MOLECULAR GENETICS OF IMMUNOGLOBULIN
New Comprehensive Biochemistry
Volume 17
Generml Editors
A . NEUBERGER London...
212 downloads
1550 Views
13MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
MOLECULAR GENETICS OF IMMUNOGLOBULIN
New Comprehensive Biochemistry
Volume 17
Generml Editors
A . NEUBERGER London
L.L.M. van DEENEN Utreclzt
ELSEVIER Amsterdam New York
*
Oxford
Molecular Genetics of Immunoglobulin
Edifors
F. CALABI and M.S. NEUBERGER Medical Research Council Ltihoratory of Molecular Biology, Hills Road, Combridge C B 2 2 Q H , U K
1987 ELSEVIER Amsterdam New York
. Oxford
0 1987, Elsevier Science Publishers
B.V. (Biomcdical Division)
All rights reserved. No part of this publication may hc rcprocluced. stored i n a retrieval system, or transmitted i n any form or by any means, electronic. mechanical. photocopying. recording or otherwise, without the prior written permission of the Publisher. Elsevicr Science Publishers B.V. (Biomedical Division). P . O . Box 1527, 1000 BM Amsterdam. The Nethcrlands. No responsihility is assumed hy the Publisher for any injury and/or damage to persons or property as a matter of products liahility. negligence o r otherwise. or frcm any use or operation of any methods. products, instructions or ideas contained in the material herein. Because of the rapid advances in the medical sciences, the Publisher recommends that independent verification o f diagnoses and drug dosages should be made. S p e d rc7guluriotz.s f i i r reciders i i i rlic U S A . This publication has been registered with the Copyright Clearance Center. Inc. (CCC). Salem, Massachusetts. Information can he obtained from the CCC about conditions under which the photocopying o f parts of this publication may he madc in the USA. All other copyright questions. including photocopving outside of the USA. should be referred to the Publisher.
ISBN 0-444-XO915-5 (volume) ISBN 0-434-80.303-3 (series) Published by: Elsevier Science Publishers B.V. (Biomedical Division) P.O. Box 211 1000 A E Amsterdam The Netherlands Sole distributors lor thc USA and C;ln;da: Elsevier Science Publishing Company. Inc 51- Vandcrbilt Avenuc New York, NY 10017 USA Library of Congress Cataloging in publication Data Molecular genetics of inimunoglohulin (New comprehensive hiochcmistry ; v . 17) Includes bibliographies and index. 1, Immunoglobulins--Genetics. 2. Gene exprcssion. I . Calahi, F. (Franco) 11. Neuberger, M.S. (Michael S.) 111. Series. [DNLM: I . Gene Expression Regulation. 2. Immunoglobulins--genetics, WI NE372F v.17 / QW 601 M7181 QD4IS.N-IX ~ 0 1 . 1 7 571.19'2 s [616.07'9] 87-24302 (QR186.71 ISBN 0-444-80915-5 (U.S.) Printed in The Netherlands
V
Preface Immunoglobulin genes are not just of interest to immunologists. An understanding of the way in which DNA rearrangement and somatic mutation contribute to antibody diversity is of importance to a wide range of biologists. The cell-type specificity of immunoglobulin gene expression is of concern to many who are interested in gene expression in mammals. Furthermore, the immunoglobulin superfamily itself presents important questions to those interested in evolution. The analysis of immunoglobulins and of their genetics has advanced rapidly since the mid-l970s, mainly as a result of the application of recombinant DNA and monoclonal antibody technologies. The essential features of the molecular anatomy of both antibodies and their genes have been largely identified; this has resulted in significant insights into the way antibody diversity is generated. Clearly, much still remains to be elucidated in these areas, whilst studies both of regulation and of phylogeny are still in their infancy. We felt nevertheless that it was a good time to draw together what we do know about the molecular genetics of immunoglobulin. We wish to thank the authors for contributing to this volume and the publisher for prompt publication. Cambridge
Franco Calabi Michael S. Neuberger
This Page Intentionally Left Blank
Contents Preface .................................................................................................... . . List of abbreviations ................................................................................ Chapter I Structure and function of antibodies D.R. Burton (Sheffield, U K ) . . . . . . . . . . . . . . . . . I. 2.
Introduction .... .... ....................... Structure of IgG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.1. General considerations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.2. Domain structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.3. Structure of Fab . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.4. Antigen recognition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.5. Structure of Fc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2.6. The hinge: IgG subclasses . . . . . . . . . . . . . . . . . 2.7. Isotypes, allotypes and idiotypes. . . . . . . . 3. Functions of IgG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.1. Introduction. . . . . . . . . . . . . . . . . . . . . . . . . . ...... 3.2. Interaction with protein A . . . . . . . . . . . . ......................... 3.3. Complement activation ................................. 3.4. Interaction with cellular .................................. 3.5. Other functions of IgG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.6. Rheumatoid factors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.7. Membrane or surface IgG . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.8. Structure-function relationships in IgG: domain hypothesis . . , . , . . , . . , , . , , . , . , 4. Structure o f other immunoglobulins in relation t o IgG . . . . . . . . 5 . Structure and function of I g M . . . . . . . . . . . . . . . . . . . . . . . . . ......... 5.1. Structure of IgM. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.2. Functions of IgM . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.3. Membrane IgM . . . . . . . . . . . . . . . . . . . . . . . . . ........ 6. Structure and function of IgA . . , . . 6.1. Structure of serum 6.2. Structure of secret 6.3. Functions of IgA ...................
v XII
1 1 3 3 6 6 8 11
21 21 22 24 26 27 27 28 36 37 39 39 39 41 41
VIII 7 . Structure and function of IgD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . X . Structure and function of IgE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . X . l . Structure o f IgE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 . 2 . Functions of IgE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9 . Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
41 43 43
Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
46 47
Chapter 2 Genes encoding the immunoglobulin constant regions M . Briiggemann (Cambridge. UK) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
51
1 . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 . Chromosomal localization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 . Organization of constant region genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.1. Mouse heavy chain genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.2. Mouse light chain genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 . 3 . Human heavy chain gencs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.4. Human light chain genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.5. Other species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.6. Switch regions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.7. Membrane exons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . J chain . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .......................................
1 constant region genes . . . . . . . . ............. 4.1. Heavy chain genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
4.2. 4.3. 4.4. 4.5. 4.6.
Light chain genes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Polymorphism . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Pseudogenes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Evolution . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Aberrations and malignancies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
52 52 53 54 55 55 58 61 62 62 64 64 67 68
69 70 72
Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
75 75
Chapter 3 Genes encoding the immunoglobulin variable regions P.H. Brodeur (Boston. MA. USA) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
81
1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 . V gene structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 . Gene families . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.1. Mouse VI, families . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.2. Human V,, families. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3. Mouse V, families . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.4. Human V, families ............................................ 3.5. Mouse V, families . . . . . . ................................. 3.6. Human V, families . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
86 87 88 89 89
IX 4.
Genenumber . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1. Number of mouse V genes 4.2. Number of human V genes
................................
. ......
.. ...,.
, ,
..,.,
, , ,
.. ... .. .. ..,
. .. ..
5. Chromosome assignment .................. ... . .. .. ... . .. ... 6 . Gene organization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.1. Igh locus organization . . . . . . . . . . . . . . , . , . . , . . , . , , . , . . . . . . . . . , . , . . . . . . .. .. .... 6.2. I g K locus organization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.3. Igh locus organization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7. Polymorphism . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8. Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgements , , , . . . . . . . . . . . . . . . . . . . . . . , . . . . . , , . , . . . . . . . . . . __ .. . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
90 90 02 94 95 95 99 101 101 105
105 106
Chapter 4 Assembly of immunoglobulin vuriuble region gene segmeitls M. Reth and L. Leclercq (Cologne, FRG and Paris, France) . . . . . . . . . . 111 1.
Introduction mechanism . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.1. Joining signals , . . . . . . . . . . . . . . . . . . . . . . . . , , . , , , , , , . . . . . . . . . . 2.2. Joining models . . . . . . . . . . . . . . . . . . . . . . . . . . . . , . . . . . . . . . . . . . . . 2.3. Control of joining. . . . . . . . . . . . . . . . . . . . . . . , . , , , , , . , . . . . . . . . . . 3. Order of rearrangement events during B cell tlcvelopment . . . . . . . 3.1, Rearrangements at the IgH locus . . . . . . . . . . . . . . . . . . . . . 3.2. Rearrangements at the light chain loci . . . , . . . . . . . . . . . . . . 4. Allelic exclusion of immunoglobulin gcne expression . . . . . . . . . . .
.. .. ..
111 112 112
.. .... . . ....
I14
.. ....
129
Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . , . . , , . . . . . . . . . . . . . . . . Kefcrences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
13 1
Chapter 5 Immunoglobulin heavy chain cluss switching U. Krawinkel and A. Radbruch (Cologne, FRG)
I17
131
135
1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
135
. ... . .. .. . .. . , .. ..
.
139
. . . . .. . .. ... . . . .. . ... . . . . . ... .. . . .. . . .. . .. . . . ... ... .. . .. ... . . ..... .. . .. . . .. . . . . .. ... .. . ... . ... .. .. ... .. .. ... , , , , . . . . . . . . . . . . . , . , . . . . . . . . . . . . . . . .
142 145
....
4.
3.2. Isotype commitment . . Molecular analysis . . , . . .
4.2. 4.3. 4.4. 4.5.
Long transcripts , . . . . . . . Class switch recombination Switch sequences . . . . . . . Switch recombination sites.
............................ .............
.. ... .. ... .. ... .. .,,
... ... . .
140
146
X 5 . Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
147
Reviews . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
149 149
Chapter 6 Immunoglobulin gene expression G.P. Cook. J.O. Mason and M.S. Neuberger (Cambridge . UK) . . . . . . . 153 I . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............ 2 . Tumours as models . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 . Patterns of immunoglobulin gene expression during B cell ontogeny . . . . . . . . . . . . . . . . 3.1. Changes in chromatin structure . . . . . . .......................... 3.2. Expression of productively rearranged lo .......................... 3.3. Expression of aherrantly rearranged loci . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.4. Expression of unrearranged loci . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 . Processes regulating immunoglobulin gene expression . . . . . . . . . . . . . . . . . . . . . . 4.1. Promoter upstream elements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2. Enhancer elements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3. Other promoter elements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4. Transcription termination . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.5. RNA cleavageipolyadenylation . . . . . . . . . . . . . . . ............... 4.6. RNA splicing . . . . . . . . . . . ............................... 4.7. Messenger R N A turnover . ................................ 4.8. Translational and posttransl ation . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 . Major aspects of cell-type specificity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5.1. Restricted cell-type specificity of immunoglobulin gene transcription . . . . . . . . 5.2. Control of the difference in mRNA abundance between B and plasma cells . . . . . . . 5.3. The relative abundance of membrane and secreted immunoglobulin . . . . . . . . . . . . . 5.4. Co-expression of two immunoglobulin classes . . . . . . . . . . . . . . . . . . . . . . . . . . . .
153 153 154 154 155 156
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
173
Chapter 7 The generation and utilization of antibody variable region diversity T . Manser (Princeton. NJ. USA) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
156
157 157 159 164 164 165 166 167 167 168 168 169 170 173
177
177 1. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 178 2 . Antigen independent diversity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 178 2.1. Combinatorial diversity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 182 2.2. Junctional diversity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185 2.3. The multiplicative potential of combinatori 3 . Antigen dependent diversity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185 3.1. The evidence for somatic mutation: a histor . . . . . . . . . . . . . . . . . . 186 188 3.2. Somatic mutation and the immune respons 190 3.3. Mechanistic considerations regarding somatic mutation . . . . . . . . . . . . . . . . . . . . . . 194 3.4. Somatic mutation and clonal selection theory . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197 3.5. T cells and somatic mutation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197 3.6. Antibody diversity and B cell subsets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
XI 4.
Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Referenccs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Chapter 8 The immunoglobulin superfamily F . Calabi (Cambridge. UK) . . . . . . . . . . . . . . . . . . . . . . .
19X 198 198
203
1 . Introduction . . . . . ........ 2 . The immunoglobulin 3. The T cell receptor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.1. The a/p T cell receptor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.2. The $8 T cell receptor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3.3. Relationship between the expression of the aip and of the $8 T cell receptors . . . . . 4 . The major histocompatibility complex . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.1. Overall structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.2. Structure of the variable region . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.3. Structure of the constant region . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4.4. Genetic basis of diversity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 . Accessory molecules of the a/p T cell receptor (CD4 and CDX) .............. 6 . Other members . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.1. Thy-1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.2. Poly-immunoglobulin receptor . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.3. Neuronal cell adhesion molecule (NCAM) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6.4. Myelin associated glycoprotein/ncuronal cytoplasmic protein 3 (MAG/Ncp 3) . . . . . . 6.5. Viral members . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 . Evolutionary considerations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
203
Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
233 233
Subject index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
241
206 207 215 218 219 221 221 224 224 226 228 229 230 230 231 231 231
XI1
List of abbreviations Ars BiP C region CDR D segment Fab
Fc FcR FR
H Hm Hs HAT HIV Ig IL-4 J segment J chain L LPS LTR MAG MHC N region NCAM N K cell
p-azophen ylarsonate immunoglobulin heavy chain binding protein constant region complementarity determining region diversity segment antigen binding fragment from papain digestion of immunoglobulin antigen binding fragment from pepsin digestion of immunoglobulin crystallizable fragment from papain digestion of immunoglobulin immunoglobulin Fc receptor framework region immunoglobulin heavy chain membrane form of immunoglobulin heavy chain membrane form of immunoglobulin heavy chain hypoxanthine, aminopterin, thymidine medium human immunodeficiency virus immunoglobulin interleukin 4 joining segment joining chain immunoglobulin light chain bacterial lipopolysaccharide long terminal repeat myelin associated glycoprotein major histocompatibility complex nucleotide region neuronal cell adhesion molecule natural killer cell
4-hydrox y-3-nitrophenylacetyl 2-phenyl-5-oxazolone PC phosphorylcholine Poly-IgR poly-immunoglobulin receptor RFLP restriction fragment length polymorphism RS rearranging sequence ( K locus) S region switch region T cell receptor TcR tk thymidine kinase V regionisegment variable regionisegment
NP
ox
This Page Intentionally Left Blank
CHAPTER 1
Structure and function of antibodies DENNIS R. BURTON Department of Bioc-lzcwristry, Universi~yof Sheffirld, ShrJjjield S I O 2TN. U K
I . Introduction Antibody molecules are essentially required to carry out two principal roles in immune defence: (i) to recognise and bind to foreign material (antigen). In molecular terms this generally means binding to structures on the surface of the foreign material (antigenic determinants) which differ from those o f the host. Such antigenic determinants are usually expressed in multiplc copies on the foreign material, e.g. proteins on a bacterial cell surface. The host needs to be able to recognise a wide variety of different structures - it has been estimated that a human being is capable of producing antibodies against more than 10" different molecular structures. This is described as antibody diversity. (ii) to trigger the elimination of foreign material. In molecular terms this involves the binding of certain molecules (effector molecules) t o antibody-coated foreign material to trigger complex elimination mechanisms, e.g. the complement system of proteins, phagocytosis by cells such as neutrophils and macrophages. The effector systems are generally triggered only by antibody molecules clustered together as on a foreign cell surface and not by free unliganded antibody. This is crucial considering the high serum concentration of some antibodies. The requirements imposed on the antibody molecule by the functions (i) and (ii) are in a sense quite opposite. Function (i) requires great antibody diversity. Function (ii) requires commonality, i.e. it is not practical for Nature to devise a different molecular solution for the problem of elimination for each different antibody molecule. In fact the conflicting requirements are elegantly met by the antibody structure represented in Fig. 1. The structure consists of three units. Two of the units are identical and involved in binding to antigen - the Fab (fragment antigen binding) arms of the molecule. These units contain regions of sequence which vary greatly from one antibody t o another and confer on a given antibody its unique binding specificity. The existence of two Fab arms greatly enhances the affinity of antibody for antigen in the normal situation where multiple copies of antigenic determinants are presented to the host. The third unit - Fc (fragment crystalline) is involved in binding to effector molecules. As shown in Fig. 1. the antibody molecule has a four-chain structure consisting o f two identical heavy chains spanning Fab and Fc and two identical light chains associated only with Fab.
7
Antigen binding
Antigen binding
Complement triggering Cell receptor binding (Rheumatoid factor binding)
Fig. I . A schcinatic rcprcsentation o f antibody structure emphasising the relationship between structure ;ind function. The antibody molecule can be thought of in terms ol three structural units. Two Fab arms bind antigen and arc therefore crucial for antigen recognition. The third unit (Fc) binds effector inolecules triggering antigen elimination. The antihody niolccule thus links antigen recognition and antigen elimination. The structure is composed of four chains. Two identical heavy (H) chains span Fah and Fc regions and two identical light ( L ) chains arc a w x i a t c d with Fah alonc.
The five classes o f antibodies o r immunoglobulins termed immunoglobulin G (IgG), IgM, IgA. IgD and IgE differ in their heavy chains termed y, p, a , 6 and E , respectively. T h e differences are most pronounced in the Fc regions of the antibody classes and this leads to the triggcring of different effector functions on binding to antigen, e . g . IgM recognition o f antigen might lead to complement activation whereas IgE recognition (possibly of the same antigen) might lead to mast cell degranulation and anaphylaxis (increased vascular permeability and smooth muscle contraction). Structural differences also lead to differences in the polymerisation state of the monomer unit shown in Fig. 1. Thus, IgG and IgE are generally monomeric whereas IgM occurs as a pentarner. IgA occurs predominantly as a monomer in serum and as a dimer in seromucous secretions. T h e major antibody in the serum is IgG and as this is the best-understood antibody in terms of structure and function we shall consider it shortly. T h e other antibody classes will then be considered in relation to IgG. First, however. a very brief overview of the structure and function o f the different immunoglobulins will be presented [ 11. IgG is the major antibody class in normal human serum forming about 70% of the total immunoglobulin. I t is evenly distributed between intra- and extravascular pools. IgG is a monomeric protein and can be divided i n t o four subclasses in humans. It is the major antibody of secondary immune responses. IgM represents about 105k of total serum immunoglobulin and is largely confined t o the intravascular pool. I t forms a pentameric structure and is the predominant antibody produced early in an immune response, serving as the first line of defence against bacteraemia. As a membrane-bound molecule on the surface of B lymphocytes it is important as an antigen receptor in mediating the response of these cells to antigenic stimulation.
3 1gA forms about 15-20% of total serum immunoglobulin where it occurs largely as a monomer. In a dimeric complex known as secretory IgA (sIgA) it is the major antibody in seromucous secretions such as saliva, tracheobronchial secretions, colostrum, milk and genitourinary secretions. IgD represents less than 1% o f serum immunoglobulin but is widely found on the cell surfaces of B lymphocytes where it probably acts as an antigen receptor analogously to IgM. IgE though a trace immunoglobulin in serum, is found bound through specific receptors on the cell surface of mast cells and basophils in all individuals. It is involved in protection against helminthic parasites but is most commonly associated with atopic allergies.
2. Structure of IgG 2.1. Gerierul considerutions
In IgG the Fab arms are linked t o thc Fc via a region of polypeptide chain known as the hinge. This region tends t o be sensitive to proteolytic attack generating the basic units of the molecule as distinct fragments. The discovery of this action by Porter in 1959 [2] provided the first great insight into antibody structure. In 1962 Porter proposed a four-chain structure for the IgG molecule [ 3 ] .Since then, chemical and sequence analyses, notably by Edelman [4]. have confirmed a four-chain structure consisting of two identical heavy (H) chains of inolecular weight approximately 50000 and two identical light (L) chains of molecular weight approximately 25 000. The molecular weight of IgG is thus typically approximately 150000. The light chains are solely associated with the Fab arms of the molecule whereas the heavy chains span Fab and Fc parts as shown in Fig. 2. A single disulphide bond connects light and heavy chains and a variable number, depending on IgG subclass (see below), connects the two heavy chains. The latter connection is made in the hinge region of the molecule. Papain cleaves heavy chains to the amino-terminal side of these hinge disulphides producing two Fab and one Fc fragment. Pepsin cleaves to the carboxy-terminal side producing a single F(ab’), fragment and smaller fragments of Fc including a carboxy-terminal pFc’ fragment. The light chains exist in two forms known as kappa ( K ) and lambda (A); the forms arc distinguished by their reaction with specific antisera. In humans, K chains are somewhat more prevalent than A. in mice. A chains are rare [ S ] . The heavy chains can also be grouped into different subclasses. the number depending upon the species under consideration. In humans there are four subclasses having heavy chains labelled y l , y2, y3 and 74 which give rise to the I g G l , IgG2, IgG3 and IgG4 subclasses. In mouse there are again four subclasses denoted IgG1. IgG2a, IgG2b and lgG3. The subclasses - particularly in humans - have very similar primary sequences, the greatest differences being observed in the hinge region. The cxistence of subclasses is an important feature as they show marked differences in their ability to trigger effector functions. In a single molecule, the two heavy chains are identical as are the two light chains; hybrid molecules are not found.
4
5 Sequence comparison [6] of monoclonal IgG proteins, either myeloma proteins or more recently antibodies generated by hybridoma technology, indicates that t h e carboxy-terminal half of the light chain and roughly three quarters of the heavy chain, again carboxy-terminal, show little sequence variation between different IgG molecules. In contrast, the amino-terminal regions of about 100 amino acid residues show considerable sequence variability in both chains. Within these variable regions there are relatively short sequences which show extreme variation and are designated hypervariable regions. There are three of these regions or ‘hot spots’ on the light chain and three on the heavy chain. Since the different IgGs in the comparison recognise different antigens, these hypervariable regions are expected to be associated with antigen recognition and indeed are often referred to as complementarity determining regions (CDRs). The structural setting for the involvement of the hypervariable regions in antigen recognition is discussed below. Sequence comparison also reveals the organisation of IgG into 12 homology regions or domains [4] each possessing an internal disulphide bond. The basic domain structure is central to an understanding of the relation between structure and function in the antibody molecule and will shortly be taken up in some detail. However, the structure in outline form is shown in Fig. 2(b,c). It is seen that the light chain consists of two domains, one corresponding to the variable sequence region discussed above and designated the V , (variable-light) domain and the other corresponding to a constant region and designated the C, (constant-light) domain. The IgG heavy chain consists of four domains, the VH and CHI domains of the Fab arms being joined to the CH2 and CH3 domains of Fc via the hinge. Antigen binding is a combined property o f the V Land ~ V, domains at the extremities of the Fab arms and effector molecule binding a property of the C,2 and/or cH3 domains of Fc. From Fig. 2(b,c) it is also clear that all of the domains except for cH2 are in close lateral association with another domain: a phenomenon described as domain pairing or truns-interaction. The CI,2 domains have two N-linked branched car~~~~~
.
~~~
~~~
~
~~
- .
~
~~
Fig. 2(a-c). The 4-chain structure of IgG. ( a ) Linear rcpresentation. Disulphide bridges link the two heavy chains and the light and heavy chains. A regular arrangement of intrachain disulphide bonds is also found. Fragments generated by proteolytic cleavage at the indicated sites are represented. This representation should be interpreted in terms o f Fig. 2(b,c) for a fuller understanding. (b) Domain representation. Each heavy chain (shaded) is folded into two domains in the Fab arms, forms a region of extended polypeptide chain in the hinge and is thcn folded into two domains in the Fc region. The light chain forms two domains associated only with an Fab arm. Domain pairing leads to close interaction of heavy and light chains in the Fab arms supplemented by a disulphide bridge. The two heavy chains are disulphide bridgcd in the hinge (the number of bridges depending on IgG subclass) and are in close domain-paired interaction at their carboxy-tcrmini. (c) Domain nomenclature. The heavy chain is composed of V , , , C,,1, C,,2 and Cl13domains. The light chain is composed of V, and C , domains. All the domains are paired except for the CF,2 domains which have two branched N-linked carbohydrate chains interposed between them. Each domain has a molecular weight of approximately 13000 Icading to a molecular weight of -50000 for Fc and Fab and 1.50000 for the whole IgG molecule. Antigen recognition involves residues from the V I , and V,. domains, complement triggering the C,2 and Fc receptor binding the C,,2 and possibly the C,,3 domain (see text).
6
bohydrate chains interposed between them. The domains also exhibit weaker cisinteractions with neighbouring domains on the same polypeptide chain. Fig. 2 shows human IgGl in a Y-shaped conformation with the Fab arms roughly coplanar with the Fc. This choice is for illustration only - the relative orientations of Fc and Fab and the involvement of the hinge in such orientations is a complex problem with possible significance for the function of IgG subclasses as discussed below. As described in detail in Chapter 2. the three constant domains and hinge of the heavy chain and the constant domain of the light chain are encoded by separate exons. The variable domains arise from genetic recombination events.
2.2. Domain structure Crystallographic studies of whole IgG and fragments of IgG [7-91 have revealed that each domain has a common pattern of polypeptide chain folding depicted in Fig. 3 . This pattern, the 'immunoglobulin fold', consists of two twisted stacked psheets enclosing an internal volume of tightly packed hydrophobic residues. The arrangement is stabilised by an internal disulphide bond linking the two sheets in a central position. One sheet has four and the other three antiparallel p-strands. These strands are joined by bends o r loops which generally show little secondary structure. Residues involved in the P-sheets tend to be conserved while there is a greater diversity of residues in the joining segments. Fig. 3 shows the chain folding for a constant domain. The @-sheets of the variable domain are more distorted than those of the C domain and the V domain possesses an extra loop. 2.3. Structure of Fab The four individual domains are paired in two types o f close truns-interaction (Fig. 4) [103,17]. The V, and VL,domains are paired by extensive contact between the /
N el b6
Face Y (fy)
Fig. 3. Peptide chain folding o f a constant domain. The segments fxl-4 (unshaded) and fyl-3 (shaded) form two roughly parallel faces of antiparallel /3-pleated sheet linked by an intra-chain disulphide bridge (filled rectangle. Cys-L31-Cys-2(K) (C,I, human IgG I ) . Cys-261-Cys-321 (CJ), Cys-367-Cys-425 (CJ)). Between the p-pleated segments arc other scgments (bl-6) forming helices, bends and other structtires. Segments fx3. 1x4, f y l and b4 arc foreshortencd in this three-dimensional representation after Beak and Feinstein [76].
7
-I1
Fig. 4. Structure of a complex of the Fab fragment of an antibody molecule with antigen. The complex was formed between hen egg-white lysozyme and the Fab fragment of a mouse monoclonal anti-lysozyme antibody. The diagram shows the crystal structure at 2.8 resolution. Alpha carbon atoms only are shown. thick lines being used for lysozymc and the heavy chain o f Fab and a thin line for the light chain. The tight pairing of V,, and V, and of C,,1 and C, domains of Fdb is clearly seen in this diagram. The area of interaction between antihody and antigen is large. approximately 20 X 30 A. The region of Fab in contact with the antigen includes hypervariable loops from both heavy and light chains with more interactions involving the former. However. the combining site is not a simple cleft enclosed by the hypervariable loops but extends beyond them. The antigenic site recognised o n lysozyme is not a linear amino acid sequence - rather it is an arrangement of amino acids in three dimensions provided by different parts of the linear sequence. There is no cvidence for significant conformational changes occurring in either antigen or Fab on complex formation. (This diagram was very kindly provided by Dr. S . E . V . Phillips.)
two respective three-strand P-sheet layers (face Y , Fig. 3 ) and the C,l and C, domains by contact between the two four-strand layers (face X, Fig. 3). In both cases the geometry of pairing is such that the two domains are related by an approximate two-fold axis of symmetry. The interacting faces of the domains are predominantly hydrophobic and the driving force for domain pairing is thus the removal of these residues from the aqueous environment. The Fab arrangement is further
8 stabilised by a disulphide bond between CHI and C, domains. This bond covalently links the carboxy-terminal region of the C, domain with the e2 segment (human IgG1) or the b l segment (human IgG2,3,4) of the CH1 domain. These latter positions, although widely separated in terms of CHI sequence, are close in space conserving the essential structure of the molecule. V,-CH1 and V,-C, cis-interactions are very limited allowing flexibility about the V-C switch region or 'elbow bending' [11,12]. In the crystallographic analyses of Fab structures this is reflected in an elbow angle, i.e. angle between the V,-V, and CH1-C, pseudo two-fold axes, varying between about 137" and 180" [8].
2.4. Antigen recognition Further contact between V,, and V, domains in Fab is made by loops from each domain - the hypervariable loops or complementarity determining regions (CDRs) - which come together in space to constitute the antigen binding site [14,15,17]. It is essentially the extreme variability of these loops on the common framework of the immunoglobulin fold which provides for the enormous diversity of antigen recognition by antibodies while retaining the same basic structure. Fig. 5 illustrates variability in human light and heavy chain V regions to highlight the relationship between framework regions and CDRs. This traditional view of antigen surrounded by CDRs may be somewhat simplified. Thus, it is predicted for example that one of the light chain CDRs is nat generally in the antigen binding site [18], that framework residues can be involved in binding (see below) and that buried residues distant from the binding site may contribute to specificity [ 181. Nevertheless a 'CDR replacement' experiment using genetic engineering techniques indicates, for hapten binding at least, thk overwhelming importance of CDRs [112]. Thus, the CDRs from the heavy chain variable region of a mouse monoclonal antibody binding NP-cap (4-hydroxy-3-nitrophenacetyl caproic acid) were substituted for the corresponding CDRs of a human myeloma protein and the hapten affinity of the 'humanised' mouse antibody found to be very similar to that of the original mouse antibody. This elegant experiment also opens up the possibility of constructing human monoclonal antibodies from the corresponding mouse antibodies. Antigen binding sites have also traditionally been viewed as clefts in the antibody structure. There is n o a priori reason why this should be so - the antigen binding site could, for example, protrude and the cleft be found in the antigen molecule itself. The traditional view has probably arisen from studies on myeloma proteins where the natural antigen was not known but, by extensive screening, small molecules were found which bound to the antigen binding site. This view is challenged by the recently solved crystal structure of the complex of the Fab fragment of a mouse monoclonal anti-lysozyme antibody and lysozyme [16,17] shown in Fig. 4. The area of interaction between antibody and antigen is large, approximately 20 x 30 A, and is formed by relatively flat complementary surfaces on the two proteins. The region of Fab in contact with antigen includes CDRs from both heavy and light chains, with more interactions involving the former, but also extends to
9 All
human light chains
..
70
x
c
.-0 L
p
40 30 20 10 0 0
I0
20
30
40
50. 60
70
90
80
100. 110
Residue #
All
human heavy chains
1 I0
100 90 80 70 60
x
r -
n
50 40
’ 30 0
20
0
10
20
30
40
50
60
Residue
70
80
90
100
110
120
#
Fig. 5. Amino acid variability in the variablc domains of human immunoglobulin heavy and light chains. For a given position variability is defned as the ratio of the number of different amino acids found at that position to the frequency of the most common amino acid. The three CDRs are apparent as peaks in both plots and the four framework regions (FRs) as separating regions of relatively low variability. (This diagram from [6] is reproduced with the kind permission of Dr. E . A . Kabat.)
some framework residues. The third CDR of the heavy chain makes a particularly large contribution to antigen contact. The antigenic site recognised on lysozyme is not a linear amino acid sequence - rather it is an arrangement of amino acids in three dimensions provided by different parts of the linear sequence (‘topographi-
10 cal’ determinant). Whilst in this case there is no evidence for significant conformational changes occurring in either antigen or Fab upon complex formation, limited changes have been reported in a different Fab-protein antigen complex [130]. At the present time, the structure of only two Fab-antigen complexes have been solved and one has to be wary in drawing general conclusions. However, a number
Fig. 6 . Structure of the Fc fragment of human IgG. (*), Alpha carbon positions: (0). approximate centres of carbohydrate hexose units. Coordinates were obtained from the Brookhaven Data Bank (after Deisenhofcr [23]).The pairing of C,,3 domains and the position o f carbohydrate between C,,2 domains is clcarly seen in this view. The contact between carbohydratc chains is much more extensive in rabbit Fc. Note that the heavy chains are described only from residue 238: residues 725-238 do not show welldefined electron density.
11
of other complexes are currently being studied, and it is likely that general principles for the details of antibody-antigen recognition will emerge in the next 2-3 years. One general principle that has been suggested is that antibodies recognise mobile regions of protein antigens [ 19,201. Others have suggested that it is surface accessibility or protrusion which is the primary requirement for antigenicity [21,22]. The correlation of accessibility or protrusion and mobility then leads to the reported correlation of mobility and antigenicity.
2.5. Structure of Fc
In the Fc of IgG [9,23] the two cH3 domains are paired in a pattern similar to that found for the CHl-C,- interaction (Fig. 6). The two CH2 domains show no close interaction but have interposed between them two branched N-linked carbohydrate chains which make little contact between one another in human Fc [23] but more extensive contact in rabbit Fc [30]. In the pairing of the C,3 domains, approximately 1000 A' of surface per domain is involved in the interaction. In the Ck,2 case the carbohydrate provides a substitute for the domain-domain contact and helps to stabilise the C,2 domain. However, the CH2-carbohydrate contact area is only about half that of, for example, the cH3-cH3 contact so that one might expect a lower inherent stability for the cH2 domain. Indeed the cH2 domain is more sensitive to proteolytic degradation than the other domains of IgG [24]. Domain stability has also been related to the apparent 'softness' of parts of the cH2 domain most remote from the CH2-cH3 interface as indicated by large temperature factors or missing electron density in the crystal analysis of human Fc [ 2 3 ] .A corresponding 'softness' has not, however, been found for rabbit Fc (Sutton B.J.. personal communication). Tables 1 and 2 show a comparison of known cH3 and c H 2 sequences. The carbohydrate chains of the IgG C,2 domains are not a single oligosaccharide moiety but consist of a set of about 20 structures based on a mannosyl-chitobiose core which can be represented [13] as:
+ ~
i(h')
(-5')
(4')
Siaa2-+6Galpl~4GlcNAc~l+2Mana 1
2 Fu c a l
1 h
1 (3)
(2)
(7
(1)
? GlcNAc~1+4Man~l+4GlcNAc~l-+4GlcNAc-Asn-297 3
12 TABLE 1 Comparison of IgG C,,3 domain sequences Human IgGl [113], IgG2 [114], IgG3 11201, IgG4 (1151, mouse l g G l (1161, lgG2a ‘a’ allotype (1171, IgG2b ‘a’ allotype [1181, IgG3 (1261 and rabbit IgG [119] are translated from nucleotide sequences. Guinea pig (G.pig) IgGl and IgG2 [59] were protein sequenced. lgGl Eu numbering [6] is used throughout this chapter. A dot indicates no residue at the position corresponding to the numbered human IgGl residue. The right-hand column ( e l , fxl, etc.) indicates the approximate domain location of residues in human Fc and should be compared with Fig. 3. Alternate (mostly hydrophobic) residues iii the P-strands tend to be buried and show greater degree of conservation than residues o n bends. Cys-367 forms an intrachain bridge with Cys-425 close t o Trp-381. The asterisked arginine (R’) at position 435 in IgG3 highlights the involvement o f this position as an allotypic marker important in protein A (Section 3.2.) and rheumatoid factor (Section 3.6.) binding. Other positions at which allotypic substitutions occur in human IgGs are 356, 358, 379, 384, 392, 431 and 436 [123].
Human
Mouse
G.pig
G1
G2
G3
G4
G1
G2a
34 1 342 343 344 345 346 347 348 349 350
G Q P R E P Q
G Q P R E P Q
G Q P R E P Q
G Q P R E P Q
G R P K A P Q
G S V R A P Q
G L V R A P Q
Y T
Y T
Y T
Y T
Y T
Y V
35 I 352 353 3.54 355 356 3.57 358 359 360
L P P S R D E L T K
L P P S R E E M T K
L P P S R E E M T K
L P P S Q E E M T K
I P P P K E Q M A K
361 362 363 364 365 366 367 368 369 370
N Q
N Q
N Q
N Q
S L T
S IT
S L T
L v K
L v K
L v K
v
v c
v
v c
v
v
c
G2b
G3
G1
Rabbit G2
G
R A Q T P Q
G P P R I P Z
G A P R M P D
G Q P L E P K
Y I
Y T
Y L
Y T
Y T
L P P P E E E M T K
L P P P A E Q L S R
I P P P R E Q M S K
L P P P R B Z L S K
L P P S R D E L S K
M G P P R E E L S S
D K
K Q
K D
K K
K K
S K
S
S L T
S L T
T L T
S L T
S L T
S L T
S
T
S L T
L v K
M I T
M v T
L v V
L v T
M I T
L I I
M I N
v
v
c
v
v
c
v
v
c
v
v
c
G
v
v
c
v
v
c
v
v v
c
.el
>fxl
v
R
v c
< .bl
i >fx2
13 TABLE I (continued) Human
37 I 372 373 374 375 376 377 378 379 380
G2
G3
GJ
G F Y P S D
G F Y P S D
G F Y P S D
G F Y P S D
Rabbit
G.pig
Mousc
GI
GI
G2a
G2b
G3
GI
G2
G
r)
D F M P E D
cr
N F F
G F Y P A D
N F F P A D
G F Y P S D
<
> fyl
F F 1’
E D
F N P G D
s
E A
I
I
I
l
l
I
I
I
I
I
I
A v E
A v E
A v E
A
7‘
v E
S v E
S V E
N v E
H v E
S
V E
Y v E
w
w
w
w
w
w
w
w
w
w
E S S G
E
S
N G
E S N G
0’1- ‘ I ’ E
w
E
N G
W N
D S S E
E K N G
386 387 388 389 390
Q P E N N
Q P E N N
Q P E N N
Q P E N N
Q P A E N
P
A S N R V P V
D . .
E K E
K A E D N
39 1 392 393 394 395 306 397 398 399 400
Y K T T P P V L D S
Y K T T P P M L D S
Y N T T I’ P M L D S
Y K T T I-’ P V L D S
Y K N T 0 P I M N T
Y K N
401 402 403 404 40s 406 407 408 409 410
D G S F F L Y S K L
D G S F F L Y S K L
D G S F F L Y S K L
D G S F F L Y S R L
N S Y F V Y S K L
D G S Y F M Y S K L
D G S Y F I Y S K L
411 412 413 414
T V D K
T V D K
T V D K
T V D K
N V Q K
R V E K
N M K T
38 1 382 3x3 384 385
S
C;
Ci
v E
N N G
S N G
R N
K
H T E E N
E L E Q D
Y K D T A P V
Y K N ‘I. P P I L D S
Y K N T P P V F D S
Y K N T P P I E D A
Y K T T P A V L D S
D T Y F L Y S K L
D E T F F L Y S R L
D G S Y F L Y S K L
D G S Y F L Y N K L
T V D T
K V D T
T V D K
S V P T
‘r E L N
.r E P V L D S
1-
D S
G
G
s
s
.b2
<
.b3
> fx3
<
.b4
> fx4
< .12s
14 T A B L E I (continued)
Mouse
Human
41s
416 417 418 419 420
42 I 422 423 424 425 426 427 428 429 430 43 1 432 433 434 435 436 437 438 439 440 44 1 442 443 444 435 446 447
G.pig
Rabbit
GI
G2
G3
G4
GI
G2a
G2b
G3
GI
G2
G
S R
S R
S R
S R
S N
K N
S K
D S
N A
S A
S E
Q
Q
Q
Q
E
V
E
L
N
D
Q
Q G
Q
Q G
E G
A Ci
E R
K
Q G
D G
Q G
R G
E
'r
w
w G
w
w
N
N
N
N
V
V
I
v
F
F
F
F
s c
s c
N
' F
s Y
w
7'
D
s
F
c
S
S
S
S
S
S
N
M H
M H
M H
M
L
V
R
E A
v
s c
N
7
w
s c
v
s c
w
v
v
-r
v
v
s
c
w
E
w
w
D V V > f y 2
1
s
F 1'
T
c.
c
'r c
S
S
S
M
M
F
v
v
v
V
w
Y
v
F T
c S
v
M
E
E
H E
H E
H E
H E
H E
H E
H E
H E
c
A L
A
A
A
.b6
H
L
H N H H T E K S
I4 N I1 H T O K N
L P N H
L
N H Y T Q K S
G L K N Y Y L K K T
L
N H Y T Q K S
G L H N H H T T K S
A
H
A A L L H H N N R ' H F Y T T Q O K K S S
G
L
H N €I
I Q K S
O K A
H N H Y T Q K S
L
L
L
L
F
I
L
I
I
I
L
H
R
R
R
<
1.
R
s
L
R
R
.e2
L
s
L
S
s
s
1-
s
s
s
s
V
s
V
.r
s
s
s
s
s
s
'r
s
s
s
s
s
P G K
P G K
P G K
L G K
P G K
P G K
P G K
P G K
P G .
P G
P G K
>ly3
Sequences here and in later Tablcs arc taken t'rom the Chemical Databank Service at S E R C Daresbury Laboratory and from Kabat et al. [6].
As shown, four types of mannosyl-chitobiose cores are found ( 5 'bisecting' N acetylglucosaminei? fucose) and outer-chain variants include the presence or absence of galactose and sialic acid. The heterogenous mixture of oligosaccharides released from an Fc preparation contains molecular species present in identical molar proportions to one another: a finding which led Rademacher and Dwek [13] to propose a non-random pairing of certain structures. Any possible correlation between carbohydrate heterogeneity and IgG subclass has to date neither been established nor definitively ruled out.
15 IABLE 2 Comparison of IgG C,,2 domain sequence\ N@ indicate$ that an N-linked carhohydrate chain is attached to Asn-2Y7 (note signal sequence Asnx-Thr). u indicates unsequcnccd. A dot indicates no rcsidue at the position corrcsponding to the numhcred IgG 1 residue. Cys-261 bridges to Cys-321 close to Trp-277. Allotypic substitutions occur at po\itions 291, 296, 309 and 339 [ 1231. Human
Mowe
G.pig
Rabbit G
G3
G4
(;I
A P E L L G G P
A P P V A . G P
A P E L L G G P
A P E F L G Ci P
V I' . . . E V
s v
s v
s v
s v
s v
24 1 242 233 241 245 246 247 248 249 250
F 1F P P K P K D '1-
F L F P P K P K D T
F L F P P K P K D T
F L F P P K P K D T
F I F P I' K P K D V
25 I 252 253 254 255 256 257 258 259 260
L M I
L M I
L M I
L M I
s
s
s
s
7
s
s
s
s
s
s
R T P E V T
R T P E V T
R T P E V T
R T P E V T
I. T P K V
L S P I V
'I
L T P K V T
L T P K A
~T
L T P K V T
L T P R V T
R T P E V T
23 I
232 233 234 235 236 237 238 239 2-10
26 1 262 263 264 265 266 267 268 269 270
c
c
c
A P N L L G
1.
'
I'
A P N L E G G P
P G N I L G G P
A P Z L L G G P
P P E N L G G P
P P E L L G G P
s v
s v
s v
s v
s v
s v
F I F P P K I K D V
F I F P P N I K D V
F I F P P K P K D A
F I F P P K P K B T
F I F P P K P K D T
F I F P P K P K D T
I-
L M I
L M l
L M I
L M I
L M I
G
s
I l
G3
G2
G2
G2,i
G2b
G1
GI
M I
T
.el
>fxl
i .hl
>fx2
v v v
v v v
v v v
v v v
v v v
v v v
c'
c v v v
c v v v
v v v
C
c v v v
c v v v
<
D
D
D
D
D
D
D
D
D
D
D
.b2
v s
v s
v s
v s
I s
v s
v s
v s
v s
v s
v s
H E D
H E D
H E D
Q E D
K D 11
E D D
E D D
E D D
Q E D
Q D E
Q D D
C
c-
TABLE 2 (continued) Human
Mouw
G pig
Rabbit
GI
G2
G3
G4
GI
G?a
G2b
G3
GI
G2
G
P E
P E
P E
P E
P E
P D
P D
v
P D
v
L E
v
P E
v
P E
v
K F N
0 F N
Q
Q F S
Q I S
0
€1
I S
V S
0 F T
0
F K
Q F N
F T
Q F T
w
w
w
w
w
w
w
w
w
w
w
Y V D
Y V D
Y V D
Y V D
F V D
F V N
F V N
F V D
Y M G
F V D
Y I N
G V E V H N
G V E V H N
G V E V H N
G V E V H N
D V E V
N V E V
H T
N V E V H
tl
N K E V H
N K L M B
‘r
T
-r
.r
N K P V G N
N E Q V R T
A
A
A
A
A
A
A
A
A
A
A
K T K
K T K
K T K
K T K
O T O
O .iQ
O T O
W
-r
Z
E
A
T
>fx3
Q
B
K
R P P
29 I 292 293 294 295 296 297 298 299 300
P R E E Q Y N@ S T Y
P R E E O F N@ S T F
P R E E Q Y N@ S T F
P R E E Q F N@ S
P R E E O F N@ S T F
T H R E D Y N@ S T L
T H R E D Y N@ S T I
P R E A Q Y N@ S T F
V L Z Z Z F N@ G T F
P K V E Q Y N@ T T F
L R E Q Q F N@ S T I
<
30 1 302 303 304 305 306 307 308 309 310
R
R
R
311 312 313 314 315
27 1 272 273 274 275 276 277 278 279 280 2x 1 282 283
284 285 286 287 288 289 290
v
v
v
v
v
v
v
.r
Y R
v
v
R
s
v
R
v
R
v
R
v
R
v
R
v
V
V
V
V
V
V
V
V
E
V
s
s
s
s
s
s
s
s
s
s
V L T V L H
V L T V V H
V L T V L H
V L T V L H
E L P l M H
A L P I O H
T L P 1 Q H
A L P I O H
A L T I Z H
V L P I Q H
T L P I T H
Q D
Q D
Q D
Q D
Q D
Q D
Q D
O D
B u
Q D
Q D
L N
L N
L N
L N
L N
M S
M S
M R
L u
L R
L R
w
w
w
w
w
w
w
w
.b3
.b l
>fx4
R
s
w
<
v
V
w
>fyl
w
< .b5
17 TABLE 2 (coininued) Human
G.pig
Mousc
Rabbit
G1
G2
G3
G4
GI
G2a
G2b
G3
G1
G2
G
316 317 318 3 19 320
G K E Y K
G K E Y K
G K E Y K
G K E Y K
G K E F K
G K E F K
G K E F K
G K E F K
u u u u
G K E F K
G K E F K
32 1 322 323 324 325 326 327 328 329 330
c
c
c
c
c
c
c
c
u
c
c
K
K
K
K
K
K
K
K
u
K
33 I 332 333 334 335 336 337 338 339 340
K
v
v
v
v
v
v
v
v
u
v
v
S N K A L P A
S N K G L P A
S N K A L P A
S N K G L P S
N S A A F P A
N N K D L P A
N N K D L P S
N N K A L P A
u u u u u U u
Y N K A L P A
H N K A L P A
P
P
P
s
P
P
P
P
u
P
P
l
I
I
l
l
l
l
I
I
I
I
E K T
E K T
E K T
E K T
E K
E R T
E R T
T R T
E K T
E K T
I
I
I
T
.r
E R T
l
I
l
I
I
l
>ry2
I
< .b6
>fy3
s
s
s
s
s
s
s
s
s
s
s
<
K A K
K T K
K
K
K
K ' K
K
K
K
K T K
K A R
.e2
T
A K
' K
I K
P
I K
P K
A K
Sequence sources as in Table 1.
The Fc carbohydrate chains have been suggested to adopt both structural and functional roles [ 13,251. Structurally they are important in conferring resistance to proteolysis, and possibly in maintenance of CH2-CH2 domain orientation and assembly. Loss of carbohydrate has minimal effect on protein A binding [26] but a profound effect on monocyte binding [27]. C lq binding [27] is only slightly affected although whole complement activation is abolished [28] (see also below). Recently, changes in the glycosylation pattern of total serum IgG have been associated with rheumatoid arthritis and primary osteoarthritis [29], In terms of exon sequence, the cH2 domain begins at Ala 231 (human IgG1, Table 2). However, in the crystal structures of human and rabbit Fc the heavy chain is first clearly identified at Pro-238. This suggests that the residues between Ala23 1 and Gly-237 are disordered, presumably reflecting flexibility. In this respect [25] the first few residues genetically defined as belonging to the cH2 domain belong more, in structural terms, to the hinge which will now be discussed in some detail.
18 2.6. The hinge: IgC subclusses
Mutant human IgGl myeloma proteins lacking the hinge (as encoded by the hinge exon, i.e. the genetic hinge) have been crystallised and the structures solved to an intermediate resolution [31-331. These molecules display Fab and Fc structures similar or identical to the structures of the isolated fragments and are approximately T-shaped. They have been described as the 'structure of the antibody molecule'. However, some caution is necessary here as, for example, the hinge-deleted IgGl Dob protein, unlike the intact IgGl molecule, neither activates complement [34] nor binds to monocyte Fc receptor [35]. Unfortunately, crystal diffraction patterns of whole 1gG have been characterised by a lack of electron density associated with part of the hinge and the whole of the Fc, a phenomenon which has been related to hinge flexibility [36,37]. In considering IgG structure, therefore, one needs to consider the hinge. Further, since the principal difference between subclasses tends to be in the nature of the hinge, this also serves to introduce IgG subclass structure. The term hinge arose from electron micrographs of rabbit IgG complexed to small bivalent haptens, which showed Fab arms assuming angles relative to one another from nearly 0" (acute Y-shaped) to 180" (T-shaped) [38,39]. The function of this hinge flexibility has generally been seen as allowing divalent recognition of variably spaced antigenic determinants. Other physical techniques have demonstrated hinge flexibility in solution, although the degree of flexibility differs between IgG subclasses [40,42]. This is to be expected, given the differences in the primary structures of the hinges from different IgG subclasses illustrated in Table 3. The hinge shown, the 'structural' hinge [25], consists of the genetic hinge and the connecting region to the C,,2 domain described above (hinge-link or lower hinge). This hinge is readily divided into three regions as illustrated [25,41]. The upper hinge can be seen as allowing flexibility of the Fab arms relative to one another (Fab-Fab flexibility) and allowing rotation of the Fab arms. The middle hinge contains the interheavy cysteine disulphide bridges and a high content of proline, and probably adopts a relatively rigid double-stranded structure. In the case of human IgG3, this is an extremely elongated structure of about 50 residues containing 11 cysteines and 19 prolines. The lower hinge is probably responsible for the flexibility of Fc relative to Fab (Fc-Fab flexibility). Segmental flexibility of IgG is correlated with hinge length. Thus, for a series of mouse monoclonal antibodies showing the same (anti-dansyl) combining site, nanosecond fluorescence polarisation spectroscopy indicates the order of flexibility IgG2b > IgG2a > IgGl [40]. Similarly guinea pig lgG2 shows greater segmental flexibility than IgGl [42]. The flexibility has been associated particularly with the upper hinge [25,41]. There is an association between hinge flexibility and effector function seen in its extreme form by the lack of flexibility and loss of effector function associated with hinge-deleted IgG. However. flexibility is closely related to the proximity of Fab and Fc and it is difficult to establish the causal factor in modulating effector function. This will be discussed in greater detail below. The equilibrium conformation of the monomeric human IgG subclasses have
TABLE 3 Comparison of hinge sequences of IgG Sequence sources as in Table 1. Residues are aligned so that the positions of the first and last interheavy disulphide bridge cysteines coincide. In human IgGl, mouse IgGl and rabbit IgG, Cys-220 (Eu numbering) forms a disulphide bridge to the light chain and thus the residues 216220 belong structurally to Fab rather than the hinge. Crystallography indicates that Pro-238 is the first residue forming part of the folded C,2 domain so that the residues from Ala-231 to Gly-237 are assigned structurally to the hinge. Papain cleaves human IgGl at position 224, pepsin at position 234. The sequence of human IgG3 corresponding to the above is given in Table 6. I
I
;Human IgGl Human IgG2 Human IgG4 Mouse IgGl Mouse IgG2a Mouse IgG2b Mouse IgG3 G.pig IgG I G.pig IgG2 Rabbit IgG
216 E P E R E S V P E P E P E P Q S E P A P
K K K R R S R W I S
I 224 S C D K T H T . .
.
.
.
.
.
.
.
.
.
.
.
.
.
Y D G G I G R T
G C P P P H T C
. G T I K T P S
.
.
. .
. .
. .
. .
.
. I T . P M
. N P . B .
.
. . p . . p G S S . . . . . P
. . I K S T P S . . Z B K P
. P . . .
.
1
Middle
I-
.
.
.
C C C C C C C C C C
P C P K C P . P T .
P V P P P P . P C .
1st
inter-heavy
s-s
. . . . . E C P P . . . . . . C I . . . P K . . . C K E C H . . . . . C I P , . P K . . . .
.
.
.
.
.
.
C C C C C C . C C
.
.
. . . .
K .
.
P P P T P P P G P P
A A A V A A P A P P
P E P P P E P . P N P N G N P Z P E P E
234 L L V A F L . E L L L E I L L L N L L L
I I
G G G . G G . V G G G G G G G G G G G G
P P P S P P P P P P
last inter-heavy
s-s
I
I
Genetic hinge
II
I
I I
I -
After Burton. 1985 [2S] and Feinstein et al
I
Lower
I
I p p
I
I
'I -
Upper
,
1986 [41]
W
20
Fig. 7. Models proposed for the solution conlormations o f human IgG subclasses. The models are proposed on the basis of sedimentation data with supporting small-angle X-ray scattering data [48]. The hinge-delcted IgGl Doh protcin is used as a reference. IgG2 and IgG4 arc shown to resemble Dob in the close approach of Fat7 and Fc: for IgG2 thc Fab arms are suggested to fold back. In IgGl the hinge is apparent and the Fab arms are non-colinear. as illustrated. I n IgG3. the central or middle hinge (Table 6) is about 90 A long. i n agreement with electron microscope studies 1491.
been investigated by physical techniques including hydrodynamic and small-angle X-ray and neutron scattering studies [44,48]. There is more or less general agreement that IgG3 is a very extended molecule as predicted from modelling studies [9,49] with a long middle hinge (Table 6), although an alternative model has been suggested [46]. We have recently proposed the structures presented in Fig. 7 [48]. These structures, although average conformations for monomeric IgGs, do show interesting correlates with the functional activity of IgG subclasses in an associated state. For example, complement activation is most efficient for IgG3 especially and also for IgGl where the Fab arms are less likely to interfere with binding sites on Fc than in IgG2 or IgG4.
21
2.7. Isotypes, allotypes und idiotypes T h e variability of antibodies is often conveniently divided into three types. Isotypes a r e variants present in all healthy members of a species: immunoglobulin classes a n d subclasses are examples o f isotypic variation involving the constant region of t h e heavy chain. Allotypes are variants that are inherited as alternatives (alleles) with not all healthy members of a species therefore inheriting a particular allotype. Allotypes occur mostly as variants of heavy-chain constant-region genes, in man in all four IgG subclasses, IgA2 a n d IgM. T h e nomenclature of human immunoglobulin allotypes is based o n the isotype o n which it is found (e.g. G l m defines allotypes on a n IgGl heavy chain, Km defines allotypes o n K light chains) followed by a n accepted WHO numhering system. The positions of some allotypes a r e noted in t h e legends t o Tables 1-7. T h e variable region of an antibody can act as a n antigen, and the unique determinants of this region that distinguish it from most other antibodies of that species a r e termed its idiotypic determinants. T h e idiotype o f an antibody, therefore, consists of a set of idiotypic determinants which individually are called idiotopes. Polyclonal anti-idiotypic antibodies generally recognise a set of idiotopes whilst a monoclonal anti-idiotype recognises a single idiotope. ldiotypes are usually specific for a n individual antibody clonc (private idiotypes) but are sometimes shared between different antibody clones (public, recurrent o r cross-reacting idiotypes). A n anti-idiotype may react with determinants distant from the antigen binding site. it may fit t h e binding site a n d express the image of the antigen o r it may react with determinants close to the binding site and interfere with antigen binding. Sequencing of an anti-idiotypic antibody generated against an antibody specific for the polypeptide GAT antigen in mice revealed a CDR3 identical to that of the antigen, i.e. the anti-idiotype contains a true image of the antigen [ l l l ] .
3. Functions of IgG 3.1. Introductiori
T h e function of I g G in simplified terms is to recognise antigen and trigger its elimination. The molecular basis of antigen recognition has been discussed above. Here we shall discuss t h e interaction with molecules related to the elimination of IgG, principally those of the complement system and cellular receptors. These molecules interact primarily with the Fc part o f IgG, a n d strong variations in subclass reactivity is a notable feature. First we consider the interaction of IgG with staphylococcal protein A which, although not a functional interaction for the host, is a n Fc interaction which is understood in detailed molecular terms.
3.2. Interaction with protein A Protein A is a major cell wall component of most strains of Staphylococcus aiivem which binds to the Fc regions of immunoglobulins of a variety of subclass and spe-
22 cies with varying affinity (251. This reaction has been widely exploited in immunoand histochemistry. The protein consists of five homology regions binding to Fc and another region that does not bind to Fc but binds to cell walls [ 1241. Trypsin digestion can be used to isolate active fragments each corresponding to an homology region and of molecular weight about 7000 (SO]. The fragments bind to Fc with a stoichiometry of 2: 1. The multivalency of both IgG and protein A with respect to one another means that if the two are added to one another in the correct proportions they will form extended complexes and precipitate. The structure of a complex of one of the fragments (fragment B) with human IgG Fc has been solved crystallographically to 2.8 A [23] and indicates that protein A binds at a site between C,2 and C,3 domains. This binding is observed for the human IgG subclasses IgG1, IgG2 and IgG4 and also for IgG3 proteins bearing allotypic markers characteristic of Mongoloid populations ( 5 I ] . In IgG3 proteins from Caucasian populations the protein A contact residue His-435 of the above IgGs is replaced by Arg. This lengthy side chain prevents the formation of favourable IgG-protein A contact so that such IgG3 proteins do not bind protein A . Protein A binding at the C1.,2-C,,3 interface is not perturbed by deletion or reduction and alkylation of the hinge or by aglycosylation of IgG [25,26,24].
3.3. Coniplement activation The classical pathway of complement is a cascade system generating a variety of potent biological molecules including anaphylatoxins and chemoattractants and leading ultimately to lysis of antibody-coated cells [ S 2 , S 3 ] . In health. foreign cells will be the primary target. I n disease, host tissue may be attacked on a large scale. e.g. in autoimmune disorders. The pathway is triggered by the interaction of the first complement component, C1, with IgG in an associated state, i.e. coating a target cell or aggregated by antigen in an immune complex. The pathway is clearly not triggered by monomeric IgG which is at high concentration in the serum. C1 is a complex of the complement components C l q , C l r and Cls. It is the subcomponent C l q which interacts with the C,2 domain of IgG to initiate the enzymatic process of the pathway. Clq is a molecule having the appearance of a ‘bunch of tulips’ [52] and it is multivalent in its binding to IgG (Fig. 8). This multivalency is probably the key to why complement is only triggered by IgG in an associated form. Binding of C l q to monomeric IgG is only weak ( K , - lo4 M-’), whereas binding to associated IgG and the consequent use of two or more of the tulip heads makes binding much tighter (K;, 10’ M-’). and allows t h e activation process to proceed [25]. Theories of activation which involve binding of antigen to the Fab arms of IgG and the induction of conformational changes which are passed down the molecule to Fc, thus affecting the interaction with C l q , are now rejected by most workers [54,25]. The reasons for this rejection are many. In the first instance, C l q multivalency in itself appears an adequate explanation of activation by associated IgG and this is highlighted by the observation that isolated C l q heads bind to IgG aggregates with a similar affinity as intact Clq to monomeric IgG (5.51. Further, C l q binding and CI activation occur whether the association of IgG is
-
23
Fig. s(a.1~).(a) A schematic view of the binding of complement Clq to two IgG molecules on a cell surface. C l q is a hexavalent molecule o l molecular weight approximately 460000. It adopts a structure likened to a hunch o f tulips in which six collagenous stalk regions are connected to six globular head regions which contain thc IgG binding site. The dimensions for C l q used here correspond to longer 'arm' regions than those originally proposcd from electron microscope studies. There is evidence from physical measurements that the arms of CIq posscss some tlexibility. although this appears less in C1 than isolated C l q . Any flexibility of Clq may complement that of Fc in reducing steric requirements in the Clq-IgG interaction. (h) A model of C l q binding to dislocated IgG molecules. In this speculative model [lOS] it is suggested that hinge flexibility allows dislocation ol the Fah arms of the IgG molecule out of the plane of the Fc allowing Fc-Fc interaction. The model has similarities to that envisaged for Clq binding to IgM based on electron microscope studies.
achieved by antigen, heat or chemical cross-linking and, in the case of chemically cross-linked IgG, they are unaffected by combining site occupancy [25].Attempts to identify a conformational change in IgG upon antigen binding which correlates with Clq binding, have not been successful [54]. Finally, in the case of human IgG3, it is particularly hard to visualise II common conformational change being passed through the extended hinge region as the result of the binding of a wide variety of different antigens at the extremities of the Fab arms. The flexibility of Fc is complemented by some flexibility in the arms of the C l q molecule [56,58] which may be important in complement triggering. Thus, flexibility reduces the stringency of steric requirements when Clq binds to an array of IgG molecules. There is general agreement about the importance of charged groups in the interaction of IgG and Clq but controversy over the precise location of the Clq binding site on IgG [25].The domain responsible for C l q binding is concluded to be c H 2 [25] as the Facb fragment of rabbit IgG (lacking the C,3 domains) binds C1 with an affinity comparable to IgG and isolated CH2 domains bind C1 with an affinity comparable to Fc. Early interest in the cH2 domain centred on Trp-277 and nearby residues, but this was quenched by the demonstration that Trp-277 is
24 buried in the crystal structure of Fc. Three Clq binding sites have more recently been proposed. The first [S9] involves residues in an extended chain region, between Lys-290 and (3111-295 in human IgG1. the second [60] involves residues in the overlapping extended chain region between His-285 and Arg-292, and the third [82] involves residues on the last two anti-parallel /?-strands of the C,2 domain (Gln-318, Lys-320, Lys-322, Pro-331, (3111-333, Thr-335, Ser-337). IgGs of different subclass and species show differing affinity for Clq. and the above proposals attempt to account t o some extent for this in terms of sequence differences between isotypes. However, there is an added complication in that it appears that the proximity of Fab arms can modulate the expression of the Clq binding site on Fc [25]. Thus hinge-deleted IgGl does not bind C l q [34]. Further and more strikingly, IgG4 does not bind C1 whereas its Fc fragment (Fc4) does [61]. This is consistent with the close approach of Fc and Fab in IgG4 visualised in Fig. 7. In comparing isotype behaviour with respect to complement it is important to distinguish C l q binding. C1 binding, C1 activation and whole complement activation. The most widely used assay is the measurement of the end-product of the whole complement cascade, i.e. cell lysis. The inability of an IgG to promote efficient lysis does not necessarily indicate an inability to bind Clq. A later stage may be implicated. For example, it appears that Clq binding is not always directly related to C1 activation [62,63] and. furthermore. later components of complement, e.g. C4b, C3b also interact with IgG. A further complication is that a small change in C l q binding affinity may, through the amplification nature of the complement cascade process. produce a large change i n whole complement activation measured as cell lysis. Comparison of the human IgG subclasses provides the following view [64]. All the subclasses in a monomeric state bind Clq with measurable affinity with the order of binding constants IgG3 > lgG1 > lgG2 > lgG4. IgG3 and IgGl activate C1 and whole complement efficiently. IgG2 is less efficient in complement activation. IgG4 does not appear to bind C1 and does not activate complement. In other species, mouse IgG3, IgG2a and IgG2b, guinea pig IgG2, rabbit IgG, rat IgG2b, lgGl and IgG2a. bind Clq and activate complement. Mouse IgG1, guinea pig IgGl and rat IgG2c bind C l q weakly. if at all, and do not significantly activate complement [25,65,66]. Whilst it is clear that C1 interacts with associated IgG primarily through C l q , there have been suggestions that C l r and/or Cls may also interact weakly with sites on IgG (e.g. [67]) but this has not been clearly demonstrated [25]. Activated forms of C3 and C4 also bind to IgG [53] via covalent interaction with residues in the heavy chain of Fab. The former interaction is important not only in the classical pathway but also for IgGs such as rabbit IgG which activate the alternate pathway.
3.4. lnteractiori with cellular Fc receptors Receptors for the Fc region of IgG are found on a number of cell types and are associated with a variety of functions including phagocytosis (monocytes, macrophages, neutrophils), antibody-dependent cellular cytotoxicity (monocytes, mac-
25 rophages, lymphocytes), maternofoetal transport (trophoblast) and possibly immunomodulation (lymphocytes). ‘Fc receptor’ is an operational term and does not imply that the same molecular species is found on the different cell types [68]. Indeed, there is good evidence that a number of molecular species are involved. Human leucocyte IgG Fc receptors (FcR) fall into three categories [69] as defined by a number of criteria but most especially by reactivity with specific monoclonal antibodies. FcRI is a 72000 molecular weight receptor found on monocytes which binds monomer IgG with high affinity ( 5 x 10’ M - ’ ) . FcRII is a 40000 molecular weight receptor found o n monocytes, granulocytes, platelets and B cells which binds well to associated IgG but only very weakly to monomer IgG ( IgG4. The subclasses are shown to bind to the same receptor by competition experiments. IgG2 does not bind. The subclass specificity of FcRII and FcR,, has not been definitively demonstrated at this stage. Murine leucocyte Fc receptors show both similarities to and differences from human Fc receptors [69]. FcRl. found on mononuclear phagocytes, shows relatively high affinity (10’ M-I) for monomeric mouse IgGZa. FcRII, found o n mononuclear phagocytes, granulocytes and B cells, preferentially binds aggregated IgG2 and IgGl. This receptor has recently been cloned and found to belong to the immunoglobulin supergene family [129]. A third receptor binds mouse IgG3 specifically. Until recently, the conventional wisdom was that complement interacts with the cH2 domain and cellular Fc receptors with the cH3 domain of IgG. This has been challenged by a number of workers [25]. The binding of IgG to the human monocyte Fc receptor (FcRI) will be briefly discussed. The cH3 domain was originally favoured, owing to the (weak) ability of the pFc’ fragment of IgG (cH3 domain dimer) to inhibit the interaction of IgG and monocyte Fc receptor. Using domain-specific anti-human IgG monoclonal antibodies this has been shown to arise from contamination of pFc’ preparations by small amounts of parent IgG [3S]. In contrast, cH2 domain involvement in receptor binding is favoured by the loss of binding associated with hinge deletion [35] and aglycosylation of IgG [27]. Further, anti-human IgG monoclonal antibodies specific for the cH3 domain and the CH2icH3 domain interface do not inhibit the Fc receptor-IgG interaction and are still able to bind to receptor-bound IgG [70]. Antibodies specific for a cH2 epitope are inhibitory and do not bind to receptor-bound IgG. It has, therefore, been suggested that cH2 is the critical domain for monocyte receptor binding [70,71]. A similar conclusion is reached for mouse IgG2b binding to mouse macrophage Fc receptor. based on the use of mutant deleted proteins [72]. There is, however, still controversy in this area, which is complicated by the existence of the different types of Fc receptor [2S,69]. Based on a sequence comparison of IgGs showing differing affinity for the monocyte Fc receptor, the model shown in Fig. 9 has been proposed [71]. The IgG binding site is suggested to coniprise residues of the lower hinge. i.e. those between the hinge disulphides and the
26
Fig. 9. A model proposed for the interaction of IgG and human monocyte Fc receptor I. The model is proposed primarily on the basis o f a comparison of sequences of IgG of different species and subclass, showing differing affinity for monocyte Fc receptor [71]. The region o f interaction on Fc is suggested to involve that between the interheavy disulphides and the folded Ci12 domain. The monocyte Fc receptor has a molecular weight o f approximately 70000 and is represented as a globular protein of appropriate size. An antigenic surface is included in the diagram t o show the close approach of foreign cell and monocyte required by the interaction. although most studies have been carried out using unliganded monomeric IgG.
folded cH2 domain between Leu-234 and Pro-238 (Table 3), and possibly those on a nearby bend (Leu-328-Pro-33 1). Finally molecules secreted or shed by T cells which have specificity for IgG (IgG binding factors, IgG-BF) have been described [ 1081. 3.5. Other functions of 1gC
3.5.1. Clearance The molecular mechanisms by which IgG is removed from the circulation are referred to as clearance. The number, nature and relative importance of the molecular species interacting with IgG in this process are unclear as is the nature of ‘damaged’ or altered IgG subject to clearance. However, it is apparent that the cH2 domain is critical in control of clearance [25]. 3.5.2. Fc-fragment active peptide A number of immune responses including polyclonal antibody production, T-cell responses such as antigen and alloantigen-induced proliferation and cell-mediated
27 cytotoxicity can be mediated by subfragments of Fc (251. A peptide corresponding to residues 335-358 of human IgG1, a sequence which spans CH2 and C,,3 domains, has been shown to induce polyclonal antibody production [73]. 3.5.3. Fc-Fc interactions in immune precipitation Classical immunology explains the precipitin reaction in terms of the formation of lattices through the bridging of antibody combining sites by multivalent antigens. Recent evidence, however, also implicates Fc-Fc interactions as being important in immune precipitation. Thus it is found that IgG and its F(ab’), fragment behave very differently in immune complex formation under certain conditions. although avidity for antigen is identical [25]. 3.6. Rheumatoid factors Rheumatoid factors are autoantibodies directed against epitopes expressed in the Fc region of IgG. Although most patients with rheumatoid arthritis show a heterogenous population of rheumatoid factors, a common specificity has been detected in most rheumatoid sera. This antibody is of the IgM class and reacts with the CH2-C,3 interface region, showing many features in common with protein A binding [74]. 3.7. Membrane or surface I g C A small percentage (about 1%) of peripheral blood B lymphocytes express detectable levels of membrane-bound IgG on their cell surfaces, which functions a s an antigen receptor. In the case of mouse IgG, an additional 71-residue carboxyterminal segment is found on membrane IgG compared to secreted IgG [7S]. I t is suggested that a 17-residue highly charged region links the C,3 domain to a 26residue transmembrane region followed by a terminal 28-residue intracellular domain. 3.8. Structure-function relationships in I g C : domain hypothesis The domain hypothesis of Edelman et al. [4] states that ‘The internal homologies and symmetry of the molecule (IgG) suggest that homology regions may have similar three-dimensional structures each consisting of a compact domain which contributes to at least one active site’. The structural statement of the hypothesis is well validated. The functional statement is also broadly validated depending on interpretation of ‘contributes’. It does not, however, appear that the IgG molecule is functionally simply the sum of independent constitutive units. Thus. t h e C,,2 domains are critically dependent on the CH3 domains for stability. and Fc function can be modulated by hinge/Fab arm conformation as discussed above. The view that each domain of IgG has evolved for a separate and independent function is not validated. It seems more likely that, as IgG has evolved through gene duplication, new functions and new ways of controlling these functions have appeared with the increasing complexity of the molecule.
28
4. Structure of other immunoglobulins in relation to IgG All immunoglobulin classes are based on a four-chain structure consisting of two identical heavy chains and two identical light chains. In all cases the chains are organised into domains formed around the immunoglobulin fold. The immunoglobulin class is determined by the nature of the heavy chain or, more precisely, by the constant part of the heavy chain. This is so because of the origin of the heavy chain gene in recombination events, as discussed in Chapter 5 . As shown in Fig. 10, IgG, IgA and IgD have a similar arrangement of three constant domains and a hinge region. For IgM and IgE the hinge is replaced by an extra domain. With the involvement of tail pieces, IgM and IgA are able to form polymeric molecules. IgM is found almost exclusively as a pentamer whereas IgA is found principally as a monomer or dimer. Comparison of constant domains [76] reveals general conserved features, such as cysteines associated with the intradomain disulphide bridge and hydrophobic residues in alternating positions characteristic of /3-pleated sheets. Comparison also allows grouping of constant domains. Thus, the IgG cH2 ( C J ) domain, for example, is best related to the IgM cH3 (C,3) domain, and the IgE C,3 (C,3) domain in terms of sequence and in terms of a common carbohydrate attachment site. It seems reasonable to argue that the latter feature will lead to non-paired C,3 and C,3 domains as for C+? in IgG. The CJ domain is best related to the C,4 and C,4 domains and all three are expected to be paired in the conventional manner for constant domains. In the absence of crystallographic structures, arguments such as the above are used below to construct schematic models for the structures of the other immunoglobulins based on the data available for IgG. Tables 4-6 group together sequences of human immunoglobulin domains and hinges for ready comparison. In general, discussion below refers to human immunoglobulin unless specifically stated otherwise.
Light (L)chain A or
K
chain
L = V,
+ C,
domains
Heavy (H)chain y = V,
*= V, V, 6 = V,
(Y=
E =
V,
+ C,1 + C1,
+
+hinge+ C2 ,
+C,2+ C,3 CHI +hinge+ C,2
+ C,3
(IgG)
+ C4, + tail piece (IgM)
+ C,3 + tail piece (IgA) + CHI +hinge+ C,2 + C,3 + tail piece (IgD) + C,1 +C,2+ C,3 + C4, (IgE)
Fig. 10. Domain composition of immunoglobulin chains. Membrane-bound immunoglobulins have extra C-terminal segments. IgD composition is that of human IgD: mouse IgD lacks the C,,2 domain.
29 TABLE 4 Comparison o f human immunoglobulin domains \iinilar t o IgG C,,3 and C,,I Alignment is after Beale and Feinstein (761 and sccks to align /3-strands (compare Table 1 ) with insertions and deletions tending to be associated with bends. The C,,1 sequenccs are aligned as far as possible with those of IgG Cl13.Eu numbering refers strictly to IgG Ci,3 and C,,I but for convenience is extended t o the other immunoglobulins. A dot indicates no residue at the position corresponding to the numbered human IgGl residue. N@ indicates N-linked carbohydrate. Intradomain disulphides link Cys-367 ( o r Cys-144) to Cys-42.5 (or Cys-200) with Trp-381 (or Trp-158) nearby. C,4 and CJ have a n extra tailpiece cysteiiie involved in polymer formation.
c,I
C,1
A S T K G P
Y A
IIX 119 120 121 122 I23 12J 125 126 127
V F P
G S A S A P T L F P
A S P T S P K V F P
A P T K A P D V F P
L L A S S D P
F A T P E W P
128 I20 130 131 132 133 134
L A P S S K S
L V S C E N S
L S L C S T Z
I I S G C R H
P E A
G S R
13s
T S G
B P S
P .
P K
C$
C,4
CJ
C,3
c',4
34 1 342 343 344 345 346 347 348 349 350
G Q P R E P Q
V A L H R P D
G N T F R P Q
A Q A P V K L
G P R A A P E
Y T
Y L
H L
L N
35 I 352 353 354 35.5 356 357
L P P S R D E
358 359 360
L T K
L P P A R E Q L N L R
L P P P S Q Q L A L N
v
v
v
36 1 362 363 364 365 366 367 368 36Y 370
N Q V S L T
E S A T 1 T
Q L V T L T
L V K
L V T
L A R
37 1 372 373 374
G F Y P
G F S P
37s 376
S D
A D
c
c
s
136 137
S
D
S P S
V F P L T
N
R C C K N I P S @ A T S V T L G C L A T
G T A A L G C L V K
S T V A V G C L A Q
G B V V I A C L V Q
148
G F F P
G Y H P
G Y F P
T S
E P
L L C E V
o
138 139 140 141 142 143 144 135 146 147
G F S P
G F S P
N F M P
149 150 IS1
D Y F P
D F L P
K D
P N
E D
152 I53
E P
D S
s
B
Q
N S P V V L A C L I T
D K R 1' L A C L I
c
A S W
v
A S T
Q Q P
T A B L E 4 (confinued)
CJ
c,4
CJ
C,3
c,4
377 378 379 3x0
I A V E
V F V Q
V L V R
I L L M
I S V Q
381 382 383 384 385 386 387 388 389 390
w
w
w
w
w
E S N G Q P E N N
M Q Q R G Q P L S P E K Y V T S A P M P E P
L Q G S Q E P R E K
Y L T W A S R Q E P
L L E H D N O E R V E Q V L N @ P T D S A G R F A H P S A T R T P Q P P P R Q K P ?
Q
S
A P G
Q G
G S
391 392 393 394 395 396 397 399
Y K T T P P V L D
400 40I 402
S D G
398
T
I
'
I57
s
s
L S V T
V T V T
V M V T
I 58
w
w
159
w
w
w
N S G A L T S G
K Y K N@ N S D I
S E S G Z G V T
Y M G T Q
D T G S L N@ G T
I60 161
I62 I63 I64
I65 I66
S Q P
S
S 167
I Q R
K G S
176 177 I7X
S S G
G G .
R D S
L S G
G F F V F
I79
L Y S L S
K Y A A T
A S G B L Y T T S
Y Y M T S
H Y A T I
1x4 185 186
s
s
s
s
s
V V
Q V
Q L
Q L
L L
187
'.r
1x8
V P
L L P
T L P A T Q C
S T P L Q Q
T V S G A W
s
s
1
L
V L
R L
T V D K S R
T V S E E E
R V A A E D
R V P A P P
E V T R A E
s
I T F
Z R
s
w
V T V
S
s
w
154 155 156
170 171 172 173 I74 175
I L
w
C,I
Q R T F P E
K L
41 I 412 413 414 415 416 417
C81
A R B F P P
s
T F W A W
C,,I
T K G F P S V L R
R Y F A H
S F F L Y
c,1
V H T F P A V L O
T T F A V T
403 404 405 406 407 408 409 410
c,1
w
168 169
1 xo
181 182 I x3
I 89 I90 191
192
s
S S
s
K D V M Q
T M T L P A T T L T
T A B L E 4 (conlitwed)
c,1
c1 ,
C,,I
c,1
c,1
L G T
G T N
L A G
W R Q
A K .
c
I06 107 lox I99 200
Q T Y I
E H V V
K S V l
G E Y K
Q M F T
R A V H E
20 I 202 20.3 204 20.5
N V N H K
K V Z H P
A L P L A F T Q K T
D A S A R S T P L S L Q N @ T A V S Q R K
206
P S N
B G B
212 213 214
T K V D K K
K E K N V P
V D K S T G K P T L Y N@ V
I D R L A G K P
s
v
215
V
L E V S Y V T D H G P M
S V N P G K
L P V
s
s
L V M S D T A G T
V V M A O V D G T
Y
Y
c,3
c,4
c,,3
c,3
c,4
418 419 420
Q Q G
N T G
K K G
P Q P
E Q K
19.3
42 1 422 423 424 425 426 427 128 429 430
N V F S
E T Y T
D T F S
A T Y T
c
D E F I
S V M H E
V V A H D
M V G H E
V V S H E
43 I 132 433 434 435 436 437 438 439 440
A L H N H Y T Q K S
A L P N R V T E R T
44 1 442 1‘43 444 445 446 441
L S L S P G K
c
c
c
I94 19.5
207 208 3JO
210 21 I
c
c
c
€
c
I V K H .
V Q H T
. Y T
A S K
N P
P S S
I K E I F
R V A H 7’
S K
S O H V
c
V
T ) W V D N@
A
c
‘r
H V N@ V
c
The data as from reference\ [ 113. 6 . 107, 9.3 atid 791
T V
K T F S
32 TABLE 5 Comparison of human immunoglobulin domains of the IgG C,,? type and IgM and IgE C,,2 domains ‘IgG C,,2 type’ refers to non-paircd domains with interposed carbohydrate chains attached to Asn-297. C,2 lacks this carbohydrate but has a chain at Asn-258 which could function similarly, as discussed in the text. C,2 and C,2 are included separately tor the sake o l the completeness. They probably more closely resemble IgG CHI or C,,3 than C,,2. A dot indicates no residue at the position corresponding to the numbered human IgGl residue. N@ indicates N-linked carbohydrate and S@ 0-linked carbohydrate. The intradomain bridge is formed between Cys-261 and Cys-321. In IgA, Cys-236 forms an intradomain bridge with Cys-296 effectively linking the bottom of the structural hinge (to which Cys-236 probably belongs) to the tip of the C,,2 domain. Cys-235 and Cys-298 form interheavy bridges which have been suggested to be Straightforward or crossed. Cys-309 in C,,2 is unaccounted for and may be involved in polymerisation and interaction with secretory component. Cys-309 in C,3 has been suggested in the IgM pentanier to form a disulphidc bridgc to the corresponding cysteine in another monomeric unit, although this is disputed. An alternative involvement in polymerisation has been proposed. I n C,2, Cys-340 forms an interchain bridge to the corresponding cysteinc. In C,2, Cys-248 and Cys-339 form two interheavy chain bridges. These two residues are suggested to be close together in space and may form a ‘crossed’ linkage system.
v 23 1 232 233 234 235 236 237 238 239 240
A
I
P E L L G G P S V
A
24 1 242 243 244 245 246 247 248 249 250
F L F P P K P K D T
F
25 1 252 253 254 255 256 257 258 259
L M I S
I F L T K S T K L
R T P E V
Q D T A I R V
A I
P P S F A S
P S@ C C H P R L
S H T
S L H R P
Y L L T P
S A Y L S
F
A L
A V
R
Q
Q D
D G F F G
D
L L L G S E A N@ L
Q P L G V
L W L R D K A T
F
A
D S N P
R G V
P S P F
E L P P
K V S
V
C S
R D
F
T
P P T V
V
K I
P P
L
R
Q S S C D G
D L F I
N
R
P
K S P T I
R
H F P
K S K L
T I Q
G G
P
33 TABLE 5 (continued)
c,3 T
T
T
I
C
C
C
C
C
L V T D L T T Y
T L T G L R D
Q
V V G S D L
L V V D L A P
260
T
T
26 1 262 263 264 265 266 267 268 269 270
C V V V D V S H E D
27 1 272 213 274 275 216 217 27 8 219 280
P E
D S
V K
V
F
N W
Y V D
F
S
K
A
S G V T F T W P
K D A H L T W E V
Q
S
T I S W T R
A T G F S P
L L C L V S G Y T P
R Q I Q
G T I
V S W
A
G T V N@ L T W S R A
I T W L E D
L R E
N@
281
G
D
T
G
S
G K
G
282 283 284 285 286 287 288 289 290
V E V H N A K T K
G E
S G K
K V P T G G V E E
G K
Q V G S G V T T D
Q V M
29 1 292 293 294 295
P R E E Q
T
T A S T T
296 291 208
Y S
T R K E E K Q R N@ G
Q V
I S E S H P N@ A
G L L E
299 300
T Y
T F
N@
A V K T H
N@
S A V
Q G P
P E R D L
C G C
R H S
N@ G S
Y
Q
P V N H S
T L
Q A E A
K E S G P T T Y
D V
D L S
Q E G E L A
30 1 302 303 304 305 306 307 308 309 310
C? R V V S V L T V L H
31 1 312 313 314 315 3 16 3 17 318 319 320
Q D W L N G K
32 1 322 323 324 325 326 327 328 329 330
C K V S
33 1 332 333 334 335 336 337 338 339 340
E Y K
S
T S T L P V G
T
T
E
S L W N A G T S V T
R D
S D W L S
C
C R V T H P H L P R
C R V D H
A L M R S T T K T S
T F
T
Q Q
E D S T K K C
D D W N
E P W
S
H G K T F T
G
E A
S
I
C E
G
E R F T
N
C
C T
T A A Y P E
K A L P A
S
P I E K T
P L K Q T I S R P K G
I S K A K
K V
S
V T H T D L P
N
T V
S V S S V L P G C A
A V
Q H
S R L T L P R
T L
N
H P
S
S L P P
K
Q
T
P
L
T A T L S K S
Nomenclature and sequence sources as in Table 4.
R L M A L R E P A
W
I E G E T Y
Q
S
T L T I K
Q S M F T
S T
Q S E
L T L S Q K H W L S D R T Y T C
Q V
T Y
R G
Q L
N@
A S S
M C V P D
G H
F
35 TABLE 6 Comparison of hinge sequences of human immunoglobulins
216 217 218 219 220 22 1 222 223 224 225
Yl
P
Y3
Y4
E P K
E R K
E L K
E S K
S
.
T
Y
C
.
D
.
P L G
G P P
D T T H
. . .
K
.
T H T
. . .
T
a1
.
s R
. P
P E
a2
.
P
c
P V P S@
T P P
c
R V P P< P P P
7'
P
w
s
Q
A
S@
S
V
P T A Q P Q A E
S@
P
S@
T
P P T
P<
________-_______________________________--
P K A
" Per P hinge
G S
S
P
L A
S@
**+37 226 227 228
229 230 23 1 232 233 234 235 236 237 238
c P P
C V E C P P
c
P R C P E P *+41
c
P S
c
c
c
P< A P E L L
PC A P P V A
P< A P E L L
G G
G .
G
P
P
+41. IgG3
= =
c
c
c
1st inter-heavy S-S
Middle hinge
c
* * +37, IgD
*(
c
c
c
.
P< A P E F L
.
P<
.
s
. .
T
G
.
Q
! a s t - i ~ ? r e ~ ~ h ~ ~_ ~Y _ - ____________ s_ y S_ _ _ . ~
Lower hinge
H
KSCDTPPPCPRCPEPKSCDTPPPCPRCPEPKSCDTPPPCPR
KAT@T@APAT@T(@)RNTGRGGEEKKKEKEKEEQEERETKTPE
Nomenclature and sequence sources are as for previous Tables. For legend, see p.36.
36 T A B L E 6 (coririniied) ~
~~
.-
-
Alignment as for Table 3. with which it should be compared. Sequences begin at the start of the hinge exon. < indicates the carboxy-terminus of the hinge exon, the cxtra residues are from the Cl,2 exon but by analogy with IgG are suggested to belong structurally to the hinge. A dot indicates no residue at the position corresponding to the numbered human IgGl residue. S@ or T@ indicates 0-linked carbohydrate attachment sites. Cys-220 (IgG1. I g A l . IgA2) forms ii disulphide linkage to the light chain. Note lhat IgG3 and IgD in particular have long hinges but of different character. IgG3 has a long middle hinge and IgD a long upper hinge. IgAl also has a relatively long upper hinge. These differences may have important consequences for function.
5. Structure and function of IgM 5. I . Structure of IgM Electron microscopic and chemical studies have led to the postulation of a low resolution model for the structure of the IgM pentamer [76,41]. From these studies and by comparison of IgM and IgG sequences a model can be proposed for the monomeric unit of IgM as shown in Fig. l l ( a ) . The Fc portion of IgM (C,3 and C,4 domains) is very similar to that of IgG, with t h c non-paired C,3 domains resembling the C J domains in having interposed N-linked, branched carbohydrate chains. The paired C,2 domains replace the hinge of IgG. There would, however, appear to be some potential for flexibility between the C,1 and C,2 domains and between C,2 and C,3. Indeed, electron micrographs of pentameric IgM [4] indicate a monomer in which the F(ab’)2 unit of Fig. l l ( a ) is rotated through 90” about its two-fold axis of symmetry (compare IgG1, Fig. 7). IgM possesses extra carbohydrate chains on the C,1, C,2, C,3 and tailpiece, as shown in Fig. ll(a). It is likely that these chains are on the ‘outside’ of the molecule rather than partially buried as in the C!; domain [77]. The tailpiece of IgM may be folded to form an extra P-strand on the Y-face of the C,4 domain [49,77]. The normal pentameric structure of IgM is represented schematically in Fig. l l ( b ) . Associated with the five IgM monomers is a molecule known as the J chain of molecular weight about 16000. Secondary structure predictive methods indicate that the J chain probably adopts an eight-stranded antiparallel P-barrel structure similar to that of an immunoglobulin domain, although an alternative two-domain model has been suggested [78]. The probable similarity of the J chain to an immunoglobulin domain opens up the possibility that it is paired with a C,4 domain in the pentameric structure and one model has placed it between two C,4 domains on adjacent IgM monomers [77].Disulphide bridges are believed to be important in the polymerisation of IgM although the nature of the linkages is controversial. One model [76] links the extra cysteine in the C,3 domain (position 309 in the numbering of Table 5 ) to the corresponding cysteine on an adjacent monomer and the penultimate cysteine of the tailpiece again to the corresponding cysteine on an adjacent monomer or to the J chain (the J chain has two cysteine residues). An-
37
C termini
Fig. I I . The structure of IgM. ( a ) The monomeric unit. This schematic representation relies greatly on comparison of the aminoacid sequence of IgM ( p chain) and IgG ( y chain) and extrapolation from known features of IgG structure. The Fab arms are as for IgG. the paired C,2 domains replace the hinge. the C,3 domains are suggested to resemble the C,,? domains i n IgG, being unpaired with interposed carbohydrate. and the C4, domains to rcseinble the paired C,3 domains of IgG. A disulphide bridge connects the heavy chains between the C,2 and C,3 domains. An additional feature is ii tailpiece of I X residues at the carboxy-termini of the heavy chains which may fold hack across the C4, domains. The molecular weight of the monomer is - l 9 ( l ~ ~ O l l . (b) The pentameric structure. A schematic repi-cscntation deduced from electron microscope and chemical studies and by comparison with IgG. The inolecule is shown as a planar star shape for clarity. The F(ab’), unit is probably rotated through 00” ;ihout its two-fold axis of symmetry. The arrangement o f disulphide bridges between monomers and position of the J chain is controversial as discussed i n the text. One monomer unit is shown shaded. The molecular weight of the pentamer is 970000.
other model [77] links one tailpiece to a C,3 of the same monomer and the other to a C,3 of an adjacent monomer or to the J chain.
5.2. Functions of IgM 5.2. I. Antigen binding Pentameric IgM is decavalent with small antigens as expected but only pentavalent with larger antigens presumably due to steric hindrance [SO]. Electron micrographs of specific sheep IgM bound to Salmonella paratyphi flagellum indicate that interaction with antigen is accompanied b y a considerable conformational change [76,80,41]. It appears that a flexion occurs between the C,2 and C,3 domains to dislocate F(ab’)2 units relative to the central Fc, disc and produce the ‘staple’ form represented in Fig. 12. The F(ab’), arms appear to maintain a fixed inter-Fab angle, presumably because of the paired C,2 domains, and hence their description as a unit. The conformational change is particularly associated with complement activation.
38
34’” Star
Staple
Fig. 12. Structural forms of IgM. These representations are bascd on electron micrographs obtained by D r . A . Feinstein and co-workers of an uncoinplexed IgM paraprotein (‘star‘) and a specific sheep IgM bound to Salmonella parafvphi Hagellum as antigen (‘staple’). The star form corresponds to the IgM pentameric structure shown in Fig. 1 l(b). although the fivc F(ab’): units are now rcpresented as rotated through 90” about the two-fold axis of symmetry. When bound to the Hagcllar antigen. the F(ab’)? arms are dislocated t o give a staple o r ‘crab-like’ configuration. Complement CI is activated on binding to complexed IgM (staple) but interacts only very weakly. yielding no significant activation, with uncomplexed IgM (star), implying an important role for the dislocation process in complement triggering.
5.2.2. Complement activation IgM is the antibody most efficient in activating the classical pathway of complement. The C l q binding sites are located on Fc, either on the C,3 or C,4 domains [go]. It is well established that single IgM molecules bound to antigen can activate complement indicating, since free IgM clearly does not activate, that C l q binding sites must become available on interaction with antigen. In fact it is apparent that native IgM expresses a single C l q binding site ( K , , - 104-10i M-’ ) but that complexing with antigen reveals extra sites and consequent multivalent attachment of 5 x lo7 M-I). It is suggested that the Clq and increased binding affinity ( K , increased lifetime of bound C l q allows activation of ClrzCls, to occur [41]. As for IgG, it appears that charged groups are important for the interaction of IgM and C l q [127,128]. None of the three proposed C l q binding sites on the C,2 domain of IgG have equivalent structures on the C,3 domain of IgM. However, two mutant IgM molecules with single amino acid changes in t h e C,3 domain have been isolated and shown to have decreased ability to bind activated C1 (and by implication Clq) [81]. A Ser + Asn mutation at position 406 produces some loss in affinity and a Pro + Ser mutation at position 436 produces a great loss. Ser-406 is equivalent to Arg301 in IgG, which is a carbohydrate contact residue. Pro-436 is equivalent to Pro331 in IgG which is in the C l q site proposed by Burton et al. [82] discussed earlier. Whatever the molecular details, it is apparent that IgG and IgM solve the problem of activating complement when in contact with antigen but not when free in serum by two different routes. Monomeric IgG relies on the aggregating ability of antigen. Polymeric IgM is already aggregated but in an inactive form and relies on antigen to dislocate the molecule to allow complement activation.
-
39
5.2.3. Interaction with cellular Fc receptors There are reports of the existence of specific receptors for IgM on a number of cell types [83] but no detailed characterisation has been carried out. 5.3. Membrane IgM IgM is a principal class of immunoglobulin on the surface of B lymphocytes where, in monomeric form, it acts as an antigen receptor to trigger an antibody response [85]. The primary structure of secreted and membrane IgM is identical to a position close to the terminus of the C,4 domain (residue 556 in mouse IgM). Whereas secreted IgM- has a further 20 residues (essentially t h e tailpiece), membrane IgM has a further 41 residues organised in three segments. The segment 556-568 is predominantly hydrophilic with 6 glutamates, 569-594 is predominantly hydrophobic and may adopt an a-helical structure traversing the cell membrane and finally a short positively charged segment probably ‘anchors’ the chain in the cytoplasm.
6 . Structure and function of IgA 6.1. Structure of serum IgA More than 80% of serum IgA occurs as a monomer with the rest occurring as relatively small polymers (dimers, trimers etc). There are two subclasses of human IgA, IgAl and IgA2, with IgAl being the predominant (8&90%) subclass in serum. The structure of both subclasses is suggested to be broadly similar to IgG as shown in Fig. 13 with a number of differences. particularly in the CH2/hingeregion of the molecule. Predicting the arrangement of the C,,2 domains is complicated by a unique carbohydrate distribution and interheavy bridging pattern. There is no N-linked carbohydrate chain in the C,2 domain at the equivalent of position 297 in human IgG1 as found in the corresponding domains (C?. C,3, C,3, C82) of other immunoglobulins. However, there is a N-linked carbohydrate at a site on the X-face of the C,2 domain (position 258 in human IgG, Table 2) towards the C,3 domain. One could envisage that the carbohydrate covered the X-face of C,2 as for C,2 (but in an inverted arrangement relative to C+?) again leading to non-paired domains as shown, but this is clearly speculative. The C,2 domain has seven cysteines. Two are involved in the usual intradomain disulphide bridge, another two in a second intradomain bridge and one is thought to be free, possibly for interaction with secretory component (see below) [86, 109,1101. The remaining two form interheavy disulphide bridges which probably tie together the tips of the C,2 domains and the bottom of the hinge [80,49]. Chemical studies were interpreted to indicate a straightforward bridging pattern as indicated in Fig. 13(a) [86,109,110]. However, from modelling studies Pumphrey has proposed a ‘cross-over’ arrangement [49]. There is a further intradomain disulphide linkage in C,,1 in addition to the conserved domain disulphide.
40
Fig. 13. The structure of IgA. (a) Serum IgA1. The structure proposed resembles that of IgG with the differences being an extended hinge region containing ten O-linked carbohydrate chains, disulphide bridges tying together the bottom o f the hinge and the tips of the C,,2 domains, differently positioned CI~,2carbohydrate chains. and carboxy-terminal tailpieces. In lgA2, the hinge is much shorter and the light chains are disulphide linked not to the heavy chain but to one another. The molecular weight of IgAl is -160000. (b) Secretory dimeric IgA. Electron micrographs indicate a double Y-shape. The J chain (molecular weight -16000) resembling an immunoglobulin domain is thought to link tailpieces of monomer IgA via disulphide bridges. The secretory component (molecular weight -70 000) resembling five immunoglobulin domains probably interacts non-covalcntly with the Fc and J chain and forms a single disulphide bridge to one of the IgA monomers. The representation shown is purely schematic.
The C,3 domain of secreted IgA possesses an 18-residue tailpiece which is very similar to that found for C,4 and similarly has an N-linked carbohydrate chain and a penultimate cysteine residue. The principal difference between the two subclasses of IgA is in the nature of the hinge. IgAl has an effective structural hinge length of about 20 residues all in the ‘upper hinge’ (Table 6) containing five O-linked carbohydrate chains per heavy chain [125]. The degree to which the IgAl hinge is extended in three dimensions is unknown at the present time. The oligosaccharides and paucity of charged amino acids in the hinge probably serve to protect it against proteolytic attack. IgA2 has a structural hinge region of about seven residues including five proline residues which is likely to be relatively short and by its nature resistant to proteolysis. A further peculiarity of IgA2 is that for most molecules (allotype A2m(l)) the light chain is disulphide bridged not to the heavy (a2) chain but to the light chain of the other Fab unit. This necessitates of course very close approach of Fab arms and complete loss of relative Fab arm flexibility. IgA dimers are formed by the association of monomers and J chain involving disulphide bridge formation between the penultimate cysteines of the tailpiece and
41 the cysteines of J chain. Alternative models of how this may occur have been discussed [77]. Electron micrographs of IgA dimer [87,88] indicate a double Y-shape connected at the stems, suggesting close approach or association of C,3 domain pairs (compare Fig. 13(b)). 6.2. Structure of secretory IgA
IgA is the predominant immunoglobulin in seromucous secretions such as saliva, tracheobronchial secretions, genito-urinary secretions, milk and colostrum where it is found in a dimeric form. The dimer involves J chain and also another molecule known as secretory component. This molecule, unlike immunoglobulins and J chain which are produced by plasma cells, is synthesised in epithelial cells. With extra segments to attach it to the epithelial cell membrane, secretory component serves as a receptor for polymeric immunoglobulin containing J chain, i.e. IgA or IgM. After endocytosis and transport, cleavage of the immunoglobuliniJ chainheceptor complex releases immunoglobulin/J chain associated with secretory component. This process is particularly important for IgA to release secretory IgA. The poly-Ig receptor has been cloned and sequenced [89] to reveal that the polyIg binding portion, i.e. secretory component, is composed of five highly conserved domains of approximately 100 amino acids which show considerable homology with immunoglobulin domains. It is possible that this arrangement of secretory components in domains facilitates interaction with the constant domains of IgA. Secretory component also becomes disulphide-linked to one of the monomers of dimeric IgA [90]. A recent model suggests that it is a cysteine on the first domain of secretory component which links to the unpaired cysteine of the C,2 domain [77]. Fig. 13(b) shows a schematic representation of dimeric secretory IgA. In contrast to serum IgA, secretory IgA shows roughly equal proportions of the two subclasses.
6.3. Functions of IgA Both subclasses of serum IgA in aggregated form weakly activate the alternate pathway of complement but the structural basis for this function is not understood at the present time. Cell surface Fc receptors for IgA have been reported [83,84].
7. Structure and function of IgD Several antibody responses include the production of specific IgD antibody [91], but the concentration of IgD in serum is very low. Since the antibody does not appear to activate any effector system, a possible protective role for IgD in serum has not been identified. However IgD, together with IgM, is a principal class of immunoglobulin found on the surface of B cells, where it is thought to act as an antigen receptor with an immunomodulatory role [92]. The structure of human IgD is suggested to resemble fairly closely that of IgG,
42 as shown in Fig. 14. With the conserved cH2 domain N-linked carbohydrate chains, these domains are postulated to be unpaired as for IgG. Differences include the presence of two N-linked carbohydrate chains in the c H 3 domain and seven-residue tailpieces. However, the most striking feature of human IgD is the very long hinge region of effectively about 70 residues which is comparable to that for human IgG3. This length is concentrated almost exclusively in the upper hinge in contrast to JgG3 which has a long middle hinge (Table 6). It should allow great flexibility in the relative position of the two Fab arms of IgD. This hinge can be divided into two distinct parts. The amino-terminal half is heavily 0-glycosylated having between four and seven 0-linked oligosaccharides per heavy chain [93,94]. (There are four or five oligosaccharides in one myeloma protein and seven in another, although the sequences of the hinge region are identical in both.) The carboxy-terminal half of the hinge is extremely rich in charged residues (3 Arg, 6 Lys, 10 Glu) and has been suggested to adopt an a-helical conformation [94,49]. A single disulphide bond probably links the two heavy chains in the hinge close to the folded C62 domain. The charged region is extremely susceptible to proteolytic attack which makes serum IgD unstable and presents great problems of isolation (911. Although drawn schematically in Fig. 14 as extended (which seems likely), the true conformation of the IgD hinge is of course unknown. When membrane-bound by extra carboxy-terminal sequences, it has been suggested that the 0-linked oligosaccharide in the upper part of the hinge may serve to protect the charged lower region from proteolysis [93]. On antigen binding, a conformational change would
Fig. 14. Structure of IgD. The structure of human IgD proposed is broadly similar to that of IgG, with the differences being an extended hinge region (divided into a region rich in 0-linked carbohydrate and a highly charged region. possibly in a helical conformation) and short tailpieces. The molecular weight of IgD is -175000. Mouse IgD has a structure very different to that of human IgD as discussed in the text.
43 expose the charged region to enzymatic cleavage, resulting in transmission of a signal into the B cell. Unlike the general case for immunoglobulin classes, there is a marked difference in the structures of human and mouse IgD [93]. Thus, mouse IgD completely lacks the C,2 domain and the carboxy-terminal charged half of the hinge containing the interheavy disulphide bridge. There is only a single N-linked oligosaccharide in the upper hinge of mouse IgD and the location of one of the C,3 oligosaccharides differs. The tailpiece of mouse secreted IgD is considerably longer (21 residues) than that of human IgD, and the homology between the C,1 domains of the two species is surprisingly low. The primary structure of mouse membrane IgD has been described [92] and Table 7 illustrates a comparison of the structures of membrane and secreted mouse immunoglobulins. Recently, receptors for IgD have been described on T cells which may be important in immunomodulation [95]. TABLE I Structure of membrane and secreted mouse immunoglobulins
Class
IgM
IgD
IgG3
IgGl
IgG2b
IgG2a
IgE
IgA
Heavy chain Number of domains Number of amino acid residues hinge spacer transmembrane segment cytoplasmic segment secreted terminus
P
6
Y3
Yl
y2b
y2a
E
a
4iV
2+v
siv
stv
3+v
3iv
J+V
siv
0 12
35 26
17
13 17
22
17
17
I6 17
18
14 25
26
26
26
26
26
26
26
26
3
S
28
28
28
28
28
14
20
21
2
2
2
2
8
20
0
From [92]
8. Structure and function of IgE 8.1. Structure of IgE
With an extra domain (C,2) replacing the hinge, the proposed structure of IgE is similar to that for monomer IgM (Fig. 15). IgE, however, lacks tailpieces and shows no tendency to polymerise. The C,3 and C,4 domains show close homology to the C,,2 and C 3 domains of IgG respectively [96] and, with the conserved carbohydrate, the structure of Fce is probably close to that of Fcy. Perhaps the greatest unknown is the arrangement of the C,2 domains. There are two cysteine residues per C,2 domain not involved in the intradomain disulphide bridge [98] and these are predicted to be located spatially close to one another at the carboxy-terminal
44
Fig. 15. The structure of IgE. The proposed structure of IgE closely resembles that of the IgM monomer with an extra constant domain (C,2) replacing the hinge region. Lacking tailpieces. the IgE molecule shows no tendency to polymcrise. The molecular weight o f IgE is -190000.
end of the domain. Both cysteines are disulphide linked to the other heavy chain. Pumphrey [49] has proposed an arrangement in which these interchain disulphide bridges are ‘crossed’ with the cysteine proximal to the amino-terminus on one chain linked to the distal one on the other and the domain pairing is similar to that observed in A light chain dimers. A crossed arrangement has also been independently suggested by Padlan and Davies [122]. Segmental flexibility in IgE appears less than that generally found for IgG subclasses [40,97] but, it has been argued. is still significant [97]. In the model discussed above there appears to be scope for flexibility between CJ and C,2 domains and between C,2 and C,3 domains [49]. The latter flexibility corresponds to that described earlier for IgM.
8.2. Functions of IgE The major effector function activities of IgE are related to its binding to cellular Fc receptors specific for the Fc region of IgE. These are basically of two types: a tight binding receptor ( K , 10“’ M-’ ) found on mast cells and basophils and a weaker binding receptor found on lymphocytes, monocytes, macrophages, eosinophils and platelets. When monomeric IgE, bound to Fc receptors on the surface of a mast cell or basophil, is cross-linked by contact with antigen, degranulation of the cell occurs releasing chemical mediators. This reaction is of course important in allergic responses. A schematic model of thc high affinity receptor has been proposed consisting of four polypeptide chains arranged in six subunits [99,121]. The receptor interaction site on IgE has received considerable attention. An early report [ IOO] described the partial protection from tryptic digestion of the region between the
-
45 C,2 and C,3 domains of cell-bound IgE, implying involvement of this region in cell receptor binding. More recently, ii cloned fragment consisting of about 213 of the C,2 and all of the C,3 domains has been shown to bind to mast cells [loll. Peptide studies have been claimed to implicate both the C,2-C,3 interface [lo21 and the C,4 domain [lo31 in receptor binding. Fluorescence studies have been taken to indicate a 'non-perpendicular' conformation of IgE to the cell surface when receptor bound [ 1041 possibly dislocated in the manner envisaged for IgG (Fig. 9. [lOS]). These studies also indicate a retention of most of the segmental flexibility o f IgE when receptor bound [97]. The function of Fc receptors for IgE on lymphocytes is possibly related to regulation of JgE synthesis and those on granulocytes, monocytes and macrophages to IgE-mediated phagocytic reactions. Mononuclear cells also secrete molecules capable of binding IgE (IgE binding factors), which appear to be related to the Fc receptor and may have a role in immunomodulation [106,107]. TABLE 8 Physicochemical properties of human iinmiinc~globulins
I gG Hcavy chain Mean serum conccntration (mg.rn1-l) Basic ztructural form
IgA
IgGl
IgG2
lgG3
IgG4
Yl
D
Y3
YJ
5
3
mon
mon
IgM P
0.5
0.5
1.5
inon
mon
pent
2
2
2
2
150
150
I60
150
Number of interheavy disulphide bridges
2
4
I1
2
Number of hcavy chain domains
4
4
4
4
5
S1
51
56
51
Number of N-linked carbohydrate chains per heavy chain constant region
I
1
1
Residues in hinge exon
15
12
62
Valency for antigen Molecular weight ( X lor')
Molecular weight of heavy chain ( X lo-') (including carbohydrate)
"
5(10)
970
1''
IgA?
sIgA
rul
02
crl/cu2
3
0.5
0.05
0.03
5x10
mon
dim
mon
mon
IgAl
mon
IgD
IgE
6
2
2
4
2
2
160
160
415
175
190
-7
2
-
1
2
4
4
-
4
s
72
57
57
-
63
72
1
5
2
s
-
3
6
I2
0
20
7
-
64
0
There is o n e interheavy S-S bridge in IgM between C k 2 and Cp3 domains - there are further bridges between monomer units as discussed in the text.
46 TABLE 9 Effector function activities of human immunoglobulins ~
IgG IgGl
IgG2
Activation of complement classical pathway alternate pathway
+ -
Binding to cell receptors" monocytesimacrophages (phagocytosis, cytoxicity)
IgA
IgG3
IgG4
IgM
f
+
-
+ + -
-
-
-
-
2
+
-
+
i-
'?
+
neutrophils (phagocytosis)
+
-
+
i-
-
+
+
-
lymphocytes (immunoregulatory, cytotoxicity)
+
-
+
?
?
+
+
+
+
trophoblasts (placental transfer)
+
-
+
mast cellsibasophils (inflammation)
-
-
-
platelets (aggregation?, release of modulatory factors?)
i
Membrane bound as antigen receptor
+
+
+
"
IgAl
IgA2
IgD
IgE
-
-
-
+
-
-
+
-
i
t
-
-
-
-
-
+
+
+
+
+
+
Note that a given cell type may possess more than one receptor type for IgG (FcRI, FcRII. etc.) and that the subclass specificity of all receptor types has not been descrihed.
9. Summary Tables 8 and 9 summarise the physicochemical and effector function activities of the human immunoglobulins.
Acknowledgements The author is a Jenner Fellow of the Lister Institute of Preventive Medicine. Pam Smith is thanked for her patience in typing this manuscript and Bhav Sheth, Jenny Woof and Ken Davis for assistance with the diagrams. The financial support of the SERC, M R C and Yorkshire Cancer Research Campaign is acknowledged.
47
References 1 Roitt, I.M.. Brostoff, J. and Male, D.K. (1985) Immunology. Ch. 5, Gower. London. 2 Porter. R . R . (1959) Biochem. J. 73. 119-126. 3 Fleischmann. J.B.. Pain, R.H. and Porter. R.R. (1962) Arch. Biochem. Biophys. Suppl. I , 174180. 4 Edelman. G.M., Cunningham, B.A.. Gall. W.E.. Gottlieh. P.D., Rutishauer, U. and Waxdal, M.J. (1969) Proc. Natl. Acad. Sci. USA 63. 78-85. 5 Turner, M.W. (1981) in: Structure and Function of Antibodies (L.E. Glynn and M.W. Steward, Eds.) Ch. 1, John Wiley, New York. NY. 6 Kabat. E . A . , Wu. T.T., Bilofsky, H . , Reid-Miller, M. and Perry. H . (1983) Sequences of protcins of immunological interest. US Department of Health and Human Services. National Institutes of Health, Washington D.C. 7 Davies, D . R . , Padlan, E . A . and Segal. D.M. (1975) Annu. Rev. Biochem. 44. 639-667. 8 Amzel, L.M. and Poljak, R.J. (1979) Annu. Rev. Biochem. 48. 961-997. 9 Marquart, M.. Deisenhofer, J . . Huber, R . and Palm. W. (1980) J . Mol. B i d . 141, 369-391. 10 Saul. F.A.. Amzel, L.M. and Poljak, R.J. (1978) J . B i d . Chem. 253, 585-597. I 1 Hanson. D . C . , Yguerabide, J . and Schumaker, V.N. (1981) Biochemistry 20. 6842-6852. 12 Wrigley. N.G., Brown. E . B . and Skchcl, J . J . (1983) J . Mol. Biol. 169. 771-774. 13 Rademacher, T . W . and Dwek. R.A. (19x4) Prog. Immunol. 5 , 95-112. I4 Davies, D . R . and Metzger, H . (1983) Annu. Rev. Immunol. 1. 87-117. 15 Givol, D. (1979) Int. Rev. Biochem. 287. 301-3M. 16 Amit. A.G.. Mariuzza. R.A., Phillips. S.E.V. and Poljak. R.J. (1985) Nature (Lond.) 313. 156158. 17 Amit, A . G . . Mariuzza. R . A . . Phillips. S . E . V . and Poljak, R.J. (1986) Science 233, 747-753. I8 Novotny. J.. Bruccoleri. R . , Ncwell. J . . Murphy. D . , Haber. H. and Karplus, M. (1983) J . Biol. Chem. 258, 14433-14437. I Y Westhof, E . , Altschuh, D.. Moras, D . . Bloomcr, A.C.. Mondragon, A , , Klug. A . and van Regcnmortel, M.H.V. (1984) Nature ( L o n d . ) 31 I . 123-126. 20 Tainer, J . A . . Getzoff, E . D . . Alexander. H . . Haughten. R.A., Olson, A . J . , Lerner, R . A . and Hcndrickson. W.A. (1984) Nature (Lond.) 312, 127-134. 21 Thornton, J.M.. Edwards. M.S., Taylor. W.R. and Barlow. D.J. (1986) EMBO J . 5, 409-413. 22 Novotny. J . . Handschumacher. M . , Haber. E . . Bruccoleri, R.E., Carlson. W.B.. Fanning, D.W., Smith. J . A . and Rose, G . D . (1986) Proc. Natl. Acad. Sci. USA 83. 226230. 23 Deisenhofer. J . (1981) Biochemistry 20, 2361-2370. 24 Weir. D . M . (1986) Handbook of Experinicntal Inimunology. 4th edn.. Blackwell, Oxford. 25 Burton, D . R . (1985) Mol. Immunol. 22. 101-206. 26 Leatherbarrow. R.J. and Dwek, R . A . (1083) FERS Lett. 164. 227-230. 27 Leathcrbarrow. R.J.. Rademacher. T.W.. Dwck. R . A . , Woof, J . M . , Clark. A , . Burton, D . R . , Richardson, N . E . and Feinstein. A. (1985) Mol. Immunol. 22, 407-415. 28 Nose. M . and Wigzell. H . (1983) Proc. Natl. Acad. Sci. USA 80, 6632-6636. 29 Parekh. R.B.. Dwek. R.A.. Sutton. B . J . . Fernandes. D . L . , Leung, A,. Stanworth. D . R . . Rademacher, T . W . , Mizuochi, T., Taniguchi. T., Masuta. K., Takeuchi. F.. Nagano, Y . , Miyamoto, T. and Kobata, A . (1985) Nature (Lond.) 316. 452-457. 30 Sutton, B.J. and Phillips. D.C. (19x3) Biocheni. Soc. Trans. I I . 13&132. 31 Silverton, E.W.. Navia. M.A. and Davies. D . R . (1977) Proc. Natl. Acad. Sci. USA 74. 514Ok5144. 32 Sarma. R . and Laudin, A . G . (1982) J . Appl. Cryst. 15. 476-481. 33 Rajan. S.S., Ely. K . R . . Abola. E.E.. Wood. M.K., Colman. P.M.. Athay. R.J. and Edmundson, A . B . (1983) Mol. Immunol. 20, 787-799. 34 Klein. M.. Haeffner-Cavaillon. N.. Isenman. D.E.. Rivat. C . . Navia. M . A . . Davies, D . R . and Dorrington, K.J. (1981) Proc. Natl. Acad. Sci. USA 78. 524528. 35 Woof, J.M.. Nik Jaafar, M . , Jeffcris. R. and Burton, D . R . (1984) Mol. Immunol. 21. 523-527. 36 Huber, R . . Deisenhofer. J . . Colman. P.M.. Masaak. M. and Palm. W. (1976) Nature (Lond.) 264. 4 15-420. 37 Ely. K.R.. Colman. P.M.. Abola, E . E . . Hess. A.C.. Peabody. D.S.. Parr. D . M . , Connell. G . E . . Laschinger. C . A . and Edmundson. A.B. ( 1978) Biochemistry 17, 820-823.
48 38 Feinstein. A . and Rowe. A.J. (1965) Nature (Lond.) 20.5. 147. 39 Valentine. R . C . and Green, N.M. (1967) J . Mol. Biol. 27. 615-617. 40 Oi, V.T., Vuong. T.M.. Hardy. R . . Reidler. J . . Dangl. I . . Hcrzenherg. L.A. and Stryer. L. (1984) Nature (Lond.) 307, 136-130. 41 Feinstein, A , , Richardson. N.E. and Taussig. M.J. (1986) Immunol. Today 7, 169-174. 42 Brunhouse. R . (1979) Mol. Inimunol. 16, 744. 43 Taniguchi. T.. Mizuochi. T.. Beale. M.M.. Dwek. R.A.. Rademachcr. T.W. and Kobata. A. (1985) Biochemistry 24. 5551-5557. 44 Michaelsen. T . E . and Natvig. J . B . (1974) J . B i d . Chcni. 249. 2778-3-785. 45 Sjoberg. B.. Rosenquist. E.. Michnclscn. I,..Pap. S. and Ostcrberg. R . (1980) Biochini. Biophys. Acta 625. I(L17. 46 Kilar. T., Simon. I . . Lakatos. S.. Vonderviszt. F.. Medgyesi. G . A . end Zavodsky. P. (1985) Eur. J . Biocheni. 147, 17-25, 47 Pilz. I . , Schwarz. E. and Palm. W . (1977) Eur. J . Biochem. 75. 195-199. 48 Gregory, L.. Davis, K . G . . Sheth. B.. Boyd, J . . Jelfcria, R . . Nave. C . and Burton. D . R . (1986) Mol. Immunol. 24. 821-829. 49 Pumphrey. R.S.H. (1986) Immunol. Today 7 , 174178. SO Sjodahl. J . (1977) Eur. J . Biochcni. 78. 471-490. 51 Recht. B.. Frangione. B.. Franklin. E . C . and Van Loghem. E. (1981) J . Immunol. 127. 917-923. 52 Reid, K.B.M. and Porter, R . R . (1981) Annu. Rev. Biocheni. 50. 433-364. 53 Reid. K.B.M. (1983) Biochem. Soc. Trans. 1 1 , 1-12. 54 Metzgcr. H. (1978) Contemp. Top. Mol. Immunol. 7. 119-152. 55 Hughes-Jones. N.C. and Gorick. B.D. (1982) Mol. Immunol. 19. 1105-1 112. 56 Perkins, S.J., Villiers, C.L., Arlaud. G.J.. Boyd, J . . Burton. D.R.. Colomh. M.G. and Dwek. R.A. (1984) J . Mol. Biol. 179. 547-557. 57 Perkins, S.J. (1985) Biocheni. J . 228. 13-76. 58 Poon. P . H . , Schumakcr. V.N.. Phillips. M.L. and Strang. C.J. (1983) J . Mol. B i d . 168. 563-577. 59 Brunhousc, R . and Cehra. J . J . (1970) Mol. Immunol. 16. YO7-01 I . 60 Lukas. T.J., Munoz. H . and Erikson. R . W . (1981) J . Inimunol. 127. 255-2560, 61 Isenman, D.E.. Dorrington. K.J. and Painter. R . H . (1975) J . Imniunol. 111. 172&1729. 62 Folkerd, E.J.. Gardner, B. a n d Hughes-Jones. N.C. (1980) Immunology 41, 179-185. 63 Circolo, A , . Battisto. P . and Borsos. T. (1985) Mol. Immunol. 22. 207-214. 64 Burton, D . R . . Gregory. L. and Jellcris. R . (1986) Monogr. Allergy 19. 7-35. 65 Medgyesi. G . A . . Fust. G . . Gcrgely. J . and Bazin. H . (1978) Immunocheniistry 15. 125-129. 66 Hughes-Jones. N.C.. Gorick, B . D . and Howard. J . C . (1983) Eur. J . Immunol. 13, 635. 67 Hughes-Jones. N.C. and Gorick. B.D. (1082) Mol. Immunol. 19. 110.5-1 112. 68 Dorrington, K.J. and Klein, M.H. (1982) Mol. Immunol. 19, 1215-1221. 69 Anderson, C.L. and Looney. R.J. (1986) Iinmunol. Today 7. 26J-266. 70 Partridge, L.J., Woof. J . M . , Jefferis. R . and Burton. D . R . (1986) Mol. Immunol. 23. 1365-1372, 71 Woof. J . M . , Partridge. L.J.. Jefferis. R . a n d Burton. D . R . (1986) Mol. Immunol. 23. 319-330. 72 Diamond. B . , Birshtein. B.K. and Scharfl. M.D. (1979) J . Exp. Mcd. 150. 721-726. 73 Morgan. E.L.. Hugli, T.E. and Weigle. W . O . (1982) Proc. Natl. Ac;id. Sci. USA 79. 5388-5391. 74 Jefferis. R.. Nik Jaafar. M.I. and Stcinitz. M. (19x3) Immunol. Lett. 7. 1Y1-194. 75 Tyler. B.M., Cowman, A.F., Gerondakis. S.D.. Adams. J.M. and Bernard. 0 . (1982) Proc. Natl. Acad. Sci. USA 79, 2008-2012. 76 B e a k , D . and Feinstein. A. (1976) 0 . Rev. Biophvs. 9 , 135-180. 77 Pumphrey. R.S.H. (1986) Immunol. Today 7. 20&2Il. 78 Koshland, M.E. (1985) Annu. Rev. Immunol. 3. 425-453. 79 Seno, M.. Kurokawa. T . , Ono. Y.. Onda, H . . Sasada. R . . Igarashi. K.. Kikuchi. M.. Sugino, Y . , Nishida. Y. and Honjo, T. (1983) Nucl. Acids Res. 11. 719-726. 80 Feinstein. A . and Richardson, N . E . (1981) Monogr. Allergy 17. 28-47. 81 Wright. J.F., Shulman, M.J.. Isenman. D . E . and Painter. R . H . (1986) Abstract 2.11.18. Sixth International Congress of Immunology.
49 82 Burton, D . R . . Boyd, J . , Brampton. A . . Easterbrook-Smith. S.B., Emanuel, E . J . , Novotny, J., Rademacher, T.W.. van Schravendijk, M.R.. Sternberg. M.J.E. and Dwek, R . A . (1980) Nature (Lond.) 288, 338-344. 83 Froese, A . and Paraskevas, F. (1983) in: Structure and Function o f Fc receptors (A. Froesc and F. Paraskevas, Eds.) Ch. I . Dekkcr, New York. NY. 84 Hoover, R . G . and Lynch, R . G . (1983) J . Immunol. 130, 521-523. 85 Rogers, J., Early, P., Carter, C . , Calame. K., Bond. M., Hood. L. and Wall, R . (1980) Cell 20, 303. 86 Wolfenstein-Todel, C.. Prelli, F., Frangione. B. and Franklin, E.C. (1973) Biochemistry 12. 5195-5197. 87 Munn, E . A . , Feinstein, A. and Munro, A.J. (1971) Nature (Lond.) 231. 527-529. 88 Dourmashkin, R . R . , Virella, G . and Parkhouse. R.M.E. (1971) J . Mol. Biol. 56. 207-208. 89 Mostov, K . E . , Friedlander. M . and Blobel. G . (1984) Nature (Lond.) 308, 37-43. 90 Pardo, A . G . , Lamm, M . E . , Plan, A . G . and Frangione, B . (1979) Mol. Iminunol. 16, 477-482. 91 Jefferis. R . (1981) Trends Biochem. Sci. 6. 1 11-113. 92 Blattner, F.R. and Tucker. P.W. (1984) Nature (Lond.) 307, 417-422. 93 Takashi, N.. Tetaert. D . , Dcbuire. B . . Lin. L . X . and Putnam, F.W. (1982) Proc. Natl. Acad. Sci. USA 79. 2850-2854. 94 Mellis, S.J. and Baenzinger, J.J. (1983) J . Biol. Chem. 258. 11557-11563. 95 Calvert, J . E . (1986) Immunol. Today 7. 13&137. 96 Barker, W.C.. Ketcham, L.K. and Dnyhot'f. M.O. (1980) J . Mol. Evol. 15. 113-127. 97 Slattcry. J . , Holowka, D . and Baird, B. (1985) Biochemistry 24, 781C7820. 98 Dorrington, K.J. and Bennich, H . H . (1978) Immunol. Rev. 41, 3-25. 99 Mctzger, H . , Rivnay. B.. Henkart. M.. Kanner. B.. Kinct. J.-P. and Perez-Montfort, R . (1984) Mol. Immunol. 21, 1167-1173. 100 Perez-Montfort. R . and Metzger. H . (1982) Mol. Immunol. 19. 1113-1125. 101 Liu, F.T., Albrandt, K . A . , Bry, C . G . and Ishizaka. T. (1984) Proc. Natl. Acad. Sci. USA 81, 5369. 102 Hamburger, R.N. (1975) Science 189, 389-390. 103 Stanworth, D . R . , Coleman. J.W. and Kahn. Z . (1984) Mol. Immunol. 21, 243-247. 104 Holowka. D . and Baird. B. (1983) Biochemistry 22. 3475-3484. 105 Burton, D.R. (1986) Immunol. Today 7. 165-167. 106 Ishizaka, K. (1983) in: Structure and Function of Fc receptors (A. Froese and F. Paraskevas, Eds.) Ch. 15, Dekkcr. New York, NY. 107 Delespesse. G . . Sarfati, M . and Rubio-Triyillo. M. (1986) Ahstract 2.63.17. Sixth International Congress of Immunology. 108 Rabourdin-Combe. C . , Neauport-Sautes. C. and Fridman. W.H. (1983) in: Structure and Function of Fc receptors (A. Froese and F. Paraskevas, Eds.) Ch. 14, Dekker, New York, NY. 109 Putnam. F. W . , Liu, Y . 3 . V . and Low. T.K. (1979) J . Biol. Chcm. 254, 286552873. 110 Yang. C.-Y.. Kratzin, H . . Gotz, H . end Hilschmann, N. (1979) Hoppe-Seyler's Z. Physiol. Chem. 360, 19 19-1 940. 111 Fougereau. M . . Corbett, S . , Ollier. P.. Kocca-Serra, J . . Roth. C., Schiff. C . , Somme, G . , Theze, J . and Tonnerre, C. (1985) Ann. Inst. Pasteur-lmniunol. 136C. 143-156. 112 Jones, P.T., Dear, P . H . , Foote. J . . Ncuherger, M.S. and Winter, G . (1986) Nature (Lond.) 321. 522-525. 113 Ellison, J.W.. Berson, B.J. and Hood, L.E. (1982) Nucl. Acids Rcs. 10. 4071-4079. 114 Ellison. J . and Hood, L. (1982) Proc. Natl. Acad. Sci. USA 79. 198.1-1988. 115 Ellison, J . . Buxbaum. J . and Hood, L. (1981) DNA I , 11-18. 116 Honjo. T.. Obata, M . . Yamawaki-Kataoka, Y . , Kataoka, T., Kawakami. T., Takahashi. N. and Mano. Y . (1979) Cell 18, 559-568. 117 Sikorav, J.-L., Auffraq, C . and Rougcon. F . (1980) Nucl. Acids Rcs. 8. 3143-3155. 118 Yamawaki-Kataoka, Y . , Kataoka, T . . Takahashi. N.. Obata. M. and Honjo. T. (1980) Nature (Lond.) 283. 786789. 119 Bernstein. K . E . , Alexander. C.B. and Mage, R . G . (1985) Inimunogenetics 18, 387-397.
50 120 Huck, S . . Fort, P.. Crawford, D . H . . Lefranc, M.-P. a n d Lefranc. G. (1986) Nucl. Acids Res. 14. 1779-1789. 121 Metzger. H.. Alcaraz. G.. Hohman, R.. Kinet. J.-P.. Pribluda, V. and Quarto. R . (1986) Annu. Rev. Immunol. 4. 419-470. 122 Padlan, E.A. and Davies. D.R. (1986) Mol. Immunol. 23. 1063-1075. 123 Van Loghem, E. (1986) Monogr. Allergy 19. 4 S 5 1 . 124 Moks. T., Abrahmsen. L.. Nilsson. B . . Hellman, U.. Sjoquist, J . and Uhlen, M. (1986) Eur. J. Biochem. 156, 637-643. 125 Baenziger. J. and Kornfeld, S . (1974) J. B i d . Chcm. 249. 7260-7269 and 727&7281. 126 Hayashida. H . , Miyata, T.. Yamawaki-Kataoka, V., Honjo. T.. Wels. J . and Blattner. F. (1984) E M B O J. 3, 2047-2053. 127 Hughes-Jones, N.C. and Gardner. B. (1978) Immunology 34. 459-463. 128 Poon, P.H., Phillips, M.L. and Schumaker. V.N. (1985) J . B i d . Chem. 260. 9357-9365. 129 Lewis, V.A.. Koch, T.. Plutner, H . and Mellman. I . (1986) Nature (Lond.) 324. 372-375. 130 Colman, P.M., Laver, W.G., Varghese, J.N., Baker. A.T. Tulloch. P.A.. Air. G.M. and Webster, R . G . (1987) Nature (Lond.) 326. 358-363.
51 CHAPTER 2
Genes encoding the immunoglobulin constant regions MARIANNE BRUGGEMANN
I . Introduction Antibody polypeptide chains are composed of domains with each domain consisting of roughly 110 amino acids (Chapter I : for a pictorial review see [ I ] ) . There is a single variable region domain i n both light and heavy chains. The constant region of the light chain is also composed of a single domain (C, or C,), whereas the heavy chain constant region has three or four domains. depending upon the class. Each domain, as well as the short hinge region, corresponds to a separate exon in the DNA. Constant region genes in mouse and human are located on three different chromosomes; the heavy chain C-region genes are in one cluster, whilst both C, and C, are located on separate chromosomes. A major difference exists between the expression of heavy and light chain genes. In onc B cell, C,, genes can be sequentially expressed but linked to the same variable region, whereas ;I light chain isotype is irreversibly expressed once it is productively rearranged. There are five antibody classes known i n both man and mouse (IgM, IgD, IgG, IgE, IgA); the class is determined by the C, region expressed ( p , 6, y , E or u ) without regard to the light chain. There are multiple genes for mouse and human y chains as well as for human a. I n addition pseudogenes have been found in the human immunoglobulin cluster.
2. Chromosomal localizatioti The chromosomal localization of immunoglobulin genes in several species is presented in Table 1 (see also Chapter 3). The chromosomal locations of immunoglobulin genes have mainly been identified either by the use of somatic cell hybrids or by in situ chromosome hybridization using labelled probes. The position on the chromosome has been obtained from banding patterns as well as from linkage analysis [2,3]. I n mouse, the IgH locus has been assigned to band Fl of chromosome 12 - in the vicinity of the prealbumin gene [4.5]: the K locus on chromosome
52 TABLE 1 Chromosomal localization of the immunoglobulin loci in man [200,201]. moube [202.5.203], rat [204,205.72] and rabbit [3]
Human Mouse Rat Rabhit
kH
IgK
14
-3
12
6
6
4 3
16
22 16 11 not known
6 has been found on the same arm as the gene for the p chain of the T cell receptor [6]. The location of the IgH locus in humans is at the distal end of the long arm of chromosome 14 at band q32.3 [2]. The gene for the T cell receptor a chain has also been assigned to chromosome 14 but near the centromere region [7]. The human K locus is on chromosome 2 although dispersed V, genes have been found on other chromosomes outside this locus and sequence data reveal that at least three of them are non-processed pseudogenes [8]. Comparison of the banding pattern of primate and rodent chromosomes shows that the patterns around the different immunoglobulin clusters are similar in the different species [3]. In some apes, the parts of the chromosome that carry the immunoglobulin genes are inverted or translocated when compared to the human counterparts; however, the banding patterns surrounding the clusters remain the same.
3. Organization of constant region genes The three immunoglobulin gene clusters found include V (variable) segments, D (diversity) segments (in the case of the heavy chain) and J (joining) segments upstream of the constant region genes. The number of functional C genes as well as the proportion of pseudogenes vary between species. All C genes that have been linked are found to have the same transcriptional orientation with respect to each other as well as to their respective J clusters. Not all members of a particular species analysed show the same organization of the c, locus; individuals are sometimes found that harbour duplications and deletions of particular genes. Thus, differences have been found when comparing the number of C genes amongst members of the same species (polymorphism). However, the organization of the loci presented here is true for most members of a particular species but will certainly not be correct for every single healthy individual.
3.1. Mouse heavy chain genes In the mouse, the IgH locus comprises eight CH genes on an approximately 200 kb region [9,10,11]. The JH cluster consists of four J segments and lies 6.5 kb upstream of C, with the D-Q52 segment located 0.7 kb upstream of J,1 [11,12]. The
53 Mouse DJ
tl
6
Y3
YI
Y2b
Y2a
E
lOkb
a
H
Fig. 1. IgH locus of human and mouse. Constant region genes are indicated by closed boxes. switch regions by stippled boxes. The switch regions S’ of human u l . E . and a2 are not precisely localized. I n addition J,, segments (vertical line with shorter lines for JIJ). the D-QS2 segment and areas that have not been overlapped (//) are indicated [ I 1 .~S,9~~.31.32.34.3S.40] (see also text).
(u,)
TABLE 2 Distances between mouse (9,lO.l I ] and human [31,32,33,34.3S.206,37] constant region genes Mouse J I I - 6.Skb -
/L
- 4.5kb - 6 - 5Skb - ~3 - 3Jkb
21 kb - 72b - 1Skb
-
~ 2 -a l4kb -
yl - 19kb - J l ~ -l 13kb - a1 - ?
-
$y - ?
-
yl
-
E
- 12kb -
LY
Human J,, - 8kb - p - 9kb - 6 - ? - 73 - 26kb
-
E
-
- y2 - 19kb - y4 - 23kb
- lOkb - ( ~ 2
map (Fig. 1) has been obtained from overlapping segments of BALBic mouse DNA cloned into A phage vectors [ l l ] . Distances are given in Table 2 and an essentially similar arrangement has been demonstrated for another inbred mouse strain (C57BLi6), although some length heterogeneity within introns, spacers and switch regions has been reported [13,11]. N o pseudogenes have been found in the C , cluster of BALBic mice but a duplication of the most 3’ C, gene has been identified in Japanese wild mice which resulted in the production of two closely linked y2a genes [14].
3.2. Mouse light chain genes There is only one copy of the C , gene in mouse and this is located about 3 k b downsteam of the J, cluster [15,16]. The K locus contains a few hundred V, genes [17] and five J, segments, one of which (J,3) appears to be non-functional as it carries an unusual splice site and has never been found to be expressed in protein (Fig. 2) [18,19]. The C, locus in mouse consists of four C, genes each of which is associated with a single J segment. The four C, genes are arranged in two pairs with only one V gene upstream of each pair (Fig. 2) [20,21,22,23,24]. It has been established by gene cloning and heteroduplex analysis that each C, is closely linked to a J, but the distance between the two pairs of C, genes is not known. CA4appears to be non-functional as it carries a splice site defect and antibodies of the A4 isotype have
54 1
2
3
J*
4
5
K
C
A
l
Fig. 2. Organization of the niouse K and A light chain loci [ 18.24.211. Constant region genes (C), J segments ( J ) and variable region genes ( V ) are given a s closcd boxes: A . polyadenylation signal; //. indicates that genes have not heen joined; .'. indicates genes with splicc site aberrations (pseudogenes) (for explanation see text).
not been observed [25]. The orientation of V, segments with respect to the C, genes has not been identified. Based on several VAl-C,, and v,2-c,,2 rearrangements, it has been argued that v,,1 might be located 5' of the J,3-CA3-J,l-C,, cluster and that V,2 might be 5' of the J,2-c,2-J,4-c,4 cluster [20]. Elliott et al. (1982) [26] have described a productive rearrangement of V,2 to J,3-CA3; this would be compatible with the data obtained by Blomberg and coworkers [20] if the CA3-C,, cluster is downstream of the CA2-C,, cluster. However, to date this has not been shown. The A locus of inbred mice is unusual by comparison to other immunoglobulin gene loci as it has a limited repertoire of only two V, genes. In other species which have multiple V, genes the immune response comprising A light chains seems to be much more heterogeneous [27].In outbred mice an amplification of A light chain genes has been found and these probably occur in blocks of closely linked C, genes as shown in Fig. 2. The number of V, genes, although still restricted, seems to be higher in outbred mice [28,29].
3.3. Hunzari heavy chain gcries The human C, gene family consists of at least nine functional genes and three pseudogenes. C,. C6, C,,, C,,, t,!Kel, CCyI. $C, C,,, C,,, C,, C,, are located on chromosome 14 (Fig. I , Tables 1 a n d 2) whereas $CEZ is found on chromosome 9 [29,30]. The organization of human C, genes differs from that of mouse; a duplication involving C,. C, and C,, genes has presumably occurred during evolution of the locus [31,32,33,34,35]. Two regions have not yet been overlapped: C,/C, and Ccrl/C,2.It is probable that the CcyI-Cy2spacer includes $C, [35,36]; evidence for the localization of the t,!K, pseudogene comes from Southern blots of DNA from individuals with C , gene deletions [37,38,39]. The other pseudogene, We,,has been located between C,, and C,, [40,41,42]. The Jl, cluster, 8 kb upstream of C,, consists of six functional J segments and three pseudo Js. A D segment is located within the J cluster, between $ J H l and J H 1 [31].
5s
3.4. Human light chain genes The structure of the K locus in man is similar to that described for the mouse (Fig. 2). A single C, gene is located about 3 kb downstream of the J, cluster [43,44]. Two major differences exist between the mouse and human loci: (1) fewer V, genes have been found in humans (estimated at around 50 [45,46]) and (2) there are four active J, segments (the equivalent to the mouse J,3 is missing). Human antibodies are associated with a diverse population of A light chains. The A locus displays a series of restriction fragment length polymorphisms which are readily detectable in normal individuals and it has been deduced from genomic hybridization that the number of A genes can be as few as six and as many as nine per haploid genome [27]. Since a similar polymorphism has been found in wild mice, this has led to the speculation that the A locus is subject to rapid variation within species [28,27]. Six clustered human C, genes have been identified over a SO kb stretch of DNA [47]. They are arranged at regular S kb intervals. The presence of conserved restriction sites around the C, copies suggests that multiple duplications of a basic S kb repeat unit has occurred during evolution. The first three of these clustered genes correspond to known. serologically defined A isotypes (see also Section 4.2.) and they are arranged as follows: S’-Mcg-KernpOz--KernpOz+-3’. The sequence of the other C, genes has not yet been completed but heteroduplex analysis and restriction enzyme mapping indicate that they have extensive homology to expressed C, genes [47]. In addition to the six linked C, genes, each of which is associated with a J, segment, three more C, genes have been identified which belong to the same linkage group, but these have not been overlapped [47,27,48,211]. Recently, Chang et al. (1986) isolated two more non-allelic C, genes, each with a single J, segment located 1.4 kb upstream of the C, [48]. Sequence analysis revealed that these two new C, should be functional, although they do not correspond to any known human A protein, and that they are closely related to each other (96% homology). In addition, a C, pseudogene has been described which contains several deletions and no J, segment [48]. A further C, pseudogene has been found which is located on a different chromosome from the rest of the A locus [49].
3.5. Other species Whilst the organization of human and, particularly, mouse immunoglobulin genes has been studied in great detail, information about other species is less complete [50].Antibody-like factors that have a molecular weight of 132000 have been described in star fish and it is notable that such factors in invertebrates display effector functions (such as complement fixation), that are similar to those shown by antibodies of higher vertebrates [ S 11. Nothing is known about the structure of the genes for these factors. 3.5.1. Heavy chain genes in other species
The organization of rabbit CH genes has been obtained from overlapping phage
56 and cosmid clones [52,53]. On a 100 kb stretch downstream of the J H cluster one C,, one C,, one C, and one C, gene have been identified. The layout of these genes is 5' 5,-8 kb-C,-55 kb-C,-12 kb-C,10 kb-C,, 3'. Apparently there is only one C, gene in the rabbit genome as judged from hybridization analysis [52].Previous data from the same laboratory showed two C, genes on different restriction fragments [54,55]. However, both genes have the same sequence and it was concluded that they represent different alleles as only one IgG subclass has been defined in rabbits by serological analysis [52]. A C8 gene could not be identified by cross-hybridization; however, IgD has been identified on rabbit lymphocytes and there might be a low degree of homology with the mouse probe used [52]. Interestingly, as many as ten C, genes have been found in the genome of both wildtype rabbits and of rabbits homozygous at the IgH locus; these C,, genes are apparently all located downstream of C, [56,52,53]. So far, seven distinct C,, genes have been isolated and two clusters of C, have been mapped: C,,-17 kb-C,,-13 kb-C,,11 kb-C,, and C,,-17 kb-CWi-l0 kb - Ca(,. It is, however, not yet clear whether the C, gene found 3' to C, is represented in one of the LY gene clusters, or whether it represents an eighth C, gene [53]. Four of these C,, genes have been found to yield heavy chain polypeptides in expression studies [S]. The order of the rat constant region genes has also been determined: 5' C,-C,-[C,,,, C,2a]-C,, - 14.5 kb-CY2,,-21 kb-C,10 kb-C, 3' [57]. The organization of these genes is strikingly similar to that of the mouse. No pseudogenes have been found in the rat cluster and, as in mouse, there are four C, genes; rat C,, and CYIare extremely homologous to each other and are most similar to mouse CYIwhilst the sequence of rat C,,, is similar to mouse y2dy2b [57,58].The fourth rat C, gene, Cyzc,shows strong cross-reactivity to rat CY1in hybridization studies. Thus, it has been deduced that there are three homologous rat C, genes which resemble the unique C,, gene in mouse and only one equivalent, rat C,,, to the mouse CY2,/C,, pair [57,58]. Indeed, the partial sequence of a rat Cyzcgene obtained from a cDNA clone reveals that it is most similar to rat C,,, however, it also shows extensive homology to mouse CY3[59]. Limited information is available about bovine IgH genes: two C, subclasses have been identified by serological analysis [60]. However. four different C, genes have been isolated from a genomic library and the sequences revealed that two of them contain unusual splice sites [61]. At present it is not clear whether any of the isolated C, genes are pseudogenes or whether the lack of correspondence between DNA and previously published protein sequences [62] reflects polymorphism. Other bovine immunoglobulin genes that have been described include JH-C, as well as 5' C,-C, 3': the distance between C, and C, is the same as in mouse [63]. The hamster JKC, region is very similar in organization to mouse [64]. However, whilst the hamster C,, including adjacent flanking region, is highly homologous to the mouse C, (between 70% and 90% depending on the domain), there is only moderate homology of the J, and S, region as judged by heteroduplex analysis [ 64). The chicken C, gene [6S] shows the same exon organization as mouse but the two have a low degree of homology in the coding region, ranging from 45% for
57 CH4 down to 18% for C,2; there is no obvious homology in the 3' untranslated region. The 3' terminus of an immunoglobulin cDNA from Xenopus laevis shows a similar degree of homology to both C, and C, chains of various species [66]. It is notable that the secretory terminus, found in the heavy chains of other species, is absent from this cDNA for A '. laevis C,; however, a possible splice site exists at the end of the last domain, suggesting that p chains might also be attached to the cell surface by a transmembrane portion [66]. The sequence of a cDNA for Xenopus laevis C, isolated by Schwager et al. [67] displays moderate homology to mouse C, (about 40% at the amino acid level) whilst V, J (60% to 70% conserved) and to a lesser extent D segments are more highly conserved. Characterization of immunoglobulin genes in lower vertebrates is very limited and an extensive study is only available for the shark. The IgH locus of this primitive elasmobranch displays features which are not found in immunoglobulin loci of higher vertebrates. The immune response in sharks is relatively restricted and there seems to be a lack of a secondary response as exemplified by the lack of somatic mutation and class switching [68]. A segmental organization involving mammalian-like V,, D and J, segments occurs in this species and the signals for V-D-J joining (heptamerinonamer) are identical to those in mammals. The sequence of the C genes resembles human C, (the homology to human C,1 is as high as 63% for the first 51 nucleotides of shark sequence presented), but in marked contrast to mammals the gene segments are organized in multiple units (-10 kb) of closely linked VH-D-JH-CH clusters. Switching from one C, region to another is therefore unlikely, the organization most resembling that found for light chain or T cell receptor genes [68].
3.5.2. Light chain genes in other species The K locus in rat closely resembles that of the mouse. A single C, exon is found 3 kb downstream of the J, cluster [167,69]. There is a marked difference between the rat and mouse J, clusters in that the rat cluster contains two additional J, segments that could have arisen by unequal cross-over [69,70] (see also Fig. 7). The A locus of the rat resembles that of the mouse, except that it consists of only a single pair of C, genes with a unique V, gene [71,72]. The two C, genes are located 3 kb apart with two J segments upstream of each C,. The order is J,2-ICrJ,2-CA2-$JA1a-$J,l b-C,, . The single V, gene has not been overlapped with the C, locus. Probably only J,2-CA2 is functional as the other J segment 5' of Ch2 ($J,2) lacks the heptamer recombination signal [72]. C,, is probably not used because of its defective J segments: t,hJ,la carries a mutated splice site whilst $J,lb has a poorly matching heptamer. This is consistent with the result of Gutman and coworkers [73] who have identified a functional CA2gene as well as two C,, pseudogenes from cDNA libraries. Nomenclature of the rat A genes is given according to their homology with the mouse genes. Two unlinked K chain loci, K1 and K2, have been found in homozygous rabbits [74]. Four major K1 alleles exist (b4, bS, b6 and b9) and the sequences of these genes reveal a high degree of divergence [62,74,75]. The analysis of the C,, locus,
58 which encodes the major isotype. shows that it is associated with five J, segments. However, in two different allelic forms of the C,, locus which have been analysed. only one or two of the J, segments are functional [76,77,74]. The b9 allele of C,, is only expressed in small amounts and this might be due to a short deletion in its enhancer region [74]. There are three J, segments in the C,, locus. In this C,, locus a deletion between the J,2 and J,4 segments (creating a 5,214 hybrid) probably accounts for the loss of two J, segments [74]. In rabbit K light chains extensive length heterogeneity has been found in the third hypervariable region which is partly attributable to heterogeneity in the length of rabbit V, segments although N sequences also play a role [78]. It is interesting to note that due to the polymorphism of the rabbit C, loci and the considerable sequence divergence between alleles, Southern blot analysis of DNA from domestic rabbits reveals multiple C,-hybridizing bands. This has led to an overestimation of the number of C, isotypes in earlier studies [75.77]. The number of C, genes in rabbits has been estimated at between five and eight as judged from Southern blots [79]. Recently, four distinct and unlinked C, genes have been isolated from a cosmid library and as n o overlap has been found between these genes it was concluded that they are located at least 15 kb apart [80]. In the chicken, a single C, gene is found about 2 kb downstream of a single J, segment [81]. This gene seems to account for all chicken A light chains. A phage clone containing the chicken A locus revealed a set of four V, segments closely linked to J,, where only the most J,-proximal V, (located 1.7 kb upstream of J,). is functional [81]. Upstream of V,1 as determined from phages spanning the entire A locus, is a set of 25 closely linked GV,, genes [82] but most rearrangements use V,1. In order to diversify the A light chain repertoire, this V,lJ,-C, gene seems to undergo extensive somatic mutations, probably involving the usage of the nonfunctional V, genes as donors in a somatic gene conversion-like process [83,81,82] (see also Fig. 7).
3.6. Switch regioris Immunoglobulin class switching involves a recombination whereby a VHDJ, segment changes its linkage from C, to another CH region. The event takes place in the vicinity of the switch (S) regions which are located 5' of the CH genes [85.86,87,88]. The S, region is composed of two kinds of 5 base pair simple tandem repeats. GAGCT and T G G G G , with the most frequent unit length being 20 base pairs (Table 3). The S regions apart from S, comprise tandemly arranged, highly repetitive sequences that arc homologous to S, but are interrupted by non-conserved stretches [89,90,91,92.~3,94,95,96].The lengths of the S regions (which are essentially defined by the number of repeats) vary from about 1 kb for mouse S, to 10 kb for mouse S,,; the distance between the S region and CH may also vary from 1 to 5 kb (Fig. 1) [96]. The basic units of the repeats are up to 52 nucleotides long and can be further subdivided into two elements of roughly 25 nucleotides [96]. The four S, regions are homologous to each other and arc based on 49 base
TABLE 3 Comparison of prevalent repeat sequence units of mouse S regions
S, GAGCTGAGCTGGGGTGAGCT S,, TPTGGGGACCAGGCTGGGCAGCTCYPGGGGAGCTGGGGTAGGT(T)GGGAP S,, TPTPGGPP(T)CCAGGCTGAGCAGCTACAGGGGAGCTGGGGYAPPTGGGAP SyZh TPTG(A)GGGACCAG(TorA)CCTAGCAGCTPTGGGGGAGCTGGGGA(AorT)GGTPGGAP S,,, NGTGGGGACCAGGCAGTACAGCTCTGGG(T)PGGG(P)NCAGG-CAG-TACAG(CTCT)G S, GGGCTGGGCTGAGCTGPGCTGAGCTGPGCTGAGCTGPPNT S, ATGAGCTGGGATGAGCTGAGCTAGGCTGGAATAGGCTGGGCTGGGCTGGTGTGGAGCTGGG~AGGCTGAGCTGAGCTGGA common sequences: (G)AGCT(G) and TGGG(G) P, purine; Y , pyrimidine; N , any nucleotidc; insertions or deletions shown in brackets Data taken from [98] and [9h].
wl W
60 pair repeats. In the case of SY3, the sequence of 44 repeats in tandem shows an average homology of 82% [97]. S,, and S , sequences have an additional unit of roughly 80 base pairs. In addition, multiples of two short common sequences have been found in all S regions: [(GAGCT),, TGGGG],,, (Table 3 ) . The number n ranges from 1 to 17 with the most frequent value being 3 , whilst m is up to a few hundred [95,96,98]. The actual site of switch recombination is usually located considerably 5’ of these highly repeated stretches and Marcu et al. (1982) have proposed that an additional consensus sequence (YAGGTTG) is located close to the point of switch recombination [98]. The switch sequences frequently repeat the first seven out of eight nucleotides of the genetic element Chi (GCTGGTGG) which has been shown to enhance recombination in prokaryotes [99,100,101]. In general. the number of Chi sequences seems to be higher than average in the immunoglobulin gene loci as compared to total eukaryotic DNA [ 1011. Chi-like sequences have been found preferentially at switch recombination sites and Kenter and Birshtein (1981) also observed a Chi sequence in the C,3 domain of a mouse C,,, gene which might have promoted the formation of a y2b-y2a hybrid immunoglobulin in a myeloma variant [ 1011. However, the assignment of any role to Chi-like sequences in immunoglobulin gene loci is speculative. By comparing other mouse S sequences to S,, one finds a decreasing order of homology: S, > S, > SY3 > (S,,,, Sy2b,SyZa). The order of S region homology does not seem to correlate with the quantity of the relevant immunoglobulin class in serum. However, there seems to be some correlation between S region length and the titer of serum immunoglobulin for the various subclasses. In BALBic mice, IgGl is the most abundant isotype (followed by IgG2a, IgG2b and IgA) and S,, is the longest switch region [96]. C57BLi6 mice have the highest IgG2b concentration followed by IgG1, IgG2a and IgA and that is in agreement with the order of S region length in this mouse strain (111. In both strains, S , is the shortest and IgE the least abundant immunoglobulin. The only constant region gene lacking obvious S sequences is C,. However, in mouse as well as in humans, a number of unusual sequences have been found in the region between C, and C,. Richards et al. (1983) [102] reported that in the mouse there is an open reading frame between the C,M exons and C,1 which could encode for a 146 amino acid protein related to immunoglobulin. The open reading frame is flanked by unique-sequence inverted repeats which extend into its putative coding region. There is also a sequence which is repeated twice in the region between the C,M exons and CB1 as well as being found within C, between the hinge and CH3 exons. In the mouse no S sequence homology has been found in the intron hetween C, and Cs but Milstein et al. (1984) [lo31 reported vestigial switch sequences in the equivalent region in humans which is also longer than in the mouse. It is accepted that in B cells p and 6 are coexpressed by differential processing of a common primary transcript [ 104,1051; nevertheless, cell lines producing secreted IgD have deleted C, and have brought C, into proximity with the rearranged VH gene. However, IgD secreting plasma cells are very rare in vivo [ 1061 and class switch with deletion of p sequences does not play a significant role
61
in membrane IgD expression. Nevertheless there might be a role for vestigial S regions in the production of serum IgD in humans as the level in humans, although quite low, is still higher than in mouse, where IgD is almost undetectable. Secreted IgD in humans might therefore be produced by cells that have switched from p to 6 although this remains unsubstantiated [103].
3.7. Membrune exons Each immunoglobulin class exists in two forms - as secreted and membrane-bound antibody. Membrane exons code for the transmembrane and cytoplasmic portion of membrane immunoglobulin and replace the secretory termini; the transmembrane portion itself consists of a stretch of hydrophobic amino acids [107. 108,109,110,111,112,113]. The structures of the individual membrane exons are outlined in Figs. 4 and 5 and Tables 4 and 5 . Two membrane exons have been identified for mouse p [ 1081 and they show a high degree of homology to human membrane exons (94,1031. The structures of the membrane exons of mouse and human 6 are similar to that of p [114,102,103,32]. In mouse, membrane 6 has two alternative polyadenylation sites yielding transcripts with either 300 nucleotides or 900 nucleotides of 3' untranslated region [104,114,1O2,115]. Apart from p and 6, extensive sequence information around the two membrane exons and flanking region has also been obtained for mouse 73 [116,117]. The 3' untranslated regions of the other y subclasses have not been fully sequenced but are known to be large [112] probably around 1.3 kb [118,119,120]. It is notable that the intron between the two membrane exons in C, is located between codons whereas all other introns in immunoglobulin genes separate the first and second base of a codon [121,122]. The (Y constant reTABLE 4 Mouse secretory termini of C,, genes and structure of membrane exons (given in base pairs) Secretory terminus: 20 codons P s 22 codons 2 codons Y E 8 codons a 20 codons
append to C,,4 in a separate exon append to C,,3 append to C,,4 append to C,,3
Structure of membrane exons:
IVS
E
- 1800 - 1200 - 1500 - 1700
a
-2500
P 6 Y
M1
IVS,l,
M2
3'UT
117 159 132 135 198
118 220 SO(k-800 80
6 6 81 81
-
-
270 -300. -900 1300 5 1350 -400. 1300. 1350
-
-
IVS, intervening sequence between the last C,, domain and the first membrane exon; IVS,,,. intervening sequence between the membrane exons; MI and M2, membrane exons; U T , untranslated region. For references see Fig. 4 and text.
62 1kb
base pairs
amino
I
I
97
121
-22 to -2
I
-1 to 40
I
81 41 to 67
920 68 to 137
Fig. 3. Organization of the inousc J chain gene. Exon structure is indicated by closed boxes, the untranslated region by the stippled box. (Data taken from Koshland. 1985 [ 1251.)
gion is the only heavy chain with a single membrane exon [123]. There are three alternative poly(A) signals yielding mRNAs with between 0.4 kb and 1.4 kb of 3' untranslated region (Fig. 4) [123].
3.8. ~rnmuriog~ohu~in J chain The J (joining) chain (reviewed by Koshland, 1975 and 1985 [124,125]) is a polypeptide chain of a molecular weight of about 15000. Unlike heavy and light chains, which contribute to all immunoglobulin molecules, the J chain is only attached covalently via disulphide bridges to the Fc portion of secreted IgM and IgA [126,127]. J chain associated with IgM or IgA shows a high affinity for the secretory component protein [ 1281 and it is therefore believed to be necessary for rapid transport through secretory epithelial cells into exocrine fluids [ 1291. The J chain gene has been assigned to chromosome 5 in the mouse [ 1301 and to chromosome 4 in humans 11311. Thus, it is not found in the vicinity of heavy or light chain genes. Also, unlike immunoglobulin genes, the J chain polypeptide is encoded by a single gene [130,132,133], which does not undergo rearrangement. J chain is a 137 residue polypeptide and the structure of the gene is shown in Fig. 3 [131]. From the analysis of secondary-structure profiles i t has been proposed that the J chain folds into a single immunoglobulin-like domain [ 1341. Comparing mouse and human J chain genes [132], one finds striking similarities of exon lengths and identical exoniintron boundaries. The nucleotide sequences show about 80% homology. There is n o apparent sequence homology between the J chain and immunoglobulin genes.
3.9. DNA motifs Alternating purine-pyrimidine stretches which could lead to the formation of Z DNA in vitro [135] have been found in the vicinity of immunoglobulin genes. They have been identified in the region between and 6 [102,103] in man and mouse as well as between the mouse C, hinge and C,3 exon. This has led to suggestions that these motifs might be implicated in p/6 transcription regulation as well as in the presumed exon deletion that has led to the absence of a C,2 exon in the mouse C6 gene [102,103,136]. Similarly, when the two human C , genes are compared, a 40 nucleotide stretch that consists of alternating purines and pyrimidines is found
TABLE 5 Comparison o f the amino acid sequence (shown in onc letter code [ 1651) of the inembranc portion of mouse IgH chains, starting with the first amino acid which distinguishes the membrane froiu thc secrcted form o f the heavy chain (cxtracellular. intraccllular and transmembrane segments are indicated) Extraccllular
EVNAEEEGFE IVNTIQHSCIMDEQSDSYMDLEEEN ELELNETCAEAQDGELD CLQLDETCAEAQDGELD CLDLDDICAEAKDGELD GLDLDDVCAEAQDGELD ELDLQDLCIEEVEGEELEE RQEPLSYVLLDQSQDILEEEAPGA Data taken from [117,122,123].
1 Ivdrophohic tr;tn\mcnibranc portion
In tracellular
NLWTTASTFIVLFLLSLFYSTTVTLF KVK GLWPTMCTFVALFLLTLLYSGFVTFI KVK GLWTTITIFISLFLLSVCYSASVTLF KVKWIFSSVVQVKQTAIPDYRNMIGQCA GLWTTITIFISLFLLSVCYSAAVTLF KVKWIFSSVVELK QTLVPEYKNMIGQAP GLWTTITIFISLFLLSVCYSASVTLF KVKWIFSSVVELKQKISPDYRNMIGQGA CLWTTITIFISLFLLSVCYSASVTLF KVKWIFSSVVELKQTISPDYRNMIGQCA
LWTSICVFITLFLLSVSYCATVTVL KVKWVLSTPMQDTPQTFQDYANILQTRA SLWPTTVTFLTLFLLSLFYSTALTVT TVRCPFGSKEVPQY
P 6
Y3 Y1 Y2b Y2a E
a
Membrane portion
64
557 nucleotides 3' of the polyadenylation signal. This region might have been involved in the gene conversion event which is proposed to have taken place during evolution of the C,, genes [137]. Another interesting sequence located upstream of mouse C, as well as of mouse C, consists of alternating purines. Coincidentally or not, (AG),, is found 5' of both genes: in c,, it is 389 nucleotides upstream of CHI and in cs it is 768 nucleotides upstream of an open reading frame between the membrane p exons and C,1 [117,102]. However, functional significance of these sequence motifs has not been demonstrated.
4. Structure of individual constant region genes An extensive collection of immunoglobulin sequences is provided by Kabat et al. (1987) [62]. The coding sequences of immunoglobulin genes are interrupted by intervening sequences and there are conserved residues at the various exon and intron boundaries which have been compiled by Mount (1982) [138]. Intervening sequences are spliced out such that the mRNA displays the correct assembly of exons as found in the protein after translation. As a rule, splicing takes place between the first and second base of the codon. Downstream of the termination codon, usually 100-300 nucleotides, a polyadenylation signal (AATAAA) is located and in mRNA a poly(A) tail is attached about 20 nucleotides 3' of this signal [139]. It has been suggested that additional sequences 3' of the polyadenylation site are essential for polyadenylation [ 1401. in particular a consensus sequence (YGTGTTYY) 30 nucleotides downstream of the AATAAA signal has been found in most mammalian genes [ 1411. 4.1. Heavy chain geries
Complete sequences for all mouse C, regions including membrane exons have been compiled by Gough and Cory (1986) [142]. Structural features of individual mouse as well as some human constant region genes are presented in Figs. 4, 5 and 6 and in Tables 4, 5 and 6. The p gene is the first C, gene to be expressed by developing B cells and consists of four domain-coding exons and two membrane exons [102,143, 114,144.145,109,108]; as shown in Table 6 the domains are of similar length. This structure is conserved in mouse and human p as well as in the other species described in Section 3.5.1. of this chapter. A different structure has been found for C, in human and mouse as illustrated in Figs. 4 and 5 and in Table 6. Mouse C, consists of only two domains (C,l and C,3 by homology considerations) and one rather long hinge exon. The C,2 exon is missing in both mouse and rat [146] but a suspected pseudodomain in mouse is located between C,hinge and C,3; this resembles C,3 as well as C,2. Therefore, it has been speculated that this pseudodomain might be a relict of a previously expressed C,2 exon that is now missing in rodents [ 102,1461. Unlike hinge exons in
65
1
h 2
Ezl+mw&
Y1
-----B-----.
1
1
Y2b
1
Y2a
1
E
a
h 2
h 2
D
3sA
3sA
h 2
2
M1
3sA
Y3
3sA
3
4SA
-
M2 (
A
*
R
M1
M2
A?
MI
M2
m
a
Mi
M2
A
m
u
n
e
u
A I
MIW
A? 0
YIY
1
h2
3 sA
Mf
A
AA
a
1 kb
H Fig. 4. Individual mouse heavy chain constant region genes and membrane exons. Numbers indicate the various exons given in striped boxes: h. hinge: s. secretory terminus; AC (adjacently coded) and X. additional putative exons for C,; A . polyadenylation signal. This for C,, was deduced from sequence homology to other C, genes [ 1181 and for C, was calculated from mRNA length [ 1221. both such putative sites are indicated with A?. The polyadenylation signal downstream of M2 for C,, and C,, has been determined by nuclease SI mapping [120, 114, 117, 112. 1231 (and see text).
y or (Y heavy chains, the 6 hinge lacks all cysteine residues which normally link the heavy chain dimer. A single linkage between the two heavy chains can be made by a cysteine residue in the carboxy terminal portion of the secreted molecule which - differing from other immunoglobulins - is encoded in a separate exon, C,s (or C,DC, distally coded) [143,147]. Immediately 3' of C,3 is a region (C,AC - adjacently coded) which was originally thought to be the 3' end of C83: however, this does not seem to be used to produce protein [147,115]. Yet another potential exon downstream of C,s and of the same length as C,s, designated 6X, can code for a hydrophilic carboxy terminus [ 1141 and has been found to be transcribed weakly in B cells [115]. However, in mouse the majority of secreted 6 chains consist of C,l-C&inge-C&C,s whilst membrane IgD consists of C,I-C,hinge-C,>Ml-M2. Major differences between mouse and human C, are two additional exons in humans: a second hinge exon and C,2 [32] (Fig. 5 and Table 6). As in mouse, there is no cysteine in the human C, hinge exon. Previously an assignment had been made for hinge region disulphide bridges based upon papain cleavage of IgD; however, the responsible cysteine residues are encoded in the C,l exon [32]. The structures of the four mouse C, genes (CY3 [117], C,, [148], CyZb [149,150,151], C,, [152,153,154]) are very similar to each other (Fig. 4 and Table 6). Apart from variability in the length of the hinge region exons (between 13 and
66 TABLE 6 Exon and intron length (numbers indicatc nucleotides) of mouse (BALBlc: p, E , a, y3, yl. y2b, y2a. 6) [145.122.111.117.148.150,l54.I02.l43] and human ( 6 . a l . ( ~ 2 y3. . y l . y2. y4. 6) [41,137.155. 156.33.157.321 CI, genes (note that for C, only a partial genomic sequence has becn published [207.94]). CHI
IVSl
Cl12
IVS2
Ci,3
IVS3
CIi4
poly(A)
p
31s
E
270 303 291 291 291 291
110 542 235 365 356 315 310
279 80 205 112 121 112 112
31X 324 393 32 1 32 1 32 1 32 1
107 78
393 3s I
98 107 107
339 324 297 330 32 I 330 330
103 78 30 72 71 72 72
309 309 309 294
207 214 214 388
86 222 222 97
324 327 327 32 1
83
330
108
I18
32 1 294 293 330
y2 y4
294 294 294
392 39 I 390
I18 118 I18
330 327 330
96
97 97
321 32 1 32 I
Mouse
CSl
IVSl
Cxhinge IVS2
C,3
6AC
IVS3
6s
IVS4
6X
6
303
376
105
999
321
90
-4800
66
420
66
Human
C,I
IVSl
C, hinge I
IVS2
c,
IVS3
c,2
IVS4
C,3
IVS5
6s
102
-2700
-700
324
-200
324
-1800
24
hinge
IVS2
Mouw
(Y
y3 yl y2b y2a Hum an €
a1
a2
y3 yl
6
303
-400
39 48 39 66 48*
99
63 24 186*’ (51. 45, 45, 4s)
45 36 36
27 27 I04
104 104 104
hinge2
72
* Indicates that the length of the hinge regions may vary between the different mouse strains and is for the C57BLlh y2a hinge exon 63 nucleotides. * * The human y3 hinge region is encoded in 4 exons as listed; all three IVS are 143 nucleotides long.
22 amino acids long) the length of the other three exons is conserved. A similar structure is found for the human C,,s (C, [155], C,, [156], Cy2 [33], C, [57]). Nevertheless, major differences are also found around the hinge exon [158] and in human C, the hinge region is encoded in four separate exons (Table 6 and Fig. 5 ) [36,155]. A discrepancy has been found between protein and nucleotide sequences concerning the presence of thc carboxyterminal lysine encoded by the last codon of CH3 in all y heavy chains. It has been suggested that this last residue has been missed in amino acid sequencing. Alternatively, the lysine may have been removed post-synthetically by an enzyme in the cytoplasm or serum, although this has not been demonstrated [ 149,1551. The C, gene, like the C, gene. is encoded in four exons; the structures of various C , genes are depicted in Figs. 4 and 6. By comparing the expressed C, gene in man to that in mouse, one finds only below average homology of CHI, c,2 and cH3, whilst C,4 is as well conserved as in other immunoglobulin genes [122]. This
67
- 6
Y3
1
hl
'
h2
2
3
S I I
M1 M2
0-l
h
1234
1kb
H
Fig. 5 . Structure of the human 8 and y3 constant region genes. Numbers indicate exons given in shaded boxes. h. hinge exon; s. secretory terminus: M. memhrane exons [32,1SS].
suggests that at least parts of C, are under weak selective pressure [122, 159,30,40,41]. However, the homology between the mouse and rat C, genes (80%) is similar to the homology shown for other immunoglobulin genes of the two species [160,57] although the first intron of the rat C, is considerably shorter than that of mouse and human. The additional sequence found in mouse but not in rat o r humans is repetitive in the genomc [ 1601. As in other immunoglobulins, the three C,, domains of the a heavy chain are encoded in separate exons (Fig. 4 and Table 6) [208,111,161,123]. However, all C,, hinge regions so far characterised are not encoded separately as in other hinge-containing antibodies but are encoded in a 5' extension of the C,,2 exon [ 11 1). Comparison of C,, sequences from different species reveals that the hinge region. unlikc other c,,domains, shows significant variation in length. Thus, the hinge rcgions of human a 1 and a 2 are 21 and 8 amino acids long, respectively, whilst the mouse a hinge is 13 amino acids long. Interestingly, hinge regions of the multiple C,, genes in rabbit also show striking length heterogeneity [56].
4.2. Light chain genes The two types of light chain constant region, C, and C,, are each encoded in a single exon of about 106 amino acids (mouse C, [162,18], mouse C, [163,164,24], human C , [43], human C, [47]). I n mouse, the two adjacent C, genes, Ch2 and C,,, share 70% homology whereas the second pair of C, genes, C,, and Ch3,shares 74% homology at the amino acid level. C, genes in humans form a rather large family [47]. Originally, A isotypes in humans have been defined by serology and correspond to single amino acid diffcrcnces. e.g. Kern+ light chains carry a glycine at position 154 whilst Oz~'isotypes have arginine at position 191. Thus, comparison of the amino acid sequences of four of the C, isotypes reveals a high degree of homology between them (about 95%) whilst a comparison between human and mouse C, genes reveals only 60 to 74%) homology [47.80]. Similarly, chicken and mouse A light chains are about 61% homologous [83]. Thus C, genes within a species show more homology to each other than between species. Comparison of the sequence o f the single mouse and human C, reveals only about 60% homology at the amino acid level [43,18]. However. a different situation exists in rabbit K chains which are encoded by multiple genes, as well as between rabbit C, alleles, where extensive divergence (22-33%) has been found [75].
68
Although both light chain isotypes fulfil the same task in combining with a heavy chain to form a functional antibody, only low homology exists between C, and C, genes - similar to that found between more distant members of the immunoglobulin gene superfamily [ 16S1166].
4.3. Polymorphism Dayhoff (1978) [16.5] presents an extensive study on inter- and intra-species homology. Thus human p and y chains are about 30% homologous which is slightly higher than the 2S% between heavy and light chains. The most extensive homology exists between y isotypes; in particular, for human C, this is as high as 9.5% [lSS]. Mouse C, genes share 6(b8.5% homology, with CyZaand C,, being the most closely related [1S8]. Additionally, the two C , genes in humans show a high degree of conservation, with over 90% homology at t h e nucleotide level, the differences being clustered at the end of c H 2 [ 1371. Low overall homology exists between the expressed human C, gene and the two human i,K, genes, as well as between the human and the mouse C, genes [40,30]. In general, it seems that C,1 is the most conserved domain between different antibodies and that the hinge is the most variable. Conserved structures of immunoglobulins include domain length and the folding pattern that is stabilized by disulphide linkage; however, comparison of the individual domains in one isotype with those in another reveals only moderate homology at the DNA level. For the CHI and C,3 regions of mouse C,, this homology is about 30%. Mouse C, and C , are about 40% homologous in amino acid sequence, a better overall match than the nucleotide sequences. Surprisingly, comparison of different y domains within an isotype gives a higher score at the DNA level than at the protein level. Comparing homologous genes in different species reveals that C, is the most conserved whereas C6 and C, are the least conserved [ 1221. In general, intron regions are less conserved than exons. An exception is found in the rat C, alleles where high conservation of both 5' and 3' flanking regions has been found (9 differences out of 854 base pairs of flanking region, i.e. 1.1% divergence between alleles) with less homology in the coding region (3.7% divergence i.e. 12 out of 318 nucleotides) [167,209]. Another unusual feature of rat C, alleles is that a disproportionately large number of the nucleotide differences between the alleles leads to differences in the amino acid sequence. The significance of these observations is not clear and they have not been found valid for other immunoglobulin genes, including rat CH genes [.57]. Allelic forms of different immunoglobulin isotypes were first detected serologically. Amongst mouse heavy chains. eight allotypic series - IgH-1, -2, -3, -4, -5, -6, -7 and -8 - have been defined for y2a, a , y2b, y l , 6, p, E and y3, respectively [168]. In some cases, serologically defined allotypic differences can be attributed to specific amino acid residues, and for the mouse C, gene a single amino acid difference determines the a or b allotype [169]. In contrast, the a and h alleles of the mouse y2a gene show extensive amino acid differences; these may have arisen
69 by the exchange of gene segments between related genes [170,154,153]. Wild mice frequently have characteristic combinations of IgH allotypic determinants and these combinations are termed haplotypes [ 1711. Allotypic markers for human yl. y 2 , y3, a2 and E heavy chains have been defined as G l m , G2m, G3m, A2m and Em (WHO meeting, 1976 [172]). The subclass heavy chain allotypes G l m , G2m, G3m and A2m are normally inherited in specific combinations. Lefranc et al. (1979) 11731 determined five major and four minor Gm-Am haplotypes in Tunisians and found different common haplotypes in Caucasoids and Negroids. Protein sequence comparisons demonstrate that there are only two amino acid differences between the G3m ( b ) and G3m ( a ) allotypes [155]. Restriction length polymorphism has been found for the Ca2 gene [174]; thus, independent identification of the A2m allelomorphs, which were previously distinguishable only by serology, has been established.
4.4. Pseudogenes A pseudogene is a gene that cannot make functional protein. Pseudogenes have been found in the human but not in the mouse IgH locus. Three non-allelic C, genes have been described in humans (Fig. 6); C, and $C,, in the heavy chain gene cluster and $CE2on chromosome 9 [41,40,159,30,29]. The number of C, genes in hominoids and related species such as Old World monkeys has been examined by Southern blot analysis. Comparison revealed that gorilla is more closely related to man than chimpanzee in respect of the number of C, genes 11751: only the gorilla and human genomes contain three C, genes - an active gene. a truncated and a processed pseudogene - whilst in chimpanzee and seven other species of monkeys the truncated C, is not present. In human , the first two coding domains have been deleted and replaced by a switch-like sequence. The CH3 and C,,4 domains correspond closely to those of the functional C, gene. Sequence homology starts at the 5' splice border of the CH3 exon [40]. Extensive 5' and 3' flanking region homology has been detected , sequence comparison and heteroduplex analysis suggest between C, and W Eand tnat after duplication K,, has undergone at least two 5' deletion events; one between the S region and CH3, such that C H I , CH2 and intervening sequences have been removed, and the other upstream of the S region. The 4CE2gene lacks all intervening sequences, the regions homologous to the four exons of C, are fused together as in mRNA and about 20 nucleotides downstream of the polyadenylation signal A-rich sequences are found. Thus, the structure of suggests that it was generated via a processed RNA intermediate. Sequences flanking 4CE2show some resemblance to retroviral long terminal repeats (LTRs) and it has been speculated that these elements might indeed be of retroviral origin and might have been involved in insertion of the processed gene into the chromosome [30]. The LTRlike sequences consist of 245 nucleotides located 5' and 164 nucleotides located 3' of the pseudo-coding region. Each unit contains both a TATA box and AATAAA-like sequences, has the same terminal inverted repeat ([TI,-[A],) and is flanked on the side opposite $CE2by the same short direct repeat (AGCT) [30].
w,,
€ € ~ ,!,I
70 However, unlike retroviral LTRs. the sequences flanking +Ct2do not constitute direct repeats. These LTR-like sequences are repetitive in the human genome as detected in Southern blotting but they are not homologous to the Alu family [30]. The (CEzgene shows about 80% homology to C, excluding a 26 base pair deletion. The 5' flanking region is not homologous to any V-D-J segment. However, (CEZ has an open reading frame which can encode a protein, different from C,, of 292 amino acids [30].The existence of such a protein is speculative. Another pseudogene, is probably also located within the human IgH locus. Such evidence is derived from Southern blot analysis of DNA from individuals having deletions of part of the IgH locus. However, (C, has not as yet been mapped on overlapping phageicosniid clones [35,36,37].This gene contains three constant domain exons and a single hinge exon which is related to the first hinge exon of Cy3. The sequence encoded by $C, does not correspond to any known human y protein; additionally. the splice signal at the 3' end of the hinge exon (ACT) does not correspond to the sequence G I G T found at the same position in other C, genes [36]. The immediate 5' flanking region of the $7 CH1 region lacks any apparent S region homology; however. two stretches of repetitive sequences not homologous to switch sequences have been identified in this region. C , is the only other human gene where such repetitive sequences have been found and they are located 5 kb upstream of the S region [ 3 5 ] . Three C, pseudogenes have been identified; one in mouse and two in human. Protein containing a C,, domain has not been discovered in mice. A two base pair deletion and a base substitution at the splice donor site of the J,4 segment has been observed when compared to the closely homologous J,1 (251. Miller and coworkers [25] argue that, even if this unconventional splice site were used, the deletion at the beginning of J,4 would result in a shortened, and possibly non-functional. mRNA. Alternatively, a possible splice site several nucleotides further downstream would result in termination in all reading frames. One of the two genes described in human contains three large deletions in the coding region as well as frameshift and point mutations. Apparently this ( C Agene also lacks an upstream J segment (481. The second @, gene in humans possesses similar features to (CE2. It is a processed pseudogene that is apparently located on a different chromosome from the rest of the A locus. The J and C region are fused together and about 20 nucleotides downstream of the polyadenylation signal a poly(A) tail is located. Further indication that it is a processed pseudogene is provided by the fact that the homology with other C, genes ends abruptly after the 3' untranslated region whilst 5' sequences contain recombination sequences essential for V-J joining. Several deletions and insertions alter C, such as to create termination codons. Interestingly, 5' and 3' of the gene there is a direct repeat of nine nucleotides which has led to the speculation that this (C, gene might have been processed by a virus
w,,
w,,
[@I. 4.5. Evolutiori Antibodies are encoded by a large number of structurally related genes which are
71 S
1
C
2
3
4
A
H H t .
LTR W
T
c 1
F
A
3
2 -
4
r
LTR
A
i
c
h
Fig. 6 . Structure of the three human C, genes. Numbers indicate the various exons given in open boxes. S, switch regions (shaded boxes) found in C, and K e ,c.: indicates a common sequence stretch (closed box) in C, and $Cc2;A , polyadenylation signal. $€, possesses , 3' A-rich sequences, and S' and 3' long terminal repeat-like sequences (LTR) as indicated schematically [40,30].
members of the immunoglobulin gene superfamily. The exoniintron structure of all immunoglobulin genes is generally similar and they have probably been generated by duplication of a primordial domain unit and subsequent multiplication and sequence divergence (reviewed by Hood et al., 1985 [176]; Tonegawa, 1986 [166]). From amino acid sequence comparison, the C,1 domain of p is found to be more related to the C,1 domain of y than to other C, or C, domains; suggesting that multiplication of a primordial gene encoding a single exon probably occurred prior to the divergence of C, and C, genes. Comparing the heavy chain genes in mammals reveals different patterns of y subclasses in the species so far examined (mouse, rat, rabbit and human). Mouse and rat have diverged rather recently, probably some 10 million years ago [16S]. Both species have four y isotypes and no pseudogenes are found in their strikingly similar IgH cluster [S7]. According to sequence homology, mouse y genes can be subdivided into three groups; CY3,C,, and C, with C,, and CyZbpresumably having arisen by duplication of an ancestral Cy2gene. The grouping according to sequence homology is different in the rat. There are certainly two or three very closely related C, genes (C,,, Cyz;,and possibly CY2,.) with the fourth rat C, gene (CyZh) on its own. A different situation again arises in humans, where four closely related C, genes are found which are not clustered but dispersed by a duplication involving a set of two C,, one C, and one C, gene [34]. Sequence comparisons of human C,, and human C, genes suggests that they have diverged from each other about 18 million years ago [16S]. The special case of human C,, which encodes four hinge exons, can be explained by quadruplication of an ancestral hinge exon, although the situation seems to be more complicated as C, shows homology to both C,, and K,, and domain transfer or gene conversion have been discussed [36,35]. In rabbit, only a single C, gene has been found (52). There is little information available about immunoglobulin genes and their organization in lower vertebrates. Sharks apparently have only IgM-like antibodies whilst amphibians have two classes of immunoglobulin, which correspond to 1gM and IgG [16S,SO]. A significant degrce of homology is found when small stretches of sequences of immunoglobulin from higher and lower vertebrates (e.g. xenopus
72 and mouse) are compared; these data suggest functional homology between these genes 167,681. All C, genes have a separate hinge exon and it has been speculated that the hinge is the remnant of an ancestral domain exon that was located between CH1 and CH2. Indeed, some similarity has been found between the y hinge and cH2 domain of p [177,153,111]. The hypothesis is supported by the finding of Kawakami et al. (1980) [145] that y C,2 and cH3 domains are most similar to p CH3 and C 4, domains, respectively. The a hinge region is encoded in the same exon as CH2 in both man and mouse and sequence homology to a splice junction has been found at the hinge-CH2 border within the C,,2 exon [111,142]. It should be noted that this sequence at the hinge-CH2 border is probably not a functional splice site and indeed its usage would lead to premature translation termination. It might, however, be the apparent remainder of an introdexon boundary of an ancestral C, gene [ l l l ] . The finding of unexpected allotype combinations in humans has led to the proposal that sequences can be exchanged between related genes [210,178]. Similarly, patchwise homology between mouse C, genes has led to the same conclusion; in particular, a model has been proposed that involves intervening sequence-mediated transfer [179,35] (reviewed by Honjo et al., 1981 1881). Two of the mechanisms (gene conversion and unequal cross-over) which could be involved in the evolution of immunoglobulin genes are illustrated in Fig. 7. If cross-over takes place, it might be possible to exchange domains as well as part of the adjacent introns. This could explain, for example, why CHI and part of the intervening sequence in mouse C,, and C,, are more homologous to each other than the other regions of the two genes [179,158]. Similarly, the sequence of Cy2,,and C,, genes in two different strains of mice, BALBic and C57BLi6, have been compared and the patchwise homology suggests a conversion of sequences between the allelic forms as well as between the two isotypes [170,154,153]. Comparison of the nucleotide sequence of the two C,, genes in humans suggests that gene conversion has played a role in their evolution such that there was a transfer of genetic information from the 3' end of the C,, gene to one of the Ca2alleles [137]. The concept of frequent intervening sequence-mediated gene transfer in the evolution of related genes is supported by investigations involving a mutant immunoglobulin where CH1 has been lost by recombination between S,, and the CH1-hinge intron [91]. However, recombination not only creates diversity within gene families but it can also explain amplification of genes, as found in the rat J, segments 1691 or human C, genes 1271, as well as gene deletions.
4.6. Aberrations and malignancies
In humans, aberrant DNA arrangements have been detected that either involve deletions within the heavy chain gene cluster or that reflect chromosomal translocations or gross rearrangements. Gene deletions, if homozygous, will lead to the lack of some isotypes in serum; however, this does not usually lead to pathological symptoms. A variety of large deletions within the human IgH locus have been de-
73
pairing
gene conversion
Fig. 7. Gene conversion versus unequal cross-ovcr. A model to explain variability and amplification within gene families [ 1991. Letters indicate different genes with upper and lower case representing different alleles.
scribed and at least one person in a hundred is heterozygous for some IgH deletion as judged by Southern blotting [39]. Two large deletions in the human IgH cluster have been used for mapping the gene order; they comprise C,,-W,C,-C,C, and ~!J€,,-C,,,-~,-C,-C, [39,180]. Individuals with deletions comprising only one of the constant region genes, y3, have also been described [181]. A wide spectrum of rearrangements in various tumors has been shown to involve chromosomes carrying heavy or light chain genes or even the heavy or light chain loci themselves whilst control tissue from the same patient does not show any rearrangements [182,183]. Chromosomal translocations involving heavy or light chain loci have been found in murine plasmacytomas and human Burkitt's lymphomas which represent different stages of B cell differentiation (reviewed by Rowley, 1982 "41; Yunis, 1983 [185]). Many of such translocations involve the c-myc proto-oncogene, c-myc being the cellular homologue of the avian myelocytomatosis virus transforming gene (v-myc). The c-myc gene is organized in three exons and is located on chromosome 15 in mouse and on chromosome 8 in hu-
74 TABLE 7 Chromosomal translocations observed i n lymphoid tumors which have becn shown to involve immunoglobulin loci Chromosomes involved in translocation
Disease
t(ll:14) or t(2:14) o r t(14:lX) t(8:14) o r t(14;18) t(8:IJ) or t(8:22) or t(2:X) t( 14;18) t( 14:18)
chronic lyrnphocytic lcukaemia acute lymphocytic leukacmia Burkitt's Ivmphoma follicular lymphoma T cell lvmphoma
( I n parts taken from [ 185.183,192.I95.1 W ] .) Oncogenes o r breakpoint regions which might be involved in the above translocations have been 10cated on the following chromosomes: X (c-rtiyc, and pvl-1); I I ( b d l ) :18 ( h d - 2 ) .
mans. It can translocate into the IgH cluster to yield t(12;15) translocations in mouse or t(8;14) in humans (reviewed by Cory, 1986 [186]; Klein, 1983 [187]); the translocations analysed to date always involve the excluded rather than the expressed allele. The chromosomal breakpoints have been analysed by gene cloning. The breakpoints in c-myc occur either upstream of the gene or in exon 1 or in the first intron. The c-myc translation initiation codon is located in exon 2 and these translocations do not therefore interrupt the c-myc protein coding sequence. The breakpoint in the IgH locus is normally within one of the switch regions. The translocation is roughly reciprocal. although a few or even a few hundred bases can be inserted or deleted at the joints [188,189]. Both reciprocal products are usually retained in the tumor cell. The translocation puts the c-myc and IgH genes in opposite transcriptional orientation [ 190). Analysis of variant translocations into the light chain loci established that all breakpoints are 5' of C,: for C, either within V, or between J, and C,, and for C, upstream of J,, 5' to a joined V,-J,, within V, or within C, (reviewed by Cory, 1986 [186]). Although there is no direct evidence that tumorigenesis is due to oncogene activation, oncogene translocations have been described in a number of malignancies (Table 7). A region on mouse chromosome 15 which is distinct from c-myc (denoted p v f -1 for plasmacytoma variant translocations) has been shown to yield translocations that always involve the C, locus [ 1911. Other translocations involving the human IgH locus at band 14q32 have been observed: in several chronic lymphocytic leukaemias the same region on chromosome 11, denoted bcl-1, has been found to have recombined into the JH cluster [192], a region on human chromosome 18, bcl-2, has recombined close to the 5' end of the JH cluster in several pre-B cell leukaemias and follicular lymphomas. T o date, no oncogenes have yet been identified in the bcl-1 and hcl-2 regions. Translocations involving these regions may well result from the same mechanism that promotes V-D-J joining [193,194]. Two rare cases of chronic lymphocytic leukaemia studied by Fell et al. (1986) revealed a translocation involving breakpoints 5' of C, and an as yet uncharacterised region on chromosome 2 different from the K locus [195]. Finally, most commonly found in human T cell tumors is an inversion of chromosome 14 or a translocation of parts of the long arm of chromosome 14 to an-
75 other chromosome [196]. Two reports describe that such an inversion brings IgH genes and T cell receptor a genes into proximity resulting in a transcribed hybrid gene consisting of V,-J,-C, [197,198].
A ckno w ledgem ents I thank L. Gilliland for helpful comments on the manuscript. I am also grateful to the many scientists who provided me with unpublished information - Drs. G . Gutman, K. Knight, C.P. Milstein, U. Pettersson, J . Schwager and D. Symons.
References 1 Pumphrey. R. (1986) Immunol. Today 7. 174-178.
2 3 4 5 6
7 8 9 10
I1 17 13 14 15
16 17 18 19
20 21 22 23 24 25 26 27
Human gene mapping. 7 (1983) Cytogenct. Cell Genet. 37. Medrano. L. and Dutrillaux. B. (1984) Adv. Cancer Res. 41. 323-367. Taylor. B.A.. Bayley. D.W.. Cherry. M.. Rihlet. R . and Weigert. M. (1975) Nature 256. 644646. Meo, T.. Johnson, J.. Beechey. C.V.. Andrcws. S.J., Peters. J. and Searle. A.G. (1980) Proc. Natl. Acad. Sci. USA 77. 55(&553. Caccia, N . . Kronenberg. M.. Saxe. D . . H a m . R.. Bruns. G.A.P.. Goverman, J . , Malissen, M.. Willard, H . , Yoshikai. Y.. Simon. M . . Hood. 1. and Mak, T.W. (1984) Cell 37. 1090-1099. Collins, M.K.L., Goodfellow. P.N.. Spurr. N . K . , Solomon. E.. Tanigawa, G.. Tonegawa, S . and Owen. M.J. (1985) Nature 314, 273-274. Lotscher. E . , Grzcschik, K.-H.. Bauer. H.G.. Pohlcnz. H.-D.. Straubinger. B. and Zachau. H . G . (1986) Nature 320. 456458. Roeder, W.. Maki, R.. Traunecker. A . and Toncgawa. S . (1981) Proc. Natl. Acad. Sci. USA 78. 474478. Shimizu. A , . Takahashi. N., Yamawaki-Kataoka. Y., Nishida. Y.. Kataoka. T. and Honjo. T. (1981) Nature 289, 149-153. Shimizu. A . . Takahashi. N., Yaoita, Y. and Honjo. T. (1982) Cell 28. 499-508. Sakano, H . , Kurosawa. Y . . Weigert, M . and Tonegawa. S . (1981) Nature 290. 562-565. Marcu, K.B.. Banerji. J . . Pcnncavage. N.A.. Lang. R. and Amheim. N. (1980) Cell 22. 187-196. Shimizu, A.. Hamaguchi. Y . . Yaoita. Y.. Moriwaki. K . . Kondo. K . and Honjo. T. (1982) Nature 298. 82-84. Max. E.E., Seidman, J.C. and Leder. P. (1979) Proc. Natl. Acad. Sci. USA 76. 345(!-3454. Sakano. H . . Hiippi. K.. Heinrich. G . and Toncgawa. S. (1979) Nature 280, 288-294. Cory, S.. Tyler, B.M. and Adams. J . M . (1981) J . Mol. Appl. Genet. 1. 103-106. Max. E.E.. Maizel, J . V . and Leder. P. (1981) J . B i d . Chem. 256. 511+5120. Huppi, K.. Jouvin-Marchc. E.. Scott. C.. Potter. M. and Weigert. M. (1985) Immunogenetics 21. 445-457. Blomberg. B.. Traunecker. A . . Eisen. H . ;ind Tonegawa. S. (1981) Proc. Natl. Acad. Sci. USA 78. 3765-3769. Miller, J . , Bothwell, A . and Storb, U . (19x1) Proc. Natl. Acad. Sci. USA 78. 3829-3833. Selsing, E.. Miller, J . , Wilson, R. and Storb. U . (1982) Proc. Natl. Acad. Sci. USA 79. 4681-4685. Scott, C.L. and Potter, M. (1983) Surv. Imniunol. Res. 2, 43-51. Alonso. A.. Hozumi. N. and Murialdo. tl. (1985) J . Imrnunol. 135. 614619. Miller, J . , Selsing, E. and Storb, U . (1982) Nature 295. 428-430. Elliott, B.W.. Eiscn, H.N. and Steiner, 1L.A. (1982) Nature 299. 5.59-561. Taub. R.A., Hollis, G.F.. Hieter, P . A . . Korsnieyer, S., Waldmann. T.A. and Leder. P. (1983) Nature 304. 172-174.
76 28 Scott, C.L.. Mushinski, J.F.. Hiippi, K.. Weigert, M. and Potter, M. (1982) Nature 300, 757-760. 29 Battey. J . , Max, E . E . . McBride, W . O . , Swan. D. and Leder, P. (1982) Proc. Natl. Acad. Sci. USA 79. 59565960. 30 Ueda, S., Nakai, S., Nishida. Y . , Hisajima, H . and Honjo, T. (1982) EMBO J. 1, 1539-1544. 31 Ravetch. J.V.. Sichenlist, U., Korsmeyer. S . . Waldmann, T. and Ledcr. P. (1981) Cell 27, 583-591. 32 White, M.B., Shen. A.L.. Word, C.J.. Tucker. P.W. and Blattner, F.R. (1985) Science 228, 73S737. 33 Ellison. J . and Hood. L. (1982) Proc. Natl. Acad. Sci. USA 79, 1984-1988. 34 Flanagan, J.G. and Rabbitts, T . H . (1982) Nature 300. 709-713. 35 Takahashi. N.. Ueda, S . , Obata, M., Nikaido. T.. Nakai. S. and Honjo. T. (1982) Cell 29, 671479. 36 Krawinkel, U . and Rabbitts, T . H . (1982) EMBO J. 1. 403-407. 37 Lefranc, M.-P., Lefranc, G . , d e Lange. G . , Out, T . A . , van den Broek, P.J., van Nieuwkoop, J.. Radl, J . , Helal, A.N., Chaabani, H.. Van Loghem, E. and Rabbitts. T.H. (1983) Mol. Biol. Med. 1, 207-217. 38 Bech-Hansen, N.T., Linsley, P.S. and Cox, D.W. (1983) Proc. Natl. Acad. Sci. USA 80, 69524956. 39 Migone. N.. Oliviero, S . , de Lange, G . , Delacroix. D . L . , Boschis, D . , Altruda, F., Silengo, L., DeMarchi, M. and Carbonara, A.O. (1984) Proc. Natl. Acad. Sci. USA 81, 5811-5815. 40 Max. E . E . , Battey, J . , Ney, R . . Kirsch, I . R . and Leder, P. (1982) Cell 29, 691-699. 41 Flanagan, J.G. and Rabbitts. T . H . (1982) EMBO J. 1, 655-660. 42 Hisajima, H.. Nishida, Y . , Nakai, S., Takahashi, N., Ueda, S . and Honjo, T. (1983) Proc. Natl. Acad. Sci. USA 80, 2995-2999. 43 Hieter, P.A., Max. E.E., Seidrnan, J . G . . Maizel, J.V.Jr. and Leder, P . ( 1980) Cell 22, 197-207. 44 Hieter, P . A . , Maizel, J.V. and Leder, P. (1982) J . Biol. Chem. 257, 151&1522. 45 Bentley, D.L. and Rabbitts, T . H . (1981) Cell 24, 613-623. 46 Klobeck, H.-G., Solomon, A . and Zachau, H.G. (1984) Nature 309, 73-76. 47 Hieter. P.A.. Hollis, G . F . , Korsmeyer. S.J., Waldmann, T . A . and Leder, P. (1981) Nature 294, 536-540. 48 Chang. H . , Dmitrovsky, E.. Hieter, P . A . , Mitchell, K., Leder, P.. Turoczi, L., Kirsch. I.R. and Hollis. G.F. (1986) J. Exp. Med. 163, 425-435. 49 Hollis. G . F . , Hieter, P.A.. McBride, O.W.. Swan. D. and Leder. P. (1982) Nature 296, 321-325. 50 Grey. H.M. (1969) Adv. Immunol. 10. 51-104. 51 Brillouet, C . , Leclerc, M.. Binaghi. R.A. and Luquet, G . (1984) Cell. Immunol. 84, 138-144. 52 Knight, K.L., Burnett, R.C. and McNicholas. J.M. (1985) J . Immunol. 134, 1245-1250. 53 Knight, K.L., Burnett, R.C. and Schneiderman, R . D . (1987) Cloning and in vitro expression of rabbit IgA heavy chain genes, in press. 54 Martens, C . L . , Moore, K.W.. Steinmetz, M . , Hood, L. and Knight. K.L. (1982) Proc. Natl. Acad. Sci. USA 79. 6018-6022. 55 Martens. C . L . , Currier, S.J. and Knight, K.L. (1984) J . Immunol. 133, 1022-1027. 56 Knight, K . L . , Martens, C . L . , Stoklosa, C.M. and Schneiderman, R . D . (1984) Nucl. Acids Res. 12, 1657-1 670. 57 Bruggemann. M., Free, J., Diamond, A , , Howard, J . , Cobbold, S. and Waldmann, H. (1986) Proc. Natl. Acad. Sci. USA 83. 6071-6075. 58 Brhggemann, M. (1987) Manuscript in preparation. 59 Bruggemann, M . , DelMastro GalfrC, P. and Calabi, F. (1987) unpublished results. 60 Milstein, C.P. and Feinstein, A . (1968) Biochem. J . 107, 550-564. 61 Symons, D . and Milstein, C.P. (1986) Bovine y genes. Pcrsonal communication. 62 Kabat. E . A . , Wu. T.T.. Reid-Miller. M . , Perry, H.M. and Gottesmann. K.S. (1987) Sequences of proteins of immunological interest. U .S. Department of Health and Human Services. Public Health Service, National Institutes of Health. Bethesda, M D , USA. 63 Knight, K.L. Personal communication. 64 McGuire, K.L., Duncan, W . R . and Tucker, P.W. (1985) Nucl. Acids Res. 13, 5611-5628. 65 Dahan. A . , Reynaud, C.-A. and Weill. J.-C. (1983) Nucl. Acids Res. 11, 5381-5389. 66 Brown, R.D., Arnientrout, R.W., Cochran. M.D.. Cappcllo. J . and Langerneier. S.O. (1981) Proc. Natl. Acad. Sci. USA 78. 1755-1759. 67 Schwager. J., Mikoryak, C . A . and Steiner. L.A. (1986) Personal communication.
77 68 Hinds. K . R . and Litman, G.W. (1986) Nature 320. 546549. 69 Sheppard, H.W. and Gutman. G . A . (1982) Cell 29, 121-127. 70 Burstein, Y . , Breiner. A.V., Brandt. C . R . . Milcarek. C . . Sweet. R.W., Warszawski. D . , Ziv. E. and Schechter, I. (1982) Proc. Natl. Acad. Sci. USA 79, 5993-5997. 71 Hcllman. L., Steen. M.-L. and Pettersson. U . (1985) Gene 40. 115-124. 72 Steen. M.-L., Hellman, L. and Pettersson, U. (1987) Gene, 55, 75-84. 73 Gutman. G . A . (1986) Personal communication. 74 Akimenko, M.-A., Mariame. B. and Rougeon. F. (1986) Proc. Natl. Acad. Sci. USA 83,518&5183. 75 Heidmann, 0. and Rougeon. F. (1982) Cell 28. 507-513. 76 Heidmann, 0. and Rougeon, F. (1983) Cell 34. 767-777. 77 Emorine. L., Dreher. K . , Kindt, T. and Max, E.E. (1983) Proc. Natl. Acad. Sci. USA 80, 5709-5713. 78 Heidmann. 0. and Rougeon. F. (1984) Nature 311. 7 4 7 6 . 79 Duvoisin. R.M.. Kocher. H . P . , Garcia. I . , Rougeon. F. and Jaton. J.-C. (1984) Eur. J. Immunol. 14. 379-382. 80 Duvoisin. R . M . , Heidmann. 0. and Jaton, J.-C. (1986) J . Immunol. 136. 4297-4302. 81 Reynaud. C.-A., Anquez, V., Dahan. A. and Weill. J . C . (1985) Cell 40. 283-291. 82 Reynaud, C.-A.. Anquez, V.. Grimal. H. and Weill. J.C. (1987) Cell 48, 379-388. 83 Reynaud. C . A . , Dahan. A. and Weil. J.C. (1983) Proc. Natl. Acad. Sci. USA 80. 4099-4103. 84 Honjo. T. and Kataoka. T. (1978) Proc. Natl. Acad. Sci. USA 75. 2140-2144. 8.5 Cory, S. and Adams. J.M. (1980) Cell 19, 37-51. 86 Rabbitts. T . H . . Forster. A , , Dunnick. W. and Bentley, D . L . (1080) Nature 283. 351-356. 87 Yaoita. Y. and Honjo. T. (1980) Nature 286, M(!-853. 88 Honjo, T.. Kataoka, T . , Yaoita. Y.. Shimizu. A.. Takahashi. N.. Yamawaki-Kataoka. Y . . Nikaido. T.. Nakai. S.. Obata, M . and Nishida. Y. (1981) Cold Spring Harbor Symp. Quant. Biol. 45. 913-923. 89 Davis. M.M.. Kim, S.K. and Hood. L.E. (1980) Science 209, 1360k1365. 90 Sakano, H.. Maki, R.. Kurosawa. Y . . Rocdcr, W. and Tonegawa. S. (1980) Nature 286, 676-683. 91 Dunnick. W.. Rabbitts, T . H . and Milstein, C. (1980) Nature 286, 669-675. 92 Ravetch, J . V . , Kirsch. I.R. and Leder. P. (19x0) Proc. Natl. Acad. Sci. USA 77. 6734-6738. 93 Takahashi, N., Kataoka. T. and Honjo, T. (1980) Gene 11. 117-127. 94 Rabbitts. T.H., Forster. A . and Milstein. C.P. (1981) Nuel. Acids Res. 9, 4509-4524. 95 Nikaido, T., Nakai, S. and Honjo. T . (1981) Nature 292. 845-848. 96 Nikaido, T . , Yamawaki-Kataoka, Y . and Honjo. T. (1982) J . B i d . Chem. 257, 7322-7329. 97 Szurek. P., Petrini. J . and Dunnick. W . (19x5) J . Immunol. 135. 620-626. 98 Stanton. L.W. and Marcu, K.B. (1982) Nucl. Acids Res. 10, 5993-6006. 99 Kataoka, T.. Miyata. T. and Honjo. T. (1981) Cell 23. 357-368. 100 Smith, G . R . . Kunes, S.M.. Schultz. D.W.. Taylor. A. and Trinan. K.L. (1981) Cell 24, 429-436. 101 Kenter, A . L . and Birshtein. B.K. (1981) Nature 293. 402-404. 102 Richards. J.E.. Gilliam, A.C., Shen. A.. Tucker. P.W. and Blattner, F.R. (1983) Nature 306, 483-487. 103 Milstein, C.P., Deverson. E . V . and Rabbitts, T . H . (1984) Nucl. Acids Res. 12. 6523-6535. 104 Maki. R., Roeder. W.. Traunecker. A . . Sidmnn, C.. Wabl. M.. Raschke. W . and Tonegawa, S . (1981) Cell 24, 353-365. 10.5 Knapp, M . R . , Lui, C.-P., Newell, N., Ward. R . B . , Tucker, P.W.. Strober. S. and Blattner, F . R . (1982) Proc. Natl. Acad. Sci. USA 79, 299&7100. 106 Bargellesi, A . , Corte, G., Cosulich, E. and Ferrarini. M. (1979) Eur. J . Immunol. 9. 490-492. 107 Alt, F.W., Bothwell. A.L.M., Knapp. M.. Siden, E . , Mather. E.. Koshland, M. and Baltimore, D. (1980) Cell 20. 293-301. 108 Early. P.. Rogers, J.. Davis, M., Calame, K.. Bond. M.. Wall, R. and Hood, L. (1980) Cell 20, 3 13-3 19. 109 Rogers, J.. Early, P., Carter, C., Calame, K., Bond, M . , Hood, L. and Wall, R . (1980) Cell 20. 303-312. 110 Liu, F.-T., Albrandt, K., Sutcliffe, J . G . and Katz. D . H . (1982) Proc. Natl. Acad. Sci. USA 79, 7852-7856.
111 Tucker. P.W., Slightom, J.L. and Blattner. F.R. (1981) Proc. Natl. Acad. Sci. USA 78, 7684-7688. 112 Tyler. B.M.. Cowman. A . F . , Adams. J.M. and Harris. A . W . (1981) Nature 293. 406-408. 113 Rogers. J . and Wall, R. (1984) Adv. Immunol. 35. 39-.59. 114 Cheng, H.-L., Blattner. F . R . . Fitzmaurice, L., Mushinski. J.F. and Tucker. P.W. (1982) Nature 296. 41k415. 115 Blattner, F.R. and Tucker, P.W. (1984) Nature 307, 417-422. 116 Komaromy, M., Clayton, L.. Rogers, J . . Robertson. S . . Kettman, J . and Wall, R. (1983) Nucl. Acids Res. 11. 6775-6785. 117 Wels. J . A . , Word, C . J . . Rimm. D., Der-Balan. C . P . , Martinez. H . M . , Tucker, P.W. and Blattner, F . R . (1984) EMBO J . 3 . 2041-2046. 118 Rogers, J.. Choi, E . , Souza. L.. Carter. C.. Word. C.. Kuehl. M., Eisenherg, D. and Wall, R . (1981) Cell 26, 19-27. 119 Yamawaki-Kataoka, Y.. Nakai. S . . Miyata. T. and Honjo. T. (1982) Proc. Natl. Acad. Sci. USA 79. 2623-2627. 120 Milcarek, C . and Hall, B. (1985) Mol. Cell. Biol. 5. 2.514-2520. 121 Sharp, P . A . (1981) Cell 23. 643-646. 122 Ishida, N.. Ueda, S., Hayashida. H . . Miyata. T. and Honjo. T. (1982) EMBO J . 1, 1117-1123. 123 Word. C.J., Mushinski, J.F. and Tucker. P.W. (1983) EMBO J . 2, 887-898. 124 Koshland, M.E. (1975) Adv. Immunol. 20. 4(k69. 125 Koshland, M.E. (1985) Annu. Rev. Imniunol. 3, 425-453. 126 Mestecky. J . and Schrohenloher. R . E . (1974) Nature 249. hS(k-652. 127 Mestecky, J . . Schrohenloher. R . E . . Kulhavy, R.. Wright, G.P. and Tomana. M. (1974) Proc. Natl. Acad. Sci. USA 71, 544548. 128 Brandtzaeg, P. and Prydz. H . (1984) Nature 311. 71-73. 129 Brandtzaeg, P. (1975) Immunology 29. 559-570. 130 Yagi. M.. D’Eustachio, P . . Ruddlc. F.H. and Koshland, M . E . (1982) J . Exp. Med. 155, 647-654. 131 Max, E.E.. McBride. O . W . . Morton. C . C . and Robinson. M.A. (1986) Proc. Natl. Acad. Sci. USA 83. 5592-5596. 132 Max, E.E. and Korsrneyer. S.J. (1985) J . Exp. Med. 161, 832-849. 133 Matsuuchi, L . , Cann, G . M . and Koshland. M.E. (1986) Proc. Natl. Acad. Sci. USA 83, 456460. 134 Zikan, J . . Novotny. J . . Trapanc. T.L.. Koshland, M.E.. Urry. D . W . . Bennett, J.C. and Mestecky, J . (1985) Proc. Natl. Acad. Sci. USA 82. 5905-5909. 135 Wang, A.H.-J., Quigley, G . J . . Kolpak. F.J.. Crawford. J . L . , Van Boom, J . H . . Van der Marel, G. and Rich. A . (1979) Nature 282. 680-686. 136 Rogers. J. (1983) Nature 305. 101-102. 137 Flanagan, J.G.. Lefranc. M.-P. and Rabhitts. T . H . (1984) Cell 36, 681-688. 138 Mount, S.M. (1982) Nucl. Acids Res. 10, 459-472. 139 Proudfood. N.J. and Brownlee, G . G . (1976) Nature 263, 21 1-214. 140 McDevitt. M . A . . Imperiale. M.J.. Ali, H. and Nevins. J . R . (1984) Cell 37, 993-999. 141 McLauchlan, J . . Gaffney. D . , Whitton. J.L. and Clements, J.B. (1985) Nucl. Acids Res. 13. 1347-1365. 142 Cough. N.M. and Cory, S . (1986) The murine immunoglobulin heavy chain constant region locus. in: Handbook of Experimental Immunology. Vol. 3, Genetics and Molecular Immunology (D.M. Weir. Ed.) Chapter 88, Blackwell Sci. Puhl., Oxford. 143 Tucker. P . W . . Liu. C.-P., Mushinski, J.F. and Blattner. F . R . (1980) Science 209. 1353-1359. 144 Kehry. M., Ewald. S . . Douglas. R . , Sibley. C.. Raschke. W.. Fambrough. D . and Hood, L. (1980) Cell 21. 393-406. 145 Kawakami, T., Takahashi, N. and Honjo, T. (1980) Nucl. Acids Res. 8. 3933-3945. 146 Sire, J.. Auffray. C. and Jordan. B.R. (1982) Gene 20. 377-386. 147 Dildrop. R . and Beyreuther. K. (1981) Nature 292. 61-63. 148 Honjo. T . , Ohata. M . , Yamawaki-Kataoka. Y . , Kataoka, T.. Kawakami. T., Takahashi. N . and Mano. Y . (1979) Cell 18. 559-568. 149 Tucker, P . W . , Marcu, K.B.. Slightom, J.L. and Blattner, F.R. (1979) Science 206, 1299-1303. 150 Tucker, P.W., Marcu, K.B., Richards. N.N. and Blattner, F.R. (1979) Science 206, 1303-1306.
79 151 Yamawaki-Kataoka, Y . . Kataoka, T . . Takahashi. N., Obata, M. and Honjo, T. (1980) Nature 283, 786789. 152 Sikorav. J.-L.. Auffray, C. and Rougeon. F. (1980) Nucl. Acids Res. 8, 3143-3155. 153 Yamawaki-Kataoka, Y.. Miyata. T. and Honjo. T. (1981) Nucl. Acids Res. 9, 1365-1380. 154 0110. R . , Auffray, C . , Morchamps. C. and Rougeon, F. (1981) Proc. Natl. Acad. Sci. USA 78, 2442-2446. 155 Huck, S . . Fort, P . , Crawford. D.H.. Lefranc. M.-P. and Lefranc. G. (1986) Nucl. Acids Res. 14, 1779-1789. 156 Ellison. J.W., Berson. B.J. and Hood, L.E. (1982) Nucl. Acids Res. 10, 4071-4079. 157 Ellison, J . , Buxbaum, J . and Hood. L. (1981) D N A 1. 11-18, 158 Hayashida. H . , Miyata. T.. Yamawaki-Kataoka. Y . . Honjo. T., Wels. J. and Blattner, F. (1984) EMBO J . 3. 2047-2053. 159 Nishida, Y . , Miki. T.. Hisajima. H . and Honjo. T. (1982) Proc. Natl. Acad. Sci. USA 79. 3833-3837. 160 Steen. M.-L., Hellman, L. and Pettersson. U . (1984) J . Mol. Biol. 177. 19-32. 161 Auffray, C., Nageotte, R.. Sikorav. J.-L.. Heidmann. 0. and Rougeon, F. (1981) Gene 13, 365-374. 162 Altenburger, W . , Neumaier. P.S.. Stcininetz. M. and Zachau, H . G . (1981) Nucl. Acids Res. 9, 971-981. 163 Bernard, 0..Hozumi, N. and Tonegawa. S. (1978) Cell 15. 1133-1144. 163 Bothwell. A.L.M.. Paskind. M.. Reth. M.. Imanishi-Kari, T., Rajewsky, K. and Baltimore, D . (1982) Nature 298. 38(&382. 165 Dayhoff. M . O . (1978) Atlas of Protein Sequence and Structure. National Biomedical Research Foundation, Washington. D.C. 166 Tonegawa, S . (1987) Chem. Scripta. 26. i n press. I67 Sheppard, H . W . and Gutman, G . A . ( I O X I ) Proc. Natl. Acad. Sci. USA 78. 70647068. 168 Green, M.C. (1979) Immunogenetics 8. 89-97. 169 Schreier, P . H . , Quester. S. and Bothwell. A . (1986) Nucl. Acids Res. 14, 2381-2389. 170 Schreier, P.H., Bothwell, A.L.M.. Mueller-Hill. B. and Baltimore, D. (1981) Proc. Natl. Acad. Sci. USA 78. 4495-4499. 171 Huang. C.-M., Parsons. M.. Wakeland. E . K . . Moriwaki, K. and Herzenberg, L.A. (1982) J . Immunol. 128, 661-667. 172 W . H . O . Review of the notation for the allotypic and related markers of human immunoglobulins. W.H.O. Meeting on Human Immunoglobulin Allotypic Markers. (1976) J . Immunogenet. 3. 357-362. 173 Lefranc. G.. De Lange. G . , Rivat. L.. Langaney, A , , Lefranc, M.-P.. Ellouze, F., Sfar, G., Sfar, M. and Van Loghem. E. (1979) Hum. Genet. 50. 199-211. 174 Lefranc. M.-P. and Rabbitts. T . H . (19x4) Nucl. Acids Res. 12, 1303-1311. 175 Uedo. S . , Takenaka. 0. and Honjo, T. (1985) Proc. Natl. Acad. Sci. USA 82, 3712-3715. 176 Hood, L., Kronenberg, M. and Hunkapiller, T. (1985) Cell 40, 225-229. 177 Sakano, H., Rogers, J.H.. Hiippi, K.. Brack. C.. Traunecker, A . , Maki, R., Wall. R . and Tonegawa. S. (1979) Nature 277. 627-631. 178 Lefranc, G., Lefranc, M.P.. Helal, A . N . . Boukef. K., Chaabani, H., Gandoura, M . S . and Van Loghern. E . (1982) J . Immunogenet. 9. 1-9. 175) Miyata. T., Yasunaga, T.. Yamawaki-Kataoka, Y., Obata, M. and Honjo, T. (1980) Proc. Natl. Acad. Sci. USA 77. 2143-2147. 180 Chaabani, H . , Bech-Hansen, N.T. and Cox, D . W . (1985) Am. J . Hum. Genet. 37, 11641171. 181 Lefranc, G., Dumitresco, S.-M.. Salier. J.-P., Rivat, L., D e Lange, G . , Van Loghem, E. and Loiselet, J . (1979) J . Irnmunogenet. 6 , 215-221. 182 Cleary, M . L . , Chao, J . , Warnkc. R. and Sklar, J . (1984) Proc. Natl. Acad. Sci. USA 81, 593-597. 183 Williams, D.L.. Look, A.T.. Melvin. S.L., Roberson, P.K., Dahl, G . , Flake, T. and Stass, S. (1984) Cell 36. 101-109. 184 Rowley. J.D. (1982) Science 216, 749-751. 185 Yunis. J . J . (1983) Science 221. 227-236. 186 Cory, S. (1986) Adv. Cancer Res. 47, 189-234.
187 188 189 190
Klein. G . (1983) Cell 32, 311-315. Neuberger. M.S. and Calabi, F. (1983) Naturc 305. 24C213. Gerondakis. S., Cory. S. and Adams. J.M. (1984) Cell 36. 973-982. Taub, R . , Kirsch. I . . Morton, C.. Lenoir, G . , Swan. D.. Tronick, S.. Aaronson, S. and Leder. P. (1982) Proc. Natl. Acad. Sci. USA 79. 7837-7841. 191 Cory. S.. Graham, M.. Webb. E.. Corcoran. L. and Adams, J.M. (1987) E M B O J . 4, 675-681. 192 Tsujimoto, Y . , Jaffe, E.. Cossman. J . , Gorham. J . . Nowell, P.C. and Croce, C.M. (1985) Science 315. 34G-343. 193 Tsujimoto. Y . , Gorham, J . , Cossman. J.. Jaffe, E . and Crocc. C.M. (1985) Science 229, 139C1393. 194 Cleary, M.L., Smith, S . D . and Sklar, J . (1986) Cell 47. 19-28. 195 Fell, H.P., Smith, R.G. and Tucker, P.W. (1986) Science 232, 491-494. 196 Zech, L . , Gahrton. G . , Hanimarstrom, L . , Julisson. G . . Mellstedt. H . . Robert, K.H. and Smith, C.I.E. (1984) Nature 308. 85%860. 197 Baer, R.. Chen, K.-C., Smith, S.D. and Rabbitts, T . H . (1985) Cell 43, 705-713. 198 Denny. C.T., Yoshikai, Y . . Mak. T.W.. Smith, S.D., Hollis. G.F. and Kirsch, I.R. (1986) Nature 320. 549-55 1. 199 Baltimore, D . (1981) Cell 24, 92-594. 200 Croce, C.M., Shander, M., Martinis, J . , Cicurel. L . , D’Ancona. G.G., Dolby, T.W. and Koprowski. H . (1979) Proc. Natl. Acad. Sci. USA 76. 34163419. 201 McBride. O.W., Hieter. P . A . , Hollis, G . F . . Swan, D . , Otey. M.C. and Leder, P. (1982) J . Exp. Med. 155. 148@1490. 202 Hengartner, H . . Meo, T. and Miiller, E . (1978) Proc. Natl. Acad. Sci. USA 75. 44944499, 203 D’Eustachio. P., Bothwell, A . L . M . . Takaro. T.. Baltimore. D . and Ruddle. F.M. (1981) J . Exp. Med. 153. 793-800. 204 Pear, W.S., Wahlstrom. G . . Szpirer, J . , Levan, G . . Klein. G . and Sumegi, J . (1986) Immunogenetics 23. 393-395. 205 Perlmann, C.. Sumegi. J., Szpirer, C.. Levan. G . and Klein, G. (1985) Immunogenetics 22, 97-100. 206 Lefranc, M.-P.. Lefranc. G . and Rabbitts, T . H . (1982) Nature 300, 76W762. 207 Takahashi. N., Nakai. S. and Honjo. T. (1980) Nucl. Acids Res. 24, 5983-5991. 208 Robinson, E . A . and Appella, E. (1980) Proc. Natl. Acad. Sci. USA 77. 4909-4913. 209 Frank. M.B., Besta. R.M., Baverstock. P . R . and Gutman. G . A . (1984) Biol. Evol. 1, 489-501. 210 Lefranc, M.-P.. Helal, A.N., D e Lange. G., Chaabani. H.. Van Loghem. E. and Lefranc, G . (1986) FEBS Lett. 196. 96102. 211 Udey. J . A . and Blomberg. B. (1987) Immunogenctics 25. 63-67.
F. Calabi and M.S. Ncubcl-ger (Eds.) M o l e c i h r - Giwivh
01 I~~i~nunoglobrrlirr
0 1987 Elaevicr Science Publishers B . V . (Biomedical Di\ision)
81 CHAPTER 3
Genes encoding the immunoglobulin variable regions PETER H. BRODEUR Department of Pathology, Tufts University School of Medicine. 136 Harrison A venue, Boston, MA 02111, USA
1. Introduction Studies of antibody structure have shown that the great diversity of antigen combining sites is due to the highly variable amino-terminal protein sequences of both light and heavy chain polypeptides. The observation that antibody polypeptide sequences have variable and constant regions presented geneticists with a parodox: how did evolution introduce such sequence diversity in the variable region while keeping the constant region free from mutations? Such considerations led Dreyer and Bennett [l] to propose, in 1965, the radical hypothesis that each antibody polypeptide is encoded by two genes - a variable region gene (V gene) and a constant region gene (C gene). The model proposed that, during the differentiation of an individual antibody forming cell, one of a number of V genes would become associated with a single C gene, either at the DNA, RNA or protein level. Direct evidence that the Dreyer and Bennett model was essentially correct was not available until the mid-seventies, when it was shown by hybridization kinetics that there was, in fact, a single copy of the murine C, gene [ 2 , 3 ] .The discovery of restriction endonucleases allowed Hozumi and Tonegawa [4] to demonstrate that V and C genes are not contiguous in germline (cmbryo) DNA but are joined to form a contiguous polynucleotide stretch in a differentiated lymphocyte (plasmacytoma). In the past ten years, the availability of recombinant DNA techniques has resulted in a tremendous wealth of information regarding the genetic structure and organization of immunoglobulin genes. This chapter will focus on the structure of the genes coding for the antibody variable regions, the number and organization of these genes, and the diversity of V genes within the germline of an individual or species.
2. V gene structure The ingenious hypothesis of Dreyer and Bennett, while anticipating the non-contiguous organization of eukaryotic genes. nevertheless underestimated the com-
82 plexity of immunoglobulin gene construction. The classical variable region of light chains, the amino-terminal 108 residues, is in fact encoded by two gene segments: a V, (variable light) segment coding for the amino-terminal 95 residues and a small J, (joining) segment encoding 13 residues (96-108) which make up the carboxyterminal portion of the variable region. The variable region o f the heavy chain adds an additional level of complexity. The classically defined variable region of the heavy chain is encoded by three gene segments: a VH (variable heavy) segment which codes for the amino-terminal 98-100 amino acids; a D (diversity) segment which contributes between 1 and 17 amino acids and a J H segment which codes for between 16 and 21 amino acids and makes up the carboxy-terminal portion of the V,, region 151. The variable regions of both light and heavy chains contain three 'hypervariable' or 'complementarity determining regions' (CDRs). Each CDR is fanked by less variable 'framework regions' (FR). Kabat's [6] original prediction that CDRs contain residues which make contact with determinants of the antigen has now been verified by several X-ray diffraction studies (reviewed in [ 7 ] ) Fig. . 1 shows the contribution of each gene segment to the variable region of light (V,J,) and heavy (VHDJH) chain polypeptides. The J, segment makes up part of CDR3 and all of FR4 of the light chain. The heavy chain CDR3 is encoded by the D gene segment and part of the J,, segment. While the extensive sequence diversity observed for I
Fig. 1. Contribution of gene segments to immunoglobulin variable regions. A . Relationship of the V , and J , ~gene segments to the variable region of light chains. B . Relationship of V l l . D and J , , gene segments to the variable region 0 1 heavy chains. Framework ( F R ) and complementarity determining regions (CDR's) are based on Kabat et 211. [ 3 S ] . See text for details.
83 CDR3 regions is readily explained by the assortment of gene segments and by junctional diversification, the genetic basis of C D R l and CDR2 diversity appcars to be the product of evolutionary processes and somatic point mutations. Although each variable region is encoded by two or three distinct gene segments, the exons which code for the amino-terminal95 to 100 residues of light and heavy chains are generally referred to as V, or V, genes, respectively. Variable region genes have a rather simple structure which is highly conserved between heavy and light chains, as well as between species. These genes always consist of two exons, which roughly correspond to two functional domains. The leader, or signal peptide, is encoded by the L exon. while the V exon codes for the V region itself. The signal peptide, which is approximately 20 amino acids in length, provides a hydrophobic amino-terminus necessary for transport of the nascent polypeptide into the endoplasmic reticulum [8]. where the signal peptide is cleaved off. The two exons are separated by a small intron which varies from about 80 to 300 nucleotides in length. This intron nearly always interrupts codon -5 of the signal peptide, codon 1 being the first amino acid of the mature (cleaved) polypeptide. Although the length of the signal peptide-coding block is variable, the length of the L exon, which includes the 5’ untranslated region, is remarkably conserved. Kelley et al. [9] noted L exon lengths of 7822 nucleotides among V, and V, genes and suggested that evolutionary constraints were operating at some level of gene expression. In addition, 10 of 11 V gene 5’ sequences examined had putative promoters (Hogness or ‘TATA’ boxes [ 101) located in regions consistent with an evolutionarily important conservation of L exon length. It should be noted that several more recently sequenced 5‘ flanking regions of germline V, genes [11,12] have TATA boxes located approximately 50 nucleotides upstream from the ‘conserved’ site noted by Kelley et al. [9]. Careful analysis of transcription initiation sites will be necessary to determine the range of permissible L exon length. A more striking 5’ consensus sequence has recently been reported by Parslow et al. [13] and Falkner and Zachau [14]. These authors have described a highly conserved octanucleotide block situated approximately 70 base pairs upstream from the initiation site of V gene sequences. Eight mouse V, genes. the two mouse V, genes, and three human V, genes, all share the octanucleotide ATTTGCAT. At this same 5’ position, six mouse V, genes have the precise inverse (ATGCAAAT) of the octanucleotide block. suggesting a possible role in regulation of light and heavy gene expression. Indeed, recent studies indicate that the octanucleotide sequence motif forms part of the binding site for a nuclear protein [15,16]. Despite the diversity of V genes required to ensure a broad combining site repertoire, these genes must maintain certain common features which are critical for their expression. For example, certain amino acids are invariant and are presumed to be indispensable for proper immunoglobulin structure [6]. The most highly conserved flanking sequences are the 3‘ heptamerinonamer consensus sequences which are believed to be the recognition elements for the joining of V, to J, or V,, to D and D to J, [17-191. Fig. 2 diagrams a typical V gene. The length of DNA from the 5‘ octanucleotide [13] to the 3‘ heptamerinonamer signal varies from 580 to 790 base pairs, most of the variation being due to the length of the intron.
84 580-790bp -150 bp
100-300bp
CACAGTG
/ -
I ’.,
‘
ATTTGCAT TATA“ ATGCAAAT
L Exon (-78 bp)
9’
I
COD ON^
’
V Exon
~CAAAAAEC
(- 294 bp)
Fig. 2 . V gcnc structure. The S’octanucleotide sequences 5’-ATTTGCAT-3‘ and S’-ATGCAAAT-3’ arc for V, and V , , gencs. respectively [ 13.141. The 3’ heptamcr/nonamer scquenccs given are for inousc v, (461.
The germline order of all immunoglobulin gene segments is not known for certain. However, the available evidence has led to a widely held assumption that the general organization is 5’-V,-J,,-CL-3’ for light chain genes and 5’-VH-D-J,-C,-3’ for heavy chain genes although the location of the germline mouse V, segments with respect to the C, exon is unclear (see Section 6.2.). The organization of these sets of genes will be discussed in detail below.
3. Gene families The first hybridization studies using V, cDNA probes revealed multiple, related sequences within the mouse genome [20]. The sequences detected by such probes were referred to as families of V genes. It is likely that the term ‘family’ was chosen to distinguish these sets of cross-hybridizing DNA sequences from V region subgroups [6] and V region isotypes 1211, previous classifications which were based only on amino acid sequence similarities within framework 1 (amino-terminal 23 residues). It is important to emphasize that both protein sequence and DNA hybridization-based classifications are somewhat arbitrary. For example, a difference of three or more FR1 amino acids was chosen to define protein sequence groups [21], while Southern blot hybridization experiments are dependent on salt cencentration and temperature, as well as the efficiency of DNA transfer, electrophoretic resolution, probe specific-activity, etc. Nevertheless, t h e accumulated protein sequence. nucleic acid sequence and hybridization data are sufficient to provide a reasonable picture of V gene families in both the mouse and human genomes. It should be appreciated that the usefulness of defining homologous sets of V genes is not the ability to unambiguously classify each germline V segment, but rather, to provide a tool to facilitate study of the size, genetic organization, polymorphism, evolution. and expression of the entire V gene repertoire.
85 3. I . Mouse V , jamilicJs
Southern blot analysis using the first cDNA probes that contained V, sequences revealed multiple VH sequence bearing restriction fragments in the mouse genome [22,23] as had been previously found using V, probes [ 2 0 ] .Cory and Adams [24] compared genomic Southern blots using heavy chain cDNA probes (containing V, sequences) cloned from two different myelomas. HPC76 and S107. The V,PC76 probe hybridized to six restriction fragments in BALBic embryo DNA, while the V,,S107 probe hybridized to a non-overlapping set of four fragments. Kemp et al. [25] demonstrated at least one additional distinct set of V, nucleotide sequences and argued from a compilation of V , , sequence data that the mouse 1gH locus might contain as many as ten V, gene families. In an attempt to extend and complete the emerging picture of V,, gene families, an extensive Southern blot analysis of 18 inbred strains was made using 24 V,, gene probes [26]. In this study Brodeur and Riblet, taking care to use probes which represented most of the V,, groups defined by amino-terminal amino acid sequences [21], found that the 24 V, genes defined seven non-overlapping V, gene families. It was determined that members of ;I particular V,, family had more than 80%’nucleotide sequence identity, while members of different families generally had less than 70% identity. Indeed, sequencc comparisons between families often revealed nucleotide identities below 60% [2 6 \, With probes representing each of the seven V,, gene families. RNA samples from 20 previously unanalyzed myelomas (from the NZB mouse strain) were examined by RNA dot blotting. Nineteen of the 20 myelomas expressed RNA which hybridized to only one of the seven V, family probes. One myeloma. NZPC3609, contained heavy chain mRNA which did not hybridize t o probes representing known V, sequences. Partial RNA sequencing [27] and Southern blot analysis using the cloned NZPC3609 V, gene confirmed that it is a member of a previously unidentified eighth V,, gene family. Recently, a ninth V, family, V,,GAM3-8, was identified by Winter et al. [28] by sequencing V,,DJ, rearrangements isolated from a genomic phage library constructed from lipopolysaccharide-stimulated B cells. There are, therefore. nine identified mouse V, gene families which have nucleotide sequence identities of approximately 80% or greater within each family. Table 1 summarizes these nine families of mouse V, genes and lists the corresponding group numbers recently proposed by Dildrop [29,3O]. This recent classification is based on protein sequence homology of the entire VH region and, not surprisingly, corresponds perfectly with VH gene families based either indirectly (hybridization studies) or directly on nucleic acid sequence homologies. Table 1 also lists the ‘classical’ V, subgroup designations of Kabat et al. [35] based on amino-terminal (FR1) amino acid sequence comparisons. Members of Kabat’s subgroup I are encoded by genes belonging to V, gene families VHQ52N and VH36-60, while members of subgroup 111 are encoded by members of four V, gene families, V,7183, vHs107, VHX24 and V,J606. Subgroups I1 and V are encoded by the vHJ558 gene family. These mouse V, subgroups obviously do not faithfully
86 TABLE 1 Mouse V,, gene tamilics Gene family'
V,,JSSH V,,QS2N V,,36-60 V,,X23 V,,7183 VllJ606 V,,S107 V,,3609 V,,GAM3-8
'
Complexity''
hO 1s
5 2 12 10
4 15
5
Corresponding protein sequence classification group'
subgroup"
1 2 3 .1 5 6 7 8 9
1I.V I I 111 Ill 111 I11 __ __
Ref
1261 [261
PI1 [321 P61
[33] ~ 4 1 12x1 [2Sl
G e n c family, as dclincd in Brodcur and Rihlet [2h]. Complexity. cstimated number of V,, gene sequences haaed on the number o f hybridizing restriction fragments resolved o n Southern blots. Group, as defined by Dildrop [29]. Subgroup, original classification of V,, protein sequences by Kabat et al. [ 3 5 ] .
predict the entire V, region homology at the protein or nucleotide sequence level. Are there additional V, gene families yet to be identified within the mouse genome? Given the wealth of amino acid and nucleic acid sequence data now available, it seems reasonable to assume that most V, gene families have been identified. Indeed, Dildrop et al. [36] examined RNA from 54 randomly selected lipopolysaccharide blast hybridomas and found that 5 1 of these expressed immunoglobulin mRNA which hybridized to a representative probe for one of the nine VH gene families. Therefore, unless plasmacytomas and hybridomas do not represent the entire germline repertoire, there should be few, if any, unidentified sets of VH gene sequences in the mouse. I t should be kept in mind, however, that V, gene families represent a classification imposed upon a very large and evolutionarily complex locus, and it is almost inevitable that V, sequences will be identified which do not neatly fit into a single family. 3.2. Human VH families
Rabbitts et al. [37] first demonstrated that a mouse VH gene cross-hybridized to a set of human genomic V, sequences, an observation leading to the isolation of several human VH genes from human fetal liver DNA. The cloned human V, genes encoded members of the protein sequence subgroup 111, one of three subgroups of human VH regions defined by Kabat et al. [ 3 5 ] .More recently, human V, genes encoding a VH subgroup I member [38] and VH subgroup 11 member [39] have been cloned. Kodaira et al. [40] have shown that VHI, VHII and V,III probes hybridize to distinct sets of restriction fragments on Southern blots. In addition, these authors found that three different V,I family probes hybridized to essentially the same
87 set of fragments and, as found with mouse V, family probes [26], the relative intensities of the hybridizing fragments varied. These results have been used to argue that the classic Kabat human V, subgroups [35] correspond to gene sequence homologies detected by nucleic acid hybridization studies [40]. Whether the three gene families identified by VH probes and corresponding to the three V, protein subgroups represent the entire human VEllocus remains unclear. Given the poor correlation of the five V, subgroups [35] with the nine V, gene families of the mouse (Table l ) , caution should be exercised when equating human protein sequence subgroups with human V, gene families. Comparison of complete (rather than amino-terminal) amino acid and/or nucleotide sequences will be useful. Southern blot analysis of human DNA using probes from the nine mouse V, gene families may also provide insights into t h e extent of germline V, diversity in the human. In fact, preliminary hybridization studies (Seth Pincus, personal communication) suggest the existence of a fourth human V,, family homologous to the mouse V,36-60 gene family [31]. 3.3. Mouse V , fumilies
The amino-terminal amino acid sequences of mouse K chains are remarkably diverse. Potter initially classified V, chains by comparing peptide sequences up to t h e invariant cysteine at position 23 [21). An isotype number was assigned to any sequence which differed by three or more residues, resulting in 26 V, isotypes (V,1 to V,26). More recently, the availability of additional sequence data permitted Potter et al. [41] to refine the classification using sequences through the first invariant tryptophan at position 35 (Kabat numbering [35]). The new classification resulted in the condensation of seven V, Cys-23 isotypes into three V, Trp-35 groups and the addition of two V, Trp-35 groups (V,27 and V,28). The 24 V, groups of the new classification consist of 18 Trp-35 and six Cys-23 groups. V, D N A probes generally hybridize to multiple restriction fragments of genomic DNA, and these V, gene families can vary in complexity from a single fragment [42] to approximately 20 hybridizing fragments [43]. Two questions which immediately arise are: (1) are the different restriction fragments which hybridize to different V, probes unique or overlapping sets?, and (2) what is the relationship of the sets defined by hybridization (gene families) to the groups defined by amino acid sequences [41]? One approach to these questions is to consider the most extensively studied V, group, V,21. At the protein level, five subgroups (VK21A,B,C,D,E)were defined by McKean et al. [44] based on common sets of amino acids in eight complete sequences of BALB/c V,21 myeloma light chains. Eighteen V,21 proteins from a library of myelomas independently derived from NZB mice were grouped into six subgroups by Weigert et al. [45]. Four additional V,21 light chains did not fall into any of the six subgroups. Using the criterion that at least two sequences sharing a unique set of three or more residues are needed to define a subgroup [21]. these four individual variant V,21 sequences could not be assigned to new subgroups. Weigert et al. [45] argued from these data that six to ten V,21 genes are encoded
88 in the germline of N Z B mice. Recently, Heinrich et al. [46] examined the BALBic germline V,21 genes in great detail. Thirteen V,21 related sequences were identified on 12 EcoRl fragments and of these, 11 were cloned. Of the five genes sequenced, three encode prototype V,21 subgroup sequences (B,C,E), and another is very homologous to one of the four individual variant V,21 sequences previously reported by Weigert e t al. [4S]. T h e fifth sequenced gene is similar to the V,21D subgroup but probably encodes a new subgroup. In the case o f the V,21 group, therefore, the estimated number o f germline genes based o n protein sequence subgroups (about ten [4S]) corresponds well with the number o f EcoR1 restriction fragments which hybridize to a V,21 probe (about 12 [46]). Cory et al. [43] studied mouse V, gene families by preparing ten V, cDNAs from different myelomas a n d hybridizing them to embryonic mouse D N A . Comparison of Southern blot patterns identified four non-overlapping sets o f restriction fragments. These four V, gene fainilies consist of sets o f restriction fragments of distinguishable mobilities for all strongly hybridizing and nearly all weakly hybridizing fragments. Different V, gene probes assigned to the same family often have nearly identical restriction fragment patterns. although the relative intensities of some bands vary. These results allowed Cory et al. to suggest that the total number of murine V, gene families is probably ten o r fewer. Cory et al. [43] and Stavnezer et al. [47] have reported that V, probes representing different V, groups (for example, V,2 and V,15) hybridize to the same set of restriction fragments. It appears, therefore. that there may be fewer V, gene faniilics than the 26 V, protein sequence groups. Furthermore, there may be some overlap between V, families, that is, weakly hybridizing fragments in ii set identified with o n e V, probe may be strongly hybridizing members of ‘different’ sets identified with different probes. Recently. D’Hoostelaere and Gibson [4X] analyzed D N A from several mouse strains using seven V, probes. each encoding V regions assigned t o different V, groups (V,4,8,9,10,1 1,21.24). Their results indicate that each V, probe hybridizes to a unique set of sfrongly hybridizing bands but it was not determined whether weakly hybridizing restriction fragments were unique o r shared by more than one family. In summary, mouse V, genes can be usefully classified into homologous sets of sequences, o r gene families, by nucleotide sequence o r hybridization criteria. In some instances. such as V,21, the protein sequence group and corresponding gene family correspond well. although there is evidence that some gene families may encode members of more than one V, group. The mouse V, locus may be a continuum of homologous sequences with considerable overlap between some, although not necessarily all, families.
3.4. Human V , families Human K light chains appear to be much less diverse than murine chains. In contrast to the 24 groups of mouse V, sequences [41], the human V, sequences have been placed into four subgroups (V,I, 11, 111, IV) [ 3 5 ] .Each human V, subgroup is characterized by a set of consensus amino acid residues distributed throughout the V region.
89 Bentley and Rabbitts [49] showed that a V,I probe and a V,III probe hybridize to essentially the same set of restriction fragments, and that most Southern blot bands represent a single V, gene copy. Furthermore, since V,I and V,III proteins are more closely related to subgroup 1V proteins than they are to each other, it has been argued that the genes encoding V,1. I11 and IV are all detected with either a V,I or V,III probe [49,50]. Klobeck et al. [51] have recently cloned a gene encoding a VJI chain and, as expected from amino acid sequence data, found negligible cross-hybridization between the V,II gene (GM607) and a V,I probe (H102 (521). Thus, one interpretation of the available data is that human V, genes comprise two gene families; one family encoding the V,I, I11 and probably IV protein sequence subgroups and a second family encoding the V,II group. On the other hand, DNA sequence analysis and appropriate hybridization conditions have been used by Zachau’s group [53-551 to classify human V, genes as V,I, VKII,V,III or VJV in concordance with Kabat’s subgroup classification. The extensive cloning and sequencing studies currently in progress in Zachau’s laboratory will ultimately provide the details of the content and organization of the human V, locus. 3.5. Mouse V , families
In contrast to the mouse K locus, studies of inbred mice to date have revealed only two germline V, genes (VA1 and V,2) [56,57]. The number of V, sequences in feral mouse species was found to be three to six [58], indicating that all species of the genus M u s may have an extremely limited set of V, genes. The mouse V,1 and VA2 genes have greater than 95% sequence homology, implying a recent duplication or gene conversion event [59]. The relative simplicity of the mouse germline V, repertoire was utilized by Weigert et al. [60] to provide the first compelling evidence for somatic mutation of immunoglobulin V regions. 3.6. H u m a n V , families
The diversity of amino acid sequences among human A light chains indicated that the A locus of man is considerably more complex than the mouse A locus. Comparison of V, protein sequences indicates that there are at least six subgroups [36]. It was not until very recently that a human V, gene was cloned. Anderson et al. [61] isolated a germline V, gene from a chromosome 22 phage library using a mouse V,1 cDNA probe. This cloned V, gene encodes a protein which does not fall into any of the six (VAI-VI) protein sequence subgroups [3S] and is therefore referred to as V,O [61]. Three additional V, genes have been cloned from Burkitt’s lymphoma lines: Tsujimoto and Croce [62] isolated a cDNA which encodes a V,I member; Anderson et al. [63] isolated a cDNA encoding a V,VI protein and Sun et al. [64] cloned a rearranged pseudogene which is most related to the V,III subgroup. Direct comparison of Southern blots of human DNA hybridized with the V,O or V,VI probes revealed non-overlapping sets of about ten restriction fragments [63]. Additional studies are necessary to determine the number of V, gene families and their relationship to the protein sequence subgroups.
90
4. Gene number A variety of molecular strategies by which antibody combining site diversity is generated have been described (reviewed by Tonegawa [ 6 5 ] ) .It is not yet clear, however, what the relative contribution of each mechanism is to the expressed antibody repertoire. Since the germline repertoire represents the starting point of V region diversity, it is important to determine the approximate number of V genes within each immunoglobulin locus. Although studies of immunoglobulin primary sequence and serological markers had given some indication of the general complexity of the immunoglobulin loci, it was the ability to prepare reasonably pure immunoglobulin mRNA and to eventually clone immunoglobulin genes which allowed a direct approach to study V gene number using nucleic acid hybridization. There are, however, inherent difficulties in determining the number of homologous but nonidentical sequences within large, complex loci wch as most clusters of immunoglobulin genes. Because of the heterogeneity of V gene sequences, attempts to enumerate V genes have generally relied on estimations of the number of sets of homologous genes (families) coupled with estimations of gene number per family. As discussed earlier, the present information is incomplete regarding the number of V gene families and the sequence heterogeneity within each family. If the number of gene copies within each family were known. however, a reasonable estimate of the total (minimal) number of V genes could be calculated. Initial attempts to determine the number of V genes within a given V family employed kinetic [66] and saturation [67] hybridization techniques. Because of the difficulties of interpreting solution hybridization data [68], most V gene enumeration studies have relied on counting restriction fragments on Southern blots using various V gene probes. Counting 'genes' by Southern blot analysis also has a number of potential problems which should be kept in mind. Underestimations can result from the comigration of restriction fragments. the inability to transfer large fragments and/or the possibility of restriction fragments bearing two (or more) V genes. A number of studies have shown that V genes are generally spaced 10 kb or more apart [22,46,69]) and, therefore, most restriction fragments (obtained with 'six-cutter' endonucleases such as EcoR1, BainHl or HindIII) bear a single V gene. Presented below are estimates of the number of V genes within the heavy and light chain loci of mouse and man; these estimates are primarily based on Southern blot data and consideration of sequence subgroup classifications. 4.1. Number of mouse V genes
The germline of BALB/c mice contains only two V, genes [56,57], and this appears true for other inbred mouse strains [%I. Feral mouse species also have a limited number of V, genes ranging from three to six [58]. In sharp contrast, the mouse V, locus is quite complex, as is evident from V region amino acid sequence comparison [41]. Based on saturation hybridization studies, Valbuena et al. [67] determined the V,21 group to be encoded by four to six germline genes, while the unrelated V,19 group (MPC-11) consisted of about
91 eight germline genes. These values were in close agreement with the calculated gene number for the V,lS group (MOPC-21) (671. It was reasoned that if each V, group contained about six genes and if there were SO V, groups, as estimated from the frequency of repeats among amino acid sequences [70], the total number of germline V, genes would be about 300. In more recent work, Cory et al. [43] analyzed the mouse V, locus using Southern blot hybridization. Using nine randomly selected V, probes, only four nonoverlapping sets were identified. This led Cory et al. to suggest that the mouse germline has about five but certainly not more than ten distinct V, families of 16 to 22 members each. Thus, the total number of V, genes was estimated to be about 1-200. A second calculation by Cory et al.. based on the estimated number of amino acid sequence groups and the average number of strongly hybridizing Southern blot bands in each set (thought to correspond to protein sequence groups), led to an increased estimate of about 300 V, genes. Again, it is important to emphasize that, in some instances, estimating the number of germline V genes using Southern blots may result in significant underestimations. For example, in an attempt to clone the BALBic germline genes homologous to the V,-OXl sequence. which is related to the V,4 group [41.71], Even et al. (721 identified 13 different sequences among 16 V,-OX1 homologous clones. Statistical analysis of these data led these investigators to estimate that the V,-OXl gene family contains greater than 20 and probably fewer than 50 genes. In contrast, only ten fragments are resolved on Southern blots of EcoRl or Hind111 digested BALBic DNA hybridized with the V,-OX1 probe [72]. The mouse V, locus contains at least nine V,, gene families which range in size from two members (VHX24) [32] t o 60 or more members (VHJ.558) [26.73]. Table 1 lists the nine known V,, gene family’s with each family’s ‘complexity’, that is, the number of hybridizing restriction fragments counted on Southern blots. The total number of restriction fragments for the nine families is approximately 130 which provides a minimal estimate for thc number of individual V, sequences within the mouse IgH locus. The estimate of the size of the VHJS.58 family should be accepted with some reservation because of its unusual complexity. Southern blots of EcoRl digested DNA resolve about 35 fragments using a VHJS.58 family probe. An initial estimate of approximately 60 members [26] was based on the examination of blots hybridized with one of six V,.,JSS8 family probes, each having 80434% homology to each other. Consideration of minor differences in patterns seen with different probes, and correcting for the inability to resolve all fragments on such complex blots, resulted in a minimal estimate of 60 V,,JSS8 members. More recently, additional germline VHJSSX family sequences have been determined from both BALBic and C57BLi6 genomes. The low repeat frequencies of germline VHJ.558 sequences noted thus far have led t o the suggestion that the VHJSS8 family may be larger than 60 members [74,7S]. Livant et al. [73] have recently examined the VHJ558 family using a variety of approaches, including saturation hybridization. Their results are consistent with SOOk1 000 VHJS.58 sequences per haploid genome. A similarly high estimate for mouse V, genes was made by Zeelon et al. [76].
92 Hybridization kinetics was used to measure the ratio of total K to V,21 m R N A in mouse spleen. This approach suggested the expression of 280 gene families and a total of approximately 2 000 V, genes (assuming approximately seven genes per family). Although the number of germline encoded V gene sequences is still uncertain, the functional o r expressed V gene repertoire appears to be consistent with estimates of 200-300 V genes in the K and IgH loci. For example. the two smallest V, families, VH2C24 and V,S107 have been extensively studied and have two and three functional genes, respectively [32,17]. Dildrop et al. [36]examined V, gene family expression in 51 unselected lipopolysaecharide-blast hybridomas from CS7BL/6 mice and found that members of these two families were expressed in approximately 8% of the hybridoma panel. Assuming random (and unselected) expression of V, genes in these hybridomas. the results are consistent with approximately 100 functional V, genes. Likewise, the percentage of hybridomas expressing vHJ558 family related genes was 64%’ which is consistent with the number of VHJS58-related genes being approximately ten times that of VHs107 plus VHX24-related genes. Therefore. the figure of five functional v genes in the vHs107 plus V,X24 families and approximately 60 V,JS58 genes is consistent with the ‘expressed’ repertoire. In agreement with these results, ;i survey of twenty randomly chosen NZB myelomas revealed that 50% express VHJ5S8-related genes [M. Thompson and R. Riblct, personal communication]. The expressed V, repertoire is also consistent with the lower (200-300) estimate of V, gene number. T h e relative frequency of V,21 group members among myelomas is approximately 8-996 and a similar percentage of K chains in normal sera react with V,21 specific antisera [77]. Extensive cloning and sequencing has revealed 13 V,21 genes [46]. Assuming random expression of V genes and V gene families, the 13 V,21 genes would represent about 7% of a 200 gene germline repertoire, consistent with estimates of 200-300 germline V, genes. As noted above, Zeelon et al. [76] have estimated the germline V, repertoire to be one to two thousand genes, and Livant et al. [73] have estimated the germline V, repertoire to consist of 1000 o r more genes. These higher estimates, if accurate, raise the possibility that the expressed V genes represent a fraction of the potential germline pool of V sequences. In summary, the mouse haploid genome contains two V, genes and approximately 300 V, and 200 V, genes as estimated by Southern blot analysis and consideration of protein sequence groups and V gene families. The possibility that such estimates are perhaps an order of magnitude too low has been suggested and awaits further investigation. 4.2. Number of h u m a n V g e r m The number of human V, genes was estimated to be quite small in the initial studies of Bentley and Rabbitts [49]. As discussed above (Section 3.4.), these authors suggested that the V,I, 111 and IV subgroups constitute a qingle family composed of about 25 germline V, genes. Consistent with this estimate. Bentley [SO] found
93 that 50% of splenic K m R N A is encoded by this set o f approximately 25 V, genes. Recently, Klobeck et al. [54] demonstrated that the V,IV subgroup is encoded by a single germline gene. As predicted by Bentley and Rabbitts [49], undcr low stringency the V,IV gene does hybridize t o approximately the same set of approximately 20 restriction fragments as a V,1 probe [54]. The number of germline genes encoding the more distantly related V,II subgroup has recently been estimated by Klobeck e t al. [51]. A V,II probe was prepared by cloning t h e productively rearranged V, gene from the human lymphoblastoid cell line GM607 which was first identified as a V,II antibody secretor using subgroup specific antisera. Blot hybridization using the cloned V,II gene revealed about half the number of bands that were identified with a V,I probe. Thus, based on blotting experiments. there appear to he approximately 40 germline V, genes. a set of approximately 25 sequences detected under low stringency conditions by V,I> V,III and V,IV probes and a set of approximately 12 genes detected by a V,II probe. Pech et al. [78] have recently reported evidence that most, and perhaps all, of the human K locus is duplicated. Therefore, there may be twicc the number of germline V, genes as originally thought; that is. there are at least 40 and perhaps 80 human V, genes. depending o n the extent of the large duplication within this locus. Until very recently. there has been relatively little data available regarding the number of human VH genes. Rabbitts et al. (371 argued that the VHIII protein subgroup is encoded by about 20 V,, genes a n d , b y assuming that all four V, subgroups then recognized [79] were of comparable complexity, they suggested that the human VH locus contains approximately 80 V,, genes. Subsequently, the five proteins which made up subgroup IV have been reclassified as VHIII sequences [ 3 5 ] . If t h e assumption of comparably sized V, gene families is applied, the estimate for t h e human V, locus is reduced to approximately 60 V,, genes. Two features of V region genes could make such estimates unreliable. First, the protein sequence subgroups d o not always correspond to sets of homologous genes [26,43]. and second, the number of genes within ii family can vary by more than ten-fold P61. Honjo’s laboratory has recently reported a direct cloning approach to study the structure of the human V, locus. Kodaira et al. [40] isolated 23 cosmid clones containing 1000 k b of the V H locus. Hybridization of these cosmid clones with three V H gene probes, each representing o n e of three V, families, identified 61 V, gene segments. It should be noted that work from both the Rabbitts and Honjo laboratories is based o n the idea that the three classic V, subgroups defined using protein sequence data [3S] a r c equivalent to three VH gene families and represent the entire germline human V,, repertoire. Although there is some evidence to suggest a reasonable correlation between V, subgroup and V, gene families, there has been no systematic survey designed to identify new V, gene families. Nevertheless, the extensive analysis of t h e human IgH locus by Honjo’s laboratory will n o doubt lead to a detailed knowledge of this locus in the near future. O n e of the cosmid clusters cloned by Kodaira et al. [40] was examined in great detail. This particular cluster (called cluster 71) contained seven V, genes, five of
94
which were shown t o be non-functional by sequence analysis. These results extend previous work in both mouse and man, which showed that approximately 40% of V, genes a r e pseudogenes [ 11,80-821. T h e human V, locus is quite diverse. A s discussed above (Section 3.6.), hybridization studies with probes for the V,I, I11 and VI subgroups, as well as V,O, indicate that each subgroup is composed of about ten genes. Based on the limited sequence homologies between these four probes. it is likely that they identify distinct, non-overlapping gene families. T h e human A locus probably contains a minimum of 40 V, sequences based on available Southern blot data. Probes for the genes encoding the V A I I ,V,IV and V,V subgroups are not yet available but will be necessary t o determine the size a n d diversity of the human V, germline repertoire.
5. Chromosome assignment Genetic analyses showed that the genes encoding immunoglobulin chains belong to three unlinked loci in m a n , mouse, and rabbit [83,84]. Such studies o n the inheritance of immunoglobulin polymorphisms led to the assignment of the mouse K locus t o chromosome 6 in tight linkage with the T cell alloantigen Lyf-2,3 [8S]. Further mapping of the murine and human immunoglobulin gene loci was accomplished using somatic cell hybrids. Using mouse-mouse hybrids and Robertsonian translocation markers, Hengartner e t al. [86] confirmed that the expression of K light chains requires a locus on chromosome 6, whereas the expressiori of heavy chains required chromosome 12. T h e formal demonstration that the structural K and f g h loci reside on chromosomes 6 and 12, respectively, was obtained by the analysis o f mouse-hamster hybrids using Southern blot hybridization [87,88]. A similar approach was used by D’Eustachio e t al. [X9] to assign the A locus to mouse chromosome 16. D’Hoostelaere et al. I901 have recently mapped the K locus 8 centimorgans from the mouse T-cell receptor beta locus (TcKP). By setting up a three-point cross, K and TcRP were mapped with respect to the morphological marker hypodactyly (Hd) allowing the chromosome order centromere-TcRP-K to be determined [90]. T h e chromosomal orientation of V, and C , genes has not been determined. T h e mouse f g h locus is located on the telomeric end of chromosome 12 [91]. However, the orientation of the heavy chain locus is controversial. T h e order centromere-V,-C, was originally proposed based on recombination frequencies [92] and an analysis of the Harwell translocation T(S;12)31H [91]. More recently, a mouse plasmacytoma (5558) carrying a translocation between the f g h locus on chromosome 12 and the c-myc locus on chromosome 15 has been fused with Chinese hamster cells by Erikson et al. [93]. These investigators concluded that the orientation of the mouse f g h locus is centromere-C,,-V,. Additional studies will be necessary to resolve this point. T h e expression of human immunoglobulin heavy chains in mouse-human hybrids was shown to be correlated with the presence of chromosome 14 [94]. Hob-
95 art et al. [95] formally demonstrated that the human lgh locus maps to chromosome 14 by nucleic acid hybridization using heavy chain constant region probes. The use of in situ hybridization allowed Kirsch et al. [96] to localize the lgh locus to the tip of the long arm of chromosome 14 at band 14q32. Based on an analysis of Burkitt lymphoma cells having X;14 translocations (between c-myc and l g h ) , Erikson et al. [97] have concluded that the chromosomal orientation of the lgh locus in man is centromere-C,-V,,. The human A locus is located o n chromosome 22. As in the case of the human Igh locus, the A genes were first tentatively mapped by studies measuring immunoglobulin gene expression in somatic cell hybrids [91] and the chromosome assignment later confirmed by direct hybridization studies [99]. The human K locus was mapped to chromosome 2 based on an analysis of human-rodent hybrids with nucleic acid probe hybridization [W] and localized close to the centromere on the short arm of chromosome 2 by in situ hybridization of normal fibroblasts and lymphocytes [ 1001.
6. Gene organization The organization of immunoglobulin gene loci has been examined using several approaches: classical Mendelian genetics, analysis of deleted DNA sequences within rearranged immunoglobulin gene loci and direct analysis of cloned DNA segments. Although the organization of no immunoglobulin gene locus is completely known, enough detail is available to outline the organization of the heavy, K and A loci in both mouse and man. Fig. 3 summarizes current views of immunoglobulin gene organization. While some features have been examined directly, much of Fig. 3 is quite speculative. 6.1. lgh locus organization
DNA cloning studies of the mouse lgh locus have provided a detailed map of the D, J H and CH regions. As discussed in Chapter 2, eight C, genes occupy a 200 kb region of chromosome 12 in the order 5’-C,-C8-Cy3-Cy,-Cy,,-C,;,-C,-C,-3’ [ 1011. Approximately eight kb 5‘ of the C, cluster are four functional JH genes (5’-JHlJH2-JH3-JH4-3’)[102]. A single D segment (D-Q52) is located 700 base pairs 5’ of JH1 [103]. The other 11 identified germline D segments (9 D-SP2 family members and 2 D-FL16 family members) have been physically linked within a 60 kb region located 20 kb 5‘ of JHl by Tonegawa and co-workers [104,105]. The DNA cloning studies from Tonegawa’s and Honjo’s laboratories [ 101,1051 together have shown that the D, JH and C, coding regions all have the same transcriptional orientation. It has been generally assumed that the V, genes are 5’ of the D-JH-C, region. Evidence for the order ~ ’ - V H - D - J H - C Hhas - ~ ’recently been obtained by the identification of a mouse strain carrying a recombinant Igh locus. This strain, C.BIR5, was constructed by Riblet by crossing strains having the lgh haplotypes a and b [106]. The cross-over event has been localized to the region between the D-FL16ID-
96 IgH LOCI VH
M.
D
(FL16 SP21
CH
JH
...... (-200) D
VH
VK
JK
JH
CH
cK
M. iN3-..-.---* (- 300)
VK
*JK
CK
....... Ha 7 - 1 0 0 ,
Fig. 3. Organization o f murine a n d human inimunoglohulin loci. Each pancl shows the murine (M.) and humnn ( H . ) immunoglobulin locus organizatioii. Much ol this figure i b speculative. See text for dctails and rclcrences. Details o f c', gcne organization are reviewed by Honjo IS] and elsewhere in this volume.
,
SP2 region and C,, giving rise to a recombinant f g h locus having the V, and D segments of the u haplotypc and the C , genes of the h parent (Brodeur and Riblet. in preparation). Therefore, the Igh haplotype of C.B/RS, V~"-D"-/-CH"(where / indicates the cross-over), provides direct evidence for the general organization of the mouse f g h locus. There are three lines of evidence which suggest that, in general, mouse V, genes belonging to the same V, gene families are clustered. This was first suggested by the cloning of DNA fragments large enough to contain more than one V, gene. Kemp et al. [22]examined three distinct clones each bearing a pair of V, genes. One clone had two members related to V,,S107, while the other two bore two V, genes which hybridized to t h e same V, probe, V,76 (V,J606 family). Bothwell et al. [ l l ] and Givol et al. [69] reported similar findings for members of the very large VHJ558family. Although no unrelated V, genes were detected among these ' 3 '
97 clones, it should be emphasized that detection of ‘non-family’ V, sequences in these experiments always relied on low stringency hybridization using probes representing only two or three unrelated Vk, families. Several mouse plasmacytomas have been useful in studying the organization of V, genes using ‘deletion mapping’ techniques. The rationale of such experiments is that the completion of a VH-D-JII rearrangement deletes all DNA sequences between the rearranged V,, and the J,, segments [24]. Therefore, B cell lines which have rearranged V, genes on both alleles are potentially useful in determining V, gene order. Deletion mapping, carried out by Kemp et al. [2S] and Rechavi et al. [ 1071, demonstrated that the V,, gene families examined were clustered; that is, homologous V,, sequences were deleted as a group. Using classical genetic recombination, coupled with restriction fragment length polymorphism (RFLP) analysis, Brodeur et al. [27] have obtained mapping data for much of the V, region. Several panels of fgh-recombinant mouse strains were constructed by Riblet [ 1061 to preserve chromosomes with recombinant fgh loci. These strains each have an independent genetic cross-over between the V, gene locus encoding the DEX idiotype. Igh-DEX, and the constant region (allotype). Since the mice were bred from parental strains having polymorphic fgh loci, the parental origin of each V, gene family could be ascertained by Southern blot analysis [%]. The v, gene families vH36-60,v,,3609, V,,J606, vHx24 and V,,J558 have not been separated from each other using these strains. Since multiple independent cross-overs between v,J558, which contains fgh-DEX and vHs107 have not separated the VH36-6O/3609/J6(j6/x24group. it was originally presumed (but not proven) that the V,,J558 family is immediately 5’ to V,,S107 [27]. Using the deletion mapping approach described above, further analysis of V, gene family organization is currently under way [Brodeur, unpublished]. A panel of over 30 Abelson-virus transformed pre-B cell lines has been established from mice heterozygous at the f g h locus. Each cell line has at least one VH-D-J, rearranged allele, allowing the presencc or absence of V,, genes on the rearranged allele to be determined by Southern blot analysis. Preliminary results based on deletion mapping have confirmed the map obtained using fgh-recombinant strains: 5’-VHS107-V,QS2N-V,7183-D-C,-3’.with vHJ558, VH36-60, vHJ606 and vH360c) mapping 5’ of v1,s107. The current map, based on deletion studies, is: ~ ’ - ~ ~ ~ 6 ~ ~ 9 - ~ ~ 107-V~Q52N~ 6 ~ ~ 6 - ~ ~ 3 6 V,7183-D-C,-3’. The position of the complex VHJSS8 family is not yet certain. However, at least some V,.lSSX sequences appear to be more distal to the C H region than vH3609. Further studies are in progress to determine whether the entire v H J % 8 gene family maps in this region. The organization of the mouse V, gene families, based on recombination and deletion studies, is shown in Fig. 4. Although the members o f mouse V, gene families appear to be generally clustered, there is evidence that some degree of interspersion may occur. Deletion mapping has indicated interspersion of V,, sequences belonging to the two adjacent families VHQ52N and V,7183 in NIHiSwiss mice [IOX]. Similar results have been obtained in the CBA mouse strain (Brodeur, unpublished) suggesting that interspersion of V,,QS2N and V,7183 members may exist in all mouse strains.
98 Centromere 12
--. -.
r
*x, , ,x\
J558
3609
36-60 Q52N 7183 J606 S107
Fig. 1. Organization of the mouse Zgl7 locus. The order or V,, gene families is based on /g/i recombinant mouse strains [27] and dcletion mapping studies [Brodeur. unpublished]. Approximate location of genetic cross-overs are designated hy ‘X‘. Distance (molecular and rccombinational) between or within V,, gene families are unknown. The map position of the V,,JSS8 family is tentative (see text).
The overall genetic size of the mouse fgh locus has been estimated by analyzing seventy recombinant inbred strains for cross-over events within the V, region (Brodeur and Riblet, in preparation). The frequency of recombinants among such strains can be used to calculate map distances [109]. Only three recombinant loci were identified among seventy strains, indicating that the fgh locus is one to two centimorgans in length, a ‘genetic distance’ which is estimated to represent 1-2000 kb of DNA [110].The estimate of one to two centimorgans for the total Igh locus is consistent with extensive back-cross analysis (over 5000 mice tested) by R . Riblet (personal communication) which maps the lgh-DEX idiotype marker 0.5 centimorgans from the C , region. Igh-DEX is encoded by a germline V, [ l l l ] gene belonging to the V,JSS8 family. Furthermore. the estimate of 100G2000 kb for the mouse Igh locus is consistent with 100-200 V, genes spaced 10-20 kb apart [151. The current picture of the mouse V, region is that at least 200 V, genes are grouped in nine sets (families) of highly homologous VH sequences - the families ranging in size from 2-100 (or more! [73]) VH sequences. The f g h locus occupies one to two centimorgans (1 000-2 000 kb) of the 70 centimorgan long mouse chromosome 12 [27]. The V, genes are 5’ of the D-JH-C, region and appear to be generally clustered, although some interspersion between two adjacent families has been noted [108]. The J, region in man consists of six functional and three pseudo-gene segments. As in the mouse, there is a single D segment immediately 5’ to the most 5‘ functional JH segment [l-91. The organization of the three kb JH cluster is 5’-+JH1-D-
It is presumed that the remaining D segments are 5’ of t h e J H cluster, although this has not been shown. Siebenlist et al. [113] cloned a 33 kb segment of the human D region and identified four D segments spaced approximately nine kb apart. Since most human heavy chain CDR3 sequences do not use any of the four germ-
99
line D segments reported by Siebenlist et al. [113], it is assumed that additional germline D segments exist. V H genes in man may be organized differently from mouse. Cosmid cloning of human V, sequences in Honjo’s laboratory [40]has revealed extensive interspersion of non-homologous V H genes. Clones were isolated using probes from each of the three defined V, families (V,,l,VHII, VHIII) which correspond to the classic V, subgroups defined by Kabat et al. [35]. Hybridization studies allowed the identification of 61 V, gene sequences spanning approximately 1000 kb of DNA. A detailed analysis of one cluster of about 40 kb (cluster 71) revealed seven V, genes arranged in the order ~‘-v,II~-v,II-vHIII-vHII-vHI-v~III-vH~-3’, suggesting extensive interspersion of V,, gene families in man. Interestingly, only two of the seven V, genes of cluster 71 appear functional by sequence analysis, and these two are both Vl,lImembers having 99% sequence homology. Further analysis of this V, cosmid collection by Honjo’s group will no doubt show whether the high frequency of V, pseudogenes and widespread family interspersion is a general feature of the human V, region. There are limited data available concerning the overall size of the human Igh locus. Johnson et al. [114]analyzed families for a restriction fragment length polymorphism detected with a vHI1 probe. This analysis was used to estimate, by logarithm of odds score, that the VklIlgenes were approximately four centimorgans from the C , gene cluster. This computation is valid only if crossing over has a uniform frequency over the entire chromosome. If the four centimorgan estimate is accurate, it suggests that the human Igh locus spans at least 4000 kb of DNA and that the 1000 kb cloned by Kodaira et al. [40]may represent only a fraction of the entire human heavy chain locus. 6.2.
IgK
locus organization
Several initial reports utilized ‘deletion mapping’ to examine mouse V, gene organization [47,115].However, this approach was no longer pursued following reports that the v, rearrangement mechanism may operate by sister chromatid exchange [116,117]or inversion [118],either of which would make deletion mapping of the K locus difficult or impossible to interpret. Gibson and colleagues [ 1191 have sought to examine mouse K gene organization using recombinants and recently reported the first instance of recombination between K locus markers. The markers used, Igrc-Efl and IgK-EfZ [120]were detected by isoelectric focusing of K chains. The genes encoding these polypeptides were shown to be 0.45 centimorgans apart. One of the EfllEj2 recombinants, ‘NAK’, was preserved as a strain homozygous for the recombinant K locus. D’Hoostelaere and Gibson [48]recently analyzed NAK and two additional K recombinants using seven distinct v, probes for Southern blot analysis. By considering the most intensely hybridizing polymorphic restriction fragments, no examples of family member interspersion was observed, indicating that V, gene families are not extensively interspersed. The map order inferred from these results is (V,19,V,21)-Efl-(V,4,V,8,VK10)-(Ef2,V,9,VKll ,V,24). A tentative map of the mouse K locus is diagrammed in Fig. 5 .
(VK
1.9.11.24)
(V, 4.8.10)
Ef1
(V, 19,21) C,
Fig. 5. Organization of the mouse K locus. Approximate locations of genetic recombinations are designated by ‘X’. This map is based on data and discussion of D’Hoostelaere and Gibson [48] and D’Hoostelaere et al. [W]. The orientation of V, and C , relative t o the centromere is unknown.
A detailed cloning and sequence study of the V,21 gene family of BALBic mice also showed that highly homologous V, genes are physically clustered [46]. It should be stressed, however, that family member interspersion of some degree has not been ruled out by any experiments to date. The mouse K locus consists of four functional J, segments (3,1,2,4,5), a single C, gene and about 300 V, genes. The J,3 segment appears to be inactive, most probably because of a mutation in its RNA splice signal [18]. There are likely to be 10-20 V, gene families and highly homologous sets of V, genes appear to be clustered. It is not known whether V, genes are 5’ or 3‘ of C, (or both). Current models of K locus rearrangement via inversion [121] would allow V, genes to be on either side of the K constant region gene. Indeed, at least one functional T cell receptor V, gene is located 3’ of C, and appears to rearrange via chromosomal inversion [ 1221. Bentley and Rabbitts [49] initially proposed the number of human V, genes to be relatively small. Their estimate was based on the finding that approximately 25 V, genes, as counted on Southern blots, constituted three of four human V, subgroups. Given the rather small apparent size of the V, locus, Zachau and colleagues [53,123] have initiated studies of V, gene organization using overlapping cloned DNA fragments. Pech et al. [S3] initially reported a cloned region (now termed cluster A) containing five V,I sequences and one pseudogene homologous to VJI subgroup members. Subsequently, Pech and Zachau [123] reported that this 80 kb region also encodes two V,III genes. both potentially functional on the basis of sequence analysis. The presence of V,IV sequences was ruled out by hybridization experiments using a V,IV probe. The order of V, genes within this region was determined to be S’-V,I-V,I-V,III-V,II-V,I-V,I-V,III-V,I-3’. Therefore, extensive interspersion of human V, gene family members exists, as in the case of human V, genes. In both cases, all V genes examined are in the same transcriptional orientation. Pech et al. [78] have recently identified a second cluster of V, genes, termed cluster B, which contains six V, genes belonging to three different subgroups (families). Interestingly, cluster B appears to be a duplicated copy of the previously reported 80 kb region (cluster A ) . The two clusters have not been linked and the extent of the duplication is not yet known. Although the orientation of V, genes
within each cluster is the same, the orientation of the two clusters relative to each other or to C , has not been determined. I t is possible, for instance. that the entire V, region has been duplicated and may be present in two different transcriptional orientations. Lotscher et al. 1551 have recently shown by somatic cell genetics that human V, genes are dispersed among several chromosomes. These investigators estimate that about 10% of human V, gene sequences may be located o n chromosomes other than chromosome 2, to which t h c functional K locus maps.
6.3. I g A locus organization
In addition to the two mouse V, genes, molecular analysis of the BALBic locus has identified four J, gene segments and four C, genes organized in two similar clusters: 5’-JAz-CAZ-JAj-C,,-3’and 5’-J,,-C,,-J,,-CAI-3’ [124,12S]. J,, is most likely a pseudogene due to several anomalies [126,127] and probably accounts for the lack of any observed productive or non-productive JA4CA4 rearrangements [ 1281. The two A clusters have not been psysically linked so that the distance between the J,,-C,z-J,,-C,j cluster and the JAA-CA3-JAL-CAI cluster is unknown, as is the relative orientation of the clusters. Furthermore, the location of the V, genes is unknown except that the V, and C, genes are tightly linked on chromosome 16 [89]. Despite the lack of direct evidence, a model of the mouse A locus organiztion has been proposed based on the highly restricted pattern of V, to J, gene rearrangements [ 1281. The structure ~ ’ - ~ , ~ / / ~ , Z - ~ , ~ - ~ , , - ~ A j / / ~ A ~ / / ~ A ~ - is ~ , 3 - ~ , l - ~ , , consistent with the observation that rearranged V,2 genes are nearly always joined to JAz,while rearranged V,1 genes are always joined to JA3or J A I The . model is also consistent with the finding that a given plasmacytoma can retain rearranged and germline forms of both V,1 and V,2 [ 1241. Since overlapping clones failed to provide evidence of the proposed organization of the h locus (Jim Miller, personal communication), definitive mapping of this locus may have to await linkage analysis using pulsed-field electrophoresis [ 1291. The first report regarding the organization of the human A locus was from Hieter et al. [13O] who identified six C, genes tandeinly arranged on SO kb of DNA. Udey and Blomberg [131] have recently shown that C,,, C,, and Ch3each have a single J, segment located approximately 1.3-1.7 kb upstream. In addition, hybridization studies have indicated the presence of at least one J, segment 5’ to each of the other three C , genes (C,,, CA5,C,(J [131]. There is, as yet, no information regarding the organization of the V, genes and V, gene families in man. It does not appear, however, that V, genes are interdigitated among the JAC, cluster [ 13I , 1321.
7. Polymorphism Immunoglobulin variable region genes are extraordinarily polymorphic, displaying a degree of genetic diversity paralleling that of the major histocompatibility com-
102
.. U
EcoRl
. u
Hindm
Fig, 6. Restriction fragment length polymorphism within the mouse Igh locus. Southern blots of BALBic (1gh") and AiHe (Igli') liver DNA hybridized with a V,,JS58 gene family probe. Dxl I [26]. DNA samples (IS& were digested to completion with either EcoRl or HiiidIII. separated by agarose gel electrophoresis, blotted and hybridized as previously described [XI.
plex (MHC) [ 1331. This extensive polymorphism presumably contributes to the role immunoglobulins and MHC products play in protecting the individual and the species against a continuously varying antigenic environment. V, gene polymorphism among inbred mouse strains can be readily seen by comparing restriction fragment patterns on Southern blots hybridized with V, probes
103 TABLE 2 Iglz haplotypes of some inbred mouse strain\
lgh-V,i"
Igh-Clf
Igh
allotype"
haplotype'
Strain
BALB, C58, C57L C57BLI6, SJL SM DBAIZ, R F AKR NZB
V,,X24" VI,J606, V,,J558, V,,SlU7. V, ,7 183, V,,36OY
V,136-60 V,,052N D'
a
a
a
1
a
d
a
b
b
b
b
b
b
b
-
a
a
a
12
C
C
c
C
j j
J I e e f a g g
j j e e f
d d e e f
d
d n e
0
0
f
a f f
f gr
g
R
e e f a g g
b c d n e
br
C
I
i
I
!k
c C
f I
e g I
l
I
e e
C
g
P
P
I
I
AiHe
AL CE RIII BSVS SWR C3H. PL
V , allele designations are based on Southern blot analysis of EcoRl digested liver DNA using V,, gene probes except for VIlX24,which is based on blots of RglII digested gcnomic DNA. VI,X24 data are from Hartman et al. [134]. Vl13609 data are from Brodeur and Riblet (unpublished). All other V,, gene family data are from Brodeur and Riblet [26]. Strains SM and PL not examined with V,,X24 prohc. ' Alleles for D region were assigned using a D-FLl6.l 5' flanking region probe (Brodeur, unpublished results) which hybridizes to members of the D-FLlh and D-SP2 families [ 1041. " Serologically determined heavy chain constant region allele (allotype) designations are as described by Lieberman [135] and Huang et al. [ 1361. The C,, allotype designation is used for thc complete ( V l , and Cl,) I@ haplotype except for recombinant haplotypes such as SM and RIII. Thew arc distinguished by adding an 'r' for recombinant.
(Fig. 6). These patterns display considerable variation among strains; for example, a survey of 18 strains revealed six to cight different patterns when Southern blots were hybridized with any one of seven V, gene probes. Mouse strains with the same restriction fragment patterns for a particular V,, gene family were considered to have the same 'allele' at that region of the locus. Using this approach, Igh-V region haplotypes were assigned to each of the 18 strains examined [26]. Table 2 lists these and includes more recent information regarding the vHx24 [134] and VH3609 [Brodeur and Riblet, unpublished] families. Table 2 also lists the Igh-C region haplotypes of these strains. I n general, strains of the same C,, haplotype also have the same restriction fragment patterns with V, probes. Thus, the V , haplotype, based on restriction fragment polymorphisms, and C,, haplotype, based on serological analyses [ 1351, together define a 'complete Igh haplotype' [ 137,261. Since V, genes are generally separated by 10 kb or more [ 5 ] , most restriction fragment length polymorphisms are due to differences within the DNA flanking V, genes. The underlying assumption is that such polymorphisms among different
104 haplotypes are associated with differences in V-gene coding regions, and therefore in primary structure of antigen-combining sites of immunoglobulins. Data to support this assumption are not easily obtained due to the inherent difficulty of determining allelic relationships among genes within cvolutionarily complex multigene sets. For instance, Loh et al. [82] attempted to define the BALBic alleles of the NP" V, gene family of the C57BLi6 strain, which had been previously analyzed by Bothwell et al. [ l l ] . The NPh gene family is a subset of t h e V,J55X family. which includes the V, gene utilized by C57BLi6 mice in the antibody response to the hapten (4-hydroxy-3-nitropheny1)acelyl(NP) [ 111. Loh et al. [82] isolated and sequenced five 'NP" equivalent' V, genes from BALBic mice. Based on strong hybridization to the NP" VH gene probe and restriction map similarities, these five BALBic genes were considered to be the BALBic V,, genes most closely related to t h e C57BLi6 NPh V, gene set. Sequence comparison of these 'NPh-equivalent' BALBic genes with the seven C57BLi6 NP"-family genes did not allow allelic relationships to be established. Loh et al. [82] suggested that the origins of these BALBic and C57BLi6 gene sets. which share 8 5 9 6 % nucleotide sequence identity, may be obscured by frequent recombination and gene conversion events. Furthermore, the dominant response to the NP hapten in BALBic mice (the NP" idiotype [138]) was shown to use a V, gene quite distinct from the BALBic NP"equivalent set. On the other hand, studies of the antibody response to phosphorylcholine (PC) and p-azophenylarsonate (Ars) have provided unambiguous examples of V, alleles among Igh haplotypes. Rudikoff and Potter [ 1391 proposed that the nearly identical sequences of PC binding myeloma proteins from BALBic (Igh") and C57BLi6 (Igh") mice are encoded by allelic forms of the same germline gene. These PC associated V, genes are members of the small V,,S107 gene family [17]. Perlmutter et al. [140] have compared the four V,S107 genes of C57BLi10 with the four BALBic VHs107 genes and established allelic pairs. The genes encoding the anti-PC responses in each strain differ at only five positions, four of which are replacement substitutions. Near et al. [31] examined allelic forms of a vH36-60 family member utilized in responses to Ars in BALBic (Igh") and AiJ (Igh') mice. These allelic germline V, genes differ at only two nucleotide positions, both of which are replacement substitutions. Data from the anti-PC and anti-Ars systems suggest that, in certain responses, structurally and functionally allelic forms of a V, gene are expressed and encode differences at the protein level. Strain-specific antibody responses to other determinants, such as the anti-NP response of BALB/c and CS7BLi6 mice, may instead utilize V, genes which are clearly non-allelic, and for which allelic relationships among homologous germline V, sequences are unclear. Therefore, the restriction fragment polymorphisms which have been identified among various Igh haplotypes most likely reflect differences in the functional antibody repertoire. It is possible that V gene polymorphisms represent an additional source of antibody diversity for the species as a whole. The functional significance of V gene polymorphism, however, is unclear. It should be appreciated that, as discussed by Kelsoe and Farina [141], the influence
105 of natural selection on a given V gene is probably minimized by the great capacity of somatic recombinatorial diversification. With respect to the evolution of immunoglobulin loci, therefore, it may only be important for an individual, or species, to have a suitably large and diverse starting library of V genes (and D and J segments) with which to somatically construct a large antibody repertoire. Polymorphism among V genes may simply reflect the immune system’s remarkable ability to construct an effective repertoire using starting libraries which, although similar in complexity, are distinct collections of germline sequences.
8. Conclusions During the last decade, much detailed information has been obtained describing the content and organization of immunoglobulin loci. In addition, a more general picture has emerged from studies of chromosome location, gene family structure and the overall size and structure of heavy and light chain loci of mouse and man. In general, it appears that a typical mammalian immunoglobulin locus consists of up to several hundred V genes, a small number of constant region genes (from one to about a dozen), a small number of J segments (about half a dozen) and, in the case of IgH loci, a set of D segments (one dozen in mouse, an unknown number in man). Obviously, evolution has provided exceptions, such as the mouse A locus with only two V genes. A striking feature of immunoglobulin locus organization is the variety of arrangements which have evolved (Fig. 3). There are no obvious mechanistic constraints requiring, for example, all J segments to be clustered (IgH and K loci versus A loci). Recent studies on the organization of T cell receptor genes (1421 and on the chicken A locus [143] further underscore the genetic diversity of antigenspecific receptors. As noted above. studies investigating the germline V gene repertoire are still in progress. Information concerning the content and organization of V gene loci will allow the analyses of the immune repertoire during ontogeny [144], within B lymphocyte subsets [145], and in the context o f autoimmune disease [146] to be made within the framework of genetic organization and germline diversity.
Acknowledgements I am indebted to Dr. Geronimo Terres for his many useful comments on this manuscript. I thank Drs. Franco Calabi and Michael Neuberger for their excellent editing (and extreme patience!). It is a pleasure to thank Ms. Julie Dzengeleski for her professional and cheerful preparation of this manuscript. The author is supported, in part, by USDHHS Grant R01-GM36064.
106
References 1 Dreyer, W.J. and Bennett, J.C. (1965) Proc. Natl. Acad. Sci. USA 54. 864-869. 2 Honjo, T., Packman. S . , Swan, D., Nau, M. and Leder, P. (1974) Proc. Natl. Acad. Sci. USA 71, 3659-3663. 3 Rabbitts, T.H. and Milstein, C. (1975) Eur. J. Biochem. 52, 125-133. 4 Hozumi, N. and Tonegawa, S . (1976) Proc. Natl. Acad. Sci. USA 73. 3628-3632. 5 Honjo, T. (1983) Annu. Rev. Immunol. I , 499-528. 6 Wu, T. and Kabat. E. (1970) J. Exp. Med. 132, 211-250. 7 Davies, D.R. and Metzger, H. (1983) Annu. Rev. Immunol. 1, 87-117. 8 Milstein, C.. Brownlee, G.G., Harrison, T.M. and Mathews, M.B. (1972) Nature New Biol. 239, 117-120. 9 Kelley, D.E., Coleclough, C. and Perry, R.P. (1982) Cell 29. 681489. 10 Breathnach, R. and Chambon. P. (1981) Annu. Rev. Biochem. 50, 349-383. 11 Bothwell, A.L.M., Paskind, M., Reth. M., Imanishi-Kari, T., Rajewsky, K. and Baltimore, D. (1981) Cell 24, 625-637. 12 0110,R.. Auffray, C., Sikorav, J.-L. and Rougeon. F. (1981) Nucl. Acids Res. 9, 4099-4109. 13 Parslow, T.G., Blair, D.L., Murphy, W.J. and Granner, D.K. (1984) Proc. Natl. Acad. Sci. USA 81, 2650-2654. 14 Falkner, F.G. and Zachau, H.G. (1984) Nature 310, 71-74. 15 Sen, R . and Baltimore. D. (1986) Cell 46, 705-716. 16 Mocikat, R., Falkner, F.G., Mertz, R . and Zachau, H.G. (1986) Nucl. Acids Res. 14, 8829-8844. 17 Early, P., Huang, H., Davis, M., Calame. K. and Hood. L. (1980) Cell 19, 981-992. 18 Max. E.E., Seidman. J.G. and Leder. P. (1979) Proc. Natl. Acad. Sci. USA 76, 345C-3454. 19 Sakano, H., Huppi, K., Heinrich, G . and Tonegawa. S. (1979) Nature 280, 288-294. 20 Seidman. J.G., Leder, A . , Edgell, M.H., Tiemeier. D.C. and Leder. P. (1978) Proc. Natl. Acad. Sci. USA 75, 3881-3885. 21 Potter, M. (1977) Adv. Immunol. 25, 141-211. 22 Kemp, D., Cory, S. and Adams, J. (1979) Proc. Natl. Acad. Sci. USA 76, 4627-4631. 23 Davis, M.M., Calame. K., Early, P. W.. Livant. D.L., Joho, R.. Weissman, I.L. and Hood, L. (1980) Nature 283, 733-739. 24 Cory. S. and Adams, J . (1980) Cell 19, 37-51. 25 Kemp, D.J.. Tyler. B., Bernard. O., Gough, N.. Gerondakis. S.. Adams, J.M. and Cory, S. (1981) J. Mol. Appl. Genet. 1, 245-261. 26 Brodeur, P.H. and Riblet, R. (1984) Eur. J . Immunol. 14. 922-930. 27 Brodeur, P.H., Thompson, M.A. and Riblet, R. (1984) in: Regulation of the Immune System, UCLA Symp. Mol. Cell. Biol., New Series, Vol. 18 (E. Sercarz, H. Cantor and L. Chess, Eds.) pp. 44-53. Alan R. Liss, Inc., New York. 28 Winter, E., Radbruch, A. and Krawinkel. U. (1985) EMBO J . 4, 2861-2867. 29 Dildrop, R. (1984) Immunol. Today, 5, 85-86. 30 Dildrop, R. (1986) in: Handbook of Experimental Immunology. Vol. 3 (D.M. Weir, Ed.) pp. 90.1-90.6, Blackwell Sci. Publ. Oxford. 31 Near, R.I., Juszcak, E.C.. Huang, S.Y.. Sicari. S.A., Margolies. M.N. and Gefter, M.L. (1984) Proc. Natl. Acad. Sci. USA 81. 2167-2171. 32 Hartman, A.B. and Rudikoff, S. (1984) EMBO J. 3, 3023-3030. 33 Perlmutter, R.M., Klotz, J.L.. Bond. M. W., Nahm. M., Davie. J.M. and Hood, L. (1984) J. Exp. Med. 159, 179-192. 34 Crews, S., Griffin, J.. Huang, H . , Calame, K. and Hood, L. (1981) Cell 5. 59-66. 35 Kabat. E.A., Wu, T.T., Bilofsky. H., Reid-Miller. M. and Perry, H. (1983) Sequences of Proteins of Immunological Interest. NIH publication. 36 Dildrop, R., Krawinkel, U., Winter. E. and Rajewsky, K. (1985) Eur. J . Immunol. 15, 1154-1156. 37 Rabbitts. T.H., Matthyssens, G . and Hamlyn, P.H. (1980) Nature 284, 238-243. 38 Rechavi, G., Ram, D., Glazer, L.. Zakut, R. and Givol, D . (1983) Proc. Natl. Acad. Sci. USA 80. 855-859.
107 39 Takahashi. N., Noma, T. and Honjo. T. (1984) Proc. Natl. Acad. Sci. USA 81. 51945198. 40 Kodaira, M., Kinashi, T . , Umemura, I., Matsuda, F., Noma, T . , Ono, Y. and Honjo. T. (1986) J. Mol. Biol. 190, 529-541. 41 Potter. M., Newell. J.B.. Rudikoll. S. and Hahcr. E. (1982) Mol. Immunol. 19, 1619-1630. 42 Selsing, E. and Storb. U . (1981) Cell 25. 47-58. 43 Cory, S., Tyler, B.M. and Adams, J . M . (1981) J . Mol. Appl. Genet. I , 103-116. 44 McKean. D . J . , Bell, M. and Potter. M. (1978) Proc. Natl. Acad. Sci. USA 75, 3913-3917. 45 Weigert, M., Gatmaitan. L.. Loh, E., Schilling. J. and Hood. L. (1978) Nature 276, 785-790. 46 Heinrich, G., Traunecker. A . and Tonegawa. S. (1984) J . Exp. Med. 159. 417-435. 47 Stavnezer, J., McGrath. J.P., Slavin, K.J., Li. R., Li. Y . . Herz, R . and Alhadeff, B. (1981) in: Immunoglobulin Idiotypes, ICN-UCLA Symp. Molec. Cell. Biol., Vol. 20 (C. Janeway, E. Sercarz and H . Wigzell. Eds.) pp. 65-73. Acadcmic Prcss. New York. 48 D’Hoostelaere, L.A. and Gibson. D . M . (1986) lmmunogenetics 23. 260-265. 49 Bentley. D.L. and Rabbitts, T. (1981) Cell 24. 613-623. 50 Bentley. D.L. (1984) Nature 307, 77-XO. 51 Klobeck. H . - G . , Soloman. A . and Zachau, H . G . (1984) Nature 309, 73-76. 52 Bentley. D.L. and Rabbitts, T . H . (1980) Nature 288. 73k733.
53 Pech, M . , Jaenichen. H.-R.. Pohlenz. H.-D.. Neumaier, P.S.. Klobeck. H.-G. and Zachau, H . G . (1984) J . Mol. Biol. 176. 189-204. 54 Klobeck, H.-G.. Bornkamm, G.W.. Combriato, G . . Mocikat. R . . Pohlenz. H.-D. and Zachau, H.G. (1985) Nucl. Acids Res. 13. 651541529, 55 Lotscher, E., Grzeschik. K.-H.. Baucr, I-I.G., Pohlenz. H.-D.. Straubinger, B. and Zachau, H . G . (1986) Nature 320. 456458. 56 Bernard. O . , Hozumi. N . and Tonegawa. S. (1978) Cell 15. 1133-1 144, 57 Brack. C.. Hirama. M., Lenhard-Schuller. R . and Tonegawa. S. (1978) Cell 15, 1-14. 58 Scott. C.L. and Potter. M. (1984) J . Immunol. 132. 2638-2643. 59 Selsing. E.. Miller, J . , Wilson, R . and Storb. U . (1982) Proc. Natl. Acad. Sci. USA 79. 4681-4685. 60 Weigert, M.G., Cesari. I . M . , Yonkovich, S . J . and Cohn. M. (1970) Nature 228, 1045-1047. 61 Anderson. M.L.M., Szajnert. M.F.. Kaplan. J . C . , McColl, L. and Young. B . D . (1984) Nucl. Acids Res. 12. 6647-6661. 62 Tsujimoto, Y. and Croce. C.M. (1984) Nucl. Acids Res. 12, 8407-8414. 63 Anderson, M.L.M.. Brown, L.. McKenzie. E.. Kellow, J.E. and Young, B.D. (1985) Nucl. Acids Res. 13, 2931-2941. 64 Sun. L.-H.K., Croce, C.M. and Showe. C . (1985) Nucl. Acids Res. 13. 4921-4933. 65 Tonegawa, S. (1983) Nature 302. 575-581. 66 Rabbitts, T . H . (1977) lmniunol. Rev. 36. 29-50, 67 Valbuena. 0.. Marcu. K.B.. Weigert. M. and Perry. R . P . (1978) Nature 276. 780-784. 68 Smith. G . P . (1976) Cold Spring Harbor Symp. Quant. Biol. 41, 863-875. 69 Givol. D . , Zakut, R.. Effron, K., Rechavi. G.. Ram. D. and Cohen. J . (1981) Nature 292. 42W30. 70 Weigert, M. and Riblet. R. (1976) Cold Spring Harbor Symp. Quant. Biol. 41, 837-846. 71 Kaartinen. M., Griffiths, G.M.. Hamlyn. P.H.. Markham. A.F.. Karjalainen. K., Pelkonen, J.L.T., Makela, 0. and Milstein. C. (1983) J . Immunol. 130. 937-945. 72 Even, J . , Griffiths. G.M.. Berek. C. and Milstein. C . (1985) E M B O J . 4. 3439-3445. 73 Livant. D . , Blatt, C. and Hood, L. (1986) Cell 47. 461-470. 74 Maizels, N . and Bothwell. A . (1985) Cell 43. 715-720. 75 Schiff, C., Milili, M. and Fougereau, M . (1985) EMBO J. 4. 1225-1230. 76 Zeelon. E.P.. Bothwell. A.L.M.. Kantor. F. and Schechter. I. (1981) Nucl. Acids Res. 9. 3809-3820. 77 Julius. M.A.. McKean. D.J.. Potter, M . and Weigert. M. (1981) Mol. Immunol. 18. 11-17. 78 Pcch, M., Smola, H . , Pohlenz. H.-D.. Straubinger. B.. Gerl. R. and Zachau, H . G . (1985) J. Mol. Biol. 183. 291-299. 79 Kabat, E . A . , Wu, T.T. and Bilofsky. H . (1979) Sequences of Immunoglobulin Chains. NIH publication, 8C-2008. 80 Cohen, J.B. and Givol. D. (1983) EMBO J . 2. 1795-1800. 81 Huang, H . . Crews. S. and Hood. L. (1981) J . Mol. Appl. Genet. 1, 93-101.
108 82 Loh, D . Y . , Bothwell, A.L.M., White-Scharf. M.E.. Imanishi-Kari. T. and Baltimore, D. (1983) Cell 33, 85-93. 83 Mage. R., Lieberman, R., Potter. M. and Terry. W. (1973) in: The Antigens (M. Sela, E d . ) pp. 299-376. Academic Press, New York. 84 Kindt, T. (1975) Adv. Immunol. 21, 35-86. 85 Gottlieb. P . D . (1974) J . Exp. Med. 140, 1432-1437. 86 Hengartner, H . , Meo. T. and Muller, E . (1978) Proc. Natl. Acad. Sci. USA 75. 4494-4498. 87 Swan. D . , D’Eustachio. P., Leinwand, L., Seidman, J . . Keithley, D. and Ruddle, F . H . (1979) Proc. Natl. Acad. Sci. USA 76. 2735-2739. 88 D’Eustachio, P., Pravtcheva, D.. Marcu, K. and Ruddle, F.H. (1980) J . Exp. Med. 151. 1545-1550. 89 D’Eustachio, P.. Bothwell, A.L.M., Takaro. T.K., Baltimore. D . and Ruddle, F.H. (1981) J . Exp. Med. 153, 793-800. 90 D’Hoostelaere, L.A., Jouvin-Marche, E. and Huppi. K. (19%) Immunogenetics 22. 277-283. 91 Meo, T.. Johnson. J . , Beechey. C . V . , Andrews, S.J.. Peters, J. and Searle. A . G . (1980) Proc. Natl. Acad. Sci. USA 77, 55Ok553. 92 Owen. F.L., Riblet, R. and ’Taylor, B.A. (1981) J . Exp. Mcd. 153, 801-810. 93 Erikson, J.. Miller. D.A.. Miller, O.J.. Abcarian, P.W., Skurla, R.M.. Mushinski. J.F. and Croce. C.M. (1985) Proc. Natl. Acad. Sci. USA 82, 4212-4216. 94 Croce. C.M., Shander. M., Martinis, J . . Cicurel, L., D’Ancona. G.G., Dolby, T.W. and Koprowski, H . (1979) Proc. Natl. Acad. Sci. USA 76. 34163419. 95 Hobart, M.J.. Rabbitts, T.H., Goodfellow. P.N., Solomon. E.. Chambers. S., Spurr. N . and Povey, S. (1981) Ann. Hum. Genet. 45, 331-335. 96 Kirsch, I.R., Morton. C . C . . Nakahar, K. and Leder, P. (1982) Science 216. 301-303. 97 Erikson, J.. Finan. J.. Nowell. P.C. and Croce, C . M . (1982) Proc. Natl. Acad. Sci. USA 79. 561 1-5615. 98 Erikson, J . , Martinis, J . and Croce, C.M. (1981) Nature 294. 173-175. 99 McBride, O . W . . Hieter. P.A., Hollis, G.F.. Swan, D., Otcy, M.C. and Leder, P. (1982) J . Exp. Med. 155. 148C1490. 100 Malcolm, S . . Barton, P . . Murphy, C . . Ferguson-Smith, M.A., Bentley, D.L. and Rabbitts, T . H . (1982) Proc. Natl. Acad. Sci. USA 79. 4957-4961. 101 Shimizu. A., Takahashi, N., Yaoita, Y. and Honjo, T. (1982) Cell 28. 499-506. 102 Sakano. H . , Maki, R. Kurosawa, Y.. Roeder, W. and Tonegawa, S. (1980) Nature 286, 676-683. 103 Sakano, H . , Kurosawa. Y . , Weigert, M. and Toncgawa. S. (1981) Nature 290. 562-565. 104 Kurosawa, Y. and Tonegawa, S . (1982) J . Exp. Med. 155. 201-218. 105 Wood, C. and Tonegawa, S. (1983) Proc. Natl. Acad. Sci. USA 80, 303(k3034. 106 Weigert, M. and Riblet, R. (1978) Springer Semin. Immunopathol. 1, 133-169. 107 Rechavi, G . , Bienz. B . , Ram, D.. Ben-Neriah, Y.. Cohen, J.B., Zakut. R. and Givol, D. (1982) Proc. Natl. Acad. Sci. USA 79. 4405-4409. 108 Alt, F . W . , Blackwell, T . K . , DePinho, R . A . , Reth. M.G. and Yancopoulos, G.D. (1986) Inimunol. Rev. 89, 6-30. 109 Taylor, B.A. (1978) in: Origins of Inbred Mice (H.C. Morse, Ed.) pp. 423-438, Academic Press. New York. 110 Steinmetz, M.. Winoto, A , , Minard, K. and Hood, L. (1982) Cell 28. 489-498. 111 Schilling. J . . Clevinger, B.. Davie, J.M. and Hood. L. (1980) Nature 283, 35-40. 112 Ravetch. J.V., Siebenlist, U.. Korsmeyer. S . . Waldmann. T. and Leder, P. (1981) Cell 27, 583-591. 113 Siebenlist. U . , Ravetch. J.V., Korsmeyer. S . , Waldrnann. T. and Leder, P. (1981) Nature 294. 63 1-635. 114 Johnson. M.J.. Natali, A . M . , Cann. H . M . , Honjo, T. and Cavalli-Sforza. L.L. (1984) Proc. Natl. Acad. Sci. USA 81, 7840-7844. 115 Salsing, E. and Storb, U. (1981) Nucl. Acids Res. 9. 5725-5735. 116 Steinmetz, M., Altenburger. W . and Zachau. H . (1980) Nucl. Acids Res. 8. 1709-1720. 117 Van Ness. B . . Coleclough, C . . Perry, R. and Weigert. M. (1982) Proc. Natl. Acad. Sci. USA 79. 262-266. 118 Lewis, S . , Gifford, A . and Baltimore, D. (1984) Nature 308, 425-428.
109 119 Gibson. D.M., ,MacLean. S.J.. Anctil. D. a n d Mathieson. B.J. (1984) Immunogenetics 20. 49.%501. 120 Gibson, D.M. and MacLean. S.J. (1970) J . Exp. Med. 149. 1477-1486. 121 Baltimore. D. (1986) Nature 319. 12-13. 122 Malissen. M . , McCoy. C., Blanc, D . , ‘Trucy, J . . Devaux, C.. Schmitt-Verhulst. A , - M . , Fitch, F.. Hood. L. and Malissen. B. (1986) Nature 319. 2X-33. 123 Pech. M . and Zachau. H . G . (1984) Nucl. Acids Rcs. 12. 9229-9236. 124 Blomberg, B.. ‘Traunecker, A . . Eisen. H. and Tonegawa. S . (19x1) Proc. Natl. Acad. Sci. USA 78. 3765-3769. 125 Miller, J.. Bothwell. A . and Storb. U. (19x1) Proc. Natl. Acad. Sci. USA 78. 3829-3833. 126 Blomberg, B. and Tonegawa. S . (1982) Proc. Natl. Acad. Sci. USA 79. 53(&533. 127 Miller, J . , Selsing, E . and Storh. U . (19x2) Nature 295. 328-430. 128 Redly. E . B . . Blomberg. B., Imanishi-Kari. ‘I.. Toncgawa. S. and Eisen. H . N . (1984) Proc. Natl. Acad. Sci. USA 81, 2484-2488. 129 Schwartz, D.C. and Cantor. C.R. (1984) Cell 37, 67-75. 130 Hietcr, P . A . , Hollis, G.F.. Korsmeycr. S.J.. Waldmann. T . A . and Ledcr, P. (1981) Nature 294.
536540. 131 Udcy, J . A . and Blombcrg, B. (1987) Immunogenctics 25, 63-70. 132 Emanuel. B.S., Cannizarro. L.A.. Tsulmoto. Y . . Nowell, P.C. a n d Croce. C.M. (1985) Nucl. Acids Res. 13. 381-387. 133 Klein. J . (1975) in: Biology of the Mouse llistocompatahility-2 Complex. pp. 105-230. Springer-
Verlag, New York. 133 Harttnan. A.B.. D‘Hoostelaere. L . A . . Potter. M. and Rudikoff. S. (1986) in: Current Topics in Microbiology and Immunology Vol. 117 ( M . Potter. J . H . Nadeau and M.P. Cancro. Eds.) pp. 131-148. Springer-Verlag. Berlin. 135 Lieberman, R . , (197X) Springer Semin. Immunopathology 1. 7-30. 136 Huang. C.-M.. Parsons. M.. Oi. V . T . . Huang. J . S . . Herzcnbcrg. L.A. (1983) Imniunogenetics 18, 31 1-321. 137 Ben-Neriah, Y., Cohn. I . B . . Rcchavi. G . . Znkut. R . and Givol. D. (1981) Eur. J . Imniunol. I I . 10 17- 1022. 138 Karjalainen. K. (1980) Eur. J. Immunol. 10. 132-139. 139 Rudikoff, S. and Potter. M . (1980) J . Immunol. 123. 2089-2092. 130 Perlmutter. R.M.. Berson. B.. Griffin. J.A. and Hood. L. (1985) J . Exp. Med. 162. 1998-2016. 141 Kelsoe. G . and Farina, D. (1987) i n : Evolution and Vcrkbrate Immunity ( G . Kelsoe and D . H . Schulze. Eds.) pp. 163-174. University of Texas Press. Austin. 112 Kroncnberg. M., Siu, G . . Hood. L. and Shastri. N . (1086) A n n u . Rev. Immunol. 4. 528-591. 143 Reynnud, C - A , , Anqucz. V.. Grirnal. H. and Weill. J.-C. (1987) Ccll. 48. 379-388. 144 Yancopoulos. G . D . , Desidcrio. S.V.. Paskind, M . , Kearney. J . F . , Baltimore. D. and Alt, F.W. ( 1984) Nature 3 I 1. 727-733. 145 Hayakawa, K.. Hardy. R.R.. Parks. D.K. a n d Ilerzcnberg, L.A. (1983) J. Exp. Med. 157, 202-21X. I46 Shlomchik. M.J.. Nemazee, D . A . . Sato. V.L.. Van Snick. J . Carson. D . A . and Weigert. M . G . (1986) J . Exp. Med. 164. 407-427.
This Page Intentionally Left Blank
F. Calahi and M.S. Ncuherger (Eds.) Mo/ec,rr/orG c v r r ~ r i c su/ /,rir,iitnoR/ohir/i,i
0 1987 Elscvier Science Publishers B.V. (Biomedical Division)
111 CHAPTER 4
Assembly of immunoglobulin variable region gene segments MICHAEL RETH" and LISE LECLERCCPb .'Institute f o r Genetics, University of Cologne, Weyertal 121, 0-5000 Cologne 41, FRG and 'lnstitut Pastrur, 25 rue du Docteur Roux, 75015-Paris, France
I . Introduction Cells of the immune system of vertebrates carry on their surface variable receptor molecules which are able to bind an unlimited variety of determinants thus protecting the organism against many different pathogens. To reach the high variability necessary for this task, the genes coding for the variable part of the receptor molecules have evolved a unique recombination mechanism which allows their somatic assembly from gene segments. On B cells, the variable receptor molecules are immunoglobulins consisting of a heavy and a light chain. The genes encoding the variable part of these chains are assembled during B cell development from different gene segments which are VH, D, JH for the heavy chain variable region and V, and JL for that of the light chain. The somatic reorganization of the V-gene segments was first described in 1976 by Tonegawa and his colleagues [ 1-41, who found that the location of V, gene segments in mature B-cell lines (myelomas) differs from that in the germline. Cloning and sequencing analysis have since revealed the organization of the V gene segments at the IgH and IgL loci (see Chapter 3). However, a dynamic picture of the order and control of rearrangement events during B cell development has only recently been obtained by the study of Abelson pre-B cell lines. Abelson cells are obtained after an infection of mouse foetal liver or bone marrow cells with Abelson-murine leukaemia virus (A-MuLV) which specifically transforms early pre-B cells with incompletely rearranged V genes [5-71. During their growth in culture, many Abelson cells continue to assemble their V genes, thus allowing a detailed study of this process [7,8]. The first part of this chapter summarizes the current knowledge of the rearrangement process with a focus on studies of Abelson lines. We then describe the different rearrangement events, according to their order of occurrence during the B cell developmental pathway. In this second section, we hope to demonstrate how proliferating pre-B cell clones are using the rearrangement process and a multiple joining strategy to fulfill two tasks: the generation of a highly diverse set of variable region genes and the expression of a functional antibody molecule on each B cell. The final section of this chapter summarizes the
112 recent data concerning the feedback mechanism responsible for the allelic exclusion of immunoglobulin gene expression.
2. The rearrangement mechanism 2. I . Joining signals Most of the enzymes mediating the rearranging process have not yet been identified and characterized in detail. Thus, our knowledge of the DNA cutting and religation events that take place during joining is only indirect. However, the sequence analysis of gene segments before and after their rearrangement has given us some insight into the order and mechanism of the joining process. Each V gene segment is flanked o n one or both sides by conserved sequences consisting of a heptamer abutting the end of the segment and a nonamer which is separated from the heptamer by a spacer region of either 12 or 23 base pairs. These sequences are called joining signals or recognition sequences [9]. Joining signals flanking the 5' end of a segment have the consensus sequence GGTTTTTGT-spacer-CACTGTG, while those flanking the 3' end of a segment have the consensus CACAGTGspacer-ACAAAAACC (Table 1). Notice that the two sequences are inverted complements of each other: thus an inverted 5' joining signal is identical to a 3' joining signal. The conservation of the joining signal is not absolute. Nonamers always contain an A or T rich core but their sequence can vary in five out of nine positions. The heptamer sequence is more strongly conserved; indeed the four nucleotides (TGTG or CACA) flanking the segment are nearly invariant, which suggests that these sequences play an important role in the recognition or cutting reactions of recombinase enzymes (see below). The sequence of the spacer region between the heptamer and nonamer is not conserved; however, its length has to be either 1222 or 2 3 k 1 base pairs. The highly conserved spacer length corresponds to one or two turns of a-helical DNA and maintains precise spatial orientation between blocks of conserved sequences within the heptamer and the nonamer. Thus similar recombinase enzymes should be able to bind to either a 12 or a 23 base pair joining signal on the DNA helix. Analysis of many V gene rearrangements revealed the general rule that two segments are joined together only if they are flanked by joining signals of different spacer length (12/23 joining rule). T o account for this rule, the following molecular mechanism was suggested [9]: the 12 or 23 base pair joining signals would be detected by different recombinases which, after binding their respective recognition sequence, would come together to form the active recombination complex (see below). An exception to the 12/23 joining rule was recently found in rearrangement events which involved a segment flanked by a 22 base pair spacer joining signal and a segment flanked solely by a heptamer [lo-151. In these rearrangements, an isolated heptamer was obviously recognized in the absence of a nonamer by t h e recombinase proteins. These findings suggest that the heptamer is the most important part of the joining signal, a notion supported by the strong conservation of its se-
113 TABLE 1 Conserved joining signals 5' joining signal
Segment
D-FL16 D-SP2 D-Q52 D-I1XIA Dpl v,,7 183 V, , 0 5 2 V1,441 v,,s107 V,,S58 V,,XIA V,2 1B VA 1 VA2
V,?B4 VJH gv,, V,10.8 Consensus
Nonamer
Spacer
Heptamer
Ref.
I? 12 12 21 23 23 2.1 23 23 23 23 12 22 23 23 21 24 23
The exainplcs above come from the immunoglobulin and T cell receptor loci of different species
114 quence. Furthermore, the heptamer consensus sequence is palindromic around the central nucleotide, a characteristic of many sequences detected or cut by DNA binding proteins. 2.2. Joiriing models The rearranging mechanism is a special form of non-homologous recombination which so far has only been found at the J clusters of B or T lymphocytes. In fact, the same recombinase system may be responsible for rearrangement events at all variable gene loci in T and B cells as suggested by the ability of an Abelson preB cell line to rearrange introduced T cell receptor gene segments [16]. Furthermore, in mice with severe combined immunodeficiency a genetic defect involving the recombinase system results in abnormal joining events in both developing B and T cells [17]. The phylogeny of the rearranging mechanism is presently unknown; however, it seems to have been present from the beginning of vertebrate evolution since sharks, one of the most primitive members of this group, have V, D and J segments flanked by joining signals (Table 1) identical to those found in mammals [18,19]. The observation that two joints are formed during each V gene rearrangement has provided a more detailed picture of the rearrangement mechanism [20]. One of the joints is the ‘coding joint’ between the two segments and the other is the ‘reciprocal joint’ in which the heptamers of the two segments are fused together [21,22]. Reciprocal joints were first discovered at the K locus [23] where, after a V,-J, assembly, both joints are often retained on the same chromosome (see Section 3.2.1.). The two joints differ in one intriguing aspect from each other. While the reciprocal joint is a precise ligation of the two heptamer sequences, the coding joint is imprecise. Nucleotides are generally lost from the ends of the segments before these are ligated together. These deletions can be as large as 20 nucleotides [24]. Furthermore, many D to JH or V, to DJH coding joints contain sequences which are neither present in the germline segments nor do they derive from sequences elsewhere in the genome. These sequences are called N sequences [20] and seem to be added to t h e segment ends in a template-free fashion (see below). The existence of a reciprocal and a coding joint o n the same chromosome cannot be easily explained by early joining models such as the copy and insertion mechanism [25-271. The model which accounts best for the different observations is that first proposed by Alt and Baltimore [20] and is depicted in Fig. 1. Once proteins have detected and bound two segments with different joining signals, a protein-DNA complex is formed in which both gene segments are held stably together (stage 1). In this complex, double-stranded DNA cuts occur precisely at the heptamer segment border, after which the heptamers are fused directly together (stage 2). The ends of the two segments are not immediately ligated but are first exposed to modifying enzymes such as double-strand exonuclease or terminal transferase which will delete or introduce nucleotides at the segment ends prior to the final ligation (stages 3-5). The modifications at the coding joint play an important role in the generation of antibody diversity. They explain why most joints
115
D
9 GCAAAAACC CGTTTTTCG
CACTGTG CACACTC GTGACAC CTGTCAC
GCAAAAACC CCTTTTTCC
J double-strand exonuclease 7 loss of bases
terminal transferase base addition
DNA polymerase and ligase ? base replication and strand joining
G C C C 1.C C C T C C CCA GCGA
0
J
Fig. 1. Joining model of a D to J segment joint. For explanation, see the text. (Taken from [ I ] and 1201)
differ from one another even when they use the same germline segments. However, the modifications also have one disadvantage: due to the flexible nature of the joint, the two segments are often (statistically in two out of three cases) not connected in the right reading frame and thus generate non-functional V genes. We will learn in a later section that a multiple joining strategy has developed which may overcome this disadvantage and favour the generation of a functional V gene (see Section 3.1.3.). The observation of chromosomal translocations in some leukaemias, in which a J H segment is brought in the vicinity of a cellular oncogene, suggests that immunoglobulin gene rearrangement may play a role in the oncogenic transformation of lymphocytes [28,29]. In rare cases, an active recombinase
116 complex containing a double-stranded DNA cut at the heptamer-segment border may be disrupted prior to the ligation step; the free DNA ends can then recombine elsewhere, resulting in a chromosomal translocation and possibly in the transcriptional activation and deregulation of oncogenes. The formation of two joints during each V gene rearrangement provides a satisfactory explanation for the occurrence of deletions and/or inversions of intervening sequences after a joint [20-22,30,31]. If the joining signals used are pointing towards each other, their fusion generates a circle of intervening sequences which is subsequently lost from the genome (Fig. 2, a). If, however, the two joining signals used have the same orientation, the coding joint and the reciprocal joint are retained on the same chromosome and generate a total inversion of the intervening sequence (Fig. 2, b). The D elements are flanked on each side by 11 base pair joining signals, either of which can be used in the joining to a JH segment. Depending on which l l base pair joining signal is used, the D to JH joint will be accompanied by either a deletion or an inversion of intervening sequences. Even though one case of inversion has been reported [20], most D to JH joints are accompanied by deletions [24] demonstrating that the 3' signal is predominantly used in this joint. In V, to J, joints, on the other hand, inversions are generally found [30,31] suggesting that most V, segments are inverted on the chromosome with respect to the J, cluster (see Section 3.2.1.). An inversion joint has also been described at the T cell receptor p chain locus and, in this case, the inverted orientation of the V, and DJ, segments prior to joining was directly proved by mapping and sequence analysis [32]. An extreme case of inversion of nearly half the chro-
Fig. 2. Deletion and inversion joining. The deletion (a) o r retention (b) of intervening sequences after a joint is dependent on the chromosomal orientation of the two segments involved. The segments are indicated by boxes and the joining signals by triangles. Two fused triangles represent the reciprocal joint. Arrows indicate the transcriptional orientations of the gene segments. (The Fig. was modified from [20].)
117 mosome occurred during the abnormal rearrangement of an immunoglobulin VH segment to the T cell receptor J, locus [33]. Of all the enzymes thought to be involved in the rearranging process (doublestrand DNase and exonuclease, terminal transferase, DNA polymerase and ligase) only the terminal transferase has been identified and characterized. The enzyme adds deoxynucleotides to the 3' end of DNA and shows a preference for dGTP [34]. The frequent presence of this nucleotide in N sequences (see above) suggests that such sequences are generated by the terminal transferase [20]. The enzyme activity is high in developing T and B cells, and was first detected [35] in the organs where lymphocyte development takes place (the thymus or the bursa of Fabricius in chickens). During B cell development, the expression of terminal transferase declines. This may be the reason why N sequences are predominantly found in early joints, such as D to JH or some of the VH to DJH rearrangements [24,36], but only rarely in VL genes which are assembled at a later stage of B cell development [31,37]. Studies of V gene rearrangements in Abelson lines have provided more direct evidence for the generation of N sequences by terminal transferase [16,36]. In one experiment, a plasmid containing D and J segments from the T cell receptor p chain locus was introduced into a foetal liver-derived Abelson line, and daughter cells were analysed for rearrangements of the introduced segments. Several of the DJ complexes formed were analysed, and N sequences were only found in complexes isolated from daughter lines that expressed terminal transferase [ 161. In addition, the above experiment demonstrated that the recombinase system of the B cell is perfectly able to recognize and rearrange T cell receptor gene segments. Thus, the same recombinase system seems to be responsible for rearranging variable region gene segments in both T and B cells. The characterization of other proteins involved in the joining process is still in its infancy. There have been reports of a double-strand DNase activity in cells or organs of B cell development [38-401. However, none of these enzymes is highly specific for the heptamer-segment border and they also cleave several unrelated TG-rich sequences [40]. The failure, so far, in identifying more of the enzymes involved in the rearranging process suggests that such enzymes either have a low abundancy or are only active in a structured protein-DNA complex which is difficult to study by classical biochemical approaches. Furthermore, our limited knowledge of the topology of the DNA at the stage where joining occurs is also hampering our understanding of the molecular mechanism of joining. Thus, at present, it is impossible to prove or disprove the details of the joining model described above by enzymological studies. 2.3. Control of joining The manner of the activation of V gene segments in the rearrangement process shows similarities to that of the expression of eukaryotic genes. Variable region gene rearrangements are tissue- and stage-specific events. So far, they have been found only in B and T lymphocytes and are restricted to a certain developmental stage of these cells. The similarities between gene expression and gene segment
118 activation suggests that the two systems possess common mechanisms. One of these mechanisms seems to be the controlled ‘opening’ of the chromosome as put forward in the accessibility model of joining [16,41]. Most regions of eukaryotic DNA are covered by proteins (chromatin) which protect the genome from uncontrolled expression. The expression of a gene requires the opening of the chromatin structure and the same has been proposed for the rearrangement of V gene segments [42]. A plasmid containing unrearranged D and JH elements linked to the thymidine kinase (rk) gene as a selectable marker was introduced into a t k - Abelson cell line. The frequencies of rearrangement of the introduced D and JH segments could be drastically increased if the cells were grown in selective (HAT) medium. Obviously, only cells expressing rk survived the selection and the transcription of the transfected tk gene ensured an open chromatin structure for the adjacent situated D and JH segments; these thus became accessible to the recombinase enzymes. The correlation between accessibility and rearrangement was even more directly shown in another experiment in which a plasmid containing V, and J, segments was introduced into an Abelson line [43]. Eleven copies of this plasmid were stably integrated at different locations in the genome but rearrangement occurred on only one of these copies during culture. The chromatin structure of the integrated DNA was tested by a DNase I sensitivity assay [16,43]. Of all the integrated plasmid copies, only the one which could rearrange in culture was DNase I sensitive, thus indicating that an open chromatin structure is one of the requirements for joining to occur. During B cell development, the specific opening of the chromatin structure at the three immunoglobulin loci is indicated by their transcriptional activity; this is observed shortly before or at the same time as rearrangement. Such transcripts derive either from unrearranged V gene segments or from around the J clusters; they are called germline or sterile transcripts because they never encode a mature immunoglobulin polypeptide 144-481. Whether these transcripts play a direct role in the rearranging process itself, is presently unknown. Their role could be more indirect, for example by either opening an immunoglobulin locus and/or by ensuring that it stays open. Accessibility is probably one of the most important control mechanisms of the rearrangement process. However, additional control elements have to be postulated to explain the behaviour of the gene segments during V gene assembly. At the IgH locus, for instance, all rearrangement events are focussed on the JH region. VH to D joints, although possible according to the 12/23 joining rule [9], are only observed in the form of a V, to DJ, joint once a D element has been appended to a J H segment [8]. Likewise. VH to VH joints are theoretically possible (see Section 3.1.3.) but are only seen as VH to VHDJH replacement joints (14,151. This order of joining cannot be solely explained by the accessibility model. In an Abelson line, which simultaneously performed D to J H and V, to DJH rearrangements, VH and D elements were clearly both accessible and nevertheless no V, to D joints were found [24]. Thus, the rearranging process may be controlled in such a way that an active recombinase complex can only be formed at the JH locus. Another phenomenon that still lacks an explanation is the ordered usage of J,
119 elements during V, gene assembly. At the K locus, four functional J, segments (J,1 to J,4 in a 5' to 3' order) are located on a 2 kb region of DNA which is transcribed in J, rearranging cells [46,47]. This suggests that all four segments are situated in an open chromatin domain and should thus be equally accessible to recombinases. However, J,l and J,2 are used much more frequently than J,3 and J,4 in the V, to J, joining process [49,50]. Furthermore, an analysis of B cells carrying V,J,2 complexes revealed that these cells had previously formed a VJJ complex [51,31]. Thus, during V, assembly, the J, segments seem to be used sequentially in a 5' to 3' direction. This J, usage pattern can be explained by a tracking model of joining [52] which postulates the existence of proteins that glide along the DNA helix until they find an appropriate joining signal to which they then bind. The ordered J, usage pattern may be the result of such a tracking mechanism if one assumes starting sites for tracking 5' of the J, locus and a 5' to 3' direction for the search. At the IgH locus, a similar 5' to 3' usage pattern is seen for D and J H elements [24]; this could be due to the same molecular mechanism (see Section 3.1.1.).
3. Order of rearrangement events during B cell development 3.1. Rearrangements at the IgH Iociis During B cell development, J H rearrangements occur in an ordered fashion. The assembly of D to JH segments precedes V, to DJH joining which can itself be followed by a V, to VHDJH joint (V, replacement; Fig. 3). These different rearrangements will be described in detail in the following three sections. 3.1.1. D to .IHjoints A D segment encodes most of the third complementary determining region (CDR3) of the V, domain. It is only 1G23 nucleotides long and is flanked on both sides by 11 base pair joining signals [53-561. Twelve D segments are located within 80 kb upstream of the four J H elements of the mouse [52].These D segments are clustered in homology groups and have the following 3' to 5' order: the single DQS2 segment lies SO0 base pairs 5' of J H 1 followed by nine D-SP2 segments and, finally, by two D-FL16 segments, which are the most upstream of the known D segments. A D to JH joint is the first rearrangement observed at the IgH locus. It seems to happen very early during B cell development. Indeed, all Abelson cells analysed so far that represent early pre-B cells, already carry a DJH complex on both IgH alleles [S]. This may indicate that the first D to JH joint occurs in a precursor B cell which cannot yet be transformed by the Abelson virus. It is even possible that the first D to JH joint takes place in a pluripotent precursor that is able to give rise to both T and B cells [57]. Between 10 and 20% of T cells carry DJH rearrangements although they never assemble a VHDJH complex [54]. Such T cells may be derived from a common TIB precursor [S7]. Alternatively, it is also possible that D to JH rearrangements take place occasionally during T cell development.
120
/
0-0 stem-cell
B- precursor
\
r
w
\
/
'\,-
;
- ,*/ \
time Fig. 3. J , , rearrangements during B cell development. Thc different rearrangement events during the clonal expansion of a B precursor are indicated on the top. Representative cells are drawn as circles indicating the rearrangement status of each cell. Notice that the p-positivc pre-B cell stage can he reached following different routes. The possible branching points to the T cell differentiation pathway are drawn as dashed lines.
A D to J H joint can occur several times on a single allele. This point became clear from the analysis of Abelson lines which originally carried a D-SP21J.3 complex on both JH alleles [24,58]. One of these lines (300-19) frequently used an upstream D element and the free JH4 segment to replace the previously formed DSP2/JH3complex (Fig. 4). The CDR3's encoded by the newly formed DJH4 complexes differ greatly from those encoded by the original DJH3 complexes (Fig. 4, c). Thus, secondary D to J H joints, which occur in 10-20% of the subclones analysed [24], may play an important role in the generation of antibody diversity. Theoretically up to four D to JH complexes can be sequentially produced on a single allele if the four JH segments are used in a 5' to 3' order, in a manner analogous to J, segments. However, once a V, segment is appended to the DJH complex, no further D to JH joint can occur because all other D segments are deleted ~~~~
~~~~~
~~~~~~~~~
Fig. 4. Secondary D to J , , rearrangement. The two DJtI3 complexes of the Abelson line 300-19 are replaced in one of its subcloncs (300-19 P4-12) by DJ,,4 complexes. (a) Location of D and J,, elements on the two IgH alleles (A and B) of 300-19. The secondary D to J,,4 rearrangements of P4-12 are indicated by arrows. (b) Sequences o f the DJ,, complexes o f 300-19 and P4-12 are compared to those of gerrnline D and J,, elements [9,54.55]. Crossover points arc marked and N-sequences are boxed. Heptamers of the S' o r 3' joining signal are underlined. (c) CDR3 sequences potentially encoded by the DJ,, complexes of 300-19 and P4-12. Amino acids determined by N-sequences are boxed and J,-sequences are underlined. (Taken from [24].)
121 during the VH to DJH joining. A DJ, complex is also fixed once the most upstream D (D-FL16) and the most 3' J,, elements (JH4) are used. To understand the biological function of multiple D to JH joining, it is important to realize that all rearrangement events occur in rapidly dividing pre-B cell clones [59,60]. How many different stem cells are giving rise to the pre-B cells generated
DFLl6-1
DSP-1 DSP-2
DSP-3
DSP-4
DSP-5
DSP-GJH~
I DSP-1J H ~
300- 19 Paaen_t
@
A
DSP-4
TACTGTGCCTAC
B
DSP2.6 DSP-6
TACTGECCTACTATAGTTACT
A
DFL16.1 DFLlG-1
TACTGTGTTTATTACTACGtiT TACTGTGTITATTACTACGAT
GGCCAAGGGACTCTGGTCATC (JH3) GGGACTCTGGTCATC (JH3)
CTATGGACTA CTATGGACTA
(JH4) (JH4)
LeuLe&GluGlySerThkGlyGln
(JH3)
B DSP-1
300-19 Pacent
@
A
DSP-4
B DSP-6
P r o T h r I l e V a l T h r ~ T r p P h e A l a T y r T r p G l y G l n (JH3)
5mL1LmePP$-12_ A
DFL16-1 T y r T y r T y r A s p G l y S e r T y a T y r A l a M e t A s p T y r T r p G l y G l n
(JH4)
B
DSP-1
(JH4)
SerMetMetValThrSerTyrTyrAlaMetAspTyrTrpGlyGln
122 TABLE 2 Usage of D and JI, segments in unselected VHDJHcomplexes (155,681 and Dildrop et al.. unpublished)
D-QS2 D-SP2 D-FL16 X Z (total)
Jlll
5112
5143
3114
Z
0
2 3 5 3 13
0 4 4 3
0
2 12 21 14
11
18
0 6 1 7
S
6 7
Data were obtained from myelomas or hybridomas from B cells activated with bacterial lipopolysaccharide. X. D element used could not be identified.
daily in the mouse bone marrow is presently unknown. Their number may be small and many of them may have already performed a first D to JH joint (see above). Without further joining abilities, the progeny of these stem cells would be restricted in their DJH variability. Taking into account the flexibility of the joint (see Section 2.2.), one may predict that secondary D to J H joints occurring throughout the clonal expansion of a pre-B cell will yield a population with diversified DJH alleles. However, secondary D to JH joining will only be profitable provided it occurs at the same developmental stage and with a similar frequency to that of VH to DJHjoining; otherwise, a newly generated DJH complex will be replaced before it has a chance to be stably integrated into a VHDJH complex. In one Abelson line analysed, secondary D to J H and VH to DJH rearrangements indeed occurred with roughly equal frequency [24]. Evidence for frequent DJH replacement during B cell development has also been obtained from an analysis of the D and JH usage in VHDJH complexes of myeloma or unselected hybridoma proteins (Table 2). The J,1 segment is found less frequently and, even then, only in association with a member of the most 5' D family (D-FL16). Thus, most DJHl joints (with the obvious exception of D-FL16/JH1see above) may have been replaced by another DJ, complex before VH to DJH joining occurs. Multiple joining events also occur at the K locus and seem to be a general mechanism during V gene assembly. This notion is supported by the fact that most V, D and J segments are present in multiple copies, thus allowing this type of joining. An extreme case is the T cell receptor a locus which contains at least 50 J elements, although multiple V to J joints at this locus have not yet been demonstrated [62]. The analysis of VHDJH complexes in myelomas and hybridomas mentimed above showed another peculiarity. The D-FL16.1 element was used more frequently than any of the nine D-SP2 elements. One reason for D-FL16 dominance may be the fact that the D-FL16/JH complex cannot be replaced by another D to JH joint. However, in Abelson lines, dominance of D-FL16 is also due to the preferential usage of upstream D segments. D-FL16 was used in eight out of 14 cases while the usage of the other (D-SP2) element declined in a 5' to 3' gradient [24]. The DJH complexes are transcribed in pre-B cells. The 5' region of most D ele-
123 ments contains a functional promoter; after a D to JH joint, this promoter is activated and the DJH complex gives rise to a D p mRNA containing the DJH complex and the C, exons. Such transcripts are translated into D p protein if a D to J, joint places the AUG start codon of the D segment in the same reading frame as the JH coding sequence [63]. The amino terminal sequence of the D p protein shows strong homology to leader sequences. The presence of a leader sequence along with the glycosylation of the D p chain suggests this protein enters the endoplasmic reticulum [45]. The role played by the D p transcript and/or by the DF protein during B cell development is still unclear. However, similar transcripts occur at the T cell receptor /3 locus where a DJ, complex is transcribed and, presumably, translated [64].
3.1.2. VH to DJH rearrangement There are 100-1 000 V, segments located at an unknown distance 5' of the D segments. These V, segments can be grouped in nine V, families whose members share more than 75% sequence homology (see Chapter 3 and [65-68]). The V, segments of different families are, in general, organized in separate clusters [67,69]. An exception is found in the elements of the most 3' families VHQ52 and V,7183 which are interspersed [24]. Studies of recombinant inbred mice [66] and a deletion analysis of Abelson lines bearing different VHDJH rearrangements [24] have allowed the order of these V, families on the chromosome to be determined (see Table 3 ) . How the different V, segments are activated for a V, to DJH joining is still unknown. This activation seems to require control elements active in B but not in T cells because the latter cells may undergo D to JH but never V, to DJH rearrangement [54]. Germline V, transcripts have been found in pre-B cells and may be part of the activation process [70]. A sequence analysis of rearranged V, segments found in Abelson lines that have been derived from foetal liver of BALBic mice revealed that the V, segments are not used randomly but in a highly restricted manner [71]. Most VHDJH complexes contained a V, segment of the V,7183 family. In particular vH81x, the most 3' ( J H proximal) functional V, segment of this family was predominantly rearranged in several independent Abelson lines [36,71]. The same preferential usage pattern was subsequently found in un-transformed foetal liver cells and hybridomas made from foetal liver pre-B cells [71,73]. Preferential V, usage was also analysed in an Abelson line (300-19) derived from the bone marrow of a NIH/Swiss mouse [24]. In this mouse strain, V,Q52 segments are the most 3' elements of the V,, cluster and, indeed, they are predominantly used for rearrangement in daughter cells of the 300-19 line. However, V, segments of other V, gene families were also rearranged in this line, although with a much lower frequency. Whereas V, elements of the nine Vkl families are not randomly used in foetal liver- or bone marrow-derived pre-B cells, resting splenic B cells or splenic B cells activated with bacterial lipopolysaccharide carry VHDJH complexes that contain V, segments of all the different families [74]. The V, family usage in these cells is roughly proportional to the size of each family and does not show any prefer-
124 TABLE 3
V,, usage of assembled V,,DJ,, complexes in pre-B and B cells [24.67,70.74] V,,family
V,,606
Vf136-60
VHSS8
V,,441
V,,S107 VFlQS2
Family size
10
2
4
12
12
3
9 4
100
Pre-B cells B cells
1 33
1
2 1
13 1
25 1
3
V117183
V,l families are given according to their presumed S‘-3‘ order
ence for those V elements situated at the 3’ end of the locus (Table 3). How this transition from a highly restricted pattern of V, usage in pre-B cells to a broader V, usage in B cells happens is an intriguing problem to which we do not have the answer. A VH usage program may exist which opens the V, locus in a 3’ to 5’ direction during B cell development; all Abelson cells as well as normal foetal liver cells may be restricted to the early stages of this program. Alternatively, a less abundant pre-B cell population with rearrangements of the more 5‘ located V, segments may develop into B cells and thereafter be selected by the immune system, thus dominating the B cell compartment in the spleen. However, it is also possible that the V, to VHDJH rearrangement mechanism (see below; [14,15]) is influencing the shift in usage pattern (see Section 3.1.3.). A V, to DJH joint is, in general, accompanied by deletion of all intervening sequences on the same allele including all free D segments [S]. Thus, in contrast to the D to JH joint, a V, to DJH joint can occur only once on a given allele. Like all the coding joints, the V, to DJH joint is flexible and is not restricted so as to ensure that V, and J H coding sequences remain in the same reading frame. Statistically, one could expect only 33% of the VH to DJH joints in pre-B cells to be in frame and to result in the expression of a p-polypeptide. Indeed, an extensive study of VH to DJ, rearrangements occurring during culture of an Abelson line showed that productive VHDJH complexes were assembled with roughly the expected frequency of 33% [24]. However, one should keep in mind that the frequency of productive V, to DJ, rearrangements in the pre-B cell population may even be lower if the D sequence used contains a stop codon in the appropriate reading frame [45,75] or if the V, segment used is a V, pseudogene with crippling mutations [24,36]. 3.1.3. VH to VHDJH joint As mentioned above, a VH to DJH joint is productive only in at most 33% of the cases and can occur only once per chromosome, generating up to 50% of pre-B cells with non-functional VHDJH complex on both alleles. These ‘null’ pre-B cells were formerly regarded as dead-end products of the B cell developmental pathway. However, recent studies have revealed that these cells have another joining option (14,151. Most VH segments contain within their coding sequence a heptamer joining signal lying just seven nucleotides upstream of their 3‘ end. This VH heptamer has the same sequence as the heptamer located at the 5’ side of a germline D segment and is still present after a V, to DJH joint. Thus, similarly to a
125 DJ, complex, a VHDJH complex carries a potential 5’ joining signal and can be joined to an unrearranged VH segment that is located upstream and that carries a 3‘ signal (Fig. 5 ) . Products of such a V, to VHDJ, joint have indeed been found [ 14,151. In two different null cell lines carrying non-functional VHDJ, complex, such a V, replacement resulted in the construction of an ‘in phase’ VHDJH complex and subsequent production of p chain. Because most VH segments carry an internal heptamer, a V, to VHDJ,, joint can occur several times on a chromosome, thus increasing the chance of the formation of a productive VHDJH complex. However, a VHDJH joint can also occur on a productive VHDJ, complex with or without destroying its ability to produce p polypeptide. The internal V, heptamer is highly conserved in most mouse and human VH segments, suggesting that V, to VHDJH joining may play an important role during B cell development. This role may be to rescue production of p chain in null preB cells or to diversify the V, segment repertoire. The contribution of V, to VHDJH joining to the 3‘ to 5’ shift of V, segment usage observed in a comparison of preB cells and B cells (see Section 3.1.2.) has not been demonstrated from data that are presently available. Indeed, in the cases analysed so far, the replacing and replaced v, segments were either neighbours or were found to lie in close proximity on the same chromosomes, suggesting that the V, to VHDJH joint is a locally restricted event. Thus, upstream v, segments may be activated for the joining to VHDJH complexes by the nearby situated IgH enhancer element, which provides an open chromatin structure in its surrounding [7&78]. ,CACAGTGI
,TACTGTG,
I
1
VH
her
gmer
9mer
7mer
D
JH
Fig. 5 . V,, to VI,DJ,, joining. A V, to DJ,, joint is shown for comparison on the top. Heptamer and nonamer of a joining signal are indicated by black triangles. The internal V, heptamer is shown as a white triangle. The location of the IgH enhancer (E) is indicated. Notice that V,, to VHDJ,, joints could occur repeatedly on the same IgH allele.
126
3.2. Rearrangemerits at the light chain loci Immunoglobulin light chains are encoded by two different IgL loci ( K and A) situated on separate chromosomes of the mouse. Assembly of light chain variable regions occurs later during B cell development than that of heavy chains, as evidenced by studies of immunoglobulin expression in liver cells of mouse embryos at different stages; light chains are always found later than heavy chains [79-811. The later assembly of V, genes is also established by analyses of foetal liver hybridomas and Abelson pre-B cell lines, all of which carry JH but only rarely J, rearrangements [7,81,82]. A recent study of an Abelson line, which assembled its VH gene as well as its V, genes during culture, indicated that the delayed V, assembly is due to regulation [83]. Rearrangements of V, to J, were only found in those daughter cells which carried a productive VHDJH complex and expressed a p chain. Thus, p chains seem to have a positive regulatory function in inducing the rearrangement process at the J, locus. The activation of the two different IgL loci is ordered in that V, to J, rearrangements always precede V, to J, rearrangements [84]. The activation of the A locus seems to be dependent on rearrangements (RS rearrangements - see below) which render the two J, alleles non-functional [ 11-13]. Thus, analogously to rearrangements at the IgH locus, the rearrangements at the light chain loci occur in an ordered and controlled fashion.
I I
.
2" VKto JK
1" VKto JK I
RS
Vx to J i
& &
@ KYKO
pre-Bcell
Bcell
time
Fig. 6. J, rearrangements during B cell development. The different rearrangement events during the clonal expansion of a pre-B cell are indicated on top. Circles indicate representative cells which have different rearrangement status. The ordcr o f RS (see Fig. 7) and V, to J, rearrangements is hypothetical: thus, only one of the many possible pathways of rearrangement at the A locus is illustrated. The loci are symbolized: K O , germline I g K locus; K + , productively rearranged and K . , non-productively rearranged I ~ alleles. K
127 3.2.1. V , to J , rearrangement Four functional J, segments are found several thousand base pairs 5’ of the C, exon [85] and 100-200 different V, segments are available for the V, to J, joint. As already mentioned (see Section 2.3.), the frequency of usage of each J, segment during V, gene assembly seems to follow a 5’ to 3’ gradient with J,1 being the most frequently and J,4 the least frequently used J, segment [49,50]. The ordered J, usage allows a p-positive pre-B cell to undergo several V, to J, joints on each J,-allele. Multiple V, to J, rearrangements may not only ensure the assembly of a productive VJ, complex; they may also allow each pre-B cell to assemble and test several productive V,J, complexes until one of them produces a functional K light chain capable of binding the pre-existing heavy chain with high enough an affinity to form an antibody molecule. Such a molecule is thought to induce feedback control (see Section 4.), stopping any further V, to J, rearrangements [86,87]. Multiple V, to J, rearrangements could thus be regarded as a program to find the best fitting light chain for the pre-existing p heavy chain. Such a program would explain why, in some B cells, a productive V,J, complex is replaced by another [31] and why the heavy and light chains isolated from the same cell tend to have a higher affinity for each other than randomly recombined heavy and light chains from different B cells [88]. The assembly of K variable regions seems to involve an inversion joining mechanism (see Section 2.2.). It is, therefore, likely that many or all mouse V, segments have an inverted orientation relative to the J, cluster and it is even possible that V, segments are not situated 5’ but 3’ to the J, locus on mouse chromosome 6. A detailed study of rearranged J, alleles in B cells actually demonstrated that both inversions and deletions frequently occur during assembly of K variable re-
Fig. 7. Possible rearrangement events at the J, locus. V, segments are assumed t o have an inverse orientation to that of the J, segments. The 22 or 11 base pair joining signals are indicated by black o r white triangles, respectively.
128 gions [22,31]. For example, the V,J,1 reciprocal joint is, in most cases, retained whereas the V,J,1 coding joint is often deleted from the K locus [51]. These findings are best explained by multiple joining events, as depicted in Fig. 7. The first V, to J,1 joint inverts all sequences between the two segments used; this inversion can include V, segments which then lie in the same orientation as the J, segment. Any further rearrangement involving these V, segments is accompanied by a deletion of the intervening sequences. A retroviral vector containing the J, cluster and an inverted V, segment was introduced into an Abelson line that was actively rearranging its own K gene segments. In this experiment, the introduced segments rearranged frequently, thus convincingly demonstrating the occurrence of multiple inversion and deletion joinings at the K locus [21,22].
3.2.2. RS rearrangements Multiple V, to J, joinings occur on each K allele ensuring the expression of a functional K light chain in most B cells. However, the K locus can be rendered nonfunctional by a further rearrangement event involving a sequence (RS, for rearranging sequence) which lies 10-20 kb 3‘ of the C, exon (Fig. 7) and which is flanked by a 22 base pair joining signal [ll-13,891. The RS element can be appended to a V, segment, a joint allowed by the 12/23 joining rule because V, segments are flanked by joining signals with a 12 base pair spacer. More frequently, RS elements are rearranged into the J,-C, intron through a joint involving an isolated heptamer. Both types of rearrangement result in the deletion of the C, exon, thus preventing any K chain production (Fig. 7). RS rearrangements are regularly found in mouse or human A-producing B cells [10,11]. In these cells, both K alleles are in most cases destroyed by an RS joint while K-producing B cells only occasionally carry even a single RS rearrangement. These findings suggest that RS rearrangements play a role in the isotype switch from K to A production in developing B cells. The order of events is not yet clear. The K locus may be destroyed before or after the A locus is activated. An intriguing possibility is that the RS rearrangements are causally related to activation of the A locus. For example, a regulator gene preventing A activation may be situated between the J, and RS segments and would, therefore, be deleted after RS rearrangements. Alternatively, after disruption of the K locus, the free /-t chain may activate the A locus in the same way as it had previously activated the K locus [83]. 3.2.3. V , to J , reurrungements The A locus of the mouse carries only two V, segments but four C, exons which are organized in two clusters (CA3-CA1 and CA2-CA4) ([90,91], for a review see [92]). A single J, segment is found 1.3 kb 5’ of each C, exon. The location and orientation of the V, segments with respect to the two C, clusters is presently unknown. However, because V,1 is in most cases appended to J,1 or J,3 while V,2 is connected to J,2, it is assumed that V,1 lies 5’ of the C,, cluster and VA2 lies 5’ of the C,, cluster [92]. In rare cases, a V,2 to J,3 or J,1 joint was found [93]. The existence of these joints suggested that the V,2-CA2 cluster lies 5‘ of the V,l-C,, cluster. In the mouse, only 5% of all immunoglobulin-positive B cells ex-
129 press A light chains, most of which are VA1CAL. Less frequently expressed isotypes are A2 and A3 while A4 is a pseudogene and never expressed [94]. The sequence of VAto J, rearrangement during B cell development has not been studied so far. Many Al-expressing myeloma carry the A2 gene segments in the germline configuration, while those expressing A2 frequently have JA1 rearrangements. Taking these data together with the fact that A 1 is more frequently expressed than A2 or A3, it is likely that rearrangement of J,1 occurs prior to that of J,2. Because a single vA1 segment is present on each allele, mouse B cells have only two chances to generate a productive A 1 light chain; this happens with a one in three chance on each allele. However, a sequence analysis of productive V,1 genes revealed that several of them may have been derived from non-functional (out of phase) V,lJ,l complexes by an, as yet unknown, mechanism deleting one or two nucleotides close to the VA-J, joint [95].
4. Allelic exclusion of immunoglobulin chain expression Even though each mouse B cell can theoretically produce two different heavy chains (one from each of its IgH alleles) and up to six different light chains (one from each of its K and two from each of its A alleles), immunoglobulin chain expression in B cells is restricted to one functional heavy and light chain. This was shown in an early analysis of F1 mice whose B cells carried a different marker ( a and b ) on each IgH allele [96]. Staining of these cells revealed that they produced either an a or b type heavy chain but never u and b together in the same cell. Thus, the expression of one IgH allele excluded the expression of the other allele, hence the name ‘allelic exclusion’. Allelic exclusion is important for the function of the immune system because it ensures that each B cell expresses only one type of heavy and one type of light chain and, thus, makes an antibody molecule with a unique binding specificity. This enables the specific activation of B cells by the relevant antigens, as demanded by the clonal selection theory [97]. Studies of immunoglobulin chain expression in pre-B and B cells showed that allelic exclusion is established by a control of the rearranging process [41,42]. According to a model proposed by Alt and Baltimore [20], this control consists of a feed-back mechanism whereby the product of a successful rearrangement on one allele stops further rearrangements on the second allele. This model was tested in a p-positive Abelson line which carried a productive VHDJH complex on one allele and a DJH complex on the second allele. After several weeks of culture, the Abelson line was subcloned and daughter lines analysed for further rearrangements. N o VH to DJH rearrangements were found in this line, although secondary D to JH joints occurred on the DJ, allele and a VH to VHDJH joint was found on the VHDJH allele (Wiese and Reth, unpublished). Thus, production of p chain seems to prevent any further VH to DJ, joint, but it still allows D to JH and VH to VHDJH rearrangements to occur. The target of the feedback control, therefore, does not seem to be the recombinase enzymes themselves, but rather the mechanism responsible for activating VH segments for a VH to DJH joint. This regulation may, for example,
130 influence the accessibility of the V, locus. Indeed, no V, germline transcripts were found in p-producing Abelson lines, suggesting that once a productive V,DJH complex is formed, the V, locus becomes inaccessible [70]. The regulatory influence of the p chain was also demonstrated in experiments where a functional p chain gene was introduced into the germline of the mouse. The introduced gene was expressed as a mature p chain in many B cells of the recipient mouse, and this expression stopped or delayed rearrangements at the JH cluster [98-101]. In this case, even the D to JH rearrangement was inhibited in 40% of the Abelson pre-B cell lines obtained from the transgenic mouse. Thus, if present before the JH locus is activated, a p chain may prevent all JH rearrangements, but once a D to J H joint has occurred, the p chain regulates the V, to DJH joint. By demonstrating that expression of the p chain controls the allelic exclusion, the above experiments rule out earlier models regarding allelic exclusion as a consequence of an extremely low rate of productive V, to DJH rearrangements [lo21 or of the destruction of IgH double-producers [103]. However, in rare cases where the rearrangement control may fail, other mechanisms could possibly contribute to the allelic exclusion of immunoglobulin chain expression. Such mechanisms could be the deletion of one IgH allele which occurred in 10% of the clonal progeny of an Abelson line [24] or the inactivation of a productive VHDJ, complex by the hypermethylation of its DNA [104]. As mentioned in Section 3.2., the p chain seems to have a dual regulatory function: the cessation of V, gene assembly and the activation of the V, to J, joint [83]. Whether both types of regulation are based on the same molecular mechanism is presently unknown. The allelic exclusion of K light chains, however, seems to follow the same principle as that of the IgH chains. The only difference appears to be that further VL to JL rearrangements are stopped by the expression of a complete antibody molecule rather than by the expression of the light chain on its own. The regulatory role of the complete antibody molecule was proposed [86] after several myeloma cells had been found that apparently violated allelic exclusion, and that contained two light chains, although only one of them bound efficiently to the heavy chain [105,106]. Further support for the regulatory role of the complete antibody molecule was provided by an experiment in which the expression of a transgenic K chain inhibited J, rearrangements only in those B cells where it was bound to a heavy chain and thus assembled into a complete antibody molecule [87,107,108]. Thus, during B cell development, productive V, to J, or V, to J, rearrangement may occur on both alleles until a light chain is expressed which binds the pre-existing heavy chain with a high affinity. Heavy chain binding protein (BiP) may be involved in this control [ 103,109,110]. BiP is expressed in pre-B cells and seems to bind to the same part of the p chain as that involved in the interaction with the light chain. The binding to BiP seems to prevent the surface expression of the p chain. Only light chains with a greater affinity for the heavy chain than BiP can efficiently bind to the heavy chain, thus allowing the cell surface expression of an antibody molecule; this cell-surface expression may itself be the stop-signal for further J, rearrangements.
131 chromosome 12
chromosome 6
chromosome 16
allele A
chromosome 12
chromosome 6
chromosome I6
allele B
Fig. 8. Regulation of immunoglobulin chain expression. The expression of an immunoglobulin chain after productive V,, to DJ,, or V, t o J , rearrangement is indicated by a solid line. The regulatory influence of the IgH chain or the complete immunoglohulin molecule is indicated by a dashed line.
In summary, the expression of a functional antibody molecule on each B cell requires several regulatory circuits where the product of a given locus can either stop rearrangements of the second allele or activate rearrangements at other loci (Fig. 8). The elucidation of the molecular basis of this regulation is presently under way and may provide a fascinating illustration of gene regulation in eukaryotic cells.
Acknowledgements The authors are grateful to Eva Siegmund who helped typing this manuscript and to Udo Ringeisen for excellent graphic work.
References 1 Tonegawa, S. (1983) Nature 302. 575.
Hozumi. N. and Tonegawa. S. (1976) Proc. Natl. Acad. Sci. USA 73. 3628. Tonegawa. S., Brack. C., Hozumi, N. and Schuller. R. (1977) Proc. Natl. Acad. Sci. USA 74, 3518. Brack, C. and Tonegawa, S. (1977) Proc. Natl. Acad. Sci. USA 74, 5652. Rosenherg, N. and Baltimore, D. (1976) J . Exp. Med. 143. 1453. Baltimore. D., Rosenherg, N . and Witte. O . N . (1979) Immunol. Rev. 48, 3. Alt, F., Rosenberg, N., Lewis, S.,Thomas, E. and Baltimore, D . (1981) Cell 27. 381. Alt, F.W., Yancopoulos, G . D . , Blackwell. T.K.. Wood, C . . Thomas, E.. Boss. N.. Coffman, R . , Rosenberg, N., Tonegawa, S. and Baltimore, D. (1984) EMBO J . 3. 1209. 9 Sakano. H., Maki, R . , Kurosawa. Y.. Roeder. W. and Tonegawa. S. (1980) Nature 286. 676. 10 Hochtl, J . and Zachau, H . G . (1983) Nature 302, 260. 11 Durdik, J . , Moore, M.W. and Selsing, E. (1984) Nature 307, 749. 12 Moore. M.W. (1985) Proc. Natl. Acad. Sci. USA 82, 6211. 13 Siminovitch. K.A., Bakhski, A . , Goldman. P. and Korsmeyer, S.J. (1985) Nature 316. 260. 14 Kleinfield, R.. Hardy, R.R., Tarlinton. D . , Dangl, J . , Herzenberg, L . A . and Weigert, M. (1986) Nature 322, 843. 15 Reth. M., Gehrmann. P.. Petrac, E. and Wiese. P. (1986) Nature 322. 840. 16 Yancopoulos. G . D . . Blackwell. T.K.. Suh, H . . Hood. L. and Alt. F.W. (1986) Cell 44, 251. 2 3 4 5 6 7 8
17 Schuler, W.. Weiler, I.J., Schuler. A., Philips, R.A., Rosenberg. N., Mak, T.W., Kearney, J.F., Perry. R.P. and Bosma, M. (1986) Cell 46, 963. 18 Litman, G.W., Berger, L., Murphy, K., Litman, R., Hinds, K. and Erickson, B.W. (1985) Proc. Natl. Acad. Sci. USA 82, 2082. 19 Hinds, K.R. and Litman. G.W. (1986) Nature 320, 546. 20 Alt, F.W. and Baltimore, D . (1982) Proc. Natl. Acad. Sci. USA 79, 4118. 21 Lewis, S., Gifford, A . and Baltimore, D . (1984) Nature 308, 425. 22 Lewis, S., Gifford, A . and Baltimore, D. (1985) Science 228, 677. 23 Steinmetz. M . , Altenburger, W . and Zachau, H.G. (1980) Nucl. Acids Res. 8, 1709. 24 Reth, M.G., Jackson, S. and Alt, F.W. (1986) E M B O J., 5. 2131. 25 Selsing, E . and Storb, U . (1981) Nucl. Acids. Res. 9, 5725. 26 Hochtl. J . , Muller, C . R . and Zachau. H.G. (1982) Proc. Natl. Acad. Sci. USA 79. 1383. 27 Van Ness, B.G.. Coleclough, C . , Perry, R . P . and Weigert. M . (1982) Proc. Natl. Acad. Sci. USA 79, 262. 28 Cleary, M.J., Smith, S . D . and Sklar, J . (1986) Cell 47, 19. 29 Haluska, F.G., Finver, S., Tsujimoto, Y. and Crocc, C.M. (1986) Nature 324, 158. 30 Lewis, S., Rosenberg. N., Alt, F. and Baltimore. D. (1982) Cell 30, 807. 31 Fedderson, R . M . and van Ness, B . G . (1985) Proc. Natl. Acad. Sci. USA 82, 4793. 32 Malissen, M., McCoy. L.. Blanc, D . , Trucy, J.. Devaux, C . , Schmitt-Verhulst, A.-M., Fitch, F., Hood, L. and Malissen, B. (1986) Nature 319. 28. 33 Baer. R . , Chen, K.C., Smith, S.P. and Rabbitts, T.H. (1985) Cell 43. 705. 34 Bollum, F.J. (1974) Enzymes 10. 145. 35 Kung, P.C., Silverstone, A.E., McCaffrey. R. and Baltimore. D . (1975) J . Exp. Med. 141, 855. 36 Desiderio, S.V.. Yancopoulos, G.D., Paskind, M.. Thomas, E., Boss, M.A.. Landau, N., Alt, F . W . and Baltimore, D. (1984) Nature 311. 752. 37 Blomberg, B. and Tonegawa. S. (1982) Proc. Natl. Acad. Sci. USA 79, 530. 38 Desiderio, S.V. and Baltimore, D. (1984) Nature 308, 860. 39 Kataoka. T., Kondo, S . , Nishi. M . , Kodaira, M. and Honjo. T. (1984) Nucl. Acids Res. 12, 5995. 40 Aguilera, R.J.. Hope, T.J. and Sakano. H . (1985) E M B O J . 4, 3689. 41 Yancopolous, G . D . and Alt, F.W. (19x6) Annu. Rev. Immunol. 4, 339. 42 Alt, F. W.. Blackwell, T.K., DePinho, R . A . . Reth. M.G. and Yancopoulos. G . D . (1986) Immunol. Rev. 89, 5. 43 Blackwell, T.K., Moorc, M.W.. Yancopoulos, G . D . , Suh, H., Lutzker. S . . Selsing, E . and Alt, F.W. (1986) Nature, 324. 585. 44 Kemp, D.J., Harris, A . W . , Cory, S. and Adams, J . M . (1980) Proc. Natl. Acad. Sci. USA 77,2876. 45 Alt, F.W., Rosenberg. N.. Enea. V . , Siden, E. and Baltimore, D. (1982) Mol. Cell Biol. 2, 386. 46 Van Ness, B . G . , Weigert, M . , Coleclough. C . , Mather, E . L . , Kelley, D . E . and Perry, R . P . (1981) Cell 27, 593. 47 Nelson, K.J., Kelley, D.E. and Perry, R . P . (1985) Proc. Natl. Acad. Sci. USA 82, 5305. 48 Picard, D . and Schaffner. W. (1985) E M B O J . 3, 3031. 49 Wood, D.L. and Coleclough, C. (1984) Proc. Natl. Acad. Sci. USA 81, 4756. 50 Honjo, T. and Habu, S. (1985) Annu. Rev. Biochem. 54, 803. 51 Selsing, E. (1984) Nucl. Acids Res. 10. 4229. 52 Wood. C. and Tonegawa, S. (1983) Proc. Natl. Acad. Sci. USA 80, 3030. 53 Sakano. H . , Kurosawa, Y . , Weigert, M. and Tonegawa, S. (1981) Nature 290, 562. 54 Kurosawa, Y . , von Boehmer, H . . Haas, W . , Sakano. H . . Traunecker, A . and Tonegawa, S. (1981) Nature 290, 565. 55 Kurosawa, Y. and Tonegawa, S. (1982) J . Exp. Med. 155, 201. 56 Early, P., Huang, H . , Davis, N.. Calame, K. and Hood, L. (1980) Cell 19, 981. 57 Muller-Sieburg, C.E., Whitlock. C . A . and Weissman, I.L. (1986) Cell 44. 653. 58 Yaoita, Y., Matunami. N., Choi, C.Y., Sugiyama, H . , Kishimoto. T. and Honjo, T. (1983) Nucl. Acids Res. 11, 7303. 59 Landreth, K.S., Rosse, C . and Clagett, J. (1981) J . Immunol. 127, 2027. 60 Opstelten. D . and Osmond, D . G . (1983) J . Immunol. 131, 2635.
133 61 Kabat. E.A., Wu, T.T., Bilofsky, H . . Reid-Miller, M. and Perry, H . (Eds.) (1983) Sequences of proteins of Biological Interest No. 8G2008, NIH, Bethesda. 62 Winoto, A , , Mjolsness, S. and Hood, L. (1985) Nature 316. 832. 63 Reth, M.G. and Alt, F.W. (1984) Nature 312, 418. 64 Siu, G . , Kronenberg, M., Strauss, E., H a m , R . , Mak, T. and Hood, L. (1984) Nature 311, 344. 65 Dildrop, R . (1984) Immunol. Today 5 . 85. 66 Brodeur, P. and Riblet, R . (1984) Eur. J . Immunol. 14, 922. 67 Brodeur, P., Thompson, M.A. and Riblet, R. (1984) in: Regulation of the Immune System, UCLA Symp. Mol. Cell. Biol., New Series, Vol. 18 (E. Sercarz, H. Cantor and L. Chess, Eds.) pp. 445-453, Alan R . Liss, New York. 68 Winter, E., Radbruch, A. and Krawinkel, U . (1985) EMBO J . 4, 2861. 69 Bothwell, A.L.M., Paskind, M., Reth, M., Imanishi-Kari, T., Rajewsky, K. and Baltimore. D . (1981) Cell 24, 625. 70 Yancopoulos, G . D . and Alt, F.W. (1985) Cell 40, 271. 71 Yancopoulos, G . D . . Desiderio, S.V., Paskind, M., Kearney, J.F., Baltimore, D. and Alt, F.W. (1984) Nature 311, 727. 72 Yancopoulos, G . D . , DePinho, R.A.. Zimmerman, K.A.. Lutzker, S.G., Rosenberg. N. and Alt, F.W. (1986) EMBO J . 5 , 3259. 73 Perlmutter, R.M., Kearney, J.F., Chang, S.P. and Hood. L.E. (1985) Science 227, 1597. 74 Dildrop, R., Krawinkel. U . , Winter. E. and Rajewsky. K. (1985) Eur. J . Immunol. 15, 1154. 75 Hagiya, M., Davis, D.D., Takahashi, T.. Okuda, K., Raschke, W.C. and Sakano, H. (1986) Proc. Natl. Acad. Sci. USA 83, 145. 76 Banerji, J . , Olson, L. and Schaffner, W. (1983) Cell 33, 729. 77 Gillies, S.D., Morrison. S.L., Oi, V.T. and Tonegawa. S . (1983) Cell 33. 717. 78 Neuberger, M.S. (1983) EMBO J. 2, 1373. 79 Levitt, D. and Cooper, M.D. (1980) Cell 19, 617. 80 Siden, E., Alt, F.W., Shinefeld, L., Sato, V. and Baltimore, D . (1981) Proc. Natl. Acad. Sci. USA 78. 1823. 81 Burrows, P . , LeJeune, M. and Kearney, J.F. (1979) Nature 280, 838. 82 Perry, R . P . , Kelley, D . E . , Coleclough. C. and Kearney, J.F. (1981) Proc. Natl. Acad. Sci. USA 78, 247. 83 Reth, M.G., Ammirati, P., Jackson, S. and Alt, F. (1985) Nature 317, 353. 84 Hietcr, P.A., Korsmeyer, S.J., Waldman, T. and Leder, P. (1981) Nature 290, 368. 85 Max, E . E . , Seidman, J.G. and Leder. P. (1979) Proc. Natl. Acad. Sci. USA 76, 3450. 86 Alt. F.W., Enea, V., Bothwell. A.L.M. and Baltimore, D. (1980) Cell 21, 1. 87 Alt, F.W. (1984) Nature 312, 502. 88 Kranz. D . M . and Voss, E.W. Jr. (1981) Proc. Natl. Acad. Sci. USA 78, 5807. 89 Klobeck, H.-G. and Zachau, H.G. (1986) Nucl. Acids Res. 14. 4591. 90 Selsing, E., Miller, J.. Wilson, R. and Storb, U . (1982) Proc. Natl. Acad. Sci. USA 79, 4681. 91 Traunecker, A., Eisen, H.N. and Tonegawa, S. (1981) Proc. Natl. Acad. Sci. USA 78, 3765. 92 Eisen, H.N. and Reilly, E.B. (1985) Annu. Rev. Immunol. 3, 337. 93 Elliott, B.W. Jr., Steiner, L.A., Eisen, H.N. (1982) Nature 299, 559. 94 Miller, J.. Selsing, E. and Storb, U. (1981) Nature 295, 428. 95 Karjalainen, K. and Coleclough. C . (1985) Nature 314, 544. 96 Pernis, B.G., Chiappino, G . , Kelus. A.S. and Gell, P.G.H. (1965) J . Exp. Med. 122, 853. 97 Burnet, M.F. (1959) The Clonal Selection Theory of Acquired Immunity. Cambridge University Press, Cambridge. 98 Grosschedl, R., Weaver, D., Baltimore. D. and Costantini, F. (1984) Cell 38, 647. 99 Weaver, D . , Costantini, F., Imanishi-Kari, T. and Baltimore, D . (1985) Cell 42, 117. 100 Weaver, D . , Reis, M.H., Albanese, C.. Costantini. F., Baltimore, D. and Imanishi-Kari, T. (1986) Cell 45, 247. 101 Rusconi, S . and Kohler, G. (198.5) Nature 314, 330. 102 Coleclough, C., Perry, P . , Karjalainen, K . and Weigert, M. (1981) Nature 290, 372. 103 Wabl, M. and Steinberg, C. (1982) Proc. Natl. Acad. Sci. USA 79, 6976.
104 105 106 107 108 109 110 111 112 113 114 115 116
Gerondakis. S., Boyd. A . , Bernard. O . , Webb, E . and Adams, J.M. (1984) EMBO J . 3, 3013. Kwan. S.P., Max, E.E.. Seidman. J.G.. Leder, P. and Scharff, M.D. (1981) Cell 26, 57. Bernard. 0.. Gough. N.M. and Adams, J.M. (1981) Proc. Natl. Acad. Sci. USA 78, 5812. Ritchie, K.A.. Brinster. R.L. and Storb, U. (1984) Nature 312; 517. Storb, U . , Denis, K.A.. Brinster. R.L. and Witte. O.N. (1985) Nature 316. 356. Haas, I.G. and Wabl, M. (1984) Nature 306. 387. Bole, D.G., Hendershot. L.M. and Kearney. J.F. (1986) J . Cell B i d . , 102, 1558. Malissen, M . , Minard, K., Mjolsness. S., Kronenberg, M.. Goverman, J.. Hunkapiller, T., Prystowsky. M.B.. Yoshikai, Y.. Fitch, F.. Mak. T.W. and Hood, L. (1984) Cell 37, 1101. Hayday, A.C., Saito, H.. Gillies. S.D.. Kranz, D . M . , Tanigawa, G.. Eisen, H., Tonegawa, S. (1985) Cell 40. 259. Early, P.. Nottenburg. C., Weissman, I. and Hood. L. (1982) Mol. Cell. B i d . 2, 829. 0110.R., Auffray. C . , Sikorav. J.-L. and Rougeon. F. (1981) Nucl. Acids Res. 9, 4099. Chien. Y.-H.. Gascoigne. N.R.J., Kavaler. J.. Lee. N.E. and Davis. M.M. (1984) Nature 309. 322. Hayday. A., Diamond, D.. Tanigawa. G.. Heilig, J . , Folsorn. V.. Saito. H. and Tonegawa. S. (1985) Nature 316. 828.
F. Calabi and M.S. Ncubcrgcr (Eds.) Muleculiir (;cncrics of Ir,lrntrrlog/obrt/irr (Biomedical Division)
01987 Elsevier Scicncc Publishers B.V.
135 CHAPTER 5
Immunoglobulin heavy chain class switching U. KRAWINKEL and A. RADBRUCH Institute for Genetics, University of Cologne, Weyertal 121, 0-5000 Cologne 41, FRG
I. Introduction Whilst the variable region of an immunoglobulin molecule carries the antigen binding site and regulatory idiotypic determinants, the constant region is responsible for the effector functions of the molecule. These functions include transmembrane signalling and secretion signals, agglutination of antigens, complement activation and binding to Fc receptors (reviewed in [l]).Immunoglobulin molecules may carry a number of different constant regions (classes which are serologically defined as isotypes) with different functions. This functional diversity enables the immune system to shape the response to different antigens. In 1964 Nossal and coworkers observed that individual activated B cells could switch the heavy chain constant region of the antibody that they produce, while retaining the antibody’s specificity [ 2 ] .Since then, considerable effort has been directed at understanding the molecular basis of heavy chain class switching. The regulatory steps and the initial phases of switching are still unclear. More is known about the later events. The comparative analysis of switched and unswitched cells has clearly shown structural rearrangements in the heavy chain gene loci of switched cells. Thus, recombination plays an important role not only in the formation of active immunoglobulin gene transcription units (V-D-J-joining) but also in the course of class switching. Switch recombinations, at least in plasmablasts (B cells activated by antigen), generate the functional diversity of secreted antibodies. They occur at high frequencies and have typical sequence requirements. The existence of switch (S) regions in front of the constant region genes suggests that specific recombinatorial mechanisms are involved. The differences in the structures of the various switch regions raise the possibility of class-specific switch recombination, which would make no sense without a corresponding regulatory mechanism. It is known that the frequency of cells expressing various immunoglobulin classes can be regulated by T cell derived lymphokines [3-91, although no lymphokine has been clearly demonstrated to induce the switch directly rather than to expand switched cells or switch precursors. In this chapter we shall review the data available from the cellular and molecular analysis of class switching.
136
2. Frequency of class switching 2.1. Avian B cells The bursa of Fabricius plays a crucial role in avian B cell ontogeny because surface immunoglobulin bearing B cells are generated there. Bursectomy studies have shown that this organ is indispensable for class switching. Chickens bursectomized at day 19 d o not have any IgG- or IgA- but only IgM-expressing B cells. Bursectomy at day 21 (hatching) results only in depletion of IgA [lo]. Thus, no detectable switching occurs in prebursal or postbursal B cells but the IgM-, IgG- or IgAexpressing B cells are generated in bursa1 follicles. Although activation by antigen and induction of immunoglobulin secretion may also occur in the bursa, it is still unclear whether the class switch is occurring only in the context of activation or independently of it. Detailed studies on the molecular basis of switching in chicken have not yet been published.
2.2. Mammalian B cells 2.2.1. Pre-B cells As in birds, the first immunoglobulin heavy chain class to be expressed in mammals is IgM; this is characterized by p heavy chains, the constant region of which is encoded by the C, gene. This is the CH gene located immediately 3' of the JH cluster. During B cell ontogeny, C, is the first CH gene to be expressed in pre-B cells upon successful VH-DH-JH joining. The frequency of normal pre-B cells that express other CH genes is below the level of detection in foetal liver and in adult bone marrow [ 111. 2.2.2. Naive B cells In small B cells, prior to activation by antigen, surface IgM and IgD become concomitantly expressed. This particular switch is of special interest because no switch recombination is involved and the p and 6 heavy chains are produced by differential splicing of long transcripts [12,13]. B lymphocytes that express classes other than IgM or IgD can be found at very low frequency (below 1% [14]). It is likely, however, that the switched small B cells are not naive cells but are memory B cells. Okumura et al. have been able to demonstrate that a particular IgG2 memory was conferred by surface IgG2-bearing B cells [15]. In any case, apart from the p to pi6 switch, class switching rarely, if ever, occurs in B cells prior to activation. 2.2.3. Activated B cells Switching to classes other than IgD is most obvious in activated B cells. Extensive studies have been performed on mouse B cells that have been polyclonally activated by bacterial lipopolysaccharide (LPS) [2,1&18] or by both LPS and 'switch factors', i.e. certain lymphokines produced by T lymphocytes [&9]. Antigen stimulation in vitro (e.g. [19]) and mitogenic stimulation of human B cells (e.g. [20])
137 have also been studied. It has been shown in these systems that single, activated B lymphocytes switch from IgM directly to IgG, IgA or IgE production (saltatory switch) and that this switch requires proliferation (see above and [21-241). The frequencies of switched cells have been determined over the time course of in vitro stimulations and found to increase from below 1% to well over 30%. The frequency of class switching within, for example, LPS cultures, can be calculated to be in the order of 1-10% per cell per generation - assuming continuous switching over the period of culture. generation times of 12 to 24 h and equal proliferation of IgM+ and IgG+ cells [18,25]. Among the switched cells, secondary switches can be observed at equally high frequencies. Between 1 and 5% of the switched cells express two IgG isotypes in the cytoplasm [181, suggesting sequential switching from IgM to an IgG, then from this IgG subclass to another IgG. Nevertheless, the majority of switched cells switches only once, from IgM directly to IgG, IgA or IgE. This is also evident from suppression of LPS activation by anti-immunoglobulin antibodies. Whereas anti-IgM suppresses the generation of any isotype, anti-IgG3 suppression effects only the production of IgG3 but not of IgG1, IgG2b or IgG2a expressing cells [26]. A second type of activated B cell is the ‘memory’ cell, an obscure cell type defined by its function. The experiment of Okumura et al. [15], in which the IgG2 memory was transferred with sorted surface IgG2+ B cells, is the strongest evidence so far for the notion that memory B cells already switch upon their generation. 2.2.4. Plasma cells Whether the high frequency of class switching in activated B cells, i.e. plasmablasts, also occurs at the terminal stage, the plasma cell, is not clear. Plasma cells are only distinguished from late plasmablasts by the fact that they no longer proliferate. Since switching in plasmablasts requires proliferation, switching in plasma cells is unlikely. It is unclear whether long-lived plasma cells from the bone marrow cannot be reactivated to proliferate and then switch again. In summary, IgH class switching in mammalian B cells seems to be closely associated with B cell activation and occurs only rarely, if at all, prior to activation. 2.2.5. Transformed B lineage cells Much of the confusion as to when and at what frequency B cells switch stems from the analysis of lymphomas and plasmacytomas. Since such transformed cells can be cloned and adapted to grow in vitro they have been studied extensively. Most of the information on DNA rearrangements in switched cells is derived from analysis of B cells that became transformed after switching. The transformation had immortalized the switched phenotype. With few exceptions, switching within transformed cell lines of the B lineage is a rare event. It has been observed in murine pre-B cell lines [27-291, human pre-B and B lymphomas [30]. the murine B cell lymphoma 1.29 [31] and in several murine myeloma and hybridoma cell lines ( e . g [32]). In general, the frequencies of switching in these lines do not reflect the switch frequencies in the corresponding B cells from which they are presumed to be derived.
138 In most lines the frequencies of switching per cell per generation are below lo-'. Exceptions are the pre-B cell line 18-81 and the B cell line 1.29, where switching can be induced by LPS to occur at frequencies similar to those of LPS blasts [27,31]. The observation that class switching in pre-B lymphomas occurs at an even higher frequency than in plasmacytomas contrasts with what is found in untransformed cells where switching is apparently induced upon B-cell activation (see above). However, it is unclear whether pre-B lymphoma cells are representative in all aspects of the pre-activation stage of B lymphocytes. It is entirely possible that with regard to class switching they are already 'activated'. The B lymphoma 1.29 is the perfect example of an inducible B cell line that, although transformed, upon activation by LPS or anti-immunoglobulin antibodies switches class at high frequency and goes on to immunoglobulin secretion as evaluated by cytoplasmic fluorescence [31]. The low frequency of class switching in cloned myeloma and hybridoma cells (below lO-'/cell/generation, see review [C]), points to a remarkable stability of isotype expression in plasma cells. Although most detailed analysis has been performed on plasmacytoma P3X63 and hybridomas derived from it, a few other myelomas, such as M P C l l [33]and 5606 [34] also show only low frequency switching. This is a first hint that switching requires specific signals and is not an automatic consequence of the activated state of a B cell as reflected by proliferation and immunoglobulin secretion of plasmacytoma cells. Detailed analysis of the low frequency switches in plasmacytomas has revealed that they are different in kind to those found in normal B cells. The plasmacytoma cells usually switch from expression of one C, gene to expression of the next CH gene downstream. The most striking examples are three IgM producing hybridomas, where no IgG-, IgA- or IgE-producing variants could be detected in lo6 cells screened. Instead IgD-producing variants were found [35,36], a switch that is extremely rare in normal murine B cells [37] presumably because the murine Cs gene lacks a switch region (see Section 4.4.). A saltatory switch from IgM to IgGl has been described only for the hybridoma line PC140 [38].
3. Switch competence and regulation Although upon activation B cells switch at very high frequency, it is clear that not all cells switch - even after long culture periods (e.g. [39]). Moreover, upon a particular mode of activation not all IgG, IgA and IgE isotypes are expressed at equal frequency. Thus, stimulation of murine splenic B cells with LPS over up to 2 weeks results in a population containing as much as 30% IgG3 but few IgG1-, IgA- and IgE-expressing cells. On the other hand, many in vivo immune responses are dominated by IgGl or IgA or IgE plasma cells, IgG3 being a rare isotype (reviewed in [A]). The questions are (a) whether all B cells or only a subpopulation (committed B cells) can switch, and under optimal conditions will do so, and (b) whether the observed isotype frequency imbalances are the result of (1) the selective activation of cells committed to certain switches, (2) the selective induction of cer-
139 tain switches or (3) the selection of cells expressing certain isotypes from a pool of randomly generated isotype producers. These questions can only in part be answered by cellular immunology, important clues coming from the analysis of the molecular events accompanying class switching (see below).
3.1. Switch commitment In no cellular system described up to now could all B cells be driven to switch. This could merely reflect the lack of optimal activation signals or the fact that the activated B cells die before they get a chance to switch. On the other hand, the analysis of the clonal progeny of one activated B cell by use of limiting dilution LPS cultures has shown that switching takes place in about 80% of these clones [18]. Nevertheless, nearly all clones contained IgM+ cells, i.e. not all siblings had switched. The picture emerging from this and related studies [9] as well as from work on the 1.29 lymphoma [31] is that most, if not all, LPS-reactive B cells are switch competent because they produce offspring, some of which may switch. The observation that not all B cells do switch can be taken as an argument for incomplete but high frequency switch induction during a short time window. 3.2. Isotype commitment The generation of several isotypes in the clonal progeny of a single murine splenic B cell following activation with LPS [18] shows that the precursor cell was not committed to switch to a single specific isotype, although some restriction probably would have gone unnoticed. There is, however, a gross imbalance - in cellular terms - in the overall frequency of the various isotypes (see above) and this imbalance is dependent on the quality of B cell activation. Thus, polyclonal activation in vitro with ‘T cell independent’ mitogens such as LPS is usually dominated by IgM and IgG3 (see review [A]) while mitogen activation in the presence of T cell derived lymphokines and ‘T cell dependent’ antigenic activation give high IgGl and low IgG3 titers ([40], review [A]). Other regulatory T cells have been described that lead to dominance of IgA and IgE [3-51. In all of these cases it is not yet clear whether the T cells induce the specific switch or whether they merely selectively expand clone size and stimulate secretion of already switched cells of certain isotypes. It is difficult to demonstrate the induction of an isotype switch at the cellular level. The first phenotypic consequence should be the expression of switched surface immunoglobulin, although it is difficult to exclude the possibility that precommitted cells were already expressing low levels of the novel isotype. In the case of LPS activation, one group has seen the expression of surface IgGl+ plasmablasts in the absence of T cell lymphokines [6]. According to these workers, the T cell help can then induce IgGl secretion by surface IgG1+ cells. Other groups claim the induction of both surface and secreted IgGl by the T cell lymphokine IL-4 [7,9]. Probably the best evidence for switch induction is the decrease in the frequency of IgG3 cells that accompanies the increase in IgGl cells upon addition of IL-4
140 [9,41]. This suggests that cells that are committed to switch can be induced to go to C,, rather than C,. But even the detailed analysis of Layton et al. [9] could not distinguish between induction of the specific switch to IgGl and the selection of precursor cells committed to the IgGl isotype, because an identifying marker for the latter cells was missing. In any case, the isotype commitment would have had occurred after activation of the yet uncommitted splenic B cell. Isotype commitment seems to be the rule particularly for transformed cells. In the murine pre-B cell line 18-81 and some other pre-B cell lines switching occurs from p to y2b at high frequency [27] whereas 1.29 cells mainly switch from IgM to IgA or IgE [31].
4. Molecular analysis The molecular events that lead to the expression of a switched immunoglobulin heavy chain have been the target of extensive studies. Nevertheless, the initial stages of class switching remain obscure. Most of the available data concern the comparative structural analysis of the IgH loci of switched and un-switched cells. 4.1. Early steps
Due to experimental difficulties, little is known about the initial phase of class switching. Specific inductive stimuli for switching have not even been hypothesized for mammalian cells except for the isotype determination by IL-4. In the cell line 1.29 partial demethylation of the C,, C, and C, genes has been found in a mixed population of switched and un-switched cells [42]. In addition, short transcripts of C,, C,, C , in 1.29 cells [42] and C,, in 18-81 cells [28] have been identified. This has been interpreted as evidence for an opening of the chromatin at those CH genes in the initial phase of switching. It could, however, equally well reflect the open-ness of switched CH genes after switch recombination (see below). Demethylation of switched CH genes has been shown in plasmacytomas [43]; furthermore, the short transcripts found in 1.29 and 18-81 could resemble the sterile C, transcripts found in a variety of B cell lines [44]. Another early event could be recombinations within switch regions (see below) and these might precede the recombinations between switch regions which are found in transformed switched cells [85]. This indicates recombinations within S , prior to the actual switch recombination. In addition, the fact that several rounds of proliferation are required for the switching of polyclonally activated and immunoglobulin secreting plasmablasts [21-231 suggests that DNA rearrangement precedes the phenotypic switch.
4.2. Long transcripts The argument has been made that the first steps of class switching in cells not yet secreting immunoglobulin involve the differential splicing of long transcripts span-
141 ning several unrearranged CHgenes [4S]. Such splicing has been shown for the simultaneous expression of c, and C6 from the same IgH locus by naive murine splenic B cells [13]. Likewise the simultaneous expression of IgM and IgG, IgA or IgE on the surface of B cells would argue for a switch without switch recombination. However, such double-expressor cells are not easy to demonstrate because they are so rare and they are hard to distinguish from B cells that have passively adsorbed serum IgG, IgA or IgE to their Fc receptors. At present one cell line is available expressing C, and C, from one IgH locus [46,47]. Long transcripts containing several C, genes have not been demonstrated directly in these cells. In another cell line the secretion of IgG by switch variants could lead to presentation of passively absorbed IgG on IgM' cells which have all CH genes in germ-line configuration [48]. Two groups have isolated normal murine B cells with surface IgG, IgA or IgE and directly examined the IgH locus organisation of the isolated cells by restriction analysis [4S,49]; in one case the heavy chain mRNA was also analysed (491. Yaoita and Honjo [45] looked at splenic B cells co-expressing surface IgM and IgE from SJA mice that had been infected with the nematode Nippostrongylus brasilierzsis. Such IgM+/IgE' cells make up about 10%. of the splenic B cells and they can be isolated by fluorescence-activated cell sorting. When examined by restriction analysis, the C, and C, genes of the IgM '/IgE+ cells were found in germ-line configuration on both chromosomes. This led the authors to suggest a two-step class switch model: in the first phase, there would be transcription of several CH genes but with differential splicing to yield co-expression of two isotypes on the cell surface; in the second step, deletion of C,, genes would result in the exclusive production and secretion of the new isotype. In the absence of apparent rearrangement of the C, and C, genes in the IgM+/IgE+ cells, the argument relies, however, on the exclusion of IgM' B cells harbouring passively adsorbed surface IgE, since most splenic B cells have Fc receptors. Yaoita and Honjo argue that in SJA mice no IgE-secreting plasma cells can be found and thus there would be no IgE available in the serum for passive adsorption. Recently, however, Katona et al. [ 5 0 ] found IgE-secreting plasma cells in some SJA mice and it was only in such mice that they found large numbers of surface IgM'IIgE' B cells. The surface IgM'IIgE' B cells could be stripped of IgE with acid, a clear indication that it was passively adsorbed. The controvcrsy about the nature of the cells analysed by Yaoita and Honjo could probably best be resolved by the direct demonstration of transcripts containing both C, and C,. The direct demonstration of long transcripts containing C, and C,/C, in murine splenic B cells has been reported by Perlmutter and Gilbert [49]. Splenic B cells were separated according to the class of surface immunoglobulin by cell sorting. The RNA in these cells was analysed by a hybridization technique in which the RNA was hybridized to CYIor C, probes immobilized on nitrocellulose filters; the filters were then probed for RNA containing C, sequences. RNA from sorted IgG1+ cells was C,- and CYI-but not C,,-positive while RNA from sorted IgA' cells was C,-, CY1-and C,-positive. Although confirmation of these results by other groups is lacking, this experiment represents a direct approach to demonstrate that the first step of class switching is controlled at the RNA level.
142
4.3. Class switch recombination The second step of class switching according to Yaoita and Honjo [45] would be the recombinational joining of two switch regions. This step is obviously easy to demonstrate if enough cells can be obtained for restriction endonuclease analysis of their IgH loci.
4.3.1. Activated B cells This analysis has been largely performed on human B cell lines transformed with Epstein-Barr virus and on murine plasmacytoma cells where class switch recombination was first detected [51]. These cells presumably had class switched before they became transformed and were isolated as IgG-, IgA- or IgE-expressing cells. In all of them, the expressed CH gene was no longer in germ line position but was juxtaposed to the VHDJH complex by deletion of intermediate CH genes. This deletional recombination - the class switch recombination - was apparently closely associated with DNA regions of remarkable structure, i.e. the switch regions (see Sections 4.4. and 4.5.). Frequently, class switch recombination could also be detected on the inactive, allelically excluded IgH locus resulting in the deletion of the same or other CHgenes [52-541. Structural reorganisation of switched IgH loci is found in all transformed cells analysed so far. Possibly, it may be the only way to ensure efficient transcription of reasonably short units in immunoglobulin-secreting terminally differentiated cells. For the analysis of switched normal (non-transformed) immunoglobulin-secreting B cells, it has proved difficult to obtain enough cells for molecular analysis. At present it has only been possible to isolate switched progeny of many independent switching events, e.g. all cells that had switched to IgGl in a polyclonal B cell stimulation carried out using LPS. This poses an additional problem. Independent blot
scanner
A ! B
-
Fig. 1. Quantitative restriction analysis for the evaluation of class switch recombination in polyclonally activated B cells. The rearrangement of the S,, region is reflected by the disappearance of the S?,,germline restriction fragment ( ). This is measured by determination of the ratio of hybridisation intensities of s,, and a reference probe. The loss of s,, is calculated from the comparison of intensity ratios in lane A (liver DNA) and B (activated B cells). Further details are given in Section 4.3.1. of this chapter.
143 TABLE 1 Class-switch rearrangement of the IgH loci of polyclonally activated B cells Time"
Phenotypeh
S, c, s73 SYI SyZh ~~-~~ i' a' i' a' i' ac i' a' i'
Early stimulation
IgM' IgG3' IgG I
RIG'' R/G R RIG R RIG
IgM+/IgGIgG3' IgG I
Ci
+
Late stimulation
+
:,'
R R
G R R
G -
-
G -/G -/G
G R -
G RIG -/G
G G R
G G RIG
G G G
G G G
G R -
G G R
G G R
G G G
G G GIR
G
G
-
-
G R
-
-
-
.' Stimulation of murine splenic B cells with LPS with or without IL-4 for about 3 days (early) to 9 days (late). " Production of immunoglobulin of the respective isotype. ' Active (a) and inactive ( i ) refer to the productive and allelically excluded IgH loci of a cell. 'I Rearrangement (R). deletion (-) or germ-line configuration (G) of EcoRI restriction fragments.
switch recombinations could be (and indeed are) heterogeneous with respect to recombination sites. There will be multiple restriction fragments that contain the novel DNA joint created by such switch recombination and these will be scattered over the whole length of a Southern blot track so that the individual bands will disappear in the background (Fig. I). Therefore, the analysis can only show the disappearance of germ-line restriction fragments carrying a given C, gene or switch region. The principle of this quantitative restriction analysis is illustrated in Fig. 1. The D N A from unstimulated cells gives the control value for the proportion of IgH loci in germ-line configuration in all cells. Using this method Hurwitz and Cebra [55] have shown that there is more rearrangement of C, genes in LPS blasts expressing little cytoplasmic IgM compared to those expressing a lot. We have sorted IgM-/IgG3+ LPS blasts and have shown that the intensity of C,-gene hybridization decreases to about 50% on day 6 and C, is practically completely absent on day 9 (Table 1, [39]). Cells that are surface IgM+/IgG- o n day 9 show no C,-gene deletion and little if any rearrangement of C enes [41]. Thus, class switch recombination is restricted to switching cells, where it happens on both alleles. It does not happen on the inactive IgH locus of cells that remain IgM producers. Furthermore, in switching cells class switch recombination preferentially appears to join the same switch regions on both alleles. To demonstrate this, we stimulated splenic heterozygous B cells with LPS and the lymphokine IL-4 (BCDFy), and isolated cells expressing the CYIgene of one of the parental allotypes. Restriction analysis showed that the majority of them had performed switch recombination to C,, on both the active and the inactive IgH loci (Table 1, [41,85]). The molecular analysis of recombinant switch regions also sheds light on switch induction and isotype commitment. Such studies reveal that, upon activation, class switching is induced in some cells but not others. Otherwise, recombinations on the excluded IgH allele would have been found in late IgM expressing cells; this
144 has not so far been found (Table 1). Furthermore, switching cells must be programmed to switch to certain isotypes because both IgH alleles perform the same type of recombination. In polyclonally activated B cells class switch recombination precedes or rapidly follows the switch in CH-gene expression. Switching by a differential RNA splicing mechanism would apply for a very short period, if at all. The frequency of cells expressing surface IgG3 begins to increase after day 3 of LPS stimulation and already by day 6 about half of the IgH loci of these cells have performed switch recombination. 4.3.2. Plusmacytomas Class switch recombination is also found to take place in plasmacytoma and hybridoma cells. These rare variant cells can be detected in many cell lines at frequencies of lo-' to lo-' (see Section 2.2.5.). In all cases analysed so far intermediate CH genes have been deleted from the active IgH loci. Frequently, however, the recombination sites were outside of the switch region - most drastically in the IgD variants (see review [C]), there being no switch sequence in front of C, [56]. This could be the reason why in normal B cells switching from IgM to IgD is rare upon activation. Furthermore, the recombinations in switch variants, unlike those in normal B cells, are always restricted to the active IgH allele [32]. Thus, it is likely that switching in plasmacytoma cells is different from physiological switching, not only by the criteria of frequency and pattern (see above) but also by that of type of recombination. Probably, it reflects the rate of spontaneous deletions within the IgH locus rather than that of switch recombinations.
4.3.3. Chromosomal translocutioris Murine plasmocytomas and human Burkitt's lymphomas contain chromosomal translocations which involve the c-myc protooncogene and, in most cases, the IgH locus. Typically, the transposed c-myc joins one of the IgH switch regions in a headto-head fashion [57-591. The removal of the oncogene from its normal context may play an essential role in tumorigenesis. Why are the IgH loci favoured recipients of the c-myc translocation? There are no structural homologies between the 5' region of c-myc and switch regions. Klein and Klein [60] suggest that c-myc translocates into chromosome loci that provide an open chromatin region, a high level of gene expression and ongoing DNA rearrangements. Only the genes of the immune system and in particular the IgH locus, are presently known to fulfill these conditions. The predominance of S, in plasmacytoma translocations and of S, in those of Burkitt's lymphomas presumably does not indicate a particular structural quality of the murine S,, and human S, regions but rather reflects the type of the cells analysed. Mouse plasmacytomas usually originate from the B cells of the omentum and the mesentery which are believed to switch to a-chain production at an early stage of maturation [3,4]. The translocation of c-myc to the S, region of the allelically excluded IgH locus may thus occur as an accident of the S,-S, recombination on both IgH loci and just resemble programmed switch recombi-
145 nation (see above). The precursor of Burkitt’s lymphomas is a pre-B or early B cell that has not yet started to switch. The S, region of these cells appears to represent a more active chromatin region than that of other heavy chain genes, as indicated by hypomethylation and DNase I sensitivity [43,61,62]. This open region seems to be a preferential target for c-myc translocation. The fact that all c-myc translocations observed so far involve the allelically excluded IgH loci probably just reflects the experimenters’ selection of IgA and IgM producing plasmacytomas and lymphomas as a subject of investigation. Why is c-myc, as opposed to other oncogenes, regularly translocated in plasmacytomas and Burkitt’s lymphomas? There is no particular sequence homology which could favour the interaction between c-myc and switch regions. It is possible that it is the activation of c-myc but not of other oncogenes that induces tumorigenic behaviour in B cells at the maturation stage characteristic for the plasmacytoma and Burkitt’s lymphoma precursor cell.
4.4. Switch sequences The class switch is mediated by a genomic rearrangement which moves a V,DJ,segment from its original location 5‘ of C, to a position 5’ of another C, gene (Cy3, C,,, C,,, C,,, C, or (2,). As discussed above, in B cells such rearrangements occur at switch regions, resulting in the deletion of the segment between the site of recombination in S, and the new S region [51,63-661. Switch regions are 2-10 kb long and composed of simple sequences such as AGCT, TGAGC, GAGCT, TGGGG, GGGGT, GAGCTGGGG, ACCAG, GCAGC [54,64-SO], repeated in tandem array (Fig. 2). Comparison of longer stretches has yielded consensus rather than identical sequences. The S,, S, and S, regions are quite homologous to each other but share less homology with the S, regions. However, weak sequence homology and weak cross-hybridization [73] indicate a distant structural relationship between s, and s,. Multiple tandem repeats of the sequence motifs mentioned above are found in S,, S, and S,, but only
tandem repetition of 49 mers ct long identical repeats
.1*,.2 3 4
....
11000bp’
1234
Sy2b
Fig. 2. Structure and superstructure of S,, S,>, S,, and S,,,,. Thc S, region carries highly repetitive sequences which frequently undcrgo deletions ( A ) prior to switch recombination. The enhancer region is designated E. S Y 3 , S,, and S,,, regions contain tandem repeats of 49mers (hatched regions). S,, and S,,, show long identical repeats (arrows) within the 49mers. The 4Ymers in S,, are flanked by direct rcpcat sequences (DR). The core of the S,, region has not yet bccn analyscd (cross-hatched region).
146
S, exhibits a regular pattern of repeated 30 base pair long sequence blocks characterized by a consensus sequence [80]. The four s, regions are homologous to each other and carry multiple repeats of a 49 nucleotide consensus [73,77]. The 49mer is repeated in tandem from 44 to more than 100 times [73,74,77]. The y2b and yl switch regions both contain long perfect repeats which do not themselves comprise reiterated short repeats [76,81]. The S,, region carries two sets of four long identical repeats each 782 base pairs apart. The higher order structure of ST1 consists of two directly repeated units of a non-49mer sequence (DRI and DRII; D R , direct repeat) interspersed by many repeats of the 49mer consensus [76]. In addition, two long identical repeat units (indicated as 1 and 2 in Fig. 2) are found in the core of S,, within the 49mer repeats. The overall organization of S,, is maintained among IgH haplotypes despite extensive length polymorphism which can be largely attributed to variation in the number of 49mers [76]. Two copies of both D R elements are maintained in all IgH haplotypes. The organisational scheme of the murine S,, region may thus be abbreviated as DRL(49) DRII-DRIr-(49),,-DRII'where n varies between 40 and 160 amongst different mouse strains. The evolution of SYImay have started from a primordial S region which can be abbreviated DRI-(49),-DRII. Duplication of this unit then generated the tandem array characteristic of the present S,, region. Amplification of the 49mers by unequal cross-over between tandemly repeated elements [82] would result in homogenization of the repeat units. A comparative analysis of all murine S regions indicates that S,, has diverged more from S, and S y Z h than these two S segments have from each other. The S,, region shows the largest length variation among the IgH haplotypes and is the most homogeneous of the four S, regions, whereas S, shows the smallest length variation and is the least homogeneous. The y2b and y2a switch regions fall somewhere between S,, and S, in both size and sequence homogeneity. The S,, and SyZh regions share a similar organisation of 49mers into repeat structures whereas S, lacks higher order structures. Too little sequence information is available for S,;,, S, and S, to identify possible higher order structures. No ordered pattern of repeated sequence units could so far be detected in the S, region. 4.5. Switch recombination sites The conservation of repetitive elements in S regions has led to the working hypothesis that such elements play a central role in the switch rearrangement. About 20 DNA sequences of the recombination junctions of various class-switches have been determined in order to get information on the sequence requirements of switch recombination [63-80,83,85]. Comparison of these sequences makes it clear that the enzymes involved in class-switching do not recognize an obviously well conserved sequence. Switch recombination sites share only little and patchy sequence homology at variable distances from the actual breakpoint of recombination. Sequence motifs such as GAGCT and G G G G T [79] or YAGGTTG [84] have been postulated to play a specific role in switch recombinase recognition. However, these hypotheses
147 are essentially unverifiable because thesc sequences are ubiquitous in all S regions. Wu and co-workers [81] have suggested that the higher order structures of S regions direct isotype switching. In all switches to S,, studied the first set of long identical repeats in S,, (1, 2, 3, 4 in Fig. 2) is always deleted and part of the second set ( l ' , 2', 3', 4') is always retained, i.e. the breakpoint is always located between the two sets of long identical repeats (Fig. 2). In the S,, region, however. the switch recombination sites studied so far [69,76,85] do not correlate with the superstructure of the region. It should be noted that the S, regions exhibiting higher order structures, namely S,, and S,,, seem to be preferentially used in certain subsets of switching B lymphocytes. Abelson virus transformed pre-B lymphocytes preferentially switch from p to y2b [27-291 and most splenic B lymphocytes which are driven into class-switching by stimulation with LPS and IL-4 (see Section 3.2.) switch from p to y l . In the S, region, switch recombination may occur everywhere between the 3' end of a V,DJ, segment and the 5' end of the C, gene [36,86]. Switch recombinations also occur, but less frequently, within that portion of S, in which the many short repeats are found. This region is the one which frequently undergoes in vitro recombination catalyzed by Escherichin coli extracts [87]. Deletions which seem to precede the recombination of S, to another S region (see Section 4.1.) are frequently observed within S, (Fig. 2). These deletions are not artefacts of molecular cloning ([74], and own results) and seem to be characteristic of IgH loci which are poised for switch recombination. It would seem from the present findings that the specificity of class-switch recombination is not mediated by consensus sequences in the S regions. It is more likely that the control of class-switching operates at the level of chromatin structure which may be influenced by repetitive sequences.
5. Conclusion The construction of switch models suffers from the lack of information on the early steps of switching. Nevertheless, one can try to sketch a simple picture of the classswitching process in mammalian B cells (Fig. 3). Two types of switching can be defined: first the switch from expression of IgM in early B cells to expression of IgM and IgD in naive B cells. This switch does not involve switch recombination but differential splicing of a long transcript; t h e regulation of this process is unclear. This switch happens at a defined stage of B cell ontogeny and presumably provides the naive B cell with a receptor (IgD) required for the activation by antigen. Upon activation, the naive B cell stops to express IgD, starts secretion of IgM and, at a high frequency, is induced to a second type of switching (Fig. 3). This switch from IgM to any other immunoglobulin class is performed by repeated recombinations within and between switch regions through several rounds of replication. It occurs only in induced cells and on both IgH alleles. Lymphokines switch factors - may be required to determine which switch regions are open for
148
Fig. 3. Programmed class switch recombination, Upon activation the B cell starts to secrete IgM, proliferate and perform class switch recombination. In early stages recornbinations within S, and probably other S regions are found (not shown). In later rounds of replications recombinations betwzeen switch regions accompany the phenotypic switch. These recombinations occur o n both, active and inactive, IgH loci of a cell. The active locus is not necessarily rearranged first. Frequently both IgH loci show recombination between the same switch regions, indicating a ‘programming‘ inductive event.
recombination. Only after switch recombination is the new C , gene expressed. Switched plasmablasts could be selectively stimulated by lymphokines to proliferate, leave the place of activation and home to the bone marrow as long-lived plasma cells, and serve as memory cells [88]. They probably would not switch again.
149
Reviews A Cebra, J . J . , Komisar, J.L. anti Schweitzer, P.A. (1984) Ann. Rev. Immunol. 2. 493-548. B Burrows, P.D. and Cooper, M.D. (1984) Mol. Cell. Biochem. 63, 97-111. C Radbruch, A . , Burger, C . , Klein, S. and Muller, W. (1986) Immunol. Rev. 89, 69-83.
References I Hood. L.E.. Weissman. I.L.. Wood. W.B. and Wilson. J . H . (1984) Immunology. 2nd Edn., Thc BenjaminiCunnings Puhl. Co.. London. 2 Nossal. G.J.V.. Szenberg. A . . Ada. G . L . and Austin, C . M . (1964) J . Exp. Mcd. 119. 485-500. 3 Kishimoto. T. and Ishizaka. K. (1979) J . Imrnunol. 1 1 1 , 1195-1205. 4 Elson. C . O . , Heck, J . A . and Strober, W. (1979) J . Exp. Med. 149. 632-64.3. 5 Kawanishi, H . . Saltzman. L.E. and Strohcr. W. (1982) J . Immunol. 129. 475-480. 6 Coutinho. A . . Benner. R.. Bjiirklund. M.. Forni. L.. Holmberg. D . . Iuars. F.. Martinez-A,. A . and Pettersson, S . (1982) Immunol. Rev. 07. 87-1 14. 7 Severinson, E.. Bergstedt-Lindqvist. S . . v a n der Loo, W. and Fernandez. C. (1982) Immunol. Rev. 67. 73-86. 8 Isakson. P . C . , Pure, E.. Vitetta, E.S. a n d Krammer. P . H . (1982) J . Exp. Med. 155, 733-746. 9 Layton, J . E . , Vitetta, E.S.. Uhr. J.W. and Krammer. P.H. (1984) J . Exp. Med. 160, 185@1863. 10 Calvert, J.E.. Kim. M.F.. Gathings. W . E . and Cooper. M.D. (198.3) J . Immunol. 131. 1693-1097. I 1 Kubagawa. H . , Gathings, W.E.. Levitt. D.. Kearney. I . F . and Cooper. M.D. (1982) J. Clin. Immunol. 2. 263-269. 12 Moore. K.W.. Rogers. J . . Hunkapiller. T'.. Early. P.. Nottenburg. C . , Weissinan, I . . Bazin, H . , Wall. R . and Hood. L.E.. (19x1) Proc. Natl. Acad. Sci. USA 78. 1800-1804. 13 Tucker. P . W . (1985) Immunol. Today 6. 181-1x3. 14 Abney. E . R . . Cooper. M . D . . Kearney. J . F . , Lawton, A . R . and Parkhouse. R . M . E . (1978) J. I m munol. 120. 2041-2048. IS Okumura, K.. Julius. M . H . . Tsu. T.. Hcrzenherg. L.A. and Herzenberg. L.A. (1976) Eur. J . Immunol. 6, 367-472. 16 Kearney. J.F., Cooper. M . D . and Lawton, A . R . (1976) J . Immunol. 117, 1567-1572. 17 Andersson, J . , Coutinho. A . and Melcherh. F. (1978) J . Exp. Med. 147. 1744-1761. 1X Coutinho, A . and Forni. L. (1982) EMBO J . I. 1251-1257. I9 Tesch. H . . Muller. W. and Rajewsky. K . (1986) J . Immunol. 136, 2892-2895. 20 Kuritani. T. and Cooper, M.D. (1982) J . Exp. Med. 155. 839-851. 21 Wabl, M . R . , Forni, L. and Loor, F. (1978) Science 199. 1078-1079. 22 Severinson-Gronowicz, E . . Doss. C. and Schreder. J . (1979) J. Immunol. 123, 2057-2061. 23 Zauderer, M. and Askonas. B.A. (1976) Nature 260, 61 1-613. 24 van der Loo, W.. Gronowicz. E.S., Strober, S . and Herzenberg. L . A . (1979) J. Immunol. 122, 1203-1208. 25 Severinson-Gronowicz, E., Doss. C., Assisi, F., Vitetta, E.S., Coffman, R.L. and Strober, S . (1979) J . Immunol. 123, 2049-2056. 26 Webb, C . F . , Gathings, W.E. and Cooper, M.D. (1983) E u r . J . Immunol. 13, 556559. 27 Burrows, P . D . , Beck, G.B. and Wabl, M.R. (1981) Proc. Natl. Acad. Sci. USA 78, 564-568. 28 Alt, F.W.. Rosenberg, N., Casanova. R.J., Thomas, E. and Baltimore. D . (1982) Nature 296, 325-332. 29 Akira. S.. Sugiyama. H.. Yoshida. N.. Kikutani, H.. Yamamura. Y . and Kishimoto. T. (1983) Cell 34. 545-55 1. 30 Kubagawa. H., Mayurni, M., Crist, W.M. and Cooper, M . D . (1983) Nature 301, 340-342.
150 31 Stavnezer. J . , Sirlin. S . and Abbott. J. (1985) J . Exp. Med. 161. 577-601.
32 33 34 35 36 37 38 39
Sablitzky. F . . Radhruch, A . and Rajewsky, K. (1982) Immunol. Rev. 67. 59-72. Liesegang. B.. Radbruch. A . and Rajewsky, K. (1978) Proc. Natl. Acad. Sci. USA 75. 3901-3906. Dorf. H . (1980) Master Thesis, University of Cologne. Cologne. Neuberger. M.S. and Rajewsky. K. (1981) Proc. Natl. Acad. Sci. USA 78. 1138-1142. Klein, S . . Sablitzky, F . and Radbruch. A . (1984) EMBO J . 3. 2473-2476. Bargellesi. A . , Corte. G . . Coaulich. E. and Ferrarini. M. (1979) Eur. J. lmmunol. 9. 49k492. Thammana. P. and Scharff. M.D. (1983) Eur. J. Immunol. 13, 614617. Radbruch. A . and Sablitzky. F. (1983) EMBO J . 2. 1929-1232. 40 Torrigiani, G. (1972) J . Immunol. 108. 161-168. 41 Radhruch. A . , Miiller. W. and Rajewsky. K. (1986) Proc. Natl. Acad. Sci. USA 83. 39543957, 42 Stavnezer-Nordgren, J . and Sirlin. S. (1986) EMBO J . 5 , 95-102. 43 Rogers, J . and Wall, R . (1981) Proc. Natl. Acad. Sci. USA 7X. 4907-491 I . 44 Nelson, K.J., Haimovich. J . and Perry. R.P. (1983) Mol. Cell. B i d . 3. 1317-1332. 45 Yaoita. Y. and Ilonjo. T. (1980) Nature 286, 8Xk852. 46 Chen, Y.W., Word, C.J., Jones. S . . Uhr, J.W.. Tucker, P.W. and Vitetta. E.S. (1986) J. Exp. Med. 164, 548-561. 47 Chen. Y.W.. Word. C.J.. Dev. V . , Uhr. J.W.. Vitetta, E.S. andTucker, P.W. (1986) J . Exp. Med. 164, 562-579. 48 Jacobs. D.H.. Sneller. M.C.. Misplon, J.A.. Edison, L.J., Kunimoti, D . Y . and Strober. W. (1986) J. Immunol. 137. 55-00. 49 Perlmutter. A.P. and Gilbert. W. (1984) Proc. Natl. Acad. Sci. USA 81, 7189-7193. 50 Katona, I.M., Urban. J.F.. Jr. and Finkelman. F.D. (1985) Proc. Natl. Acad. Sci. USA 82. 511-515. 51 Honjo. T. and Kataoka. T. (1978) Proc. Natl. Acad. Sci. USA 75. 214&2144. 52 Hurvitz, J.L.. Coleclough. C. and Cebra. J.J. (1980) Cell 22. 349-3.55. 53 Coleclough. C . , Cooper. D. and Perry, R.P. (1980) Proc. Natl. Acnd. Sci. USA 77. 1422-1427. 54 Lang, R.B.. Stanton. L.W. and Marcu. K.B. (1982) Nucl. Acids Res. 10. 611-621. 55 Hurwitz, J.L. and Cebra. J . J . (1982) Nature 299. 742-745. 56 Shimizu, A , , Takahashi. N.. Yaoita, Y. and Honjo. T. (1982) Cell 28. 499-50.5. 57 Klein, G. (1983) Cell 32. 311-315. 58 Cory. S . (1983) Immunol. Today 4, 205-207. 59 Leder, P.. Battey. J.. Lenoir. G.. Moulding. C . . Murphy. W . , Potter, H . . Steward. T. and Taub. R. (1983) Science 222. 765-771. 60 Klein. G. and Klein. E. (1985) Immunol. Today 6. 20&215. 61 Yagi, M. and Koshland, M.E. (19x1) Proc. Natl. Acad. Sci. USA 78, 4907-49 1 I . 62 Mills, F.C.. Fisher, L.M.. Kuroda, R.. Ford, A.M. and Gould. H . J . (1983) Nature 306, 809-812. 63 Rabbitts, T . H . , Forster. A,. Dunnick. W. and Bentley, D.L. (1980) Nature 283, 351-356. 64 Sakano. H., Maki, R . . Kurosawa, Y . , Roeder. W. and Tonegawa, S. (1980) Nature 286, 676682. 65 Davis. M.M., Kim, S . K . and Hood. L.E. (1980) Science 209. 136(k1368. 66 Cory. S. and Adams, J . M . (1980) Cell 19. 37-43. 67 Nikaido. T., Nakai, S . and Honjo, T. (1981) Nature 292, 84.5-848. 68 Gough. N.M. and Bernard. 0 . (1981) Proc. Natl. Acad. Sci. USA 78. 509-513. 69 Obata, M., Kataoka. T., Nakai, S . . Yamagishi. H . , Takahashi. N., Yamawaki-Kataoka, Y.. Nikaido, T., Shimizu, A . and Honjo. T. (1981) Proc. Natl. Acad. Sci. USA 78. 2437-2441. 70 Gillies. S . D . . Morrison. S.L.. Oi, V.T. and Tonegawa. S . (1983) Cell 33. 717-728. 71 Kallen. cited as unpublished in Genebank (1984). 72 Gremberg. R., Lang, R.B.. Diamond, M.S. and Marcu, K.B. (1982) Nucl. Acids Res. 10,7751-7761. 73 Stanton, L.W. and Marcu. K.B. (1982) Nucl. Acids Res. 10. 5993-6006. 74 Szurek. P., Petrini. J. and Dunnick. W . (1985) J . Immunol. 135. 62(L626. 75 Kataoka. T.. Kawakanii. T.. Takahashi. N. and Honjo, T. (1980) Proc. Natl. Acad. Sci. USA 77. 9 19-923. 76 Mowatt. M.R. and Dunnick, W . A . (1986) J. Immunol. 136. 2674-2683. 77 Kataoka, T . , Miyata, T. and Honjo. T. (1981) Cell 23, 357-368. 78 Takahashi, N . , Kataoka. T. and Honjo, T. (1980) Gene 11. 117-127.
151 79 Nikaido. T.. Yamawaki-Kataok;i. Y. a n d Honjo. T. (19x2) I . Biol. Chem. 257. 7322-7329. Yamagishi. H.. Tnkahashi. N.. Yamawaki-Kataoka. Y . . NiXO Obata. M.. Kataoka, T., Nakai kaido. T.. Shimizu. A . and Honjo, ‘I. (19x1) Proc. Natl. A c x l . Sci. USA 78. 2437-2441. X I Wu. T.T.. Reid-Miller. M.. Perry. f1.M.. Kabat. E . A . (1984) E M B O J . 3. 2033-2040. X2 Smith. G.P. (1973) Cold Spring Harbor Symp. Ouiint. Biol. 3X. 507-513. 83 Kim, S.M., Davis, M.. Sinn. E . , Patten. P . a n d Hood. L. (1081) Cell 27. 573-578. 84 Marcu. K.B., Lang, R.B.. Stanton. L.W. and Harris. L.J. (19x2) Nature 298. 87-89. 85 Winter. E.. Krawinkel. U. and Radhruch, A . (19x7) E M B O J . 6 , 1663-1671. 86 Apuilera. R . . Hope. T.J. and Sakano. H . (19x5) EMBO J . 4. 3689-3693. 87 Kataoka. T., Takedn. S.I. and H o n j o . T. (19x3) Proc. Natl. Acad. Sci. USA 80. 26662670. 88 MacLennan, I.C. and Gray. D . (19x6) Iiiimunol. Rev. 91. 61-85,
This Page Intentionally Left Blank
153 CHAPTER 6
Immunoglobulin gene expression GRAHAM P. COOK, JOHN 0. MASON and MICHAEL S. NEUBERGER Medical Research Council Laborator! of Molec,ukir Biology, Hills Roud, Carnbridge CBZ ZQH, U K
1. Introduction Immunoglobulin genes a r e exprcssed in cells of the B cell lineage and t h e detailed patterns of expression a r e characteristic o f the particular stages of ontogeny. Studies of the regulation of immunoglobulin gene expression are, therefore, predominantly concerned with identifying the mechanisms that ensure that the immunoglobulin gene loci are active only in lymphoid cells as well as those that govern thc different patterns of immunoglobulin gene expression characteristic of the various stages of B cell differentiation. This review is based largely on results obtained from the study of mouse lymphoid cell lines and it is therefore worth considering the validity of applying conclusions obtained from such data to thc situation in vivo.
2. Tumours as models Many lymphoid cell lines exist and these are taken to reflect some of the various stages of B cell ontogeny. Thus, prc-B cell lines (which, in the mouse system, are frequently obtained by transformation with Abelson murine leukaemia virus) are taken to correspond to B cells at an early stage of ontogeny which are undergoing o r have recently undergone assembly of the variable region genes, and which at most express only intracellular heavy ( p ) chain. B cell lymphomas are analogues of a diverse group of cells that bear membrane immunoglobulin. Plasmacytomas a n d hybridomas are taken to be analogues of immunoglobulin-secreting plasma cells. Obviously, tumours cannot be a perfect reflection of the normal in vivo situation. Plasma cells are terminally differentiated cells that d o not divide and which contain a n enormously extensive array of endoplasmic reticulum; the same preponderance of intracellular membranes is not apparent in plasmacytoma and hybridoma cells maintained in culture, presumably because this would not be consistent with rapid proliferation. Similarly, primary cells can often be induced t o differentiate in response to mitogens o r interleukins, whilst this is true t o a much lesser extent of cell lines. Nevertheless, despite such limitations, the technical ad-
154 vantages of working with cell lines and, therefore, with essentially homogeneous cell populations, is so great that much of the work associated with understanding the molecular mechanisms that regulate gene expression has been carried out with such systems. In many cases, the conclusions have subsequently been tested on primary cells, the results usually being in agreement. The ability to establish lines of transgenic mice may allow the conclusions reached by use of cell lines to be tested in vivo.
3. Patterns of immunoglobulin gene expression during B cell ontogenY The DNA rearrangement required for the production of a functional immunoglobulin gene can also yield aberrant integrations of the variable region gene segments that are incapable of directing the synthesis of antibody polypeptide chains. Nevertheless, productively rearranged, aberrantly rearranged and germ-line loci are usually all transcribed in lymphoid cells. Thus. quite apart from the DNA rearrangement, the structure of the chromatin of the immunoglobulin gene loci in lymphoid cells differs from that in other cell lineages. Before considering transcription itself, we will discuss the structural changes that are observed in the chromatin of the immunoglobulin gene loci. 3.1. Changes in chromatin structure
The structure of the chromatin at the immunoglobulin gene loci in lymphoid cells differs from that found in other cell types. Evidence comes from investigations into the degree of nuclease sensitivity and of DNA methylation. In other systems it has been observed that active genes are generally in a nuclease sensitive structure and are undermethylated at CG dinucleotides. These correlations also apply to immunoglobulin genes. Thus, in liver, the loci are found to be DNase I resistant [14] and hypermethylated [1,5-71 whereas in B lymphomas and plasmacytomas the C, and C, genes on both alleles are DNase 1 sensitive and hypomethylated. However, nuclease sensitivity does not simply correlate with active transcription. The cell line 7 0 2 / 3 harbours both a productively rearranged and a germ-line K allele; both are normally transcriptionally silent. Nevertheless, both are DNase I sensitive. Induction of K transcription in these cells by treatment with a mitogen (bacterial lipopolysaccharide) does not appear to affect the general DNase I sensitivity of the gene but does result in the appearance of a DNase I hypersensitive site in the region of the K enhancer on both chromosomes [8,9]. An actively transcribed K gene also contains DNase I hypersensitive sites in the region of the V, promoter and around the C, polyadenylation site [2,4,6,10]. Similarly, hypersensitive sites in the heavy chain locus in lymphoid cells have been identified in the region of the enhancer and of the switch region [ 11,121. There is a correlation between the general demethylation of the immunoglobulin gene loci and their transcriptional activity [1,6,7,13], although clearly the de-
155 methylation of all HpaIIIMspI recognition sites is not a prerequisite for transcription [7,13-151. Whilst the rearranged V, segments in plasmacytomas are hypomethylated and DNase I-sensitive, most of the unrearranged V, segments in plasmacytomas are hypermethylated and DNase-resistant [ 1.31. Similarly, whilst the productively rearranged C, genes in a plasmacytoma are nuclease sensitive and demethylated [5,6],the exons of the unrearranged yl gene in an IgM-expressing plasmacytoma are hypermethylated [ 5 ] . Class switching appears to correlate with the demethylation of the incoming CH gene. In fact, work on the 1.29 B cell lymphoma suggests that demethylation may occur prior to class switching. Sub-clones of 1.29 that express IgM and which yet are committed to switch either to IgA or to IgE, have already demethylated the relevant incoming C, gene [ 161. The situation with regard to the state o f the chromatin of the C, exons is somewhat different from that of the other C,, genes located 3' of C,. Firstly, it is much closer to C, than are the other C,, genes and secondly there are many IgM-expressing B cell lines that transcribe through or into the 6 locus. Studies of different IgM-expressing B cell lymphomas and plasmacytomas indicate that the C, locus is methylated in some lines and demethylated in others; the degree of C, methylation in different lymphomas does not, however, correlate with the extent of 6 transcription [ 5,171.
3.2. Expression of productively rearrariged loci Productively rearranged IgH genes first appear at the pre-B cell stage. Such cells contain a relatively low abundance of p mRNA - some two orders of magnitude less than in plasmacytomas. Immunoglobulin p polypeptide is detected inside the cell, presumably located in the endoplasmic reticulum, and is degraded intracellularly. Such intracellular turnover can also occur in plasmacytoma cells, although the extent of turnover may depend on the heavy chain class expressed [27]. Productive light chain rearrangement allows the synthesis of membrane immunoglobulin, although the DNA rearrangement itself is not sufficient to ensure light chain expression. Several cell lines have been described that harbour productive K gene rearrangements but which require induction by treatment with mitogens or other stimuli in order to achieve K expression [ 18,191. The most immature B cells express membrane IgM. However. such cells often contain mRNAs for both the membrane and secreted form of the p polypeptide chain (termed pm and p,,, respectively). The ratio of p,,, to p, mRNA varies considerably amongst B cell lines. Sometimes the two are in equimolar amounts, though often pm mRNA predominates. Nevertheless. whilst many B cell lines contain ps mRNA, secreted IgM is often not readily detectable; this indicates the importance of translational or posttranslational regulation in determining the cell phenotype. More mature B cells often co-express surface IgM and IgD and there are rarer cells that show other Combinations of heavy chain class expression. The later stages of B cell maturation and particularly the development into an IgM-secreting plasma
156 cell, are accompanied by the appearance of mRNA for the immunoglobulin J chain (see [20] for a review). The J chain polypeptide is detected in all plasmacytomas regardless of the heavy chain class expressed [21,2?]; it is presumably degraded intracellularly except in IgM and IgA expressing cell lines where it forms part of the secreted antibody [22]. Plasma cells contain a much larger amount of mRNA for both heavy and light chain than is found in B cells; this mRNA is found largely on membrane-bound polysomes [23]. Pulse-chase experiments indicate that the heavy chain mRNA is very stable with a cytoplasmic half-life of at least 6 h and probably more like 20 h [24,25]. Pulse-chase experiments at the protein level indicate that the heavy and light chains are assembled very shortly after synthesis [26]. Oligosaccharides are added in the rough endoplasmic reticulum soon after polypeptide synthesis; the immunoglobulin then proceeds to the Golgi apparatus and the sugars are only trimmed immediately prior to secretion [26].
3.3. Expression of aherrantly rearranged loci In many lymphocytes it is found that, whereas one allele encodes the expressed immunoglobulin polypeptide chain, the other has undergone some aberrant or incomplete DNA rearrangement leading for example to an out-of-frame V-(D)-J joining or to a D-JH integration that lacks an appended VH segment. Similarly. Aexpressing cells usually harbour some aberrant rearrangement at their K loci, although the A genes are normally found in the germ-line configuration in K-expressing cells (discussed in Chapter 4). Transcripts are often detected from the excluded allele, although both the rate of transcription and the level of mRNA accumulation varies from cell line to cell line, depending upon the nature of the aberrant rearrangement (see [28] and references therein). In several cell lines, aberrantly rearranged alleles have been found to be translated into an immunoglobulin polypeptide fragment that is degraded within the cell and does not contribute to the expressed antibody [29,30]. In the case of several D-JH integrations, transcripts have been detected that initiate a few nucleotides upstream of the rearranged D segment [31,32]. Some of these DJH-C, transcripts have been shown to be translated into polypeptides that are presumed to be synthesized on membrane-bound polysomes as the nucleotide sequences suggest the presence of a hydrophobic leader at the amino-terminal end of the polypeptide [31] and, at least in one cell line, the protein has been shown to be glycosylated [32]. 3.4. Expression of unrearranged loci Whilst transcription of the endogenous immunoglobulin gene loci in cells outside the haematopoietic lineage has not been described, transcription of unrearranged gene segments has been observed in B, T and myeloid cell lines [32-351. Thus, in the case of IgH loci that retain the germ-line configuration, sterile p transcripts (i.e. transcripts that d o not initiate at a V gene promoter) have been observed in B and T cell lines and these transcripts initiate in the region of the IgH enhancer
157 [32,36].Interestingly, the abundance of these transcripts is not significantly higher in plasma cells than in B cells [37].Similarly, nuclear transcripts of the mouse C, locus have also been detected in plasmacytomas that retain a germ-line K configuration; these transcripts initiate some 3.5 kb upstream of the J, segments. These polyadenylated sterile C, transcripts are not processed into mRNA, although they contain apparently functional J,-C, splice junctions. Rather, they are degraded within the nucleus [38]. Transcription of unrearranged V, segments of the mouse VHII sub-group (the JS58 family) has been described in pre-B cell lines that have not produced a functional heavy chain rearrangement [39]. Transcripts derived from unrearranged V, genes belonging to other sub-groups have not been detected, but this may simply reflect the low abundance of these transcripts as the V,II sub-group is larger than the other mouse V, sub-groups (see Chapter 3). With occasional exceptions (e.g. see [40]) the germ-line V, transcripts are not normally detected in more differentiated cells of the B lineage [41] and it has been proposed that these transcripts reflect an ‘opening-up’ of the unrearranged V, segments that is a prerequisite for joining [39]. Transcripts have also been observed from the unrearranged V, segments in K-expressing cell lines [42].
4. Processes regulating immunoglobulin gene expression Like most genes transcribed by RNA polymerase 11, immunoglobulin mRNA molecules are capped at their 5‘ end and have a 3‘ poly(A) tail. The 5’-untranslated regions vary in length upwards from three nucleotides depending on the V gene employed [43,44]. The 3’-untranslated regions vary in length between 100 and 200 nucleotides for light chain and secreted heavy chain mRNA. The mRNA of membrane forms of the heavy chain are often longer and employ multiple cleavage sites in the generation of their 3‘ ends (see Chapter 2). Our understanding of how immunoglobulin genes are expressed in a cell type specific manner has largely resulted from the study of cis-acting DNA sequences that control gene expression. More recently, studies have focussed on the factors which bind to these sequences. Classically, the cis-acting DNA sequences have been grouped into those located near the transcription start site (promoter upstream and TATA elements) and those located far from the start (enhancer elements). Whilst all of these elements can be considered to be components of the promoter, we shall discuss them separately for the sake of convenience.
4. I . Promoter upstrewn elemerirs At the 5‘ end of practically all V genes so far sequenced a homology is found to the TATA consensus (see [44]). The role of the TATA is thought to be in determining the position of transcriptional initiation by RNA polymerase I1 [45]. Little study has been made of immunoglobulin gene TATA elements and there are no published data concerning factors that interact specifically with them.
158 Sequences upstream of the TATA are implicated in the regulation of transcription. Transfection experiments, in which upstream sequences have been fused to heterologous genes, have shown that the variable regions of both the heavy chain 146,471 and of the K and A light chains [48,4Y] possess promoter elements that are preferentially active in cells of the lymphoid lineage. The exact degree of cell type specificity observed varies according to the details of the assay used. Both V, and V,, promoters have been observed to be only weakly active in fibroblasts [50,51] but strongly active in plasmacytomas as well as in pre-B and B cell lines [4&52]. There is also evidence that V, promoters show activity in T cells 1.531. A detailed functional analysis of the immunoglobulin promoter elements is not available. However, comparison of sequences from a number of immunoglobulin promoters revealed the presence of a well-conserved octanucleotide consensus (ATGCAAAT) in all V, promoters and its complement (ATTTGCAT) in all V, promoters as well as in the heavy chain enhancer [54,55]. This octanucleotide has been shown to be essential for transcription in both VH and V, promoters, as deletion of it abolishes promoter activity [46,55,56]. Furthermore, in the presence of the IgH enhancer, the octanucleotide is a sufficient V, upstream promoter element as measured in transfection assays [57]. A seven out of eight match to the octanucleotide is found in the promoter region of another gene encoding a lymphoid specific protein, the immunoglobulin J chain (581. However, the octanucleotide element is not restricted to lymphocytespecific genes. It is also found in the promoters of the herpes simplex virus thymidine kinase gene 1591, histone H2B genes [60.61] and both U1 and U2 small nuclear RNA genes [62-651 - all of which are active outside the lymphoid lineage. Moreover, it has been demonstrated that the octanucleotide is a functional part of these promoters [5Y,62-65]. A seven out of eight match to the octanucleotide is found in the SV40 enhancer. Indeed, the fact that the SV40 and the IgH enhancers use common factors is suggested by competition assays performed both in vivo [66] and in vitro [67]. Furthermore, the SV40, polyoma, IgH and K enhancers are all repressed by the adenovirus E 1A gene product 168-701. A nuclear factor designated NF-A which binds to the octanucleotide in both V, and V, promoters as well as in the IgH enhancer has been identified by gel retardation assays 171.721. This factor is found in nuclear extracts of fibroblasts as well as in cells of lymphoid origin. Nuclear extracts from these various cell types give indistinguishable DNase I footprints on the octanucleotide [7 11. Transcription of a K gene in vitro using different cell extracts has been shown to occur in a cell type dependent manner [73], this discrimination requiring upstream promoter sequences that include the octanucleotide. Similar experiments have shown that the octanucleotide upstream of the human histone H2B gene binds a nuclear factor present in HeLa cells [74] and these sequences in the H2B promoter region, which include the octamer, are required for optimal in vitro transcription of H2B [75]. Thus, there is an apparent paradox in that V, and V, promoters show a lymphoid cell type specificity, and yet the main component of the promoter that has been identified is an octanucleotide which is an essential component of many nonlymphoid-specific genes that in vitro can bind a nuclear factor present in many cell
159 types. Furthermore, oligomerisation of a short region of the SV40 enhancer which includes the octanucleotide motif, creates a lymphoid-specific enhancer when assayed on an enhancerless p-globin gene [76]. Possible solutions to this paradox are given by the suggestions that specificity is provided by the combination of promoter and enhancer [59,77], as well as by the indications that there are multiple NF-A components (NF-A1; NF-A2) binding to the octanucleotide, one of which (NF-A2) is lymphoid specific [78,79]. Apart from the octanucleotide no other strongly conserved consensus sequences have been identified in VH gene promoters, though this does not exclude the presence of other cis-acting elements. A second consensus is found in the promoter of V, genes [%I; this sequence (TGCAGCGTG) is also found in the heavy chain enhancer. However, this element is less well conserved than the octamer and mutations within it do not appear to alter the activity of a V, promoter in transfection assays [52,56].N o nuclear factor has yet been found which binds this element, and its significance remains unclear. 4.2. Enhancer elements Enhancers are classically defined as DNA sequences which stimulate transcription of a linked gene from its authentic start site. This stimulation is observed with the enhancer placed upstream or downstream of the gene, at a distance of several thousand base pairs and in an orientation-independent manner (for a review see ")I). Enhancers were originally described in viruses but have since been identified in a number of cellular genes. The first cellular enhancer to be found was in the major intron of the mouse heavy chain locus [81-831 and subsequently in the mouse K [84,85] and human IgH loci [86]. The IgH enhancer is spread over some 400 base pairs and is located between the J H cluster and the p switch region such that canonical VH-D-JH joining or heavy V ?
I
-
D
-)i*WWHll "1
"2
JH
CP
IgH mRNA
?
v3
\/ \/
GERMLINE
-
to
C6,y.f.a
t
Fig. 1. Immunoglobulin gene rearrangement and expression. A highly simplified view of the mouse IgH locus is presented which is neither to scale nor arc the full complements of gene segments depicted. The IgH enhancer is indicated by the symbol E.
160 chain class switching leave the enhancer intact (Fig. 1). It is envisaged that somatic recombination brings a V, gene promoter within the activation distance of the enhancer. thus potentiating its transcription; activation of germ line V, genes located immediately 5' to the productively rearranged V, segment has also been observed (401. Immunoglobulin enhancers differ from previously identified viral enhancers in their spectrum of activity, enhancers from SV40 or polyoma virus being active in a variety of cell types [87,115,161,162]. Transfection experiments have established that both the IgH [81,82], and the K enhancers (841 are preferentially active in plasmacytoma cells. Although weak activity has been described in fibroblasts, this weak activity manifests a strong dependence on distance [88,89]. The fact that some deletions of the IgH enhancer increase its activity in non-lymphoid transfectants has been used to infer the existence of repressor molecules in non-lymphoid cells (a) 301 ATTAAGTTTAAAATATTTTTAAATGAATTGAGCAATGTTGAGTT
N F-pE 1
NF-pE 3 421
GGAAGGGA~AATAAA_A_C_CACTAGGTAAACTTGTAGCT~~G-G-T~~~AAGAA~~~~~T 0
481 0 0 AACACTCTGTCCAGCCCCACCAAACCGAAAGTCCAGGCTGAGCAAAA 0
-
p
b
ATTTGCAT TCTAAAATAAGTTGAGGATTCAGCCGAAACTGGAGAGGTCCTCTTTTAACT
NF-A1 N F-A 2 601 TATTGAGTTCAACCTTTTAATTTTAGCTTGAGTAGTTCTAGTTTCCCCAAACTTAAGTTT
661
Fig. 2(a,b). The mouse IgH and K enhancers. ( a ) 'The IgH enhancer. Open circles above and below the sequence indicate G residues on the top and bottom strands t h a t were protected against dimethyl sulphate modification in the genomic footprinting experiments described in [%I: tilled circles indicate G residues that exhibited enhanced reactivity. The main protected clusters have heen grouped into four regions (El-E4) that show homology to the consensus CAGGTGGC [Y3]: these are boxed. The conserved octanucleotide is boxed and doubly underlined. Factors that have been described to interact specifically with the consensus sequcnces are indicated helow the relevant boxes. Sequences that fit to the proposed enhancer core sequence (TGG;?PPG [163]) are indicated with a broken line. The se-
161
[88,89]. Such repressor molecules have been proposed in other work [go] where transcription of a human yl gene transfected into mouse L cells appeared to be strongly stimulated by treatment of the cells with the protein synthesis inhibitor cycloheximide. Experiments in which the IgH enhancer is linked to a heterologous gene and incorporated into the mouse germline [91,92] have shown that the enhancer is capable of conferring rigid lymphoid cell type specificity, even when placed 3' to the test gene. In these transgenic mice, activity within the lymphoid lineage is largely confined to the B cell pathway, supporting earlier conclusions from transfection experiments [46]. This B cell specificity agrees with genomic footprinting data [93,94] in which, following treatment of cells with the methylating agent dimethyl (b)
3687 AGCTTTTGTGTTTGACCCTTCCCTGCCAAAGGCAACTATTTAAGGACCCTTTAAAACTCT
3147 TGAAACTACTTTAGAGTCATTAAGTTATTTAACCACTTTTAATTACTTTAAAATGATGTC
3807 AATTCCCTTTTAACTATTAATTTATTTTAAGGGGGGAAAGGCTGCTCATAATTCTA
3867 TTTTCTT"G_T_A_A_A~AACTCTCAGTTTCTGTTTTACTACCTCTGTCACCCAAGAGTTGGCA
3927
CAGTTGCTTAAGATCAGAAGTGAAGT
NF-KB 3987 CTGCCAGTTCCTCCTAG
CAGATTACAGTTGACCTGTTCTGGTGTGGCTAA
4047
4107 TCTGGACACCCAAATACAGACCCTGGCTTAAGGCCTGTCCTGTCCATACAGTAGGTTTAGCT quence within the arrows contains full enhancer activity as judged from transfection assays. The scquence is numbered with nucleotide 1 being at the XhaI site immediately 3' of J,,4. ( b ) The K enhancer. Sequences (El-E3) that are homologous to the E consensus proposed for the IgH enhancer [93] are boxed ah is the NF-KB binding site. Squares indicate G residues on the two strands which, when methylated, interfere with factor binding in vitro [ 1051. NF-pE3 has been observed to hind to the K E3 consensus [ 1051. Sequences within the iirrows have f u l l enhancer activity as judged from transfection assays [85,84]. Broken lines indicate hotnology to the enhancer core sequence [ 1631 and the sequence is numbered following Max et al. [ 1641.
162 sulphate, several regions of the enhancer were shown to be resistant to methylation only in cells of the B lineage. Such resistance to methylation suggests that, in B lymphocytes, there are factors that are specifically bound to these regions. The protections from dimethyl sulphate modification were not observed in fibroblasts or in two T cell lymphomas (Fig. 2a). Although transfection and transgenic mouse experiments carried out with the IgH enhancer linked to heterologous genes indicate that enhancer activity is limited to B cells, rearranged IgH genes introduced into the mouse germ line are often expressed in both B and T cells of the transgenic animals [53,95]. This apparent paradox is discussed more fully in Section 5.1. of this chapter. However, one possible solution is that the IgH enhancer is active early in lymphoid ontogeny (before separation of the B and T lineages) and this is sufficient to allow subsequent expression of the transgenic heavy chain genes (but not of heterologous genes) in descendent T cells without the enhancer itself exhibiting activity. This explanation presumes that IgH transcription only manifests a transient requirement for the enhancer. Such a model is supported by the existence of several cell lines in which aberrant heavy chain class switching has resulted in deletion of the IgH enhancer [9&99]; these lines retain active heavy chain gene expression. Indeed, when DNA from the enhancer-deleted gene was cloned out of these cell lines and reintroduced into plasmacytoma cells, expression of the transfected gene was dependent on provision of an enhancer; these experiments have been interpreted as suggesting a role for the enhancer in establishing but not in maintaining stable transcription complexes [100,101]. The cell type specificity of the IgH enhancer observed in vivo can, to a certain extent, be mimicked in vitro [ 1021. Stimulation of heterologous gene transcription occurs to a greater extent with nuclear extracts from lymphoid cell lines than from fibroblasts if the enhancer is placed immediately upstream of the test gene [102,103]; not surprisingly, however, this stimulation is much lower than that observed in vivo. At present, there are no reports of complementation of fibroblast extracts with fractionated lymphoid extracts. although such experiments would, presumably, identify putative cell type specific factors. The existence of such factors is implied by experiments in which fibroblasts containing a transfected. productively rearranged heavy chain gene were shown to express this gene following fusion with red cell ghosts previously loaded with nuclear extracts from a variety of B lymphoid lines. This activation required the IgH enhancer to be linked to the transfected heavy chain gene [104]. Genomic footprinting [93,94]. as already discussed, has shown the presence of cell type specific interactions with the enhancer (Fig. 2a). These contacts are mainly clustered into four regions ( E l to E4). all showing homology to the consensus CAGGTGGC. The ATTTGCAT octanucleotide lies immediately adjacent to the fourth homology region (E4) and is included in these protections. Binding of nuclear factors to the octanucleotide in the enhancer has been demonstrated by gel retardation assays and by dimethyl sulphate and DNase I footprinting [71,105]. Gel retardation experiments have been used to identify other factors binding to the heavy chain enhancer [105,106]. Two factors have been identified, NF-pE1 and
163
NF-pE3, which bind to the E l and E3 elements respectively. No factors have yet been described that bind in vitro to E2 or E4. Thus, despite the fact that elements E l through E4 show homology to one another, NF-pE1 and NF-pE3 show distinct binding specificity as shown by competition experiments [105,106]. Analysis of the dimethyl sulphate interference patterns obtained for NF-pE1 shows that the binding site extends beyond the E consensus. Both NF-pE1 and NF-pE3 are found to have a widespread distribution amongst mammalian cell types. Analysis in vitro of proteins binding to the mouse K enhancer [lo51 shows that a sequence ( K E ~ which ), is related to the E3 element of the heavy chain enhancer, binds the same factor (NF-pE3) as deduced from competition experiments. A second factor has been identified which binds to the K enhancer, NF-KB;this factor binds to the sequence GGGGACTTTCC [ 1051. Genomic footprinting around the region assumed to encompass the enhancer in the human K locus reveals a factor contacting a homologue of the NF-KB recognition sequence [107]. Induction of K transcription in the pre-B cell line 70Z/3 by treatment with bacterial lipopolysaccharide has been shown to be accompanied by an induction of NF-KBas detected by gel retardation assays [ 1081. This induction occurs in the absence of new protein synthesis, suggesting that NF-KB is formed by modification of an inactive precursor [108]. The combined use of protein synthesis inhibitors and of mitogens super-induces the factor. Treatment of 702/3 cells with phorbol esters has also been shown to activate K transcription [ 1101, and this also correlates with induction of NF-KB.The induction by phorbol esters implies a role for protein kinase C in t h e activation pathway. Although NF-KBwas originally found exclusively in cells of the B lineage, treatment of other cells such as HeLa cells (human fibroblast) with phorbol ester or Jurkat cells (a human T cell lymphoma) with phytohaemagglutinin, results in NFKB induction [108]. The NF-KB binding site is not restricted to the K enhancer. Although not found in other immunoglobulin gene regulatory elements, it constitutes part of the SV40, cytomegalovirus and human immunodeficiency virus enhancers. Interestingly, the SV40 enhancer has been shown to be activated by phorbol esters in a manner independent of protein synthesis [ 1111. These results imply that, during the differentiation of B cells, cell type specificity of immunoglobulin gene expression is in part achieved by specific modification of a precursor factor that is of widespread tissue distribution. A role for NF-KB in the activation rather than in t h e maintenance of K gene expression has been proposed following studies carried out on the S107 plasmacytoma [109]. S107 expresses its endogenous K gene but does not contain NF-KB as judged from gel retardation assays carried out using extracts from untreated cells. The plasmacytoma also fails to express transfected K genes despite transcription of the endogenous loci. No enhancer has yet been found in the mouse A locus, although transfection experiments indicate that expression of a transfected, rearranged A , light chain gene in certain plasmacytoma lines manifests an enhancer requirement (unpublished observations). However, the mouse A locus possesses only two V, genes and, therefore, there may be no requirement to place an enhancer downstream of the
164 start sites; thus, it is possible that if an enhancer does exist, it is not located in a major intron. An enhancer has been identified in the human A locus but is not, as yet, well characterised [112].
4.3. Other promoter elements There are indications that elements other than the promoter and the enhancer may be involved in the regulation of immunoglobulin expression. Grosschedl and Baltimore [47] found that sequences other than the enhancer but which are also located within the gene, have a small effect on the amount of IgH mRNA that is produced. However, it is not clear where such sequences are located nor whether they are active at the transcriptional or posttranscriptional level. Evidence that the activity of the promoter depends upon intragenic sequences apart from the enhancer comes from experiments in which some or all of the introns of a rearranged IgH gene are removed. When such mutant genes are tested in transfection assays, the amount of mRNA they produce is often considerably diminished; this effect may reflect a general intron requirement for the production of IgH mRNA [113]. A mutant mouse myeloma line has been described which produces reduced levels of a chain mRNA [114]. Examination of the a locus in this line reveals that at least 4 kb of sequence 3’ to the body of the gene is deleted and replaced with sequences of unknown origin. Nuclear run-off assays show that the polymerase loading on the a gene is less than in the parental line. This reduced level of a transcription might be due to the loss of a positive regulator from the a locus, or to the introduction of a negative one from elsewhere in the genome.
4.4. Transcription termination Little is known about the process of termination in RNA polymerase I1 transcription units. Most of the evidence concerning termination of immunoglobulin gene transcription applies to the p-6 region of the heavy chain locus and comes from nuclear run-off assays [17,37,116,117]. In IgM-secreting plasmacytomas, which contain p but not 6 mRNA, nuclear run-off assays indicate that polymerase loading falls off in the region between C, and C,, such that transcription of the C, exons is essentially undetectable [ 17,371. No specific sites of transcription termination have been found, but rather RNA polymerase loading seems to fall off over a region of several thousand base pairs between the C,M exons and CJ. In some cell lines, however, there is also some unloading between the C,4 and C,M exons
WI.
In contrast to IgM-secreting plasmacytomas, IgH transcription in B cells that express membrane IgM often continues into the C, exons whether the B cells express both membrane IgM and IgD or only membrane IgM [17]. Thus, the main difference in transcription termination in the p-6 locus occurs on differentiation of a B cell into an IgM-secreting plasma cell, as in the plasma cell there is little transcription read through into the C, exons. In the case of IgG expression, it has been shown that both in B cell lines that express membrane IgG2a and in myelomas
165 that secrete IgG2a transcription of the CyZagene is found to terminate well downstream of the y2a membrane exons [118]. The findings that, in B cell lines, RNA polymerase density within the p-6 locus falls off gradually, rather than at a discrete point and that the density on the Cis gene does not correlate simply with the abundance of 6 mRNA, have also been demonstrated in primary cells [116,119]. Whereas neonatal B lymphocytes contain significantly less 6 mRNA than adult B cells, in both cell types a similar proportion of polymerase molecules continue through C, into C , [119]. Also consistent with results obtained using cell lines is the observation that B cells treated with lipopolysaccharide show an altered pattern of transcription termination in that an increased proportion of polymerase molecules now unload between C, and C , [116]. In summary, in antibody-secreting cells that contain little mRNA for the membrane form of the heavy chain, transcription of the heavy chain locus nevertheless continues into and beyond the membrane exons. Similarly, in cells expressing membrane IgM, RNA polymerase molecules often continue transcribing into the 6 locus; there does not appear to be a simple correlation between the amount of C, transcription and the steady-state level of 6 mRNA. Caution must be exercised in assigning any regulatory role to transcription termination, as it is possible that termination is largely a consequence of cleavageipolyadenylation. It has been found [120] that an 800 base pair fragment from t h e 3' flanking region of the mouse P-globin gene which includes the region within which transcription termination normally occurs is not sufficient to cause termination when inserted into the adenovirus E1A gene. However, a larger fragment containing the P-globin polyadenylation site in addition to the termination region does cause transcription termination in the same assay. In further support of such an hypothesis, an a-globin gene with a mutant polyadenylation site has been described [ 1211; it is found that not only do transcripts from this gene not polyadenylate correctly, but transcription continues for several hundred nucleotides further than usual, terminating after a cryptic polyadenylation site which is located downstream of the mutant site [121]. Thus, although some differential transcription termination is seen during B cell development, it is possible that the altered pattern of termination is a consequence (rather than a cause) of differential polyadenylation site usage. A role for termination as a modulated, regulatory step in immunoglobulin gene expression, therefore, remains to be established. 4.5. R N A cleavageipolyadenylatiori Cleavage of the primary transcript and its polyadenylation are thought to be tightly coupled events in vivo, since all accurately processed 3' termini are polyadenylated. However, in vitro studies [ 1221 show that the processes can be separated, at least for adenovirus-2 L3 mRNA. All immunoglobulin gene mRNAs contain the usual highly conserved sequence AAUAAA some 20 nucleotides upstream of the poly(A) tract, but no other highly conserved sequences that specifically identify all immunoglobulin gene polyadenylation sequences have been described. Multiple mRNAs are produced from a specific immunoglobulin heavy chain lo-
166 cus both in the co-expression of two heavy chain classes from the same chromosome and in the production of the mRNAs for the membrane and secreted forms of the same heavy chain class. Presumably, these events require the processing of a common primary transcript into different mRNAs, each utilising a different polyadenylation site. However, regulation of these events by controlling the usage of polyadenylation sites has not been demonstrated. 4.6. R N A splicing Whilst significant advances are now being made in our understanding of the molecular mechanisms of RNA splicing [123,124], there is little information at this level that specifically applies to immunoglobulin genes. Attempts have been made to deduce the pathway of removal of the introns from immunoglobulin gene transcripts by looking at the steady-state levels of mRNA precursors in the nucleus [ 125-1271, While the techniques used had insufficient resolution to determine the order of removal of the small introns, it was found in an IgM-secreting line that the J,,-C, intron was normally removed before the C,4-CPMl intron (consistent with processing in a 5'-3' direction) [ 1261. However, in contrast to this finding, a transcript from the mouse a locus has been described which contains the large V,C, intron, but lacks the C,,-C,M intron [ 1271, indicating that splicing of the primary a transcript does not always proceed in a 5'-3' direction. The main problem raised by the splicing of immunoglobulin gene transcripts arises from the co-expression of two heavy chain classes from the same chromosome. A large proportion of B cells co-express IgM and IgD on their surface; in any one cell, the two heavy chain classes are expressed from the same chromosome and use the same rearranged variable region. Cell lines that exhibit a similar phenotype have been described (for example, see [125,128]). It has been generally assumed that the mRNAs for the p and 6 heavy chains are derived from a common precursor by differential splicing; the critical choice would be whether to splice from the rearranged J H segment to the C,1 exon or to the C,1 exon. Splicing from J, to C,1 would require the six splice acceptor sites of the C, region being ignored. As yet, there are no experimental data concerning how this splicing is achieved. Indeed, the existence of a common p-6 primary transcript (which would be at least 25 kb long) has not been formally demonstrated. It is worth noting that in the case of the C, gene - unlike the genes for the other heavy chains (see Section 5.3. of this chapter) - the production of the mRNAs for t1;z membrane and secreted forms of the heavy chain involves differential RNA splicing. This is because the carboxy-terminal ends of the secreted and membrane forms of the 6 polypeptide are encoded in distinct exons located 3' of the C,3 exon. The question of stable co-expression of C, and other CH genes has also been raised. In particular, primary B cells have been described in which p and E are coexpressed from the same chromosome [ 1291. As lymphocytes have Fc receptors for IgE, it is difficult to exclude t h e possibility that the IgM' IgE' cells seen in this work are not in fact IgM ' cells that have passively adsorbed secreted IgE onto their surface. B cells have also been identified that co-express IgM and IgA on their
167 surface [130]. A primary transcript extending from a rearranged V, gene through C, and on to C,, would be about 200 kb long (slightly longer than the transcript for the blood-clotting factor, factor VIII). Sandwich hybridization studies have been used to support the existence of an RNA containing both p and a sequences [130]. Considerable weight has been given to the idea that p and other heavy chain classes apart from 6 can be expressed from the same primary transcript by the isolation of a variant of the IgM-expressing mouse B lymphoma line BCL, that stably coexpresses IgM and IgGl on its surface; these immunoglobulins contain the same V, region and derive from transcripts from the same chromosome [131,132]. Nuclear run-off assays and sandwich hybridization studies on this line are consistent with both classes being produced from a common precursor transcript. 4.7. Messenger R N A turnover
The half-life of immunoglobulin gene messenger RNA in plasmacytomas has been estimated from pulse-chase experiments to be certainly greater than 6 h and probably between 20 and 40 h [24,25]. There is no corresponding estimate for the halflife in B cells. However, by following the decay of p mRNA after its induction by heat-shock in cells transfected with a p gene under heat-shock control, it has been estimated that the half-life of p mRNA in a plasmacytoma (more than 15 h) is considerably greater than in a B cell lymphoma ( 3 to 4 h) [133]. The molecular basis of this differential mRNA turnover has not been identified. 4.8. Translational and posttranslational regulation
In resting B cells, the level of p,, mRNA is about ten-fold higher than that for the corresponding a,,, mRNA [ 1341, yet IgD is expressed on the membrane of these cells at a higher density than IgM [ 1351. This suggests that the relative expression of these two immunoglobulins must be controlled at the translational or posttranslational levels. It has been found that although the rate of a,,, polypeptide synthesis in B lymphocytes is about 10% of that of pm,surface IgM turns over faster than surface IgD, resulting in higher net expression of IgD [135]. There is evidence for translational or posttranslational control in the expression of the membrane forms of p [136]. y2a [137], and E [138] heavy chains. In each case, immunoglobulin-secreting cells are also found to contain mRNA for the membrane form. However, there is no corresponding expression of surface immunoglobulin. Even when more RNA for the membrane form is present than is found in analagous membrane immunoglobulin bearing cells, these secreting cells do not express immunoglobulin polypeptide on the membrane. Cells lacking membrane IgE have been shown nonetheless to be actively synthesising intracellular E , chains [ 1381, implicating posttranslational regulation. It is attractive to speculate that it is the proliferation of intracellular membranes that accompanies B cell to plasma cell differentiation which may impede membrane immunoglobulin from reaching the cell surface; much of the membrane immunoglobulin would then get degraded within the cell [139]. This type of phenomenon might also explain the
168 decrease in the expression of other surface proteins that accompanies B cell differentiation. A number of B cell lines contain p5 mRNA, often equimolar with the amount of p m , and yet do not secrete immunoglobulin [140]. Consistent with this is the fact that resting B cells that contain both p,,, and ps mRNAs translate both forms, but the ps polypeptide is not correctly processed or secreted [141]. Thus, resting B cells can exert posttranslational control over ps production. Some B cells [142] and B lymphomas [ 1431 which contain p5 mRNA do secrete p5 chains, although this may simply reflect their being at a later developmental stage. It is possible that the posttranslational inhibition of IgM secretion in B cells is correlated with the absence of immunoglobulin J chain in these cells. However, it is notable that nonlymphoid cells (which do not express J chain) that have been transfected with constructs that ensure production of mRNA for immunoglobulin p and light chains, are nevertheless capable of assembling and secreting IgM, despite the absence of J chain polypeptide [144]; furthermore, some human myeloma IgMs have been described that lack J chain (see [145]).
5. Major aspects of cell-type specijkity In Section 3 of this chapter, the patterns of immunoglobulin gene expression that are characteristic of different stages of differentiation were described, and Section 4 summarises our present knowledge about the various levels at which expression is regulated. In this final section, the ways in which the various regulatory elements and mechanisms contribute to the overall pattern of immunoglobulin expression in different cell types are considered.
5.1. Restricted cell-type specijicity of immunoglobulin gene transcription Normally, productively rearranged immunoglobulin genes are only present in cells of the lymphoid lineage. However, from transfection experiments it is clear that rearranged immunoglobulin genes are only correctly expressed in lymphoid lines [46,50,14&148]. Similarly, transgenic mice carrying rearranged immunoglobulin genes integrated into the germ line only express these genes in lymphocytes [53,95,149-1511 - although, in several of these reports, expression was found in both B and T cells. The expression of transgenic K genes does, however, appear to be restricted to cells of the B lineage [149]. How is this cell-type specificity achieved? As described in Section 4 in this chapter, transfection and transgenic mouse experiments have shown that both the enhancers and the promoters of immunoglobulin genes confer cell-type specificity. The molecular mechanism by which these elements confer cell-type specificity remains to be identified. Nevertheless, it seems likely that it is the cell-type specificity of these transcription elements that accounts for the inability of non-lymphoid cells to express transfected immunoglobulin genes. However, it is notable that, whereas using both cellular transfection and transgenic mouse assays, the IgH en-
169
hancer (when linked to hetevologous test genes) manifests activity which is largely restricted to cells of the B lineage [46,91,92,152], productively rearranged transgenic IgH genes are often active in both B and T cells. It may be that there is synergy between promoters and enhancers [77] such that the IgH enhancer could activate expression of immunoglobulin genes in T cells, but is unable to potentiate transcription from the promoters of heterologous genes when transfected into the same cells. Alternatively, as discussed in Section 4.1. l . , active IgH transcription may only require transient activity of the IgH enhancer. Thus, if the enhancer is active early in lymphocyte ontogeny, but is no longer fully active in mature T cells, the transient early activity of the enhancer may nevertheless be sufficient to ensure transcription of the transgenic IgH genes in mature T cells. Activity of the IgH enhancer early in lymphocyte ontogeny might explain why many T cells are found to harbour D-JH integrations and contain sterile IgH transcripts initiating in the region of the enhancer, as activation of the IgH locus might render it accessible to factors involved in both IgH transcription and variable gene segment rearrangement (see Chapter 4 and [34] as well :is references therein). Furthermore, the accessibility of the IgH locus in normal T cells is indicated by the fact that there is a DNase I hypersensitive site in the region of the p switch region in many T cell lines [12]. It is interesting in this context to note that the data discussed here suggest that it is the regulation of V, to DJH joining (and therefore, presumably, the control of accessibility of the germ line V,, cluster) that accounts for the lack of immunoglobulin heavy chain gene expression in T cells of normal mice. Although transgenic IgH genes are often expressed in both B and T cells, expression of transgenic K genes is B cell restricted [95,149]. This observation could be explained by a model in which rearrangement of the germ line K locus is correlated with its transcriptional activation. As the K locus does not normally rearrange until after productive heavy chain rearrangement and as T cells do not usually express complete heavy chain polypeptides, transgenic K genes would not be expected to be expressed in T cells. It should, however, be noted that assigning a role to the immunoglobulin enhancers in ‘activation’ of regions of the chromosome is premature. The immunoglobulin gene enhancers have always been assayed as transcriptional activators; they have not, as yet, been demonstrated to act as foci for regulatory events associated with altering local chromatin structure - as may be assayed, for instance, by regional DNase sensitivity. 5.2. Control of the difference in rnRNA abundance between B and plasma cells Plasma cells and their tumour analogues contain large amounts of mRNA for immunoglobulin heavy and light chains, the abundance being up to 100-fold higher than in B cells (see, for example, [153]). Several lines of evidence suggest that posttranscriptional events play a major role in the regulation of this change. The steady-state levels of heavy chain mRNA in the nuclei of B and plasma cells are much more similar than in the cytoplasm. Thus, 3-6-fold differences have been
170 found in the nuclear IgH RNA levels of cell lines which have 100-500-fold differences in cytoplasmic IgH mRNA levels [133,153]. A similar conclusion comes from nuclear run-off assays [37,133,152], where the polymerase loading across the IgH locus either appears to be comparable amongst representatives of both cell types or is certainly not sufficient on its own to account for the difference in mRNA levels. Therefore, the difference in the amount of mRNA accumulation is not solely due to a difference in the rate of production of the primary transcript. It is not known at which stage the differential regulation occurs, but the similarity of immunoglobulin nuclear RNA levels in B cell lymphomas and plasmacytomas suggests that it must be a cytoplasmic or late nuclear event [133,153]. It is probable that differential half-life of cytoplasmic mRNA for the immunoglobulin polypeptides is a major contributor [133]. It is conceivable that this differential half-life of immunoglobulin mRNA may be coupled in some way to translation. For instance, the increase in immunoglobulin mRNA in plasma cells may be correlated with the proliferation of endoplasmic reticulum or other changes associated with the differentiation into a secretory cell. In support of this idea, it has been found [37] that sterile IgH transcripts are not subject to differential posttranscriptional control in the same way as authentic IgH transcripts; in other words, the level of sterile transcripts (i.e. those lacking the variable region and its associated leader sequence) is similar in B cells and plasma cells. These sterile transcripts originate either from cryptic promoters upstream of DJH joints or in the region of the enhancer. The latter category cannot be translated [36]. Measurement of the ratio of membrane-bound to free cytoplasmic C, mRNA in B and T cell lines has shown that only about 50% of the sterile transcripts present in T cell lines are located on membrane-bound polyribosomes [34]. It is to be presumed that these are the sterile transcripts that originate upstream of the DJH joints [31,32]. Nuclear run-off assays have been carried out on splenic B cells [116,119,154]. In contrast to the findings in cell lines, the RNA polymerase density on the p gene was found to increase when resting B cells were stimulated with bacterial lipopolysaccharide, in one case by as much as 8-10-fold [116]. However, it should be remembered that lipopolysaccharide treatment not only causes B cells to differentiate but also causes them to leave the resting state and start proliferating, thus making it difficult to draw direct comparisons with cell lines.
5.3. The relative aburzdurice of membrane and secreted immunoglobulin Whereas membrane IgM bearing B cells contain either more pn,than ps mRNA or roughly equimolar amounts of the two forms, plasma cells contain a vast excess of pS mRNA. Examination of the organisation of the C, gene suggests various possible mechanisms for regulating the ratio of the production of the two mRNA forms (Fig. 3 ) . Four types of mechanism can easily be envisaged: (a) regulation of transcription termination such that much of the transcription in plasma cells terminates before the p,,, polyadenylation site; (b) regulation of cleavage/ polyadenylation such that, for example, the primary transcript is efficiently cleaved at the p\ polyadenylation site in plasma cells but not in B cells; (c) regulation of
171 L VDJ
$1
cP
*
CF4
s
M1 M2
1 as,
AS
Am
(not to scale)
Fig. 3 . Production of k,and p,,)rnRNAs.
splicing such that there is competition between the splicing out of the CP4-C,M1 intron and the use of the p5 polyadenylation site; (d) a regulated cleavage of the primary transcript at some point between the two polyadenylation sites which would therefore preclude the production of p,,,mRNA. Analysis of nuclear RNA has shown that the precursors of the membrane and secreted forms in the nucleus are present in the same ratio as the mRNAs in the cytoplasm [126]. This demonstrates that the relative production of p,,,and ps mRNAs is determined in the nucleus, although, as described in Section 4.4., the overall ratio of membrane IgM to secreted IgM produced is also controlled at the translational and/or posttranslational levels. Several groups have used nuclear run-off assays to ascertain whether transcription termination could play a role in determining the production of membrane versus secreted immunoglobulin [37,116-1181. Whilst no evidence of a specific termination site has been found, the data suggest that, whereas in B cell lymphomas most polymerase molecules continue considerably beyond the C,M polyadenylation site, in IgM-secreting plasmacytomas polymerase loading does fall off in the region of the membrane exons. This off-loading varies considerably between cell lines; in most lines tested the membrane exons are transcribed almost as actively as the C,4 exon, but in a few lines up to 80% of polymerase molecules off-load before reaching the membrane exons [37]. Comparison of lines that express the membrane or the secreted form of IgG2a indicates that, in both cell types, RNA polymerase continues substantially beyond the C,, membrane polyadenylation site [118]. Thus, termination of transcription may play a role in the regulation of p,,, versus p, production in some cell lines, but it is not clear whether this is generally true. Certainly, there is enough transcription through the p m polyadenylation site in plasmacytomas to ensure that mutant genes that have a defective p s polyadenylation site produce high levels of p mRNA, all of which is polyadenylated at the membrane site [155]. Furthermore, as discussed in Section 4.2. of this chapter, the
172 difference in polymerase loading in the region 3‘ of C,4 that is found on comparing B cell lymphomas and plasmacytomas, could be a consequence (rather than a cause) of differential cleavage/polyadenylation. Thus, it seems unlikely that the differential production of the mRNAs for membrane and secreted forms of immunoglobulin heavy chain is solely regulated at the level of transcription termination. There is evidence which supports the proposal that it may be possible to polyadenylate the primary IgH transcript at a membrane polyadenylation site and then subsequently cleave and polyadenylate at a secreted site. A small RNA has been described that is polyadenylated at the a,,, polyadenylation site and that appears to have a 5’ terminus close to the a, site [127]. Similarly, an RNA has also been described which is polyadenylated at p m and contains the C,M exons but not the other exons of the p gene [156]. However, these RNAs have either been described in B lymphomas or in a T cell lymphoma/plasmacytoma hybrid but they have not been found - as one might more reasonably expect - in several immunoglobulinsecreting plasmacytomas analysed [ 127,155,1561, Therefore, the significance of sequential cleavageipolyadenylation in the generation of mRNA for the secreted form of IgH polypeptides remains unclear. Whilst it has been popular to ascribe the differential production of pm and p< mRNAs to regulation at t h e level of polyadenylation (e.g. see [157]), it is notable that there is no direct evidence in support of this. Indeed, experiments in which the p m and p5 polyadenylation sites are used to substitute for the normal polyadenylation site of the human a-globin gene do indicate that the p,,, site is stronger than the ps site [ M I ; however, transfection of the chimaeric genes into B and plasma cell lines does not reveal any difference in the relative strengths of the two polyadenylation sites when comparing the two cell types. Thus, t h e relative production of p,,, and ps mRNAs is unlikely to be simply determined by the polyadenylation sites. Indeed, Peterson and Perry [159] found that normal p , , , / ~reg~ ulation was abolished when the p,,, site was brought 900 base pairs closer to the p\ site. In this case, both B and plasma cells produced roughly equimolar quantities of the two transcripts. Normal regulation was restored by the insertion of 900 base pairs of ‘miscellaneous’ DNA. These results suggest a model in which the relative production of the two forms of p mRNA is determined by competition between polyadenylation at psand splicing of C,4 to C,M1. This could be regulated, for example, by a trans-acting factor specific to plasma cells which inhibits splicing of C,4 to C,Ml. Alternatively, changes in the ratios of polyadenylation and processing effector molecules could be involved, such that polyadenylation is more efficient in plasma cells than B cells or splicing is more efficient in B cells than in plasma cells [160]. In conclusion, the relative production of p,,, and p5 is controlled at the level of RNA processing in the nucleus. An attractive model for the regulation of pm/ps production involves competition between cleavageipolyadenylation at the p, site and splicing of the C,4 and C,Ml exons.
173
5.4. Co-expression of two immunoglobulin classes A number of B cells have been described that co-express p and 6, p and y , p and a or p and E (see Section 4.6. of this chapter). Such co-expression requires alternative splicing of a common primary transcript. We do not know how such splicing occurs, although there is as yet no demonstration that such splicing is regulated in a cell type specific manner. It could be that the splicing pattern is simply a consequence of the three-dimensional structure of the primary transcript and that the production of mRNAs for multiple IgH classes is ultimately regulated at the level of production of the primary transcript by control of transcription termination or cleavageipolyadenylation. Finally, it is worth noting that, at least in the case of B cells co-expressing IgM and IgD on the membrane, the ratio of the amounts of the two heavy chain classes expressed o n the cell surface is considerably affected by translational or, more likely, posttranslational mechanisms ([ 134,1351 and see Section 4.8.).
References 1 Mather. E . L . and Perry. R.P. (1983) Proc. Natl. Acad. Sci. USA 80. 4649-4693. 2 Chung, S . - Y . , Folsom, V. and Woolcy. J . (1983) Proc. Natl. Acad. Sci. USA 80, 2427-2431. 3 Storb. U., Wilson. R.. Selsing, E. and Wallield. A . (1981) Biochemistry 20, 99&996. 4 Pospelov. V.A.. Klobeck. H . G . and Zachau. H . G . (1984) Nucl. Acids Res. 12, 7007-7021. 5 Rogers. J. and Wall. R. (1981) Proc. Natl. Acad. Sci. USA 78, 7497-7501. 6 Storb. U. and Arp. B. (1983) Proc. Natl. Acad. Sci. USA 80, 6642-6646. 7 Blackman, M.A. and Koshland. M . E . (19x5) Proc. Natl. Acad. Sci. USA 82. 3809-3813. 8 Parslow. T.G. and Granncr, D.K. (19x1) Nature 729. 449-451. 9 Parslow. T.G. and Granner. D . K . (19x3) Nucl. Acids Res. 11. 4775-4792. 10 Weischet. W.O.. Glotov. B.O.. Schnell. H . and Zachau, H.G. (19x2) Nucl. Acids Res. 10. 3627-3645. I 1 Mills, F.C.. Fisher. C . M . . Kuroda. R.. Ford. A . M . and Gould, H.J. (1983) Nature 306, 809-X12. 12 Storb. U.. Arp, B. and Wilson, R . (1981) Nature 294. 9(l-92. 13 Akira. S., Sugiyama. H . , Sakaguchi. N. and Kishimoto. T. (1984) EMBO J . 3, 677-681. I4 Nelson, K.J.. Mather, E . L . and Perry, R.P. (1984) Nucl. Acids Res. 12, 1911-1922. 15 Gerondakis, S., Boyd, A , , Bernard, O., Webb, E. and Adams. J.M. (1984) EMBO J. 3, 301?-3021. 16 Stavnezer-Nordgren, J. and Sirlin, S. (1986) EMBO J. 5, 95-102. 17 Mather, E.L., Nelson, K.J., Haimovich. J . and Perry, R.P. (1984) Cell 36, 329-338. 18 Nelson, K.J., Kelly, D . E . and Perry, R.P. (1985) Proc. Natl. Acad. Sci. USA 82, 5305-5309. 19 Wall, R., Briskin, M.. Carter. C . . Govan. H.. Taylor, A . and Kincade, P. (1986) Proc. Natl. Acad. Sci. USA 83, 295-298. 20 Koshland, M.E. (1985) Annu. Rev. Immunol. 3. 425-453. 21 Kaji, H . and Parkhouse, R . M . E . (1974) Nature 249, 45-47. 22 Mosmann, T.R., Gravel, Y., Williamson, A.R. and Baumal. R . (1978) Eur. J. Immunol. 8, 94-101. 23 Mechler, B. and Rabbitts, T . H . (1981) J . Cell Biol. 88, 29-36. 24 Storb. U . (1983) Biochem. Biophys. Res. Commun. 52, 1483-1491. 25 Cowan. N.J. and Milstein, C. (1974) J. Mol. Biol. 82, 469-481. 26 Tartakolf, A . and Vassalli. P. (1979) J. Cell Biol. 83. 284-299. 27 Argon, Y. and Milstein, C. (1984) J. Immunol. 133, 1627-1634. 28 Kelley. D.E.. Wiedemann, L.M., Pittet. A . - C . , Strauss, S . , Nelson, K.J.. Davis, J., Van Ness, B. and Perry. R.P. (1985) Mol. Cell Biol. 5. 166G1675.
174 29 30 31 32 33 34 35 36 37 38 39 40
41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79
Kwan, S.-P., Max. E . E . . Seidmann. J.G.. Lcder, P. and Scharff, M.D. (1981) Cell 26, 57-66. Bernard. O . , Cough, N.M. and Adams, J.M. (1981) Proc. Natl. Acad. Sci. USA 78, 5812-5816. Reth, M.G. and Alt. F.W. (1984) Nature 312. 418-428. Alt. F.W.. Rosenberg. N . . Enea. V.. Siden. E. and Baltimore. D. (1982) Mol. Cell Biol. 2. 38&4()0. Kemp, D.J.. Harris, A.W. and Adams. J.M. (1980) Proc. Natl. Acad. Sci. USA 77, 740C-7404. Zuniga, M.C., D’Eustachio, P. and Ruddle. N.H. (1982) Proc. Natl. Acad. Sci. USA 79, 30153019. Schwaber, J., Molgaard. H., Orkin, S.H.. Gould. H.J. and Rosen, F.S. (1983) Nature 304. 355358. Lennon, G.G. and Perry. R.P. (1986) Nature 318, 475-478. Kelley, D.E. and Perry, R.P. (1986) Nucl. Acids Res. 14. 5431-5446. Van Ness, B.G.. Weigert, M.. Coleclough. C., Mather, E.L.. Kelley, D . E . and Perry, R.P. (1981) Cell 27, 593-602. Yancopoulos, G . D . and Alt. F.W. (1985) Cell 40, 271-281. Wang, X.-F. and Calame. K. (1985) Cell 43. 659-665. Mather. E.L. and Perry, R.P. (1981) Nucl. Acids Res. 9, 6855-6867. Picard. D. and Schaffner, W. (1984) EMBO J . 3. 3031-3035. Kelley. D . E . , Coleclough. C . and Perry. R.P. (1982) Cell 29, 681-689. Wall, R . and Kuehl. M. (1983) Annu. Rev. Immunol. 1. 393-422. Benoist, C. and Chambon. P. (1981) Nature 290. 304310. Mason, J.O.. Williams, G.T. and Neuberger, M.S. (1985) Cell 41. 470-487. Grosschedl, R. and Baltimore. D. (198.5) Cell 41. 88.5-807. Picard. D. and Schaffner. W. (1985) EMBO J. 4. 2831-2838. Foster. J . . Stafford. J . and Queen. C. (1986) Nature 315. 423-425. Gillies, S.D. and Toncgawa. S . (1983) Nucl. Acids Res. 11. 7981-7997. Venkat-Gopal. T., Shimada, T.. Baur, A.W. and Nienhuis. A.W. (198.5) Science 229. 1102-1104. Queen, C., Foster. J.. Stauber, C . and Stafford. J. (1986) Immunol. Rev. 89. 49-68. Grosschedl. R.. Weaver. D.. Baltimore. D. and Costantini. F. (1984) Cell 38, 647-658. Parslow. T . G . . Blair, D.L.. Murphy. W.J. and Granner, D.K. (1984) Proc. Natl. Acad. Sci. USA 81. 26X-2654. Falkner, F.G. and Zachau, H . G . (1984) Nature 310, 71-74. Bergman. Y..Rice, D . . Grosschedl. D. and Baltimore, D . (1985) Proc. Natl. Acad. Sci. USA 81. 704 1-7045. Ballard. D.W. and Bothwell. A . (1986) Proc. Natl. Acad. Sci. USA 83. 96269630. Matsuuchi. L.. Cann. G.M. and Koshland. M.E. (1986) Proc. Natl. Acad. Sci. USA 83, 456460. Parslow, T.G., Jones. S.D., Bond. B. and Yamamoto. K.R. (1987) Scicnce 235. 1498-1501. Harvey. R.P., Robins. A.J. and Wells. J.R.E. (1982) Nucl. Acids Res. 10, 7851-7863. Perry. M.. Thomsen. G . H . and Roeder. R.G. (1985) J. Mol. Biol. 185. 479-499. Mattaj, I.W., Lienhard. S., Jiricny, J . and De Robertis. E.M. (1985) Nature 316, 163-167. Krol, A,. Lund, E . and Dahlberg, J.E. (1985) EMBO J. 4, 1529-1535. Ciiiberto. G., Buckland. R., Cortese, R. and Philipson. L. (1985) EMBO J . 4, 1537-1543. Ares. M.J., Mangin. M. and Weiner, A.M. (1985) Mol. Cell Biol. 5, 1560-1570. Mercola, M.. Goverman. J . , Mirell, C. and Calame, K. (1985) Science 227, 266270. Sassone-Corsi, P.. Wildeman, A. and Chambon. P. (1985) Nature 313. 458-463. Borrelli, E . , Hen, R. and Chambon. P. (1984) Nature 312. 6OX-612. Velcich. A . and Ziff. E . (1985) Cell 40. 705-716. Hen, R.. Borrelli, E . and Chamhon, P. (1985) Science 230. 1391-1394. Singh, H.. Sen. R., Baltimore, D. and Sharp. P.A. (1986) Nature 319, 154-158. Hromas, R. and Van Ness, B. (1986) Nucl. Acids Res. 14, 4837-4848. Mizushina-Sugano. J . and Roeder, R.G. (1986) Proc. Natl. Acad. Sci. USA 83, 8511-8515. Sive. H.L. and Roeder, R.G. (1986) Proc. Natl. Acad. Sci. USA 83, 6382-6386. Sive, H.L.. Heintz. N. and Roeder. R . G . (1986) Mol. Cell Biol. 6. 3329-3340. Schirm. S., Jiricny, J. and Schaffner, W. (1987) Genes and Development I , 65-74. Garcia. J.V.. Bich-Thuy. Le t., Stafford. J. and Queen, C. (1986) Nature 322, 383-385. Landolfi. N.F., Capra. J.D. and Tucker. P.W. (1986) Nature 323. 548-561. Staudt, L.M., Singh, H . . Sen. R., Worth. T., Sharp, P.A. and Baltimore, D. (1986) Nature 323, 64&643.
175 80 Serfling. E.. Jasin, M. and Schaffner. W. (1985) Trends Genet. 1. 224-230.
Banerji, J . . Olson, L . and Schaffner. W . (1983) Cell 33. 729-740. Gillics, S.D.. Morrison, S.L., Oi. V.T. and Tonegawa, S. (1983) Ccll 33, 717-728. Neuberger, M.S. (1983) E M B O J. 2, 1373-1378. Picard. D. and Schaffner. W . (1984) Nature 307. 80-82. Stafford. J . and Queen, C. (1984) Mol. Ccll Biol. 4, 1042-1049. Rabbitts, T.H., Forster. A , , Baer, R . and Hamlyn. P.H. (1983) Nature 306, 806-809. De Villiers. J . . Olson, L.. Tyndall. C. and Schaffncr, W. (1982) Nucl. Acids Res. 10, 7965-7976. Wasylyk, C. and Wasylyk. B. (1986) EMBO J. 5 , 553-560. Kadesch, T., Zervos. P. and Ruezinsky. D. (1986) Nucl. Acids Res. 14. 8209-8221. Ishihara, T., Kudo, A . and Watanabe. T. (1984) J . Exp. Med. 160, 1937-1942. Gerlinger, P., LeMeur. M . , Irrmann. C.. Rcnard, P., Wasylyk, C. and Wasylyk, B. (1986) Nucl. Acids Res. 14, 6565-6577. 92 Reik. W.. Williams, G . . Barton. S., Norris, M.. Neubcrger, M. and Surani, M.A. (1987) Eur. J . Immunol. 17, 465-469. 93 Ephrussi. A.. Church. G . M . , Toncgawa. S. and Gilbert, W . (1985) Science 227. 134-140. 94 Church. G . M . . Ephrussi, A , . Gilbert. W. and Tonegawa. S. (1985) Nature 313. 798-801. 95 Storb. U.. Pinkert, C.. Arp, B.. Eagler. P.. Gollahon. K.. Manz. J . , Brady. W. and Brinster, R.L. (1986) J. Exp. Med. 164, 627-641. 96 Wabl, M.R. and Burrows, P.D. (1984) Proc. Natl. Acad. Sci. USA 81, 2452-2455. 97 Klein. S.. Sablitzky. F. and Radbruch, A . (1984) EMBO J . 3. 2473-2476. 98 Eckhardt, L . A . and Birshtein. B.K. (1985) Mol. Cell Biol. 5 , 85G868. 99 Aguilcra. R.J., Hope, T.J. and Sakano. H . (1985) E M B O J . 4. 3689-3693. 100 Zaller. D.M. and Eckhardt. L.A. (1985) Proc. Natl. Acad. Sci. USA 82, 5088-5092. I01 Klein, S., Gerster. T.. Picard. D . . Radbruch. A . and Schaffner. W . (1985) Nucl. Acids Res. 13. 8901-89 12. 102 Scholer, H . R . and Gruss. P. (1985) E M B O J . 4. 3005-3013. 103 Augereau. P. and Chambon, P. (1980) EMBO J . 5 , 1791-1797. 104 Maeda, H . . Kitamura, D . . Kudo. A , . Araki. K. and Watanabe, T. (1986) Cell 45, 25-33. 105 Sen. R . and Baltimore. D . (1986) Ccll 46.705-716. 106 Weinberger, J . , Baltimore, D. and Sharp. P.A. (1986) Nature 322. 84C848. 107 Girnble. J.M. and Max. E.E. (1987) Mol. Cell Biol. 7, 15-25. I O X Sen. R . and Baltimore. D. (1986) Cell 47. 921-928. 109 Atchison. M.L. and Perry. R . P . (1987) Ccll 48. 121-128. I 1 0 Rosoff. P.M.. Stein. L.M. and Cantlcy. L.C. (1984) J. Biol. Chem. 259, 7056-7060. I I 1 Imbra. R . J . and Karin. M. (1986) Nature 323. 555-558. 112 Spandidos. D.A. and Anderson. M.C.M. (1984) FEBS Lett. 175, 152-158. 113 Neuberger, M.S. and Williams, G.T. Manuscript in preparation. 114 Gregor. P.D. and Morrison, S.L. (1986) Mol. Cell Biol. 6, 1903-1916. 115 Laimins. L . A . . Khoury, G . . Gorman, C.. Howard, B . and Gruss, P. (1982) Proc. Natl. Acad. Sci. USA79.6453-6457. 116 Yuan, D. and Tucker. P.W. (1984) J . Exp. Med. 160, 564-583. 117 Ruether, J.E.. Madcrcrious. A , . Lavery. D . . Logan. J.. Fu. S.M. and Chen-Kiang, S. (1986) Mol. Cell Biol. 5 , 123-133. 118 Milcarek, C . and Hall, B. (1985) Mol. Cell Biol. 5 , 2514-2520. I19 Yuan. D . (1986) Mol. Cell Biol. 6, 1015-1022. 120 Falck-Pederson, E., Logan, J . , Shenk, T. and Darnell, J . E . (1985) Cell 40, 897-905. 121 Whitelaw, E. and Proudfoot, N. (1986) E M B O J. 5, 2915-2922. 122 Moore. C . L . , Skolnik-David, H . and Sharp, P . A . (1986) EMBO J . 5 . 1929-1938. 123 Grabowski. P.J., Seiler, S . R . and Sharp. P.A. (1985) Cell 42. 345-353. 124 Krainer, A . R . and Maniatis. T. (1985) Cell 42. 725-736. 125 Knapp, M.R.. Liu. C.P.. Newell. N . . Ward. R.B.. Tucker. P.W.. Strober. S. and Blattncr. F. (1982) Proc. Natl. Acad. Sci. USA 79, 299&3000. 126 Nelson. K.J., Haimovich. J. and Perry, R.P. (1983) Mol. Cell Biol. 3, 1317-1332. 81 82 83 84 85 86 87 88 89 90 91
176 127 128 129 130 131 132 133 134 135 136
137 138 139 140
Stavnezer. J . (1986) Nucl. Acids Res. 14. 6129-6144. Laskov. R., Ishay-Michaeli, R.. Wallach. M., Givol. D . and Kim. K.J. (1983) EMBO J. 2, 167-172. Yaoita. Y . , Kumugai, Y . , Okumura, K. and Honjo. T. (1982) Nature 297, 697-699. Perlmutter, A.P. and Gilbert. W . (1984) Proc. Natl. Acad. Sci. USA 81, 7189-7193. Chen, Y.-W., Word. C.J., Jones, S.. Uhr, J.W., Tucker, P.W. and Vitetta. E.S. (1986) J . Exp. Mcd. 164, 548-561. Chen, Y.-W., Word, C . J . , Vaithilingham. D . . Uhr. J.W.. Vitetta, E.S. and Tucker, P . W . (1986) J . Exp. Med. 164, 562-579. Mason. J . O . . Williams, G.T. and Neuberger. M.S. (1987) Manuscript submitted. Yuan, D . and Tucker, P.W. (1984) J . Imniunol. 132, 1561-1565. Yuan. D . (1984) J . Immunol. 132, 156&1570. Yuan. D . and Tucker, P.W. (1984) J . Exp. Med. 156, 962-974. Rogers, J . , Choi, E . , Souza. L.. Carter. C . . Word, C . , Kuehl, M.. Eisenherg, D . and Wall. R . (1981) Cell 26, 19-27. Sitia. R . (1985) Mol. Immunol. 22. 1289-1296. Sitia, R . , Neuberger, M.S. and Milstein, C . , manuscript submitted. Raschke. W . C . , Mather, E . L . and Koshland. M . E . (1979) Proc. Natl. Acad. Sci. USA 76.
3469-3473. 141 Sidman. C. (1981) Cell 23, 379-389. 142 Vassalli. P.. Tartakoff, A., Pink. J.R.L. and Jaton, J.C. (1980) J . Biol. Chem. 255, 11822-11827. 143 Sihley, C . H . , Ewald, J.J., Kehry, M.R.. Douglas, R.H., Raschke. W.C. and Hood, L.E. (1980) J. Immunol. 125, 2097-2105. 144 Cattaneo. A . and Neuherger, M.S. (1987) E M B O J. 6. 2753-27.58. 145 Brandtzaeg, P. and Prydz, H . (1984) Nature 311, 71-73. 146 Deans, R.J., Denis. K . A . , Taylor. A . and Wall. R. (1984) Proc. Natl. Acad. Sci. USA 81. 1292-1296. 147 Falkner. F . G . and Zachau, H . G . (1982) Nature 298. 286-288. 148 Stafford. J . and Queen, C. (1983) Nature 306, 77-79. 149 Storb, U.. O’Brien. R.L., McMullen. M.P.. Gollahon, K.A. and Brinster. R.L. (1984) Nature 310. 238-241. 150 Rusconi, S. and KBhler. G. (1985) Nature 314. 33&334. 151 Yamamura. K . I . , Kudo, A . , Ebihara. T., Kamino. K.. Araki. K.. Kumahara, Y . and Watanabe. T. (1986) Proc. Natl. Acad. Sci. USA 83, 2152-2156. 152 Gerster. T., Picard, D. and Schaffner, W . (1986) Cell 45, 4.5-52. 153 Perry. R.P. and Kelley, D.E. (1979) Cell 18. 1333-1339. 154 Chen-Bettecken, U., Wecker, E. and Schinipl, A. (1985) Proc. Natl. Acad. Sci. USA 82,7384-7388. 155 Danner, D. and Leder, P. (1985) Proc. Natl. Acad. Sci. USA 82. 865Pr8662. 156 Kemp, D.J., Morahan, G . , Cowman, A.F. and Harris, A.W. (1983) Nature 301, 83-87. 157 Early, P., Rogers, J., Davis, M.. Calame, K., Bond, M., Wall, R . and Hood, L . (1980) Cell 20, 3 13-3 19. 158 Mason, J . O . (1987) P h . D . Thesis. University of Cambridge. 159 Peterson, M . L . and Perry, R.P. (1986) Proc. Natl. Acad. Sci. USA 83, 8883-8887. 160 Milstein, C . , Burrone, O . R . , Dunnick, W.. Milstein, C.P. and Rabbitts, T . H . (1981) The Class Switches, in: Mechanisms of Lymphocyte Activation (K. Resch and H. Kirchner. Eds.), pp. 6>77.
Elsevier, Amsterdam. 161 Byrne. B.J., Davis, M.S., Yamaguchi, J., Bergsma, D.J. and Subramanian. K.S. (1983) Proc. Natl. Acad. Sci. USA 80, 721-725. 162 Spandidos, D.A. and Wilkie, N.M. (1983) EMBO J . 2, 1193-1199. 163 Weiher, H., Konig, M. and Gruss, P. (1983) Science 219, 626631. 164 Max, E . E . , Maizel, J . V . and Leder, P. (1981) J . Biol. Chem. 256, 51164120.
177 CHAPTER 7
The generation and utilization of antibody variable region diversity TIM MANSER Department of Molecular Biology, Princeton University, Princeton, NJ 08544, USA
1. Introduction It is now well established that the vertebrate immune system is capable of synthesizing an enormous number of distinct antibody variable region structures. In recent years the genetic basis for this ability in the mouse has been elucidated. Diversity of the V region arises from four sources: (a) diversity encoded directly in the germ-line genome in the form of V region heterogeneous multigene families; (b) diversity created by the somatic rearrangement of different combinations of gene segments to form functional V region genes, and the association of different V, and V, polypeptides to form the heterodimeric V domain (combinatorial diversity); (c) diversity created at the junctions of V gene segments due to apparent addition and deletion of nucleotides during segment joining (junctional diversity) ; and, finally, (d) diversity created by somatic replacement of nucleotides in expressed V, and V, genes (somatic mutation). What now remains to be determined is the manner in which this potential for generating diversity is utilized toward the formation of antibody specificity and immunity. In this chapter, I review what is known about the genetic mechanisms that create diversity and discuss recent experiments that provide insights into the question of how this diversity is utilized during an immune response. The majority of research in this area has used the mouse as an experimental system, and 1 will draw upon this data base nearly exclusively. Data obtained from other systems will be discussed only when they appear to conflict with what has been learned from the mouse. The ability to create a large number of different V region structures should be of little value to the organism if most or all of these structures are not functionally distinct - that is, have different binding specificities. Nevertheless, it is possible that the function of antibody diversity in some instances is not related to specificity for antigen, or that some diversity has little or no function. I therefore endeavor to point out the evidence for the functionality of diversity, paying particular attention to observed differences in antigen specificity. In recent years evidence has accumulated strongly suggesting that the expression of both combinatorial-junctional diversity and of somatic mutational diversity varies as a function of the developmental stage of the B cell. Gene segment rear-
178 rangements that create combinatorial and junctional diversity seem to occur nearly exclusively at the pre-B cell stage of ontogeny - that is, during the antigen independent phases of B cell differentiation. During these stages of differentiation each pre-B cell combines and expresses a single set of segments and thus the resulting B cell expresses a single V region structure. It appears that this form of diversity remains largely invariant throughout the subsequent antigen dependent stages of differentiation. Conversely, there is a strong correlation between the time elapsed after antigenic stimulation of the B cell population and the degree of somatic mutational diversity expressed by this activated population. This suggests that the majority of mutational diversity may be created during the antigen dependent stages of differentiation. Unfortunately, the degree to which cellular selective processes, acting on either the ‘naive’ or immune B cell population, influence the degree of expression of these two forms of diversity, is not well understood. Antigen dependent and independent phases of B cell ontogeny nevertheless provide two convenient conceptual frameworks in which to review the formation and utilization of diversity. The developmental regulation of expression of the different forms of V region diversity could have a profound impact on the character of the preimmune and immune antibody repertoires and on the manner in which the former is transformed into the latter.
2. Antigen independent diversity 2.1. Combinatorial diversity An active light chain variable region gene is created by the somatic juxtaposition of two gene segments, the V, and J, segments. A functional heavy chain variable gene is constructed by the fusion of at least three gene segments, the V,, D and J, segments (see [l] and [2] for reviews). Here I briefly review the origins of the resulting combinatorial diversity and refer the interested reader to Chapters 2 and 3 for a more detailed discussion of the structure, number and genomic organization of immunoglobulin V and C region genes. The V, and VL segments encode the majority of their respective V region polypeptides - the amino-terminal 95-97 amino acids. The JH and JL gene segments encode the carboxy terminal 12 to 17 amino acids and the D segment encodes a region between V, and J, consisting of between 1 and 15 amino acids. There are two classes of light chain variable region genes in mammals, K and A. Gene segment ‘counting’ experiments that rely on Southern blotting, Cot analysis and cloning and sequencing suggest that there are approximately 100 V, and 300 V, segments in the mouse genome [3-61. Only two V, gene segments are present in the genome of most inbred strains of mice [7] and the concentration of A light chains in normal mouse sera is only 5% of the K concentration. A single study of the D region segments encoded in the genome of the BALB/c mouse revealed 12 different segments which could be grouped into two families (D-FL16 and D-SP2), and a single segment (D-Q52) [8]. Sequencing analyses of expressed V, genes have provided evidence for several more germ-line D
179 segments [9.10, T. Manser, unpublished results]. Sequencing of the DNA upstream of mouse C, and C, revealed four functional JH and four functional J, segments [ 11-14]. Sequence analysis of expressed variable region genes has confirmed that these segments are probably the only functional J segments in the genome since every expressed sequence can be accounted for by one of the already characterized germline J’s. The molecular map of the BALB/c V, locus reveals that only two V, and 4 J, segments are present. Of the eight VA-J, combinations that are theoretically possible, only three are predominantly found to be expressed among myelomas and hybridomas [7]. Studies on the rearrangement status of V gene segments in fetal liver (the fetal site of B cell development) and in Abelson virus transformed pre-B cell lines that spontaneously undergo D to JH, VH to DJH and V,- to JL recombination in vitro suggest that a temporal pattern of V gene segment rearrangement occurs during the development from pre-B to B cell (see Chapter 4 of this volume for a more detailed discussion). The deduced sequence of joining events is: D to J, at both chromosomes; VH to DJH at one allele, followed by a second such event at the other allele if the first event creates a non-functional gene (e.g. results in an out of frame joint); V, to J, (at both alleles if necessary) and, finally, V, to J, if both V,-JK’s are non-productive or the productive V,J, has been deleted [15]. It has been proposed [ 161 that this temporal pattern results from positive and negative regulation of rearrangement events mediated by the protein products of productively rearranged gene segments (e.g. an intact p heavy chain inhibits subsequent VH to DJ, joining and promotes V,-J, joining). It is suggested that such regulation is necessary to ensure that the expression of heavy and light chain genes is allelically excluded (see Chapter 4). Due to the order and orientation of the VH and V, gene segments in genomic DNA (see Chapter 3 ) it is possible that in some instances a given product of gene segment fusion could be replaced due to secondary joining events. In the case of heavy chain variable region gene segments, where the order of segments along chromosome 12 of the mouse is: centromere-VH family-D family-J, family [6], and the D’s and JH’s and possibly all the V,’S are in the same orientation [17], a primary DJH joint could be replaced by subsequent rearrangement of an upstream D to a downstream J H . Analogously, a joined V,J, could be replaced by an upstream V, in the same orientation, or a downstream V, in opposite orientation, to a downstream J,. Such secondary rearrangements may increase the frequency of productive joints on a per cell basis during B cell ontogeny and may serve a purpose during antigen dependent stages of differentiation as well (see below). The mechanism by which V region gene segments become juxtaposed has only recently received experimental attention [18-221. I refer the interested reader to Chapter 4 of this volume for a more detailed discussion of these matters. Evidence does exist, however, suggesting that certain gene segments and combinations of segments are expressed more predominantly than others in the B cell population. Since such biases could clearly influence the amount of functional V region diversity expressed by the immune system, the evidence for such biases will now be considered. Alt and his colleagues have observed that of the more than 100 V,,
gene segment exons present in the V, locus of the BALB/c mouse [6], only a few are predominantly expressed in fetal liver [16,23]. These gene segments are members of the V,7183 family and are those most proximal to the JH-CH locus [16]. This observation, combined with the observation that D to J, recombination precedes V, to D recombination [24,25], has led these workers to propose a 3’ to 5‘ ‘tracking’ model for V, gene segment rearrangement [23]. Other workers have confirmed that members of the VH7183 family are involved in the majority of V, rearrangements in fetal liver [26]. Such a bias in segment usage at the stage of immature B cells would be expected to have an influence on V, segment usage in the mature B cell population and thus on the degree of functional diversity expressed by this population. Several lines of evidence suggest, however, that this fetal bias in V, use is not reflected by the V region repertoire of the adult mouse. Klinman and others have evaluated the V regions expressed by the B cell population at various stages of mouse development [27-311. The results suggest that while an extreme fetal bias in V, segment usage appears to exist, this bias is not carried over into the B cell population of the mature animal. These studies have also shown that members of the VH7183 family are not the only V, sequences prevalently expressed in fetal liver, members of the V,36-60 family are also disproportionately expressed [29,31]. Since the V,36-60 family has been mapped as one of the most distal to the J H - C H locus [32], this observation makes the 3’ to 5’ ‘tracking’ model far less appealing. Manser and Gefter have also shown that both the V,36-60 gene segment and a particular member of the V~J.558family (VHIdCR) are each productively rearranged and expressed at a frequency of approximately 1/350 adult B cells [33]. Further, the V,IdCR segment is productively rearranged to a diverse group of D segments and to all the J, segments at roughly equal frequencies [34]. In toto, these data suggest that during the developmental transition from fetus to adult, the V, repertoire is transformed from being highly biased in VH segment expression to being, to the first approximation, random. How is this transition accomplished? A possible molecular explanation has been recently provided by the work of Weigert and his colleagues [35] and Reth and his coworkers [36]. Both of these groups have been examining V region expression in transformed B cells. Both groups have obtained evidence that a phenomenon termed ‘V, replacement’ spontaneously occurs in members of these transformed lines. That is, the V, exon segment which was originally part of a VHDJH complex has been ‘replaced’ by another, upstream V, exon segment, leaving the DJ, region of the original VHDJH gene undisturbed. While the mechanism whereby this replacement takes place is not understood, the site of VH to DJ, recombination seems to occur at a position in the ‘acceptor’ V, where a cryptic heptamer sequence is found. This heptamer in combination with a nonomer sequence is found in highly conserved form flanking all functional germline V, and VL segments examined to date, and is thought to constitute part of the recognition sequence for the putative ‘recombinase’ enzymes that mediate gene segment joining (reviewed in [1,2] and in Chapter 4 of this volume). If V, replacement occurs in pre-B cells which initially express a member of the V,7183 family, and the donor V, is chosen from any of the up-
181
stream VH’s with similar frequency, it may explain why the fetal repertoire is highly skewed toward expression of the V,7183 family while the adult repertoire is combinatorially more diverse. This observation also has important implications for the mechanism of gene segment joining (see Chapter 4 in this volume). While the adult VtjDJH repertoire appears to be rich in combinatorial diversity. the work of Coleclough and Honjo and their colleagues suggests that this is not true of the adult V,J, repertoire [37,38]. Both groups of investigators have found that the J,1 and J,2 gene segments (first and second most distal segments to the C, exon, respectively) are predominantly expressed among splenic B cells. N o evidence suggesting skewed use of certain V, gene segments has been obtained, and since the four functional J, segments encode the highly conserved fourth framework region of the V, domain it is unclear at present whether the biased use of J,1 and J,2 has any major effect on the diversity of specificity expressed by the mature B cell population. While there may be biases in the use of certain V exon segments by the mature B cell population, the number of distinct antigen-binding specificities expressed by this population exceeds lo7 [39,40]. It is generally assumed that the contribution of combinatorial diversity to this figure is substantial, but there is little direct evidence supporting the idea that a large fraction of combinatorial diversity is functional. Affinity labelling experiments have been used to show that both V, and V, contribute to the formation of the antigen combining site [41]. However, the specific contribution of individual gene segments to specificity has not been systematically studied. This problem is further complicated by the observation that, while hybridomas isolated after immunization with a particular antigen often display similar antigenic specificities, their only structural commonality may be that they share a single V, or V, segment [10.42-531. It is obvious that different combinations of gene segments most often encode V domains with different antigen specificities (e.g. see [42,54,55]). Nevertheless, knowledge of the physical basis for this difference in specificity is restricted to the few V domains for which the X-ray crystallographic structure of an antibody-antigen complex has been solved [56,57]. In most of these cases the eliciting antigen is not known. Therefore, while it is clear that some measure of the expressed combinatorial diversity must be related to antigenic specificity, the possibility must be considered that some fraction of this diversity is non-functional [58] or provides a function unrelated to antigen specificity (e.g. see reference [59]). In this regard it is possible that V genes are in pieces largely to ensure that junctional diversity (see below) can be created. Having a large number of different copies of each type of segment may not only allow diversity to be stored in the germ line but may also increase the chance that junctional diversity is created productively. For example, since four functional J, segments are present in the genome, a maximum of four V,J, rearrangements can presumably occur per cell per chromosome. A single pre-B cell has a maximum of eight chances to make a productive V,J, rearrangement. Since an out of frame join will on average occur twothirds of the time, a cell has eight chances to beat one in three odds. Three or more joining events are required to produce a functional V, gene representing one
182 in nine odds of productive joining. In the absence of multiple V segments the efficiency of pre-B to B cell transition would be very low. A further question concerning the functionality of combinatorial diversity is raised by the fact that the bulk of a heavy or light chain variable region gene is encoded in either the V, or V, segments - only 10-20% of the carboxy-terminal information is donated by the JL or D and JH segments. Four of the complementarity determining regions (CDR’s) are encoded in the germline (within the V, and V, segments) and only two are partially created by somatic rearrangement. If it is assumed that, on average, all six CDR’s participate in the formation of an antigen combining site, the specificity of an antibody is largely determined by germ-line information. Perhaps the structure of germ-line encoded CDR‘s has been selected in evolution for ‘general antigen binding’ characteristics while the somatically constructed CDR’s provide fine specificity of binding.
2.2. Junctional diversity It was initially observed by Max et al. [60] that a joining event between two gene segments could occur at different nucleotide positions within these germ-line elements. Now that hundreds of rearranged VH and V, genes have been sequenced, it has become clear that the mechanism(s) responsible for both VL-JL and VH-DJH joining are highly ‘imprecise’. It appears that a large fraction of joining events are out of frame with respect to D , J, or JL downstream coding sequences. It has been suggested that the allelic exclusion of expression of heavy and light chain genes can be largely explained by non-functional joining events [61]. A recent observation by Karjalainen and Coleclough, however, suggests that an out-of-frame joining event may sometimes be compensated for by a deletion of one or two base pairs upstream of the joint [62]. The ‘imprecision’ of gene segment joining not only generates lack of function but also generates VH and VL polypeptides with novel amino acids and length differences in junctional regions. That the resulting antibody diversity is functional in the case of light chains has been directly demonstrated by Eisen [63] and Capra [64] and their colleagues. These investigators used heavy and light chain reassociation experiments in which a heterologous light chain differed in amino acid sequence from the homologous chain at the VLJ, junction. In both cases the resulting reassociated antibodies lacked affinity for a haptenic determinant characteristic of the homologous antibody. In the case of V, genes it appears that not only does the imprecision of V, to DJH and D to J, joining create diversity, but de novo addition of nucleotides at both junctions and possible D to D joining events amplify this diversity. Nucleotides are often present at VH-D and D-JH junctions that cannot be accounted for by germ-line sequences at the 3’ cnd of the VH segment. the 5’ end of the J, segment, or the 5’ and 3’ cnds of the putative D gene segment. Data presented in Fig. 1 serve to illustrate this point. Alt and Baltimore have proposed that the lymphocyte specific terminal transferase (a template independent DNA polymerase) adds these nucleotides de novo during D to JH and VH to DJ, joining, and they
have termed such sequences ’N’(nucleotide) regions [65]. The observation that N regions tend to be rich in G residues has been cited by these investigators a s support for the role of terminal transferase in N region addition since this enzyme adds dGMP preferentially to free DNA 3‘ hydroxyl ends in vitro. Recent experiments [66] using Abelson virus transformed pre-B cell lines in which VH to DJH and D to J, joining spontaneously occurs have lent support to this hypothesis and are discussed in Chapter 4. Comparison of the ‘core’ D region sequences found in rearranged V, genes with the sequences of the characterized germ-line D elements suggests that D to D joining events may also increase the diversity in this region o f the V, gene. It is D
VH
-
JH
....... .
.....................................................
. . _AGA __
ACC TAT GGT/GGT A
.....AGA
TAT AGT AAC AC
C TAT GCT ATG
_ _ _ _ _ AGA
GAN NAT GGT TAN CC
G TTT GCT TAC
.....AGA
GNN GAT GAT GGT TAC TCG CT
._... AGA
AAG ATC TAT GAT/GGT TAC G
.....AGA
M G GGA/GGN
.....AGA
TCG GGG GGT TAC GAC GGG
.....AGA
GAC TAT AGT GAC TAC CTG T A
- - -AGA
GC TAC TGG TAC
GAT/TAT AGT AAC TAC GGC C
T GCT TAC GG TTT GCT TAC CC TGG T T T GCT TAC TGG C TAC TTT GAC
..
ACC TCC TCC TAT GAT/GGN GAC CTC T
CC TGG NTT GCT
.....AGA
TCT GGG/TAT
GT GNC TGG NTT
.....AGA
GNC AGN TCG G G N TAC CCC CTG
.._.. AGA
TCC CCT TAN/AGT AAC TAC CT
..._. AGA
TCG ATG G/TT ACT AC/T
GAT G
CTA T
GCT ATG GAC TAC T TAC TAT GCT AT TAC TAT GCT
Fig. 1. Nucleotidc sequences in the VllD.II,region of several functional V,, genes that arc partially cncoded by the same V,, segment. The sequences arc aligned at the 3’ terminal AGA codon donated by the V,, segment and are prescntcd in triplet form. Nucleotides that can be accounted f or by either germline V,,, D o r J , I gene segments arc shown in plain type. those that cannot arc shown in italics (i.c. putative ’N’ regions). The boundarics between V,,. D and J,, coding regions are indicated by gtps in the sequence. Nucleotidcs that have not been unambiguously identified are represented by an .N’. Slashes represent locations in which homology with one germ-line D element ends and homology with another such element begins (i.c. putative sites of D-D joining). Homologies o f less than 4 nucleotides were considered insignificant for the purposes of this analysis. All o f these penes are expressed by hybridomas derived from the splenic B cells of AiJ mice. The spleen cells were mitogcnically stimulated in vitro with either bacterial lipopolysaccharide or goat anti-mouse IgM antibodies prior to hyhridoma formation. The top 8 sequcnccs are from [ 3 S ] which provides a detailed description of the isolation and characterization of thcse hybridomas. The hottom 5 sequences have not been previously published. (T. Manser. unpublished ohscrvntions.)
184 often observed that the sequence in the D region of expressed V, genes can be best accounted for by assuming that two germ-line D elements have contributed information (for examples see Fig. 1). Kurosawa and Tonegawa originally proposed that D to D joining events might account for such 'hybrid' D regions [8].It must be said, however, that it is also possible that a number of germ-line D segments remain to be identified or that the D segment repertoire varies in different strains of mice since several investigators have characterized V, genes that contain D regions whose structures cannot be accounted for by any known BALBic germline D element [9,10, T. Manser, unpublished results]. Recent experiments by Gefter and his colleagues [67] and Capra and Tucker and their colleagues [68,69] have provided more detailed evidence that D to D joining events may occur. Both groups of investigators noticed that a serine residue recurred at the VHD junction in antibodies synthesized by hybridomas derived from NJ mice immunized with I-'-"zophenvlarsonate (An)-protein conjugates. All these antibodies are Ars specific and are partially encoded by a V, segment whose germline sequence is known. Gefter and his colleagues used site directed mutagenesis to show that if this serine residue is changed to alanine, Ars binding activity is lost [70]. Thus, it is possible that antigen selection of randomly generated junctional amino acids is responsible for the recurrence of serine at the V,-D junction. However, several lines of evidence argue that this is not the case. First, if the serine is changed to threonine by site-directed mutagenesis no alteration in the affinity for Ars can be detected in the resulting antibodies [70]. Threonine has never been observed at this position in the over 30 independently isolated Ars binding antibodies which are encoded by this single VH segment. Second, in all such antibodies the junctional serine residue is encoded by the TCX group of serine codons, AGT or AGC serine codons are never observed. Examination of the 3' flanking sequences of the encoding germline V, segment [71] shows that the terminal codon of this segment is immediately flanked by CAC, thus no part of the TCX serine codon could be donated by 3' flanking sequences of this segment. The possibility that another V, segment, identical in all respects to the characterized germ-line V, except in containing a 3' flanking TCX codon, is present in the A/J genome, has been effectively ruled out using Southern blotting analyses [67]. Finally, the amino acid codon immediately 3' to the TCX serine codon is highly variable, while the next 3' codon can be usually accounted for either by a characterized AiJ germline D element [69] or, more interestingly. by a J,, segment (direct V, to J, joining should not be possible if the currently accepted rules of gene segment joining are correct). This evidence strongly suggests that a fourth segment contributed to the formation of the heavy chain variable region gene that encodes this family of antiArs antibodies. An alternative hypothesis is that the coding V, segment 'replaced' (see above) another serine encoding gene segment during the formation of these V, genes. Two likely candidates for these 'acceptor' segments that are members of the V,7183 family do not contain a T C dinucleotide sequence at their 3' ends [23]. Four heavy chain variable region gene segments may be utilized during other rearrangement events as well since VH-D junctional amino acids have been observed to be highly conserved among antibodies elicited with several other antigens [43].
2.3. T h e multiplicative potential of comhinatorial and junctional diversity If we assume that, to the first approximation, V gene segments and their ultimate polypeptide products independently assort during the formation of V domains in the B cell population, then 10’ different combinations (100 V,’s x 20 D’s x 4 J,’s x 300 V,’s x 4 J,’s) can be expressed by this population (ignoring the contribution of V,,). A conservative estimate concerning the number of different junctional amino acids increases the number of possible V region structures to greater than loy. There are approximately 1OX B cells in a mouse. Any individual combination of segments and junctions. therefore, has a probability of less than 1 in 10 of being expressed at any one time. These calculations, although probably oversimplifications, serve to make two points: ( 1 ) the number of different antibody structures that can be created by combinatorial and junctional processes alone is enormous, and (2) whether or not an antibody encoded by any single combination of segments and junctions will be expressed during an immune response depends not only on whether the resulting antibody has specificity for the immunogen, but also on the probability that this combination will be assembled as well. Due to the large number of possible variable region domains as compared to total B cells, genetically identical individuals will express. at any one time. very different antibody repertoires. Is this amount of diversity required for immune function? Many different combinations of segments and junctions are clearly capable of encoding antibodies with similar specificities, that is. the V region repertoire is redundant [43-531. Why, then, are so many gene segments carried in the germ-line? A possible explanation for this apparent paradox is provided by the ‘priming problem’ argument [72] - extensive diversity is required to ensure that the immune response begins within a reasonable time after antigen is encountered. A potential for diversity that is both redundant in terms of antigen specificity and greater than can be expressed at one time, may serve to buffer the animal against the possibly deleterious effects of both the stochastic assortment of gene segments and the ‘imprecision’ of joining. That is, the probability that a given antigenic specificity will reside in the ‘null set’ is minimized. It must also be considered that the excess diversity is functioning in an immuno-regulatory capacity [59] and is not directly related to antigen specificity.
3. Antigen ‘dependent’ diversity In the previous sections I have discussed issues concerning the forms of antibody diversity that are expressed by both the ‘antigen naive’ and the immune B cell populations. I now turn to a discussion of a form of diversity that is predominantly expressed by only the immune B cell population, namely somatic mutation.
186
3.1. The evidence for sornutic nzutution: u historical perspective Prior to there being any data concerning the primary structure of immunoglobulins, many theorists noted that the mammalian genome was simply too small to encode, in a colinear fashion, the diverse repertoire of antibodies any individual animal was capable of producing [73].I t seemed inescapable that a large fraction of diversity was created by somatic events. A number of these theorists proposed that somatic mutation of immunoglobulin genes was the most plausible way to generate antibody diversity. With the advent of biochemical procedures for determining the primary structure of proteins it became possible to directly address the question of the structural basis of the diversity of antibody binding specificity. Initially, the structures of human antibodies were studied d u e to their availability in essentially homogeneous form from patients with multiple myeloma. These studies confirmed that the antibody molecule was composed of variable and constant regions and demonstrated that there were areas of hypervariability within the variable regions [74]. These studies demonstrated little, however, about the genetic origins of antibody diversity. T h e seminal studies of Weigert and Cohn provided the first insights into this question (75-771. They determined the primary structures of the V regions of a large number of mouse light chains of the A l type that were synthesized by myeloma tumors that had been induced in BALBic mice by a procedure developed by Potter’s group [7X]. It was known that only a minor fraction of norm‘
187 somatic mutation was one of the mechanisms that generated antibody diversity in the mouse. The relevant question then immediately became - does somatic mutation act only to diversify A chains? This was particularly important to answer since there was now a body of evidence suggesting that a large number of different germ-line V, and V, genes were present in the mouse genome [73]. It was possible that sufficient diversity was germ-line encoded in these cases. Weigert and his colleagues again used myelomas as a monoclonal source of both expressed K chains and the mRNA encoding these chains. Saturation hybridization data on genomic D N A with variable region cDNA probes made from myeloma mRNA encoding V, chains of the V,21 subgroup were obtained [SO]. They concluded that the mouse genome did not contain enough V,21 genes to encode all the variant amino acid sequences that had been previously identified. Subsequently, several groups [Sl-831. making use of the discovery that expressed V, genes were juxtaposed next to the single genomic C, gene in myelomas. succeeded in cloning expressed V, genes. These clones were then used as probes to isolate their gerin-line counterparts. Sequence comparisons indicated that the expressed V, genes often differed from the germ-line by single nucleotide substitutions in variable region coding but not in constant region coding sequences. These results demonstrated that somatic mutation also occurred in V, genes. In contrast to the data obtained from the study of V,, nucleotide replacements were found in both hypervariable and framework regions of these V, genes, demonstrating that mutation could occur throughout this segment. At this point, several questions concerning somatic mutation remained: Was mutation peculiar to myelomas o r did it occur in normal B cells? Were V, genes diversified by nucleotide replacement? What fraction of the antibody diversity expressed by an animal is the result of somatic mutation and how much of this diversity is functional? The pursuit of these questions awaited the development of hybridoma technology by Kohler and Milstein [84] and, thus, the ability to immortalize B cells that are participating in an immune response in vivo. Utilizing hybridoma technology in combination with serology and recombinant DNA technology, research groups led by Hood, Baltimore and Gefter began molecular analyses of the major idiotypic families of antibodies elicited by immunization of BALB/c mice with phosphorylcholine (PC), of C57BLi6 mice with 4-hydroxy-3-phenylacetyl (NP), and o f strain A mice with phenylarsonate (Ars). They succeeded in isolating hybridomas that expressed hapten-binding antibodies bearing idiotypic determinants characteristic of the anti-hapten serum antibodies (85-871. These results strongly suggested that hybridoma populations were derived. at least in part, from B cells that had been participating in the immune response in the animal. Gefter's group. in collaboration with Riblet's group, used mouse genetics in combination with serology and hybridonia technology to show that the abilit). to express the recurrent Ars idiotype correlated precisely with the presence of a single germ-line V, segment in V,-recombinant mice and with the rearrangement of this same gene segment in hybridomas [88]. This analysis provided direct evidence
that idiotype could be used as a measure of the expression of a single germ-line V segment by the B cell population in the animal and in hybridomas derived from that animal. This finding confirmed the idea that V genes expressed by hybridomas were directly derived from V genes expressed by the B cell population in vivo. Subsequent molecular analysis of expressed rearranged V, genes derived from hybridomas and their germ-line counterparts conducted by all three groups [71,85,89] revealed that somatic nucleotide replacement had often diversified the V, genes expressed by these cell lines. In some cases this diversity was extensive, resulting in up to seven amino acid substitutions in the V, region [85,89]. It now seemed clear that somatic mutation could act on all immunoglobulin V genes and appeared to play a major role in the generation of antibody diversity in the animal.
3.2. Somatic mutation and the immune response With the advent of rapid mRNA sequencing protocols [90,91] and improvements in hybridoma techniques, it became possible to structurally analyze the antibodies produced by many hybridomas isolated from a single immunized mouse. Weigert and Gerhard and their collaborators have used these technologies to examine the immune response of BALB/c mice to the Sb determinant of influenza virus hemagglutinin. By restricting their analysis to anti-Sb antibodies that utilized the VJlC light chain V region, they were successful in isolating sets of hybridomas that appear to be derived from the same expanded B cell clone [92,93]. This conclusion was based on identity both of VH-D and D-J, junctional nucleotides and of aberrant rearrangements involving the non-expressed C, allele. These hybridomas express V, and V, genes that clearly have been altered by somatic mutation. Many of these nucleotide alterations are shared among the V genes expressed by several members of the clonally related group of hybridomas, however, each V,-V, pair contains unique mutations. The hybridomas can, therefore, be arranged in a ‘lineage of mutation’. The most straightforward interpretation of these data is that mutation must have been ongoing during the expansion of the clone from which these hybridomas were derived. Several other conclusions fundamental to the understanding of the nature of mutation can be made from this elegant work. Since the elapsed time from the initial immunization to the isolation of hybridomas is known, and several hybridomas appear to represent progressive steps in a single ‘branch’ of the lineage, a minimum rate of mutation in V, and V, genes as a function of cell division can be estimated. The resulting estimate (lO-’/V region base pairicell division in both cases) is 5-6 orders of magnitude higher than the spontaneous ‘background’ rate of mutation in mammalian cells [94,95]. Members of a single branch of the lineage express different heavy chain isotypes so that mutation presumably was ongoing during these differentiative changes. Finally, the ratio of silent to productive nucleotide changes in the V, genes expressed by these hybridomas is high (ten) whereas the ratio is low (2) in the V, genes (randomly occurring mutations should generate a ratio of 3). This suggests that stepwise alterations occurred in these V, genes and were continually selected at the level of the re-
189 sulting altered V region structure by antigen (and hence are functional). No such positive antigen selection apparently acted on the alterations in V,. In fact, replacement mutations in these v, genes seem to have been selected against. As expected, the V, mutations are predominantly clustered in CDR’s (particularly CDRl), whereas the V, mutations are uniformly dispersed. Thus, these data suggest that while mutation occurs throughout a V region with roughly equal frequency, the influence of antigen selection can drastically bias the products of mutation that are expressed by isolated hybridoma populations. Groups led by Rudikoff [96] and Rajewsky [97] have also been successful in isolating clonally related hybridomas after immunization with a( 1-4)galactan and antiidiotype, respectively. Molecular analysis of the V, and V, genes expressed by these hybridomas has yielded data that are concordant with the conclusions made by Weigert et al. described above. More recently, Levy and his colleagues [98] have structurally analyzed the V, and V, genes expressed by a human B lymphoid tumor at various times before and after anti-idiotype therapy. This tumor is judged to be of clonal origin as defined by identity of V region junctional sequences and immunoglobulin gene rearrangements. A progressive accumulation of nucleotide differences was observed over time throughout the V, and V, genes expressed by this tumor. Estimation of the minimum rate of mutation in the V, and V, genes expressed by the tumor (assuming one tumor cell division per day) yields a value of 5x 10p4/Vregion base pairicell division, in reasonable agreement with the value determined using mouse hybridoma data. This result demonstrates not only that somatic mutation of V genes occurs in humans but also suggests that high rate is an evolutionarily conserved characteristic of this process and may therefore have functional significance (see below). Gefter [99] and Milstein (100,101] and their colleagues have extensively studied the ontogeny of the immune responses of A/J mice to Ars and of BALB/c mice to 2-phenyl-oxazolone (Ox) respectively. In both cases recurrent major idiotypic families of antibodies are elicited by immunization. The ‘time course’ of expression of structurally related antibodies can therefore be followed by collecting hybridomas from different mice at various times after immunization. Both these groups observe that while the V genes expressed by hydridomas isolated early (days 3-9) in the primary immune response have not been altered by somatic mutation, hybridomas isolated later (day 14 on) in the primary response and in the secondary response express V genes that have been extensively altered by mutation. These data suggest that mutation is not active prior to and early in the immune response. In addition, the number of mutations observed in V genes expressed by hybridomas isolated at increasing times after immunization in both these systems suggests that mutation occurs at a high rate for an extended period, in agreement with the conclusions reached by Weigert et al. Both these groups have also shown that mutated antibodies expressed by hybridomas isolated at late times after immunization have higher affinities for the eliciting hapten than do germ-line encoded antibodies expressed by hybridomas isolated early. This observation provides a molecular explanation for t h e affinity maturation of serum antibodies that is observed during many immune responses [102], and it is consistent with a progressive process of
190 ongoing somatic mutation and antigen selection for B cells that express V regions that have acquired increased affinity for the immunogen [103]. It is therefore clear that somatic mutation is creating functional diversity utilized in these two responses. The experiments described above do not rule out the formal possibility that some of the observed mutation occurs prior to the immune response in a small fraction of B cells, and that this fraction of cells is then preferentially clonally expanded during an immune response. In this regard, evidence suggesting that somatic mutation may be operative at the pre-B cell stage of differentiation has been obtained [ 104-1O61.
3.3. Mechanistic considerations regarding somatic mutation Due to the lack of direct experimental evidence concerning the mechanism by which somatic nucleotide replacements occur in variable region genes, little can be concluded at present concerning the nature of this mechanism(s). In this section I endeavor to review what has been learned indirectly about this process and discuss how this information bears on the feasibility of a number of models for the generation of ‘mutational’ diversity. 3.3.1. Two classes of models f o r somatic mutation
A wide variety of models for the generation of somatic ‘mutational’ diversity have been forwarded [107-1141. These models tend to fall into two categories based on whether they propose that ‘mutational’ diversity is introduced into V genes de novo (e.g. V gene specific hypermutation, mutation at a background rate followed by selection) or whether it results from the ‘scrambling’ of information already present in the germ-line genome (e.g. somatic recombination, gene conversion). I will not endeavor to review all of the models that have been proposed, but will simply point out that the implications of these two classes of models for the manner in which antibody diversity is utilized by the immune system are fundamentally different. Random de novo mutation of V genes will produce all possible V domain structural variants, including those that have no function or deleterious function (e.g. autoantibodies). ‘Scrambling’ will produce only different combinations of germ-line elements and would presumably generate V domains that vary in structure in a controlled way. In the former case, only the ability to mutate V genes at a certain rate could be acted upon by natural selection during the evolution of the species. In the latter case, however, the extended V region family (i.e. all members that participate in ‘scrambling’ events) might evolve as a single functional unit, and deleterious or non-functional mutations that occurred within this family would not be fixed in the population. 3.3.2. In vitro model systems f o r the study of somatic mutation An in vitro model system for the study of somatic mutation has long been sought. Several transformed cell lines derived from the B lineage have been observed to spontaneously suffer mutation in their expressed V region genes at a rate far higher
191
than observed at other loci [105,115,116]. T h e rates observed are similar to the rate of V gene mutation that has been estimated from clonally related hybridomas (see above). This suggests that a V region specific hypermutational mechanism is active in these cell lines. More detailed analyses of the factors responsible for the increased V region mutation rate in such cell lines may eventually provide valuable insights into the mechanism by which V region mutation occurs in vivo. Unfortunately, since so little is known about the V region mutational mechanism(s) operative in vivo it is difficult at present to determine what constitutes a bona fide in vitro model system.
3.3.3. Evidence concerning the rriechriisrn of somatic mutation T h e location and type of mutations that occur in V genes indicate that the mechanism is not base (either in the base that is changed o r substituted) o r sequence specific. V genes expressed by hybridomas isolated from immunized mice often display clustering of mutations in CDR's. That this is not simply the result of sequence specificity o f mutation is demonstrated by the analysis of the location of the silent mutations in coding regions. Fig. 2 displays the location of silent mutations that have been observed in several different V, and V, genes expressed by hybridomas derived from immunized mice. It is apparent that these mutations have occurred throughout the length of the V, and V, genes. 1
10
30
20
CDRI . . . . .
CDRI ............
" ox, K
40
60
50
70
80
90
100
CDR2 ................
CDR2 ......
............................................................................................. "
Fig. 2. The location of silent mutations within V,, and V, segments. The position of silent nucleotide substitutions that have been observed in thc functionally rearranged V genes expressed by hybridomas dcrived from immunized micc are indicated h y an asterisk. Idcntity with the germ-line (or consensus) sequencc is indicated by a dash. The location of coniplcmentarity determining regions (CDR) is indicated. The V,,I 1 data rcprcsent the compilation o l 3 independent V,, sequences. thc V,,Oxl sequence represents 8 V,, sequences and the V,Oxl scquence represents 5 sequences. (The V , , l l data are taken from [93] and thc V,,Oxl and V,Oxl d a t a are takcn from references [lOO] and [lOl].)
192
Gorski et al. have shown [117] that a rearranged V, segment expressed in a myeloma cell line is somatically mutated while the non-expressed unrearranged allele on the opposite chromosome is not. These data suggest that all V gene segments are not inherently mutable, they must be rearranged to create a 'substrate' for mutation. Sequence analyses o f rearranged V gene coding and flanking regions conducted by several groups confirm and extend this conclusion [118-1201. While mutations are found in both coding and flanking sequences, the flanking mutations are found only in immediate upstream and downstream sequences. Thus, a zone of mutability must exist in and around a rearranged V region gene. While rearrangement appears necessary for mutability, this rearrangement need not be productive since a VJ with an out of frame joint displays somatic mutations [Sl]. These data all suggest that mutations are targeted specifically to rearranged V region genes, presumably through the creation of a unique DNA sequence organization due to rearrangement. Alternatively, the zone o f mutability may be determined by a site 3' of the J cluster and extend 5' in a sequence non-specific manner. Rearrangement events would then simply serve to bring V and D exon segments into the zone of mutability. Unfortunately. data on the mutated state of an unrearranged J locus in a cell that expresses highly mutated V region genes are lacking. The putative cis-acting mutational element(s) must be present at all three V region chromosomal loci since V,, V, and V, genes are all mutable. That such elements are tightly linked to rearranged V genes is suggested by recent observations by Weaver et al. [121] and O'Brien et al. [15X] that a rearranged V, or V, gene that has been reintroduced into a novel chroniosonial location as a transgene is mutable. From the study of a group of VJ67 genes. Gearhart and Bogenhagen proposed that, while mutation occurs throughout the V genes with roughly equal probability, the mutations themselves are clustered. indicating that creation of an 'entry site' for mutation is rate limiting [ 1181. The statistical analysis used to support this conclusion has recently been contested, however [ 1321. Trans-acting elements are presumably also required for the mutation of a rearranged V region gene. The most obvious factors that act i n trans on these genes, the components of the transcription apparatus, do not appear to be directly linked to V region hypermutability in B cells. Unrearranged V genes are transcribed at a high rate in pre-B cells [ 12.11. yet these genes do not appear;to suffer mutations. Constant region exons arc cotranscribed with the V exon but are not mutated [ 1241. Unrearranged C, genes are transcribed at a high rate in B cells [125] but do not suffer mutation. Whether or not active transcription is indirectly required for hypermutability. however. is not known. The putative trans-acting factors involved in V region rearrangement events (see Chapter 4) and isotype switch recombination (see Chapter 5 ) also do not appear to be causally linked to V gene hypermutation. Many expressed rearranged V region genes that lack somatic mutations have been characterized (e.g. see [87,99,101]). All V genes expressed by hybridomas derived from B cells after a short period of mitogen stimulation [34] or constructed early in a primary immune response [99,101] express germ-line V genes. The B cell progenitors of many of
these hybridomas presumably had undergone isotype switch recombination since many of the hybridomas express IgGs [YY. 1011. Several hybridomas expressing V regions that have suffered mutations and are expressed as IgMs, have also been identified [Y6]. Whether DNA replication is required for somatic mutation is not known. However, the finding that hybridomas representing clonal ‘lineages o f mutation’ (see above) can be isolated, indicates that mutation is correlated with cell division. ‘Scrambling’ theories of somatic mutation share the premise that all ‘mutationnl‘ antibody diversity is germ-line encoded and is expressed through the exchange o f information between expressed and unexpressed V region genes. T w o mechanisms that have been shown to be capable o f exchanging genetic information in this way are recombination and gene conversion. Due to the size of the extended V gene family (including pseudogenes), there is a large potential repertoire of donor sequences for such events. Evidence f o r gene conversion among V and C region genes occurring on a n evolutionary time scale [ 12&130] and V-V recombination events occurring in hybridomas [ 1311 has been presented. Since the product of somatic mutation is most often single nucleotide substitutions, it must be assumed that V region gene conversion o r recombination events involve short lengths of DNA. Convincing evidence that such ‘micro’ gcne conversion events occur over evolutionary time between major histocompatibility antigen genes has been presented [ 1321. What sets somatic mutation apart from genetic exchange on an evolutionary time scale, however, is its exceeding high rate. High rates of gene conversion have been observed in yeast [ 1331 and trypanosomes [ 1341. so there is biological precedence for the idea that V gene specific ‘hyperconversion’ could occur. Recent molecular analyses of genes encoding A light chains in the chicken [I341361 have revealed that, while only one functional V, segment appears to be present in the germ-line genome, a variety o f distinct V, genes are expressed by B cells in the bursa (the organ center of B cell differentiation in birds). T h e expressed V, genes differ from the germ-line gene at single nucleotide positions, inany of which are also found within sevcral V, pseudogenes that are located imniediately upstream of the functional V,. These observations strongly suggest that ;I substantial fraction of V, diversity in the chicken is generated by the ‘scrambling‘ of germ-line information. Several lines of evidence argue that germ-line ‘scrambling’ models cannot account for all of the somatic mutational changes observed to occur among the V region genes of the mouse. however. T h e original somatic mutation data of Weige r t , Cohn and Tonegawa [75,79] argue that conversion is not responsible for the nucleotide replacements observed in V, 1, since there are only two cross-hybridizing members of the V, gene family i n the mousc genome. Extensive cloning and nucleotide sequencing analyses o f both the mutated products o f a single mouse germ-line V, segment and other germ-line V,, segments that are highly homologous to it have been conducted by several groups [SS,XS,S9]. The vast majority of somatic nucleotide changes observcd in these singlc V,, segments cannot be accounted for by exchanges between these segments and other members of the same germ-line family. If, a s expected, ;I certain degree of homology is required for ex-
194 change of information between genetic loci via either conversion o r recombination, members of a structurally related family would seem t o be the most likely participants in such ‘scrambling’ events. Finally. J segments and their 3’ flanking sequences are clearly substrates for mutation, yet other regions homologous to the J-C loci are not present in the mouse genome [138]. Therefore. while s o m e fraction of somatic mutational diversity may be the result of ‘scrambling’ of germ-line information, the majority of this diversity appears to be created by random d e novo events in the mouse. Mutation of V genes by such a mechanism will create diversity in a manner that is not influenced by the evolutionary history of the species o r the immunological history o f the individual. The ability t o generate diversity in this way may be a distinct advantage in the defense against pathogens that a r e capable of rapid antigenic variation during the course of an infection.
3.4. Somatic mutatiori mid cloriul selection ilieory In light of the data discussed above it is apparent that the clonal selection hypothesis [ 1391 and other theories concerning the creation of immunological memory and tolerance that use this theory as a foundation, must be updated. This hypothesis still constitutes a suitable framework within which t o discuss the initial phases of the immune response, that is. the stimulation of antigen binding B cells t o clonal expansion. However. a radical adjustment of the clonal selection theory is required to accommodate the observation that the rate of ongoing somatic nucleotide replacement during clonal expansion approaches 1V’ibase pairicell division. Since the combined target size of a V,-V, gene pair is approximately 700 base pairs, mutations will accumulate in expressed V domains at a rate of one per cell division on average, when mutation is active. Moreover, since the current data suggest that mutation is not active during the initial phases of clonal expansion. and this period was included in the elapsed time used to estimate the rate of mutation, the rate at later stages of the response must be higher than 1OP3/basepairicell division. Clonal selection can, therefore. n o longer be viewed as a o n e step process, but must be thought t o consist of recurrent rounds of mutation and selection. 3.4. I . The coticepi qj’ mutritioriul death Assuming that variable domains respond to mutational change as d o other proteins, and somatic mutation is indeed a random process, a large percentage of somatic mutation events must result in the loss of antigen binding activity. It has been observed that a single amino acid substitution in a V domain can result in loss of antigen binding activity [70,140,141]. It has been reported that the somatic mutation process may occasionally result in insertionideletion events [ 118,1191. The majority of such mutations occurring in coding sequences would be expected to result in loss of function due t o the high probability of shifts in reading frame. This concept of ‘mutational death’ must now be incorporated into the clonal selection theory. T h e depletion of expanding B cell clones d u e to mutational death may simply constitute the cost of introducing functional diversity into the responding B cell population. Indeed, it has been argued [ 1221 that if the rate of mutation were
195 substantially lower than 1OP'/base pair/ cell division, the amount of new diversity introduced would not be enough for antigen selective processes t o draw upon productively. If the rate were higher, clonal expansion could not occur due to the increased frequency of mutational death. T h e rate observed is, therefore, thought to be the result of a compromise between these two opposing forces. According to this argument, subtle alterations in the rate o f mutation should have a dramatic influence on the outcome of the response and, therefore, would appear to be a logical point for regulatory factions of the immune system to act (see further discussion below). If the rate were decreased subtly, the rcsult might be that B cell clones expressing V domains particularly prone to mutational death would, nevertheless, dominate the response since the ability to traverse a n 'onslaught of mutation' would hold little selective advantage [ 1031. and clones would presumably be expanded simply in proportion to their ability to bind antigen. If the rate were subtly increased, the response woulcl rapidly be suppressed d u e to the resulting mutational death of all responding clones. Several groups have observed changes in the variable region population expressed during immune responses that are most easily interpretable in terms of the concept of mutational death. Milstein and coworkers observe that hybridomas. producing antibodies against 2-phenyl-5-oxazolone (Ox) and that have been obtained by fusion 7 days after immunization, predominantly express a single combination of V gene segments. O n day 14, this combination has suffered extensive somatic mutation, and on day 3 of the secondary response this combination is rarely observed [loo]. T h e observation that V region structures expressed by hybridomas isolated from the early primary response are not expressed in the secondary response has also been made in the Ars and influenza hemagglutinin systems [99,142]. These observations can be easily explained by assuming that particular variable region structures a r e simply not 'adaptable' to mutational change - that is. the probability is high that a mutational alteration will destroy rather than enhance their function [103]. W e have isolated two hybridomas from Ars immunized AiJ mice that express V domains that appear to be examples of mutational death that has occurred in vivo. T h e germ-line V gene segments and junctional residues that compose these V domains a r e known to encode an antibody with high affinity for Ars. Nevertheless. these two hybridomas express somatically mutated forms of this V domain that have affinities for Ars that are 2-3 orders o f magnitude lower than the germ-line structure [159].
3.4.2. Escape from mutational tlcwtli A s discussed above, secondary rcarrangement events could result in the replacement of out of frame V gene segment fusions during the pre-B t o B cell transition. Analogously, a V gene that had suffered a 'lethal' mutation during B cell clonal expansion might be rescued by the secondary rearrangement of another combination of V gene segments o r by the replacement of the defective gene segment. If, as proposed [ 161, the polypeptide product of a given locus is required to suppress subsequent joining events of the same type. the loss o r alteration of that
polypeptide product might allow secondary replacing rearrangements to occur. It is doubtful that such a process would allow the rescue of a large fraction of the B cells that had suffered a lethal V region mutation, since the probability that specificity for the immunogen could bc restored randomly would presumably be low. Nevertheless, B cells that undergo such a process may escape mutational death and be assimilated into the immune B cell repertoire. 3.4.3. Immutzological mernory Theories concerning the formation of immunological memory in the B cell compartment must also bc adjusted in view of the recent revelations concerning random mutation occurring during the response. The view that the V region repertoire expressed by the ‘memory’ B cell population is simply the result of quantitative alterations of the ‘naive’ repertoire appears no longer tenable. It must now be considered that random mutation and mutational death greatly influence the composition of the immune repertoire. For example, B cells that express V regions with high affinity for the immunogen may be driven to effective extinction by ongoing mutation. whereas cells that express V regions having lower affinity may cease to participate in the response as antigen concentrations decrease and, therefore, survive mutation and become memory cells. If mutation continues to occur at a high rate in higher order responses. memory may not be the result of structural stability within the immune antibody repertoire but may be a dynamic state in which this repertoire is continually reshaped by cycles of mutation and selection. Some evidence suggesting that the mutation-selection process may continue in ’memory’ B cell populations has been obtained. Askonas and Williamson originally observed ;I phenomenon which they termed ‘clonal senescence’ upon repeated adoptive transfers and antigen stimulation of an expanded B cell clone identified by a characteristic immunoglobulin isoelectric focussing pattern. The pattern was seen to disintegrate over months of adoptive transfers and eventually to disappear [ 1431. White-Scharff and Imanishi-Kari have repeated this experiment, using the immune response of the C57BLi6 mouse to the hapten 4-hydroxy-3-nitrophenylacetyl (NP) as a model system [ 1441. They followed both the expression of NP binding antibodies and a major idiotypic family of antibodies expressed by this strain of mice in response to NP. After only 3-4 adoptive transfers the amount of antigen binding idiotype began to decrease, and a concomitant rise in a population of idiotypc bearing antibodies that did not bind the antigen was observed. 3.4.4. Tolerance Finally. theories concerning B cell tolerance must now be altered to concur with the new data. As originally formulated, the clonal selection hypothesis provided for the clonal deletion or anergy of mature B cells that emerged from pre-B cell populations expressing autoreactive V regions (1391. It is hard to imagine how such a process could be effected upon B cells that express autoreactive V regions created de novo during clonal expansion as a result of random mutation. That a single amino acid substitution in a V domain can convert an antibody to autospeci-
197 ficity has been demonstrated by Diamond and Scharff [14S]. Following antigenmediated activation, induction of tolerance in B cells may not be possible and other factions of the immune system may be required to prevent the growth of autoreactive clones (see below).
3.5. T cells and somatic mutatioti A large body of data has been amassed indicating that the structure of antibodies elicited by a T cell dependent form of a n antigenic determinant varies substantially in comparison to a T cell independent form of the same determinant. The variation in predominant isotypic class of antibody elicited by T dependent as well as independent antigens is well documented (reviewed in [ 1461). Expression of idiotypic determinants by the elicited antibody population has been observed to differ substantially in responses to T cell dependent and independent forms of the same haptenic determinant [ 1471. The participation of T cells during a humoral immune response clearly influences the structure of the antibodies elicited. Given these observations. it i s tempting t o speculate that T cells may be capable of regulating the degree to which somatic mutation is active in B cells participating in an immune response. All of the responses in which somatic mutation has been observed to occur are T cell dependent responses. Interestingly, a molecular analysis of antibodies elicited during the T cell independent response to NP in CS7BLi6 conducted by Maizels and Bothwell provided no evidence for somatic mutational alteration of the elicited V regions [ 1481. I t has also been observed that the extensive affinity maturation of serum antibodies characteristic of a T cell dependent response does not occur in response to T cell independent antigens (1491. Evidence obtained from the molecular analyses of the anti-Ars and anti-Ox immune responses suggests that affinity maturation is mainly due to somatic mutation during the immune response [93,99.100]. The activity of mutation only in T cell dependent responses would allow ;I failsafe mechanism to prevent the uncontrolled expansion of autoreactive V regions created de novo via mutation - the B cells expressing such structures would be incapable of directly interacting with T helper cells, since the T cell compartment would presumably lack members with specificity for the same antigen (assuming. ;IS current data suggests [lSO], that the T cell receptor is not altered by somatic mutation during the response). While these data may be suggestive of ii role for T cells in the regulation of the somatic mutation of antibody V region genes. further speculation in this area should await further data. 3.6. Antibody diversity arid B cell sirh.set.s
Extensive evidence for the distribution of the B cell population into subsets that differ in the expression of serologically defined cell surface markers has been presented (reviewed in [ 1511). Two major subsets that differentially express markers termed Lyb-3. Lyb-S and Lyb-7 (abbreviated Lyb-S+ and LybS-5- B cells) exist in the mouse B cell population. More recently. a small subset of murine B cells that
express the Ly-1 surface antigen has been described [ 1521. Evidence has been presented suggesting that these B cell populations may be distinct with regard to a variety of immune functions, including the expression of immunoglobulin diversity [153]. Skewed expression of germ-line V region genes has been suggested for both Lyb-5' [154] and Ly-1 B [155] cells. In the case of Ly-1 B cells, this skewing appears to be dramatic - the majority of cells in this subset express A light chains. Serological evidence has been presented suggesting that V regions expressed by Lyb-5' B cells d o not undergo somatic mutational alteration [156] and those expressed by Ly-1 B cells in culture spontaneously mutate at a high rate [157]. The lack of extensive molecular evidence supporting these suggestions makes further interpretation impossible. Howevcr, the idea that different factions of the antibody repertoire are expressed by distinct B cell subsets and that these subsets may differ in their capacity for V region somatic mutation is worthy of further investigation.
4. Summary As stated at the onset, it is clear that the immune system has an enormous potential for generating different antibody V region structures. Combinatorial and junctional processes alone appear to be capable of creating billions of distinct V regions. Somatic mutation seems able to amplify this number to an essentially infinite value. However, the elaboration of humoral immunity requires that only a small fraction of all potential V region diversity be selectively and functionally expressed. Recent studies concerning the manner in which the genetic potential for diversity is utilized by the immune system prior to and during specific immune responses have provided information regarding how this is accomplished. With the genetic basis for antibody diversity now well established, investigations of this type represent a new frontier in the quest for an understanding of the molecular and cellular processes that result in humoral immunity.
Acknowledgements I would like to thank Malcolm Gefter, Larry Wysocki and Martin Weigert for many insightful discussions. This work was supported in part by a Grant from t h e National Institutes of Health. AI2373Y.
References 1 Tonegawa. S. (19x3) Nature 307. 575-581. 2 Honjo. T. (1983) Annu. Rev. Inimunol. I . 199-528. 3 Cory, S., Tyler, B.M. and Adanis. J . M . (1981) J . Molcc. AppI. Genet. I . 103-114. 1 Zeelon. E.P.. Bothwell, A.L.M.. Kantor, F. and Schechter. I . (19x1) Nucl. Acids Res. 9. 3800-3820.
199 5 Kemp. D . J . . Tyler. B.. Bernard. 0..Gough. N. and Gcrondakis. S. (1981) J . Mol. Appl. Genet. I . 245-256. 6 Brodeur. P. and Riblet, R . (1984) Eur. J . Immunol. 14. 922-930. 7 Eisen. H . N . and Reilly. E . B . (1985) Annu. Rcv. Immunol. 8 Kurosawa. Y. and Tonegawa, S. (1982) J . Exp. Med. 155, 201-218. 9 Kaartinen, M.. Griffiths. G . M . . Mai-khain. A . F . and Milstein, C. (19x3) Nature 304. 320-324. 10 Gridley, T.. Margolies. M.N. and Gcltcr. M.L. (1985) J . lmmunol. 134. 12361244. 1 1 Max. E . E . . Seidnian. J . G . and Leder. P. (1979) Proc. Natl. Ac;id. Sci. USA 76. 345(&3454. 12 Sakano. H . , Huppi, K.. Heinrich. G and Tonegawa. S. (1979) Nature 280. 288-294. 13 Sakano, H . , Maki. R . . Kurosawa. Y . . Koedci-. W. and Tonegawa. S. (1980) Nature 286, 676683. 14 Early, P., Huaiig, H . . Davis. M., Cnlame. K. a n d Hood. L. (1980) Cell 19, 981-992. 15 Durdik. J . , Moore. M.W. a n d Selsing. E. (1984) Nature 307, 749-752. 16 Yancopoulos. G . D . and Alt. F.W. (1986) Annu. Rev. Immunol. 4. 339-368. 17 Wood. C . and Tonegawa. S. (1980) Proc. Natl. A c i d Sci. USA 80. 3030-3034. 18 Lewis. S., Gifford. A . and Baltimore. D . (198.5) Science 228. 077-685. 1 0 Desiderio. S. and Baltimore. D. (19S-l) Nature 308. S6(L862. 20 Kataoka, '1.. Kondo, S.. Nishi. M.. Kodairo. M. and Honjo. T. (1984) Nucl. Acids Res. 12. 5995-60 10. 21 Le\vis. S.. Gifford. A . and Baltimore. D . (1984) Naturc 308. 425-428. 22 Blackwell. T.K. and Alt. F . W . (19x4) ('ell 37. l(15-117. 23 Yancopoulos, G . D . , Desiderio. S . V . . €'a>kiiiil. M.. Kcarney. J . F . . Baltimore. D . and Alt, F.W. (1984) Naturc 31 1 , 727-733. 24 Alt. F. W.. Yancopoulos. G . D . . Blackwell. 'T.K.. Wood. C . , 'l'homas. E.. Boss. M . , Coffman, R.. Rosenberg. N . . Tonegawa. S. and Baltimore. 11. (1984) E M B O J . 3. 1209-1219. 25 Yaoita. Y.. Matsunami. N.. Choi. C . Y . . Supiy;iin;i, H.. Kishimoto. T. and Honjo. T. (1983) Nucl. Acids Res. 11. 7303-7316. 26 Perlmuttcr, R.M.. Kearncy. J.F.. Chang. S.1'. and Hood. L. (1985) Science 227. 1597-1601. 27 Cancro. M.P.. Wylie. D . E . . Gerhard. M'. aiid Klinman, N.R. (1979) Proc. Natl. Acad. Sci. USA 76. 6577-6581. 28 Sigal. N.H.. Pickard. A . R . . Metcalf. E.S.. Cicai-hai-t.P.J. and Klinman, N . R . (1977) J . Exp. Med. 146. 933-048. 29 Riley. S.C., Connors. S.J.. Klinman. N . K . and Opata. R . T . (19x6) Proc. Natl. Acad. Sci. USA 83. 2589-2593. 30 Teale, J . (1985) J. Immunol. 135. 953-958. 31 Teale, J. and Kcarney, J.F. (1986) J . Mol. Cell Immunol. 2, 2x3-292. 32 Brodeur. P. and Riblet. R. (1984) i n : Kepulation o f the Immune System, pp. 444-453. Liss. New York. 33 Near. R . . Manser. T. and Gefter. M 1.. (I0X.S) J . Immunol. 134. 20042009. 34 Manser. T.. Huang. S.-Y. and Gefter. M.I.. (1984) Science 226. 1283-1288. 35 Kleinfield, R.. Hardy. R . . Tarlinton. D . . Dangl. J . . Herzenberg. L. and Weigert, M. (1986) Nature 322. 843-846. 36 Reth. M . . Gehrmann, P . . Petrac. E . mid Wiese. P. (1986) Nature 322. 84C842. 37 Wood. D . L . and Coleclough. C. (1984) Proc. Natl. Acad. Sci. USA 81. 4756-4760. 322 Nishi. M . . Kataoka. T. and Honjo. T. (1988.5) Proc. Natl. Acad. Sci. USA 82, 6399-6403. 39 Sherman. L . A . , Vitiello. A . and Klinmai. N . R . (1983) Annu. Rev. Immunol. I . 63-88. 40 Owen. J . A . , Sigal, N . H . and Klinman. N.R. (1082) Nature 295, 347-348. 41 Kindt. T. and Capra. J . D . (1984) in: The Antihody Enigma, Plenum Press. New York. 42 Capra. J . D . and Fougereau. M. (1983) lmmunol. Today 4. 177-179. 43 Boersch-Supan. M.E.. Agarwol. S.. White-Scharff. M.E. a n d Imanishi-Kari, T. (1985) J. Exp. Med. 161. 1272-1292. 44 Dzierzak. E.A.. Brodeur. P.. Marion. '1. .. Janeway. C . A . and Bothwell. A . (1985) 162. 14941511. 45 Rocca-Serra. J . . Matthcs. H . W . . Kaartinen. M . . Milstein. C., Theze. J . and Fougercau, M. (1983) EMBO J . 2. 867-872. 46 Perlmuttcr. R . . Klotz, J.L.. Bond. M . W . . Nahm. M.. Davie. J . M . and Hood, L. (1984) J . Exp. Med. 159. 179-192.
200 , M . and Fougereau. M. (1983) Nucl. Acids Res. 11. 4007-4017. 48 Schilling, J . . Clevinger. B.. Davie, J.M. and Hood. L. (1980) Nature 283. 35-40. 49 Robbins, P.F.. Rosen, E.M.. Haba, S . and Nisonoff, A . (1986) Proc. Natl. Acad. Sci. USA 83. 10S& 1054. SO Bothwell. A.L.M. (1984) in: The Biology of Idiotypes. (M.I. Greene and A . Nisonoff. Eds.) pp. 19-34, Plenum Publ. Co., New York. 51 Sikder. S.K.. Akolkar. P.N.. Kalada. P.M.. Morrison. S.L. and Kabat, E . A . (1985) J. Immunol. 135. 4215-4221. 52 Rohbins. P.F.. Rosen. E.M., Haha. S . and Nisonoff. A. (1986) Proc. Natl. Acad. Sci. USA R3. lO5& 1054. 53 Rudikoff, S.. Pawlita. M.. Pumphrey. J . . Muahinski. E . and Potter. M. (1983) J . Exp. Mcd. 158. 1385- 1400. 54 Lcgrain. P. and Buttin. G . (1985) J . Imniunol. 134. 3468-3473. 55 Rocca-Scrra. J . . Tonnelle. C . and Foueercau. M. (19S3) Nature 304. 353-355. 56 Davies, D . R . and Metzger. 11. (19x3) Annu. Rev. Imniunol. 1, 87-118. 57 Aniit. A.G.. Mariuzza. K.A.. Phillips, S.E.V. and Poljak. R.J. (1985) Nature 313. 156158. 58 Kelsoe. G . and Farina. D . (19Sh) in: Evolution and Vertebrate Immunity: The Antigen Receptor and MHC Gene Familics. ( G . Kelwe and D . Schulze. Eds.). University of Texas Medical Branch Series o n Biomedical Sciences. 59 Jerne. N.K. (1974) Ann. Immunol. (Inst. Pastcur) 125C. 373-389. 00 Max, E . E . , Seidman, J.G., Miller. H. and Leder, P. (19x0) Cell 21. 797-799. 61 Coleclough. C . , Perry. R.P.. Karjalaincn, K . and Weigert. M. (1981) Nature 290. 372-378. 62 Karjalaincn. K. and Colcclough. C. (1985) Nature 314. 541-546. 63 Azuma. T.. I p s . V . , Reilly. E.B. and Eiaen. H.N. (1984) Proc. Natl. Acad. Sci. USA X I . 6139-6144. 64 Jeske. D.J.. Jarvis, J . . Milstein. C. and Capra. J . D . (19x4) J. Iminunol. 133. lOYCL1092. 65 Alt. F.W. and Baltimore. D . (1982) Proc. Natl. Acad. Sci. USA 70. 41 IS-4122. 66 Dcsidcrio. S.V.. Yancopoulos. G.P.. Paskind. M.. Thomas. E.. Boss. M.A.. Landau. N.. Alt. F. W. and Baltimore, D . (1984) Nature 311, 752-755. 67 Wysocki, L.. Manser, T.. Gridley, T. and Geftcr. M . L . (1980) J . Imniunol. 137. 3699-3701. 68 Milner. E.C.B., Meek. K.D.. Rathhun. G . . Tucker. P. and Capra. J . D . (1986) Immunol. Today 7. 3&40. 69 Landolfi. N.F.. Capra, J.D. and Tucker. P.W. (19x6) J . Immunol. 137. 362-36.5. 70 Sharon. J . . Gefter. M.L.. Manscr. '1'. and Ptashnc. M. (1086) Proc. Natl. Acad. Sci. USA 83, 2628-263 I. 71 Siekevitz. M.. Huang. S.-Y. and Gefter. M.L. (1983) Eur. J . Immunol. 13. 123-132. 72 Cohn. M. (1970) Cell. Inimunol. I.461-467. 73 Cold Spring Harbor Symp. Q u a n t . B ~ o l . Vol. . 41 (1976) 74 Cold Spring Harbor Synip. Qunnt. Biol.. Vol. 32 (1967) 75 Weigert, M.G.. Cesari. I.M., Yonkovich. S.J. and Cohn. M. (1970) Nature 228. 1045-1047. 76 Cesari. I.M. and Wcigcrt. M. (1973) Proc. N;itl. Acad. Sci. USA 70. 2112-21 16. 77 Weigert. M. and Riblet. K. (1976) Cold Spring H;irhor Symp. Quant. Biol. 41, 837-846. 78 Potter. M. (1972) Physiol. Rev. 52. 631-710. 79 Bernard, 0.. Hozumi. N. and Toncgawa. S. (1978) Cell 15. 1133-1 144. 80 Valbuena, O . , Marcu, K.13.. Weigert. M. and Perry, K.P. (IY78) Nature 276, 780-784. 81 Pech. M.. HBchtl, J . . Schncll. H . and Zachnu. H.G. (1981) Nature 291, h6X-670. 82 Selsing, E. and Storb, Cl. (19x1) 25. 47-5s. 83 Gershenfeld, H.K., Tsukamoto. A , . Wcissman. I.L. and Joho. R . (19x1) Proc. Natl. Acad. Sci. USA 78, 76747678. 84 ti6hlcr. G . and Milstein, C, (1975) Nature 2%. 495-497. 85 Bothwell, A.L.M.. Paskind. M., Reth. M.. Inianishi-tiari. T.. Rajcwsky. K. and Baltimore. D. (1981) Cell 24, 625-637. 86 Marshak-Rothstein. A , . Siekevitz. M.. Margolies. M.N.. Mudgctt-Hunter. M. and Gefter. M.L. (1980) Proc. Natl. Acad. Sci. USA 77. I I2WI 124. 87 Gearhart. P.J.. Johnson, N.D.. Douglas, R . and Hood. L. (1981) Nature 291. 29-34.
88 Siekevitz, M., Geftcr, M.L.. Brodeur. P., Riblet. R . and Marshak-Rothstein. A. (1982) Eur. J . Immunol. 12, 1023-1032. 89 Crews. S . , Griffin, J . , Huang, H . , Calame, K. and Hood. L. (1981) Cell 25. 59-66. 90 Hamlyn, P.H.. Brownlee. G . G . , Cheng. C . C . . Gait, M.J. and Milstein. C. (1978) Cell 15. 1067-1075. 91 Hamlyn, P . H . , Gait, M.J. and Milstein. C. (1981) Nucl. Acids Res. 9, 4485-4494. 92 McKean, D . , Huppi, K., Bell, M.. Staudt. L.. Gerhard, W. and Wcigert. M. (1984) Proc. Natl. Acad. Sci. USA 81, 318G3184. 93 Clarke, S . H . , Huppi, K., Ruezinsky. D . , Staudt, L . , Gerhard. W. and Weigert. M. (1985) J. Exp. Med. 161, 687-704. 94 Vogel, F. (1970) in: Chemical Mutagenesis in Mammals and Man. (F. Vogel and G . Rorhborn, Eds.) pp. 1668, Springer-Verlag, Heidclberg. 95 O’Neill, J.P., Brimer, P.A. and Hsie, A.W. (1981) Mutat. Res. 82. 343-353. 96 Rudikoff, S . . Pawlita, M., Pumphrey, J . and Heller. M. (1984) Proc. Natl. Acad. Sci. USA 81. 2 162-2 166. 97 Sablitzky. F., Wildner, G . and Rajewsky, K. (1985) EMBO J . 4. 345-350. 98 Cleary. M.L.. Mecker. T . C . . Levy. S . . Lee. E . . Trela. M . , Sklar, J . and Levy, R . (1986) Cell 44. 97-106. 99 Wysocki, L . , Manser. T. and Gefter. M.L. (1986) Proc. Natl. Acad. Sci. USA 83, 1847-1851. 100 Berek. C.. Griffiths, G.M. and Milstein, C. (1985) Nature 316, 412-418. 101 Grifliths. G . M . , Berek, C.. Kaartinen. M. and Milstein, C. (1984) Nature 312. 271-275. 102 Siskind, G . W . and Benacerraf, B. (1969) Adv. Immunol. 10. 1-50. 103 Manser, T . , Wysocki, L.J.. Gridley, T.. Near. R.I. and Gefter, M.L. (1985) Immunol. Today 6, 94-101. 104 Zeigler. S.F., Treiman. L.J. and Witte. O . N . (1984) Proc. Natl. Acad. Sci. USA 81, 1529-1533. 105 Wahl. M . , Burrows, P . D . , Gahain, A . V . and Steinbcrg. C. (1985) Proc. Natl. Acad. Sci. USA 82. 479-482. 106 Meyer, J . . Jack, H.-M.. Ellis. N. and Wabl, M. (1986) Proc. Natl. Acad. Sci. USA 83. 695(!-6953. 107 Seidman. J . G . , Leder, A., Nau. M . , Norman. B. and Leder. P. (1978) Science 202, 11-17. 108 Brenner, S. and Milstein, C . (1966) Nature 21 I , 242-244. 109 Kabat. E.A.. Wu, T.T. and Bilofsky, H . (1979) J. Exp. Med. 149. 1299-1313. 110 Edelman, G . M . and Gally, J . A . (1967) Proc. Natl. Acad. Sci. USA 57. 353-358. 111 Jerne. N.K. (1971) Eur. J . Immunol. I . 1-9. 112 Smithies, 0. (1976) Cold Spring Harbor Symp. Quant. B i d . 41, 161-168. 113 Szilard. L. (1960) Proc. Natl. Acad. Sci. USA 46. 293-302. 114 Lennox, E.S. and Cohn. M. (1967) Annu. Rev. Biochcm. 36, 365-406. 115 Cook. W . D . and Scharff. M.D. (1977) Proc. Natl. Acad. Sci. USA 74. 56x7-5691. I16 Baumal. R.. Birshtein, B.K.. Coffino. P. and Scharff. M . D . (1973) Science 182. 165-166. 117 Gorski. J . . Rollini. P. and Mach. B. (1983) Science 220, 1179-1181. 118 Gearhart. P.J. and Bogenhagen, D . F . (1983) Proc. Natl. Acad. Sci. USA 80. 3439-3443. 119 Kim. S., Davis. M . , Sinn. E.. Patten. P. and Hood. L. (1981) Cell 27. 573-581. 120 Huppi, K. (1987) Ph.D.Thesis. University of Pennsylvania. 121 Weaver, D., Reis. M.H.. Albanese, C.. Constantini. F.. Baltimore, D. and Imanishi-Kari. T. (1986) Cell 45, 247-259. 122 Weigert. M . . submitted for publication. 123 Yancopuolous. G . D . and Alt, F.W. (1985) Ccll 40. 271-281. 123 Altenburger, W.. Neumaier, P.S.. Steinmctz. M. and Zachau. H . G . (1981) Nucl. Acids Res. 9. 97 1-98 1. 125 Van Ness, B.G., Weigert, M.. Colcclough, C.. Mather. E.L.. Kelly, D.E. and Perry, R.P. (1981) Cell 27. 593-602. 126 Schreier. P . H . . Bothwell. A.L.M.. Mucllcr-Hill. B . and Baltimore. D . (1981) Proc. Natl. Acad. Sci. USA 78. 4495-4499. 127 Clarke, S.H., Claflin. J.L. and Rudikoff. S . (1982) Proc. Natl. Aciid. Sci. USA 79. 328&3284. 128 Clarke. S . H . and Rudikoff, S. (1984) J . Exp. Med. 159. 773-782. 129 Bentley. D . L . and Rabbitts. T . H . (19x3) Cell 32. 181-189.
130 Near, R . I . . Juszczi%k.E.C.. Huang. S.-Y.. Sicari. S.A.. Margolics. M.N. and Gefter. M.L. (1984) Proc. Natl. Acad. Sci. USA X I . 2167-2171. 131 Dildrop. R . . Briiggemann. M.. Radbruch. R . . Rajewsky. K. and Bcyreuther. K. (1982) EMBO J . 1 . 035-640. 132 Mellor. A.L.. Weiss. E.A.. R:uiiachandran. K . and Flavell. R.A. (19x3) Nature 306, 792-795. 133 Klar. A.J.S.. Strathern. J . N . and Abrahiim. J . A . (1984) Cold Spring Harbor Synip. Quant. Biol. 49. 77-88.
I34 Bernards, A . (1985) Biochini. Biophys. Acta 824, I-IS. 135 Reynaud, C . - A , , Anquez. V.. Dahan. A . and Weill. J.-C. (19x5) Ccll 40. 283-291. 136 Reynaud. C . - A , , Anqucz. V . . Grimal. H. and Weill. J.-C. (1987) Cell 48. 379-388. 137 Thompson, C.B. and Nciman. P . E . (1987) Cell 48. 369-378. 138 Van Ncss. B.G., Coleclough. C . , Perry. R.P. and Wcigcrt. M . (1982) Proc. Natl. Acad. Sci. USA 79. 262-266. I39 Burnet. F.M. (1959) The Clonal Selection Theory o f Acquired Immunity (Cambridge University Press. London) 140 Cook. W . D . . Rudikotl‘. S.. Giusti. A.M. and Scharff. M.D. (1982) Proc. Natl. Acad. Sci. USA 79. 124(k1244. 141 Rudikoff. S . . Giusti. A.M.. Cook. W . D . and Scharff. M.D. (1982) Proc. Natl. Acad. Sci. USA 79. 1979-1983. 142 Clarke, S.. Gcrhard. W . and Weigcrt. M . . submitted for publication. 143 Williamson. A.R. and Askon:rs, B . . 4 . (1972) Nature 238. 337-339. 144 White-Scharf, M.E. and Ininnishi-Kari. T, (1986) J . Immunol. 137. 887-896. I45 Diamond. B . and Sch;lrff, M . D . (1084) Proc. Natl. Acad. Sci. USA 81. 5841-5844. 146 Mosier, D . E . and Suhbarao. 13. (1982) Immunol. Today 3. 217-222. 147 Smith, F.I.. Tcsch, H . and R;ijcwsky. K . (1984) Eur. J . Immunol. 14, 195-200. 148 Maizcls. N . and Bothwell, A . (1985) Cell 43. 715-720. 149 Huchet. R . and Fcldniann. M. (1973) Eur. J . Immunol. 3. 40-55. 150 Kronenberg. M.. Siu. G . , Hood. L.E. and Shastri. N . (19x6) Annu. Rev. Immunol. 4.529-592. 151 Kung, J.T. and Paul. W.E. (1983) Inimunol. Today 4.37-41. 152 Hayakawa. K., Hardy. R . R . , Herzcnberg. L.A.. Steinherg. A . D . and Herzcnberg. L.A. (1984) in: Progress in Immunology. ( V . Y . Yamamura and T. Tada. Eds.) pp. 661-681. Academic Press. Tokyo. 153 Singer. A . and Hodcs. R.J. (19x3) Annu. Rev. Immunol. 1. 21 1-242. 154 Huher. B.T. (1982) Immunol. Rec. h4, 57-77. 155 Braun, J . (1983) J . Immunol. 130. 21 13-2120. 156 Woodland, R.T. and Huber. B . T . (1984) J . Immunol. 133. 1801-1810. 157 Braun. J . . Forouzanpour. F.. King. L.. Teheranizedah. K.. Bray. M. and Klicwer, S. (1986) Immunol. Rev. 93. 5-22. 158 O’Brien. R . L . . Brinster, R.L. and Storb. U. (1987) Nature 326. 405-409. 159 Manser. T.. Parhami-Sei-en. B.. Margolics. M.N. and Gefter. M.L. (1987) J.Exp. Med., in prcss.
203 CHAPTER X
The immunoglobulin superfamily FRANC0 CALABI M R C Laboratory of Moleciilrir Biology. Hills Road, CB? 2 Q H Carnbririge, U K
I . Introduction lrnmunoglobulin polypeptide chains are composed of homology units [ 1,2]. Related units are found in a large set o f non-immunoglobulin proteins. Thus all these proteins, belonging to several functionally diversified families. can be grouped into ;I single superfamily, the immunoglobulin superfamily, based exclusively o n structural homology [3]. Such homology between members of different families is h i ited as a rule to the protein structure. homology being virtually non existent at the DNA level, except for a very general principle of organization (each homology unit is usually encoded by a single exon). However. within individual families, DNA sequence homology is found to pseudogenes and to gene sequences which are not known to b e expressed. These gene sequences must be regarded as members of the immunoglobulin superfamily. since they may play o r may have played iniportant roles in its evolution. Any unifying hypothesis is bound t o introduce some degree of distortion to the experimental data, and this may be very significant when. as in the case of the immunoglobulin superfamily, the unifying criterion can often be only partially verified. However, such an hypothesis is justified in so far as it makes specific predictions which are testable [4]. The analysis o f how variations of a basic structural module a r e achieved during evolution through the operation of a variety of genetic mechanisms and of how such variations can serve different functional purposes is clearly of both great theoretical and practical interest. Furthermore, structural relatedness can be assumed t o reflect relatedness to an ancestral function. Thus, the investigation of the evolutionary relationships amongst members of the superfamily may lead to predictions for members o f unknown function. In this respect, in choosing immunoglobulins as a structural standard (which is clearly dictated by the quality a n d the quantity of the information available). it must be appreciated that the function they are serving has arisen late in phylogeny and may thus be significantly different from the ancestral function.
2. The immunoglobulin homology unit T h e qualifying feature of the immunoglobulin homology unit is its molecular architecture. Delineation of this structure has resulted from a considerable amount
204
Fig. 1. Polypeptide chain folding in immunoglobulin V and C units. Thick arrows: p-strands; thin lines: loops. Filled arrows (p-strands A.B,D.E) lay on the plane of the sheet. whilst hatched arrows @-strands C,(C').F,G) lay on a parallel plane behind. A lilled circle on p-strands B and F indicates the cysteines which establish the intra-unit disulphidc. The filled square on @-strand C indicates the tryptophan residue which is an invariant component o f the unit core [ h ] .
of sequence and crystallographic data [ 5 ] .Basically, the unit has been likened to a sandwich, consisting of two stacked antiparallel @-sheetswhich enclose an internal space filled mainly by hydrophobic amino acid side chains; this structure can be viewed as consisting of three elements [6]: (1) a pin, including an invariant tryptophan and the two invariant cysteines which link facing @-sheets; (2) a @-sheet core, including conserved (mainly inward pointing) residues in @-sheet strands; and ( 3 ) a periphery, including some non-conserved @-strand structures as well as the loops which connect individual @-strands in a characteristic sequence. Whilst in different immunoglobulin units extensive insertions and deletions as well as replacements are found in the periphery, especially in the loops. the core shows mainly replacements, which are at times extensive but are mostly conservative in nature. Two types of immunoglobulin units can be distinguished: V and C ([7], Fig. 1 and Table 1). Seven @-strands(A to G) are found in both types. However, V units contain two additional @-strands(C' and C") as part of an extra hairpin loop between the C and D strands. V, and V,, units are also distinguishable on the basis of a few critical residues [8.9]. In immunoglobulins, units of the same type are found paired in domains. Such pairing occurs through the 4-stranded @-sheetsin C domains and the 5-stranded psheets in V domains and involves a variety of specific inter-unit interactions [lo]. Whilst pairing of VH units has never been found. both V,-V, and V,-V, pairings occur, the latter one possibly resulting in a different geometry of the binding site. To what extent can any linear polypeptide sequence be expected to fold in a three-dimensional structure characteristic of the basic immunoglobulin unit? Given our very limited knowledge of the rules governing protein folding, four minimal criteria have been suggested [ 111: (1) the test sequence must be approximately 100 amino acids long; (2) it must contain cysteine residues at positions homologous to
205 TABLE 1 Structural features of immunoglobulin units A. Folding pattern characteristic of immunoglobulin units is suggested by:
1. conserved cysteines and tryptophan; 2. p-strand motifs; these show a prevalence of replacements, rather than of insertionsideletions and are organized in two p-sheets, such that: a. mid-sheet p-strands are more hydrophobic than edge p-strands; b. side chains pointing toward the opposite p-sheet tend to be hydrophobic. B. V-C distinguishing features: I. core: 1. V units have an extra hairpin loop and two extra p-strands (C' and C ) . The latter are found in a five-stranded p-sheet with strands C, F and G. As a consequence, the number of residues between the disulphide-bonded cysteines is higher in V (-70) than in C (-60) units; 2. p-strand motifs can be defined that are somewhat characteristic of each type of unit [9]; 3. V units pair through the p-sheets composed of strands C, ( C ' , C ) , F, G, whilst C units pair through the p-sheets composed of strands A, B. D, E. Since interface p-sheets are more conserved than solvent-exposed P-sheets, @strands C, F and G are more conserved amongst V units than A, B, D and E, whilst the converse is true amongst C units. 11. loops: V units have a conserved glycine (or less frequently aspartate, i.e. a turn-promoting residue) between p-strands A and B. Furthermore, a salt bridge is usually found between an arginine (or less frequently a lysine) near the carboxyl end of the C/D loop and an aspartate at the carboxyl end of the E/F loop. C units have a conserved proline in each of the loops between strands A/B and C/D.
C. V,-VH distinguishing features: 1. CDRl is longer in VL whereas CDR2 is longer in VF,. 2. The residues conserved in interface @sheets (residues cumulatively present in 3 0 % of sequences at the given position) are: strand
V,
position
V,
vosition
C C'
Val/Ile Leu TrP Trp
37 45 47 103
Phe/Tyr Pro/Phe LeuIGly Phe
36 44 46 98
G
(position number is according to [206]).
D. VH-VLcontacts involve [lo]: 1. hydrogen bonding between glutamines in strands C; 2. herringbone pairs involving hydrophobic residues in strands C, F, G.
E. Unit pairing requires identity of type and is suggested by: 1. lower primary sequence variability in one p-sheet (presumably the interface p-sheet) rather than in the opposite p-sheet (presumably solvent-facing); 2. electrostatic charge compatibility.
206
w IgG FcR
Poly-lQR
a,B-gp
Thy-1
MRCOX-2
NCAM
4 1 , MAGlNCp 3
Fig. 2. Presently known incnibci-s o f the imniuno~lobulinsupcrfamily. 0. immunoglobulin-like V units: units: @. non-imiiiiiiioglohulin-lil\c V units: 0. C units. Interchain disulphide bonds arc not sho\\n. The douhlc line irepresents the plnsina inemhrane to which ‘lliy-1 and a form of NCAM a t e attached via ;I link to ;I phophoinositide. ‘The structure of the TcR ii chain is hypothetical.
0. units distantly related to iminuno~lohiilinV
the cysteines which establish the immunoglobulin intra-unit disulphide bond; (3) structural predictions [ 12-14] must indicate thc potential of P-strand formation at positions homologous to those o f immunoglobulin units; (4) sequence homology to immunoglobulin units must be statistically significant [ 151. Furthermore, if pairing of units is to occur, a further set of criteria is expected to be met (Table I ) . Members of the immunoglobulin superfamily which have been identified at present are sketched i n Fig. 2. In this review, 1 only shall discuss in detail members (other than immunoglobulins) which consist of at least one unit meeting the standard criteria and shall only mention other inore distantly related members in the context of the cvolution o f the whole supcrfamily.
3. T h e T cell receptor Although it has long heen known that T lymphocytes interact with antigen by way of specific receptors, the identification of such receptors has been accomplished only recently (reviewed in [16]). At least two kinds o f receptors are presently known. which are expressed b y T cclls which most likely belong t o different lineages. I shall refer to these as the a/p and the $6 T cell receptors (TcR’s).
207
3. I . The alp T cell receptor. This is the antigen receptor which is expressed by the majority of mature T lymphocytes. Like immunoglobulins, it is highly diverse and its diversity is clonally distributed. However, in contrast to iiiiniiinoglobulins. it only recognizes foreign antigen in t h e context o f a major liistocot7ipatibility complex molecule; this targets recognition t o cell-bound structures. Whilst the a/@TcR's and immunoglobulins have evolved under different selective pressures, they clearly share a common ancestor. as both their structure and genetics are fundamentally organized according to the same principles. 3. I . I . Overall structure Like immunoglobulins, the alp T c R consists of two chains which arc disulphidebonded a n d it is organized into ;I V and ;I C region. There are. however, a number of significant differences from i m in LI n oglo h i t I ins . First , w hi I st i m in unogl o bu I i n s a re hoth cell-bound and soluble receptors. the u l p T c R is o n l y cell-bound. Second, the binding site is monomeric. Third, whilst hoth componcnt chains span the plasma membrane, the C region is much smaller than that of immunoglobulins such that t h e extracellular portion of the tv/P TcR molecule rather resembles an immunoglobulin Fab arm. Fourth. the a/@TcR is closely associated with a set of proteins (the CD3 complcx). which act a s ;I signal transducer for the coupling of antigen binding to cell activation [ 171. In addition. other molecules (CDJ and CD8, see below) may play an important role in binding of the T cell to the antigeniMHC complex.
3.1.2. Strcict~ireof the varirihlr r .' 'c1 ~0 1' 1 This is the domain in which the cwip T c K is most homologous t o immunoglobulins. .4lignmetit o f primary sequences (Fig. 3 ) shows conservation o f @-strand patterns as well of residues which are known t o be critical in V-V packing. Some features of loop architecture are also conserved. This suggests that both folding and pairing of V,, and V, units occur in ;I similxr way to that o f immunoglobulin V domains Variability plots show the existence i n hoth V,, and V, of three hypervariable regions, which in the primary sequences map to positions homologous to the complementarity determining regions ( C D R ' s ) o f immunoglobulins [ 19-25]. This suggests that the antigeniMHC binding site o f the NIP TcR largely results from the juxtaposition of these three CDR's. In these analyses, both V,, and V, display an overall high level of variability and extra hypervariable regions have been proposed to occur in V, [19]. However, this does not necessarily imply an extra binding site. In the first place, the significancc of the extra hypervariable regions in V, has been questioned, since the sequence sample is statistically small and V,'s do not represent a homogeneous population ([26] and see below). Secondly, sequence variability reflects freedom from structural constraints, which only indirectly correlates with antigen binding; for example, a fourth region of hypervariability exists in human V, [27]and this does not form part of the antigen binding site.
(A) V,
QQ
10
~
1 0
~
30
!
: 104
~
5;
~
70
60
80
9OI
~
;I00
U
:
l
Z
O
I
!2
cr:
NVQ QSPESLIVPEGAR TSLNCTF SDSAS******Q YFWWY QHSG KAE'KALM SIFSNGEK********EEGR FTIH LNKAS LHFSLHI RoSQPSD SALYLCAV LYGGSGNK LIFGTGTL L S W
Vp NS KVI QTPRYLVKGQGQK AKMRCIP EKGHP******* W F W Y
QNKN NEFKFLI N*FQNQEVL€Q*IDMTE*KR FSAE CPSNS PC*SLEI QSSEAGD SALYLCAS L*NWSQDT QYFGPGTR L L m
-
V., GHG KLE QPEISISRPRDET AQISCKV FIESFRS****V TIHWY QKPN QGLEFLL YVLATPTHI*'*FLDKEYKK MEAS KNPSA STSILTI YSLEEED EAIYYCSY MSDSSGFH KVFAEGTK LIVIPS V,
DI VMT QSPSSLSVSAGER VTMSCKS SQSLLNSGNQKN FLAWY QKPG QPPKLLI YGASTRESG*******VPDR FTGS **GSG TDFTLTI SSVQAED LAWYCQN
HS****YP LTFGAGTK
VH
*E VKL VESGGGLVQPGGS LRLSCAT S*GFTFSDF*** YME
YYGSTWYF DVWGAGTT VTvSS
QPPG KRLEWIAAS RNKGNKYTTEYSASVKGR FIVS RDTSQ SILYLQM NALRAED TAIYYC
A
B
A
Human C k
CDRl C
C'
B
C
E
D
CDR2
Q P W S
+ Human CBI EDLNKVFPPE Mouse C ---RN-T--I(
P
Human C,
Mouse C,
t
Ph -Y
A
D
E
F
CDRB
G
209 I t has been remarked that both V,, and V, are somewhat more homologous to V, than t o V , in their core structurc. However, this does not imply significant differences of the binding site, since. for example. V, CDR loop lengths are closer to those of V,, than to those of V,; furthermore, V, dimers d o not necessarily pack in a significantly different way from V,.-V,, [ 101. 3.1.3. Genetic basis of diversity
In the germ line both V,, and V,. like immunoglobulin V regions, are encoded in separate segments, each present i n multiple. diverse copies (families). During the somatic assembly process, segments can recombine independently and nucleotides can be inserted and/or deleted from the junctions. In this way. a large repertoire of different V regions can be derived from a much smaller repertoire of germ-line sequences (see Chapters 3 and 4). T h e segmental arrangement of V regions is clearly a critical factor in the generation of diversity. It has been suggested that this arrangement resulted from the insertion of a transposon-like element into a primordial V exon [28]; this element became stably integrated into the germ line. whilst maintaining the ability to be excised during the somatic development o f immunocompetent cells. Sequence variability resulting from imprecision i n the excision process became utilized in the generation of the antigen binding site. Consistent with this, the insertion is found at a position corresponding to ii region in the polypeptide ( C D R 3 ) which is subject to few structural constraints. The ends of the excised D N A sequence have a unique organization [29]: ( a ) each e n d consists of two short conserved sequences (a heptamer and a nonamer) which a r e separated by a spacer; (b) the spacer can span either one o r two turns of t h e D N A helix (one- o r two-turn type); (c) the heptamerinonamer sets at the two ends a r e in inverted orientation with rcspcct to each other; (d) the spacers at the two ends a r e of different type. i.e. one-turn type at o n e end and two-turn type at the opposite e n d . This organization is shared by all V region loci. Heptamerinonamer sequences a r e also conserved across loci. i.c. the same sequences are found in both immunoglobulin and TcR gene segments. This pattern of conservation suggests that these sequences are critical to recombination a n d that the recombination (joining) machinery has similar requirements i n T a n d B cells. Indeed, this has already been shown t o be the case ( [ 3 0 ]and Chapter 4). ~~~
~~
~
~
Fig. 3 . (A.B). Alignment of immunoglobulin and T c e l l receptor V (panel A) and C (panel B) units. P-strand sequences (from [6] and 12051) xi-c boxed and indicated by letters A to G.*, padding chnrCDR’s (7’cell receptor hypervariable regions acters introduced to maximize nlignmentz. I’ancl A : map essentially t o corresponding positions. see text). conserved glycine residue in the loop connecting P-strands A and B in V units; *. kcv residues in V,,-V, packing [ l o ] . Horizontal brackets, salt bridgcs. V, and V l l sequences are from the niwse myeloma MCPC 603 [206] (this V, is unusual in the length of its C D R l [205]):V,, and V, iirc Iron1 the mouse T-helper hybridoma 2B4 [207.208]: V, is the nimt frequently rearranged V at thc miuse TcRyl locus (1771 and see tcxt). Panel B: - , interspccies identity; +. identity to human C,. C‘ i-cgion sequences are from [2Oh] (human Ig CJ. (209l (human T’cR C B l ) .[ Z I O ] (mouse TcR C,, and C,,, arc identical), [ Z I I ] (human TcR Cy,) and [77](mouse TcR Cd).
=.
210
Fig. 3 . Orientation o f immunoglobulin a n d TcR V gene segments relative to joining signals. The symbol '2' indicates ii two-turn type joining signal a n d '1' ii one-turn type joining 4gnal. Within each type of signal. the conserved hcptarners :IIK adincent to the V gene segment. whilst the conserved nonamers point toward each other. Although n o D segment has s o far been shown at the TcR y locus. its existence has not been excluded.
T h e V, locus consists of V a n d J segments, whereas the V, and V,, loci are composed of V , D and J segments. The existence o f D segments has also been recently reported at the V, locus [316]. Differences between these loci are found in the relative orientation of recombination signals and coding segments (Fig. 4); this is most significant when contrasting V, and V,. A V , , region is assembled in two steps of which D-J joining is the first. D-J joining may also occur as an obligatory first event in V, assembly; however, germ-line V, segments can join both to D-J and directly to J . As a consequence D segments are obligatory in IgH V regions. dispensable in TcR V regions [31-331. D - D joining can occur i n V, [13]and may also in principle occur occasionally in Vk,. iis both 21 one-turn and a two-turn recombination signal sharing the nonamer scquence can be found o n the 5' side of some D, segments [34]. Comparison of the germ-line V gene repertoires of immunoglobulins to those of aip TcR's shows significant differences (Table 1). Both V,, and V, segments are more heterogeneous in sequence than immunoglobulin V segments; this is reflected in the larger number of subfamilies, as defined by nucleotide homology below 75% [20-251 and correlates with the high background in variability plots (see above). O n the other hand, T c R a and T c R P V segment subfamilies contain fewer members. D, segment complexity is amplified by the use of multiple reading frames [35]. T h e J,, a n d J, segments are more numerous and more divergent, as well as longer than immunoglobulin J's. Thc J,, segments a r e unusually long and the sequences of their 5' ends show homology t o D, segments; it has therefore been hypothesized that the J,, segments are equivalent to a D-J fusion. possibly as a result of some germ-line D N A rearrangement 1361. The organization of the J, family is unique: in the mouse it is estimated to consist o f more than 50 segments which are distributed over at least 60 kb and are more widely spaced than those of any other J cluster [37]. A similar organization is likely to exist in man [38]. Such a n arrangement has important implications for transcription, since transcripts of a rearranged T c R a locus must span up to 70 kb. T h e somatic recombination which results in V region assembly introduces diversity by three mechanisms: first, different combinations of V, D and J segments; second, variability in the position of strand breaks; third, template-independent
21 1 'I'ABLE 2 Size of the germ-line repertoire o f T c e l l receptor and immunoglobulin V gene segments (including pseudogenes) V
J
D
total
subfamilies
total
subfamilies
total
B human
6X (
1x
mouse
13 ( < 2 1 )
14
human inouse
47 ( 4 2 ) 55
12 II
42 19
hum an inouse
12
4 4
3 4
human inouse
>hO 300
3 0
human mouse
4(NO 300
4 2-4
4 2
3 I
13 14
N
Y
X
H >4 12
9 4
K
4
5
A
human mouse
>9 4
Subfamilies are defined by greater than 75'r homology amongst members. Data f o r V, and human V,, arc extrapolated from the number and frequency of k n o w segments. the value in brackets giving the 95% confidence upper limit [22-25.215]; for inouse V,, the data mainly derive from Southern blotting experiments [20.21]; for V, from Southern hlotting as well as from cloning experiments [75-78.8(kX2]. For J,, the numher or elements known 211 present is given: the total repertoire size is estimated to he larger. For the germ-line repertoire of iiniiiunoglobulin V gene segments scc Chapter 3.
addition of nucleotides to the recombining termini (N segments). T h e first two mechanisms occur at all V loci. the third. which is due to the action of terminal transferase [39], occurs nearly exclusively a t V,, V,, and V, loci. Vl- a n d V, assembly occur at a later stage than V,, and V,. Thus, differences in the occurrence o f N segments may simply reflect different developmental regulation o f terminal transfcrase activity in the T and B lineages. Combinations of V region gem segments. although largely unrestricted. may not be completely random; some bias has bccn ohserved at the IgH locus which is linked to the temporal order of asscnibly (see Chapters 4 and 7). It is not known whether a similar situation exists a t either the TcRa o r at the TcRP locus: however. some bias in J segment usagc ma): exist i n both mouse and man [40,21]. O n average, only a small proportion o f assembled V regions is functional. In immunoglobulins, rescue of non-productive chromosomes may result as a conse-
212 quence of secondary joining or of V segment replacement in non-functional V regions ([39] and Chapter 4). Neither in v, nor in v, segments are the recombination signals found which have been postulated to mediate V segment replacement [41]. However, the larger number of J segments. especially at the T c R a locus. augments the potential for secondary joinings. Furthermore, since D, segments, unlike D,'s, are used in all three translational frames, productive assembly is more likely at the TcRP than at the IgH locus. Assembled V, and V, genes can mutate at a high rate by an as yet unknown mechanism. Mutations are rare in primary B cells, but accumulate during the progression of the immune response and correlate with an increased affinity for antigen (maturation) (see Chapter 7). With one exception [42]. no evidence for a similar mechanism has so far emerged from the analysis of expressed V, or V, regions. Thus, affinity maturation may n o t play any significant role in a/p TcR recognition. This may be due t o ;I bias in the sampling, since most of the T cells analysed may be equivalent to primary B cells. However, it is more likely to reflect different selective pressures: no specificity control mechanism (thymic selection, and/or dependence on regulatory T cells) is operational in peripheral T cells and a/p TcR mutations which might cause loss of self MHC restriction (see below) and/or the generation of self-aggressive specificities must be prevented. In summary, the genetic strategy of the alp TcR is characterised by two main differences from immunoglobulins: first, greater heterogeneity of framework sequences; this may well correlate with diversity at the binding site, for example by dictating different conformations of CDR's, in analogy with immunoglobulin V regions [6]. Second, restriction of somatic diversification to CDR3: this may imply that variability at C D R l and CDR2 is under genetic selection (see below). 3.1.4. Structure of the coristuiit regiori
The constant region of the aij3 TcR consists of a C-like domain (Ccrplus C,) linked by a connecting peptide to the transmembrane and intracytoplasmic tail. Both C, and C, show conservation of p-strand pattern and contain key residues typical of immunoglobulin C units (Fig. 3). Howevcr, in C, the homology unit is only 90 amino acids long and little homology exists at positions corresponding to p-strands C, F and G, which are also poorly conserved across species. Divergence is most evident in the sequence aligning with j3-strand C, which is lacking the tryptophan residue that is an invariant component of the core of the immunoglobulin unit [6]. Thus, whilst conservation of j3-strands A . B, D and E and of few other critical residues suggests that C,, and C, pack in a manner analogous to that of immunoglobulin C domains, it remains to be seen whether C,, folds like a typical C unit. Both (Y and p chains contain one cysteine residue located approximately 20 amino acids from the cell membrane within the connecting peptide. Thus, although C, also contains a conserved unpaired cysteine, the disulphide bond linking the two chains most likely occurs between the connecting peptides. Both chains are known to be N-glycosylated, the extent of glycosylation varying between species, between chains and even within the same chain [43,44]. Glycosylation sites are found in both C units and in the connecting peptides.
213
a
= Cunii
0=
=
0-
100 basepairs
Connecting peptide
= Transmembrane =
0=
lntracytoplasmic
3 untranslated region
m.
Fig. 5 (A.B). ( A ) Genomic organization of humaii TcR C region genes. exons; //, introns. Numbers give approximate intron lengths i n lib. Thc TcR y chain connecting peptide is encoded by a number (1-3) of highly related exons which varies hctwecn individuals (1741 and see Fig. 6). (B) Gcnomic organization of mouse TcR C, genes. Identical tilling pattern indicates sequence homology. Arrows indicate direction of transcription.
Finally, the transmembrane stretch of both a and p chains contains basic residues which have been hypothesized to form salt bridges with acidic residues occurring in equivalent position in the polypeptides of the CD3 complex [18]. Crosslinking studies have shown the TcRP chain to be topographically close to the CD3 y chain at the cell surface [4S]. The genomic organization of TcRa and TcRP C region genes is illustrated in Fig. 5 . Two tandemly arranged TcRP C region genes exist in both mouse and man, resulting from a duplication that also involves the D, and J, segment cluster. Se-
214 quence identity of over 95%, in the coding regions of the two C,’s suggests strong selection. The two TcRP C region genes are equally used by functionally different classes of T cells (helperlcytotoxic). The TcRP C region genes are unusual in that the C, immunoglobulin homology unit is not encoded in a separate exon.
3. I .5. The alp T cell receptor and the major histocompatibility complex It has long been known that most T cells recognize a foreign antigen only in association with a major histocompatibility complex (MHC) molecule of a specific class (either class 1 or class 11) and allotype, a phenomenon known as MHC restriction [46]. There is good evidence that it is the alp TcR that determines all these specificities [47-501. I n contrast, antibody recognition is not generally MHC restricted. What is the basis of this difference? Two pieces of evidence suggest that obligatory MHC restriction is not due to basic structural differences between alp TcR’s and immunoglobulins: first, the alp TcR and immunoglobulin V domains are highly homologous, suggesting a similar molecular architecture. with a single binding site shaped according to identical principles; second, antibodies recognizing foreign antigen in association with an MHC molecule do exist (511. Thus the bias in the aip TcR recognition repertoire must be due to selection. Where does such a selection occur? Several lines of evidence indicate that MHC class and allotype restriction is due to thymic selection of a/p complexes [52]. Thus. in most cases neither the a chain alone nor the p chain (nor any V,,or V, gene segment) is individually sufficient for the recognition of MHC class ([32,53-55] one exception is discussed in [ 5 6 ] ) and allotype [35,57-59]. However, individual a and /3 chains may recognize MHC molecules non-specifically, i.e. independently of class and type. Thus, the same a chain is shared by alp TcR’s specific for: ( 1 ) pigeon cytochrome c and MHC class I1 Ek or Ek”’ [37,58]; (2) ovalbumin and MHC class I1 A” [5Y]; (3) an allotypic MHC class I Dh 1591. Since the three a/p TcR’s listed have been generated by in vitro manipulations (i.e. they have not been selected as a complex in the thymus) and do not crossreact, this particular a chain may impose a bias towards MHC recognition that is independent of class and allotype [59]. Whilst this bias may also be due to selection of individual chains in the thymus, V,, andior V, gene segments are clearly not individually selected [53,55]. These conclusions have two significant implications. First, they support an early hypothesis that there is a germ-line repertoire of V regions that are specific for MHC molecules [60]. However, by making such specificity independent of MHC class and allotype. they dispense with an otherwise problematical requirement for a co-evolution at the population level of V region and MHC genes [61]. Second, they suggest that this MHC bias is carried by germ-line encoded CDR’s (CDRI and 2), whilst determination of MHC class- and allotype-specificity as well as foreign antigen binding must largely be the role of CDR3, which is the only target of somatic variability. Different requirements for germ-line repertoire selection may explain why, despite prima facie wastefulness [62], immunoglobulins and cdp TcR’s have evolved as two completely independent. yet equally specific recognition systems.
215
3.2. The $6 T cell receptor Despite lack of direct evidence for a receptor function, two elements strongly suggest that this molecule constitutes a second type of TcR. First, both the structure and the genetics of at least one of the component chains, the y chain, are closely homologous to those of TcR cy and /3 chains, including features of diversity (see below). Second, the TcRy is expressed at the cell surface in association with the CD3 complex, which is postulated to act a5 a signal transducer in coupling antigen binding and cell activation in a//3 TcR-positive T cells [17]. The CD3 present on T cells expressing TcRy is known to be functional [63,64-671. Whilst early in ontogeny the TcRy is expressed by a large number of thymocytes, in the adult it is found only on a small minority (less than 5 % ) both of thymocytes and of circulating T cells. All such TcRy expressing cells are alp TcRnegative [67,66], express immunoglobulin Fc receptors and can effect antibody dependent as well as direct cytotoxicity. The in vitro killing of target cells, albeit specific, occurs independently both of previous sensitization and of MHC allotype and is not inhibited by antibodies against MHC molecules, showing similar features to natural killer cells [64.65,68]. Thus, the ylS TcR is likely to be non-MHC restricted. Consistent with this, TcRy-positive cells express neither CD4 nor CD8 (these molecules possibly playing an accessory role in MHC recognition by d p TcRpositive cells, see below) and may not be thymus-dependent [67,66,69]. In humans, TcRy's are heterogeneous in structure; it is not clear whether this heterogeneity has functional relevance and/or whether it identifies different classes of T cells. Data from different laboratories are tentatively summarized in Table 3 . On the basis of the presence of interchain disulphide bridges, two forms can be distinguished, the non-disulphide-bonded form probably representing more than TABLE 3 Structural features of TcR's Humaii
Mouse
y chain
40-44 + occasionally 3&41
55-60 (4(k45)h 40
35
31-34
6 chain
43 (invisihlc. ? ) '
38-40 (62)"
45
Interchain disulphide
+
-
+
glycosylated polypeptide backbone
32
Numbers represent range of molecular weights in kDa; for the y chain these are given for both the glycosylated (cell surface) form(s) and the polypeptide hackhone. I and I1 refer to two distinct types of TcR's which have been identified in huinaiis. See text for details. " In the human disulphide-bonded form a 6 chain was directly visualized in six out of a total of nine clones analysed [63-65.681. hypothcsized in one other case [65]and possibly missing in the remaining two [64]. In the non-disulphide-bonded form, thc data in parentheses refer to a polyclonal TcRy-positive cell line from normal peripheral blood ( y chain only. [ h S ] )and t o a thymocyte clone (y/S chains, [h3)).
216 half of the alp TcR-negative, CD3-positive circulating T cells [65]. At least two y polypeptides of molecular weight 31-34000 and 40000 have been found, of which the first may be more common and the second may be restricted to disulphidebonded complexes. Both polypeptides are heavily glycosylated; occasionally, partial glycosylation products may be found in variable amounts on the cell surface [64,65]. Much less is known about the non-y (6) chain for lack of specific probes. However, at least two different forms of this chain exist in non-disulphide-bonded complexes, one of which might be thymus specific [63]. On the basis of its pattern of expression in ontogeny, it has recently been proposed that a newly identified TcR C,-like gene, located approximately 70 kb upstream of C,, might encode C, [216]. Some TcRy’s might be homo-. rather than heterodimers [64]. A single form of $6 TcR has been described in the mouse [70-72]. Like a and p chains, the y chain consists of a V and a C region. There are two isotypic TcR C, region loci in man [73,74]. Three TcRy loci exist in the mouse [75-781: there is no evidence that the TcRy2 and y4 loci (nomenclature according to [77]) can encode functional polypeptides (see below). A fourth locus (TcRy3) is found in the BALBlc mouse, but it is likely to be of little functional relevance, since it contains multiple defects (stop codons in all three reading frames of the single J segment as well as defective splice and polyadenylation sites) and it is not conserved in different strains (75,761. The sequence of all human and mouse y isotypes reveals typical features of an immunoglobulin C homology unit and contains a conserved N-glycosylation site in mouse T c R y l as well as in both human isotypes. The C unit is followed by a connecting peptide, of which the membranedistal segment shows the most dramatic variations amongst mouse and human TcR C, regions (Fig. 6). In humans this is due to different numbers (between 1 and 3) and combinations of homologous 16 amino acid long units, each unit being encoded by a separate exon [73,74]. Three different C, regions originate from the CY2locus probably due to polymorphism in the number and type of such exons rather than to differential splicing. Differences in connecting peptide size may be amplified by the occurrence of extra N-glycosylation sites. The membrane-proxima1 segment of the connecting peptide is conserved between isotypes as well as across species and is encoded by the same exon as the transmembrane and intracytoplasmic tail. In man, an unpaired cysteine is found only in the C,, connecting peptide. Thus, the human disulphide-bonded form of y chain can only correspond to this isotype. The only mouse y polypeptide chain that has been identified is both N-glycosylated and found in a disulphide-bonded dimer [70-721. All mouse y isotypes are predicted to have an unpaired cysteine (in the connecting peptide), but only CYI (in the C domain) and C, (in the connecting peptide) have N-glycosylation sites and only the CYIlocus is substantially transcribed in foetal thymocytes, where the y chain is known to be expressed [77,79]. All y chain transmembrane segments share with a and p chains the presence of a charged basic residue, which is presumably implicated in the association with CD3. The sequence of V, regions shows features typical of immunoglobulin and TcR V,, and V, regions (Fig. 3). An exception is found in p-strand G, where the se-
217 C unit
1
S
N
1
I
s
I
Connecting Peptide
N
I
S
I
N
I
N
5
I
I S
N
s I
I
S
S
I
I
I
I
I
t
N
N N
I
I
N
N
I
I
H U M A N y 2 (FRO 2 2)
1
HUMAN y 2 ( H P B MLT)
1
H U M A N y 2 (PEER)
1
MOUSE y 1
N
l
N N I l
I
l
N l
s
s
I
I s
s I
I
I
s I
N
111
N N I 1
n
s I
NSN
HUMANyi
5
I
I
1
TM + CY
I
1
MOUSEyP
s
I
I
N 1
S 1
I - -
MOUSEy4
Fig. 6. Structure of TcR y chain connecting peptitle\. as deduced from c D N A clone>, Boxm with siniilar filling patterns (i.c. either cross-stripc\ o r shatlcd) are homologous in sequence. Blank spaces are introduced to maxiniizc alignments. Fro 2.1. HPB-MLT and PEER are cell lines established horn dilferent individuals [7JI. The lengths of thc C’ u n i t ( II 0 amino acids) and ol the transmembrane and cytoplasmic segment (approximatcly 53 aniiiio : d s ) is a l s o \hewn 11s a reference. S. potential disulphidc liridge: N. potential N-linked glycosylatioii \ i t c
quence Ah-X-Gly in all V,’s rcplaces the Gly-X-Gly which is found absolutely conserved in all other V units. This sequence is encoded by the J segment and in V, and V,. forms a P-bulge which contributes in a characteristic way to V-V domain packing [XI. Comparison of V, sequences shows hypervariable regions analogous to immunoglobulin CDR’s. The genetic organization of V, regions is similar to that of V, and V,. The germline repertoire of V gene segments is limited (Table 2). Only one V and one J segment are present at mouse TcRy2. y3 and y4 loci and these segments belong to the same subfamily [75,76,78]. However, the complexity of the mouse TcRyl Vsegment family is considerably greater and this is true to an even larger extent of the human family [77,80,81,74,82]. In the latter, four V segments are pseudogenes [go]. These may nonetheless play a functional role, as pseudogenes have been shown to contribute to the somatic generation of diversity at the chicken V, locus (see Chapter 7). No D segment has yet been shown to exist; however, J, segments are similar to J, and may also be possibly equivalent to D-J fusion events. V, region assembly involves limited combinatorial variability in TcRy-positive cells. At the mouse TcRyl locus, the only one which consists of multiple V seg-
218 ments and which is known to encode a functional y chain, equal usage of V segments is observed only in early foetal thymocytes; later in ontogeny as well as in the adult only a single J-distal V segment is found assembled [77.79]. Likewise, there is evidence to suggest that, in adult humans. fewer V, segments are used by TcR y-positive cells than are found in the non-functional rearrangements of TcR ynegative cells [80,65]; the V, pseudogene segments are never assembled [80]. This situation appears to be the reverse of that reported at the IgH locus. where restricted use of J-proximal V segments is found early in ontogeny, whilst the adult repertoire is largely unbiased (see Chapter 4). The restricted combinatorial diversity at TcRy loci might be due to selection for receptor binding specificities: however. it may also result from V segment replacements following non-productive assemblies. Indeed. in contrast to V, and V,, but like V, segments, a sequence corresponding to the putative replacement signal is absolutely conserved in all known V, segments, both in mouse and man [41]. Whilst the two human TcRy loci share V segments (analogously to the IgH and TcRp loci) the three mouse TcRy loci do not. Although mouse y2 and y4 V segments are closely linked [ 7 5 ] ,no instance of 'scrambling' has yet been reported. Thus, in the mouse. the assembly and transcription o f one y locus does not preclude the assembly and transcription of another y isotype. Given the close proximity and opposite orientation, the mouse TcRy2 and y4 genes might well share control elements. Somatic diversification of V, regions does result from junctional variability ( N segments and flexibility in recombination breakpoints), but. similarly to V, and V,, is never observed after assembly. Thus, variability in y chains is likely to be topographically limited to the third CDR loop within a substantially conserved framework.
3.3. Relationship between the expression of the alp rind of the ylS T cell receptors The TcRy-positive cells have often assembled a functional V, region gene on only one chromosome and as a rule contain partially assembled V, regions (D joined to J ) with the a loci in germ-line configuration, thus being aip TcR-negative [64,65,83,84]. Conversely, alp TcR-positive cells contain assembled, mostly nonfunctional V, region genes on both chromosomes and are y TcR-negative [85,86,87,78]. In ontogeny and during intrathymic differentiation, V region assembly begins approximately synchronously at the TcRy and p loci and precedes V,J, joining [83,84]. A developmental program has been proposed (Fig. 7) [72], which resembles that postulated for immunoglobulin loci (see Chapter 4). According to this view, expression of y/S TcR polypeptides prevents assembly and expression at TcRa and p loci and thus identifies a separate lineage of T cells. This model is supported by the finding that, contrary to the alp TcR, the ylS TcR pathway is neither MHC-restricted nor thymus-dependent. and may be functionally more relevant at early stages in ontogeny.
,e
219
Ylb TcR expression
V; and Vgt
joint joint ) joint
L
Vp -DJB
,J;V
,olnt
jolnt
w
alp TcR expresslon
Fig. 7. Developmental relationship between the nip TcR and the y/8 TcR expressing T cell lineages. See text for details.
4. The major histocompatibility complex The members of the immunoglobulin superfamily that are encoded in the major histocompatibility complex (MHC) (Fig. 8) constitute a large family which, on the basis of functional criteria. can be divided into two major sets [SX-911. The first consists of antigen-presenting molecules and includes the classical transplantation antigens (class I, see below) and immune response factors (class 11). The function of the second is presumably in differentiation, since these molecules (which in the mouse include the Qa and TL antigens [92]) are expressed on specific cell types; molecules analogous to this second set V (CD1) are also encoded by a small family .--._--
H LA
4 MHC class
DP DO Human chromosome 6
II
--.
....
*I
+ I 1 4
DR
B
C
I
I
I
I
I
1,
,
(short arm)
A I
+ To the telomere To the telornere
Mousechromosornel7
*I/-,, K
MHC class
+/,
D
I-AIM
I +lI+
*
L-OOarTL----)
-I .
H-2
w
200 kb
Fig. 8. Map of the human and mouse major histocompatibility complex (based on [212 and 1431). Only genes coding for class I and class 11 antigen-presenting molecules are shown. In contrast to the situation in humans, one of the mouse H-2 class I loci ( K ) is found separate from the others, on the opposite side of the class I1 region. probably as ii result of an inversion of this region of chromosome 17.
220 of MHC-related genes. which map to a different chromosome [93]. Both sets consist of cell-surface molecules. Alongside the genes coding for the identified protein products, a much larger number of genes is found with homologous coding potential. some of which a r e clearly pseudogenes. Here I shall concentrate exclusively on t h e first set, since little is known about the function of the second. Antigen presentation can be viewed as an adaptation of a n older cell-cell recognition function into two separate systems which identify distinct classes of M H C molecules. T h e first system has evolved to monitor a n d ensure the integrity of cell surface structures and consists o f M H C molecules expressed on most cell types and mainly recognized by cytotoxic T cells (class 1 molecules). T h e second system has evolved to mediate cell-cell interactions in the immune response and consists of M H C molecules mostly expressed on macrophages and B cells and mainly recognized by regulatory T cells (class 11 molecules). T h e functional diversification between class 1 and class 11 molecules is reflected in substantial structural differences (see below). T h e antigen-presenting function correlates with a high degree of diversity, resulting from two simultaneous requirements [46]: ( a ) the ability to bind to foreign antigens; (b) the ability to bind to TcR’s. A s a rule. both requirements must be met by the same M H C molecule in order to trigger a T cell response. However. since the effective trigger must be a trimolecular complex of M H C molecule, T c R and foreign antigen, any pairwise interaction between individual components is generally much weaker than that between classical receptor-ligand pairs (e.g. antigen-antibody. hormone-hormone receptor). Each class of M H C antigen-presenting molecule consists of multiple isotypes. Thus. three class I isotypes ( H L A A , -B and -C) and at least three class 11 isotypes ( H L A - D P , -DQ and - DR) are found in man. Each isotype occurs in ;I large number o f diverse forms. T h e diversity of M H C antigen-presenting molccules differs from that of immunoglobulins in two major respects. First, it cxists primarily within the species (polymorphism) and is much more limited within each individual. This polymorphism is unique in ( a ) the large number of alleles at each locus (more than 40 serologically detectable variants are presently known at the H L A - B locus a n d primary sequences show even greater heterogeneity). ( b ) the comparable abundance of each allele and (c) the extent of primary scquence divergence between alleles (this can be more than 8% in amino acid differences at the H L A - B locus). Clearly, a large, balanced polymorphism maximizes heterozygosity [94]and implies that limited M H C diversity confers a selective advantage. However, it is equally clear that the M H C , unlike the immunoglobulin and T c R systems, has not evolved to provide maximum diversity within o n e individual. Thus, within the individual, some M H C diversity is likely to be of selective advantage, but a large diversity may be detrimental. Indeed it may be suggested that the extent of M H C diversity has conflicting effects on the antigen-presenting potential and the T cell repertoire within each individual, since, whilst expanding the former, it reduces the latter as a consequence of the deletion of T cell clones that a r e reactive to self M H C [95]. A second important difference between M H C antigen-presenting molecules and immunoglobulins is in the distribution of the repertoire of diversity within each in-
22 1 dividual. Whilst immunoglobulin and TcR diversity is distributed amongst a set of cell clones, M H C diversity (within each M H C class) is entirely represented in each cell. These patterns of distribution reflect the requirement of an interaction between a target (the M H C molecule) and an effector (the TcR) for the immune function. Clearly, for the cellular immune system to be effective, the target must be present on all cells whilst the eftector must be specific. These requirements also impose different constraints on the amount of diversity which can be achieved by the immunoglobulin and the MHC systems within the individual. 4.1. Overall structure
Although little is known about the three-dimensional structure of M H C molecules, on the basis of primary sequence data as well as of preliminary crystallographic evidence [96] it can be assumed that their general structural plan is not very different from that of TcR’s. Thus, they are composed of two different chains, a heavy ( a ) and a light ( p ) chain, and consist of a membrane-distal domain, to which variability is essentially restricted, a membrane-proximal domain, which is essentially invariant, a transmembrane and an intracytoplasmic tail. Both extracellular domains result from the pairing of two units (Fig. 2); however, in class 1 both V domain units (a1 and a2) are contributed by the same chain ( a ) ,whilst the C domain is contributed by one a chain unit ( a 3 ) and by &-microglobulin (which is not M H C encoded). In class 11, both domains result from one a chain and one p chain unit (the V domain from a1 and p l and the C domain from a2 and p2). Furthermore in class I molecules, but not in class I1 or T cell receptor molecules, the transmembrane and intracytoplasmic segments are not dimeric. 4.2. Structure of the variable regiori
This region consists of the a1 and a2 units in class I and of the a1 and p l units in class I1 molecules. All these units have lengths very close to those of classical immunoglobulin units, but none of their canonical features (see Section 2 in this chapter). Thus, it is likely that both the folding and the packing of the two units of each domain are drastically different from those of immunoglobulin V units. Two elements, however, suggest that MHC V domain units share a basically conserved architecture: first, the variability in primary sequence is clustered, allowing the distinction of framework and hypervariable regions [97,98]; second, features of predicted secondary structure are conserved amongst all units [99,100]. Thus, in class 1 a1 and a2 and class I1 P l units the amino-terminal half would consist of three P-strands in antiparallel orientation, whilst another (possibly two) P-strand would span the carboxy-terminal stretch. The structure of the middle section is less easy to predict, but it is likely that it folds at least partly into an a-helical conformation (Fig. 9). Both class I a2 and class I1 p l domains are likely to have an internal disulphide bond. It has been proposed [loo] that these secondary structure elements fold into an ‘open sandwich’ type of tertiary structure [ l o l l that consists of a single P-sheet covered on one of its sides by a layer of helices and loops; how-
H-2 I- Ap, ~
S
~
7
Q
~
20
10 1
30 1-
'
40
R
~
50
.\\\\\\\\\\\\\-
Y 60
I
70
<\\\\\\\\\\\\\'
~
~
80
~
90
S
Fig. Y.(A,B,C)Correlation between primary sequence variability and elements of predicted secondary structure in MHC molecules. Black histograms. variability plots; open bars. predicted P-strands; hatched blocks, predicted a-helices; hatched blocks included in boxes, P-strands or a-helices. Panel A: HLAA (the sequence shown corresponds to HLA-A2; data are taken from [108]). Panel B: H-2K (the sequence shown corrcsponds to H-2K":data from [ 106 and 2131). Panel C: H-2 I-A (the sequence shown corresponds to I-Ah;data from [214]).
D
~
223
Fig. 10. Predicted tertiary structures for MI IC niolccules V units. Thick arrows. P-strands; stripes. ahelices: thin lines. loops. Filled arrows lay on the plane of the sheet. whilst hatched arrows lay on a parallel plane behind. Filled circles indicate cystcines presumed to form the intra-unit disulphide. Model I is from [ IOO], I1 and 111 from [99].
ever, other arrangements are also possible (Fig. 10) [99]. These predictions are in agreement with circular dichroism measurements and with the analysis of conformational determinants that are recognized by antibodies [ 102-1051. A similar tertiary structure can be tentatively assigned to the class I1 a1 unit, although the degree of uncertainty in the assignment is high. The packing of the two units into each V domain remains highly speculative. Clearly, primary sequence variability in MHC V units, whilst reflecting the existence of structurally distinct subfamilies (allelic series), in analogy with immunoglobulin V region subfamilies. must i n part contribute directly to the binding site(s) for foreign antigen and TcR. Several lines of evidence suggest that segments of clustered variability (hypervariable regions) play such a role. First, differences in the ability of different MHC molecules to trigger a T cell response to synthetic polypeptides correlate uniquely with sequence differences in these regions [97]. Second, mutant MHC molecules that have been selected for altered binding to TcR’s show changes in these regions [106]. Third, a specific sequence at one of the hypervariable regions has been shown to be sufficient to confer binding to a TcR [107]; conversely, ii synthetic peptide spanning a single hypervariable region has been shown to specifically prevcnt binding to TcR [ 108]. Fourth, peptides which bind to and are presented by MHC molecules have some homology to these regions [ 1091. In contrast to immunoglobulin CDR’s. the hypervariable regions in MHC V units fall within stretches of apparently conserved secondary structure. Given our ignorance of tertiary and quaternary structures, it is not known whether hypervariable regions ,juxtapose in space, delimiting a single binding site. Some indirect evidence, however, suggests that this may be the case. Thus, topographical epitopes contributed by at least two distinct hypervariable regions have been defined both by monoclonal antibodies and by cloned T cell lines [ 104,105.1 10,1111. Furthermore, changes located in one hypervariable region which abolish TcR binding can be rescued by simultaneous changes in one of the other hypervariable regions [ 1121. Finally, different peptides which bind to and are presented by the same MHC molecule have been shown to compete with each other for MHC binding [109,113,114].
224 MHC molecules bind to short peptides [115-1221. in agreement with the welldocumented notion that T cell recognition requires processing of native antigens [123]. This binding appears to be governed by an intriguing set of rules: (1) only one peptide binding site is present on each MHC molecule. This site can bind several different peptides and thus the binding is of low specificity; (2) binding may require homology at certain critical positions between the peptide and the MHC molecule. Since in the latter these positions map within hypervariable regions, different MHC molecules differ in their ability to bind to the same peptide. Such differences correlate with the ability to present the peptide and thus constitute the basis of MHC allotype restriction; ( 3 ) in order to be recognized by T cells, the complex between the MHC molecule and the peptide must differ at certain critical positions from self MHC. Any different (allogeneic) MHC molecule which mimics the same configuration will also be recognized. This constitutes the basis of alloreactivity; (4) in some cases the MHC-peptide complex is stable only in association with a TcR [117]. A model has been proposed by which the binding of a peptide to an MHC molecule requires displacement of a structural element spanning a hypervariable region from its normal configuration [ 1091. Albeit highly speculative, this theory may explain the very slow association rate of the peptide-MHC molecule complex (1 mol/s [ 120]), since it requires an energetically unfavourable step.
4.3. Structure of the constant region MHC molecule C domain units have features that are typical of immunoglobulin C units [99,100,124,125]. This has been experimentally verified by the resolution of the crystal structure of free &-microglobulin [126]. However, preliminary crystallographic evidence [ 1271 also suggests that in the C domains of class I molecules the packing of &-microglobulin and the a3 unit has unique features when contrasted to the packing of immunoglobulin C units: pairing would occur at a different angle and p,-microglobulin would be somewhat shifted along the major axis of the molecule. As a consequence, the cis-interaction between the V and C domains appears to be more extensive. Similarly, cis-interactions have been proposed to occur in class I1 molecules [125]. The difference in the length of class I1 a and /3 connecting peptides has been proposed to be compensated for by the occurrence of a twist in the longer segment due to the presence of three proline residues [ 1251. Transmembrane segments are strongly conserved within class I1 a and p chains, reflecting the requirement for a reciprocal interaction. Structural predictions suggest that these segments are folded into a-helices with a face consisting predominantly of glycine, which, if paired, would allow a parallel arrangement [ 1251. The intracytoplasmic segment is not conserved and may be involved in intracellular transport [ 1281. 4.4. Genetic basis of diversity
What are the factors responsible for the unusual features of the MHC polymorph-
225 ism? An exceptionally high rate of spontaneous mutations (2 x l op4 per gene per gamete) has been reported at the mouse H-2K locus [129]. Since mutations were scored on the basis of a phenotypic effect (graft rejection), the actual rate must be even higher. Molecular analysis of these single-step mutants has revealed common features [ 1061: (a) nucleotide changes are multiple and clustered; (b) only a single cluster is introduced by each individual mutational event: (c) clusters introduced by independent events may overlap: ( d ) the clustered changes occur in the wild type sequence of both allelic and non-allclic (isotypic) genes of the same class. These observations indicate that polymorphic diversity may result from reciprocal (unequal crossing over) or non-reciprocal (gene conversion) recombination between different MHC genes. Such exchanges, occurring over short stretches (from a potential minimum of 5 to a potential maximum of 95 nucleotides) could generate diversity by allowing some degree of combinatorial freedom amongst sets of diverse elements of less than V unit size. Conversely, recombination over longer distances has been postulated to contribute to sequence homogenization. The frequency of recombination tends to correlate with the extent of homology between the genes involved and appears to be higher within exon than intron sequences. This has been taken to suggest that recombination may operate on mature mRNA substrates [ 1301, although the observations may simply be explained by the existence of positive selection f o r amino acid replacements (see below) in association with the requirement for short exchanges. I n mutants derived from intercrosses the maternally derived gene is affected as a rule [ 1311 and identical mutations have been observed repeatedly in the same sibships. Thus, recombination is likely to occur predominantly in the female and by mitotic recombination during early expansion in the germ line. Homology to the A phage and E. coli x sequence has been found close to the proposed recombination breakpoints [ 1321. An unusually high frequency of the CG dinucleotides has also been corrclated with the occurrence of homologous recombination [ 1331. The significance of these observations remains unclear. Is the high rate of mutation a t the H - 2 K locus sufficient to account for the MHC polymorphism? Two elements suggest that this is not t h e case. First, a much lower spontaneous mutation rate has been observed at other MHC loci [129]. Second. mutation rates, as estimated from the ratio of silent nucleotide changes to the total number of potentially silent mutation sites, are not significantly different between polymorphic and non-polymorphic regions [ 1341. However, positive selection for mutations in hypervariable regions is strongly suggested by a higher relative rate of replacement than of silent changes. A similar situation has been reported to occur within the reactive centre o f serine protease inhibitors [135]. In both cases, it has been postulated that the selective pressure results from differential resistance to pathogenic microorganisms conferred by polymorphic variants, according to a classical model [136]. The extent of polymorphism may be further amplified by ‘hitchhiking’ of concomitant. closely linked mutations [ 1371. Despite the faster evolutionary rate, the extent of divergence amongst presentday alleles implies that a large fraction of the MHC polymorphism predates the
origin of the human and mouse species. This hypothesis of a trans-specific mode of evolution (as defined in [ 1381) is supported by the repeated occurrence of identical alleles in different contemporary populations and, together with t h e frequency of intra-MHC recombination events, may explain the lack of species and isotype specificity in allelic variants. The variable extent of MHC polymorphism in different species may be due to random fluctuations in the allelic complements of founder populations and may have in turn influenced the species' adaptability. Since both class 1 and class I1 molecules exist as heterodimers and in multiple, coexpressed isotypes, diversity could potentially occur as a result of combinatorial mechanisms. However, due to the tight syntenic arrangement of the genes coding for paired V units (unusual in the case of heterodimeric proteins and reflected in a strong linkage disequilibrium). allelic forms of a and /3 chains as well as different isotypes tend to occur in a limited number of combinations (haplotypes). The preservation of the same arrangement in all species studied suggests selection against random combinations. In support of this. haplotype mismatched class I1 a and /3 chains generally fail to associate [ l3Y]. A limited amount of combinatorial freedom, however, does exist. Thus, association of class 11 a and /3 chains from different haplotypes has been reported to occur both within and between isotypes [ 14O,141]. New combinations can also arise from genetic recombination between haplotypes. Recombination frequencies are markedly haplotype dependent, ranging in the H-2K-1 interval from 0.02% in crosses between d and s haplotypes to more than 80 times higher in crosses between h or k and M u s musculus molossinus or Mus musculus castaneus haplotypes [ 142,1431. Furthermore, cross-over points between haplotypes recombining at high frequency are clustered (hotspots). Four such hotspots have been mapped so far within the mouse MHC, two in the K to 1 interval and two within the 1 region [ 143-1441. The sequence of one of these hotspots reveals homology to the y, sequence as well as to the core sequence of human hypervariable minisatellite regions. and may be able to assume a left-handed Z-DNA conformation [ 1431.
5. Accessory molecules of the alp T cell receptor (CD4 and CD8) These are cell surface molecules which are found o n all mature a/p TcR-positive cells, where they are expressed i n a mutually exclusive manner, as well as on both a/@TcR-positive and cv/p TcR-negative immature thymocytes, where they are coexpressed [145,146]. CD4 has also been found to be expressed in the brain in a pattern which is conserved in primates as well as in rodents and which is suggestive of that of a neuropeptide receptor (1471. Since CD4 has been shown to function as a receptor for HIV-1 [148]. its pattern of tissue distribution is consistent with the pathological and clinical findings in HIV-1 infections (acquired immune deficiency syndrome). CD8 exists mainly as disulphide-bonded dimers. In rodents. the dimer is composed of two different chains ( a and p). which have similar polypeptide sizes, but differ in glycosylation to an extent which is opposite in mice and rats: in mice, the
227 longer polypeptide chain ( a ) is inore heavily glycosylated, whilst in rats the converse is true, such that the relative size o f the two mature glycoproteins is also reversed [149-1501. In mouse thymocytes an alternative form of LY chain is found ( a ' ) . which differs in the intracytoplasmic segment (see below) [ 15 I ] . Although alp heterodimers are t h e natural form, homodimers of the form aia. a i d and d / a ' have been observed in vitro [152]. In humans. CDX consists of a single chain homologous to the LY chain of rodents and this chain is found predominantly as a disulphide-bonded homodimer on mature T cells; however. within the thymus it is also found disulphide-bonded to C D l , a n MHC class I-like molecule which is expressed on immature thymocytes. These larger complexes are likely to result from (CDX),: ( C D I ) , and (CDX),: (CDl), stoichiometries [ 153.1541. CD4 is apparently found as a monomer o n the cell surface. However. a small fraction of CD4 may exist ;IS a homodimer [ 1551 o r in association with the aip T c R [ 1561. Both CD8 a and p chains. a s well a s the unique CD4 polypeptide consist of a V homology unit, which corresponds t o the amino-terminal end [ 157-161.150. 162,155,163,164]. The homology is highest to V, and spans the whole V region in the case of CD4 and of the rat CD8 p chain, whilst it is limited to the V segment in the CD8 a chain. Thus, it can be expected that packing of the paired V units in CD8 will result in a structure similar t o immunoglobulin V,_-V,-domains. T h e CD8 locus is closely linked t o the immunoglobulin K locus both in mouse (where it codes for both a and /?chains) and in man [ 165,1661. T h e CD4 V unit is encoded in two separate exons [ 1631. An intervening sequence is found at a position corresponding to a loop between the proposed C' and D P-strands. Such a n arrangement conforms to the general rule that postulates introns to occur between sequences coding for distinct compact structural units o r 'modules' [167] and has intriguing evolutionary implications (see below). In the CD8 chain, the V domain is followed by an unusually long connecting peptide. which is proline-rich and somewhat homologous to the hinge region of the mouse immunoglobulin a chain [ 15x1. by a transmembrane segment and by an intracytoplasmic tail. This tail is much shorter in the LY' chain (found in mouse thymocytes, see above) than in thc N chain. due t o alternative splicing [152]. T h e CD4 V unit is followed b y a polypeptide stretch which has been proposed t o be organized into three domains [lSS]. This hypothesis is supported by the finding that each of the proposed domains is encoded in a separate exon [163]. All three domains show low homology to immunoglobulin units [ 1641. Thus, CD4 may resemble other members of the immunoglobulin superfamily composed of multiple, tandemly arranged. mutually related units (poly-immunoglobulin receptor, a,B-glycoprotein. neuronal cell-adhesion molecule a n d myelin-associated glycoproteinineuronal cytoplasmic protein. see below). Furthermore, homology has been found between t h e membrane-proximal units of CD4 and CD2 (also known as the sheep erythrocyte receptor, a cell surface molecule present on all mature T cells a n d with a role in T cell activation and adhesion to targets) [168]. The CD4 intracytoplasmic segment shows wine homology to the intracytoplasmic segment of
228 MHC class I1 molecules, this homology being highest in humans [162]. CD4iCD8 expression on mature T cells generally correlates with the class of MHC molecule recognized by the aip TcR, CD8 being expressed on class I- and CD4 on class II-restricted T cells. A model has been proposed which postulates that these molecules increase the avidity of the interaction between the (rip TcR and the MHC molecule/foreign antigen complex by binding to the C (non-polymorphic) domain of the MHC molecule [169]. The model is supported by the finding that the response of CDX- (or CD4-), low responder T cells to MHC class I' (or class 11') targets is enhanced when such T cells are converted to a CD8+ or (CD4') phenotype by DNA transfection [ 17O,171]. However, both CD4 and CD8 show low sequence conservation across species in the extracellular domains [ 155,1611, much lower than within each class of MHC molecule. Furthermore, studies with anti-CD4ianti-CD8 antibodies show that: (a) anti-CD4 antibodies can block T cells which are MHC class I1 restricted even when the targets only express the class I1 V domain [172]; (b) anti-CD4ianti-CD8 antibodies can inhibit T cell activity which is induced via MHC- and aip TcR-independent pathways and which does not require the expression of MHC molecules by the target [173,174]. This suggests that CD4iCD8 either bind to a non-MHC molecule on the target cells or that, upon binding to MHC molecules, they exert a negative regulatory function in T cell activation. Such a regulation would be overcome by a strong positive signal due to a high affinity interaction through the a/p TcR.
6 . Other members Homology to immunoglobulin units is also found in molecules which are not directly involved in immune recognition. Whilst some of these molecules have no known function (Thy-1 , MRC OX-2, a , B-glycoprotein), others clearly interact with homologous molecules either within the immune system (immunoglobulin receptors) or in different systems (NCAM and MAGiNcp 3 ) . Whereas Thy-1 consists of a single immunoglobulin unit [175], MRC OX-2 and the macrophage-lymphocyte Fc receptor [ 176-1781 consist of two. The poly-immunoglobulin receptor [ 179,1801, the a,B-glycoprotein [ 1811, the neuronal celladhesion molecule [ 182,1831 and the myelin-associated glycoproteinheuronal cytoplasmic protein [184,185] share a structure consisting of five tandem units which are mutually closely related within the same molecule. A similar structure is found in CD4 (see above). In the poly-immunoglobulin receptor the connecting peptide and the transmembrane segment may also correspond to truncated immunoglobulin units. Homology to immunoglobulin units is often weak; whilst p-strand patterns are suggestive of V units. only Thy-1. the membrane-distal unit of MRC OX-2 and the poly-immunoglobulin receptor units possess the extra hairpin loop (C'iC") which is characteristic of V units (Fig. 11). Thus, the polypeptide chain may fold in a similar way to C units. Although all these molecules are believed to exist as monomers, in most cases the possibility of homodimeric associations has not been ex-
229 MTQ
12
VTMSCKS
12
FIAWYW
3
OPPKI.I.1
THY-1
VTS
9
LRLDCRH
12
SLTRLKH
3
L3uI'!.G
0x2 NCMI(31 MAG (31
TAQ
13 12 12
ASLRCSI, VTLVCDA VSLLCGA
9 IVTWQKK 3 6 TMSWTKD 6 LLTWMXl 1
G i E W T
ARQ IV€
11
VSITCYY
1 3 VTLTCVA
3 5
GGCITLI ,GEPTIL'i
10
1
P-IqR 5 5 (31 Y-FcR
IFG LW LEP
A
VTLTCEG
B
RKYWCRQ DFQLR9 STQWFHN
C
3
9
1
1C CENL
1
C'
3
5 5
'IPI>?JTGS
3
TDFTLTI
'
LAWYCQNE
6
LTFGAGTK
TPEIITYRS
8
YIKVLT!,
-I
EGDYFCELQ
?.
NPNSSNKS
IQPTYKDR ERSRSSVS VAESL
3
TELGLLN DSSEVTI LDL
12
EGCYMCLF EAEWCIAE DGIYACIAE
12
1
9 GTFVVNI
7 7
SGRYKCGLG ZCRYTCRYR
VSSKYAGR SPDR VQASYT
D
2
Fill. t-KATV
E
'
2
SGEYRCQME
F
?WCSGI(V LKVFAWK NAYGQLJNR
13 VSQGPGLL 5 KGWSGGSR 1 MLGVIS3
G
Fig. 11. Sequence alignment from MCPC 603 V, [206], mousc Thy-I [175]. mouse NCAM (third domain. [183]). rat MAGiNcp 3 (third domain. [ISS]). rat M R C OX-? [176]. human secretory component (amino-terminal domain, [ 180]), human a,B-glycoprotein (amino-terminal domain. [ 1811) and mouse macrophage-lymphocyte IgG Fc receptor (amino-terminal domain. [ 177,1781). Only P-strand sequences arc shown, which are indicated hy letters A to G; figures in between give the number of residues in the loops connecting these @-strand\.
cluded; furthermore. intramolecular domain pairing may occur in molecules consisting of multiple units. 6.1. Thy-1
Thy-1 is a cell-surface glycoprotein which is mostly found on cells in the brain and on T cells. Whilst expression in the brain is phylogenetically conserved, expression on T cells is not. Thus in the mouse, Thy-1 is found on both thymocytes and peripheral T cells, in the rat it is essentially only found on thymocytes and in man it is found on neither [186]. Thy-1 is found as a monomer with two intrachain disulphide bonds. Both sequence alignment and secondary structure predictions suggest a close homology to a single immunoglobulin unit which may be closer to the ancestral unit than to contemporary V's and C's [175]. A Thy-1-like molecule has been purified from squid brain and has been shown to contain a 40 amino acid long stretch that is equally homologous to both the amino- and the carboxy-terminal half of V units [ 1871. Thus, this sequence may correspond to the half unit sized building blocks from which the ancestral immunoglobulin unit could have been derived (see below). The mode of anchoring of Thy-1 to the cell membrane is unusual in that it occurs via a phosphoinositide rather than via a hydrophobic amino acid stretch within the protein itself [188.189]. An identical mode of membrane anchoring has been reported for a form of the neuronal cell-adhesion molecule (see below) as well as for a T cell activating protein (TAP, [190]), which is also expressed on the majority of mouse T cells and, whilst having a similar molecular weight, is clearly distinct from Thy-1. As phosphatidylinositol metabolism is associated with the transduction of stimuli across the membrane, it is intriguing that cross-linking of Thy-1 triggers T cell activation, thus supporting suggestions that Thy-1 might have a receptor function. Such activation, whilst bypassing the antigen receptor, does require membrane
expression of CD3 [191]. In the absence of the latter. Thy-1 cross-linking leads only to an increase in the intracellular Ca" concentration which is not T cell specific [192].
6.2. Poly -immurzoglobulin receptor This molecule mediates the translocation of polymeric immunoglobulin (IgA and IgM) across epithelia. The receptor is expressed at the basolateral surface of several gland cells, where it can bind to immunoglobulin in the interstitial fluid. The complex, which involves a disulphide bond with the unit most proximal to the membrane [180], is endocytosed. transported in vesicles across the cell and released at the apical cell surface into the external secretion. The extracellular portion of the receptor (secretory component) is released together with the bound immunoglobulin as a consequence of proteolytic cleavage. Intracellular transport is dependent on the integrity of the large intracytoplasmic segment of the poly-immunoglobulin receptor [ 1931.
6.3. Neuronal cell adhesiori molecule ( N C A M ) This is a cell-surface glycoprotein which mediates cell-cell bonds [194,195]. It is classified as a primary cell-adhesion molecule since it is expressed o n early embryonic cells and is found on derivatives of all three germ layers. In the adult. NCAM is expressed on a variety of tissues, although it is mostly expressed in neurons, glia and muscle cells. There is evidence that many morphogenetic processes (nerve bundling, guidance of axonal growth and formation of neuromuscular synapses) are controlled by spatial and temporal gradients in NCAM expression. Cellcell adhesion is due to homophilic binding (like-like interaction), which is mediated through the amino-terminal portion of the molecule and involves multiple interactions. as suggested by its strong dependence on NCAM concentration. NCAM is found in three different forms, which share a common extracellular region but differ in their transmembraneicytoplasmic segments. One form (the ssd or small surface-domain polypeptide) is anchored to the membrane via a phosphoinositide, analogously to Thy-1 [ 1961. The other two forms differ in the size of the intracytoplasmic domain as a result of differential splicing. The relative proportion of the three forms varies with the tissue and the age of the animal. In the extracellular region, the most membrane-proximal unit is linked to three complex carbohydrates containing polymers of sialic acid. The number of sialic acid units is known to modulate the homophilic binding and varies with the developmental stage. NCAM is phylogenetically conserved. However, whilst in vertebrates it is expressed throughout life, in flies and nematodes its expression is restricted to stages of nervous system morphogenesis.
231 6.4. Myelin associated glycoproteitilrieurotiul cytoplasmic protein 3 (MAGlNcp 3 )
MAG is one of a set of cell-surface glycoproteins expressed by myelin-forming cells which have been hypothesized to mediate the apposition of the myelin sheath to the axon. Two forms of MAG are known which, similarly to NCAM, differ in the intracytoplasmic domain as a result of alternative splicing. The carboxy-terminal 318 amino acids of MAG are identical to the partial sequence so far obtained of a protein that has been designated as rat neuronal cytoplasmic protein 3 [184]. However, the latter was previously believed to be a neuropeptide precursor and to be expressed in specific groups of neurons rather than in glial cells. The reason for this discrepancy is unclear. 6.5. Viral members
The adenovirus type 2 E3119 kDa glycoprotein shows some homology in primary sequence as well as a similar predicted secondary structure profile to the C unit of MHC molecules [ 1971. The existence of a structural relationship is strengthened, however, by the finding of a functional interaction, since the E3 glycoprotein, which is expressed early during virus infection and is not required for the virus life cycle in vitro, binds to the MHC class 1 a chain and blocks its intracellular transport to the plasma membrane [198,199]. As T cell killing of virally infected targets requires expression of MHC molecules. this mechanism may allow the virus to escape from immune surveillance, by preventing infected cells from expressing MHC class I molecules. Weak homology to immunogobulin C,, units has also been found at two distinct positions within the HIV-I envelope glycoprotein gpl10 [ 1481. This homology, albeit of questionable structural significance, since it spans subunit lengths and is of limited extent, may have functional significance, since t h e virus is known to bind to CD4, thereby gaining entry i n t o the cell. Finally, two cellular genes belonging t o the immunoglobulin superfamily have been found transduced in viruses i n a spliced form, a TcR p chain gene in a feline retrovirus [200] and an MHC class I gene in cytomegalovirus (S. Beck. personal communication).
7. Evolutionary considerations In the evolution of the immunoglobulin superfamily (Fig. 12) three critical steps can be discerned: (1) the assembly of the primordial V unit. According to one hypothesis [201], the primordial building block was a unit half the size of present day V units, with a high propensity to self-asscmble into a stable, symmetric dimer. This hypothesis derives from the observation of a highly symmetrical topology in V units and is supported by the tindings that the CD4 V unit coding sequence is split into two halves by an intron [ 1631 and that the squid Thy-1-like molecule is homologous to a half-unit [ 187). In a different theory, the V domain may have re-
232
4
J
1 CD4 poly-lg receptor
Thy-1
MRC OX-2
MHC molecules CD1 molecules
T cell receptors
1 Immunoglobulins
IgG FcR I B-gP NCAM MAGiNcp 3
Fig. 12. Hypothetical evolutionary tree o l the immunoglobulin superfamily. Round symbols, genes or gene segments; square symbols. polypeptide units: tilled symbols. V units: empty symbols; C units. See text for details.
sulted from the fusion of multiple copies of a smaller building block [202]; (2) derivation of the C unit, which presumably greatly favoured chain-chain association, whilst allowing greater flexibility in the structure of the V domain; (3) splitting of the exon encoding the V domain. which dramatically increased the potential for variability. The evolutionary relatedness found amongst members of the immunoglobulin superfamily suggests that the diversity of present day functions constitutes an adaptation, under different selective pressures. of the same primordial function. The biological role of those members whose function has yet to be determined can also be expected to be related to this primordial function. Since primordial functions are phylogenetically conserved, the investigation of structurally and/or functionally related systems in lower organisms can provide clues in the quest for the function of the primordial immunoglobulin system. The study of the fusibility gene locus in Botryllus, a colonial tunicate, as well as of self-incompatibility systems in plants, has led to the suggestion that the vertebrate major histocompatibility complex, and thus perhaps the whole immunoglobulin superfamily, has derived from self-nonself recognition systems evolved to prevent self-fertilization in hermaphrodite organisms [203,204].
233 However, an alternative hypothesis is that the function of the primordial V unit derived from its propensity to self-associate [ 1871. Thus, the immunoglobulin superfamily may have evolved as a primitive, like-like recognition system. Such a function is still clearly recognizable in the homophilic binding of NCAM, which is both documented in early embryogenesis and is conserved in phylogenesis, as well as in the interactions between immunoglobulin and immunoglobulin-like cellular receptors. The interactions between TcR's and MHCiforeign antigens as well as between immunoglobulins and foreign antigens can be viewed as a progressively increasing divergence from the primordial function. The hypothesis is strengthened by the suggestion that the tendency to establish symmetric interactions has been a major mechanism in driving the evolution of the family [201]. Further studies will tell whether its predictory value can be verified.
Acknowledgements 1 wish to thank P. Delmastro-Galfre, C. Milstein and M.S. Neuberger for en-
couragement, C. Chothia, R.A. Mariuzza, M.J. Sharpe, G. Winter and especially K. Staden for helpful discussions and S . Beck for sharing of unpublished results. This work was supported by a special fellowship from the Leukemia Society of America.
Ref eYences 1 Hill. R.L.. Delaney. R.. Fellows. R . E . and Lehoviiz. H . E . (1966) Proc. Natl. Acad. Sci. USA 56.
-7 3 4
5 6 7 8 9 10 I1 12 13 14 15 16
17 18 19
20
1762-1 769. Edelman. G . M . and Gall, W . E . (1969) Annu. Rev. Biocheni. 38. 415-360. Hood. L . E . , Kronenberg. M . and Hunkapiller, T. (10x5) Cell 40. 225-229. Popper. K.R. (1959) The Logic o f Scientific Discovery, Mutchison. London. Amzcl. L.M. and Poliak, R . J . (1979) Annu. Rev. Biochetn. 48. 961-997. Lcsk. A . M . and Chothia. C. (1982) J . M o l . H i d . 160. 325-332. B e a k . D. and Feinstein. A . (1970) Q u a r t . Rev. Riophys. 9. 135-180. Chothia. C., Novotny. J.. Bruccoleri. R . nnd Karplus, M . (1985) J . Mol. B i d . 186. 651-663. Taylor, W.R. (1986) J . Mol. Biol. 1%. 233-258. Novotny. J . and Habcr. E . (1985) Proc. Natl. A d . Sci. USA 82. 4592-4596. Williams, A . F . (1984) Immunol. Today 5. 210-221. Gamier, J . . Osguthorpe. D.J. and Rohson. B. (1978) J . Mol. Biol. 120, 97-120. Chou, P.Y. and Fasman. G.D. (1978) Adv. Enzymol. 47. 45-148. Kytc. J . and Doolittle, R.F. (1982) J . Mol. Biol. 157. 105-132. Dayhoff. M.. Barker. W. and Hunt. L.P. (19x3) Methods Enzymol. 91. 524-545. Kronenberg. M.. Siu, G . . Hood. G.S. and Shastri. N . (1986) Annu. Rev. Immunol. 4. 529-591. Weiss. A . , Imboden, J . . Hardy. K.. Manger. B.. 'l'crhorst. C. and Stoho, J . (1986) Annu. Rev. Immunol. 4. 593-619. Novotny, J . , Tonegawa. S., Saito. H . . Kranz. D.M. and Eisen, H.N. (19x6) Proc. Natl. Acad. Sci. USA 83, 742-746. Patten. P.. Yokota. T.. Torhbard. J . . Chicn. Y.-h.. Arai, K.-i. and Davis. M.M. (1985) Nature 312. 4&46. Arden. B.. Klotz. J.L.. Siu. G . and Hood. L.E. (1985) Nature 316. 783-787.
21 Becker, D.M.. Patten. P.. Chien. Y.-h.. Yokota, T.. Eshhar. Z.. Giedlin, M.. Gascoigne. N.R.J., Goodnow. C.. Wolf, R . , Arai. K.4. and Davis. M.M. (1986) Nature 317. 43C-434. 22 Leiden. J . M . and Strominger, J.L. (1986) Proc. Natl. Acad. Sci. USA 83, 445&4460. 23 Concannon. P..Pickcring. L.A.. Kung. P . and Hood. L. (1986) Proc. Natl. Acad. Sci. USA 83. 6598-6602. 24 Yoshikai. Y.. Kimura. N . . l'oyonaga. B. and Mak, T.W. (1986) J . Exp. Med. 164. 9C-103. 25 Kiniura. N.. Toyonaga, B.. Yoshikai. Y . . Triebcl, F.. Debre. P . , Minden. M.D. and Mak. T.W. (1986) J. Exp. Med. 164. 739-750. 26 Schiffer. M.. Wu. T.T. and Kabat. E . A . (1986) Proc. Natl. Acad. Sci. USA 83. 445-4463, 27 Capra, J.D. and Kehoe. J.M. (1074) Proc. Natl. Acad. Sci. USA 71. 845-848. 28 Siu. G . . Kronenberg. M.. Strauss. E.. Hnar<. K.. Mak. T.W. and Hood. L. (1984) Nature 311. 3.14350. 29 Tonegawa, S. (1983) Nature 303. 575-581. 30 Yancopoulos. G . D . . Blackwell, T . K . . Suh. E l . , I-lood. L. and Alt. F.W. (1986) Cell 44. 251-259. 31 Yoshikai. Y . . Anatoniou. D . . Clark. S.P., Ynnagi. Y.. Sangster. R.. Van den Elsen. P.. Terhorst. C . and Mak. T.W. (1984) Nature 312, 521-524. 32 Jones. N.. Leiden. J . . Dialynas. D.. Fraser, J . . Clahby. K . . Kishimoto. T.. Strominger, J.L.. Andrews. D., Lane, W. and Woody. J. (1985) Science 127,311-314. 33 Rupp, F., Acha-Orbea. H . , Hengartncr. H . . Zinkernagel, R . and Joho. R. (1985) Nature 31.5. 425-427. 34 Kurosawa, Y . and Toncgawa. S. (1982)J . Exp. Mcd. 155. 201-218. 35 Governian. J . . Minard. K.. Shastri. N . . Hunkapiller, T . . Hanshurg. D . . Sercarz. E. and Hood. L. (1985) Cell 40. 859-867. 36 Hayday, A . C . . Diamond. I1.J.. Tanigawa. G . , Ilcilig. J.S.. Folson. V . . Saito. H. a n d Tonegawa. S. (1985)Nature 316. 828-832. 37 Winoto. A , . Mjolsness. S. and Hood. L. (19x5) Nature 316. 832-836. 38 Yoshikai, Y., Clark. S.P.. Taylor. S.. Sohn, U.. Wilson. B.1.. Minden. M.D. and Mak, T.W. (19x5) Naturc 316. 837-840. 39 Yancopoulos. G.D. and Alt. F.W. (1986) Annu. Rev. Inimunol. 4.339-368. 40 Barth. R.K.. Kim. B.S.. Lan. N.C., Hunkapiller. T,. Sobieck, N.. Winoto. A , , Gcrshenfeld, H.. Okada. C.. Hansburg, D.. Weissinan. I . and Hood. L. (1985) Nature 316, 517-573. 41 Reth. M.. Gehrmann. P.. Petrac, E . and Wiesc. P. (1980) Nature 322. X4(!-842. 42 Augustin, A . A . and Sirn. G.K. (1987) Cell 3Y. 5-12. 43 Hubbard. C.S.. Kranz. D.M.. Longmore. G.11.. Sitkovsky. M.V. and Eisen. H.N. (1986) Proc. Natl. Acad. Sci. USA 83, 1852-1856. 44 Brenner. M.B.. McClcan. J . . Schett. H.. Warnke. R.A.. Joncs. N . and Strominger. J.L. (1987) J . lmmunol. 138. 1502-1509. 45 Brenner. M.B.. Trowbridge. I.S. and Strominger. J.L. (1985) Cell 40. 18.7-190. 46 Schwartz. R . H . (1985) Annu. Rev. Inimunol. 3. 237-2611, 47 Marrack. P . . Shimonkevitz. R.. Zlotnik. A , . Dialynas. D.. Fitch. F. and Kappler. J . (1983) J . Exp. Med. 158, 1635-1646. 48 Yague, J.. White. J . . Coleclough. C., Kappler. J.. Palmer. E. and Marrack. P. ( l Y X 5 ) Cell 42. 81-87, . S.. McCubrey. J . . Kicfcr. H . . von Boehmer. 1-1. and Steinmetz. M . 49 Dembic, 2.. Haas. W . . W (1986) Nature 320. 232-238. 50 Saito. T . , Weiss. A , . Miller. J . . Norcrma. M.A. and Gcrmain. R.N.(lYX7) Nature 324, 125-130. 51 Froscher, B.G. and Klinman. N.R. (1986) J . Exp. Med. 164. l9&210. 52 von Boehmer, H . (1986)Immunol. Today 7. 333-336. 53 Roehm. H.. Herron. L.. Camber. J.. DiGiusto, D.. Haakins. K.. Kapplcr. J . and Marrack. P. (1984) Cell 38. 577-584. 54 Acuto. 0..Campen. T.J.. Roycr, H.11.. Huscey. R . E . . Poole. C.B. and Reinherz. E.L. (1985) J . Exp. Med. 161. 13261343. 55 Garman. R . D . , KO. J.-L.. Vulpe. C . D . and Raulet. D.EI. (1986) Proc. Natl. Acad. Sci. USA 83. 3987-399 1. 56 Kappler. J . W . . Wade. T.. White. J . . Kushnir. E . . Blackman. M.. Bill. J . . Roehm. N. and Marrack. P. (1987)Cell 49. 263-271.
235 57 Fink. P.J., Matis. L . A . . McElligott. D.L.. Bookman. M. and Hedrick. S.M. (1986) Nature 321, 2 19-226. 58 Winoto. A . . Urban. J.L.. Lan. N.C.. Goverman. J.. Hood. L. and Hamburg. D. (19x6) Nature 324. 679-682. 59 Blackman, M., Yagiie. J . . Kubo. R . . Gay, D., Coleclough, C.. Palmer. E . , Kappler. J . and Marrack. P. (1986) Cell 47. 349-357. 60 Jerne. N. (1971) Eur. J. Immunol. 1. 1-9. h l Bodmer. W . F . (1972) Nature 237, 139-145. 62 Edelman, G . M . (1976) Cold Spring Harbo mp. Quant. Biol. XLI, 891-902. 63 Bank. I., DePinho. R . A . , Brenner. M.B.. simcris. J.. Alt, F.W. and Chess, L. (1986) Nature 322, 179-181. 64 Borst, J . . van de Griend. R . J . , van Oostvccn. J . W . . Ang. S.-L.. Melief. C.J.. Seidman. J . G . and Bolhuis. R.L.H. (19x7) Nature 325. 683-688. 65 Brcnner, M.B., McLean. J . . Scheft. H . . Rihcrdy. J . . Ang. S . - L . . Seidman. J . G . . Devlin. P. and Krangel. M.S. (1987) Nature 325. 689-693. 66 Bluestone, J . A . . Pardoll. D.. Sharrow. S.O. and Fowlkes, B.J. (1987) Nature 326. 82-84. 07 Lanier. L.L. and Weiss. A. (1986) Nature 324. 268-270. OX Moingeon. P . . Jitsukaua. S., Faure. F.. Troalen, F.. Triebel. F., Graziani. M . . Foresticr, F . , Bellet. D . . Bohuon, C. and Hercend. T. (1987) Nature 325. 723-726. 69 Yoshikai. Y.. Reis, M.D. and Mak. T . W . (19x6) Nature 324. 482-485. 70 Lew. A . M . , Pardoll. D.M.. Maloy. W . L . . Fowlkes. B.J.. Kruisbeek. A , . Cheng, S.-F.. Germain. R.N.. Bluestone, J.A.. Schwartz. R . H . and Coligan. J . E . (1986) Science 234. 1401-1405. 71 Nakanishi, N . , Maeda, K., Ito. K.. Heller. M . and 'loncgawa, S. (lY87) Nature 325. 72C723. 72 Pardoll. D.M.. Fowlkes. B.J.. Bluestone. J . A . . Kruisheek, A., Maloy, W.L., Coligan, J.E. and Schwartz, R . H . (1987) Nature 326. 79-81. 73 Lefranc. M.-P.. Forster, A . and Rabbitts. T . H . (1986) Proc. Natl. Acad. Sci. USA 83, 9596-9600. 74 Littman, D . R . . Newton. M.. Cronimie. D . , Ang. S.-L., Scidman. J . G . . Gettner. S.N. and Weiss. A . (1987) Nature 326. 85-88. 75 Hayday, A.C.. Saito, H . . Gillies. S . D . . Kranz. D . M . . Tanigawa. G . , Eisen. H.N. and Tonegawa. S. (1985) Cell 40. 259-269. 76 Iwamoto, A.. Rupp, F.. Ohashi. P.S.. Walker. C.L.. Pircher. H.. Joho, R . , Hengartner, H. and Mak. T . W . (1986) J . Exp. Med. 163. 1203-1212. 77 Garman, R . D . , Doherty, P.J. and Raulet. D . H . (1986) Cell 45. 733-742. 78 Traunecker, A.. Olivieri, F.. Allen. N . arid Karjalainen, K. (1986) E M B O J . 5, 1589-1593. 79 Heilig. J.S. and Tonegawa. S. (1986) Nature 322. 8 3 f A 4 0 . 80 Lcfranc. M.-P.. Forster. A . . Baer. R . , Stinson. A . and Rabbitts. T . H . (1986) Cell 45. 237-246. 81 Quertermous. T.. Strauss. W.. Murre. C . . Dialynas. D.P.. Strorningcr. J.L. and Seidman, J.G. (1986) Nature 322, 184187. 82 Yoshikai. Y . . Toyonaga. B.. Koga, Y . . Kimura. N . . Gricsser, H. and Mak. T.W. (1987) Eur. J. Immunol. 17, 119-126. 83 Born, W.. Rathhun. G . . Tucker, P.. Marrack. P. and Kappler. J . (1986) Scicnce 234. 479-482. H4 van Dongen, J.J.M., Quertermous. T , . Bartram. C . R . , Gold. D.P.. Wolvers-Tcttcro. I.L.M.. Comans-Bitter, W.M.. Hooijkaas. H . . Adriaansen. H.J.. de Kelin. A.. Raghavachar, A , . Ganser. A , . Duby. A.D.. Scidman. J.G.. van den Elscn. P. and Terhorst. C. (1987) J. Immunol. 138. 126(!-3269. X5 Dialynas. D.P., Murre. C.M.. Quertermous. T.. Boss. J.M., Leiden. J . M . , Seidman. J.G. and Strominger, J.L. (1986) Proc. Natl. Acad. Sci. USA 83. 2619-2623. X6 Rupp. F.. Frech. G.. Hengartner. H . . Zinkernagel. R.M. and Joho, R. (1986) Nature 321, 876-878. 87 Reilly. E . B . , Kranz. D . M . . Tonegawa. S. and Eisen, H . N . (1986) Nature 321. 878-880. 88 Klein. J . , Figueroa, F. and Nagy. Z . A . (1983) Annu. Rev. Immunol. 1. 119-142. 89 Hood. L.. Steinmetz, M. and Malissen. €3 (19x3) Annu. Rev. Immunol. I . 529-568. YO Mdler. G . (ed.) Immunol. Rev. 81. 19x5 91 M d l c r , G . (cd.) Iinmunol. Rev. 85. 19x5. 92 Flaherty. L. (1981) in: The Role of The Maior Histocompatibility Complex in Immunobiology. (M. Dorf. Ed.) pp. 33-57. Wiley. New York.
236 Calabi. F. and Milstein. C. (1986) Nature 323. 54(!-543. Fisher. R.A. (1922) Proc. Roy. Soc. Edinburgh 42. 321-341. Lo. D. and Sprent. J. (1986) Nature 319, 672-675. Bjorknian. P.J., Strominger. J.L. and Wiley. D.C. (1985) J . Mol. B i d 186. 205-210. 97 Menglc-Gaw, L. and McDevitt. H . O . (1985) Annu. Rev. Inimunol 98 Ways, J.P.. Coppin. H . L . and Parham. P. (1985) J . Biol. Chem. 260. 1192&-11933. 99 Vega. M.A.. Bragado. R . . Ezqucrra. A . m i Lopez de Castro. J.A. (1981) Biochemistry 23. 823-83 I . 100 Auffray, C . and Novotny, J . (1984) Nucl. Acids Res. 12. 243-255. 1 0 1 Richardson, J.S. (1981) Adv. Protein Chem. 34. 305. 102 Lancet. D . . Parham, P. and Strominger. J.L. (1979) Proc. Natl. Acad. Sci. USA 76. 3844-3848. 103 Tragardh, L.. Curman. B.. Wiinan. K . . Rask. L. and Peterson, P. (1979) Biochemistry 18. 2218-2126. 104 Krangel. M.S.. Taketani. S., Pious. D . and Strominger, J.L. (1983) J . Exp. Med. 157, 324336. 105 Taketani, S . , Krangel. M.S.. Pious. D. and Strominger. J . L . (1983) J . Immunol. 131. 2935-2938. 106 Nathenson, S.G.. Geliebter. I . . Pfaffenbach. G.M. and Zeff. R . A . (1986) Annu. Rev. Immunol. 4. 171-502. 107 Mengle-Gaw, L., Conncr. S . . McDevitt, H.O. and Fathman. C . G . (1984) J . Exp. Med. 160, 1 1 8 4 1194. 108 Parham. P., Clayberger. C.. Zorn. S.L.. Ludwig. D.S.. Schoolnik. G . K . and Krensly. A.M. (1987) Nature 325. 625-628. I09 Guillet, J.-G., Lai, M.-Z.. Briner. T.J.. Buus. S.. Sette, A , . Grey. H.M.. Smith. J.A. and Gefter, M.L. (1987) Science 235. 865-870. 1 1 0 Cohn. L . E . , Glimcher. L.H.. Waldniann. R.A.. Smith. J.A.. Ben-Nun. A , . Seidman. J . G . and Choi. E. (1986) Proc. Natl. Acad. Sci. USA 83. 747-751. 1 1 1 Lechler, R., Ronchese, F.. Braunstein. N. and Germain, R . N . (1986) J . Exp. Med. 163. 678-696. 112 Sherman. L . A . (1982) Nature 297. 5 1 1-513. 113 Guillct. J.-G., Lai. M.-Z.. Briner. T.J.. Smith. J.A. and Gefter. M.L. (1986) Nature 324, 260-262. 114 Buus. S . . Sette, A., Colon. S.M.. Milea. C. and Grey, H.M. (1987) Science 235. 1353-1358. 115 Babbitt. B.P.. Allen, P.M., Matsucda. G . . Haher. E. and Unanue. E . R . (1985) Nature 317, 359-361. 116 Ashwcll, J.A. and Schwartz. R.H. (1986) Nature 320. 176179. 117 Watts, T.H.. Gaub. H . E . and McConnell. H.M. (1986) Nature 320. 179-181. 118 Buus, S., Colon, S.M., Smith. C.. Freed. J.H.. Miles, C. and Grey. H.M. (1986) Proc. Natl. Acad. Sci. USA 83, 3968-3971. 119 Babbitt, B.P., Matsueda. G . . Haber. E . . Unanue. E . R . and Allen, P.M. (1986) Proc. Natl. Acad. Sci. USA 83. 4509-4513. 120 Buus. S . . Sette, A . , Colon. S.M.. Jenis, D.M. and Grey. H.M. (1986) Cell 47, 1071-1077. 121 Townsend, A.R.M., Rothbard, J.. Gotch. F.M., Bahadur, G.. Wraith, D . and MeMichael. A.J. (1386) Cell 44, 959-968. 122 Maryanski, J.L., Pala. P.. Corradin. G.. Jordan. B.R. and Cerottini. J.-C. (1986) Nature 324, 578-579. 123 Unanue, E . R . (1984) Annu. Rev. Immunol. 2. 395-428. 124 Cohen. F.E., Sternberg. M.J.E. and Taylor. W.R. (1980) Nature 285. 37&382. 125 Travers, P.. Blundell, T.L.. Sternberg. M.J.E. and Bodmer. W.F. (1984) Nature 310, 235-238. 126 Becker, J.W. and Reeke, G . N . (1085) Proc. Natl. Acad. Sci. USA 82. 4225-4229. 127 Bjorkman, P.J. and Wiley, D . C . , unpublished results. 128 Zuniga. M.C. and Hood. L.E. (1986) J . Cell Biol. 102. 1-10. 129 Klein. J . (1978) Adv. Immunol. 26. 55-146. 130 Weiss, E . H . , Golden, L., Zakut, R . , Mellor. A.L., Fahrner, K.. Kvist. S. and Flavell, R . A . (1983) E M B O J . 2. 453-462. 131 Loh, D . Y . and Baltimore. D . (1984) Nature 309, 639-640. 132 Wu, S.. Saunders. T . L . and Bach. F.H. (1986) Nature 324, 676-679. 133 Rask, L.. Gustafsson, K.. Larhanimar. D.. Ronne, H . and Peterson. P.A. (1985) Immunol. Rev. 84. 123-143. 93 94 95 96
237 134 Gustafsson. K.. Wiman, K.. Emmoth. E.. Larhamniar. D., Bohme, J.. Hyldig-Nielsen. J . . Ronne. H., Peterson. P.A. and Rask. L. (1984) EMBO J . 3. l655-l661. 135 Hill. R . A . and Hastie, N.D. (1987) Nature 326, 9 6 9 9 . 136 Haldane. J.B.S. (1949) Ricerca Scient., Suppl. 19. 68-76. 137 Perler, F . , Efstradiatis. A , . Lomedico. P.. Gilbert. W.. Kolodner. R . and Dodgson. J . (1980) Cell 20. 555-565. 138 Arden. B . and Klcin, J. (1982) Proc. Natl. Acad. Sci. USA 79. 2342-2346. 139 Germain. R . N . , Bentley. D . M . and Quill. H . (1985) Cell 43. 233-242. 140 Charron. D . . Lotteau, V. and Turmel. P. (1983) Nature 312. 157-159. 141 Germain. R.N. and Quill, H . (1986) Nature 320. 72-75. 142 Shiroshi, T.. Sagai, T. and Moriwaki. K . (1982) Nature 300, 370-372. 143 Steinmetz, M., Stephan. D.. Fischer Lindahl. K. (1986) Cell 44, 895-904. 144 Lafuse, W.P.. Berg. N.. Savarirayan, S. and David, C.S. (1986) J . Exp. Med. 163. 1518-1528. 145 Reinherz. E.L. and Schlossman. S.F. (1980) Cell 19. 821-827. I46 Crisanti, A , . Colantoni. A . . Snodgrass. K. a n d von Boehrner, H . (1986) EMBO J. 5 . 2837-2843. 147 Pert, C.B.. Hill. J.M.. Ruff. M.R.. Rerman. R.M.. Rohey, W . G . , Arthur, L.O.. Ruscetti, F.W. and Farrar. W.L. (1986) Proc. Natl. Acad. Sci. USA 83. 92549258. 148 Maddon, P.J.. Dalgleish. A . G . . McDougal. J.S.. Clapham. P.R.. Weiss, R.A. and Axel. R. (1986) Cell 47, 333-348. I49 Luescher. B.. Rousseaux-Schmid. M.. Naini. H . Y . . MacDonald. H . R . and Bron, C. (1985) J . Immunol. 135. 1937-1944. 150 Johnson. P. and Williams. A.F. (1986) Naturc 323. 73-76. 151 Walker. I.D.. Hogarth. P.M., Murray. B.1.. Lovering, K.E.. Classon. B.J.. Chambers, G . W . and McKenzie, I.F.C. (1984) Immunol. Rev. 82. 47-77. 152 Tagawa. M., Nakauchi. H.. Herzenberg. 1. A . and Nolan. G . P . (1986) Proc. Natl. Acad. Sci. USA 83, 3422-3426. 153 Ledbetter, J . A . , Tsu. T.T. and Clark. E . A . (1985) J. Immunol. 134. 42Xk425.1. 154 Snow, P.M.. Van De Rijn. M . and Tcrhorst. C . (1985) Eur. J. Immunol. 15. 529-532. 155 Classon. B.J.. Tsagaratos. J.. McKenzie. I.F.C. and Walker. I . D . (1986) Proc. Natl. Acad. Sci. USA 83. 4490-4503. 156 O’Neill, H . C . . McGrath. M.S.. Allison. J . P . and Weissman. I.L. (1987) Cell 49, 143-151. 157 Littman. D . R . , Thomas. Y . . Maddon. P.J.. Chess, L. and Axel, R. (1985) Cell 40, 237-246. IS8 Sukhatme. V . P . , Sizer, K.C., Vollmer. A.C.. Hunkapiller. T. and Parnes. J.R. (1985) Cell 40, 591-597. 159 Zamoyska, R., Vollmer. A.C.. Sizer. K . C . . Liaw. C.W. andParnes. J.R. (1985) Cell 43. 153-163. 160 Nakauchi. H . . Nolan. G.P.. Hsu. C.. H u ~ i g .H.S., Kavathas. P. and HerZenberg, L.A. (1985) Proc. Natl. Acad. Sci. USA 82, 512&5130. 161 Johnson. P . , Gagnon. J . . Barclay, A . N . and Williams. A.F. (1985) EMBO J. 4, 2539-2545. 162 Maddon. P.J.. Littman. D . R . . Godfrey, M.. Maddon, D.E.. Chess. L. and Axel, R . (1985) Cell 42. 93-104. 163 Littman, D . R . and Gettner. S.N. (1987) Nature 325, 453-455. 164 Clark, S.J.. Jefferies. W.A.. Barclay. A.N.. Gagnon. J . and Williams, A.F. (1987) Proc. Natl. Acad. Sci. USA 84, 1649-1653. 165 Gottlieb, P.D. (1974) J. Exp. Med. 140. 1432-1437. 166 Sukhatme, V.P.. Vollmer. A.C.. Erikson. J . . Isohe. M.. Croce. C. and Parnes, J.R. (1985) J . Exp. Mcd. 161. 429-434. 167 G o , M. (1983) Proc. Natl. Acad. Sci. USA 80. 19641968. 168 Williams. A.F., Barclay. N.A.. Clark. S.J.. Paterson. D . J . and Willis, A.C. (1987) J. Exp. Med. 165. 368-380. 169 Swain, S.L. (1983) Immunol. Rev. 74, 129-142. 170 Dembic, Z., Haas, W., Zamoyska, R . , Parnes, J . , Steinmetz, M . and von Boehmer, H. (1987) Nature 326, 51g511. 171 Gay, D . , Maddon, P., Sekaly, R., Talle, M . A . , Godfrey, M., Long, E., Goldman, G., Chess. L., Axel, R . , Kappler, J . and Marrack, P. (1987) Nature 328, 626629.
172 Golding, H., McCluskey. J.. Munitz, T.I.. Germain. R.N.. Margulies. D.H. and Singer, A . (1985) Nature 317. 425-427. 173 Fleischer, B., Schrezenmcier, U. and Wagner. H . (1986) J . Immunol. 136, 1625-1628. 174 Van Seventer, G . A . , Van Lier. R . A . . Spits. H . . Ivanyi. P. and Melief, J.M. (1986) Eur. J. Immunol. 16. 1363-1371. 175 Williams. A.F. and Gagnon, J . (1982) Science 216, 696703. 176 Clark. M.J.. Gagnon. J.. Williams. A . F . and Barclay, A.N. (1985) EMBO J. 4, 113-118. 177 Ravctch, J.V.. Luster. A . D . . Weinshank, R . . Kochan. J . . Pavlovec. A , . Portnoy, D.A., Hulmes. J., Pan. Y.-C.E. and Unkeless. J.C. (1986) Science 234, 718-725. 178 Lewis, V . A . , Koch, T.. Plutner. H. and Mellman. I . (1986) Nature 324, 372-375. 179 Mostov. K.E.. Friedlander. M. and Blobel. G. (1984) Nature 308, 37-43.
180 Eiffert. H.. Quentin. E.. Decker. J.. Hillemcir. S.. Hufschmidt. M.. Klingmuller, D . , Weber, M.H. and Hilschmann, H . (1984) Hoppe-Seyler’s Z. Physiol. Chem. 365, 1489-1495. 181 Ishioka, N., Takahashi. N. and Putnam. F.W. (1980) Proc. Natl. Acad. Sci. USA 83, 2363-2367. 182 Cunningham. B.A., Hoffman. S . . Rutishauser. U.. Hemperly, J.J. and Edelman. G.M. (1986) Proc. Natl. Acad. Sci. USA 83, 311&3120. 183 Barthels. D., Santoni, M.-J.. Wille. W.. Ruppert, C . , Chaix, J.-C.. Hirsch, M.-R.. FontecillaCamps. J.C. and Goridis, C. (1987) EMBO J. 6. 907-914. 184 Sutcliffe, J . G . , Milner. R.J., Shinnick. T.M. and Bloom. F . E . (1983) Cell 33. 671-682. 185 Salzer, J.L., Holmes. W.P. and Colman. D . R . (1987) J . Cell Biol. 104, 957-965. I86 Scki. T.. Spurr, N.. Ohata. F . . Goycrt. S . . Goodfellow. P. and Silver. J . (1985) Proc. Natl. Acad. Sci. USA 82. 6657-6661, 187 Williams, A.F.. Barclay, A.N.. Clark. M.J. and Gagnon. J . (1985) in: Gene Expression During Normal and Malignant Differentiation. (L.D. Andersson. C.G. Gahmherg and P. Ekblom, Eds.) p p , 125-138. Academic Press. London. 188 Low, M.G. and Kincade. P.W. (1985) Nature 318. 62-64. 189 Tse. A . G . D . , Barclay. A.N.. Watts. A . and Williams. A.F. (1985) Science 230, 1003-1008. 190 Reiser. H . , Oettgen. H . . Ych. E.T.H.. Terhorst. C.. Low, M.G., Benacerraf. B . and Rock. K.L. (1986) Cell 47, 36.5-370. 191 Guntcr. K.C.. Germain. R . N . . Kroczek. R . A . , Saito. T.. Yokoyama, W.M.. Chan. C., Weiss, A . and Shevach, E.M. (1987) Nature 326. 505-507. 192 Kroczck, R . A . , Gunter. K.C.. Germain. R.N. and Shevach. E.M. (1986) Nature 322. 181-184. 193 Mostov, K.E.. de Bruyn Kops. A. and Deitcher, D.L. (1986) Cell 47. 359-364. 194 Rutishauser, U. (1986) Trends Neurosci. 9. 37.1-378. 195 Rutishauser. U. and Goridis. C. (1986) Trends Genetics 2. 72-76. 196 Hemperly. J.J.. Edelman. G . M . and Cunningham. B.A. (1986) Proc. Natl. Acad. Sci. USA 83. 9822-9826. 197 Chatterjee. D . and Maizel. J.V. (1984) Proc. Natl. Acad. Sci. USA 81. 6039-6043. 198 Burgert, H.-G. and Kvist. S. (1985) Cell 41, 987-997. 199 Andersson. M.. Paabo. S . . Nilsson. T. and Peterson, P.A. (1985) Cell 43, 215-222. 200 Fulton, R.. Forrest. D.. McFarlane. R . . Onions. D. and Neil. J.C. (1987) Nature 326. 19C194. 201 McLachlan. A . (1980) in: Proc. 2Xth Colloquium of Protides of Biological Fluids, Brussels. pp. 29-32. Pergamon. Oxford. 202 Ohno. S . . Matsunaga. T. and Wallace, R.B. (1982) Proc. Natl. Acad. Sci. USA 79. 19Y9-2002. 203 ScoIield. V.L.. Schlumpberger. J.M.. West. L.A. and Weissman. I.L. (1982) Nature 295, 499-502. 204 Burnet. F.M. (1970) Nature 226. 123-126. 205 Chothia, C.. Lesk. A.M., Levitt. M., Amit, G., Mariuzza, R.A.. Phillips. S.E.V. and Poljak, R.J. (19x6) Science 233. 755-758. 206 Kabat, E . A . . Wit. T.T.. Bilofsky. H.. Reid-Miller. M. and Perry. H. (1983) Sequences of Protein of Immunological Interest. U.S. Department of Health and Human Services. 207 Chien. Y.-h.. Becker, D.M. Lindsten. T.. Okaniura, M., Cohen. D.I. and Davis, M.M. (1984) Nature 312, 31-35. 208 Chien. Y.-h.. Gascoigne. N.R.J.. Kavaler. J . . Lee. N.E. and Davis, M.M. (1984) Nature 309. 322-326.
239 209 Tunnacliffe. A,. Kefford, R.. Milstein. C . . Forster, A. and Rabbitts. T.H. (1985) Proc. Natl. Acad. Sci. USA 82, 5068-5072. 210 Gascoigne. N.R.J., Chien, Y.-h.. Becker. D.M., Kavaler. J. and Davis. M.M. (1984) Nature 310, 387-391. 211 Lefranc. M.-P., Forster, A. and Rabbitts. T . H . (1986) Proc. Natl. Acad. Sci. USA 83. 9596-9600. 212 Lawrence, S.K., Smith. C.L., Srivastava. R., Cantor, C.R. and Weissman. S.M. (1987) Science 235, 1387-1390. 213 Klein. J . and Figueroa, F. (1986) Immunol. Today 7, 41-44. 214 Klein, J. and Figueroa, F. (1986) Immunol. Today 7, 78-81. 215 Kimura, N., Toyonaga, B., Yoshikai, Y.. Du. R.-P. and Mak. T.W. (1987) Eur. J . Immunol. 17. 375-383. 216 Chien, Y.-H., Iwashima. M.. Kaplan. K . B . . Elliott, J.F. and Davis. M.M. (1987) Nature 327, 677-682.
This Page Intentionally Left Blank
24 1
Subject index a. see IgA and IgH
a , - B glycoproteins. 227. 228 Abelson lines, I 1 1, 138. 147, 179,183 Acquired immune deficiency syndrome, 226 Adenovirus. 158. I65 E3il9kDa glycoprotcins. 231 Allelic exclusion. 129. 156. 182 Allotypes. 21 40. 08. 72 Alloreactivity. 224 Alternative splicing. 136, 140. 144. 227. 2 3 0 . 231 Alu family. 70 Anaphylaxis. 2 Antibody-dependent ccllular cytotoxicity. 24. 2 15 Antigen binding. 8. 37. 181 Antigen presentation. 220 Ars (/,-azophenylnrsonate). 104. 184. 187, 195. 197 Avian B cells. 136 /3,-microglobulin. 221, 224 B cells. 2. 3. 39. 41. 43. 60. 65. 123. 136. 142. 153. 1.58. 160. 187. 197, 220 H cell Iymphom;i. 137. 153. 158 /I(./- 1 alld h('l-2. 74 BiP. 130 Bovine IgH genes. 56 Bursa of Fabricius. 117. 136
c-nzvc. 73, 94, 144 Clq, 17. 22. 38 C D I , 219, 227 CD2. 227 CD3. 207, 212. 215, 230 CD3. 207. 215. 226, 231 CD8. 207, 215, 226 Cell-type qxcificity. 168 CG dinucleotide\, 225 Chi sequences. 60. 225. 226 Chicken IgH genes. 56 A genes. 58. 217
Chromatin. 147. IS4 Chromosome localization, 51, 62, 94, 219. 227 Chromosome translocations. 73. 115, 14.1 Class switch. 57. 135, 155, 192 commitment to. 139, 143 frequency of. 136 induction, 139. I43 in plasinacytoinas. 144 long transcripts, 136. 140 LPS activation. 136. 143 rccombination. 142. I46 regulation. I38 \econdary. I37 sequences. 145 Clonal selection theory. I04 Clonal senescencc. 196 Coin hi 11nt ori al diversity , I 78. I 8 1 Complement. 2. 17. 18. 20. 22. 38. 41. 55 Coinplementaritv determining regions (CDR's). 5, 8. 87. 120. 182. 180. 191. 207, 212. 214. 217 Co-expression 0 1 IgH gene\. 140. 166. 173 Constant (C) region. 5. 211 genes, 52, 213 Cytomegalovirus, 163. 23 1 Cytotoxicity. 215 antibody-dependent. 715 6. we IgD and IgH Dcletional joining. 1 16 Deletions of inimunoglohulin, 72 Diversity. 115. 177. 210. 220. 224 Diversity ( D ) segments, 52. 82, 95. OX, 116. 119%178. 1x3. 210, 212 usage, 121 DJII replacements. 122 transcripts. 122. 156 DNase in joining. 117 DNase I sensitivity. 118. 145. 154 Domains of immunoglobulin, 5 , 6. 27 6. see
IgE and IgH
242 E l a protein of adenovirus. 158 E3ilYkDa glycoprotein of adenovirus type 2, 231 En h‘i nce r IgH. 125. 159, 168 K . 163 polyoma. 160 s v 4 0 . 160 Exonuclease in joining, 115 Fab and F(ab’), fragments. 1. 3, 4. 6. 32. 207 Fc and pFc’ fragments, I , 3. 11. 25. 26 Fc receptors. 18. 24, 39. 41. 44. 46, 141, 215. 228 Flexibility of immunoglobulin. 18 Framework regions. 82 Fusibility gene locus. 232 y. si’c IgG and IgH Gene conversion, 58. 64. 71. 72. 104. 193, 225 Genomic footprinting, 161 Glycosylation. 6. 11. 40. 42. 156
Hamster. IgG genes. 56 Haplotypes. 69, 103. 146. 226 Heavy-chain binding protein. 130 Heptamer. 112, 124, 128, 180 Heptamerinonamer signals, 83. 112, 209 Hinge region, 3. 18, 64 HIV-I. 163, 226 gpl 10. 231 HLA-A. 220 -B. 220 -c.220 -DP. 220 -DO. 220 -DR. 220 Human Fc receptors. 25 hypervariable minisatellite regions. 226 IgH enhancer, 159 IgH locus. 54, 64. 95 immunodeficiency virus, 163. 226 light chain loci, 55. 99, 101 V,, families, 86 V, families. 87 V, families. 89 Hybridomas, 86. 138, 187 Hypervariable regions. see Complementarity determining regions Hypodactyly, 94
Idiotype. 21 IgA. 3. 230 (I gene structure, 64 allotypes. 40 expression. 141 functions, 39, 41 hinge homology to CD8. 227 secretory form. 41 serum form. 39 sequence. 29 structures, 39. 41 IgD. 3 6 gene structure. 64 expression, 155. 166 sequence. 29 function. 43 receptors. 43 structure. 741 IgE. 3 binding lactors. 45 E gene structure. 66 expression. 141, 166 function. 44 receptor. 45 sequence. 29 structure. 43 IgG. 2 binding factors, 26 clearance. 26 complement activation. 21 expression. 1-11 Fc receptor binding, 24 functions. 21 y gene structure. 65 membrane form, 27. 61 protein A binding. 21 sequence. 12 structure. 3 IgH-DEX idiotype. 98 IgH genes bovine. 56 chicken. S6 chromosome localization. 51. 94 co-expression. 140. 166, 173 deletions. 71 enhancer, 125, IS9 hamster, 56 haplotypes. 69. 103. 146 human. 54. 64. 86. 89. 95 hypermethylation. 130
243 mouse. 52. 64, 85, 89. 95 rabbit rat. 56 rearrangcment. I19 R N A processing. 170 shark, 57 sterile transcripts, 118. 155. IS6 X . laevis. 57 IgH locus organization. 96 Ig,-Efl and Ig,-Ef2, 99 IgM. 2. 230 complemcnt activation, 38 expression. 141. 164, 167. 170 Fc receptor binding, 39 functions. 36 membrane lorm. 39, h l . 164, 170 p gene structure. 64 wcreted form. 164. 170 sequence. 29 structure, 36 Immune precipitation. 27 Immunological memory. 196 Immunoglobulin carbohydrate chains. 6, I I , 40. 42 complementarity determing regions ( C D R s ) . 5 . 8. 82. 120. 182. 189, 191 constant (C) region. 5 doinains. 5. 6. 27. 62 gene evolution. 70 chromosomal localization. 51. 61. 94 heavy chain. 3 isotypes. 21. 135 light chain. 3 hoinology unit. 203 in the star lish. 55 superfamily. 68. 71 variable ( V ) regions. 5 Influenza haemagglutinin. 1x8. 195 lntcrleukin 4 (IL-4), 139, 143. 147 lntcrvening sequence-mediated transfer, 72 Inversional joining, 116. 127 lsotypc, 21, x4. 135
a t the TcRV, locu\. 117. 210 control of. 11X D to D. 184. 210 D to Jll. 116. 119, 210 111 B cell development. 126 replacement, 118 wcondary. 120. 179, 21 1 5ignals. 83. 112. 128. 209 V,,to DJ,,. 118. 122. I23 V I It o V ~ ~ DI IJX ,~ 124 ~ , V, t o J,. 116. 127 V, to J,. 128 Junctional diversity, 182 K
K
genes chroinosome localization. 5 I , 94. 227 human. 55. 67. 88. 99. 227 mouse, 5.1, 67, X7. 09. 227 rabbit. 57 rat, 57, 68 rcarrangemcnt. 114. 126 locus organization. 99
A genes
chicken. 58. 67. 217 chromosome localization. 52, 94 enhancer, I59 isotypcs. 55. 67 human. -55. 67. 8Y. 101 mouse, 53. 07. 89. 101 rabbit. 58. 67 rat. 57 rearrangement. 126. I28 A locus organization. 101 Leader sequence. 83 Long terminal repeats (LTRs). 69 LPS cultures. 136. 139. 142 LPS induction. 163 Lyb-5 B cells. 197 Ly-l B cells. 198 Lyt-2.3, 94 Lysozyme. 7
w. see IgH and IgM J chain. 36. 62. 156. I68 Joining ( J ) segments. 52. 82. 95. 98. 100. 127, 178. 210. 217 usage. 119. 127. 211 Joining. 112, 179. 192 accessibility model. 118
M,icrophage. 220 Mast cells, 2. 45 Major histocompatiblllty complex (MHC). 101. 193.219. 232 class 1 molecules. 2lY. 228. 231 class I1 molecules. 219. 227. 228
244 haplotypes. 226 molecule, 233 binding to short peptides, 224 diversity, 220, 224 framework regions. 22 I hypervariable regions. 221. 223, 225 intracellular transport, 224, 231 structure, 221 polymorphism. 220. 225 recombination. 226 hotspots. 226 restriction, 207, 212, 213. 224 Membrane immunoglobulin. 27. 38. 61, 155. 164. 170 Memory cells. 136. 137, 196 Messenger RNA turnover. 167. 170 Methylation, 130. 140. 145. 154 Mouse /fill locus, 52, 95 light chain loci, 53. 99. 1 0 1 V,, families. 85 V, families, 87 C - I T Z ~ C 74. . 94. 144 MRC OX-2, 228 Myelin associated glycoprotein (see alro Neu ronal cytoplasmic protein), 227, 228. 231 Myeloid cells. 156 N segments. 58. 114. 117, 182. 210. 218 Natural killcr cells, 25, 215 Neuronal cell-adhesion molccule, 227, 228. 229. 230. 233 Neuronal cytoplasmic protein (see crl.ro Myelin associated glycoprotein). 227, 228. 231 NF-AI and NF-A2. I 5 8 NF-KB, 163 NF-pE1. 163 NF-pE3. I63 Nonanier. 112 NP (4-hydroxy-3-nitrophenylacetyl). 8, 104. 1x7 196, 197 Octanuclcotide motif. 83. 158 Ox (2-phenyl-5-oxazolone). 189, 195. 197 Phagocytosis, 1. 24 Phosphoinositide, 229, 230 PC (phosphorylcholine), 104, 187 Plasmrrblasts. 135. 148 Plasma cells, 137, 153, 157, 169
Plasniacytoma. 137, 144, 1.53. 169 Poly-immunoglobulin receptor. 41, 227, 228, 230 Polyadenylation. 154. 165. 170 signals. 65. 151 Polymorphism, 68. 1 0 1 , 220. 225 Polyoma cnhanccr, 160 Post-translational regulation, 167 Post-transcriptional regulation. 164. 170 Pre-B cells. 1 1 1 . 121. 136. 140. 153. 158. 178, 190. 192 Primary ostcoarthritis. 17 Promoter, 157. 164 Promoter upstream clement, 157 Protein A. 17. 21 Pseudogencs. 52, 54. 69, 124. 129, 217 pv1- I , 74
Rabbit lgH genes. 55 K
genes. 57
A genes. 58
Rat IgH genes, 56 K genes. 57. 68 A genes, 57 Rearrange men t . sce J oining Recombination, 146. 193. 225. 226 hotspots, 226 Restriction fragmcnt length polymorphism. 55. 69. 97. 99. I04 rheumatoid arthritis. 17. 27 factors. 27 RNA processing, p1,,and p,, 170 splicing. 166, 170 turnover. 167 RS (rearranging sequence). 126, 128 Secreted immunoglobulin, 61, 165 Secretory component, 39. 41, 61, 230 Self-incompatibility systems, 232 Serine protease inhibitors, 225 Serum levels of immunoglobulins, 45 Severe combined immune deficiency, 114 Shark, 57,71, 114 Signal sequence, 83 Somatic mutation. 57, 58. 177. 186 at TcR loci, 212. 218
245 Splicing, see R N A Sterile transcripts. 118. 140. 155 SV40 enhancer. 160. 163 Switch, see Class switch Switch (S) regions, 58, 69. 70. 144. 145 Tcells. 43. 117. 119, 123. 139, 156, 158, 162. 169. 197. 212 cytotoxic, 214, 220 helper. 214 T cell activating protein (TAP), 229 T cell receptor. 100, 114, 116. 122. 206, 220. 223. 233 LY chain gene inversic~n/translocation,75. I 17 a/P, 207, 214. 226 C region. 212 glycosylation. 2 12 hypervariable regions. 207. 212, 214 interchain disulphide bond. 212 somatic mutation, 212 thymic selection, 212. 214 V gene segments. 210 V regions. 209 V segment replacement, 218 /3 chain gene inversional joining, 116. 117 retrovirus transduced, 23 I yl6, 215 expression, 215 in ontogeny, 215 and MHC restriction. 215, 218 y chain, 216 connecting peptide, 216 glycosylation. 216 hypervariahle regions. 217 loci, 57. 216 somatic mutation, 218 V gene segments, 217 V segment usage, 218 V segment replacement, 218 6 chain, 216 genes, chromosomal location, 52, 94
T cell repertoire. 220 TATA box. 83. 157 Terminal trransferase. 114. 117, 182. 211 Termination of transcription, 164 Thy- I , 228, 229. 230 in squid brain. 229. 231 T L antigens. 219 Tolerance, 196 1-opographical determinant. 9 Transcript ion at the TcR (Y locus. 210 initiation, 157 polyadenylation. 165. 170 termination. I64 ( b e ulso RNA Transgenic mice. 130. 161, 168 Translation, I67 Unequal crossing-over, 57, 72. 140, 22.5
V genes, 83, 209 families. 84. 210. 223 numbers. 90, 178 polymorphism. 101 rearrangement. 112. 179, 192, 209 structure, 81 V segments. 82, 123, 178. 210, 217 replacement. 124. 180, 211. 218 usage, 123, 125, 180, 218 Variability, 9 Variable (V) region(s), 5 evolution, 209 isotypes, 84 subgroups. 84 V , , genes, X4, 123 V,, transcripts, 123. 130, 157 V, gencs, 53, 55. XI, 127 V, genes, 53. 54. 89, 128 V, transcripts, 157 Z-DNA. 64. 226
This Page Intentionally Left Blank