martins da Silva, Kil Jin Park and Míriam Dupas Hubinger

Weir, G. S. D. In Developments of food proteins; Hudson, B. J. F.; Elsevier Applied Science Publishers: New York, US, 1986; pp 175-217. Whitaker, J. R. In Handbook of Food Enzymology; R. J. Whitaker; A. G. J. Voragen; D. W. S. Wong; Marcel Dekker: New York, US, 2003. Yasuhara, A.; Morita, M. Chemosphere. 1987, vol 16, 2559-2565. Yin, H.; Pu, J.; Yutingwan; Xiang B.; Bechtel, P. J.; Sathivel, Sathivel, S. Rheological and Functional Properties of Catfish Skin Protein Hydrolysates. J. Food Sci. 2010, vol. 75, n. 1, E11-E17. Yoshii, H.; Soottitantawat, A.; Liu, X. D. Innov. Food Sci. Emerg. Technol. 2001, vol 2, 55– 61.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 15

LIFE CYCLE ASSESSMENT OF MUSSEL CULTURE Diego Iribarren, María Teresa Moreira, and Gumersindo Feijoo Dept. of Chemical Engineering, University of Santiago de Compostela, Spain

ABSTRACT The application of Life Cycle Assessment (LCA) for the environmental analysis of mussel culture was considered through the study of the main production areas in Galicia (NW Spain). Inventory data came from interviews and surveys from a set of vessels accounting for the production of more than 7,000 tonnes of mussels cultured in rafts. In addition, physico-chemical characterization of wastewater from the vessels was performed. Abiotic resources depletion, global warming, ecotoxicity, human toxicity, acidification, ozone layer depletion, photochemical oxidant formation, and eutrophication were the impact categories included. Characterization results for each of the categories revealed the importance of taking into account not only the operational issues, but also the capital goods. The consumption of diesel for the vessel arose as the main contributor to potential environmental impacts, along with energy demand and iron production linked to capital goods. Furthermore, an analysis with four different scenarios was carried out, highlighting the importance of studying capital goods in greater detail. Additionally, a toxicity/ecotoxicity analysis was performed, proving a lack of consensus when characterizing toxicity and ecotoxicity potentials. Finally, mussel aquaculture was compared to mussel capture, finding that mussel aquaculture may present a higher potential environmental impact for farmed mussels due to the involvement of a number of operational inputs and outputs without correspondence in current data for mussel capture.

1. INTRODUCTION Aquaculture has emerged as a dominant sector in world fisheries due to its enormous potential to balance the decline in available marine seafood resources. In the case of mussels, unlike for most other aquatic species, wild mussel production is much smaller than cultured mussel production. In fact, mussel share in production roughly represents 10% for mussel

358

Diego Iribarren, María Teresa Moreira and Gumersindo Feijoo

capture, while the remaining 90% corresponds to mussel culture (Josupeit, 2005). Worldwide, this mollusc is cultivated mainly in floating structures called rafts, in long-lines and, to a lesser extent, lying on fixed structures on the sand and naturally attached to coastal rocks (Tirado and Macias, 2006). Table 1 shows the most important mussel producing countries. Worldwide, China is the main producer (Conde, 2007). However, its mussel production is mainly intended for national supply and, surprisingly, its role in the production of canned and frozen mussels is not relevant (Josupeit, 2005). Table 1. Overview of mussel production worldwide (source: FAO, 2006) Country China Thailand Spain Denmark New Zealand Chile Italy France Holland

Tonnes produced in 2004 717,368 296,000 294,826 99,500 86,353 78,845 77,653 74,100 67,200

Main method Culture Culture Culture Capture Culture Culture and capture Culture and capture Culture Culture

World mussel production has steadily increased over the past decades, from about 700,000 tonnes in the 1970s to 900,000 tonnes in the 1980s. In 2005 world production had increased up to 1.8 million tonnes (Fao, 2006, 2007), with Spain accounting for 210,000 tonnes (Mapa, 2007). When considering the production of mussels intended for human consumption, then the Spanish mussel sector occupies the world‘s top position in sales since China is still developing this industry (Jian-Guang and Qisheng, 2005; Franco, 2006). Activities related to the Spanish mussel sector are primarily located in Galicia (NW Spain), where around 98% of the total national production takes place. Mussels (Mytilus galloprovincialis) are the single largest cultured shellfish in Galicia (more than 200,000 tonnes per year), with a strong impact on its economy (turnover of roughly 100 million Euro) (Xunta de Galicia, 2006). Galician cold waters and the geographic nature of the region with characteristic rias provide fabulous aquaculture areas for farming mussels. The expansion and intensification of aquaculture has raised a number of issues in terms of its negative impact on the environment. In particular, mussel farming constitutes an extensive aquaculture practice that demands vessel operation. In regard to the Galician coastal fleets, they are co-responsible for many of the impacts linked to offshore fleets, but the special characteristics of the Galician rias make the ecosystem highly sensitive to marine toxicity or eutrophication (Rodríguez-Lado and Macías, 2006). When dealing with both fisheries and aquaculture, general environmental concerns include direct ecological impacts on targeted species (Pauly et al., 2002; Christensen et al., 2003; Myers and Worm, 2003), disturbance and displacement of benthic communities (Johnson, 2002), and alteration of trophic dynamics (Jackson et al., 2001). However, the environmental analysis of seafood systems should not be limited to biological aspects. A more comprehensive approach is recommended. In this sense, for the environmental evaluation of mussel farming, the use of Life Cycle Assessment (LCA) was considered.

Life Cycle Assessment of Mussel Culture

359

Table 2. Compilation of LCA studies on seafood Reference Papatryphon et al., 2003, 2004 Ziegler et al., 2003 Hospido and Tyedmers, 2005 Aubin et al, 2006, 2009 Ellingsen and Aanondsen, 2006 Grönroos et al., 2006 Mungkung et al., 2006 Thrane, 2006 Ziegler and Valentinsson, 2008 Ayer and Tyedmers, 2009 Iribarren et al., 2010

Subject Rainbow trout farming Frozen fillets from cod fished in the Baltic Sea Spanish tuna fisheries Carnivorous finfish production Norwegian cod fishing and salmon farming Production of rainbow trout in Finland Shrimp aquaculture in Thailand Danish fish products (mainly flatfish) Creeling and trawling of Norway lobster Salmon culture in Canada Galician mussel sector

LCA is a technique for assessing the environmental aspects and potential impacts associated with a product by compiling an inventory of relevant inputs and outputs of a product system, evaluating the potential environmental impacts associated with those inputs and outputs, and interpreting the results of the inventory analysis and impact assessment phases in relation to the objectives of the study (Iso, 2006a, 2006b). LCA adopts a ‗cradle to grave‘ approach pursuing the impacts of a product throughout its life cycle: from raw material acquisition (the cradle) through its production and use to its final disposal (the grave). LCA has proved to be a suitable environmental management tool when it comes to evaluating the environmental performance of seafood (Pelletier et al., 2007). A compilation of selected LCA studies on seafood is presented in Table 2. In this chapter, mussel farming was considered for the evaluation of its environmental performance by LCA. The analyzed mussel culture system is the one most common in Spain: rafts (Figure 1). This system is defined as any floating structure constructed of wood or reeds, kept afloat using any combination of buoyant materials such as wood, sealed barrels, inflated air chambers or extruded polystyrene blocks. The main components of the raft are the grid (mesh of wooden beams), the flotation system, the anchoring system (shackle chain and concrete anchoring blocks), and the cultivation system (ropes with plastic pegs) (Tirado and Macias, 2006).

Figure 1. Conventional raft for mussel culture.

Diego Iribarren, María Teresa Moreira and Gumersindo Feijoo

360

2. LCA FRAMEWORK The main objective of this chapter is to evaluate the potential environmental impacts linked to mussel aquaculture. The identification of the activities with a relevant contribution to the environmental impact will lead to suggest where improvement actions should focus for a better environmental performance.

2.1. System Boundaries Figure 2 shows a diagram of the system under study. The activities developed in the raft system include: 







 

Seed collection. Mussel farmers usually obtain this seed from two different sources: coastal stock from the rocky shoreline and collector ropes suspended from cultivation rafts (Labarta et al., 2004). Another possibility consists of the use of netting strips submerged at 1-2 m depth during the reproduction period of the mussel. Seed pre-fattening. This operation is performed by attaching small seeds to the rope with the aid of a thin cotton net. These ropes are submerged in the sea, hanging from the platform (Figueras, 1989). Rope thinning. The thinning-out process is carried out when individual mussels reach a size of around 5 cm (Pérez-Camacho, 1992), generally after 4-6 months. Three or four new ropes can be obtained from each initial rope, allowing the mussels to grow with a more homogenous shell length and a smaller density of molluscs per rope length until they reach commercial size (7-10 cm). Harvest, selection and packaging. Growing ropes are hauled onto vessels with hydraulic cranes and stripped of their mussels. Afterwards, the clumps of mussels are separated, washed with seawater, classified according to shell length and then bagged. Construction, operation and maintenance of the raft. Construction, operation and maintenance of the auxiliary cultivation vessels. The term auxiliary vessel is used to distinguish vessels used for aquaculture purposes from regular fishing vessels.

Figure 2. System under study: mussel culture.

The mussel cultivation system was considered for analysis as a whole, including all the abovementioned activities inside the system boundaries. The process flow diagram for mussel culture is presented in Figure 3.

Life Cycle Assessment of Mussel Culture

361

Figure 3. Process flow diagram for mussel aquaculture.

As shown in Figure 3, some aspects concerning capital goods were included. Capital goods mean goods, such as machinery and equipment, used in the life cycle of products. In particular, the consumption of inputs for the construction of the vessel, the raft and their components were considered. However, the treatment of end-of-use materials from capital goods was excluded because of the lack of reliable information. With respect to capital goods, the following items were covered: (i) overall energy demand (i.e., energy demand linked to structure and equipment); (ii) textile materials (flax, cotton, and nylon) for ropes, thin nets and yarns; (iii) polypropylene (PP) for big-bags; (iv) high density polyethylene (HDPE) for plastic pegs; (v) PET for floats; (vi) concrete for anchoring blocks; (vii) wood for the raft and the auxiliary vessel; (viii) stainless steel for

362

Diego Iribarren, María Teresa Moreira and Gumersindo Feijoo

machinery (de-clumping machine, re-tubing machine, basket, etc.); (ix) steel for machinery (hydraulic crane); and (x) iron for floats, shackle chain and engines.

2.2. Functional Unit The functional unit (FU) is defined by ISO standards as a quantified performance of a product system for use as a reference unit in an LCA study (Iso, 2006a). The FU selected for this case study was the annual mussel production of a conventional raft: 89.74 t/raft. This figure is the average value inferred from the specific questionnaires developed for this case study as explained in section 2.3. This number questions the average value of 50 t/raft often linked to this aquaculture practice by other sources (Amegrove, 2007; Pedramol, 2007).

2.3. Data Acquisition According to official data from the regional government, the number of vessels operating in aquaculture-related activities in Galicia was 1,096 vessels in 2007 (Plataforma Tecnolóxica da Pesca, 2007). More than 85% were located in the southwest coast of the region. The Ria de Arousa was selected as the most representative geographical area for the study of mussel culture in Spain, accounting for 71% of the total aquaculture fleet. Further details about location are provided in Figure 4. A questionnaire was prepared to collect the necessary data for the different processes involved, from seed collection to mussel packaging in sacks prior to industrial processing. This survey comprised a wide range of structural and operational aspects of both the vessel (dimensions; hull material; main and auxiliary engine powers; annual consumption of diesel, oil, and antifouling paint; average disposal of wastewater; etc.) and the raft (construction material, dimensions, life span, number/material/dimensions of the floats, anchoring system, annual consumption of tar oil, etc.). The skippers of 22 auxiliary vessels in charge of 80 rafts filled out the questionnaire. Moreover, in order to evaluate the emissions to the sea, wastewater samples collected from three vessels were analyzed. These samples were taken during a one-year period, taking into account seasonal variations in mussel culture, which inherently affect vessel operation. Standard methods (Apha, 1995) were used in order to quantify the main physico-chemical parameters: Chemical Oxygen Demand (COD), Biological Oxygen Demand (BOD5), Total Solids, Total Volatile Solids, Total Suspended Solids, Total Volatile Suspended Solids, chloride, Total Organic Carbon (TOC), Total Kjeldahl Nitrogen (TKN), fats and oils, etc. In addition, metal content (Cl, Br, Rb, Sr, K, Fe, Ca) was measured using X-ray fluorescence. Furthermore, concentrations of sixteen polycyclic aromatic hydrocarbons (PAHs) were ionchromatographically quantified, including acenaphtene, acenaphthylene, anthracene, benzo(a)anthracene, benzo(a)pyrene, benzo(b)fluoranthene, benzo(k)fluoranthene, benzo(g,h,i)perylene, chrysene, dibenzo(a,h)anthracene, phenanthrene, fluoranthene, fluorene, indenopyrene, naphthalene and pyrene. Chrysene, phenanthrene and fluoranthene were the only PAHs that reached the detection limit. Therefore, they were included as part of the life cycle inventory for mussel culture.

Life Cycle Assessment of Mussel Culture

363

Figure 4. Area of study for mussel culture in rafts. The star symbols indicate the assessed parks.

The information provided by the survey was completed with data from different companies, including data for engines (Caterpillar, 2007), specific equipment for mussel culture (Talleres Aguin, 2007), hydraulic cranes (Industrias Guerra, 2007), and specific products for myticulture (JJ Chicolino, 2007). To a lesser extent, reference values from bibliographic sources were considered (Cáceres-Martínez et al., 1994; Pérez-Camacho et al., 1995; García et al., 2000; Troell et al., 2004).

2.4. Inventory Data As stated before, the questionnaire was filled out by the skippers of 22 auxiliary vessels in charge of 80 rafts. The average annual production per raft resulted in 89.74 tonnes of mussels. Thus, the total production evaluated was around 7,180 tonnes. Mussel culture in Galicia presents very well-defined characteristics within a specific legal framework. Therefore, a set of standard values for mussel culture in conventional rafts was established in order to propose a model for the raft and the auxiliary vessel (Table 3). Some of the inventoried elements can be observed in Figure 5.

364

Diego Iribarren, María Teresa Moreira and Gumersindo Feijoo

Table 3. Conventional values for rafts and auxiliary vessels used in mussel culture Auxiliary vessel Parameter

Value

Hull material

Wood

-

-

Material

Wood

-

-

Length

16.68

2.34

m

Length

26.55

1.06

m

Width

5.38

0.99

m

Width

Units

Parameter

Value

Standard deviation

Units

20.14

0.64

m

5.90

0.72

floats

Life span

31.88

5.74

year

Number of floats

Main engine power

209.65

89.03

hp

Material of the floats

Ironb

-

-

Auxiliary engine power

53.06

29.70

hp

Floats length

2.17

0.07

m

Crew

2.88

1.05

persons

Floats diameter

3.73

0.54

m

18.91

6.93

t

Number of attended rafts

3.65

1.84

rafts

Weight of the concrete anchoring block

Distance to cultivation site

2.49

1.65

miles

Life span

19.50

5.60

years

Annual diesel consumption

5,225.00

3,100.22

l/year

Annual consumption of tar oil

109.56

68.65

l/year

Annual oil consumption

87.34

58.56

l/year

Rope lengthc

11.72

0.64

m

Annual paint consumption

60.00

36.25

l/year

Rope material

Nylon

-

-

Time for maintenance and repairsa

26.67

9.19

d/year

Material of the mussel pegsd

Plastic (HDPE)

-

-

l/month

Annual consumption of cottone

19.14

17.04

boxes/year

Monthly wastewater a

Raft Standard deviation

30.83

18.28

The auxiliary vessel works an average of 180 days per year Iron covered with polyester c The length for collector ropes is 5,00 m d Each peg is placed through the rope with a separation of 40 cm e Each box contains 500 m of cotton b

Life Cycle Assessment of Mussel Culture

365

Figure 5. Some inventoried elements: (1) hydraulic crane and basket, (2) rope with plastic pegs, (3) shackle chain, (4) grading table, (5) de-clumping machine, re-tubing machine and big-bag, (6) engine.

Emissions to the sea were considered using real data from laboratory measures for wastewater from auxiliary vessels (Table 4), along with the average value for rope (nylon) loss from questionnaires. No estimates involving other items were included. Using all the available information, the life cycle inventory of the mussel culture was carried out (Table 5). Although the FU of the case study is the annual production of a raft, Table 5 is presented for the production of 1 kg of farmed mussels of commercial size in order to make the reading easier. The main input from nature corresponds to mussel seeds, which are partly collected from a coastal rocky area where mussel farmers collect the seeds just by means of scrapers (Cáceres-Martínez et al., 1994). The remaining percentage of seeds is obtained from collector ropes and netting strips (Tirado and Macias, 2006). The other main inputs gathered in the inventory table come from the technosphere. The input value for diesel use in the auxiliary vessel is in agreement with bibliographic sources (Troell et al., 2004). Similarly, wood demand is also in line with other published data (García et al., 2000). Life spans for capital goods were taken into account. According to the questionnaires for this case study, a life span of 12.5 years was assumed for textile materials and plastic pegs as well as 19.5 years for floats, anchoring blocks, chain and raft wood, 5 years for big-bags, and

Diego Iribarren, María Teresa Moreira and Gumersindo Feijoo

366

nearly 32 years for vessel wood. Life spans for machinery ranged from 10 to 25 years depending on each machine (Tirado and Macias, 2006). SimaPro 7 was the software used for the computational implementation of the inventory (Goedkoop et al., 2008). The ecoinvent database was chosen for background processes (Frischknecht et al., 2007a), while bibliographic data were used for flax yarn production (Turunen and van der Werf, 2006). Electricity production was considered by assuming the mix for Spain as presented in the ecoinvent database (Dones et al., 2007). Table 4. Analytical data of wastewater from auxiliary vessels for mussel farming Parameter

Value

pH

7.28  0.48

Total COD (g O2/l)

0.65  0.31

Soluble COD (g O2/l)

0.43  0.28

BOD5 (g O2/l)

0.04  0.06

Total Solids (g/l)

44.65  10.75

Total Suspended Solids (g/l)

0.22  0.16

Total Volatile Solids (g/l)

11.12  8.50

Total Volatile Suspended Solids (g/l)

0.18  0.15

Chloride (g/l)

24.66  3.86

TOC (g C/l)

0.05  0.07

Inorganic Carbon (g C/l)

0.04  0.01

Total Carbon (g C/l)

0.09  0.08

Ammoniacal nitrogen (mg N/l)

0.58  1.37

Organic Nitrogen (mg N/l)

5.57  4.37

Fats (mg/l)

0.95  0.56

Chlorine (%)

0.74  1.02

Bromine (ppm)

74.52  16.72

Rubidium (ppm)

0.87  0.78

Strontium (ppm)

7.52  0.77

Potassium (%)

0.03  0.02

Calcium (%)

0.02  0.02

Iron (ppm)

9.33  14.33

Chrysene (g/l)

0.023  0.01

Phenanthrene (g/l)

0.019  0.01

Fluoranthene (g/l)

0.014  0.01

Life Cycle Assessment of Mussel Culture

367

Table 5. Inventory data for mussel culture in traditional rafts (1 kg of commercial mussels) INPUTS From the technosphere Materials and fuels 1. Chemicals and other materials Iron 13.03

g

Antifouling paint

0.17

g

Stainless steel Other steels Nylon HDPE PET

0.08 0.19 3.55 0.32 0.02

g g g g g

Concrete

10.81

g

Cotton 0.27 Acetate rayon 9.47 Flax 6.69 Polypropylene (PP) 0.33 Tar oil 1.22 Oil C15-C50 0.27 2. Wood Pine and oak 1.84 Eucalyptus 36.87 Ash tree 0.01 Total Wood 38.71 3. Diesel 15.96 Energy 1. Infrastructure and 2.67 equipment OUTPUTS To the technosphere Final product 1. Mussel of commercial 1.00 size Waste to treatment 1. Polypropylene (PP) 15.24 2. HDPE 0.04 3. Cotton 0.06 4. Nylon 0.64 To the environment: emissions to air 1. Carbon dioxide 43.10 2. Methane 3.99 3. Dinitrogen monoxide 1.09 4. Sulphur dioxide 39.91 5. Carbon monoxide 100.58 6. Nitrogen oxides 766.30 7. NMVOC 31.93

From the environment Raw materials 1. Seeds from rocky shoreline Mussel seed 5.85 Use of rocky 5.16·10-8 shoreline 2. Seeds from collector ropes Mussel seed 9.05 3. Seeds from netting strips Mussel seed 1.81 Total mussel seed 16.71 4. Use of sea 59.56 surface

g ha g g g cm2

g mg mg mg ml ml g g mg g ml MJ To the environment: emissions to the ocean 1. Wastewater from auxiliary vessels kg g g g g g mg mg mg mg mg mg

Total COD

0.37

mg O2

BOD5 Solved solids Suspended solids Chloride TOC Chlorine Bromine Potassium Calcium Organic nitrogen Fats Rubidium Strontium Iron Chrysene Phenanthrene Fluoranthene 2. Nylon

0.02 25.11 0.12 19.94 0.03 4.18 0.04 0.17 0.11 3.34 0.55 0.45 4.45 5.57 0.01 0.01 0.01 0.12

mg O2 mg mg mg mg C mg mg mg mg g N g g g g ng ng ng g

368

Diego Iribarren, María Teresa Moreira and Gumersindo Feijoo

3. RESULTS Classification and characterization were performed to evaluate the potential environmental impacts according to ISO guidelines (Iso, 2006b). The CML 2000 midpoint method was used (Heijungs et al., 1992; Guinée et al., 2001). This implies the use of an environmental impact assessment method, which results in the definition of an environmental profile for the assessed product by quantifying the environmental effect on different categories and assessing indirect or intermediate effects on humans (Feijoo et al., 2007). The following impact categories were considered: acidification potential (AP), ozone layer depletion potential (ODP), abiotic depletion potential (ADP), global warming potential (GWP), eutrophication potential (EP), photochemical oxidant formation potential (POFP), fresh water aquatic ecotoxicity potential (FETP), marine aquatic ecotoxicity potential (METP), terrestrial ecotoxicity potential (TETP), and human toxicity potential (HTP). This set of categories is very common in LCA for seafood (Pelletier et al., 2007). When assessing the potential environmental impact of myticulture (i.e., mussel culture), it is recommended to distinguish contributions linked to operation from those related to capital goods (Frischknecht et al., 2007b). Table 6 shows the characterization results for the evaluation of the environmental performance of mussel culture. On the one hand, the term capital goods involves the demand of energy, iron, concrete, textile materials, plastics, steel, and wood for the construction of machinery and equipment used in mussel farming. On the other hand, the term operation embraces (i) diesel production and use for the operation of the vessel, (ii) oil and antifouling paint production for the maintenance of the vessel, (iii) tar oil production for the maintenance of the raft, (iv) operational solid waste treatment, and (v) wastewater emission from vessels. Wastewater arising from vessels was considered the only direct emission to the sea. The release of non-ferrous metals related to the use of antifouling paint was excluded on the rationale of a lack of agreement between toxicity factors and the state of the oceans (Hospido and Tyedmers, 2005). Table 6. Environmental characterization for mussel culture in traditional rafts (values per FU) Impact category

Unit

Abiotic depletion Global warming Ozone layer depletion Human toxicity Fresh water aquatic ecotoxicity Marine aquatic ecotoxicity Terrestrial ecotoxicity Photochemical oxidant formation Acidification Eutrophication

kg Sb eq kg CO2 eq kg CFC-11 eq kg 1,4-DB eq kg 1,4-DB eq kg 1,4-DB eq kg 1,4-DB eq kg C2H2 eq kg SO2 eq kg PO43- eq

Value Capital goods 28.67 3.59·104 1.70·10-3 1.18·104 3.76·103 5.00·107 81.45 21.38 5.64·102 24.46

Operation 27.37 2.55·103 6.21·10-3 1.65·103 1.17·102 5.34·105 -2.69 0.13 20.76 7.85

Total 56.03 3.84·104 7.91·10-3 1.34·104 3.88·103 5.05·107 78.76 21.50 5.84·102 32.30

Figure 6 clearly shows the contribution of operation and capital goods to the impact categories. On the basis of this figure, the advisability of including capital goods as an impact source is demonstrated. In fact, the extensive and non-continental nature of mussel farming in

Life Cycle Assessment of Mussel Culture

369

Spain put forward this result as already known for agricultural products (Frischknecht et al., 2007b). In a very notable way, capital goods established themselves as the main origin of the potential environmental impacts related to acidification, eutrophication, photochemical oxidant formation, global warming, human toxicity, and the three ecotoxicity categories. Regarding abiotic depletion potential, a similar contribution for both operation and capital goods was observed. On the other hand, the main potential contribution to ozone layer depletion came from operation, which accounted for a contribution percentage of roughly 80%. Moreover, the potentially favourable impact of operation to TETP is related to plastic recycling.

Figure 6. Contributions to the environmental impact potentials in mussel culture: operation vs. capital goods.

The next step aimed to identify the main processes behind the contributions to the potential environmental impacts. This task determines the usefulness of LCA as a decision supporting tool, and its results are summarized in Figure 7 where the potential contributions to each of the impact categories are shown for the six processes identified as the main contributors. Three processes stood out as main sources of potential impacts: (i) electricity production for capital goods (energy demand), (ii) diesel production and use for the operation of the vessel, and (iii) iron production for capital goods. 120

Contribution (%)

100

80

60

40

20

0 ADP

GWP

ODP

HTP

FETP

METP

TETP

POFP

Cotton production (capital goods)

Nylon production (capital goods)

Iron production (capital goods)

Energy demand (capital goods)

Diesel production and use (operation)

Paint production (operation)

Figure 7. Process contribution for mussel farming in rafts.

AP

EP

370

Diego Iribarren, María Teresa Moreira and Gumersindo Feijoo

Energy demand for capital goods prevailed for GWP, POFP, AP, and EP, as well as for the four toxicity and ecotoxicity categories. Moreover, electricity production for capital goods accounted for 14% of the potential impact for ODP. Diesel consumption includes the production of diesel and its combustion for vessel operation. This process arose as the main potential source of impact for ADP and ODP. Additionally, it also presented a relevant contribution to the potential environmental impact for EP (29%), GWP (12%), and TETP (8%). Iron production for capital goods played a role in the environmental characterization of mussel farming. This is mainly due to the large weight of floats and shackle chain for the raft even though their life spans have been taken into account. This process significantly contributed to ADP with a percentage of 48% of the impact for this category. It also involved lower percentages for GWP (6%), ODP (6%), and POFP (5%). Furthermore, toxicity and ecotoxicity categories were also affected by this process (15% for HTP, 9% for FETP, 3% for METP, and 10% for TETP). To a lesser extent, other processes contributed to the potential environmental impacts. For example, nylon production (mainly linked to the use of ropes for mussel culture) accounted for a contribution of 9% to EP, 6% to GWP, and 2% to POFP, AP, and TETP. Other examples are paint production for the maintenance of the vessel (contribution of 7% to HTP, and 5% to TETP) or cotton production (contribution of 8% to EP, and 2% to ADP).

4. DISCUSSION AND IDENTIFICATION OF IMPROVEMENT POTENTIALS 4.1. Improvements Potentials The characterization results are very useful when approaching improvement actions in the myticulture field. In this sense, the attributional LCA of mussel culture led to focus the identification of improvement potentials not only on operational issues but also on capital goods. However, specific improvement actions on capital goods are difficult to identify given the prevalence of the overall energy demand as main responsible for the contributions to the impact potentials. Related to energy use, mussel culture is not considered an activity with high energy consumption as compared to the cultivation of other species such as shrimp or salmon, especially regarding operational activities (Troell et al., 2004). However, according to the previous results, it seems evident that improvement actions should be centred on the minimization of diesel consumption in the auxiliary vessel. This would lead to a significant improvement for each of the environmental indicators. Therefore, efforts should be made to reduce the diesel demand for auxiliary vessels: use of fuels with higher energy efficiency, sustainable planning and logistic organization of vessel route to the rafts, etc. Concerning capital goods, it would be advisable to act on the corresponding energy demands. Nonetheless, the estimated term ‗energy demand for capital goods‘ involves all the capital goods for mussel farming; therefore, actions on this term become difficult. On the contrary, this barrier is not found when dealing with the minimization of iron consumption levels given that improvement potentials concern a few capital goods: engines, floats, chains,

Life Cycle Assessment of Mussel Culture

371

and shackles. In this sense, there is a wide range of alternatives such as technological innovation (e.g. use of new materials and designs).

4.2. Energy Demand for Capital Goods Energy demand for capital goods was found to be one of the main contributors to the different impact categories. However, this value means a rough estimate and should be more accurate. This could be achieved by inventorying in greater detail the different capital goods involved in mussel aquaculture. Since this possibility is out of the scope of this chapter, an analysis of the relevance of this value was performed instead. Four scenarios were defined: -

Scenario 0: current case study (no change). Scenario 1: reduction of 10% for the overall energy demand for capital goods. Scenario 2: reduction of 25%. Scenario 3: reduction of 50%.

Figure 8 shows that as the overall energy demand for capital goods was decreased, a gradual reduction in characterization values was observed. This reduction was clear for GWP, AP, METP, HTP, TETP, POFP, FETP, and EP. On the other hand, there was no influence over ADP. Similarly, the influence was minimal for ODP. These observations stress the importance of studying capital goods in greater detail. 8E-03

500

kg CFC-11 eq

Corresponding Units

600

400

300 200

6E-03 4E-03 2E-03

100 0E+00

0 ADP

TETP

Scenario 0

Scenario 1

POFP Scenario 2

AP

ODP

EP

Scenario 3

Scenario 0

Scenario 1

Scenario 2

Scenario 3

50 kt 1,4-DB eq

Corresponding Units

40000

30000 20000 10000

40 30 20 10

0

0

GWP Scenario 0

Scenario 1

HTP Scenario 2

FETP Scenario 3

METP Scenario 0

Scenario 1

Scenario 2

Scenario 3

Figure 8. Analysis of the relevance of the value assigned to the energy demand for capital goods.

Diego Iribarren, María Teresa Moreira and Gumersindo Feijoo

372

4.3. Toxicity and Ecotoxicity Categories The results of the environmental characterization for the toxicity and ecotoxicity categories strongly depend on the selected method (Renou et al., 2008). In order to study this dependence, the use of the EDIP 2003 method was considered. This led to new characterization values for the toxicity and ecotoxicity potentials. From the comparison of these new values with those corresponding to CML 2000 (Table 7), the following conclusions were drawn: -

-

-

The lump sum of the values for the three EDIP 2003 categories linked to human toxicity accounted for 97.93% of the total toxicity impact; whereas, if CML 2000 is used, then the value for the human toxicity potential only involved 0.03% of the total toxicity impact. If EDIP 2003 is used, the sum of the values for the two different categories related to water ecotoxicity accounted for only 2.06% of the total toxicity impact; while the value of the sum of the two CML 2000 categories associated with water ecotoxicity accounted for 99.97%. Finally, the value for soil (terrestrial) ecotoxicity potential accounted for 1.66·10-3% of the total toxicity impact when using EDIP 2003 and, similarly, for 1.46·10-4% if CML 2000 is used.

According to the two first conclusions, a lack of consensus was proved when characterizing toxicity and ecotoxicity potentials. Table 7. Comparison of toxicity and ecotoxicity potentials calculated through two different methods CML 2 baseline 2000 HTP FETP

METP TETP (kg 1,4-DB eq) 13,432 3,878 50,484,945 79 EDIP 2003 V1.01 ETWC ETWA ETSC HTA HTW (m3) 6,430,372 2,341,658 7,069 415,816,565 320,533 ETWC: ecotoxicity water chronic HTA: human toxicity air ETWA: ecotoxicity water acute HTW: human toxicity water ETSC: ecotoxicity soil chronic HTS: human toxicity soil

HTS 3,610

4.4. Eutrophication Potential When studying mussel farming, EP also becomes a controversial impact category. It has been suggested that mussels (filter feeders) can act as a buffer against eutrophication processes since they mean a top down control on the phytoplankton biomasses and sequester nutrients (Nakamura and Kerciku, 2000; Cloern, 2001). However, Nizzoli et al. (2005)

Life Cycle Assessment of Mussel Culture

373

estimated the global effects of suspended mussel (Mytilus galloprovincialis) farming on oxygen and nutrient dynamics. This study found ratios between particulate nutrient consumption and net dissolved nutrient regeneration rates of 1.1 for nitrogen and 2.5 for phosphorous. Nevertheless, their results question the belief that dense populations of mussels act as a buffer against eutrophication problems since, whilst it was true that the mussel ropes exerted an intense grazing pressure on the phytoplankton, the ingested organic nutrients were rapidly recycled back to the water column by the mussel ropes and the underlying sediments, where they would fuel further phytoplankton growth. Thus, the net effect of mussels may be to increase phytoplankton turnover and productivity, rather than to decrease phytoplankton biomass. Consequently, in this mussel culture LCA, it was decided not to use any correction factor concerning the characterization value for EP.

4.5. Mussel Capture Thrane (2004) studied the potential environmental impacts for several Danish products, including mussels from capture. The comparison between mussel aquaculture and capture was then possible in terms of a comparative LCA. This comparison was limited to operational issues given that input data for mussel capture as implemented into the ‗LCA food data base‘ just consider the diesel input for the operation of the vessel (Nielsen et al., 2003). Moreover, this is a rough comparison that omits the difference in production capacity between mussel aquaculture and capture. Note that mussel farming only targets one species (i.e., mussels) while captured mussels come from multi-species fisheries. Table 8 gathers the characterization ratios for mussel aquaculture versus mussel capture for each of the impact categories. The ratio was greater than one for every category. Thus, a higher potential environmental impact for farmed mussels is inferred. This fact is related to the involvement of a number of operational inputs and outputs without correspondence in current data for mussel capture. Furthermore, mussel aquaculture entails a greater consumption of diesel: 0.016 l diesel/kg of farmed mussels versus 0.012 l diesel/kg of captured mussels. Table 8. Environmental comparison between mussel aquaculture and mussel capture Impact category Abiotic depletion Global warming Ozone layer depletion Human toxicity Fresh water aquatic ecotoxicity Marine aquatic ecotoxicity Terrestrial ecotoxicity Photochemical oxidant formation Acidification Eutrophication

Ratio aquaculture/capture 1.50 1.38 1.33 2.62 1.56 1.43 3.56 1.50 1.40 1.35

374

Diego Iribarren, María Teresa Moreira and Gumersindo Feijoo

CONCLUSION LCA has been successfully used to assess the environmental performance of mussel aquaculture in traditional rafts. Models for rafts and auxiliary vessels were established. Furthermore, a detailed inventory for mussel culture was made available through data provided by different skippers who operate in the main productive areas. In order to identify the environmental hot spots of mussel culture, ten impact categories were studied. The potential environmental impacts linked to capital goods were distinguished from those related to operation. Consequently, the minimization of the energy and iron demand for capital goods was encouraged. Regarding operation, the optimization of diesel consumption for auxiliary vessels was primarily suggested. New attempts are needed in order to provide a more accurate value for the energy demand for capital goods. In addition, further efforts to better characterize toxicity, ecotoxicity and eutrophication potentials are also recommended. Finally, studies should be addressed to assess new capital goods options such as submerged platforms or circular rafts, which are presented as innovative alternatives for the traditional rafts.

ACKNOWLEDGMENTS D. Iribarren wishes to thank the Spanish Ministry of Education for financial support (grant reference: AP2006-03904).

REFERENCES Amegrove, Asociación de Mejilloneros de O Grove, 2007. <www.amegrove.es>. Apha-Awwa-Wpcf, 1995. Standard Methods for the examination of water and wastewater, nineteenth ed. Washington, USA. Aubin, J., Papatryphon, E., van der Werf, H.M.G., Petit, J., Morvan, Y.M., 2006). Characterisation of the environmental impact of a turbot (Scophthalmus maximus) recirculating production system using Life Cycle Assessment. Aquaculture 261, 12591268. Aubin, J., Papatryphon, E., van der Werf, H.M.G., Chatzifotis, S., 2009. Assessment of the environmental impact of carnivorous finfish production systems using life cycle assessment. J. Clean. Prod. 17, 354-361. Ayer, N.W., Tyedmers, P.H., 2009. Assessing alternative aquaculture technologies: life cycle assessment of salmonid culture systems in Canada. J. Clean. Prod. 17, 362-373. Cáceres-Martínez, J., Robledo, J.A.F., Figueras, A., 1994. Settlement and postlarvae behaviour of Mytilus galloprovincialis: field and laboratory experiments. Mar. Ecol. Prog. Ser. 112, 107-117. Caterpillar®, 2007. <www.cat.com>. Christensen, V., Guenette, S., Heymans, J., Walters, C., Watson, R., Zeller, D., Pauly, D., 2003. Hundred-year decline of North Atlantic predatory fishes. Fish Fish. 4 (1), 1-24. Cloern, J.E., 2001. Our evolving conceptual model of the coastal eutrophication problem. Mar. Ecol. Prog. Ser. 210, 223-253.

Life Cycle Assessment of Mussel Culture

375

Conde, A., 2007. The Spanish mussel sector. <www.havbrukskompaniet.no>. Dones, R., Bauer, C., Bolliger, R., Burger, B., Faist Emmenegger, M., Frischknecht, R., Heck, T., Jungbluth, J., Röder, A., Tuchschmid, M., 2007. Life Cycle Inventories of Energy Systems: Results for Current Systems in Switzerland and other UCTE Countries, ecoinvent report No. 5. Swiss Centre for Life Cycle Inventories, Dübendorf, Switzerland. Ellingsen, H., Aanondsen, S.A., 2006. Environmental impacts of wild caught cod and farmed salmon – A comparison with chicken. Int. J. Life Cycle Ass. 1 (1), 60-65. FAO, 2006. Seafood international. Supplies and markets mussels. FAO Fishstat, 10. FAO, 2007. Global aquaculture production 1950-2005. Fisheries and Aquaculture Information and Statistics Service. <www.fao.org>. Feijoo, G., Hospido, A., Gallego, A., Rivela, B., Moreira, M.T., 2007. Análisis de ciclo de vida (II): metodología y etapas (in Spanish). Ingeniería Química 444, 114-125. Figueras, A.J., 1989. Mussel culture in Spain and France. World Aquaculture 20 (4). Franco, M., 2006. A miticultura en Galicia: unha actividade de éxito e con futuro (in Galician). Revista Galega de Economía 15 (1), 251-256. Frischknecht, R., Jungbluth, N., Althaus, H.J., Doka, G., Heck, T., Hellweg, S., Hischier, R., Nemecek, T., Rebitzer, G., Spielmann, M., Wernet, G., 2007a. Overview and Methodology, ecoinvent report No. 1. Swiss Centre for Life Cycle Inventories, Dübendorf, Switzerland. Frischknecht, R., Althaus, H.J., Bauer, C., Doka, G., Heck, T., Jungbluth, N., Kellenberger, D., Nemecek, T., 2007b. The environmental relevance of capital goods in Life Cycle Assessments of products and services. Int. J. Life Cycle Ass. 12 (1), 7-17. García, E., San Martín, C., García, O., Miranda, F., Pais, M., 2000. La contribución de la actividad mejillonera al desarrollo local de Galicia (in Spanish). Consello Regulador da Denominación de Orixe Mexillón de Galicia. Goedkoop, M., de Schryver, A., Oele, M., 2008. Introduction to LCA with SimaPro 7. PRé Consultants, the Netherlands. Grönroos, J., Seppälä, J., Silvenius, F., Mäkinen, T., 2006. Life cycle assessment of Finnish cultivated rainbow trout. Boreal Env. Res. 11, 401-414. Guinée, J.B., Gorrée, M., Heijungs, R., Huppes, G., Kleijn, R., de Koning, A., van Oers, L., Wegener, A., Suh, S., Udo de Haes, H.A., 2001. Life cycle assessment. An operational guide to the ISO standards. Centre of Environmental Science, Leiden, the Netherlands. Heijungs, R., Guinée, J.B., Huppes, G., Lankreijer, R.M., Udo de Haes, H.A., Wegener, A., Ansems, A.M.M., Eggels, P.G., van Duin, R., 1992. Environmental life cycle assessment of products. Guide, NOH report 9266. Centre of Environmental Science, Leiden, the Netherlands. Hospido, A., Tyedmers, P., 2005. Life cycle environmental impacts of Spanish tuna fisheries. Fish. Res. 76, 174-186. Industrias Guerra, 2007. <www.iguerra.com>. Iribarren, D., Moreira, M.T., Feijoo, G., 2010. Revisiting the Life Cycle Assessment of mussels from a sectorial perspective. J. Clean. Prod. 18, 101-111. ISO, 2006a. ISO 14040 Environmental management – Life Cycle Assessment – Principles and framework. ISO, 2006b. ISO 14044 Environmental management – Life Cycle Assessment – Requirements and guidelines.

376

Diego Iribarren, María Teresa Moreira and Gumersindo Feijoo

Jackson, J., Kirby, M., Berger, W., Bjorndal, K., Botsford, L., Bourque, B., Bradbury, R., Cooke, R., Erlandson, J., Estes, J., Hughes, T., Kidwell, S., Lange, C., Warner, R., 2001. Historical overfishing and the recent collapse of coastal ecosystems. Science 293, 629638. Jian-Guang, F., Qisheng, T., 2005. Development of mussel industry in China. <www.aquacultureassociation.ca>. JJ Chicolino, 2007. <www.jjchicolino.es>. Johnson, K., 2002. Review of national and international literature on the effects of fishing on benthic habitats. NOAA Technical Memorandum NMFS F/SPO, no. 57. Maryland, USA Josupeit, H., 2005. Mussel production and markets. <www.globefish.org>. Labarta, U., Fernández-Reiriz, M.J., Pérez-Camacho, A., Pérez-Corbacho, E., 2004. Bateeiros, mar, mejillón. Una perspectiva bioeconómica (in Spanish). Sectorial Studies, Foundation CaixaGalicia, Spain. MAPA, 2007. La acuicultura en España (in Spanish). Ministry of Agriculture, Fisheries and Food, Spain. <www.mapa.es>. Mungkung, R.T., Udo de Haes, H.A., Clift, R., 2006. Potentials and limitations of Life Cycle Assessment in setting ecolabelling criteria: A case study of Thai shrimp aquaculture product. Int. J. Life Cycle Ass. 11 (1), 55-59. Myers, R., Worm, B., 2003. Rapid worldwide depletion of predatory fish communities. Nature 423, 280-283. Nakamura, Y., Kerciku, F., 2000. Effects of filter-feeding bivalves on the distribution of water quality and nutrient cycling in a eutrophic coastal lagoon. J. Mar. Syst. 26, 209221. Nielsen, P.H., Nielsen, A.M., Weidema, B.P., Dalgaard, R., Halberg, N., 2003. LCA food data base. <www.lcafood.dk>. Nizzoli, D., Welsh, D.T., Bartoli, M., Viaroli, P., 2005. Impacts of mussel (Mytilus galloprovincialis) farming on oxygen consumption and nutrient recycling in a eutrophic coastal lagoon. Hydrobiologia 550, 183-198. Papatryphon, E., Petit, J., van der Werf, H.M.G., 2003. The development of life cycle assessment for the evaluation of rainbow trout farming in France. 4th International Conference: Life Cycle Assessment in the Agri-Food Sector, 6-8 October 2003, Horsens, Denmark. Papatryphon, E., Petit, J., Kaushik, S., van der Werf, H.M.G., 2004. Environmental impact assessment of salmonid feeds using life cycle assessment (LCA). Ambio 33 (6), 316-323. Pauly D., Christensen, V., Guénette, S., Pitcher, T., Sumaila, U., Walters, C., Watson, R., Weller, D., 2002. Towards sustainability in world fisheries. Nature 418, 689-695. Pedramol Factory, 2007. <www.pedramol.com>. Pelletier, N.L., Ayer, N.W., Tyedmers, P.H., Kruse, S.A., Flysjo, A., Robillard, G., Ziegler, F., Scholz, A.J., Sonesson, U., 2007. Impact categories for life cycle assessment research of seafood production systems: review and prospectus. Int. J. Life Cycle Ass. 12 (6), 414421. Pérez-Camacho, A., 1992. Cultivo de mejillón en la batea (in Spanish). Aquaculture books, Xunta de Galicia, Spain. Pérez-Camacho, A., Labarta, U., Beiras, R., 1995. Growth of mussels (Mytilus edulis galloprovincialis) on cultivation rafts: influence of seed source, cultivation site, and phytoplankton availability. Aquaculture 138, 349-362.

Life Cycle Assessment of Mussel Culture

377

Plataforma Tecnolóxica da Pesca, 2007. <www.pescadegalicia.com>. Renou, S., Thomas, J.S., Aoustin, E., Pons, M.N., 2008. Influence of impact assessment methods in wastewater treatment LCA. J. Clean. Prod. 16, 1098-1105. Rodríguez-Lado, L., Macías, F., 2006. Calculation and mapping of critical loads of sulphur and nitrogen. Sci. Total Environ. 366, 760-771. Talleres Aguin, 2007. <www.aguin.com>. Thrane, M., 2004. Environmental impacts from Danish fish product – Hot spots and environmental policies. PhD dissertation, Aalborg University, Denmark. Thrane, M., 2006. LCA of Danish fish products. Int. J. Life Cycle Ass. 11 (1), 66-74. Tirado, C., Macias, J.C., 2006. Cultivo de mejillón. Aspectos generales y experiencias en Andalucía (in Spanish). Regional Ministry of Agriculture and Fisheries, Andalucia, Spain. Troell, M., Tyedmers, P.H., Kautsky, N., Rönnbäck, P., 2004. Aquaculture and energy use. Encyclopedia of Energy (1), 97-108. Turunen, L., van der Werf, H.M.G., 2006. Life Cycle Analysis of Hemp Textile Yarn. Comparison of three hemp fibre processing scenarios and a flax scenario. Report of the European Union project HEMP-SYS. Xunta de Galicia, 2006. Anuario de Pesca Galicia 2005 (in Galician). Regional Ministry of Fisheries and Sea Affairs, Galicia, Spain. Ziegler, F., Nilsson, P., Mattsson, B., Walther, Y., 2003. Life cycle assessment of frozen cod fillets including fishery-specific environmental impacts. Int. J. Life Cycle Ass. 8 (1), 3947. Ziegler, F., Valentinsson, D., 2008. Environmental life cycle assessment of Norway lobster (Nephrops norvegicus) caught along the Swedish west coast by creels and conventional trawls – LCA methodology with case study. Int. J. Life Cycle Ass. 13, 487-497.

Reviewed by Dr. A. Hospido, LCA expert working at the department of Chemical Engineering of the University of Santiago de Compostela (Spain).

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 16

MUSSELS AS A TOOL IN METAL POLLUTION BIOMONITORING – CURRENT STATUS AND PERSPECTIVES Joanna Przytarska1 and Adam Sokołowski2 1

Institute of Oceanology Polish Academy of Sciences, Department of Marine Ecology Powstancow Warszawy 55, 81-712 Sopot, Poland 2 University of Gdansk, Institute of Oceanography, Laboratory of Estuarine Ecology Pilsudskiego 46, 81-378 Gdynia, Poland

The dynamics and range of environmental changes that have been observed recently in many coastal and estuarine regions highlight the importance of monitoring for the understanding of these alterations to ecosystems. Of particular relevance are issues which concern the loss of biodiversity, pollution, water quality, sustainable development, and climate change and their potential impact on marine biota. High quality, long-term monitoring programmes have been developed in recent decades to determine current contamination status against which future changes can be assessed (Oldfield and Dearing, 2003; Simcik, 2005; Batzias et al., 2006). In practice, monitoring pollutants is a very complex task, and it comprises an important element of the global observation system. The Mussel Watch Program was created with the aim of determining current metal status in coastal environments as an efficient tool to monitor environmental trace metal levels. The Mussel Watch Program has been implemented in many countries worldwide including the United States, the United Kingdom, France, Hong Kong, and Australia. Pollutant contamination and that of trace metals in particular, has been an environmental issue in many countries for decades, and there is still a need to assess the bioavailability and toxicity of metals in many water basins. This aspect is extremely important not only for estimating the environmental risk of metal contamination to marine fauna and flora, but also 

tel.: + 48 58 7311780, fax: + 48 58 5512130, E-mail address: [email protected]

Joanna Przytarska and Adam Sokołowski

380

the potential effect of metals on humans. Despite trace metals being natural elements in the marine environment, they pose very serious concerns for seafood safety and various aspects of the tourism industry (Wang and Rainbow; 2008). The contamination of the coastal and estuarine areas can be assessed using biological monitors (biomonitors) which accumulate organic and non-organic compounds in their tissues at concentrations which are proportional to the ambient bioavailability (Philips and Rainbow, 1994; e Silva et al., 2006). Therefore, a single biomonitor provides information on the availability and accumulation of a particular compound, and it can be used to assess the environmental status of this compound on a local scale (e Silva et al., 2006). The choice of a biological monitor depends on the characteristics of the study area and the objectives of the monitoring program (Resh, 2008). Mussels or other bivalves are commonly exploited for biomonitoring aquatic metal pollution because of their specific biological features relative to other organisms. Bivalves, including oysters, mussels and clams, have been used as biomonitors for evaluating metal pollution in marine water basins for nearly seventy years (Zhou et al., 2008). Bivalves have played an essential role in developing observational methods to detect the potential impact of contaminants on ecosystems over long periods of time, and the importance of biomonitoring programs is now unquestionable.

MUSSELS OF THE FAMILY MYTILIDAE AS BIOINDICATORS OF MARINE POLLUTION The standard method of biological monitoring is based on bioindicators and biomonitors. A bioindicator is an organism (or part of an organism or a community of organisms) that contains information on the quality of the environment (or a part of the environment). A biomonitor is an organism (or part of an organism or a community of organisms) that contains information on the quantitative aspects of the quality of the environment (Zhou et al., 2008). The Mytilus edulis complex, which is known as the blue mussel, is one of the most common bioindicators and biomonitors used in marine metal pollution biomonitoring programs. This medium-sized edible marine bivalve has many features which make it a useful tool in the evaluation of environmental pollution, especially of metal pollution in marine ecosystems. These include the following: 



wide geographical distribution and stable populations – mytilids are widespread and common on both sides of the Atlantic and Pacific oceans, they inhabit hard substrates in coastal zones from the White Sea to the Mediterranean Sea in Europe on the eastern Atlantic coast, from the Canadian Arctic to North Carolina in the western Atlantic, from the Arctic to California on the eastern Pacific coast, and from the Arctic to Japan in the western Pacific (Zatsepin et al., 1988; Gosling, 1992; Seed ,1992; Szefer et al., 2002, 2006; Przytarska et al., 2010); ease of collection in sufficient quantities – mussels are usually of a reasonable size and occur in high abundances in marine ecosystems (Walker et al., 2001; Conti et al., 2002; Conti and Cecchetti, 2003);

Mussels as a Tool in Metal Pollution Biomonitoring… 



 





 



381

sedentary, epibenthic life mode – mussels live attached to hard substrates by strong elastic, thread-like structures called byssal threads, which are secreted by byssal glands located in the foot (Walker et al., 2001; Conti et al., 2002; Conti and Cecchetti, 2003); filter-feeding mode – mussels feed by straining suspended matter and food particles from the water column, therefore they take up metals from seawater and suspended particles (Rainbow, 1995); reasonably long life span – mussels can live up to 18-24 years (Zhou et al., 2008); profound knowledge of mussel biology and ecology – many aspects of mussel life cycle, behaviour, and physiology have been studied for many years and are well known, and the relevant chemical data can be interpreted in an ecotoxicological context (Walker et al., 2001; Conti et al., 2002; Conti and Cecchetti, 2003); high tolerance to fluctuations of hydrological parameters such as temperature, salinity, and dissolved oxygen in the water, which enables them to inhabit a variety of environments (Casas et al., 2004; Szefer et al., 2006). Highly tolerant of a wide range of environmental conditions, mussels are euryhaline and occur in high densities in marine as well as brackish waters (Baltic) down to 4 PSU, although they do not thrive in salinities of less than 15 PSU and their growth rate are reduced below 18 PSU. Mussels are also eurythermal and able to withstand freezing conditions for several months. These bivalves are well acclimated to a 5-20 °C temperature range, with an upper sustained thermal tolerance limit of about 29 °C for adults. Its climatic regime varies from mild, subtropical locations to frequently frozen habitats (Barnabe, 1994); high bioconcentration factors of pollutants – mussels accumulate in their tissues elements, organic, and inorganic compounds at high concentrations and have limited ability to regulate their internal body concentrations (e.g. Zn; Zhou et al., 2008); resistance to handling stress induced by laboratory and field studies in cages (Zhou et al., 2008); important component of food chain – mussels play an important role in the transfer of organic matter and pollutants from the water column to sediments through filtration and biodeposition, and thus contribute in coupling energy fluxes between pelagic and benthic systems. Mussels are food for predatory vertebrates (fish, birds) and invertebrates. Furthermore, until the nineteenth century, blue mussels were harvested from wild beds, and they are a staple of many seafood dishes in the cuisines of many European countries including Spain, Portugal, France, the Netherlands, Belgium, and Italy (Walker et al., 2001); strong net accumulation – mussels are able to accumulate metals in concentrations which correspond to the levels of available metals in their ambient water (Rainbow and Phillips, 1993).

An increase in the concentration of a chemical in biomonitors over time occurs relative to the chemical concentrations in the external environment. This is why many ‗mussel watch‘ monitoring programs have been implemented in recent years to asses the spatial and temporal trends in metal contaminations in coastal and estuarine waters, including bays, estuaries, and large semi-enclosed areas (Zhou et al., 2008).

Joanna Przytarska and Adam Sokołowski

382

ACCUMULATION OF TRACE METALS IN MUSSELS Metals are natural components of the earth‘s crust. Although most are trace elements in minerals, metals like chromium, iron, and manganese are present in high amounts in the environment. These metals have some common properties, i.e. they occur in nature mostly in inorganic forms as either ions or salts and occasionally in organic forms. Many metal composites are stable, which explains their prevalence in the environment. When present in organisms in excess of metabolic demands, metals can exert harmful effects that depend on the time of exposure, bioavailability in the environment, and on the quantities that are ingested and ultimately reach critical target organs. Since metals have been used commercially for centuries, environmental metal pollution is widespread, and exposure to metals and metal compounds continues to be a major public health issue (Caussy et al., 2003). Depending on its physiology and position in the food chain, animals have developed different feeding and digestion strategies. This affects the way in which metals are processed during the assimilation process, resulting in potentially large differences in metal assimilation efficiencies (McGeer et al., 2004). The bivalves of the family Mytilidae, like other marine invertebrates, take up and accumulate both essential and non-essential trace metals, all of which can potentially have toxic effects. Mussels accumulate metals from the water through adsorption onto free body surfaces, or absorption across cell walls or body surfaces such as the gill and/or gut, and assimilate them from ingested food (McGeer et al., 2004). These accumulated metals are divided into two components - metabolically available and stored, detoxified metals. The total accumulated content of a given element does not determine its toxicity since this is related to a threshold concentration of internal metabolically available metal (Rainbow, 2007). The mechanisms for reducing metal accumulation and toxicity include inhibiting uptake, detoxification, storage, and elimination (McGeer et al., 2004). Many trace metals are detoxified in the form of deposits or insoluble granules in invertebrate soft tissues (Hopkin, 1989; Marigomez et al., 2002; Rainbow, 2007). Hopkin (1989) described three types of intracellular granules:   

type A — consisting of concentric layers of Ca and Mg phosphates which might contain trace metals such as Zn and Mn; type B — more heterogeneous in shape and always containing sulphur in association with metals which include Cu and Zn; type C — often polyhedral with a crystalline form, generally containing Fe, probably derived from ferritin (Rainbow, 2007).

Two types of granules are known in molluscs. One of them is the Ca phosphate-based granule which is capable of storing Cd, Cu, Co, Fe, Mn, Ni, and Zn (Mason and Jenkins, 1995; Viarengo and Nott, 1993) and rendering these metals non-bioavailable to both the mollusc and organisms that consume them (Nott and Nicolaidou, 1990, 1993, 1994). Another granule type is derived from Cu-S complexes that appear to be a product of the normal lysosomal breakdown of metallo-sulphur proteins such as metallothioneins (Langston et al., 1998). These granules have been shown not only to complex Cu, but also Cd and Ag (Viarengo and Nott, 1993), with the end result that the metal is excreted, recycled, or permanently stored (McGeer et al., 2004).

Mussels as a Tool in Metal Pollution Biomonitoring…

383

Metal content in mussels is the result of assimilation and elimination. The rate of metal accumulation is closely linked with the mussel life cycle, ecophysiological state, growth dynamics, age, and sexual maturity. In addition, tissue metal concentration can vary with water depth, salinity, temperature, and food availability, all of which affect metal bioavailability and speciation (Kramer, 1994, Andral et al., 2004). The toxicity of a metal depends on many different factors. Metals can have lethal effects (acute toxicity) or long-term toxic impacts (chronic toxicity) such as reduced growth and reproduction (Walker et al., 2001). The major toxicity symptoms occur on the skin (As), and in the nervous system (Pb, Hg, As), blood (Pb, As), kidney (Pb, Hg, Cd), and lung (Cd), and can be carcinogenic (As, Cd, Cr) (Caussy et al., 2003). Factors influencing metal toxicity include the characteristics of the organism, the route of exposure, the type and form of the metal, and the physical and chemical characteristics of the environment. Free metal ions, which typically correspond with the dissolved fraction, are considered the most bioavailable and toxic. Some metals are more toxic in one state than another, as in the case of Cr (Caussy et al., 2003); for example, the mobility and toxicity of Cr (VI) in sea water and bottom sediments are high compared to Cr (III). In the marine environment, the percentage contribution of these forms varies with the redox potential of the water. Inorganic Hg can be methylated by microorganisms, which results in the much lower bioavailability of methyl Hg than of its inorganic form. Arsenic exists in different oxidation states, and the inorganic form can be accumulated in marine organisms and transformed in their bodies to the organic arsenobetaine form (C5H11AsO2). In contrast to Hg and Sn, the inorganic form of As is more toxic than its organic form (Caussy et al., 2003).

BIOTIC AND ABIOTIC FACTORS INFLUENCING TRACE METAL LEVELS IN MARINE ORGANISMS Abiotic Factors Water hardness, pH, dissolved organic carbon, alkalinity, and many other factors affect the chemical speciation, toxicity, and bioavailability of metals in the environment. Knowledge about different metal forms in marine water bodies has grown considerably in recent decades, and this allows predicting the influence of abiotic and biotic factors on metal uptake and accumulation by organisms (Caussy et al., 2003). 

  

Chemical form of metals present in the ambient water – metals occur in waters in dissolved (ions, organic and non-organic complexes, colloids) and suspended forms. Ions are considered the most assimilable form. Water temperature – higher temperatures increase metabolism in animals and subsequently metal accumulation rates. Dissolved oxygen – the bioavailability of metals changes with increasing dissolved oxygen. Organic substances – the presence of organic substances enhance metal bioaccumulation.

Joanna Przytarska and Adam Sokołowski

384  

 





Salinity – there is evidence that low salinity increases metal accumulation in some invertebrates (Rainbow, 1995). Water pH reaction – increasing pH reaction affects the dissolubleness of metals. The pH reaction is the most significant factor controlling the separation of metal ions and polar organo-metallic compounds (Caussy et al., 2003). Between-metal competition – interactions between metals can exert an increasing (synergism) or decreasing (antagonism) effect on metal activity. Oxidation/reduction potential – the redox activity of some metal ions like Cu (II) and Fe (III) catalyses the oxidation of GSH resulting in thyil and hydroxyl radicals (Halliwell and Gutteridge, 1989; Stohs and Bagchi, 1995, Canesi et al., 1999). GSH is the most abundant cellular thiol involved in metabolic and transport processes, and it protects cells from the toxic effects of different endogenous and exogenous compounds, including oxygen reactive species and heavy metals (Meister and Anderson, 1983; Sies and Ketterer, 1988; Taniguchi et al., 1989, Canesi et al., 1999). Organic carbon content – the formation of organometallic compounds depends on the organic matter content; therefore, interactions of metal ions with organic carbon (for example humic acids) and the formation of metal oxides in bottom sediments also depends on organic matter (Caussy et al., 2003). In addition, some metals show high affinity with organic matter (e.g. Zn, Cu) that increases their bioavailability and assimilation efficiency. Seawater circulation – this can affect the geographical and vertical distributions of different metal forms.

Biotic Factors   



Specimen or genetic type – different species accumulate metals in different ways depending on the internal features of a given taxon (Rainbow, 1995). Sex – females seem to accumulate more trace metals than males (Lobel et al., 1991). Age – the effect of age on metal accumulation rates is minor; for example, Boyden (1974) found a relation that indicated the soft-tissue metal concentrations of older mussels were lower than in younger bivalves. Yap et al. (2003) noted a relationship between body size and metal concentrations in the mussel Perna viridis, suggesting that different age-related physiological requirements can account for lower metal concentrations in older individuals. Furthermore, they also found that large, aged mussels tend to pump less water through their bodies per unit of body weight, resulting in slower metal uptake from the external environment. Body size - Boyden (1974) suggested that metal concentrations in molluscs decreases or remains constant with increasing body weight. Cossa et al. (1980) showed that smaller mussels were richer in trace metals than larger ones, while Hummel et al. (1997) and Saavedra et al. (2004) reported no major size-related differences in metal concentrations in the soft tissues of Mytilus e. edulis or Mytilus e. galloprovincialis. Riget et al. (1996) suggested that the relationship between size and element concentrations should be taken into account particularly in areas which are not affected by human impact.

Mussels as a Tool in Metal Pollution Biomonitoring…  





385

Phase of life – larvae usually accumulate metals differently than adults because of their different feeding strategy. Physiological condition – different physiological conditions of organisms, which are directly related to reproductive cycle, temperature, and quality of food, influence the rate of metal assimilation and accumulation and subsequently its toxicity. Reproductive status – some metals aggregate in the gonads and are removed from body to the external environment with the reproductive cells (O‘Leary and Breen, 1998). Nutrition – different diets can also affect metal accumulation in biota (Zhou et al., 2008).

MONITORING IN SITU IN THE MARINE ENVIRONMENT The traditional monitoring of trace metals in marine environments includes measuring metal concentrations in waters, sediments, and biota (Wu et al., 2007). Low concentrations of dissolved metals in sea water makes analyses difficult since significant sample contamination can occur during analytical procedures and pre-concentration is required (Phillips and Rainbow, 1993; Phillips, 1995; Wu et al., 2007). In addition, significant temporal variations in metal concentrations in waters often require frequent sampling and analyses (Phillips and Rainbow, 1993; Wu et al., 2007), and the bioavailability of dissolved forms is not precisely defined (Phillips and Rainbow, 1993; Phillips, 1995; Rainbow, 1990; Rainbow and Phillips, 1993). Metal concentrations in sediments provide a time-integrated proxy of metal levels, but these are affected by particle size, organic content, sediment characteristics, and redox conditions that vary geographically (Phillips and Rainbow, 1993; Wu et al., 2007). Comparing metal concentrations in waters and sediments using monitoring with living organisms is advantageous for several reasons (Zhou et al. 2008). Firstly, biomonitoring is highly sensitive and can detect tenuous biological changes in organisms that are induced by metal exposure. Thus, this reflects the integrated effects of various pollutants occurring in biologically available forms on organisms in the marine environment, which means it is of direct ecological relevance. Thirdly, this method can detect pollutants at low levels that might be below detection limits in waters and sediments. Lastly, biomonitoring permits performing extended sampling. The standard biomonitoring method is based on bioindicators. Approximately 40% of recent publications about bioindicators concern metal contamination and focus mainly on plants, invertebrates, fish, and mammals (Burger, 2006). Commonly used metal bioindicators in the marine environment include plankton, invertebrates, crustaceans, fish, plants, birds, and mammals (Zhou et al., 2008). Biomonitors not only accumulate metals from waters, but they provide a time-integrated proxy of all bioavailable metal fractions in the ambient environment. However, tissue metal concentrations in biomonitors are affected by biotic and abiotic factors to different extents and some data have to be interpreted (Phillips and Rainbow, 1993; Walker et al., 2001; Leung et al., 2001, 2002). These natural factors usually result in large variations in metal concentrations of biomonitor species geographically and temporally (Luoma and Rainbow, 2005; Leung et al., 2008).

386

Joanna Przytarska and Adam Sokołowski

It is challenging to understand the influence of metals on organisms based on metal concentrations in the abiotic environment because many factors impact metal bioavailability (Walker et al., 2001). In this aspect, monitoring in situ in the marine environment provides more direct information that can be interpreted in an ecological context. Over the last twenty years, in situ biological monitoring techniques have been developed to minimise procedural errors (Worsfold, 1994). Monitoring systems can be used to identify the responses of living organisms to metal pollution incidents that are of ecological relevance, and they can potentially indicate significant biological disturbances (Bloxham et al., 1999). Walker et al. (2001) suggested four directions for in situ monitoring: 1) analyses of community structure (i.e., the presence or absence of sensitive organisms or assemblages) from clean and contaminated sites in order to assess the effect of contaminants ('community effect'); 2) measurement of pollutant concentrations in indicatory organisms, e.g. bivalves of the family Mytilidae. This kind of monitoring is based on the assumption that the concentration of chemical elements and substances in soft tissues is proportional to their environmental concentrations (George and Coombs, 1977; Cossa, 1988; Andral et al., 2004); 3) estimating the effects of contaminants on living organisms using biomarkers. Biomarkers are measurable biological parameters at suborganismic (genetic, enzymatic, physiological, morphological) levels whose structural or functional changes indicate the influence of a given contaminant or group of contaminants, environmental influences in general, and the action of particular contaminants are described qualitatively and sometimes also quantitatively (Markert, 2007); 4) identification of genetically different lines (races, variation) which develop specific immunity systems in response to elevated levels of toxic substances. Natural selection favours mutations which capacitate producing higher quantities of detoxification substances. Monitoring in situ is a useful tool for collecting information about influencing factors, bioavailability, and the biological consequences of pollutant contamination (Walker et al., 2001).

FUTURE PERSPECTIVES Although many recent studies focus on metal contamination, little remains known about the risks which metal pollution poses to ecosystems. The common praxis in metal biomonitoring programs is determining contamination levels in local areas. There are few unique data that tackle the issue of the global monitoring of metal pollution (for example Szefer et al., 2006, Przytarska et al., 2010); however, biomonitoring programs have been established to enable large-scale geographical comparisons with a particular emphasis on bivalves such as mussels. Using marine mussels as sentinels of coastal contamination was proposed and first tested in the 1970s (Goldberg et al., 1978; Goldberg, 1980). This strategy

Mussels as a Tool in Metal Pollution Biomonitoring…

387

has since been widely accepted throughout the world, and is currently in practice in different national programs in many regions (Zhou et al., 2008). Different techniques and methods have been established for biomonitoring marine metal pollution. The choice of analytical techniques depends on the aims and scope of a given program. The most common method used to assess environmental metal levels is based on measurements of soft-tissue metal concentrations in benthic invertebrates, particularly bivalves. The concentration of metals in animal bodies provides information on the extent of metal exposure, thus it is a time-integrated measure of metal bioavailability (Phillips and Rainbow, 1993, Zhou et al., 2008). However, different tissues accumulate metals at different rates depending on metabolic turnover rates. For example, since concentrations of some metals (Cd, Pb, Zn, Hg) are higher in mussel gills than in other soft tissues, the gills are considered to be one of the major target organs (Kucuksezgin et al., 2008). More recently, studies on specific macromolecules (proteins, enzymes, nucleic acids) have been developed to determine metal pollution levels in marine organisms. In addition, behavioural and morphological observations have been identified in marine species that are responses to elevated contamination levels in the marine environment, and these are supplementary markers of environmental ‗health‘. For example, Chafik et al. (1996) identified a cause-and-effect relationship between morphological deformations of bivalve shells and soft tissue concentrations of Cu and Cd. Over the last few years, increasing numbers of publications have appeared that focus on modelling metal bioavailability in aquatic environments and the physiological processes involved in metal accumulation: ingestion, assimilation, elimination, and growth (Wang and Fisher, 1997; Rainbow, 2007; Wang and Rainbow, 2008; Muller et al., 2010). Models of metal bioavailability in the environment and the metabolic transformations of metals help to understand metal activity and biological handling. Mathematical models also permit predicting metal toxicity and identifying the potential metabolic mechanisms of pollutants (Zhou et al., 2008). Major advances in the understanding of metal ecotoxicology include biokinetic or biodynamic models, which are instrumental tools for interpreting total bioaccumulated metal concentrations and identifying their potential impact on aquatic organisms, including phytoplankton, invertebrates, and fish (Wang et al., 1996; Wang and Fisher, 1999; Luoma and Rainbow, 2005). The development of new analytical methods sheds new light on the understanding of the effects of metals on organisms, populations, and ecosystems. Technological innovations have decreased markedly detection limits thus enabling the detection of variability in tissue levels over long time periods (Peakal and Burger, 2003). Consequently, risk assessments can be now estimated with much higher resolution geographically and temporally, and the biological impact of metals on biota can be detected at much lower environmental concentrations. Generally, metal concentrations in waters and sediments are described separately from trace metals in marine organisms. Only recently has an integrated picture of metal status in the marine environment, i.e. water, sediments, and biota, been proposed to address the complexity of metal contamination. Another new concept concerns the process of benthic– pelagic coupling. The production and biological structures of pelagic communities generate fuel for the production of many benthic species (Sommer, 1989; Graf, 1992; Valiela, 1995; Sundback et al., 2003). Benthic–pelagic coupling describes processes that operate across and between the sea floor and open-water ecosystems. Large, unpredictable variations in inter-

388

Joanna Przytarska and Adam Sokołowski

species relations have been a major impediment in applying local experimental results to large-scale management and conservation issues. The concept of benthic–pelagic coupling is exploited in investigations of energy flows and contaminant trophic transfer in ecosystems (Wassmann et al., 2006). Primary production in the water column determines biomass at the sea floor (60% of net primary production sinks to the sea floor). Suspension-feeding bivalves play a basic role in coastal soft sediments since they are an important factor in the energy transfer from the water column to these sediments through filtration and biodeposition (Wildish and Kristmanson, 1997). Through deposition, trace metals bound to organic particles are transferred from the water to the sea bottom where they can be accumulated by benthic organisms. Carnivorous invertebrates and fish that feed on benthos transmit contaminants to higher trophic levels, including to humans. On the other hand, fauna detritus sediments to the sea floor increasing sediment organic carbon and providing food for scavengers like some infaunal Nemertea. Since metal pollution affects different ecological formations (benthos, pelagic organisms, epibionts, etc.) to varying extents, environmental risk assessments focus primarily on those populations which show the highest sensitivity to anthropogenic stress. Although general mechanisms for the uptake and the biological effects of elements on marine organisms with respect to environmental conditions have been established in several regions, spatial heterogeneity with regard to hydro-geochemical conditions and ecological factors preclude generalizing about metal accumulation mechanisms. Therefore, site-specific studies are required to clarify unequivocally the impact of metal pollutants on local biota in areas of interest, as it is inevitable that local differences in habitat and community structure (e.g. size and demographic structure, species composition) will affect tissue accumulated concentrations of metals and their influence on the biocenosis. Future perspectives on metal monitoring should include exposure assessment and description of exposure pathways from all environmental matrices, including air, water, food, and bottom sediments. Exposure assessments take into account the distribution and concentration of metals from various sources, identify exposure pathways, and quantify metal transfer among different ecosystem compartments (Caussy et al., 2003). According to Caussy et al. (2003), in order to establish exposure assessment and risk management it is important to evaluate the following: 1) factors common to the majority of affected individuals or communities, such as common contamination sources in the environment; 2) sampling approaches including detailed sampling methodologies and strategies; 3) documentary evidence of the temporal and spatial characteristics of exposure and the trends and/or exposure gradients identified. The available data can be used in predictive models of exposure; 4) speciation of a contaminant using one or more analytical procedures; 5) bioavailability by a variety of laboratory methods. In order to assess the global problem of metal pollution, it is necessary to continue the Mussel Watch Program on a large scale. Understanding contaminant distributions in

Mussels as a Tool in Metal Pollution Biomonitoring…

389

sediments and benthic biota is possible by combining expertise from different disciplines such as toxicology, ecology, and chemistry. Key recommendations were proposed by Gordeev (2002). To obtain reliable, comparable results on metal concentrations in air, water, suspended matter, soil, bottom sediment, and biota, it is necessary to use reference materials widely and to perform international intercalibrations regularly. Metal contaminants are usually of double origin–natural and anthropogenic; thus, it is essential to use diverse methods which permit discriminating between natural and anthropogenic forms. Monitoring should encapsulate all environmental spheres in the coastal zone, including the atmosphere, the cryosphere, the hydrosphere, the sedimentosphere, the endosphere, and the biosphere. Recommendations for studying the processes of the quantitative and qualitative transformation of dissolved forms of metals and metals connected with particulate materials in these zones are widely postulated.

REFERENCES Andral, B., Stanisiére, J.Y., Sauzade, D., Damier, E., Thebault, H., Galgani, F., Boissery, P., 2004. Monitoring chemical contamination levels in the Mediterranean based on the use of mussel caging. Marine Pollution Bulletin, 49: 704-712. Barnabe, G., (ed.), 1994. Aquaculture: biology and ecology of cultured species. Ellis Horwood Series in Aquaculture and Fisheries Support, Wiley and Sons, Chichester, UK: 403 pp. Batzias, F.A., and Siontorou, C.G., 2006. A knowladge-based approach to environmental biomonitoring. Environmental Monitoring and Assessment, 123: 167–197. Bloxham, M.J., Worsfold, P.J., Depledge, M.H., 1999. Integrated Biological and Chemical Monitoring: In situ Physiological Responses of Freshwater Crayfish to Fluctuations in Environmental Ammonia Concentrations. Ecotoxicology, 8(3): 225-237. Boyden, C.R., 1974. Trace element content and body size in molluscs. Nature, 251: 311-314. Burger, J., 2006. Bioindicators: A review of their use in the environmental literature 19702005. Environmental Bioindicators, 1(2):136-144. Canesi, L., Viarengo, A., Leonzio, C., Filippelli, M., Gallo, G., 1999. Heavy metals and glutathione metabolism in mussel tissues. Aquatic Toxicology, 46: 67–76. Casas, S., Cossa, D., Gonzalez, J.L., Bacher, C., Andral, B., 2004. Modelling trace metal accumulation in the Mediterranean mussel, Mylilus galloprovincialis. Rapport du Congrès de la Commission Internationale pour l'Exploration Scientifique de la Mer Méditerranée, 37: 306-308. Caussy, D., Gochfeld, M., Gurzau, E., Neagu, C., Ruedel, H., 2003. Lessons from case studies of metals: investigating exposure, bioavailability, and risk. Ecotoxicology and Environmental Safety, 56: 45–51. Chafik, A., Cheggour, M., Kaimoussi, A., 1996. Etude préliminaire de l‘impact des activités de traitement et transformation des phosphates sur le milieu marin ‗Cas de Jorf Lasfar‘ Trav. Documents, Institut National de Recherche Halieutique, Casablanca, Maroco, 94: 17 pp.

390

Joanna Przytarska and Adam Sokołowski

Conti, M.E., and Cecchetti, G., 2003. A biomonitoring study: trace metals in algae and molluscs from Tyrrhenian coastal areas. Environmental Research, 93: 99-112. Conti, M.E., Tudino, M.B., Muse, J.O., Cecchetti, G., 2002. Biomonitoring of heavy metals and their species in the marine environment: the contribution of atomic absorption spectroscopy and inductively coupled plasma spectroscopy. Research Trends in Applied Spectroscopy, 4: 295-324. Cossa, D., 1988. Cadmium in Mytilus spp.: Worldwide survey and relationship between seawater and mussel content. Marine Environmental Research, 26: 265–284. Cossa D., Bourget E., Pouliot D., Piuze J., Chanut J.P., 1980. Geographical and seasonal variations in the relationship between trace metal content and body weight in Mytilus edulis. Marine Biology, 58: 7-14. George, S.G., Coombs, T.L., 1977. The effects of chelating agents on the uptake and accumulation of cadmium by Mytilus edulis. Marine Biology, 39: 261–268. Goldberg, E.D., 1980. The International Mussel Watch. Report of the International Mussel Watch work- shop, commission on natural resources. Washington, DC: National Academy of Sciences: 248pp. Goldberg, E.D., Bowen, V.T., Farrington, J.W., Harvey, G., Martin, J.H., Parker, P.L., Risebrough, R.W., Robertson, W., Schneider, E., Gamble, E., 1978. The Mussel Watch. In Environmental conservation. The Foundation of Environmental Conservation, La Jolla, CA, 5: 101-105. Gordeev, V.V., 2002. Pollution of the Arctic. Regional Environmental Change, 3: 88–98. Gosling, E.M., 1992. Systematics and geographic distribution of Mytilus. In: Gosling E.M. (ed.), The mussel Mytilus: ecology, physiology, genetics and culture, Amsterdam, Elsevier: 1-20. Graf, G., 1992. Benthic-pelagic coupling: a benthic review. Oceanography and Marine Biology Annual Review, 30: 149-190. Halliwell, B., and Gutteridge, J.M.C., 1989. Free Radicals in Biology and Medicine, 2nd ed. Clarendon Press, Oxford: 560 pp. Hopkin, S.P., 1989. Ecophysiology of metals in terrestrial invertebrates. Barking, UK, Elsevier Applied Science: 366 pp. Hummel, H., Modderman, R., Amiard-Triquet, C., Rainglet, F., van Duijn, Y., Herssevoort, M., de Jong, J., Bogaards, R., Bachelet, G., Desprez, M., Marchand, J., Sylvand, B., Amiard, J.C., Rybarczyk, H., de Wolf, L., 1997. A comparative study on the relation between copper and condition in marine bivalves and the relation with copper in the sediment. Aquatic Toxicology, 38: 165-181. Kramer, J.M., 1994. In: Kramer, J.M. (ed.), Biomonitoring of Coastal Waters and Estuaries. CRC Press, Boca Raton: 360 pp. Kucuksezgin, F., Muammer Kayatekin, B., Uluturhan, E., Uysal, N., Acikgoz, O., Gonenc S., 2008. Preliminary investigation of sensitive biomarkers of trace metal pollution in mussel (Mytilus galloprovincialis) from Izmir Bay (Turkey). Environmental Monitoring and Assessment, 141: 339–345. Langston, W.J., Bebianno, M.J., Burt, G.R., 1998. Metal handling strategies in molluscs, In Langston, W.J., Bebianno, M.J., (eds.), Metal Metabolism in Aquatic Environments. London, UK, Chapman and Hall: 219-283. Leung, K.M.Y., Morgan, I.J., Wu, R.S.S., Lau, T.C., Svavarsson, J., Furness, R.W., 2001. Growth rate as a factor confounding the use of the dogwhelk Nucella lapillus as

Mussels as a Tool in Metal Pollution Biomonitoring…

391

biomonitor of heavy metal contamination. Marine Ecology Progress Series, 221: 145– 159. Leung, K.M.Y., Svavarsson, J., Crane, M., Morritt, D., 2002. Influence of static and fluctuating salinity on cadmium uptake and metallothionein expression by the dog whelk Nucella lapillus (L.). Journal of Experimental Marine Biology and Ecology, 274: 175– 189. Leung, K.M.Y., Furness, R.W., Svavarsson, J., Lau, T.C., Wu, R.S.S., 2008. Field validation, in Scotland and Iceland, of the artificial mussel for monitoring trace metals in temperate seas. Marine Pollution Bulletin, 57: 790–800. Lobel, P.B., Bajdik, C.D., Belkhode, S.P., Jackson, S.E., Longerich, H.P., 1991. Improved protocol for collecting mussel watch specimens taking into account sex, condition, shell shape, and chronological age. Archives of Environmental Contamination and Toxicology, 21: 409-414. Luoma, S.N., and Rainbow, P.S., 2005. Why is metal bioaccumulation so variable? Biodynamics as a unifying concept. Environmental Science and Technology, 39: 1921– 1931. Marigomez, I., Soto, M., Carajaville, M.P., Angulo, E., Giamberini, L., 2002. Cellular and subcellular distribution of metals in molluscs. Microscopy Research and Technique, 56: 358–92. Markert, B., 2007. Definitions and principles for bioindication and biomonitoring of trace metals in the environment. Journal of Trace Elements in Medicine and Biology, 21: 77– 82. Mason, A.Z., and Jenkins, K.D., 1995. Metal detoxification in aquatic organisms. In: Tessier, A., and Turner, D.R., (ed.) Metal speciation and bioavailability in aquatic systems. Chichester, UK, Wiley: 479-608. McGeer, J., Henningsen, G., Lanno, R., Fisher, N., Sappington, K., Drexler, J., 2004. Issue paper on the bioavailability and bioaccumulation of metals. U.S. Environmental Protection Agency Risk Assessment Forum: 122 pp. Meister, A., and Anderson, M.E., 1983. Glutathione. Annual Review of Biochemistry, 52: 711–760. Muller, E.B., Nisbet, R. M., Berkley, H. A., 2010. Sublethal toxicant effects with dynamic energy budget theory: model formulation. Ecotoxicology, 19: 48–60. Nott, J.A., and Nicolaidou, A., 1990. Transfer of metal detoxification along marine food chains. Journal of the Marine Biological Association of the United Kingdom, 70: 905912. Nott, J.A., and Nicolaidou, A., 1993. Bioreduction of zinc and manganese along a molluscan food chain. Comparative Biochemistry and Physiology, 104A: 235-238. Nott, J.A., and Nicolaidou, A., 1994. Variable transfer of detoxified metals from snails to hermit crabs in marine food chains. Marine Biology, 120: 369-377. Oldfield, F., and Dearing, J. A., 2003. The role of human activities in past environmental change, in: K. D. Alverson, R. S. Bradley, T. F. Pedersen (eds.), Paleoclimate, Global Change and the Future, Springer-Verlag, Berlin: 143–162. O‘Leary, C., and Breen, J., 1998. Seasonal variation of heavy metals in Mytilus edulis, Fucus vesiculosus and sediment from the Shannon Estuary. Proceedings of the Royal Irish Academy, 98b (3): 153-169.

392

Joanna Przytarska and Adam Sokołowski

Peakall, D., and Burger, J., 2003. Methodologies for assessing exposure to metals: speciation, bioavailability of metals, and ecological host factors. Ecotoxicology and Environmental Safety, 56: 110–121. Phillips, D.J.H., 1995. Proceedings of the 3rd international-conference on trace-metals in the aquatic environment e Aarhus, Denmark, May 1994 introduction. Marine Pollution Bulletin, 31: 183-192. Phillips, D.J.H., and Rainbow, P.S., 1993. Biomonitoring of trace aquatic contaminants. CRC Press, Boca Raton, FL: 371 pp. Phillips, D.J.H., and Rainbow, P.S., 1994. Biomonitoring of Trace Aquatic Contaminants (second edition). London, Chapman and Hall: 371 pp. Przytarska, J., Sokołowski, A., Wołowicz, M., Hummel, H., Jansen, J., 2010. Comparison of trace metal bioavailabilities in European coastal waters using mussels from Mytilus edulis complex as biomonitors. Environmental Monitoring and Assessment, 166: 461–476. Rainbow, P.S., 1990. Heavy metals in the marine environment. In: Furness, R.W., and Rainbow, P.S. (eds.). CRC Press, Boca Raton, FL: 67-80. Rainbow, P.S., 1995. Biomonitoring of heavy metal availability in the marine environment. Marine Pollution Bulletin, 31: 183-192. Rainbow, P.S., 2007. Trace metal bioaccumulation: Models, metabolic availability and toxicity. Environment International, 33: 576–582. Rainbow, P.S., and Phillips, D.J.H., 1993. Cosmopolitan biomonitors of trace metals. Marine Pollution Bulletin, 26: 593-601. Resh, V.H., 2008. Which group is best? Attributes of different biological assemblages used in freshwater biomonitoring programs. Environmental Monitoring and Assessment, 138: 131–138. Riget, F., Johansen, P., Asmund, G., 1996. Influence of length on element concentrations in blue mussels (Mytilus edulis). Marine Pollution Bulletin, 32(10): 745-751. Saavedra, Y., González, A., Fernández, P., Blanco, J., 2004. The effect of size on trace metal in raft cultivated mussels (Mytilus galloprovincialis). The Science of the Total Environment, 318: 115-124. Seed, R., 1992. Systematics evolution and distribution of mussel belonging to the genus Mytilus. American Malacological Bulletin, 9: 123-137. Sies, H., and Ketterer, B., 1988. In: Sies, H., and Ketterer, B., (eds.), Glutathione Conjugation: Mechanisms and Biological Significance. Academic Press, London: 480 pp. e Silva, C.A.R., Smith, B.D., Rainbow, P.S., 2006. Comparative biomonitors of coastal trace metal contamination in tropical South America (N. Brazil). Marine Environmental Research, 61: 439–455. Simcik, M. F., 2005. Air monitoring of persistent organic pollutants in the great lakes: IADN vs. Aeolos. Environmental Monitoring and Assessment, 100: 201–216. Sommer, U., 1989. Plankton ecology: Succession in plankton communities. In: Marcus, N.H., and Boero, F., (eds.), 1998. Minireview: The importance of benthic pelagic coupling and the forgotten role of life cycles in coastal aquatic systems. Limnology and Oceanography, 43: 763-768. Stohs, S.J., and Bagchi, D., 1995. Oxidative mechanisms in the toxicity of metal ions. Free Radical Biology and Medicine, 18: 321–336.

Mussels as a Tool in Metal Pollution Biomonitoring…

393

Sundback, K., Miles, A., Hulth, S., Pihl, L., Engstorm, P., Selander, E., Svenson, A., 2003. Importance of benthic nutrient regeneration during initiation of macroalgal bloom in shallow bays. Marine Ecology Progress Series, 246: 115-126. Szefer, P., Frelek, K., Szefer, K., Lee, Ch.-B., Kim, B.S., Warzocha, J., Zdrojewska, I., Ciesielski, T., 2002. Distribution and relationships of trace metals in soft tissue, byssus and shells of Mytilus edulis trossulus from the southern Baltic. Environmental Pollution, 120: 423-444. Szefer, P., Fowler, S.W., Ikuta, K., Paez Osuna, F., Ali, A.A., Kim, B.-S., Fernandes, H.M., Belzunce, M.J., Guterstam, B., Kunzendorf, H., Wołowicz, M., Hummel, H., DeslousPaoli, 2006. A comparative assessment of heavy metal accumulation in soft parts and byssus of mussels from subarctic, temperate, subtropical and tropical marine environments. Environmental Pollution, 139: 70-78. Taniguchi, N., Higashi, T., Sakamoto, Y., Meister, A., 1989. Glutathione Centennial: Molecular Perspectives and Clinical Applications. Academic Press, London: 441 pp. Valiela, I., 1995. Marine ecological processes (second edition). Springer-Verlag, New York: 686 pp. Viarengo, A., and Nott, J.A., 1993. Mechanisms of heavy metal cation homeostasis in marine invertebrates. Comparative Biochemistry and Physiology, 104C: 355-372. Walker, C.H., Hopkin, S.P., Sibly, R.M., Peakall, D.B., 2001. Principles of ecotoxicology. London, Taylor and Francis: 211 pp. Wang, W.X., Fisher, N.S., Luoma, S.N., 1996. Kinetic determinations of trace element bioaccumulation in the mussel Mytilus edulis. Marine Ecology Progress Series, 140: 91– 113. Wang, W.X., and Fischer, N.S., 1997. Modelling metal bioavailability for marine mussels. Review of Environmental Contamination and Toxicology, 151: 39-65. Wang, W.X., and Fisher, N.S., 1999. Assimilation efficiencies of chemical contaminants in aquatic invertebrates: a synthesis. Environmental Toxicology and Chemistry, 18: 2034– 2045. Wang, W.X., and Rainbow, P.S., 2005. Influence of metal exposure history on trace metal uptake and accumulation by marine invertebrates. Ecotoxicology and Environmental Safety, 61: 145–159. Wang, W.X., and Rainbow, P.S., 2008. Comparative approaches to understand metal bioaccumulation in aquatic animals. Comparative Biochemistry and Physiology, Part C 148: 315–323. Wassmann, P., Reigstad, M., Haug, T., Rudels, B., Carroll, M.L., Hop, H., Gabrielsen, G.W., Falk-Petersen, S., Denisenko, S.G., Arashkevich, E., Slagstad, D., Pavlova, O., 2006. Food webs and carbon flux in the Barents Sea. Progress in Oceanography, 71: 232–287. Wildish, D.J., and Kristmanson, D., 1997. Benthic Suspension Feeders and Flow. Cambridge University Press, Cambridge: 409 pp. Worsfold, P.J., 1994. Environmental monitoring - a flow injection approach. Journal of Automatic Chemistry, 16: 153-154. Wu, R.S.S., Lau, T.C., Fung, W.K.M., Ko, P.H., Leung, K.M.Y., 2007. An ‗artificial mussel‘ for monitoring heavy metals in marine environments. Environmental Pollution, 145: 104110.

394

Joanna Przytarska and Adam Sokołowski

Yap, C. K., Ismail A., Tan S. G., 2003. Effects of Total Soft Tissue and Shell Thickness on the Accumulation of Heavy Metals (Cd, Cu, Pb, and Zn) in the Green-Lipped Mussel Perna viridis. Russian Journal of Marine Biology, 29(5): 323–327. Zatsepin, V.I., Filatova, Z.A., Shilejko, A.A., 1988. Klass dwustworchatyie molljuski (Bivalvia). In: Pasternak R.K. (Ed.), Zhizn‘Zhivotnyh-Molljuski-IgłokożieChlenistonogie (The life of animals-molluscs). Prosveshchenie, Izdatelstvo, Moscow: 65112. Zhou Q., Zhang J., Fu J., Shi J., Jiang G., 2008. Biomonitoring: An appealing tool for assessment of metal pollution in the aquatic ecosystem. Analytica Chimica Acta, 606: 135–150.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 17

SCLEROCHRONOLOGY – MUSSELS AS BOOKKEEPERS OF AQUATIC ENVIRONMENT Samuli Helama Arctic Centre, University of Lapland, Finland

ABSTRACT Growth of several aquatic organisms is recorded in their hard parts. The skeleton of mussels (akin to clams, corals and brachiopods) is known to portray an array of shell growth increments. Investigations delving into the anatomy of these annuli have proven that the most discernible of them are often exhibiting annual periodicity. In other words, an increment is layered once a year. Rigorous examination of these increments is most commonly called as sclerochronology. Essentially, the sclerochronological approaches all benefit from the meticulous comparison and matching of shell growth increment records between several individuals. This procedure, called as sclerochronological crossdating, relies on growth increment widths and ensures that no increment is falsely added or missing in the resulting chronology. Apart from crossdating, the sclerochronological studies may benefit from the procedures of detrending and pre-whitening. Many environmental factors significantly influence the thickness variability of the increments. Both detrending and pre-whitening enable capturing the internally driven growth variability and to isolate the growth variations caused by external factors. Correlation analysis can be used to find out those environmental variables potentially influencing the shell growth variability. Mussels are thus keeping the book of environmental history. Sclerochronologists with skill of crossdating and other methods of time-series analysis are benefitted by increased ability to read these books.

INTRODUCTION Man has been fascinated by mollusks and collected them for thousands of years (Waselkov 1987). Shells can be found from archaeological sites (Bar-Yosef Mayer 2005). They have frequently been depicted in art and fished for food and pearls (Cox 1957). The natural beauty of the shells is in their exoskeletons, which are able to take many forms and

396

Samuli Helama

sizes (Ball 1922; Eagar 1978; Tevesz and Carter 1980; Watters 1994). Part of this beauty comes from the annuli that form harmonic rings around the shell surface and amplify the geometric appearance of the shell shape. Not until very recently, however, man has paid particular interest on the annuli and especially their scientific significance. In fact, the most spectacular of the annuli, the growth increments of the shells, are formed on annual basis and yield scientific information similar to the annuli in the stems of extra-tropical trees. While tree-rings have been studied dendrochronologically since the dawn of the twentieth century (e.g. Douglass 1921), the shell growth increments have not been under scientific examination not the recent decades. Accordingly, the science of the shell growth increments has coined the term sclerochronology (Jones 1983). With restriction to bivalves, the term malacochronology was used by Witbaard et al. (2004). In this paper the sclerochronological science is revealed in the context of mussel shell growth. Mussels, akin to clams, corals and brachiopods, are known to form increments in their shells on daily to annual rhythms (Mutvei et al. 1994, 1996; Dunca and Mutvei 1996, 2001; Dunca 1999; Mutvei and Westermark 2001; Dunca et al. 2005). The most discernible of those are commonly annual increments. This may not be a surprise considering the strength of the annual cycle of nature that, in turn, is thus imprinted in the growth structures of mussel shells. Consequently, the sclerochronological information from annual increments is likely the best known component of the shell growth of mussels. For these reasons, this paper will examine and review the particular aspects of the annual shell growth increments of mussels. Literature citings to sclerochronological studies on clams, or even to dendrochronological examples, have not bee avoided in the case of relevant supporting evidence. The main topic of the paper is however a mussel as an organism whose growth, and especially the growth variability, can be inferred from its annuli, particularly the widths of the shell growth increments.

SOURCES OF SHELLS Sclerochronological approach prerequisites shells - these can originate from different sources. Needless to say, the shell can be collected from the natural environments of the species and modern habitats of the populations. Moreover, sclerochronological research can utilize shells from the depositions of museums, ancient humans and nature, the latter types of shells being those of archaeological (e.g. Bar-Yosef Mayer 2005) or paleontological (e.g. Kidwell 1991) origins, respectively. In any case, the shells should not be collected imprudently. First, an anthropogenic disturbance in the habitat may harm the population living in that or nearby environments. Secondly, the collection of shells from any type of environment may not be allowed without license and the researcher ought to be aware of these restrictions and permissions needed. This is because several species of mussels are endangered. An example of this kind is freshwater pearl mussel (Margaritifera margeritifera) which is an anthropogenically threatened invertebrate listed in Annexes II and V of the European Habitats Directive and Appendix III of the Bern Convention. In Finland, for example, M. margaritifera was protected by law already in 1955, and Finland‘s Nature Conservation Act requires permission for any disturbance on living organisms and even for the collection of empty shells or fragments of dead mussels (Valovirta 1998). That is, the

Sclerochronology – Mussels as Bookkeepers of Aquatic Environment

397

collection of archaeological or fossil shells of that species is to be carried out under authorized license only. Consequently, the researcher should familiarize himself with the required permissions as a part of field-work planning process. This planning should consider the species involved and the regional environmental and conservation legislations. As previously alluded to, the research may benefit from shells of several distinctly different origins. There are several reasons to study shells of mussels not only those collected recently, but also those shells of mussels that have died decades, centuries or even millennia ago. The benefits of studying shells from museum collections, archaeological sites or paleontological deposits are two-folded. First, the study of historical or fossil shells may benefit the modern populations of mussels that thus remain undisturbed. The usage of the museum or fossil shells can thus be of particular importance in the case of endangered species, to preserve the populations that still exist. This is to apply the paleoecological techniques to the analysis of the historic skeletal remains of species that are threatened with extinction. Recently, such a biological approach has been coined to as conservation paleobiology by Flessa (2002). Secondly, the benefit of using dead instead of live-collected shells is that the research conducted using old shells is able to provide the researcher with information from pre-anthropogenic periods (Helama et al. 2007b). Moreover, the timescales under investigation can be extended by the use of dead shells. The study material of this paper comprises three large and robust shells of the freshwater pearl mussel (Margaritifera margaritifera (Linnaeus 1758)), collected from beside the River Kolmosjoki (Lapland, Finland) in 1980 (Helama et al. 2009b). The specimens were found lying on the surface sediments along the river margin. The samples now belong to the collections of the Finnish Museum of Natural History (Invertebrates Division), University of Helsinki (Valovirta 1998). The annual shell growth of these shells was initially studied previously (Helama and Valovirta 2008a). The sclerochronological characteristics of the shells are detailed in this study and further reviewed in the context of the sclerochronological theories. In conclusion, the sclechronological studies can benefit from shells of biological, historical, archaeological or paleontological provenances, these originating from modern populations, museum archives, deposits by pre-historic humans or fossil record. Once the shells are obtained, the pre-analytic work phases proceed with highly similar procedures despite of differences in the shell origin. These phases of the work are described next.

INTERNAL SHELL GROWTH INCREMENTS The annual growth increments of mussels have traditionally been used for determining the ontogenetic age of the individuals. In Europe, such studies have dealt with M. margaritifera, Unio crassus, U. tumidus, U. pictorum, Anodonta anatina, A. cygnea and Pseudanodonta minima (Hendelberg 1960; Björk 1964; Negus 1964; Bauer 1992; Timm 1994; Helama and Valovirta 2008a, 2008b). The pioneering studies on the mussel research studies made use of the increments visible either directly on the outer shell or the cutting plane of the ligament (e.g. Hendelberg 1960). The general difficulty is to observe the increment borders on the shell surface due to darkness of the periostracum. In particular the increments near the ventral margin are often very narrow and clustered. More recently there

398

Samuli Helama

has been a tendency to determine, count and measure the internal growth increments from the well-prepared cross-sections of the shells. Timm (1994) compared the approaches of growth increment counting using several mussel species. It was found out the internal growth increments yielded a higher number of annual increments than the other approaches, due to better visibility of increments in the cross-sections. In conclusion, more reliable time-series can be produced from internal increments. The preparation of the cross-sections ideally proceeds by cutting the shell, grounding, polishing and etching the internal shell material (Mutvei et al. 1994, 1996; Dunca and Mutvei 1996, 2001; Dunca 1999; Mutvei and Westermark 2001; Dunca et al. 2005). The work thus includes physical and chemical treatments. Much of the physical procedure can be carried out in a typical petrologic laboratory. Following the methods described by Dunca and Mutvei (2001), the valve of chosen specimen is cut from the umbo to the ventral margin (Figure 1A). To do so, the cut proceeds perpendicular to the annuli (i.e. ‗winter-lines‘) and, thus, along the axis of minimum growth (Figure 1A).

Figure 1. The sampling of the shell (here, Margaritifera margaritifera) proceeded by cross-sectioning each valve from umbo (―U‖) to ventral margin (―V‖) along the axis of minimum shell growth (A). The treated cross-section surfaces were viewed under a microscope (B). The widths of the annual increments were measured as the distances (arrows) between consecutive ‗winter-lines‘. Prismatic (P) and nacreous (N) shell layers shown as light and dark gray colours, respectively.

Sclerochronology – Mussels as Bookkeepers of Aquatic Environment

399

Instead of cutting through the axis of maximum growth, Dunca and Mutvei (2001) counted exactly the same number of increments on the axes of minimum and maximum growth sections, with better visible increments in the minimum growth section. Next, the sections are to be ground and polished, using grinding paper and diamond paste, respectively. The section surface is then to be etched. This is to treat the sections for 20-30 min (37 to 40 ºC) in a mixture of 1 % acetic acid, 25% glutaraldehyde and a smidgeon of alcian blue (Mutvei et al. 1994, 1996). The treatment results in an enhanced discernibility of the internal growth structures, with particularly winter lines coloured bluish. The treated section surfaces (Figure 1B) can then be viewed under a microscope. They could be determined, counted and measured under a dendrochronological measuring table or simply digitally photographed. In the latter case, the increments are to be measured from the photographic enlargements of known scale. In both cases, the widths of the increments are determined as distances between and perpendicular to successive ‗winter-lines‘ from the outer layer of shell calcium carbonate (Figure 1C). The described methodology follows the techniques developed at the Palaeozoological Department, Swedish Museum of Natural History (Mutvei et al. 1994, 1996; Dunca and Mutvei 1996, 2001; Dunca 1999; Mutvei and Westermark 2001; Dunca et al. 2005).

LONGTIME TREND IN THE WIDTH SERIES The data of consecutive increments are to be compiled into time-series of shell growth increment widths. In such data, each increment width value is initially associated with the biological year of the increment formation. It can be seen that the shell growth increments display considerable growth variations at different time scales. The overall shape of the timeseries however is often dictated by a longtime trend (Figure 2). That is, the biologically young increments, those located near the umbo, can be considerably wider than the increments located near the ventral margin, i.e. those representing the oldest portion of the shell growth. This negative exponential shape is similar between the growth trends of several mussel species and habitats (Timm and Mutvei 1993; Dunca 1999: San Miguel 2004; Helama and Valovirta 2007; Rypel et al. 2008, 2009). In sclerochronological studies, this trend is to be identified and removed. By definition, the trend is age-related component of the growth variability. Therefore, the detection of the trend is a basic step for isolating the growth forcings those internal (i.e. ageing) and external (i.e. climate) to growth. Statistically, the necessity for trend removal is the same in dendrochronology (Fritts 1976; Cook et al. 1990a, 1995; Cook and Peters 1997) and sclerochronology (Strom et al. 2005; Helama et al. 2006; Butler et al. 2010). It is due to the non-stationary and heteroscedastic nature of the sclerochronological time series, that is, the local mean of increment widths tend to vary as a function of biological age and the local variance of the widths have been shown to be proportional to mean. The simplest approach to remove the trend and to stabilize the heteroscedastic variance in the series is first to find an expected growth curve for the series (Figure 2A) and, secondly, to divide the observed values of increment widths by the values of the curve (Figure 2B). This is the procedure commonly called as standardization (or detrending, or indexing). The resulting dimensionless, ratiobased indices are expected to show no trend of ageing and being homoscedastic. In practice,

400

Samuli Helama

the former transformation is facilitated more easily than the latter (see Cook and Peters 1997; Helama et al. 2004).

Figure 2. The standardization of the incremental time-series. Growth trends were modelled using a modified negative exponential curve (gray line) as fitted to series of observed increment widths (black line), individually to each series (A, B, C). The dimensionless index series were computed by division between the observed and modelled widths (gray line), and these series were further processed into prewhitened index series (black line) that had virtually lost their autocorrelation (D, E, F).

Negative trends were evident in all three sample series of M. margaritifera (Figures 2A, B, C). These growth trends were modeled using the formula of a modified negative exponential function (Fritts et al. 1969). Subsequent to the growth trend modeling, the series of ratio-based indices were derived as division between the observed and modeled increment widths (Figures 2D, E and F). The last increment of each specimen was excluded from timeseries analyzes of this study. These increments had no identifiable winter-line due likely to post-mortem corrosion of the ventral margin or unfinished shell growth due to a mortal event during the growing season.

Sclerochronology – Mussels as Bookkeepers of Aquatic Environment

401

SERIAL CORRELATION IN THE INDEX SERIES The index series of mussel growth increments may exhibit high autocorrelation. The autocorrelation appears as an inertia that influences the shell growth variability on multiannual scales, that is, the consecutive index values are not independent but depending on each other. Since the index series have been detrended, this type of growth dependence, serial correlation, is evidently independent of the trend. While a portion of this autocorrelation can originate from external factors (such as climate), it is noteworthy that the level of the autocorrelation can be higher in the indices than in the climate (Helama et al. 2010). Therefore one could assume that a significant proportion of the serial correlation originates from the physiological factors of the mussels. The structure inherent to serial correlation of each index series can be identified using the autoregressive-moving average (ARMA) modelling. ARMA models of Box and Jenkins (1970) determine the underlying structure of mathematical persistence in time-series. Residuals from ARMA models are thus series that have practically lost their autocorrelation. This is a process called as pre-whitening. Serial correlation was extant in the three M. margaritifera sample series. Subsequent to detrending by negative exponential curve, the samples A, B and C exhibited first order autocorrelations 0.38, 0.24 and 0.60, respectively. The pre-whitened index series (Figures 2D, E, F) had virtually lost their serial correlation with the coefficients of first order autocorrelations 0.01, -0.03 and -0.05 for the sample series A, B and C, respectively.

SCLEROCHRONOLOGICAL CROSSDATING The time-series of shell growth increment widths are exhibiting growth variations at different scales. With these regards, the longtime trend in the widths could be associated with the mussel ageing, whereas a portion of the variability on multi-annual scales could be linked to inertial growth features. Likewise, since these constituents derive from biological origins, they would appear highly inherent to growth processes themselves. Importantly, both the trend and autocorrelation can be defined (i.e., parameterized) and consequently eliminated. The outcome of the detrending and pre-whitening, the index series, would thus be characterized by growth variations by forcings external to growth dynamics. Such forcing could potentially include climatic, hydrological and ecological factors. Since all these factors are predominantly external to growth, their influence could be expected considerably similar and, even more importantly, highly synchronous over relevant scales. In fact, this synchrony forms the basic philosophy of sclerochronological science. The synchrony of growth variations enables the incremental variations to be temporally compared between the mussels in a given population. This comparison, in turn, facilitates the basis for sclerochronological crossdating which, akin to dendrochronological dating (Fritts 1976), ensures the veracity of the resulting sclerochronologies (Helama et al. 2006). Crossdating has recently been applied to several species of mussels (Helama et al. 2006, 2007a; Helama and Valovirta 2008a; Rypel et al. 2008, 2009). Similarly to dendrochronological dating (Douglass 1941; Fritts 1976), the sclerochronological crossdating compares temporal patterns of growth variability among multiple samples from a given time period and site. Aligning the growth patterns among specimens ensures that no annuli have

402

Samuli Helama

been falsely added or missed when measuring the increments. In the case of live collected shells, the calendar date for the increment nearest the ventral margin is known. The tentative calendar years of increments towards the umbo can be assigned by counting backwards in time. The increments of the shell from museum, archaeological or paleontological archives may become crossdated with the increments of the live-collected shells to determine the date of death and extend the master chronology to an earlier date. This necessitates a temporal overlap between a portion of the lifespan of the dead and live-collected shells. Yet, offsetting the series and their fragments by lagging them forward and backward in time is necessary to terminate the crossdating (Figure 3).

Figure 3. Sclerochronological crossdating illustrated for three sample series. Visual inspection revealed synchrony between the series over the past decades but prior to 1930 the sample series B showed growth events with lags of one year (A). This was further revealed by the lack of correlation (here, Pearson correlations, r) prior to 1930, but notably high correlation subsequent to same date, between the sample series B and the mean series of samples A and C (B). Inclusion of the increment of that particular year into the sample series B resulted in consistent synchrony and correlation between the sample series (C).

Sclerochronology – Mussels as Bookkeepers of Aquatic Environment

403

If an elevated correlation (commonly, Pearson correlation coefficient) is found in an offsetting position, the number of years lagged can be taken as an indication of the number of missed or falsely added growth. The importance of detrending and pre-whitening should not be underestimated. It is well known that autocorrelated series may show artificial elevated cross-correlations due to pure chance (Yule 1926; Bartlett 1935; Quenouille 1952). While detrending is prerequisite of prewhitening (Box and Jenkins 1976), the latter results in index series that have lost their series correlativity. Consequently, sclerochronological cross-dating is greatly enhanced by the use of the data that are not only de-trended but also pre-whitened (Cook 1985; Monserud and Yamaguchi 1989). Moreover, it is notable that crossdating is additionally enabled by comparisons between the shell-specific series (i.e. sample series) and the mean of all other crossdated series (i.e. master chronology) in a given site, as previously demonstrated for mussels and clams (Helama et al. 2006) and for M. margaritifera in Figures 3B and C. In particular, it was found that one increment of Sample B had not been registered when measuring the increments of that sample. Moreover, it became evident that the year of missing increment was 1930. Adjusting the series of the Sample B for a missing increment resulted in a high growth synchrony between the three series (Figure 3). The great longevity of the analysed mussels became evident as the samples showed 99, 137 and 162 annual increments. Although such ages may not be exceptions among the same species (see Ziuganov et al. 2000), it is noteworthy that the increment counts shown here became evident subsequent to crossdating. This further proves their veracity.

SUMMARY CHRONOLOGY CALCULATION The index series are to be combined into the mean chronologies (Fritts 1976). This is commonly done by averaging the annual index values using the arithmetic mean (Figure 4A). Alternatively, the use of the biweight robust mean (Mosteller and Tukey, 1977) could improve the chronology estimation in the presence of growth disturbances, outliers, as proposed by tree-ring studies (Cook 1985). Recently, the robust chronology estimation has been used to build sclerochronologies as well (Butler et al. 2010). However, if the sample size drops below six series, as in many sclerochronological studies, the biweight robust mean estimation could be replaced simply by the median (Mosteller and Tukey 1977; Cook et al. 1990b). Simply, the benefit of the biweight robust mean and median is their resistance to the particular outliers in the data (Cook 1985; Cook et al. 1990b). It is noteworthy that the use of the median in the case of low sample size was previously found beneficial in a related sclerochronology study (Helama et al. 2009a). In general, the sclerochronologies calculated using mean and median as summary statistics showed, in general, similar variations (Figure 4A). There were, however, intervals of time over which the two chronologies differed. The period of greatest difference occurred during the 1930s. During this period, the sclerochronological computed using mean showed notably higher index values compared to the chronology calculated by the median. If fact, it was previously found (Helama and Valovirta 2008a) that one of the shells (Sample B) had experienced a shell damage that had resulted in a missing increment in 1930. The damage had first interrupted the growth of that specimen for 1 year, after which the shell repair had

404

Samuli Helama

resulted in anomalously high growth rate for the next 8 years. The result was consistent with a preceding study showing an accelerated growth rate subsequent to shell damage, during the shell repair (Ziuganov et al. 2000). In the context of summary statistics, the sclerochronology calculated by median was not as sensitive to the anomalously high index values in a single sample series during this period as the chronology computed by the mean.

Figure 4. Sclerochronologies built using the arithmetic mean and the median (A). Temporal variability in the mean temperatures of July-August and June-August bi-monthly and tri-monthly summer seasons (B). Comparison between the instrumentally observed temperatures (July-August) and the scleroclimatically (median) recorded temperatures produced by scaling (Esper et al. 2005) of the mean and standard deviation of the sclerochronology to the corresponding values of the instrumental record over the common period (i.e. 1876-1979) (C).

Sclerochronology – Mussels as Bookkeepers of Aquatic Environment

405

To conclude, the growth variability of the sample series may be controlled by factors specific to given microhabitat and individual life-history. Therefore, mean (or median) growth series provide records that are more reliable about the underlying environment than any individual sample series (Fritts 1976). The mean chronology could be reckoned to be the final product of studies delving into the annual shell growth variability whereas the mean of crossdated index series may be regarded as a reasonable goal of any sclerochronological study (Helama et al. 2006).

SCLEROCLIMATOLOGY As mentioned above, the methods of chronology construction (i.e. detreding and prewhitening) aim at removing index variability inherent to the growth processes of the mussels, whereas the resulting sclerochronology is expected to indicate growth variations due to external factors. Determination of the factors affecting the growth variability in a given site can be derived using statistical calibrations (Blasing et al. 1984; Biondi 1997). Statistical relationship between the growth variability and any available environmental time-series can be examined. The environmental data should have been recorded on regular basis to show at least an annual but preferably seasonal or monthly resolvability. Environmental data fulfilling the requirements are typically either meteorological or hydrological time-series and, consequently, these series have previously been used in combination with mussel sclerochronologies (Mutvei et al. 1994, 1996; Dunca 1999; Mutvei and Westermark 2001; Dunca et al. 2005; Rypel et al. 2008, 2009, Helama et al. 2009a, 2010). Probably the simplest statistical method of estimating the scleoroclimatic or sclerohydrologic relationships could be the Pearson product-moment correlation coefficient. Pearson correlation describes the linear relationship between two time series, thus, the sclerochronology and environmental series. Compared to multivariate estimates, Pearson correlation are been found more robust to a priori decisions about the selections of the datasets (Blasing et al 1984). Pearson correlations does not account for potential non-linearity between the sclerochronological and environmental variability. Moreover, the multicollinearity among the environmental variables may hamper the analysis (Fritts and Wu 1986). Therefore, the use of multivariate analysis (e.g. Biondi 1997) could be more an appropriate approach to reveal the relationships of the sclerochronology against a set of environmental data with high inter-correlativity. Previous studies have shown that the sclerochronological variations can be linked with the variability in the summer temperatures in the study region (Helama et al. 2009a, 2010). The two chronologies, calculated by the mean and the median, were thus correlated with the mean series of summer temperatures. A systematic difference was found to demonstrate appreciably higher scleroclimatic correlations for the median chronology (Figure 5). It could thus be assumed that the chronology index values calculated by the median had higher climatic value in comparison to the indices computed using the mean. The highest scleroclimatic correlations were additionally found for the mean temperatures of the summer seasons June-August and July-August (see Figures 4B and C). The correlations were positive for analysed seasons. It thus became clear that the warm summers result in wide increments, whereas the cool summer in narrow increments.

406

Samuli Helama

Figure 5. Scleroclimatic correlations (here, Pearson correlations) between the mean and median sclerochronologies and the mean temperatures (Karasjok weather station, Norway) of monthly (JUN, JUL, AUG), bi-monthly (JJ, JA) and tri-monthly (JJA) summer seasons.

CONCLUSION The shell of the mussels keeps growing and the animal continues to deposit the exoskeleton layers of calcium carbonate until its death. Examination of these layers brings the malacological science very close to study of tree-rings. Moreover, the application of crossdating to the annual shell growth increments makes the sclerochronology analogous to dendrochronology. Much of the numerical techniques used in sclerochronological studies originates more or less directly from dendrochronological literature (Fritts 1976), so that the science of sclerochronology has been referred to as the marine (Hudson et al. 1976; Jones 1983; Marchitto et al. 2000) or aquatic (Helama et al. 2006) counterpart of dendrochronology. The big marine clam, Arctica islandica, has similarly been called as ―tree of the sea‖ (Witbaard 1997). Sclerochronological studies provide information that is of use in multitude of disciplines. The counts of annual increments provide assessments of longevity (Ziuganov et al. 2000; Helama and Valovirta 2008a). The incremental methods can be exploited to build chronological frameworks for dating the shell material for biogeochemical analyses (Carell et al. 1987, 1995; Nyström et al. 1996; Versteegh et al. 2009) or post-mortem ages of the shells unearthed from the field (Helama et al. 2009b). Moreover, an established network of sclerochronologies can be used for spatiotemporal estimations of annual mussel growth variability and the dependence of this variability on environmental variables or anthropogenic factors (Mutvei et al. 1994, 1996; Timm and Mutvei 1993; Dunca 1999; Mutvei and Westermark 2001; Dunca et al. 2005; Helama et al. 2009a; Rypel et al. 2008, 2009). Alternatively, the past climate variability can be inferred from the increment widths of the mussels (Schöne et al. 2004; Helama et al. 2010). Common to all these approaches is that the reliability of their results will be greatly augmented by the use of sclerochronological crossdating, which in turn is highly benefitted from detrending and pre-whitening.

Sclerochronology – Mussels as Bookkeepers of Aquatic Environment

407

This paper has been aimed at examining and reviewing the related aspects of the annual growth increments of the shell. The particular focus has been in the shell growth variability of mussels. Moreover, the aim of the paper has been to demonstrate a simple pathway of approaches and analytical methods to be applied from the field to the laboratory and computerized calculations of resulting sclerochronological data. The described sclerochronological methods of standardization, pre-whitening, crossdating and chronology calculating, are applied to isolate the variations due to external factors and to amplify their appearance in the final chronology. The existence of external variations, in turn, shows that the mussels are keeping the book of aquatic environment. If properly applied, the sclerochronological methods are to translate the unwritten stories recorded inside the shells into the language of natural science. These methods help us to interpret the messages structured to the books made of calcium carbonate. Sclerochronologists with the skill of standardization and pre-whitening can read the books written with darker ink. Sclerochronologists with skill of crossdating can read the books without missing a page or two.

ACKNOWLEDGMENTS The shell samples were collected under license from The Lapland Regional Environment Centre. The meteorological data was available at: http://www.rimfrost.no/. This study was supported by the Academy of Finland.

REFERENCES Ball, G. H. (1922). Variation in fresh-water mussels. Ecology, 3, 93-121. Bartlett, M. S. (1935). Some aspects of the time-correlation problem in regard to tests of significance. Journal of the Royal Statistical Society, 98, 536-543. Bar-Yosef Mayer, D. E. (2005). An Introduction to Archaeomalacology. In D. E. Bar-Yosef Mayer (Ed.), Archaeomalacology: Molluscs in Former Environments of Human Behaviour (pp. 1-4). Oxford: Oxbow Books. Bauer, G. (1992). Variations in the life span of the freshwater pearl mussel. Journal of Animal Ecology, 61, 425-436. Biondi, F. (1997). Evolutionary and moving response functions in dendroclimatology. Dendrochronologia, 15, 139-150. Björk, S. (1962). Investigations on Margaritifera margaritifera and Unio crassus. Limnologic Studies in Rivers in South Sweden. Acta Limnologica, 4, 1-109. Blasing, T. J., Solomon, A. M. and Duvick, D. N. (1984). Response functions revisited. TreeRing Bulletin, 44, 1-15. Box, G. E. P. and Jenkins, G. M. (1970). Time-series analysis, forecasting and control. San Francisco: Holden-Day. Butler, P.G., Richardson, C.A., Scourse, J.D., Wanamaker, A.D., Jr., Shammon, T.M. and Bennell, J.D. (2010). Marine climate in the Irish Sea: analysis of a 489-year marine

408

Samuli Helama

master chronology derived from growth increments in the shell of the clam Arctica islandica. Quaternary Science Reviews, 29, 1614-1632. Carell, B., Forberg, S., Grundelius, E., Henrikson, L., Johnels, A., Lindh, U., Mutvei, H., Olsson, M., Svardstrom, K. and Westermark, T. (1987). Can mussel shells reveal environmental history? Ambio, 16, 2-10. Carell, B., Dunca, E., Gärdenfors, U., Kukakowski, E., Lindh, U., Mutvei, H., Nyström, J., Seire, A., Slepukhina, T., Timm, H., Westermark, T. and Ziuganov, V. (1995). Biomonitoring of pollutants in a historic perspective. Emphasis on mussel and snail shell methodology. Annali di Chimica, 85, 353-370. Cook, E. R. (1985). A time series analysis approach to tree-ring standardization. Doctoral dissertation. University of Arizona, Tucson. Cook, E. R. and Peters, K. (1997). Calculating unbiased tree-ring indices for the study of climatic and environmental change. The Holocene, 7, 359-368. Cook, E. R., Briffa, K. R., Meko, D. M., Graybill, D. A. and Funkhouser, G. (1995). The 'segment lenght curse' in long tree-ring chronology development for palaeoclimatic studies. The Holocene, 5, 229-237. Cook, E. R., Briffa, K. R., Shiyatov, S., and Mazepa, V. (1990a). Tree-Ring Standardization and Growth-Trend Estimation. In E. Cook and L. Kairiukstis (Eds.), Methods of dendrochronology: applications in the environmental science (pp. 104-123). Dordrecht: Kluwer Academic Publishers. Cook, E. R., Shiyatov, S. and Mazepa,V. (1990b). Estimation of the Mean Chronology. In E. Cook and L. Kairiukstis (Eds.), Methods of dendrochronology: applications in the environmental sciences (pp. 123-132). Dordrecht: Kluwer Academic Publishers. Cox, I. (1957). The Scallop: Studies of a shell and its influences on humankind. London: The 'Shell' Transport and Trading Company, Limited. Douglass, A. E. (1921). Dating our prehistoric ruins. Natural History, 21, 27-30. Douglass, A. E. (1941). Crossdating in dendrochronology. Journal of Forestry, 39, 825-831. Dunca, E. (1999). Bivalve shells as archives for changes in water environment. Vatten, 55, 279-290. Dunca, E. and Mutvei, H. (1996). Periodic microgrowth patterns in shells of freshwater unionid bivalves. Bulletin de l‟Institut océanographique, Monaco, no. special, 14, 127131. Dunca, E. and Mutvei, H. (2001). Comparison of microgrowth pattern in Margaritifera margaritifera shells from south and north Sweden. American Malacological Bulletin, 16, 239-250. Dunca, E., Mutvei, H. and Schöne, B. R. (2005). Freshwater bivalves tell of past climates: But how clearly do shells from polluted rivers speak? Palaeogeography, Palaeoclimatology, Palaeoecology, 228, 43-57. Eagar, R. M. C. (1978). Shape and function of the shell: a comparison of some living and fossil bivalve mollusks. Biological Reviews, 53, 169-210. Esper, J., Frank, D. C., Wilson, R. J. S. and Briffa, K. R. (2005). Effect of scaling and regression on reconstructed temperature amplitude for the past millennium. Geophysical Research Letters, 32, L07711, doi:10.1029/2004GL021236. Flessa, K.W. (2002). Conservation paleobiology. American Paleontologist, 10, 2-5. Fritts, H. C. (1976). Tree rings and climate. London: Academic Press.

Sclerochronology – Mussels as Bookkeepers of Aquatic Environment

409

Fritts, H. C. and Wu, X. (1986). A comparison between response function analysis and other regression techniques. Tree-Ring Bulletin, 46, 31-46. Fritts, H. C., Mosimann, J. E. and Bottorff, C. P. (1969). A revised computer program for standardizing tree-ring series. Tree-Ring Bulletin, 29, 15-20. Helama, S. and Valovirta, I. (2007). Shell morphometry, pre-mortal taphonomy and ontogeny-related growth characteristics of freshwater pearl mussel in northern Finland. Annales Zoologici Fennici, 44, 285-302. Helama, S. and Valovirta, I. (2008a). The oldest recorded animal in Finland: ontogenetic age and growth in Margaritifera margaritifera (L. 1758) based on internal shell increments. Memoranda Societatis pro Fauna et Flora Fennica, 84, 20-30. Helama, S. and Valovirta, I. (2008b). Ontogenetic morphometrics of individual freshwater pearl mussels (Margaritifera margaritifera (L.)) reconstructed from geometric conchology and trigonometric sclerochronology. Hydrobiologia, 610, 43-53. Helama, S., Läänelaid, A., Tietäväinen, H., Macias Fauria, M., Kukkonen, I. T., Holopainen, J., Nielsen, J. K. and Valovirta, I. (2010). Late Holocene climatic variability reconstructed from incremental data from pines and pearl mussels – a multi-proxy comparison of air and subsurface temperatures. Boreas, doi:10.1111/j.15023885.2010.00165.x. Helama S., Lindholm M., Timonen M. and Eronen M. (2004). Detection of climate signal in dendrochronological data analysis: a comparison of tree-ring standardization methods. Theoretical and Applied Climatology, 79, 239-254. Helama, S., Nielsen, J. K., Macias Fauria, M. and Valovirta, I. (2009a). A fistful of shells: amplifying sclerochronological and palaeoclimate signals from molluscan death assemblages. Geological Magazine, 146, 917-930. Helama S., Nielsen J. K. and Valovirta I. (2007a). Conchology of endangered freshwater pearl mussel: conservation palaeobiology applied to museum shells originating from northern Finland. Bollettino Malacologico, 43, 161-170. Helama S., Nielsen J. K. and Valovirta I. (2009b). Evaluating contemporaneity and postmortem age of malacological remains using sclerochronology and dendrochronology. Archaeometry, 51, 861-877. Helama, S., Schöne, B. R., Black, B. A. and Dunca, E. (2006). Constructing long-term proxy series for aquatic environments with absolute dating control using a sclerochronological approach: introduction and advanced applications. Marine and Freshwater Research, 57, 591-599. Helama, S., Schöne, B. R., Kirchhefer, A. J., Nielsen, J. K., Rodland, D. L. and Janssen, R. (2007b). Compound response of marine and terrestrial ecosystems to varying climate: pre-anthropogenic perspective from bivalve shell growth increments and tree-rings. Marine Environmental Research, 63, 185-199. Hendelberg, J. 1960: The fresh-water pearl mussel, Margaritifera margaritifera (L.). One the localization, age, and growth of the individual and on the composition of the population according to an investigation in Pärlälven in Arctic Sweden. Fishery Board of Sweden. Institute of Freshwater Research. Drottningholm. Report, 41, 149-171. Hudson, J. H., Shinn, E. A., Halley, R. B. and Lidz, B. (1976). Sclerochronology: a tool for interpreting past environments. Geology, 4, 361-364. Jones, D. S. (1983). Sclerochronology: reading the record of the molluscan shell. American Scientist, 71, 384-391.

410

Samuli Helama

Kidwell, S. M. (1991). The Stratigraphy of Shell Concentrations. In P. A. Allison and D. E. G. Briggs (Eds.), Taphonomy: Releasing the Data Locked in the Fossil Record (pp. 211290). New York: Plenum Press. Marchitto, T.M., Jones, G. A., Goodfriend, G. A. andWeidman, C. R. (2000). Precise temporal correlation of Holocene mollusk shells using sclerochronology. Quaternary Research, 53, 236-246. Monserud, R. A. and Yamaguchi, D. K. (1989). Comments on ‗Cross-dating methods in dendrochronology‘ by Wigley et al. Journal of Archaeological Science, 16, 221-224. Mosteller, F. and Tukey, J. W. (1977). Data analysis and regression: a second course in statistics. Reading, Massachusetts: Addison-Wesley. Mutvei, H. and Westermark, T. (2001). How environmental information can be obtained from Naiad shells. Ecological Studies, 145, 367-379. Mutvei, H., Dunca, E., Timm, H. and Slepukhina, T. (1996). Structure and growth rates of bivalve shells as indicators of environmental changes and pollution. Bulletin de l‟Institut océanographique, Monaco, no. special, 14, 65-72. Mutvei, H., Westermark, T., Dunca, E., Carell, B., Forberg, S. and Bignert, A. (1994). Methods for the study of environmental changes using the structural and chemical information in molluscan shells. Bulletin de l‟Institut oc´eanographique, Monaco, no. special, 13, 163-186. Negus, C. (1966). A quantitative study of the growth and production of unionid mussels in the River Thames at Reading. Journal of Animal Ecology, 35, 513-532. Nyström, J., Lindh, U., Dunca, E., and Mutvei, H. (1995). A study of M. margaritifera shells from the River Pauliströmsån, S. Sweden. Nuclear Instruments and Methods in Physics Research Section B: Beam Interactions with Materials and Atoms, 104, 612-618. Quenouille, M. H. (1952). Associated measurements. London: Butterworths. Rypel, A.L., Haag, W.R., and Findlay, R.H. (2008). Validation of annual growth rings in freshwater mussel shells using cross dating. Canadian Journal of Fisheries and Aquatic Sciences, 65, 2224–2232. Rypel, A.L., Haag, W.R., and Findlay, R.H. (2009). Pervasive hydrologic effects on freshwater mussels and riparian trees in southeastern floodplain ecosystems. Wetlands, 29, 497-504. San Miguel, E., Monserrat, S., Fernández, C., Amaro, R., Hermida, M., Ondina, P. and Altaba, C.R. (2004). Growth models and longevity of freshwater pearl mussels (Margaritifera margaritifera) in Spain. Canadian Journal of Zoology, 82, 1370-1379. Schöne, B.R., Dunca, E., Mutvei, H. and Norlund, U. (2004). A 217-year record of summer air temperature reconstructed from freshwater pearl mussels (M. margarifitera, Sweden). Quaternary Science Reviews, 23, 1803-1816. Strom, A., Francis, R. C., Mantua, N. J., Miles, E. L. and Peterson, D. L. (2005). Preserving low-frequency climate signals in growth records of geoduck clams (Panopea abrupta). Palaeogeography, Palaeoclimatology, Palaeoecology, 228, 167-178. Tevesz, M. and Carter, J. G. (1980). Environmental relationships of shell form and structure of Unionacean bivalves. In D. C. Rhoads and R. A. Lutz (Eds.), Skeletal growth of aquatic organisms: Biological records of environmental change (pp 295-322). New York: Plenum Press.

Sclerochronology – Mussels as Bookkeepers of Aquatic Environment

411

Timm, H. (1994). Big clams of the Estonian freshwaters: comparison of the age, shell length, and shell weight in different species and populations. Proceedings of the Estonian Academy of Sciences, Biology 43, 149-159. Timm, H. and Mutvei, H. (1993). Shell growth of the freshwater Unionid Unio crassus from Estonian rivers. Proceedings of the Estonian Academy of Sciences, Biology, 42, 55-67. Valovirta, I. (1998). Conservation methods for populations of Margaritifera margaritifera (L.) in Finland. Journal of Conchology, Special Publication, 2, 251-256. Versteegh, E. A. A., Troelstra, S. R., Vonhof, H. B., and Kroon, D. (2009). Oxygen Isotope Composition of Bivalve Seasonal Growth Increments and Ambient Water in the Rivers Rhine and Meuse. Palaios, 24, 497-504. Waselkov, G. A. (1987). Shellfish gathering and shell midden archaeology. In M. B. Schiffer (Ed.), Advances in archaeological method and theory: Volume 10 (pp. 93-210). Orlando: Academic Press. Watters, G. T. (1994). Form and function of unionoidean shell sculpture and shape (Bivalvia). American Malacological Bulletin, 11, 1-20. Witbaard, R. (1997). Tree of the sea: the use of the internal growth lines in the shell of Arctica islandica (Bivalvia, Mollusca) for the retrospective assessment of marine environmental change. Rijksuniversiteit Groningen. Witbaard, R., Jansma, E., and Sass, U.G.W. (2004). Malacochronology, the application of dendrochronological methods on marine bivalve (shell) growth. Tree Rings in Archaeology, Climatology and Ecology, 2, 160-170. Yule, G. U. (1926). Why do we sometimes get nonsense-correlations between time series? A study in sampling and the nature of time-series. Journal of the Royal Statistical Society, 89, 1-64. Ziuganov V., San Miguel E., Neves R.J., Longa A., Fernández C., Amaro R., Beletsky V., Popkovitch E., Kaliuzhin S. and Johnson T. (2000). Life span variation of the freshwater pearl shell: A model species for testing longevity mechanisms in animals. Ambio, 29, 102-105.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 18

MARINE BIOTOXINS AND BLUE MUSSEL: ONE OF THE MOST TROUBLESOME SPECIES DURING HARMFUL ALGAL BLOOMS Paulo Vale Instituto Nacional dos Recursos Biológicos, I.P. / L-IPIMAR 1449-006 Lisbon, Portugal

INTRODUCTION Marine biotoxins are produced by a few species of microalgae, mostly dinoflagellates. These biotoxins are produced in abnormal quantities during blooms of these microalgae and are accumulated mainly in filter-feeding organisms, such as bivalves. Bivalves are the major vectors of human poisonings in temperate waters. In tropical waters more complex food web interactions lead to the accumulation and bioamplification along the food chain of reef fishes of the toxins causing ciguatera fish poisoning (CFP). Marine biotoxins cause gastrointestinal and/or neurological symptoms. In some of these syndromes the symptoms are short lived, while for instance in CFP symptoms may persist for months. In rare cases, severe intoxications might prove fatal, such as extreme cases of paralytic shellfish poisoning (PSP). In order to prevent human intoxications with contaminated bivalves, phytoplankton and flesh testing analysis are carried out routinely in producing areas. These monitoring programmes follow established food safety laws that allow the interdiction of harvesting activity in the bivalve producing areas. These banning periods impose a socio-economical burden in all those directly or indirectly involved in bivalve trading (Franco, 2005). The periods may last from days to months. In some cases, depending on the bivalve species, particular retention of the toxins might occur year-round. For just a few of these extreme cases some strategies have been found, namely industrial processing might allow continuous bivalve harvest. In Europe, two exceptions allowing harvest when toxin levels are above the regulatory levels in force are permitted under the current legislation (European Commission, 1996; 2002). Heat treatment followed by evisceration and canning is used today in Spain to deal with the persistent

414

Paulo Vale

contamination with PSP toxins of the giant cockle Acanthocardia tuberculata (Berenguer et al., 1993), while fresh scallop‘s, Pecten maximus or Pecten jacobaeus, evisceration deals with the persistence of amnesic shellfish poisoning (ASP) toxins in the digestive glands (Salgado et al., 2003). However, evisceration is amenable only to large sized and hard body species, such as these two. Various in vivo methods for accelerating the detoxification process have been tried in the past, particularly for PSP toxins. They include thermal and osmotic stress, electric shocks, decrease in pH, and chlorination (Shumway et al., 1995). None of these methods, however, has proved effective. A review of recent EU projects on detoxification shows either with added algal food or not, depuration takes too many days to be of any use to the bivalve industry (Lassus et al., 2007). The aquaculture sector relies then mainly in natural decontamination processes, taking place in estuarine and lagunar areas after the toxin-producing microalge bloom decays. The decay is species-dependent. In the case of the widely cultivated species in Europe, the blue mussel, scientific data points that it is amongst the most toxic species and presents the longest harvest restriction periods, although some exceptions are known, as those mentioned above. Data accumulated after several years studying Portuguese bivalves will be reviewed to illustrate this point. Following recommendations of a working group organised by the Community Reference Laboratory for Marine Biotoxins on sampling plans (EU-CRL, 2001), the Portuguese programme for biotoxins was refined in 2002 to better incorporate the concept of indicator species – the species that has the highest rate of toxin accumulation. For lagunar and estuarine areas both blue mussels (Mytilus galloprovincialis) and common cockles (Cerastoderma edule) were chosen as weekly indicators. Not a single species, but two were chosen. This outcomes of previous experience showing mussels could reach higher toxin levels than cockle, clams or oysters, and also took longer time to return to safe levels in order to reopen producing areas. If a regulatory decision had to be made based solely on toxin levels in mussel, exploitation of other commercial species would suffer unnecessary closures (Figure 1). As mussels retain toxins longer than other species, when new blooms of toxic microalgae take place, they tend to surpass first the regulatory levels, as toxins ingested add up to the toxin burden already present in the tissues. When the bloom ends, in comparison for example with cockles, toxin levels in mussels might remain above the regulatory levels for several weeks (Figure 1). Detailed data on the main occurring toxins will be next reviewed, and mechanisms underlying the physiological responses will be discussed.

DIARRHETIC SHELLFISH POISONING TOXINS Certain microalgae from genus Dinophysis and Prorocentrum produce okadaic acid (OA), dinophysistoxin-1 (DTX1) and dinophysistoxin-2 (DTX2) (Lee et al., 1989; Hu et al., 1992; James et al., 1997). The okadaites are implicated in a gastrointestinal illness, designated as Diarrhetic Shellfish Poisoning (DSP) (FAO, 2004). Most commonly only planktonic microalgae of genus Dinophysis are implicated in shellfish contamination (Lee et al., 1989).

Marine Biotoxins and Blue Mussel

415

Microalgae of genus Prorocentrum are benthonic and rarely have been held culprit for transferring these toxins into bivalves.

a) mussel cockle

64

b)

640

PSP (µg STX equiv./100g)

mussel cockle

480 320 160

Mar

Jan

Dec

Oct

Oct

Sep

Jul

Aug

0

Jun

0

Nov

DSP (µg OA equiv./100g)

128

Figure 1. Temporal toxicity mussel and cockle Aveiro Figure 1. Temporal evolutionevolution of toxicity of in mussel and in cockle from Aveiro lagoon, from Portugal: a) DSP lagoon, Portugal: a) DSP toxins in summer/autumn 2002; b) PSP toxins in the toxins in summer/autumn 2002; b) PSP toxins in autumn/winter 2005/2006. Dashed lines represent autumn/winter 2005/2006. Dashed lines represent the regulatory limits for DSP regulatory limits for DSP and PSP toxins, respectively. Dashed arrows highlight residual levels in mussels the time of a new bloom. DoubleDashed arrows represent time gap between mussel and cockle and at PSP toxins, respectively. arrowsthehighlight residual levels in in mussels detoxifyingatbelow the regulatory limit. the time of a new bloom. Double arrows represent the time gap

between mussel and cockle in detoxifying below the regulatory limit.

20

5000

4000

3000

2000

0

Ester content (%)

40

1000

Ester content (%)

6000

5000

4000

3000

2000

1000

60

60

40

20

b)

d) 2500

2000

1500

1000

500

0

3000

2000

0

1000

0

0

Ester content (%)

0

Ester content (%)

At the Portuguese coast the main DSP producers are Dinophysis acuminata (from spring to autumn) and Dinophysis acuta (from summer to autumn) (Vale and Sampayo, 2000). Similarly, in the Galician (Spain) coast where exists the European largest mussel production, the same two Dinophysis species are responsible for DSP contamination. Blooms of Dinophysis acuta sometimes occur earlier in Portugal, and these same populations will cause 100 in Galicia by physically driven accumulation 100 toxicity later (Escalera et al., 2010). The first one produces only OA, while the second one produces both OA and DTX2. In bivalves these 80 toxins appear esterified with fatty 80acids, the 7-O-acyl derivatives. While a fair proportion of free toxins pool exists in blue mussels (Figures 2a and 2b), in other bivalves these are almost fully esterified, and only traces 60 60 of free toxins remain (Figures 2c and 2d). More interesting, mussels accumulate more DTX2 than cockles or clams (Vale and Sampayo, 2002; Vale, 2004). 40 40 In order to better understand these differences, the esters pool and the free toxin pool were studied in detail in mussels and cockles from a very toxic lagoon from the Portuguese 20 northwest 20 coast: Aveiro lagoon (Vale, 2004). Thea)esters were eliminated quickly bothc)in mussels and 0 free toxins remained longer in mussels 0 cockles, while (Figure 3). This research carried out in 2003 showed that more toxins could be found in plankton harvested in mussel harvesting areas than in cockle‘s areas. Total OA eq. (µg/Kg) OA eq. (µg/Kg) But these slight differences did not represent a Total qualitative difference, with the same 100 proportion of OA and DTX2 available in both 100 areas (Vale, 2004). It was then understood that apparently for mussels it was easier to esterifie OA than to esterifie DTX2 (Figures 2 and 3). In turn, the80esterified toxins in mussels are quickly 80 eliminated, the same as in cockles (Figure 1a, Figure 3).

and PSP toxins, respectively. Dashed arrows highlight residual levels in mussels at the time of a new bloom. Double arrows represent the time gap between mussel and cockle in detoxifying below the regulatory limit.

Paulo Vale 100

100

80

80 Ester content (%)

60

40

60

40

20

20

a)

c) 5000

4000

3000

2000

Total OA eq. (µg/Kg)

100

100

80

80 Ester content (%)

Ester content (%)

Total OA eq. (µg/Kg)

1000

0

6000

5000

4000

3000

2000

1000

0 0

0

60

40

20

60

40

20

b)

d)

Total DTX2 eq. (µg/Kg)

2000

1500

1000

500

0

3000

2000

1000

0 0

0

2500

Ester content (%)

416

Total DTX2 eq. (µg/Kg)

OA free OA ester

120

a)

DTX2 ester DTX2 ester

b)

100 DTX2 (µg/100g)

80 60 40 20 0

3/Jun 17/Jun 1/Jul 15/Jul 29/Jul 12/Aug 26/Aug 9/Sep 23/Sep 7/Oct 21/Oct 4/Nov

180 160 140 120 100 80 60 40 20 0

3/Jun 17/Jun 1/Jul 15/Jul 29/Jul 12/Aug 26/Aug 9/Sep 23/Sep 7/Oct 21/Oct 4/Nov

OA (µg/100g)

Figure 2. Percentages of in esters found bivalves in Portuguese bivalves fromshown Aveiro Figure 2. Percentages of esters found Portuguese from Aveiro lagoon, as alagoon, function function of the a) total of DSP equivalents: a) and b) mussels; of the totalshown contentasofaDSP equivalents: andcontent b) mussels; c) and d) cockles. Data covers the yearsc) d) data cockles. thefound yearsabove 2002-2005. data wherewas totalpresented DSP was 2002-2005.and Only whereData total covers DSP was the limitOnly of quantification (LCMS data). found above the limit of quantification was presented (LC-MS data).

Figure 3. Distribution between free and esterified forms of a) OA and b) DTX2 observed in summer through 2003 in edible tissues of bluefree mussels fromesterified Aveiro (LC-MS data).of a) OA and Figureautumn 3. Distribution between and forms

b) DTX2 observed in summer through autumn 2003 in edible tissues of blue mussels from Aveiro (LC-MS data).

a)

b) 5

5 OA-ester

0.10 OA-ester

0.08

Figure 3. Distribution between free and esterified forms of a) OA and b) DTX2 observed in summer through autumn 2003 in edible tissues of blue mussels from Aveiro (LC-MS data). Marine Biotoxins and Blue Mussel

417

a)

b) 5

DTXs (µg/g)

4

OA-ester + DTX2-ester (µg/g)

OA-ester DTX2-ester OA DTX2

3 2 1

0.10 OA-ester DTX2-ester OA DTX2

4

0.08 0.06 0.04

3

0.02 0.00

2

-0.02 -0.04

1

OA + DTX2 (µg/g)

5

-0.06 -0.08

0

0 0

1

2

3 4 DAYS

5

6

7

-0.10 0

1

2

3 4 DAYS

5

6

7

Figure Figure 4. Decontamination curves of okadaites in digestive glands of in a) mussel, b) cockle (LC-MS 4. Decontamination curves of okadaites digestive glands of a) data). Regression lines for okadaites in mussel are shown only for esterified OA and in cockle for all mussel, b) cockle (LC-MS data). Regression lines for okadaites in mussel toxin forms.

are shown only for esterified OA and in cockle for all toxin forms.

4-Nov

7-Out

21-Out

9-Set

23-Set

26-Ago

12-Ago

29-Jul

1-Jul

15-Jul

3-Jun

17-Jun

DTX2 %

Toxin remaining ( %)

In vivo depuration experiments were carried out in tanks to confirm these results observed in nature (Vale, 2004). In mussels detoxification was faster from OA and DTX2 esters (85% and 83%, respectively), while free OA and DTX2 were eliminated more slowly a) b) Mytilus represented over one week (58 and plankton 44%, respectively) (Figure 4a). In cockle esterified toxins 80% Cerastoderma 100 mussel the majority of the toxins and were fully eliminated (>99%) after one week, following an Scrobicularia 70% exponential decay curvecockle (Figure 4b). 80 60% As DTX2 is less converted to esters, and in turn the free form is eliminated slowly than 50% esters, there is a gradual increase in the percentage of 60 total DTX2 found in routine mussel 40% is clearly illustrated in Figure 5a, where the percentage of DTX2 was low in samples. This 30% due to contamination being derived solely early summer, 40 from eating D. acuminata cells, which do 20% not produce DTX2. The percentage of DTX2 increases during the D. acuta season. The ratio 10% between OA and DTX2 in plankton is around2060:40 %, and in cockle DTX2 also fluctuates around 40% during the end of summer and autumn. However, in mussels DTX2 0% 0 in mid autumn. Sudden drops in percentage surpasses steadily the 40% ratio and reaches 80% 0 2 4 6 8 10 12 14 16 18 this ratio, were coincident with blooms of D. acuta, representing ingestion of fresh toxins in a Days in tank ratio 60:40 % (Vale, 2004, 2006a). AsFigure esters determination was indirect, to chemical (over alkaline hydrolysis of theDTX2 fatty 5. a) Comparison of totalresorting DTX2 percentage total OA+ total acid moiety, at this stage of the research it was hypothesized the esters were attributed sum) between plankton, mussel and cockle from Aveiro lagoon, 2003 (LC-MS exclusively the transformation of OA and were DTX2presented into 7-O-acyl derivatives in mussels data). toDetails of free and ester forms in Figure 3. Arrows point (Quilliam et al., 2003). Another research carried out in summer 2005 confirmed the D. acuta maximals in plankton. b) Detoxification experiments with 7-O-acyl bivalves derivatives explained the majority the toxins esters (pre-column found in a variety of species, comprising naturally contaminated withofPSP HPLC-FLD data). mussels, cockles, clams and razor clams (Vale, 2006b). A strange finding was found related to the presence of odd fatty acids (FA): C15:0, C17:0, C17:1, and a probably branched FA isomer of C16:0 (br-C16:0). The esters with this br-C16:0 where found in high percentages particularly in two species of estuarine clams (Ruditapes decussatus, Venerupis senegalensis), where they represented 13-34% of total esters found. This percentage was smaller in cockles (6-9%) and in mussels (below 2.5%). In razor clams the percentage of br-C16:0 was low, but in contrast these presented a high percentage of odd fatty acids.

418

Paulo Vale

Figure 5. a) Comparison of total DTX2 percentage (over total OA+ total DTX2 sum) between plankton, mussel and cockle from Aveiro lagoon, 2003 (LC-MS data). Details of free and ester forms were presented in Figure 3. Arrows point D. acuta maximals in plankton. b) Detoxification experiments with bivalves naturally contaminated with PSP toxins (pre-column HPLC-FLD data).

These odd and branched FA are not produced by eukariontes but are commonly seen as bacterial markers (Harvey and Macko, 1997; Ivanova et al., 2000). Another study carried out in 2009 in a smaller lagoon – Albufeira lagoon – showed again a high percentage of br-C16:0 in cockle but not in mussel (Vale, 2010b). Due to the difficulty in identifying its structure, its tentative identification was done by comparing relative retention times of free FA with FA esterified into OA. It was putatively identified as a multimethyl-branched isomer abundant in marine matrices: the isoprenoid 4,8,12-trimethyltridecanoic acid (TMTD). However, such a high percentage of TMTD is not found amongst the FA composing the digestive glands of cockles. But in contrast, TMTD is relatively more abundant in mussel‘s digestive glands, but not so abundant amongst its OA esters (Vale, 2010b). As TMTD is a product of phytol degradation (the isoprenoid moiety of chlorophyll) by certain bacteria, this led to a hypothesis pointing that part of the OA ester pool actually may be located in the gut flora of bivalves and not intracellularly in the digestive gland. This might explain its quick turnover, as bacteria multiply and are gradually eliminated in faeces. On the other hand, free toxins might be tied to bonding proteins in the digestive gland, making its elimination slower. In a research by Rossignoli and Blanco (2010) the subcellular distribution of OA in mussels was found to be in the in the cytosol, by means of centrifugation and ultrafiltration. Notwithstanding only a small proportion of the total toxin was found to be in free form, being most of it bound to a soluble cellular compound with a molecular mass which ranged from 30 to 300 kDa. A series of fractionations of samples digested with a protease, a lipase, and amylase suggested that the component to which okadaic acid is bound is a high density lipoprotein. Unfortunately, these authors did not look into the distribution of OA esters. Another study by Guéguen et al. (2009) found OA esters precipitated quickly while free OA remained in the supernantant. These authors attributed the localization of OA esters to the lysosome fraction and free OA to the cytosol. This hypothesis is not in contradiction with the hypothesis by Vale (2010b), as both bacteria and lysosomes are large in size and will precipitate faster than other soluble components of the cells.

Marine Biotoxins and Blue Mussel

419

Recent research by Vale also showed that either in mussels or cockles after a simple centrifugation free OA and free DTX1 are mostly located in the supernatant (about 80%). On the other side, 7-O-acyl esters of OA and DTX1 will rapidly precipitate and about 80% in mussel and 90% in cockle are found in the supernatant.

PARALYTIC SHELLFISH POISONING TOXINS In the marine environment paralytic shellfish poisoning toxins (PSP) are produced by dinoflagellates belonging to some members of Alexandrium genus, Pyrodinium bahamense and Gymnodinium catenatum (Hallegraeff, 1993). High concentrations of these toxins in bivalve molluscs, or in other vectors such as crabs, might induce neurological disturbances in the human consumer, known as the PSP syndrome (Shumway, 1995). The severity of this seafood poisoning might be fatal in some instances due to the progressive respiratory paralysis. At the western Iberian coast Gymnodinium catenatum is the major PSP producer, followed by sporadic contamination episodes caused by Alexandrium minutum. G. catenatum produces a wide range of toxins, mostly belonging to the N-sulfocarbamoyl group, followed by the decarbamoyl group (Ordás et al., 2004). Another group that is exclusively produced by G. catenatum are the benzoate analogues (Negri et al., 2003; Vale, 2008b). In shellfish these are present at trace levels, and mostly are converted to the decarbamoyl group (Vale, 2008a). In addition to Acanthocardia tuberculata, an open sea species, at the Iberian coast the estuarine clam Scrobicularia plana presents long retention of PSP toxins. This bivalve has been studied in detail and compared with mussels and cockles (Artigas et al., 2006). In vivo depuration experiments were carried out in tanks confirming elimination of PSP toxins was very slow in tank when compared to mussels and cockles (Figure 5b). It had been previously hypothesized this clam could feed on G. catenatum cysts that deposit in the sediment (Vale and Sampayo, 2001), but this experiment pointed in the opposite direction: a strong retention mechanism. After a week in tank, mussels retained 27% of the original toxin, while cockles retained only 16% (Artigas et al., 2006). In vivo experiments confirmed the observations in the natural medium that differences among species are due to different elimination rates (Figure 1b). Pronounced differences of toxin‘s profile during elimination were not observed (Figure 6a and 6b). On the other way, rapid differences are observed mainly during toxification in species that present strong carbamoylase activity, such as Scrobicularia plana (Figure 6c) and Spisula solida (Artigas et al., 2007). These species transform rapidly the N-sulfocarbamoyl toxins into decarbamoyl analogues, which present much higher specific toxicity. Bivalves might present another biotransformation route poorly studied at the moment. Some toxins such as saxitoxin (STX) and N21-sulfocarbamoyl-saxitoxin (B1) might be single and double hydroxylated at C11 position, originating the M-toxins (Dell‘Aversano et al., 2008). However, unlike the classic PSP toxins which upon oxidation render strongly fluorescent products, these metabolites present very low fluorescence, and can only be detected with a mass spectrometer. When studying the contribution of M1 to the toxin profile of some Portuguese bivalve species, a comparison was made with its precursor B1: M1 accounted for 70% of total peak area of B1+M1 in Mytilus galloprovinciallis, 45% in

Paulo Vale

420

Cerastoderma edule and 20% in Ruditapes decussatus (Vale, 2010a). Curiously M1 was more abundant in the species that usually retain longer PSP toxins, in the following order: mussels > cockles > clams (Artigas et al., 2006). Thus the longer toxin‘s retention, the more extensively these are converted into metabolites.

a)

100%

b)

100%

c) 100%

90%

90%

80%

80%

70%

70%

60%

60%

90% 80%

STX B1 GTX2+3 C1/2 dcGTX2+3 dcSTX

30% 20% 10%

40%

STX B1 GTX2+3 C1/2 dcGTX2+3 dcSTX

30% 20% 10%

60%

40% 30% 20% 10% 0%

0

1

3

6

8

0

13

2

3

6

6 9

0%

0%

STX B1 GTX2+3 C1+2 dcGTX2+3 dcSTX

50%

7

Days

Days

96 144

40%

50%

12 24 36 48

50%

Molar percent

Molar percent

Molar percent

70%

Hours

Figure 6. Evolution profiles of N1-H during containing during artificial Figure 6. Evolution of profilesofof N artificialtoxins detoxification of naturally 1-H containing toxins contaminated: a) mussel; b) cockle contaminated: (see also Fig. 5b); a) andmussel; c) during b) artificial toxification of Fig. 5b); detoxification of naturally cockle (see also Scrobicularia planaartificial with a G. catenatum culture. data obtained by HPLC-FLD and c) during toxification of All Scrobicularia plana with aafter G.peroxide catenatum oxidation of digestive glands, showing only N1-H containing toxins.

digestive gland mass (g)

YTXs (µg/g)

Cells / Liter

with variation in their sensitivity to the toxins, as determined by the in vitro response of isolated, unsheated nerves to STX and tetrodotoxin (reviewed in Bricelj and Shumway, 1998). According to these studies, the most insensitive are Mytilus edulis, Mytilus californianus and the scallop Placopecten magellanicus. Oysters are the most sensitive, and a) b) clams intermediate (these studies did not provide any information on cockles, chosen here to compare with the blue mussel). Thus, the less sensitive will accumulate more. But this does 0.70 in some species. 0.40 1.6explain mussel 1400 not the tailing observed during the decontamination phase YTX equiv. cockle Other mechanisms clearly apply to bivalves that present long retention. It is long known 1.4 DG 0.60 Protoceratium spp. 1200 the North American butter clam Saxidomus giganteus accumulates PSP toxins particularly in Gonyaulax spinifera 0.30 1.2 siphons for months (Bricelj and Shumway, 1998). In 0.50 the Mediterranean waters, the giant 1000 cockle Acanthocardia tuberculatum retains toxins in the foot. A group tried to partially purify 1.0 0.40 800 a poison-binding protein from A. tuberculatum, and found it possessed a molecular weigh of 0.20 0.8 181 kDa (Takati et al., 2007). Unfortunately, 600 for the moment,0.30 protein binding of PSP toxins is a 0.6 field still little explored, but might provide a key to explain the differential retention of 0.20 400 toxins 0.10 0.4 between Mytilidae and other groups.

24/Oct

10/Oct

0.00

26/Sep

0 12/Sep

0.0 29/Aug

0.10

16/Aug

200

1/Aug

0.2 18/Jul

YTX equiv. (mg/Kg)

culture. All data obtained by HPLC-FLD after peroxide oxidation of digestive glands, showing only N1-H containing toxins. Differences in accumulation of PSP toxins among bivalve species have been correlated

0.00 0

2

4 6 Days

8

10

Figure 7. a) Temporal variability of YTXs in mussel and cockle and the occurrence of several toxic microalgae in Aveiro Lagoon during summer/autumn 2005; b) detoxification of mussels naturally contaminated from Lisbon Bay from yessotoxins (DG = digestive glands; YTX equiv. = yessotoxin equivalents as determined by ELISA assay)

Marine Biotoxins and Blue Mussel

421

OTHER OBSERVATIONS IN MUSSELS Although PSP and DSP family of toxins are the most serious problems faced by the shellfish industries both in Portugal and Spain, there are other regulated marine compounds occurring in bivalves. To date amnesic shellfish poisoning (ASP) toxins were never linked to severe human poisonings in Europe. These toxins tend to accumulate and disappear quickly from shellfish and no relevant data to compare species in detail as above is available. Diatom blooms causing this contamination are short lived and closure periods rarely surpass one week (Vale et al. 2008). Unlike dinoflagellates that present strong motility, diatoms tend to sink much quicker. In Portugal suspended mussel cultures are scarce, and samples analysed in the monitoring programme are intertidal mussels, that are only exposed to the topmost surface of the water column, while cockles are exposed to lower sections of the water column during high tide. This has been the explanation attributed so far as to why mussels present usually lower levels of this toxin than cockles for example (Vale and Sampayo, 2001). Although yessotoxins (YTXs) are still regulated in European legislation, there has been much controversy over its importance to human health because of its low oral activity (Tubaro et al., 2004). The characterization of a natural compound as a marine biotoxin, has been mostly based in the outcome of the toxicity observed after intraperitonial injection in mice, which is an artificial feeding route. Nevertheless, these compounds present an interesting example of the differential behaviour observed in mussels and other bivalves. At Aveiro lagoon mussels presented higher levels of YTXs than cockles (Gomes et al., 2008b). In either species, the decrease of toxins was not as quick as usually observed with other toxins following the decay of the microalgae bloom (Figure 7a). Prolonged retention in mussels was later observed in Cascais bay mussels (Gomes et al., 2008a). In vivo experiments showed over a period of 10 days no decrease in toxin concentration. An increase was even observed, but this was attributable to loss of tissue mass (Figure 7b). Another curious observation was found during the assessment of a prototype for a commercial rapid diagnostic kit based in lateral flow immunochromatographie (LFIC) (Laycock et al., 2006). The kit presented a severe drawback, which was a high percentage of false positives as determined by another technique: liquid chromatography coupled to mass spectrometry (LC-MS) (Vale et al., 2009). From these, 37% in the range below 50 µg OA equiv./kg, i.e., the cut-off programmed in the method, and 79% in the range of 50-160 ug/kg, i.e., the current regulatory limit. The detection of too many false positives is cumbersome; particularly when low levels of toxins occur. This will require food business operators relying in this test to unnecessarily further test by a confirmatory method in a centralised laboratory a high percentage of the samples. Extracts from clams (Tapes decussatus, Venerupis senegalensis) and oyster (Crassostrea spp.) gave few false positives (Table 1). Cockle (Cerastoderma edule) and the clam Scrobicularia plana gave low percentages of false positives in the south and SW coasts, but these were higher at the NW coast. Mussel (Mytilus spp.) had the highest percentage of false positives, which also seemed dependent on geographic location. The highest percentage of false positives was observed at the northwest coast, where usually the highest DSP levels are recorded year after year (Vale et al., 2008). Comparison between mussels and cockles from Aveiro lagoon, showed false positives might appear from autumn through spring, a period of usually low toxic microalgae countings (Vale et al., 2009).

and c) during artificial toxification of Scrobicularia plana with a G. catenatum culture. All data obtained by HPLC-FLD after peroxide oxidation of digestive glands, showing only N1-H containing toxins. Paulo Vale

a) mussel cockle Protoceratium spp. Gonyaulax spinifera

1.2

0.70

1200

0.60

1000

0.50

1.0 800 0.8 600 0.6

Cells / Liter

YTX equiv. (mg/Kg)

1.4

1400

YTXs (µg/g)

1.6

b)

0.20 0.30 0.20

0.2

200

0.10

0.0

0

0.00

24/Oct

10/Oct

26/Sep

12/Sep

29/Aug

16/Aug

1/Aug

18/Jul

0.30

0.40

400

0.4

0.40

YTX equiv. DG

0.10

digestive gland mass (g)

422

0.00 0

2

4 6 Days

8

10

Figure 7. a) variability of YTXs mussel cockleand andcockle the occurrence several toxicof Figure 7. Temporal a) Temporal variability of in YTXs inand mussel and theofoccurrence microalgae Aveiro Lagoon during 2005;during b) detoxification of mussels naturally several in toxic microalgae in summer/autumn Aveiro Lagoon summer/autumn 2005; b) contaminated from Lisbon Bay from yessotoxins (DG = digestive glands; YTX equiv. = yessotoxin detoxification of mussels naturally contaminated from Lisbon Bay from yessotoxins equivalents as determined by ELISA assay).

(DG = digestive glands; YTX equiv. = yessotoxin equivalents as determined by ELISA assay)

Table 1. Distribution by geographic area and species of false positives recorded in a prototype of LFIC assays for okadaites by comparison with data obtained simultaneously by LC-MS. NW = northwest, SW = southwest Portuguese Coastline

Bivalve species

False Positives (%)

Mytilus

Nº of samples tested 81

NW

Cerastoderma+Scrobicularia

85

37.6

Mytilus

20

35.0

SW+south

Cerastoderma+Scrobicularia

50

14.0

NW+SW+south

Ruditapes+Venerupis+Crassostrea 41

NW SW+south

72.8

5.0

Can these false responses still represent degradation products of the okadaites, that the test kit can detect, but not the LC-MS, which scans only the intact molecule? Or can these represent an unspecific binding of the antibody to a wide range of other natural or anthropogenic compounds? When antibody assays are developed, the cross reactivity is tested among other marine biotoxins of the same family, in this case DTX1 and DTX2 (Laycock et al., 2006), but nothing is known towards the wide array of other structures naturally present or of anthropogenic origin. Curiously, about the double of false positives were found in mussel when compared with cockles. Similar ratios were found when comparing the average annual DSP levels in mussels and cockles in selected production areas in several consecutive years (summarised in Table 3 by Vale et al., 2008).

Marine Biotoxins and Blue Mussel

423

CONCLUSION Blue mussels are widely used in aquaculture, having the ability to colonise substrates in a dense packed vertical habitat, unlike other bottom dweller bivalves. However, for aquaculturists the blue mussel physiology poses more problems than other benthic bivalves when comes to the speed of accumulation and elimination of marine biotoxins. There is still much to understand regarding the biotransformation of marine biotoxins in bivalves. The recent hypothesis that gut bacteria might play a major role in biotransformation in some benthic bivalves but less in mussels is still a puzzle. All are herbivorous and relay strongly in phytoplankton. All degrade chlorophyll and TMTD, one of its intermediate degradation products, is very abundant in mussels. Why bacteria do not play such an important role in mussel? Among other physiological differences, mussels possess byssal formation for attachment in contrast to benthic bivalves living free in the sediment. Byssal formation can be inhibited by bacteria (Ayala et al., 2006; Dobrestov et al., 2006). Bacteria can also degrade byssal protein (Venkateswaran and Dohmoto, 2000). In this biochemical warfare of biofouling organisms, could the specific bacteria involved in OA esterification be largely inhibited in mussels, and in this case little TMTD was incorporated in OA esters? A comparison between Mytilus edulis, Cerastoderma edule and Ensis siliqua showed that immune cells and functions differed extensively in these three closely related species, with M. edulis showing a much higher level of immunological vigour that may be linked to its considerable resilience to adverse environmental conditions (Wootton et al., 2003). If OA is not rapidly transformed into esters, its binding to lipoproteins might diminish its interference with the mussel metabolism. OA is a potent inhibitor of protein phosphatases in eukariotic cells. The stereochemistry modification imposed by esterification also renders OA inactive against protein phosphatases (Takai et al., 1992). In turn this binding maintains a residual level of toxins above the regulatory limit, prohibiting the harvesting and selling of mussels. Mussels have been extensively used in the past as a biological indicator of pollution in monitoring programs. The reason for this choice is that the mussel is a sessile, filter-feeding organism, able to accumulate within its tissues many of the contaminants (pesticides, hydrocarbons, metals, etc.) present in seawater (Viarengo and Canesi, 1991). However, depending on the compound of study, mussels might present a binding capacity quite different from other commercial bivalves, and might supply overestimated accumulation data in relation to the accumulation by other aquatic species.

ACKNOWLEDGMENTS The programmes FCT/PRAXIS 2/2.1/MAR/1718/95 from FCT, ―Sanidade e Salubridade de Moluscos Bivalves‖ - ―POPESCA 1995/1999‖ (QCAII/med.3), ―Segurança, Vigilância e Qualidade de Moluscos Bivalves‖ - MARE 2000/2006 (QCAIII/med.4) and ―BENPER‖ MARE 2006/2008 (QCAIII/med.4) supported this research.

424

Paulo Vale

REFERENCES Artigas, M.L., Amorim, A., Vale, P., Gomes, S.S., Botelho, M.J., Rodrigues, S.M., 2006. Prolonged toxicity of Scrobicularia plana after PSP events and its relation to Gymnodinium catenatum cyst consumption and toxin depuration. In: Moestrup, Ø. et al. (Eds.), Proceedings of 12th International Conference on Harmful Algae, ISSHA and IOC of UNESCO, Copenhagen, Netherlands, pp. 273-275. Artigas, M.L., Vale, P., Gomes, S.S., Botelho, M.J., Rodrigues, S.M., Amorim, A., 2007. Profiles of PSP toxins in shellfish from Portugal explained by carbamoylase activity. Journal of Chromatography A., 1160 (1-2), 99-105. Ayala, C., Clarke, M., Riquelme, C., 2006. Inhibition of byssal formation in Semimytilus algosus (Gould, 1850) by a film-forming bacterium isolated from biofouled substrata in northern Chile. Biofouling, 22(1), 61- 68. Berenguer, J.A., Gonzalez, L., Jimenez, I., Legarda, T.M., Olmedo, J.B., Burdaspal, P.A., 1993. The effect of commercial processing on the paralytic shellfish poison (PSP) content of naturally-contaminated Acanthocardia tuberculatum L. Food Addit. Contam., 10 (2), 217 230. Bricelj, V.M., Shumway, E., 1998. Paralytic shellfish toxins in bivalve molluscs: occurrence, transfer kinetics, and biotransformation. Rev. Fish. Sci., 6, 315-383. Dell‘Aversano, C., Walter, J.A., Burton, I.W., Stirling, D.J., Fattorusso, E., Quilliam, M.A., 2008. Isolation and structure elucidation of new and unusual saxitoxin analogues from mussels. J. Nat. Prod., 71 (9), 1518-1523. Dobretsov, S., Dahms, H.-U., Qian, P.-Y., 2006. Inhibition of biofouling by marine microorganisms and their metabolites. Biofouling, 22 (1), 43-54. Escalera, L., Reguera, B., Moita, T., Pazos, Y., Cerejo, M., Cabanas, J.M., Ruiz-Villarreal, M., 2010. Bloom dynamics of Dinophysis acuta in an upwelling system: In situ growth versus transport. Harmful Algae, 9 (3), 312-322. EU-CRL, 2001. Report of the working group on sampling plans. Brussels, 3-4/Oct/2001. European Commission, 1996. Commission Decision 96/77/EC establishing the conditions for the harvesting and processing of certain bivalve molluscs coming from areas where the paralytic shellfish poison level exceeds the limit laid down by Council Directive 91/492/EEC. Official Journal, L 015, 46-47. European Commission, 2002. Commission Decision 2002/226/EC establishing special health checks for the harvesting and processing of certain bivalve molluscs with a level of amnesic shellfish poison (ASP) exceeding the limit laid down by Council Directive 91/492/EEC. Official Journal, L 075, 65-66. FAO, 2004. Marine Biotoxins, FAO Food and Nutrition Paper, 80. Food and Agriculture Organization of the United Nations, Rome. 278 pp. Franco, M., 2005. Social and economic effects of biotoxins: the case of mussels farming in Galicia region. In: AOAC First Joint Toxin Symposium and Task Force Meeting, Baiona, Spain, 11-14 April 2005. Abstract book, pp. 63. Gomes, S.S., Palma, A.S., Botelho, M.J., Moita, T., Vale, P., 2008a. Monitorização de iessotoxinas em mexilhão na baía de Lisboa. In: Avances y tendencias en Fitoplancton Tóxico y Biotoxinas, Gilabert, J. (Ed.), Univ. Politécnica de Cartagena, Espanha, pp. 223-229.

Marine Biotoxins and Blue Mussel

425

Gomes, S.S., Vale, P., Botelho, M.J., Rodrigues, S.M., Cerejo, M., Vilarinho, M.G., 2008b. ELISA Screening for yessotoxins in Portuguese shellfish. In: Moestrup, Ø. et al. (Eds.), Proceedings of 12th International Conference on Harmful Algae, ISSHA and IOC of UNESCO, Copenhagen, Netherlands, pp. 290-292. Guéguen, M., Duinker, A., Marcaillou, C., Aasen, J., Barillé, L., 2009. First approach to localizing lipophilic biotoxins in the mussel digestive glands. In: 7th International Conference on Molluscan Shellfish Safety, Nantes, France, 15-19/June/2009. Abstract book pp 64. Hallegraeff, G.M. 1993. A review of harmful algal blooms and their apparent global increase. Phycologia, 32, 79-99. Harvey, H.R. Macko, S.A., 1997. Catalysts or contributors? Tracking bacterial mediation of early diagenesis in the marine water column. Org. Geochem., 26, 531-544. Hu, T., Marr, J., deFreitas, A.S.W., Quilliam, M.A., Walter, J.A., Wright, J.L.C., Pleasance, S., 1992. New diol esters isolated from cultures of the dinoflagellates Prorocentrum lima and Prorocentrum concavum. J. Nat. Products, 55 (11), 1631-1637. Ivanova, E.P., Zhukova, N.V., Svetashev, V.I., Gorshkova, N.M., Kurilenko, V.V., Frolova, G.M., Mikhailov, V.V., 2000. Evaluation of phospholipid and fatty acid compositions as chemotaxonomic markers of alteromonas-like proteobacteria. Current Microbiology, 41, 341-345. James, K.J., Bishop, A.G., Gillman, M., Gillman, M., Kelly, S.S., Roden, C., Draisci, R., Lucentini, L., Giannetti, L., Boria, P., 1997. Liquid chromatography with fluorimetric, masss spectrometric and tandem mass spectrometric detection for the investigation of the seafood-toxin producing phytoplankton, Dinophysis acuta. J. Chromatogr. A, 777, 213221. Lassus, P., Gowland, D., McKenzie, D., Kelly, M. Braaten, B., Marcaillou-Martin, C., Blanco, J., 2007. Industrial scale detoxification of phycotoxin-contaminated shellfish: myth or reality? In: Busby, P. (Ed.). Proceedings of the 6th International Conference on Molluscan Shellfish Safety, Miscellaneous Series 71, The Royal Society of New Zealand, Wellington, NZ, pp. 289-297. Laycock MV, Jellett JF, Easy DJ, Donovan MA. 2006. First report of a new rapid assay for diarrhetic shellfish poisoning toxins. Harmful Algae 5: 74-78. Lee, J.S., Igarashi, T., Fraga, S., Dahl, E., Hovgaard, P., Yasumoto, T., 1989. Determination of diarrhetic shellfish toxins in various dinoflagellate species. J. Appl. Phycol., 1: 147152. Negri, A., Stirling, D., Quilliam, M., Blackburn, S., Bolch, C., Burton, I., Eaglesham, G., Thomas, K., Walter, J., Willis, R., 2003. Three novel hydroxybenzoate saxitoxin analogues isolated from the dinoflagellate Gymnodinium catenatum. Chem. Res. Toxicol., 16(8), 1029-1033. Ordás, M.C., Fraga, S., Franco, J.M., Ordás, A., Figueras, A. 2004. Toxin and molecular analysis of Gymnodinium catenatum (Dinophyceae) strains from Galicia (NW Spain) and Andalucia (S Spain). J. Plankt. Res., 26, 341-349. Quilliam, M.A., Vale, P., Sampayo, M.A.M., 2003. Direct detection of acyl esters of OA and DTX2 in Portuguese shellfish by LC-MS. In: Molluscan Shellfish Safety, Villalba, A., Reguera, B., Romalde, J.R., Beiras, R. (Eds.), Consellería de Pesca e Asuntos Marítimos da Xunta de Galicia and IOC of UNESCO, Santiago de Compostela, Spain, pp. 67-73.

426

Paulo Vale

Rossignoli, A.E., Blanco, J., 2010. Subcellular distribution of okadaic acid in the digestive gland of Mytilus galloprovincialis: First evidences of lipoprotein binding to okadaic acid. Toxicon, 55 (2-3), 221-226. Salgado, C., Maneiro, J., Correa, J., Pérez, J.L., Arévalo, F., 2003. ASP biotoxins in scallops: the pratical application in Galicia of Commission Decision 2002/226/CE. In: Molluscan Shellfish Safety, Villalba, A., Reguera, B., Romalde, J.R., Beiras, R. (Eds.), Consellería de Pesca e Asuntos Marítimos da Xunta de Galicia and IOC of UNESCO, pp. 169-177. Shumway, S.E., 1995. Phycotoxin-related shellfish poisoning: bivalve molluscs are not the only vectors. Rev. Fish. Sci., 3, 1-31. Shumway, SE, van Egmond, H, Hurt, JW, Bean, LL. 1995. Management of shellfish resources. In: Hallegraeff, GM, Anderson, M, Cembella, AD (eds.) Manual on harmful marine microalgae. IOC Manuals and Guides, UNESCO, 33, 436-463. Takai, A., Murata, M., Torigoe, K., Isobe, M., Mieskes, G., Yasumoto, T., 1992. Inhibitory effect of okadaic acid derivatives on protein phosphatases. Biochem. J., 284, 539-544. Takati, N. Mountassif, D. Taleb, H. Lee K., Blaghen M., 2007. Purification and partial characterization of paralytic shellfish poison-binding protein from Acanthocardia tuberculatum. Toxicon, 50 (3), 311-321. Tubaro, A., Sosa, S., Altinier, G., Soranzo, M.R., Satake, M., Della Loggia, R., Yasumoto T., 2004. Short-term oral toxicity of homoyessotoxins, yessotoxin and okadaic acid in mice. Toxicon, 43 (4), 439-445. Vale, P., 2004. Differential dynamics of dinophysistoxins and pectenotoxins between blue mussel and common cockle: a phenomenon originating from the complex toxin profile of Dinophysis acuta. Toxicon, 44 (2), 123-134. Vale, P., 2006a. Differential dynamics of dinophysistoxins and pectenotoxins, part II: offshore bivalve species. Toxicon, 47 (2), 163-173. Vale, P., 2006b. Detailed profiles of 7-O-acyl esters in plankton and shellfish from the Portuguese coast. Journal of Chromatography A, 1128, 181-188. Vale, P., 2008a. Fate of benzoate paralytic shellfish poisoning toxins from Gymnodinium catenatum in shellfish and fish detected by pre-column oxidation and liquid chromatography with fluorescence detection. Journal of Chromatography A, 1190 (1-2), 191-197. Vale, P., 2008b. Complex profile of hydrophobic paralytic shellfish poisoning compounds in Gymnodinium catenatum detected by liquid chromatography with fluorescence and mass spectrometry detection. Journal of Chromatography A, 1195, 85-93. Vale, P., 2010a. Metabolites of saxitoxin analogues in bivalves contaminated by Gymnodinium catenatum. Toxicon, 55 (1), 162-165. Vale, P., 2010b. Profiles of fatty acids and 7-O-acyl okadaic acid esters in bivalves: Can bacteria be involved in acyl esterification of okadaic acid? Comparative Biochemistry and Physiology, Part C, 151, 18–24. Vale, P., Botelho, M.J., Rodrigues, S.M., Gomes, S.S., Sampayo, M.A.M., 2008. Two decades of marine biotoxin monitoring in bivalves from Portugal (1986-2006): a review of exposure assessment. Harmful Algae, 7 (1), 11-25. Vale, P., Gomes, S.S., Lameiras, J., Rodrigues, S.M., Botelho, M.J., Laycock, M.V., 2009. Assessment of a new LFIC assay for the okadaic acid group of toxins using naturally contaminated bivalve shellfish from the Portuguese coast. Food Additives and Contaminants, 26 (2), 229-235.

Marine Biotoxins and Blue Mussel

427

Vale, P., Sampayo, M.A.M., 2000. Dinophysistoxin-2: a rare diarrhetic toxin associated with Dinophysis acuta. Toxicon, 38 (11), 1599-1606. Vale, P., Sampayo, M.A.M., 2001. Domoic acid in Portuguese shellfish and fish. Toxicon, 39 (6), 893-904. Vale, P., Sampayo, M.A.M., 2002. Esterification of DSP toxins by Portuguese bivalves from the Northwest coast determined by LC-MS  a widespread phenomenon. Toxicon, 40 (1), 33-42. Viarengo, A., Canesi, L., 1991. Mussels as biological indicators of pollution. Aquaculture, 94 (2-3), 225-243. Venkateswaran, K., Dohmoto, N., 2000. Pseudoalteromonas peptidolytica sp. nov., a novel marine mussel-thread-degrading bacterium isolated from the Sea of Japan. International Journal of Systematic and Evolutionary Microbiology, 50, 565–574. Wootton, E.C., Dyrynda, E.A., Ratcliffe, N.A., 2003. Bivalve immunity: comparisons between the marine mussel (Mytilus edulis), the edible cockle (Cerastoderma edule) and the razor-shell (Ensis siliqua). Fish and Shellfish Immunology, 15, 195-210.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN: 978-1-61761-763-8 Editors: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 19

IMMUNOTOXICITY OF ENVIRONMENTAL CHEMICALS IN THE PEARL FORMING MUSSEL OF INDIA- A REVIEW Sajal Ray*1, Mitali Ray1, Sudipta Chakraborty2 and Suman Mukherjee3 1

Aquatic Toxicology Laboratory, Department of Zoology, University of Calcutta, West Bengal, India 2 Parasitology and Immunology Laboratory, Department of Zoology, Maulana Azad College, West Bengal, India 3 Immunobiology Laboratory, Department of Zoology, A.B.N. Seal College, West Bengal India.

INTRODUCTION Mollusca comprises of a wide ranging invertebrate Phylum with nearly 100,000 number of living species. Mussels are aquatic bivalves distributed in diverse types of waterbodies of India. Internal visceral organs of mussels are located between the muscular foot and calcareous hard shell. Pair of valves enclose the soft body parts and are attached with adductor muscle. The space between the membranous mantle and soft visceral mass constitutes mantle cavity harbouring the gill. Gill is the chief respiratory organ of mussel which actively participates in the process of filter feeding. During filtration of the water column, the freshwater mussels are capable of filtering a large volume of water. While filtering the water for the purpose of food procurement, mussels create characteristic regional current in its aquatic environment. This movement of water mass in the form of current interferes with the important process of distribution of dissolved particulates and gases. Many of these particulates are of nutritional, metabolic and toxicological importance and the dissolved gases include oxygen, carbon dioxide etc. Filter feeding activity of mussel thus * Corresponding author: [email protected], Aquatic Toxicology Laboratory, Department of Zoology, University of Calcutta, 35, Ballygunge Circular Road, Kolkata-700019, West Bengal, India.

430

Sajal Ray, Mitali Ray, Sudipta , et al.

influences various physiological activities of the other inhabitants of water by influencing their nutritional, immunological and toxicological status. Coexistence and perpetuation of aquatic flora and fauna of the freshwater environment is a result of successful evolutionary process where the mussels play a key role. Successful perpetuation and reproductive activity of mussel depend on biosafe propagation of the species in its toxin-free habitat. Physiological defence of mussel mostly depends on its highly evolved immunological system. Molluscan immunity is chiefly dependent on the activity of the circulating haemocytes or blood cells. In Lamellidens marginalis, the information on blood cell is limited with reference to the toxicity of common environmental contaminants. Gradual shrinkage and contamination of habitat by environmental contaminants appear to be a serious threat to the freshwater mussel. Various agrotoxins and metalloid toxin like arsenic are reported as major toxins which affect the immunological status of L. marginalis.

ECONOMIC IMPORTANCE OF INDIAN FRESHWATER MUSSEL Apart from its ecological significance, L. marginalis is a traditional item of diet for human and poultry. Both rural and selected population of urban India prefers L. marginalis as an item of daily food. However, the species is more popular among the under-privileged rural population including the tribes as food. The species is often being sold in open market for human consumption. L. marginalis is eaten in both cooked and semi-cooked form. The species is available in both shelled and deshelled form in selected daily market. The flesh of L. marginalis is used as an important component of artificial poultry feed. Following a definite ratio, the dried and processed meat of mussel is mixed with other edible components to prepare a balanced diet for poultry. Moreover, ornamental pearls can be grown in L. marginalis. Pearl is a traditional component of ornament and is highly expensive for its jewellery value. Most of the commercial pearls are usually grown in the marine oyster belonging to the genus Pinctada. In India, L. marginalis is one of the few species of freshwater origin where pearl is generated. Formation of pearl involves secretion of nacre layer which is known as ‗mother of pearl‘. The nacre is secreted around a foreign particle giving birth to a developing pearl of different size, lusture and colouration. Formation of pearl is an immunological response involving recognition of non-self and encapsulation reaction. By secreting the nacreous content, a mussel successfully encapsulates the invading particulate matter and dissociates the foreign substance from self tissue. Successful formation of pearl involves effective immune response and allied physiological processes and activities. Encapsulation reaction is an established immune function of mussel by which the animal effectively gets rid of physiological adversities elicited by foreign pathogen and parasites. Environmental chemicals impart toxicological effect on the immunological profile of the bivalves affecting possible formation of ornamental pearl. The shell of bivalve and gastropod mollusc is a rich source of calcium. Calcium is a clinically important element needed for the growth of bone and tooth. Moreover, calcium is often used by the pharmacological industry for the preparation of selected medicine. Commercial, biological and nutritional importance of Indian mussel including L. marginalis is well established and hence the species demands special attention for its biological propagation in its natural habitat.

Immunotoxicity of Environmental Chemicals …

431

IMMUNITY OF MUSSEL AND ENVIRONMENTAL TOXINS Mussels rely mostly on innate immunity to combat against foreign pathogen and parasites. The natural habitat of freshwater mussels of India often remains infested with diverse forms of pathogens. Various species of microorganisms, bacteria, parasites and viruses are abundantly present in the waterbodies. The disease producing organisms continuously impart a physiological challenge on the mussels. Such situation leads to elicitation of immune reaction in the host for its successful survival. Haemocytes, the circulating blood cells of the haemolymph play a pivotal role in the freshwater mussel. Mussels rely mostly on the innate immunity to combat the environmental toxins and invading pathogens. Hard calcareous shell or valves provide the first line of defence against pathogens and toxins. Under the exposure of the pathogens, parasites and environmental toxins, the two valves are kept closed tightly to restrict the entry of unacceptable agents. In this context, highly developed adductor muscles play a significant role. Adductor muscle is capable of contraction resulting formation of a water-tight enclosure restricting the entry of pathogens and toxins. Mussels developed a highly evolved sensory system to recognise and identify the presence of toxic elements and specific environmental cues in the event of immunological challenge. Despite evolution of a highly evolved system of immuno-recognition and musculature, opportunistic entry of toxic pathogens is not uncommon. Additionally, the secretory mucous of the internal viscera provides another line of defence against the entry of pathogens and toxins. Calcareous shells and mucous are considered as external physicochemical barriers which provide an effective line of immunological defence of first order. Under poor nutritional and immunological status, their first line of defence is often breached yielding physiological exposure to toxins and pathogens. Toxins and external pathogens often escape the first line of biological defence and interact with the internal environment of the organism (Figure 1). Mussel exhibits open circulatory system with the haemocoel containing haemolymph as blood. Blood of mussel is composed of fluid and cellular component. Plasma, a serum part of the blood, contains numerous components including lectins, minerals, sugars and interleukin like molecules. Physiological and immunological activities of these components is less characterised with limited available information. Haemocytes on the other hand is a relatively better studied component of mussel immune system. Haemocytes are generated in specific haematopoietic organs under discrete cellular communication process. In molluscs, the haematopoietic organs are distributed in the body system as diffused tissues. However, occurrence of diverse population is a characteristic feature of the mussel haemocyte. Various workers have classified haemocytes on the basis of morphology and functional attributes. On having enormous diversity in body planning, habitat preference, ethology and physiological characters, classification schemes of blood cells of mussels appear to be varying. Such a situation created debate and confusion among the workers of this field. However, the immune profile of the mussel appears to be extremely different from that of the mammals. Mussel lacks antibody and complement like molecules in the blood and mostly depends on the innate immunity. Inspite of these limitations, mussels have evolved a specialised system of immunorecognition and discriminative ability of self from nonself. In this respect, the haemocytes, the chief immunoeffector cells of the mussels are reported to perform various functions like phagocytosis, nonself recognition, nutrient carriage, encapsulation, aggregation and adhesion [1].

Sajal Ray, Mitali Ray, Sudipta , et al.

432

Aquatic Immunotoxins

Mussel

External Barrier

Haemolymph

Haemocyte

Nonself recognition

Wound healing

Phagocytosis

Cytotoxicity Immunoadhesion

Aggregation/ encapsulation

Figure 1. Immunotoxicological attribute of mussel haemocyte

Figurean 1: Immunotoxicological of mussel haemocyte Mussels contribute important member of attribute the freshwater ecosystem of India. Freshwater environment includes ponds, lakes, irrigation canals and artificial embankments. These water bodies are either of perennial or non-perennial type with different sizes and shapes. Freshwater ecosystem of India harbours an enormous biodiversity including plants and animals with multiple taxonomic identities. Uniqueness of functional interrelationship is a result of evolutionary success which permits the inhabitants of freshwater habitat to reproduce and perpetuate to ensure a balanced ecosystem. L. marginalis, the common freshwater mussel represent the Phylum Mollusca. Mollusca exhibit an enormous diversity in anatomy, physiology, habitat preference, behaviour and immunological profile. Aquatic molluscs largely rely on innate immunity to combat the pathogen and toxic exposure. In this context, the mussels largely depend on diverse immunocytes distributed in blood and elsewhere for elicitation of immune response. Report of adaptive immunity is very limited in invertebrate series. In Arthropoda, a few insect species had evolved inducible humoral factors which appeared in their blood following a brief experimental exposure of pathogen. These inducible factors like hemolin are soluble proteins with multiple isomers. Mussels are shelled bivalves and their hard shell is composed mainly of calcium carbonate. Calcified shells provide the mussels the first line of immunological barrier against environmental toxins and pathogen. Air and water tightness of internal body cavity is result of evolution of strong pair of lateral muscles known as adductor muscles. These specialised musculature and hard external shell contribute the effectiveness of immunological defence in mussel. Continuous interaction with the adverse chemical environment often leads to degeneration or loss of

Immunotoxicity of Environmental Chemicals …

433

external layer of shell. Calcareous shell has the unique ability of regeneration following the principle of dynamic equilibrium of calcium uptake from external medium. Chronic exposure to immunotoxins like mineral acid and alkali interferes with the replenishment of calcium layer affecting the mussels adversely. Domestic and industrial use of mineral acid and alkali render the mussel vulnerable to tissue damage and immunoalteration. Shell, the effective external physiochemical barrier of mussel is often subjected to risk of irreversible damage caused by potential immunotoxins like sulphuric acid, hydrochloric acid, nitric acid, bleaching agents like bleaching powder and alkali like sodium hydroxide and potassium hydroxide. Once the first line of external barrier is breached off, the environmental toxins and pathogens initiate functional interaction with the cellular components of the immunological system of the mussel. The cellular array of molluscan immunity involves progenitor cells, haemostatic cells or granular cells, phagocytic cells, macrophages, nutritive cells and pigmented cells etc. Scientists classified the immunocytes of molluscs on the basis of morphology and functional attributes. For many of these classification schemes, there arose contradiction and debate and the issue remained alive till date. However, the progenitor cells are probable stem cells which are transformable to other cell types through differentiation and maturation. Phagocytes are immunocompetent cells of mussel which are involved in the process of immunorecognition and engulfment of the nonself particulates. In elicitation of immunological response, the phagocytic cells play an important role under the exposure of environmental chemicals. A discrete population of circulating blood cells or haemocytes acts as phagocytes in mussels. Haemostatic cells are involved in the process of aggregation, agglutination and lysozyme production during immunological stimulation. Nutritive cells are distinct in immunoencapsulation and wound healing process in invertebrates and may be involved in transport of various nutritive elements. Moreover, there are specific cell types of sessile behaviour which may be actively associated with immunofunctions. These nonmobile cells include pore cells distributed in the pericardium. Apart from the cellular participation, the haematopoietic organs are often involved in the process of phagocytosis [2].

IMMONOTOXIC CHEMICALS OF THE AQUATIC ENVIRONMENT Immunology deals with the physiological defence of an organism under the challenge of pathogen, parasite and toxins. Immunity of an animal exhibits two functionally operating systems i.e., cell mediated immunity and humoral immunity. Immunity in general, follow specific attributes namely innate and adaptive responses. Invertebrates like mussel depend mostly on innate immunological response and lack antibody molecules. In spite of the absence antibody molecule, invertebrates evolved an effective mechanism of discriminating the self from nonself, the essential prerequisite of immunorecognition. Successful elicitation of immune response of mussel enabled them to perpetuate in the environment as a ‗positive variant‘. In many of the biological and environmental situations, the aquatic habitat of mussel is contaminated by chemical substances of unknown or less known toxicity. Immunotoxicity involves an initiation of physiological adversity in functioning of immunological system. Immunotoxins are the chemical compounds which bear potentiality to affect immunotoxicity

434

Sajal Ray, Mitali Ray, Sudipta , et al.

in a defined organism under specific ecophysiological condition. Nature and magnitude of immunotoxicity depend on multiple factors i.e. concentration of toxins, exposure type and span, routes of entry and nutritional state of the animal. Toxin induced shift in the immunological status of the animal may lead to aggravation of infective and disease process. Studies on human indicate that various chemicals of industrial and environmental origin are capable of producing deleterious effect on immune system. Immunotoxicity is defined as adverse effects on the functioning of immune system that results from exposure to chemical substances. Altered immune function may lead to increased incidence or severity of infectious diseases. Identification of immunotoxicants is difficult because the chemicals can cause a wide variety of complicated effects on the immune function. Observations on human and rodents have clearly demonstrated that a number of environmental and industrial chemicals adversely affect the immune system. Exposure to asbestos, benzene, polychlorinated biphenyls, polybrominated biphenyls, dioxine can lead to immunosuppression in human. Toxic agents can also cause autoimmune disorders in which healthy tissues are affected by the immune system that fails to differentiate self antigens from foreign antigens. Dieldrine induces autoimmune responses against blood cell resulting in haemolytic anaemia. Allergens are immunotoxicant compounds that stimulate the immune system and cause allergy or hypersensitivity. Many allergens can cause a variety of clinical manifestations such as asthma, rhinitis and anaphylaxis. The industrial chemicals like toluene diisocyanate and metals like nickel, beryllium are allergic agents. Freshwater ecosystem of India is often contaminated with diverse forms of environmental chemicals. The chemicals include pesticides, toxic metals, metalloids, detergents etc. Arsenic, a toxic metalloid has drawn attention to the toxicologists due to its precarious presence in the aquatic ecosystem. Extraction of the contaminated groundwater for the purpose of irrigation often contaminates the natural habitat of pearl forming mussel of India. Reports on immunotoxicity of arsenic residues in mussels are available in literature of recent past. Another group of biopesticide containing toxic azadirachtin has been posing a serious threat to the immune status of the mussels. These pesticides are used to protect plants fro pest attack. But during rainy season, residues of azadirachtin based pesticides contaminate the natural habitat of mussel affecting the normal functioning of their immune system.

MAJOR IMMUNOTOXICOLOGICAL ATTRIBUTE OF MUSSEL Mussels rely on the functional attributes of the haemocytes to combat the environmental toxins. Being the principal immunoeffector cells, haemocytes are capable of eliciting effective immunological response under the exposure of common environmental chemicals. Apart from the haemocytes, the secondary parameters of immunological functionary include shell, mucous, humoral component, gills, digestive tract and gland. Haemocytes are the cellular components of the blood of the mussels performing diverse physiological functions. They actively participate in the process of nutrient carriage, wound healing, phagocytosis, aggregation, encapsulation, cytotoxicity and nonself recognition. Functional homeostasis of the blood of the mussel is under the influence of density and physiological status of the haemocytes. Total and differential density of the haemocytes is under the influence of

Immunotoxicity of Environmental Chemicals …

435

exposure of the mussels to various xenobiotics and pathogens. However, no uniform scheme of classification of haemocytes is available in the mollusc and this situation raised enough contradiction, debate and confusion among the scientists working in this field. Extensive study was done by [3] on the morphological variety of the haemocytes of L. marginalis and effect of sodium arsenite on the haemocyte density of the same species. They reported salient variations as blast like cells, agranulocytes, granulocytes, hyalinocytes and asterocytes (Figure 2 a-e). Blast-like cells were abundant and were identified by their high nuclear to cytoplasmic ratio. Their nuclei remain extended up to the peripheral region of the cell membrane. Agranulocytes exhibited large number of eosinophilic granules. Hyalinocytes were spindle shaped cells with centrally located condensed nuclei. Asterocytes are star shaped spreading cells with sharp filopodial extensions. Multiple of radiating projections of cytoplasm is characteristic to asterocytes.

(a)

(b)

(c)

(d)

(e)

(f)

Figure 2. Light microscopic images of the haemocyte subpopulation of L. marginalis stained with Giemsa‘s stain (a) blast like cell (b) agranulocyte (c) hyalinocytes (d) granulocyte (e) asterocyte or spreading haemocyte (f) a haemocyte with engulfed yeast particles (on arrow heads). (Magnification: 100x; Scale = 10µm)

In this important study, the workers examined the alteration of haemocyte density by sodium arsenite, a major, natural environmental contaminant of the mussel habitat. Mussels were experimentally exposed to sublethal concentrations of 1, 2, 3, 4 and 5 ppm of sodium arsenite for 24, 48, 72, 96 hours in static water environment. Arsenic exposure resulted a steady fall in the total count of the haemocytes along with the blast like cells. Granulocyte density was increased significantly under the exposure of sodium arsenite. Density of the asterocytes was elevated under the high concentrations of sodium arsenite. Arsenic treated mussels were examined for possible recovery of haemocyte density by exposing them in arsenic free water up to a period of 30 days. Result indicated a state of irreversible inhibition

436

Sajal Ray, Mitali Ray, Sudipta , et al.

of cell density by sodium arsenite. A major population of haemocytes is functionally associated with innate immune response of mussel. Thus, the observation was indicative to appearance of immunotoxicity in mussel distributed in the arsenic contaminated habitat in India. Study of total count and differential count of haemocyte of the mussel under the exposure of azadirachtin based pesticide is in report [4, 5]. Azadirachtin is a highly toxic neem based limonoid and a principal component of biopesticide. This pesticide is a recent introduction in the agricultural practice of India. This less studied environmental toxin was tested on the haemocyte density of L. marginalis. Mussels were experimentally exposed to 0.03, 0.06 and 0.09 ppm of azadirachtin for 24, 48, 72, 96 hours in static water environment. Relative exposure of higher concentrations of azadirachtin yielded a significant rise in total haemocyte count. Study indicates a possible state of immunotoxicity resulted from the exposure of the mussel to azadirachtin. Both arsenic and azadirachtin appear to initiate a state of immunotoxicity by altering the total count and differential count of the circulating blood cells or immunocytes.

NONSELF SURFACE ADHESION AND PHAGOCYTOSIS Exposure to azadirachtin results a shift in the nonself surface adhesion and phagocytic response of haemocyte of freshwater pearl forming mussel of India [6]. Discriminative ability of the immunocytes to recognise self and nonself provides the premises for effective immunoelecitation. Organisms, by various physiological means, discriminate the nonself toxic particulates during their invasion into the body. This is an important immunological phenomenon evolved in the phylogeny. Molluscs developed this unique ability of differentiation as prime attribute of haemocyte functions. Discrete subpopulation of haemocyte is capable to perform immunorecognition under the challenge of parasite and pathogen. Screening of nonself surface recognition efficacy was carried out by exposing the haemocytes of azadirachtin treated mussel to glass surface. Azadirachtin exposure yielded a significant shift in the surface adhesion of selected population of haemocytes. Azadirachtin induced shift in nonself surface adhesion is suggestive to alteration in immunological status of the mussel. Phagocytosis on the other hand plays a key role in combating the invading microorganism. Phagocytosis is a widely recorded immunological phenomenon reported in almost all animal groups. Phagocytosis involves recognition, chemotaxis, attachment, engulfment, killing and digestion of nonself particulates (Figure 3). Exposure to 0.03, 0.06 and 0.09 ppm of azadirachtin upto seven days of span inhibited the phagocytic response of mussel haemocytes. In this experiment, haemocytes were challenged with cultured yeast particles and phagocytic index was determined (Figure 2f). Azadirachtin induced inhibition in phagocytosis suggested a state of immunotoxicity in the mussel. It is assumed that the mussel distributed in its natural habitat might also experience similar degree of immunotoxicity under the exposure of azadirachtin, a common environmental toxin. Arsenic is another major aquatic contaminant affected the phagocytic efficacy of freshwater mussel [7]. Phagocytic index of the haemocyte was determined in mussels exposed to 1, 2, 3, 4 and 5 ppm of sodium

Immunotoxicity of Environmental Chemicals …

437

Figure 3. Immunological attributes of the haemocytes of L. marginalis involving phagocytosis and generation of cytotoxic molecule - nitric oxide. Phagocytosis is associated with (1) endocytosis of nonself particle (NP) (2) fusion of the phagosome (P) with lysosomal vesicle (LV) secreting hydrolytic enzymes (3) degradation of the NP in the phagolysosomal vesicle (PLV) (4) exocytosis of degraded undigestable residues from the haemocyte. Cytoxic molecule nitric oxide (NO) is generated during conversion of L-arginine to L-citrulline by nitric oxide synthase (NOS); nitric oxide reacts with superoxide anion (O2 ) generated by mitochondrial NADPH oxidase to form potent antipathogenic molecule – peroxynitrite (ONOO ).

arsenite for 24, 48, 72, 96 hours and 30 days.Most of the experimental exposure of sodium arsenite resulted in significant inhibition of phagocytosis of yeast by the mussel haemocytes. Asterocytes were recorded as principal cell type performing engulfment. Inhibition in phagocytosis under similar experimental condition was also noted for the haemocytes of arsenic haemocytes of L. marginalis when challenged with human red blood corpuscles (HRBC) [8]. Such impairment in the phagocytic potency of the haemocytes of arsenic exposed mussels possibly indicates a compromise in the immunological status of the animals distributed in contaminated habitats (Figure 4). Generation of nitric oxide in the haemocytes of the mussel was estimated under the experimental exposure of 1, 2, 3, 4 and 5 ppm of sodium arsenite for 24, 48, 72, 96 hours and 30 days [7]. Haemocytes are reported to have the ability to generate multiple cytotoxic agents including nitric oxide. Exposure to sodium arsenite resulted in inhibition in nitric oxide generation in the haemocytes of the mussel. Mussel haemocytes often kill intrahaemocytic pathogens with the help of nitric oxide. Nitric oxide mediated pathogen destruction is an established strategy of host‘s defence [9]. Additionally, nitric oxide chemically produces toxic residues of peroxynitrite – another potential pathogen killing agent of molluscan haemocytes (Figure 3). Inhibition of the nitric oxide generation in the haemocytes of the mussel exposed to sodium arsenite indicates impairment of this effective strategy of defence in host. This depletion in generation of nitric oxide by the sodium arsenite exposed mussels was concurred with inhibition in the phagocytic potency by the same cells. Impairment of

Sajal Ray, Mitali Ray, Sudipta , et al.

438

phagocytosis and generation of nitric oxide renders a state of immunoincompetence in the freshwater mussel under the exposure of sodium arsenite (Figure 4). Exposure of Immunotoxin

FP

O2 NADPH oxidase

L-alanine

M

NOS

O2

Nucleus

L-citrulline

(1) (2) MN HP Oxidative stress

L

(3)

Figure 4. Immunotoxic arsenite functional attributes the Figure 4. Immunotoxiceffect effectof ofsodium immunotoxins onon thethe functional attributes of theofhaemocytes of L. marginalis involving inhibition in phagocytosis of foreign particles (FP) and suppression in generation of cytotoxic molecule - nitric oxide. In absence of proper scavenging of superoxide anion (O2 ) generated by NADPH oxidase, oxidative stress might develop causing: (1) generation of nuclear aberration like micronucleus (MN), (2) inducing leakage in the lysosome (L) biomembrane releasing self destructive hydrolytic particles (HP), (3) destabilisation of structural integrity of biomembrane of cell.

LYSOSOMAL STABILITY Arsenic has been reported to have prominent adverse effect on the lysosomal membrane stability in the freshwater mussel haemocyte [10].The retention of the neutral red, a cationic probe, within the lysosomal compartment over time is determined as an indicator of damage to the lysosomal membrane. The lysosomes of the haemocytes of L. marginalis exposed to 1, 2, 3, 4 and 5 ppm of sodium arsenite for 24, 48, 72, 96 hours, 15 and 30 days exhibited significantly low neutral red retention time. The retention time for the neutral red decreased in a dose and time dependent manner under the exposure of sodium arsenite. The lysosomal compartment stores several hydrolytic enzymes which upon released in the cell cytoplasm can cause self destruction of the cell. Arsenic rendered destabilisation of the lysosomal membrane of the haemocytes making the cells vulnerable to its own reactive molecules of immunological importance. The observation indicates the potential immunotoxicological threat induced by arsenic on the mussels and similar freshwater organisms in contaminated habitat. Recent reports indicate that the selected environmental chemicals like arsenic, azadirachtin, cadmium [11, 12] and other pesticides and detergents are imparting serious

Immunotoxicity of Environmental Chemicals …

439

damage to the freshwater ecosystem of India [Table 1]. Several groups of invertebrates are under the physiological threat of selected toxins. Since many of these species including pearl forming mussel are of special economical importance, a sustainable strategy need to be adopted for protection and utilisation of this bioresource for human welfare. Table 1: Common environmental contaminants of freshwater environment of India Types of Chemical Acid

Alkali Detergent Bleaching agent Metal

Metalloid Pesticide

Name Sulphuric acid Hydrochloric acid Nitric acid Sodium hydroxide Potassium hydroxide Different commercial brands Bleaching powder Cadmium Chromium Lead Mercury Arsenic Organophosphate Pyrethroids Azadirachtin based biopesticides

REFERENCES [1] Chen, J. H. and Bayne, C. J. (1995). Bivalve mollusc hemocyte behaviors: characterization of hemocyte aggregation and adhesion and their inhibition in the California mussel (Mytilus californianus). Biol. Bull., 188, 255–266. [2] Roitt, I., Brostoff, J. and Male, D.(2001). Evolution in immunity. In: Immunology, (sixth Ed.) pp. 211-233, Mosby, Ediburgh, London. [3] Chakraborty, S., Ray, M. and Ray, S. (2008). Sodium arsenite induced alteration of hemocyte density of Lamellidens marginalis - an edible mollusk from India. Clean– Soil Air Water, 36 (2),195-200. [4] Mukherjee, S., Ray, M. and Ray, S. (2006). Azadirachtin induced modulation of total count of haemocytes of an edible bivalve Lamellidens marginalis. Proc. Zool. Soc., 59(2), 203-207. [5] Mukherjee, S., Ray, M. and Ray, S. (2008). Dynamics of hemocyte subpopulation of Lamellidens margiialls exposed to a neem based pesticide. In: Zoological Research in Human Welfare, Vol.1, Paper 40, pp.389-394, Kolkata, India. [6] Mukherjee, S., Ray, M. and Ray, S. 2009. Immunotoxicity of azadirachtin in freshwater mussel relation to surface adhesion of hemocytes and phagocytosis. Animal Biol. J., 1(2), 1-7. [7] Chakraborty, S., Ray, M., and Ray, S. (2009b). Evaluation of phagocytic activity and nitric oxide generation by molluscan haemocytes as biomarkers of inorganic arsenic exposure. Biomarkers, 14(8), 539-546.

440

Sajal Ray, Mitali Ray, Sudipta , et al.

[8] Chakraborty, S., Ray, M. and Ray, S. 2010. Cytotoxic response and nonself phagocytosis as innate immunity of mollusc under arsenic exposure. Animal Biol. J., 1(3),173-183. [9] Bogdan, C. (2001). Nitric oxide and the immune response. Nat. Immunol., 2(10), 907916. [10] Chakraborty, S. and Ray, S. (2009a). Nuclear morphology and lysosomal stability of molluskan hemocyte as possible biomarkers of arsenic toxicity. Clean- Soil Air Water, 37 (10), 669-675. [11] Das, S. and Jana, B. B. (2003). Oxygen uptake and filtration rate as animal health biomarker in Lamellidens marginalis (Lamarck). Indian J. Exp. Biol., 41(11), 1306-1310. [12] Das, S. and Jana, B. B. (2004). Distribution pattern of ambient cadmium in wetland ponds distributed along an industrial complex. Chemosphere, 55(2), 175-185.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN: 978-1-61761-763-8 Editors: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 20

ANTICOAGULANT AND CARBOHYDRATE INDUCED INTERFERENCE OF AGGREGATION OF MUSSEL HAEMOCYTE UNDER AZADIRACHTIN EXPOSURE Suman Mukherjee, Mitali Ray and Sajal Ray* Aquatic Toxicology Laboratory, Department of Zoology, University of Calcutta, West Bengal, India

ABSTRACT Lamellidens marginalis (Mollusca; Bivalvia; Eulamellibranchiata) is a freshwater edible mussel distributed in the wetland of different districts of WestBengal, India. Natural habitat of the species is under risk of contamination by multineeem, a newly introduced azadirachtin (limonoid) based pesticide.Blood or haemolymph of L. marginalis contains haemocytes, capable of performing diverse physiological functions. Haemocytes, the circulating blood cells are considered as immunoreactive agent capable of performing phagocytosis, nonself adhesion and aggregation. Magnitude of haemocyte aggregation was studied in depth under the exposure of 0.006, 0.03, 0.06 and 0.03 ppm of azadirachtin for varied span of exposure. Azadirachtin exposure yields decrease of haemocyte aggregation against a control level of aggregation of 34.21%. In the dynamic ecosystem of freshwater, the inhabitants participate in the struggle of niche occupation for survival and existence. Situation often leads to a state of acute predation and fight among animals. As a result, the animals experience physical wounding and loss of body fluid. Aggregation of haemocyte at wound site prevents the loss of blood and entry of microorganism and considered as an immunological response. Magnitude of hemocyte aggregation of mussel was screened under the experimental exposure of EDTA and mannose at different concentrations. Study was aimed to screen the effect of chelating agent and sugars on aggregation. For all the chemicals screened, a drastic increase in the occurrence of free cells were reported which is suggestive to role of these agents in the physiological process of haemocyte aggregation. Moreover, exposure to azadirachtin may lead to gradual loss of blood cell homeostasis of freshwater mussel distributed in its natural habitat. Continuous exposure to toxic azadirachtin may lead to a population

*

Corresponding author : [email protected], Department of Zoology, Aquatic Toxicology Laboratory, University of Calcutta, 35 Ballygunge Circular Road, Kolkata-700019, WestBengal, India,

442

Suman Mukherjee, Mitali Ray And Sajal Ray decline of freshwater mussel and loss of biodiversity in the freshwater ecosystem of India.

Keywords: Azadirachtin, Bivalve, Haemocyte.

INTRODUCTION Lamellidens marginalis is a freshwater filter feeding mussel distributed in the wetlands and water bodies of WestBengal and other states of India. This edible species is a common dietary item of rural human population and is an ingredient of artificial feed for fish and poultry (Chakraborty et al., 2008). The species is not cultured and is harvested indiscriminately from its natural habitat. Natural pearl is often found in the species which emphasizes its potentiality to be a commercial aquacrop. L. marginalis, a burrowing bivalve has the natural ability to increase sediment homogenization and provide clear substratum for the colonization of epiphytic and epizoic biota thereby increasing their importance as a member of freshwater ecosystem. Rapid urbanization, toxic contamination of wetland and indiscriminate harvestation pose a serious threat to the existence and propagation of the species in its natural habitat. Azadirachtin based biopesticides are efficient in controlling pest population and considered as relatively less hazardous in relation to environmental stability and bioaccumulation (Schmutterer, 1990). Chemically azadirachtin is a tetraterpenoid which is present in the seed kernal of neem tree (Azadirachta indica). During monsoon, agricultural runoffs loaded with azadirachtin residues contaminate the natural habitat of L. marginalis. Haemocytes, the circulating cells of the bivalves act as the major immune effector cells (Adema et al., 1991; Cheng et al., 1996). Cell mediated immune response of L. marginalis is elicited through discrete subpopulation of haemocytes under the exposure of pathogen and toxins (Pattnaik et al., 2007). Phagocytosis of non-self particulates, recognition of non-self surface and cell-cell aggregation are the distinct responses offered by circulating haemocytes (Rustishauser et al., 1988; Cheng et al., 1996). Optimum aggregation of haemocyte in the haemolymph of L. marginalis is a normal physiological phenomenon. Cell-cell attachment is a significant metabolic behaviour (Chen and Bayne, 1995) exhibited by molluscs. In this present study, degree of cell aggregation was detyermined under the toxic exposure of azadirachtin. Simultaneously aggregation in vitro was experimentally interfered with ethylene diamine tetraacetic acid (EDTA) (5 to 50 mM) and mannose (5 to 50 mM) under the exposure of sublethal concentration of azadirachtin. Study was aimed to analyze the degree of aggregation, magnitude of interference under the exposure of 0.006, 0.03, 0.06 and 0.09 ppm of azadirachtin. Information will provide an information base in understanding the degree of haemocyte aggregation in presence of sublethal concentration of azadirachtin.

Anticoagulant and Carbohydrate Induced Interference …

443

MATERIAL AND METHOD Collection and Treatment of Mussels The adult healthy L. marginalis with shell size of 7-8 cm were manually collected from the selected wetlands of the district of South 24 Parganas of West Bengal, India. Animals were transported to the laboratory in rectangular plastic containers with a dimension of 12‘x18‘x 6‘ at a density of 4-6 individuals per box in moist condition. Prior to experimentation, animals were acclimatized for 15 days in the laboratory. During acclimatization, L. marginalis were maintained in aquaria with fresh supply of pond water with temperature of 29°C±3°C and the animals received uniform ration of illumination. During the course of acclimatization and experiment, the animals were fed with chopped Hydrilla sp. and common aquatic weeds (Raut, 1991). Routine replenishment of water was carried out in every 12 hours to avoid residual toxicity. Aqueous solutions of Multuneem (Multiplex, India Private Limited, Azadirachtin E.C. 0.03%) formulations were prepared in Borosilicate glass containers with azadirachtin concentrations of 0.006, 0.03, 0.06, and 0.09 ppm. The pH of the solution was maintained at 7.2. Each experimental set consisted of 10 animals of same shell length. Animals were exposed to a volume of 5 litre of pesticide solution for varied span of exposure i.e. 1,2,3,4,7,15 and 30 days. For control, a set of animals were kept in identical volume of pesticide free analytical grade water. The experiments were carried out in static water environment and fresh solutions of pesticide were replenished in every 12 hour.

Collection of Haemolymph Shells of the animals were cleaned by gentle brushing under running tap water to remove adhered plant species and clay particles. The shells of control and posttreated animals were sterilised with ethanol and were bled aseptically, and the haemolymph was collected from posterior adductor muscle (Brousseau et al., 1999) by a sterile syringe with needle of 22 gauge at a volume not exceeding 1ml per bleed per day .The bleeding and collection procedure was carried out at 4C (Cold laboratory, Blue Star) to prevent cell aggregation.

Cell Viability and Enumeration The viability of haemocytes of L. marginalis of all experimental variants was tested with 2% Trypan blue for 10 min following the dye exclusion principle. Cell enumeration was carried out by Neubauer hemocytometer. Total number of viable haemocytes was determined microscopically by estimating the percentage of stained and unstained cells (Suave et al., 2002). Experiments were carried out with cell suspension with greater than 95 % viable haemocytes.

444

Suman Mukherjee, Mitali Ray And Sajal Ray

Aggregation Assay of Haemocyte Aggregation assay (Chen and Bayne, 1995) involved preparation of free cell suspension by treating the freshly collected control and toxin exposed haemolymph with 20% formalin (Merck, India) at a ratio of 1:1 (V/V). Percent aggregation was determined using following formula:

Total free cell numbers in test treatment The percentage of free cells =

× 100 Total free cell numbers in fixed fresh haemolymph

The experiment was repeated for five times. Fixed monolayer of cells was stained with Giemsa‘s stain (Himedia, India) or hematoxylin- eosin stain (Himedia, India) on slide for examination and photo-documentation under microscope (Axiostar, Zeiss, Germany) with digital image recording facility. Phase contrast image analyses of live cells were carried out using phase optics fitted with digital camera.

Aggregation Interference by EDTA and Mannose in vitro Control and treated haemocytes were mixed with 5mM, 10mM, 25mM and 50mM of EDTA (SRL, India) and mannose (SRL, India) as possible interfering agent at a ratio of 1:1 (V/V), (Kenney et al., 1972). To obtain values for ‗no aggregation‘ we proceeded as follows: fresh haemolymph was mixed with 20% formalin (1: 1, V/V) to immediately block cell aggregation. Percent aggregation was determined using the formula of Chen and Bayne (1995).The experiment was repeated for five times.

RESULT Cell Aggregation under Azadirachtin Exposure Immediately after collection of haemolymph from mussel, the haemocytes remain dispersed and appeared as round in shape (Figure1). However, their shape gradually changed from round to elongated ones within ten minutes. Sometimes, aggregation (Figure 2) occurred rapidly during the process of bleeding. After initial intercellular contact, cells were found to form aggregate (Figure 3) and form clump.

Anticoagulant and Carbohydrate Induced Interference …

Figure 1. Phase contrast microscopic image of weak aggregation response of haemocytes of L. marginalis. x1000.

Figure 2. Phase contrast microscopic image of moderate aggregation response of haemocytes of L. marginalis. x1000.

445

446

Suman Mukherjee, Mitali Ray And Sajal Ray

Figure 3. Phase contrast microscopic image of cohesive aggregation response of haemocytes of L. marginalis. x1000.

Cell aggregation or clump formation (Figure 4) is involved in maintaining blood homeostasis and wound healing (Sminia, 1981) process in molluscs. The aggregation of haemocyte in bivalves is reversible and aggregated haemocytes may disperse and re-enter the circulatory system partially as wound healing progresses. An increase in percentage of haemocyte aggregation was recorded against all the concentrations of pesticide formulations for 1 and 2 days of exposure (Figure 5). However, haemocytes collected from L. marginalis exposed to 0.006 ppm of azadirachtin showed a progressive increase of aggregation from 2 to 30 days (Figure 5). A decrease in percentage haemocyte aggregation was recorded against 0.03, 0.06 and 0.09 ppm of azadirachtin exposure after 2 days in comparison to control (Figure 5).

Figure 4. Light microscopic image of strong aggregation response of haemocytes of L. marginalis. x100.

Anticoagulant and Carbohydrate Induced Interference …

Control

0.006ppm

0.03ppm

0.06ppm

447

0.09ppm

Figure 5. Dynamics of aggregated haemocytes of L. marginalis exposed to azadirachtin.

100Aggregation in Presence of EDTA and Mannose Cell

0.09pp m

0.06pp m

0.03pp m

0.006p pm

Control

50 0 Interference of haemocytes aggregation was studied extensively by treating the cells with anticoagulent agent, EDTA and carbohydrate mannose of varying concentrations to determine highest and lowest values of free cells in respect to control (Figure 6 & 7). Azadirachtin induced modulation of interference of aggregation was recorded under the exposure of 0.006, 0.03, 0.6 and 0.09 ppm of azadirachtin for highest span of exposure. A concentration of 50 mM of EDTA was found to be the effective concentration in generation of 80% free haemocytes in control against generation of 95% free haemocytes in treated set (0.09 ppm/ 7 days). A concentration of 50 mM of mannose was found to be the effective concentration in generation of 72% free haemocytes in control against generation of 90% free haemocytes in treated set (0.09 ppm/ 7 days). Data is indicative to azadirachtin induced modification of haemocyte surface characters.

Suman Mukherjee, Mitali Ray And Sajal Ray

448

100 90

Free haemocyte (%)

80 70 60 50 40 30 20 10 0

5

10

25

50

EDTA (mM)

Control

0.006ppm

0.03ppm

0.06ppm

0.09ppm

Figure 6. EDTA induced interference of aggregation of haemocytes of L. marginalis exposed to azadirachtin.

10 0

0.09pp m

0.06pp m

70

0.006p pm

Free haemocyte (%)

80

0.03pp m

90

Control

100 50 0

60 50 40 30 20 10 0

5

10

25

50

Mannose (mM)

Control

0.006ppm

0.03ppm

0.06ppm

0.09ppm

Figure 7. Mannose induced interference of aggregation of haemocytes of L. marginalis exposed to azadirachtin.

0.09pp m

0.06pp m

0.03pp m

0.006p pm

Control

100 50 0

Anticoagulant and Carbohydrate Induced Interference …

449

DISCUSSSION Haemocytes, the circulatory blood cells are considered as immunoreactive agents capable of performing aggregation. Optimum aggregation of haemocyte in the haemolymph of L. marginalis is a normal physiological phenomenon. Cell-cell attachment is a significant metabolic behaviour (Chen and Bayne, 1995) exhibited by molluscs. Aggregation of haemocytes at the wound site prevents the loss of blood and entry of microorganisms and considered as an immunological response. Aggregation of haemocytes around invaded microorganisms or pathogen is considered as an effective immune reaction. Many workers termed this phenomenon as ―encapsulation reaction‖ or ―encapsulation response‖, an important cellular immunological reactivity (Nappi and Christensean, 2005). Through successful encapsulation, a molluscan host species restricts the unsafe proliferation and invasion of pathogen through physical detachment. Most of cellular aggregation is mediated through divalent cations or sugar residues as evident from the studies carried out in other invertebrate species (Takahashi et al., 1994). Bivalve often experiences subchronic and chronic exposures of pesticide residues in its natural habitat. In this present study, haemocyte aggregation was screened in depth under the experimental exposure of azadirachtin and possible interference of aggregation was studied under the treatment of EDTA, a cation chelator and mannose. Aggregation of haemocytes of invertebrates is considered as an important metabolic function (Chen and Bayne, 1995) and less studied in L. marginalis. In normal physiological condition, 34.21% of haemocytes expressed cell aggregation. Exposure to 0.03, 0.06 and 0.09ppm of azadirachtin expressed an increase in aggregation for 48 hours of exposure followed by a decrease in aggregation. Exposure to 0.09 ppm of azadirachtin for 7 days yielded a lowest of cell aggregation as 7%. Azadirachtin induced inhibition of aggregation after 48 hours of exposure is indicative to a state of immunological alteration and partial breakdown of blood homeostasis. Such a situation may lead to uncontrolled loss of blood following an injury at natural habitat contaminated by azadirachtin. Azadirachtin treated haemocytes, when exposed to varying concentrations of EDTA and mannose resulted dose responsive aggregation. A highest concentration of 50 mM of EDTA and mannose yielded the highest degree of free cell. In this experiment, azadirachtin treated haemocytes were exposed to specific chemical agent like EDTA and mannose for screening the possible shift in aggregation magnitude. Stepwise increase of occurrence of free cell under the exposure of EDTA is indicative of possible role of divalent cations and sugar residues in the physiological event of intercellular attachment. The control level of occurrence of free haemocytes was less in comparison to experimental exposure to EDTA and mannose. Decrement of aggregation response by interfering agents under azadirachtin exposure was indicative to the involvement of cations in the process of intercellular aggregation. Exposure of haemocytes to azadirachtin resulted in a chronic stress at the level of haemocyte aggregation. Exposure resulted in a shift in aggregation response of haemocytes. In the competitive environment of freshwater, animals struggle for food, space and mate and are often subjected to accidental tissue injury. Haemocyte aggregation is reported to be a major mechanism of blood clot formation at the site of injury thus arresting the fatal loss of blood (Holmblad and Soderhall, 1999; Theopold et al., 2004).Simultaneously, formation of larger clot or thrombus and their persistence in blood may lead to cardiac arrest resulting instant death of the species. However, the maintenance of blood homeostasis is an essential

450

Suman Mukherjee, Mitali Ray And Sajal Ray

physiological requirement which controls the optimum level of haemocyte aggregation as effective physiological reaction. Azadirachtin induced alteration of haemocyte aggregation is a precarious physiological condition which may lead to death of the species following tissue injury. EDTA and mannose interfered with haemocyte aggregation at different concentrations. Data is suggestive of positive roles of divalent ions and carbohydrate residues in the cellular process of haemocyte aggregation of L. marginalis.

ACKNOWLEDGMENT Authors thankfully acknowledge DST FIST and UGC SAP Government of India, for departmental instrumental facility and necessary fund support.

REFERENCES Brousseau, P., Payette, Y., Tryphonas, H., Blakley, B., Boernaus, H., Flipo, D., Fournier, M., 1999. “Manual of Immunological Methods”. CRS Press, Boca Raton, FL. Chakraborty, S., Ray, M. and Ray, S. 2008. Sodium arsenite induced alteration of hemocyte density of Lamellidens marginalis – an edible molluscs from India. Clean Soil Air Water., 36 (2):195-200. Chen, J. H. and Bayne, C. J. 1995. Bivalve Mollusc Hemocyte Behaviours: Characterization of Hemocyte Aggregation and Adhesion and Their Inhibition in the California Mussel (Mytilus californiasus). Biol. Bull., 188: 255-256. Cheng, J. H., Yang, H. Y. Y., Peng, S. W., Cheng, Y. J. and Tsai, K.Y. 1996. Characterization of abalone (Haliotis diversicolor) hemocytes in vitro. Biol. Bull., 31(1): 31 – 38. Holmblad, T. and Soderhall, K. 1999. Cell adhesion molecules and antioxidative enzymes in a crustacean, possible role in immunity. Aquacult., 172: 111 – 123. Kenney, D. M., Belamarich, F. A. and Shepro, D. 1972. Aggregation of horseshoe crab (Limulus polyphemus) amebocytes and reversible inhibition of aggregation by EDTA. Biol. Bull., 143: 548 – 567. Nappi, A.J. and Christensean, B.M. 2005. Melanogenesis and associated cytotoxic reactions: application to insect innate immunity. Insect. Biochem. Mol. Biol., 35: 443-459. Pattnaik, S., Chainy, G.B.N. and Jena, J.K. 2007. Characterization of Ca2+-ATPase activity in the gill microsomes of freshwater mussel, Lamellidens marginalis (Lamarck) and heavy metal modulations. Agricult., 270 (1-4): 443-450. Raut, S.K. 1991. Laboratory Rearing of Medically and Economically Important Molluscs. In “Snails, Flukes and Man”. ( M.S. Jairajpuri, Ed.), pp.79- 83. Zoological Survey of India Pub. Rustishauser, U., Acheson, A., Hall, A. K., Mann, D. M. and Sunshine, J. 1988. The neural cell adhesion molecule (NCAM) as a regulator of cell-cell interaction. Sci., 40: 53 – 57. Sauve, S., Brousseau, P., Pellerin, J., Morin, Y., Senecal, L., Goudreau, P. and Fournier, M. 2002. Phagocytic activity of marine and fresh water bivalves: in vitro exposure of hemocytes to met (Ag, Cd, Hg and Zn). Aquat. Toxicol., 508 (3-4)189-200.

Anticoagulant and Carbohydrate Induced Interference …

451

Schmutterer, H. 1990. Properties and potential of natural pesticides from the neem tree Azadirachta indica. Annu. Rev. Entomol., 35: 271-297. Sminia, T. 1981. Gastropods pp 191-232 In ―Invertebrate blood cells”, N.A. Ratcliffe and A.F. Rowiay. Eds. Academic Press. New York Takahashi, K.G.., Azuma, K. and Yokosawa, H. 1994. Hemocyte aggregation in the solitary ascidian Halocynthia roretzi: plasma factors, magnesium ion and met-lys- bradykinin induced the aggregation. Bio. Bull., 186: 247-253. Theopold, U., Schmidt, O., Soderhall, K. and Dushay, S. 2004. Coagulation in arthropods: defence, wound closure and healing. Trends in Immunol., 25(6): 289 – 294.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 21

THE ORIGIN OF POPULATIONS OF DREISSENA POLYMORPHA NEAR THE NORTH-EASTERN BOUNDARY OF ITS DISTRIBUTION AREA I. S. Voroshilova1, V. S. Artamonova2 and V. N. Yakovlev1 1

Papanin Institute of the Biology of Inland Waters, Russian Academy of Sciences, Borok, Nekouzskii raion, Yaroslavl oblast, 152742 Russia 2 А. N. Severtsov Institute of Ecology and Evolution Moscow, 33 Leninskij prosp., 119071, RUSSIA

ABSTRACT The expansion of the zebra mussel, Dreissena polymorpha, is observing during at least two hundred years. It has increased the speed at the end of the twentieth century. Adaptation of these species to new natural conditions beyond bounds of ecological optimum is interesting in evolutionary aspect. However, populations of the northern boundaries of the present range, which are the most essential in this respect, practically are not studied until now. For studies of microevolution processes the phylogeographic methods with application of mitochondrial DNA analysis are widely used. Haplotype diversity of the mtDNA locus, encoding cytochrome c oxidase subunit I for D. polymorpha is learned across the large part of its distribution area, however the previous investigations have no included the boundary populations of the north-eastern regions. Samples of the zebra mussels located at 580 – 640 N were studied in our investigation. Two of Caspian haplotypes have been found here, that supported the assumption about the spread of the zebra mussel into the northern area from Caspian Sea. The results of our work supply the general pattern of gene geography of D. polymorpha, and suggested to possible existence of secondary sources of the zebra mussel spread beyond the bounds of Ponto-Caspian region.



E-mail: [email protected]

454

I. S. Voroshilova, V. S. Artamonova and V. N. Yakovlev

Keywords: Boundary populations, zebra mussels, Allele-specific PCR.

INTRODUCTION The bivalve zebra mussel (Dreissena polymorpha (Pallas)) is one of the most rapidly expanding species. The original geographic range of the zebra mussel comprised fresh and brackish waters of Ponto-Caspian sea basins (Andrusov 1897; Kinzelbach 1986; Starobogatov and Andreeva 1994). This species began to expand as early as prehistoric times; however, the greatest increase in its range has been due to shipping traffic (Andrusov 1897; Skorikov 1903; Dekzbakh 1935; Mordukhai-Boltovskoi 1960; Kharchenko 1995; Marsden et al. 1995; Müller et al. 2001; Orlova 2002; Stepien et al. 2002; Minchin et al. 2003; Astanei et al. 2005; Gelembiuk et al. 2006; etc.). In Europe, D. polymorpha invaded Italian and Irish waters and the northeastern Gulf of Finland in the past decades (Antzulevich and Lebardin 1990; Valovirta and Porkka 1996; Ram and McMahon 1996; Minchin et al. 2003, Orlova and Panov 2004; Quaglia et al. 2007). In the 20th century it even reached North America, where it invaded the Great Lakes and expanded southwards to the Gulf of Mexico (Hebert et al. 1989; Strayer et al. 1991). Invasions of the zebra mussel have had serious ecological and economic consequences (Karataev et al. 1994; Kharchenko 1995; Mackie and Schloesser 1996; Ram and McMahon 1996), which has made the sources and trends of the species' expansion a particularly important issue. Phylogeographic methods using molecular markers have been employed to determine the origin of zebra mussel populations (Boileau and Hebert 1993; Marsden et al. 1995, 1996; Stepien et al. 2002, 2003, 2005; Astanei et al. 2005; Gelembiuk et al. 2006; May et al. 2006). The polymorphism and geographic distribution of the haplotypes of the mitochondrial DNA (mtDNA) locus encoding subunit I of cytochrome oxidase (COI) have been studied in most detail. May et al. (2006) used DNA sequencing to identify five haplotypes within the D. p. polymorpha range. Only in the Caspian Sea basin were all the five haplotypes found. In populations of the Black Sea basin, as well as in all other samples, May et al. found only two haplotypes, A and B. These results led the authors to the conclusion that all invasive populations of D. p. polymorpha, including those of the northeastern part of the range, originated from the Black Sea basin. It should be noted, however, that the northeastern part of the range was not analyzed sufficiently in the cited study. It was represented by only two small samples (20 and 14 animals) from the Gulf of Finland (the Baltic Sea) and the Rybinskoe Reservoir (the Volga River) (May et al. 2006). At the same time, most previous researchers had a different view on the origin of zebra mussel populations of northern Russian waters. It was assumed that this species expanded northwards from the Volga via natural water bodies and artificial canals connecting the rivers that belong to the basins of the Baltic, Caspian, and White seas (Skorikov 1903; Dekzbakh 1935; Mordukhai-Boltovskoi 1960; Starobogatov and Andreeva 1994). Although large populations of zebra mussel existed only in the middle Volga River until reservoirs were constructed (Bening 1924), small populations of the mollusc were often found in the upper river, as well as in the water bodies connecting the Volga basin with those of the

The Origin of Populations of Dreissena Polymorpha…

455

Baltic and White seas (Skorikov 1903; Kutshina 1964; Stalmakova 1977; Vygolova 1977; Slepukhina and Vygolova 1981; Sergeeva 2008). Many authors believe that large D. polymorpha populations cannot exist for a long time north of 59° N because of adverse climatic conditions (Bening 1924; Starobogatov and Andreeva 1994; Kharchenko 1995). Indeed, data on northern populations are contradictory. For example, Gassies and Lokard included the zebra mussel in the lists of molluscs inhabiting lakes Ladoga and Onega in the period from 1868 to 1900, whereas Kessler and Linko did not mention the species among bivalves living in these water bodies (Skorikov 1903). However, the existence of the northernmost D. p. polymorpha population in the Severnaya Dvina River has been repeatedly confirmed by subsequent reviews (Skorikov 1903; Ostroumov 1957; Kutshina 1964; Sergeeva 2008). The origin and characteristics of marginal zebra mussel populations is an issue of critical importance. Indeed, microevolution is assumed to be considerably more rapid in marginal populations than in the central part of a species range. When considering the periphery of a species range, Mayr (1974) distinguished a boundary region where the reproductive capacity and mortality due to adverse environmental conditions incessantly compete with each other. Like many other researchers, Mayr believed that the extreme conditions of the periphery of a species range could cause an increase in the differences between its marginal and central populations (Ford 1971; Mayr 1974; Lewontin 1978, etc.). Therefore, we analyzed the distribution of the haplotypes of the mtDNA COI locus in marginal populations of D. p. polymorpha and compared samples from these populations with those collected in the lower reaches of the rivers belonging to the Black Sea and Caspian Sea basins.

MATERIALS AND METHODS Molluscs were collected in the years 2004–2006 in water bodies belonging to the Vyshnii Volochek, Volga–Baltic, and Severnaya Dvina water systems (natural water bodies and canals between them), which connect the basins of the White, Caspian, and Baltic seas (Figure 1). To determine the characteristics of marginal populations, we also analyzed samples from the original species range in the basins of the Black Sea (the Dniester estuary and the Dnieperodzerzhinskoe Reservoir) and the Caspian Sea (the Volga Delta). Table 1 shows the sizes of the samples. The molluscs were sampled by means of a trapezoid dredge and collected from stake nets and bottom trawls; in addition, they were manually collected from natural substrates. When sampling the molluscs from the water bodies where a related species D. bugensis occurs along with D. polymorpha, we used morphological and allozyme analyses for diagnosing these species and their hybrids (Voroshilova et al., in press). Soft tissues of each individual mussel were fixed in 96% ethanol (1 : 5). The valves of the shells were dried in the air at room temperature. Phenol–chloroform extraction (Sambrook et al. 1989) was used to isolate total DNA from ethanol-fixed tissues. A 710-bp PCR fragment of the region encoding COI was obtained

456

I. S. Voroshilova, V. S. Artamonova and V. N. Yakovlev

using the primers described by Folmer et al. (1994) according to the amplification protocol recommended by the authors. The nucleotide sequences of the primers were the following: LCO1490: 5'–GGTCAACAAATCATAAAGATATTGG–3', HCO2198: 5'–TAAACTTCAGGGTGACCAAAAAATCA–3'. Polymorphism of mtDNA was analyzed as shown in Figure 2.

Figure 1. Sampling locations of populations of the zebra mussel, Dreissena polymorpha, and some directions of its dispersal in Eastern Europe. Populations are numbered from 1 to 12 (listed in Table 1). Arrows indicate possible directions of the zebra mussel dispersal. 1 – the boundary of its range as described by Starobogatov (Starobogatov & Andreeva 1994). 2 – artificial canals. Artificial canals and water systems: A. Dnieper-Neman system (via a canal between Jaselda and Shara rivers); B. BerezinaDaugava system; C. Dnepr-Bug system; D. Volga-Don Canal; E. Vyshnii Volochek system; F. Tikhthin system; G. Moskva-Volga Canal; H. Volga-Baltic system; I. Severo-Dvinskii Canal; J. White SeaBaltic Canal; K. Kama-Severnaya Dvina Canal.

The Origin of Populations of Dreissena Polymorpha…

457

Table 1. Sampled populations of D. p. polymorpha Site

Sample location

1 2 3 4 5

Dniester River Dnieper River, Dnieperodzerzhinskoe Reservoir Volga Delta Sutka River, Rybinskoe Reservoir Suda River, Rybinskoe Reservoir Cooling pond of the Cherepovets thermoelectric power plant, Suda River Siz,menskii Pool, Sheksninskoe Reservoir Sheksna River, Sheksninskoe Reservoir Lake Kubenskoe Belousovskoe Reservoir Lake Uzhin Severnaya Dvina River

6 7 8 9 10 11 12

Basin Black Sea Black Sea Caspian Sea Caspian Sea Caspian Sea Caspian Sea Caspian Sea Caspian Sea White Sea Baltic Sea Baltic Sea White Sea

Sample size 36 29 32 35 27 33 34 35 29 26 31 27

Figure 2. The design of nucleotide sequence analysis for the fragment of СОI mtDNA Dreissena polymorpha. The sequence is included in the GenBank international database (AF510508).

The nucleotide polymorphism at position 31 (Figure 2) was determined by digesting the full-length PCR product with the DraI restriction endonuclease (Fermentas, Lithuania) under the conditions recommended by the manufacturer. The enzyme cleaved the nucleotide sequence that contained A but not G at this position (Figures. 2, 3). Allele-specific PCR (AS PCR) was performed to identify the nucleotide polymorphisms at positions 153 and 333. For this purpose, we developed two pairs of allele-specific primers: Fc and Fd for identifying the nucleotide at position 333 and Ra and Rb for position 153:

458

I. S. Voroshilova, V. S. Artamonova and V. N. Yakovlev Fc: 5'–CTAGAGTTATAGGACATTCAGAG–3', Fd: 5'-CTAGAGTTATAGGACATTCAGAC–3', Ra: 5'–CTAGTATTATTGGTACCAATCTA–3', Rb: 5'–CTAGTATTATTGGTACCAATCTG–3'.

Each of these nucleotide positions was tested in two parallel experiments. Along with the primers LCO1490 and HCO2198 (the synthesis of the full-length PСR product served as a positive control), one of the allele-specific primers was added to the amplification mixture. The appearance of a truncated PCR product along with the full-length one in the course of amplification indicated that the nucleotide complementary to the 3' end of the allele-specific primer was at the tested position in the given DNA sample.

Figure 3. Restriction of PCR products using the endonuclease Dra I. Lanes1–5 are D. polymorpha; lane 6, 50 bp ladder; 7, 8 are D. bugensis (positive control).

We used a PTC-100™ (MJ Research, Inc.) or Amply 4 (Biokom) thermocycler to carry out AS PCR in 25 μl of an amplification buffer solution (Fermentas) containing 10 mM Tris– HCl (pH 8.9), 50 mM KCl, and 0.08% Nonidet P40. The buffer solution for testing the samples with the use of the allele-specific primers contained 2.0 mM MgCl2 in the case of the Fc and Fd primers and 3.0 mM MgCl2 in the case of the Ra and Rb primers. In all cases, the amplification mixture contained 100–300 ng of total DNA, 10 pmol of each primer, 200 nmol of each of the four deoxyribonucleotides, and 0.5–1.0 U of Taq polymerase (Bionem, Russia).

The Origin of Populations of Dreissena Polymorpha…

459

Figure 4. Selection of optimal condition for allele-specific amplification using the 3-primer system. (A) Lanes 1, 3, 5, 8 are PCR products with using universal primers (LCO1490, HCO2198) and allelespecific primer Fc; lanes 2, 4, 6, 9 are PCR products with using universal primers (LCO1490, HCO2198) and with allele-specific primers Fd; lane 8, 50 bp ladder. (B) Lanes 1, 3, 6, 8 are PCR products with using universal primers (LCO1490, HCO2198) and allele-specific primer Ra; lanes 2, 4, 7, 9 are PCR products with using universal primers (LCO1490, HCO2198) and with allele-specific primers Rb; lane 5, 50 bp ladder.

The following reaction profile was optimal: 95°C for 4 min; 35 DNA synthesis cycles of 95°C for 50 s, 62°C for 1 min, and 72°C for 1 min; and final extension at 72°C for 10 min.

I. S. Voroshilova, V. S. Artamonova and V. N. Yakovlev

460

Table 2. Haplotypes of СОI mtDNA, which are detected according to the design in this study Haplotype А В D I tip

Positions of nucleotide substitutions in the fragment of СО I mtDNA* 31 bp 153 bp 333 bp G T C G T G G C G А T С

In the rare cases when a truncated PCR product was absent or, conversely, present in both variants (Fc + Fd and Rа + Rb), the annealing temperature was varied between 54 and 64°C, which always allowed us to eventually determine which nucleotide is contained at the analyzed position of the given sample (Figure 4). The PCR and restriction products were identified by 1.5–2.0% agarose gel electrophoresis with the use of Tris–acetate buffer solution (pH 8.0). Gene Ruler™ DNA Ladder double-stranded markers with a step of 50 bp (Fermentas) were used as markers of nucleotide sequence length. A combined haplotype was defined as the combination of nucleotides at positions 31, 153, and 333 (Table 2, Figure 2). The χ2 test modified for small samples (Zhivotovsky 1991) was used to estimate the significance of differences in mtDNA haplotypes between samples. The primary DNA sequence was analyzed in nine samples of the full-length fragment of the COI mtDNA locus. The sequencing was performed by means of an automated sequencer with a MegaBACE-500 electrophoretic chamber (48 capillaries) with the use of a DYEnamic ET, Dye Terminator Cycle Sequencing KIT for Mega BACE DNA Analysis System in the EvroGen Laboratory (Moscow, Russia). The SeqMan 4.00 software (DNASTAR, Inc.) was used to analyze the nucleotide sequence.

RESULTS We searched for D. polymorpha populations at the northeastern periphery of its current range in the years 2004 and 2005. As a result, small populations were found in the Sheksninskoe and Belousovskoe reservoirs of the Volga–Baltic Waterway and water bodies belonging to the White Sea basin, including Lake Kubenskoe, the mouths of its tributaries, and the Severnaya Dvina River (Figure 1). It is noteworthy that only small colonies of D. polymorpha (no more than three aggregations of 20–30 mussels each), which were distributed very irregularly, were found on natural substrates in the Belousovskoe Reservoir and Lake Kubenskoe. Single zebra mussels and small groups (up to 10 molluscs) on the shells of Unionidae were found on silty ground in the Sheksninskoe Reservoir. The largest aggregations of zebra mussels were found on stake nets in Lake Kubenskoe, as well as in the Siz'menskii Pool of the Sheksninskoe Reservoir and in the Severnaya Dvina. Samples for sequencing were taken from northern water bodies belonging to the basins of the Caspian, Baltic, and White seas (from the Rybinskoe and Sheksninskoe reservoirs and the Severnaya Dvina River, two samples from each; from the Belousovskoe Reservoir, three

The Origin of Populations of Dreissena Polymorpha…

461

samples). All nucleotide sequences proved to correspond to those published earlier and included in the GenBank international database. Earlier, they were called haplotypes A, B, C, and D (May et al. 2006; Gelembiuk et al. 2006; Gen Bank: DQ840121, DQ840122, DQ840123, DQ840124). Zebra mussels with the A haplotype were found in the Sheksninskoe and Belousovskoe reservoirs; those with the B haplotype, in the Belousovskoe Reservoir; those with the C haplotype, in the Sheksninskoe Reservoir, and those with the D haplotype, in the Severnaya Dvina River. Since these haplotypes only differed from one another at three nucleotide positions (6, 153, 333), we developed two pairs of allele-specific primers permitting large-scale analysis of samples for identifying the nucleotides at positions 153 and 333 (the nucleotide at position 6 was not analyzed because it was difficult to identify the truncated PCR product against a background of the full-length one in agarose gel). In addition, an earlier study on zebra mussels from the Bug River estuary of the Black Sea (Therriault et al. 2004) found a characteristic nucleotide substitution at position 31 that could be identified using the DraI restriction endonuclease. The procedure of the large-scale analysis is described under "Materials and Methods." Having analyzed the molluscs from the detected populations according to our methodology, we found carriers of three haplotypes of the COI mtDNA locus (A, B, and D). The A and B haplotypes were prevailing in all samples studied (Figure 5, Table 3).

Figure 5. Haplotype frequency of COI for sampling Dreissena p. polymorpha. (1) Dniester River, (2) Dnieperodzerzhinskoe Reservoir, Dnieper River, (3) Volga Delta, (4) Rybinskoe Reservoir, Sutka River, (5) Rybinskoe Reservoir, Suda River, (6) Cooling pond of the Cherepovets thermoelectric power plant, Suda River, (7) Siz,menskii Pool, Sheksninskoe Reservoir, (8) Sheksna Reservoir, (9) Lake Kubenskoe, (10) Belousovo Reservoir, (11) Lake Uzhin, (12) Severnaya Dvina River, (13) Seine River, (14) IJsselmeer Lake, (15) Danube River, (16) Ingulets River, (17) Kherson, Dnieper River, (18) Kiev Reservoir, Dnieper River, (19) Lagan, Caspian Sea canal, (20) Liman, Caspian Sea canal, (21) Astrakhan, Volga River, (22) Ural River, (23) Volgograd, Volga River, (24) Rybinsk Reservoir, Volga River, (25) Gulf of Finland. 1-12 - our data (marked by points), 13-15 - data of May et al. 2006.

462

I. S. Voroshilova, V. S. Artamonova and V. N. Yakovlev Table 3. Haplotype frequencies of СОI mtDNA in investigated samplings of D. polymorpha

Site

Haplotype frequencies Sample location

А

В

D

1

Dniester River

0,03

0,97

0,00

2

Dnieper River, Dnieperodzerzhinskoe Reservoir

0,89

0,11

0,00

3

Volga Delta

0,44

0,56

0,00

4

Sutka River, Rybinskoe Reservoir

0,74

0,26

0,00

5

Suda River, Rybinskoe Reservoir

0,93

0,07

0,00

6

0,85

0,15

0,00

7

Cooling pond of the Cherepovets thermoelectric power plant, Suda River Siz,menskii Pool, Sheksninskoe Reservoir

0,73

0,27

0,00

8

Sheksna River, Sheksninskoe Reservoir

0,57

0,40

0,03

9

Lake Kubenskoe

1,00

0,00

0,00

10

Belousovskoe Reservoir

0,69

0,27

0,04

11

Lake Uzhin

0,61

0,35

0,03

12

Severnaya Dvina River

0,04

0,59

0,37

However, the rarer D haplotype was also found in mollusc populations of water bodies belonging to all the sea basins studied except the Black Sea one (i.e., the basins of the Caspian, Baltic, and White seas). It was found in samples from the Sheksna River of the upper Volga basin (which is part of the Caspian Sea basin), Lake Uzhin and the Belousovskoe Reservoir of the Baltic Sea basin, and the Severnaya Dvina River of the White Sea basin. We did not find significant differences in the haplotype frequencies between samples collected from different parts of the same water body (the Sheksna River and Siz'menskii Pool; the cooling pond of the Cherepovets thermoelectric power plant and the Suda River proper). The differences between the samples from the Rybinskoe and Belousovskoe reservoirs and Lake Uzhin were also nonsignificant. The frequencies of the prevailing haplotype (A) in the zebra mussel populations of Lake Kubenskoe, the Suda River, and the cooling pond were close to 1; therefore, the samples from these populations significantly differed from most samples from all other zebra mussel populations of the Volga–Baltic system (p < 0.001–0.025). In addition, the sample from the Severnaya Dvina considerably differed in the mtDNA haplotype frequencies from the samples from all other northern waters (p < 0.001). Molluscs with the B haplotype were prevailing in this sample, and the frequency of the D haplotype was substantially higher than in other populations.

The Origin of Populations of Dreissena Polymorpha…

463

DISCUSSION To the north of the Rybinskoe Reservoir, zebra mussels are mainly distributed in the form of small groups that are often impossible to detect by the standard methods of collecting zoobenthos. The study of populations at the periphery of the species range is substantially complicated by the difficulty to find again some of the mollusc populations that were detected earlier. The origin of the zebra mussel populations of the upper Volga is being actively discussed, but there is no consensus on this issue thus far. For example, mussel populations of the Caspian Sea basin have long been regarded as the most probable source of D. polymorpha in the upper Volga region (Andrusov 1897; Skorikov 1903; Starobogatov and Andreeva 1994). Subsequent analysis of the frequency distribution of the COI mtDNA haplotypes led to the assumption that the upper Volga D. polymorpha populations had most probably originated from the Dnieper River basin populations (Gelembiuk et al. 2006; May et al. 2006). However, of all D. polymorpha populations of the upper Volga, only a small sample (14 animals) from the Rybinskoe Reservoir has been analyzed; hence, it cannot be excluded that this sample contained no molluscs with characteristic Caspian haplotypes for merely accidental reasons. To test the hypothesis that the upper Volga populations of the zebra mussel originated from the Dnieper basin, we analyzed a more representative sample from the Rybinskoe Reservoir (35 mussels) and, in addition, the samples from the mollusc populations of the Volga–Baltic system (the Sheksninskoe and Belousovskoe reservoirs). Our methodology for the analysis of the nucleotide sequence of the COI locus without sequencing allowed us to identify four haplotypes (A, B, D, and type I) that were earlier found in the basins of the Black and Caspian seas (Therriault et al. 2004; Gelembiuk et al. 2006; May et al. 2006). Therefore, we could substantially increase the sizes of the samples compared to previous researchers. Note, however, that our methodology does not allow the detection of nucleotide polymorphisms at positions 6 and 232 and, hence, the identification of the rare haplotypes C and D2 that were earlier found in zebra mussels from the Caspian Canal and the Ural River (May et al. 2006). Our method identifies the D2 haplotype as D and the C haplotype as B. In addition, this method does not allow the identification of four unique haplotypes (LC1, LC2, LG2, and LG4) that have been found in zebra mussels from German and Italian lakes (Quaglia et al. 2007). However, this is unlikely to have considerably distorted our estimation of the haplotype distribution in the populations studied, because the C and D2 haplotypes were very rare even in the samples where they were originally found (May et al. 2006) and the LC1, LC2, LG2, and LG4 haplotypes occurred only locally. Our analysis has demonstrated that the A and B haplotypes are prevailing in the populations studied, as they are in other parts of the species range, their frequencies varying even in neighbouring water bodies belonging to the same basin (Figure 5). For example, it was earlier found that at lest half zebra mussels from the Caspian Canal and the lower Volga River carried the B haplotypes, whereas this haplotype was entirely absent in mussels from the lower Ural River, although the Ural runs into the Caspian Sea and the sample from this river was as large as 20 molluscs (May et al. 2006). The considerable differences in haplotype frequencies between neighbouring zebra mussel populations are still poorly understood; they may have resulted from the founder

464

I. S. Voroshilova, V. S. Artamonova and V. N. Yakovlev

effect. Anyway, this indicates that a similarity in haplotype frequencies is not a reliable criterion for common origin of D. polymorpha populations. In particular, we cannot conclude that the zebra mussel populations of the upper Volga have originated from the Black Sea basin. Analysis of the distribution of unique haplotypes over the species range seems much more promising. These are, e.g., the C, D, and D2 haplotypes found in the zebra mussel populations of the Caspian Sea and the mouths of the Volga and Ural rivers (Gelembiuk et al. 2006). In addition, Therriault et al. (2004) found a haplotype that they called type I of the COI mtDNA locus in zebra mussels from the Bug River (the Black Sea basin). Later studies outside of the basins of the Caspian and Black seas (Albrecht et al. 2007; Quaglia et al. 2007; Grigorovich et al. 2008) failed to detect these unique haplotypes. We have found that the Caspian haplotype D, which has not been found in the Black Sea basin thus far, is rather common in the zebra mussel populations of the northeastern periphery of the species range. Therefore, this part of the range is most likely to have been populated by zebra mussels from the Volga basin. The populations from which the species range extended north-eastwards were probably located in the upper or middle Volga River. Even the first studies on the fauna of the upper and middle Volga region published as early as the 18th century reported on the findings of zebra mussels. Zebra mussels have been regularly found in the upper Volga since 1880 (Skorikov 1903, Derzhavin et al. 1921; Bening 1924), although Bening (1924) believed that D. polymorpha could not steadily acclimatize there because of the high humic acid content of the water and assumed that the zebra mussels occurring in collection of molluscs were regularly brought there by barges and steamers. At the same time, relatively large aggregations of zebra mussels occurred in the middle Volga basin downstream of the Oka River mouth before the system of reservoirs was constructed (Bening 1924). Probably, these populations became the source of the northward expansion of the species. The populations of D. polymorpha in the Severnaya Dvina belonging to the White Sea basin (at the northernmost margin of the current species range) are of special interest. It was recently suggested that D. polymorpha could migrate to the Severnaya Dvina from the Volga basin via the Severnaya Dvina Canal (Starobogatov and Andreeva 1994); earlier, Skorikov (1903) considered it possible that the zebra mussel could migrate to this river via the Kama– Severnaya Dvina water system, which existed in the period between 1822 and 1838. In theory, zebra mussels might (though rarely) spread to the Severnaya Dvina from the Baltic region via the White Sea–Baltic system. However, this is hardly the case, because there are no zebra mussel populations in the rivers and lakes of the White Sea–Baltic Canal. In addition, zebra mussels were found in the Severnaya Dvina before the canal was constructed; hence, this cannot have been the main route of the northward expansion of the mollusc. Starobogatov and Andreeva (1994) hypothesized that stable populations of the mollusc could not exist in the Severnaya Dvina, and the mussel aggregations found in the river originated from molluscs that were constantly brought there. However, our data do not confirm this hypothesis. Indeed, if the Severnaya Dvina population had existed exclusively owing to molluscs regularly brought from another water body, zebra mussels from the Severnaya Dvina and the donor population would have had the same prevailing mtDNA haplotype. However, the

The Origin of Populations of Dreissena Polymorpha…

465

Severnaya Dvina sample of the molluscs considerably differs from the samples from all other northern water bodies in mtDNA haplotype frequencies (Figure 5, Table 3). The Severnaya Dvina populations of the zebra mussel also differ from its population in Lake Kubenskoe belonging to the Severnaya Dvina catchment area. In the sample from Lake Kubenskoe, we found only the A haplotype, whose frequency in the Severnaya Dvina is as low as 0.04. In addition, the shipping route through Lake Kubenskoe and the segment of the Severnaya Dvina near its mouth is very seldom used at present. This leads to the conclusion that considerable numbers of zebra mussels cannot be regularly brought to the Severnaya Dvina from Lake Kubenskoe. Nor can the molluscs be brought through the Kama–Severnaya Dvina route, which is not used at all now. The unique composition and frequency distribution of the COI haplotypes in the zebra mussel sample from the Severnaya Dvina River can be explained only by a long isolation of the local population, which is most likely to have originated from the Volga populations (Figure 5). Anyway, we have good grounds to conclude that the D. polymorpha population of the Severnaya Dvina reproduces independently, rather than is replenished by veligers or adult mussels brought from neighbouring populations. This is further confirmed by our earlier data on the phenotypic structure of D. polymorpha populations, which showed that the sample from the Severnaya Dvina considerably differed from samples collected in neighbouring water bodies in the frequencies of shell colour variants. In this population, we found the combinations of phenes that were apparently absent in all other parts of the species range (Sergeeva 2008). Thus, the results of analysis of the COI mtDNA locus and morphological data indicate that the zebra mussel population of the Severnaya Dvina living at temperatures that are extreme for this species is unique. At present, numerous peripheral populations of the zebra mussel are unlikely to affect aquatic ecosystems as strongly as large populations from the central part of the species range do. It cannot be excluded, however, that they have some unusual characteristics; e.g., they may be more resistant to adverse environmental conditions. This should be taken into consideration in predicting the routes of further expansion of D. polymorpha.

ACKNOWLEDGMENTS We thank N.M. Mahnovic, V.A. Cherepanov, D.P. Karabanov, D.L. Layus and colleagues of GosNIORKH laboratory in Vologda for help in collecting samples, and A.A. Makhrov, E.N. Pakunova for help in preparing this article. This study was supported by the program of the Russian Academy of Sciences "Biological Diversity" (subprogram "Gene Pools and Genetic Diversity").

REFERENCES Albrecht, C., Schultheiss, R., Kevrekidis, T., Streit, B., and Wilke, T. (2007). Invaders or endemics? Molecular phylogenetics, biogeography and systematic of Dreissena in the Balkans. Freshwater Biology, 52, 1525-1536.

466

I. S. Voroshilova, V. S. Artamonova and V. N. Yakovlev

Andrusov, N. I. (1897). Fossil and living Dreissenidae of Eurasia. St. Petersburg: Merkushev, M. Press [in Russian, with German summary]. Antzulevich, A.T., and Lebardin M.V. (1990). «Travelling mussel» Dreissena polymorpha (Pall.) in the vicinity of Leningrad. Vestnik Leningradskogo Gosudarstvennogo Universiteta, Seria Biologia, 4 (24), 109-110 [in Russian]. Astanei, J., Gosling, E., Wilson, J., Powell, E. (2005). Genetic variability and phylogeography of the invasive zebra mussel, Dreissena polymorpha (Pallas). Molecular Ecology, 14, 1655-1666. Bening, A.L. (1924). On study ground living in the River Volga. Saratov: Monograph Volzhskoi biol. station. [in Russian]. Boileau, M.G.H., and Hebert, P.D.N. (1993). Genetics of the zebra mussel (Dreissena polymorpha) in populations from the Great Lakes region and Europe. In: T.F. Nalepa, and D. Schloessler (Eds.), Zebra Mussels: Biology, Impacts and Control (pp. 225-238). Boca Raton, Florida: Lewis Publishers. Dekzbakh, N.K. (1935). The spread Dreissena polymorpha Pallas (Mollusca) in European part of USSR and factors, which conditioning its expansion. Bull. MOIP. Dep. biol., 44 (4), 56-58. [in Russian]. Derzhavin, A.N., Dekzbakh, N.K., and Lepneva, S.G. (1921). Caspian elements in the fauna of Upper Volga. Proc. Naturalistic association in Yaroslavl, 1 (1), 26-40. [in Russian]. Ford, E.B. (1971). Ecological genetics. London: Chapman and Hall. Gelembiuk, G.W., May, G.E., and Lee, C.E. (2006). Phylogeography and systematics of zebra mussels and related species. Molecular Ecology, 15, 1033-1050. Grigorovich, I.A., Kelly, J.R., Darling, J.A., and West, C.W. (2008). The Quagga Mussel Invades the Lake Superior Basin. J. Great Lakes Res., 34, 342-350. Hebert, P.D.N., Muncaster, B.W., and Mackie, G.L. (1989). Ecological and genetic studies on Dreissena polymorpha (Pallas): a new mollusk in the Great Lakes. Can. J. Fish. Aquat. Sci., 46, 1587-1591. Karataev, A.Y., Lyakhnovich, V.P., Afanasev, S.A. et al. (1994). A position of species in biocenoses. In Starobogatov, Y.I. (Eds.), Dreissena polymorpha (Pall.) (Bivalvia, Dreissenidae). Taxonomy, ecology and practical importance (pp. 180-195). Moscow: Nauka Press. [in Russian]. Kharchenko, T.A. (1995). Dreissena area, ecology, biofoulings. Gidrobiologicheskii Zhurnal, 31 (3), 3-21. [in Russian]. Kinzelbach R. (1992). The main features of the phylogeny and dispersal of the zebra mussel Dreissena polymorpha. In Neumann D., Jenner H.А. (Eds.), The Zebra mussel Dreissena polymorpha (pp. 5-17). New York, USA: Gustav Fisher. Kutshina, E.S. On distribution of Dreissena polymorpha Pallas in the Severnaya Dvina. In Kuzin, B.S., and Shtegman, B.K. (Eds.), Biology the zebra mussel and control (pp. 3137). Moscow, and Leningrad: Nauka Press. [in Russian]. Lewontin R.C. 1974. The genetic basis of evolutionary change. New York and London: Columbia University Press. Mackie, G.L., and Schloesser, D.W. (1996). Comparative biology of zebra mussels in Europe and North America: An overview. American Zoologist, 36, 244-258. Marsden, J.E., Spidle, A., and May B. (1995). Genetic similarity among zebra mussel populations within North America and Europe. Can. J. Fish. Aquat. Sci., 52, 836-847.

The Origin of Populations of Dreissena Polymorpha…

467

Marsden, J.E., Spidle, A.P., May, B. (1996). Review of genetic studies of Dreissena spp. American Zoologist, 36, 259-270. May, G.E., Gelembiuk, G.W., Panov, V.E., Orlova, M.I., Lee, C.E. (2006). Molecular ecology of zebra mussel invasions. Molecular Ecology, 15, 1021-1031. Mayr, E. (1974). Population, species and еvolution. Cambridge, Massachusetts: Harvard Univ. Press. Minchin, D., Maguire, C., Rossell, R. (2003). The zebra mussel (Dreissena polymorpha Pallas) invades Ireland: human mediated vectors and the potential for rapid intranational dispersal. Biology and environment, Proceedings of the Royal Irish Academy, 103 (1), 23-30. Mordukhai-Boltovskoi, F.D. (1960). Caspian fauna in Azov-Black basin. Moscow, and Leningrad: Publishers of the Academy of Science USSR. [in Russian]. Müller J., Woll S., Fuchs U., Seitz A. (2001). Genetic interchange of Dreissena polymorpha populations across a canal. Heredity, 86, 103-109. Orlova M.I. (2002). Dreissena (D.) polymorpha: evolutionary origin and biological peculiarities as prerequisites of invasion success. In Leppakoski E., Olenin S., Gollasch S. (Eds.), Invasive aquatic species of Europe. Distribution, impact and management. (pp. 127-134). Dordrecht-Boston-London: Kluwer Publishers. Orlova, M.I., Panov, V.E. (2004). Establishment of the zebra mussel, Dreissena polymorpha (Pallas), in the Neva Estuary (Gulf of Finland, Baltic Sea): distribution, population structure and possible impact on local unionid bivalves. Hydrobiologia, 514, 207-217. Ostroumov, N.A. (1957). A rafting and fish industry of some northern rivers in the European part of USSR. Proceedings of the naturalistic Institute attached to the State University named after of Gorkii, A.M. in Perm, XIV (1), 1-17. [in Russian]. Quaglia, F., Lattuada, L., Mantecca, P., and Bacchetta, R. (2007). Zebra mussels in Italy: where do they come from? Biological Invasions, 10 (4), 555-560. Ram, J.L., and McMahon, R.F. (1996). Introduction: The Biology, Ecology, and Physiology of Zebra Mussels. Amer. Zool., 36, 239-243. Sergeeva, I.S. (2008). A phenotypical structure of Dreissena polymorpha (Pallas) in the north-eastern part of its range. Biology of Inland waters, 3, 53-60. Skorikov, A.C. (1903). Modern distribution of Dreissena polymorpha (Pallas) in Russia. Saratov: Year-book Volzhskoi boil. station. [in Russian]. Slepukhina, T.D., and Vygolova, O.V. (1981). Zoobenthos. In (Eds.), Hydrobiology and bed silt in the White Lake (pp. 215-232). Leningrad: Nauka Press. [in Russian]. Starobogatov, Y.I. and Andreeva, S.I. (1994). Range and its history. In Starobogatov, Y.I. (Eds.), Dreissena polymorpha (Pall.) (Bivalvia, Dreissenidae). Taxonomy, ecology and practical importance (pp. 47-56). Moscow: Nauka Press. [in Russian]. Stalmakova, G.A. (1977). Benthos of the White Lake in Vologda region (observations during 1973-1974). Proceedings of GosNIORKH, 116, 128-137. [in Russian]. Stepien, C.A., Taylor, C.D., and Dabrowska, K.A. (2002). Genetic variability and phylogeographical patterns of a nonindigenous species invasion: a comparison of exotic vs. native zebra and quagga mussel populations. Journal of Evolutionary Biology, 15, 314-328. Stepien, C.A., Taylor, C.D., Grigorovich, I.A., Shirman, S.V., Wei, R., Korniushin, A.V., and Dabrowska K.A. (2003). DNA and systematic analysis of invasive and native dreissenid mussels: Is Dreissena bugensis really D. rostriformis? Aquatic Invaders, 14 (2), 8-18.

468

I. S. Voroshilova, V. S. Artamonova and V. N. Yakovlev

Stepien, C.A., Brown, J.E., Neilson, M.E., and Tumeo, M.A. (2005). Genetic Diversity of Invasive Species in the Great Lakes Versus Their Eurasian Source Populations: Insights for Risk Analysis. Risk Analysis, 25 (4), 1043-1060. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring: Cold Spring Laboratory Press. Strayer, D.L. (1991). Projected Distribution of the Zebra Mussel, Dreissena polymorpha, in North America. Can. J. Fish. Aquat. Sci., 48, 1389-1395. Therriault, T.W., Docker, M.F., Orlova, M.I., Heath, D.D., MacIsaac, H.J. (2004). Molecular resolution of the family Dreissenidae (Mollusca: Bivalvia) with emphasis on PontoCaspian species, including first report of Mytilopsis leucophaeata in the Black Sea basin. Molecular Phylogenetics and Evolution, 30, 479-489. Valovirta, I., Porkka, M. (1996). The distribution and abundance of Dreissena polymorpha (Pallas) in the eastern Gulf of Finland. Memoranda Soc. Fauna Flora Fennica, 72, 63– 78. Voroshilova I.S., Artamonova V. S., Makhrov A. A., and Slynko Yu. V. Hybridization between the two species dreissenids Dreissena polymorpha (Pallas, 1771) and Dreissena bugensis (Andrusov, 1897) in naturally conditions. Biol. Bull. (in press). Vygolova, O.V. (1978). Association of zoobenthos in the Cherepovetz Reservoir: Biology of fishes and intensification of fishery in lakes. Leningrad: Proceedings of GosNIORKH. p. 39-42. [in Russian]. Zhivotovsky, L.A. (1991). Population biometry. Moscow: Nauka Press. [in Russian].

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 22

UNIONIDAE FRESHWATER MUSSEL ANATOMY Diana Badiu,1 Rafael Luque2 and Ovidiu Teren3 1

Department of Biochemistry Faculty of Natural and Agricultural Sciences Ovidius University of Constanta 124, Mamaia Blvd., 900527 Constanta (Romania) 2 Departamento de Quimica Organica Universidad de Cordoba Campus de Rabanales Edificio Marie Curie (C- 3) Ctra Nnal IV, Km 396 Cordoba (Spain), E-14014 3 Department of Biophysics Faculty of Medicine Ovidius University of Constanta 1, University Al., Campus (B Part) Constanta (Romania)

ABSTRACT Freshwater mussels of the family Unionidae, also known as naiads, have inhabited fresh waters around the world for the past 400 million years. The presence of these unique mussels ensures our water quality and helps support the worldwide pearl industry. Yet their continued survival is by no means certain, due to overharvesting, environmental degradation and the rapid spread of exotic mussel species. Most research related to mussels has dwelt on different topics as fine-scale, intradrainage distribution patterns and life history traits relevant to applied conservation and propagation issues but there are only a few reports on anatomy studies. This chapter provides baseline reference material regarding the anatomy of Unionidae freshwater mussels, focusing in particular on the subfamily Unioninae with the aim to improve the knowledge in mussels of professional biologists and amateur naturalists as well as their preservation.

Keywords: shell, valve, mantle, muscle, stomach.



E-mail: [email protected]

470

Diana Badiu, Rafael Luque and Ovidiu Teren

1. THE GENERAL MORPHOLOGY AND ANATOMY OF UNIONIDAE The Unionoida, commonly known as freshwater pearly mussels or naids, is a diverse order of bivalved molluscs. Comprised of over 150 genera and flung widely upon all continents except Antarctica, the Unionoida is a conspicuous member of the macrobenthos of the world‘s rivers and stable lacustrine habitats (Turgeon et al., 1998). The general morphology and anatomy of family Unionidae (naiads) is well known, but the special features are frequently not mentioned, or very fragmentarily, in text books on zoology, and not even in recent special works on mollusca. It is necessary to first orient ourselves on the Tree of Life. Although there has been some incongruence among molluscan classification schemes, most arrangements are consistent with the bivalvia split among two subtaxa: Protobranchia and Autobranchia (= Isofilibranchia + Pteriomorpha + Anomalodesmata + Heterodonta + Palaeoheterodonta). According to the current consensus (Brusca and Brusca, 2003), the Unionoida belong to the latter in the subclass Palaeoheterodonta. The recent Palaeoheterodonta, however, receives only a single non-unionoid genus, the marine Neotrigonia. The divisions among the Autobranchia and the inclusion of the Unionoida among the Palaeoheterodonta have been based, traditionally, upon hinge morphology (Badra, 2004). The order Unionoida nominally includes two superfamilies, the Unionoidea and Etherioidea, distinguished by larval forms. The superfamily Unionoidea, with glochidia larvae, includes Unionidae (Africa, Eurasia, India, North America), Hyriidae (Australasia, South America) and Martaritiferidae (Eurasia, North America). The Etherioidea (Muteloidea) with lasidia larvae includes the Etheridae (= Mycetopodidae) (Africa, South America) and Iridinidae (Mutelidae) (Africa) (Heard and Vail, 1976). The same authors argument that ―the two different types of larvae cannot be considered to be derived one from the other or from any hypothetical direct ancestry‖. Ideas of continental drift were not widely accepted of course, at the time of McMichael and Hiscock (1958). The two authors postulated from scant evidence that an ancestral form invaded Australia from SE Asia, but soon afterward McMichael and Iredale (1959) acknowledged that dispersal via an Antarctic land bridge were feasible. The families Unionidae, Hyriidae and Margaritiferidae have in recent decades been associated as the superfamily Unionoidea based upon their shared possession of glochidiumtype parasitic larvae. Glochidia are small, bivalved larvae. Besides the morphological differences among the glochidia of the three families, the Unionidae, Hyriidae and Margaritiferidae are readily distinguishable based upon their adult anatomy (Heard, 1979; Graf and Cummings, 2006). Several species of the subfamily Unioninae, the main focus of this chapter, are highlighted below: Amblema plicata (Say, 1817), Cyclonaias tuberculata (Rafinesque, 1820), Elliptio crassidens (Lamark, 1819), Elliptio dilatata (Rafinesque, 1820), Fusconaia ebena (Lea, 1831), Fusconaia flava (Rafinesque, 1820), Megalonaias nervosa (Rafinesque, 1820), Plethobasus cyphyus (Rafinesque, 1820), Pleurobema sintoxia (Rafinesque, 1820), Quadrula metanevra (Rafinesque, 1820), Quadrula nodulata (Rafinesque, 1820), Quadrula pustulosa

Unionidae Freshwater Mussel Anatomy

471

(Lea, 1831), Quadrula quadrula (Rafinesque, 1820) and Tritogonia verrucosa (Rafinesque, 1820). While there seems to be widespread agreement upon the recognition of these taxa, there is confusion regarding their precise generic composition and phylogeny.

2. DESCRIPTION OF SUBFAMILY UNIONINAE. CYCLONAIAS TUBERCULATA (RAFINESQUE, 1820) Biology Like most freshwater mussels of the subfamily Unioninae, this species requires a fish host to complete its life cycle. Eggs are fertilized and develop into larvae within the female. These larvae, called glochidia, are released into the water and must attach to a suitable fish host to survive. After attachment, epithelial tissue from the host fish grows over and encapsulates the glochidium, usually within a few hours. The glochidia then metamorphoses into a juvenile mussel within a few days or weeks. After metamorphosis, the juvenile is sloughed off as a free-living organism. Juveniles are found in the substrate where they develop into adults. (Arey, 1921; Lefevre and Curtis, 1912). When first discovered by Leeuwenhoek in 1697, glochidia were considered by some (but not by Leeuwenhoek) to be parasites living in the mussel‘s gills, and were given the scientific name Glochidium parasiticum by Fuller (1974). For nearly threequarters of a century, a lively debate ensued as to whether these ―agglomerations of animicules,‖ as some called them, were mussel parasites or mussel larvae. Houghton (1862) appears to have been the first to identify glochidia on fishes, and Fuller (1974) experimentally demonstrated their parasitic role and their true identity as larval mussels. The females of some Unioninae have structures resembling small fish, crayfish, or other prey that are displayed when the larvae are ready to be released. Other Unioninae display conglutinates, packets of glochidia that are trailed out in the stream current, attached to the mussel by a clear strand. These ―lures‖ may entice fish into coming in contact with glochidia, increasing the chances that glochidia will attach to a suitable host. Some Unioninae are winter breeders that carry eggs, embryos, or glochidia through the winter and into the spring, while others are summer breeders whose eggs are fertilized and glochidia released during one summer (Brusca and Brusca, 2003). North American freshwater Unioninae are historically divided into two behavioral groups based upon the duration that glochidia are held in the marsupia. Tachytictic or short-term breeders spawn in the spring or summer and release their glochidia later the same year, usually by July or August. Bradytictic or long-term breeders spawn in the summer or early autumn, form glochidia, and typically hold these larvae in the marsupium until the following spring or summer. But some otherwise ―bradytictic‖ individuals release glochidia in autumn or winter to overwinter on their hosts. They remain dormant on their host until a threshold temperature is reached the following spring, at which time they metamorphose and excyst (Watters and O‘Dee, 1999).

472

Diana Badiu, Rafael Luque and Ovidiu Teren

The purple wartyback (Cyclonoias tuberculata) is a tachytictic breeder with a reproductive period beginning in June and ending in August (summer breeder) (Badra, 2004). Glochidia remain on the fish host for a couple weeks to several months depending on the species and other factors. During this time the glochidia transforms into the adult form then drops off its host (Kat, 1984). Although the advantages of having fish hosts are not fully understood in which two factors are known to provide benefits. Similar to animal facilitated seed dispersal in plants, fish hosts allow mussels that are relatively sessile as adults to be transported to new habitat and allow gene flow to occur among populations. The fish host also provides a suitable environment for glochidia to transform in. Some of them are able to utilize many different fish species as hosts while others have only one or two known hosts. General known hosts for the purple wartyback are the yellow bullhead (Ameiurus natalis) and channel catfish (Ictalurus punctatus). These species were identified as hosts in laboratory experiments. It is possible that additional species are utilized as hosts in natural environments (Oesch, 1984).

Conservation and Management Eastern North America is the global centre of diversity for freshwater mussels with over 290 species. In a review of the status of U.S. and Canadian Union by the American Fisheries Society one third of these were considered endangered (Williams et al., 1993). Thirty-five Unioninae are thought to have gone extinct in recent times (Turgeon et al., 1998). There are forty five species native to Michigan. Nineteen of these are state-listed as endangered, threatened, or special concern (Box and Mossa, 1999). The decline of this group over the last couple hundred years has been attributed mainly to our direct and indirect impacts to aquatic ecosystems. Threats include habitat and water quality degradation from changes in water temperature and flow, the introduction of heavy metals, organic pollution such as excessive nutrients from fertilizers, pesticides and herbicides, dredging, and increased sedimentation due to excessive erosion (Fuller, 1974; Bogan 1993). High proportions of fine particles (sand and silt) were found to be a limiting factor regarding density and species richness across several watersheds in Lower Michigan (Badra and Goforth, 2002). Using certain agricultural practices such as conservation tillage, grass filter strips between fields and streams, and reforestation in the floodplain can help reduce the input of silt and other pollutants. Forested riparian zones help maintain a balanced energy input to the aquatic system, provide habitat for fish hosts in the form of large woody debris, reduce the input of fine particles by stabilizing the stream banks with roots, and provide shade which regulates water temperature (Walker et al., 2001). Due to the unique life cycle of this species, fish hosts must be present in order for reproduction to occur. The loss of habitat for these hosts can cause the extirpation of populations. Barriers to the movement of fish hosts such as dams and impoundments also prevent migration and exchange of genetic material among populations that helps maintain genetic diversity within populations (Bogan, 1993). Cyclonaias tuberculata is mainly found in rivers with definite riverine conditions and stronger current, like the Lake Erie drainage and the Kalamazoo, St. Joseph, Thornapple and Grand Rivers of the Lake Michigan drainage. It has also been recorded in the Menominee

Unionidae Freshwater Mussel Anatomy

473

River in the Upper Peninsula, Lake St. Clair drainage, the Detroit River and Lake Erie (Van der Schalie, 1938).

Anatomy of Subfamily Unioninae Unioninae bivalves or freshwater pearly-mussels serve as an exemplary system for examining many of the problems facing systematises and conservation biologists today. Most of the species and genera were described in the late 1800s and early 1900s, but few phylogenetic studies have been conducted to test conventional views of species and classification. The purple wartyback is up to 12.7 cm (5 inches) long, and is round. The shell is fairly thick, heavy and compressed. The anterior end is rounded, the posterior end somewhat angled. The dorsal margin is straight to slightly round and the ventral margin is broadly rounded (Oesch, 1984) Like other freshwater mussels from subfamily Unioninae, C. tuberculata have soft inner bodies and hard outer shells. The soft tissues include a large muscular foot used for locomotion, an enveloping mantle that secretes the shell, anterior and posterior adductor muscles that enable to the animal to close its shells, labial palps that move food particles to the mouth, and two pairs of gills. The gills have three functions: (1) respiration like fish, mussels use their gills to breathe, (2) filter feeding, the gills move food particles to the mouth, and (3) in females, the gills incubate baby mussels (larvae) until they are mature and ready to be released (Watters et al., 2009). The middle lobe of the mantle edge has most of a bivalve's sensory organs. In the mussel‘s foot are found paired statocysts, which are fluid filled chambers with a solid granule or pellet (a statolity). The statocysts help the mussel with georeception or orientation. Mussels are heterothermic, and therefore are sensitive and responsive to temperature (Cummings and Mayer, 1992). Unioninae in general may have some form of chemical reception to recognize fish hosts. How the purple wartyback attracts or if it recognizes its fish host is unknown (Watters et al., 2009). Internal organ systems include an open circulatory system powered by a heart; a digestive system that consists of mouth, stomach, gut, and anus; a decentralized nervous system that controls movement of the foot and adductor muscles; and reproductive organs that usually occur separately in male and female mussels (Bogan and Roe, 2008) (Figure 1). C. tuberculata species have two shells, or valves, arranged left and right. The earliest part of the shell is called the beak or umbo. The shell expands along the margins as the animal grows. Most freshwater mussels have a dorsal area called the hinge, which has interdigitating projections called teeth. These teeth serve to keep the shells aligned and prevent shearing during burrowing. The anterior- most teeth are called the cardinal (or pseudocardinal) teeth, whereas the posterior teeth are the lateral (or pseudolateral) teeth. Some Unioninae lack teeth all together. The shells are held together in life by two adductor muscles which close the shells. These muscles counteract the ligament, a non-living proteinaceous structure which acts as a spring to open the shells. The muscular foot protrudes from the anterior half of the shells; the siphons, the openings through which water enters and exits the shells, are located posteriorly (Watters et al., 2009).

474

Diana Badiu, Rafael Luque and Ovidiu Teren

Figure 1. The basic anatomy of freshwater Unioninae (here with foot, which is absent in adults) 1) (shell; 2) umbo; 3) digestive gland; 4) stomach; 5) cerebropleural ganglion; 6) anterior adductor muscle; 7) labial palp; 8) mouth; 9) foot; 10) mantle; 11 gonad; 12) intestine; 13) gills; 14) visceral ganglion; 15) anus; 16) posterior adductor muscle; 17) ligament; 18) kidney; 19) heart (adapted from Burch, 1975).

The shells have three different layers. The outer layer (called the periostracum) is made of organic material that may be yellow, green, brown, or black. The middle layer (prismatic layer) is made of elongate crystals of calcium carbonate (CaCO3). The lustrous inner layer (nacre or mother-of-pearl layer) is made of plate-like crystals of calcium carbonate and may be white, pink, salmon, or purple. The mussel's external shell is composed of two hinged halves or "valves" (Silverman et al., 1985). The valves are joined together on the outside by a ligament, and are closed when necessary by strong internal muscles. Mussel shells carry out a variety of functions, including support for soft tissues, protection from predators and protection against desiccation (Figure 2) (Walker et al., 2001). On the inner surface of the shells are scars, sites of attachment for various muscles, including the adductors and the pallial line, the linear scar where the mantle tissue is anchored to the shell. Freshwater mussels live by filter-feeding food from the surrounding water with their gills, or ctenidia. Because of their food-gathering function, these gills are much larger than is needed for respiration. North American species lack true siphons, or tubes for water intake and release, such that many species are confined to burrowing only to the posterior edge of the shell during much of the year. This renders them susceptible to predators, desiccation, temperature and other environmental extremes (Bauer and Wachtler, 2001) (Figure 3). Cyclonaias tuberculata (Rafinesque, 1820) is also filter feeders. The mussel use cilia to pump water into the incurrent siphon where food is caught in a mucus lining in the demibranchs. Particles are sorted by the labial palps and then directed to the mouth. Mussels

Unionidae Freshwater Mussel Anatomy

475

have been cultured on algae, but they may also ingest bacteria, protozoans and other organic particles (Arey, 1921; Meglitsch and Schram, 1991; Watters et al., 2009).

Figure 2. Morphology of a freshwater Cyclonaias tuberculata (Rafinesque, 1820), illustrating structures and terminology. a. exterior of right valve; b. interior of left valve (adapted from Burch, 1975).

The periostracum (outer shell layer) has several pustules, and ridges on the dorsal wing. Younger specimens are yellowish to greenish brown, while older specimens tend to be more uniformly (Oesch, 1984) (Figure 4). The beak cavity is very deep. The nacre is almost always purple, and rarely white (Cummings and Mayer, 1992; Oesch, 1984; Watters et al., 2009). In Michigan, this species can be confused with the pimpleback. The pimpleback usually has a prominent green ray, lacks a dorsal wing and purple nacre (Oesch, 1984).

476

Diana Badiu, Rafael Luque and Ovidiu Teren

Like most bivalves C. tuberculata has a large organ called a foot, which disappear in oldness. This foot is large, muscular, and generally hatchet-shaped. It is used to pull the animal through the substrate (typically sand, gravel, or silt) in which it lies partially buried. It does this by repeatedly advancing the foot through the substrate, expanding the end so it serves as an anchor, and then pulling the rest of the animal with its shell forward. It also serves as a fleshy anchor when the animal is stationary (Watters et al., 2009).

Figure 3. Morphology of a general freshwater mussel shells (adapted from Watters et al., 2009).

Figure 4. Morphology of a general freshwater mussel shells (adapter from Watters et al., 2009).

Unionidae Freshwater Mussel Anatomy

477

Shell shape is variable and somewhat subjective in C. tuberculata. A kidneyshell may appear elongate as a juvenile, but become something entirely different as an adult. While shape is an ideal starting point, its best used as just a piece of the identification puzzle. Figures 5, 6, 7, 8 and 9 summarize some examples (Lefevre and Curtis, 1912; Van der Schalie, 1938).

Figure 5. Eliptical shape of a general freshwater mussel shell (adapted from Bogan & Roe, 2008).

Figure 6. Elongate shape of a general freshwater mussel shell (adapted from Bogan & Roe, 2008).

Figure 7. Round shape of a general freshwater mussel shell (adapted from Bogan & Roe, 2008).

478

Diana Badiu, Rafael Luque and Ovidiu Teren

Figure 8. Quadrate shape of a general freshwater mussel shell (adapted from Bogan & Roe, 2008).

Figure 9. Triangular shape of a general freshwater mussel shell (adapted from Bogan & Roe, 2008).

To distinguish left from right the posterior ridge and beak will be orientated so that diagonals drawn along the posterior ridge converge anteriorly and diverge posteriorly (Figure 10). The pseudocardinal teeth (if present) will always be anterior of the lateral teeth. The age of mussels can be determined by looking at annual rings on the shell, but generally the maximum life-span is not longer than 25 years. However, no demographic data on this species has been recorded. Unioninae in general and C. tuberculata especially are rather sedentary, although they may move in response to changing water levels and conditions. Although not thoroughly documented, the mussels may vertically migrate to release glochidia and spawn. Often this species is buried under the substrate (Oesch, 1984). Unioninae food continues to be the subject of debate. Allen (1914, 1921) and Churchill and Lewis (1924) found the gut to contain mostly diatoms and other algae, although the diatoms passed through the digestive system intact. However, Imlay and Paige (1972) believed that mussels fed on bacteria and protozoans. Bisbee (1984) found different

Unionidae Freshwater Mussel Anatomy

479

proportions of algal species in the guts of two mussel species, suggesting that not all species fed upon the same food.

Figure 10. Shell orientation (wabash pigtoe, Fusconaia flava) (adapted from Van Der Schalie, 1938).

Recently, Nichols and Garling (1998) demonstrated that mussels were omnivores, feeding on detritus and zooplankton, as well as algae and bacteria. Newly metamorphosed juveniles do not filter-feed with their gills, but may feed on interstitial nutrients using cilia on their foot, gills, and mantle. This stage may last several years before changing to a filterfeeding mode (Tankersley et al., 1997). Yeager et al. (1993) believed that food for juveniles consisted of interstitial bacteria, yet an algal mix including silt was suggested as food by Gatenby et al. (1993). Small amounts of silt have been found to enhance survivorship in cultured mussels, both adults and juveniles (Hudson and Isom, 1984; Hove and Neves, 1991), probably by introducing bacteria and zooplankton. Gametogenesis, the formation of eggs and sperm, is initiated by changes in water temperature and/or light levels. It appears to be threshold temperatures or light levels that cue reproductive events. For those species relying on some upper temperature threshold, constant low water temperatures, such as are found below some dams, may prevent reproduction from ever taking place. In such conditions, populations of adult mussels may live out their normal lives and die without ever producing offspring (Howard, 1915; Gordon and Smith, 1990). Typically, sexes are separate, although small numbers of hermaphrodites have been found in many species (Fischerstrom, 1761; Van der Schalie, 1966; 1970; Heard, 1979). Males liberate sperm into the water, sometimes as spherical (Lynn, 1987; Barnhart and Roberts, 1997) or disc-shaped aggregates termed spermatozeugmata. Females downstream take up the sperm with incoming water. Fertilization success may be related to population density, with a threshold density required for any reproductive success to occur (Downing et al., 1993). Eggs are fertilized in the suprabranchial chambers of the gills and then apparently are moved to the marsupia. The marsupia are regions of the gill that act as brood chambers for the glochidia. Their placement and structure vary from genus to genus and have been used as key taxonomic characteristics. The marsupium may change in shape and structure during the breeding season (Smith, 1979; Kays et al., 1990; Richard et al., 1991).

480

Diana Badiu, Rafael Luque and Ovidiu Teren

During this time, the marsupium either does not function as a site of respiration (Richard et al., 1991) or operates at greatly reduced efficiency (Allen, 1921; Tankersley and Dimock, 1992). This region may remain non-respiratory during the non-breeding season as well (Richard et al.,1991). The developing embryos are physiologically isolated in the marsupium from the outside water (Kays et al., 1990). Muscles associated with the water tubes may be responsible for maintaining this isolation. Cyclonaias tuberculata is listed as Endangered in Wisconsin, Threatened in Illinois, Iowa and Minnesota, and significantly rare in North Carolina. In Michigan it is listed as Special Concern. The IUCN Red List considers this species Lower Risk, Near Threatened.

CONCLUSION AND FUTURE RESEARCH Advancement of our knowledge of the subfamily Unioninae in the areas of systematics anatomy and evolution will require a renewal of effort in already established areas of research, reviewed earlier here, and a concerted effort aimed at the development and application of new tools. Therefore, the fossil record of freshwater bivalves should be carefully reviewed, and phylogenetic hypotheses including fossil taxa must be developed. In conclusion, the freshwater malacological community has made great strides in understanding the life history, distribution, ecology and anatomy of unioniform bivalves, but we have really only laid the groundwork for the future. Exploration of new genetic data sources must continue, and new methods of describing the shells and the anatomy of freshwater mussels must be developed. However, the importance of collecting basic naturalhistory information cannot be overstated. The study of systematics and evolution is an historical endeavor and one that seeks to integrate various sources of data to develop hypotheses that are then subjected to further tests. Only by fostering research along the many diverse lines of interest in freshwater mussels will we begin to see real progress toward a more complete understanding of them.

REFERENCES Allen, W.R (1914). The food and feeding habits of freshwater mussels. Biological Bulletin, 27, 127–147. Allen, W.R. (1921). Studies of the biology of freshwater mussels. Biol. Bull., 40, 210–241. Arey, L. (1921). An experimental study on glochidia and the factors underlying encystment. J. Exp. Zool., 33, 463-499. Badra, P. (2004). Special Abstract for Cyclonaias tuberculata (Purple wartyback). Lansing, MI: Michigan Natural Features Inventory. Accessed at http://web4.msue.msu.edu/mnfi/abstracts/aquatics/Cyclonaias_tuberculata.pdf. Badra, P.J.; Goforth, R.R. (2002). Surveys of Native Freshwater Mussels in the Lower Reaches of Great Lakes Tributary Rivers in Michigan. Report number MNFI 200203. Report to Michigan Dept. of Environmental Quality, Coastal Zone Management Unit, Lansing, MI. 39pp.

Unionidae Freshwater Mussel Anatomy

481

Barnhart, M.C.; Roberts, A.D. (1997). Reproduction and fish hosts of unionids from the Ozark uplifts. 16–20. In: K.S. Cummings, A.C. Buchanan, C.A. Mayer and T.J. Naimo (eds.), Conservation and management of freshwater mussels II: Initiatives for the future. Proceedings of a UMRCC symposium, St. Louis, MO: Upper Mississippi River Conservation Committee, Rock Island, IL. Bauer, G.; Wachtler, K. (2001). Ecology and evolution of the naiads. 83-388. In: G. Bauer, Wachtler K., (eds.), Ecology and evolution of the freshwater mussels Unionoida. Ecological Studies, Vol. 145. Berlin: Springer-Verlag. Bisbee, G.D. (1984). Ingestion of phytoplankton by two species of freshwater mussels, the black sandshell, Ligumia recta, and the three ridge, Amblema plicata, from the Wisconsin River in Oneida County, Wisconsin. Bios. 55, 219–225. Bogan, A.E. 1993. Freshwater bivalve extinctions (Mollusca: Unionoida): A search for causes. Am. Zool., 33, 599-609. Bogan, A.E.; Roe, K.J. (2008). Freshwater bivalve (Unioniformes) diversity, systematics, and evolution: status and future directions, J. North Am. Benthol. Soc., 27(2), 349-369. Box, J.B.; Mossa, J. (1999). Sediment, land use, and freshwater mussels: prospects and problems. J. North Am. Benthol. Soc.,18, 99-117. Brusca, R.; Brusca, G. (2003). Invertebrates. Sunderland, Massachusetts: Sinauer Associates, Inc., 365pp. Churchill, E.P.; Lewis, SI. (1924). Food and feeding in fresh water mussels. Bulletin of the United States Bureau of Fisheries, 39, 439–471. Cummings, K., Mayer C., 1992. Field guide to freshwater mussels of the Midwest. Champaign, Illinois: Illinois Natural History Survey Manual 5. Accessed at http://www.inhs.uiuc.edu/cbd/collections/mollusk/fieldguide.html. Downing, J.A.; Rochon, Y.; Perusse, M. (1993). Spatial aggregation, body size, and reproductive success in the freshwater mussel Elliptio complanata. J. North Am. Benthol. Soc , 12, 148–156. Fischerstrom, I. (1761). De concharum margaritiferarum natura. Commentarii de Rebus in Scientia Naturali et Medicina Gestis, 10, 204–205. Fuller, S. (1974). Clams and mussels (Mollusca: Bivalvia). In: Hart, C.W. Jr., Fuller S.L.H. eds. Pollution ecology of freshwater invertebrates. Academic Press, New York, 228-237. Gatenby, C.M.; Neves RJ.; Parker BC. (1993). Preliminary observations from a study to culture recently metamorphosed mussels, J.NorthAm.Benthol.Soc., 10, 128 -130. Gordon, M.E.; Smith, DG. (1990). Autumnal reproduction in Cumberlandia monodonta (Unionoidea: Margaritiferidae). T.Am.Microsc.Soc., 109, 407–411. Graf, D.L.; Cummings, K.S. (2006). Palaeoheterodont Diversity (Mollusca: Trigonioida + Unionoida): what we know and what we wish we knew about freshwater mussel evolution. Zool. J.Linn.Soc., 148, 343-394. Heard, W.H.; Vail, V.A. (1976). Anatomical systematics of Etheria elliptica (Pelecypoda, Mycetopodidae), Malacol.Rev., 9, 15-24. Heard, W. H. (1979). Hermaphroditism in Elliptio (Pelecypoda: Unionidae). Malacol. Rev., 12, 21–28. Houghton, W. (1862). On the parasitic nature of the fry of Anodonta cygnea. Quart.J.Micros.Sci. (n.s.), 2, 162–168.

482

Diana Badiu, Rafael Luque and Ovidiu Teren

Hove, M.; Neves, R. (1991). Distribution and life history of the James River spinymussel. Endangered Species Buletin, 16, 9. Howard, A.D. (1915). Some exceptional cases of breeding among the Unionidae. The Nautilus, 29, 4–11. Hudson, R.G.; Isom, B.G. (1984). Rearing juveniles of the freshwater mussels (Unionidae) in a laboratory setting. The Nautilus, 98, 129–135. Imlay, M.J., Paige, M.L., (1972). Laboratory growth of freshwater sponges, unionid mussels, and sphaeriid clams. Progressive Fish Culturist, 34, 210–216. Kat, P.W. (1984). Parasitism and the Unioniacea (Bivalvia). Biol.Rev. 59, 189-207. Kays, W.T.; Silverman, H.; Dietz, T.H. (1990). Water channels and water canals in the gill of the freshwater mussel, Ligumia subrostrata: Ultrastructure and histochemistry. J.Exp.Zool., 254, 256–269. Lefevre, G.; Curtis, W. (1912). Experiments in the artificial propagation of fresh-water mussels. Proc. Internat. Fishery Congress, Washington. Bull. Bur. Fisheries, 28, 617-626. Lynn, J.W. (1987). Release of motile spermatophores from the freshwater mussel Anodonta grandis. Am.Zool. 27, 90A [abstract]. McMichael, D.F., Hiscock, I.D., (1958), A monograph of the freshwater mussels (Mollusca: Pelicypoda) of the Australian Region. Aust.J.Mar.Freshwater Res., 9, 372-507. McMichael, D.F., Iredale, T. 1959, The land and freshwater Mollusca of Australia, In: Keast A., Crocker RL., Christian CS. (eds.), Biogeography and ecology in Australia, Dr. W. Junk. The Hagne, 224-245. Meglitsch, P.; Schram, F. (1991). Invertebrate Zoology, Third Edition. New York, NY: Oxford University Press, Inc. Nichols, S.J., Garling D., (1998). Food web dynamics of Unionidae in a canopied river and a non-canopied lake. Program and Abstracts, Freshwater Mussel Symposium, Columbus, OH, 28–29. Oesch, R.D. (1984). Missouri Naiades: A Guide to the Mussels of Missouri. Missouri Department of Conservation. 270 pp. Richard, P.E.; Dietz TH.; Silverman H. (1991). Structure of the gill during reproduction in the unionids Anodonta grandis, Ligumia subrostrata, and Carunculina parva texasensis. Can.J.Zool., 69, 1744–1754. Silverman, H.; Steffens, W.L.; Dietz, T.H. (1985). Calcium from extracellular concretions in the gills of freshwater unionid mussels is mobilized during reproduction. J.Exp.Zool., 236, 137–147. Smith, D.G. (1979). Marsupial anatomy of the demibranch of Margaritifera margaritifera (Lin.) in northeastern North America (Pelecypoda: Unionacea). J.Molluscan Stud., 45, 39–44. Tankersley, R.A.; Hart, J.J.; Weiber, M.G. (1997). Developmental shifts in feeding biodynamics of juvenile Utterbackia imbecillis (Mollusca: Bivalvia). Pp. 282–283. In: Cummings KS., Buchanan AC., Mayer CA., Naimo TJ. (eds.), Conservation and management of freshwater mussels II: Initiatives for the future. Proceedings of a UMRCC symposium, St. Louis, MO. Upper Mississippi River Conservation Committee, Rock Island, IL. Tankersley, R.A.; Dimock, R.V. (1992). Quantitative analysis of the structure of the marsupial gills of the freshwater mussel Anodonta cataracta. Biol. Bull., 182, 145–154.

Unionidae Freshwater Mussel Anatomy

483

Turgeon, D.D.; Quinn, J.F.Jr.; Bogan, A.E.; Coan, E.V.; Hochberg, F.G.; Lyons, W.G.; Middelsen, P.M.; Neves, R.J., Roper, C.F.E.; Rosenberg, G.l; Roth, B.; Scheltema, A.; Thompson, F.G.; Vecchione, M.; Williams, J.D. (1998). Common and scientific names of aquatic invertebrates from the United States and Canada: mollusks, 2nd edition. American Fisheries Society, Special Publication 26, Bethesda, Maryland. Van der Schalie, H. (1966). Hermaphroditism among North American freshwater mussels. Malacologia, 5, 77–78. Van der Schalie, H. (1970). Hermaphroditism among North American freshwater mussels. Malacologia, 10, 93–112. Van der Schalie, H. (1938). The naiad fauna of the Huron River, in southeastern Michigan. Miscellaneous Publications of the Museum of Zoology, University of Michigan, 40, 1-83. Walker KF., Byrne M., Hickey W., Rober D.S. (2001). Ecology and evolution of freshwater mussels Unionoida, In: Freshwater Mussels (Hyriidae) of Australasia, Bauer G. and Wachtles E. ed., p.6. Watters, G.T.; Hoggarth, M.A.; Stansbery, D.H. (2009). The freshwater mussels of Ohio, Sheridon Books Inc., The Ohio University Press, Columbus. Watters, G.T.; O‘Dee, SH. (1999). Glochidia of the freshwater mussel Lampsilis overwintering on fish hosts. J. Molluscan Stud., 65, 453–459. Williams, J.D.; Warren, M.L.Jr.; Cummings, K.S.; Harris, J.L.; Neves, R.L. (1993). Conservation status of freshwater mussels of the United States and Canada. Fisheries, 18, 6-22. Yeager, M.M.; Cherry, D.S.; Neves, R. (1993). Interstitial feeding behavior of juvenile unionid mussels. ASB Bulletin, 40, 113-117.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 23

THE CYTOGENETICS OF MYTILUS MUSSELS Andrés Martínez-Lage and Ana M. González-Tizón Departamento de Biología Celular y Molecular, Universidade da Coruña, La Coruña, Spain

Mussels within the genus Mytilus are one of the most thoroughly studied marine molluscs at both the ecological and physiological levels. A great number of studies on morphology, morphometry, proteins and DNA markers have been performed, but origin and taxonomy of this genus still remains unclear. Based on these studies, different authors recognised the existence of different species, semi-species or subspecies within this genus. For example, according to McDonald et al. (1991) these are five taxa: M. edulis, M. galloprovincialis, M. trossulus, M. californianus and M. coruscus, and Gosling (1992) includes M. (edulis) desolationis as a subspecies of M. edulis. Data from different mitochondrial and nuclear DNA markers have revealed strong biogeographic and phylogenetic relationships among M. edulis, M. galloprovincialis and M. trossulus -these three forming the M. edulis complex- (Varvio et al. 1988; Koehn 1991; McDonald et al. 1991; Rawson and Hilbish, 1998; Quesada et al. 1998; Martinez-Lage et al. 2002; Riginos and McDonald 2003; Riginos and Cunningham 2005; Pereira Silva and Skibinski 2009). According to Blot et al. (1988) and Gérard et al. (2008) M. desolationis seems to be a ―semispecies in the super-species Mytilus edulis complex‖, whereas M. californianus and M. coruscus constitute two separate species as shown by the results obtained from the 18S ribosomal DNA (Kenchington et al. 1995), mitochondrial DNA (Hilbish et al. 2000), and satellite DNA Apa I (Martínez-Lage et al. 2002, 2005) analyses. The three species included in the M. edulis complex hibridise to a greater or lesser extent in the regions where they cohabit. Mytilus edulis and M. galloprovincialis hybrids occur off the western coast of Europe from the Bay of Biscay along the French coast to Great Britain and Ireland (Skibinski et al. 1978, Coustau et al. 1991, Gosling, 1992; Gardner 1996; Bierne et al. 2003). M. galloprovincialis x M. trossulus have been found on the Pacific coast of North America (McDonald and Koehn 1988; Rawson et al. 1999; Wonham 2004), and M. trossulus x M. edulis in Newfoundland (Toro et al. 2002), in the Danish straits separating the Baltic and North Seas (Väinölä and Hvilsom 1991; Riginos and Cunningham, 2005), in Nova Scotia (Saavedra et al. 1996; Comesaña et al. 1999), and recently in the Netherlands

486

Andrés Martínez-Lage and Ana M. González-Tizón

(Śmietanka et al. 2004), possibly in the Norwegian fjords near Bergen (Ridgway and Nævdal, 2004), and in Scotland (Beaumont et al. 2008, Zbawicka et al 2010). Due to the ecological importance, the worldwide distribution and its high economic value in aquaculture, cytogenetic analyses of Mytilus species are of a special interest. The knowledge on cytogenetic characteristics gives information about the number and morphology of chromosomes, differential distribution of euchromatin-heterochromatin regions, chromosomal rearrangements, provides new data about phylogenetic relatedness between taxa, and helps to clarify taxonomy. At present, a great variety of banding techniques are available to analyse chromosomes, allowing a thorough knowledge of the genetics of numerous animal and plant species. However, this is not the case of molluscs and particularly of bivalves. In these species the development of banding techniques has been hampered by a lack of in vitro cell lines, the high degree of chromosome condensation and their small size that, subsequently, leads to the failure of a satisfactory banding. Cytogenetic studies of Mytilus mussels have mainly provided information about genome size (C-value), chromosome number and morphology, location of ribosomal loci, and identification of heterocromatin-euchromatin regions. Genome size or C-value, i.e., the total amount of DNA within the haploid genome, is a valuable character for evolutionary studies. C-value is species specific, although shows high intraespecific and interspecific variability (C- value paradox). Although C- value does not show relation neither with systematics and phylogeny of species nor with chromosome number and organismal complexity, it is a very important factor in evolution and sequence-based genomic analyses. ―Mutation pressure‖ and ―optimal DNA‖ theories are the most accepted to explain the C-value paradox. Mutation pressure theories consider the large portion of non-coding DNA as ―junk‖ or ―selfish‖ DNA, whereas optimal theories emphasize the strong link between DNA content and cell and nuclear volumes (for a review see Ryan Gregory 2001). In genus Mytilus, genome size was determined for M. edulis (Hinegardner 1974; Rodríguez-Juiz et al. 1996), M. galloprovincialis (Ieyama et al. 1994; Rodríguez-Juiz et al. 1996), M. trossulus (González-Tizón et al. 2000), M. californianus (Hinegardner 1974; González-Tizón et al. 2000), and M. coruscus (Ieyama et al. 1994), with values ranging from 1.35 to 1.91 picogrames (table 1). First studies on Mytilus species concerned data on their chromosome number, all of them having a diploid chromosome number of 2n=28. However, karyotypes showed differences in chromosome morphology. For chromosome classification, authors followed the criteria stablished by Levan et al. (1964) [meaning that the chromosomes should be previously measured to determine the centromeric index, CI, (i.e., length of short arm/ total chromosome length)]. Chromosomes are classified as metacentric (m) when CI is 37.5 - 50.0; submetacentric (sm) when values are 25.0 - 37.5; subtelocentric (st) if the ratio is 12.5 - 25.0; and telocentric (t) when CI ranges from 0.0 to 12.5. Karyotypes for M. edulis from the different European localities studied always show 6 pairs of metacentric chromosomes and 8 of submetacentric or subtelocentrics (figure 1a) (Thiriot-Quiévreux 1984; Dixon and Flavell 1986; Cornet 1993; Insua et al. 1994; MartínezLage et al. 1995, 1996). However M. galloprovincialis and M. trossulus from different localities showed chromosome polymorphisms (differences in morphology). Interestingly, M. galloprovincialis from Atlantic coasts and from a big part of the Mediterranean Sea and M. edulis have identical karyotypes (figure 1b) (Dixon and Flavell 1986; Pasantes 1990; Martínez-Lage et al. 1994, 1996), whereas those from Gulf of Lion and from the east coast of

The Cytogenetics of Mytilus Mussels

487

the Iberian Peninsula show karyotypes with 5 metacentric chromosome pairs and 9 submetacentric or subtelocentrics (Thiriot-Quiévreux 1984; Insua et al. 1994; Martínez-Lage et al. 1996). Mytilus trossulus from Baltic Sea have 6 metacentric and 8 submetacentric or subtelocentric pairs (figure 1c) (Insua et al. 1994; Martínez-Lage et al. 1995, 1996; Wolowicz and Thiriot-Quiévreux 1997), and those from west America show 7 metacentric and 7 submetacentric or subtelocentric pairs (Martínez-Lage et al. 1997) (figure 1d). a)

1

2

3

4

c)

1

5

2

3

4

5

7

8

9

10

11

12

13

14

6

7

8

9

10

2

3

4

5

6

7

8

9

1

M. galloprovincialis

2

3

4

d)

11

12

13

14

1

5

10

11

12

13

14

11

12

13

14

1

6

7

8

9

10

11

12

13

14

M. trossulus (America)

2

3

4

5

f)

M. desolationis

g)

1

6

M. trossulus (Europe)

e)

1

b)

M. edulis

6

7

8

9

10

11

12

13

14

10

11

12

13

14

M. coruscus

2

3

4

5

6

7

8

9

M. californianus

2

3

4

5

6

7

8

9

10

Figure 1. Idiograms of the six mussel Mytilus species and mapping of ribosomal loci in the M. edulis, M. galloprovincialis, M. trossulus and M. californianus: black blocks correspond to 18S+5.8S+28S ribosomal loci which always are detected; grey blocks indicate the polymorphic 18S+5.8S+28S ribosomal loci; striped blocks show the 5S ribosomal loci. Grey circles correspond to the positive chromomycin A3 bands (guanine-citosine rich regions) in the three European Mytilus. (Based on Martínez-Lage et al. 1994, 1995, 1996, 1997; Insua et al. 1994, 2001; Thiriot-Quievreux 1984; Ieyama 1984; Martínez-Expósito et al. 1997; Insua and Mendez 1998; González-Tizón et al. 2000).

488

Andrés Martínez-Lage and Ana M. González-Tizón Table 1. C-values (given in picogrames) for the Mytilus species analysed

The mussel M. desolationis has 6 metacentric and 8 submetacentric or subtelocentric chromosomes (figure 1e) (Thiriot-Quiévreux 1984), whereas M. coruscus possess 5 metacentrics and 9 submetacentrics or subtelocentrics (figure 1f) (Ieyama 1984). Lastly, karyotype of M. californianus consists of 7 metacentric and 7 submetacentric pairs (figure 1g) (Martínez-Lage et al. 1997). None of the karyotypes of these Mytilus species have showed the presence of sexual chromosomes. Banding patterns are very scarce in Mytilus species. First of being applied on chromosome metaphases were sister chromatid exchanges (SCEs) on M. edulis as an approach to detect chromosome damage caused by environmental mutagens (Dixon and Clark 1982; Dixon 1983). Afterwards, ―classical‖ bandings (as C-, G-, R-, fluorochrome stainings, and Ag-NORs) and molecular banding (fluorescent in situ hybridisation) were applied. Longitudinal banding patterns on M. galloprovincialis chromosome are restricted to a ―Gbanding-like‖ obtained after treatment with 2xSSC solution (Méndez et al. 1990), G-bands using trypsin enzyme (Martínez-Lage et al. 1994), and R-banding by treatment with BrdU (Martínez-Expósito et al. 1994), all of them with very limited reproducibility. C- banding patterns and chromosome staining with fluorochromes as chromomycin A3 or DAPI, allowed the location of heterochromatin (Adenine-Timine rich) and/or euchromatin (Guanine-Citosine rich) regions in M. edulis, M. galloprovincialis and M. trossulus. Heterochromatin in interphase nuclei and chromosomes of M. edulis were initially performed by Dixon et al. (1986) and Dixon and McFadzen (1987). Later, in M. galloprovincialis, Martínez-Lage et al. (1994), by means of the combined use of C-banding, staining with the fluorochromes chromomycin A3 and DAPI, and chromosome treatment with some restriction endonucleases (REs) described different types of heterochromatin. The treatment of M. galloprovincialis chromosomes with REs showed that these enzymes acted differentially and determined specific banding patterns on the chromosome complement, and also the existence of C-heterochromatin heterogeneity in mussel chromosomes. Later, C-banding, Ag-NORs and fluorochrome stainings on M. edulis, M. galloprovincialis and M. trossulus identified changes in the constitutive heterochromatin among these species, allowing the identification of these three mussels (Martínez-Lage et al. 1995). These analyses proved that Mytilus

The Cytogenetics of Mytilus Mussels

489

possess small amounts of constitutive hetechromatin. A posterior study of the C-band polymorphism was carried out in M. galloprovincialis by Pasantes et al. (1996). The silver staining method applied on chromosome metaphases allows the detection of the nucleolar organisers regions (NORs) which were active at the precedent interphase. Chromosomal Ag-NORs were obtained for M. edulis, M. galloprovincialis, M. trossulus and M. californianus by different authors. With the development of the molecular FISH techniques, mapping of major ribosomal loci (18S-5.8S-28S) was more reliable, and extensively applied in mussels and other several bivalve species. Results obtained from AgNORs and FISH revealed that in M. edulis, M. galloprovincialis, M. trossulus and M. californianus, these loci locate on telomeric or subtelomeric regions of metacentric and/or submetacentric/subtelocentric chromosomes in a number varying from 4 to 6 (figure 1) (Insua et al. 1994, 2001; Martínez-Expósito et al. 1994, 1997; Martínez-Lage et al. 1995, 1997; Insua and Méndez 1998; González-Tizón et al. 2000). FISH to locate the minor ribosomal loci (5S rRNA) was performed in M. galloprovincialis and M. edulis (Insua et al. 2001), which displayed two loci on one metacentric chromosome pair (occasionally, some metaphases showed one additional locus on another metacentric pair) (figure 1). Lastly, FISH was used to locate the telomeric repeat arrays (Plohl et al. 2002), and the histone H1 and the core histones H2A-H2B-H3-H4 in M. galloprovincialis (Eirín-López et al. 2002, 2004). These histone loci mapped at telomeric/subtelomeric regions on three chromosome pairs. Results obtained from cytogenetic data let us observe great karyotype similarities. First, M. edulis and M. galloprovincialis are nearly identical considering karyotypes, and the number and location of ribosomal loci (figure 1), but differences in C-bands are clear (figure 2). However, we must mention here that the number of C-bands varies depending on the material used; it is high when using chromosomes from nauplius larvae (Martínez-Lage et al. 1995), but lower when using chromosomes from adults. Second, karyotype differences are more pronounced between M. trossulus from American and European coasts, not only regarding to the chromosome morphology but also the location of ribosomal loci. Maybe, chromosome pair 9 of M. trossulus from American coasts and chromosome pair 8 from the European populations be alike in morphology and location of the major ribosomal loci, but the rest of chromosomes and the locations of ribosomal loci are different (figure 1). Third, the karyotype of M. californianus is more similar to M. trossulus than to the rest of Mytilus, but both species can be clearly differentiated by karyotyping. Fourth, cytogenetic analyses in M. desolationis and M. coruscus are limited exclusively to the description of karyotypes, which unravel obvious karyotype differences among them and the rest of Mytilus analysed. Karyotype differentiation is an important mechanism for reproductive isolation and speciation (Navarro and Barton 2003). Closely related species often differ by chromosome rearrangements that might give problems at meiosis and to reduce the fertility of F1 hybrids, and thus to confer postzygotic isolation. Genetic isolation is more likely to be accomplished by sucessive chromosome rearrengements (mainly inversions), each of which slightly reduces fertility, than by a single substitution that reduces it severely (White 1978; Walsh 1982; King 1993; Futuyma, 1998). Despite these genetic mechanisms, the existence of hybrids among different Mytilus species is well documented. Hybrid M. trossulus x M. galloprovincialis populations have been described on the Pacific coast of North America (McDonald and Koehn 1988; Rawson et al. 1999; Wonham 2004), M. edulis x M. trossulus in European and

490

Andrés Martínez-Lage and Ana M. González-Tizón

American coasts (Toro et al. 2002; Riginos and Cunningham 2005), and M. edulis x M. galloprovincialis in different European coasts (Gardner 1996; Bierne et al. 2003). a)

M. edulis

c)

M. trossulus (Europe)

b)

M. galloprovincialis

Figure 2. Idiograms for C-banding in Mytilus edulis, M. galloprovincialis and M. trossulus. Black and grey blocks indicate the intensities of the C-bands. (Based on Martínez-Lage et al. 1994, 1995).

The existence of hybrid populations in some of Mytilus species seems to be in accordance with chromosomal rearrangements producing balanced meiosis, in which normal segregation of the meiotic products occurs, but they will no longer be able to form a postmating isolating mechanisms, and will generally result in chromosomal polymorphisms (King 1987). The high similarity in chromosome morphology between M. edulis and M. galloprovincialis easily explains the occurrence of hybrids which are able to produce F2 and backcrosses. Karyotype similarity would also explain the high viability of the European M. edulis x M. trossulus hybrid populations. So, chromosome similarity would reduce the probabilities of unbalanced meiosis and, subsequently, not many acentric and dicentric meiotic products will be produced. This would explain why no strong reproductive barriers are currently acting to maintain the integrity of the European M. trossulus genome (Riginos and Cunningham 2005). However, the differences in karyotypes of M. trossulus and M. edulis from American coasts would produced unbalanced meiosis which cause non-viable gametes in a very high proportion, and so it would explain why M. trossulus x M. edulis hybrids are rare and only appear in a frequency of 0%-2.5% (Saavedra et al. 1996; Rawson et al. 2001). In conclusion, cytogenetic studies are needed to investigate the chromosome rearrangements occurred in Mytilus. There is still quite to be done regarding all these mussels, specially on M. galloprovincialis from west American coast, M. trossulus from east American coast, M. desolationis and M. coruscus. Karyotype analyses and chromosome banding give information on chromosomal rearrangements playing a role in the majority of speciation events and, subsequently, explain the effects of the rearrangements on the fitness of heterozygous hybrids.

The Cytogenetics of Mytilus Mussels

491

ACKNOWLEDGMENTS The authors thank Joaquín Vierna for his comments.

REFERENCES Beaumont AR, Hawkins MP, Doig FL, Davies IM, Snow M (2008) Three species of Mytilus and their hybrids identified in a Scottish Loch: natives, relicts and invaders? Journal of Experimental Marine Biology and Ecology 16, 512-524. Bierne N, Borsa P, Daguin C, Jollivet D, Viard F, Bonhomme F, David P (2003) Introgression patterns in the mosaic hybrid zone between Mytilus edulis and M. galloprovincialis. Molecular Ecology 12, 447-461. Blot M, Thiriot-Quiévreux C, Soyer J (1988) Genetic relationships among populations of Mytilus desolationis from Kerguelen, M. edulis from the North Atlantic and M. galloprovincialis from the Mediterranean. Marine Ecology Progress Series 44, 239-247. Comesaña AS, Toro JE, Innes DJ, Thompson RJ (1999) A molecular approach to the ecology of a mussel (Mytilus edulis-M. trossulus) hybrid zone on the east coast of Newfoundland. Canadian Marine Biology 133, 213-221. Cornet M (1993) A short-term culture method for chromosome preparation from somatic tissues of adult mussel (Mytilus edulis). Experientia 49, 87-90. Coustau C, Renaud F, Delay B (1991) Genetic characterisation of the hybridisation between Mytilus edulis and Mytilus galloprovincialis on the Atlantic coast of France. Marine Biology 111, 87-93. Dixon DR (1983) Sister chromatid exchange and mutagens in the aquatic environment. Marine Pollution Bulletin 14, 282-284. Dixon DR, Flavell N (1986) A comparative study of the chromosomes of Mytilus edulis and Mytilus galloprovincialis. Journal of the Marine Biological Association of the United Kingdom 66, 219-228. Dixon DR, Clark KR (1982) Sister chromatid exchange: a sensitive method for detecting damage caused by exposure to environmental mutagens in the chromosomes of adult Mytilus edulis. Marine Biological Letters 3, 163-172. Dixon DR, McFadzen IRB (1987) Heterochromatin in the interphase nuclei of the common mussel Mytilus edulis L. Journal of Experimental Marine Biology and Ecology 112, 1-9. Dixon DR, McFadzen IRB, Sisley K (1986) Heterochromatin marker regions (nucleolar organisers) in the chromosomes of the common mussel Mytilus edulis (Mollusca: Pelecypoda). Journal of Experimental Marine Biology and Ecology 97, 205-212. Eirín-López JM, González-Tizón A, Martínez-Lage A, Méndez J (2002) Molecular and evolutionary analysis of mussel histone genes (Mytilus spp.): possible evidence of an ―orphon origin‖ for H1 histone genes. Journal of Molecular Evolution 55, 272-283. Eirín-López JM, Ruíz MF, González-Tizón A, Martínez-Lage A, Sánchez L, Méndez J (2004) Molecular evolutionary characterization of the mussel Mytilus histone multigene family: first record of a tandemly repeat unit of five histone genes containing an H1 subtype with ―orphon‖ features. Journal of Molecular Evolution 58, 131-144.

492

Andrés Martínez-Lage and Ana M. González-Tizón

Futuyma DJ (1998) Evolutionary Biology. Sinauer Associates, Inc. Sunderland, Massachussets. Gardner JPA (1996) The Mytilus edulis species complex in southwest England: effects of hybridization and introgression upon interlocus associations and morphometric variation. Marine Biology 125, 385-399. Gérard K, Bierne N, Borsa P, Chenuil A, Féral JP (2008) Pleistocene separation of mitochondrial lineages of Mytilus spp. mussels from Northern and Southern Hemispheres and strong genetic differentiation among southern populations. Molecular Phylogenetics and Evolution 49, 84-91. González-Tizón AM, Martínez-Lage A, Rego I, Ausió J, Méndez J (2000) DNA content, karyotypes, and chromosomal location of 18S-5.8S-28S ribosomal loci in some species of bivalve molluscs from the Pacific canadian coast. Genome 43, 1095-1072. Gosling EM (1992) The mussel Mytilus: ecology, physiology, genetics and culture. Elsevier Press, Amsterdam. Hilbish TJ, Mullinax A, Dolven SI, Meyer A, Koehn RK, Rawson PD (2000) Origin of the antitropical distribution pattern in marine mussels (Mytilus spp.): routes and timing of transequatorial migration. Marine Biology 136, 69-77. Hinegardner R (1974) Cellular DNA content of the Mollusca. Comparative Biochemistry and Physiology 47, 447-460. Ieyama H (1984) Karyotypes in eight species of the Mytilidae (Bivalvia: Pteriomorphia). Venus 43, 240-254. Ieyama H, Kameoka O, Tan T, Yamasaki J (1994) Chromosomes and nuclear DNA contents of some species in Mytilidae. Venus 53, 327-331. Insua A, Freire R, Ríos J, Méndez J (2001) The 5S rDNA of mussels Mytilus galloprovincialis and M. edulis: sequence variation and chromosomal location. Chromosome Research 9, 495-505. Insua A, Labat JP, Thiriot-Quiévreux C (1994) Comparative analysis of karyotypes and nucleolar organizer regions in different populations of Mytilus trossulus, Mytilus edulis and Mytilus galloprovincialis. Journal of Molluscan Studies 60, 359-370. Insua A, Méndez J (1998) Physical mapping and activity of ribosomal RNA genes in mussel Mytilus galloprovincialis. Hereditas 128, 189-194. Kenchington E, Landry D, Bird CJ (1995) Comparison of taxa of the mussel Mytilus (Bivalvia) by analysis of the nuclear small-subunit rRNA gene sequence. Canadian Journal of Fisheries Aquatic Sciences 52, 2613-2620. King M (1987) Chromosomal rearrangements, speciation and the theoretical approach. Heredity 59, 1-6. King M (1993) Species evolution: The role of chromosome change, Cambridge University Press, Cambridge. Koehn RK (1991) The genetics and taxonomy of the species in the genus Mytilus. Aquaculture 9, 125-145. Levan A, Fredga K, Sandberf AA (1964) Nomenclature for centromeric position on chromosomes. Hereditas 52, 201-220. Martínez-Expósito MJ, Pasantes JJ, Méndez J (1994) NOR activity in larval and juvenile mussels (Mytilus galloprovincialis LMk.). Journal of Experimental Marine Biology and Ecology 175, 155-165.

The Cytogenetics of Mytilus Mussels

493

Martínez-Expósito MJ, Méndez J, Pasantes JJ (1997) Analysis of NORs and NOR-associated heterochromatin in the mussel Mytilus galloprovincialis. Chromosome Research 5, 268273. Martínez-Lage A, González-Tizón AM, Ausió J, Méndez J (1997) Karyotypes and Ag-NORs of the mussels, Mytilus californianus and M. trossulus from the Pacific Canadian coasts. Aquaculture 153, 239-249. Martínez-Lage A, González-Tizón AM, Méndez J (1994) Characterization of different chromatin types in Mytilus galloprovincialis L. after C-banding, fluorochrome and restriction endonuclease treatments. Heredity 72, 242-249. Martínez-Lage A, González-Tizón AM, Méndez J (1995) Chromosomal markers in three species of the genus Mytilus (Mollusca: Bivalvia). Heredity 74, 369-375. Martínez-Lage A, González-Tizón AM, Méndez J (1996) Chromosome differences between European mussel populations (genus Mytilus). Caryologia 49, 343-355. Martínez-Lage A, Rodríguez F, González-Tizón AM, Prats L, Cornudella L, Méndez J (2002) Comparative analysis of different satellite DNAs in four mussel Mytilus species. Genome 45, 922-929. Martínez-Lage A, Rodríguez-Fariña F, González-Tizón AM, Méndez J (2005) Origin and evolution of Mytilus mussel satellite DNAs. Genome 48, 247-256. McDonald JH, Koehn RK (1988) The mussels Mytilus galloprovincialis and Mytilus trossulus on the Pacific coast of North America. Marine Biology 99, 111-118. McDonald JH, Seed R, Koehn RK (1991) Allozymic and morphometric characters of three species of Mytilus in the Northern and Southern Hemispheres. Marine Biology 111, 323335. Méndez J, Pasantes JJ, Martínez-Expósito MJ (1990) Banding pattern of mussel (Mytilus galloprovincialis) chromosomes induced by 2xSSC/Giemsa-stain treatment. Marine Biology 106, 375-377. Navarro A, Barton NH (2003) Chromosomal speciation and molecular divergence-accelerated evolution in rearranged chromosomes. Science 300, 321-324. Pasantes JJ, Martínez-Expósito MN, Martínez-Lage A, Méndez J (1990) Chromosomes of Galician mussels. Journal of Molluscan Studies 56, 123-126. Pasantes JJ, Martínez-Expósito MJ, Méndez J (1996) C-band polymorphism in the chromosomes of the mussel Mytilus galloprovincialis. Caryologia 49, 233-245. Pereira Silva E, Skibinski DOF (2009) Allozymes and nDNA markers show different levels of population differentiation in the mussel Mytilus edulis on British coasts. Hydrobiologia 620, 25-33. Plohl M, Prats E, Martínez-Lage A, González-Tizón A, Méndez J, Cornudella L (2002) Telomeric localization of the vertebrate-type hexamer repeat, (TTAGGG)n, in the wedgeshell clam Donax trunculus and other marine invertebrate genomes. The Journal of Biological Chemistry 277, 19839-19846. Quesada H, Gallagher C, Skibinski DAG, Skibinski DOF (1998) Patterns of polymorphism and gene flow of gender-associated mitochondrial DNA lineages in European mussel populations. Molecular Ecology 7, 1041-1051. Rawson PD, Agrawal V, Hilbish TJ (1999) Hybridization between the blue mussels Mytilus galloprovincialis and M. trossulus along the Pacific coast of North America: evidence for limited introgression. Marine Biology 134, 201-211.

494

Andrés Martínez-Lage and Ana M. González-Tizón

Rawson PD, Hayhurst S, Vanscoyoc B (2001) Species composition of blue mussel populations in the northern Gulf of Maine. Journal of Shellfish Research 20, 31-38. Rawson PD, Hilbish TJ (1998) Asymmetric introgression of mitochondrial DNA among European populations of blue mussels (Mytilus spp.). Evolution 52, 100-108. Ridgway G, Naevdal GN (2004) Genotypes of Mytilus from waters of different salinity around Bergen. Norway Helgoland Marine Research 58, 104-109. Riginos C, Cunningham CW (2005) Local adaptation and species segregation in two mussel (Mytilus edulis x Mytilus trossulus) hybrid zones. Molecular Ecology 14, 381-400. Riginos C, McDonald JH (2003) Positive selection on an acrosomal sperm protein, M7 lysin, in three species of the mussel genus Mytilus. Molecular Biology and Evolution 20, 200207. Rodríguez-Juíz, A. M., M. Torrado, and J. Méndez. 1996. Genome-size variation in bivalve molluscs determined by flow cytometry. Marine Biology 126:489-497. Ryan Gregory T (2001) Coincidence, coevolution, or causation? DNA content, cell size, and the C-value enigma. Biological Reviews 76, 65-101. Skibinski DOF, Ahmad M, Beardmore JA (1978) Genetic evidence for naturally occurring hybrids between Mytilus edulis and Mytilus galloprovincialis. Evolution 32, 354-364. Śmietanka B, Zbawicka M, Molowicz M, Wenne R (2004) Mitochondrial DNA lineages in the European populations of mussels (Mytilus spp.). Marine Biology 146, 79-92. Saavedra C, Sewart DT, Stanwood RR, Zouros E (1996) Species-specific segregation of gender-associated mitochondrial DNA types in an area where two mussel species (Mytilus edulis and M. trossulus) hybridize. Genetics 143, 1359-1367. Thiriot-Quiévreux C (1984) Chromosome analysis of three species of Mytilus (Bivalvia : Mytilidae). Marine Biological Letters 5, 265-273. Toro JE, Thompson RJ, Innes DJ (2002) Reproductive isolation and reproductive output in two sympatric mussel species (Mytilus edulis, M. trossulus) and their hybrids from Newfoundland. Marine Biology 141, 897-909. Varvio SL, Koehn RK, Väinölä R (1988) Evolutionary genetics of the Mytilus edulis complex in the North Atlantic region. Marine Biology 98, 51-60. Väinölä R, Hvilsom MM (1991) Genetic divergence and a hybrid zone between Baltic and North Sea Mytilus populations (Mytilidae; Mollusca). Biological Journal of the Linnean Society 43, 127-148. Walsh JB (1982) Rate of accumulation of reproductive isolation by chromosome rearrangements. The American Naturalist 120, 510-532. White MJD (1978) Modes of Speciation. WH Freeman and Co. San Francisco. Wolowicz M, Thiriot-Quiévreux C (1997) The karyotypes of the most common bivalves species from the south Baltic. Oceanological Studies 2-3, 209-221. Wonham MJ (2004) Mini-review: distribution of the Mediterranean mussel Mytilus galloprovincialis (Bivalvia: Mytilidae) and hybrids in the Northeast Pacific. Journal of Shellfish Research 23, 535-543. Zbawicka M, Burzyński A, Skibinski D, Wenne R (2010) Scottish Mytilus trossulus mussels retain ancestral mitochondrial DNA: complete sequences of male and female mtDNA genomes. Gene 456, 45-53.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN 978-1-61761-763-8 Editor: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 24

A NEW APPROACH IN BIOMONITORING FRESHWATER ECOSYSTEMS BASED ON THE GENETIC STATUS OF THE BIOINDICATOR DREISSENA POLYMORPHA Godila Thomas1, Göran I. V. Klobučar2, Alfred Seitz1 and Eva Maria Griebeler1 1

Department of Ecology, Zoological Institute, University of Mainz, Germany 2 Department of Zoology, Faculty of Science, University of Zagreb, Croatia

ABSTRACT Evolutionary toxicology investigates population genetic effects caused by environmental contamination. Toxicant inputs of increasing industry, agriculture and fast growing cities have severely modified freshwater ecosystems. These anthropogenic stressors are expected to influence population genetic patterns by causing mortalities, so that, e.g., a recent reduction in genetic diversity would be indicative of deteriorating environmental conditions. The amount of genetic diversity can therefore be applied as a biomarker for the condition of freshwater ecosystems in a biomonitoring system. The zebra mussel is a common bioindicator for passive as well as active biomonitoring of freshwater ecosystems. Here, we suggest a novel approach to establish the genetic status of zebra mussel populations as an independent indicator of environmental condition. In this strategy, the well-established techniques of comet assay, micronucleus test and microsatellite analysis are combined to assess the health of freshwater habitats.

Keywords: ecotoxicology, population genetics, genetic diversity, biomonitoring, genotoxicity, comet assay, micronucleus test.



microsatellites,

Corresponding author: [email protected], Fon: +49 6131 3923956, Fax: +49 6131 3923731

496

Godila Thomas, Göran I. V. Klobučar, Alfred Seitz et al.

Ecotoxicology is an interdisciplinary field which encompasses the impact of anthropogenic stressors on the living environment. Due to an ever increasing human population and its activities associated with agriculture, defense, industry and commerce, anthropogenic pollutants are widely distributed in ecosystems (Vitousek et al. 1997, Bickham et al. 2000). The majority of the toxicant inputs terminate in aquatic ecosystems. They have severely modified freshwater ecosystems, and the long-term ecological effects of these hazardous substances are largely unknown (Anderson et al. 1994). Evolutionary toxicology is an important focus in the field of ecotoxicology. It investigates population genetic effects caused by environmental contamination. Pollution can clearly be a selective force and it is probable that organisms that inhabit polluted environments are continuously exposed to mutational pressure (Crow 1997). Toxicant inputs can have impacts on wildlife populations causing somatic and heritable mutations (Bickham et al. 2000). Bearing in mind the importance of DNA in maintaining homeostasis of all organisms and for the transfer of information to offspring, it is important to assess genotoxicity (damage of DNA and chromosomes) to determine pollution-related stress in an ecosystem (Klobučar et al. 2003). Genotoxic effects in germ cells can result in rapid alterations of gene frequencies in natural populations (Depledge 1998). However population genetic effects are not only due to molecular toxic mechanisms. Stochastic effects leading to inbreeding in small populations, overall loss of genetic diversity and loss of heterozygosity, as well as the accumulation of deleterious mutations in a gene pool (mutational load) are compounding factors that reduce fitness and accelerate the process of population extinction (Saccheri et al. 1998, Bickham et al. 2000, Theodorakis 2001). Genetic changes in a population due to toxicants, especially the loss of genetic diversity, might be permanent and could only recover if the population survived for a very long time, if there was no considerable gene flow from other populations. On the other hand, due to the mutagenic effect of chemicals, new alleles and genes could arise and increase population genetic diversity. While selection and genetic drift typically reduce genetic diversity, mutation and migration are the major processes that increase genetic variability in a population. If no catastrophe is happening, these evolutionary processes act slowly, so the timescale relevant for the response of genetic diversity is rather years than months. Therefore, one advantage of monitoring genetic diversity is that footprints of toxicants in population genetic patterns may still be detectable after years or decades, even if the abundance of the population has already recovered. As there is often a time lag before changes in genetic diversity become significant, a genetic diversity indicator is expected to be primarily useful for multigenerational exposures (Bickham et al. 2000, Bagley et al. 2002). A bioindicator is an organism reflecting environmental conditions of its habitat by its presence or absence and its function (van Gestel and van Brummelen 1996). The zebra mussel Dreissena polymorpha has been established as a bioindicator for passive as well as active biomonitoring of freshwater ecosystems (Sues et al. 1997, Roditi et al. 2000, Bervoets et al. 2005, Pain et al. 2005). It has been applied as an early warning system for freshwater quality (Sluyts 1996, Bocherding and Jantz 1997). Moreover, the zebra mussel has been used as a model organism for freshwater mussels in several studies dealing with anthropogenic impacts on environments (Griebeler and Seitz 2007, Hidde 2008). The genetic diversity of D. polymorpha, analysed by the neutral microsatellite markers, seemed to be sensitive to environmental conditions in our preliminary studies: We observed a highly

Biomonitoring based on the Genetic Status of Dreissena polymorpha

497

significant negative correlation between genetic diversity (assessed as expected heterozygosity He) and water conductivity in populations of the rivers Danube (in Hungary), Thaya (Austria) and Sio (Hungary) (Figure 1, n = 12, r = -0.9637, p < 0.0001). 1,22

1,2 1.20 1,18 1.18

arcsin (√He)

1,16 1.16 1,14 1.14 1,12 1.12 1,1 1.10 1,08 1.08 1,06 1.06

1,04

00

200 200

400 400

600 600

800 800

1000 1000

1200 1200

conductivity (µS/cm) Figure 1. Genetic diversity of zebra mussel populations measured as expected heterozygosity (He), versus water conductivity (µS/cm). He was arcsin (√) transformed.

Water conductivity can provide information on salinity, water inflows, hydrodynamics, but also on water pollution, like agricultural runoff and industrial discharges (JDS 2001). At the sampling site with the highest conductivity (1084 µS, Figure 1), the water was highly polluted. It could be suggested that the observed correlation between the conductivity and the heterozygosity of the bioindicator D. polymorpha indicates sensitivity of its genetic diversity to freshwater pollution. Furthermore, zebra mussel populations are ideal for studying long-term effects of anthropogenic stressors. Individuals of different generations of zebra mussel populations can be well distinguished, as it is possible to identify the age of the individuals by counting annual rings on the shells (Jantz 1998). By establishing age classes of a population, we were able to show the process of an important long-term effect in a population genetic pattern: In the river Drava in Croatia, we detected an increase in the percentage of heterozygotes in one population with an increasing age of individuals reaching a steady state He of about 60% (Figure 2). The increasing percentage of heterozygotes with increasing age could reflect a heterosis effect (selection against homozygotes) in this population. Although we can only speculate on the causes of this pattern, the clear trend in change suggests that selective forces have impacted this population.

Godila Thomas, Göran I. V. Klobučar, Alfred Seitz et al.

498

percentage of heterozygotes (%)

In total, due to its aforementioned properties, we hypothesize that the zebra mussel could be a suitable indicator for biomonitoring freshwater ecosystems based on population genetic diversity studies. 100 90 80 70 60 50 40 30 20 10 0 1

2

3

4

5

age Figure 2. Percentage of heterozygote individuals of five successive age classes at one microsatellite locus in a sample of 83 zebra mussel individuals.

Biomonitoring is the measurement of the response of living organisms to man-made changes in their environment. Following the approach of biomarker-based biomonitoring (Shugart et al 1992), we will measure responses to pollution at different levels of biological organisation, from population down to molecular level. As defined by the National Academy of Sciences (1989), a biomarker is a xenobiotically-induced variation in cellular or biochemical components or processes, structures, or functions that is measurable in a biological system or sample. Here, we suggest a novel approach in biomonitoring freshwater habitats based on the genetic status of D. polymorpha. In 2000, Bickham et al. proposed population genetic changes as the ―ultimate‖ biomarker of effect. Consequently, we will measure the genetic diversity of zebra mussel populations as an independent long term indicator of environmental pollution in our approach. This ―ultimate‖ biomarker has a slower response time than conventional biomarkers, but it is highly relevant in ecological concerns as it reflects the genetic plasticity of the population (Shugart et al. 1992). We will assess the genetic diversity of populations by microsatellite analysis. Due to their high variability and codominant mode of inheritance, microsatellites are very suitable markers to detect fast changes in genetic diversity within and among populations that are caused by environmental contamination (Bickham et al. 2000, Dimsoski and Toth 2000). Additionally, the effects of anthropogenic stressors at the population level will be assessed by measuring the population characteristics abundance and age structure. Populations exposed to pollution may have significantly reduced sizes compared to reference populations, resulting in a genetic bottleneck (Whitehead et al. 2003).

Biomonitoring based on the Genetic Status of Dreissena polymorpha

499

If an ecological effect at the population level is due to chemical exposure, responses at lower levels of biological organization should also be or have been apparent (Shugart et al. 1992). Consequently, we will also measure short term indicators of pollution exposure at the molecular and cellular level of D. polymorpha. We will assess two biomarkers of genotoxicity whose response is more relevant of a recent toxic influence by comet assay and micronucleus test. These are relatively simple and rapid techniques for the detection of genotoxic pressure and common and well established in the field of ecotoxicology. They have been successfully applied for zebra mussels and have provided reliable and significant results with respect to freshwater pollution (Pavlica et al. 2001, Klobučar et al. 2003). To detect the unknown chemical stressors, a broad range of parameters will be measured, e.g., physico-chemical parameters, heavy metals and organic compounds. In this new approach, we will measure biomarkers at different levels of biological organisation as well as water quality parameters to assess the short and long-term impacts of environmental contamination on the genetic status of zebra mussel populations. This is a strategy to monitor instantaneous and long-term effects of pollution on freshwater ecosystems, and could aid in managing pressures on these ecosystems. In a current project, we test our new approach in biomonitoring. We assess and compare the genetic status of zebra mussel populations of polluted and non-polluted sites in the river Drava in Croatia.

ACKNOWLEDGMENTS A slightly modified version of this commentary is a part of the PhD thesis of Godila Thomas. We thank S. Winkelmann, M. Paunovic, B. Csanyi and R. Erben for help with field work, N. Hammouti, D. Berens and M. Šrut for valuable discussions and F. Jung and T. Schneider for help with the microsatellite analyses in the laboratory. This study is funded by the Johannes Gutenberg-University of Mainz.

REFERENCES Anderson, S.; Sadinski, W.; Shugart, L.; Brussard, P.; Depledge, M.; Ford, T.; Hose, J.; Stegeman, J.; Suk, W.; Wirgin, I. and Wogan, G. (1994). Genetic and Molecular Ecotoxicology. A Research Framework. Environmental Health Perspectives, 102, 3-8. Bagley, M. J.; Franson, S. E.; Christ, S. A.; Waits, E. R. and Toth, G. P. (2002). Genetic Diversity as an Indicator of Ecosystem Condition and Sustainability: Utility for Regional Assessment of Stream Condition in the Eastern United States. Cincinnati, OH: U.S. Environmental Protection Agency. Bervoets, L.; Voets, J.; Covaci, A.; Chu, S.; Qadah, D.; Smolders, R.; Schepens, P. and Blust, R. (2005). Use of transplanted zebra mussels (Dreissena polymorpha) to assess the bioavailability of microcontaminants in flemish surface waters. Environmental Science and Technology, 39, 1492-1505.

500

Godila Thomas, Göran I. V. Klobučar, Alfred Seitz et al.

Bickham, J. W.; Sandhu, S.; Hebert, P. D. N.; Chikhi, L. and Athwal, R. (2000). Effects of chemical contaminants on genetic diversity in natural populations: implications for biomonitoring and ecotoxicology. Mutation Research, 463, 33-51. Bocherding, J. and Jantz, B. (1997). Valve movement response of the mussel Dreissena polymorpha - the influence of pH and turbidity on the acute toxicity of pentachlorophenol under laboratory and field conditions. Ecotoxicology, 6, 153-165. Crow, J. F. (1997). The high spontaneous mutation rate: is it a health risk? Proceedings of the National Academy of Sciences of the United States of America, 94, 8380-8386. Depledge, M. H. (1998). The ecotoxicological significance of genotoxicity in marine invertebrates. Mutation Research, 399, 109-122. Dimsoski, P. and Toth, G. P. (2000). Development of DNA-based Microsatellite Marker Technology for Studies of Genetic Diversity in Stressor Impacted Populations. Ecotoxicology, 10, 229-232. Griebeler, E. M. and Seitz, A. (2007). Effects of increasing temperatures on population dynamics of the zebra mussel Dreissena polymorpha: implications from an individualbased model. Oecologia, 151, 530-543. Hidde (D). Auswirkungen des Klimawandels auf die klein- und großräumige genetische Populationsstruktur von Makrozoobenthos in Rhein, Main und Mosel [online]. 2008 [cited 2008 july 17]. Available from: URN: http://nbn-resolving.de/urn/ resolver.pl?urn=urn:nbn:de: hebis:77-16591. Jantz, B. (1998). Size and age structure of a riverine zebra mussel population (River Rhine, Rh-km 168-861). Limnologica, 28, 395-413. Joint Danube Survey (JDS). Results of on-board analyses: Conductivity [online]. 2001 [cited 2008 01 25]. Available from: URL: www.icpdr.org/JDS. Klobučar, G. I. V.; Pavlica, M.; Erben, R. and Papeš, D. (2003). Application of the micronucleus and comet assays to mussel Dreissena polymorpha haemocytes for genotoxicity monitoring of freshwater environments. Aquatic Toxicology, 64, 15-23. National Academy of Sciences/National Research Council (1989). Biologic Markers in Reproductive Toxicology (pp. 395). Washington, DC: National Academy Press. Pain, S.; Biagianti-Risbourg, S. and Parant, M. (2005). Relevance of the Multixenobiotic Defence Mechanism (MXDM) for the Biological Monitoring of Freshwaters - Example of its Use in Zebra Mussel. In: J. V. Livingston (Ed.), Trends in Water Pollution Research (pp. 203-220). New York, NY: Nova Science Publishers. Pavlica, M.; Klobučar, G. I. V.; Mojaš, N.; Erben, R. and Papeš, D. (2001). Detection of DNA damage in haemocytes of zebra mussel using comet assay. Mutation Research, 490, 209-214. Roditi, H. A.; Fisher, N. S. and Sanudo-Wilhelmy, S. A. (2000): Field testing a metal bioaccumulation model for zebra mussels. Environmental Science and Technology, 34, 2817-2825. Saccheri, I.; Kuussaari, M.; Kankare, M.; Vikman, P.; Fortelius, W. and Hanski, I. (1998). Inbreeding and extinction in a butterfly metapopulation. Nature, 392, 491-494. Shugart, L. R.; McCarthy J. F. and Halbrook, R. S. (1992). Biological Markers of Environmental and Ecological Contamination: An Overview. Risk Analysis, 12, 353-360. Sluyts, H.; Van Hoof, F.; Cornet, A. and Paulussen, J. (1996). A dynamic new alarm system for use in biological early warning systems. Environmental Toxicology and Chemistry, 15, 1317-1323.

Biomonitoring based on the Genetic Status of Dreissena polymorpha

501

Sues, B.; Taraschewski, M. and Rydlo, M. (1997). Intestinal Fish Parasites as Heavy Metal Bioindicator: A Comparison between Acanthocephalus lucii (Palaeacanthocephala) and the Zebra Mussel, Dreissena polymorpha. Bulletin of Environmental Contamination and Toxicology, 59, 14-21. Theodorakis, C. (2001). Integration of Genotoxic and Population Genetic Endpoints in Biomonitoring and Risk Assessment. Ecotoxicology, 10, 245-256. Van Gestel, C.A.M. and Van Brummelen, T. C., (1996). Incorporation of the biomarker concept in ecotoxicology calls for a redefinition of terms. Ecotoxicology, 5, 217–225. Vitousek, P. M.; Mooney, H. A.; Lubchenco, J. and Melillo J. M. (1997). Human domination of earth´s ecosystems. Science, 277, 494-499. Whitehead, A.; Anderson, S. L.; Kuivila, K. M.; Roach, J. L. and May, B. (2003). Genetic variation among interconnected populations of Catostomus occidentalis: implications for distinguishing impacts of contaminants from biogeographical structuring. Molecular Ecology, 12, 2817-2833.

In: Mussels: Anatomy, Habitat and Environmental Impact ISBN: 978-1-61761-763-8 Editors: Lauren E. McGevin ©2011 Nova Science Publishers, Inc.

Chapter 25

MUSSELS: THEIR COMMON ENEMIES AND ADAPTIVE DEFENSES Devapriya Chattopadhyay Department of Earth Sciences, Indian Institute of Science Education & ResearchKolkata, Mohanpur Campus, Mohanpur, India

ABSTRACT Mussels are bivalves that are variously adapted for relatively immobile nature. They are characterized by the presence of short byssal threads attached close to exposed surface of hard substrates. Majority of them occur in intertidal areas, although some of them have occasionally been reported from deep water. Because of their relatively immobile nature and ubiquitous presence in the littoral and shallow sublittoral waters, they have been commonly targeted by their natural enemies. The natural enemies of mussels can be categorized in four main groups. The first group consists of predators like fish, crabs, birds, starfish and snails. Fish, crabs and birds just peel or crush the hard shell. Starfish uses whole body consumption. Predatory snails drill holes in the hard shell and consume the soft tissue; this kind of predation can be identified postmortem. Predation could be responsible for up to 50% of the mortality of a mussel population. The severity of predation generally is size and locality selective. Often the smaller size class of mussels takes the heaviest hit. The second groups of natural enemies are the competitors, fighting for similar food and space such as barnacles, crepidula, tunicates. These competitions could be severe enough to drive entire mussel population to the brink of extinction. However, these competitors are often serving as prey items for the same predators that prey upon mussels. In those scenarios, these competitors often render a positive feedback on the mussels by sharing the predation stress. The third group is the shell destroyers such as demosponges, polychaete. They are known to damage the calcitic shells of mussels by boring them. These boreholes are different from predatory drillholes as they are generally non-lethal. However, those boreholes damage the structural integrity of the shell and eventually lead them to disintegration by wave action. The fourth group of natural enemies are the parasites such as mytilicola, pinnotheres. These parasites often cause significant damage to the vital organs affecting respiration, filtration, ventilation and digestion. Although primarily these natural enemies render negative effect on mussel

504

Devapriya Chattopadhyay population, the overall interaction is very complicated and often produces positive effects locally.

INTRODUCTION Mussels are bivalves that belong to the order Mytiloida. The members of this order are generally byssate and epifaunal throughout life or secondarily burrowing. The dominant bivalves in this group are solitary (many Modiolus) or gregarious forms (e.g. Mytilus, Brachidontes) oriented with the plane of the commisure approximately perpendicular to the substrate. These groups of closely attached byssate bivalves are generally inhabitants of shelf environments and are concentrated in and especially adapted to high energy shallow water conditions of littoral and shallow sublittoral benthic zones (sometimes they are found in fresh water too). Generally littoral and sublittoral areas are also the prime hunting area of numerous invertebrate and vertebrate predators. Because of their limited mobility and ubiquitous presence in this zone, mussels have been commonly targeted by these predators. Apart from predation, modern mussel community is also affected by competition and parasitism. In modern marine environment biological interactions such as these are one of the important sources of natural selection. Unfortunately, it is often difficult to trace these influences over the evolutionary timescale. The evolutionary history of mussels shows development of certain characters that are clearly advantageous against common natural enemies. So it has been suggested that these natural enemies have played an important role in shaping the evolutionary lineage of mussels through time.

EVOLUTIONARY HISTORY The order Mytiloida has a long evolutionary history starting from Devonian continuing till Recent. Bivalves of this order adapt to high energy shallow water conditions in having hydrodynamically streamlined shells which are tightly affixed to the substrate by short byssus. This also provides effective protection against the predators. It is comprised of two superfamilies, Mytilacea and Pinnacea. The first superfamily is represented by the family Mytilidae and Mysidiellidae. The fossil record of the family Mytilidae dates back to Early Paleozoic. Fossil records seem to indicate that Modiolus- and Lithophaga-like species probably originated in the Silurian and Devonian, as such forms occur early in the Paleozoic strata. Mytilus-like species may have evolved from the Brachidontes group during the Jurassic. The fossil record of the other family Mysidiellidae is relatively short continuing from Lower Triassic to Upper Triassic. Sperfamily Pinnacea is represented by the family Pinnidae. It has a fossil record continuing from Lower Carboniferous to Recent. This family, secondarily members of the order, is usually arbitrarily classed as Pteriacea. They are morphologically isolated but also have much in common with the Mytilicea and there is no paleontological evidence that Pinnidae were derived from inequivalve ancestors.

Mussels: Their Common Enemies and Adaptive Defenses

505

NATURAL ENEMIES As mentioned before, most of the mussel groups are inhabitant of the shallow marine area which is also the very place of hunting for many invertebrate and vertebrate predators. Apart from the predators, this area is the habitat of other invertebrate groups (such as barnacles) that often compete with mussels for food and resources. In addition to predation and competition, there are two other types of biotic interaction that commonly affects the mussel population, namely the parasitism and the shell destruction. The natural enemies affect the mussel population in two different ways; some of them target the planktonic and postveliger stage while others attack the attached stage. It may be argued that since the mussel mortality is highest in planktonic and postveliger stage (Molloy et al., 1997), the mortality of attached mussels (both juvenile and adult) that is inflicted by natural enemies is of little importance to overall population dynamics of most of the mussels. However, the question that is most commonly being asked is what biotic factors limit the densities of attached mussels since the planktonic mussels are not known to cause ecological and economic problems, only attached stages do. Consequently, in this study, the natural enemies of the attached stage were discussed in greater details.

PREDATION Of all potential mortality factors, predation plays perhaps the most important role. Many species feed on mussels and amongst the most important are crabs, gastropods, starfish and birds. Most of these predators attack both the larval and the attached phase.

Durophagous Predation Durophagous or shell crushing predation is one of the major modes of predation affecting mussel population. Laboratory and field experiments show that crabs (Cancer and Carcinus) can take large numbers of mussels in their diets (Kitching et al., 1959; Seed, 1969a; Walne & Dean, 1972; Harger, 1972b). The results suggest that size selection occurs and that the upper size limit which can be opened is directly related to the size of the crab. Kitching et al., (1959) and Ebling et al. (1964) reported extensive crab predation in Lough Ine and tentatively attributed the absence of mussels sublittorally in many localities to this cause (Kitching and Ebling, 1967). The littoral crab population, however, varies seasonally, with an offshore migration into deeper water during winter (Naylor, 1962). In their experiments with crabs in the Menai Straits (North Wales), Walne & Dean (1972) found that the mortality from crab predation is generally most intense in the low shore and sublittoral areas where crabs are most abundant and where they can feed for longer periods. Since all size ranges of crabs can crush small mussels whilst the large mussels are only available to larger, stronger crabs, a disproportionate mortality among the smaller mussels is to be expected. Heavy mortality of plantigrades due to crab predation has been demonstrated by Edwards (1968), Reynolds (1969) and Harger (1972b). Spatfall may be effective only when there are sufficient plantigrades to satisfy the needs of the predators and also provide a surplus to stock

506

Devapriya Chattopadhyay

the mussel beds. Growth in M. edulis would therefore be accompanied by a relative decrease in crab predation. Feeding habit of Carcinus was examined by Ropes (1968), who showed that feeding is influenced by abundance, size and type of food. Temperature, tides and time of day also appeared to be important. Walne & Dean (1972) also demonstrated that crabs can discriminate between the size of prey when given a choice, but the numbers eaten could be modified by experimental conditions. Prey density seemed to be important, and a competitive element between crabs may also have been involved. Perkins (1967) showed that Carcinus would feed on a greater proportion of smaller mussels even though larger ones could be opened without difficulty. He suggested that a learning process may be involved, which enables crabs to feed with minimum effort. Seed (1980) have observed that the mud crab Panopeus herbst and the blue crab Calllnectes sapidus can consume large numbers of the Atlantic ribbed mussel Geukensia (=Modiolus) demlssa. He also observed that although the crabs could consume mussels over a wide size range they showed a marked reluctance to feed on larger mussels whilst smaller, more easily predated prey was still available. Under regimes of unlimited prey availability both crabs showed a pronounced preference for specific size classes of mussels. Harger (1972a) showed that both Cancer antennarius and Pachygrapsus crassipes had a preference for M. edulis over M. californianus. The maximum length of the mussels eaten by both crabs was dependent on the size of the predator. Predation rates were such that the mussels required six to eight weeks from settlement before they become large enough to escape predation by crabs, and he concluded that to survive on most rocky shores inabitated by crabs, mussels must settle at densities in excess of 10000 per square meter. When the two species of mussel occurred together, M. californianus was afforded some protection from predation by the presence of M. edulis, but the later species only settled in high enough densities to survive during summer months. Oystercatchers (Haematopus) feed extensively on Mytilus (Webster, 1941; Drinnan, 1958; Tinbergen & Kruuk, 1962; Tinbergen & Norton-Griffiths, 1964; Dare, 1966; NortonGriffiths, 1967; Heppleston, 1971), particularly over the winter months. This frequently results in heavy mortality in commercial mussel beds. On exposed shores, however, although mussels are taken in small numbers, oystercatchers seem to feed chiefly on limpets and dogwhelks (Feare, 1971). Sandpipers (Feare, 1966), knot (Prater, 1972), various species of duck (Belopolskii, 1961; Manikowski, 1968; Theisen, 1968; Nilsson, 1969) and gulls (Oldham, 1930; Rooth, 1957) are also known to feed on Mytilus. Milne & Dunnet (1972) record around 70% of the net annual production of a mussel bed passed to bird predators (oystercatchers, eider and gulls).

Drilling Predation There are two main families of gastropods, muricid and naticid, that are responsible for the mortality due to drilling predation. These groups are carnivorous gastropods who drill a hole on the outer shell of mussels. After drilling, they ingest the soft inner part. Since the drill holes often get preserved along with the shell, it is of particular interest to paleontologists studying ancient predator-prey interaction. In modern marine environment, drilling predation is one of the major causes of mortality among bivalve population. Since, mussels that have been attacked by predatory gastropods, can generally be identified by presence of a small hole

Mussels: Their Common Enemies and Adaptive Defenses

507

drilled through the shell, it is easier to evaluate their impact on the prey population even without direct monitoring of the attack. The dogwhelk Nucella lapillus is a widely distributed littoral predator in Europe, especially abundant on exposed rocky shores, where it is known to feed extensively on mussels (Fishcher-piette, 1935; Pleissis, 1958; Kitching, Sloane & Ebling, 1959; Largen, 1967; Seed, 1969a; Menge, 1976, 1977). It has also been reported from North American coasts (Kowalewski, 2004; Chattopadhyay & Baumiller, 2007; Casey & Chattopadhyay, 2008). The distribution of Nucella on the mussel beds is markedly seasonal – during the winter, few adult whelks are found actively feeding since at this time of the year they aggregate in cracks and pools in order to breed (Feare, 1972). Laboratory experiments indicate that the adult whelks could each consume an average of 2.17 mussels (1-3 cm in length) per week during the summer months whilst the immature individuals took an average of 1.01 mussels of this size range (Seed, 1969a). Whether such experiments reflect the normal feeding rate in natural population is, however, uncertain. Examination of drilled shells in some studies showed that the thinnest parts of the shell are most commonly attacked, especially at the umbonal end and around the region where the adductor muscles are inserted (Kitchell et al., 1981). They have also demonstrated that for naticid gastropod Polinices duplicatus, selection of prey size is determined by the net-energy gain of the attack. Chattopadhyay and Baumiller (2009) have demonstrated the same to be true for muricid gastropod preying upon Mytillus trossulus. However, Kowalewski (2004) observed no significant cite stereotypy in drilled Mytillus trossulus preyed upon by Nucella lamellosa. Harger (1972a) observed that Thais emarginata showed a strong preference for M. edulis over M. californianus in the low intertidal. Several other gastropods, such as Ocenebra (Chew & Eisier, 1958), Urosalpinx (Human, 1971) and Acanthina, Ceratostoma and Jaton (Harger, 1972b) are known to eat mussels.

Starfish Attacks Asteroid starfish are major predators of mussels in many areas. Although Asterias rubens is usually present on most rocky shores in northern Europe in low densities, periodically their numbers rise dramatically such that they form a blanket over much of the middle and lower shore. Such areas may become devoid of Mytilus (Seed, 1969a; Dare, 1973, 1975). Dare (1975) recorded large invasions of Asterias onto beds of mussels just above low water mark in Morecambe Bay (England). Such swarms of starfish are clearly a major factor in controlling the distribution of M. edulis in the low shore and sublittorally. Other varieties of sea stars (such as Asterias vulgaris, Pisaster ochraceus, Leptasterias polaris) were reported to prey upon mussel beds from North America (Paine, 1966, 1969; Himmelman & Dutil, 1991). As a result of some interesting experiments, Hancock (1965) concluded that Asterias has difficulty in opening mussels from Denmark, which had large adductor muscles than mussels of comparable size from British water. However, these results can also be explained by differences in chemical attraction. Castilla (1972) has shown that Asterias orientates towards Mytilus in Y-maze experiments, especially between November and May, but less readily between June and October. He suggested that this seasonal difference may be due a lowered chemosensitivity, or to seasonal changes in the production of attractants by the prey.

508

Devapriya Chattopadhyay

Kitching, Sloane & Ebling (1959) concluded, as a result of transplantation experiments, that the seastar Marthasterias glacialis was responsible for preventing the establishment of Mytilus sublittorally in Lough Ine (Ireland). Paine (1966, 1969, 1971, 1974) has studied the predation of Stichaster australis on Perna canaliculus in New Zealand and Pisaster ochraceus on Mytilus californianus on the west coast of America. In both cases, the character of intertidal community is dependant in part on the predatory activities of the starfish and, in particular, on their preferential consumption of the mussels (Landenberger, 1968; Paine, 1969; Feder, 1970). Removal of the starfish from the shore results in encroachment by the mussels (both vertically downwards and horizontally) into areas not previously occupied, eventually producing a virtual monoculture of mussels. Predation by Pisaster and Stichaster controls the distribution of the mussels on the low shore. In addition to the predators already mentioned, various fish (eg. plaice, flounder) also feed on mussels, especially in flat sandy areas. Zebra mussel has been targeted by various fish groups such as round goby, freshwater drum, common carp and pumpkinseed (summarized by Molloy et al., 1997). The grazing activities of limpets (Connel, 1972) and sea urchins may also account for some mortality, particularly amongst young mussels on low shore. Mammals such as seals, sea otters and walrus are also reported to take limited numbers of mussels in certain localities.

MULTIPLE PREDATOR EFFECT (MPE) In many classical studies on predator–prey interactions, the system has been treated from a two-taxon perspective, that of the predator and its prey; interactions with other predators have generally not been considered. However, among ecologists the past few decades have seen much discussion devoted to the interaction between different predatory groups and the resulting ‗emergent effects‘ (Sih et al. 1985, 1998; Lima and Dill 1990). Given that natural communities typically have multiple predators feeding on many prey, understanding emergent multiple predator effects (MPEs) is a critical issue for community ecology (Wilbur and Fauth 1990; Wooton 1994). Studies suggest two main types of emergent effects: (1) risk reduction caused by predator–predator interactions and (2) risk enhancement caused by conflicting prey responses to multiple predators. Many studies have observed the first type of emergent effect where the interaction of multiple predators reduced the net risk for mussels. Kitching, Sloane and Ebling (1959) studied the predation of mussels in Lough Ine (Ireland). Thais lapillus was the most conspicuous predator of mussels (M. edulis) on the open coast nearby, but was absent in the Lough proper, probably due to intense predation by crabs. Consequently, the mussels escaped drilling predation in that area. Paine (1971) reported that, rather surprisingly, Neothais scalaris seemed to have little influence on Perna canaliculus populations in New Zeland. The gastropod was capable of eating both large and small mussels, and was present on the shore in high densities. He concluded that small Perna was more accessible to predators than large mussels and these small individuals are the preferred prey of the starfish Stichaster. In order to attack the small Perna, the drilling gastropods need to compete with starfish. Going for large mussels high in the intertidal is not an option either since the gastropod then exposes itself to higher physical hazards. Consequently, the prey population is virtually unharmed by the drilling predators. In a

Mussels: Their Common Enemies and Adaptive Defenses

509

laboratory experiment, Chattopadhyay & Baumiller (2007) have demonstrated that the presence of a crab, Cancer gracilis, drilling gastropods change their behavior and largely abstain from drilling mussels. That can significantly reduce the mortality rate of Mytilus trossulus due to decreased drilling predation by Nucella lamellosa.

ANTI-PREDATORY STRATEGIE Clumping Clumping behavior in mussels has been shown to act as a successful anti-predatory defense against durophagous predators like crabs and lobsters (Okamura, 1986; Lin, 1991). This interpretation of clumping behavior is further supported by experimental evidence showing that exposure to chemical cues derived from crushing predators can induce clumping behavior (Côté and Jelnikar, 1999) and increased number and diameter of byssal threads produced by the mussel Mytilus edulis (Côté, 1995). Okamura (1986) showed that the risk of crushing predation is lowest for individuals on the interior of clumps where the negative effects of aggregate living are highest. Aggregate living is ubiquitous in natural populations of mussels in spite of the reduced growth rate and decreased fecundity experienced by aggregated mussels, especially those in the center (Bertness and Grosholz, 1985). The mussels experience a trade-off between the negative effects of living in clumps and the protection afforded by aggregate living. Casey & Chattopadhyay (2008) have observed a significant decrease in the drilling frequency within the group containing clumped mussels compared to the mussels kept in isolation, confirming that clumping acts as a successful antipredatory strategy against drilling predators.

Shell Structure Shell Morphology has been observed to be highly plastic in response to chemical cue from the predators. Changing the growth rate could be beneficial against predation in different ways. Increasing growth rate often results in thickening the shell that plays an important role against durophagous predation since thicker shells require higher strength to crush. On the other hand, increase in growth rate results in attaining larger size that might serve as a protective defense (―size-refuge‖). Blue mussels Mytilus edulis have been observed to show induced defense in the presence of a durophagous predator (Leonard et al., 1999). In the presence of intense crab predation, they develop thicker shells and produced more byssal threads that are firmly attached to the substrate. Similar results have been studied in the presence of starfish (Reimer & Tedengren, 1996). Mytilus edulis, were cultured in field enclosures in close vicinity of and in absence of its predator, the starfish Asterias rubens. After four weeks, the morphology differed such that predator-exposed mussels were significantly smaller in outer size (shell length, height and width), but had significantly larger posterior adductor muscle, thicker shell, and more meat per shell volume. Sommer et al. (1999) have demonstrated the size refuge for Mytilus edulis attacked by starfish Asterias rubens in a laboratory experiment.

Devapriya Chattopadhyay

510

Small individuals of Mytilus sp. are extremely vulnerable to predation by invertebrate predators, but the general opinion is that the predation pressure is limited when mussels reach larger sizes (e.g. starfish predation, Paine 1976 and Oneill et al. 1983). However, Reimer & Tedengren (1996) study shows that the expression "escape by growth", commonly used to describe life history traits of Mytilus sp. (e.g. Paine 1976), needs some modification. Mussels may as well "escape by growth reduction", i.e. become more compact and improve their defenses, in response to presence of predators.

Behavioral Defense In addition these physiological defenses, mussels often show behavioral modifications that are beneficial against predation. For instance, mussels sometime use a ―reverse size refuge‖. They share habitat with barnacles in the intertidal zone. It has been observed that the smaller size class of Modiolus modiolus takes refuge in dead barnacle shells (personal observation). This behavior often protects them from drilling and avian predators. Mussels can, most likely, reduce their attractiveness to predators by reducing the activity and thereby the release of attracting substances. Such behaviors, i.e. lowered activity when exposed to chemical stimuli from predators, are reported in marine mussels (Doering 1982, Vial et al. 1992, Reimer et al. 1995). Another, more speculative, possibility is that M. edulis have a "chemical camouflage", involving release of substances that repels starfish (Castilla 1972).

COMPETITION FOR FOOD AND RESOURCES This group of natural enemies consists of the competitor, fighting for similar food and space such as barnacles, crepidula, tunicates and sponges. Competition could be severe enough to drive entire mussel population to the brink of extinction. However, these competitorss often serve as prey items for the same predators that prey upon mussels. In those scenarios, the competitors render a positive feedback on the mussel population by sharing the predation stress.

Intraspecific Intense spatfalls of young plantigrades can constitute a major mortality factor through intraspecific competition, since the underlying mussels suffocate, thereby loosening the entire population from the surface of the substratum. Under such conditions, large areas are denuded of mussels, especially during stormy weather (Dare, 1975). Small mussels may become attached amongst larger individuals where they find competition too severe and die. Alternatively, the attachment of plantigrades around the bases of adult mussels may afford the former some protection from predators (Kitching and Ebling, 1967). Competition for space can be especially acute in areas of fast growth, and this occasionally leads to ‗hummocking‘, mussels in the center of the hummock often having no direct contact with the substratum.

Mussels: Their Common Enemies and Adaptive Defenses

511

This in turn may lead to instability, with much of the population being easily torn away during rough seas. However, in terms of general population dynamics this should be considered as emigration rather than mortality, since some of these mussels will survive to colonize other areas. Knight-Jones & Moyse (1961) concluded that intraspecific competition may be more severe in colder than warmer latitudes, or in difficult environments, where species are few and primary production less.

Interspecific On most rocky shores space is the major resource (Dayton, 1971; Connell, 1972) and competition for space amongst barnacles, algae and mussels may be intense. Under these conditions, mussels are often the competitive dominants (Paine, 1971, 1974). There is often competition between different species of mussels. Competition between Mytilus edulis and Mytilus californianus has been studied in great detail and in most of the cases M. californianus establishes itself as the competitive dominant (Harger, 1972b; Paine & Levin, 1981). Besides competing different mussel species, they also compete with other invertebrate groups in shallow water. The freshwater sponge Ephydatia fluviatilis and the zebra mussel Dreissena polymorpha were found to compete for space in Lake Trasimeno, because they colonize the same hard substrata (rocks and concrete) (Gaino, 2005). Sponges tend to be encrusting but they can give rise to massive forms on concrete. In both cases, sponges grow and can gradually envelop the valves up to the final encapsulation of the mussels. Asexual reproduction by means of resistant bodies, or gemmules, allows sponges to withstand the environmental stress, such as desiccation of the habitat or temperature values beyond the limit that are acceptable for mussel survival. The suppressive influence of E. fluviatilis allows this sponge to be considered a natural enemy of D. polymorpha, acting as a biological control agent on the spreading of the mussel population. The interaction between barnacles and mussels are often competitive as far as the food and resources are concerned. However, it becomes fairly complicated with the presence of a predator. Lively & Raimondi (1987) observed the interaction between three intertidal groups, barnacle and mussels (competitors) and gastropod (predator). They observed that barnacle clumps enhance the recruitment of mussels and therefore have a positive effect on both barnacle survivorship and mussel recruitment. Morula, the gastropods predator, had a negative effect on mussel density and the mussels have a negative effect on barnacle density. The density of Morula on barnacle density is positive due to its selective removal of mussels. These results suggest an indirect mutualism between barnacle and the predator, because barnacles attract settlement or enhance the survival of the mussels, and the predator reduces the competitive effect of mussels on barnacles. Similar scenario has been observed in the western coast of North America. Although the barnacles generally compete with Mytilus trossulus, they also share the predation pressure imposed by the drilling gastropod Nucella lamellosa. Consequently, in the intertidal habitat very few drilled mussels can be found while most of the drillholes are concentrated in the barnacles (Kowalewski, 2004; Chattopadhyay & Baumiller, 2007; Casey & Chattopadhyay, 2008). Such instances of multiple interactions leading to a positive effect have also been discussed in the prior section on MPE.

512

Devapriya Chattopadhyay

SHELL DESTRUCTION This group is the shell destroyers such as demosponges, polychaete. They are known to damage the calcitic shells of mussels by boring them. These boreholes are different from predatory drillholes as they are generally nonlethal. However, such boreholes damage the structural integrity of the shell and eventually lead them to disintegration by wave action. Compression tests showed that high levels of Polydora ciliata infestation tended to weaken the shells of Mytilus edulis. A predation experiment indicated that the heavily infested, weakshelled mussels may be more vulnerable to the predatory activities of the crab, Cancer pagurus (Kent, 1981). Damage and removal of the protective periostracum layer of deep-sea mussels by various eukaryotic and prokaryotic microorganisms (Hook & Golubic, 1988, 1990, 1992) exposes the mineral portion of the shell to microbial destruction. This biogenic destruction exceeds the rates of inorganic carbonate dissolution in the infested area. Two types of destructive agents attack the shells of live mussels. The first type forms shallow caries along the interface between periostracum and the mineral shell, primarily attacking intercrystalline organic matrix. The second type represents boring microorganisms, morphologically similar to chytrids that penetrate and permeate the entire mineral portion of the shell. These activities significantly weaken the shell structure and increase its internal porosity (Hook & Golubic, 1993).

PARASITISM The numerous parasites which mussels may harbor are not generally thought to cause substantial mortality, though infected mussels may occasionally show symptoms of disease. Numerous larval trematodes have been described from Mytilus (Nicol, 1906; Lebour, 1912; Jameson & Nicoll, 1913). Whilst the encysted metacercaria do little harm, the presence of rediae and sporocysts may injure the molluscan host. Sporocysts of certain forms, e.g., Bucephalus, can damage the gonad and may even lead to castration. Pinnotheres (pea crabs) are commonly encountered in the mantle cavity of Mytilus and whilst their presence does not seem to affect growth or mortality of the host, they could be an important factor when food is in short supply. Wright (1917), however, points out that Pinnotheres is rarely encountered in poorly nourished mussels. Hancock (1965) and Seed (1969b) found that tissue weights of infected mussels were significantly lower than those of non-infected mussels. The relationship is a parasitic one, the crab often causing extensive gill damage (Seed, 1969b). In a related species, Fabia, Pearce (1966) found palp damage and mantle blisters to be additional problems. Some species of pea-crabs are known to be hostspecific, but there is a considerable variation amongst the Pinnotheridae (Pearce, 1966). The rate of infection is related to the size of the host (Houghton, 1963; Seed, 1969b). Seed also found differences in infection rates within coexisting populations of M. edulis (highly infected) and M. galloprovincialis (poorly infected). Of all the parasites of Mytilus, the ‗red-worm‘, Mytilicola intestinalis, has received the greatest attention. Much of this work was simulated after it was thought that it was responsible for the massive mortality of mussels on the Dutch beds in 1950. First described

Mussels: Their Common Enemies and Adaptive Defenses

513

by Steuer (1902) in M. galloprovincialis, Mytilicola is a cyclopoid copepod which occurs in the gut, often as many as several dozens found in a single mussel. It was first recorded in Britain by Ellenby (1974) but since that time it has been shown to be widespread in Northern Europe (Grainger, 1951; Hockley, 1951; Korringa, 1951; Thomas, 1953; Bolster, 1954; Waugh, 1954; Hepper, 1955; Leloup, 1960; Davey & Gee, 1976; Robledo et al, 1994). Genovese (1958) maintained that Mytilicola causes little or no damage in M. galloprovincialis. However, it is more generally accepted that the presence of the parasite may lead to loss of condition and even death, although the degree of infection may be important (Cole & Savage, 1951; Mayer-Waarden & Mann, 1951). Andreu (1963) found an inverse relationship between flesh weight and number of parasites present. Hepper (1955) suggested that infection is not always harmful, particularly if conditions are generally favorable. Infection in more stressful situations, on the other hand, can cause serious harm. Reduced filtration rates by parasitized mussels have been reported by Caspers (1939) and Mayer-Waarden & Mann (1951). Mann (1956) drew attention to the adverse effects on gonad development. Electron microscope studies (Giusti, 1967) have shown Mytilicola to be a true parasite causing mechanical removal of the microvillar border of the intestinal epithelium. Mytilicola is estuarine, occurring especially in sandy or muddy bays (Mayer-Waarden & Mann, 1954 a, b) where water movement is sluggish and salinity is slightly lowered (Vilela & Monteiro, 1958). Campbell (1970) suggested that the amount of silt in the intestine of the mussel may be important in controlling the number of parasite present, and she also maintained that juvenile stages in the hepatopancreas may cause most damage. Andreu (1963) found greatest infestations in areas encountering little mixing with oceanic waters, but suggested that low salinity is probably not a decisive factor. Williams (1967, 1968) and HrsBrenko (1967) found a relationship between size of host and degree of infection; the latter worker also examined some of the factors which might influence the degree of infection and spread of parasite. Mussels higher in the littoral zone, and those raised from the bottom, are generally less infected since the infective copepodid stage crawls close to the sea bed. Williams (1969) examined the breeding cycle of Mytilicola, especially in relation to temperature and suggested that the disaster observed in the north European shellfish industry, and in which Mytilicola infection was implicated, could have been due to the unusually high sea temperature. Besides Mytilicola, there are other worms that often parasitize mussels. Polyclad worm (Stylochus mediterraneus Galleni) frequently infest Mytilus galloprovincialis Lm. They first straddle the valves at the posterior edge of the shell and then, after having digested the posterior adductor muscle, remove and swallow the soft parts of the mussels (Gallanil et al., 1980). Molloy et al., (1997) has identified 34 species that are involved in parasitic relationship with zebra mussel.

DISCUSSION The biotic interaction between the mussel and their natural enemies are far from being simple. Although, we refer groups of animal as ―natural enemies‖ based on the negative primary effect of the interaction, it is often evident that the interactions yield multiple effects. In the case of mussels, the predators generally do have negative effects on the population.

514

Devapriya Chattopadhyay

However, multiple predators could result in risk reduction. Siddon and Witman (2004) studied the effect of interaction between urchin, crab, lobster and mussels. They observed no significant risk reduction for urchins occurred in mussel habitats when crabs and lobsters were combined. Lobsters also produced a positive indirect effect on mussels by reducing crab predation. Thus, lobsters modify crab behavior and dampen changes in community structure. The competitors could have both positive and negative effects. When they are competing for food and space, they could result in a negative effect on the mussel population. However, these competitors are often victims of the same predators that prey upon the mussel. Consequently the competitors share the predation pressure and yield a positive effect on the mussel population by being the ―favorite prey‖ for the predator (eg. barnacle-mussel interaction). Shell destroyers are primarily having a negative effect on the population. None the less, often they act as a predator avoidance entity. Parasites have negative effect by affecting different organs of the host; however, they can contribute in predator avoidance. Competitors, shell destroyers and parasites are often epibiotic. Recent studies (e.g. Wahl et al. 1997; Laudien and Wahl 1999; Saier 2001) have demonstrated that epibiosis can substantially affect predation in two different ways. Laudin & Wahl (2004) has observed the effect epibionts on mussel predation by the two common predators, the shore crab Carcinus maenas and the starfish Asterias rubens. Low-preference epibionts such as hydrozoans simply led to avoidance of the basibiont by both consumer species. In contrast, barnacles increased predation by shore crabs (shared doom effect) while they decreased predation by starfish (associational resistance effect). The high trophic connectivity of communities, such as mussels, can produce large numbers of indirect interactions. Although many trait-mediated indirect interactions (TMII) are caused by changes in prey behavior, less is known about the effects of changes in predator behavior such as prey switching or multiple predator effects (MPE) on indirect interactions, especially in marine systems. These changes in the behaviors of the natural enemies could have substantial effect on the population dynamics of mussel community.

REFERENCES Andreu, B., 1963, Propagacion del copépodo parasito Mytilicola intestinalis en el mejillón cultivado de las rias gallegos (N. W. de Espana). Investigación Presquera, 24: 3-20 Belopolskii, L.O., 1961, Ecology of the sea colony birds of the Barents Sea. H. A. Humphrey, London Bertness, M.D., Grosholz, E., 1985, Population dynamics of the ribbed mussel, Geukensia demissa: the costs and benefits of an aggregated distribution. Oecologia, 67: 192–204 Bolster, G.C., 1954, The biology and dispersal of Mytilicola intestinalis Steuver, a copepod parasite of mussels. Fisheries Investigations. Ser. II, 18:1-30 Campbell, S. A., 1970, The occurrence and effects of Mytilicola intestinalisin Mytilus edulis. Marine Biology, 5: 89-95 Casey, M. & Chattopadhyay, D., 2008, Clumping behavior as a strategy against drilling predation: Implications for the fossil record. Journal of Experimental Marine Biology and Ecology, 367: 174–179

Mussels: Their Common Enemies and Adaptive Defenses

515

Caspers, H., 1939, Uber Vorkommen und Metamorphose von Mytilicola intestinalis Steuer (Copepoda parasitica) in der südlichen Nordsee. Zoologischer Anzeiger, 126:161-171 Castilla, J.C., 1972, Responses of Asterias rubensto bivalve prey in a Y maze. Marine Biology, 12:222-228 Chattopadhyay, D. & Baumiller, T. K., 2009, An experimental assessment of penetration, excavation and consumption rates of the muricid gastropod, Nucella lamellosa. Journal of Shellfish Research, 28: 1-7 Chattopadhyay, D. & Baumiller, T. K., 2007, Drilling under threat: An experimental assessment of the drilling behavior of Nucella lamellosa in the presence of a predator. Journal of Experimental Marine Biology and Ecology, 352: 257–266 Chew, K. K. & Eisler, R.E., 1958, A preliminary study of the feeding habits of the Japanese oyster drill Ocenebra japonica. Journal of the Fisheries Research Board of Canada, 15: 529-535 Cole, H. A. & Savage, R. E., 1951, The effect of parasitic copepod Mytilicola intestinalis(Steur) upon the condition of mussels. Parasitology,41:156-161 Connell, J. H., 1972, Community interactions on marine rocky intertidal shores. Annual Review of Ecology and Systematics,31: 169-192 Côté, I.M., 1995, Effects of predatory crap effluent on byssus production in mussels. Journal of Experimental Marine Biology and Ecology, 188: 233–241. Côté, I.M., Jelnikar, E., 1999, Predator-induced clumping behaviour in mussels (Mytilus edulis Linnaeus). Journal of Experimental Marine Biology and Ecology, 235: 201–211. Dare, P. J., 1966, The breeding and wintering populations of the oystercatcher (Haematopus ostralegus L.) in the British Isles. Fishery Investigations, Ser. II, 25:1-69 Dare, P. J., 1973, The stock of young mussels in Mrecambe Bay, Lancashire. Ministry of Agriculture Fisheries and Food, Shellfish Information Leaflet, 28:1-14 Dare, P. J., 1975, Settlement, growth and production of mussel Mytilus edulis L. in Morecambe Bay. Fisheries Investigations, London, Ser. II, 28:1–25 Davey, J. T. & Gee, J. M., 1976, The occurrence of Mytilicola intestinalis Steuer, an intestinal copepod parasite of Mytilus, in the south-west of England, Journal of the Marine Biological Association of the United Kingdom, 56:85-94 Dayton, P. K., 1971, Competition, disturbance and community organisation: the provision and subsequent organisation: the provision and subsequent utilisation of space in a rocky intertidal community. Ecological Monographs, 41: 351-389 Doering,P . H. 1982, Reduction of attractivenes to the seastar Asterias forbesi (Desor) by the clam Mercenaria mercenaria(Linnaeus). Journal of Experimental Marine Biology and Ecology, 60: 47-61. Drinnan, R. E., 1958, The winter feeding of the oystercatcher (Haematopus ostralegus L.) on the edible mussel (Mytilus edulis) in the Conway estuary. Fishery Investigations, Ser. II, 22: 1-15 Ebbling, F. J., Kitching, J. A., Muntz, L. & Taylor, C. M., 1964, The ecology of Lough Ine. 13. Experimental observations of the destruction of Mytilus edulisaand Nucella lapillus by crabs. Journal of Animal Ecology,33:73-82 Edwards, E., 1968, A review of mussel production by raft culture. Irish Sea Fisheries Board, Resources Record Paper, 7pp Ellenby, C., 1947, A copepod parasite of the mussel new to the British fauna. Nature,159: 645-646

516

Devapriya Chattopadhyay

Feare, C. J., 1966, The winter feeding of the purple sandpiper. British Birds, 59: 165-179 Feare, C. J., 1971, Predation of limpets and dogwhelks by oystercatchers, Bird Study, 18: 121-129 Feare, C.J., 1972, The adaptive significance of aggregation bahaviour in the dogwhelk Nucella lapillus (L.), Oecologia, 7:117-126 Feder, H. M., 1970, Growth and predation by the sea star Pisaster ochraceus (Brandt) in Monterey Bay California, Ophelia, 8:161-185 Fischer-Piette, E., 1935, Histoire d'une moulière. Bulletin biologique de la france et de la Belgique,69:153-177 Gainoa, T. L. E., 2005, Competition between the freshwater sponge Ephydatia fluviatilis and the zebra mussel Dreissena polymorpha in Lake Trasimeno (central Italy). Italian Journal of Zoology,72: 27 - 32 Genovese, S., 1958, Sulla presenza di Mytilicola intestinalisSteur (Copepoda parasitica) nel lago di Ganzirri. Atti della Societá Peloritana di Scienze Fisiche, 5:47-53 Giusti, F., 1967, The action of Mytilicola intestinalisSteur on Mytilus galloprovincialisLam. Of the Tuscan Coast. Parasitology, 28: 17-26 Grainger, J. N. R., 1951, Notes on the biology of the copepod Mytilicola intestinalisSteur. Parasitology, 41: 135-142 Hancock, D. A., 1965, Adductor muscle size in Danish and British mussels in relation to starfish predation. Ophelia, 2: 253-267 Harger, J. R. E., 1972 a, Variation and relative 'niche' size in the sea mussel Mytilus edulis in association with M. californianus. Veliger, 14: 275-283 Harger, J. R., 1972b, Competitive co-existence: maintenance of interacting associations of the sea mussels Mytilus edulis and Mytilus californianus. Veliger, 14: 387-410 Hepper, B. T., 1955, Environmental factors governing the infection of mussels Mytilus edulisby Mytilicola intestinalis. Fishery Investigations.Ser. II, 20: 1-21 Heppleston, P. B., 1971, The feeding ecology of oyster-catchers (Haematopus ostralegus L.) in winter in northern Scotland. Journal of Animal Ecology, 40:651-672 Himmelman, J. H., Dutil, C., 1991, Distribution, population structure and feeding of subtidal seastars in the northern Gulf of St. Lawrence. Marine Ecological Progress Series, 76:71– 72 Hockley, A. R., 1951, On the biology of Mytilicola intestinalis (Steur). Journal of the Marine Biological Associationof the United Kingdom, 30: 223-232 Houghton, D. R., 1963, The relationship between tidal level and the occurrence of Pinnotheres pisum (Pennant) in Mytilus edulis L. Journal of Animal Ecology, 32: 253257 Hrs-Brenko, M., 1967, Mytilicola intestinalis Steur (Copepoda, parasitica) a parasite in mussels in the east Adriatic. Thalassia Jugoslavica, 3:143-159 Human, V. L., 1971, The occurrence of Urosalpinx cinerea (Say) in Newport Bay. Veliger, 13:299 Jameson, H. L. & Nicoll, W., 1913, On some parasites of the scoter (Oedemia nigra) and their relationship to the pearl-inducing trematode in the mussel. Proceedings of the Zoological Society of London, 53-63 Kent, R. M. L., 1979, The influence of heavy infestations of Polydora ciliata on the flesh content of Mytilus edulis. Journal of the Marine Biological Association of the United Kingdom, 59: 289-297

Mussels: Their Common Enemies and Adaptive Defenses

517

Kitchell, J.A., Boggs, C.H., Rice, J.A., Kitchell, J.F., Hoffman, A., Marinell, J., 1981, Prey selection by naticid gastropods: experimental tests and application to the fossil record. Paleobiology, 7: 533–552. Kitching, J. A. & Ebling, F. J., 1967, Ecological studies at Lough Ine. Advances in Ecological Research, 4:197-291 Kitching, J. A., Sloane, J. F. & Ebling, F. J., 1967, The Ecology of Lough Ine. Journal of Animal Ecology, 28: 331-341 Knight-Jones, E. W. & Moyse, 1961, Intraspecific competition in sedentary marine animals. In F.L. Milthorpe (ed.) Mechanisms in biological competition, 15:72-95 Korringa, P., 1951, Le Mytilicola intestinalis Steur (copepod parasitica) menace l'industrie moulière en Zelande. Revue des travaux de l'Office (scientifique et technologique) des Pêches maritimes, 17: 347-381 Kowalewski, M., 2004, Drill-holes produced by the predatory gastropod Nucella lamellosa (Muricidae): palaeobiological and ecological implications. Journal of Molluscan Studies, 70: 359–370. L. Gallanil, P. Tongiorgi, E. Ferrero and U. Salghetti, 1980, Stylochus mediterraneus (Turbellaria: Polycladida), Predator on the Mussel Mytilus galloprovincialis. Marine Biology, 55: 317-326 Landenberger, D. E., 1968, Studies on selective feeding in the Pacific Starfish Pisasterin South Carolina. Ecology, 49: 1062-1075 Largen, M. J., 1967, The diet of the dogwhelk Nucella lapillus (Gastropoda, Prosobranchia). Journal of Zoology,151: 123-127 Laudien, J. & Wahl, M., 1999, Indirect effects of epibiosis on host mortality: starfish predation on different fouled mussels. Publication Stn Zoology Napoli Marine Ecology, 20:35–47 Laudien, J. & Wahl, M., 2004, Associational resistance of fouled blue mussels (Mytilus edulis) against starfish (Asterias rubens) predation: relative importance of structural and hemical properties of the epibionts. Helgol Marine Research, 58:162–167 Lebour, M. V., 1912, A review of British marine cercaria. Parasitology, 4:416-456 Leloup, E., 1960, Researches sur la répartition de Mytilicola intestinalis Steur 1905 le long de la cote Belge. Bulletin de l'Institut royal des sciences naturelles de Belgique, 36: 1-12 Leonard, G. H., Bertness, M. D. & Yund, P. O., 1999, Crab predation, water borne cues and inducible defences in the blue mussel Mytilus edulis. Ecology, 80: 1-14 Lima, S. L. & Dill, L. M., 1990, Behavioral decisions made under the risk of predation: a review and prospectus. Canadian Journal of Zoology, 68:619–640. Lin, J., 1991, Predator-prey interactions between blue crabs and ribbed mussels living in clumps. Estuarine & Coastal Shelf Science, 32: 61–69. Manikowski, S., 1968, Observations on the occurrence and distribution of birds in the Baltic near the Hel Peninsula (Poland). Acta ornitologica, 11: 45-59 Mann, H., 1956, The influence of Mytilicola intestinalison the development of the gonads of Mytilus edulis. Rapport et procès-verbaux des réunions.140: 57-58 Menge, B. A., 1976, Organization of the New England Rocky Intertidal Community: Role of Predation, Competition, and Environmental Heterogeneity. , 46: 3-12 Menge, B. A., 1977, Predation Intensity in a Rocky Intertidal Community. Relation between Predator Foraging: Activity and Environmental Harshness. Oecologia, 34: 1-16

518

Devapriya Chattopadhyay

Meyer-Waarden, P. F. & Mann, H., 1951, Researches allemandes relatives au 'Mytilicola', copepod parasite de la moule existant dans les watten allemandes 1950-1951. Revue des travaux de l'Office (scientifique et technologique)des Pêches maritimes, 17: 63-74 Meyer-Waarden, P. F. & Mann, H., 1954a, Ein weiterer Beitrag zur Epidemiologie von Mytilicola intestinalis. Archi für Fischereiwissenschaft, 5:26-34 Meyer-Waarden, P. F. & Mann, H., 1954b, Untersuchungen über die Bestände von Mytilus galloprovincialis an der italienischen Küste auf ihren befall mit Mytilicola intestinalis (Copepoda parasitica). Bolletino di Pesca, 8:201-220 Milne, H. A. & Dunnet, G. M., 1972, Standing crop, productivity and trophic relations of the fauna of the Ythan estuary. In R.S.K. Barnes and J. Green (eds.) The estuarine environment, Associated Scientific Publishers, Amsterdam, pp. 86-106 Molloy, D. P., Karatayev, A. Y., Burlakova, L. E., Kurandina, D. P., Laruelle, F, 1997, Natural enemies of Zebra mussel: predators, parasites and competitors. Reviews in Fiesheries Sciences, 5: 27-97 Naylor, E., 1962, Seasonal changes in the population of Carcinus maenasin the littoral zone. Journal of Animal Ecology, 31: 601-609 Nicol, w., 1906, Notes on trematode parasites of the cockle and mussel. Annals and Magazine of Natural History, 7: 148-155 Nilsson, L., 1969, Food consumption of diving ducks wintering at the coast of southern Sweden in relation to food resources. Oikos, 20: 128-135 Norton-Griffiths, M., 1967, Some ecological aspects of the feeding bahaviour of the oystercatcher Haematopus ostralegus on the edible mussel Mytilus edulis. Iblis, 109: 412-424 Okamura, B., 1986. Group living and the effects of spatial position in aggregations of Mylitus edulis. Oecologia, 69: 341–347. Oldham, C., 1930, The shell smashing habit of gulls. Iblis, 12:239-243 Oneill,S . M., Sutterlin, A. M. and Agget, D. 1983, The effect of size selective feeding by starfish (Asterias vulgaris) on the production of Mytilus edulis cultured on nets. Aquaculture, 35: 211-220 Paine, R. T., 1966, Food web complexity and species diversity. American Naturalist, 100: 6575 Paine, R. T., 1969, The Pisaster-Tegulainteraction: prey patches, predator food preference and intertidal community structure. Ecology, 50:635-644 Paine, R. T., 1971, A short term experimental investigation of resource partitioning in a New Zealand rocky intertidal habitat. Ecology, 52: 1096-1106 Paine, R. T., 1974, Intertidal community structure. Experimental studies on the relationship between a dominant competitor and its principal predator. Oecologia, 15:93-120 Paine,R . T., 1976, Size-limited predation: an observational and experimental approach Mytilus-Pisaster interaction. Ecology, 57: 858-873 Pearce, J. B., 1966, The biology of the mussel crab Fabia subquadratafrom the waters of the San Juan Archipeligo, Washington. Pacific Sciences, 20: 3-35 Perkins, E. J., 1967, Some aspects of the biology of Carcinus maenas (L.). Transactions of the Dumfriesshire and Galloway Natural History and Antiquarian Society, 44: 47-56 Pleissis, Y., 1958, Note preliminaire sur l'étude statistique des coquilles vides de bivalves en particulier de Mytilus edulis. Bulletin du Musée national d'Histoire naturelle, 30: 318330

Mussels: Their Common Enemies and Adaptive Defenses

519

Prater, A. J., 1972, The ecology of Morecambe Bay. The food and feeding habit of Knot (Calidris canutus L.) in Morecambe Bay. Journal of Applied Ecology, 9: 179-194 Reimer, O. & Tedengren, M., 1996, Phenotypical improvement of morphological defenses in the mussel Mytilus edulis induced by exposure to the predator Asterias rubens. Oikos, 75: 383-390 Reimer, O., Olsson, B., Tedengren, M., 1995, Growth, physiological rates and behavior of Mytilus edulis exposed to the predator Asterias rubens. Marine and Freshwater Bahavior and Physiology,25: 233-244 Reynolds, N., 1969, The settlement and survival of young mussels in the Conway fishery. Fishery Investigations, 26: 1-24 Robledo, J. A. F., Santarém, M. M., & Figueras, A., 1994, Parasite loads of rafted blue mussels (Mytilus galloprovincialis) in Spain with special reference to the copepod, Mytilicola intestinalis. Aquaculture, 127: 287-302 Rooth, J., 1957, Over het voedsel van de zilvermeeuwen. (On the food of herring gulls.) Levende natuur, 60: 209-213 Ropes, J. W., 1968, The feeding habits of the green crab Carcinus maenas (L.). Fishery Bulletin.67: 183-203 Saier, B., 2001, Direct and indirect effects of seastars Asterias rubens on mussel beds (Mytilus edulis) in the Wadden Sea. Journal of Sea Research, 46:29–42 Seed, R., 1969a, The ecology of Mytilus edulis L. (Lamellibranchiata) on exposed rocky shores. Growth and mortality. Oecologia, 3:277-316 Seed, R., 1969b, The incidence of the pea crab Pinnotheres pisum in the two types of Mytilus (Mollusca: Bivalvia) from Padstow, south-west England. Journal of Zoology, 158: 413420 Siddon, C. E. & Witman, J. D., 2004, Behavioral indirect interactions: Multiple predator effects and prey switching in the rocky subtidal. Ecology, 85: 2938–2945 Sih, A., Crowley, P., Mcpeek, M., Petranka, J., Strohmeier, K., 1985, Predation, competition, and prey communities: a review of field experiments. Annual Review of Ecological System. 16:269–311. Sih, A., Englund,G., Wooster, D., 1998, Emergent impacts of multiple predators on prey. TREE, 13: 350–355. Sommer, U., Meusel, B., Stielau, C., 1999, An experimental analysis of the importance of body-size in the seastar-mussel predator-prey relationship. Actu Oecologica, 20: 8l-98 Steur, A., 1902, Mytilicola intestinalis, n. gen. n. sp. Aus dem Darme von Mytilus galloprovincialisLam. Zoologischer Anzeiger, 25: 635-637 Thomas, H. T., 1953, Mussels. Rapport et Procès-verbaux dex Réunions. 134: 34 Tinbergen, N. & Kruuk, H., 1962, Van scholesksters en mosselen. (About oystercatchers and mussels.) Levende natuur, 65: 1-8 Tinbergen, N. & Norton-Griffiths, M., 1964, Oystercatchers and mussels. British Birds, 57: 64-70 Vial, M. V., Simpfendörfer, R. W., Lopez, D. A., Gonzalez, M. L. and Oelckers, K. 1992. Metabolic responses of the intertidal mussel Perumytilus purpuratus (Lamarck) in emersion and immersion. Journal of Experimental Marine Biology and Ecology. 159: 191-201

520

Devapriya Chattopadhyay

Viela, H. & Monteiro, M. C., 1958, Infestation of the mussel mytilus edulis in the Tejo River by the copepod Mytilicola intestinalis Steur. Notas e Estudos do Instituto de Biologia Maritima, 20: 1-20 Wahl, M., 1997, Increased drag reduces growth of snails: comparison of flume and in situ experiments. Marine Ecological Progress Series, 151:291–293 Walne, P. R. & Dean, G. J., 1972, Experiments on Predation by the Shore Crab, Carcinus Maenas L., on Mytilus and Mercenaria. Journal of Marine Science, 34: 190-199 Waugh, G. D., 1954, The occurrence of Mytilicola intestinalis (Steur) on the east coast of England. Journal of Animal Ecology, 23: 364-367 Webster, J. D., 1941, Feeding habits of the black oystercatcher. Condor, 43: 175-180 Wilbur, H. M. & Fauth, J. E., 1990, Experimental aquatic food webs: interactions between two predators and two prey. American Naturalist, 135:176–204 Williams, C. S., 1967, The parasitism of young mussels by Mytilicola intestinalis. Journal of Natural History, 1: 299-301 Williams, C. S., 1968, The influence of Polydora ciliata (Johnst) on the degree of parasitism of Mytilus edulis L. by Mytilicola intestinalis Steur. Journal of Animal Ecology, 37:709712 Williams, C. S., 1969, The life history of Mytilicola intestinalis Steur. Journal du Conseil, 32: 419-429 Wooton, J. T., 1994, Predicting direct and indirect effects: an integrated approach using experiments and path analysis. Ecology.75: 151–165. Wright, F., 1917, Mussel beds, their production and maintenance. Annals of Applied Biology, 4: 123-125

INDEX A absorption, 100, 121, 122, 152, 204, 208, 335, 382, 390 absorption spectroscopy, 390 abuse, 282 accessibility, 341 acclimatization, 443 accounting, xvi, 80, 357, 358, 362 accuracy, 304, 332 acetic acid, 399 acetylcholine, 58, 185 acetylcholinesterase, 54, 58, 62, 63, 66, 98, 120, 124, 206, 208 acid, ix, xi, 1, 2, 3, 5, 6, 8, 9, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 23, 25, 27, 29, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 55, 56, 57, 58, 65, 100, 108, 110, 115, 116, 122, 145, 148, 149, 150, 151, 152, 153, 154, 156, 157, 158, 160, 161, 162, 163, 167, 170, 171, 176, 179, 190, 191, 212, 250, 254, 257, 259, 261, 262, 268, 301, 344, 345, 346, 347, 349, 414, 417, 418, 425, 426, 427, 433, 439, 442, 464 activated carbon, 344 active site, 151, 164, 166 active transport, 199 activity level, 287 adaptation, xiii, 85, 121, 206, 207, 222, 237, 239, 245, 246, 248, 250, 256, 257, 260, 266, 269, 334, 494 adaptations, 40, 207, 234, 246, 262 adductor, xviii, 429, 431, 432, 443, 473, 507, 509, 513 adhesion, xii, xix, 145, 146, 147, 149, 150, 152, 153, 154, 157, 160, 163, 166, 167, 169, 170, 171, 431, 436, 439, 441, 450 adhesions, xi, 145, 152 adhesive properties, 148, 163, 167

adhesive strength, 159, 160 adhesives, xii, 145, 147, 150, 162, 168, 169, 171 adjustment, 250, 340 ADP, 368, 370, 371 adrenaline, 150 adsorption, 106, 293, 382 advantages, xv, 104, 130, 337, 338, 339, 346, 472 Aegean Sea, 193 aerobic capacity, 248, 249 AFM, 157 Africa, 76, 198, 286, 470 agglutination, 433 aggregation, xix, 307, 431, 433, 434, 439, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 481, 516 agriculture, xx, 49, 80, 82, 200, 224, 286, 292, 296, 495, 496 albumin, 269 alcohols, 2, 175 aldehydes, 176, 255 algae, 41, 93, 170, 202, 204, 209, 215, 390, 474, 478, 479, 511 algorithm, 185 alienation, 83 alkaline hydrolysis, 417 alkenes, 176 alkylation, 253 allele, 223, 231, 233, 457, 458, 459, 461 allergy, 434 alters, 114 aluminium, 152 amines, 157 amino acids, xii, 48, 58, 108, 110, 117, 132, 133, 145, 152, 157, 161, 165, 168, 179, 182, 206, 250, 257, 339, 344 ammonia, 3, 5, 9, 10, 33, 124, 211, 257 amphibia, 134, 141

522

Index

amplitude, 408 amylase, 418 amyotrophic lateral sclerosis, 125 anaphylaxis, 434 anatase, 169 anatomy, ix, x, xvii, xx, 43, 170, 395, 432, 469, 470, 474, 480, 482 anchoring, 84, 359, 361, 362, 364, 365 aneuploidy, 103, 224, 231 animal disease, 201 animal diseases, 201 annealing, 460 ANOVA, 272 anoxia, 98, 111, 123, 127, 192, 211, 248 antagonism, 384 anthropogenic agents, xii, 173 anti-apoptotic role, 99 antibody, 110, 175, 422, 431, 433 antioxidant, xiv, 54, 56, 57, 58, 69, 70, 98, 111, 114, 126, 174, 175, 176, 177, 185, 187, 188, 189, 192, 248, 249, 251, 252, 253, 256, 264, 265, 269, 276, 277, 278, 279, 280, 282, 283, 287 anus, 473 apoptosis, 64, 98, 112, 119, 122, 136, 141, 142, 202 apoptotic mechanisms, 131 appropriations, 82 aquaculture, x, xv, xvi, xviii, 73, 82, 84, 85, 87, 88, 93, 174, 224, 240, 303, 333, 338, 357, 358, 359, 360, 361, 362, 371, 373, 374, 375, 376, 414, 423, 486 aquatic habitats, 174, 248 aquatic systems, 66, 281, 391, 392 arabinoside, 178 archaeological sites, 395, 397 architecture, 119 Argentina, 40, 44, 251, 256 arginine, 149, 157, 437 arithmetic, 403, 404 aromatic compounds, 52, 59, 150, 168, 282 aromatic hydrocarbons, 50, 60, 68, 101, 140, 144, 176, 212, 217, 236, 240, 298, 300 aromatic rings, 291 aromatics, 157, 161, 162 arsenic, xix, 199, 430, 434, 435, 437, 438, 439, 440 arthropods, 151, 451 aryl hydrocarbon receptor, 291 asbestos, 52, 55, 434 Asia, 198, 217, 242, 286, 470 Asian countries, 200, 217, 218 aspartic acid, 344

assets, 74 assimilation, 37, 205, 213, 215, 278, 382, 383, 384, 385, 387 asthma, 434 astrocytes, 144 atmospheric deposition, 276 atomic force, 169 atoms, 152, 199, 295 ATP, 98, 117, 118, 182, 194 attachment, 146, 149, 151, 159, 168, 171, 423, 436, 442, 449, 471, 474, 510 Australasia, 470, 483 Austria, 497 authorities, 139 autoimmune diseases, 111, 117 avoidance, 215, 514 azadirachtin, xix, 434, 436, 438, 439, 441, 442, 443, 446, 447, 448, 449

B bacteria, ix, 1, 3, 35, 37, 38, 39, 142, 180, 209, 325, 418, 423, 426, 431, 474, 478, 479 bacterial infection, 131, 143 bacterium, 424, 427 Balkans, 465 banks, 93, 472 Barents Sea, 393, 514 barriers, xiii, 91, 221, 431, 490 barriers to entry, 91 Beagle Channel, 187 beams, 359 behavioral variation, x, 43, 51 behaviors, 253, 439, 510, 514 Belgium, 301, 381 benzene, 290, 434 benzo(a)pyrene, 69, 136, 142, 178, 181, 203, 204, 284, 293, 294, 297, 300, 362 benzophenone, 183 beryllium, 434 beverages, 338, 339 bile, 193, 282 bioaccumulation, xiii, 101, 119, 130, 187, 190, 191, 198, 199, 200, 201, 202, 203, 204, 205, 206, 208, 212, 215, 216, 217, 222, 258, 262, 263, 264, 276, 277, 284, 287, 288, 383, 391, 392, 393, 442, 500 bioavailability, xvi, 50, 103, 186, 202, 209, 211, 212, 215, 218, 243, 254, 281, 288, 289, 298, 379, 380, 382, 383, 384, 385, 386, 387, 388, 389, 391, 392, 393, 499

Index biochemistry, xiii, 123, 187, 188, 191, 206, 245 biodegradability, 159 biodegradation, 199 biodiversity, xvi, xix, 60, 138, 237, 255, 379, 432, 442 biogeography, 261, 465 bioindicators, x, xiii, 43, 56, 61, 97, 98, 211, 245, 280, 380, 385 biological consequences, 386 biological control, 511 biological processes, 289 biological responses, 51, 137 biological systems, 334 biologically active compounds, 255 biomass, 304, 316, 317, 318, 320, 321, 326, 327, 329, 334, 373, 388 biomaterials, xii, 145, 151, 160, 161, 162, 168 biomonitoring, xiii, xvii, xxi, 51, 52, 56, 57, 59, 60, 63, 68, 71, 72, 103, 104, 125, 130, 139, 186, 196, 222, 235, 238, 239, 246, 247, 251, 253, 257, 261, 281, 282, 380, 385, 386, 387, 389, 390, 391, 392, 495, 496, 498, 499, 500 biosensors, 159 biosphere, 389 biosynthesis, 41, 98, 130, 253, 254 biotechnology, ix, xii, 145, 160 biotic factor, 48, 174, 383, 505 birds, xxi, 381, 385, 503, 505, 514, 517 birth control, 201 birth rate, 227 bisphenol, 131, 183 Black Sea, 68, 253, 260, 280, 289, 454, 455, 457, 461, 462, 464, 468 bleaching, 433 bleeding, 443, 444 blood clot, 449 body fat, 291, 292 body fluid, xix, 51, 441 body size, 213, 215, 384, 389, 481 body weight, x, 43, 48, 63, 204, 316, 319, 320, 384, 390 bonds, 154, 341, 342 bone, 281, 430 boreholes, xxi, 503, 512 boundary conditions, 306, 326, 330 bradykinin, 451 brain, 112, 252 Brazil, 177, 188, 337, 392 breakdown, 175, 382, 449 breast cancer, 111, 182, 193, 194, 299 breathing, 292

523

breeding, 228, 479, 480, 482, 513, 515 bridges, 349 Britain, 513 brominated flame retardants, 215 budding, 82 Bulgaria, 245 by-products, 175, 287, 354

C cadmium, 51, 55, 61, 63, 66, 69, 71, 111, 112, 119, 121, 125, 141, 143, 177, 179, 180, 183, 189, 191, 192, 199, 209, 213, 218, 238, 268, 279, 390, 391, 438, 440 calcium, 45, 154, 291, 399, 406, 407, 430, 432, 474 calcium carbonate, 45, 399, 406, 407, 432, 474 calibration, 6 canals, 44, 184, 432, 454, 455, 456, 482 cancer, 108, 111, 126, 182, 193 capillary, 6, 268 capital goods, xvi, 357, 361, 365, 368, 369, 370, 371, 374, 375 capitalism, 80 carbohydrate, 177, 447, 450 carbohydrates, 48, 55, 206, 346 carbon, xiv, xix, 2, 40, 77, 157, 158, 165, 204, 205, 264, 265, 268, 270, 272, 273, 276, 277, 278, 281, 283, 288, 290, 292, 307, 316, 319, 320, 327, 329, 344, 383, 384, 388, 393, 429 carbon atoms, 2, 158 carbon dioxide, xix, 429 carbonyl groups, 142 carcinogen, 59, 192 carcinogenesis, 66, 121, 123, 189 carcinogenicity, 189, 294 carcinoma, 111, 119, 120 cardiac activity, 247 cardiac arrest, 449 caries, 512 carotenoids, 56 carp, 239, 508 carrier agents, xv, 337, 347, 349, 353 cartel, 91 case study, 218, 219, 362, 365, 371, 376, 377 casein, 120, 123 Caspian Sea, xx, 453, 454, 455, 457, 461, 462, 463, 464 castration, 287, 512 catabolism, 72 catalysis, 124

524

Index

catalytic activity, 111 catastrophes, 212 catfish, 472 cation, 58, 72, 124, 191, 393, 449 causation, 494 cDNA, 110, 127, 132, 195 cell culture, 141, 159, 189 cell cycle, 63, 112, 114, 117, 122, 123 cell death, 237 cell line, 182, 486 cell lines, 182, 486 cell membranes, xiii, 245, 246 cell signaling, 130, 131, 139, 140, 216 cellular homeostasis, 48, 278 cellulose, 106 cercaria, 517 chaperones, 99, 111, 118 chelates, 154 chemical properties, 64, 201 chemical reactions, 339 chemical stability, 347 chemisorption, xi, 145 chemotaxis, 436 chemotherapeutic agent, 182 chicken, 342, 346, 347, 375 Chile, 44, 91, 358, 424 China, 40, 44, 88, 91, 196, 200, 213, 225, 226, 241, 358, 376 chlorination, xviii, 414 chlorine, 290, 292, 295 chloroform, 5, 455 chlorophyll, ix, 2, 5, 9, 33, 36, 37, 39, 306, 307, 312, 313, 418, 423 cholesterol, 184, 250, 252 cholinesterase, 67, 71 chromatid, 491 chromatography, 167, 268, 344, 349, 350, 425 chromium, 240, 382 chromosome, 486, 488, 489, 490, 491, 492, 494 chronic diseases, 286 chronology, xvii, 161, 395, 402, 403, 405, 407, 408 ciguatera, xvii, 413 ciguatera fish poisoning, xvii, 413 cilia, 46, 474, 479 circulation, xv, 49, 76, 77, 285, 384 City, 1, 251, 300 class, xxi, 58, 175, 179, 194, 200, 201, 251, 288, 290, 503, 510 cleaning, 201, 335 cleavage, 149, 342

climate, xvi, 55, 75, 198, 207, 210, 211, 259, 379, 399, 401, 406, 407, 408, 409, 410 climate change, xvi, 210, 211, 379 cloning, 122, 127, 182 closure, 247, 257, 261, 421, 451 cluster analysis, xiii, 17, 18, 32, 221, 236 clustering, 227, 229, 230 clusters, 228, 234 CO2, 368 coal, 253, 294 coal tar, 294 coatings, 165 cobalt, 253, 261 coding, 181, 184, 486 codominant, 223, 498 codon, 113 coenzyme, 187 collagen, 146, 147, 165, 168 colon, 111 colonization, 88, 442 color, iv, 45, 150 combined effect, 334 combustion, 199, 200, 293, 370 combustion processes, 199 community, 2, 38, 40, 41, 74, 81, 174, 206, 209, 237, 380, 386, 388, 480, 504, 508, 514, 515, 518 compensation, 248, 262 competition, ix, xv, 48, 85, 86, 87, 91, 92, 93, 246, 303, 304, 305, 316, 317, 320, 322, 326, 327, 331, 332, 341, 384, 504, 505, 510, 511, 517, 519 competitors, xxi, 151, 503, 510, 511, 514, 518 compilation, 359 complement, xii, 173, 431, 488 complementary DNA, 66 complexity, xii, 61, 197, 198, 201, 205, 209, 210, 387, 486, 518 composites, 382 composition, ix, xiii, xiv, 1, 35, 36, 38, 39, 40, 104, 108, 111, 114, 153, 160, 206, 222, 245, 246, 249, 254, 255, 256, 258, 260, 261, 262, 264, 266, 268, 276, 277, 279, 281, 298, 299, 333, 335, 344, 345, 346, 388, 409, 465, 471, 494 compounds, xiii, 51, 52, 55, 56, 57, 58, 59, 60, 65, 66, 98, 136, 141, 151, 162, 164, 166, 169, 175, 178, 181, 182, 183, 193, 195, 199, 200, 201, 204, 208, 214, 218, 219, 245, 267, 269, 270, 273, 276, 277, 278, 280, 287, 288, 289, 290, 292, 293, 294, 295, 297, 298,鿘339, 341, 344, 349, 381, 382, 384, 421, 422, 426, 433, 434 comprehension, xiv, 263

Index conceptual model, 374 condensation, 147, 347, 486 conditioning, 466 conduction, 201 conductivity, 306, 497 conference, 392 configuration, 290 conflict, 91, 92 conjugation, 166, 175 connectivity, 514 consensus, xvi, 148, 170, 357, 372, 463, 470 conservation, xi, xx, 98, 129, 131, 144, 276, 388, 390, 397, 409, 469, 472, 473 constant rate, 327 Constitution, 82 consumption, xiv, xv, xvi, xxi, 44, 89, 90, 92, 205, 245, 253, 285, 290, 292, 298, 303, 304, 305, 307, 308, 313, 320, 321, 329, 331, 332, 344, 357, 358, 361, 362, 364, 370, 373, 374, 424, 430, 503, 508, 515, 518 consumption rates, xv, 303, 304, 305, 308, 313, 329, 331, 332, 515 contaminant, 55, 66, 68, 69, 71, 176, 181, 185, 211, 213, 218, 219, 232, 234, 235, 265, 268, 269, 277, 283, 288, 289, 386, 388, 435, 436 contamination, xi, xiii, xiv, xvi, xviii, xix, 50, 59, 63, 70, 71, 122, 129, 130, 133, 139, 140, 141, 178, 180, 187, 192, 193, 195, 198, 209, 211, 217, 218, 221, 222, 232, 236, 242, 243, 253, 259, 264, 265, 277, 279, 280, 287, 288, 292, 293, 294, 296, 297, 298, 300, 379, 380, 385, 386, 387, 388, 389, 391, 392, 414, 415, 417, 419, 421, 430, 441 contradiction, 418, 433 control condition, 59, 248 convention, 174 cooking, 89, 91, 201, 339, 344 cooling, 5, 345, 349, 462 coordination, 151 copolymers, 160, 167 copper, 51, 55, 61, 62, 66, 69, 72, 122, 143, 150, 151, 154, 164, 165, 166, 169, 175, 177, 179, 180, 183, 185, 189, 192, 196, 199, 238, 240, 390 Coriolis effect, 76, 77 correlation, xiv, 6, 33, 34, 35, 36, 38, 102, 103, 111, 131, 139, 235, 264, 269, 273, 275, 278, 288, 401, 402, 403, 405, 407, 410, 497 correlation analysis, 6, 103, 235 correlation coefficient, 38, 102, 269, 403, 405 correlations, xiv, 104, 125, 235, 254, 264, 269, 276, 277, 278, 279, 403, 405, 406, 411

525

corrosion, 160, 165, 400 cosmetics, 201 cost, 50, 56, 82, 92, 104, 185, 198, 339 cotton, 360, 361, 364, 370 Council of Ministers, 200 covalent bond, 154, 157 covering, 174, 182, 198, 200, 204, 208, 210, 286 critical value, 349 critics, 92 Croatia, 129, 133, 137, 140, 261, 495, 497, 499 cross-linking reaction, xi, 145, 147, 152, 161 crude oil, 190 crystal structure, 119, 126 crystalline, 382 crystals, 45, 474 cues, 431, 509, 517 cultivation, 79, 80, 81, 82, 83, 84, 85, 88, 89, 90, 113, 228, 304, 359, 360, 364, 370, 376 culture, ix, x, xvi, 73, 74, 80, 93, 94, 98, 159, 239, 332, 333, 340, 357, 358, 359, 360, 362, 363, 364, 365, 367, 368, 369, 370, 373, 374, 375, 390, 420, 481, 491, 492, 515 curing process, xi, xii, 145, 146 cuticle, 148, 153, 157, 166, 169 cyanide, 150, 151 cycles, 36, 38, 49, 153, 154, 177, 210, 392, 459 cycling, 126, 213, 376 cyclooxygenase, 203 cyst, 424 cysteine-rich protein, 101, 179, 252 cystine, 169 cytochrome, xx, 50, 56, 181, 182, 192, 193, 207, 249, 269, 282, 453, 454 cytogenics, ix cytometry, 140, 494 cytoplasm, 108, 114, 117, 135, 435, 438 cytosine, 178 cytoskeleton, 112 cytotoxic agents, 437 cytotoxicity, 189, 434

D damages, iv, 178 danger, 78 Danube River, 254, 461 data analysis, 409 database, 122, 366, 457, 461 datasets, 405 decay, xviii, 45, 246, 414, 417, 421

526

Index

decentralisation, 82 decomposition, 269, 310, 314, 325, 329 defecation, 288 defects, 339 defence, xix, 54, 55, 56, 58, 111, 140, 187, 188, 189, 194, 276, 277, 279, 301, 430, 431, 432, 433, 437, 451 defense mechanisms, 103 deficiencies, 230, 238 deficiency, 47, 224, 243 deficit, 231 degradation, xiii, 49, 53, 55, 66, 68, 72, 124, 141, 176, 204, 245, 246, 265, 268, 295, 300, 339, 349, 418, 422, 423, 437, 472 degradation process, xiii, 245, 246 degradation rate, 72 dehydration, 340 democracy, 82 demographic data, 478 demographic structure, 388 denaturation, 60 Denmark, 44, 225, 358, 376, 377, 392, 507 Department of Commerce, 268 deposition, 293, 347, 388 deposits, 75, 382, 397 depression, 126, 247, 248 derivatives, 57, 169, 176, 183, 190, 200, 208, 347, 415, 417, 426 desiccation, 45, 246, 474, 511 desorption, 154 destination, 89 destruction, 117, 437, 438, 505, 512, 515 detachment, 47, 449 detection, 51, 71, 120, 125, 139, 140, 167, 169, 190, 202, 212, 219, 256, 269, 270, 271, 276, 279, 289, 350, 362, 385, 387, 399, 421, 425, 426, 463, 489, 499 detection system, 139 detergents, 58, 434, 438 detoxification, xviii, 50, 58, 59, 119, 179, 181, 191, 192, 212, 252, 255, 265, 278, 279, 287, 382, 386, 391, 414, 417, 420, 422, 425 developing countries, 49, 242 deviation, xiii, 76, 222, 246, 250, 364 dibenzo-p-dioxins, 299, 301 diesel fuel, xi, 129 diet, 36, 186, 205, 257, 286, 293, 430, 517 dietary intake, 293 diffusion, 199, 289

digestion, xxi, 2, 46, 53, 207, 213, 333, 340, 382, 436, 503 dihydroxyphenylalanine, 155, 156, 166, 169, 170, 171 dimerization, 123 dioxin, 290, 291, 292, 299 dioxin-like PCBs, 291, 292 dioxins, xiv, 49, 199, 236, 264, 267, 269, 270, 291, 292, 299, 300 dipeptides, 157, 160, 161, 162 diploid, 486 direct measure, xiii, 263, 264 disadvantages, 159 disaster, 513 discharges, 49, 201, 286, 497 discrimination, 151, 210 displacement, 358 dissociation, 98, 162 dissolved oxygen, 3, 7, 33, 38, 247, 256, 283, 304, 306, 307, 310, 311, 312, 313, 314, 319, 326, 327, 330, 381, 383 distillation, 293 distilled water, 5, 340 disturbances, 254, 386, 403, 419 divergence, 227, 238, 242, 493, 494 diversity, xx, xxi, 143, 170, 192, 201, 204, 210, 233, 234, 240, 241, 346, 431, 432, 453, 472, 481, 495, 496, 497, 498, 518 DNA, x, xiii, xx, 41, 47, 52, 54, 60, 61, 63, 64, 65, 69, 70, 71, 72, 97, 123, 130, 142, 144, 174, 177, 178, 181, 188, 189, 190, 193, 199, 203, 206, 210, 211, 212, 213, 221, 222, 223, 224, 225, 226, 227, 229, 230, 231, 232, 235, 236, 237, 239, 240, 241, 242, 251, 253, 255, 256, 287, 293, 454, 455, 458, 459, 460, 467, 485, 486, 492, 494, 496, 500 DNA damage, 52, 54, 60, 61, 63, 64, 71, 144, 177, 178, 189, 190, 203, 210, 251, 253, 255, 500 DNA lesions, 178, 189 DNA repair, 64, 178, 189, 287 DNA sequencing, 454 DNA strand breaks, 178, 190, 193, 211, 251 docosahexaenoic acid, 2 dominance, 2 dopamine, 150, 206, 214 double bonds, 176 down-regulation, 111 draft, 86 drainage, xx, 159, 202, 469, 472 drinking water, 290 Drosophila, 116

Index drug carriers, 160 drug delivery, 201 drugs, 55, 160, 180, 217, 218 drying, xv, 267, 293, 294, 337, 338, 345, 346, 347, 349, 353

E early warning, 52, 174, 185, 186, 205, 206, 208, 287, 496, 500 East Asia, 340 Eastern Europe, 456 ecology, 62, 144, 187, 190, 213, 222, 281, 282, 381, 389, 390, 392, 466, 467, 480, 481, 482, 491, 492, 508, 515, 516, 519 economic consequences, 454 economic efficiency, 81 economic performance, 74, 94 economic policy, 86 economic problem, 505 economy, 53, 74, 358 ecosystem, xix, 40, 49, 60, 75, 120, 139, 142, 174, 192, 198, 206, 207, 210, 215, 216, 246, 261, 265, 280, 304, 358, 388, 394, 432, 434, 439, 441, 442, 496 ecotoxicological genetics, xiii, 222, 233, 237, 238 editors, 281 effluent, 3, 165, 184, 194, 195, 209, 210, 217, 218, 236, 515 effluents, 100, 184, 185, 201, 206, 208, 210, 213, 214, 218, 236, 280 EGF, 148 egg, 169, 184, 207, 262, 289, 292, 298, 300 Egypt, 39 eicosapentaenoic acid, 2 eigenvalues, 273 elaboration, 94 elastin, 146 election, 266 electricity, 369, 370 electrodes, 169 electromagnetic, 131 electromagnetic field, 131 electron, 121, 151, 152, 154, 155, 175, 201, 207, 208, 210, 249, 268 electron microscopy, 121 electron paramagnetic resonance, 154 electrons, 252 electrophoresis, 71, 178, 190, 228, 232, 234, 460 ELISA, xi, 129, 133, 134, 135, 136, 138, 139, 422, 425

527

elongation, xi, 97, 98, 105, 106, 107, 111, 114, 124 elucidation, 424 embryogenesis, 47 emigration, 511 emission, 368 employment, 104 emulsions, 346 encapsulation, 345, 346, 430, 431, 434, 449, 511 encoding, xi, xx, 129, 131, 132, 133, 195, 453, 454, 455 endangered species, 397 endocrine, 183, 184, 195, 201, 207, 213, 222, 240, 293, 300 endocrine system, 183, 195, 201 endocrinology, 213 endonuclease, 457, 458, 461, 493 enemies, xxi, 503, 504, 505, 513, 518 energy consumption, 370 energy efficiency, 370 energy transfer, 388 enforcement, 74, 81 engineering, 166, 170 England, 281, 492, 507, 515, 519, 520 enlargement, 80, 259 environmental change, xii, xvi, 48, 173, 222, 262, 379, 391, 408, 410 environmental characteristics, 205 environmental conditions, xiii, xxi, 47, 50, 108, 182, 203, 245, 246, 249, 266, 288, 329, 381, 388, 423, 455, 465, 495, 496 environmental contamination, xi, xx, 66, 97, 287, 495, 496, 498, 499 environmental degradation, xx, 469 environmental effects, 238, 253, 333 environmental factors, x, xvii, 3, 41, 43, 47, 48, 130, 137, 139, 177, 250, 251, 282, 289, 290, 296, 298, 395 environmental impact, ix, x, xvi, 43, 50, 56, 67, 206, 217, 245, 281, 357, 359, 360, 368, 369, 370, 373, 374, 375, 377 environmental influences, 386 environmental protection, 279 Environmental Protection Agency (EPA), 2, 65, 200, 205, 214, 391, 499 environmental quality, 174, 186, 200, 202, 203, 251 environmental risks, 144 enzymatic activity, 50, 176 enzyme immobilization, 169 enzyme induction, 290

528

Index

enzymes, xii, 47, 53, 54, 56, 57, 58, 60, 61, 69, 70, 98, 102, 115, 119, 126, 131, 133, 146, 149, 151, 159, 160, 162, 168, 174, 175, 176, 180, 181, 185, 187, 188, 192, 193, 206, 213, 228, 234, 248, 249, 251, 252, 253, 256, 257, 266, 278, 283, 290, 293, 340, 341, 344, 387, 437, 438, 450, 488 epithelium, 46, 513 equality, 85 equilibrium, 49, 88, 203, 205, 206, 433 equipment, 93, 290, 339, 361, 363, 367, 368 erosion, 242, 472 erythrocytes, 62 esophagus, 46 ester, 161, 212, 418 estrogen, 183, 184, 195, 291, 293, 301 etching, 398 ethanol, 443, 455 ethers, 258 ethology, 431 ethylene, 160, 442 ethylene glycol, 160 eucalyptus, 88 euchromatin, 486, 488 Eurasia, 466, 470 European Commission, xviii, 413, 424 European Community, 174 European Parliament, 292, 299 European Union (EU), xviii, 174, 200, 294, 299, 377, 414, 424 evolutionary principles, 262 examinations, 294 excision, 60, 71 exclusion, 83, 443 excretion, 203, 205, 250, 257, 289, 295 exocytosis, 437 exoskeleton, 406 expenditures, 209 experiences, 80, 449 experimental condition, 139, 234, 437, 506 experimental design, 340 expertise, 104, 389 exploitation, xviii, 83, 84, 253, 414 exploration, xi, 98 exporter, 90 exports, 90 expressed sequence tag, 142 external environment, 381, 384, 385 extinction, xxi, 397, 496, 500, 503, 510 extraction, 5, 39, 79, 81, 83, 90, 122, 159, 267, 289, 339, 344, 455

extrusion, 345 exudate, 346

F fabrication, 164, 169 factor analysis, 240 fairness, 85, 87 false positive, 421, 422 family members, 122, 182 farmers, 85, 88, 91, 92, 360, 365 farming techniques, 81 farms, x, 73, 74, 79, 80, 82, 83, 84, 85, 88, 91, 281 fat, 292, 295 fat soluble, 292 fatty acids, x, 2, 6, 32, 34, 35, 36, 37, 39, 41, 180, 249, 257, 258, 260, 415, 417, 426 fauna, xvi, 250, 379, 388, 464, 466, 467, 483, 515, 518 feces, xiv, 285, 304, 317, 320 fermentation, 339, 340 ferritin, 382 fertility, 489 fertilization, 47, 231, 253, 289 fertilizers, 200, 472 fiber, 349 fibers, 146, 165 filament, 46 film thickness, 6 films, 164 filters, 106, 130, 320 filtration, x, xviii, xxi, 5, 38, 50, 97, 199, 202, 203, 234, 319, 327, 334, 381, 388, 429, 440, 503, 513 financial support, 353, 374 fingerprints, 204 Finland, 359, 395, 396, 397, 407, 409, 411, 454, 461, 467, 468 fish, xv, xxi, 3, 59, 60, 61, 62, 65, 66, 67, 69, 71, 84, 90, 93, 138, 181, 195, 201, 216, 218, 227, 233, 237, 256, 257, 278, 280, 281, 282, 283, 284, 286, 290, 291, 292, 293, 294, 296, 300, 304, 337, 338, 339, 340, 343, 344, 346, 347, 359, 376, 377, 381, 385,鿘387, 388, 426, 427, 442, 467, 471, 472, 473, 481, 483, 503, 508 fish oil, 292 fisheries, 85, 86, 87, 95, 283, 338, 354, 357, 358, 359, 373, 375, 376 fishing, 80, 81, 82, 83, 85, 95, 359, 360, 376 fission, 121 fitness, 233, 234, 237, 240, 490, 496

Index flame, 200 flame retardants, 200 flavor, xv, 337, 338, 339, 340, 344, 345, 346, 349, 350, 353 flexibility, 153 flight, 154 flooding, 75 flora, xvi, xix, 287, 379, 418, 430 flora and fauna, xix, 287, 430 flotation, 359 fluctuations, 102, 130, 180, 246, 250, 381 fluid, 250, 431, 473 fluorescence, 178, 212, 268, 282, 362, 419, 426 fluoxetine, 253 follicles, 47 food particles, 46, 381, 473 food products, 350 food safety, xvii, 413 Ford, 238, 455, 466, 499 forecasting, 407 formula, 82, 90, 400, 444 fouling, 160, 289, 306, 332 foundations, 75, 88, 94 founder effect, 464 fragments, 60, 178, 396, 402 France, xvi, 40, 44, 70, 88, 93, 129, 210, 214, 261, 266, 281, 282, 283, 333, 358, 375, 376, 379, 381, 425, 491 free radicals, 71, 107, 174, 188, 252 freedom, 93 freezing, 89, 111, 127, 203, 381 frequencies, 223, 231, 236, 239, 462, 463, 465, 496 frequency distribution, 314, 315, 463, 465 friction, 76 functional changes, 51, 386 fungi, ix, 1, 35, 37, 38, 39, 40, 180 furan, 291, 292 fusion, 159, 252, 437

G gamete, 237 gametogenesis, 47, 48, 184, 203, 207, 214, 215, 289 gel, 60, 71, 115, 167, 178, 190, 228, 232, 234, 344, 460, 461 gel formation, 167 gene expression, 47, 58, 64, 119, 193, 195, 214, 236 gene pool, 496

529

genes, 59, 64, 113, 115, 123, 131, 132, 133, 144, 166, 167, 181, 182, 183, 192, 223, 236, 248, 255, 291, 300, 491, 492, 496 genetic alteration, 103 genetic diversity, xx, 233, 234, 236, 237, 238, 242, 472, 495, 496, 497, 498, 500 genetic drift, 496 genetic information, 224, 228 genetic marker, 235 genetic traits, 210 genetics, xii, 221, 222, 232, 233, 237, 238, 239, 241, 242, 332, 390, 466, 486, 492, 494, 495 genome, 67, 113, 143, 486, 490 genotoxicology, 71, 242 genotype, 223, 233, 240, 242 geography, xx, 453 germ cells, 496 Germany, 129, 145, 444, 495 Gibraltar, 286 gill, xiv, xviii, 46, 53, 60, 64, 67, 71, 72, 100, 103, 124, 125, 132, 176, 178, 188, 189, 190, 249, 253, 258, 264, 270, 273, 382, 429, 450, 479, 482, 512 gland, xiv, 40, 46, 53, 54, 55, 56, 58, 60, 64, 69, 70, 72, 100, 101, 104, 105, 106, 122, 131, 140, 148, 150, 166, 177, 178, 181, 187, 188, 189, 190, 192, 193, 203, 210, 247, 261, 264, 268, 270, 272, 273, 275, 276, 277, 278, 279, 280, 418, 426, 434 glass transition, xvi, 338, 347, 348, 349, 353 glass transition temperature, xvi, 338, 347, 348, 349, 353 globalization, 239 glochidium, 47, 470, 471 glucose, 48, 159, 347 glucose oxidase, 159 glue, ix, xi, 145, 150, 166, 170 glutamate, 344 glutamic acid, 344 glutathione, xiv, 56, 57, 64, 175, 187, 188, 194, 251, 264, 266, 268, 272, 281, 282, 299, 389 glycerol, 114 glycine, 149, 161, 344 glycogen, 247, 304 gonads, 6, 18, 31, 32, 33, 35, 36, 37, 39, 46, 181, 184, 210, 214, 385, 517 governance, 75, 94 gracilis, 509 grading, 365 graduate students, 332 granules, 55, 58, 175, 382, 435 grass, 233, 240, 472

Index

530

grazing, 39, 373, 508 Great Britain, 485 Great Lakes, 67, 213, 241, 454, 466, 468, 480 Greece, 43, 71, 97, 99, 117, 120, 122, 189, 200, 219, 261, 280 grounding, 398 groundwater, 434 growth dynamics, 383, 401 growth factor, 131, 149, 166 growth mechanism, 79 growth rate, 3, 47, 48, 108, 114, 227, 247, 248, 249, 289, 327, 329, 338, 381, 404, 410, 509 growth rings, 410 guanine, 487 guidelines, 179, 190, 199, 226, 368, 375 Gulf of Mexico, 226, 238, 454 gum Arabic, 346, 347, 348, 349, 350, 352, 353

H habitats, ix, xii, xiv, xxi, 44, 47, 173, 246, 256, 258, 285, 288, 304, 332, 376, 381, 396, 399, 437, 470, 495, 498, 514 hair, 246 half-life, 51, 57, 186, 204 haploid, 486 haplotypes, xx, 453, 454, 455, 460, 461, 463, 464, 465 hardness, 154, 383 harmful effects, 382 harvesting, xvii, 84, 413, 415, 423, 424 hazardous substances, 69, 496 hazards, 508 haze, 346 HDPE, 361, 364, 367 health effects, 198, 293, 300 health problems, 205 health status, x, 43, 52, 53, 54, 61, 68, 206, 209, 211, 215, 247, 260, 261 heart rate, 207 heat loss, 347 heat shock protein, 130, 248 heavy metals, x, 47, 49, 52, 58, 59, 63, 97, 98, 99, 101, 106, 107, 111, 120, 131, 142, 178, 179, 180, 183, 189, 192, 203, 208, 211, 214, 222, 225, 228, 233, 235, 240, 243, 252, 280, 284, 286, 384, 390, 391, 393, 472, 499 height, 77, 509 helium, 6 heme, 151, 175, 180

hemisphere, 44, 76, 210 hemp, 377 hepatocellular carcinoma, 111, 119 hepatoma, 136 herbicide, 178 heterochromatin, 486, 488, 493 heterogeneity, 210, 234, 388, 488 heterosis, 497 heterozygote, 231, 243, 498 hexachlorobenzene, 281 hexachlorobiphenyl, 193 hexane, 282 high density lipoprotein, 418 high density polyethylene, 361 histidine, 147, 154, 157, 171 histochemistry, 482 histone, 489, 491 homeostasis, xix, 48, 49, 53, 57, 58, 59, 65, 72, 174, 179, 191, 248, 252, 393, 434, 441, 446, 449, 496 Hong Kong, ix, xvi, 1, 3, 39, 40, 41, 175, 187, 256, 280, 379 host, 144, 392, 431, 437, 449, 471, 472, 473, 512, 513, 514, 517 hot spots, 286, 374 human exposure, 292 human welfare, 439 humoral immunity, 433 Hungary, 497 hunting, 504, 505 hybrid, 83, 126, 160, 166, 167, 168, 242, 490, 491, 494 hybridization, 492 hydrocarbons, 41, 176, 179, 188, 190, 200, 286, 299, 349, 423 hydrogen, xi, 49, 56, 129, 134, 149, 151, 153, 175, 178, 180, 189, 192, 292 hydrogen bonds, 149, 153 hydrogen peroxide, xi, 56, 129, 134, 151, 175, 178, 180, 189, 192 hydrolases, 58, 124 hydrolysis, xi, xv, 98, 113, 182, 337, 338, 339, 340, 341, 342, 343, 344, 347, 353 hydrolysis kinetics, 341 hydroperoxides, 175 hydrophobic properties, 203, 254 hydrophobicity, 204, 290 hydroquinone, 161, 167 hydrothermal activity, 281 hydroxide, 433, 439 hydroxyapatite, 153, 164

Index hydroxyl, 70, 125, 252, 384 hypersensitivity, 434 hypothesis, 104, 134, 135, 136, 233, 242, 249, 418, 423, 463, 464 hypoxia, 3, 41, 98, 104, 131, 247

I Iceland, 391 ideal, 75, 200, 202, 264, 287, 477, 497 illumination, 443 image, 66, 444, 445, 446 image analysis, 66 images, 435 imbalances, 92 immersion, 266, 519 immobilization, xii, 145, 178 immune function, 140, 430, 434 immune reaction, 431, 449 immune response, 207, 430, 432, 433, 436, 440, 442 immune system, 141, 207, 211, 291, 431, 434 immunity, xix, 386, 427, 430, 431, 432, 433, 439, 450 immunocompetent cells, 433 immunogenicity, 159 immunosuppression, 434 impact assessment, xii, 197, 359, 368, 376, 377 Impact Assessment, vi, 197, 285 impacts, x, 43, 49, 61, 178, 185, 207, 209, 210, 218, 287, 303, 304, 333, 358, 359, 369, 375, 377, 383, 472, 496, 499, 501, 519 imports, 90 in situ hybridization, 192 in vivo, xviii, 108, 113, 114, 124, 159, 174, 178, 185, 190, 279, 293, 414 inbreeding, 224, 228, 231, 496 inbreeding coefficient, 224 incidence, 434, 519 incompatibility, 238 incomplete combustion, 253 independence, 249 independent variable, 340 indexing, 399 India, vi, xviii, xix, 226, 227, 429, 430, 431, 432, 434, 436, 439, 441, 442, 443, 444, 450, 470, 503 indirect effect, 514, 519, 520 indirect measure, 224 inducer, 163 inducible protein, 184, 287

531

induction, xi, 55, 56, 59, 61, 62, 65, 66, 114, 129, 130, 144, 177, 178, 179, 180, 181, 183, 189, 191, 192, 193, 195, 206, 207, 208 industrial chemicals, 434 industrial processing, xvii, 362, 413 industrialisation, 90 industrialization, 295 inertia, 401 infancy, 211 infestations, 513, 516 inflammation, 101, 142, 202, 252 infrared spectroscopy, 152 infrastructure, 81 ingestion, xv, 199, 205, 289, 303, 304, 317, 319, 320, 325, 387, 417 inheritance, 498 inhibition, 65, 70, 98, 108, 114, 124, 165, 171, 208, 246, 341, 435, 436, 437, 438, 439, 449, 450 inhibitor, 111, 114, 115, 134, 136, 165, 423 initiation, xi, 97, 98, 105, 106, 113, 114, 122, 124, 125, 203, 393, 433 innate immunity, 142, 431, 432, 440, 450 inoculation, 65 insecticide, 292 insects, 292 insertion, 146 instant noodles, xv, 337 institutional change, 81 institutional economics, 94 insulation, 347 integration, 91, 186, 205, 256 interdiction, xvii, 413 interface, 112, 117, 153, 169, 173, 333, 346, 512 interference, 278, 423, 442, 447, 448, 449 intermediaries, 278 internal environment, 431 internal growth, 398, 399, 411 internalised, 56 interphase, 488, 489, 491 interrelations, 240 intestine, 513 introns, 143 invertebrates, xi, xiii, xiv, 35, 40, 47, 60, 61, 64, 65, 66, 71, 72, 98, 99, 119, 129, 130, 141, 142, 145, 170, 175, 178, 179, 181, 183, 186, 191, 192, 194, 198, 201, 205, 212, 213, 217, 222, 234, 237, 239, 240, 253, 255, 256, 257, 259, 260, 261, 262, 285, 290, 296, 300, 381, 382, 384, 385, 387, 388, 390, 393, 433, 439, 449, 481, 483, 500 ion transport, 252

Index

532

ionization, 154, 162 ions, 52, 55, 126, 152, 153, 154, 160, 178, 182, 253, 261, 382, 383, 384, 392, 450 Ireland, 467, 485, 508 iron, xvi, 55, 122, 150, 152, 153, 154, 155, 160, 164, 170, 171, 175, 177, 180, 357, 362, 368, 369, 370, 374, 382 iron transport, 164 Islam, 265, 276, 281, 283 isolation, 119, 159, 168, 225, 227, 465, 480, 489, 494, 509 isomers, xiv, 136, 263, 267, 432 isotope, 40, 200, 265, 266, 268, 276, 278, 280, 281, 282, 283, 284 isozymes, 241, 248 Italy, vi, 63, 68, 69, 92, 93, 193, 195, 208, 213, 225, 282, 285, 286, 300, 354, 358, 381, 467, 516

J Japan, xv, 44, 225, 303, 304, 305, 332, 334, 380, 427 Japan, Sea of, 427 Jordan, vi, 245 judiciary, 81 justification, 93 juveniles, 3, 184, 253, 479, 482

K karyotype, 488, 489 karyotyping, 489 kidney, 144, 290, 383 kinase activity, 144 kinetics, 204, 205, 212, 213, 215, 264, 341, 424 Korea, 44

L labeling, 175 lactate dehydrogenase, 41, 256, 257 lakes, 44, 208, 209, 392, 432, 455, 463, 464, 468 larva, 47, 289 latency, 124 leaching, 201 lead pollution, 143 leakage, 438 learning, 82, 506 learning process, 506 legality, 86

legislation, xviii, 84, 85, 413, 421 leisure, 201 lesions, 66 leucine, 344 liberalisation, 84 life cycle, ix, 231, 359, 361, 362, 365, 374, 375, 376, 377, 381, 383, 392, 471, 472 ligament, 45, 397, 473, 474 ligand, 183 linear function, 317 linearity, 405 Lion, 486 lipid metabolism, 57 lipid oxidation, xv, 337, 339, 343 lipid peroxidation, 55, 56, 65, 72, 175, 176, 177, 187, 188, 189, 210, 251, 252, 255, 269, 273, 278 lipids, 2, 5, 40, 41, 48, 55, 56, 107, 174, 182, 203, 206, 209, 210, 250, 253, 254, 255, 261, 262, 304 lipoproteins, 423 liquid chromatography, 176, 212, 421, 426 Lithuania, 457 liver, 46, 62, 64, 66, 69, 71, 111, 120, 124, 136, 195, 281, 283, 290, 340 liver cells, 136 living environment, 496 localization, 117, 121, 141, 175, 248, 409, 418, 493 locus, xx, 223, 228, 231, 256, 453, 454, 455, 460, 461, 463, 464, 465, 489, 498 longevity, 403, 406, 410, 411 low temperatures, 48, 117, 248 lying, 358, 397 lysine, 157, 160, 161, 162, 344 lysosome, 55, 211, 418, 438 lysozyme, 433

M machinery, xi, 98, 99, 119, 254, 361, 362, 366, 368 macroalgae, 265, 280 macromolecules, 387 macrophages, 433 magnesium, 104, 106, 451 magnetic field, 142 Maillard reaction, 344 Maine, 248, 260, 494 Maine, Gulf of, 248, 260, 494 majority, 90, 91, 349, 388, 417, 490, 496 majority group, 91 malaria, 292 malate dehydrogenase, 208, 260

Index Malaysia, vi, xii, 221, 222, 223, 224, 225, 227, 228, 230, 232, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243 maltodextrins, 346, 347 management, 68, 81, 83, 90, 91, 94, 142, 183, 276, 283, 359, 375, 388, 467, 481, 482 manganese, 154, 175, 180, 382, 391 mangroves, 188 MANOVA, 6, 8, 17, 31, 32 mantle, xviii, 45, 46, 47, 53, 54, 134, 135, 177, 250, 429, 469, 473, 474, 479, 512 manufacture, 201 manufacturing, 93, 170, 286 MAP kinases, 129, 131, 132, 133, 135, 137, 138, 139, 144 mapping, 127, 377, 487, 489, 492 marine environment, x, xvi, 2, 3, 35, 39, 41, 43, 50, 58, 59, 61, 63, 67, 68, 142, 143, 178, 183, 187, 189, 218, 238, 246, 247, 253, 255, 265, 276, 287, 288, 295, 298, 380, 383, 385, 386, 387, 390, 392, 393, 411, 419, 504, 506 markers, xiii, xx, 2, 36, 37, 40, 50, 53, 68, 139, 143, 186, 206, 207, 208, 209, 216, 221, 222, 223, 225, 226, 227, 230, 234, 235, 236, 239, 240, 241, 242, 259, 260, 269, 278, 282, 343, 387, 418, 425, 454, 460, 485, 493, 496, 498 marketing, 92 marsh, 40, 239 masking, 344 mass loss, 156 mass spectrometry, 157, 212, 268, 421, 426 mastectomy, 159, 164 matrix, 45, 149, 154, 169, 283, 289, 512 meat, xv, 292, 337, 338, 339, 340, 341, 342, 343, 344, 345, 347, 348, 349, 350, 353, 430, 509 media, 60, 174, 222, 250, 290 median, 403, 404, 405, 406 mediation, 425 medication, 201 Mediterranean, vi, xi, xiv, xv, 44, 61, 62, 70, 71, 72, 79, 93, 98, 108, 126, 129, 139, 141, 174, 180, 181, 185, 186, 193, 196, 200, 213, 218, 251, 257, 258, 260, 264, 265, 280, 281, 282, 283, 285, 286, 289, 294, 296, 297, 301, 333, 380, 389, 420, 486, 491, 494 meiosis, 489, 490 melt, 75, 345 melting, 178 membrane permeability, 176, 289

533

membranes, xiii, 102, 103, 117, 182, 206, 245, 246, 249, 258 memory, 306 mercury, 55, 63, 71, 100, 121, 124, 125, 141, 142, 143, 177, 178, 179, 183, 187, 189, 199, 238, 283 Mercury, 100, 142, 439 messages, 407 messenger RNA, 119 messengers, 2, 252 metabolic pathways, 254 metabolism, ix, 48, 56, 63, 65, 66, 71, 121, 175, 180, 192, 204, 205, 206, 210, 233, 240, 247, 248, 250, 251, 252, 257, 261, 262, 265, 277, 289, 301, 334, 383, 389, 423 metabolites, xiii, 56, 60, 69, 183, 206, 212, 217, 219, 245, 250, 287, 290, 292, 419, 424 metacentric chromosome, 486, 489 metal oxides, 152, 159, 384 metalloids, 49, 434 metals, xiii, xvi, 3, 41, 49, 52, 55, 57, 58, 59, 64, 67, 69, 70, 72, 98, 100, 101, 104, 106, 107, 120, 143, 152, 153, 159, 164, 176, 177, 178, 179, 180, 188, 191, 192, 198, 199, 200, 201, 206, 207, 208, 214, 216, 219, 222, 224, 232, 234, 240, 245, 252, 253, 258, 259, 266, 280, 281, 286, 287, 368, 379, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 423, 434 metamorphosis, 47, 260, 471 metaphase, 59 meter, 306, 506 methanol, 5, 268 methodology, 185, 266, 342, 377, 399, 408, 461, 463 methylation, 254, 298 Mexico, 258 mice, 113, 120, 136, 294, 421, 426 microencapsulation, 345, 346, 353 micronucleus, xxi, 59, 62, 63, 67, 71, 103, 104, 117, 120, 122, 178, 185, 189, 190, 252, 438, 495, 499, 500 microorganism, xix, 436, 441 microsatellites, 222, 235, 239, 241, 495, 498 microscope, 398, 399, 444, 513 microscopy, 153, 157, 169 microsomes, 450 migration, 50, 60, 472, 492, 496, 505 mining, 199, 209, 280 Ministry of Education, 374 Mississippi River, 481, 482 mitochondria, 48, 53, 180, 208, 210, 248, 262 mitochondrial DNA, xx, 64, 453, 454, 485, 493, 494

534

Index

mitogen, 142, 144, 250 mitosis, 112 mixing, 76, 513 model system, 105, 287 modeling, xv, 109, 110, 115, 116, 205, 283, 303, 304, 317, 332, 400 modelling, 119, 278, 387, 401 modification, xi, 71, 83, 86, 98, 107, 159, 286, 423, 447, 510 moisture, 338, 349 moisture content, 349 mold, 147 molecular biology, 186, 192, 237 molecular mass, 56, 146, 147, 149, 418 molecular oxygen, 151 molecular weight, 58, 101, 114, 162, 179, 209, 252, 288, 296, 300, 343, 346, 347, 349 molecules, xii, 48, 98, 117, 131, 155, 156, 157, 162, 167, 168, 171, 180, 182, 197, 199, 201, 202, 203, 207, 265, 346, 431, 433, 438, 450 mollusks, 60, 122, 181, 213, 222, 240, 250, 255, 258, 260, 261, 299, 333, 395, 408, 483 monitoring, ix, x, xii, xiii, xiv, xvi, xvii, 36, 43, 49, 50, 51, 52, 53, 54, 57, 61, 62, 63, 64, 68, 71, 120, 125, 126, 143, 173, 174, 176, 177, 180, 181, 182, 183, 185, 186, 187, 190, 191, 194, 198, 199, 201, 203, 205, 211, 213, 215, 217, 222, 238, 240, 246, 249, 251, 252, 255, 258, 259, 260, 279, 285, 287, 288, 306, 379, 380, 381, 385, 386, 388, 391, 392, 393, 413, 421, 423, 426, 496, 500, 507 monoclonal antibody, 109 monolayer, 444 monomers, 104 monosodium glutamate, 344 monounsaturated fatty acids, ix, 1 Montana, 143 Moon, 166 Morocco, 124, 142 morphology, xvi, xx, 338, 353, 431, 433, 440, 470, 485, 486, 489, 490, 509 morphometric, 492, 493 mortality rate, 178, 218, 227, 509 mosaic, 491 Moscow, 394, 453, 460, 466, 467, 468 motif, 117, 148, 170 MPI, 232 mRNA, 104, 107, 113, 181, 182, 248 mtDNA, xx, 453, 454, 455, 456, 457, 460, 461, 462, 463, 464, 465, 494 mucus, 474

multiple factors, 434 multiplication, 291 muscles, 45, 431, 432, 473, 474, 507 Mussel Watch Program, xvi, 379, 388 mutant, 123 mutation, 242, 496, 500 mutation rate, 242, 500 myosin, 342, 347

N NaCl, 115 naiad, 483 nanomaterials, 201, 215 nanoparticles, 52, 55, 67, 69, 160, 171, 201, 216 nanotechnology, 201, 214 naphthalene, xiv, 264, 268, 273, 276, 362 national product, 358 National Research Council, 69, 77, 500 native species, 93, 253, 289 natural enemies, xxi, 503, 504, 505, 510, 513, 514 natural habitats, 183, 246 natural killer cell, 140 natural resources, xiii, 222, 390 natural selection, 227, 241, 504 nature of time, 411 negative consequences, 253 negative relation, 103, 204 nematode, 63 nerve, 144 nervous system, 383, 473 Netherlands, 44, 201, 213, 332, 333, 375, 381, 424, 425, 485 neurodegeneration, 123 neurotoxicity, 206, 291, 301 neurotransmitter, 150 neutral lipids, 56, 69, 218 New England, 517 New Zealand, 44, 91, 225, 259, 283, 358, 425, 508, 518 nickel, 126, 175, 180, 191, 200, 434 Nile, 279 nitrate, 3, 5, 9, 10, 33, 36, 106, 214 nitrates, 77 nitric oxide, 124, 252, 437, 438, 439 nitric oxide synthase, 437 nitrogen, xiv, 5, 6, 157, 165, 199, 214, 250, 251, 264, 265, 268, 270, 272, 273, 276, 277, 278, 280, 283, 284, 366, 367, 373, 377 NK cells, 135

Index NMR, 155, 157, 166, 169 North America, 44, 198, 199, 248, 253, 262, 299, 420, 454, 466, 468, 470, 471, 472, 474, 482, 483, 485, 489, 493, 507, 511 North Sea, 62, 66, 144, 219, 225, 242, 485, 494 Norway, 212, 281, 359, 377, 406, 494 nuclear magnetic resonance, 155 nuclei, 59, 178, 435, 488, 491 nucleic acid, 106, 107, 213, 252, 387 nucleophiles, 157, 158 nucleotides, 339, 344, 460, 461 nucleus, 59, 108, 135, 136, 178 numerical analysis, 334 nutrients, x, 2, 3, 38, 49, 73, 74, 76, 77, 78, 79, 304, 325, 333, 372, 472, 479 nutrition, 35, 38, 288, 339

O objectivity, 87 oceans, xiv, xv, 76, 198, 285, 368, 380 oil, 49, 64, 129, 133, 136, 139, 160, 179, 181, 182, 190, 193, 218, 251, 259, 282, 286, 294, 339, 346, 362, 364, 367, 368 oil production, 368 oil spill, 64, 133, 179, 181, 190, 193, 251, 282, 294 Oklahoma, 280 oligomers, 162 one dimension, 201 oogenesis, 195 operating system, 433 optimization, 340, 374 organ, xviii, 46, 49, 60, 82, 133, 206, 290, 384, 429, 473, 475 organelles, 53, 54, 57 organic chemicals, 199, 200 organic compounds, xiv, xvi, 65, 213, 264, 273, 278, 290, 345, 380, 499 organic materials, 3 organic matter, xiv, xv, 35, 40, 253, 281, 285, 303, 307, 310, 311, 314, 319, 320, 321, 329, 381, 384 organism, xv, 48, 49, 50, 51, 52, 53, 57, 60, 61, 113, 138, 139, 147, 183, 206, 213, 234, 246, 247, 248, 250, 251, 252, 253, 255, 264, 267, 277, 278, 279, 285, 288, 289, 293, 334, 380, 383, 396, 423, 431, 433, 434, 471, 496 organochlorine compounds, xiv, 57, 217, 274, 285 organotin compounds, 141, 240 oscillations, 327 osmolality, 250

535

overharvesting, xx, 469 overlap, 254, 402 ownership, 83 ox, 278 oxidation, xi, 57, 72, 123, 145, 150, 151, 155, 156, 162, 165, 177, 199, 251, 339, 343, 345, 346, 383, 384, 419, 420, 426 oxidation rate, 151, 165 oxidative damage, 55, 56, 175, 176, 177, 188, 251, 252, 260, 278, 282 oxidative reaction, 176 oxidative stress, 54, 55, 56, 57, 59, 65, 70, 72, 115, 121, 124, 125, 126, 142, 144, 174, 177, 180, 187, 188, 189, 193, 202, 203, 210, 251, 252, 254, 256, 260, 261, 262, 265, 278, 279, 280, 438 oxygen, xv, xix, 5, 7, 34, 48, 60, 63, 71, 98, 150, 151, 152, 154, 155, 156, 165, 174, 199, 247, 256, 257, 265, 278, 289, 303, 304, 305, 306, 307, 308, 310, 311, 312, 314, 325, 329, 331, 332, 333, 335, 337, 373, 376, 383, 384, 429 oxygen consumption, 247, 256, 257, 307, 310, 314, 329, 331, 335, 376 oxygen consumption rate, 307, 329, 331 oyster, 62, 142, 194, 195, 226, 241, 249, 258, 261, 421, 430, 515, 516 oysters, xv, xvii, xviii, 41, 55, 65, 70, 200, 217, 227, 238, 256, 258, 337, 380, 414 ozone, xvi, 357, 368, 369

P Pacific, 3, 44, 195, 210, 217, 241, 242, 260, 380, 485, 489, 492, 493, 494, 517, 518 packaging, 90, 360, 362 PACs, 215 paints, 133, 200 palladium, 180, 192 parallel, 76, 112, 114, 458 paralysis, 419 parasite, 433, 436, 513, 514, 515, 516, 518 parasites, xxi, 93, 258, 430, 431, 471, 503, 512, 514, 516, 518 Parliament, 85, 86 parotid, 168 partition, 203 path analysis, 520 pathogens, 247, 431, 433, 435, 437 pathology, 55

536

Index

pathways, x, xi, 67, 97, 101, 104, 131, 140, 141, 142, 143, 145, 152, 185, 203, 210, 237, 246, 252, 290, 339, 388 PCA, xiv, 264, 269, 270, 272, 273, 274 PCBs, xiv, 49, 50, 52, 55, 57, 69, 176, 181, 196, 213, 254, 259, 264, 265, 267, 268, 269, 271, 273, 274, 275, 276, 277, 278, 279, 281, 285, 290, 291, 292, 294, 295, 296, 301 PCR, 59, 64, 111, 112, 192, 225, 226, 240, 454, 455, 457, 458, 459, 460, 461 Pearson correlations, 402, 405, 406 PEP, 228, 231 pepsin, 146, 147 peptide chain, xi, 97 peptides, 110, 151, 152, 153, 156, 157, 160, 161, 163, 167, 168, 170, 182, 341, 343, 344, 347 performance, 52, 176, 248, 249, 250, 255, 261, 359, 360, 362, 368, 374 pericardium, 433 periodicity, xvii, 395 permeable membrane, 218 permit, 151, 211, 387, 389 peroxidation, 52, 55, 57, 64, 176, 177, 249 peroxide, 56, 151, 175, 420 peroxynitrite, 70, 437 perylene, 293, 297, 362 pesticide, xix, 58, 286, 292, 436, 439, 441, 443, 446, 449 pesticides, 49, 51, 58, 65, 72, 98, 101, 176, 180, 183, 200, 204, 206, 208, 253, 261, 265, 266, 282, 283, 286, 296, 300, 423, 434, 438, 451, 472 PET, 361, 367 phagocytosis, xix, 54, 140, 202, 207, 431, 433, 434, 436, 437, 438, 439, 440, 441 pharmaceuticals, 55, 200, 214, 218, 253 pharmacology, 301 phase transitions, 114 phenol, 147 phenylalanine, xi, 145, 147, 161, 162, 165 phosphates, 77, 382, 389 phosphatidylcholine, 254 phosphatidylethanolamine, 254 phosphoenolpyruvate, 257 phospholipids, xiii, 177, 245, 250, 251, 254, 256, 257, 259 phosphorous, 373 phosphorylation, xi, 98, 99, 108, 110, 114, 115, 117, 118, 122, 126, 127, 129, 131, 132, 133, 134, 135, 136, 138, 140, 141, 142, 143, 149, 251 photosynthesis, 77

phthalates, 183 phylum, 253 physical environment, 35, 94 physical interaction, 152 physical properties, xiii, 245, 246, 249 physical stability, 353 physiological factors, 289, 401 physiology, x, 41, 43, 50, 56, 182, 183, 202, 205, 239, 282, 289, 332, 381, 382, 390, 423, 432, 492 phytoplankton, xiv, xvii, 2, 3, 35, 36, 37, 38, 39, 40, 75, 77, 249, 250, 265, 278, 283, 285, 335, 372, 376, 387, 413, 423, 425, 481 pigments, 55, 188 pilot study, 68, 218 plaque, 146, 148, 149, 153, 154, 166, 171 plasma membrane, 175 plasticity, 498 plastics, 368 platform, 88, 112, 305, 306, 307, 308, 309, 326, 330, 360 poison, 420, 424, 426 Poland, 97, 379, 517 polarity, 346 polarization, 112 police, 81 polonium, 200 polybrominated biphenyls, 434 polybrominated diphenyl ethers, 200 polychlorinated biphenyls (PCBs), 55, 176, 265 polychlorinated dibenzofurans, 300 polycyclic aromatic hydrocarbon, xiv, 41, 49, 55, 67, 69, 133, 142, 176, 190, 193, 199, 212, 215, 217, 219, 222, 236, 251, 256, 261, 265, 268, 283, 285, 293, 299, 300, 301, 362 polydimethylsiloxane, 349 polymer, 152, 157, 162, 165, 346 polymer chains, 152 polymerase, 458 polymerization, 156, 164 polymers, xi, 145, 146, 165, 347 polymorphism, 226, 237, 238, 454, 457, 489, 493 polymorphisms, 122, 227, 232, 234, 241, 243, 457, 463, 486, 490 polypeptide, 56, 160, 170, 171 polyphenols, 178, 194 polypropylene, 361 polystyrene, 359 polyunsaturated fat, ix, xiii, 1, 2, 11, 12, 13, 14, 15, 16, 19, 21, 23, 25, 27, 29, 40, 176, 188, 245, 252, 349

Index polyunsaturated fatty acids, xiii, 2, 40, 176, 188, 245, 252, 349 polyvinyl chloride, 307 pools, 104, 507 population density, 305, 316, 319, 320, 322, 326, 330, 479 population growth, 198, 338 population size, 60 Porifera, 143 porosity, 512 Portugal, 79, 141, 191, 381, 413, 415, 421, 424, 426 positive correlation, xiv, 33, 35, 176, 264 positive feedback, xxi, 503, 510 positive relationship, 180 potassium, 104, 106, 433 poultry, 339, 430, 442 power plants, 304 praxis, 386 precedent, 489 precipitation, 202, 344 predation, xix, xxi, 246, 441, 503, 504, 505, 506, 508, 509, 510, 511, 512, 514, 516, 517, 518 predators, x, xxi, 43, 45, 47, 48, 304, 474, 503, 504, 505, 506, 507, 508, 509, 510, 513, 518, 519, 520 prevention, 159, 164 primate, 168 principal component analysis, 269, 270, 272, 274 private ownership, 83 probability, 199, 224 probe, 65, 438 procurement, xix, 429 producers, x, 44, 73, 74, 86, 90, 91, 92, 93, 94, 415 product market, 91 production capacity, 373 productivity, 75, 76, 78, 80, 82, 373, 518 profitability, 87, 93 project, 63, 87, 186, 279, 332, 377, 499 proliferation, xi, 52, 57, 61, 62, 69, 78, 98, 108, 111, 112, 120, 449 propagation, xix, xx, 430, 442, 469, 482 property rights, 74, 81, 83, 85, 93, 95 prostaglandins, 261 protective coating, 166 protective mechanisms, 266 protein family, 150, 169 protein hydrolysates, 340, 344 protein kinase C, xi, 98, 99, 110, 113, 115, 116, 119, 120, 124, 125, 127 protein kinases, 112, 115, 122, 140, 143 protein oxidation, 57, 252

537

protein sequence, 132, 133, 171 protein signatures, 185 protein structure, 109, 110, 115, 116, 119, 123 protein synthesis, xi, 71, 97, 98, 99, 100, 104, 106, 107, 111, 113, 117, 121, 123, 124, 126, 177, 253 protein-protein interactions, 126 proteins, xi, xx, 48, 53, 54, 55, 56, 58, 59, 64, 98, 99, 106, 107, 108, 109, 110, 111, 114, 117, 118, 121, 122, 123, 124, 125, 126, 127, 129, 130, 131, 133, 139, 143, 145, 146, 147, 148, 149, 150, 151, 152, 153, 155, 156, 157, 159, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 174, 181, 182, 183, 184, 190, 191, 192, 193, 194, 206, 207, 209, 211, 261, 287, 338, 341, 344, 347, 356, 382, 387, 418, 432, 485 proteolysis, 342 proteome, 185 proteomics, 67, 187 prototype, 421, 422 Prozac, 259 public administration, 80 public domain, 83, 84 public health, 195, 288, 294, 382 public sector, 90, 91 pulp, 218, 236, 242 purification, 39, 89, 115

Q qualitative differences, 66, 300 quality assurance, 180, 191 quality of life, 201 quinone, xi, 145, 148, 150, 151, 152, 155, 156, 157, 158, 160, 170, 171 quinones, 150, 155

R radiation, 236, 237 radicals, 60, 70, 154, 174, 176, 252, 384 radio, 200 Raman spectroscopy, 168 reactants, 155 reaction rate, 248, 341, 342 reaction temperature, 342 reactions, xii, xv, 54, 55, 68, 145, 162, 176, 180, 192, 206, 217, 252, 337, 338, 339, 450 reactive oxygen, 56, 69, 71, 106, 111, 174, 178, 248, 249, 251, 252, 260, 262, 265, 282

538

Index

reactivity, 162, 201, 422, 449 reading, 365, 409 reagents, 104, 154, 168 real terms, 90 reality, 425 reception, 473 receptors, 63, 183 recognition, 117, 127, 193, 430, 431, 434, 436, 442, 471 recommendations, iv, xviii, 93, 389, 414 recreational areas, 3 recycling, 369, 376 Red List, 480 Red Sea, 62 redistribution, 295 regeneration, 373, 393, 433 regression, 408, 409, 410 regulatory framework, 179 relative toxicity, 291 relatives, 349, 518 relevance, xvi, 141, 161, 164, 181, 186, 193, 206, 237, 371, 375, 379, 385, 386 reliability, 406 repair, 60, 71, 178, 179, 189, 265, 403 replacement, 206 replication, x, 97 reproduction, x, xii, 2, 3, 36, 38, 39, 40, 53, 93, 195, 197, 207, 209, 211, 289, 295, 300, 304, 360, 383, 472, 479, 481, 482, 511 reproductive cells, 385 reproductive organs, 473 research and development, 338 reserves, 206, 207, 304 residues, xi, 58, 68, 110, 113, 117, 118, 145, 148, 149, 153, 154, 156, 157, 158, 179, 276, 293, 434, 437, 442, 449 resilience, 423 resistance, 48, 57, 66, 101, 144, 160, 165, 182, 193, 194, 207, 216, 241, 265, 287, 381, 403, 514, 517 resolution, 86, 120, 121, 126, 387, 468 resorcinol, 165 resources, xvi, 74, 81, 83, 209, 276, 290, 357, 426, 505, 511, 518 respiration, xxi, 199, 205, 207, 208, 247, 260, 304, 314, 316, 319, 325, 334, 473, 474, 480, 503 response time, 498 responsiveness, 58, 174 restructuring, 85 reticulum, 53, 68, 180 rhinitis, 434

ribosomal RNA, 98, 107, 124, 127, 492 ribosome, xi, 97, 106, 107, 110, 111, 114, 117, 120, 121, 125 rights, iv, 74, 81, 82, 83, 85, 95, 96 rings, 155, 290, 298, 396, 406, 408, 409, 478, 497 risk assessment, 67, 130, 195, 201, 206, 209, 254, 255, 262, 284, 291, 292, 298, 387, 388 risk management, 388 river basins, 227 RNA, 63, 107, 121, 123, 124, 206, 213 RNAi, 108 rocks, xv, 44, 79, 88, 303, 358, 511 rodents, 434 Romania, 469 room temperature, 455 roughness, 347 Rouleau, 212 Royal Society, 425 runoff, 36, 210, 286, 497 rural population, 430 Russia, 44, 259, 453, 458, 460, 467

S salinity, x, xiii, xv, 3, 5, 7, 33, 38, 43, 47, 48, 51, 75, 76, 137, 138, 139, 174, 185, 186, 196, 211, 245, 246, 250, 251, 254, 255, 258, 259, 261, 285, 288, 289, 290, 296, 306, 307, 310, 311, 312, 314, 319, 326, 327, 329, 330, 334, 381, 383, 384, 391, 494, 497, 513 saliva, 168 salmon, 50, 340, 359, 370, 375, 474 salts, 5, 77, 78, 250, 339, 382 saltwater, ix, x, 43, 44 sanctions, 85 SAP, 450 saturated fat, ix, 1, 2, 11, 12, 13, 14, 15, 16, 19, 21, 23, 25, 27, 29 saturated fatty acids, ix, 1, 2 saturation, 319 scaling, 319, 404, 408 scars, 474 scavengers, xii, 56, 57, 145, 179, 388 sclerochronology, xvii, 395, 396, 399, 403, 404, 405, 406, 409, 410 screening, 3, 38, 166, 178, 179, 185, 194, 332, 449 SEA, 259 seafood, xiii, xiv, xv, xvi, 80, 84, 218, 222, 245, 285, 288, 290, 337, 338, 339, 340, 357, 358, 359, 368, 376, 380, 381, 419, 425

Index seasonal changes, ix, 1, 6, 18, 31, 32, 38, 121, 177, 192, 507 seasonality, 186 secondary sector, 89 secretion, 46, 55, 430 sediment, 40, 41, 78, 93, 140, 153, 173, 191, 199, 202, 205, 213, 214, 215, 217, 218, 232, 236, 252, 280, 289, 293, 298, 300, 333, 385, 388, 389, 390, 391, 419, 423, 442 sedimentation, 78, 104, 472 sediments, 55, 100, 101, 114, 141, 175, 187, 199, 202, 212, 215, 216, 218, 225, 243, 280, 286, 293, 298, 333, 373, 381, 383, 384, 385, 387, 388, 389, 397 seed, 39, 74, 88, 255, 334, 360, 362, 367, 376, 442, 472 segregation, 490, 494 selectivity, 69 selenium, 71, 175, 187 self-control, 93 self-fertilization, 231 semi-permeable membrane, 53, 212 sensing, 141 sensitivity, 62, 174, 179, 208, 219, 248, 249, 253, 257, 388, 420, 497 sensors, 306, 307, 308 sequencing, 166, 182, 460, 463 serine, 58, 113, 117, 118, 149, 259 serotonin, 206, 214 serum, 114, 335, 431 sewage, xii, 3, 38, 100, 197, 201, 208, 209, 210, 217, 218, 265, 280, 281, 282, 283, 284, 286 sex, 47, 203, 206, 227, 290, 301, 391 sex chromosome, 47 sex ratio, 206, 227 shade, 472 shape, 44, 46, 74, 88, 112, 289, 349, 382, 391, 396, 399, 411, 444, 476, 477, 478, 479 shear, 160 sheep, 281 shelf life, xvi, 338, 345, 353 shell destroyers, xxi, 503, 512, 514 shellfish, xvii, xviii, 84, 205, 213, 217, 333, 339, 358, 413, 414, 419, 421, 424, 425, 426, 427, 513 ships, 151, 160, 303 shock, 143, 144, 146 shoreline, 360, 367 shores, xiv, 44, 285, 506, 507, 511, 515, 519 short supply, 512 shortage, 325

539

shrimp, 167, 233, 238, 240, 281, 339, 340, 342, 370, 376 shrinkage, xix, 349, 430 sibling, 299 signal peptide, 167 signal transduction, 63, 112, 120, 140, 142, 291 signaling pathway, xi, 129, 131, 138, 140, 141 signalling, 141, 142, 143, 258 signals, 52, 124, 251, 287, 409, 410 signs, 90 silica, 344 silicon, 168 silk, 146, 168 silkworm, 108, 123 silver, 160, 179, 180, 192, 199, 489 simulation, 306, 329, 334 Singapore, 39 siphon, 46, 474 sister chromatid exchange, 488 skeletal remains, 397 skeleton, xvii, 395 skin, 45, 47, 346, 383 sludge, 93, 218 smoking, 293, 294 social benefits, 74, 81 social institutions, 81 social sciences, 94 sodium, 153, 433, 435, 436, 437, 438 sodium hydroxide, 153, 433 software, 6, 269, 366, 460 solid phase, 204, 349 solid surfaces, 146 solid waste, 368 solubility, 201, 310, 344, 346 somatic cell, 293 sorption, xvi, 338, 349, 353 sorption isotherms, xvi, 338, 349, 353 South Africa, 298, 301 Southeast Asia, 68, 240 Southern Africa, 225, 239 Spain, xvi, xviii, 44, 79, 82, 90, 91, 96, 98, 126, 141, 187, 257, 263, 312, 327, 329, 333, 334, 335, 357, 358, 359, 362, 366, 369, 375, 376, 377, 381, 410, 413, 415, 421, 424, 425, 469, 485, 519 specialists, 94 speciation, 222, 281, 383, 388, 391, 392, 489, 490, 492, 493 species richness, 472 specifications, 85 spectrophotometer, 269

540

Index

spectrophotometric method, 72, 126 spectrophotometry, 100, 121, 122 spectroscopy, 157, 390 sperm, 254, 479, 494 spermatogenesis, 113, 254 spin, 152 spindle, 59, 178, 435 sponge, 132, 139, 511, 516 Spring, 280, 468 St. Petersburg, 466 stabilization, 147, 149, 345, 346 stabilizers, 338 stable isotopes, 264, 265, 269, 277, 281, 283, 284 stakeholders, 212 standard deviation, 210, 268, 345, 404 standardization, 399, 400, 407, 408, 409 starch, 228, 232, 234, 347 stars, 47, 48, 507 starvation, xv, 256, 299, 303, 325 statistics, xiii, 221, 223, 228, 236, 403, 410 steel, 51, 160, 164, 165, 186, 267, 361, 367, 368 stem cells, 433 sterile, 443 steroids, 184 sterols, xiii, 193, 245, 249, 253 stomach, 2, 46, 469, 473 storage, xv, 2, 51, 56, 67, 163, 164, 252, 295, 304, 337, 345, 349, 352, 353, 382 streams, 472 stress factors, 47, 114 stressors, xx, 48, 55, 141, 198, 206, 207, 208, 209, 210, 211, 247, 258, 495, 496, 497, 498, 499 strong interaction, 49 strontium, 281 structural protein, 146, 164, 171 structuring, 501 subdomains, 116 substitution, 290, 461, 489 substitutions, 460 substrates, xi, xxi, 3, 56, 115, 124, 135, 145, 162, 166, 168, 170, 175, 180, 181, 183, 380, 381, 423, 455, 460, 503 succession, 2 sucrose, 104 sulfur, 40 sulphur, 199, 265, 377, 382 Sun, 148, 167, 170 suppression, 98, 123, 438 supraventricular tachycardia, 256 surface area, 83, 88, 201

surface layer, 78, 326 surgical intervention, 159 surplus, 505 surveillance, 279 survey, 201, 213, 215, 362, 363, 390 survival, xix, xx, 47, 52, 60, 106, 112, 113, 130, 177, 185, 207, 209, 210, 234, 237, 240, 242, 300, 431, 441, 469, 511, 519 survival rate, 185 susceptibility, xv, 65, 70, 279, 337 suspensions, 61 sustainability, xii, 174, 198, 281, 376 sustainable development, xvi, 379 Sweden, 407, 408, 409, 410, 518 swelling, 55 Switzerland, 195, 218, 340, 375 symptoms, xvii, 383, 413, 512 synaptic clefts, 58 syndrome, 64, 78, 121, 185, 196, 233, 240, 419 synthesis, xi, xii, 56, 58, 59, 61, 97, 98, 100, 105, 106, 107, 108, 111, 118, 130, 140, 146, 147, 151, 159, 162, 168, 178, 179, 200, 208, 283, 393, 458, 459

T Taiwan, 200, 216 tanks, 417, 419 tannins, 178, 190 taphonomy, 409 tar, 362, 364, 368 target organs, 382, 387 taxonomy, xx, 485, 486, 492 teeth, 473, 478 temperature, x, xiii, xv, 3, 5, 6, 33, 37, 38, 39, 40, 43, 47, 48, 51, 69, 75, 76, 77, 104, 121, 124, 130, 131, 137, 138, 139, 140, 174, 176, 183, 186, 202, 207, 208, 210, 211, 245, 246, 247, 248, 249, 250, 254, 255, 260, 261, 267, 285, 288, 289, 290, 296, 306, 307, 310, 311, 312, 313, 319, 326, 330, 332, 334, 335, 338, 340, 341, 343, 347, 349, 381, 383, 385, 408, 410, 443, 460, 471, 472, 473, 474, 479, 511, 513 tendons, 146, 168 tensile strength, 160 tensions, 63 testing, xvii, 65, 182, 185, 190, 213, 214, 333, 411, 413, 458, 500 tetrachlorodibenzo-p-dioxin, 291 Thailand, 173, 186, 358, 359

Index thermal oxidation, 349 thermal resistance, 98 thermosets, 170 thinning, 335, 360 threshold level, 253 thrombus, 449 thyroid, 291 tides, 78, 209, 246, 506 time periods, 86, 387 time series, 399, 405, 408, 411 time use, 133 tin, 199, 209, 268 tissue, xii, xiv, xxi, 2, 5, 6, 33, 36, 37, 39, 41, 46, 47, 48, 51, 52, 60, 71, 99, 125, 142, 145, 159, 166, 170, 175, 176, 177, 206, 211, 216, 249, 250, 253, 256, 259, 264, 267, 268, 272, 273, 278, 279, 281, 282, 287, 288, 289, 293, 383, 384, 385, 387, 388, 393, 421, 430, 433, 449, 471, 474, 503, 512 titanium, 165 Title V, 85 toluene, 434 total product, 91, 363 tourism, xvi, 49, 380 toxic contamination, 442 toxic effect, xii, 51, 58, 64, 173, 174, 197, 203, 205, 234, 252, 286, 287, 291, 382, 384 toxic metals, 59, 101, 252, 434 toxic substances, 174, 386 toxicity, xvi, xix, 51, 55, 56, 64, 70, 72, 126, 136, 185, 199, 200, 201, 206, 207, 208, 209, 211, 214, 216, 239, 250, 265, 290, 291, 292, 293, 300, 357, 358, 368, 369, 370, 372, 373, 374, 379, 382, 383, 385, 387, 392, 415, 419, 421, 424, 426, 430, 433, 440, 443, 500 toxicology, xx, 54, 65, 190, 202, 216, 222, 238, 287, 301, 389, 495, 496 toxicology studies, 202 toxin, xviii, xix, 413, 414, 415, 417, 418, 419, 421, 424, 425, 426, 427, 430, 436, 444 trace elements, 41, 142, 382 trade-off, 261, 509 training, 305, 332 traits, xx, 469, 510 transaction costs, 74, 94 transactions, 74 transcription, x, 72, 97, 112, 141, 248, 291 transcripts, 111 transduction, 130 transformation, 41, 91, 199, 204, 389, 400, 417 transformation product, 199

541

transformations, 387 transition metal, 122, 153 transition temperature, 347, 349, 353 translation, xi, 97, 98, 99, 104, 106, 107, 108, 111, 114, 118, 122, 124, 125 translocation, 64, 127 transmission, 223 transparency, 85, 87 transplantation, 41, 63, 68, 70, 228, 266, 282, 283, 508 transport, 50, 133, 182, 193, 194, 207, 208, 210, 249, 286, 289, 291, 384, 424, 433 transport processes, 384 tributyltin chloride, 141 triggers, 123 triglycerides, 48 trypsin, 149, 488 tryptophan, 161, 167, 344 tumorigenesis, 112 tumours, 60, 294 turbulence, xiv, 285 Turkey, 280, 390 turnover, 53, 89, 124, 233, 248, 278, 286, 287, 358, 373, 387, 418 tyrosine, 140, 147, 148, 149, 150, 151, 155, 159, 160, 161, 164, 167, 168, 345 Tyrosine, 161, 165, 345 tyrosine hydroxylase, 150, 164

U ultrastructure, 164 UNESCO, 68, 424, 425, 426 uniform, 435, 443 United Kingdom (UK), xvi, 41, 191, 192, 193, 208, 259, 299, 334, 335, 353, 354, 379, 389, 390, 391, 491, 515, 516 United Nations, 61, 68, 199, 354, 424 urban area, 184, 195, 214 urbanisation, 252 urbanization, 49, 198, 442 USSR, 255, 466, 467

V vacuum, 5 Valencia, 280 validation, 179, 187, 192, 234, 256, 280, 327, 391 valleys, x, 73, 74, 75

Index

542

vanadium, 180, 191 vapor, 100 variations, xvii, 6, 51, 104, 105, 131, 138, 170, 187, 188, 212, 215, 234, 235, 241, 261, 282, 288, 298, 320, 325, 332, 335, 362, 385, 387, 390, 395, 399, 401, 403, 405, 407, 435 vector, 293 vegetables, 293, 299, 338 vegetation, 260 vehicles, 253 ventilation, xxi, 335, 503 Venus, 492 vertebrates, xi, 98, 129, 132, 290, 381 vesicle, 437 vessels, x, xvi, 3, 73, 88, 186, 357, 360, 362, 363, 364, 365, 366, 367, 368, 370, 374 victims, 514 virus replication, 112 viruses, 431 viscera, 431 viscosity, 346, 349 vision, 74 visualization, 332 vitamin E, 56 vitamins, 2 volatility, 346 volatilization, 293

W Wales, 505 waste, 57, 144, 203, 286, 292, 338, 339, 342, 344 waste water, 203, 286 wastewater, xvi, 3, 141, 192, 217, 218, 357, 362, 364, 365, 366, 368, 374, 377 water activity, 347, 348, 349 water ecosystems, 281, 387 water quality, ix, xiii, xvi, xx, 1, 3, 35, 38, 63, 70, 87, 131, 139, 175, 176, 225, 234, 239, 257, 263, 264, 277, 283, 290, 305, 306, 307, 308, 332, 376, 379, 469, 472, 499 water resources, 174

watershed, 217, 281 waterways, 57, 200 weakness, 139 wealth, 81, 208 weight loss, 304 welfare, 254 western blot, 111 wetlands, 276, 442, 443 wettability, 171 wholesale, 88 wild animals, 51 wildlife, 58, 282, 292, 496 wind farm, 304, 332 withdrawal, 83 wood, 111, 127, 253, 359, 361, 365, 368 workers, 181, 183, 332, 431, 435, 449 World Health Organisation, 292 World Wide Web, 41 worms, 513 wound healing, 433, 434, 446

X X-ray, 362

Y yarn, 366 yeast, 105, 107, 108, 111, 113, 114, 115, 118, 119, 121, 123, 124, 126, 127, 138, 144, 339, 435, 436, 437 yolk, 184, 207 young women, 299

Z zinc, 61, 66, 67, 69, 70, 72, 117, 140, 143, 175, 179, 180, 183, 200, 242, 280, 391 zoology, 470 zooplankton, ix, 1, 3, 35, 37, 38, 39, 479